HmiRQP0284 hsmq-0639

TM
G
en eCopoeia
Expressw ay to Discovery
All-in-One™ miRNA qPCR Primer
Catalog number:
: HmiRQP0284
User Manual and Primer Validation Report
GeneCopoeia, Inc.
9620 Medical Center Drive, #101
Rockville, MD 20850
USA
301-762-0888
866-360-9531
inquiry@genecopoeia.com
www.genecopoeia.com
© 2009 GeneCopoeia, Inc.
All-in-One™ miRNA qPCR Primer Manual and Validation Report
Primer Manual and Validation Report
I.
Introduction
II.
Product Information
III. Additional Materials Required or Recommended
IV. Procedure
V.
Storage
VI. Applications
VII. All-in-One miRNA qPCR primer validation report
VIII. Limited Use License and Warranty
I. Introduction
miRNAs are single-stranded non-coding RNA molecules that are on average about 22 nucleotides in
length that regulate gene expression and thereby regulate different physiological activity in the cell.
However, they are difficult to detect due to their short lengths. All-in-One miRNA qPCR primers are
specific miRNA upstream detection primers for qPCR. When combined with the GeneCopoeia
All-in-One miRNA qRT-PCR Detection Kit, the primers can be used for miRNA quantitation.
GeneCopoeia All-in-One miRNA qPCR primers have been validated in qPCR reactions using their
specific cDNAs as templates.
II. Product Information
Package
PCR
Catalog#
Primer ID
Mature_Acc
Mature_ID
size
Conc.
size
HmiRQP0284
hsmq-0639
MIMAT0000226
hsa-miR-196a
71bp
100 µM
500 rxn
10× Mix
3 rxn
HmiRQT0001
Positive Control cDNA Mix
III. Additional Materials Required or Recommended
GeneCopoeia All-in-One™ miRNA qRT-PCR Detection Kit (Cat Nos. AOMD-Q020 or AOMD-Q050)
2
All-in-One™ miRNA qPCR Primer Manual and Validation Report
IV. Procedure
1. Upon receiving centrifuge the tubes at 12,000 rpm for 30 seconds so that the liquid stays at the
bottom of the tubes.
2. The primers are dissolved in TE (10mM Tris-Cl, 1mM EDTA). The concentration of each primer is
100 µM. Dilute the primers to the concentration of 2 µM with sterilized ddH2O before use.
3. For each reaction, take one of the primers and add it to a PCR primer reaction tube (2 µl primer for
20 µl reaction). The final working concentration of the primer should be 0.2 µM. The products are
used together with the All-in-One miRNA qRT-PCR Detection Kit. For details, refer to the appendix
of primer-specific All-in-One miRNA qPCR Validation Report, Part B, Procedure, Section “qPCR to
detect miRNA”.
4. The primers are provided with a positive control cDNA mix for use as templates for validation. The
quality of the primers may be validated with the method described in the appendix of primer-specific
All-in-One miRNA qPCR Validation Report, Part B, Procedure, Section “qPCR to detect miRNA”.
5. These primers should be used with a miRNA Poly (A) tailing kit. It is not suitable for use with a
®
TaqMan miRNA detection kit.
6. The positive control cDNA mix is synthesized with the All-in-One miRNA qRT-PCR Detection kit
which uses a uniquely designed oligo-dT adaptor as the reverse transcription primer and a universal
reverse qPCR primer that specifically matches to the oligo-dT adaptor. The mix cannot be used in
conjunction with other miRNA Poly (A) tailing kits to validate the All-in-One miRNA qPCR primer.
V. Storage
Store in -20°C and avoid repeated freeze-thaw cycles .
VI. Applications
All-in-One miRNA qPCR Primers are used for detection of miRNA expression. When combined with
the All-in-One miRNA qRT-PCR Detection Kit the primers can be used to detect miRNAs both
qualitatively and quantitatively.
VII. All-in-One miRNA qPCR Primer Validation Report
A. Materials and Methods
1.
Instrument
iQ5 Real Time PCR Detection System: Bio-Rad
2.
