- Universität zu Köln

Untersuchung zur Speicherung und Funktion von
Sulfatid in Neuronen anhand von transgenen Mäusen
Inaugural-Dissertation
zur
Erlangung des Doktorgrades
der Mathematisch-Naturwissenschaftlichen Fakultät
der Universität zu Köln
vorgelegt von
Rebekka Maria van Zyl
aus Köln
Köln, 2009
Berichterstatter:
Prof. Dr. G. Schwarz
Prof. Dr. V. Gieselmann
Tag der mündlichen Prüfung: 26.10.2009
Inhaltsverzeichnis
1
Einleitung .......................................................................................................................... 1
1.1
Das Nervensystem der Vertebrata.............................................................................. 1
1.2
Lipide: Struktur und Funktion der Sphingolipide ...................................................... 4
1.3
Cerebosid-Sulfotransferase (CST) ............................................................................. 6
1.4
Synthese und Abbau von Sulfatid ............................................................................... 8
1.4.1
Funktion von Sulfatid im zentralen Nervensystem ............................................ 9
1.5
Lysosomale Speichererkrankungen.......................................................................... 11
1.6
Metachromatische Leukodystrophie (MLD) ............................................................ 14
1.6.1
Therapie-Ansätze der Metachromatischen Leukodystrophie........................... 16
1.7
Mausmodelle der metachromatischen Leukodystrophie .......................................... 17
1.8
Zielsetzung................................................................................................................ 18
2 Material und Methoden ...................................................................................................... 20
2.1
Materialien und Chemikalien................................................................................... 20
2.1.1
Geräte und Verbrauchsmaterial........................................................................ 21
2.1.1.1
Geräte ....................................................................................................... 21
2.1.1.2 Verbrauchsmaterialien ................................................................................. 23
2.1.2
Substanzen........................................................................................................ 23
2.1.3
Kits ................................................................................................................... 25
2.1.4
Nährmedien und Bestandteile für Bakterien .................................................... 25
2.1.5
Zellkultur.......................................................................................................... 25
2.1.5.1
Zellkulturmedien und Zusätze.................................................................. 25
2.1.5.2
Zelllinien .................................................................................................. 26
2.1.6
Software ........................................................................................................... 26
2.1.7
Lösungen .......................................................................................................... 27
2.1.7.1
Nährmedien für Bakterienkulturen........................................................... 27
2.1.7.2
Antibiotika Stammlösung......................................................................... 27
2.1.7.3
Lösungen und Puffer für die Immunfärbung............................................ 28
2.1.7.4
Lösungen für molekularbiologische und biochemische Methoden.......... 29
2.1.8
Bakterienstämme .............................................................................................. 33
2.1.9
Verzeichnis der Plasmide ................................................................................. 33
2.1.10
Verzeichnis der Primer..................................................................................... 34
2.1.11
Molekulargewichtsstandards............................................................................ 36
2.1.12
Verzeichnis der Antikörper .............................................................................. 37
2.2
Versuchstiere............................................................................................................ 38
2.2.1
Wildtyp-Kontrolltiere....................................................................................... 38
2.2.2
ASA-Knockout-Mäuse..................................................................................... 38
2.2.3
ApoE-Knockout-Mäuse ................................................................................... 38
2.2.4
ASA-Knockout/ApoE-Knockout-Mäuse ......................................................... 38
2.2.5
Thy1-CGT transgene Mäuse ............................................................................ 38
2.3
Anfertigung von Gewebeschnitten............................................................................ 39
2.3.1
Paraffinschnitte................................................................................................. 39
2.3.2
Gefrierschnitte.................................................................................................. 39
2.4 Mikrobiologische und Molekularbiologische Methoden................................................ 40
2.4.1.4
Transfektion von Zellen ........................................................................... 41
2.4.1.5
Stabile Transfektion ................................................................................. 44
I
Inhaltsverzeichnis
2.4.2
Immunfluoreszenz-Färbung ............................................................................. 44
2.4.2.1
Immunfärbung.......................................................................................... 45
2.4.2.2
Mikroskopische Auswertung der Immunfärbungen................................. 46
2.5
Nucleinsäure Präparationen .................................................................................... 46
2.5.1.
Kultivierung der Bakterien............................................................................... 46
2.5.2
Lagerung von Bakterien ................................................................................... 47
2.5.3
Amplifizierung und Isolierung von Plasmid-DNA .......................................... 47
2.5.3.1
Transformation von E.coli-Zellen ............................................................ 47
2.5.3.2
Isolierung von Plasmid-DNA................................................................... 47
2.5.3.3
Plasmid-Isolierung (analytischer Maßstab, »Mini-Prep«) ....................... 48
2.5.3.4
Plasmid-Isolierungen (präparativer Maßstab, »Midi-Prep«) ................... 48
2.5.3.5
Schneiden von DNA mit Restriktionsendonukleasen .............................. 48
2.5.3.6
Auftrennen von DNA-Fragmenten durch Agarose-Gelelektrophorese ... 49
2.5.3.7
Konzentrationsbestimmungen von DNA ................................................. 49
2.5.3.8
Reverse Transkription .............................................................................. 50
2.5.3.9
Polymerase-Ketten-Reaktion (PCR) ........................................................ 51
2.5.3.10
Phenol-Chloroform-Extraktion ................................................................ 52
2.5.3.11
Saure Ethanolfällung ................................................................................ 53
2.5.3.12
Auffüllen überhängender Vektorenden.................................................... 53
2.5.3.13
Ligation .................................................................................................... 54
2.5.3.14
Herstellung von Adaptern ........................................................................ 55
2.6
Biochemische Methoden........................................................................................... 55
2.6.1
In-situ-Hybridisierung...................................................................................... 55
2.6.1.1 Herstellung der RNA-Gensonden ................................................................ 55
2.6.1.2 In-situ-Hybridisierung.................................................................................. 56
2.6.2
Nachweis von Proteinen................................................................................... 57
2.6.2.1 Ernten von Zellen für die Western-Blot-Analyse ........................................ 57
2.6.2.2 Proteinbestimmung....................................................................................... 58
2.6.2.3 Sodium-Dodecyl-Sulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE).. 58
2.6.2.4
Semi-Dry Western-Blot (Kyse-Andersen, 1984) ..................................... 60
2.6.3
Nachweis von Proteinen in Gefrierschnitten.................................................... 61
2.6.3.1 Allgemeine Immunhistochemie ................................................................... 61
2.6.3.2 Immunhistochemischer Nachweis von Sulfatid in Gewebe......................... 62
2.6.3.3 Alcianblau-Färbung...................................................................................... 62
2.6.3.4 Immunhistochemie mittels ABC-Methode .................................................. 63
2.6.4
Isolierung der Plasmamembran........................................................................ 64
2.6.5
Cerebrosid-Sulfotransferase-Assay.................................................................. 66
2.6.6
Extraktion von Lipiden aus Zellen ................................................................... 66
2.6.6.1 Vorbereitung von LiChroprep® RP-18........................................................ 66
2.6.6.2 Lipidextraktionen (modifiziert nach van Echten-Deckert, 2000) ................ 66
2.6.6.3 Lipidextraktionen (modifiziert nach Bligh und Dyer, 1959) ....................... 68
2.6.6.4 Auftrennen von Lipiden auf DC-Platten - Dünnschichtchromatographien . 68
2.6.6.5 Immundetektion von Sulfatid auf DC-Aluminiumfolien ............................. 69
2.6.7
ESI-MS (Elektrospray Ionisation-Massen Spektrometrie) von Lipiden .......... 70
2.7
Mäuse ....................................................................................................................... 70
2.7.1
Tierexperimentelles Arbeiten........................................................................... 70
2.7.2
Genotypisierung der Mäuse ............................................................................. 71
2.7.3
Verhaltenstest - Open Field Test...................................................................... 71
2.7.4
Statistische Auswertung ................................................................................... 72
II
Inhaltsverzeichnis
3. Ergebnisse ........................................................................................................................... 73
3.1
MLD-Mausmodell: ASA- und ASA/ApoE–Knockout Mäuse.................................... 74
3.1.1
Analyse der Lebensspanne der verschiedenen Knockout Genotypen.............. 74
3.1.2
Biochemische Analysen der ASA- und ASA/ApoE-Knockout-Mäuse: Analyse
der Sphingolipide im Cortex und im restlichen Gehirn.................................... 75
3.1.3
Histochemische und Immunfluoreszenz-Analysen der ASA- und ASA/ApoEKnockout-Mäuse: ............................................................................................. 81
3.1.3.1 Untersuchung der Sulfatid-Akkumulation in Neuronen im Kleinhirn, Cortex
und im Stammhirn ............................................................................................ 81
3.1.3.2 Immunfluoreszenz Analyse der Sulfatid-Akkumulation in Neuronen im Cortex
und im Stammhirn ............................................................................................ 89
3.2.4
Lipidanalyse und Vergleich der beiden ASA-Knockout-Stämme C57BL/6 und
129/Ola ............................................................................................................. 96
3.1.5
Zusammenfassung der Daten zu den biochemischen und
immunhistochemischen Untersuchungen an MLD-Mausmodellen ................. 99
3.2 Transgene Thy-1-CGT-Mäuse: Analyse der letalen audiogenen Anfälle bei transgenen
Mäusen, die einen erhöhten Sulfatid-Gehalt in Neuronen aufweisen ........................ 100
3.2.1
Nachweis der CGT-Expression im Gehirn von Thy-1-CGT-Mäusen ........... 100
3.2.2
Analyse der Überlebensdauer und der audiogenen Anfälle der Thy-1-CGTMäuse.............................................................................................................. 102
3.2.3
Induktion und Bestimmung der c-Fos-Expression im Colliculus inferior bei
Thy-1-CGT-Mäusen ....................................................................................... 106
3.2.4
Isolierung von Lipiden aus Thy-1–CGT-Mäusen und Analyse des SulfatidGehalts in der neuronalen Plasmamembran ................................................... 108
3.2.5
Analyse der Ganglioside von transgenen Thy-1-CGT-Mäusen..................... 111
3.2.6
Lipid-Analyse der Plasmamembran von transgenen CGT-, CST- und
CGT/CST- Mäusen......................................................................................... 114
3.2.7
Zusammenfassung der Ergebnisse der biochemischen und ESI-MS
Untersuchungen an den transgenen Thy-1-CGT-Mäusen .............................. 117
3.3
In vitro Zellkulturversuche an der Cerebrosid-Sulfotransferase (CST)................. 118
3.3.1
Biochemische Analyse von CST-Fusions-Proteinen ..................................... 118
3.3.2
Analyse von MAL und PLP als mögliche Transporter der CST.................... 121
3.3.3
Export- und Lokalisations-Untersuchung an dem Fusionsprotein DPPIV(TM)39CST ............................................................................................................. 125
3.3.4
Subzelluläre Lokalisation der humanen Gal3-Sulfotransferase 1, 2 und 4 .... 129
3.3.5
Zusammenfassung der Ergebnisse zur subzellulären Lokalisation der CST . 132
4. Diskussion ......................................................................................................................... 133
4.1 Sulfatid-Akkumulation in Neuronen von ASA- und ASA/ApoE-defizienten Mäusen...134
4.2 Analyse der Thy-1 CGT-Mäuse: C18-langkettiges Sulfatid löst letale audiogene
Anfälle in transgenen Thy-1 CGT-Mäusen aus .......................................................... 140
4.3 Subzelluläre Lokalisations-Analyse der Cerebrosid-Sulfotransferase (CST): Retention
der CST im Endoplasmatischen Retikulum ................................................................ 147
4.4
Ausblick .................................................................................................................. 152
5
Zusammenfassung........................................................................................................ 154
6
Abstract ......................................................................................................................... 156
III
Inhaltsverzeichnis
7
Literatur........................................................................................................................ 158
8
Abbildungsverzeichnis ................................................................................................. 178
9
Tabellenverzeichnis...................................................................................................... 180
10
Plasmidkarten........................................................................................................... 181
11
Abkürzungsverzeichnis............................................................................................ 185
Danksagung................................................................................................................................ i
Eidesstattliche Erklärung ........................................................................................................ ii
Lebenslauf ................................................................................................................................iii
IV
1 Einleitung
1 Einleitung
1.1
Das Nervensystem der Vertebrata
Das Nervensystem von Vertebraten ist ein Netzwerk von spezialisierten Zellen. Es wird im
Allgemeinen in zwei Bereiche eingeteilt: das zentrale Nervensystem (ZNS), das beim
Menschen und den übrigen Wirbeltieren das Gehirn und das Rückenmark umfasst, und das
periphere Nervensystem, das den Teil des Nervensystems umfasst, der außerhalb des Gehirns
und Rückenmarks gelegen ist.
Das Nervensystem besteht hauptsächlich aus Nervenzellen (Neuronen), die bei Nagetieren ca.
35 % der Zellen, beim Menschen etwa 10 % ausmachen (Baumann & Pham-Dinh, 2001),
sowie den verschiedenen Neurogliazellen. Gliazellen bilden im Vergleich zu Neuronen die
Mehrheit der ZNS-spezifischen Zelltypen. Sie sind die Stützzellen, die für die strukturelle
Verstärkung des Nervensystems verantwortlich sind. Sie schützen die Neuronen durch eine
Isolierungsschicht und unterstützen sie auch in verschiedenen anderen Funktionen. Im Gehirn
und im Rückenmark des ZNS wird zwischen Mikrogliazellen und Makrogliazellen
unterschieden, wobei letztere sowohl aus Astrozyten als auch aus Oligodendrozyten bestehen.
Die Mikrogliazellen machen etwa 5-20 % aller Gliazellen im ZNS aus und kommen sowohl
in der weißen wie auch in der grauen Substanz vor. Sie sind die zerebralen Makrophagen.
Verschiedenartige pathologische Veränderungen, z.B. durch Verletzungen oder den Befall
von Fremdorganismen im ZNS führen zu ihrer Aktivierung, die sie befähigt, eine adaptive
Immunreaktion zu initiieren (Drenkhahn & Zenker, 1994; Kreutzberg, 1996). Daraufhin
verändert sich ihre Morphologie zu amöboiden Zellen, die Phagozytose betreiben (Bechmann
& Nitsch, 1997). Neben der Beseitigung von Pathogenen entfernen die zerebralen
Makrophagen ebenfalls zytotoxische Substanzen und abgestorbene Zellbestandteile (Streit,
2001; Raivich & Banati, 2004).
1
1 Einleitung
Astrozyten bilden die Mehrheit der Gliazellen im ZNS. Sie kommen sowohl in der weißen
Substanz als fibrillenreiche Faserglia vor, als auch in der grauen Substanz als
protoplasmatische Astrozyten. Sie umschließen die Blutkapillaren im Gehirn und sind ein
wichtiger Bestandteil der Blut-Hirn-Schranke. Über chemische Signale kommunizieren sie
sowohl untereinander als auch mit Neuronen.
Die Oligodendrozyten kommen nur im ZNS vor und interagieren untereinander und mit
Neuronen. Sie besitzen kleine runde Zellkerne, die sehr heterochromatinreich sind. Mit ihren
strahlenförmigen Fortsätzen bilden sie die elektrisch-isolierende Myelinschicht um die
Axone. Im peripheren Nervensystem wird die Myelinschicht von den Schwannschen Zellen
gebildet.
Axone werden im Verlauf der Entwicklung des Nervensystems myelinisiert, indem die
Membranen der Schwannschen Zellen oder der Oligodendrozyten in bis zu 50 verschiedenen
konzentrischen Lagen um die Axone der Neuronen wachsen. Durch die Verdrängung des
Zytoplasmas aus diesen Membranschichten kommt es zu einer kompakten Lipidschicht, dem
Myelin. Myelin erhält dadurch eine spiralförmige Struktur mit einem besonders hohen LipidGehalt von 70 % (Baumann & Pham-Dihn, 2001). Myelin ist reich an Cholesterol,
Phospholipiden und Glykosphingolipiden, wobei Galaktosylceramid und Sulfatid den größten
Anteil ausmachen (Morell et al., 1994). Da diese Lipide eine schlechte elektrische
Leitfähigkeit besitzen, sorgt die Myelinschicht für die elektrische Isolierung der Axone. Diese
sog. Myelinscheide wird in ihrer Kontinuität um die Axone in bestimmten Abständen
unterbrochen. Diese Unterbrechungen werden Ranviersche Schnürringe genannt. Der
zwischen je zwei Ringen gelegene myelinisierte Abschnitt wird als Internodium bezeichnet.
Die Reizweiterleitung entlang der Axone erfolgt durch Aktionspotentiale von Schnürring zu
Schnürring, was den Vorteil einer schnelleren saltatorischen Erregungsweiterleitung
gegenüber den nicht-myelinisierten Axonenbahnen wirbelloser Tiere hat.
2
1 Einleitung
Abb. 1.1: Schematische Darstellung eines Neurons. Oligodendrozyten bilden eine isolierende Myelinschicht
um die Axone der Neuronen. Die Unterbrechungen der Myelinscheide werden Ranviersche Schnürringe genannt
(modifiziert nach stem cells - stemcells.nih.gov-).
Untersuchungen an Mäusen, bei denen die Lipidsynthese der Myelinlipide defekt ist, zeigen
deren Wichtigkeit für die Formation und Erhaltung von Myelin (Bosio et al., 1996; Coetzee et
al., 1996). Ein bekanntes Mausmodell, das dies verdeutlicht ist die CerebrosidGalaktosyltransferase (CGT)-Knockout-Maus (Coetzee et al., 1996; Bosio et al., 1998;
Dupree et al., 1998), die weder Galaktosylceramid (GalCer) noch Sulfatid bilden kann. Die
Tiere zeigen hauptsächlich eine fortschreitende Demyelinisierung und sterben bereits nach
drei bis zwölf Wochen (Bosio et al., 1996; Coetzee et al., 1996; Dupree et al., 1998).
3
1 Einleitung
1.2
Lipide: Struktur und Funktion der Sphingolipide
Lipide stellen eine Klasse von Molekülen dar, deren strukturelle und biologische Funktionen
sehr vielseitig sind. Lipide sind in Wasser unlöslich, aber in Fetten und organischen
Solventien (Chloroform) löslich. Die Hauptaufgabe von Lipiden in einem zellulären Verband
ist die Formation der Permeabilitätsbarriere von Zellen und subzellulären Organellen in der
Form einer Lipid-Doppelschicht (Singer & Nicolson, 1972). Es gibt drei Hauptgruppen von
Membranlipiden: Cholesterin, Glycerolipide und Sphingolipide.
Cholesterin leitet sich von den Stearoiden ab, Glycerolipide vom Glycerin und Sphingolipide
vom Sphingosin (Kolter & Sandhoff, 1999). Unter den Sphingolipiden nimmt Sphingomyelin
eine Sonderstellung ein, da es aufgrund seiner polaren Phosphatgruppe auch zu den
Phospholipiden zählt.
Sphingolipide sind mittels ihres lipophilen Anteils, dem Ceramid, in der Membran verankert
und bilden zusammen mit den Glykoproteinen und Glykoaminoglykanen die sogenannte
Glykocalix (mit Ausnahme von Sphingomyelin).
Sphingolipide liegen in unterschiedlichen Formen vor, die art- und zelltypspezifisch sind (van
Meer & Lisman, 2002). Dabei können sie mit vielen Zuckerresten verknüpft sein, die in ihrer
Art und Anzahl variieren (sog. Glykosphingolipide, Kolter & Sandhoff, 1999). Der
Lipidanker der Glykosphingolipide kann ebenfalls in der Alkylkettenlänge, im Sättigungsund Hydroxylierungsgrad variieren. Zusammen mit den Phospholipiden stellen die
Glykosphingolipide die Hauptbausteine der eukaryotischen Plasmamembran dar.
Eine der übergeordneten Hauptfunktionen von Glykosphingolipiden ist die Beteiligung an der
Entwicklung des zentralen Nervensystems (Hucho, 1982) sowie der Aufbau der
Permeabilitätsbarriere der Haut (Wertz & van den Bergh, 1989). Glykosphingolipide sind an
der Zell-Zell-Erkennung beteiligt und treten in Wechselwirkung mit Rezeptoren und
Enzymen innerhalb der Membranen (Yamashita et al., 2002). Des Weiteren sind sie an
Signaltransduktion (Huwiler et al., 2000), Apoptose, Proliferation, Differenzierung und
Entzündungsprozessen beteiligt (Maceyka et al., 2005; Posse de Chaves, 2006; Taha et al.,
2006). Sie spielen eine entscheidende Rolle bei der Bildung der Myelinscheiden des
peripheren
und
zentralen
Nervensystems.
Zudem
dienen
Glykosphingolipide
als
Bindungsstellen für Viren (Markwell et al., 1981), Bakterien (Karlsson, 1981) und Toxine
(Walton et al., 1988). Kommt es bei der Synthese oder dem Abbau von Sphingolipiden zu
Defekten, so können verschiedene degenerative neuronale Erkrankungen hervorgerufen
werden (s. Abschnitt 1.5).
4
1 Einleitung
Die
Ausgangssubstanz
von
Sphingomyelinen
(Phosphosphingolipide)
und
Glykosphingolipiden ist Ceramid. Ceramid besteht aus einer Fettsäure und aus einem
langkettigen Aminoalkohol, dem D-erythro-Sphingosin. Die Synthese beginnt im
Endoplasmatischen Retikulum und wird im Golgi-Apparat fortgesetzt. Zuerst vermittelt die
Serin-Palmitoyltransferase eine Kondensation von Palmitoyl-CoA und L-Serin zu 3Ketosphinganin. Danach erfolgt eine NADPH-abhängige Reduktion von 3-Ketosphinganin zu
D-erythro-Sphinganin. In der nächsten Reaktion wird Sphinganin zu Dihydroceramid,
welches weiter zu Ceramid dehydriert wird (Rother et al., 1992; Michel et al., 1997; Geeraert
et al., 1997).
Abb. 1.2 : Ceramidsynthese. Aus Serin und Palmitoyl-CoA wird Ceramid über 3-Ketosphinganin, Sphinganin
und Dihydroceramid gebildet. Das Ceramid bildet das Grundgerüst für weitere komplexere Sphingolipide (Abb.
modifiziert nach Stoffel & Bosio, 1997). (CoA = Coenzym A, PLP = Pyridoxalphosphat, NADPH =
Nicotinamid-Adenin-Dinukleotid-Phosphat (reduzierte Form); SK= Sphingosin-Kinase, S1P= Sphingosin-1Phopshat; S1PP= Sphingosin-1-Phopshat-Phosphatase).
Erfolgt eine Übertragung der Phosphorylcholin-Gruppe des Phosphatidylcholins auf das
Ceramid, so entstehen Sphingomyelin (Abb. 1.4) sowie Diacylglycerin. Sphingomyelin ist ein
Bestandteil von Myelinscheiden und Plasmamembranen.
5
1 Einleitung
Abb. 1.3: Sphingomyelin. Das Grundgerüst bildet das Sphingosin. An die C2-Aminogruppe ist eine Fettsäure
über eine Amidbindung verknüpft und an die C1-Hydroxylgruppe eine Phosphatgruppe über eine
Phosphoesterbindung.
Durch die ß-glykosidische Addition von Zuckerresten an das Ceramid entsteht durch das
Anhängen von Galaktose, Galaktosylceramid (GalCer) oder von Glukose, Glucosylceramid
(GlcCer) (Schulte & Stoffel, 1993; Paul et al., 1996). Die Biosynthese von Ceramid und
Galaktosylceramid läuft im Endoplasmatischen Retikulum ab. Die Zugabe von Glukoseresten
zur Bildung von Glucosylceramid oder von Phosphocholin auf Ceramid zur Bildung von
Sphingomyelin erfolgt im Golgi-Apparat. Einige Glykosphingolipide, wie die Ganglioside
leiten sich vom Laktosylceramid ab, das durch die Übertragung eines Glukoserestes und
anschließend eines Galaktoserestes auf die primäre Hydroxylgruppe von Ceramid entsteht
(Basu et al., 1968). Die Biosynthese der Ganglioside erfolgt im Golgi-Apparat.
Ganglioside, die zur Klasse der Glykolipide gehören, sind besonders häufig auf der
Oberfläche von Neuronen vorhanden. Sie entstehen aus den Vorläufer-Gangliosiden GM3
und GD3 wobei verschiedene Sialyltransferasen die Anbindung der Sialinsäuren katalysieren
(Pohlentz et al., 1988; Kolter et al., 2002; van Echten-Deckert & Herget, 2006).
1.3
Cerebosid-Sulfotransferase (CST)
Die Cerebrosid-Sulfotransferase ist ein Typ II-Transmembranprotein. Sie transferiert mit
Hilfe des Sulfatdonors PAPS (3´-Phosphoadenosin-5´-Phosphosulfat) eine Sulfatgruppe auf
die 3´-Hydroxyl-Gruppe von Galaktosylceramid (Morell & Radin, 1969; Basu et al., 1971;
van der Bijl et al., 1996). Lactosylceramid (LacCer) wird von den Enzymen UDP-GlukoseCeramid Glycosyltransferase (GlcT-1) und UDP-Galaktose-Glukosyl-CGT synthetisiert. Im
nächsten Schritt wird LacCer mittels der CST sulfatiert. Die Synthese von Sulfatid und
Sulfolaktosylceramid (SLacCer) erfolgt im Golgi-Apparat (Eckhardt et al., 2007; MolanderMelin et al., 2004).
6
1 Einleitung
Abb. 1.4: CST katalysiert die Synthese von Sulfatid und SLacCer. (modifiziert nach Eckhardt et al., 2007).
CGT = Cerebrosid-Galaktosyltransferase; Gal-Cer = Galaktosyl-Ceramid; GlcT-1 = Glukose-CeramidGlykosyltransferase; GalT-1 = Galaktose-Glukosyl-CGT; LacCer = Laktosyl-Ceramid; SLacCer = SulfoLaktosyl-Ceramid
Ein
Hauptprodukt
ausgehend
vom
Ceramid
ist
das
Glykosphingolipid
3-O-
Sulfogalaktosylceramid (Sulfatid, s. 1.4), was hauptsächlich in Gehirn und Nieren gebildet
wird (Honke et al., 2004; Ogawa et al., 2004).
Die CST cDNA wurde bisher aus Maus und Mensch kloniert. Beide CSTs weisen zwei NGlykosylierungsstellen an Asn-66 und Asn-312 auf. Es konnte gezeigt werden, dass die
Glykosylierung von Asn-66 und Asn-312 für die vollständige katalytische Aktivität murinerCST erforderlich ist (Eckhardt et al., 2002).
Die Golgi-Lokalisation einiger Sulfo- und Glykosyltransferasen geht einher mit der Fähigkeit
zur Oligomerisierung (Colley 1997). Im Falle der CST ist die Lokalisation auf den medialtrans-Golgi beschränkt. Des Weiteren konnte gezeigt werden, dass die CST Homodimere in
lebenden Zellen bildet (Yaghootfam et al., 2007) und dass die Dimerisierung durch die
luminale Domäne des Enzym vermittelt wird. Diese Oligomerisierung der CST ist
unabhängig von den N-Glykosylierungsstellen und der Transmembran-Domäne.
7
1 Einleitung
1.4
Synthese und Abbau von Sulfatid
Sulfatid (3-O-Sulfogalaktosylceramid) ist zusammen mit Sphingomyelin eines der ersten
Sphingolipide, das von Thudichum 1884 beschrieben wurde. Sulfatid macht ungefähr drei bis
vier Prozent des totalen Lipidgehaltes des Myelins aus (Norton & Poduslo, 1982). Wie viele
andere Sphingolipide weist die Struktur des Sulfatids Acylketten verschiedener Längen auf.
Die Acylreste können auch hydroxyliert sein. Sulfatid ist ein Sulfatester von
Galaktosylceramid, in dem die Sulfatgruppe an die C-3 Hydroxyl-Gruppe gebunden ist
(Stoffyn & Stoffyn, 1963; von Figura et al., 2001). Das Grundgerüst Sphingosin besteht
hauptsächlich aus C-18 Sphingoidbase (Stoffyn, 1966). Die Haupt-Fettsäurekettenlänge von
Sulfatid unterscheidet sich zwischen weißer und grauer Substanz. Sulfatid besteht in adulter
humaner weißer Substanz hauptsächlich aus C22-C26 Fettsäuren, wobei im infantilen Gehirn
C18-Fettsäureketten einen signifikanten Anteil ausmachen (Pernber et al., 2007)
Abb. 1.5: 3-O-Sulfogalaktosylceramid (Kolter & Sandhoff, 1999). Das Grundgerüst ist ein Galaktocerebrosid
an dem eine Sulfatgruppe angelagert ist.
Die Synthese von Sulfatid startet im Endoplasmatischen Reticulum. Die UDPGalaktose:Ceramid-Galaktosyltransferase (CGT), ein ca. 54 kDa großes Enzym, das Cterminal eine Transmembrandomäne sowie ein ER-Rückhaltesignal besitzt (Sprong et al.,
1998), katalysiert den Transfer von Galaktose auf die C1-Hydroxylgruppe des Ceramids,
wobei Galaktosylceramid gebildet wird (Bosio et al., 1996a; Stoffel & Bosio, 1997). Dabei
kann sowohl nicht-hydroxyliertes-Ceramid als auch 2-hydroxyliertes Ceramid als Substrat
dienen (Morell & Radin, 1969; Basu et al., 1971; van der Bijl et al., 1996).
Das entstandene Galaktosylceramid (GalCer) wird zum Golgi-Apparat transportiert, wo es
schließlich zu Sulfatid verestert wird.
Der Abbau von Sulfatid erfolgt in lysosomalen Kompartimenten. Dabei katalysiert die
Arylsulfatase A (ASA) im ersten Schritt eine Hydrolyse der Sulfatgruppe. Diese Reaktion
benötigt als Co-Faktor Sphingolipid Aktivator Protein B (Saposin B), welches das Sulfatid
8
1 Einleitung
aus der Membran herauslöst und somit der ASA zugänglich macht (Kolter & Sandhoff, 2005;
Eckhardt, 2008).
GalCer wird mit Hilfe des Enzyms Galaktocerebrosid ß-Galaktosidase in die Bestandteile
Ceramid und Galaktose zerlegt (Abb. 1.6)
Abb. 1.6: Abbau von Sulfatid. Der Abbau erfolgt in Lysosomen, katalysiert von dem Enzym ASA und dem
Aktivatorprotein Saposin B (GalCer = Galaktosylceramid; ASA = Arylsulfatase A; SapA/B = Saposin A/B).
Aufgrund eines Defektes im ASA-Gen oder, in selteneren Fällen des Saposin B-Gens kommt
es zur Akkumulation von Sulfatid in Lysosomen (Gieselmann et al., 1998; Eckhardt, 2008).
Die daraus entstehende Krankheit wird metachromatische Leukodystrophie genannt (s.
Abschnitt 1.6).
1.4.1 Funktion von Sulfatid im zentralen Nervensystem
Sulfatid ist ein Hauptbestandteil von myelinisierenden Zellen im zentralen Nervensystem.
Über starke ionische Interaktion ist Sulfatid an das Myelin Basische Protein (MBP) und an
Proteolipid Protein (PLP) gebunden. Zusammen mit Galaktosylceramid (GalCer) hat Sulfatid
eine unterstützende Isolierungs-Funktion der Membranschicht und trägt damit zur Erhöhung
der Nervenleitgeschwindigkeit bei. (Arvanitis et al., 1992; Norton & Poduslo, 1973; Vacher et
al., 1989; Schmidt & Thews, 2000).
Es wird vermutet, dass Sulfatid auch beim aktiven Natrium-Transport als Co-Faktor der
Natrium-Kalium-ATPase dient (Rintoul & Welti, 1989).
Sulfatid ist hauptsächlich in Oligodendrozyten und in Schwann-Zellen vorhanden, aber auch
in Neuronen und Astrozyten. Allerdings ist noch nicht geklärt, ob Neuronen und Astrozyten
selbst Sulfatid synthetisieren oder ob es durch Lipoprotein-Endozytose importiert wird. Eine
9
1 Einleitung
Möglichkeit ist, dass Sulfatid mit Hilfe von Rezeptor-vermittelter Endozytose in Neurone
transportiert wird (Han, 2007).
ApoE enthaltende Lipoproteine spielen eine wichtige Rolle bei der Aufrechterhaltung der
Lipid-Homöostase im Gehirn (Han, 2004). Sulfatid ist in den ApoE-enthaltenden HDL (High
Density Lipoprotein)-like Lipoproteinen der cerebrospinalen Flüssigkeit von Menschen
enthalten. Aufgrund der Expression von ApoE-Rezeptoren auf Neuronen ist es diesen
möglich, über Endozytose ApoE-Lipoproteine aufzunehmen (Pitas et al., 1987; Han, 2004).
Dies ist vor allem wichtig, um Cholesterol für das Axonwachstum und die Reparatur zu
transportieren (Vance et al., 2006). Das von Han (Han et al., 2003; 2007) vorgeschlagene
Modell beschreibt, dass die von den Astrozyten ausgeschütteten ApoE-Lipoproteine Sulfatid
von der Myelin-Membran aufnehmen und über Endozytose mit Hilfe des LDL-Rezeptors oder
LDL-Rezeptor-ähnlichen Proteinen in Neuronen transportieren.
Sulfatid spielt eine wichtige Rolle bei der Differenzierung von Oligodendrozyten als negativer
Regulator. Wie Untersuchungen an CST-Knockout-Mäusen zeigten, führt ein Sulfatid-Defizit
zu einem zwei- bis dreifachen Anstieg an differenzierten Oligodendrozyten (Hirahara et al.,
2004). Auch scheint Sulfatid an der Initiation der Myelinisierung beteiligt zu sein. Im Fall von
Schwann-Zellen bindet Sulfatid an Komponenten der extrazellulären Matrix wie Laminin
oder Tenascin-R (Roberts et al., 1985; Pesheva et al., 1997). Diese interagieren wiederum mit
Signalmolekülen der Gliamembran, wie beispielsweise Integrinen und F3. Somit wird ein
Signalweg aktiviert, der über die c-src/fyn Kinase vermittelt wird (Li et al., 2005).
Sulfatid hat einen Einfluss auf glial-axonale Signalweiterleitung, denn in CST-KnockoutMäusen wurde ein verringerter Axondurchmesser gemessen (Marcus et al., 2006). Auch
konnte eine Dislokation von Ionenkanälen beobachtet werden, die mit der Zerstörung der
glial-axonalen Verbindungen an den Paranodien zusammenhängen könnte (Ishibashi et al.,
2002). Dass Sulfatid wichtig für die Erhaltung des axo-glialen Kontaktes im peripheren
Nervensytem ist, zeigte sich ebenfalls bei den CST-Knockout-Mäusen. Bei ihnen treten in den
peripheren Nerven ausgedehnte axonale Veränderungen an den Ranvierschen Schnürringen
auf, mit abnormal großen Vesikeln. Die verschiedenen Adhäsionsmoleküle, wie Caspr
(Contactin assoziiertes Protein) und Neurofascin 155 (NF 155, Gliales Adhäsionsprotein)
befinden sich in nur noch zur Hälfte in der paranodalen Region (Hoshi et al., 2007). Beide
Proteine werden für die glial-axonalen Protein-Lipid-Interaktion benötigt.
Sulfatid könnte auch an der Rekrutierung von Proteinen an die Myelin-Membran beteiligt
sein, wie z.B. im Falle von NF 155. Dies zeigen Veränderungen in der Zusammensetzung von
Lipid-Rafts in CGT-Knockout-Mäusen (Schafer et al., 2004; Schafer & Rasband, 2006).
10
1 Einleitung
Interessanterweise zeigten Myelin- und Lymphozyten Protein (MAL)-defiziente-Mäuse
ähnliche Veränderungen der Nerven (Schaeren-Wiemers et al., 2004). MAL ist ein tetraspan
Lipid-Raft Protein, das eine Rolle bei der Bildung von Membran-Microdomänen im Myelin
spielt (Erne et al., 2002). Bei einer MAL-Defizienz ist der Transport von Sulfatid zu den
„paranodalen Lipid Rafts“ (kleine, bewegliche, dicht gepackte Mikrodomänen, zum größten
Teil bestehend aus Glykosphingolipiden und Cholesterol; Brown & London, 1998; Simons &
Toomre, 2000; Simons & Vaz, 2004) beeinträchtigt und ruft somit eine Störung der glialaxonalen Zellverbindung hervor (Schaeren-Wiemers et al., 2004).
1.5
Lysosomale Speichererkrankungen
Unter dem Begriff lysosomale Speicherkrankheiten wird eine Gruppe von ca. 40
Erkrankungen zusammengefasst. In den meisten Fällen handelt es sich um genetische Defekte
lysosomaler Enzyme. Die Defekte, die die Abbauproteine betreffen, führen hauptsächlich
dazu, dass die Abbauwege in den Lysosomen stark gestört sind. Die klinischen
Konsequenzen, die durch eine solche Abbau-Defizienz folgen, hängen von den jeweils
betroffenen Zelltypen ab. Infolge des Enzymdefektes kommt es zur Akkumulation nicht
abbaubarer Substanzen in den Lysosomen. Die daraus resultierenden Krankheiten werden
Speicherkrankheiten genannt. Nach der Speichersubstanz werden sie Sphingolipidosen
genannt, von denen bisher ca. 40 Varianten bekannt sind (Vellodi, 2005). Mit Ausnahme der
Fabrerschen Erkraunkung werden Sphingolipidosen autosomal resessiv vererbt.
In der folgenden Tabelle 1 werden einige der Lysosomalen Speicherkrankheiten
zusammengefasst.
11
1 Einleitung
Tabelle 1. Verschiedene Glykosphingolipid-Speicherkrankheiten. Dargestellt sind die jeweilige
Speicherkrankheit mit dem entsprechenden Enzym-Defekt und die daraus resultierende Speichersubstanz.
Lysosomale Krankheit
Defektes Enzym
Speichersubstanz(en)
Betroffene Organe
Farbersche Krankheit
(Ceramidose) (Iwamori &
Moser, 1975)
Niemann-Picksche
Krankheit (Elleder, 1989)
(Sphingomyelinose)
Gauchersche Krankheit
(Glucocerebrosidose) (Brady
et al., 1965)
Ceramidase
Ceramid
Viscera und Gehirn
Sphingomyelinase
Sphingomyelin
Viscera und Gehirn bei
Typ A
Glucocerebrosid-βGlucosidase
(Glucosylceramid-βGlucosidase)
Galaktocerebrosid-βGalaktosidase
(Galaktosylceramid-βGalaktosidase)
Gangliosid-GM1-βGalaktosidase
Glucosylceramid
Viscera und
Gehirn
(bei infantiler Form)
Galaktosylceramid
Gehirn (weiße
Substanz)
Gangliosid GM1;
Keratansulfat
Gehirn
viscerale Organe
α-Galaktosidase A
viscerale Organe
Hexosaminidase A
α-Galaktosylgalaktosylceramid und αGalaktosyllactosylcera-mid
Gangliosid GM2
Hexosaminidasen A
und B
Ganglioside GM2 und G
A2
Gehirn
Viscera
Sulfatid-Sulfatase
(Arylsulfatase A)
Sulfatid
Gehirn (weiße
Substanz)
und Niere
Krabbesche Krankheit
(Glucocerebrosidose)
(Miyatake & Suzuki, 1972)
GM1-Gangliosidose
(Jatzkewitz & Sandhoff,
1963)
Fabrysche
Krankheit
(Gieselmann, 1995)
GM2-Gangliosidose,
Variante B (TaySachssche
Krankheit)
(Sandhoff, 1969)
GM2-Gangliosidose,
Variante 0
(Sandhoff & Kolter, 1995)
Metachromatische
Leukodystrophie
(Sulfatidose) (Gieselmann et
al., 1998) und Austinische
Krankheit (Schmidt et al.,
1995)
Gehirn
(graue Substanz)
Da der Abbau der Glykosphingolipide streng sequentiell erfolgt, führt der Ausfall bereits
eines Enzyms zu einer Blockierung der gesamten Abbaukaskade. Alle Substanzen werden nur
bis zu dem blockierten Schritt abgebaut und nicht mehr abbaubare Lipidsubstrate reichern
sich intralysosomal an. Im Normalfall erfolgt der konstitutive Abbau der Glykosphingolipide
in den späten Endosomen und Lysosomen (Sandhoff et al., 1977 & 1995). Von den
Glykolipiden werden die Zuckerreste vom nichtreduzierenden Ende her abgespalten. Da
einige terminale Zucker vor dem Zugriff der Exohydrolasen geschützt sind (wie z.B. bei
Sulfatid),
werden
sogenannte
Aktivator-Proteine
benötigt.
Diese
Sphingolipid-
Aktivatorproteine A, B, C und D, kurz SapA, -B, -C und –D entstehen durch Proteolyse aus
einem gemeinsamen Vorläuferprotein, dem Prosaposin.
12
1 Einleitung
Nach der Zuckerabspaltung entsteht Ceramid, welches zu Sphingosin und einer langkettigen
Fettsäure abgebaut wird. Die so entstandenen Sphingosin-Basen, Fettsäuren und
Monosaccharide verlassen dann das Lysosom.
Eine der häufigsten Sphingolipidosen ist durch die Defizienz der ß-Glukocerebrosidase und
somit durch die Anreicherung von Glucosylceramid gekennzeichnet (Brady et al., 1965;
Patrick A.D., 1965; Beutler & Grabowski, 1995). Diese Krankheit wird die Gauschersche
Erkrankung genannt (s. Tabelle 1, Abb. 1.7). Um neuronale Erkrankungen handelt es sich bei
der Krabbeschen Krankheit sowie bei den Gangliosid-Speicherkrankheiten. Bei der
Krabbeschen Krankheit führt das Fehlen der lysosomalen Galaktocerebrosidase zum fast
vollständigen Abbau des Myelins (Suzuki & Suzuki, 1970; Suzuki et al., 1995). Verursacht
wird dies durch den erhöhten Anteil von Psychosin, dem Lysolipid Derivat von
Galaktosylceramid in den Myelinlipiden, was in der Zerstörung der myelinbildenden
Oligodendrozyten resultiert. Bei den Gangliosid-Speicherkrankheiten, wie z.B. der GM2Gangliosidose, liegt ein Defekt bei dem Enzym Hexosaminidase A und/oder B vor und führt
zur Speicherung von Gangliosid GM2 in der grauen Substanz des Gehirns (Gravel et al.,
1995; Sandhoff et al., 1989).
Beim Menschen sind zahlreiche Glykosphingolipid-Speicherkrankheiten (s. Tabelle 1)
bekannt, die bis auf eine alle Schritte des Glykosphingolipid-Abbaus betreffen (Abb. 1.7).
Abb. 1.7: Abbau der Sphingolipide und der dazu gehörigen Speichererkrankungen. Die einzelnen
Metabolite sind unterstrichen, die Namen der mit dem jeweiligen Abbauschritt verbundenen Erbkrankheiten
kursiv, die der beteiligten Proteine umrandet dargestellt. (MLD: Metachromatische Leukodystrophie, ASA:
Arylsulfatase A, Hex: Hexosaminidase, GM2AP: GM2-Aktivatorprotein, Sap: Sphingolipid-Aktivatorprotein).
13
1 Einleitung
1.6
Metachromatische Leukodystrophie (MLD)
Die Leukodystrophien sind genetisch bedingte progressive Krankheiten, die das Gehirn, das
Rückenmark und umliegende Nerven betreffen. Der Terminus "Leukodystrophie" leitet sich
von "leuko" [griechisch] = weiß und "dystrophien" [griechisch] = fehlerhaft ab.
Die Metachromatische Leukodystrophie, kurz MLD, ist eine autosomal rezessiv vererbte
Erkrankung aus der Gruppe der lysosomalen Speicherkrankheiten. Bei Neugeborenen wird
eine Inzidenz von 40.000 bis 100.000 geschätzt (Gustavson & Hagberg, 1971; Heim et al.,
1997). Aufgrund des Fehlens von aktiver Arylsulfatase A (ASA) liegt ein gestörter Abbau des
3-0-Sulfogalaktosyl-ceramid (Sulfatid) vor (Austin et al., 1963) und es kommt zur SulfatidAkkumulation im Nervensystem, hauptsächlich in Oligodendrozyten, Schwann-Zellen und
Phagozyten, aber auch in Astrozyten und Neuronen (von Figura et al., 2001). Ebenso wurde
in den Nieren sowie in der Gallenblase und den Gallengängen Sulfatid-Anreicherung
beobachtet (von Figura et al., 2001; Jatzkewitz, 1958; Jatzkewitz et al., 1970).
Arylsulfatase A
Abb. 1.8: Die Desulfatierung von Sulfatid durch die Arylsulfatase A ist der erste Schritt des Abbaus von
Sulfatid.
Die Störungen dieses Abbaus können zum einen durch Mutationen in der Arylsulfatase und
zum anderen durch eine Defizienz des Aktivatorproteins Saposin B (Shapiro et al., 1979)
verursacht werden. Alleine 115 Mutationen der Arylsulfatase sind bis heute bekannt
(Gieselmann, 1998). Mit Hilfe von Saposin B, das als membranaktiver Co-Faktor des
lysosomalen Glykosphingolipidkatabolismus agiert (Kishimoto et al., 1992; Kolter &
Sandhoff, 2005), wird das Sulfatid aus der Membran gelöst und dem ASA-Enzym für die
Abspaltung der Sulfatgruppe verfügbar gemacht.
Es gibt drei klinische Subtypen von MLD, die sich in erster Linie im Zeitpunkt des Ausbruchs
der Krankheit unterscheiden. In allen Fällen kommt es zu einem fortschreitenden Verlust der
physischen und intellektuellen Funktionen über einen relativ langen Zeitraum.
14
1 Einleitung
Die drei Formen sind die spät infantile, die juvenile und die adulte Form.
Die spät-infantile Form tritt im Alter zwischen 6 Monaten und 2 Jahren auf. Die Patienten
erkranken mit dem Verlust des bereits erlernten Gehens sowie des Stehens. Im weiteren
Verlauf treten Dysarthrie und Aphasie auf. Ebenso nimmt die Sehfähigkeit vermehrt ab.
Weitere Symptome sind eine Verfärbung der Makula sowie eine fast vollständige Störung der
Koordinations-Bewegung. Es folgen Erblindung, Erschlaffung der Gliedmaßen, die zur
Tetraplegie führen und schließlich Dezerebration.
Nach Ausbruch der klinischen Symptome tritt nach ungefähr fünf Jahren der Tod des
Patienten ein (von Figura et al., 2001).
Die juvenile Form tritt zwischen dem vierten und sechzehnten Lebensjahr auf. Zu Beginn der
Krankheit machen sich eine Verschlechterung der schulischen Leistung, undeutliche Sprache,
Gangstörungen, Inkontinenz und Persönlichkeitsstörungen bemerkbar. Im weiteren Verlauf
entwickeln die Patienten Ataxie (Störung der Bewegungsform) und Tetraplegie. Schließlich
kommt es zur Dezerebration und die Patienten sterben meist, bevor sie das 20. Lebensalter
erreicht haben.
Bei der Spät/adulten Form tritt die Erkrankung zwischen der Pubertät und dem Senium (bis
ca. 63. Lebensjahr) ein. Die ersten auffälligen Symptome sind eine Verschlechterung der
intellektuellen Fähigkeiten in Schule und Beruf, eine Störung der Persönlichkeit,
Gedächtnisverlust und auch psychotische Symptome wie Halluzinationen. Weiterhin kommt
es zu Bewegungsstörungen, spastischer Lähmung von Armen und Beinen, Erblindung und
Inkontinenz. Diese Form der MLD kann innerhalb weniger Jahre zum Tode führen, sich aber
auch bis zu Jahrzehnten hinziehen. Diese drei Formen der MLD sind bedingt durch
verschiedene Mutationen. Es sind zahlreiche Mutationen des ASA kodierenden ASA-Gens
auf dem Chromosom 22 bekannt (Kreysing et al., 1990).
Die Unfähigkeit, Sulfatid abzubauen resultiert in einer intralysosomalen Speicherung, welche
bereits makroskopisch und mittels einer speziellen Färbung (Alcianblau-Färbung) erkennbar
ist (Wittke et al., 2004; Ramakrishnan et al., 2007). Eine Reduzierung der weißen Substanz
des zentralen Nervensystems sowie des Myelins in den peripheren Nerven ist sichtbar (von
Figura et al., 2001). Eine veränderte Zusammensetzung der weißen Substanz liegt vor. Der
Anteil von Sulfatid ist erhöht, aber der Anteil von anderen Lipiden wie Cholesterin, GalCer
und Sphingomyelin ist verringert.
Es ist noch unklar, wie die Akkumulation von Sulfatid zur Demyelinisierung der
Nervenleitung und zum Verlust der Nervenzellen führt (Gieselmann, 2003). Die
Akkumulation ist aber nicht nur auf die lysosomalen Kompartimente beschränkt, sondern
15
1 Einleitung
auch im Myelin zu finden (Saravanan et al., 2004). Inwiefern sich nun diese intrazelluläre
Speicherung und/oder die erhöhte Menge an Sulfatid in der Plasmamembran auf die
Krankheit auswirkt, muss noch geklärt werden.
1.6.1 Therapie-Ansätze der Metachromatischen Leukodystrophie
Zurzeit sind mögliche Therapieansätze für die MLD stark begrenzt. Eine Form der Therapie
ist die Knochenmark-Transplantation. Hierzu werden gesunde Zellen von Spender-Personen
in das Knochenmark der erkrankten Person transplantiert. Die gesunden Zellen sollen
funktionell aktive ASA sezernieren (Kornfeld et al., 1992). Jedoch scheint diese Form der
Therapie bei Patienten, die bereits Symptome entwickelt hatten, nicht wirksamen zu sein (von
Figura et al., 2001).
Ein deutlicherer Effekt kann mit Hilfe der viralen Transduktion erreicht werden. Nach
retroviraler Transduktion der transplantierten Zellen konnte eine erhöhte Menge an ASA in
verschiedenen Geweben nachgewiesen werden (Learish et al., 1996). Allerdings war die
Sulfatidkonzentration in Nieren und Gehirn unverändert, in der Leber um 1/3 erniedrigt. Aus
den Untersuchungen ging hervor, dass eine mindestens 200 %ige ASA-Enzymaktivität
notwendig wäre, um eine wesentliche Reduktion der Sulfatidkonzentration in Leber und Niere
zu erreichen (Matzner et al., 2002).
Untersuchungen, basierend auf der Injektion von adenoviralen Vektoren ergaben, dass eine
ASA-Überexpression in Oligodendrozyten vorhanden war. Jedoch konnte keine pathologische
Veränderung beobachtet werden. Nur im frühen Stadium der Krankheit bei ASA-defizienten
Mäusen konnte ein Rückgang der Sulfatid-Akkumulation beobachtet werden (Sevin et al.,
2007). Dies deutet daraufhin, dass ein Gentherapie-basierter Ansatz keinen wesentlichen
histologisch nachweisbaren Effekt auf die Sulfatid-Speicherung hat.
Bei der Enzymersatztherapie wird rekombinant hergestellte humane ASA systemisch injiziert.
In ASA-defizienten Mäusen führte dies zur Reduzierung der Sulfatidspeicherung in den
peripheren Nerven, im Gehirn und im Rückenmark (Matzner & Gieselmann, 2005). Eine
weitere Möglichkeit zur Therapie der MLD ist die Inhibition der Cerebrosid-Sulfotransferase.
Die Hemmung dieses Enzyms könnte zu einer verminderten Bildung und somit zu einer
verminderten Akkummulation von Sulfatid führen.
16
1 Einleitung
1.7
Mausmodelle der metachromatischen Leukodystrophie
Metachromatische Leukodystrophie ist eine genetische Erkrankung und wurde nur für den
Menschen beschrieben. Daher gibt es in der Natur kein geeignetes Tiermodell (Gieselmann,
1998; 2003). Zur Klärung der Funktion von Genen und deren Produkten in vivo können
Mausmutanten erzeugt werden, in welchen gezielt eine Gen-Defizienz (sog. Knockouts, engl.)
oder fremde Gensequenzen in das Genom eingebracht werden. Daher wurde zur Erforschung
der menschlichen MLD eine ASA-defiziente-Maus-Linie erzeugt (Hess et al., 1996). Das
Maus ASA-Gen ähnelt dem humanen Gen sehr (Kreysing et al., 1994).
Dieses ASA-Knockout-Mausmodell zeigt einige Charakteristika der humanen MLD, aber im
Vergleich zum Patienten einen milderen Phänotyp. Die Tiere speichern Sulfatid in denselben
Geweben wie die Patienten, einschließlich Oligodendrozyten, Schwann-Zellen und
Astrozyten (Coenen et al., 2001; Gieselmann et al., 1998; Lüllmann-Rauch et al., 2001). Mit
steigendem Alter zeigen die Tiere auch einen erhöhten Gehalt an Sulfatid und bereits nach 12
Monaten zeigen sich Verhaltensänderungen und neurologische Symptome mit Gangstörung
und neuronaler Degeneration des akustischen Ganglions (Hess et al., 1996; Gieselmann et al.,
1998; D´Hooge et al., 1999a; 2001). Genauere Untersuchungen der neuromotorischen
Fähigkeiten zeigten, dass bereits nach sechs Monaten eine Verhaltensänderung auftritt. Diese
gehen einher mit dem Beginn der Sulfatid-Akkumulation in diesem Alter, welche vor allem in
der weißen Substanz stattfindet (Yaghootfam et al., 2005; Stroobants et al., 2008). Dennoch
zeigen die ASA-defizienten-Mäuse, abgesehen von axonaler Degeneration, keine umfassende
Demyelinisierung. Die Gründe für diese Diskrepanz sind noch unklar. Ein möglicher Grund
könnte zum einem das Lebensalter der Mäuse und zum anderen die Spezies-spezifischen
Unterschiede im Sphingolipid-Metabolismus sein.
Um die Anwendbarkeit des MLD-Mausmodells zu verbessern, war die nächste Möglichkeit
die Synthese von Sulfatid zu steigern. Der selektive Anstieg von Sulfatid-Speicherung in
Neuronen
wurde
erreicht
durch
die
transgene
Überexpression
von
Cerebrosid-
Galaktosylsulfotransferase (CGT) unter dem neuronalen Promotor Thy-1 (Eckhardt et al.,
2007). Die Thy1-CGT Mäuse zeigen eine progressive axonale Degeneration, die mit einem
Anstieg von Sulfatid in den Neuronen und motorischen Koordinations-Defiziten einhergeht.
Unabhängig von ihrem genetischen Hintergrund weisen diese Mäuse eine signifikant
verkürzte Lebensspanne auf, wobei der Tod sehr plötzlich auftritt. Zusätzlich zeigen die
transgenen CGT-Mäuse ein unruhiges Verhalten, das auf eine mögliche Überregbarkeit der
Neuronen zurückzuführen ist. Allerdings konnte die Ursache noch nicht geklärt werden.
17
1 Einleitung
Erste Hinweise bezüglich der Überregbarkeit von Neuronen, wurden bei den ASAdefizienten-transgenen CGT-Mäusen beobachtet. Diese Mäuse wiesen eine erhöhte SulfatidAkkumulation im Gehirn sowie eine gesteigerte Sulfatid-Speicherung in den zentralen und
peripheren Neuronen auf (Eckhardt et al., 2007). Die transgenen CGT/ASA-defizientenMäuse entwickelten zudem neuromotorische Koordinations-Defizite. Untersuchungen der
Nervenfasern ergab eine Degeneration der Nerven im Rückenmark. Des Weiteren konnte
anhand von EEG-Messungen bei den transgenen CGT/ASA-defizienten-Mäusen eine
kortikale Hyperexzitabilität (Überregbarkeit) festgestellt werden (Eckhardt et al., 2007).
1.8
Zielsetzung
Ein für die Analyse der MLD wichtiges Tiermodell stellt die Knockout-Maus dar, in der das
ASA-Gen inaktiviert wurde.
Bei X. Han (2007) wurde beschrieben, dass Sulfatid möglicherweise durch Apolipoprotein-E
von Astrozyten zu Neuronen transportiert wird und dass eine ApoE-Defizienz zu einem
erhöhten Sulfatid-Gehalt im Cortex führt (Han et al., 2004; 2007).
Anhand einer ASA- und ApoE-defizienten Maus soll in dieser Arbeit geklärt werden, ob das
zusätzliche ApoE-Defizit eine Veränderung des Sulfatid-Gehalts bewirkt. Dabei soll der
Fokus auf den Neuronen liegen und somit analysiert werden, ob die Neuronen mit Hilfe des
ApoE-Proteins Sulfatid erhalten oder aber eigenes Sulfatid produzieren.
Ein weiteres Ziel ist die Analyse des transgenen MLD-Mausmodells Thy1-CGT.
Die transgenen Thy-1-Mäuse überexprimieren UDP-Galactose:Ceramid Galactosyltransferase
(CGT) unter der Kontrolle des Thy1.2 Promotors, wodurch es zu einer Sulfatid-Anreicherung
in den Neuronen kommt. Dadurch sollten neurologische Effekte, die die Sulfatid-Speicherung
in den Neuronen möglicherweise auslöst, analysiert werden.
Erste Untersuchungen an transgenen Mäusen deuten darauf hin, dass die Sulfatid-Speicherung
einen Effekt auf die funktionellen Eigenschaften von neuronalen Membranen hat (Eckhardt et
al., 2007).
In dieser Arbeit sollen die Auswirkungen der Überexpression von CGT auf den SulfatidGehalt in Neuronen bestimmt werden. Weitere Untersuchungen, wie Verhaltensexperimente
an Thy-1-CGT-Mäusen und Lipid-Analysen der neuronalen Plasmamembran sollen weitere
Erklärungen für die neurologische Übererregbarkeit liefern.
18
1 Einleitung
Ein zusätzliches Projekt dieser Arbeit ist die Aufklärung der Struktur-Funktions-Beziehung
der Cerebrosid-Sulfotransferase (CST). Die Inhibition der CST könnte zur Reduzierung der
Sulfatid-Menge bei MLD-Patienten führen. Hierzu ist die Produktion größerer Mengen CST
notwendig, um detaillierte Strukturanalysen vorzunehmen, deren Kenntnisse es bedarf, um
potentielle Inhibitoren zu finden und zu testen.
Voruntersuchungen zeigten jedoch, dass eine lösliche Variante der CST (ohne N-terminale
Transmembran-Domäne) nur sehr ineffizient sezerniert wird. Daher sollen verschiedene
Konstrukte erstellt werden, indem einzelne Aminosäuren bzw. Bereiche des Enzyms entfernt
werden sowie einige Fusionsproteine von sekretorischen Proteinen mit der CST hergestellt
werden, um ein Sekretion des CST zu bewirken. Zusätzlich sollen die Auswirkung auf die
Enzymaktivität, Stabilität und subzelluläre Lokalisation bestimmt werden.
19
2 Material und Methoden
2 Material und Methoden
2.1
Materialien und Chemikalien
Alle verwendeten Chemikalien, Enzyme und Kulturmedien wurden von den Firmen Applied
Biosystems, Biorad, Gibco, Merck, MoBiTec, Molecular Probes, Amersham Pharmacia
Biotech, Qiagen, Fermentas, Roth und Sigma bezogen. Sie hatten, sofern nicht anders
angegeben, die Reinheitsgrade »p.a.«, »reinst« bzw. »für mikrobielle Medien«.
Restriktionsendonukleasen stammten von der Firma Fermentas.
Alle wässrigen Lösungen wurden mit deionisiertem Wasser angesetzt, welches mit einer
MilliQ/UF-Ultrafiltrationsanlage (Millipore) aufbereitet wurde. Sterilisiert wurde durch
autoklavieren bzw. sterilfiltrieren.
20
2 Material und Methoden
2.1.1
Geräte und Verbrauchsmaterial
2.1.1.1 Geräte
Gerät
Firma
Agarosegelkammern mit Zubehör
Eigenbau, Biorad
Brutschränke
Forma Scientific, Thermo Electron, Dreireich
Digital-pH-Meter 646
Knick, Berlin
Eismaschine
Ziegra, Isernhagen, Deutschland
Elektrophoresekammern für PAGE
Mini Protean Gelkammern, Biorad, Hercules,
CA, USA
Groß: Proteax Xi, Biorad, Hercules, CA, USA
ESI-MS
HCT-Ultea, Bruker
Filmentwickler
Automat Curix 60, AGFA, Mortsel, Belgien
Gefriertruhe (-80)
Sanyo
Ultra
low,
Sanyo
Scientific,
Bensenville/Illinois, USA
Gefrierschrank (-20)
Öko Arctis Super electronic, AEG, Nürnberg
Heizblock
Stuart Scientific, Newcastle, UK
Kühlschrank (+4°C)
Öko Santo Superelectronic, AEG, Nürnberg
Kühlblock für Enzyme
Fermentas, St. Leon-Rot
Kryostat
Leica CM 1510S, Leica, Wetzlar
Magnetrührer Ikamag RET
Ika-Werke, Staufen, Deutschland
MALDI Voyager-DE STR mass
PE Biosystems, Warrington, Chesire, UK
spectrometer
Mikroplatten-Lesegerät
GENios, Tecan, Zürich
Mikroskop
Lichtmikroskop: Zeiss Telaval 31, Carl Zeiss AG
Fluoreszenzmikroskop: Zeiss Axiovert 100M,
Axiocam HRm, Carl Zeiss AG, Oberkochen
PCR-Gerät
T3 Thermocycler, Biometra, Göttingen
Phosphoimager BAS-1800II
Fujifilm, Straubenhardt
Präparierbesteck
neoLab, Heidelberg
Reacti Therm „Heating and stirring
Pierce, Rockfort, Illinois, USA
module“
21
2 Material und Methoden
Schüttelinkubator
New Brunswick Scientific, Edison/New Jersey,
USA
Spectrophotometer DU 640
Beckmann, München
Sterilbank
BDK Luft- und Reinraumtechnik, SonnenbühlGenkingen
Clean Air Technik, JA Woerden, Niederlande
Thermomixer
Thermomixer comfort, Eppendorf, Hamburg
„TLC-Sampler“ 4
Camag, Berlin
Ultraturrax
Janke & Kunkel IKA-Labortechnik, Staufen
Ultraschallwasserbad
Bransonic, Branson, Danbury/Connecticut, USA
UV-Handlampe
Konrad Benda Laborgeräte und UV-Strahler,
Wiesloch, Deutschland
Vakuumpumpe HCL-Haep
Labor Consult MP 280, Bovenden
Vortexer Unimag Zx3 Classic
UniEquip, Martinsried
Waagen
PC 4400, Mettler, Giessen, Schweiz
CP12S-0CE, Sartorius, Göttingen
Wasserbad
1083, GFL, Burgwedel, Deutschland
Zentrifugen
Eppendorf Zentrifuge 5810 R, Eppendorf,
Eppendorf Zentrifuge 5415 D, Eppendorf,
Eppendorf Zentrifuge 5417 R, Eppendorf,
Hamburg
Beckmann CPKR Zentrifuge, Beckmann,
Beckmann Ultrazentrifuge Optima TLX 120000
rpm, Rotor TLN 100, Beckmann, München
Heraeus Labofuge 400e (Zellkultur), Heraeus,
Hanau, Deutschland
22
2 Material und Methoden
2.1.1.2
Verbrauchsmaterialien
Material
Firma
DC-Aluminiumfolien 20x20cm Kieselgel
Merck, Darmstadt
60 F254
DC-Platten 20x20 cm Kieselgel 60,
Merck, Darmstadt
Gefrierröhrchen
Cellstar Cryo, Greiner,
Frickenhausen
Küvetten
Sarsted, Nümbrecht
6/24er-Loch Mikrotiter-Platten
Sarsted, Nümbrecht
Pipetten PipetmanP
Gilson, Middleton,
Quarz-Küvette
Hellma®, Mühlheim
Zellkulturflaschen
Sarsted, Nümbrecht
Zentrifugenröhrchen (50 ml, 15 ml)
Sarsted, Nümbrecht
Zählkammer (Neubauer) für eukaryontische Zellen VWR, Darmstadt
2.1.2
Substanzen
Name
Firma
2-Propanol
Carl Roth, Karlsruhe
Agarose
Invitrogen, Karlsruhe
Alcian blue 8x
Sigma-Aldrich, Steinheim
Bovines Serum-Albumin (BSA)
Sigma-Aldrich, Steinheim
Calciumchlorid
Sigma-Aldrich, Steinheim
Chloroform
JTBaker, Phillipsburg/ New Jersey,
Merck, Darmstadt
DMSO (Dimethylsulfoxid)
Sigma-Aldrich, Steinheim
Dinatriumhydrogencarbonat
Merck, Darmstadt
DPX Mounting Medium for Histology
Fluka, Buchs
Ethylendiamintetraessigsäure (EDTA)
Fluka, Buchs
Essigsäure
Merck, Darmstadt
Ethanol
Merck, Darmstadt
ExGen
Fermentas, St. Leon-Rot
Glaswolle
Sigma-Aldrich, Steinheim
23
2 Material und Methoden
Glukose
Sigma-Aldrich, Steinheim
Glycerin
Merck, Darmstadt
Histo Green
Linaris, Wertheim - Bettingen
n-Hexan
Merck, Darmstadt
LiChroprep® RP-18 (40-63 µm)
Merck, Darmstadt
Lipofectamine 2000
Invitrogen, Karlsruhe
Kaiser Glyceringelatine
Merck, Darmstadt
Kaliumchlorid
Merck, Darmstadt
Nitrocellulose Transfer Membran
Schleicher & Schüll
Magnesiumchlorid
Fluka, Buchs
Milchpulver
Reformhaus
Methanol
Merck, Darmstadt
Natriumchlorid
Sigma-Aldrich, Merck
Natriumhydrogencarbonat
Merck, Darmstadt
NBT/ BCIP-Stocklösung
Roche, Grenzach-Wyhlen
Paraformaldehyd
Merck, Darmstadt
Phenol
Carl Roth, Karlsruhe
Phosphate Buffered Saline (PBS)
Gibco/ Invitrogen, Karlsruhe
Polyvinylalkohol
Fluka, Buchs
Ready-Load TM 1 Kb Plus
Fermentas, St. Leon-Rot
Röntgenfilme
Fujifilm
Salzsäure
Merck, Darmstadt
SDS (Natriumdodecylsulfat)
Biorad, München
Stickstoff (flüssig)
Linde Gas, Pullach
Tris ultra pur
Gibco / Invintrogen, Karlsruhe
Tryptone-Peptone
Difco, Detroit / Michigan, USA
Tween 20
Fluka, Buchs
Vectastain ABC-Kit
Linaris, Wertheim - Bettingen
Whatman-Papier
Schleicher & Schüll
24
2 Material und Methoden
2.1.3
Kits
Kit
Firma
QIAprep DNA Mini Kit
Qiagen, Hilden
QIAprep Spin Mini Preparation Kit
Qiagen, Hilden
QIAprep Spin Midi Preparation Kit
Qiagen, Hilden
QIAquick PCR Purification Kit
Qiagen, Hilden
QIAquick Gel Extraction Kit
Qiagen, Hilden
2.1.4
Nährmedien und Bestandteile für Bakterien
Name
Firma
Agar
Sigma-Aldrich, Steinheim
Bacto-Hefeextrakt
Difco, Ditroit/ Michigan, USA
Trypton
Oxoid, Hampshire, England
Ampicillin
Sigma-Aldrich, Steinheim
Chloramphenicol
Sigma-Aldrich, Steinheim
Kanamycin
Sigma-Aldrich, Steinheim
G418
Sigma-Aldrich, Steinheim
2.1.5
Zellkultur
2.1.5.1 Zellkulturmedien und Zusätze
Name
Firma
B27-Supplement
Gibco / Invitrogen, Karlsruhe
Dulbecco´s modified minimal essential medium
Gibco / Invitrogen, Karlsruhe
(DMEM)
DMEM/F-12
Gibco / Invitrogen, Karlsruhe
Fetal Calf Serum (fötales Kälber-Serum)
Gibco / Invitrogen, Karlsruhe
Gentamycin
Sigma-Alderich, Steinheim
L-Glutamin 200 mM (100x)
Gibco / Invitrogen, Karlsruhe
Penicillin/Streptomycin
Gibco / Invitrogen, Karlsruhe
Phosphate-Buffered Saline (PBS), 10x
Gibco / Invitrogen, Karlsruhe
Penicillin-Streptomycin-Lösung
Gibco / Invitrogen, Karlsruhe
25
2 Material und Methoden
Poly-L-Lysin
Sigma-Aldrich, Steinheim
Trypsin (Trypsin/EDTA Lösung 1x)
Gibco / Invitrogen, Karlsruhe
Trypan Blau Lösung
Sigma-Aldrich, Steinheim
2.1.5.2 Zelllinien
Die Tabelle gibt die Zelllinien an, die in dieser Arbeit verwendet wurden. Von allen Zellen
wurde regelmäßig Überstand abgenommen und per PCR auf Mycoplasmen kontrolliert.
Name
Anmerkung
CHO-K1 (Chinese hamster ovary)
Puck et al., 1958
CHO-GalT
von CHO-K1 abgeleitete Zelllinie, stabil
mit der Ceramid-Galaktosyltransferase aus
Ratte transfiziert (Stahl et al., 1994)
CHO-Sulf
von
CHO-GalT
zusätzlich
abgeleitet
mit
der
Zelllinie,
Cerebrosid-
Sulfotransferase aus Maus transfiziert
(Eckhardt et al., 2002)
CHO-39CST
von CHO-K1 abgeleitete Zelllinie, stabil
mit der um sechs Basenpaare verkürzten
Cerebrosid-Sulfotransferase
aus
Maus
transfiziert
HT 1080 humane Fibrosarcoma
2.1.6
Rasheed S. et al., 1974
Software
Datenverarbeitung
Office-Windows2000, -WindowsXP
Bildbearbeitung
AxioVision Rel. 4.6, Zeiss
Adobe Photoshop 7.0
Corel Draw 12
Aida Software
Statistik
Statistica
26
2 Material und Methoden
2.1.7
Lösungen
2.1.7.1 Nährmedien für Bakterienkulturen
Name
Zusammensetzung
LB (Luria Bertani)- Medium
10 g/l Trypton
10 g/l NaCl
5 g/l Hefeextrakt
Name
Zusammensetzung
SOC- Medium
10 mM NaCl
2,5 mM KCl
10 mM MgCl2
20 mM MgSO4
20 mM Glukose
0,5% Hefeextrakt
2% Trypton
LB-Agarplatten
LB-Medium
15 g/l Agar
2.1.7.2 Antibiotika Stammlösung
Antibiotika
Konzentration
Ampicillin:
Stammlösung: 25 mg/ml in H2O
Arbeitskonzentration: 50 µg/ml
Chloramphenicol:
Stammlösung: 10 mg/ml in H2O
Arbeitskonzentration: 20 µg/ml
27
2 Material und Methoden
Kanamycin:
Stammlösung: 10 mg/ml in H2O
Arbeitskonzentration: 20 µg/ml
Lysostaphin
Stammlösung: 2,5 mg/ml in H2O
Arbeitskonzentration: 100 µg/ml
Genatamicin
Stammlösung: 50 mg/ml in H2O
Arbeitskonzentration: 15 µg/ml
G418
Stammlösung: 50 mg/ml in H2O
Arbeitskonzentration: 700 µg/ml
2.1.7.3 Lösungen und Puffer für die Immunfärbung
Lösung
Zusammensetzung
150 mM NaCl-Lösung
0,44 g in 50 ml H2O Æ steril filtrieren
PBS
9,55 g/l PBS
Waschpuffer
PBS / dest. H2O
Permeabilisierungspuffer
0,3% TritonX-100 in PBS
Blockingpuffer
0,3% Gelatine in PBS
1% BSA in PBS
4% Paraformaldehyd
4 g Paraformaldehyd
100 ml PBS
Inaktivierung
0,3% H2O2 / PBS
endogener Peroxidase Aktivität
Reduktion freier Aldyhedgruppen
0,5% Glycin / PBS
28
2 Material und Methoden
Permeabilisierungs-/Blockingpuffer
0,05% Tween 20,
(für den Nachweis von Sulfatid in Gewebe) 1% BSA / PBS
2.1.7.4 Lösungen für molekularbiologische und biochemische Methoden
Lösung
Zusammensetzung
TE-Puffer
10 mM Tris-HCl, pH 8
1 mM EDTA
50 x TAE-Puffer
40 mM Tris
20 mM Essigsäure
2 mM Na2EDTA, pH 8,5
Ethidiumbromid Stammlösung
10 mg/ml Ethidiumbromid in bidest. H2O
Lysispuffer
1% Triton X-100 oder NP-40
(Zellen)
20 mM Tris-HCl pH 8
50 mM NaCl
5 mM EDTA
1 mM PMSF (frisch dazu geben
Homogenisierungs-
TBS (kalt )
puffer (Gewebe)
1 mM PMSF in H2O, 4°C
Acrylamid 40% (w/v)
Acrylamid/Bisacrylamid (29:1)
APS 10% (w/v)
Ammoniumperoxodisulfat
ECL-Lösung
2,5 mM Luminol (Fluka) in DMSO
0,4 mM p-Coumarsäure (Fluka) in DMSO
100 mM Tris-HCl pH 8,5
30% H2O2 (frisch dazu)
29
2 Material und Methoden
10 x Laufpuffer
250 mM Tris-Base
1,9 M Glycin
1% SDS; pH auf 8,6 einstellen
4 x Probenpuffer
8% SDS
40% Glycerol
240 mM Tris-HCl, pH 6,8
4% Bromphenolblau
4% β-Mercaptoethanol
Sammelgelpuffer
500 mM Tris-HCl, pH 6,8
0,4% SDS
Trenngelpuffer
1,5 M Tris-HCl, pH 8,8
0,4% SDS
Blotpuffer
48 mM Tris-Base
39 mM Glycin
auf pH 8,5 einstellen
0,037% SDS
20% (v/v) Methanol
2 x SEAP-Puffer
21 g Diethanolamin
100 µl 1M MgCl2
mit HCl auf pH 9,8 mit einstellen
ad 100 ml H2O
SEAP-Substrat-Lösung
20 mg p-Nitrophenolphosphat
auf 5 ml 1x SEAP-Puffer
3 M NaOH
6 g NaOH
ad 50 ml H2O
30
2 Material und Methoden
Ponceau-Lösung
0,2% Ponceau S
3% Trichloressigsäure
TBS/T
1 x TBS
0,5% Tween 20
10 x PBS
100 mM Na2HPO4/ NaH2PO4, pH 7,4
1,5 M NaCl
25 mM KCl
10 x TBS
100 ml 1 M Tris-HCl pH 8,0
300 ml 5 M NaCl
auf 1 l mit destilliertem H2O auffüllen, pH 8,0
DEPC-H2O bidest.
H2O wird mit 0,1% DEPC gemischt, über Nacht
bei RT gerührt und 2x autoklaviert
20 x SSC
3 M NaCl
0,3 M Natriumcitrat
pH wird auf 7,0 eingestellt
Hybridisierungs-
50% Formamid
puffer In-situ
1% Denhardt`s Lösung
0,2% SDS
0,25 mg/ml Lachsspermien-DNA
10% Hybridisierungssalz (3 M NaCl, 0,1 M
PIPES, 0,1 M EDTA)
Maleinsäurepuffer
100 mM Maleinsäure, pH 7,5
150 mM NaCl
Waschpuffer
Maleinsäurepuffer
0,3% Tween 20
31
2 Material und Methoden
AP-Puffer
100 mM Tris-HCl pH 9,5 frisch ansetzen
100 mM NaCl
50 mM MgCl2
DC-Färbelösung
625 mM Kupfersulfat
9,4% konzentrierte Phosphorsäure
DC-Laufmittel
60 ml Chloroform
(Sphingolipid-Auftrennung)
27 ml Methanol
4 ml H2O
DC-Laufmittel
60 ml Chloroform
(Gangliosid-Auftrennung)
35 ml Methanol
8 ml 0,22% CaCl2
NBT / BCIP -Lösung
200 μl der NBT/ BCIP-Stocklösung
(Roche)
in 10 ml 0,1 M Tris-HCl (pH 9,5),
0,1 M NaCl
0,05 M MgCl2 verdünnt.
0,3% Plexigum
3% Polyisobutylmethacrylat („Plexigum“)
1:10 in n-Hexan verdünnt
Reaktionspuffer CST-Assay
100 mM Tris-HCl (pH 7.0)
20 mM MgCl2
2,5 mM ATP
20 µM PAPS/ [35S]-PAPS (~ 5000 MBq/mmol)
TUB (“theroretical upper phase”)
Methanol (48 Teile)
150 mM NaCl (47 Teile)
Chloroform (3 Teile)
32
2 Material und Methoden
2.1.8
Bakterienstämme
Bezeichnung
E.coli XL1-blue
Herkunft
Bullock et al., 1987
supE44, hsdR17, recA1, endA1, gyrA46, thi-1
2.1.9
Verzeichnis der Plasmide
Plasmid
Herkunft / Erläuterung
pBluescript
Klonierungsvektor mit T3- und T7-Promotor,
Stratagene
pcDNA3.1
Klonierungsvektor, Strategene; Ausgangsvektor
für CST-Konstrukte
pEF
Klonierungsvektor, Invitrogen; Ausgangsvektor
für CST-Konstrukte
psB 4.7
Klonierungsvektor,
freundlicherweise
zur
Verfügung gestellt von Dr. T. Dierks, Göttingen
(für die Selektion in DHFR- Zellen)
pEF-IL-39-CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 6 Basenpaare
verkürzt mit Interleukin-2 als Signalpeptid
pEF-IL-42-CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 9 Basenpaare
verkürzt mit Interleukin-2 als Signalpeptid
pEF-IL-45-CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 12 Basenpaare
verkürzt mit Interleukin-2 als Signalpeptid
pEF-IL-48-CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 15 Basenpaare
verkürzt mit Interleukin-2 als Signalpeptid
pEF-IL-51-CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 18 Basenpaare
verkürzt mit Interleukin-2 als Signalpeptid
33
2 Material und Methoden
psB4.7-39CST*
enthält die Cerebrosid-Sulfotransferase ohne
Transmembran-Domäne und um 6 Basenpaare
verkürzt (für stabile Zelllinie in CHO-K1 Zellen
genutzt)
pcDNA-AchE-Furin-CST*
enthält
die
Cerebrosid-Sulfotransferase
mit
vorgeschalteter Acetylcholinesterase
pcDNA-Seap-Furin-CST*
enthält
die
vorgeschalteter
Cerebrosid-Sulfotransferase
sekretorischer
mit
alkalischer
Phosphatase
pcDNA3-39CST*
enthält die Cerebrosid-Sulfotransferase um 6
Basenpaare verkürzt
pcDNA3-Gal3ST1*
enthält
Galactose-3-O-Sulfotransferase
1
(humane CST)
pcDNA3-Gal3ST2*
enthält Galactose-3-O-Sulfotransferase 2 (galβ3GalNac-3-O-Sulfotransferase 2)
pcDNA3-Gal3ST4*
enthält Galactose-3-O-Sulfotransferase 4 (galβ3GalNac-3-O-Sulfotransferase 4)
pcDNA3-DPPIV (TM)*
enthält
die
Transmembrandomäne
der
Dipeptidylpeptidase 4
pcDNA3-DPPIV-TM_39CST-HA* enthält die DPPIV-TM und die 39CST, mit HATag
pEGFP-C1
GFP
am
C-Terminus
exprimiert;
Klonierungsvektor, Stratagene
pEGFP-N3
GFP
am
N-Terminus
exprimiert
Klonierungsvektor, Stratagene
*Plasmidkarten siehe Anhang
2.1.10
Verzeichnis der Primer
Oligonukleotid-Primer wurden durch MWG (Ebersberg, Deutschland) synthetisiert, in sterilen
H2O gelöst, so dass eine Stammlösung von 100 pmol/μl vorlag, aliquotiert und bei -20°C
gelagert. Die Nummern entsprechen fortlaufend vergebenen Nummern der Instituts-internen
Primer-Liste.
34
2 Material und Methoden
Tabelle 2.1 : Verzeichnis der genutzten Primer
lfd.
Nr.
1734
1735
1736
1737
1738
1739
Bezeichnung
39 CST
42 CST
45 CST
48 CST
51 CST
anti-IL2
1740
1780
1781
1782
1783
1784
1826
anti-IL2-NEU
Maus CST1
Maus CST2
ASA sense
ASA anti
ASA Neo
T7_primer
1842 CGTas1
1843 CGTas2
1871 Rat-CGT-883
2193 CGT1455
2194 IL-2 sense
Sequenz
Länge
eingesetzt für
CCCAACATGGCCTTCACGACC
21
Vektor-Konstrukt
GCCTTCACGACCTCAGAGGC
20
Vektor-Konstrukt
ACCTCAGAGGCTGCAGCACC
20
Vektor-Konstrukt
GCTGCAGCACCCTGCTCC
18
Vektor-Konstrukt
CCCTGCTCCCCTATTCCCAATG
22
Vektor-Konstrukt
AGGTGCACTGTTTGTGACAAGTGC
24
Vektor-Konstrukt
AGGTGCACTGTTTGTGACAAGTGCAAG
ACTTAGTGC
36
Vektor-Konstrukt
ATGACTCTGCTGCCAAAGAAGC
22
Genotypisierung
CCACCTTAGAAAGTCCCTAAGG
22
Genotypisierung
TAGGGTGGAAGTTACCCTAGA
21
Genotypisierung
TGACCCAGGCCTTGTTCCCAT
21
Genotypisierung
GGAGAGGCTATTCGGCTATGAC
22
Genotypisierung
GGTAATACGACTCACTATAG
20
Sequenzierungen
GCGCTAGCGGCAATATCCAGTAGGAA
ATACTGGC
34
Genotypisierung
GCGCTAGCATACTGGCAGAAAGAGAT
CTGATGG
33
Genotypisierung
GCTGGTGTCAAGTATCTGTC
20
Sequenzierung
GCTTATGTCCCAGAGTTTAACTCAC
RNA-Sonde
CTAGCGCCATGTACAGGATGCAACTCC
TGTCTTGCATTGCACTAAGTCTTGCACT
TGTCACAAACAGTGCAAGC
74
Vektor-Konstrukt
GCTTGCACTGTTTGTGACAAGTGCAAG
ACTTAGTGCAATGCAAGACAGGAGTTG
CATCCTGTACATGGCG
70
Vektor-Konstrukt
CTTGGTACCTCTAGAGCAGCCATGAGG
CCCC
31
Vektor-Konstrukt
2195 IL-2 anti
Kpnl_Xbal_huA
2215 ChE
Blunt_huAChE_
2216 AS
TCTCAGGTCTGAGCAGCGATCC
EcoRI_Eco47III_ CCTGAATTCAGCGCTAGATACAAAAGA
2217 m
CCCAACATGGCCTTCACGA
CGCTCTAGATTACACCACCTTAGAAAG
2218 Xbal_mCST_AS TCCCTAA
2337 CSTanti Seq.
GGTTGACACCCTCCTGCTGAGCCG
CTAGCCATGTACAGGATGCAACTCCTG
TCTTGCATTGCACTAAGTCTTGCACTTG
2338 IL2-sense-NheI
TCACAAACAGTGCAGAA
CCGGTTCTGCACTGTTTGTGACAAGTG
CAAGACTTAGTGCAATGCAAGACAGG
AGTTGCATCCTGTACATGG
2339 IL2-anti-AgeI
GCGCGGTACCAGATCTGCCATGTACAG
2350 39CST_Kpnl
GATGCAACTC
39CSTanti_EcoR CGCGAATTCACTTACCTGCCCACCTTA
GAAAGTCCC
2351 I
GTAATACGACTCACTATAGGGGCTTAT
2540 T7se_CGTse
GTCCCAGAGTTTAAC
2541 T7se_CGTanti
GCGCTCATCTCACCTTCTTTTCG
GTAATACGACTCACTATAGGGTCATCT
CACCTTCTTTTCG
2542 T7an_CGTan
GTAATACGACTCACTATAGGGATGATG
2543 T7se_cFosse
TTCTCGGGTTTCAACG
CGCTCACAGGGCCAGCAGCGTGGGTG
2544 T7se_cFosan
AG
22
Vektor-Konstrukt
46
Vektor-Konstrukt
34
24
Vektor-Konstrukt
Sequenzierung
72
Vektor-Konstrukt
72
Vektor-Konstrukt
37
Vektor-Konstrukt
36
Vektor-Konstrukt
42
23
RNA-Sonden
RNA-Sonden
40
RNA-Sonden
43
RNA-Sonden
28
RNA-Sonden
35
2 Material und Methoden
2545 T7an_cFosse
2546 T7an_cFosan
an39CST2618 HA_EcoRI
2619 se39CST_KpnI
2620 Dpp_TMDse
2621 DPPP_TMDan
2690 GAL3ST1se
2691 GAL3ST1an
2692 GAL3ST4se
2693 GAL3ST4an
2708 Gal3ST2se_neu
2709 Gal3ST2an_neu
2743 Adapter HAse
2744 Adapter HAanti
2.1.11
CGCATGATGTTCTCGGGTTTCAACG
GTAATACGACTCACTATAGGGTCACAG
GGCCAGCAGCGTGG
GCGCGAATCTCAGGCGTAATCGGGGA
CG
GCGCGGTACCCCCAACATGGCCTTCAC
G
GCGCAAGCTTATGAAGACACCGTGGA
AGG
GCGCGGTACCTTCATCTTTGCTCAGC
GCAAGCTTACCATGCTGCCACCGCAGA
AGAAGC
GCGAATTCCCACCGCAGGAAATCGCG
GCAAGCTTACCATGGGCCCTCTCTCTC
CTGCC
GCGAATTCTGGGGAGAGTGGCCTTGAA
GTCTTGAG
GGCAGGATAATGTCCATCCTGAGAGGC
CTTAGCCAAACCCTACTTTTTCAGGAA
TGGGA
CGCGAATTCTACCCTTATGACGTCCCC
GATTACGCCTAAGGGCCCGCG
CGCGGGCCCTTAGGCGTAATCGGGGAC
GTCATAAGGGTAGAATTCGCG
25
RNA-Sonden
41
RNA-Sonden
28
Vektor-Konstrukt
28
Vektor-Konstrukt
29
26
Vektor-Konstrukt
Vektor-Konstrukt
33
26
Vektor-Konstrukt
Vektor-Konstrukt
32
Vektor-Konstrukt
35
27
Vektor-Konstrukt
Vektor-Konstrukt
Vektor-Konstrukt
48
Vektor-Konstrukt
48
Vektor-Konstrukt
Molekulargewichtsstandards
1 kb DNA-Standard GeneRuler Ladder (Fermentas)
100 bp DNA-Standard GeneRuler Ladder (Fermentas)
50 bp DNA-Standard GeneRuler Ladder (Fermentas)
Protein Standard Page Ruler Prestained Protein Ladder 671 (Fermentas)
36
2 Material und Methoden
2.1.12
Verzeichnis der Antikörper
Zur Detektion von Proteinen im Western-Blot und in der Immunohistochemie wurden
folgende Antikörper verwendet:
Name
Verdünnung Firma
Antiserum ST2
1:500 (IF)
Yaghootfam et al., 2007
Polyklonaler anti-MBP aus Kaninchen
1:5000 (WB) Chemicon
Na+/K+ ATPase aus Maus
1:1000 (WB) DSHB*
Monoklonaler anti-Sulph I aus Mäusen
1:400 (IF)
Monoklonaler anti-NCAM aus Ratte, H28
50 µg/ml (WB) Chemicon
Monoklonaler anti-NSE aus Ratte,
1:100 (IF)
Polyklonaler anti-HPR-3 aus Kaninchen
1:100 (IHC)
P. Fredmann
Dako
Abouzied et.al., 2004
Polyklonaler anti NeuN aus Maus
1:500 (IHC) Chemicon
Hybridoma 12CA5 (Anti-HA Tag), aufgereinigt
10 µg/ml (WB) Roche
Polyklonaler anti Calnexin aus Ratte
1:500 (IF)
Polyklonaler anti cFos aus Kaninchen
1:3000 (IHC) Santa Cruz
Peroxidase gekoppelter anti-Maus aus Ziege
1: 5000 (WB) Dianova
Chemicon
Peroxidase gekoppelter anti-Kaninchen aus Ziege 1:5000 (WB) Dianova
Peroxidase gekoppelter anti-Ratte aus Ziege
1:5000 (WB) Dianova
Alexa Fluor 488 anti-Kaninchen-IgG aus Ziege
1:400 (IF)
Molecular Probes
Alexa Fluor 488 anti-Ratte-IgG aus Ziege
1:400 (IF)
Molecular Probes
Alexa Fluor 568 anti-Ratte-IgG aus Ziege
1:400 (IF)
Molecular Probes
Alexa Fluor 568/680 anti-Maus-IgG aus Ziege
1:400 (IF)
Molecular Probes
Alexa Fluor F(ab’)2 fragment 586 anti-Ratte-IgG
1:400 (IF)
Molecular Probes
1:400 (IF)
Jackson
aus Ziege
Cy2- anti-Kaninchen-IgG aus Ziege
Laboratories
Biotinylierter anti-Ratte aus Ziege
1:200 (IHC) Dianova
Biotinylierter anti-Maus aus Ziege
1:200 (IHC) Dianova
*Developmental Studies Hybridoma Bank, Iowa (http://dshb.biology.uiowa.edu/)
IHC= Immunhistochemie; IF= Immunfluoreszenz; WB= Western-Blot-Analyse
37
2 Material und Methoden
2.2
2.2.1
Versuchstiere
Wildtyp-Kontrolltiere
Als Kontrollen wurden Tiere der Stämme C57BL/6, 129Ola und C57BL/6/129Ola verwendet.
Die Tiere wurden sowohl von Charles River Deutschland (Kisslegg/Sulzfeld) bezogen, als
auch aus eigener Zucht verwendet.
2.2.2
ASA-Knockout-Mäuse
Die Arylsulfatase A defiziente Mausmutante wurde von Hess 1996 (Hess et al., 1996)
generiert. Die Tiere der hier beschriebenen Versuche stammen aus eigener Weiterzucht der
durch Hess generierten Mauslinie. Arylsulfatase A defiziente Mäuse dienen als Modell für
eine besondere Form der Lipidose, der Metachromatische Leukodystrophie.
2.2.3
ApoE-Knockout-Mäuse
Die ApoE-Knockout-Mäuse wurde von A.S. Plump (Plump & Breslow, 1995) hergestellt. Sie
wurden von der Firma Charles River bezogen. Zur Erhaltung der Mauslinie wurden
ausschließlich die homozygoten Mäuse verpaart.
2.2.4
ASA-Knockout/ApoE-Knockout-Mäuse
Die ASA-Knockout/ApoE-Knockout-Mäuse wurden durch die Verpaarung von homozygoten
ASA- und ApoE–Knockout-Mäusen hervorgebracht.
2.2.5
Thy1-CGT transgene Mäuse
Diese Mausmutante wurde von Dr. M. Eckhardt (Eckhardt et al., 2007) generiert.
Die CGT-Sequenz aus Ratte unter der Kontrolle des neuronalen Thy1-Promotors wurde in das
Mausgenom eingefügt. Daraus resultierten zwei verschiedene transgene Mauslinien, die je
nach Integrationshäufigkeit des Thy1-CGT-Transgens eine unterschiedlich starke Expression
des Transgens aufwiesen. Beide Mauslinien, Linie 4747 und Linie 4743 mit einer transgenen
Expression wurden in der vorliegenden Arbeit verwendet. Zur Erhaltung der Mauslinie
wurden für die Verpaarungen Wildtyp-Mäuse verwendet.
38
2 Material und Methoden
2.3
Anfertigung von Gewebeschnitten
Um verschiedene Untersuchungen wie Anfärbungen von Proteinen und histologische
Untersuchungen durchführen zu können, wurden von Mausgehirn-Gewebe mittels eines
Mikrotoms wie auch eines Kryostaten Schnitte angefertigt.
2.3.1
Paraffinschnitte
Das Mausgehirn wurde im Vorfeld mit 4% PFA perfundiert und über Nacht wieder in 4 %
PFA fixiert. Danach wurde das Gewebe in PBS gewaschen und mit Hilfe der
Paraffiniermaschine von Sakura in einem Vakuum-Infiltrations-Prozessor über eine
Alkoholreihe entwässert und anschließend in flüssigem Paraffin eingebettet. Die fertiges
Gewebe beinhaltenden Paraffinblöcke wurden zum Anfertigen der 4 μm dicken Schnitte
vorgekühlt. Die jeweiligen Gewebeschnitte wurden mit dem Mikrotom von Leica angefertigt.
Die gewonnenen Schnitte wurden getrocknet und bis zu ihrer Verwendung bei
Raumtemperatur gelagert.
2.3.2
Gefrierschnitte
Das Gewebe wurde nach der Präparation über Nacht in 4% PFA fixiert und eine weitere
Nacht mit 20% Saccharose inkubiert. Dies diente dazu, die Bildung von Gefrierkristallen, die
das Gewebe zerstören könnten, zu verhindern. Danach wurde das Gewebe bei -80°C
eingefroren. Das Gewebe wurde dann im Kryostaten bei -20°C durch das Einbetten in
spezielles
Gefriermedium
(Sakura,
Tissue-Tek
O.C.T™
Compound)
auf
der
Schneidehalterung fixiert und bei einer Temperaturen zwischen -15°C und -20°C geschnitten.
Die Schnittdicke lag zwischen 12-14 µm. Die auf Objektträger aufgenommenen Schnitte
wurden bis zur weiteren Verwendung bei -80°C gelagert.
39
2 Material und Methoden
2.4 Mikrobiologische und Molekularbiologische Methoden
2.4.1
In vitro Transfektion von Zellen
2.4.1.1
Kultivierung von Zellen
Sämtliche Arbeiten mit Säugerzellen fanden unter sterilen Bedingungen statt und es wurden
ausschließlich sterile Einmalplastikmaterialien verwendet. Alle Puffer, Medien und Lösungen
wurden stets vor Gebrauch auf 37°C aufgewärmt.
Die Zellen wurden in Zellkulturflaschen, die eine Größe von 80 cm2 bzw. 175 cm2 hatten, in
DMEM-Medium bei 37°C in einem wasserdampfgesättigten Inkubationsschrank mit einem
5%-igen CO2-Anteil kultiviert. Das verwendete Grundmedium DMEM enthielt anorganische
Salze, Aminosäuren, Vitamine, Glukose, Puffer und den Indikatorpuffer Phenolrot. Des
Weiteren wurden für das optimale Zellwachstum fötales Kälberserum (FCS, 10%
Endkonzentration) und Penicillin (1 U/ml)/Streptomycin (100 µg/ml) eingesetzt.
FCS enthält Wachstumsfaktoren, Hormone und Proteine wie Albumin. Es wurde
hitzeinaktiviertes (56°C für 30 Minuten) FCS verwendet, um im Serum enthaltene
Komplementfaktoren zu inaktivieren und eine Komplementaktivierung und Zelllyse zu
vermeiden. Die Antibiotika dienten als vorbeugende Maßnahme zur Vermeidung von
Kontaminationen durch Bakterien.
Die Zellen wurden alle fünf Tage in einem Verhältnis von 1:10 passagiert. Hierzu wurden
Zellen mit 10 ml Trypsin durch vorsichtiges Spülen mit einer Pipette von dem
Kulturschalenboden abgelöst, in sterile Zentrifugenröhrchen überführt und mit DMEMMedium gewaschen und zentrifugiert (5 Minuten, 300 x g). Das Pellet wurde in 10 ml
DMEM-Medium resuspendiert und die Zelllösung in neue Kulturflaschen überführt.
2.4.1.2
Einfrieren und Auftauen
Nachdem die Zellen mit Trypsin abgelöst und bei 1200 rpm für 5 Minuten. zentrifugiert
waren, erfolgte eine Resuspension der Zellpellets in 20% FCS, 10% DMSO in DMEM. Die
Zellsuspension wurde in Cryo-Röhrchen aliquotiert (je 1 ml), für zwei Tage bei –80°C
gekühlt und dann in flüssigem Stickstoff gelagert.
Zum Auftauen wurden die Zellen auf 37°C erwärmt und in 10 ml vorgewärmtem DMEMMedium resuspendiert und abzentrifugiert. Das Pellet wurde in 10 ml DMEM aufgenommen
40
2 Material und Methoden
und 1 ml der Zellsuspension wurde in 6 ml DMEM in einer 25 cm2 Zellkulturflasche
kultiviert.
2.4.1.3
Zellzahl- und Vitalitätsbestimmung
Die Zellzahl wurde mit einem Hämozytometer nach Neubauer bestimmt. Das Raster der
Zählkammer ist in neun Quadrate unterteilt, wobei sich in den vier Ecken Flächen zum
Auszählen befinden. Diese vier Eckquadrate sind wiederum in 16 kleinere Quadrate unterteilt
und haben je eine Fläche von 1 mm2.
Vor der Zellzahlbestimmung wurden die Zellen wie bei der Kultivierung, abgelöst und
abzentrifugiert und anschließend in frischem DMEM-Medium aufgenommen.
Um die Vitalität der Zellen zu bestimmen, wurden 10 µl Zellsuspension mit 10 µl
Trypanblau-Lösung vermischt und auf die Zellkammer aufgebracht. Abgestorbene Zellen
haben eine veränderte Membrandurchlässigkeit, dadurch dringt das Trypanblau in die Zellen
ein, während gesunde Zellen ungefärbt bleiben.
Pro Ansatz wurden mindestens 100 Zellen gezählt, je nach Zellzahl wurden bis zu vier
Eckquadrate gezählt. Die Zellzahl / ml wurde wie folgt berechnet:
Formel:
(N Zellen / N Quadrate) x 2 (Verdünnung) x 104 = Zellen / ml
2.4.1.4
Transfektion von Zellen
Die Transfektion dient der Einschleusung heterologer DNA in Eukaryontenzellen. Die
verwendeten Methoden wurden zur transienten Transfektion eingesetzt. Transiente
Transfektion bedeutet kurzfristiges Einbringen von DNA in viele Zellen. Dadurch ist eine
schnelle funktionelle Untersuchung innerhalb von ein bis drei Tagen möglich.
Zur Transfektion von Zellen wurden in dieser Arbeit zwei unterschiedliche Ansätze
verwendet.
a) ExGen-Methode (nach Fermentas)
Das Makromolekül-Reagenz Polyethylenimin (PEI), das eine kationische Ladungsdichte
besitzt, reagiert mit der DNA zu einem starken diffusionsfähigen Komplex, der leicht über
Endozytose in die Zelle aufgenommen wird.
41
2 Material und Methoden
Abb. 2.1: Der Polyethylenimin-DNA-Komplex wird über Endozytose in die Zelle aufgenommen (modifiziert
nach Fermentas).
Vorbereitung der Zellen:
Eine 24-Loch-Zellkultur-Platte wurde mit sterilen Deckgläschen (ø 12 mm) bestückt. In jeder
Vertiefung der Zellkultur-Platte wurden 5x104 Zellen ausgesät und über Nacht im CO2Brutschrank unter Standardkulturbedingungen inkubiert.
Am Tag der Transfektion wurde das Kulturmedium zwei bis vier Stunden vor der
Versuchsbeginn/Transfektionsbeginn
erneuert.
NaCl-Lösung
und
PBS
wurden
auf
Raumtemperatur erwärmt.
Herstellung eines Endozytose-Komplexes
Um eukaryontische Zellen mit DNA transfizieren zu können, muss die DNA zunächst mit
ExGen zu einem diffusionsfähigen Komplex verbunden werden.
Zur Herstellung des Komplexes wurde folgender Reaktionsansatz pipettiert (Beispiel für
einen Ansatz):
DNA
2 µg
ExGen
3,3 µl
150 mM NaCl
25 µl
150 mM NaCl
25 µl
Die ExGen Lösung wurde zu der DNA Lösung hinzugefügt, gut gemischt und für 10
Minuten. bei RT inkubiert.
42
2 Material und Methoden
Transfektion:
Von den vorbereiteten Zellen wurde das Medium abgenommen und je 300 µl serumfreies
Medium zu den Zellen gegeben. 50 µl der ExGen-DNA Lösung wurde tropfenweise
hinzugefügt. Die Inkubation erfolgte für 4-5 Stunden und Standardkulturbedingungen, dann
wurde das Medium abgenommen und die Zellen mit PBS gewaschen. Anschließend erhielten
die Zellen 0,5 ml serumhaltiges DMEM und wurden über Nacht wieder in den CO2Brutschrank gestellt.
b) Lipofectamin–Methode (nach Invitrogen)
Bei der Lipofectamin-Methode erfolgt die Einschleusung der DNA in die Zelle durch
Liposomen. Der Vorteil bei dieser Technik ist, dass nur eine geringe Menge an DNA und
wenige Zellen für die Transfektion notwendig sind.
.
Abb. 2.2: Lipofectamin-Methode. Kationische Lipide verbinden sich mit der DNA und werden zusammen von
der Zelle aufgenommen (modifiziert nach Invitrogen).
Vorbereitung der Zellen:
Eine 24-Loch-Zellkultur-Platte wurde mit sterilen Deckgläschen (ø 12 mm) bestückt. In jede
Vertiefung wurden 3x104 Zellen ausgesät und über Nacht im CO2-Brutschrank inkubiert. Am
Tag der Transfektion wurde das Kulturmedium erneuert.
43
2 Material und Methoden
Herstellung des DNA- Liposomen-Komplexes:
Zur Herstellung des DNA-Liposomen-Komplexes wurde folgender Ansatz pipettiert:
DNA
5 µg
Lipofectamin
2 µl
DMEM (ohne FCS und Antibiotikum)
50 µl
DMEM (ohne FCS und Antibiotikum)
50 µl
Die DNA- und die Lipofectamin-Lösung wurden zusammengegeben, vorsichtig gemischt und
für 20 Minuten bei Raumtemperatur inkubiert.
Transfektion:
Zu den Zellen wurde 100 µl des DNA-Liposomen-Komplexes tropfenweise hinzugefügt. Die
Inkubation erfolgte über 4-5 Stunden bei 37°C im CO2-Brutschrank.
Danach wurden die Zellen dreimal mit PBS gewaschen, erhielten 0,5 ml DMEM und wurden
anschließend über Nacht wieder im CO2-Brutschrank kultiviert.