Reagents
™
All-in-One miRNA qRT-PCR Detection Kit (Catalog Nos. AOMD-Q020 or AOMD-Q050)
Validation templates: cDNAs extracted from 10 different human tissues
3
All-in-One™ miRNA qPCR Primer Manual and Validation Report
B. Procedure
RNA Extraction
1.
Sample preparation
Place a small amount of material from a human tissue sample into a pre-cooled mortar. Add a small
amount of liquid nitrogen and grind the tissue to a fine powder. Transfer the powder to a centrifuge tube
containing 1 ml of TRIzol (Invitrogen). Vortex for 5 minutes. (If the samples are cultured cells, use about
6
7
10 ~10 cells with 1 ml of TRIzol). Pipette up and down until the cells are completely lysed).
2.
Phase separation
Leave the cell or tissue samples at room temperature for about 10 minutes. Add 200 µl of chloroform per
1 ml of TRIzol. Close the cap and vortex vigorously for 1 minute. Let the samples settle down at room
temperature for 2-5 minutes. Centrifuge at 12,000 g for 15 minutes at 6°C. Remove tubes from the
centrifuge being careful not to disturb the liquid. The samples should be separated into 3 layers with RNA
in the top layer.
3.
RNA Precipitation
Carefully transfer about 450 µl (per 1 ml TRIzol) of the supernatant to a new centrifuge tube containing
600 µl of cold 2-propanol. Mix well and keep at –20°C fo r 10 minutes. Then centrifuge at 12,000 g for 10
minutes (at 6°C).
4.
Washing
Remove the supernatant. Add 500 µl of cold 75% ethanol. Vortex until a pellet forms at the bottom of the
tube. Centrifuge at 12,000 g for 5 minutes (6°C). Remove the supernatant. Centr ifuge briefly again and
remove the remaining supernatant.
5.
Dissolve RNA
Air-dry the samples for 5 to 10 minutes. (Do not over dry the samples. The samples are dry when they
turn white). Dissolve the samples in 30 µl of DEPC water. Label the samples properly and store them at
–80°C.
6.
Determine RNA Concentration
Take 1 µl of RNA sample. Dilute the sample 1:10 in DEPC water. RNA concentration can be measured
with a NanoDrop (Thermo Scientific). DEPC water should be used as a blank. Record both the RNA
concentration and the ratio of A260/A280.
4
All-in-One™ miRNA qPCR Primer Manual and Validation Report
7.
RNA electrophoresis
7.1.Prepare denaturing gel
Add 1 g of agarose into 75 ml of de-ionized water. Boil the agarose for 1–2 minutes and cool it
down to about 70°C. Add 10 ml of 10X MOPS, 15 ml of f ormaldehyde and 5 µl of ethidium bromide
(EB). Pour the gel into a tray with big combs. Cover the tray.
7.2.Prepare electrophoresis buffer (1X MOPS)
Take 50 ml of 10X MOPS and dilute 1:10 to the final volume of 500 ml with de-ionized water. Pour
the buffer into a gel box, and add some EB to it.
7.3.Preparation of RNA sample
Take 3 µl of the RNA sample and add DEPC to a total volume of 18 µl. Heat the sample at 65°C for
10 minutes. Cool it down immediately. Add 2 µl of 1X RNA loading buffer into the sample.
7.4.RNA electrophoresis
Place the RNA gel in a gel box with 1X MOPS electrophoresis buffer. Pre-run the gel at 100 V for 5
minutes. Load the treated RNA samples into the gel and run at 100 V until the bromophenol blue
runs to about one third the length of the gel. Take a picture using a UV scanner.
8.
RNA detection results
Electrophoresis results of RNAs from 10 different tissues(3 µl RNA each well). See table 8.2 for the
specific lane information.
Table 8.2. RNA sample source, concentration and the ratio of OD260/OD280.
5
All-in-One™ miRNA qPCR Primer Manual and Validation Report
Lane
Tissue
1
Brain
2385
1.9
2
Lung
2430
1.94
3
Liver
2521
1.91
4
Kidney
3444
1.94
5
Breast
2785
1.87
6
Testis
2972
1.9
7
Placenta
3515
1.91
8
Spleen
3344
1.91
9
Heart
3394
1.91
10
Pancreas
3101
1.91
Concentration
(ng/µl)
OD
A260/A280
Note: In order to detect miRNAs, the extracted RNA must contain small molecular weight RNAs. The kit
used for RNA extraction must be applicable for isolation of total RNA or small RNA. The quality of RNA is
critical to the success of downstream experiments. Follow the instructions of the RNA extraction kit
exactly. Examine RNA samples by electrophoresis to ensure high quality.
miRNA reverse transcription
1.