2.4.1.5
Stabile Transfektion
Bei der stabilen Transfektion erfolgt ein Einbau der DNA in das Genom, das auch an die
nächste Generation weitergegeben wird.
Die Herstellung einer stabilen Zelllinie erfolgte zunächst wie bei einer transienten
Transfektion. Allerdings wurden die Zellen nach 48h in eine 6mm- Zellkultur-Platte überführt
und unter Selektionsdruck gesetzt. Dieser erfolgte mittels Zugabe eines Antibiotikums, gegen
das die eingeschleuste Fremd-DNA-Plasmid eine Resistenz besitzt. Diejenigen Zellen, die die
DNA eingebaut hatten, überlebten. Die Antibiotika-Zugabe wurde so lange durchgeführt, bis
stabile Zellklone sichtbar wurden. Diese Klone wurden wiederum umgesetzt und auf
Expression der eingebauten Fremd-DNA untersucht.
2.4.2
Immunfluoreszenz-Färbung
Mit Hilfe von Antikörpern lassen sich Proteine und andere Substanzen innerhalb von Zellen
detektieren. Antikörper binden an Antigene. Durch gründliches Waschen werden
unspezifische Bindungen gelöst, um die spezifischen Oberflächenmerkmale von Proteinen,
44
2 Material und Methoden
die von den Antikörpern erkannt werden, zu erhalten, müssen die ausgewählten Bereiche
vorsichtig fixiert werden.
Die Sichtbarmachung von Antigen-Antikörper-Reaktionen kann durch verschiedene
Methoden erfolgen. Sie kann auf einer stabilen Brücke zwischen dem gesuchten
Reaktionspartner (Antikörper/Antigen) mit dem Amplifikationssystem beruhen. Als
Amplifikatoren dienen in dieser Arbeit Fluoreszenzfarbstoffe. Die Amplifikatoren werden
kovalent oder nicht kovalent (adsorptiv) an die Reaktanten gekoppelt.
Bei der indirekten Immunfluoreszenz-Methode erfolgt die Markierung des Primärantikörpers
durch
den
Einsatz
von
fluoreszierenden
Antiimmunglobulinen
durch
einen
Sekundärantikörper, der von einer anderen Tierspezies stammt und prinzipiell alle
Primärantikörper bindet, gegen die er gerichtet ist.
Die verwendeten Fluoreszenzfarbstoffe werden durch unterschiedliches Licht einer
bestimmten Wellenlänge angeregt, beispielsweise blau, UV oder grün. Mittels verschiedener
Filter
ist
nur
das
Licht
der
verwendeten
Farbstoffe
oder
Fluorochrome
im
Fluoreszenzmikroskop zu erkennen, so dass der indirekte Nachweis von bestimmten
Proteinen möglich ist. Durch die Verwendung von mehreren Primärantikörpern gegen
verschiedene Proteine und deren indirekten Nachweis mit geeigneten Sekundärantikörpern,
die mit verschiedenen Farbstoffen gekoppelt sind, lassen sich außerdem Kolokalisationen
innerhalb einer Zelle ermitteln.
2.4.2.1 Immunfärbung
In den Versuchen wurde die indirekte Immunfluoreszenz- Methode angewandt:
Die Zellen wurden auf den Deckgläschen durch 4%-iges PFA für 15 Minuten fixiert. Zur
Permeabilisierung der Zellmembran wurden Zellen anschließend für 10 Minuten mit 0,3%
Triton X-100/PBS (perforiert die Membran) behandelt. Das im Puffer enthaltene Triton X100. Bei Immunfärbungen gegen Sulfatid wurden die Zellen nicht permeabilisiert, da das im
Puffer enthaltene Triton X-100 das Sulfatid aus der Membran herauslöst.
Vor der Inkubation mit dem primären Antikörper wurden die Zellen 30 Minuten lang in
Blocking-Puffer inkubiert, um unspezifische Bindungen von Antikörpern zu verringern. Es
handelte sich hier um eine Sättigung der unspezifischen Bindungsstellen durch 0,3% Gelatine.
Die Immunfärbung wurde in einer feuchten Kammer (Petrischale ausgelegt mit
wassergetränktem Filterpapier) auf Parafilm durchgeführt. Nach 1-2h Inkubation mit dem
Primärantikörper bei Raumtemperatur im Dunkeln wurden die Deckgläschen dreimal mit PBS
45
2 Material und Methoden
gewaschen, um ungebundene Antikörper zu entfernen. Nach dem Waschen wurde der
Sekundärantikörper ebenfalls für 60 Minuten im Dunkeln eingesetzt. Eine erneute Waschung
mit PBS entfernte unspezifische Bindungen. Hiernach erfolgte eine Färbung des Zellkerns mit
dem DNA-Farbstoff DAPI (4´,6-Diamidin-2´-phenyllindol-dihydrochlorid) für 5 Minuten..
Nach dem Färben wurden die Deckgläschen auf Objektträgern in Polyvinylalkohol (Fluka)
eingebettet und bis zur Auswertung im Dunkeln bei 4°C gelagert.
2.4.2.2 Mikroskopische Auswertung der Immunfärbungen
Die Präparate wurden mit den Fluoreszenzmikroskopen Axioplan und Aixoimages (Zeiss) mit
Fluoreszenzfiltern für TexasRed, RFP, FITC und DAPI untersucht. Die Mikroskope waren
mit einer AxioVision-Software ausgestattet. Die elektronischen Bilder wurden zur Publikation
mit ADOBE PHOTOSHOP 7.0 bearbeitet.
2.5
Nucleinsäure Präparationen
2.5.1.
Kultivierung der Bakterien
Für die Kultivierung von Bakterien wurde der zu untersuchende Stamm mittels einer sterilen
Impföse einem DMSO-Stock entnommen und auf einer LB-Agar-Platte mit dem
entsprechenden Antibiotikum ausgestrichen. Nach etwa 12 Stunden Inkubation, bei 37°C,
wurden die Bakterien entweder in LB-Medium oder auf LB-Agar-Platten bei 37°C weiter
kultiviert.
Für die Kultivierung resistenter Bakterienstämme wurden die entsprechenden Antibiotika den
Nährmedien zugesetzt.
Übernacht-Kulturen wurden in 5 ml LB-Medium (inklusive Antibiotikum) angelegt. Für die
anschließende Tag-Kultur wurde die Übernacht-Kultur 1:200 in frischem LB-Medium
verdünnt und bei 37°C und 200 rpm im Brutschrank bis zum Erreichen der mittleren logPhase (OD600 = 0,3) inkubiert.
46
2 Material und Methoden
2.5.2 Lagerung von Bakterien
Für die längere Aufbewahrung von Bakterienstämmen bei –80°C wurden 7 % DMSO-Stocks
angelegt. DMSO verhindert die zellschädigende Kristall-Bindung des Wassers.
2.5.3 Amplifizierung und Isolierung von Plasmid-DNA
Für die Transfektionen wurde reine Plasmid-DNA benötigt. Hierzu wurden die
entsprechenden Plasmide in E.coli-Stämme transformiert, mit Mini-Prep (Qiagen)
aufgereinigt,
über
Restriktionsverdau
und
anschließende
Agarose-Gelelektrophorese
kontrolliert und schließlich mittels Maxi-Prep (Qiagen) in großer Menge isoliert.
2.5.3.1 Transformation von E.coli-Zellen
Die bei -80°C gelagerten kompetenten Zellen wurden langsam auf Eis aufgetaut. Pro Ansatz
wurden 50 µl Bakterien mit 1 µg/µl Plasmid-DNA vorsichtig vermischt. Als Kontrolle diente
ein Aliquot Bakterien ohne Zugabe von DNA. Die Ansätze wurden 30 Minuten auf Eis
gehalten, anschließend erfolgte ein Hitzeschock für 30 Sekunden bei 42°C im Wasserbad.
Dann wurden die Bakterien für weitere 1,5 Minuten abgekühlt (auf Eis). Danach wurden
direkt 950 µl SOC-Medium zugegeben und die E.coli-Zellen für eine Stunde bei 37°C und
200 rpm inkubiert. Nach der Inkubation wurden die Bakterien bei 4000 x g für 10 Minuten
und 4°C abzentrifugiert. Vom Überstand wurden 850 µl verworfen, mit dem Rest wurde das
Pellet resuspendiert. Je 1x10 µl und je 1x100 µl pro Ansatz wurden auf Ampicillin-Platten (50
µg/ml) ausplattiert und über Nacht bei 37°C im Brutschrank inkubiert.
2.5.3.2 Isolierung von Plasmid-DNA
Die Plasmid-Präparation erfolgte nach der Methode der alkalischen Lyse. Die Lyse der Zellen
erfolgt hierbei durch SDS; das alkalische Milieu denaturiert DNA und EDTA inhibiert
DNasen durch das Entziehen von Mg2+-Ionen. Um zu verhindern, dass freie RNA bei der
Affinitätschromatographie mit der Plasmid-DNA um die Bindungsstelle konkurriert, wurde
dem Puffer außerdem RNase A zugegeben, um die freigesetzte RNA zu hydrolysieren. Nach
der Lyse und der darauf folgenden Abtrennung der denaturierten, nicht-löslichen
Zellbestandteile wurde der Überstand auf Silicagelsäulen aufgetragen. Silica ist in der Lage
47
2 Material und Methoden
bei hohen Salzkonzentrationen Plasmid-DNA zu binden. Die gebundene Plasmid-DNA kann
dadurch sehr einfach gewaschen und anschließend mittels niedriger Salzkonzentration wieder
von der Säule eluiert werden.
2.5.3.3 Plasmid-Isolierung (analytischer Maßstab, »Mini-Prep«)
Von selektiven LB-Platten wurden Einzelkolonien gepickt, in 5 ml LB-Medium mit
Ampicillin (50 µg/ml) überführt und über Nacht bei 37°C und 200 rpm inkubiert.
Für die darauf folgende Isolierung der Plasmid-DNA wurde das QIAprep-Spin Mini-Prep-Kit
(Qiagen) verwendet. Die Durchführung der Isolierung erfolgte nach den Anweisungen des
Herstellers. Die isolierte DNA wurde anschließend über einen Restriktionsverdau getestet.
2.5.3.4 Plasmid-Isolierungen (präparativer Maßstab, »Midi-Prep«)
Zur Präparation großer Mengen Plasmid-DNA wurde das QIAprep Plasmid Midi-Prep-Kit
(Qiagen) eingesetzt. Die Säulen-Kapazität der zu isolierenden DNA liegt bei ca. 500 µg DNA.
Dazu wurde die Übernacht-Kultur einer vorher untersuchten Mini-Prep (vgl. 2.5.3.3 sowie
2.5.3.5) 1:100 in 100 ml LB-Medium mit Ampicillin (50 µg/ml) angeimpft und über Nacht im
37°C-Schüttler inkubiert.
Die Isolierung wurde gemäß den Angaben des Herstellers durchgeführt und die isolierte
Plasmid-DNA bis zur weiteren Verwendung bei -20°C gelagert.
2.5.3.5 Schneiden von DNA mit Restriktionsendonukleasen
Restriktionsendonukleasen erkennen spezifische Basenabfolgen von vier, sechs oder acht
Basen, die in den meisten Fällen palindromisch sind. Die Enden des DNA-Fragments sind
entweder glatt (sog. „blunt ends“) oder sie stehen über (sog. „sticky ends“). Die Überhänge
der sticky ends sind oft zwei bis vier Basen lang und lassen sich leichter in Vektoren ligieren
als glatte Enden. Die hier verwendeten Restriktionsenzyme wurden für analytische und
präparative Arbeiten eingesetzt.
48
2 Material und Methoden
Um zu kontrollieren, ob das gewünschte Plasmid isoliert wurde, erfolgte ein
Restriktionsverdau mit der eluierten DNA einer Mini-Prep (siehe 2.5.3.3), der zur
abschließenden Analyse auf ein 1%-iges Agarosegel aufgetragen wurde.
Die Methode wurde nach Sambrock et al (1989) durchgeführt.
In einem Endvolumen von 25 µl wurden folgende Reaktionen gestartet:
5x Puffer
5 µl
Restriktionsenzym
1 µl
DNA-Lösung
1 µg/µl
ad H2O
25 µl
Als Puffer wurden die von jedem Hersteller zu den jeweiligen Enzymen empfohlenen Puffer
verwendet. Der Reaktionsansatz wurde je nach Enzym und Angabe des Herstellers für 1-2,5
Stunden bei 37°C inkubiert. Bis zur weiteren Verwendung, d.h. der abschließenden Analyse
durch Agarosegel Auftrennung der Restriktionsfragmente, wurde der Ansatz auf Eis gehalten,
um weitere Reaktionen der Restriktionsenyme zu verhindern.
2.5.3.6 Auftrennen von DNA-Fragmenten durch Agarose-Gelelektrophorese
DNA-Fragmente lassen sich in Agarose-Gelen mittels Elektrophorese auftrennen. Durch
Vergleich der Laufstrecke mit gleichzeitig aufgetrennten Größenstandards lässt sich die
Größe
der
einzelnen
Fragmente
abschätzen.
Für
diese
Arbeit
wurde
eine
Agarosekonzentration von 1% (w/v) eingesetzt. Die jeweilige Menge Agarose wurde in 100
ml 1 x TAE-Puffer gelöst und im Mikrowellengerät geschmolzen. Nach dem Abkühlen wurde
die Agarose mit Ethidiumbromid (0,1 µg/ml) versetzt und in eine Gelkammer gegossen. Die
DNA-Proben wurden mit 2 µl Loading-Puffer versetzt und in die Geltaschen pipettiert. Die
anschließende Elektrophorese erfolgte bei einer konstanten Spannung von 80 V. Das Ergebnis
wurde durch Betrachtung bei UV-Licht kontrolliert und als Videoprint dokumentiert.
2.5.3.7 Konzentrationsbestimmungen von DNA
Die Konzentration der DNA lässt sich anhand der optischen Dichte bestimmen. DNA hat im
ultravioletten Bereich der elektromagnetischen Strahlung sein Absorptionsmaximum bei
49
2 Material und Methoden
260 nm. Ein Absorptionsmaximum von 280 nm haben die Aminosäuren Phenylalanin und
Tyrosin.
Für doppelsträngige DNA entspricht eine optische Dichte (OD) von eins bei einer
Wellenlänge von 260 nm einer Nukleinsäurekonzentration von 50 µg/ml. Die Konzentration
lässt sich aus der OD bei 260 nm, dem Verdünnungsfaktor und einem für DNA spezifischen
Extinktionskoeffizienten errechnen.
Der Reinheitsgrad der DNA wurde aus dem Verhältnis zwischen OD260 und OD280 bestimmt,
wobei eine relativ proteinfreie DNA-Lösung ein Verhältnis zwischen 1.8 und 2.0 aufweist.
2.5.3.8 Reverse Transkription
Das Grundprinzip der RNA-Isolierung sieht ungefähr folgendermaßen aus: Die Zellen werden
lysiert, die RNasen inaktiviert und die RNA anschließend aus dem Lysat isoliert. Auf diese
Weise erhält man am Ende Gesamt-RNA, d.h. ein Gemisch aus ribosomaler RNA (rRNA),
Transfer-RNA (tRNA), messenger RNA (mRNA) und anderen. Die mRNA macht daran nur
einen Anteil von ca. 2 % aus. Für die meisten Anwendungen reicht das bereits aus,
beispielsweise für RT-PCR.
Reverse Transkriptasen katalysieren die Bildung eines komplementären DNA-Stranges
(cDNA) aus mRNA. Für die cDNA Synthese aus isolierter mRNA wurde das RT-PCR-KIT
(First Strang) der Firma Fermentas verwendet. Es wurde ein Oligo dT Primer verwendet, der
an die 3‘ PolyA-Sequenz der RNA binden kann.
Für eine Reverse Transkription wurde entsprechend den Angaben des Herstellers folgender
Reaktionsansatz verwendet:
4 µl
5x First-Strang Puffer
1 µl
10 mM dNTP
1 µl
0,5 μg/μl Primer
1 µl
20 U/μl RNase Inhibitor
(RiboLockTM)
1 μl
200 U/μl RT (RevertAidTM)
H Minus
X μl
1-5 μg RNA
ad 10 μl
HPLC-H2O
50
2 Material und Methoden
Der Reaktionsansatz wurde für 5 Minuten bei 70°C und dann für 5 Minuten bei 37°C
inkubiert. Anschließend wurde eine Inkubation für 1 h bei 42°C durchgeführt. Die
Inaktivierung der reversen Transkriptase erfolgt bei 95°C für 10 Minuten. Danach wurden die
Proben auf 4°C abgekühlt.
In der darauf folgenden PCR, die dazu diente spezifische Nukleinsäureabschnitte zu
amplifizieren, wurden 0,5 µl bzw. 2 µl des cDNA- Reaktionsansatzes eingesetzt.
2.5.3.9 Polymerase-Ketten-Reaktion (PCR)
Die
Polymerase-Ketten-Reaktion
(PCR)
stellt
eine
leistungsfähige
Technik
zur
Amplifizierung von DNA-Fragmenten dar.
Über spezifische Oligonukleotid-Primer, so genannte Startermoleküle, welche das zu
amplifizierende Fragment flankieren, können mit Hilfe einer thermostabilen DNAPolymerase DNA-Fragmente von bis zu 15 kb amplifiziert werden.
In dieser Arbeit wurden für die PCR das System von Fermentas und das RedTaq Ready Mix
Kit® von Sigma verwendet. Die Reaktionsansätze setzten sich für die beiden Systeme wie
folgt zusammen:
Fermentas
Sigma
2 μl
10x Taq Reaction-Puffer
10 μl
Red Taq Ready Mix
2 μl
2 mM dNTPs
2 μl
Primer 1 (5 pmol/µl)
1,2 μl
MgCl2
2 μl
Primer 2 (5 pmol/µl)
1 μl
Primer 1 (5 pmol/µl)
x μl
Template
1 μl
Primer 2 (5 pmol/µl)
ad 20 μl
PCR-H2O
1 μl
Taq-Polymerase
X μl
Template
ad 20 μl
HPLC-H2O
Die PCR-Reaktion besteht aus drei grundlegenden Schritten.
Zu Beginn eines Zyklus wird die doppelsträngige DNA in der Denaturierungsphase in
Einzelstränge aufgetrennt. Danach erfolgt die Anlagerung der Primer an die DNA.
51
2 Material und Methoden
Die Temperatur für die Primer-Anlagerung hängt von deren Schmelztemperatur und damit
von der Länge und Basenzusammensetzung der jeweiligen Primer ab. Die Schmelztemperatur
(Tm) wird über folgende Formel abgeschätzt werden:
Tm = [2°C x (Anzahl an A und T Basen)] + [4°C x (Anzahl an G und C Basen)]
Die Temperatur für die Primeranlagerung sollte ~5-10°C unter der Schmelztemperatur liegen.
Zuletzt folgt die Verlängerungsphase, in der die Polymerase aktiv wird und die eigentliche
Amplifizierung der DNA stattfindet.
Ein Zyklus aus Denaturierung, Primer-Anlagerung und Primer-Verlängerung wurde in der
Regel 25-35 Mal durchgeführt. Dauer und spezifische Temperaturen der einzelnen Schritte
wurden je nach Anwendung modifiziert, um optimale Bedingungen für die Primer zu schaffen
und optimale DNA Ausbeuten zu erreichen.
Reaktionsbeispiel
5
min.
95°C Initiale Denaturierung
30
Sek.
95°C Denaturierung
30
Sek.
55°C Primer-Anlagerung
1
min./kb 72°C Primer-Verlängerung
5
min.
72°C
∞
4°C
2.5.3.10 Phenol-Chloroform-Extraktion
Zur Gewinnung reiner DNA wurde eine Phenol-Chloroform-Extraktion durchgeführt, bei der
linearisierte DNA von Nukleinsäuren, Proteinen und anderen Verunreinigungen befreit
wurde.
Dazu
wurde
die
DNA-Lösung
mit
einem
Volumen
Phenol/Chloroform/Isoamylalkohol (25/24/1; v/v/v) versetzt, durch Invertieren gemischt und
5 Minuten bei 15.000 g zentrifugiert. Dadurch bildeten sich drei verschiedenen Phasen: die
untere ist die Phenolphase, in der Interphase sind Proteine enthalten, und die obere, wässrige
Phase enthält die DNA. Die obere Phase wurde abgenommen und in ein neues
Reaktionsgefäß überführt. Um Verunreinigungen durch Phenolreste auszuschließen, wurden
erneut zwei Volumen Chloroform zugefügt und wie oben beschrieben zentrifugiert. Die obere
Phase (gelöste Nukleinsäuren) wurde abgenommen, die Nukleinsäuren anschließend
52
2 Material und Methoden
präzipitiert (vgl. folgender Abschnitt) und je nach Bedarf weiter verarbeitet oder gelagert (bei
-20°C).
2.5.3.11 Saure Ethanolfällung
Bei der sauren Ethanolfällung wurde 1/10 Volumen Natriumacetat pH 4,6 und das 2,5 fache
Volumen 95%-iger Ethanol zur gelösten DNA gegeben und das Reaktiongefäß mehrmals
invertiert. Das Gemisch wird für 30 Minuten bei -80°C inkubiert. Danach wurde die DNA für
30 Minuten bei 15.000 g pelletiert. Nach Abnahme des Überstandes kann das DNA-Pellet in
70%-igem Ethanol gewaschen werden. Nach erneuter Zentrifugation und Abnhame des
Überstandes wurde das Pellet getrocknet und die DNA im gewünschten Volumen Wasser
aufgenommen.
2.5.3.12 Auffüllen überhängender Vektorenden
Die durch einen Restriktionsendonuklease-Verdau entstandenen DNA-Überhänge können mit
Hilfe des Klenow Fragmentes aufgefüllt werden. Das Klenow Fragment ist eine Typ I DNAPolymerase, die neben der 5'-3' Polymeraseaktivität auch eine 3'-5' FehlerkorrekturExonukleaseaktivität aufweist, aber keine DNA-Polymerase I Exonukleaseaktivität. In dieser
Arbeit wurde das Klenow Enzym von Fermentas nach folgendem Ansatz verwendet:
0,1-0,4
µg
verdaute DNA
2,0
µl
10x Klenow Puffer
0,5
µl
2mM dNTP Mix
0,5
µl
Klenow Fragment (10 U/μl)
ad 20
µl
HPLC-H2O
Der Ansatz wurde für 10 Minuten bei 37°C inkubiert. Die Inaktivierung des Klenow
Fragments erfolgte durch eine Inkubation bei 70°C für 15 Minuten.
53
2 Material und Methoden
2.5.3.13 Ligation
Die Einbringung eines DNA-Fragmentes (Insert) in einen linearisierten Vektor, ebenso wie
die Verknüpfung zweier DNA-Fragmente kann mittels des Enzyms T4-Ligase erreicht
werden. Der Vorgang an sich wird als Ligation bezeichnet. Die T4-Ligase katalysiert hierbei
die Bildung von Phosphodiesterbindungen zwischen dem 5’-Phosphat-Ende des DNAFragmentes und der 3’-OH-Gruppe eines anderen DNA-Fragmentes bzw. des Vektors. Die
Bildung von Phosphodiesterbindungen erfolgt unter Hydrolyse von ATP und kann sowohl bei
überhängenden Enden als auch bei nicht-überhängenden Enden erfolgen.
In dieser Arbeit wurde für die Ligation von DNA-Fragmenten die T4 DNA Ligase von
Fermentas verwendet. Ligationen wurden in kleinen Volumina durchgeführt, um die
Wahrscheinlichkeit zu erhöhen, dass sich die kompatiblen Enden zusammenlagern.
Folgende Ansätze wurden verwendet:
Glatte
Überhängende
Enden
Enden
2 μl
2 μl
T4 DNA Ligase Puffer
1 μl
0,5 μl
T4 DNA Ligase (1 Weiss Unit/μl)
20 ng
20 ng
Vektor
1-3 fache
Menge des
Vektors
ad 20 μl
1-3 fache Menge
Insert
des Vektors
ad 20 µl
HPLC-H2O
Der Ansatz wurde durch kurzes Zentrifugieren gemischt und für 1 h bei RT (22°C) inkubiert.
Die Berechnung von Vektor- und Insertmenge, die für eine optimale Ligation benötigt
werden, wurde durch die nachstehende Formel berechnet:
X ng Insert =
(Y bp Insert) ⋅ (Z ng Vektor)
(total bp Vektor)
54
2 Material und Methoden
2.5.3.14
Herstellung von Adaptern
Für die Erstellung von sehr kleinen DNA-Fragmenten, die mittels PCR-Amplifikation nicht
möglich wären, wurden Oligonukleotid-Adapter erzeugt. Kurze Adapter können durch das
Aneinanderlagern von Oligonukleotidstartermolekülen hergestellt werden. Dazu wurde
folgender Reaktionsansatz gewählt:
10
μg
Oligonukleotid I
10
μg
Oligonukleotid II
10
μl
T4-Ligase
70
μl
HPLC-H2O
Der Ansatz wurde 2 Minuten bei 95 °C inkubiert, dann innerhalb von 2 Minuten schrittweise
auf 50 °C abgekühlt und für 8 Minuten bei dieser Temperatur gehalten. Anschließend folgte
die Abkühlung auf Raumtemperatur und eine Inkubation für 10 Minuten.
Der Adapter wurde nun mittels der sauren Ethanolfällung (vgl. XXX Abschnitt oben) gefällt
und das Pellet schließlich in 15 μl Wasser aufgenommen.
Verwendet man zwei Oligonukleotidmoleküle, die an ihren Enden komplementär zueinander
sind, können auch längere Adapter hergestellt werden.
2.6
Biochemische Methoden
2.6.1
In-situ-Hybridisierung
2.6.1.1
Herstellung der RNA-Gensonden
Zur Herstellung einer Sonde wurde das zur Hybridisierung einzusetzende Fragment in einen
geeigneten Transkriptionsvektor, der T3-, T7- oder SP6-Promotoren enthält, umkloniert. Zur
Markierung wurden 1-2 μg Plasmid linearisiert, anschließend unter RNase-freien
Bedingungen durch Phenol/Chloroform-Extraktion gereinigt und der sauren Ethanolfällung
unterzogen. Die Markierung erfolgte mittels eines DIG-Labeling Kits der Firma Roche.
Dazu wurde in DEPC-behandeltem H2O gelöste DNA mit 2 μl 10 x Transkriptionspuffer, 2 μl
DIG-Labeling-Mix und 2 μl der entsprechenden RNA-Polymerase versetzt und 2 h bei 37°C
55
2 Material und Methoden
inkubiert. Im Anschluss erfolgte die Entfernung der DNA durch Zugabe von 2 μl RNasefreier DNase I (10 U/μl) bei 37°C für 15 Minuten. Die Reaktion wurde durch Zugabe von 2 μl
200 mM EDTA gestoppt, und die synthetisierte RNA wurde erneut mit 0,1 Volumen 3 M
Natriumacetat und 2,5 Volumen Ethanol gefällt. Die Sonde, die sich im Pellet befindet, wurde
mit 70%-igem Ethanol gewaschen, die RNA getrocknet und das Pellet schließlich in DEPCbehandeltem H2O aufgenommen.
Um die Markierungseffizienz zu bestimmen, wurde eine Verdünnungsreihe der markierten
Probe und einer markierten Kontroll-RNA angefertigt. Je 1 µl der Verdünnungen wurde auf
einer Nylonmembran (Hybond N+) fixiert und bei einer Temperatur von 120°C für 30
Minuten gebacken. Anschließend erfolgte die Entwicklung mit dem anti-DIG-Fab-APKonjugat wie unten (2.6.1.2) beschrieben. Als Reagenz zur Chemilumineszenz-Reaktion
wurde die NBT/BCIP-Lösung (Roche; 200 µl auf 10 ml AP-Puffer) verwendet. In den
verschiedenen Versuchen wurden die ihrer Markierungseffizienz der Sonden entsprechenden
Verdünnungen eingesetzt. Die Sonden Antisense-CGT und Sense-CGT wurden 1:1000
eingesetzt.
2.6.1.2
In-situ-Hybridisierung
In-situ-Hybridisierung dient zum Nachweis von RNA oder DNA in Geweben bzw. Zellen
mittels einer hergestellten Sonde aus einer Nukleinsäure, die über Basenpaarung an die
nachzuweisende Nukleinsäure hybridisiert.
Für diese Analyse dienen als Ausgangsmaterial Gefrier- / Parafinschnitte von Mäusegehirnen,
die wie unter 2.3 beschrieben hergestellt wurden.
Wenn Paraffinschnitte genutzt wurden, mussten diese zunächst von dem Paraffin befreit
werden, Gefrierschnitte konnten direkt fixiert werden (s.u.). Die Schnitte wurden zunächst in
drei Xylolbäder für 10 Minuten inkubiert. Danach erfolgte eine „Wässerung“ der Schnitte, da
das Gewebe für die Anfertigung von Schnitten entwässert worden war. Die Zuführung von
Wasser erfolgt über eine absteigende Propanolreihe (100%, 100%, 100%, 96%, 90%, 75%,
50%) in der die Schnitte jeweils für 5 Minuten inkubiert wurden. Danach wurden die Schnitte
für 5 Minuten mit PBS gewaschen und in 4% PFA für 90 Minuten fixiert. Anschließend
wurden sie mit PBS gewaschen und für 4 Minuten in Proteinase K (10 μg/ml) inkubiert,
erneut mit PBS gewaschen und für weitere 4 Minuten mit 0,25% Triton X-100
permeabilisiert. Die Schnitte wurden für weitere dreimal 5 Minuten in PBS gewaschen und
56
2 Material und Methoden
anschließend für 8 Minuten in 0,2 M HCl und danach für 10 Minuten in 0,1 M TEA-Lösung
inkubiert.
In der Zwischenzeit wurden die Sonde in Hybridisierungspuffer mit 0,08 M DTT
entsprechend ihrer Markierungssignalstärke verdünnt, für 5 Minuten bei 80°C inkubiert und
bis zur Verwendung auf Eis bewahrt.
Nach der Inkubation mit TEA-Lösung wurden die Schnitte für weitere 10 Minuten bei 50°C
in 2 x SSC inkubiert und danach direkt auf die Schnitte gegeben. Die Hybridisierung erfolgte
über Nacht bei 70°C in einer feuchten Kammer. Am folgenden Tag wurden die Schnitte
zweimal für 5 Minuten mit 2 x SSC bei 60°C gewaschen, dann einmal für 30 Minuten mit
0,1 x SSC / 50% Formamid inkubiert und abschließend für 45 Minuten in 0,1 x SSC
gewaschen. Als nächstes erfolgte die Äquilibrierung der Schnitte in Maleinsäurepuffer (100
mM Maleinsäure, 150 mM NaCl, pH 7,5), bevor unspezifische Bindungsstellen für 30
Minuten
mit
Blocklösung
(2%
Blockreagenz
von
Boehringer-Mannheim
in
Maleinsäurepuffer) geblockt wurden. Der anti-Digoxigenin-AP Fab-Fragment Antikörper
wurde 1:5000 in der Blocklösung verdünnt und über Nacht bei 4°C auf den Schnitten
inkubiert. Nach der Inkubation mit dem Antikörper wurden die Schnitte 5 x je 1 h mit
Maleinsäurepuffer gewaschen und anschließend mit AP-Puffer (100 mM Tris-HCl, 100 mM
NaCl, 5 mM MgCl2) äquillibriert. Für die Entwicklung wurde die NBT/BCIP-Lösung in dem
AP-Puffer entsprechend den Herstellerangaben verdünnt und für 2 h bis drei Tage in einer
feuchten Kammer auf die Schnitte gegeben.
2.6.2
Nachweis von Proteinen
2.6.2.1
Ernten von Zellen für die Western-Blot-Analyse
Zur Untersuchung der exprimierten Proteine 48h nach Transfektion wurde das Medium von
den Zellen gesammelt und die transfizierten Zellen wurden gemäß folgenden Angaben lysiert.
Die Zellen wurden mit PBS dreimal gewaschen. Das vorsichtige Ablösen der Zellen wurde
mit PBS / 2 mM EDTA erreicht und die abgelösten Zellen für 3 Minuten bei 3000 rpm
zentrifugiert. Das Zellpellet wurde in 50 µl Lysispuffer (1% Triton X-100, 20 mM Tris-HCl
pH8, 50 mM NaCl, 5 mM EDTA) resuspendiert und mittels einer 23 G Kanüle 20-mal auf
und ab gezogen. Dies diente zum vollständigen Aufschließen der Zellen. Hiernach wurde das
Zellhomogenat für weitere 15 Minuten auf Eis inkubiert. Alle 5 Minuten wurden die Zellen
stark gemischt. Danach erfolgte ein Zentrifugation des Homogenates bei 15000g für 15
57
2 Material und Methoden
Minuten bei 4°C zur Abtrennung der Zelltrümmer. Die löslichen Proteine befanden sich im
Überstand und wurden zur weiteren Untersuchung nach der Zentrifugation in ein neues
Reaktionsgefäß überführt.
2.6.2.2 Proteinbestimmung
Proteinkonzentrationen wurden mit Hilfe des BioRad DC Assay Systems durchgeführt nach
Lowry et al., 1951. Alle Arbeitsschritte richteten sich nach den Angaben des Herstellers
(BioRad).
Zur Erstellung einer Eichkurve wurden verschiedene Konzentrationen einer BSA-Lösung
folgender Konzentrationen als Standard verwendet: 0 mg/ml, 0,2 mg/ml, 0,5 mg/ml, 1 mg/ml,
2,5 mg/ml. Je 5 μl des Standards oder der Proben wurden in die Vertiefungen einer 96-LochPlatte pipettiert. Alle Werte wurden als Doppelwerte bestimmt.
Da die Puffer, in denen die Proteine gelöst waren, SDS enthielten, wurde gemäß
Herstellerangaben Reagenz S zu Lösung A gegeben (20 µl Reagenz S pro 1 ml Lösung A).
Von der somit hergestellten Lösung A’ wurden 25 μl in jede vorgesehene Proben-Vertiefung
gefüllt und mit je 200 μl Lösung B gemischt. Nach einer Inkubationszeit von 15 Minuten bei
RT wurde die Extinktion in einem Microplate Reader (Tecan) bei einer Wellenlänge von λ =
750 nm gemessen.
2.6.2.3
Sodium-Dodecyl-Sulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE)
Die Trennung der Proteine aufgrund ihrer molekularen Masse, unabhängig von ihrer
Eigenladung, erfolgt durch diskontinuierliche SDS-PAGE. Dazu werden denaturierende,
SDS-haltige Gele nach Laemmli (Laemmli et al., 1970) angefertigt, die ein niederprozentiges
Sammelgel und ein höherprozentiges Trenngel enthalten. In dieser Arbeit wurden zwei
vertikale Elektrophoresesysteme der Firma Biorad verwendet, Mini-Protean 3 Elektrophorese
System (Mini-Gele) und Protean II XL Vertikal Elektrophorese (Maxi-Gele).
Hauptbestandteil der SDS-Polyacrylamid Gele sind das anionische Detergens SDS, das die
Proteine denaturiert, der Polymerisationsinitiator Ammoniumperoxodisulfat (APS), für die
Quervernetzung des Polyacrylamids und der Polymerisationskatalysator TEMED. Um eine
gleichmäßige Polymerisierung des Trenngels (Zusammensetzung s.u.) zu gewährleisten,
erfolgte nach dem Gießen eine Überschichtung mit wassergesättigtem n-Butanol. Die
58
2 Material und Methoden
Konzentration des Trenngels wurde je nach Größe des zu untersuchenden Proteins
angeglichen. Die Konzentration verringert sich, je größer die molekulare Masse des
entsprechenden Proteins.
Nach dem vollständigen Polimerisieren des Trenngels wurde das n-Butanol entfernt und das
Gel mit Wasser gewaschen. Das Sammelgel wurde angesetzt wie in der Tabelle angegeben
und vorsichtig über das Trenngel gegossen. Mit Hilfe eines eingehängten Kamms wurden
Probentaschen in das Sammelgel eingebracht.
Tabelle 2.2. Zusammensetzung der Trenngellösung (Bsp. 10 %)
5 ml Mini-Gel [ml]
30 ml Maxi-Gel [ml]
Aqua bidest.
2,4
14,4
Acrylamid-Lsg
1,25
7,5
Trenngelpuffer
1,25
7,5
10 % SDS
0,05
0,3
10 % APS
0,05
0,3
TEMED
0,005
0,03
Tabelle 2.3. Zusammensetzung der 5 % Sammelgellösung
2 ml Mini-Gel [ml]
8 ml Maxi-Gel [ml]
Aqua bidest.
1,2
4,8
Acrylamid-Lsg
0,25
1
Sammelgelpuffer 0,5
2
10 % SDS
0,02
0,08
10 % APS
0,02
0,08
TEMED
0,002
0,008
Nach der Polymerisierung des Gels wurde es in die Elektrophoresekammer gestellt und mit
den Proteinproben beladen. Als Größenstandards wurden die Proteinmarker 661 Pager Ruler
und 671 Prestained Page Ruler der Firma Fermentas verwendet.
Vor dem Beladen auf das SDS-Gel wurden die Proteinproben mit 4-fach-Probenpuffer
versetzt und 5 Minuten bei 95°C erhitzt. Proben, bei denen die Na+/K+-ATPase nachgewiesen
werden sollte, wurden maximal auf 60°C erhitzt. Die Auftrennung der Proteine erfolgte mit
folgenden Spannungen bzw. Stromstärken:
Mini-Gel: 80 V bis die Probe vollständig in das Sammelgel eingewandert war, danach 120 V;
Stromstärke variabel
59
2 Material und Methoden
Maxi-Gel: 25 mA je Gel mit einer Spannungsbegrenzung auf 500 V
Nachdem die Lauffront den unteren Rand des Gels erreicht hatte, wurde der Strom
abgeschaltet, die Gele wurden aus der Kammer genommen und wie im Folgenden
beschrieben weiterbehandelt.
2.6.2.4 Semi-Dry Western-Blot (Kyse-Andersen, 1984)
Unter dem Begriff Western-Blot versteht man die Übertragung von Proteinen aus einem Gel
auf eine Membran, welche meist aus Nitrozellulose besteht. Die durch SDS-PAGE nach
molekularer Masse aufgetrennten Proteine werden in gleicher Anordnung auf die Membran
übertragen, so dass mittels Detektion bestimmter Proteine durch geeignete Antikörper die
Identifizierung von spezifischen Proteinen aus einem Proteingemisch heraus möglich ist.
Das Blotten von SDS-Gelen wurde mithilfe der Semi-Dry Methode nach Kyse-Anderson
durchgeführt. Für jedes Gel wurden 6 Stück Whatman-Papiere entsprechender der Gel-Größe
in Blotpuffer getränkt und ein Stück Nitrozellulose-Membran in H2O angefeuchtet. Zum
Aufbau des Blots wurden drei Stück des in Blotpuffer getränkten Whatman-Papiers in einem
Stapel auf die Anode gelegt, gefolgt von der angefeuchteten Nitrozellulose-Membran, dem zu
blottenden Gel und den verbleibenden drei Stück Whatman-Papier. Um ein gleichmäßiges
Blotten zu gewährleisten, wurde beim Aufbau des Blots immer darauf geachtet, dass sich
keine Luftblasen zwischen den einzelnen Lagen befanden. Die Apparatur wurde mit dem
Deckel (der Kathode) verschlossen und das Gel mit einer Stromstärke von 0,8 mA pro
Quadratzentimeter Gelfläche für 1,5 h geblottet.
Die Effizienz der Proteinübertragung auf die Membran wurde nach dem eigentlichen BlotVorgang mittels PonceauS-Färbung überprüft. Dafür wurde die Nitrozellulose-Membran für
einige
Minuten
in
PonceauS-Gebrauchslösung
inkubiert
und
anschließend
zur
Differenzierung der Proteinbanden mit Wasser gewaschen. Durch das Abspülen des nicht
gebunden PonceauS mit H2O sind die Proteine als rote Banden zu erkennen. Eine
gleichmäßige Färbung des Blots zeigt außerdem an, ob der Proteintransfer Luftblasen-frei
erfolgt ist, oder ob gegebenenfalls durch Luftblasen nicht geblottete Bereiche entstanden sind.
Gleichmäßig geblottete Membranen wurden anschließend an die Ponceau Färbung für den
Nachweis von Proteinen mit spezifischen Antikörpern verwendet. Dafür wurden zunächst die
freien Bindungsstellen der Membran durch Inkubation mit der Blocklösung (3%
Magermilchpulver in 1xPBS) für 30-60 Minuten bei RT unter Schütteln geblockt, um freie
Proteinbindungsstellen abzusättigen. Nach der Blockierung wurde der Primärantikörper in
60
2 Material und Methoden
Blocklösung verdünnt und für 1.5h bei Raumtemperatur
inkubiert. Danach wurde die
Membran 3 x für je 10 Minuten in TBS/Tween gewaschen und anschließend für 1 h mit dem
in TBS/Tween verdünnten Sekundärantikörper inkubiert. Es folgte ein weiteres dreimaliges
Waschen wie oben beschrieben.
Die Detektion des Signals erfolgte über verstärkte Chemilumineszenz (ECL). Hierbei ist der
sekundäre Antikörper mit einer HRP gekoppelt, die das Substrat der ECL umsetzt, was in
einem Lumineszenz-Signal resultiert. Dies wird in der Dunkelkammer ausgenutzt um einen
aufgelegten Röntgenfilm zu belichten. Da das Signal übereinstimmt mit der Position des
Proteins im Gel (= Blot) kann zusätzlich ermittelt werden, welche Mol Masse das Protein hat.
Dazu wurde auf die Membran 10 ml ECL-Lösung und 3,1 μl H2O2 gegeben und die Membran
für 1 Minute darin inkubiert. Anschließend konnte ein Film durch Auflegen auf die Membran
belichtet und mittels Entwicklungsmaschine entwickelt werden. Die Exposition der Filme
wurde für unterschiedliche Zeiträume durchgeführt (30 – 300 sec.).
2.6.3 Nachweis von Proteinen in Gefrierschnitten
2.6.3.1 Allgemeine Immunhistochemie
Die Immunfluoreszenz-Analyse ermöglicht den Nachweis von Proteinen mit Hilfe von
Antikörpern an fixierten Geweben. Für die Analyse wurden die Gefrierschnitte zunächst für
15 Minuten in 4% PFA fixiert. Danach wurde eine 3malige Waschung mit PBS durchgeführt,
worauf eine Permeabilisierung mit 0.5 %Triton X-100 für 5 Minuten erfolgte. Um
unspezifische Bindungsstellen zu blockieren, wurde anschließend für 60 Minuten in 1% BSA
in PBS inkubiert. Der Primärantikörper wurde in 1% BSA / PBS gelöst und die Schnitte über
Nacht bei 4°C in einer feuchten Kammer mit der Antikörper-Lösung inkubiert. Es schlossen
sich wiederum drei Waschschritte mit PBS an, woraufhin die Inkubation mit dem
Sekundärantikörper (ebenfalls in 1% BSA / PBS) für 1h bei RT an. Nicht gebundene
Sekundärantikörper wurden durch erneutes dreimaliges Waschen in PBS entfernt. Für die
Zellkernmarkierung wurden die Präparate 5 Minuten in einer DAPI-Lösung inkubiert (1:500
in PBS) und die Schnitte anschließend einmal in PBS und dann kurz in H2O gewaschen.
Schließlich wurden die Präparate in Polyvinylalkolohl Eindeckelmedium mit DABCO (Fluka)
eingedeckelt und bis zur mikroskopischen Analyse bei 4°C lichtgeschützt aufbewahrt.
61
2 Material und Methoden
2.6.3.2
Immunhistochemischer Nachweis von Sulfatid in Gewebe
Mit Hilfe des SulphI Antikörpers (Fredmann et al., 1988) wurde an Gewebeschnitten Sulfatid
nachgewiesen.
Hierzu wurden Kryoschnitte langsam aufgetaut und mit PBS gewaschen. Die Schnitte wurden
zunächst in 0,05% Glycin / PBS für 30 min inkubiert. Es folgte, nach einer 3-4-stündigen
Inkubation mit 0,05% Tween 20, 1% BSA / PBS-Lösung, die Inkubation des primären
Antikörpers Sulph (1:100 in 0,01% Tween-20, 1% BSA / PBS-Lösung) bei 4°C über Nacht.
Am folgenden Tag wurden die Schnitte dreimal mit PBS gewaschen und anschließend mit
dem sekundären Antikörper für 3 h bei Raumtemperatur inkubiert. Die Schnitte wurde danach
wieder mit PBS gewaschen und mit Polyvinylalkohol Eindeckelmedium eingedeckelt.
2.6.3.3
Alcianblau-Färbung
Die Akkumulation von Sulfatid im Gewebe wurde histologisch durch die Alcianblau-Färbung
nachgewiesen. Hierzu wurden 12-14 µm dicke Kryoschnitte verwendet. Nach dem Auftauen,
wurden die Schnitte zuerst mit PBS gewaschen, um etwaige Saccharosereste zu entfernen.
Für eine garantierte selektive Färbung von Sulfatid musste bei der verwendeten Scott-Lösung
(2,5% Paraformaldehyd, 0,025 M Na-Acetat pH 5,7, 0,3 M MgCl2) der pH genau eingestellt
sein und das MgCl2 immer frisch zur angesetzten Stocklösung zugegeben werden.
Zuerst wurden die Schnitte über 24h mit der Scott-Lösung fixiert (Präinkubation), wobei
Lösung mindest dreimal gewechselt wurde. Danach wurde die Scott-Lösung durch die
Färbelösung (0,025% Alcianblau 8 GX in Scott-Lösung) ersetzt und die Schnitte für weitere
24h über Nacht bei Raum Temperatur inkubiert. Das Prinzip der Alcianblau-Färbung beruht
dabei darauf, dass das Alcianblau an die negative Ladung des Sulfatids im Gewebe bindet.
Nach der Färbung wurden die Schnitte mit Scott-Lösung gewaschen, um die unspezifische
Hintergrundfärbung zu verringern. Dies erfolgte wiederum für 24h, wobei die Lösung
ebenfalls dreimal gewechselt wurde.
Im Anschluss wurde zur Überprüfung der angefärbten Zellstrukturen eine Immunhistochemie
(s. 2.2.2.) mit den neuronalen Antikörpern HRP-3 (Hepatoma-derived growth factor-related
protein-3) sowie NeuN (neuronal nuclei) durchgeführt.
62
2 Material und Methoden
2.6.3.4
Immunhistochemie mittels ABC-Methode
Parafinschnitte wurden verwendet, wenn diese vorher durch eine Xylolreihe drei mal
5 Minuten
deparafiniert
und
anschließend
stufenweise
durch
abnehmende
Alkoholkonzentrationen hydriert. Es folgte eine dreimalige Waschung in PBS. Die
Behandlung von Kryoschnitten wurde an diesem Punkt begonnen. Um endogene Peroxidase
Aktivität zu inaktivieren, wurden die Schnitte mit 0,3% H2O2 behandelt. Danach wurden die
Präparate mit PBS gespült und es folgte eine Permeabilisierung mit 0,5 % Triton-X 100 / PBS
für 5 Minuten bei Raumtemperatur. Die Schnitte wurden nochmals mit PBS gewaschen. Im
Anschluss wurden sie mit 2 % BSA für 30 Minuten bei Raumtemperatur blockiert. Der
primäre Antikörper wurde in 2 % BSA / PBS verdünnt und die Schnitte wurden mit der
Antikörperlösung über Nacht bei 4°C inkubiert.
Am folgenden Tag wurde zunächst der nicht gebundener Antikörper mit PBS ausgewaschen
und die Schnitte mit einem biotinylierten sekundären Antikörper (in 2 % BSA / PBS) für
1.5 h bei Raumtemperatur inkubiert.
Zur Herstellung des ABC-Komplexes wurde in der Zwischenzeit nach Anweisung des
Herstellers Lösung A 1:100 in PBS verdünnt, gut durchmischt und mit 1:100 in PBS
verdünnter Lösung B versetzt. Durch die anschließende Inkubation für 30 Minuten konnte
sich so der Avidin-Biotinylierte Enzym-Komplex (ABC-Komplex) bilden. In dieser Arbeit
wurde sich des Avidin-Biotinylierten HRP Systems bedient (VECTOR Laboratories).
Abb. 2.3: Darstellung der Immunhistochemie mit der ABC-Methode (Quelle: VECTOR Laboratories).
Der ABC-Komplex wurde direkt nach der Inkubation des biotinylierten sekundären
Antikörpers auf die Schnitte gegeben und für 1 h bei RT dort belassen. Durch die Bindung des
63
2 Material und Methoden
ABC-Komplexes an den biotinylierten Sekundärantikörper war somit das Antigen mit einem
großen Komplex „markiert“, was zu einer deutlichen Signalverstärkung bei der Visualisierung
führte. Diese wurde mittels der Substrate 3,3´-Diaminobenzidin (DAB) oder Histogreen wie
folgt durchgeführt:
•
Histogreen Substrat-Lsg:
2 Tropfen Histogreen Chromogen (Nr1)
1ml Histogreen-Buffer (Nr.2) und dazu
2 Tropfen H202 (Nr.3); gut mischen
•
DAB-Substrat-Lsg:
100µl 0,5% DAB-Lösung in 1ml TBS
+ 1µl H2O2, gut mischen
Bei Anfärbung der Schnitte mit HistoGreen wurden diese im Anschluss mittels einer
Ethanolreihe (3 x 100% EtOH für 30 sec.) gefolgt von einer Xylolreihe (3 x 100% Xylol für
30 sec.) dehydriert. Die Schnitte wurden in DPX Einbettmedium eingebettet und bis zur
Analyse bei 4°C gelagert.
2.6.4
Isolierung der Plasmamembran
Die Isolierung der Plasmamembran (und auch des Myelins) wurde unter Zuhilfenahme eines
Saccharose-Gradienten durchgeführt. Diese Methode beruht darauf, dass die Plasmamembran,
im Vergleich zu anderen zellulären Bestandteilen, eine geringe Dichte hat und deshalb in
einem Saccharose-Gradienten „schwebt“. Für die Analyse (nach Li, Serwanski, Miralles et al.
2007 & Henn, Hansson and Hamberger, 1972) dienten Mausgehirne als Ausgangsmaterial.
Diese wurden zunächst in 4 ml kalten Puffer A (10% Saccharose, 1 mM NaHCO3 pH7.4, 1
mM MgCl2, 0,5 mM CaCl2,
0,5 mM EDTA, 1mM PMSF) mit einem Teflonstab
Homogenisator (Potter S) bei einer Laufdrehzahl von 900 rpm bei 4°C homogenisiert. Vom
Homogenat wurden je 2 x 100 µl Aliquots entnommen und bis zur weiteren Verarbeitung bei
–80°C gelagert. Das Homogenat wurde bei 1400 g für 10 Minuten und 4°C pelletiert. Der
Überstand wurde gesammelt und bei 4°C aufbewahrt. Das Pellet wurde erneut in Puffer A
homogenisiert und wiederum bei 1400 g für 10 Minuten und 4°C zentrifugiert. Der Überstand
wurde mit dem ersten vereinigt und wiederum bei 1400 g für 10 Minuten und 4°C
abzentrifugiert. Anschließend wurde dieser Überstand bei 13800 g für 10 Minuten bei 4°C
pelletiert.
64
2 Material und Methoden
Das Pellet wurde in 9 ml 30% Saccharose aufgenommen, in Ultrazentrifugenröhrchen
überführt, vorsichtig mit 2-3 ml 10,5% Saccharose überschichtet und für 2 h bei 20000 rpm
und 4°C in der Ultrazentrifuge im Ausschwingrotor zentrifugiert. Bei diesem ZentrifugationSchritt sammelte sich das Myelin aufgrund seiner Dichte in der Interphase zwischen 10,5%
und 30% Saccharose. Dieses sozusagen schwebende, milchigweiße Myelin wurde
abgenommen und zur Entfernung der Saccharose mit 5 mM Tris-HCl in PBS für je 30
Minuten bei 25000 rpm und 4°C gewaschen. Das Pellet wurde in 200 µl 5 mM Tris-HCl
aufgenommen und bei -20°C gelagert. Anschließend wurde das resultierende Pellet aus dem
1. Saccharosegradienten erneut auf einen weiteren diskontinuierlichen Saccharose-Gradienten
(35%-25%-10%) geladen und 2 h bei 22000 rpm und 4°C zentrifugiert.
PM-Gradient
Myelingradient
10%
10.5%
Myelin
Myelin
30%
PM
PM-Pellet
25%
35%
Mitochondrien
Abb. 2.4: Schematische Darstellung der eingesetzten Sucrose-Gradienten.
Die schwebende Plasmamembran wurde aus der Phase zwischen 35 % - 25 % Saccharose
abgenommen, mit 2 ml 5 mM Tris-HCl gemischt und 4-5 x durch Invertieren gemischt.
Hiernach wurden zu dem Gemisch weitere 8 ml 5 mM Tris-HCl hinzugefügt und für je 30
Minuten bei 25000 rpm und 4°C gewaschen.
Das abschließende Plasmamembranpellet wurde in 200 μl 5 mM Tris-HCl aufgenommen, in
je 2 x 100 ml Aliquots aufgeteilt und bis zur weiteren Verwendung bei -80°C gelagert.
Homogenate und Plasmamembran wurden im weiteren Verlauf einer Lipidanalyse nach
Bligh-Dyer (s. 2.6.6.3) sowie einer Western-Blot-Analyse auf angereicherte Proteine in der
Plasmamembranfraktion unterzogen.
65
2 Material und Methoden
2.6.5
Cerebrosid-Sulfotransferase-Assay
Die transfizierten Zellen wurden in 20 mM Tris-HCl / 150 mM NaCl (pH 7,0) mit
zugegebenen Protease Inhibitoren lysiert und der postnukleare Überstand auf eine
Proteinkonzentration von 5-10 mg/ml eingestellt (s. 2.6.2.1).
Für jede Probe wurden 5 µl GalCer (4 mg/ml) und 10 µl 1% Triton X-100 in ein 1,5 ml
Reaktionsgefäß überführt und in der Speed Vac eingedampft. Danach erfolgte die Zugabe von
40 µl Reaktionspuffer. Die Reaktion wurde durch die Zugabe von 10 µl Lysat gestartet und
für 60-120 Minuten bei 37°C inkubiert. Durch das Zuführen von 1 ml Chloroform / Methanol
(2:1) wurde die Reaktion gestoppt. Dann wurden 200 µl 150 mM NaCl hinzugegeben, für
1 Minute gut durchmischt und für 5 Minuten bei 1400 g zentrifugiert. Die organische Phase
wurde vorsichtig abgenommen und mit TUP (Methanol / 150 mM NaCl / Chloroform,
48:47:3) gewaschen. Das Gemisch wurde erneut in der Speed Vac eingedampft, die Lipide
wurden in 20 µl von Chloroform / Methanol (2:1) gelöst, auf eine HPTLC Silica Gel Platte
aufgetragen und in Chloroform / Methanol / Wasser (65:25:4) entwickelt.
2.6.6
Extraktion von Lipiden aus Zellen
2.6.6.1
Vorbereitung von LiChroprep® RP-18
Die LiChroprep® RP-18-„Kügelchen“ wurden zunächst in 2 Volumen Chloroform /
Methanol (2:1) suspendiert und dann 30 Minuten gerührt. Anschließend wurden sie
sedimentiert und der Überstand verworfen. Abschließend wurden die Kügelchen mit 2
Volumen Methanol gewaschen und in Methanol bei 4°C gelagert.
2.6.6.2
Lipidextraktionen (modifiziert nach van Echten-Deckert, 2000)
Lipide wurden sowohl aus Zellen wie auch aus Mausgewebe extrahiert. Zellen wurden
zunächst von der Zellkulturschale gelöst und pelletiert. Zu dem Zellpellet wurden 1ml
Methanol und 2ml Chloroform (Methanol / Chloroform 1:2) hinzugegeben und mit Hilfe des
Ultra-Turrax zerkleinert.
Das Mausgewebe wurde in 2 ml kaltem TBS mit 1mM PMSF mittels des Ultra-Turrax
homogenisiert und anschließend bei 100000 g und 4°C pelletiert.
66
2 Material und Methoden
Die Suspensionen wurde in einem 10fachen Überschuss an Chloroform / Methanol (2:1)
aufgenommen und in ein Pyrex-Röhrchen überführt Dieses Homogenat wurde danach mit
einem kleinen Rührfisch für 4 Stunden bei 56°C gerührt, um apolare Lipide in Lösung zu
bringen. Durch nachfolgende Zentrifugation bei 1300 rpm (10 Minuten, 4°C) wurde
unlösliches Material und Gewebereste sedimentiert. Der Überstand wurde in einem frischen
Pyrex-Röhrchen gesammelt und das Sediment erneut extrahiert. Dafür wurden 6-8 ml
Chloroform/ Methanol (1:1) hinzugegeben. Die Suspension wurde wieder mit einem kleinen
Rührfisch für 4 Stunden bei 56°C gerührt. In dieser 2. Extraktion wurden die polaren Lipide
freigesetzt. Durch erneute Zentrifugation, 10 Minuten mit 1300rpm bei 4°C, wurde
unlösliches Material sedimentiert, der Überstand wurde abgenommen und mit dem Überstand
der ersten Extraktion vereinigt. Dieses Extrakt wurde im 50°C-Wasserbad erhitzt und unter
Einblasen von Stickstoff eingedampft. Die so erlangten Gesamtlipide wurden in 300 µl
CHCl3/MeOH, (1:1) aufgenommen und bis zur weiteren Verwendung bei -20°C gelagert.
Um die Glycerophospholipide aus der Gesamtlipid-Fraktion zu verseifen, wurden diese in
2,5 ml Methanol aufgenommen und 5 Minuten im Ultraschallwasserbad gelöst. Dann wurden
62,5 μl 4 M Natriumhydroxid hinzugegeben. Diese Lösung wurde unter Rühren für 2 Stunden
bei 37°C inkubiert. Die Hydrolyse wurde anschließend durch Zugabe von 10 μl Essigsäure
gestoppt, die Lösung wie bereits beschrieben im 50°C-Wasserbad erhitzt und erneut unter
Stickstoff eingedampft. Die Lipide wurden in 1 ml Methanol aufgenommen und 5 Minuten im
Ultraschallwasserbad gelöst. Zur Entsalzung wurden die Lipide auf eine folgendermaßen
präparierte Säule gegeben (Schwarz et al., 1997; van Echten-Deckert, 2000): Eine
Pasteurpipette wurde mit Glaswolle gestopft. Die in Methanol gelagerten LiChroprep® RP18-„Kügelchen“ wurden resuspendiert und auf die Glaswolle pipettiert. Zur Äquilibrierung
der Säule wurde diese anschließend zweimal mit 1 ml 0,1 M Chloroform / Methanol /
Kaliumchlorid
(3:48:47)
gewaschen.
Die
Lipidlösung
wurde
mit
1 ml
300 mM
Ammoniumacetat versetzt und anschließend auf die Säule gegeben. Das Pyrex-Röhrchen, das
die Lipidlösung beinhaltete, wurde zweimal mit je 0,5 ml Methanol / 200mM
Ammoniumacetat (1:1) gewaschen und die resultierende Lösung auf die Säule gegeben.
Anschließend wurde die Säule sechs- bis achtmal mit je 1 ml destilliertem Wasser gespült.
Um das Eluat aufzufangen wurde ein frisches Pyrex-Röhrchen unter die Säule gestellt.
Zur Elution der Lipide wurde dann zunächst 1 ml Methanol, dann sechsmal je 1ml
Chloroform / Methanol (1:1) auf die Säule gegeben. Das Eluat wurde wie bereits erläutert im
50°C warmen Wasserbad und unter Einblasen von Stickstoff eingedampft. Die eingedampften
Lipide wurden abschließend in 300 μl Chloroform / Methanol (1:1) gelöst und in ein
67
2 Material und Methoden
Glasfläschchen mit Teflondeckel überführt. Die Lipide wurden bis zur Analyse bei –20°C
gelagert.
2.6.6.3 Lipidextraktionen (modifiziert nach Bligh und Dyer, 1959)
Die Plasmamembranfraktionen (vgl. 2.6.4) wurden gemäß einer nach Bligh-Dyer
modifizierten Lipidextraktion unterzogen. Dazu wurden zu den 100 µl Ausgangsmaterial
375 µl Chloroform / Methanol (1:2) gegeben und gut durchgemischt.
Dann erfolgte die Zugabe von 125 µl Chloroform, wurde gute durchmischt und 125 µl H2O
zugegeben. Nach dem Mischen der Lösung wurde diese bei 3000 rpm für 2 Minuten
zentrifugiert. Die organische Phase (untere) wurde vorsichtig entnommen, in ein neues
Reaktionsgefäß überführt und in der Speed Vac eingedampft.
Die Lipide wurden in 200 µl Chloroform / Methanol (1:1) gelöst und in ein Glasfläschchen
mit Teflondeckel überführt und bei –20°C gelagert.
2.6.6.4 Auftrennen von Lipiden auf DC-Platten - Dünnschichtchromatographien
Die Dünnschichtchromatographie (TLC) wurde zur Analyse der extrahierten Lipide
angewandt.
Die Lipide wurden mit Hilfe des „TLC-Modul“ von Camag auf eine HPTLC Kieselgel 60
Platte aufgetragen. Für die erste TLC-Platte wurden 10 μl der Lipidlösung aufgetragen.
Anhand der Signale dieser Platte wurde der Lipidgehalt anhand von Cholesterin berechnet
(s.u.) und somit für jede weitere TLC die aufgetragenen Lipidmengen auf Cholesterin
normalisiert aufgetragen. Die beladene TLC-Platte wurde in eine Chromatographiekammer
mit dem entsprechenden Laufmittel (soweit nicht anders vermerkt Chloroform, Methanol und
destilliertes Wasser im Verhältnis 35:15:2) gestellt. Sobald die Lauffront des Laufmittel bis
ungefähr 1-2cm unter den Plattenrand gelaufen war, wurde die Platte aus der Kammer
genommen und mittels eines Föns kurz getrocknet. Anschließend wurde die Platte großzügig
mit Kupfersulfat-Färbelösung eingesprüht, kurz mit einem Fön getrocknet, danach fünf
Minuten bei 180°C zur Visualisierung der Signale gebacken und abschließend eingescannt.
Die Quantifizierungen der Lipidbanden erfolgte densitometrisch mit Hilfe der AIDA Software
(Advanced Image Data Analyzer; Raytest, Straubenhardt, Deutschland). Für die einzelnen
Lipide wurden mit bekannter Konzentrationen Eichgeraden erstellt.
68
2 Material und Methoden
Für Ganglioside wurden das Laufmittel Chloroform / Methanol / 0.22% CaCl2 (60:35:8) und
für die Cerebroside Chloroform / Methanol / H2O bidest. (65/25/4) genutzt.
2.6.6.5
Immundetektion von Sulfatid auf DC-Aluminiumfolien
Das Protokoll der „Thin Layer Chromatography Overlay“ wurde zum ersten Mal durch
Bethke und Kollegen publiziert (Bethke et al., 1986) und in der vorliegenden Arbeit
modifiziert
zur
Immundetektion
von
Sulfatid
auf
TLC-Platten
nach
erfolgter
Lipidauftrennung angewendet.
Die Dünnschichtchromatographie wurde für die Immundetektion mit DC-Aluminiumfolien
20x20cm Kieselgel 60 durchgeführt. Die Lipide wurden mit dem „TLC-Sampler“ von
Camag aufgetragen, mit jeweils einer Standardlipidlösung an beiden Rändern der DC-Platte.
Die beladene Platte wurde in eine Chromatographiekammer mit Laufmittel gestellt. Nachdem
die Lauffront bis 1 cm an den oberen Rand der Platte gelaufen war, wurde sie
herausgenommen und kurz getrocknet. Anschließend wurden die beiden äußeren Spuren, die
die Standardlipidlösung trugen, abgetrennt und entwickelt. Danach wurden die Spuren wieder
an die TLC-Platte angelegt und der Bereich der gesuchten Lipide ausgeschnitten. Dieser Teil
der TLC-Platte wurde nachfolgend weiterverarbeitet. Er wurde zweimal 1 Minute mit 0,3%
„Plexigum“-Lösung gewaschen, zwischendurch kurz mit einem Fön getrocknet, dann 1
Stunde bei 55°C getrocknet und in Tris-HCl-Puffer 200mM (pH 7,5) für ein weitere Stunde
bei Raumtemperatur inkubiert. Die Platte wurde erneut kurz mit einem Fön getrocknet und
eine Stunde bei Raumtemperatur in 2% BSA und 0,05% Tween-20 in PBS inkubiert.
Nach der Blockierung wurde die Platte mit dem ersten Antikörper (Maus-anti-SulphI, 1:100
in Blockinglösung) für 1,5 h bei Raumtemperatur inkubiert. Danach wurde die Platte dreimal
mit PBS für je 15 Minuten gewaschen und zwischendurch kurz mit einem Fön getrocknet.
Der sekundäre Antikörper (alkalische Phosphatase konjugierter Ziege-anti-Maus-Antikörper;
1:500) wurde ebenso für 1,5 h bei Raumtemperatur inkubiert. Danach wurde die Platte
viermal mit PBS für je 10 Minuten gewaschen und zwischendurch kurz bei Raumtemperatur
getrocknet. Die Platte wurde in NBT/BCIP-Färbelösung je nach Intensität der Banden wenige
Minuten bis über Nacht bei Raumtemperatur lichtgeschützt inkubiert und entwickelt. Die
Teile der DC-Aluminiumfolie, die nicht zur Immundetektion herangezogen wurden, dienten
der Visualisierung der Lipidzusammensetzung durch Kupfersulfat-Färbelösung.
69
2 Material und Methoden
2.6.7 ESI-MS (Elektrospray Ionisation-Massen Spektrometrie) von Lipiden
Elektorspray-Ionisation-Massen-Spektrometrie wurde angewendet, um die quantitativen
Unterschiede in den Lipiden verschiedener Genotypen, sowie die verschiedenen FettsäurenKettenlängen von Sulfatid zu bestimmen.
Hierzu wurde 5 µl Lipide über eine Silica-Säule (LiChroCART 125-4 Si-60; MERCK) laufen
gelassen, um eine bessere Auftrennung und auch nochmalige Reinigung der Lipide zu
gewährleisten. Danach erfolgte der Transfer in die Elektrospray Kapillare bei 4000 V. Als
Kollisionsgas diente Argon.
Die negativ geladenen Glykolipide wie Sulfatid wurden im negativen Modus gemessen. Für
jede Probe wurde ein Spektrumlauf von 15 Minuten durchgeführt. Als Wasch- und
Elutionslösung dienten A) Wasser und 1% NH4OH-4% (w/v), B) Acetonitril-0%, C)
Isopropanol-26% (w/v), D) n-Heptan-70% (w/v). Die Messungen wurden freundlicherweise
von Herrn Werner Tomberg durchgeführt.
2.7
Mäuse
2.7.1
Tierexperimentelles Arbeiten
Die in dieser Arbeit durchgeführten Tierversuche erfolgten nach den Vorgaben des geltenden
Tierschutzgesetzes.
Alle Mauslinien wurden mit Futter und Wasser ad libidum in einem 12-stündigen Tag-Nacht
Rhythmus gehalten. Für die Gewebeentnahme wurden die Tiere zunächst mit Diethylether
betäubt und dann durch zervikale Dislokation getötet.
Um histologische Schnitte für histochemische Untersuchungen zu erhalten, wurden die Tiere
zunächst perfundiert. Hierfür wurden die Tiere zunächst durch eine intraperitonale Injektion
mit Avertin (15 μl pro g Körpergewicht) betäubt, dann durch die linke vordere Herzkammer
eine Kanüle eingestochen, über die 1% Procain in PBS injiziert wurde, um eine Verengung
der Arterien zu verhindern. Diese Injektion wurde für 10 Minuten durchgeführt, bevor eine
Perfundierung mit 4% PFA bzw. 6% Glutaraldehyd in 0,1 M Phosphatpuffer, pH 7,3
vorgenommen wurde (für ca 20 Minuten). Injektion mit Procain sowie Perfusion erfolgten mit
Hilfe einer peristaltischen Pumpe (60 x/Minute). Die perfundierten Mäuse wurden über Nacht
weiter in 4% PFA bzw. 3% Glutaraldehyd bei 4°C fixiert.
70
2 Material und Methoden
2.7.2 Genotypisierung der Mäuse
Die Genotypisierung diente zur Überprüfung der Maus-Genotypen und wurde standardmäßig
an ca. 3-4 Wochen alten Tieren durchgeführt. Dazu wurde den Mäusen ein kleines Stück der
Schwanzspitze (ca. 0,5-1 cm) entnommen und über Nacht bei 56°C schüttelnd in 750 μl
Lysepuffer mit 5 μg/ml Proteinase K lysiert. Die vollständig aufgelöste Schwanzspitze wurde
am nächsten Morgen zuerst mit 250 μl 6 M NaCl versetzt, weitere 5 Minuten bei 56°C
inkubiert und 10 Minuten bei 13.000 rpm abzentrifugiert, um die unlöslichen Bestandteile zu
pelletieren. 750 μl des Überstandes wurden in ein neues Reaktionsgefäß überführt und mit
500 μl Isopropanol versetzt. Nach mehrmaligem leichten hin und her Schwenken fiel die
DNA aus und wurde für 3 Minuten bei 1300 rpm abzentrifugiert. Das so erhaltende DNAPellet wurde daraufhin mit 70% EtOH gewaschen und getrocknet, und anschließend in 300 μl
dH2O aufgenommen. Nach photometrischer Konzentrationsbestimmung wurden ca. 300 ng
genomische Maus-DNA in PCR-Analysen eingesetzt.
Die PCR-Bedingungen für eine Genotypisierung einer ASA-, ApoE-defizienten Maus und
einer transgenen Thy1-CGT Maus sahen wie folgt aus:
Programm:
5 min 94°C
30 sec. 94°C
30 sec. 50°C(CST),
(56°C(CGT,ASA,) ;68°C(ApoE))
}
x 32
60 sec. 72°C
10min. 72°C
2.7.3 Verhaltenstest - Open Field Test
Zur Bestimmung möglicher Veränderungen in den Verhaltensweisen transgener Mäuse
wurden sog. Open Field Tests durchgeführt. Der „Open Field“ Aktivitätstest wurde dazu
genutzt, die Lokomotorische Aktivität von Mäusen zu messen und diente des Weiteren zur
Analyse möglicher motorischer Defizite, Nervosität oder Ängstlichkeit.
Folgende Parameter wurden gemessen: Anzahl und Zeit der Sprünge sowie des Aufrichtens,
Durchschnittsgeschwindigkeit, zurückgelegte Strecke sowie die Zeit im Zentrum und im
Ruhezustand. Dazu wurden die Mäuse einzeln für je 5 Minuten in eine Box des Typs ENV515-16, mit einer Größe vom 44 cm x 44 cm gesetzt, deren Boden und Plexiglaswände
Lichtschranken aufwiesen, die mit einem Computer verbunden waren. Jedes Mal, wenn eine
71
2 Material und Methoden
Maus eine Lichtschranke passierte, wurde es mit Hilfe der Activity Software Version 4.36
(Med. Associates Inc., St. Albans, USA) vermerkt.
2.7.4 Statistische Auswertung
Die aus dem Aktivitätstest erhaltenen Daten wurde mit dem Programm Statistika ausgewertet
und die Ergebnisse als arithmetische Mittelwerte ± Standardabweichung bzw. Standardfehler
(SEM; wie angegeben) dargestellt. Zur Berechnung biochemischer Signifikanzen wurde die
Varianzanalyse nach R. A. Fisher angewandt. Ein p-Wert kleiner 0,05 wurde als signifikant
gewertet.
72
3 Ergebnisse
3. Ergebnisse
Die metachromatische Leukodystrophie (MLD) ist eine lysosomale Speicherkrankheit die auf
einen Gendefekt des Enzyms Arylsulfatase A (ASA) beruht. Die ASA katalysiert den ersten
Schritt im Abbau des Sphingolipids 3-O-Sulfo-Galaktosylceramid (Sulfatid). Das Enzym
entfernt die Sulfatgruppe vom polaren Teil des Lipids. Wenn dieser Schritt aufgrund des
ASA-Enzymdefektes nicht mehr durchgeführt werden kann, wird Sulfatid nicht mehr
abgebaut und akkumuliert in den Lysosomen. Die Synthese des Sulfatids erfolgt im GolgiApparat durch das Enzym Cerebrosid Sulfotransferase (CST).
Mit Hilfe von MLD-Mausmodellen soll die molekulare Pathologie sowie die Rolle von
Sulfatid untersucht werden. Dazu wurden zunächst in-vivo-Untersuchungen von ASAKnockout- und ASA/ApoE-Knockout-Mäusen durchgeführt, um zum einen den Einfluss von
Lipiden und deren Menge, vor allem an Sulfatid, zu bestimmen und zum anderen die
morphologische Lokalisation von Sulfatid zu untersuchen. Diese Ergebnisse werden im ersten
Abschnitt gezeigt (3.1).
Im zweiten Abschnitt des Ergebnisteils (3.2) sind die Untersuchungen auf histologischer
(3.2.1) und biochemischer Ebene (3.2.2) der Thy-1-CGT-Mäuse aufgeführt, die die
Cerebrosid-Galaktosyltransferase (CGT) überexprimieren. Der dritte Teil der Arbeit (3.3)
befasst sich mit der CST. Hierzu wurden verschiedene Fusionskonstrukte der CST in vitro in
einem Zellkulturmodell untersucht, um die Lokalisation der CST genau zu klären und ein
Expressionssystem zu etablieren, bei dem größere Mengen an CST gewonnen werden können.
Die Produktion von größeren Enzym-Mengen soll es ermöglichen, Inhibitoren gegen die CST
zu finden.
73
3 Ergebnisse
3.1
MLD-Mausmodell: ASA- und ASA/ApoE–Knockout Mäuse
ASA-defiziente Mäuse, die als Mausmodell der MLD erzeugt worden sind (Hess et al. 1996)
zeigten eine Akkumulation von Sulfatid, ähnlich wie bei der menschlichen MLD.
Untersuchungen an Gehirnschnitten von ASA-defizienten Mäusen zeigten SulfatidAkkumulation in den Neuronen (Wittke et al. 2004). Allerdings ist es noch unklar, ob das
Sulfatid zu den Neuronen importiert wird oder ob die Neuronen es selbst synthetisieren. X.
Han (2002) zeigte, dass in ApoE-Knockout-Tieren im Cortex ein erhöhter Gehalt an Sulfatid
vorhanden war und schloss daraus, dass Apolipoprotein-E für den Transport von Sulfatid zu
den Neuronen zuständig ist. Um diese Hypothese zu untersuchen, wurde die DoppelKnockout-Maus ASA/ApoE erzeugt und analysiert. Damit sollte die Frage geklärt werden, ob
die ASA/ApoE-defizienten Mäuse eine verstärkte Sulfatid-Speicherung besitzen und ApoE
als Sulfatid-Transporter zu den Neuronen notwendig ist. Die ASA-Knockout-Mäuse dienten
als Kontrolle, um die in den Neuronen vorhandene Sulfatid-Akkumulation nachzuweisen und
um den Sulfatid-Gehalt vergleichen zu können.
3.1.1 Analyse der Lebensspanne der verschiedenen Knockout Genotypen
Im Rahmen dieser Arbeit wurden die folgenden vier Genotypen untersucht: ASA-Knockout,
ApoE-Knockout, ASA/ApoE-Knockout und Wildtyp (wt), auf C57BL/6-Hintergrund. Die
Doppel–Knockout-Mäuse ASA/ApoE wurden durch die Verpaarung der ASA-Knockout- mit
der ApoE-Knockout-Maus erzeugt.
Für die Erstellung einer Überlebenskurve (Abb.3.1) wurden keine Tiere berücksichtigt, die
bereits für andere Untersuchungen verwendet wurden. Die maximale Lebensdauer der
ASA/ApoE-Knockout-Mäuse (n = 29) und auch der ASA-Knockout-Mäuse (n = 30) war im
Vergleich zu den Wildtyp-Tieren (n = 29) verkürzt. In der Abbildung 3.1 ist zu erkennen, dass
die mittlere Lebensdauer bei allen vier Genotypen etwa gleich ist. Eine erhöhte Sterberate
wurde erst im Alter von ca. 1,5 Jahren bei den ASA- und ASA/ApoE-Knockout-Tiere
beobachtet. Bei den ASA/ApoE-Knockout-Mäusen wurde eine Reduzierung der Lebensdauer
im Vergleich zu den Wildtyp-Tieren festgestellt. Nur sehr wenige Knockout-Tiere erreichten
wie die Wildtyp-Tiere eine normale Lebensdauer von zwei Jahren und älter.
74
3 Ergebnisse
[Tage]
Abb. 3.1: Überlebenskurve der ASA/ApoE-Knockout-, ASA-Knockout- und Wildtyp-Mäuse (wt). Die
ASA- und ASA/ApoE-Knockout-Tiere wiesen eine geringere maximale Lebensdauer auf als die Wildtyp Mäuse.
Die mittlere Lebensdauer ist bei allen Tieren gleich. Es wurden beide Genera in die Kaplan-Meier
Überlebenskurve mit einbezogen. Wildtyp n= 29; ASA-KO n= 30; ASA/ApoE-KO n= 29.
3.1.2 Biochemische Analysen der ASA- und ASA/ApoE-Knockout-Mäuse: Analyse der
Sphingolipide im Cortex und im restlichen Gehirn
Aufgrund von Versuchen an ApoE-Knockout-Mäusen wurde ein Modell erstellt, nachdem der
Transport von Sulfatid von Astrozyten zu den Neuronen mit Hilfe des ApoE-Protein erfolgt
(Han et al. 2002, Cheng et al. 2008). Um zu überprüfen, ob die ApoE-Defizienz in
Kombination mit der ASA-Defizienz einen Effekt auf den Sulfatid-Gehalt in Neuronen
bewirkt, wurde die Sulfatid-Speicherung in den Tieren biochemisch durch Lipidanalyse und
histologisch mittels verschiedener Antikörper gegen Neuronen-spezifische Proteine
untersucht.
Für die Analyse wurden je Genotyp drei Tiere der Alterstufen 12 Monate und 18-24 Monate
verwendet, um eine quantitative Auswertung der vorhandenen Lipidmengen zu ermöglichen.
Für das Alter 18-24 Monate wurden die Genotypen Wildtyp, ASA-Knockout und ASA/ApoEKnockout verwendet. Für die Analysen wurden ApoE-Knockout-Mäuse im Alter von 12
Monate verwendet, da zum Zeitpunkt der Untersuchungen noch keine Tiere im Alter von 1824 Monaten vorhanden waren. Aus dem Cortex und dem restlichen Gehirn wurden die Lipide
isoliert und zunächst mittels Dünnschichtchromatographie aufgetrennt. In der Abbildung 3.2
sind die qualitativen Analysen der Sphingolipide sowie deren Quantifizierung dargestellt.
75
3 Ergebnisse
Abb. 3.2: Analyse und Quantifizierung der Lipide des Cortex und des Gesamtgehirns von 12 und 18-24
Monate alten Mäusen. Analysiert wurden die Lipide des Gehirns (mit Ausnahme des Cortex, der entfernt
worden war) (A, C, E) und die Lipide des Cortex (B, D, F). Die Lipide wurden auf eine HPTLC Kieselgel 60
Platte aufgetragen. Dargestellt ist ein repräsentatives Beispiel der Lipidzusammensetzung je Genotyp. Insgesamt
wurden je Genotyp n = 3 Tiere untersucht. Als Laufmittel diente Chloroform/Methanol/Wasser im Verhältnis
65:25:4. C-F zeigen die quantitative Auswertung der Lipide GalCer und Sulfatid des Gesamtgehirns im Alter
von 12 Monaten (C) und 18-24 Monaten (E), sowie des Cortex im Alter von 12 Monaten (D) und 18-24
Monaten (F) dargestellt. Ein Stern zeigt einen statistisch signifikanten Unterschied (t-Test, p < 0.05).
GalCer = Galaktosylceramid, PE = Phosphatidylethanolamin, PC = Phosphatidylcholin; SM = Sphingomyelin.
76
3 Ergebnisse
Die Analyse der Lipide mittels Dünnschichtchromatographie ließ Unterschiede im GalCerund im Sulfatid-Gehalt zwischen Wildtyp und den ASA-Knockout- und ASA/ApoEKnockout-Mäusen erkennen, aber keinen Unterschied zwischen Wildtyp- und ApoEKnockout- und zwischen ASA-Knockout- und ASA/ApoE-Knockout-Tieren. Bei den ASAKnockout-Mäusen ist sowohl im Cortex wie auch im restlichen Gehirn bereits nach 12
Monaten eine stärkere Sulfatid-Bande vorhanden, die nach 18-24 Monaten noch intensiver ist.
Die quantitative Auswertung der Dünnschichtchromatographie von jeweils drei Genotypen
zeigte im Cortex nach 12 Monaten (D) noch keinen signifikanten Unterschied. Im restlichen
Gehirn war aber ein Anstieg der Sulfatid-Menge in den ASA-Knockout und ASA/ApoEKnockout Tieren festzustellen (C). Bei den älteren Tieren von 18-24 Monaten ergab die
Quantifizierung einen signifikanten Unterschied in der Sulfatid-Menge zwischen Wildtyp und
ASA-Knockout und ASA/ApoE-Knockout. Dieser Anstieg an Sulfatid war in der Analyse
jeweils für beide Bereiche, Cortex und restliches Gehirn, statistisch signifikant. Die
Quantifizierung von Galaktosylceramid (GalCer) ergab keinen signifikanten Unterschied im
Alter von 12 Monaten. Jedoch konnte im restlichen Gehirn eine Reduktion an GalCer im
Alter von 18-24 Monaten festgestellt werden.
Um eine genauere Analyse der molekularen Sulfatid-Spezies im Gehirn zu erhalten, wurden
in
dieser
Arbeit
die
Sphingolipide
mit
Hilfe
einer
Elektrospray-Ionenfallen-
Massenspektrometrie (ESI-MS) untersucht. Diese Technik basiert auf der Desolvatisierung,
d.h. auf dem Transfer von Ionen aus der Lösung in die Gasphase, was einen endergonischen
Prozess darstellt. Im elektrischen Feld werden die Ionen bei Atmosphärendruck in die
Gasphase transferiert. Die Moleküle bleiben intakt und ihre Molekülmasse kann im
angeschlossenen Massenspektrometer bestimmt werden.
In Neuronen und Astrozyten wurde hauptsächlich kurzkettiges Sulfatid (C18:0) gefunden
(Berntson et al., 1998; Issac et al., 2006), wohingegen langkettiges C24:1-Sulfatid im Myelin
vorhanden ist (Vos et al., 1994). Eine genaue Bestimmung der Sulfatid-Spezies kann, wenn
zum Beispiel ein erhöhter C18:0-Sulfatid-Gehalt vorliegt, erste Anzeichen auf eine mögliche
Sulfatid-Anreicherung in Neuronen ergeben.
In den folgenden Abbildungen sind exemplarisch die Massenspektren der mittels ESI-MS
gemessenen deprotonierten Sphingolipide des Cortex (Abb.3.3) und des restlichen Gehirns
(Abb.3.4) von ASA-Knockout- und ASA/ApoE-Knockout-Mäusen, sowie Wildtyp- und
ApoE-Knockout-Mäusen dargestellt. Für diese Analyse wurden die Gesamtlipide verwendet,
die bereits mit Hilfe der Dünnschichtchromatographie analysiert worden waren.
Eine Ionen-Abtastung wurde im negativen Modus durchgeführt, um altersbedingte
Veränderungen in der molekularen Spezies von Sulfatid im Cortex und im restlichen Gehirn
77
3 Ergebnisse
von Wildtyp-, ApoE-Knockout-, ASA-Knockout- und ASA/ApoE-Knockout-Mäusen zu
charakterisieren. Repräsentative Massenspektren von den jeweiligen Genotypen im Alter von
12 Monaten und 18-24 Monaten sind für den Cortex in Abbildung 3.3 A-D und für das
restliche Gehirn in Abbildung 3.4 A-D dargestellt. Die ASA-Knockout- und die ASA/ApoEKnockout-Mäuse zeigten bereits (Abb. 3.3) nach 12 Monaten im Cortex einen erhöhten
kurzkettigen Fettsäure C18:0 Sulfatid-Derivat-Wert (Abb. 3.3 A, C), der auch bei den älteren
(18-24 Monate) Tieren, zu finden war (Abb. 3.3 B, D). Im Vergleich zu den Wildtyp- und den
ApoE-Knockout-Mäusen ist eine deutliche Signifikanz sichtbar (Abb. 3.3 C, D). Ein erhöhter
Peak bei 806.7 m/z, der charakteristisch für C18:0 Sulfatid ist, ist in den Spektren (Abb. 3.3
A, B) klar erkennbar. Des Weiteren ist ein altersabhängiger Anstieg an langkettiger Fettsäure
C24:1-Sulfatid bei beiden Knockout-Mausstämmen im Alter von 18-24 Monaten festzustellen
(3.3-D). Ähnliche Ergebnisse sind auch im restlichen Gehirn bei den ASA-Knockout- und den
ASA/ApoE-Knockout-Mäusen zu beobachten (Abb. 3.4 A-D). Zwar war im Alter von 12
Monaten noch kein wesentlicher Unterschied festzustellen (Abb. 3.4 A, C), allerdings ändert
sich das bei den älteren Mäusen. Hier ist ein signifikanter Unterschied von Wildtyp- zu den
ASA- und ASA/ApoE-Knockout-Mäusen zu sehen. Sowohl die kurz- als auch die
langkettigen Sulfatid-Spezies C18:0 und C24:1 sind deutlich erhöht, wie anhand der
statistischen Auswertung gezeigt ist (Abb. 3.4 D).
78
3 Ergebnisse
Abb. 3.3: Massenspektren und quantitative Auswertung der aus dem Cortex isolierten Lipide.
Gesamtlipide, die aus dem Cortex 12 und 18-24 Monate alter Mäuse isoliert wurden, wurden mittels einer ESIIonenfalle im negativen Ionenmodus auf ihre Sulfatid-Masse hin untersucht. Dargestellt sind die Masse-zuLadung-Verhältnisse (m/z). Jeweils eine repräsentative Analyse von insgesamt drei unterschiedlichen Tieren pro
Genotyp (n = 3) ist in A (12 Monate) und B (18-24 Monate) dargestellt. Die Zahlen zeigen die Massenpeaks der
deprotonierten Sulfatide (M-H-) entsprechend ihrer Fettsäurekette an. Der Peak 722.7 m/z entspricht dem
Sulfatid-Derivat C12:0, der als interner Standard (IS) eingesetzt wurde. Der Peak 806.7 m/z entspricht einem
Sulfatid mit einem C18:0-Fettsäurerest. Der Sulfatid-Derivat Peak 888.7 m/z entspricht einem C24:1Fettsäurerest. Die Pfeile kennzeichnen zum einen den IS- und zum anderen den C18:0-Peak, der im Vergleich
zum Wildtyp erhöht ist. C-D stellt die quantitative Auswertung des C18:0- und C24:1-kettigen Sulfatid-Gehalts
des Cortex im Alter von 12 Monaten (C) und 18-24 Monaten (D) dar. Ein Stern zeigt einen statistisch
signifikanten Unterschied (T-Test, p< 0.05).
79
3 Ergebnisse
12 Monate
18-24 Monate
Abb. 3.4: Massenspektren und quantitative Auswertung der aus dem Gesamtgehirn isolierten Lipide.
Lipide, die aus dem Gehirn ohne Cortex 12 und 18-24 Monate alter Mäuse isoliert wurden, wurden mittels einer
ESI-Ionenfalle im negativen Ionenmodus auf ihre Sulfatid-Masse hin untersucht. Dargestellt sind die Masse-zuLadung-Verhältnisse (m/z). Jeweils eine repräsentative Analyse von insgesamt drei unterschiedlichen Tieren pro
Genotyp (n = 3) ist in A (12 Monate) und B (18-24 Monate) dargestellt. Die Zahlen zeigen die Massenpeaks der
deprotonierten Sulfatide (M-H-) entsprechend ihrer Fettsäurekette an. Der Peak 722.7 entspricht dem SulfatidDerivat C12:0, der als interner Standard (IS) eingesetzt wurde. Der Peak 806.7 m/z entspricht einem Sulfatid mit
eineem C18:0-Fettsäurerest. Der Sulfatid-Derivat Peak 888.7 m/z entspricht einem C24:1-Fettsäurerest. C-D
stellt die quantitative Auswertung des C18:0- und C24:1-kettigen Sulfatid-Gehalts des Cortex im Alter von 12
Monaten (C) und 18-24 Monaten (D) dar. Ein Stern zeigt einen statistisch signifikanten Unterschied (T-Test,
p< 0.05).
80
3 Ergebnisse
3.1.3 Histochemische und Immunfluoreszenz-Analysen der ASA- und ASA/ApoEKnockout-Mäuse:
Bei den biochemischen Untersuchungen der Lipide zur Aufklärung der Sulfatidspezies fielen
Unterschiede in der Fettsäurekettenlänge und der Menge an Sulfatid zwischen ASA-,
ASA/ApoE-Knockout- und Wildtyp- bzw. ApoE-Knockout-Mäusen auf. Ein erhöhter Wert
von kurzkettigem C18:0-Sulfatid wurde in den ASA- und ASA/ApoE-Knockout-Tieren
gemessen. C18:0-Sulfatid ist hauptsächlich in Neuronen zu finden. Im Folgenden wurde
versucht, diese Anreicherung von C18:0-Sulfatid in Neuronen histologisch nachzuweisen.
3.1.3.1 Untersuchung der Sulfatid-Akkumulation in Neuronen im Kleinhirn, Cortex und im
Stammhirn
Mit Hilfe des Farbstoffes Alcianblau lässt sich beispielsweise an Gehirnschnitten von Mäusen
Sulfatid-Akkumulation nachweisen. In den ASA- und in ASA/ApoE-Knockout-Mäusen
könnte so histologisch die Akkumulation von Sulfatid in Oligodendrozyten und auch in
Neuronen gezeigt werden (Wittke et al., 2004).
Um die genaue, zelluläre Lokalisation von Sulfatid speziell in den Neuronen zu untersuchen,
wurde eine Alcianblaufärbung zusammen mit einem neuronalen Marker, HRP-3 (Hepatoma
derived growth factor related protein-3) und NeuN (neuronal nuclei) durchgeführt. Es sollte
vor allem geklärt werden, ob die ApoE-Defizienz in den Doppel-Knockout-Tieren einen
Einfluss auf neuronale Sulfatid-Speicherung hat. Da bereits gezeigt worden war, dass eine
verstärkte Sulfatid-Akkumulation in den Bereichen des Cortex, Kleinhirns und Stammhirns zu
erkennen ist, konzentrierten sich die Analysen auf diese Bereiche. Für die Analyse wurden
Tiere im Alter von 12 und 18-24 Monaten untersucht. Für die Alcianblaufärbung und die im
Anschluss folgende immunhistochemische Färbung mit den neuronalen Markern HRP-3 bzw.
NeuN wurden 12-14 µm dicke Kryoschnitte des Gehirns verwendet. HRP-3 wird im
Nervensystem stark exprimiert und ist in den meisten Neuronen im Nucleus lokalisiert (ElTahir et al., 2009). Um die Gesamtheit der Neuronen zu markieren, wurde mit NeuN eine
weitere Analyse durchgeführt. Es wurden jeweils Schnitte des gleichen Bereiches verwendet,
um die gezeigten Regionen vergleichen zu können. Als negative Kontrollgewebe wurden
hierbei Gehirnschnitte von Wildtyp- und ApoE-Knockout-Tieren verwendet, da diese keine
Sulfatid-Akkumulation zeigen. In den Abbildungen 3.6-3.11 sind beispielhaft die Ergebnisse
der unterschiedlichen Färbungen, Alcianblau in Kombination mit HRP-3 (Abb. 3.5-3.7) und
Alcianblau mit NeuN (Abb. 3.8-3.10) jeweils für die Gehirnbereiche Kleinhirn, Cortex und
81
3 Ergebnisse
Stammhirn gezeigt. Das HRP-3- bzw. NeuN-Signal ist braun gefärbt, die SulfatidSpeicherung blau.
Schon im Alter von einem Jahr war in den verschiedenen Gehirn-Bereichen, wie Medulla,
Cortex sowie in den Nuclei des Vorder- und Mittelhirn eine Sulfatid-Speicherung zu finden,
wobei jedoch nach 18-24 Monaten in der weißen wie auch in der grauen Substanz eine
intensivere Alcianblaufärbung zu sehen war.
Es konnte bei keinem untersuchten Alter im Kleinhirn eine spezifische Sulfatidfärbung in den
Neuronen oder in den Purkinje-Zellen nachgewiesen werden (Abb. 3.5, 3.6). Im Cortex
konnte jedoch schon bei einjährigen ASA-Knockout-Mäusen und auch bei den DoppelKnockout-Tieren eine schwache Anreicherung von Sulfatid in Neuronen beobachtet werden.
Im Alter von zwei Jahren wurde im Cortex eine verstärkte Anfärbung von Sulfatid in den
Neuronen gefunden (Abb. 3.6, 3.9). Ebenso trat eine zunehmende Speicherung an Sulfatid im
Stammhirn auf. In den Neuronen war in der Medulla oblongata im Bereich des preposilus
nucleus und dorsal paragigantocellular nucleus vor allem bei den älteren Tieren von zwei
Jahren eine vermehrte Co-Färbung von Alcianblau und HRP-3 bzw. NeuN präsent (Abb. 3.7,
3.10). Bei den jüngeren Tieren war nur eine leichte Sulfatid-Akkumulation nachweisbar (Abb.
3.7, 3.10). Die Daten zeigen deutlich, dass in den Neuronen von ASA-Knockout-Mäusen wie
auch ASA/ApoE-Knockout-Tieren Sulfatid gespeichert wurde. Neben den Alcianblaupositiven Neuronen sind weitere Zellen mit Alcianblau gefärbt, diese wurden bereits in
früheren Studien als Oligodendrozyten und Phagozyten identifiziert (Wittke et al., 2004).
82
3 Ergebnisse
Abb. 3.5: Alcianblaufärbung in Kombination mit dem neuronalen Marker HRP-3 im Kleinhirn.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp- (wt), ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO), die doppelt gefärbt wurden mit Alcianblau (blau) und HRP-3 (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Es handelt sich immer um dieselbe Region in drei
verschiedenen
Vergrößerungen.
HRP-3
(1:100)
wurde
mittels
Peroxidase
sichtbar
gemacht.
Maßstabsbalken: 50 µm.
83
3 Ergebnisse
Abb. 3.6: Alcianblaufärbung in Kombination mit dem neuronalen Marker HRP-3 im Cortex.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp- (wt) , ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO) die doppelt gefärbt wurden mit Alcianblau (blau) und HRP-3 (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Es handelt sich immer um dieselbe Region in drei
verschiedenen Vergrößerungen. HRP-3 (1:100) wurde mittels Peroxidase sichtbar gemacht. Maßstabsbalken:
50 µm. Die Pfeile markieren Neuronen mit akkumulierten Sulfatid.
84
3 Ergebnisse
Abb. 3.7: Alcianblaufärbung in Kombination mit dem neuronalen Marker HRP-3 im Stammhirn.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp-(wt), ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO), die doppelt gefärbt wurden mit Alcianblau (blau) und HRP-3 (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Der Ausschnitt des gewählten Abbildungsbereiches zeigt die
Gehirn-Sektion der Medulla oblongata. Es handelt sich immer um dieselbe Region in drei verschiedenen
Vergrößerungen. HRP-3 (1:100) wurde mittels Peroxidase sichtbar gemacht. Maßstabsbalken: 50 µm.
85
3 Ergebnisse
Abb. 3.8: Alcianblaufärbung in Kombination mit dem neuronalen Marker NeuN im Kleinhirn.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp-(wt), ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO), die doppelt gefärbt wurden mit Alcianblau (blau) und NeuN (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Der Ausschnitt des gewählten Abbildungsbereiches zeigt die
Gehirn-Sektion des Kleinhirns. Es handelt sich immer um dieselbe Region in drei verschiedenen
Vergrößerungen. Neu-N (1:500) wurde mittels Peroxidase sichtbar gemacht. Maßstabsbalken: 50 µm.
86
3 Ergebnisse
Abb. 3.9: Alcianblaufärbung in Kombination mit dem neuronalen Marker NeuN im Cortex.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp-(wt), ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO), die doppelt gefärbt wurden mit Alcianblau (blau) und NeuN (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Der Ausschnitt des gewählten Abbildungsbereiches zeigt die
Gehirn-Sektion des Cortex. Es handelt sich immer um dieselbe Region in drei verschiedenen Vergrößerungen.
Neu-N (1:500) wurde mittels Peroxidase sichtbar gemacht Maßstabsbalken: 50 µm. Pfeile zeigen auf Neuronen
mit angereicherten Sulfatid.
87
3 Ergebnisse
Abb. 3.10: Alcianblaufärbung in Kombination mit dem neuronalen Marker NeuN im Stammhirn.
Dargestellt sind 12-14 µm dicke Gehirnschnitte von Wildtyp-(wt), ASA-Knockout- (KO) und ASA/ApoEKnockout-Mäusen (dKO), die doppelt gefärbt wurden mit Alcianblau (blau) und NeuN (braun), das als
neuronaler Marker (braun) eingesetzt worden ist. Der Ausschnitt des gewählten Abbildungs-Bereiches zeigt die
Gehirn-Sektion der Medulla oblongata. Es handelt sich immer um dieselbe Region in drei verschiedenen
Vergrößerungen. Neu-N (1:500) wurde mittels Peroxidase sichtbar gemacht Maßstabsbalken: 50 µm. Pfeile
zeigen auf Neuronen mit angereicherten Sulfatid.
88
3 Ergebnisse
3.1.3.2 Immunfluoreszenz Analyse der Sulfatid-Akkumulation in Neuronen im Cortex und im
Stammhirn
Mit der Immunfärbung sollte mit Hilfe des spezifischen Sulfatid-Antikörpers SulphI
(Fredman, 1988) untersucht werden, ob die Neuronen bei den ASA-Knockout- und
ASA/ApoE-Knockout-Mäusen Sulfatid-Speicherung aufweisen. Wie bereits in der CoFärbung von Alcianblau und den neuronalen Markern HRP-3 und NeuN zu sehen ist,
speichern die Neuronen teilweise Sulfatid. Ein Vergleich der Ergebnisse dieser zwei
Nachweismethoden sollte eine verlässliche Aussage über die Lokalisation der SulfatidSpeicherung im Gehirn zulassen. Eine spezifische Markierung von neuronalen Zellen wurde
durch die Auswahl verschiedener Marker gewährleistet. Für die Co-Färbung mit dem
Antikörper SulphI wurden die neuronalen Marker HRP-3, NSE (Neuronen spezifische
Enolase) und ß-III-Tubulin ausgewählt. Für die folgende Analyse wurden Kryoschnitte des
Gehirns von 12 und 18-24 Monate alten Mäusen mit Immunfluoreszenz-markierten
Antikörpern gefärbt. Je Alter und Genotyp wurden dafür jeweils Schnitte von mindestens drei
Tieren untersucht.
Sowohl bei den ASA- wie auch bei den ASA/ApoE-Knockout-Mäusen wurden in den HRP-3
positiven Neuronen im Vergleich zu den Wildtyp- und den ApoE-Knockout-Mäusen eine
verstärkte Sulfatid-Anreicherung gefunden (Abb. 3.11). Die Sulfatid-Anreicherung wurde mit
dem SulphI-Antikörper (rot) nachgewiesen, während eine Co-Färbung mit dem neuronalen
Marker HRP-3 (Abb. 3.11) bzw. NSE (Abb. 3.13, 3.15) und ß-III-Tubulin (Abb. 3.12, 3.14)
mit einem grün fluoreszierenden Zweitantikörper markiert wurde. In den Bereichen des
Cortex und der Medulla oblangata konnte bereits im Alter von einem Jahr eine beginnende
Sulfatid-Akkumulation in den Neuronen beobachtet werden. Mit zunehmendem Alter
verstärkt sich diese Akkumulation.
Im oberen Teil der Abbildung 3.11 A sind die Aufnahmen von einjährigen Tieren gezeigt.
Sulfatid und HRP-3 sind bei den ASA-Knockout-Mäusen und bei den ASA/ApoE-KnockoutMäusen nicht co-lokalisiert. Die Abbildung 3.11 B. zeigt HRP-3 positive Zellen mit
zytoplasmatischem Sulfatid. Diese Beobachtungen sind auch bei den anderen beiden
neuronalen Markern zu finden. So ist eine deutliche Co-Lokalisation von SulphI und ß-IIITubulin und SulphI und NSE bei den Mäusen im Alter von 18-24 Monaten in den
Abbildungen 3.12 B und 3.13 B vorhanden.
89
3 Ergebnisse
Abb. 3.11: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem neuronalen Marker
HRP-3. Co-Färbung von 12-14 µm dicke Kryoschnitten mit SulphI (rot; 1:500) und HRP-3 (grün, 1:100). Die
Überlagerung der einzelnen Bilder mit zusätzlicher DAPI-Kernfärbung (1:500) ist auf der rechten Seite der
Abbildung dargestellt. A zeigt Färbungen von Gehirnschnitten von einem Jahr alten Tieren und in B ist die
Färbung an Gehirnschnitten von 18-24 Monaten alten Mäusen dargestellt. Repräsentativ ist je ein Schnitt für
jeden Genotyp abgebildet. Maßstabsbalken: 10 µm; von Wildtyp-(wt), ASA- (KO) und ASA/ApoE-KnockoutMäuse (dKO).
90
3 Ergebnisse
Abb. 3.12: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem neuronalen Marker ßIII-Tubulin. Co-Färbung von 12-14 µm dicken Kryoschnitten mit SulphI (rot, 1:500) und ß-III-Tubulin (grün,
1:500). Die Überlagerung der einzelnen Bilder mit zusätzlicher DAPI-Kernfärbung (1:500) ist auf der linken
Seite der Abbildung dargestellt. A zeigt Färbungen von Gehirnschnitten von einem Jahr alten Tieren und in B ist
die Färbung an Gehirnschnitten von 18-24 Monate alten Mäusen dargestellt. Repräsentativ ist je ein Schnitt für
jeden Genotyp abgebildet. Maßstabsbalken: 10 µm; Wildtyp- (wt), ASA-Knockout- (ASA-KO) und ASA/ApoEKnockout-Mäuse (ASA/ApoE KO).