Thaw all the reagents needed for miRNA reverse transcription. Mix reagents well by gently inverting
the tubes. Spin down briefly and keep on ice.
2.
Prepare miRNA reverse transcription reaction: Add the following reagents into an RNase-free
reaction tube which is pre-cooled on ice. The final volume should be 25 µl.
6
All-in-One™ miRNA qPCR Primer Manual and Validation Report
Reagents
Volume
Total RNA
Final concentration
2 µg
2.5 U/µl Poly A Polymerase
1 µl
2.5 U
RTase Mix
1 µl
5X Reaction Buffer
5 µl
ddH2O (RNase/DNase free)
to 25 µl
1X
Note: The total RNA in the reaction must contain small molecular RNA. If total RNA is used, the amount
of RNA should be between 1 ng ~ 5 µg. If the purified small molecular RNA is used, the amount of
RNA should be between 0.1 ng ~ 1 µg
3.
Reverse Transcription Reaction: Mix reaction solution well. Spin down briefly. Incubate the reaction
solution at 37°C for 60 minutes. Terminate the reac tion by heating at 85°C for 5 minutes. The
products of reverse transcription can be diluted 1:5 with sterile water for the downstream qPCR
reaction.
qPCR to detect miRNA
1. Thaw 2X All-in-One qPCR mix from the All-in-One miRNA qRT-PCR Detection Kit. Mix well by
inverting the tube several times. Spin down briefly and keep on ice.
2. Prepare qPCR reaction solution on ice. All miRNAs are tested in duplicate. NTC (No template
control) is tested singly.
Reagents
Volume
Final Concentration
2×All-in-One qPCR Mix
10 µL
1X
All-in-One miRNA qPCR Primer
(2 µM) 2 µL
0.2 µM
Universal Adaptor PCR Primer
(2 µM) 2 µL
0.2 µM
First strand cDNA (diluted 1:5)
2 µL
ddH2O
4 µL
Final volume
20 µL
7
All-in-One™ miRNA qPCR Primer Manual and Validation Report
3. Mix the qPCR reaction solution well. Transfer the solution to a PCR tube. Spin briefly to make sure
that the reaction solution is at the bottom of the tube.
4.
The qPCR reaction, using the standard 3-step method to detect the DNA amount (these
experiments were designed based on Bio-Rad iQ5 instrument). Melting analysis can be done
immediately after the amplification reactions.
Number of Cycles
Step
Temperature
Time
Detection
1
Pre-denature
95 °C
10min
No
Denature
95 °C
10sec
No
Annealing
See reference below
20sec
No
Extension
72 °C
10sec
Yes
40
Temperature range
66 °C ~ 95 °C
Rate of temperature change
0.5 °C/ step
Duration
6 sec/ step
30 °C
30 sec
Detection
Yes
No
Note: The above conditions are designed for use with the Bio-Rad iQ5Q-PCR instrument. If other
instruments are used, adjust the extension time and conditions for analysis as recommended by
the manufacturers. The annealing conditions for each miRNA assay may be different. Please refer
to the details of the conditions in the following section.
8
All-in-One™ miRNA qPCR Primer Manual and Validation Report
C. Test Results
hsa-miR-196a(
(hsmq-0639 primer)
)
1.1 Validation.
hsa-miR-196a
Amplification Plot
hsa-miR-196a Melting Analysis Curve
Marker
Electrophoresis Result in lane 21-22-23-24 (contains two positive controls and two NTC)
(5 µl of the PCR of products, run on 3% agarose gel)
1.2 Discrimination assay of primer with single-base differences in their sequences
1.2.1
hsa-miR-196a BLAST
hsa-miR-196a
UAGGUAGUUUCAUGUUGUUGGG
hsa-miR-196b
UAGGUAGUUUCCUGUUGUUGGG
9
All-in-One™ miRNA qPCR Primer Manual and Validation Report
The BLAST alignment shows that a single-base difference exists between the two miRNAs:
hsa-miR-196a and hsa-miR-196b. To discriminate and validate the primer of interest
(hsa-miR-196a) . Two plasmids were constructed for each of the two miRNAs.