91
3 Ergebnisse
Abb. 3.13: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem neuronalen Marker
NSE. Co-Färbung von 12-14 µm dicken Kryoschnitten mit SulphI (rot, 1:500) und NSE (grün, 1:100). Die
Überlagerung der einzelnen Bilder mit zusätzlicher DAPI-Kernfärbung (1:500) ist auf der rechten Seite der
Abbildung dargestellt. A zeigt Färbungen von Gehirnschnitten von einem Jahr alten Tieren und in B ist die
Färbung an Gehirnschnitten von 18-24 Monate alten Mäusen dargestellt. Repräsentativ ist je ein Schnitt für
jeden Genotyp abgebildet. Maßstabsbalken: 10 µm. Wildtyp- (wt), ASA-Knockout- (ASA-KO) und ASA/ApoEKnockout-Mäuse (ASA/ApoE KO).
92
3 Ergebnisse
Besonders im Bereich der Mendulla oblangata waren viele mit Sulfatid angereicherte
Neuronen zu finden. Diese Ergebnisse sind in den Abbildungen 3.14 im Vergleich zu ß-IIITubulin und in 3.15 zu NSE dargestellt. Auch hier zeigte sich zunächst nur eine partielle
Sulfatid-Anreicherung in Neuronen bei den einjährigen Mäusen, die sich aber mit
zunehmendem Alter wesentlich verstärkte. Eine klar erkennbare Co-Lokalisation von SulphI
mit dem jeweiligen neuronalen Marker, ß-III-Tubulin und NSE war zu beobachten (Abb. 3.14
B, 3.15 B).
Diese Immunfluoreszens-Aufnahmen zeigen deutlich, dass bei den ASA-Knockout- und den
ASA/ApoE-Knockout-Mäusen eine Sulfatid-Speicherung in den Neuronen vorhanden ist, und
dass die ApoE-Defizienz keinen merklichen Effekt auf die Sulfatid-Akkumulation hat.
93
3 Ergebnisse
Abb. 3.14: Immunfluoreszenz-Analyse von Gewebeschnitten der Medulla oblangata mit dem neuronalen
Marker ß-III-Tubulin. Co-Färbung von 12-14µm dicken Kryoschnitten mit SulphI (rot, 1:500) und ß-IIITubulin (grün, 1:500). Die Überlagerung der einzelnen Bilder mit zusätzlicher DAPI-Kernfärbung (1:500) ist auf
der linken Seite der Abbildung dargestellt. A zeigt Färbungen von Gehirnschnitten von einem Jahr alten Tieren
und in B ist die Färbung an Gehirnschnitten von 18-24 Monate alten Mäusen dargestellt. Repräsentativ ist je ein
Schnitt für jeden Genotyp abgebildet. Maßstabsbalken: 10 µm. Wildtyp- (wt), ASA-Knockout- (ASA-KO) und
ASA/ApoE-Knockout-Mäuse (ASA/ApoE KO).
94
3 Ergebnisse
Abb. 3.15: Immunfluoreszenz-Analyse von Gewebeschnitten der Mendulla oblangata mit dem neuronalen
Marker NSE. Co-Färbung von 12-14µm dicken Kryoschnitten mit SulphI (rot, 1:500) und NSE (grün, 1:100).
Die Überlagerung der einzelnen Bilder mit zusätzlicher DAPI-Kernfärbung (1:500) ist auf der linken Seite der
Abbildung dargestellt. A zeigt Färbungen von Gehirnschnitten von einem Jahr alten Tieren und in B ist die
Färbung an Gehirnschnitten von 18-24 Monate alten Mäusen dargestellt. Repräsentativ ist je ein Schnitt für
jeden Genotyp abgebildet. Maßstabsbalken: 10 µm. Wildtyp- (wt), ASA-Knockout- (ASA-KO) und ASA/ApoEKnockout-Mäuse (ASA/ApoE KO).
95
3 Ergebnisse
3.2.4 Lipidanalyse und Vergleich der beiden ASA-Knockout-Stämme C57BL/6 und
129/Ola
Zur Untersuchung der MLD wurde ein Mausmodell erzeugt, in dem eine ASA-Defizienz
vorhanden ist. Hierbei wurden verschiedene Mausstämme, die unterschiedliche Hintergründe
haben, verwendet. In dieser Arbeit wurden die beiden ASA-Knockout Stämme mit dem
Hintergrund C57BL/6 und 129/Ola untersucht. Es sollte untersucht werden, ob der genetische
Hintergrund einen Effekt auf das Ausmaß der Sulfatid-Speicherung hat. Dazu wurden die
Lipide des Gehirns und der Niere von einem Jahr und zwei Jahre alten Tieren analysiert. Für
die Untersuchung der Lipide wurden je Altersstufe und Hintergrund drei verschiedene Tiere
herangezogen.
In den Abbildungen 3.16 A-D sind die Ergebnisse für das Gehirn und in 3.17 A-D die
Ergebnisse für die Niere dargestellt. Im Gehirn zeigte sich bereits nach dem ersten Lebensjahr
ein erhöhter Sulfatid-Gehalt in den C57BL/6- und 129/Ola Knockout-Mäusen. Bei den ASAKnockout-Mäusen mit C57BL/6- und 129/Ola-Hintergrund war schon im Alter von einem
Jahr ein signifikanter Anstieg festzustellen (Abb. 3.16 A-B). Im Alter von zwei Jahren war bei
beiden ASA-Knockout-Stämmen ein signifikanter Unterschied im Vergleich zu den WildtypMäusen im Sulfatidgehalt zu beobachten. Deutlich ist eine verstärkte Sulfatid-Bande in der
TLC (Abb. 3.16 B) bei den ASA-Knockout-Tieren zu sehen. Allerdings liegt zwischen den
beiden ASA-Knockout Stämmen kein signifikanter Unterschied vor. Der unterschiedliche
Hintergrund hat keinen Einfluss auf die Sulfatid-Menge.
Im Falle der Niere zeigte sich ein ähnliches Bild. Allerdings war zuerst im Alter von einem
Jahr nur bei den C57BL/6 ASA-Knockout-Mäusen eine gesteigerte Sulfatid-Menge zu finden.
Dies zeigte sich auch in den TLC-Analysen. Die Sulfatid-Banden sind wesentlich stärker bei
den Knockout-Tieren als bei den Wildtyp-Tieren (3.17-B). Die Quantifizierung zeigte, dass
bei beiden ASA-Stämmen ein signifikant erhöhter Anstieg an Sulfatid erst nach zwei Jahren
festzustellen (Abb. 3.16 D) war.
Eine Anreicherung an Sulfatid zeigte sich bei den C57BL/6 – und bei den 129/Ola-Tieren
schon im Alter von einem Jahr. Allerdings konnte zwischen den beiden Stämmen auch in der
Niere kein signifikanter Unterschied festgestellt werden, so dass auch hier der genetische
Hintergrund keinen Einfluss auf den Sulfatid-Gehalt hat.
96
3 Ergebnisse
Abb. 3.16: Analyse und Quantifizierung der Lipide des Gehirns von 12 und 20 Monate alten C57BL/6 und
129/Ola Mäusen. Die Lipide wurden auf eine HPTLC Kieselgel 60 Platte aufgetragen und stellen je Genotyp
ein repräsentatives Beispiel der Lipidzusammensetzung dar. Insgesamt wurden je Genotyp n = 3 Tiere
untersucht. Als Laufmittel diente Chloroform/Methanol/Wasser im Verhältnis 65:25:4. C-D stellen die
Quantifizierung der Sulfatid- und Sphingomyelin-Menge (normiert auf Cholesterol) der Gesamtlipide des
Gehirns im Alter von einem Jahr (C) und 20 Monaten (D) dar. Ein Stern zeigt einen statistisch signifikanten
Unterschied
(t-Test,
p<0.05).
GalCer = Galaktosylceramid,
PE = Phosphatidylethanolamin,
PC
=
Phosphatidylcholin; SM = Sphingomyelin.
97
3 Ergebnisse
Abb. 3.17: Analyse und Quantifizierung der Lipide der Niere von 12 und 20 Monate alten C57BL/6 und
129/Ola. Die Lipide wurden auf eine HPTLC Kieselgel 60 Platte aufgetragen und stellen je Genotyp ein
repräsentatives Beispiel der Lipidzusammensetzung dar. Insgesamt wurden je Genotyp n = 3 Tiere untersucht.
Als Laufmittel diente Chloroform/Methanol/Wasser im Verhältnis 65:25:4. C-D stellen die Quantifizierung der
Sulfatid- und Sphingomyelin-Menge (normiert auf Cholesterol) der Gesamtlipide der Niere im Alter von einem
Jahr (C) und 20 Monaten (D) dar. Ein Stern zeigt einen statistisch signifikanten Unterschied (t-Test, p< 0.05).
GalCer = Galaktosylceramid, PE = Phosphatidylethanolamin, PC = Phosphatidylcholin; SM = Sphingomyelin.
98
3 Ergebnisse
3.1.5 Zusammenfassung der Daten zu den biochemischen und immunhistochemischen
Untersuchungen an MLD-Mausmodellen
Anhand der Untersuchungen auf biochemischer und immunhistochemischer Ebene war
festzustellen, dass die ASA/ApoE-Knockout-Mäuse eine verkürzte Lebensdauer im Vergleich
zu den Wildtyp-Mäusen haben.
Mit Hilfe der ESI-MS-Analysen konnte ein erhöhter Gehalt an C18:0-Sulfatid im Cortex und
im Gesamtgehirn bei den ASA-Knockout- und den ASA/ApoE-Knockout-Mäusen
nachgewiesen werden.
In den Neuronen des Cortex und der Medulla oblangata war in den Mäusen im Alter von zwei
Jahren eine erhöhte Sulfatid-Anreicherung zu finden. Dies wurde mit Hilfe von AlcianblauFärbung in Kombination mit einem neuronalen Marker nachgewiesen. Zusätzlich wurde dies
mit Hilfe einer Immunfluoreszenz-Untersuchung bestätigt.
Der Vergleich von C57BL/6- und 129/Ola-ASA-Knockout-Mausstämmen ergab, dass die
Tiere mit C57BL/6 und 129/Ola genetischen Hintergrund bereits nach einem Jahr einen
erhöhten Sulfatid-Gehalt besitzen. Beide Knockout-Stämme zeigten ebenfalls im Alter von
zwei Jahren einen signifikant erhöhten Sulfatid-Gehalt. Zwischen den beiden genetischen
Hintergründen ist kein signifikanter Unterschied festzustellen.
99
3 Ergebnisse
3.2
Transgene Thy-1-CGT-Mäuse: Analyse der letalen audiogenen
Anfälle bei transgenen Mäusen, die einen erhöhten Sulfatid-Gehalt in
Neuronen aufweisen
Dieser Abschnitt beinhaltet die Analyse eines transgenen Mausmodells, den Thy1-CGT. Ein
wichtiges Enzym des Sulfatid-Anabolismus ist das Protein Ceramidgalaktosyltransferase
(CGT), welches im Endoplasmatischen Retikulum lokalisiert ist. Die Überexpression von
CGT in den Neuronen (mittels des Promotors Thy-1) in den transgenen CGT/ASAdefizienten-Mäusen
resultiert
in
einer
selektiven
Erhöhung
des
Sulfatid-Gehalts
(Eckhardt, 2008). Das Auftreten von Sulfatid in Neuronen in ASA-Knockout-Mäusen konnte
bereits durch spezifische Antikörper nachgewiesen werden. Des Weiteren zeigte sich, dass die
transgenen CGT-Mäuse sehr empfindlich gegenüber audiogenen Reizen sind. Nach einem
relativ geringen Geräusch-Stimulus (Schlüsselklirren) zeigten sie letale audiogene Anfälle.
Ob neuronales Sulfatid eine Rolle hierbei spielt, ist noch nicht geklärt.
3.2.1 Nachweis der CGT-Expression im Gehirn von Thy-1-CGT-Mäusen
In frühen Studien wurden ASA-defiziente Thy-1-CGT-Mäuse mit einem gemischten
Hintergrund C57BL/6/129Ola analysiert (Eckhardt et al., 2007). In den folgenden
Untersuchungen wurde sich hauptsächlich auf die Mäuse mit einem reinen Hintergrund
C57BL/6 konzentriert. Hierzu wurden zwei unabhängige transgene Mauslinien, 4747 und
4743, analysiert. Für die folgenden Analysen wurden Kryoschnitte der Gehirne von 120 Tage
alten Mäusen einer in situ-Hybridisierung mit der CGT-RNA-Sonde unterzogen.
Die Auswertung ergab, dass die Expression des CGT-Transgens in den verschiedenen GehirnBereichen der Thy-1-CGT-Mäuse zu finden war. Die In situ-Hybridisierung zeigte durchweg
die transgene Expression im Vorderhirn, im Stammhirn und im Rückenmark. Des Weiteren
konnte auch im Hippocampus, im Cortex und im Colliculus inferior (CI) eine transgene
Expression nachgewiesen werden (Abb. 3.18 B). Die transgene Linie 4743 zeigte insgesamt
eine stärkere CGT-Expression als die Linie 4747.
100
3 Ergebnisse
Abb. 3.18: In situ-Hybridisierung von Thy-1-CGT-Mäusen. In A ist die Struktur des CGT-TransgenKonstrukt dargestellt, das zur Generierung der transgenen CGT-Mäuse genutzt worden ist (Eckhardt et al.,
2007). In B sind die Ergebnisse der in situ-Hybridisierung der Gehirne von 120 Tagen alten Thy-1-CGT-Mäusen
von der Linie 4747 und 4743 sowie von Wildtyp-Tieren (wt) mit der CGT-RNA-Sonde beispielhaft dargestellt.
Neben dem jeweiligen sagitalen Kryogehirnschnitt ist eine Großaufnahme des Colliculus inferior (CI) zu sehen.
Die Pfeile markieren den Colliculus inferior. CGTan = CGT RNA antisense-Sonde.
101
3 Ergebnisse
3.2.2 Analyse der Überlebensdauer und der audiogenen Anfälle der Thy-1-CGTMäuse
Bei den transgenen Mäusen war unabhängig vom genetischen Hintergrund eine verkürzte
Lebensspanne zu beobachten. Des Weiteren wurden Anfälle festgestellt, die sich in
unkontrolliertem Springen und Laufen sowie in Muskelkrämpfen äußerten. Ausgelöst wurden
diese Anfälle durch audiogene Reize. Um eine quantitative Aussage zu den audiogenen
Anfällen machen zu können, wurden die Tiere einer milden akustischen Stimulation
ausgesetzt, genauer gesagt einem Schlüsselklirren, wie bei Kawai et al., 2001 beschrieben.
Diese Beobachtungen sind in der Abbildung 3.19 statistisch ausgewertet. Für die Erstellung
der Überlebenskurve wurden alle Tiere aus Würfen der beiden Linien verwendet, die nicht für
andere Zwecke gebraucht worden sind. Die Überlebenskurve wurde nach dem Kaplan-MeierVerfahren erstellt. Das Kaplan-Meier-Verfahren dient der Schätzung der ÜberlebensWahrscheinlichkeit in einem bestimmten Zeitintervall. Um eine quantitative Aussage über die
Reaktion auf eine akustische Stimulation machen zu können, wurden die Tiere dem
akustischen Stimulus Schlüsselklirren (ca. 90-100 dB) für 5-10 Sekunden ausgesetzt. Hierfür
wurden Tiere von jedem Genotyp im Alter von drei, sieben und elf Wochen untersucht. Der
Prozentsatz der Tiere, die auf den Stimulus mit unkontrolliertem wilden Hin- und Herlaufen
(weiße Balken) reagierten, bzw. nach einem tonisch-klonischen Krampfanfall (schwarze
Balken) verstarben, ist in Abbildung 3.19 dargestellt.
102
3 Ergebnisse
Abb. 3.19: Überlebenskurve und letale audiogene Anfälle von transgenen Thy-1-CGT-Mäusen. In A ist die
Kaplan-Meier-Überlebenskurve der beiden transgenen Linien tg 4747 und tg 4743 sowie der Wildtyp-Tiere
dargestellt. Es wurden beide Geschlechter in die Berechnung mit einbezogen und bei den Wildtypen beide
Linien zusammengefasst. In B ist in Prozent die Reaktion auf die akustische Stimulation (Schlüsselklirren; 90100 dB), das wildes Hin- und Herlaufen (weiße Balken) und der sofort nach dem Anfall auftretende Tod
(schwarze Balken) gezeigt. Die Auswertung wurde freundlicherweise von Dr. M. Eckhardt durchgeführt.
Aus der Überlebenskurve ist ersichtlich, dass die transgenen Mäuse beider Linien eine
signifikant reduzierte Lebensspanne aufwiesen (Abb. 3.19 A). Innerhalb der ersten
Lebenswochen (11-18) starben 50 % der Tiere, wobei die Tiere der Linie 4743 verstärkte
Symptome zeigten und schon nach 11 Wochen und die Tiere der Linie 4747 nach 18 Wochen
eine 50 %ige Sterberate erreichten.
Die gesteigerte Anfälligkeit für akustische Reize scheint der Grund für die hohe Sterberate zu
sein. Dieser akustische Reiz von 90-100 dB, bei einer Frequenz zwischen 3500-20500 Hz
löste unkontrolliertes wildes Hin- und Herlaufen aus, auf das oft ein klonisch-tonischer Anfall
folgte (Abb. 3.19 B). Bei beiden Linien wurde dieses Verhalten beobachtet. Zusätzlich
103
3 Ergebnisse
starben zwischen 35 % (tg 4743) und 75 % (tg 4747) der transgenen Mäuse innerhalb von 20
Sekunden an Atemstillstand (Abb. 3.17 B). Bei den Wildtyp-Mäusen waren mit einer
Ausnahme keine audiogenen Anfälle zu beobachten.
Beobachtungen dieser Mäuse zeigten außerdem ein hyperaktives Verhalten im Vergleich zu
den Wildtyp-Tieren. Um diese erhöhte Aktivität zu analysieren, wurde mit den transgenen
Mäusen ein sogenannter „Open-field“-Test durchgeführt. Mit diesem Test werden
verschiedene Aktivitätsparameter analysiert. Dies sollte Aufschluss darüber geben, ob die
generelle motorische Aktivität im Vergleich zu den Kontrolltieren gesteigert ist. Zur Analyse
wurden Tiere beider Linien, 4747 und 4743, im Alter von sechs und 17 Wochen getestet. Für
den „Open-field“-Test wurden Wildtyp- (n=40) und tg 4747- und tg 4743-Tiere (n= 25)
herangezogen (Abb. 3.20). Die Ergebnisse des „Open-field“-Testes zeigten einige
Gemeinsamkeiten, aber auch einige Unterschiede im Verhalten von Kontroll- und transgenen
Tieren auf: So ist die zurückgelegte Strecke und die Durchschnittsgeschwindigkeit für die
Gruppen etwa gleich. Werden jedoch die Parameter betrachtet, die mit der lokomotorischen
Aktivität zu tun haben, so sind Veränderungen bei den transgenen Mäusen im Vergleich zu
den Wildtyp-Mäusen zu beobachten: So waren die Anzahl der Sprünge deutlich erhöht. Bei
den älteren Tieren zeigte sich, dass beide Geschlechter sich wesentlich weniger im Zentrum
der Box aufhielten, d.h. dass sie weniger in der Mitte saßen bzw. die Mitte der Box
durchquert haben. Dies könnte darauf hindeuten, dass die älteren transgenen Mäuse mit der
Zeit ein vermindertes Gehör besitzen und somit ihre Umgebung schlechter wahrnehmen
können. Dies korreliert auch mit den beobachteten Anfällen. Je älter die Mäuse wurden, traten
die Anfälle nicht mehr so häufig auf wie in den ersten Lebenswochen.
104
3 Ergebnisse
Abb. 3.20: Ergebnisse des „Open-field“-Verhaltenstests mit sechs bzw. 17 Monate alten Thy-1 CGT
Mäusen. Darstellung von Teilergebnissen der Wildtyp- (wt) und der transgenen Tieren (tg), die für fünf Minuten
in der „Open field“-Box beobachtet wurden. Tiere im Alter von 45 Tagen (sechs Wochen; blaue Balken) und
120 Tagen (17 Wochen; rote Balken) wurden analysiert. Es sind jeweils die Mittelwerte mit ANOVA mit
anschließendem Fischer LSD-Test ausgewertet worden. Die Fehlerbalken stellen die errechneten Standardfehler
(x +/- SEM; n=25-40) dar. Ein Stern signalisiert einen statistisch signifikanten Unterschied (t-Test, *= p < 0.05).
105
3 Ergebnisse
3.2.3 Induktion und Bestimmung der c-Fos-Expression im Colliculus inferior bei Thy1-CGT-Mäusen
Ein spezieller Bereich im Gehirn ist für die Verarbeitung und Weiterleitung von akustischen
Signalen verantwortlich. Dieser Bereich wird Colliculus inferior genannt und befindet sich
zwischen Kleinhirn und Cortex. Im Colliculus inferior werden erregende und hemmende
Signale von den Neuronen der Hörbahn und der Hörrinde verarbeitet. Der zentrale Bereich
hat eine tonotope Organisation, wobei die Frequenzachse von dorsal nach ventral verläuft,
also von tiefen zu hohen Frequenzen. Faingold zeigte, dass der Colliculus inferior eine
zentrale Rolle bei der Induktion von audiogenen Anfällen spielt (Faingold, 2002). Wie schon
in der in situ-Hybridisierung zu sehen war, wird das CGT-Transgen stark im Bereich des
Colliculus inferior exprimiert (Abb. 3.21 A). Um die durch Anfälle induzierte Hyperaktivität
der Neuronen im Colliculus inferior sichtbar zu machen, wurde die Expression des c-fosGenes in den transgenen Mäusen analysiert. c-Fos ist ein Proto-Onkogen, das zur Familie der
„immediate early genes“-Transkriptionsfaktoren gehört. Die Transkription von c-fos ist bei
neuronaler Aktivität stark hochreguliert und wird daher als Marker für neuronale Aktivität
eingesetzt (Bullit, 1990; Klein et al., 2004). Für diese Analyse wurden die Mäuse gewählt, die
nach dem akustischen Reiz das unkontrollierte Hin- und Herlaufen zeigten, aber nicht starben,
sowie Mäuse, die keinem Reiz ausgesetzt waren. Eine Stunde nach dem Anfall wurden die
Tiere perfundiert und Kryoschnitte von 12-14 µm Dicke angefertigt. Über c-FosImmunhistochemie wurde die Anzahl der c-Fos-positiven Zellen bestimmt. Die transgenen
Mäuse, die nicht dem akustischen Reiz ausgesetzt waren, zeigten bereits eine signifikant
verdoppelte Anzahl der c-Fos-exprimierenden Neuronen im Colliculus inferior im Vergleich
zum Wildtyp-Tieren. Eine Stunde nach dem Schlüsselklirren war die Anzahl bei den
transgenen Mäusen der c-Fos-positiven Zellen sogar um das sechsfache erhöht (Abb. 3.21 B).
106
3 Ergebnisse
Abb. 3.21: c-Fos-Immunhistochemie des Colliculus inferior. In A ist die c-Fos Expression (schwarze Punkte)
in den transgenen Mäusen (CGT-tg) nach einem akustischen Reiz zu sehen. Nach einer Stunde des Reizes
wurden die Tiere, die mit Anfällen reagiert haben, mittels c-Fos Immunhistochemie (1:3000) analysiert.
Zusätzlich wurden auch Tiere untersucht, die dem akustischen Reiz nicht ausgesetzt waren. In B ist die
Quantifizierung von c-Fos-positiven Zellen/mm2 dargestellt. Audiogener Stress n=6; ohne audiogenen Stress
n=3. Der Maßstabsbalken entspricht 100 µm (I-III), 50 µm (IV-VI).
Da sowohl das Transgen CGT als auch c-Fos im Colliculus inferior bei den transgenen Tieren
hochreguliert ist, wurde eine in situ-Hybridisierung mit der CGT-RNA-Sonde und eine
anschließende c-Fos-Immunhistochemie durchgeführt. So konnte festgestellt werden, ob die
transgenen CGT-exprimierenden
Zellen
gleichzeitig c-Fos-positiv
sind. Für
diese
Untersuchung wurden ebenso wie bei der Analyse der c-Fos-Expression 120 Tage alte Mäuse
genommen, die einem akustischen Reiz unterzogen worden waren. In der Abbildung 3.22 A
ist zu sehen, dass bei den transgenen Tieren die CGT-exprimierenden Zellen nahezu alle cFos positiv sind. Zwei Drittel der c-Fos-markierten Zellen exprimiert das Transgen CGT. Dies
lässt vermuten, dass ein Zusammenhang zwischen der Überexpression von CGT und dem
hoch regulierten c-Fos besteht.
107
3 Ergebnisse
Abb. 3.22: In situ-Hybridisierung mit c-Fos-Immunhistochemie im Colliculus inferior. In A sind die
Färbungen mit der CGT-RNA-Sonde und dem c-Fos-Antikörper (1:3000) zu sehen, jeweils von Thy-1-CGTund Wildtyp-Mäusen. Der Maßstabbalken entspricht 50 µm (I-II), 20 µm (III-IV). In B ist die Auszählung (n=6)
der CGT- und c-Fos-positiven Zellen im Bereich des Colliculus inferior abgebildet.
3.2.4 Isolierung von Lipiden aus Thy-1–CGT-Mäusen und Analyse des SulfatidGehalts in der neuronalen Plasmamembran
Die bereits festgestellte gesteigerte Expression von CGT könnte unter anderem der Grund für
das veränderte Verhalten der Thy-1-CGT-Mäuse sein. Die gesteigerte Expression an CGT
führt eventuell zu einem erhöhten Gehalt an GalCer und/oder Sulfatid und hat somit einen
Effekt auf die elektrophysiologischen Eigenschaften der Neuronen der transgenen Mäuse.
Daher wurde eine Lipid-Analyse der neuronalen Plasmamembranen durchgeführt. Da jedoch
ein großer Anteil von GalCer und Sulfatid im Gehirn aus dem Myelin stammt, wurde
zunächst die neuronale Plasmamembran durch ein modifiziertes zwei-Stufen-ZentrifugationsProtokoll isoliert. Dabei wurde im ersten Gradienten das Myelin entfernt und im zweiten
Gradienten die Plasmamembran gewonnen. Mittels Western-Blot-Analyse konnte gezeigt
werden, dass das Myelin entfernt worden ist. Hierzu wurde der MBP-(Myelin basisches
Protein) Antikörper verwendet. Die Anreicherung der Plasmamembran (PM) wurde mit dem
Na+/K+-ATPase-Antikörper kontrolliert (Abb. 3.23 A). Die extrahierten Lipide der
Plasmamembran wurden mittels TLC (Abb. 3.23 B) und ESI-MS (Abb. 3.24 A-B) untersucht.
Für diese Analyse wurden Gehirne von 120 Tage und 18 Monate alten Thy-1 CGT Mäusen
verwendet.
108
3 Ergebnisse
Abb. 3.23: Western-Blot und Lipid-Analyse des Gehirns von Thy-1-CGT-transgenen Mäusen. A: 50 µg
Protein aus dem Homogenat (H) und der Plasmamembran (PM) Isolierung wurden aufgetragen und die
Anreicherung der PM mit Na+/K+-ATPase-Antikörper (1:1000) und die Entfernung von Myelin mit MBPAntikörper (1:5000) nachgewiesen. B: Gesamtlipide (normiert auf Cholesterol) aus der PM und dem Homogenat
wurden isoliert und mittels HPTLC-Platten im Laufmittel Chloroform/Methanol/dH2O im Verhältnis 65:25:4
analysiert. Die entsprechenden Standards wurden auf der gleichen Dünnschicht-Platte aufgetragen. Insgesamt
wurden je Genotyp n = 3 Tiere analysiert. GalCer = Galaktosylceramid, PE = Phosphatidylethanolamin,
PC = Phosphatidylcholin; SM = Sphingomyelin; der Pfeil zeigt C18:0 GalCer an.
Wie in der TLC zu sehen, ist C18:0-GalCer in der Plasmamembran-Fraktion angereichert
(Abb. 3.23 B, Pfeil). Weiterhin ist vor allem die untere Sulfatid-Bande, die C18:0 Sulfatid
beinhaltet, gesteigert. Eine genaue Bestimmung der Sulfatid-Spezies wurde mit Hilfe der ESIMS durchgeführt (Abb. 3.24). Die Zugabe des internen C12:0-Sulfatid-Standard
(1111 pmol/~200mg Feuchtgewicht) erlaubte eine Quantifizierung. Die Massen-Spektren
zeigen bei den transgenen Mäusen einen deutlichen Anstieg an C18:0 Sulfatid (Massen-Peak
bei 806.7 m/z). Die Quantifizierung zeigt einen signifikanten Unterschied zwischen den
transgenen und den Wildtyp-Tieren. In der Abbildung 3.24 B ist die Quantifizierung über den
internen Standard dargestellt. Allerdings konnte kein Unterschied zwischen den jungen und
den alten transgenen Tieren festgestellt werden.
109
3 Ergebnisse
Abb. 3.24: Quantitative Bestimmung der Sulfatid-Spezies in der Plasmamembran von Thy-1-CGTMäusen. A: Repräsentative ESI-Spektren der Plasmamembran- und Homogenat-Gesamtlipide. Die Lipide
wurden in Gegenwart von C12:0 Sulfatid-Standard (interner Standard, IS, 722.7 m/z) extrahiert und im
negativen Modus gemessen. Der Peak von 806.7 m/z entspricht einem Sulfatid mit einem C18:0-Fettsäurerest,
888.7 m/z entspricht einem Sulfatid mit einem C24:1-Fettsäurerest. B: Quantifizierung von Sulfatid mit einem
C18:0-, hydroxyliertem C18:0- und C24:1-Fettsäurerest in der Plasmamembran und im Homogenat von 120
Tage und 18 Monate alten transgenen Thy-1-CGT- und Wildtyp-Mäusen. Die Massen-Peaks bei 834.7 m/z und
885.7 m/z wurden über MS/MS Fragmentierung als C40:6 Phosphatidylserin (PS) und C38:4
Phosphatidylinositol (PI) identifiziert.
110
3 Ergebnisse
3.2.5 Analyse der Ganglioside von transgenen Thy-1-CGT-Mäusen
In der Literatur wird beschrieben, dass letale audiogene Anfälle mit einer Veränderung des
Sphingolipid-Metabolismus einhergehen. Mäuse, die ausschließlich das Gangliosid GM3
synthetisieren, zeigten eine ähnliche Sensitivität gegenüber akustischer Stimulation wie die
transgenen Thy-1-CGT-Mäuse (Kawai et al., 2001). Daher wurde der Gangliosid-Gehalt der
Gehirn-Bereiche Colliculus inferior, Cortex, Kleinhirn und Stammhirn der transgenen Mäuse
untersucht. Hierzu wurden jeweils 120 Tage alte transgene und Wildtyp-Tiere verwendet. Die
Ganglioside wurden nach der Methode von Folch et al. (1957) mit anschließender
Aufreinigung der Ganglioside über eine C18-reversed-Phase-Kartusche (SEP-PAK18,
Millipore) extrahiert und mittels Dünnschichtchromatographie aufgetrennt. Als Standard
wurden kommerziell erhältliche Ganglioside verwendet. Abbildung 3.25 A zeigt
repräsentative Dünnschichtchromatographien der aufgereinigten Ganglioside. Eine Erhöhung
an GM3 oder andere Gangliosiden konnte bei transgenen CGT-Mäusen im Vergleich zu den
Wildtyp-Mäusen nicht festgestellt werden, weder im Colliculus inferior noch in den anderen
untersuchten Gehirnregionen.
111
3 Ergebnisse
Abb. 3.25: Analyse der Ganglioside von transgenen Thy-1-CGT-Mäusen. Ganglioside aus den GehirnBereichen des Colliculus inferior, Kleinhirn, Stammhirn und Cortex von 120 Tage alten Mäusen wurden isoliert
und
mittels
HPTLC-Platten
aufgetrennt.
A
stellt
eine
Dünnschichtchromatographie
(Laufmittel
Chloroform/Methanol/0,22% CaCl2 60:35:8) von zwei untersuchten Tieren pro Genotyp (n=2) dar, während die
quantitative Auswertung in B zu sehen ist. Die hier quantifizierten Ganglioside (GM1, GD1a, GD1b, GT1b)
ergeben zusammen 100 %.
Des Weiteren wurde eine Lipid-Analyse der Sphingolipide des Cortex und des Colliculus
inferior von 120 Tage alten transgenen Mäusen und entsprechenden Wildtyp-Mäusen
durchgeführt. Wie in der TLC zu erkennen ist (Abb. 3.26 A), führt die transgene Expression
der CGT zu einer weiteren GalCer-Bande, die sich zwischen der nicht hydroxylierten (nonfatty acid, NFA) und der hydroxylierten (high fatty acid, HFA) GalCer-Bande befindet (Abb.
3.26 A). Diese Bande wurde mit Hilfe von Massen-Spektrometrie identifiziert als C18:0112
3 Ergebnisse
GalCer (Eckhardt et al., 2007). Die ESI-MS Untersuchung der kortikalen Lipide zeigte einen
erhöhten C18:0-Sulfatid-Peak (Massen-Peak 806.7 m/z). Da Neuronen kein hydroxyliertes
C18:0-Sulfatid besitzen, spricht das Verhältnis von nicht-hydroxyliertem zu hydroxyliertem
C18:0 dafür, dass ein Anstieg an C18:0-Sulfatid vorhanden war (Abb. 3.26 B-C).
Abb. 3.26: Lipid-Analyse des Cortex und des Colliculus inferior von 120 Tage alten Thy-1-CGT-Mäusen.
A: Dünnschichtchromatographie der Gesamtlipide des Cortex und des Colliculus inferior von 120 Tage alten
transgenen und Wildtyp-Tieren als Kontrolle. Der Pfeil markiert C18:0-GalCer. Standards sind auf der rechten
Seite
angezeigt:
Chol=Cholesterol,
GalCer=Galaktosylceramid,
PE=Phosphotidylethanolamin,
PC= Phosphotidylcholin, SM= Sphingomyelin. B: ESI-MS Analyse der cortikalen Lipide. Gemessen im negativ
Modus. Der Peak von 806.7 m/z entspricht einem Sulfatid mit einem C18:0-Fettsäurerest, 888.7 m/z entspricht
einem Sulfatid mit einem C24:1-Fettsäurerest und 822.7 m/z entspricht hydroxylierten-C18:0-Sufatid (hC18:0Sulfatid). C: Quantifizierung von C18:0-, hC18:0- und C24:1 Sulfatid im Cortex und im Colliculus inferior von
120 Tage und 18 Monate alten transgenen Thy-1-CGT- und Wildtyp-Mäusen. Die Massen-Peaks wurden im
Verhältnis zueinander gesetzt, da kein interner Standard zugesetzt worden ist.
113
3 Ergebnisse
Diese Ergebnisse zeigen, dass der Anstieg an C18:0-GalCer und C18:0-Sulfatid der einzige
signifikante Unterschied in der Lipidzusammensetzung in transgenen Neuronen ist. Das weist
darauf hin, dass der erhöhte GalCer- und/oder Sulfatid-Gehalt in der neuronalen
Plasmamembran der Grund für die Anfälligkeit gegenüber akustischen Reizen ist, die
audiogene Anfälle bei den transgenen Tieren auslösen.
3.2.6 Lipid-Analyse der Plasmamembran von transgenen CGT-, CST- und CGT/CSTMäusen
Um die Hypothese zu bestätigen, dass die transgenen CGT-Mäuse aufgrund des erhöhten
Sulfatid-Gehalts empfindlich auf einen akustischen Reiz mit einem Anfall reagieren, wurde
versucht, in den Neuronen den Sulfatid-Gehalt zu steigern. Dies wurde erreicht durch
zusätzliches Einbringen eines weiteren Transgens, der Cerebrosid-Sulfotransferase (CST).
Die folgenden Experimente wurden mit transgenen Tieren durchgeführt, die einen gemischten
Hintergrund (C57BL/6 / 129 Ola) besitzen, da es nicht möglich war, reine transgene CSTMäuse mit C57BL/6 Hintergrund zu erhalten. Des Weiteren waren alle transgene CST-Mäuse
ASA-defizient. Diese Tiere wurden mit den transgenen CGT-Tieren verpaart und so CST-,
CGT und CGT/CST-doppelt-transgene Tiere generiert. Die so erhaltenen Mäuse waren in
Bezug auf das ASA-Gen heterozygot und hatten einen gemischten Hintergrund von 75 %
C57BL/6 und 25 % 129/Ola. Die Heterozygotie des ASA-Gens hat keinen Effekt auf den
Sphingolipid -Gehalt. Es wurde keine Akkumulation von Sulfatid in heterozygoten ASATieren festgestellt (Stroobants et al., 2008).
Die Analyse der Lebenserwartungen bei den transgenen Mäusen, freundlicherweise
durchgeführt von Dr. M. Eckhardt, zeigte, dass die transgenen CST-Tiere eine normale
Lebensdauer hatten. Jedoch wiesen 10 % der transgenen CGT-Mäuse mit dem genetisch
gemischten Hintergrund eine verkürzte Lebensdauer auf (starben innerhalb der ersten zwölf
Monate). Allerdings zeigten die doppelt-transgenen CST/CGT-Mäuse innerhalb der ersten elf
Lebenswochen eine 50 %ige-Sterberate. Es wurde mit diesen transgenen CGT- und
CST/CGT-Tieren auf gemischtem Hintergrund ebenfalls eine akustische Stimulation
durchgeführt. Hierbei zeigte sich, dass diese transgenen-CGT Mäuse mit dem genetisch
gemischten Hintergrund ebenso wie die mit C57BL/6-Hintergrund audiogene Anfälle
bekommen. Allerdings starben keine transgenen CGT-Tiere auf gemischtem genetischen
Hintergrund als Antwort auf den akustischen Reiz. Im Gegensatz dazu starben fast 70 % der
transgenen doppel-CGT/CST-Mäuse an auf die Anfälle folgendem Atemstillstand.
114
3 Ergebnisse
Aufgrund dieser Ergebnisse, wurde eine Analyse der Plasmamembran von diesen transgenen
Mäusen durchgeführt. Zunächst erfolgte eine Überprüfung der Aufreinigung der
Plasmamembran anhand einer Western-Blot-Analyse (Abb. 3.27 A). In der Abbildung des
Western-Blots ist eine erfolgreiche Anreicherung der Plasmamembran zu erkennen. Dies zeigt
sich zum einen durch ein verstärktes Western-Blot-Signal des Na+/K+-Kanal-Antikörper
(spezifischer Membran-Marker) bei den Plasmamembran-Proben und zum anderen weisen
diese Proben ein schwaches bis kein Signal des MBP-Antikörpers (spezifischer MyelinMarker) im Vergleich zu den Homogenat-Proben auf. Somit konnte ausgeschlossen werden,
dass die Plasmamembran-Proben durch Myelin kontaminiert sind.
Nach der Lipidextraktion wurden die Fraktionen der Plasmamembran und des Homogenates
über die TLC sowie mittels der ESI-MS analysiert.
Die Lipid-Analyse der isolierten Plasmamembran von den vier untersuchten Genotypen
(transgen-CST, transgen-CGT, transgen-CGT/CST und Wildtyp) zeigte eine vergleichbar
starke C18:0-–GalCer-Bande bei den transgenen CGT- und den transgenen CGT/CSTMäusen (Abb. 3.27 B). Die ESI-MS-Daten zeigten, dass der C18:0-Sulfatid-Gehalt bei den
transgenen CGT-Mäusen mit dem gemischten genetischen Hintergrund signifikant erhöht ist.
Jedoch liegt der C18:0-Sulfatid-Gehalt wesentlich höher bei den doppelt transgenenCGT/CST-Mäusen im Vergleich zu den transgenen CGT-Mäusen (Abb. 3.27 C, E). Bei den
transgenen CST-Tieren war keine Veränderung in der Lipidzusammensetzung zu finden.
Diese Daten zeigen eine deutliche Korrelation zwischen Empfindlichkeit gegenüber
audiogenen Reizen und dem C18:0-Sulfatid-Gehalt in der Plasmamembran.
115
3 Ergebnisse
Abb. 3.27: Aufreinigung und Lipid-Analyse der Plasmamembran von transgenen Mäusen mit dem
gemischten Hintergrund C57BL/6 x 129 Ola. A: 50 µg Protein aus dem Homogenat (H) und der
Plasmamembran (PM)-Isolierung wurden aufgetragen und die Anreicherung der PM mit Na+/K+-ATPaseAntikörper (1:1000) und die Entfernung von Myelin mit MBP-Antikörper (1:5000) nachgewiesen. B: Die
Gesamtlipide der PM wurden mit Hilfe von HPTLC aufgetrennt. Der Pfeil zeigt C18:0-GalCer in der
angereicherten tg CGT- und tg CGT/CST-PM-Fraktion an. C: Repräsentatives ESI-Chromatogramm vom
Homogenat und der PM. Die Lipide wurden in Anwesenheit von einem internen C12:0-Sulfatid-Standard (IS)
extrahiert und im negativ Modus gemessen. Der Peak von 806.7 m/z entspricht einem Sulfatid mit einem C18:0Fettsäurerest, 888.7 m/z entspricht einem Sulfatid mit einem C24:1-Fettsäurerest Die Massen-Peaks bei 834.7
m/z und 885.7 m/z wurden über MS/MS-Fragmentierung als C40:6 Phosphatidylserin (PS) und C38:4
Phosphatidylinositol (PI) identifiziert. D-E: zeigen die Quantifizierung von C18:0- und C24:1 Sulfatid im
Homogenat (D) und in der PM (E) von den vier Genotypen Wildtyp (n=3), tg CST (n=3), tg CGT (n=6) und tg
CGT/CST (n=6).
116
3 Ergebnisse
3.2.7 Zusammenfassung der Ergebnisse der biochemischen und ESI-MS
Untersuchungen an den transgenen Thy-1-CGT-Mäusen
Die biochemischen Untersuchungen sowie die Analyse der Sulfatid-Spezies mittels ESI-MS
zeigten, dass die transgenen Thy-1-CGT-Mäuse GalCer und Sulfatid in Neuronen
synthetisierten sowie eine erhöhte Sterblichkeitsrate besitzen.
Beobachtungen zeigten, dass die transgenen CGT-Mäuse sehr empfindlich gegenüber
akustischer Stimulation waren, die teilweise zu letalen audiogenen Anfällen führte.
Mittels c-Fos-Immunhistochemie wurde eine erhöhte neuronale Aktivität im Bereich des
Colliculus inferior nachgewiesen.
Analysen der neuronalen Plasmamembran von transgenen CGT-Mäusen ließen einen
erhöhten GalCer und C18:0-Sulfatid-Gehalt erkennen.
Dieser gesteigerte C18:0-Sulfatid-Gehalt korreliert mit letalen.
117
3 Ergebnisse
3.3
In vitro Zellkulturversuche an der Cerebrosid-Sulfotransferase (CST)
Die Cerebrosid-Sulfotransferase (CST) ist ein Typ II-Transmembran-Protein, das eine
Sulfatgruppe auf Galaktose transferiert. Eine Akkumulation von Sulfatid, hervorgerufen durch
einen Defekt des Enzyms Arylsulfatase A (ASA), führt zur metachromatischen
Leukodystrophie (MLD), einer lysosomalen Speicherkrankheit. Eine wirkungsvolle Therapie
ist bis jetzt noch nicht gegeben. Eine mögliche Option, um MLD zu behandeln, ist die
Inhibition des Enzyms CST. Daher sollte die Produktion einer großen Menge an CST
ermöglichen, eine Struktur-Analyse durchzuführen und nach möglichen Inhibitoren der CST
zu suchen.
Aufgrund dessen wurden in dieser Arbeit verschiedene CST-Fusions-Proteine hergestellt, um
nicht-membrangebundene CST in eukaryontischen Zelllinien zu exprimieren. Die Enzyme
sollten aus dem Kulturüberstand dieser Zelllinien gereinigt und für strukturelle und
funktionelle Analysen eingesetzt werden.
Die verschiedenen CST-Konstrukte wurden sowohl biochemisch sowie auf ihre subzelluläre
Lokalisation hin untersucht.
3.3.1 Biochemische Analyse von CST-Fusions-Proteinen
Um das Enzym CST aus dem Kulturüberstand isolieren zu können, wurde zunächst die
Transmembran-Domäne entfernt. Diese lösliche CST wurde allerdings nicht in den
Kulturüberstand sezerniert, sondern verblieb weiterhin in der Zelle. Daraufhin wurden
verschiedene CST-Konstrukte erstellt, die jeweils ausgehend vom N-Terminus um weitere
neun Basenpaare verkürzt und mit einem IL-2-Signalpeptid versehen waren (siehe
Plasmidkarten im Anhang). All diesen Konstrukten fehlt ebenso die Transmembran-Domäne
(Abb. 3.28). Die so erhaltenen CST-Konstrukte, genannt pEF-39CST, pEF-42CST, pEF45CST, pEF-48CST, pEF-51CST wurden biochemisch untersucht (die Zahl gibt jeweils an,
an welcher Aminosäure-Position des CST-Wildtyp-Proteins die CST-Mutante anfängt).
118
3 Ergebnisse
Abb. 3.28: Schematische Darstellung der CST-Konstrukte. Die Aminosäure-Position des jeweiligen Anfangs
der CST-Konstrukte nach der Transmembran-Domäne (TM) ist gezeigt. Unterstrichen ist die entfernte
Transmembran-Domäne. Die Pfeile und die Zahlen geben jeweils an, an welcher Aminosäure-Position des CSTProteins der Beginn der Mutanten ist. KD= katalytische Domäne.
Hierfür wurden diese in CHO-KI (Chinese hamster ovary; Wildtyp)-Zellen transfiziert. Nach
72 h wurde der Kulturüberstand entnommen und die Zellen lysiert. Die Proteine des Zelllysats
der transfizierten CHO-Zellen sowie der Kulturüberstand wurden über eine SDS-PAGE
aufgetrennt und nach dem Western-Blot-Verfahren weiterbehandelt. Mit Hilfe des
polyklonalen CST-Antiserums ST2 (Yaghootfam et al., 2007) wurde die CST-Expression
nachgewiesen. Als positive Kontrolle dienten CHO-Sulf Zellen. Diese Linie exprimiert
zusätzlich zur Ceramidgalaktosyltransferase (CGT) stabil die CST (Eckhardt et al., 2002). Im
Anschluss daran wurde ein radioaktiver Aktivitäts-Assay mit den CST-Proben durchgeführt,
um festzustellen, ob die verkürzten CST-Konstrukte noch Aktivität besitzen. Hierbei wurden
die Proben mit [35S]PAPS and Galaktocerebrosid inkubiert. Das Produkt wurde über HPTLC
aufgetrennt und mittels Phosphoimager detektiert. Die Western-Blot- Analyse zeigt, dass die
verschiedenen CST-Konstrukte exprimiert werden und sowohl im Lysat als auch im
Kulturüberstand nachweisbar sind. Allerdings laufen die CST-Banden, die aus dem
Kulturüberstand stammen, etwas höher als die in den dazugehörigen Lysaten. Dies ist
möglicherweise auf eine Glykosylierung der im Kulturüberstand befindlichen CST-Proteine
zurückzuführen. Die Lysat-Banden zeigen ein wesentlich deutlicheres Signal als die CSTBanden aus dem Kulturüberstand. Daher ist davon auszugehen, dass nur ein geringer Teil des
CST-Proteins in den Kulturüberstand sezerniert wurde. Des Weiteren konnte nachgewiesen
werden, dass die CST-Fusions-Proteine alle noch Aktivität besitzen. Auffällig war jedoch,
dass außer der 39CST keine andere CST mehr Aktivität im Kulturüberstand zeigte. Daher
wurde nur von der 39CST eine stabile Zelllinie von CHO-K1 Zellen angelegt, die für weitere
Untersuchungen wie subzelluläre Lokalisation (Abs. 3.3.2-4) verwendet worden ist.
119
3 Ergebnisse
Abb. 3.29: Expression der CST-Konstrukte und deren Aktivitäts-Nachweis. CHO-K1-Zellen, die mit den
fünf CST-Konstrukten transfiziert worden waren, wurden nach ca. 72 h für die Western-Blot-Analyse (A) und
den Aktivitäts-Nachweis (B) aufbereitet. A: Die Proteine in dem Gesamt-Zelllysat (Ly) und dem
Kulturüberstand (Medium – M) wurden über SDS-PAGE aufgetrennt (jeweils 1/10 vom Gesamtvolumen
aufgetragen) und die CST mit dem ST2 Antiserum (1:5000) detektiert. Das Molekulargewicht der CST beträgt
ca. 54 kDa.
B: Die Aliquots, 10 µl des Kulturüberstands und 10 µl des Zelllysates (5 µg Protein) wurden mit [35S]PAPS und
Galaktocerebrosid im Standard-CST-Assay inkubiert. Das Sulfatid wurde mittels HPTLC aufgetrennt und durch
den Gebrauch des PhosphoImager nachgewiesen. Als positive Kontrolle dienten die Wildtyp-CST und CHOSulf-Zellen.
Aufgrund der Tatsache, dass die Expression der `verkürzten´ CST´s in den Zellen nicht den
gewünschten Effekt hatte, größere Mengen in den Kulturüberstand zu sezernieren, wurden
weitere Fusions-Konstrukte erstellt. Diesbezüglich wurden Plasmide konstruiert, welche zur
Expression der Fusionsproteine AChE-Furin-lCST und -Seap-Furin-lCST führten. Diese
Zusätze an die lösliche CST (ohne Transmembran Domäne), wie die vollständigen Proteine
AChE (Acetylcholinesterase) und Seap (sekretorische alkalische Phosphatase) wurden
gewählt, da von ihnen bekannt ist, dass sie in den Kulturüberstand sezerniert werden.
Zusätzlich war eine Furinschnittstelle zwischen AChE bzw. Seap und CST eingebaut. Dies
diente dazu, das Furin als Endoprotease an dieser Schnittstelle, AChE bzw. Seap von der CST
intrazellulär abspaltet und somit kein Fusionsprotein mehr vorliegt.
Diese Konstrukte wurden ebenso auf Expression und Sekretion hin untersucht. Als positive
Kontrolle dienten wiederum CHO-Sulf-Zellen wie auch das Konstrukt mit der löslichen
verkürzten CST (s.o.), 39CST. Wie in der Abbildung 3.30 zu sehen ist, werden die
verschiedenen Fusionsproteine in den transfizierten Zellen exprimiert, jedoch war keine
Sekretion in den Kulturüberstand bei AChE-lCST und Seap-lCST zu erkennen. Es hat somit
120
3 Ergebnisse
keine wesentliche Verschiebung des Proteins in den Kulturüberstand stattgefunden und der
Großteil der Proteine verblieb weiterhin in der Zelle.
Abb. 3.30: Expressions-Nachweis der Fusionsproteine im Lysat von CHO-K1-Zellen. 72 h nach der
Transfektion wurde Lysat aus den transient transfizierten Zellen hergestellt und je Spur 1/10 des
Gesamtvolumens vom Kulturüberstand (Medium-M) und dem Lysat (Ly) aufgetragen. Die Detektion der CST
erfolgte mit dem ST2-Antiserum (1:5000), das die CST erkennt, welche ein Molekulargewicht von ca. 54 kDa
hat.
3.3.2 Analyse von MAL und PLP als mögliche Transporter der CST
Die vorangegangen Untersuchungen zeigten, dass das lösliche Enzym CST zum größten Teil
in der Zelle verbleibt und nicht in den Zellkultur-Überstand sezerniert wird, obwohl
verschiedene Fusions-Konstrukte erstellt worden sind. Es stellt sich nun die Frage, ob es einen
Faktor gibt, der das Enzym in der Zelle zurückhält. Möglicherweise wird ein weiteres Protein
für den Transport benötigt. Denkbare Transport-Lipoproteine, die bereits in der Literatur
beschrieben worden sind, sind zum einen das Proteolipidprotein (PLP) und das Myelin und
Lymphozyt Protein (MAL).
Anhand von Immunfluoreszenz-Untersuchungen sollte getestet werden, ob eine CoTransfektion von MAL bzw. PLP mit CST eine Co-Lokalisation hervorruft. Dazu wurden die
codierende Sequenz von PLP bzw. MAL mit einem C-terminalen HA-Markierung in den
pcDNA3-Vektor kloniert und dieses Fusionsprotein zusammen mit der CST transfiziert. Die
CST wurde mit dem ST2-Antiserum und die Fusionsproteine über die HA-Markierung in der
Immunfluoreszenz detektiert. Zur genaueren Bestimmung der Lokalisation wurden die MALund PLP-kodierenden Plasmide sowohl in CHO-K1-Zellen wie auch in die stabile CSTZelllinie 39CST-CHO transfiziert (Abs. 3.3.1).
In der Abbildung 3.31 A ist zunächst die CST mit einem grün fluoreszierenden sekundären
Antikörper nachgewiesen. In den folgenden Bildern ist das Fusions-Protein MAL-HA in
CHO-K1-Zellen (B) und in der stabilen 39CST-CHO-Zelllinie (C) mit Hilfe des 12CA5Antikörpers gegen die HA-Markierung gezeigt. In den unteren Bildern sind die Co-Färbungen
121
3 Ergebnisse
des MAL-HA-Proteins mit der CST gezeigt. Zuerst ist die Co-Färbung von MAL-HA in der
stabilen CST-Zelllinie gezeigt (D) und dann folgt die Co-Färbung von MAL-HA cotransfiziert mit dem 39CST-Protein in CHO-K1-Zellen (E).
Diese Versuche wurden ebenfalls mit PLP durchgeführt. Zunächst ist in der Abbildung 3.32
wieder die CST nachgewiesen (A), dann das PLP-HA-Protein in den CHO-K1- (B) und in den
39CST-CHO-Zellen (C). Ebenso wurde eine Co-Transfektion von PLP-HA mit 39CST
durchgeführt. In D ist die Färbung von PLP-HA in den 39CST-CHO-Zellen zu sehen und in E
die Co-Transfektion von PLP-HA und 39CST.
Sowohl bei der mit MAL wie auch bei der mit PLP durchgeführten Immunfluoreszenz zeigte
sich, dass es zu keiner Veränderung der Lokalisation des CST-Proteins kommt. Die
CSTbefindet sich im Endoplasmatischen Retikulum (ER), wie in den Abbildungen 3.31 &
3.32 zu sehen ist. Eine Co-Lokalisation von MAL bzw. PLP mit CST ist nicht zu beobachten.
Somit kommen diese Proteine nicht als mögliche Transporter-Faktoren für die CST in Frage.
122
3 Ergebnisse
Abb. 3.31: Co-Färbung der CST mit MAL-HA in CHO-K1- und 39CST-CHO-Zellen. A zeigt die mit der
39CST stabil transfizierten Zellen (39CST-CHO), in denen die CST mit dem - Antiserum (grün; 1:500) gefärbt
ist. B-C ist die Expression von MAL-HA (12CA5-Antikörper gegen die HA-Markierung; rot; 1:500) jeweils in
CHO-K1- (B) und in 39CST stabil transfizierten CHO-Zellen (C) dargestellt. D-E zeigen eine Doppelfärbung
des Fusionsproteins MAL-HA in der 39CST-CHO-Zelllinie (D), in der die CST mit dem Antiserum ST2
angefärbt ist. E zeigt eine Co-Transfektion von MAL-HA und 39CST in CHO-K1-Zellen. Die Überlagerung der
einzelnen Bilder ist mit zusätzlicher DAPI-Kernfärbung (1:500) erkennbar. Maßstabsbalken: 20 µm. Dargestellt
ist ein repräsentatives Ergebnis von insgesamt drei Versuchen. 39CST entspricht dem Konstrukt, 39CHO-Zellen
der stabilen Zelllinie.
123
3 Ergebnisse
Abb. 3.32: Co-Färbung der CST mit PLP-HA in CHO-K1- und 39CST-CHO-Zellen. A zeigt die mit der
39CST stabil transfizierten Zellen (39CST-CHO), in denen die CST mit dem ST2-Antiserum (grün; 1:500)
gefärbt ist. B-C ist die Expression von PLP-HA (12CA5-Antikörper gegen die HA-Markierung; rot; 1:500)
jeweils in CHO-K1- (B) und in 39CST stabil transfizierten CHO-Zellen (C) dargestellt. D-E zeigen eine
Doppelfärbung des Fusionsproteins PLP-HA in der stabilen 39CST-CHO-Zelllinie (D), in der die CST mit dem
Antiserum ST2 angefärbt ist. E zeigt eine Co-Transfektion von PLP-HA und 39CST in CHO-K1-Zellen. Die
Überlagerung der einzelnen Bilder ist mit zusätzlicher DAPI-Kernfärbung (1:500) erkennbar. Maßstabsbalken:
20 µm. Dargestellt ist ein repräsentatives Ergebnis von insgesamt drei Versuchen. 39CST entspricht dem
Konstrukt, 39CHO-Zellen der stabilen Zelllinie.
Neben der Immunfluoreszenz-Untersuchung wurde ebenfalls eine Western-Blot-Analyse
durchgeführt, um festzustellen, ob beide Proteine, PLP (34 kDA) und MAL (17 kDa) mit der
richtigen Größe exprimiert wurden. Die Inkubation mit dem ST2-Antiserum führte zur
Detektion der CST, ein ca. 54 kDA großes Protein, und über den 12CA5-Antikörper von PLP,
124
3 Ergebnisse
das ca. 34 kDa groß ist. Die Western-Blot-Membran wurde mit beiden Antikörpern
zusammen inkubiert. Allerdings konnte MAL nicht detektiert werden.
Abb. 3.33: Expression der CST, MAL und PLP. 48 h nach Transfektion wurde Zelllysat aus den
unterschiedlich transient transfizierten Zellen hergestellt und je Spur 50 μg Protein aufgetragen. Die Detektion
der CST erfolgte mit dem ST2-Antiserum (1:5000) und des PLP-HA mit dem 12CA5-AK (10 µg/ml), der das
Fusionsprotein anhand der HA-Markierung erkennt. PLP-HA hat rechnerisch ein Molekulargewicht von 34
kDa. In der ersten Spur wurde das Lysat der untransfizierten CHO-K1-Zellen aufgetragen, in der zweiten und
dritten Spur CHO-K1-Zellen transfiziert mit PLP-HA und MAL-HA, in der vierten Bahn CHO-K1-Zellen
transfiziert mit PLP-HA und CST sowie in der letzen Bahn CHO-K1-Zellen transfiziert mit CST und MAL-HA.
3.3.3 Export- und Lokalisations-Untersuchung an dem Fusionsprotein DPPIV(TM)39CST
Um festzustellen, ob für den Export der CST der luminale Teil der CST oder eher die
Transmembran-Domäne verantwortlich ist, wurde ein CST-Plasmid hergestellt, in dem die
CST an eine Domäne eines Proteins fusioniert wird, von dem bekannt ist, dass es an der
Zelloberfläche lokalisiert ist. Hierfür wurde die amino-terminale-Domäne der TransmembranDomäne (TM) des Plasmamembran-Proteins Dipeptidylpeptidase (DPPIV) verwendet. Die
DPPIV ist ein Typ II-Transmembran Protein und wird den Exopeptidasen zugeordnet. Von
Munro (1995) wurde gezeigt, dass Lysozym nach Kopplung an die TM-Domäne der DPPIV
zur Plasmamembran transportiert wurde. Zusammen mit der löslichen Form der 39CST und
einer HA-Markierung wurde daher ein Plasmid konstruiert, das das Fusionsprotein DPPIV
(TM)-39CST-HA kodiert (siehe Plasmidkarte im Anhang). Durch dessen LokalisationsBestimmung (mit Hilfe von Immunfluoreszenz) ist möglicherweise eine Aussage zu machen,
ob der luminale Teil der CST für die Retention im ER verantwortlich ist.
Zunächst erfolgte ein Expressions-Nachweis über Western-Blot-Analyse mit Hilfe des ST2Antiserums und dem 12CA5-Antikörper. Als positive Kontrollen dienten zum einen das
Zelllysat einer Überexpression HA-markierter muriner CST (CST-HA) aus CHO-K1 Zellen
und zum anderen ein Lysat von den CHO-Sulf-Zellen.
125
3 Ergebnisse
Abb. 3.34: Expressions-Nachweis der DPPIV(TM)-39CST-HA in CHO-K1 Zellen. 48 h nach der
Transfektion wurden die transfizierten Zellen lysiert und je Spur 50 µg Protein aufgetragen. Der Nachweis der
DPPIV(TM)-lCST-HA erfolgte zum einen mit dem 12CA5-AK (gegen die HA-Markierung; 1 µg) (A) und zum
anderen mit dem ST2-Antiserum (1:5000) (B). Als positive Kontrollen dienten die murine CST-HA und CHOSulf-Zellen.
Sowohl mit dem ST2-Antiserum wie auch mit dem Antikörper gegen die HA-Markierung
konnte die DPPIV(TM)-39CST-HA auf Expressionsebene nachgewiesen werden.
Um zu überprüfen, ob es zum Transport an die Plasmamembran kommt, wurde eine
Immunfluoreszenz-Analyse durchgeführt. Mit einem Antikörper gegen Calnexin, das im ER
lokalisiert ist, und mit dem Konstrukt CST1-36-GFP, dass als Golgi-Marker dient, wurde eine
genaue zelluläre Lokalisation des Proteins ermöglicht. In Yaghootfam et al. (2007) wurde
gezeigt, dass das CST1-36-GFP-Fusionsprotein, das lediglich aus den ersten N-terminalen 36
Aminosäuren der CST (die die Transmembran-Domäne beinhaltet) mit einem GFP-Tag
besteht, spezifisch im Golgi-Apparat lokalisiert ist. Zusätzlich wurde ein Fusionsprotein
erzeugt, das aus der TM-Domäne des DPPIV und einem GFP-Signal besteht. Dies wurde als
Plasmamembran-Marker eingesetzt. Um eine Vergleichsmöglichkeit im Bezug auf die
Lokalisation der CST zu haben, wurde zusätzlich eine Immunfluoreszenz-Färbung mit CSTHA als Kontrolle durchgeführt. In Abbildung 3.35 B ist eine deutliche Co-Lokalisation der
CST-HA mit Calnexin zu sehen. Zur besseren Darstellung des jeweiligen Lokalisation-Orts
der überexprimierten Proteine wurden diese für sich allein in der Abbildung 3.35 aufgeführt.
126
3 Ergebnisse
127
3 Ergebnisse
Abbildung 3.35 I zeigt eine deutliche Co-Lokalisation von DPPIV(TM)-39CST-HAund dem
ER Protein Calnexin in transient transfizierten CHO-K1-Zellen. Weitere Aufnahmen zeigten,
dass wie bei der CST-HA keine Anreicherung des Proteins im Golgi-Apparat festzustellen ist.
Ebenso konnte keine Co-Lokalisation zwischen der DPPIV(TM)-GFP und dem DPPIV(TM)39CST-HA ermittelt werden.
Aufgrund dieser Ergebnisse und der aus den vorherigen Versuchen erhaltenden Daten wird
deutlich, dass ein starkes ER-Rückhaltesignal, das sich anscheinend in der katalytischen
Domäne der CST befindet, vorhanden ist. Das Entfernen der Membran Domäne, sowie der
Austausch der Domäne mit vollständigen sekretorischen Proteinen (z.B. AChE, Seap) bzw.
Membran Domänen (z.B. DPPIV), bewirkte keine Veränderung der zellulären Lokalisation.
Abb. 3.35: Subzelluläre Lokalisation des DPPIV(TM)-39CST-HA in CHO-K1-Zellen. A: zeigt die GolgiLokalisation von CST1-36-GFP. In B ist CST-HA zu sehen. C-D sind Doppelfärbungen in CHO-K1-Zellen von
CST-HA (rot) mit Calnexin (grün)-C sowie CST1-36-GFP (grün)-D. E zeigt das Fusionsprotein DPPIV-GFP und
F: DPPIV-lCST-HA (rot). G-I zeigt die Doppelfärbung von DPPIV(TM)-lCST-HA (rot) mit DPPIV(TM)-GFP
(G), mit CST1-36-GFP (H) und mit dem ER-Marker Calnexin (I). Maßstabsbalken = 20 µm. Die Überlagerung
der einzelnen Bilder ist zusätzlich mit DAPI-Kernfärbung (1:500) zu erkennen. Antikörper-Verdünnung:
Calnexin 1:300, 12CA5 1:500. Dargestellt ist ein repräsentatives Ergebnis von vier Versuchen.
128
3 Ergebnisse
3.3.4 Subzelluläre Lokalisation der humanen Gal3-Sulfotransferase 1, 2 und 4
Aufgrund der Tatsache, dass die CST in der Zelle verbleibt und hauptsächlich im ER
lokalisiert ist, wurde untersucht, ob zu der CST homologe Sulfotransferasen, bei einer
Überexpression ebenso im ER verbleiben.
Die Familie der humanen Galaktose 3-0-Sulfotransferasen (Gal3ST) besteht aus vier
Mitgliedern: Gal3ST1 (Galaktose-3-O-Sulfotransferase 1; humane CST), Gal3ST2 (galβ3GalNAc -3-O-Sulfotransferase 2), Gal3ST3 (galβ-3GalNAc 3'-Sulfotransferase 3) und
Gal3ST4 (galβ-3GalNAc 3'-O-Sulfotransferase). Diese vier sind verantwortlich für die
Sulfatierung von verschiedenen Akzeptor-Substraten. Sie katalysieren den Transfer von Sulfat
auf die C-3-Position des jeweiligen Substrates. GalCer und LacCer sind die Substrate von
Gal3ST1, N-3-Acetylgalaktosamin für Gal3ST2, N-3-Acetylgalaktosamin für Gal3ST3, und
N-Acetylglucosamin und N-Acetylgalaktosamin für Gal3ST4 (Seko et al., 2001)
Für die Analyse der subzellulären Lokalisation der humanen Sulfotransferasen, wurden
Gal3ST1, Gal3ST2 und Gal3ST4 mit einer HA-Markierung versehen (siehe Plasmidkarte im
Anhang). Als positive Kontrolle wurde das Fusionsprotein CST-HA eingesetzt. Zunächst
wurde mittels Western-Blot-Methode die Expression der Sulfotransferasen nachgewiesen.
Dazu wurden Zelllysate aus den transfizierten CHO-K1 Zellen nach 48 h hergestellt. Die HAmarkierten Proteine wurden mit dem 12CA5-Antikörper nachgewiesen. Es konnte von allen
drei Sulfotransferasen eine Proteinexpression festgestellt werden (Abb. 3.36). Das schwächere
Signal bei der Gal3ST2 stammt von einer geringeren Expressionsrate und konnte auch bei den
Immunfluoreszenz-Untersuchungen beobachtet werden.
Abb. 3.36: Western-Blot-Nachweis der humanen Sulfotransferasen Gal3ST1, Gal3ST2 und Gal3ST4. 48 h
nach der Transfektion wurden die transfizierten Zellen isoliert und je Spur 50 µg Protein aufgetragen. Der
Nachweis der Gal3ST-Konstrukte erfolgte wie in A zu sehen mit dem 12CA5-Antikörper (gegen die HAMarkierung; 10 µg/ml) gezeigt. Als positive Kontrolle diente CST-HA.
Im Anschluss daran erfolgte eine Immunfluoreszenz-Analyse, um festzustellen, wo die
Sulfotransferasen in der Zelle lokalisiert sind. Dafür wurden die Fusionsproteine Gal3ST1HA, Gal3ST2-HA und Gal3ST4-HA in CHO-K1-Zellen transfiziert. Zur genaueren
129
3 Ergebnisse
Bestimmung der Lokalisation wurden Co-Färbungen mit Calnexin, das im ER lokalisiert ist,
und mit dem Konstrukt CST1-36-GFP, das als Golgi-Marker dient, durchgeführt.
In Abbildung 3.37 sind beispielhaft die verschiedenen Doppelfärbungen dargestellt. Die
transient transfizierten Gal3ST-HA Fusionsproteine wurden mit Anti-HA-Antikörper und
einem rot-fluoreszierenden Zweitantikörper angefärbt, während die Färbung des ER–Proteins
mit einem grün-fluoreszierenden Zweitantikörper erfolgte. Die Golgi-Färbung ist mittels des
GFP-Signals
des
Konstrukt
CST1-36-GFP
sichtbar.
Die
Ergebnisse
der
Immunfluoreszenzanalyse zeigen, dass alle drei untersuchten Sulfotransferasen Gal3ST(1, 2,
4)-HA im ER lokalisiert sind (Abb. 3.37 C, E, G). Eine Lokalisation im Golgi Apparat ist nur
zum Teil vorhanden (Abb. 3.37 B, D, F). Diese Ergebnisse zeigen deutlich, dass nicht nur die
CST im ER zurückgehalten wird, sondern dies auch bei den ähnlich aufgebauten
Sulfotransferasen der Fall ist.
Die Ergebnisse lassen zusammengefasst vermuten, dass es noch einen weiteren
entscheidenden Faktor gibt, der für einen Weitertransport der Sulfotransferasen nötig ist.
130
3 Ergebnisse
Abb. 3.37: Co-Färbung der humanen Sulfotransferasen Gal3ST1, Gal3ST2 und Gal3St4 mit ER- und
Golgi-Proteinen. A: Golgi-Lokalisation von CST1-36-GFP. In B-G sind die Doppelfärbungen in CHO-K1-Zellen
von Gal3ST1-HA (rot) und CST1-36-GFP(grün)-B sowie Calnexin (grün)-C, D-E zeigt dies für Gal3ST2-HA, FG für Gal3ST4-HA mit Calnexin (grün; G) und CST1-36-GFP (grün; F). Maßstabsbalken= 20 µm. Die
Überlagerung der einzelnen Bilder ist zusätzlich mit DAPI-Kernfärbung (1:500) zu erkennen. AntikörperVerdünnung: Calnexin 1:300, 12CA5 1:500. Dargestellt ist ein repräsentatives Ergebnis von drei Versuchen.
131
3 Ergebnisse
3.3.5 Zusammenfassung der Ergebnisse zur subzellulären Lokalisation der CST
Die
biochemischen
Untersuchungen
sowie
die
Immunfluoreszenz-Analyse
mittels
verschiedenen subzellulären Markern zeigten, dass durch die Entfernung der MembranDomäne und weitere Deletionen am N-Terminus der CST es zu keiner Sekretion in den
Zellkultur-Überstand kam.
Es konnte zudem auch durch die Herstellung der Fusionsproteine AChE-Furin-lCST und
Seap-Furin-lCST keine gesteigerte Sekretion in den Zellkultur-Überstand festgestellt werden.
Des Weiteren besitzen die Proteine PLP und MAL keinen Einfluss auf den Transport der
39CST aus dem ER.
Außerdem konnte keine Veränderung der Lokalisation des Fusionsproteins DPPIV(TM)39CST-HA festgestellt werden.
Die homologen humanen Sulfotransferasen befinden sich ebenso wie die murine CST, bei
einer Überexpression in der Zelle, zum größten Teil im ER.
132
4 Diskussion
4. Diskussion
"Lysosomale Speicherkrankheiten" sind zurückzuführen auf Defekte von lysosomalen und
nicht-lysosomalen Proteinen, wodurch es zur Akkumulation von Komponenten (z. B. vom
Proteinen und Lipiden) kommt, die normalerweise in den Lysosomen abgebaut werden.
Besonders schwerwiegend ist die Akkumulation fehlerhaft abgebauter Proteine im
Nervensystem, da eine Fehlfunktion des Nervensystems stets mehrere Körperfunktionen
betrifft.
Eine bislang nicht behandelbare lysosomale Speicherkrankheit, die hauptsächlich das
Nervensystem
betrifft,
ist
die
metachromatische
Leukodystrophie
(MLD).
Die
Funktionsschädigung liegt hierbei im lysosomalen Enzym Arylsulfatase A (ASA), das am
Abbau von 3-O-Sulfogalactosylceramid (Sulfatid) beteiligt ist. Sulfatid ist ein polares
Glykolipid, das hauptsächlich in der Myelin-Scheide des Nervensystems vorkommt.
Aufgrund der ASA-Defizienz kommt es zu einer Akkumulation von Sulfatid in den
Lysosomen, wodurch eine progressive Demyelinisierung und des Weiteren charakteristische
neurologische Symptome auftreten.
Durch diese Arbeit sollten mit Hilfe verschiedener Maus-Modelle weitere Einblicke in die
MLD erhalten werden. Hierbei galt der Aufklärung der Effekte durch Sulfatid-Akkumulation
ein besonderes Interesse.
133
4 Diskussion
4.1
Sulfatid-Akkumulation in Neuronen von ASA- und ASA/ApoEdefizienten Mäusen
Zurzeit ist noch wenig bekannt, welchen Effekt eine erhöhte Sulfatid-Speicherung auf die
verschiedenen Zell-Funktionen hat. Durch die Herstellung eines ASA-defizienten
Mausmodells
(Hess
et
al.,
1996)
wurden
neue
Möglichkeiten
geschaffen,
die
Speicherkrankheit auf zellulärer und molekularer Ebene zu studieren und zu verstehen. ASAKnockout-Mäuse sind unfähig, Sulfatid abzubauen und weisen eine intralysosomale
Lipidspeicherung auf. Die Lokalisation der Lipidspeicherung in den neuronalen und nichtneuronalen Geweben der Mäuse ist vergleichbar mit der bei MLD-Patienten beschriebenen
Lipidose (von Figura et al., 2001). Verschiedene Arbeitsgruppen konnten am MLDMausmodell eine Sulfatid-Akkumulation in Astrozyten, Oligodendrozyten und Neuronen
nachweisen (Molinder-Melin et al., 2004; Wittke et al., 2004). Außerdem zeigten die
Purkinje- und Glia-Zellen im Kleinhirn morphologische Veränderungen (D´Hooge et al.,
1999). Zudem wurde eine Demyelinisierung im akustischen Ganglion beobachtet, die im
Alter von 6 bis 12 Monaten auftritt (D´Hooge et al. 1999a; Coeven et al., 2001).
Erstaunlicherweise zeigen die ASA-Knockout-Tiere im Vergleich zu den MLD-Patienten aber
einen wesentlich milderen Phänotyp. Die Mäuse haben eine normale Lebensdauer (vgl. Abb.
3.1) und zeigen auch keine weit verbreitete Demyelinisierung (Gieselmann et al., 1998).
Sulfatid kommt zwar überwiegend in der Myelin-Scheide der Axone vor, seine de novoSynthese erfolgt aber in den Oligodendrozyten (Svennerholm et al., 1992; Vos et al., 1990).
Sulfatid wurde allerdings auch innerhalb von Neuronen gefunden (Raghavan & Kanfer, 1972;
Wittke et al., 2004). Auf welche Weise Sulfatid zu den Neuronen gelangt oder ob es dort
endogen synthetisiert wird, ist noch nicht geklärt. Han und Kollegen beschrieben in diesem
Zusammenhang ein denkbares Modell, mit dem sie postulieren, dass der Transport von
Sulfatid über das ApoE-enthaltende HDL-Lipoprotein (high density lipoprotein-like
lipoprotein) erfolgt (Han et al., 2003 und 2007). ApoE-assoziierte Lipoprotein-Partikel
werden von den Astrozyten freigegeben und nehmen nach diesem Modell Sulfatid von der
Myelin-Scheide über einen sogenannten „kiss and run“-Mechanismus auf. Mittels Endozytose
durch den überwiegend in den Neuronen exprimierten LDL (low density lipoprotein)–
Rezeptor oder den LDL related-Protein-Rezeptor können die ApoE-assoziierten LipoproteinPartikel, die Sulfatid enthalten, in die Neuronen aufgenommen werden (Han et al., 2007;
Cheng et al., 2008).
134
4 Diskussion
Ziel dieser Arbeit war die Analyse der Sulfatid-Akkumulation in den Neuronen von ASAund ASA/ApoE-Knockout-Mäusen. Dabei sollte genau untersucht werden, ob eine ApoEDefizienz einen Effekt auf die neuronale Sulfatid-Anreicherung hat.
Die hierzu erzeugten Doppel-Knockout-Mäuse sollten im Vergleich mit ASA-KnockoutMäusen Aufschluss darüber geben, ob der Sulfatid-Transport in die Neuronen mittels des
ApoE-Proteins erfolgt.
Die Doppel-Knockout-Mäuse zeigten gegenüber ASA-Knockout-Mäusen keinen deutlichen
Unterschied in der Lebenszeit. Jedoch war die maximale Lebenszeit bei beiden KnockoutStämmen im Vergleich zu den Wildtyp-Tieren verkürzt. Wenige Tiere wurden älter als
anderthalb Jahre. Die ApoE-Defizienz scheint dabei keine Auswirkungen auf den früheren
Tod der Tiere zu haben, denn Kontrolltiere mit ApoE-Defizienz überleben im Vergleich zu
den Wildtyp-Tieren ebenso lang.
Die Lipidanalyse des Gesamtgehirns und des Cortex mittels TLC ergab im Alter von einem
Jahr zunächst keine relevante Erhöhung des Sulfatid-Gehalts in den ASA- und ASA/ApoEKnockout-Mäusen. Wie literaturgemäß zu erwarten war (Gieselmann et al., 1998;
Yaghootfam et al., 2005), zeigte die Lipidanalyse des Cortex und des restlichen Gehirns bei
ASA-Knockout-Mäusen
im
Alter
von
18-24
Monaten
einen
signifikant
erhöten
Sulfatidgehalt. Dies wurde ebenfalls bei den ASA/ApoE-Knockout-Stämmen im Alter von
18-24 Monaten festgestellt. Ein wesentlicher Unterschied in der Sulfatidmenge zwischen
ASA- und ASA/ApoE-Knockout-Mäusen war jedoch nicht vorhanden. Um das in der
Dünnschichtchromatographie erkennbare Sulfatid besser quantifizieren zu können, wurde die
ESI-MS-Technik verwendet. Außerdem gab es Anhaltspunkte dafür, dass verschiedene
Sulfatid-Spezies in unterschiedlichen Zellen vorkommen. So kommt Sulfatid mit kurzkettigen
Fettsäuren verstärkt in Astrozyten und in Neuronen vor (Isaac et al., 2006), langkettiges
Sulfatid hingegen im Myelin (Vos et al., 1994). Eine genaue Untersuchung mit Hilfe des ESIMS konnte eine präzise Zusammensetzung der Sulfatid-Spezies und der Menge an Sulfatid in
den beiden untersuchten Bereichen liefern. Die Ergebnisse der Dünnschichtchromatographie
konnten massenspektrometrisch bestätigt werden. Dabei stellte sich heraus, dass C24:1kettiges Sulfatid ebenso wie C18:0-kettiges Sulfatid im gesamten Gehirn signifikant erhöht
waren. Aufgrund der wesentlich besseren Auftrennung der Sulfatidspezies mit Hilfe der ESIMS-Technik war bereits im Alter von einem Jahr ein erhöhter Gehalt an C18:0-kettigem
Sulfatid im Cortex festzustellen. Dazu ist es erwähnenswert, dass die subzelluläre
Lokalisation der Glykosphingolipide ihre Fettsäuren-Kettenlänge bestimmt, d. h. die
Zuckerreste bleiben stets konstant, wohingegen die Fettsäuren-Kettenlängen innerhalb
135
4 Diskussion
desselben Moleküls variieren können (Isaac et al., 2006). Das Sulfatid der Myelinscheiden hat
beispielsweise mehrheitlich langkettige Fettsäuren (Vos et al., 1994). Daher könnte der
erhöhte C24:1-Sulfatid-Wert im Cortex und im restlichen Gehirn bei den ASA- und
ASA/ApoE-Knockout-Mäusen aus dem Myelin stammen. Diese Vermutung wird bestätigt
durch bereits durchgeführte Analysen an den ASA-Knockout-Mäusen, die zeigten, dass eine
Akkumulation von Sulfatid im Myelin von Oligodendrozyten und Schwann-Zellen zu finden
ist (Coenen et al., 2001; Taylor et al., 2002; Saravanan et al., 2007). Passend hierzu wurde
innerhalb von Astrozyten und Neuronen Sulfatid gefunden, das vorherrschend eine
Stearinsäure (C18:0) besitzt (Bertson et al., 1998; Issac et al., 2002, Pernber et al., 2004). Dies
und die Ergebnisse aus der ESI-MS lassen darauf schließen, dass der gemessene erhöhte
C18:0-Sulfatid-Gehalt auf eine Akkumulation von Sulfatid innerhalb von Neuronen
zurückzuführen ist. Verschiedene Studien an ASA-Knockout-Mäusen bestätigen diese
Vermutung, denn immunhistochemische und histochemische Analysen zeigten eine massive
Anreicherung an Sulfatid in Neuronen und auch in Astrozyten bei ASA-defizienten Mäusen.
(Hess et al., 1996; Molander-Melin et al., 2004; Wittke et al., 2004, eigene Beobachtungen).
Es ist daher davon auszugehen, dass ein großer Anteil des C18:0-kettigen Sulfatids von den
Neuronen stammt und diese unter normalen Bedingungen Sulfatid selbst synthetisieren.
Solange jedoch das entsprechende Abbau-Enzym, in diesem Fall ASA, vorhanden ist, kommt
es nicht zu einer Sulfatid-Anreicherung. Indessen sollte jedoch berücksichtigt werden, dass
kurzkettige Fettsäuren von Sulfatid in frühen Stadien der Myelinisierung zu finden sind (von
Figura et al., 2001) und das Sulfatid mittels eines Transportproteins, z. B. durch das ApoEProtein, zu den Neuronen transportiert werden könnte (Han et al., 2003 und 2007; Cheng et
al., 2008). Die Daten zeigen aber deutlich, dass ebenfalls ein signifikant erhöhter Gehalt an
C18:0-kettigem Sulfatid bei den ASA/ApoE-Knockout-Mäusen im Vergleich zu den WildtypMäusen vorhanden war, aber kein wesentlicher Unterschied zu den ASA-Knockout-Mäusen
besteht. Im Gegensatz zu Han (2004) konnte in der vorliegenden Arbeit im Cortex ein Jahr
alter ApoE-Knockout-Mäuse keine Erhöhung des Sulfatid-Gehaltes nachgewiesen werden.
Sowohl der Sulfatid-Gehalt des Cortex, wie auch der des restlichen Gehirns zeigten bei den
ApoE-Knockout-Mäusen keinen Unterschied zu den Wildtyp-Mäusen. Auch konnte bei den
Doppel-Knockout-Mäusen kein signifikanter Unterschied zu den ASA-Knockout-Mäusen im
Cortex und im restlichen Gehirn nachgewiesen werden. Lediglich ein etwas geringerer C24:1Sulfatid-Gehalt war bei den ASA/ApoE-Knockout-Mäusen festzustellen, obwohl eine
Zunahme an Sulfatid erwartet wurde.
136
4 Diskussion
Die Resultate deuten darauf hin, dass ApoE keine wesentliche Rolle bei dem Transport von
Sulfatid zu den Neuronen zukommt.
Die Intensität der Sulfatid-Akkumulation sowohl bei der humanen metachromatischen
Leukodystrophie (MLD) und den ASA-Knockout-Mäusen variiert von einem Zelltyp zum
anderen. Um zu bestätigen, dass Sulfatid tatsächlich in den Neuronen der ASA-KnockoutMaus und vor allem auch in der Doppel-Knockout-Maus angereichert ist, wurden
immunhistochemische und histochemische Untersuchungen durchgeführt.
Durch verschiedene Studien sowie die in dieser Arbeit durchgeführten Untersuchungen
konnte Sulfatid-Speicherung in unterschiedlichen Bereichen des Gehirns detektiert werden
(Molinder-Melin et al., 2004; Wittke et al., 2004; diese Arbeit). Die Sulfatid-Akkumulation
konnte durch eine histochemische Färbung mittels Alcianblau vor allem in der Medulla
oblangata und der Pons (Wittke et al., 2004; diese Arbeit), sowie in einigen Bereichen des
basalen Vorderhirns und des Mesenzephalons festgestellt werden (Wittke et al., 2004).
Desweiteren konnte Sulfatid in den Oligodendrozyten und Neuronen bei jungen Tieren, sowie
in den aktivierten Mikroglia-Zellen bei den älteren Knockout-Tieren nachgewiesen werden.
Wegen des polyanionischen Charakters von Sulfatid-Aggregaten ist eine Färbung mit einem
kationischen Farbstoff für deren histochemische Anfärbung besonders geeignet. Mit Hilfe von
Alcianblau kann eine Anfärbung von sulfatierten Komponenten erreicht werden (Schott et al.,
2001). Die Sulfatid-Anreicherung wurde zunächst so durch die Alcianblau-Färbung
eingefärbt, wie sie auch bei Lüllmann-Rauch et al. (2001) beschrieben ist. Im Anschluß an
diese Färbung wurde mit spezifischen Antikörpern, die gegen die Neuronen-spezifischen
Proteine HRP-3, NSE und ß-III-Tubulin gerichtet waren, der Nachweis für die SulfatidAkkumulation in den neuronalen Zellen erbracht.
Vor allem in den Bereichen der Medulla oblongata und der Pons sowie im Cortex konnte bei
den ASA-Knockout- und bei den Doppel-ASA/ApoE-Knockout-Mäusen bereits im Alter von
einem Jahr Sulfatid-Akkumulation nachgewiesen werden. In der Medulla oblongata wurde
eine verstärkte Zunahme an Sulfatid-akkumulierenden Neuronen bei beiden Knockout-MausStämmen im Alter von 18-24 Monaten festgestellt. Diese Ergebnisse wurden auch mit Hilfe
von Immunfluoreszenz-Analysen bestätigt. Unter Einsatz des SulphI-Antikörpers, der
spezifisch an Sulfatid bindet (Fredmann et al., 1988), wurde eine Zunahme an Sulfatidpositiven Neuronen bei beiden Knockout-Stämmen beobachtet. ASA- und ASA/ApoEKnockout-Tiere zeigten eine ähnliche Verteilung der angefärbten Zellen in den untersuchten
Hirnbereichen sowie eine ähnliche Farbintensität.
137
4 Diskussion
Vergleicht man die Resultate der histologischen Untersuchung mit denen der Lipidanalyse,
läßt sich zusammenfassend sagen, dass ApoE keinen nennenswerten Anteil am Transport von
Sulfatid zu den Neuronen hat, denn zum einen weisen die ApoE-Knockout-Mäuse keinen
wesentlichen Unterschied zu den Wildtyp-Mäusen auf, zum anderen zeigen die ASA/ApoEDoppel-Knockout-Mäuse keinen entscheidenden Unterschied zu den ASA-Knockout-Tieren.
Beide besitzen eine erhöhte Menge an C18:0-Sulfatid und zeigen Sulfatid-angereicherte
Neuronen im Cortex und der Medulla oblongata.
Im Umkehrschluss könnte dies jedoch bedeuten, dass die lysosomale Speicherung in den
Neuronen aus dem intra-neuronalen Sulfatid-Umsatz selbst stammt. Die quantitativen
Unterschiede zwischen den Gehirn-Bereichen lassen vermuten, dass der Sulfatid-Gehalt
innerhalb der jeweiligen Neuronen unterschiedlich ist.
Es ist jedoch nicht auszuschließen, dass das Sulfatid auf anderen Wegen zu den Neuronen
transportiert wird. Eine Möglichkeit wäre die lysosomale Exozytose. Es wurde gezeigt, dass
Lysosomen sezerniert werden (Reddy et al., 2001; Gerasimenko et al., 2001). Anhand von
Studien an primären Nieren-Zellen der ASA-Knockout-Maus wurde belegt, dass Lysosomen
die Sulfatid-Anreicherung aufweisen, durch Ca2+-Stimulation sezerniert werden (Klein et al.,
2004). Bei MLD-Patienten wurde bereits extrazelluläres Sulfatid im Urin und auch in der
Zerebrospinalflüssigkeit gefunden (von Figura et al., 2001). Somit wäre durchaus die
Möglichkeit gegeben, dass Sulfatid durch lysosomale Sekretion zu anderen Zellen wie z. B.
Neuronen gelangt, und dort wiederum Sulfatid-Anreicherungen verursachen kann.
Des Weiteren ist der Transport von Sulfatid zu den Neuronen mit Hilfe von Exosomen
möglich. Exosomen sind endosomal-abgeleitete Mikrovesikel und wurden erstmals durch Pan
und Kollegen beschrieben. Sie spielen eine wichtige Rolle bei der Entfernung von unnötigen
Membranbestandteilen während der Entwicklung von Retikulozyten (Pan et al., 1985).
Weitere Untersuchungen ergaben, dass Exosomen ebenfalls für die interzelluläre
Kommunikation verantwortlich sind, indem sie den Transfer von Molekülen von einer Zelle
zur
anderen
ermöglichen.
Interessanterweise
sezernieren
auch
myelinisierende
2+
Oligodendrozyten Exosomen in einer Ca -abhängigen Art und Weise. Diese Exosomen
enthalten neben den wichtigsten Myelin-Faktoren wie MBP (Myelin und Lymphozyten
Protein) und PLP (Proteolipid Protein), auch die Myelin-Lipide GalCer und Sulfatid (KrämerAlbers et al., 2007). Überschüssige Myelin-Komponenten werden über Exosomen-Transport
ausgeschieden. In gleicher Weise könnte man die Abgabe von Membran-Bestandteilen des
endosomalen Kompartiments über Exosomen als eine Art Hilfe ansehen, mit der sich die
Oligodendrozyten vor der schädlichen Wirkung einer Überproduktion oder Akkumulation
138
4 Diskussion
durch ein Abbau-Defizit von Myelin-Komponenten wie Sulfatid bewahren. Auf diese Weise
wäre es möglich, dass Oligodendrozyten der ASA-Knockout-Mäuse oder der MLD-Patienten
das angereicherte Sulfatid über die Exosomen sezernieren. Über Exosomen sezerniertes
Sulfatid könnte wiederum über Phagozytose von Neuronen aufgenommen werden, so dass es
zu der beschriebenen Anreicherung von Sulfatid in den Neuronen kommt.
Ob neuronales Sulfatid nun durch Neuronen endogen synthetisiert wird, oder über
extrazelluläre Wege in die Neuronen gelangt, konnte in dieser Arbeit nicht eindeutig geklärt
werden und bedarf weiterer Untersuchungen. Allerdings spricht der erhöhte C18:0-kettige
Sulfatid-Wert bei den Knockout-Stämmen für eine Anreicherung von endogen synthetisiertem
Sulfatid in den Neuronen, da kurzkettiges Sulfatid spezifisch für Neuronen ist (Issac et al.,
2006; Pernber et al., 2004).
Des Weiteren bleibt unklar, welche neurologischen Konsequenzen die Sulfatid-Akkumulation
in Neuronen haben könnte. So zeigen transgene CGT-Mäuse, welche die CerebrosidGalaktosyltransferase unter dem neuronalen Promotor Thy-1 exprimieren, zum einen einen
erhöhten Gehalt an C18:0-kettigem Sulfatid und zum anderen audiogene Anfälle.
Die funktionellen Konsequenzen neuronaler Sulfatid-Anreicherung lassen verschiedene
Spekulationen zu. Über ASA-Knockout-Mäuse wurde berichtet, dass neuromotorische
Defizite, Lernbehinderung und mit fortgeschrittenem Alter auch Tremor auftreten (D´Hooge
et al., 1999 und 2001; Hess et al., 1996). Es ist schwierig zu sagen, wie und in welchem
Umfang diese funktionellen Defekte direkt den spezifischen Regionen des Gehirns
zugeschrieben werden können, da die Sulfatid-Anreicherung in vielen Zelltypen vorkommt
und die Neuronen auf allen Ebenen des ZNS vom Cortex bis zu den efferenten Nervenzellen
beeinflusst.
Die Akkumulation von Sulfatid ist nicht nur auf die lysosomalen Kompartimente beschränkt,
sondern wurde ebenso im Myelin (Saranvan et al., 2004) und in Neuronen (Pernber et al.,
2002; Wittke et al., 2004; Molander-Melin et al., 2004) beobachtet, wo sich das Sulfatid in
der Plasmamembran befindet. Es stellt sich nun die wichtige Frage, in welchem Umfang die
intrazelluläre lysosomale Speicherung oder die erhöhte Menge an Sulfatid in der
Plasmamembran in die Pathogenese der MLD-Krankheit involviert ist. Insofern wird es als
wesentlich befunden, fortführende Studien der Neuronen anzuschließen, um weitere Einblicke
in die Lipidzusammensetzung und Funktion von Sulfatid in der Plasmamembran zu erhalten.
139
4 Diskussion
4.2
Analyse der Thy-1 CGT-Mäuse: C18-langkettiges Sulfatid löst letale
audiogene Anfälle in transgenen Thy-1 CGT-Mäusen aus
Sofern es das Muster der Lipidspeicherung betrifft, ähnelt das ASA-defiziente Maus-Model
der humanen Metachromatischen Leukodystrophie (Wittke et al., 2004). Allerdings
entwickeln die Mäuse nicht die schwerwiegenden neurologischen Symptome wie es im
fortgeschrittenen Stadium der humanen Krankheit der Fall ist (Gieselmann et al., 1998).
Die Sulfatid-Akkumulation ist nicht nur auf die Oligodendrozyten und Schwann-Zellen
beschränkt, sondern wurde ebenfalls in anderen Glia-Zellen und in Neuronen gefunden (von
Figura et al., 2001; Pernber et al., 2002; Isaac et al., 2006). Jedoch ist die physiologische
Rolle von Sulfatid in diesen Zellen noch völlig unbekannt. Die Sulfatid-Anreicherung in den
Neuronen könnte in die Pathogenese der MLD involviert sein. Es ist z. B. bekannt, dass sich
bei MLD im Nerven-System Sulfatid-Anreicherungen in den myelinisierenden Zellen und in
Makrophagen befinden, die Myelin-Ablagerungen aufgenommen haben. Außerdem wurde bei
MLD-Patienten (wie bei den ASA-defizienten Mäusen) ebenfalls eine Anreicherung von
Sulfatid in Neuronen gefunden (Wittke et al., 2004; Molander-Melin et al., 2004).
MLD-Patienten mit spät infantiler und adulter Form der MLD leiden oft an epileptischen
Anfällen (Wang et al., 2001). Auslöser hierfür könnte zum einen die Demyelinisierung des
zentralen Nervensystems sein. Zum anderen könnten die Anfälle auch das Produkt einer
neuronalen Fehlfunktion aufgrund eines erhöhten Sulfatid-Gehalts in der Plasmamembran der
Neuronen sein. Anhand des MLD-Maus-Modells wurde bereits nachgewiesen, dass Sulfatidakkumulierende Neuronen im Spiral-Ganglion des Innenohres, dem Cochlear Nucleus und
ventral Cochlear Nucleus im Bereich des auditorischen Signalweges degenerieren (D´Hooge
et al., 1999; Wittke et al., 2004). Weiterhin wurden Abweichungen bei der cortikalen
Elektroenzephalografie (EEG) nachgewiesen, die sich in einer abnormalen Zunahme der
Spannungsamplitude bei ASA-defizienten-Mäusen äußerte, obwohl bei den ASA-defizienten
Tieren noch keine epileptischen oder audiogenen Anfälle beobachtet werden konnten
(Eckhardt, 2007). Es ist jedoch durchaus denkbar, dass die Entstehung audiogener Anfälle
durch eine gesteigerte Sulfatid-Synthese und Akkumulation in den Neuronen intensiviert
wird.
Aufgrund dessen wurde der Frage nachgegangen, welche physiologischen Auswirkungen eine
Neuronen-spezifische Anreicherung von Sulfatid hervorrufen würde. Zu diesem Zweck
wurden transgene Mäuse erzeugt, welche die Cerebrosid-Galaktosyltransferase (CGT) unter
dem neuronalen Promotor Thy-1.2 überexprimieren. Die Aktivität des Enzyms CGT führt zur
140
4 Diskussion
Bildung von Galaktosyl-Cerebrosid, das durch das Enzym Cerebrosid-Sulfotransferase (CST)
zu Sulfatid umgewandelt wird.
Es konnte festgestellt werden, dass, abhängig von ihrem genetischen Hintergrund (C57BL/6
und C57BL/6/129Ola), diese transgenen CGT-Mäuse eine signifikant verkürzte Lebensspanne
aufwiesen und zum Teil sehr plötzlich starben. Außerdem wurde eine erhöhte Rate an
audiogenen Anfällen verzeichnet, die teilweise letale Auswirkungen hatten. Audiogene
Anfälle können in verschiedenen Mausstämmen induziert werden. In der Literatur werden
audiogene Anfälle klassifiziert in wildes Hin- und Herlaufen sowie klonische und tonische
Anfälle (Henry, 1967; Schreiber & Graham, 1976). Das wilde Hin- und Herlaufen ist eine Art
Ausbruch von unkontrolliertem Rennen und tritt als erstes Sympton auf, gefolgt vom
Umfallen der Maus und starkem Zittern (klonisch) und anschließendem Ausstrecken der
Zunge (tonisch). Normalerweise werden Mausstämme, die keine Anfälle bekommen, also
zunächst resistent gegen akustische Reize sind, durch intensive akustische Schallbelastung
während der postnatalen neuronalen Entwicklung sensibilisiert gegenüber akustischen
Signalen. Dieser Vorgang wird auch als akustisches „priming“ beschrieben (Henry, 1967;
Pierson & Liebmann, 1992; Ross et al., 2001). Im Gegensatz dazu ist bei den transgenen
CGT-Mäusen, welche die CGT nur in den Neuronen überexprimieren, ein akustisches
„priming“ zur Auslösung audiogener Anfälle nicht notwendig. Denn die transgenen CGTMäuse sind von Geburt an sehr geräuschempfindlich und weisen letale audiogene Anfälle
bereits nach einer schwachen akustischen Stimulation (z. B. Schlüsselklirren) auf. Die
Ergebnisse dieser Arbeit weisen darauf hin, dass Auslöser hierfür die Überexpression des
Transgens CGT in den Neuronen und die damit verbundene Sulfatid-Anreicherung ist. Eine
Entwicklungsstörung der Neuronen, wie beim akustischen „priming“ ist unwahrscheinlich, da
der Thy-1.2 Promotor erst in reifen Neuronen aktiv wird (Caroni, 1997) und die Morphologie
des Gehirns der transgenen CGT-Tiere normal ist.
Mit Hilfe der in situ-Hybridisierung konnte die CGT-Expression im Vorderhirn, im
Stammhirn und im Rückenmark nachgewiesen werden. Des Weiteren konnte in den GehirnBereichen des Hippocampus, des Cortex und im Colliculus inferior (CI) das mCGTTranskript detektiert werden. Vor allem in der Gehirnregion des CI war ein intensives in situHybridisierungs-Signal erkennbar, das auch mit einer erhöhten c-Fos-Expression einherging.
C-Fos gehört zur Familie der immediate-early-genes Transkriptionsfaktoren und ist bei
neuronaler Aktivität hochreguliert (Morgan et al., 1987; Morgan & Curran, 1989; Kovacs,
2008). Um die auffällig erhöhte neuronale Aktivität nachzuweisen, die die transgenen CGTMäuse zeigten, wurde eine histochemische Färbung mit einem c-Fos-spezifischen Antikörper
141
4 Diskussion
durchgeführt. Eine erhöhte c-Fos-Expression im Bereich des CI ist von besonderem Interesse,
denn der Colliculus inferior zählt zu den auditorischen Strukturen des Gehirns. In der
Literatur finden sich bereits Hinweise darauf, dass der CI ein Schlüsselpunkt für die Initiation
von audiogenen Anfällen ist und möglicherweise auch audiogene Anfälle aller Art von dort
ausgehen können (Clough et al., 1997; Kwon & Pierson, 1997; Morgan & Curran, 1991;
Faingold & Casebeer, 1999; Garcia-Cairasco 2002; Kai & Niki, 2002). Ohne akustische Reize
wurde bei den transgenen CGT-Mäusen eine 2-fache Erhöhung der c-Fos-Expression in
Neuronen festgestellt. Allerdings erhöhte sich nach einem akustischen Reiz (Schlüsselklirren)
die Anzahl der c-Fos-positiven-Neuronen um das 6-fache bei den transgenen CGT-Mäusen im
Vergleich zu den Wildtyp-Mäusen. Dies zeigt deutlich, dass bei den transgenen Tieren eine
stark erhöhte neuronale Aktivität vorhanden ist, die sich in audiogenen Anfällen äußert.
Möglicherweise wird dies durch die gesteigerte Expression der CGT und die damit
verbundenen erhöhte GalCer und/oder Sulfatid-Menge verursacht.
Eine Rolle bei diesen Anfällen könnte zum einen das GABAerge (γ-Aminobuttersäure) oder
das glutamaterge neuronale System spielen. Es wurde beispielsweise bereits festgestellt, dass
die Hemmung der GABAergen Neuronen im Colliculus inferior eine entscheidende Funktion
bei der Induktion audiogener Anfälle einnimmt (Faingold et al., 2000 und 2002). GABA
nimmt unter den inhibitorischen Neurotransmittern des zentralen Nervensystems eine
wichtige Aufgabe bei der Kontrolle neuronaler Schaltkreise ein. Es entfaltet seine
inhibitorische Wirkung durch Hyperpolarisation der Membran nachgeschalteter Neuronen
(postsynaptsiche Inhibition). Störungen der GABAergen Transmission spielen eine
wesentliche Rolle bei verschiedenen neurologischen Erkrankungen.