1.2.2
Sequence result of the miRNA qPCR plasmids
hsa-miR-196a sequence result:
hsa-miR-196b sequence result:
1.2.3 qPCR validation
Using the All-in-One miRNA qRT-PCR Detection Kit, the hsa-miR-196a-specific primer
was validated using miRNA expression plasmids for hsa-miR-196a and hsa-miR-196b
7
as templates (about 10 molecules/reaction).
The percent relative discrimination was calculated using the differences between the
Ct values of the mismatched template and the matching template with respect to the
-∆Ct
hsa-miR-196a-specific primer (Relative discrimination =2
×100%). The results are
shown in the table below:
Ct Value of Standard Plasmid Template
Anneal
Amplify
Temp.(℃
℃)
Relative Discrimination
hsa-miR-196a
hsa-miR-196b
hsa-miR-196b
64.5
21.04
27.59
1.067%
63.3
18.95
24.47
2.172%
61.4
17.03
21.93
3.348%
1.2.4
Conclusion
Based on these results, a qPCR annealing temperature between 61.4 and 63.3 °C is
recommended. This range gives the highest amplification efficiency as well as the best
relative discrimination between the two single-base-different miRNAs.
10
All-in-One™ miRNA qPCR Primer Manual and Validation Report
VIII. Limited Use License and Warranty
Limited Use License
Following terms and conditions apply to use of all OmicsLink™ ORF Expression Clones in all lentiviral vectors and Packaging Kit (the
Product). If the terms and conditions are not acceptable, the Product in its entirety must be returned to GeneCopoeia within 5 calendar
days. A limited End-User license is granted to the purchaser of the Product. The Product shall be used by the purchaser for internal
research purposes only. The Product is expressly not designed, intended, or warranted for use in humans or for therapeutic or
diagnostic use. The Product must not be resold, repackaged or modified for resale, or used to manufacture commercial products without
prior written consent from GeneCopoeia. This Product should be used in accordance with the NIH guidelines developed for recombinant
DNA and genetic research. Use of any part of the Product constitutes acceptance of the above terms.
Limited Warranty
GeneCopoeia warrants that the Product meets the specifications described in the accompanying Product Datasheet. If it is proven to the
satisfaction of GeneCopoeia that the Product fails to meet these specifications, GeneCopoeia will replace the Product. In the event a
replacement cannot be provided, GeneCopoeia will provide the purchaser with a refund. This limited warranty shall not extend to anyone
other than the original purchaser of the Product. Notice of nonconforming products must be made to GeneCopoeia within 30 days of
receipt of the Product. GeneCopoeia’s liability is expressly limited to replacement of Product or a refund limited to the actual purchase
price. GeneCopoeia’s liability does not extend to any damages arising from use or improper use of the Product, or losses associated
with the use of additional materials or reagents. This limited warranty is the sole and exclusive warranty. GeneCopoeia does not provide
any other warranties of any kind, expressed or implied, including the merchantability or fitness of the Product for a particular purpose.
GeneCopoeia is committed to providing our customers with high-quality products. If you should have any questions or
concerns about any GeneCopoeia products, please contact us at 301-762-0888.
© 2009, GeneCopoeia, Inc.
GeneCopoeia, Inc.
9620 Medical Center Drive, #101
Rockville, Maryland 20850
Tel: 301-762-0888 Fax: 301-762-8333
Email: inquiry@genecopoeia.com
Web: www.genecopoeia.com
GeneCopoeia Products are for Research Use Only
Copyright © 2009 GeneCopoeia, Inc.
Trademarks: iQ5™ (Bio-Rad); GeneCopoeia™, OmicsLink™, All-in-One™, (GeneCopoeia Inc.); Trizol™ (Invitrogen);
NanoDrop™ (Thermo Scientific)
AOPM1001
11