Kommt es zu einer Reduzierung der GABAergen Neurotransmission führt dies beispielsweise
bei GEPR-Ratten (genetically epilepsy-prone rats) zu audiogenen Anfällen (Faingold et al.,
1989 und 1994). Die GABA-vermittelte Inhibition ist ein wichtiger Bestandteil des
akustischen Antwort-Musters der Colliculus inferior-Neuronen. Allerdings spielt die
exzitatorische Neurotransmission vermittelt durch den Neurotransmitter Glutamat ebenfalls
eine entscheidende Rolle bei der Reaktion der Colliculus inferior-Neuronen auf einen
akustischen Reiz. Verschiedene neurochemische wie auch histologische Untersuchungen
belegen, dass Glutamat eine signifikante Rolle bei der exzitatorischen Weiterleitung im
Colliculus inferior einnimmt (Caicedo & Eybalin, 1999; Feliciano & Potashner, 1995; Liao et
al., 2000; Suneja et al., 1995). Kommt es nun zu Veränderungen des Neurotransmitters
Glutamat, resultiert dies möglicherweise in einem stark erhöhten neuronalen Feuern der
Colliculus inferior-Neuronen, wodurch wiederum die Anfälle als Reaktion auf einen
142
4 Diskussion
intensiven akustischen Reiz ausgelöst werden (Faingold et al., 1991a, b und 2000; Li et al.,
1999; Zhang & Kelly, 2001).
Wie kommt es nun zu den neuronalen Störungen, die sich evtl. auf die durch GABA bzw.
Glutamat induzierte neuronale Hyperpolarisation bei den transgenen CGT-Tieren auswirkt?
Die Untersuchungen der (neuronalen) Plasmamembran zeigten spezifisch einen signifikant
erhöhten Wert an C18:0-kettigem Sulfatid bei den transgenen CGT-Mäusen. Ebenfalls war
bei den Doppel-transgenen Mäusen CST/CGT der Gehalt an Sulfatid im Vergleich zu den
Wildtyp- und den einfach transgenen-Mäusen signifikant erhöht.
Da spezifisch der Gehalt an C18:0-Sulfatid in den Neuronen als stark erhöht nachgewiesen
wurde, wird
ls mögliche Folge der C18:0-Sulfatid-Akkumulation ein Effekt auf die
spannungsabhängigen Ionen-Kanäle postuliert. Es wurde bereits nachgewiesen, dass Sulfatid
in Plasmamembranen lokalisiert (Vos et al., 1994; Bansal et al., 1999) und in den so
genannten
Detergenzien-unlöslichen
Mikrodomänen
(„Lipid-Rafts“)
angereichert
ist
(Blomqvist et al., 2003). Während Intergral-Membranproteine in das Lipid-Milieu der
Plasmamembran fest verankert sind, werden die Ionen-Kanäle durch dynamische
Veränderungen im Mikromilieu der Membran moduliert (Barrates, 2002; Tilman & Cascio,
2003). Insofern ist es denkbar, dass eine Störung des Membran-Milieus aufgrund von
Sulfatid-Anreicherung in der neuronalen Plasmamembran einen Effekt auf die Funktion, die
Regulation und den Transport einiger Membran-Proteine (z. B. Ionen-Kanäle und/oder
Lipidtransporter) hat. Für die Sphingomyelinase D wurde bereits gezeigt, dass es durch die
Freisetzung von negativ geladenen Ceramid-1-Phosphat des Sphingomyelins zur Aktivierung
der K+-Kanäle kommt (Ramu et al., 2006). In Glia-Zellen von ASA-defiezenten Mäusen
wurde bereits nachgewiesen, dass MAL (Myelin und Lymphozyten Protein) Sulfatid bindet
und folglich in den lysosomalen Kompartimenten fehl-lolkalisiert wird (Saravanan et al.,
2004). Nachfolgende Studien zeigten, dass Sulfatid die Aktivität der Na+/K+-ATPase sowie
verschiedener Kalium-Kanäle beeinflusst (Lingwood et al., 2004 und 2005; Ramu et al.,
2006). Auch konnte eine Beeinflussung der Insulin-Sekretion in Pankreas-Zellen durch die
Modulation der Aktivität des ATP-sensitiven-K+-Kanals (KATP) nachgewiesen werden
(Buschard et al., 2002 und 2006). Hierbei inhibiert Sulfatid die Insulin-Sekretion indem es die
K+-Kanal-Sensitivität
gegenüber
der
ATP-Inhibition
reduziert.
Sulfatid
interagiert
möglicherweise mit Kir6.2, der porenbildenden Untereinheit des KATP-Kanals. Dies ist bereits
für die langkettigen Lipide CoAs (Coenzym-A Ester) und PIPs (PhosphatidylinositolPhosphat), die eine Interaktion mit Kir6.2 eingehen, gezeigt (Schulze et al., 2003). Kir6.2
Kanäle werden in vielen Hirnregionen (inklusive des Colliculus inferior) exprimiert (Dunn143
4 Diskussion
Meynell et al., 1998). Durch die Bindung von ATP an den KATP-Kanal-Komplex erfolgt eine
Schließung des Kanals, was zur Anreicherung von intrazellulärem Kalium führt und eine
Membran-Depolarisation bewirkt. Die Depolarisation durch KATP erhöht wiederum die
Erregbarkeit von Neuronen.
So könnte es im Falle der transgenen CGT-Mäuse durch den erhöhten Anteil an Sulfatid zu
einer Beeinflussung der KATP-Kanäle kommen, indem die ATP-Bindung an den Kanal
reduziert wird, der Kanal hauptsächlich geöffnet bleibt und es somit durch den dauerhaften
Einfluss an Kalium zu einer Membran-Hyperpolarisation kommt. Eine Hyperpolarisation
würde die Erregbarkeit von Neuronen herabsetzen. Handelt es sich bei den betroffenen
Neuronen um GABAerge Neuronen könnte somit deren inhibitorische Wirkung vermindert
und ein audiogener Anfall ausgelöst werden.
Ein weiteres Beispiel für einen durch Sulfatid beeinflussbaren Kanal, der in Neuronen
lokalisiert ist, stellt der Calzium-aktivierte Kalium-Kanal (BKCa-Kanal) dar. Er besitzt eine
große Einzelkanalleitfähigkeit und schützt sozusagen als Notbremse die Neuronen vor einem
zu starken Anstieg der zellulären Calziumkonzentration. Für seine Aktivierung sind jedoch
gewisse Konzentrationen an Calziumionen notwendig. Über eine bimolekulare Kopplung ist
eine Interaktion zwischen dem Calzium- und Kalium-Kanal vorhanden, wodurch die KCaKanäle durch hohe Calziumionen-Konzentrationen aktiviert werden. Damit geht auch eine
schnelle Änderung des Membranpotentials der Nervenzellen einher (Berkerfeld et al., 2006).
Es konnte gezeigt werden, dass Sulfatid eine wichtige Komponente bei der Öffnung von
BKCA-Kanälen ist, indem es die Öffnungsdauer von Calzium- und spannungsabhängigen
Kalium-Ionenkanälen steigert (Chi & Qi, 2006). Da die BKCA-Kanäle an vielen
pathologischen Prozessen beteiligt sind, könnte eine Veränderung der Sulfatid-Menge in der
Plasmamembran wie im Falle der transgenen CGT-Mäuse zu einer neuronalen Dysfunktion
führen, die audiogene Anfälle auslösen könnte.
In Bezug auf die audiogenen Anfälle konnte festgestellt werden, dass zwar transgene CGTMäuse zu audiogenen Anfällen neigen, im Gegensatz dazu sind jedoch transgene CST-Mäuse
nicht von solchen Anfällen betroffen. Es sei jedoch erneut daran erinnert, dass bei den
transgenen CST-Mäusen kein erhöhter Sulfatid-Gehalt festgestellt werden konnte. Allerdings
zeigen die Mäuse, die sowohl CST als auch CGT überexprimieren (Doppel-transgene Mäuse),
eine erhöhte Sensitivität gegenüber audiogener Stimulation. Dies korreliert mit dem erhöhten
Sulfatid-Gehalt in den Neuronen bei den Doppel-transgenen- gegenüber den CGT-transgenenMäusen. Zwar konnte ein Anstieg an C18:0-kettigem GalCer festgestellt werden, der etwa
gleich bei den transgenen CGT- wie auch bei den bei den Doppel-transgenen-Mäusen war,
144
4 Diskussion
jedoch wurde bei den transgenen CGT/CST-Mäusen in der neuronalen Plasmamembran ein
wesentlich höherer Anstieg an C18:0-kettigem Sulfatid im Vergleich zu den transgenen CGTMäusen verzeichnet. Dies deutet darauf hin, dass nicht GalCer sondern Sulfatid für die
Anfälle verantwortlich ist.
Auffällig ist jedoch, dass die transgenen Tiere mit zunehmendem Alter keine audiogenen
Anfälle mehr bekommen. Auch reagieren sie nur schwach bis gar nicht auf Geräusche in ihrer
Nähe. Dies könnte darauf hindeuten, dass die Mäuse mit fortschreitendem Alter eine
Degeneration im Bereich des spiralen Ganglions erlitten haben und taub geworden sind. Bei
den ASA-defizienten Mäusen liegt ein ähnlicher Fall vor. ASA-Knockout-Mäuse, die eine
beträchtliche Menge an Sulfatid in den Neuronen akkumulieren (Wittke et al., 2004, siehe
Ergebnisse 3.1), weisen keine audiogenen Anfälle auf (Dr. M. Eckhardt, persönliche
Mitteilung). Ein möglicher Grund hierfür ist der frühe Hörverlust, der auf die relativ frühe
Degeneration der spiralen Ganglion-Zellen des Innenohres und der Neuronen des
auditorischen Signalsystems bei ASA-defizienten Mäusen zurückzuführen ist (Coenen et al.,
2001; D´Hooge et al., 1999). Der Verlust des Gehörs ist bei vielen Nagetieren zu finden, die
anfällig sind für audiogene Anfälle, wie zum Beispiel die DBA/2-Mäuse (Willott & Turner,
2000). Ebenfalls konnte bei zwei Epilepsie-Ratten-Stämmen der GEPR-3s und GEPR-9s eine
erhöhte Gehör-Reizschwelle nachgewiesen werden (Faingold et al., 1986a, b und 1990).
Allerdings zeigte Faingold (2002) auch, dass bei audiogenen Anfall-Formen der frühe
Gehörverlust mit einer Änderung der Neurotransmitter im Colliculus inferior einhergeht. Dies
könnte als eine Art kompensatorischer Mechanismus als Ausgleich für einen verringerten
akustischen Eingang wirken.
Ähnliche Befunde wie die audiogenen Anfälle wurden in Mäusen beschrieben, die
Veränderungen in den Gangliosiden aufweisen. Ganglioside sind Glykosphingolipide, die in
großer Menge im zentralen Nervensytem vorhanden sind. Sie spielen eine entscheidende
Rolle bei der Entwicklung und der Funktion des zentralen Nervensystems. So sind
Ganglioside wichtig für die Stabilisation der paranodalen Verbindungen. Gangliosiddefiziente-Mäuse entwickeln mit fortschreitendem Alter Störungen in der paranodalen Region
(Yamashita et al., 2005). Doppel-Knockout-Mäuse, denen die Gangliosid-GD3-Synthase und
die GalNAcT (ß 1,4-N-Acetyl-Galactose-Aminyltransferase) fehlen, synthetisieren GM3 als
Hauptgangliosid. Der GM3-Gehalt ist bei diesen Mäusen im Vergleich zu den WildtypKontrollen stark erhöht. GD3/GalNAcT-Knockout-Mäuse zeigen ein ähnliches Verhalten wie
die transgenen CGT-Mäuse, in dem Sinn, dass sie sehr anfällig gegenüber akustischen Reizen
sind, die letztlich zu letalen audiogenen Anfällen führen (Kawai et al., 2001). Eine Analyse
145
4 Diskussion
der Ganglioside von transgenen CGT-Mäusen ergab jedoch keinen signifikanten Anstieg an
GM3
oder
anderen
Gangliosiden.
Ferner
wurde
auch
keine
Veränderung
der
Lipidzusammensetzung bei den GD3/GalNAcT-Knockout-Mäusen beschrieben. Daraus ist zu
schließen, dass der gesteigerte Sulfatid-Gehalt in den Neuronen keinen entscheidenden
Einfluss auf die Biosynthese der Ganglioside hat. Es bleibt dennoch eine interessante und
bislang ungeklärte Möglichkeit, den neuronalen GalCer- und Sulfatid-Gehalt bei den
GD3/GalNAcT-Knockout-Mäusen auf Gemeinsamkeiten mit den transgenen Thy-1-CGTMäusen zu untersuchen. Möglicherweise liegt ein erhöhter GalCer- oder Sulfatid-Gehalt vor,
da die fehlenden Ganglioside möglicherweise durch Glykosphingolipide kompensiert werden.
Obwohl die Akkumulation von Sulfatid im Wesentlichen in den endosomalen und
lysosomalen Kompartimenten vorkommt, ist der Gehalt von Sulfatid bei den ASAdefizienten-Mäusen im aufgereinigten Myelin gesteigert. Das weist darauf hin, dass ebenfalls
in der Plasmamembran (zumindest von Oligodendrozyten) ein gesteigerter Sulfatid-Gehalt
vorhanden ist (Saravanan et al., 2004; Ramakrishnan et al., 2007). Es ist daher sehr
wahrscheinlich, dass nicht nur in den transgenen Thy-1-CGT Mäusen, sondern auch in den
ASA-defizienten Mäusen der Sulfatid-Gehalt in der Plasmamembran erhöht ist und somit
einen Effekt auf die neuronale Erregbarkeit ausübt. Möglicherweise ist dies auch bei MLDPatienten der Fall.
Die Thy-1-CGT-Mäuse dienen als ein nützliches Modell, um die Auswirkungen eines
erhöhten Sulfatid-Gehalts auf die funktionellen Eigenschaften der Neuronen bei MLDPatienten zu untersuchen. Des Weiteren kann mit Hilfe der transgenen Mäuse die
physiologische Rolle von Sulfatid in den Neuronen aufgeklärt werden. Dies ist natürlich nicht
nur für die MLD von besonderer Bedeutung, sondern trägt dazu bei, die Rolle, die Sulfatid bei
anderen Krankheiten einnimmt, zu bestimmen. So wurde zum Beispiel beschrieben, dass eine
reduzierte Menge an Sulfatid in der grauen Substanz bei der Alzheimer-Krankheit festgestellt
wurde, was im Hinblick auf einen ApoE-abhängigen Sulfatid-Transport (Han et al., 2007)
eine mögliche Erklärung für die Veränderung an Sulfatid in den kortikalen Neuronen wäre.
146
4 Diskussion
4.3
Subzelluläre Lokalisations-Analyse der Cerebrosid-Sulfotransferase
(CST): Retention der CST im Endoplasmatischen Retikulum
In den vergangenen Jahren wurden verschiedene Ansätze untersucht, die eine Behandlung der
lysosomalen Speicherkrankheit MLD ermöglichen. Mögliche Therapieformen beinhalteten
die Enzym-Ersatz-Therapie, die Gen-Therapie und die Substrat-Reduktions-Therapie.
Die
Enzym-Ersatz-Therapie
wurde
bereits
bei
vielen
verschiedenen
lysosomalen
Speicherkrankheiten, wie der Gaucher-Krankheit, Fabry-Krankheit, Pompe-Krankheit und vor
allem bei der Mukopolysaccharidose angewendet (Schiffmann & Brady, 2002; Siatskas &
Medin, 2001; Hodges & Chen, 2006; Miebach, 2005; Pastores & Thadhani, 2002).
Eine Anzahl von Berichten behandelt Gen-Therapie-Ansätze an Maus-Modellen der
lysosomalen Krankheiten (Sands & Davidson, 2006; Matzner & Gieselmann, 2005; Biffi &
Naldini, 2005; Eto et al., 2004; Ellinwood et al., 2004). Obwohl einige dieser Studien gute
Resultate vorweisen, wird eine klinische Applikation in absehbarer Zukunft noch nicht
möglich
sein.
Im
Gegensatz
dazu
scheint
die
Substrat-Reduktions-Therapie
ein
aussichtsreicheres Konzept zu sein, denn diese Therapie-Form ist bereits erfolgreich an
Patienten mit der Gaucher-Typ1-Krankheit getestet worden (Jmoudiak & Futerman, 2005;
Cox, 2005; Butter et al., 2005; Moyses, 2003). Im Vergleich zu der Enzym-Ersatz-Therapie,
besitzt die Substrat-Reduktions-Therapie bei Krankheiten, die das zentrale Nervensystem
betreffen, einige Vorteile. Denn anders als bei der Enzym-Ersatz-Therapie, bei der z. T.
relativ hochmolekulare Enzyme die Blut-Hirn-Schranke (BHS) passieren müssen, liegt der
Vorteil der Substrat-Reduktions-Therapie darin, dass lediglich kleine molekulare kompetitive
Inhibitoren die BHS überqueren müssen, um an ihre Zielenzyme binden zu können. So wurde
bereits
gezeigt,
dass
das
Präparat
N-Butyldeoxynojirimycin
die
Synthese
von
Glukosylceramid inhibiert und für die Therapie der Gaucher-Krankheit, bei der
Glukosylceramid akkumuliert, erfolgreich eingesetzt werden kann (Platt et al., 1994).
Bei der metachromatischen Leukodystrophie ist Sulfatid das akkumulierende Lipid. Die
Patienten leiden an einer Demyelinisierung und verheerenden neurologischen Symptomen
(von Figura et al., 2001). Da die Synthese von Sulfatid ausgehend vom Ceramid über zwei
Schritte erfolgt, die von den Enzymen CGT und CST katalysiert werden, sind diese Enzyme
mögliche Ziele für Inhibitoren. Im Gegensatz zu der Glukosylceramidtransferase sind
Inhibitoren für die CST oder CGT zurzeit noch nicht verfügbar. Jedoch wurde bereits gezeigt,
dass Mäuse, die nur eine funktionale Kopie des CGT-Gens tragen, eine reduzierte Menge an
Galaktosylceramid sowie auch an Sulfatid aufweisen (Bosio et al., 1996; Coetzee et al.,
147
4 Diskussion
1996). Dies verdeutlicht, dass die Inhibition der CGT sowie der CST eine mögliche Option
ist, die Sulfatidakkumulation bei der MLD zu reduzieren.
Sowohl der Test von potentiellen Inhibitoren als auch das rationale Design von Inhibitoren
bedarf der genauen Kenntnis der enzymatischen und strukturellen Eigenschaften des Sulfatidsynthetisierenden Enzyms, der CST. Daher werden große Mengen an gereinigtem Enzym
benötigt, die für die Identifikation von Inhibitoren und für strukturelle Untersuchungen
verwendet werden könnten.
Die CST ist ein TypII-Transmembran-Protein, das eine Sulfatgruppe auf die 3-HydroxylGruppe des Galaktosylcerebrosids überträgt. Voruntersuchungen zeigten bereits, dass lösliche
CST (ohne Transmembran-Domäne) nicht aus der Zelle transportiert wird, sondern zum
größten Teil in der Zelle verbleibt (Mitteilung von Mandy Karbach). Die Untersuchung
modifizierter Deletions-Konstrukte, wie z. B. die 39CST (ohne Transmembran-Domäne),
oder von Fusions-Proteinen der CST mit sekretorischen Proteinen (z. B. AchE-Furin-lCST)
zeigten zwar, dass ein Teil der synthetisierten CST im Zellüberstand zu finden war, jedoch
weiterhin der größte Anteil in der Zelle verblieb. Dies konnte auch durch CoLokalisationsstudien mit Hilfe von Immunfluoreszenz-Analysen bestätigt werden. Mit einem
Antikörper gegen ein ER-spezifisches Protein und dem Fusions-Protein CST1-36-GFP (36
Aminosäurereste der amino-terminalen Domäne) als spezifischer Golgi-Marker, wurde eine
zelluläre Lokalisation des Proteins CST durchgeführt. Der überwiegende synthetisierte Anteil
der untersuchten CST befand sich im ER.
Möglicherweise ist durch das Entfernen der Transmembran-Domäne ein noch nicht bekanntes
ER-Lokalisationssignal freigelegt worden. Im Falle des NMDA (N-Methyl-D-Aspartat)Rezeptor wurde gezeigt, dass zu den bereits bekannten ER-Rückhaltesignalen noch ein
weiteres ER-Rückaltesignal vorhanden ist (Qui et al., 2009). Der NMDA-Rezeptor ist ein
heteromerer Komplex. Die Haupt-splice-Variante NR1- und die Untereinheit-NR2 werden im
ER zurückgehalten, wenn sie alleine exprimiert werden. Werden sie jedoch zusammen
exprimiert, wird ein funktionsfähiger Rezeptor an der Zell-Oberfläche geformt (McIlhinney et
al., 1998; Okabe et al., 1999; Fukaya et al., 2003). Frühere Studien haben bereits gezeigt, dass
die NR1-Untereinheit zwei ER-Retentions Motive, RRR und KKK, besitzt (Standley et al.,
2000; Horak & Wenthold, 2009). Im Falle der NR2A-Unterheit stellte sich heraus, dass ein
weiteres ER-Rückhaltesignal in dieser Untereinheit vorhanden ist und dass dies durch die
Komplexbildung mit NR1 maskiert wird (Qui et al., 2009). In gleicher Weise könnten im
Falle der CST mehrere restriktive Mechanismen für die Qualitätskontrolle der CST im ER
vorhanden sein.
148
4 Diskussion
Es wird vermutet, dass die ER-Retention der CST durch ihre luminale katalytische Domäne
vermittelt wird. Gestützt wird diese Theorie durch Untersuchungen an Fusionsproteinen,
wobei ein GFP-Fusions-Protein mit der amino-terminalen Domäne der CST effizient zum
Golgi-Apparat transportiert wird (Yaghootfam et al., 2007), wohingegen ein Fusions-Protein,
das die katalytische Domäne der CST besitzt und fusioniert ist mit der amino-terminalen
Membran-Domäne eines Plasmamembran-Proteins (Dipeptidylpeptidase IV), im ER
zurückgehalten wird. Letzteres spricht dafür, dass ein „verstecktes“ ER-Rückhaltesignal
vorhanden ist, das den Weitertransport zum Golgi verhindert, sobald die CST so modifiziert
ist, dass der entsprechende verbergende Enzymbereich nicht exprimiert wird.
Eine andere Möglichkeit wäre, dass ein noch unbekannter Export-Faktor den ER-Export der
CST limitiert. Es ist beispielsweise denkbar, dass MAL (Myelin und Lymphozyten Protein)
und PLP (Proteolipid Protein) für den Transport der CST notwendig sind. Die Eliminiation
von endogenem MAL führt zur Blockierung des apikalen Transports von Membran- und
sekretorischen Proteinen (Cheong et al., 1999; Puertollano & Alonso, 1999a; Puertollano et
al., 1999b; Martin-Belmonte et al., 2000 und 2001). PLP ist ein Integral-TransmembranProtein, das durch Protein-Lipid Interaktion an der Sortierung und dem direkten MembranTransport von Myelin-Komponenten beteiligt ist (Krämer et al., 2001). Ein Defekt des PLP
führt zur Demyelinisierung und axonaler Degeneration in PLP-Knockout-Mäusen (Griffiths et
al., 1998a, b).
In der vorliegenden Arbeit konnte allerdings sowohl mit MAL als auch mit PLP bei einer CoTransfektion mit 39CST keine Co-Lokalisation oder eine subzelluläre Veränderung der
39CST beobachtet werden, so dass MAL und PLP als mögliche Transporter-Proteine der CST
ausgeschlossen werden. Der Frage, ob andere Transporter-Proteine für den Weitertransport
von Relevanz sind, sollte weiterhin nachgegangen werden. Es ist jedoch ebenfalls nicht
auszuschließen, dass der betreffende Transport-Faktor in den in dieser Arbeit verwendeten
Zelllinien (CHO-K1, COS) nicht vorhanden ist, so dass es ausschließlich durch den fehlenden
Transporter der CST zu einer Anreicherung von CST im ER kommt. Diese Frage könnte
weiterhin durch Verwendung geeigneter Zellkulturen und/oder Primärzellen geklärt werden.
Die Akkumulation von CST im ER könnte auch mit Hilfe der „Kin recognition“(Verwandtschafts-Erkennungs-) Hypothese erklärt werden. Die „Kin recognition“-Hypothese
basiert auf der Interaktion von Enzymen mit ihren Nachbarenzymen mittels ihrer
Transmembran-Domäne. Die durch diese Interaktion entstehenden Oligomere sind zu groß,
um in Vesikel verpackt zu werden und um das ER oder den Golgi-Apparat auf sekretorischem
Wege zu verlassen (Nilsson et al., 1991 und 1993). Untersuchungen an den Golgi-Enzymen
149
4 Diskussion
N-Acetyl-Glucoaminyltransferase I (NAGT I) und Mannosidase II (Mann II) zeigen zum
Beispiel, dass NAGT I und Mann II spezifisch über ihre Transmembran-Domäne interagieren,
so dass es zu einer Akkumulation der Proteine im Golgi kommt (Nilsson et al., 1994). Die
„Kin-recognition“-Oligomerisation für Hetero- wie auch Homo-Oligomere ist demnach ein
einfacher effektiver Weg, Proteine entlang des sekretorischen Signalweges zurückzuhalten.
Die CST könnte ebenso eine Oligomerisation mit einem anderen verwandten Enzym oder mit
sich selbst über die Membran-übergreifende-Domäne eingehen. Fehlt jedoch dieser
Oligomerisations-Partner, könnte dies einen Rücktransport zum ER bewirken. Die
Expressionen von p33 und NAGT I, das normalerweise mit Mann II interagiert, bewirkte so
zum Beispiel eine Relokalisation von endogenem Mann II ins ER, da die Interaktion mit
NAGT I durch p33 blockiert war (Nilsson et al., 1994). Dagegen sprechen jedoch die
Ergebnisse, die mit dem DPPIV-TM-39CST-Konstrukt durchgeführt worden sind. Hierbei
wurde die Transmembran-Domäne der CST mit der Transmembran-Domäne der
Dipeptidylpeptidase IV ausgetauscht. Dies führte auch nicht zu einem ER-Export.
Durch die starke Überexpression der CST aufgrund der transienten Transfektion, ist eine ERRetention wegen einer Fehlfaltung des Enzyms ebenfalls möglich. Unter physiologischen
Umständen wird jedes neu synthetisierte Protein nach der Insertion in die ER-Membran durch
luminale Chaperone, wie Calnexin, Calreticulin oder Protein Disulfid-Isomerase gebunden,
deren Aufgabe es ist, die Proteinfaltung, die für die Protein-Reifung und Oligomerisierung
notwendig ist, zu ermöglichen (Helenius et al., 1992). Fehlgefaltete Proteine werden am
Weitertransport gehindert und abgebaut, womit dem ER eine wichtige Rolle bei der
Qualitätskontrolle des Protein-Transportes innerhalb des sekretorischen Weges zu kommt
(Hammond & Helenius, 1995). Die Überexpression der CST könnte eine erhöhte Rate an
fehlgefalteten
CST-Proteinen
bewirken,
wodurch
eine
komplexe
Interaktion
der
missgefalteten CST mit Chaperonen hervorgerufen wird. Diesem Komplex ist es nicht mehr
möglich das ER zu verlassen. Untersuchungen am G-Protein des Vesikulären Stromatitis
Virus (VSV) zeigten, dass es zu Komplexen von fehlerhaft-gefalteten VSVG-Proteinen
kommt, die unter anderem den Komplex VSVG-Calnexin einschließen, und daher eine
Beeinflussung der Mobilität von VSVG besteht, so dass es im ER verbleibt (de Silvia et al.,
1993; Nehls et al., 2000). Interaktionen zwischen fehlgefalteten Proteinen und ERChaperonen können irreversibel werden, möglicherweise durch eine Veränderung der ERMatrix. Obwohl im ER von lebenden Zellen die Chaperone dazu beitragen, Aggregation und
nicht-produktive Interaktionen von gefalteten Proteinen zu verhindern, werden solche
Reaktionen nicht immer vollkommen unterdrückt. Ob ein Protein eine Aggregation oder
150
4 Diskussion
Fehlfaltung durchmacht oder nicht, und ob die Aggregate permanent oder nur transient sind,
hängt von verschiedenen Faktoren ab. Diese Faktoren können sowohl die Struktur der
Proteine, die Konzentration und die Expressions-Stärke des Proteins, sowie die Faltungsrate
und die Konzentration von möglichen Faltungs-Helfer-Enzymen beeinflussen oder Chaperone
sein. Im Falle des CST-Proteins könnte dieser Chaperon-CST-Komplex verhindern, dass
irreversible intermolekulare Interaktionen innerhalb der Zelle entstehen. Ob und wie die CST
ebenfalls einen Chaperon-Komplex eingeht (ähnlich wie das VSVG-Protein), könnte durch
weitere Untersuchung beispielsweise mit Hilfe der Photobleaching-Technik und / oder
Zeitraffer-Aufnahmen geklärt werden.
Des Weiteren ist von vielen Proteinen bekannt, dass diese zwischen dem ER und dem Golgi
hin und her transportiert werden. Sie besitzen ein dibasisches Signal in ihrer
zytoplasmatischen Domäne, das anscheinend von einem Sortierungs-Mechanismus erkannt
wird, der anschließend den Rücktransport vom Golgi vermittelt (Letourneur et al., 1994).
Einen Nachweis für die Existenz von Golgi-Enzymen, die konstitutiv zwischen dem Golgi
und ER pendeln, erbrachten Untersuchungen an Zellen, welche die Mutante Sar1 exprimieren,
wodurch der ER-Export blockiert ist (Storrie et al., 1998; Zaal et al., 1999). Diese Studien
zeigten, dass die Mehrheit der Golgi-Enzyme innerhalb eines Zeitblockes im ER festgehalten
und viele Enzyme zum ER zurück transportiert und somit recycelt werden. Dieser Zeitblock
dauerte ungefähr drei bis fünf Stunden und entsprach der Mitosephase des Zellzyklus (Zaal et
al., 1999). In welcher Zellzyklus-Phase sich die CST-transfizierten Zellen zum Zeitpunkt der
Untersuchung befanden, wurde nicht erfasst, so dass eine Aussage zum ERrückwärtsgerichteten Transport schwierig ist. Für das Vorliegen eines Rücktransports vom
Golgi zum ER spricht zwar, dass bei den Immunfluoreszenz-Untersuchungen teilweise eine
Golgi-Färbung zu beobachten war. Allerdings befand sich bei allen verschiedenen
untersuchten CST-Konstrukten der überwiegende Teil des synthetisierten CST-Proteins im
ER. Interessanterweise zeigten die humanen Sulfotransferasen (Gal3ST1, Gal3ST2 und
Gal3St4) eine verstärktes Vorkommen im ER.
In der Konsequenz ist davon auszugehen, dass der rückwärtsgerichtete Transport zum ER im
Falle der CST eher eine untergeordnete Rolle für die ER-Lokalisation der CST ist spielt.
Vielmehr ist vermutlich eine oder mehrere der weiter oben genannten Möglichkeiten für die
Akkumulation der CST im ER verantwortlich.
151
4 Diskussion
4.4
Ausblick
Das Modell des Sulfatid-Transports von Oligodendrozyten zu Neuronen mit Hilfe von
Apolipoprotein-E, das aus Astrozyten stammt, konnte anhand der vorliegenden Ergebnisse
nicht bestätigt werden. Zur genauen Charakterisierung der neuronalen Sulfatid-Akkumulation
sind weitere mögliche Transport-Wege des Sulfatids bzw. dessen Synthese in den Neuronen
zu untersuchen. Da gezeigt worden ist, dass sich in den von Oligodendrozyten sezernierten
Exosomen neben den typischen Myelin-Proteinen auch GalCer und Sulfatid befinden
(Krämer-Albers et al., 2007), könnten Analysen der neuronalen Plasmamembran darüber
Aufschluß geben, ob es überhaupt einen Transport-Weg gibt. Werden Exosomen, die Sulfatid
beinhalten, identifiziert, könnte dies die Sulfatid-Anreicherung in den Neuronen erklären.
Auch eine genaue Bestimmung der Sulfatidspezies der neuronalen Plasmamembran von
ASA- und ASA/ApoE-Knockout-Mäusen durch ESI-MS könnte einige Rückschlüsse auf
mögliches exogenes Sulfatid ermöglichen. Eventuelle Unterschiede in der Differenzierung
von Neuronen, die Sulfatid akkumulieren, könnten mit Hilfe der Technik der Primärkultur
nachgewiesen werden. Dabei wäre eine Aufdeckung von morphologischen Veränderungen
denkbar, die in vivo möglicherweise nicht erkennbar sind. Eine saubere Neuronen-Kultur von
ASA- und ASA/ApoE-Knockout-Mäusen ohne Oligodendrozyten oder andere Gliazellen
könnte mit Hilfe von radioaktiver metabolischer Markierung zeigen, ob eine endogene
Sulfatidsynthese vorhanden ist. Eine weitere interessante Analyse wäre die Herstellung eines
Maus-Modells, dass eine ASA- sowie eine CGT-Defizienz besitzt und die CGT in
Oligodendrozyten überexprimiert (ASA (-/-)/CGT (+/-)/tg-PLP-CGT). Sofern in diesen
Tieren eine Sulfatid-Akkumulation in den Neuronen zum Beispiel mit Alcianblau-Färbung
nachgewiesen werden kann, würde dies daraufhin deuten, dass das Sulfatid von den
synthetisierenden
Oligodendrozyten
stammt
und
ein
weiterer
ApoE-unabhängiger
Transportweg von Sulfatid zu den Neuronen besteht. Findet man dagegen keine SulfatidSpeicherung mehr in den Neuronen, würde dies für eine endogene Sulfatid-Synthese in den
Neuronen sprechen.
Die audiogenen Anfälle bei den transgenen CGT-Mäusen korrelieren mit der Menge an
Sulfatid in den Neuronen. Elektronenzephalogramm (EEG)-Untersuchungen am Colliculus
inferior könnten zeigen, ob ein mögliches epileptisches EEG-Muster vorliegt, und somit einen
eindeutigen Hinweis auf die neuronale Beeinflussung der Reizweiterleitung geben.
152
4 Diskussion
Eine immunhistochemische-Analyse von GABA oder Glutamat sowie ein AktivitätsNachweis der beiden Neurotransmitter würde dazu beitragen, zu erkennen, inwieweit die
inhibitorische oder die erregende Reizweiterleitung durch den erhöhten Sulfatid-Gehalt
beeinflusst wird. Immunfärbungen der Natrium- und Kaliumkanäle könnten Aufschluss
darüber geben, ob diese durch die Anreicherung an Sulfatid in der Plasmamembran
Beeinträchtigungen aufweisen. Weiterhin würden Untersuchungen an Lipid Rafts in der
Plasmamembran aufzeigen, ob es zu Veränderungen in der Sulfatid-abhängigen Sortierung
von Membran-Proteinen kommt.
Mit Analysen der spiralen-Ganglion-Zellen könnte geklärt werden, inwieweit die geringere
Sensitivität gegenüber audiogenen Reizen bei den älteren transgenen CGT-Mäuse von einer
Degeneration der spiralen Ganglion-Zellen im Innenohr und den Neuronen des Gehörgangs
stammt.
Der Weitertransport der exprimierten CST wird behindert durch deren Retention im ER. Ein
effizienter Export der CST erfordert eventuell einen ER-Export-Faktor, der z. B. ein Chaperon
sein könnte. Zunächst sollte jedoch ausgeschlossen werden, dass die Retention im ER
aufgrund einer Fehlfaltung entsteht. Denkbar wäre der Nachweis der spezifischen Aktivität
der CST im ER und im Golgi Apparat, die natürlich am intakten Enzym um ein Vielfaches
höher wäre, als am fehlgefalteten.
Ein effizienterer Export aus dem ER ist möglicherweise in Zellen vorhanden, die endogene
CST exprimieren. Mittels Untersuchungen an Zellen von denen bekannt ist, dass sie CST
synthetisieren (wie Schwann-Zellen, Oligodendrozyten, Nieren-Zellen), könnte bestimmt
werden, ob in den Zellen, die keine endogene CST exprimieren, der entscheidende ExportFaktor fehlt, und es deshalb zur Akkumulation kommt.
Zusätzlich könnte eine Expressions-Klonierungs-Methode dazu beitragen, ER-ExportFaktoren zu identifizieren. Eine cDNA-Bibliothek aus CST-exprimierenden und Sulfatidsynthetisieren Zellen oder Geweben wird in Zellen exprimiert, welche die CST stabil
exprimieren. Zellen, die dann den ER-Export-Faktor exprimieren und somit die CST aus dem
ER schleusen, sollten an der Zelloberfläche befindlichen CST hängen bleiben. Diese Zellen
könnten dann mittels verschiedener Antikörper untersucht werden, wodurch der gesuchte
Faktor ermittelbar wird.
153
5 Zusammenfassung
5 Zusammenfassung
Metachromatische Leukodystrophie (MLD) ist eine genetisch bedingte Defizienz des lysosomalen
Enzyms Arylsulfatase A und führt zur lysosomalen Akkumulation von Sulfatid sowie einer
schwerwiegenden Demyelinisierung im zentralen Nervensystem des Menschen. Ein Tier-Modell der
MLD sind die ASA-Knockout-Mäuse, die durch die Inaktivierung des ASA-Gens erzeugt wurden. Die
ASA-Knockout-Mäuse entwickeln lysosomale Sulfatid-Speicherungen ähnlich wie bei der humanen
MLD.
Galaktosylceramid (GalCer) und 3-O-Sulfogalactosylceramid (Sulfatid) gehören zu den häufigsten
Sphingolipiden in Myelin-produzierenden Glia-Zellen, konnten jedoch beide auch in Neuronen
nachgewiesen werden. Ob es sich dabei um endogenes oder aus Glia-Zellen stammendes GalCer und
Sulfatid handelt, ist bislang noch nicht eindeutig geklärt. Han beschrieb ein Modell, in dem Sulfatid
durch Apolipoprotein E von Astrozyten zu Neuronen transportiert wird. Der Fokus dieser Arbeit lag
auf der Sulfatid-Akkumulation in den Neuronen von ASA- und ASA/ApoE-Knockout-Mäusen.
Unabhängig vom zusätzlichen eingebrachten ApoE-Knockout zeigten die ASA/ApoE-KnockoutMäuse ebenso wie die ASA-Knockout-Mäuse einen gleichsam erhöhten Sulfatid-Gehalt im Cortex
und im gesamten Gehirn im Alter von 18-24 Monaten. Die Sulfatid-Akkumulation wurde durch
histochemische Färbungen mit Alcianblau nachgewiesen. Sulfatid-Speicherung wurde bereits bei
jüngeren Tieren (12 Monate) und verstärkt bei den älteren Tieren in Neuronen bei den ASA- und
ASA/ApoE-Knockout-Mäusen detektiert. Die neuronale Sulfatid-Anreicherung, besonders im Bereich
der Medulla oblongata und Pons, deutet darauf hin, dass die ApoE-Defizienz in den DoppelKnockout-Tieren keinen wesentlichen Einfluss auf die Akkumulation von Sulfatid in Neuronen hat.
Daher ist die Anreicherung von Sulfatid entweder von einem anderen Transporterweg abhängig, oder
die Akkumulation in den Neuronen entsteht durch endogen synthetisiertes Sulfatid.
Transgene Thy-1-CGT-Mäuse überexprimieren die Ceramid-Galaktosyltransferase (CGT) unter dem
neuronalen Promotor Thy-1 und synthetisieren in den Neuronen C18:0-GalCer und Sulfatid in
verschiedenen Bereichen des Gehirns. Diese transgenen CGT-Mäuse weisen auf dem C57BL/6
154
5 Zusammenfassung
Hintergrund eine signifikant reduzierte Lebensspanne auf. Zusätzlich wurde bei den transgenen CGTMäusen eine erhöhte Empfindlichkeit gegenüber akustischen Reizen festgestellt. Nach einer relativ
milden Geräusch-Stimulation wie Schlüsselklirren (ca. 90-100 dB) entwickelten die transgenen CGTTiere letale audiogene Anfälle, die sich in unkontrolliertem Hin- und Herlaufen äußerte, die mit
Krämpfen verbunden waren und sogar teilweise zum Tod des transgenen Tieres führten. Allerdings
konnten bei den transgenen Mäusen, die die Cerebrosid-Sulfotransferase (CST) in den Neuronen
überexprimieren, keine solchen Anfälle beobachtet werden. In Doppel-Transgenen Tieren, die sowohl
CGT wie CST exprimieren, wurde dagegen eine stärkere Sensitivität gegen audiogene Reiz-Induktion
im Vergleich zu den transgenen CGT-Mäusen erfasst. Wie in dieser Arbeit gezeigt wird, korreliert
diese verstärkte audiogene Sensitivität mit dem erhöhten Sulfatid-Gehalt in der neuronalen
Plasmamembran von CST/CGT-transgenen Mäusen im Vergleich zu transgenen CGT-Mäusen.
Verursacht durch den erhöhten Sulfatid-Gehalt in den Neuronen kommt es zu den letalen audiogenen
Anfällen bei den transgenen Mäusen. Da bei der lysosomalen Speicherkrankheit MLD SulfatidAkkumulation in den Neuronen vorhanden ist und MLD-Patienten ähnliche neurologische Symptome
aufweisen, können diese Ergebnisse sowie weitere Untersuchungen tiefere Einblicke in die
neurologischen Auswirkungen dieser Krankheit anhand des transgenen Maus-Modells liefern.
Eine mögliche therapeutische Option für die lysosomale Speicherkrankheit MLD ist die SubstratReduktions-Therapie, wobei die Synthese des akkumulierenden Sulfatids durch spezifische Inhibitoren
verhindert werden soll. Im Falle der MLD wird der letzte Schritt der Sulfatid-Synthese, der Transfer
einer Sulfatgruppe auf Galaktosylcerebrosid von der CST, einem Typ II–Transmembran-Protein
katalysiert. Die Produktion einer großen Menge an CST-Protein sollte es ermöglichen, eine detaillierte
Struktur-Analyse sowie die Testung von potentiellen Inhibitoren durchzuführen. Allerdings wird die
Expression einer großen Menge des CST-Proteins durch dessen ineffizienten Export aus dem
Endoplasmatischen Retikulum (ER) erschwert. Untersuchungen mit verschiedenen CST-FusionsProteinen ergaben, dass die CST zum größten Teil im ER zurückgehalten wird. Diese ER-Retention
könnte möglicherweise durch die luminale katalytische Domäne hervorgerufen werden. Ein FusionsProtein aus der amino-terminalen Membran-Domäne der CST und einem GFP-Reporter-Protein wurde
effizient in den Golgi-Apparat transportiert, im Gegensatz dazu verblieb ein Fusions-Protein,
bestehend aus der katalytischen Domäne der CST und der amino-terminalen Transmembran-Domäne
eines Plasmamembran-Proteins (Dipeptidylpeptidase IV), im ER.
Interessanterweise zeigten Expressions-Analysen an den humanen Sulfotransferasen Gal3ST1,
Gal3ST2 und Gal3ST4, dass bei diesen ebenfalls eine ER-Export-Blockierung vorhanden ist. Da die
relative Menge des im ER zurückgehaltenen CST-Proteins mit dem Expressions-Gehalt ansteigt,
könnte der Transport der CST aus dem ER durch einen noch unbekannten ER-Export-Faktor limitiert
sein.
155
6 Abstract
6 Abstract
An inherited deficiency for lysosomal enzyme Arysulfatase A (ASA) leads to 3-O-sulfogalactosylceramide (sulfatide) accumulation and drastic demyelination in the central nervous
system of humans. These cause the inherited lysosomal storage disease “metachromatic
leukodystrophy” (MLD). As an animal model, the ASA-knockout mice have previously been
generated by disruption of the ASA gene, such that ASA-knockout mice develop lysosomal
sulfatid accumulation similar to the human MLD. Galactosylceramide (GalCer) and sulfatide are
abundant sphingolipids in myelinating glial cells. Besides this, low levels of GalCer and sulfatide
have been found in neurons. To date, it is not well understood, whether neuronal sulfatide is
synthetized endogenously or rather, transported to neurons via an as yet unknown mechanism. In
a transport model described by Han, sulfatide is transported by apolipoprotein E from astrocytes
to neurons. In the present study it should be elucidated, whether the neuronal distribution of
sulfatide storage in ASA- and ASA/ApoE-knockout mice differ in any way. We could show, that
double-knockout mice as well as the ASA-knockout mice showed an increased sulfatide-level in
the cortex and brain of 18-24 month old mice, which is to day that the additional ApoE-knockout
did not cause any difference in neuronal sulfatide levels. By means of histochemical staining
using alcian-blue it was proven that neuronal sulfatide storage was already detectable in relatively
young mice of 12 months and intensified in older ASA- and ASA/ApoE-knockout mice. Neuronal
sulfatide was most prominent in many nuclei of the medulla oblongata and pons in both, ASAand ASA/ApoE-knockout mice, suggesting that the ApoE-deficiency does not have any different
effect on the neuronal accumulation of sulfatide in ASA/ApoE-knockout mice as compared to
ASA-knockout mice. It can therefore be concluded that sulfatide storage in neurons are either due
to a completly different transport-protein or the accumulation is generated by endogenously
synthesized sulfatide in neurons.
Transgenic mice overexpressing UDP-galactose:ceramide galactosyltransferase (CGT) under the
control of the Thy1.2 promoter synthesize C18:0 fatty acid containing GalCer and sulfatide in
156
6 Abstract
neurons. Depending on the genetic background, these transgenic mice have a significantly
reduced life span; e.g. mice on a C57Bl/6 background died earlier as compared to their
counterparts on C57Bl/6/129Ola background. Transgenic mice were extremely sensitive to sound
stimuli and displayed lethal audiogenic seizures after relatively mild acoustic stimulation, i.e. key
jangling (90-100 dB), which was reflected in a wild running phase followed by muscle spasms
and partly occurring death. However, transgenic mice expressing cerebroside-sulfotransferase
(CST) in neurons did not show sensitivity to audiogenic seizures. In contrast, transgenic mice
expressing CGT and CST were characterized by an enhanced sensitivity to audiogenic seizure
induction. The latter correlated with elevated sulfatide levels in neuronal plasmamembranes of
double transgenic mice in comparison to CGT-transgenic mice, and strongly suggested that lethal
audiogenic seizures are caused by elevated sulfatide levels in transgenic neurons. During the
lysosomal storage disease MLD, neurons accumulate substantial amounts of sulfatide as well,
which possibly contributes to the pathogenesis of the disease. CGT-transgenic mice can therefore
be considered as a useful animal model to further investigate how sulfatide affects functional
properties of neurons.
Even if there is no cure of the lysosomale storage disease MLD up until now, there are
different approaches tested, of which substrate-reduction therapy currently seems to be the
most promissing. Here, the synthesis of accumulating sulfatide is inhibited by specific small
inhibitors, which are particularly modified to be able to cross the blood-brain barrier (BBB).
In case of MLD, the very last step of sulfatide synthesis is the transfer of a sulphate group to
galactosylcerebroside. This reaction is catalyzed by the CST, a type II transmembrane protein.
Large amounts of purified CST are needed in order to allow detailed structural analysis and
screening for specific inhibitors. However, the inefficient export of the enzyme from the
endoplasmtic reticulum (ER) impedes high level purification of CST. Studies on different
CST fusion-proteins indicated that high amounts of the CST are retained in the ER, which is
most probably mediated by its luminal catalytic domain. In fact, a protein consisting of the
amino-terminal membrane domain of CST fused to an EGFP reporter protein was efficiently
transported to the Golgi Apparatus, whereas a fusion protein of the catalytic domain of CST
with the amino-terminal membrane domain of dipeptidylpeptidase IV was retained in the ER.
Interestingly, the expression of human sulfotransferases Gal3ST1, Gal3ST2 and Gal3ST4
demonstrated that their export from the ER was blocked, too. The relative amount of CST retained
in the ER increased with the expression level of the protein, suggesting that an unknown ER
export factor might limit ER export of the CST.
157
7 Literatur
7 Literatur
•
Arvanitis
D.,
Dumas
Immunocytochemical
M.,
Szuchet
localization
of
S.
(1992).
Myelin
myelin/oligodendrocyte
palingenesis.
2.
glycolipids
in
multilamellar structures. Dev Neurosci 14:328-335.
•
Austin J., Balasubramanian A.S., Pattabiraman T.N., Saraswathi S., Basu D.K.,
Bachhawat B.K. (1963). A Controlled Study Of Enzymic Activities In Three Human
Disorders Of Glycolipid Metabolism. J Neurochem 10:805-816.
•
Bansal R., Winkler S., Bheddah S. (1999). Negative regulation of oligodendrocyte
differentiation by galactosphingolipids. J Neurosci 19:7913–7924.
•
Barrantes F.J. (2002). Lipid matters: nicotinic acetylcholine receptor-lipid interactions
Mol Membr Biol 19:277-284.
•
Basu S., Kaufman B., Roseman S. (1968). Enzymatic synthesis of ceramide-glucose
and ceramide-lactose by glycosyltransferases from embryonic chicken brain. J Biol
Chem 243:5802-5804.
•
Basu S., Schultz A.M., Basu M., Roseman S. (1971). Enzymatic synthesis of
galactocerebroside by a galactosyltransferase from embryonic chicken brain. J Biol
Chem 246:4272-4279.
•
Baumann N. & Pham-Dinh D. (2001). Biology of oligodendrocyte and myelin in the
mammalian central nervous system. Physiol Rev 81:871-927.
•
Bechmann I. & Nitsch R. (1997). Identification of phagocytic glial cells after lesioninduced anterograde degeneration using double-fluorescence labeling: combination of
axonal tracing and lectin or immunostaining. Histochem Cell Biol 107:391-397.
•
Berg J.M., Tymoczko J.L., Stryer L. (2003). Biochemie. Spektrum Berlin.
•
Berkefeld H., Sailer C.A., Bildl W., Rohde V., Thumfart J.O., Eble S., Klugbauer N.,
Reisinger E., Bischofberger J., Oliver D., Knaus H.G., Schulte U., Fakler B. (2006).
BKCa-Cav channel complexes mediate rapid and localized Ca2+-activated K+
signaling. Science 314:615-620.
158
7 Literatur
•
Berntson Z., Hansson E., Rönnbäck L., Fredman P. (1998). Intracellular sulfatide
expression in a subpopulation of astrocytes in primary cultures. J Neurosci Res
52:559–568.
•
Bethke U., Müthing J., Schauder B., Conradt P., Mühlradt P.F. (1986). An improved
semi-quantitative enzyme immunostaining procedure for glycosphingolipid antigens
on high performance thin layer chromatograms. J Immunol Methods 89:111-116.
•
Beutler E. & Grabowski G.A. in: Scriver C.R., Beaudet AL., Vall D., Sly W.S. (1995).
The metabolic and molecular basis of inherited disease. McGraw Hill, NY 2641-2670.
•
Biffi A. & Naldini L. (2005). Gene therapy of storage disorders by retroviral and
lentiviral vectors. Hum Gene Ther 16:1133–1142.
•
Bligh E.G. & Dyer W.J. (1959). A rapid method of total lipid extraction and
purification. Can J Biochem Physiol. 37:911-917.
•
Blomqvist M., Osterbye T., Mansson J.E., Horn T., Buschard K., Fredman P. (2003).
Selective lack of the C16:0 fatty acid isoform of sulfatide in pancreas of type II
diabetic animal models. APMIS 111:867–877.
•
Bosio A., Binczek E., Stoffel W. (1996). Functional breakdown of the lipid bilayer of
the myelin membrane in central and peripheral nervous system by disrupted
galactocerebroside synthesis. Proc Natl Acad Sci USA 93:13280-13285.
•
Bosio A., Binczek E., Haupt W. F., Stoffel W. (1998). Composition and biophysical
properties of myelin lipid define the neurological defects in galactocerebroside- and
sulfatide-deficient mice. J Neurochem 70:308-315.
•
Brady R.O., Kanfer J.N., Shapiro A.D. (1965). Metabolism of Glucocerebrosides. II.
Evidence of an enzymatic deficiency in Gaucher's disease. Biochem Biophys Res
Commun 18:221-225.
•
Brown D.A. & London E. (1998). Functions of lipid rafts in biological membranes.
Annu Rev Cell Dev Biol 14:111-136.
•
Bullock W.O., Fernandez J.M., Short J.M. (1987). XL1-Blue: A high efficiency
plasmid
transforming
recA
E.coli
strain with
beta-galactosidase
selection.
Biotechinques 5:376-378
•
Bullitt E. (1990). Expression of c-fos-like protein as a marker for neuronal activity
following noxious stimulation in the rat. J Comp Neurol 296:517-530.
•
Buschard K., Høy M., Bokvist K., Olsen H.L., Madsbad S., Fredman P., Gromada J.
(2002). Sulfatide controls insulin secretion by modulation of ATP-sensitive K(+)-
159
7 Literatur
channel activity and Ca(2+)-dependent exocytosis in rat pancreatic beta-cells.
Diabetes 51:2514-2521.
•
Buschard K., Blomqvist M., Månsson J.E., Fredman P., Juhl K., Gromada J. (2006).
C16:0 sulfatide inhibits insulin secretion in rat beta-cells by reducing the sensitivity of
KATP channels to ATP inhibition. Diabetes 55:2826–2834.
•
Butters T.D., Dwek R.A., Platt F.M. (2005). Imino sugar inhibitors for treating the
lysosomal glycosphingolipidoses. Glycobiology 15:43–52.
•
Caicedo A. & Eybalin M. (1999). Glutamate receptor phenotypes in the auditory
brainstem and mid-brain of the developing rat. Eur J Neurosci 11:51-74.
•
Caroni P. (1997). Overexpression of growth-associated proteins in the neurons of adult
transgenic mice. J Neurosci Methods 71:3–9.
•
Cheng H., Zhou Y., Holtzman D.M., Han X. (2008). Apolipoprotein E mediates
sulfatide depletion in animal models of Alzheimer's disease. Neurobiol Aging, article
in press.
•
Cheong K.H., Zacchetti D., Schneeberger E.E., Simons K. (1999). VIP17/MAL, a
lipid raft-associated protein, is involved in apical transport in MDCK cells. Proc Natl
Acad Sci USA 96:6241-6248.
•
Chi S. & Qi Z. (2006). Regulatory effect of sulphatides on BKCa channels. Br J
Pharmacol 149:1031–1038.
•
Clough R.W., Eells J.B., Browning R.A., Jobe P.C. (1997). Seizures and protooncogene expression of c-fos in the brain of adult genetically epilepsy-prone rats. Exp
Neurol 146:341-353.
•
Coenen R., Gieselmann V., Lüllmann-Rauch R. (2001). Morphological alterations in
the inner ear of the arylsulfatase A-deficient mouse. Acta Neuropathol 101:491-498.
•
Coetzee T., Fujita N., Dupree J., Shi R., Blight A., Suzuki K., Suzuki K., Popko B.
(1996). Myelination in the absence of galactocerebroside and sulfatide: normal
structure with abnormal function and regional instability. Cell 86:209-219.
•
Colley K.J. (1997). Golgi localization of glycosyltransferases: more questions than
answers. Glycobiology 7:1-13.
•
Cox T.M. (2005). Substrate reduction therapy for lysosomal storage diseases. Acta
Paediatr Suppl 94:69–75.
•
D’Hooge R., Coenen R., Gieselmann V., Lüllmann-Rauch R., De Deyn P.P. (1999a).
Decline in brainstem auditory-evoked potentials coincides with loss of spiral ganglion
cells in arylsulfatase A-deficient mice. Brain Res 847:352-356.
160
7 Literatur
•
D’Hooge R., Hartmann D., Manil J., Colin F., Gieselmann V., De Deyn P.P. (1999b).
Neuromotor alterations and cerebellar deficits in aged arylsulfatase A-deficient
transgenic mice. Neurosci Lett 273:93–96.
•
D’Hooge R., van Dam D., Franck F., Gieselmann V., De Deyn P.P. (2001).
Hyperactivity, neuromotor defects, and impaired learning and memory in a mouse
model for metachromatic leukodystrophy. Brain Res 907:35–43.
•
de Silva A., Braakman I., Helenius A. (1993). Posttranslational folding of vesicular
stomatitis virus G protein in the ER: involvement of noncovalent and covalent
complexes. J Cell Biol 120:647–655.
•
Drenkhahn D. & Zenker W. (1994). Benninghoff Anatomie. Urban und
Schwarzenberg Wien/München/Baltimore 1:15. Auflage.
•
Dunn-Meynell A.A., Rawson N.E., Levin B.E. (1998). Distribution and phenotype of
neurons containing the ATP-sensitive K+ channel in rat brain. Brain Res 814:41-54.
•
Dupree J.L., Coetzee T., Suzuki K., Popko B. (1998). Myelin abnormalities in mice
deficient in galactocerebroside and sulfatide. J Neurocytol 27:649-659.
•
Eckhardt M., Fewou S.N., Ackermann I., Gieselmann V. (2002). N-glycosylation is
required for full enzymic activity of the murine galactosylceramide sulphotransferase.
Biochem J 368:317-324.
•
Eckhardt M., Khalaj Hedayati K., Pitsch J., Lüllmann-Rauch R., Beck H., Fewou S.N.,
Gieselmann V. (2007). Sulfatide storage in neurons causes hyperexcitability and
axonal degeneration in a mouse model of metachromatic leukodystrophy. J Neurosci
27:9009–9021.
•
Eckhardt M. (2008). The role and metabolism of sulfatide in the nervous system. Mol
Neurobiol 37:93-103.
•
Elleder M. (1989). Niemann-Pick disease. Path Res Pract 185:293-328.
•
Ellinwood N.M., Vite C.H., Haskins M.E. (2004). Gene therapy for lysosomal storage
diseases: the lessons and promise of animal models. J Gene Med 6:481–506.
•
El-Tahir H.M., Abouzied M.M., Gallitzendoerfer R., Gieselmann V., Franken S.
(2009). Hepatoma-derived growth factor-related protein-3 interacts with microtubules
and promotes neurite outgrowth in mouse cortical neurons. J Biol Chem 284:1163711651.
•
Erne B., Sansano S., Frank M., Schaeren-Wiemers N. (2002). Rafts in adult peripheral
nerve myelin contain major structural myelin proteins and myelin and lymphocate
protein (MaL) and CD59 as specific markers. J Neurochem 82:550-562.
161
7 Literatur
•
Eto Y., Shen J.S., Meng X.L., Ohashi T. (2004). Treatment of lysosomal storage
disorders: cell therapy and gene therapy. J Inherit Metab Dis 27:411–415.
•
Faingold C., Gehlbach G., Travis M.A., Caspary D.M. (1986a). Inferior colliculus
neuronal response abnormalities in genetically epilepsy-prone rats: evidence for a
deficit of inhibition. Life Sci 39:869-878.
•
Faingold C., Gehlbach G., Caspary D.M. (1986b). Decreased effectiveness of GABAmediated inhibition in the inferior colliculus of the genetically epilepsy-prone rat. Exp
Neurol 93:145-159.
•
Faingold C., Gehlbach G., Caspary D.M. (1989). On the role of GABA as an
inhibitory neurotransmitter in inferior colliculus neurons: iontophoretic studies. Brain
Res 500:302-312.
•
Faingold C., Walsh E.J., Maxwell J.K., Randall M.E. (1990). Audiogenic seizure
severity and hearing deficits in the genetically epilepsy-prone rat. Exp Neurol 108:5560.
•
Faingold C., Boersma Anderson C.A., Caspary D.M. (1991a). Involvement of GABA
in acoustically-evoked inhibition in inferior colliculus neurons. Hear Res 52:201-216.
•
Faingold C., Gehlbach G., Caspary D.M. (1991b). Functional pharmacology of
inferior colliculus neurons. In: Altschuler, R.A., Neurobiology of Hearing: The
Central Auditory System. Raven Press, NY 223-251.
•
Faingold C., Randall M.E., Anderson C.A. (1994). Blockade of GABA uptake with
tiagabine inhibits audiogenic seizures and reduces neuronal firing in the inferior
colliculus of the genetically epilepsy-prone rat. Exp Neurol 126:225-232.
•
Faingold C. & Casebeer D. (1999). Modulation of the audiogenic seizure network by
noradrenergic and glutamatergic receptors of the deep layers of superior colliculus.
Brain Res 821:392-399.
•
Faingold C., Li Y., Evans M.S., (2000). Decreased GABA and increased glutamate
receptor-mediated activity on inferior colliculus neurons in vitro are associated with
susceptibility to ethanol withdrawal seizures. Brain Res 868:287-295.
•
Faingold C. (2002). Role of GABA abnormalities in the Inferior Colliculus
pathophysiology - audiogenic seizures. Hear Res 168:223-237.
•
Feliciano M. & Potashner S.J., (1995). Evidence for a glutamatergic pathway from the
guinea pig auditory cortex to the inferior colliculus. J Neurochem 65:1348-1357.
•
Folch J., Lees M., Stanley G.H.S. (1957). A simple method for the isolation and
purification of total lipides from animal tissus. J Biol Chem 226:497-509.
162
7 Literatur
•
Fredman P., Mattsson L., Andersson K., Davidsson P., Ishizuka I., Jeansson S.,
Månsson J.E., Svennerholm L. (1988). Characterization of the binding epitope of a
monoclonal antibody to sulphatide. Biochem J 251:17-22.
•
Fukaya M., Kato A., Lovett C., Tonegawa S., Watanabe M. (2003). Retention of
NMDA receptor NR2 subunits in the lumen of endoplasmic reticulum in targeted NR1
knockout mice. Proc Natl Acad Sci USA 100:4855– 4860.
•
Garcia-Cairasco N. (2002). A critical review on the participation of inferior colliculus
in acoustic-motor and acoustic-limbic networks involved in the expression of acute
and kindled audiogenic seizures. Hear Res 168:208-222.
•
Geeraert L., Mannaerts G.P., van Veldhoven P.P. (1997). Conversion of
dihydroceramide into ceramide: involvement of a desaturase. Biochem J 327:125-132
•
Gerasimenko J.V., Gerasimenko O.V., Petersen O.H. (2001). Membrane repair: Ca(2+)elicited lysosomal exocytosis. Curr Biol 11:971-974.
•
Gieselmann V. (1995). Lysosomal storage disease. Biochim Biophys Acta 1270:103136.
•
Gieselmann V., Matzner U., Hess B., Lüllmann-Rauch R., Coenen R., Hartmann D.,
D’Hooge R., DeDeyn P., Nagels G. (1998). Metachromatic leukodystrophy: molecular
genetics and an animal model. J Inherit Metab Dis 21:564-574.
•
Gieselmann V., Franken S., Klein D., Mansson J.E., Sandhoff R., Lüllmann Rauch R.,
Hartmann D., Saravanan V.P., De Deyn P.P., D’Hooge R., van der Linden A.M.,
Schaeren-Wiemers N. (2003). Metachromatic leukodystrophy: consequences of
sulphatide accumulation. Acta Paediatr Suppl 92:74-79
•
Gravel R.A., Clarke J.T.R., Kaback M.M., Mahuran D., Sandhoff K., Suzuki K. in
Scriver C.R., Beaudet Al., Vall D., Sly W.S. (1995). The metabolic and molecular
basis of inherited disease. McGraw Hill, NY 2839- 2879.
•
Griffiths I., Klugmann M., Anderson T., Yool D., Thomson C., Schwab M.H.,
Schneider A., Zimmermann F., McCulloch M., Nadon N., Nave K.A. (1998a). Axonal
swellings and degeneration in mice lacking the major proteolipid of myelin. Science
280:1610-1613.
•
Griffiths I.R., Klugmann M., Anderson T.J., Thomson C., Vouyiouklis D., Nave K.A.
(1998b). Current concepts of PLP and its role in the nervous system. Microsc Res
Tech 41:344-358.
•
Gustavson K.H. & Hagberg B. (1971). The incidence and genetics of metachromatic
leucodystrophy in northern Sweden. Acta Paediatr Scand 60:585-590.
163
7 Literatur
•
Hammond C. & Helenius A. (1995). Quality control in the secretory pathway. Curr
Opin Cell Biol 7:523–529.
•
Han X, M Holtzman D, McKeel DW Jr, Kelley J, Morris JC. (2002). Substantial
sulfatide deficiency and ceramide elevation in very early Alzheimer's disease:
potential role in disease pathogenesis. J Neurochem 82:809-818.
•
Han X, Cheng H, Fryer J.D., Fagan A.M., Holtzman D.M. (2003). Novel Role for
Apolipoprotein E in the Central Nervous System. J Biol Chem 278:8043-8051.
•
Han X. (2004). The role of apolipoprotein E in lipid metabolism in the central nervous
system. Cell Mol Life Sci 61:1896-1906.
•
Han X. (2007). Potential mechanisms contributing to sulfatide depletion at the earliest
clinically recognizable stage of Alzheimer’s disease: a tale of shotgun lipidomics. J
Neurochem 103:171–179.
•
Heim P., Claussen M., Hoffmann B., Conzelmann E., Gartner J., Harzer K.,
Hunneman D.H., Kohler W., Kurlemann G., Kohlschutter A. (1997). Leukodystrophy
incidence in Germany. Am J Med Genet 71: 475-478.
•
Helenius A., Marquardt T., Braakman I. (1992). The endoplasmic reticulum as a
proteinfolding compartment. Trends Cell Biol 2:227–231.
•
Henn FA, Hansson HA, Hamberger A. (1972). Preparation of plasma membrane from
isolated neurons. J Cell Biol 53:654-661.
•
Henry K.R. (1967). Audiogenic seizure susceptibility induced in C57BL-6J mice by
prior auditory exposure. Science 158:938-940.
•
Hess B., Saftig P., Hartmann D., Coenen R., Lüllmann-Rauch R., Goebel H.H., Evers
M., von Figura K., D’Hooge R., Nagels G., De Deyn P., Peters C., Gieselmann V.
(1996). Phenotype of arylsulfatase A-deficient mice relationship to human
metachromatic leukodystrophy. Proc Natl Acad Sci USA 93:14821-14826.
•
Hirahara Y., Bansal R., Honke K., Ikenaka K., Wada Y. (2004). Sulfatide is a negative
regulator of oligodendrocyte differentiation: development in sulfatide-null mice. Glia
45:269–277.
•
Hodges B.L. & Cheng S.H. (2006). Cell and gene-based therapies for the lysosomal
storage diseases. Curr Gene Ther 6:227–241.
•
Honke K., Zhang Y., Cheng X., Kotani N., Taniguchi N. (2004). Biological roles of
sulfoglycolipids and pathophysiology of their deficiency. Glycoconj J 21:59-62.
164
7 Literatur
•
Horak M. & Wenthold R. J. (2009). Different roles of C-terminal cassettes in the
trafficking of full-length NR1 subunits to the cell surface. J Biol Chem 284:9683–
9691.
•
Hoshi T., Suzuki A., Hayashi S., Tohyama K., Hayashi A., Yamaguchi Y., Takeuchi
K., Baba H. (2007). Nodal protrusions, increased Schmitdt- Lantermann incisures, and
paranodal disorganisations are characteristic features of sulfatide-deficient peripheral
nerves. Glia 55:584-594.
•
Hucho F. (1982). Einführung in die Neurochemie, ein Lehrbuch. Verlag Chemie,
Weinheim.
•
Huwiler A., Kolter T., Pfeilschifter J., Sandhoff K. (2000). Physiology and
pathophysiology of sphingolipid metabolism and signaling. Biochim Biophys Acta
1485:63-99.
•
Isaac G., Pernber Z., Gieselmann V., Hansson E., Bergquist J., Månsson J.E. (2006).
Sulfatide with short fatty acid dominates in astrocytes and neurons. FEBS J 273:1782–
1790.
•
Ishibashi T., Dupree J.L., Ikenaka K., Hirahara Y., Honke K., Peles E., Popko B.,
Suzuki K., Nishino H., Baba H. (2002). A myelin galactolipid, sulfatide, is essential
for maintenance of ion channels on myelinated axon but not essential for initial cluster
formation. J Neurosci 22:6507–6514.
•
Iwamori M. & Moser H. W. (1975). Above-Normal Urinary Excretion of Urinary
Ceramides in Farber's Disease and Characterization of Their Component by High
Performance Liquid Chromatography. Clin Chem 21:725-729.
•
Jatzkewitz H. (1958). Two types of cerebroside sulfates as so-called prelipids and
storage substances in leukodystrophy of type Scholz (metachromatic form of diffuse
sclerosis). Hoppe Seylers Z Physiol Chem 311:279-282.
•
Jatzkewitz H. & Sandhoff K. (1963). On a biochemically special form of a infantile
amaturotic idiocy. Biochim Biophys Acta 70:354-356.
•
Jatzkewitz H., Mehl E., Sandhoff K. (1970). Blocks in the catabolism of sulphatides
and gangliosides as a cause of human neurological diseases. Biochem J 117:6-8.
•
Jmoudiak M. & Futerman A.H. (2005). Gaucher disease: pathological mechanisms
and modern management. Br J Haematol 129:178–188.
•
Kai N. & Niki H. (2002). Altered tone-induced Fos expression in the mouse inferior
colliculus after early exposure to intense noise. Neurosci Res 44:305-313.
165
7 Literatur
•
Karlsson K.A. (1981). Animal Glycosphingolipids as membrane attachment sites for
bacteria. Annu Rev Biochem 58:309-350.
•
Kawai H., Allende M.L., Wada R., Kono M., Sango K., Deng C., Miyakawa T.,
Crawley J.N., Werth N., Bierfreund U., Sandhoff K., Proia R.L. (2001). Mice
expressing only monosialoganglioside GM3 exhibit lethal audiogenic seizures. J Biol
Chem 276:6885-6888.
•
Kishimoto Y., Hiraiwa M., O'Brien J.S. (1992). Saposins: structure, function,
distribution, and molecular genetics. J Lipid Res 33:1255–1267.
•
Klein B.D., Fu Y.H., Ptacek L.J., White H.S. (2004). c-Fos immunohistochemical
mapping of the audiogenic seizure network and tonotopic neuronal hyperexcitability in
the inferior colliculus of the Frings mouse. Epilepsy Res 62:13-25.
•
Kolter T., Proia R.L., Sandhoff K. (2002). Combinatorial ganglioside biosynthesis. J
Biol Chem 277:25859-25862.
•
Kolter T. & Sandhoff K. (1999). Sphingolipids: their metabolic pathways and the
pathobiochemistry of neurodegenerative diseases. Angew Chem Int Ed 38:1532-1568.
•
Kolter T. & Sandhoff K. (2005). Principles of lysosomal membran digestion:
stimulation of sphingolipid degradation by spingolipid activator proteins and anionic
lysosomal lipids. Annu Rev Cell Dev Biol 21:81-103.
•
Kovács K.J. (2008). Measurement of immediate-early gene activation- c-fos and
beyond. J Neuroendocrinol 20:665-672.
•
Kornfeld S. (1992). Structure and function of the mannose 6-phosphate/insulinlike
growth factor II receptors. Annu Rev Biochem 61:307-330.
•
Krämer E.M., Schardt A., Nave K.A. (2001). Membrane traffic in myelinating
oligodendrocytes. Microscop Res Tech 52:656-671.
•
Krämer-Albers E-M., Bretz N., Tenzer S., Winterstein C., Möbius W., Berger H.,
Nave K-A., Schild H., Trotte J. (2007). Oligodendrocytes secrete exosomes containing
major myelin and stress-protective proteins: Trophic support for axons? Proteomics
Clin App 1:1446–1461.
•
Kreutzberg G.W. (1996). Microglia: a sensor for pathological events in the CNS.
Trends Neurosci 19:312-318.
•
Kreysing J., von Figura K., Gieselmann V. (1990). Structure of the arylsulfatase A
gene. Eur J Biochem 191:627-631.
•
Kreysing J., Polten A., Hess B., von Figura K., Menz K., Steiner F., Gieselmann V.
(1994) Structure of the mouse arylsulfatase A gene and cDNA. Genomics 19:249-256.
166
7 Literatur
•
Kwon J. & Pierson M. (1997). Fos-immunoreactive responses in inferior colliculi of
rats with experimental audiogenic seizure susceptibility. Epilepsy Res. 27:89-99.
•
Kyse-Andersen J. (1984). Electroblotting of multiple gels: a simple apparatous
without buffer tank for rapid transfer of proteins from polyacrylamide to
nitrocellulose. J Bioch Biophys Methods 10:203-209
•
Laemmli U.K. (1970). Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 227:680-685.
•
Learish R., Ohashi T., Robbins P.A., Bahnson A., Boggs S.S., Patrene K., Schwartz
B.E., Gieselmann V., Barranger J.A. (1996). Retroviral gene transfer and sustained
expression of human arylsulfatase A. Gene Ther 3:343-349.
•
Letourneur F., Gaynor E.C., Hennecke S., D´emollière C., Duden R. (1994). Coatomer
is essential for retrieval of dilysine-tagged proteins to the endoplasmic reticulum. Cell
79:1199–1207.
•
Li S., Liquari P., McKee K.K., Harrison D., Patel R., Lee S., Yurchenco P.D. (2005).
Laminin-sulfatide binding initiates basement membrane assembly and enables
receptor signaling in Schwann cells and fibroblasts. J Cell Biol 169:179–189.
•
Li X., Serwanski D.R., Miralles C.P., Bahr B.A., De Blas A.L. (2007). Two pools of
Triton X-100-insoluble GABA(A) receptors are present in the brain, one associated to
lipid rafts and another one to the post-synaptic GABAergic complex. J Neurochem
102:1329-1345.
•
Liao W.H., van Den A.T., Herman P., Frachet B., Huy P.T., Lecain E., Marianowski
R. (2000). Expression of NMDA, AMPA and GABA (A) receptor subunit mRNAs in
the rat auditory brainstem. II. Influence of intracochlear electrical stimulation. Hear
Res 150:12-26.
•
Lingwood D., Fisher L.J., Callahan J.W., Ballantyne J.S. (2004). Sulfatide and Na+K+-ATPase: a salinity-sensitive relationship in the gill basolateral membrane of
rainbow trout. J Membr Biol 201:77–84.
•
Lingwood D., Harauz G., Ballantyne J.S. (2005). Regulation of fish gill Na(+)-K(+)ATPase by selective sulfatide-enriched raft partitioning during seawater adaptation. J
Biol Chem 280:36545–36550.
•
Lowry O.H., Rosebrough N.J., Farr A.L., Randall R.J. (1951). Protein measurement
with the Folin phenol reagent. J Biol Chem 193:265-275.
•
Lüllmann-Rauch R., Matzner U., Franken S., Hartmann D., Gieselmann V. (2001).
Lysosomal sulfoglycolipid storage in the kidneys of mice deficient for arylsulfatase A
167
7 Literatur
(ASA) and of double-knockout mice deficient for ASA and galactosylceramide
synthase. Histochem Cell Biol 116:161-169.
•
Maceyka M., Milstien S., Spiegel S. (2005). Sphingosine kinases, sphingosine-1phosphate and sphingolipidomics. Prostaglandins Other Lipid Mediat 77:15-22.
•
Marcus J., Honigbaum S., Shroff S., Honke K., Rosenbluth J., Dupree J.L. (2006).
Sulfatide is essential for the maintenance of CNS myelin and axon structure. Glia
53:372–381.
•
Markwell M.A.K., Svennerholm L., Paulson J.C. (1981). Specific gangliosides
function as host cell receptors for Sendai virus. Proc Natl Acad Sci USA 78:54065410.
•
Martín–Belmonte F., Arvan P., Alonso M.A. (2001). MAL mediates apical transport
of secretory proteins in polarized epithelial Madin-Darby canine kidney cells. J Biol
Chem 276:49337-49342.
•
Martín–Belmonte F., Puertollano R., Millán J., Alonso M.A. (2000). The MAL
proteolipid is necessary for the overall apical delivery of membrane proteins in the
polarized epithelial Madin-Darby canine kidney and Fischer rat thyroid cell lines. Mol
Biol Cell 11:2033-2045.
•
Matzner U, Hartmann D, Lüllmann-Rauch R, Coenen R, Rothert F, Månsson JE,
Fredman P, D'Hooge R, De Deyn PP, Gieselmann V. (2002). Bone marrow stem cellbased gene transfer in a mouse model for metachromatic leukodystrophy: effects on
visceral and nervous system disease manifestations. Gene Ther 9:53-63.
•
Matzner U. & Gieselmann V. (2005). Gene therapy of metachromatic leukodystrophy.
Expert Opin Biol Ther 5:55–65.
•
McIlhinney R.A., Le Bourdellès B., Molnár E., Tricaud N., Streit P. & Whiting P.J.
(1998). Assembly intracellular targeting and cell surface expression of the human Nmethyl-D-aspartate receptor subunits NR1a and NR2A in transfected cells.
Neuropharmacology 37:1355– 1367.
•
Michel C., van Echten-Deckert G., Rother J. Sandhoff K., Wang E., Merill Jr. A.H.
(1997). Characterization of Ceramide Synthesis. J Biol Chem 272:22432-22437.
•
Miebach E. (2005). Enzyme replacement therapy in mucopolysaccharidosis type I.
Acta Paediatr Suppl 94:58–60.
•
Miyatake T. & Suzuki K. (1972). Globoid cell leukodystrophy: additional deficienciy
of psychosine galactosidase. Biochem Biophys Res Commun 48:538-543.
168
7 Literatur
•
Molander-Melin M., Pernber Z., Franken S., Gieselmann V., Månsson J.E., Fredman
P. (2004). Accumulation of sulfatide in neuronal and glial cells of arylsulfatase A
deficient mice. J Neurocytol 33:417–427.
•
Morell P. & Radin N.S. (1969). Synthesis of cerebroside by brain from uridine
diphosphate galactose and ceramide containing hydroxy fatty acid. Biochemistry
8:506-512.
•
Morell P., Quarles R.H., Norton W.T. (1994). Myelin formation, structure, and
biochemistry. Basic Neurochemistry: Molecular, Cellular, and Medical Aspects 117143.
•
Morgan J.I., Cohen D.R., Hempstead J.L., Curran T. (1987). Mapping patterns of c-fos
expression in the central nervous system after seizure. Science 237:192–197.
•
Morgan J.I. & Curran T. (1989). Stimulus-transcription coupling in neurons: role of
cellular immediate-early genes. Trends Neurosci 12: 459–462.
•
Morgan J.I. & Curran T. (1991). Stimulus-transcription coupling in the nervous
system: involvement of the inducible proto-oncogenes fos and jun. T Annu Rev
Neurosci 14:421-451.
•
Moyses C. (2003). Substrate reduction therapy: clinical evaluation in type 1 Gaucher
disease. Philos Trans R Soc Lond B Biol Sci 358:955–960.
•
Munro S. (1995). An investigation of the role of transmembrane domains in Golgi
protein retention. EMBO J 14:4695-4704.
•
Nehls S., Snapp E.L., Cole N.B., Zaal K.J.M., Kenworthy A.K. (2000). Dynamics and
retention of misfolded proteins in native ER membranes. Nat Cell Biol 2:288–295.
•
Nilsson T., Lucocq J.M., Mackay D., Warren G. (1991). The membrane spanning
domain of beta-1,4-galactosyltransferase specifies trans Golgi localization. EMBO J
10:3567-3575.
•
Nilsson T., Slusarewicz P., Hoe M.H., Warren G. (1993). Kin recognition. A model
for the retention of Golgi enzymes. FEBS Lett 330:1-4.
•
Nilsson T., Hoe M.H., Slusarewicz P., Rabouille C., Watson R., Hunte F., Watzele G.,
Berger E.G., Warren G. (1994). Kin recognition between medial Golgi enzymes in
HeLa cells. EMBO J 13:562-574.
•
Norton W.T. & Poduslo S.E. (1982) Biochemical studies of metachromatic
leukodystrophy in three siblings. Acta Neuropathol 57:188-196.
•
Ogawa D., Shikata K., Honke K., Sato S., Matsuda M., Nagase R., Tone A., Okada S.,
Usui H., Wada J., Miyasaka M., Kawashima H., Suzuki Y., Suzuki T., Taniguchi N.,
169
7 Literatur
Hirahara Y., Tadano-Aritomi K., Ishizuka I., Tedder T.F., Makino H. (2004).
Cerebroside sulfotransferase deficiency ameliorates L-selectin-dependent monocyte
infiltration in the kidney after ureteral obstruction. J Biol Chem 279:2085-2090.
•
Okabe S., Miwa A., Okado H. (1999). Alternative Splicing of the C-Terminal Domain
Regulates Cell Surface Expression of the NMDA Receptor NR1 Subunit. J Neurosci
19:7781–7792.
•
Pan B.T., Teng K., Wu C., Adam M., Johnstone R.M. (1985). Electron microscopic
evidence for externalization of the transferrin receptor in vesicular form in sheep
reticulocytes. J Cell Biol 101:942–948.
•
Pastores G.M. & Thadhani R. (2002). Advances in the management of AndersonFabry disease: enzyme replacement therapy. Expert Opin Biol Ther 2:325–333.
•
Patrick A.D. (1965). A deficiency of Glucocerebrosidase in Gaucher's Disease.
Biochem J 97:17-18.
•
Paul P., Kamisaka Y., Marks D.L., Pagano R.E. (1996). Purification and
characterization of UDP-glucose: ceramide glucosyltransferase from rat liver Golgi
membranes. J Biol Chem 271:2287-2293.
•
Pernber Z., Molander-Melin M., Bethold C.H., Hansson E., Fredman P. (2002).
Expression of the Myelin and oligodendrocyte progenitor marker sulfatide in neurons
and astrocytes of adult rat brain. J Neurosci Res 69:86-93.
•
Pernber Z., Richter K., Mansson J.E., Nygren H. (2007). Sulfatide with different fatty
acids has unique distributions in cerebellum as imaged by time-of-flight secondary ion
mass spectrometry (TOF-SIMS). Biochim Biophys Acta 1771:202-209.
•
Pesheva P., Gloor S., Schachner M., Probstmeier R. (1997). Tenascin-R is an intrinsic
autocrine factor for oligodendrocyte differentiation and promotes cell adhesion by a
sulfatide-mediated mechanism. J Neurosci 17:4642-4651.
•
Pierson M. & Liebmann S.L. (1992). Noise exposure-induced audiogenic seizure
susceptibility in Sprague-Dawley rats. Epilepsy Res 13:35-42.
•
Pitas R.E., Boyles J.K., Lee S.H., Foss D., Mahley R.W. (1987). Astrocytes synthesize
apolipoprotein E and metabolize apolipoprotein E-containing lipoproteins. Biochim
Biophys Acta 917:148-161.
•
Platt F.M., Neises G.R., Dwek R.A., Butters T.D. (1994). N-butyldeoxynojirimycin is
a novel inhibitor of glycolipid biosynthesis. J Biol Chem 269:8362-8365.
•
Plump A.S. & Breslow J.L. (1995). Apolipoprotein E and the apolipoprotein Edeficient mouse. Annu Rev Nutr 15:495-518.
170
7 Literatur
•
Pohlentz G., Klein D., Schwarzmann G., Schmitz D., Sandhoff K. (1988). Both GA2,
GM2, and GD2 synthases and GM1b, GD1a, and GT1b synthases are single enzymes
in Golgi vesicles from rat liver. Proc Natl Acad Sci USA 85:7044-7048.
•
Posse de Chaves E.I. (2006). Sphingolipids in apoptosis, survival and regeneration in
the nervous system. Biochim Biophys Acta 1758:1995-2015.
•
Puck, T.T., Cieciura, S.J. and Robinson, A. (1958). Genetics of somatic mammalian
cells. III. Long-term cultivation of euploid cells from human and animal subjects. J
Exp Med 108:945-956.
•
Puertollano R. & Alonso M.A. (1999a). MAL, an integral element of the apical sorting
machinery, is an itinerant protein that cycle between the trans-Golgi network and the
plasma membrane. Mol Biol Cell 10:3435-3447.
•
Puertollano R., Martín-Belmonte F., Millán J., de Marco M.C., Albar J.P., Kremer L.,
Alonso M.A. (1999b). The MAL proteolipid is necessary for normal apical transport
and accurate sorting of the influenza virus hemagglutinin in Madin-Darby canine
kidney cells. J Cell Biol 145:141–145.
•
Qiu S., Zhang X.M., Cao J.Y., Yang W., Yan Y.G., Shan L., Zheng J., Luo J.H.
(2009). An Endoplasmic Reticulum Retention Signal Located in the Extracellular
Amino-terminal Domain of the NR2A Subunit of N-Methyl-D-aspartate Receptors. J
Biol Chem 284:20285-20298.
•
Raghavan S. & Kanfer J.N. (1972). Ceramide galactoside of enriched neuronal and
glial fractions from rat brain. J Biol Chem 247:1055-6.
•
Raivich G. & Banati R. (2004). Brain microglia and blood-derived macrophages:
molecular profiles and functional roles in multiple sclerosis and animal models of
autoimmune demyelinating disease. Brain Res Rev 46:261-281.
•
Ramakrishnan H., Khalaj Hedayati K., Lüllmann-Rauch R., Wessig C., Fewou S.N.,
Maier H., Goebel H.H., Gieselmann V., Eckhardt M. (2007). Increasing sulfatide
synthesis in myelin-forming cells of arylsulfatase A-deficient mice causes
demyelination and neurological symptoms reminiscent of human metachromatic
leukodystrophy. J Neurosci 27:9482–9490.
•
Ramu Y., Xu Y., Lu Z. (2006). Enzymatic activation of voltage-gated potassium
channels. Nature 442:696–699.
•
Rasheed S., Nelson-Rees W.A., Toth E.M., Arnstein P., Gardner M.B. (1974).
Characterization of a newly derived human sarcoma cell line (HT-1080). Cancer
33:1027-1033.
171
7 Literatur
•
Reddy A., Caler E.V., Andrews N.W. (2001). Plasma membrane repair is mediated by
Ca2+-regulated exocytosis of lysosomes. Cell 106:157–169.
•
Rintoul D.A. & Welti R. (1989). Thermotropic behavior of mixtures of
glycosphingolipids and phosphatidylcholine: effect of monovalent cations on sulfatide
and galactosylceramide. Biochemistry 28: 26-31.
•
Roberts D. D., Rao C. N., Magnani J. L., Spitalnik S. L., Liotta L. A., Ginsburg V.
(1985). Laminin binds specifically to sulfated glycolipids. Proc Natl Acad Sci USA
82:1306-1310.
•
Ross K.C., Coleman J.R., Jones L.S. (2001). Anti-epileptiform effects of audiogenic
seizure priming on in vitro kindling in rat hippocampus. Neurosci Lett 299:234-238.
•
Rother J., van Echten G., Schwarzmann G., Sandhoff K. (1992). Biosynthesis of
sphingolipids: dihydroceramide and not sphinganine is desaturated by cultured cells.
Biochem Biophys Res Commun 189:14-20.
•
Sambrook J., Fritsch E.F., Maniatis T. (1989). Molecular cloning: A laboratory
manual. 2nd Ed. Cold Spring Harbor Laboratory Press, NY, USA.
•
Sandhoff K. (1969). Variation of beta-N-acetylhexosaminidase-pattern in Tay- Sachs
disease. FEBS Lett 4:351-354.
•
Sandhoff K. (1977). The biochemistry of sphingolipid storage diseases. Angew Chem
Int Ed Engl. 16:273-285.
•
Sandhoff K., Conzelmann E., Neufeld E., Kaback M.M., Suzuki K. (1989). in: Scriver
CR., Beaudet Al., Vall D., Sly WS. The metabolic and molecular basis of inherited
disease. McGraw Hill, New York, NY 1807-1839.
•
Sandhoff K. & Kolter T. (1995). Glykolipide der Zelloberfläche – Biochemie ihres
Abbaus. Naturwissenschaften 82:403-413.
•
Sands M.S. & Davidson B.L. (2006). Gene therapy for lysosomal storage diseases.
Mol Ther 13:839–849.
•
Saravanan K., Schaeren-Wiemers N., Klein D., Sandhoff R., Schwarz A., Yaghootfam
A., Gieselmann V., Franken S. (2004). Specific downregulation and mistargeting of
the lipid raft-associated protein MAL in a glycolipid storage disorder. Neurobiol Dis
16:396-406.
•
Saravanan K., Büssow H., Weiler N., Gieselmann V., Franken S. (2007). A
spontaneously immortalized Schwann cell line to study the molecular aspects of
metachromatic leukodystrophy. J Neurosci Methods 2007 161:223-233.
172
7 Literatur
•
Schaeren-Wiemers N., Bonnet A., Erb M., Erne B., Bartsch U., Kern F., Mantei N.,
Sherman D., Suter U. (2004). The raft-associated protein MAL ist required for
maintenance of proper axon-glia interactions in the cetral nervous system. J Cell Biol
166:731-742.
•
Schafer D.P., Bansal R., Hedstrom K.L., Pfeiffer S.E., Rasband M.N. (2004). Does
paranode formation and maintenance require partitioning of neurofascin 155 into lipid
rafts? J Neurosci 24:3176-3185.
•
Schafer D.P. & Rasband MN. (2006). Glial regulation of the axonal membrane at
nodes of Ranvier. Curr Opin Neurobiol 16:508-514.
•
Schiffmann R. & Brady R.O. (2002). New prospects for the treatment of lysosomal
storage diseases. Drugs 62:733–742.
•
Schmidt B., Selmer T., Ingendoh A., von Figura K. (1995). A novel amino acid
modification in sulfatases that is defective in multiple sulfatase deficiency. Cell
82:271-278.
•
Schmidt R.F. & Thews G. (2000). Physiologie des Menschen. Berlin, Heidelberg,
New York. Springer.
•
Schneider A., Lander H., Schulz G., Wolburg H., Nave K.A., Schulz J.B., Simons M.
(2005). Palmitoylation is a sorting determinant for transport to the myelin membrane.
J Cell Sci 118:2415–2423.
•
Schott I., Hartmann D., Gieselmann V., Lüllmann-Rauch R. (2001). Sulfatide storage
in visceral organs of arylsulfatase A-deficient mice. Virchows Arch 439:90-96.
•
Schreiber R.A. & Graham J.M. (1976). Audiogenic priming in DBA/2J and C57BL/6J
mice: interactions among age, prime-to-test interval and index of seizure. Dev
Psychobiol 9:57–66.
•
Schulte S. & Stoffel W. (1993). Ceramide UDPgalactosyltransferase from myelinating
rat brain: purification, cloning, and expression. Proc Natl Acad Sci USA. 90:1026510269.
•
Schulze D., Rapedius M., Krauter T., Baukrowitz T. (2003). Long-chain acyl-CoA
esters and phosphatidylinositol phosphates modulate ATP inhibition of KATP
channels by the same mechanism. J Physiol 552:357 –367.
•
Schwarz A., Terstappen G.C., Futerman, A.H. (1997). Isolation of gangliosides by
cloud-point extraction with a nonionic detergent. Anal Biochem 254:221-225.
173
7 Literatur
•
Seko A., Hara-Kuge S., Yamashita K. (2001). Molecular cloning and characterization
of a novel human galactose 3-O-sulfotransferase that transfers sulfate to gal beta 13galNAc residue in O-glycans. J Biol Chem 276(28):25697-25704.
•
Sevin C., Verot L., Bernaiss A., van Dam D., Bonnin D., Nagels G., Fouquet F.,
Gieselmann V., Vanier M.T., DeDeyn P.P., Alibourg P., and Carier N. (2007). Partial
cure of established disease in an animal model of metachromatic leukodystrophy after
intracerebral adeno-associated virus-mediated gene transfer. Gene Ther 14:405-414.
•
Shapiro L.J., Aleck K.A., Kaback M.M., Itabashi H., Desnick R.J., Brand N., Stevens
R.L., Fluharty A.L., Kihara H. (1979). Metachromatic leukodystrophy without
arylsulfatase A deficiency. Pediatr Res 13:1179-1181.
•
Siatskas C. & Medin J.A. (2001). Gene therapy for Fabry disease. J Inherit Metab Dis
2:25–41.
•
Simons K. & Toomre D. (2000). Lipid rafts and signal transduction. Nat Rev Mol Cell
Biol 1:31-39.
•
Simons K. & Vaz W.L. (2004). Model systems, lipid rafts, and cell membranes. Annu
Rev Biophys Biomol Struct 33:269-295.
•
Singer S.J. & Nicolson G.L. (1972). The fluid mosaic model of the structure of cell
membranes. Science 175:720-731.
•
Sprong H., Kruithof B., Leijendekker R., Slot J.W., van Meer G., van der Sluijs P.
(1998). UDP-galactose:ceramide galactosyltransferase is a class I integral membrane
protein of the endoplasmic reticulum. J Biol Chem 273:25880-25888.
•
Stahl N., Jurevics H., Morell P., Suzuki K., Popko B. (1994). Isolation,
characterization, and expression of cDNA clones that encode rat UDP-galactose:
ceramide galactosyltransferase. J Neurosci Res 38:234-242.
•
Standley S., Roche K.W., McCallum J., Sans N., Wenthold R.J. (2000). PDZ domain
suppression of an ER retention signal in NMDA receptor NR1 splice variants. Neuron
28:887–898.
•
Stoffel W. & Bosio A. (1997). Myelin glycolipids and their functions. Curr Opin
Neurobiol 7:654-661.
•
Stoffyn P. & Stoffyn A. (1963). Structure of sulfatides. Biochim Biophys Acta
70:218-220.
•
Stoffyn P.J. (1966). The structure and chemistry of sulfatides. J Am Oil Chem Soc
43:69-74.
174
7 Literatur
•
Storrie B., White J., Röttger S., Stelzer E.H.K., Suganuma T., Nilsson T. (1998).
Recycling of Golgi-resident glycosyltransferases through the ER reveals a novel
pathway and provides an explanation for nocodazole-induced Golgi scattering. J Cell
Biol 143:1505–1521.
•
Streit W.J. (2001). Microglia and macrophages in the developing CNS.
Neurotoxicology 22:619-624.
•
Stroobants S., Leroy T., Eckhardt M., Aerts J-M., Berckmans D., D’Hooge R. (2008).
Early signs of neurolipidosis-related behavioural alterations in a murine model of
metachromatic leukodystrophy. Behav Brain Res 189:306–316.
•
Suneja S.K., Benson C.G., Gross J., Potashner S.J. (1995). Evidence for glutamatergic
projections from the cochlear nucleus to the superior olive and the ventral nucleus of
the lateral lemniscus. J Neurochem 64:161-171.
•
Suzuki K. & Suzuki Y. (1970). Globoid cell Lekuodystrophy (Krabbe's Disease):
Deficiency of Galactocerebroside-β-Galactosidase. Proc Natl Acad Sci USA 66:302309.
•
Suzuki K., Suzuki Y., Suzuki K. in: Scriver C.R., Beaudet A.L., Vall D., Sly W.S.
(1995). The metabolic and molecular basis of inherited disease. McGraw Hill, New
York, NY 2671-2692.
•
Svennerholm L., Boström K., Fredman P., Jungbjer B., Månsson J.E., Rynmark B.M.
(1992). Membrane lipids of human peripheral nerve and spinal cord. Biochim Biophys
Acta 1128:1-7.
•
Taha T.A., Mullen T.D., Obeid L.M. (2006). A house divided: ceramide, sphingosine,
and sphingosine-1-phosphate in programmed cell death. Biochim Biophys Acta
1758:2027-2036.
•
Taylor C.M., Marta C.B., Bansal R., Pfeiffer S.E. (2004). The transport, assembly, and
function of myelin lipids. In: Lazzarini RA. Myelin biology and disorders. 1.
Academic, NY 57–88.
•
Thudichum J.L.W. (1884). A treatise on the chemical constitution of the brain,
London.
•
Tilman T.S. & Cascio M. (2003). Effects of membrane lipids on ion channel structure
and function. Cell Biochem Biophys 38:161-190.
•
Vacher M., Waks M., Nicot C. (1989). Myelin proteins in reverse micelles: tight lipid
association required for insertion of the Folch-Pi proteolipid into a membrane-mimetic
system. J Neurochem 52:117-123.
175
7 Literatur
•
van der Bijl P., Lopes-Cardozo M., van Meer G. (1996). Sorting of newly synthesized
galactosphingolipids to the two surface domains of epithelial cells. J Cell Biol.
132:813-821.
•
van Echten-Deckert G. (2000). Sphingolipid extraction and analysis by thin-layer
chromatography. Methods Enzymol 64-79.
•
van Echten-Deckert G. & Herget T. (2006). Sphingolipid metabolism in neural cells.
Biochim Biophys Acta 1758:1978-1994.
•
van Meer G. & Lisman Q. (2002). Sphingolipid transport: rafts and translocators. J
Biol Chem 277:25855-25858.
•
Vance J.E., Karten B., Hayashi H. (2006). Lipid dynamics in neurons. Biochem Soc
Trans 34:399-403.
•
Vellodi A., Foo Y., Cole T.J. (2005). Evaluation of three biochemical markers in the
monitoring of Gaucher disease. J Inherit Metab Dis 28:585-592.
•
von Figura K., Gieselmann V., Jaeken J. (2001). Metachromatic Leukodystrophy. In:
Scriver C.R., Beaudet AL., Vall D., Sly W.S. The metabolic and molecular basis of
inherited disease. McGraw Hill, NY 148:3695-3724.
•
Vos J.P., Lopes-Cardozo M., Gadella B.M. (1994). Metabolic and functional aspect of
sulfogalactolipids. Biochim Biophys Acta 1211:125–149.
•
Walton K.M., Sandberg K., Rogers T.B., Schnaar R.L. (1988). Complex ganglioside
expression and tetanus toxin binding by PC12 pheochromocytoma cells. J Biol Chem
263:2055-2063.
•
Wang
P.J.,
Hwu
W.L.,
Shen
Y.Z.
(2001).
Epileptic
seizures
and
electroencephalographic evolution in genetic leukodystrophies. J Clin Neurophysiol
18:25–32.
•
Wertz P. W. & van den Bergh, B. (1998). The physical, chemical and functional
properties of lipids in the skin and other biological barriers. Chem Phys Lipids 91:8596.
•
Willott J.F. & Turner J.G. (2000). Neural plasticity in the mouse inferior colliculus:
relationship to hearing loss, augmented acoustic stimulation, and prepulse inhibition.
Hear Res 147:275-281
•
Wittke D., Hartmann D., Gieselmann V., Lüllmann-Rauch R. (2004). Lysosomal
sulfatide storage in the brain of arylsulfatase A-deficient mice: cellular alterations and
topographic distribution. Acta Neuropathol 108:261-271.
176
7 Literatur
•
Yaghootfam A., Gieselmann V., Eckhardt M. (2005). Delay of myelin formation in
arylsulphatase A-deficient mice. Eur J Neurosci 21:711-720.
•
Yaghootfam A., Sorkalla T., Häberlein H., Gieselmann V., Kappler J., Eckhardt M.
(2007). Cerebroside sulfotransferase forms homodimers in living cells. Biochemistry
46:9260-9269.
•
Yamashita T., Wada R., Proia R.L. (2002). Early developmental expression of the
gene encoding glucosylceramide synthase, the enzyme controlling the first committed
step of glycosphingolipid synthesis. Biochim Biophys Acta 1573:236-240.
•
Yamashita T., Wu Y.P., Sandhoff R., Werth N., Mizukami H., Ellis J.M., Dupree J.L.,
Geyer R., Sandhoff K., Proia R.L. (2005). Interruption of ganglioside synthesis
produces central nervous system degeneration and altered axon-glial interactions. Proc
Natl Acad Sci USA. 102:2725-2730.
•
Zaal K.J.M., Smith C.L., Polishchuk R.S., Altan N., Cole N.B. (1999). Golgi
membranes are absorbed into and reemerge from the ER during mitosis. Cell 99:589–
601.
•
Zhang H. & Kelly J.B. (2001). AMPA and NMDA receptors regulate responses of
neurons in the rat’s inferior colliculus. J Neurophysiol 86:871-880.
177
8 Abbildungsverzeichnis
8 Abbildungsverzeichnis
1.1:
Schematische Darstellung eines Neurons …………………………………
3
1.2:
Ceramidsynthese ……………………………………………..……………
5
1.3:
Sphingomyelin …………………………………………………………….
6
1.4:
CST katalysiert die Synthese von Sulfatid und SlacCer.…………………..
7
1.5:
3-O-Sulfogalaktosylceramid…………….…………………………………
8
1.6:
Abbau von Sulfatid …………………………………………………..……
9
1.7:
Abbau der Sphingolipide und der dazu gehörigen Speichererkrankungen.
13
1.8:
Die Desulfatierung von Sulfatid durch die Arylsulfatase A.………………
14
2.1:
Der Polyethylenimin-DNA-Komplex………………………………………
42
2.2:
Lipofectamin-Methode…………………………………………………….
43
2.3:
Darstellung der Immunhistochemie mit der ABC-Methode ………………
63
2.4:
Schematische Darstellung der eingesetzten Sukrose-Gradienten …….…...
65
3.1:
Überlebenskurve der ASA/Apo-E-Knockout-, ASA-Knockout- und
Wildtyp-Mäuse………………………………………………………….....
3.2:
Analyse und Quantifizierung der Lipide des Cortex und des Gesamtgehirns
von 12 und 18-24 Monate alten Mäusen……………………………………
3.3:
79
Massenspektren und quantitative Auswertung der aus dem Gesamtgehirn
isolierten Lipide ……………………………………………………………..
3.5:
76
Massenspektren und quantitative Auswertung der aus dem Cortex
isolierten Lipide……………………………………………………………..
3.4:
75
80
Alcianblaufärbung in Kombination mit dem neuronalen Marker HRP-3
im Kleinhirn. …………………………………………………………..……
83
178
8 Abbildungsverzeichnis
3.6:
Alcianblaufärbung in Kombination mit dem neuronalen Marker
HRP-3 im Cortex ………………………………………………..……….....
3.7:
Alcianblaufärbung in Kombination mit dem neuronalen Marker
HRP-3 im Stammhirn ………………………………………………………
3.8:
85
Alcianblaufärbung in Kombination mit dem neuronalen Marker
NeuN im Kleinhirn …………………………………………………..……..
3.9:
84
86
Alcianblaufärbung in Kombination mit dem neuronalen Marker
NeuN im Cortex……………………………………………………….……
87
3.10: Alcianblaufärbung in Kombination mit dem neuronalen Marker
NeuN im Stammhirn…………………………………………………….…
88
3.11: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem
neuronalen Marker HRP-3………………………………………………....
90
3.12: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem
neuronalen Marker ß-III-Tubulin ……………….………………………....
91
3.13: Immunfluoreszenz-Analyse von Gewebeschnitten des Cortex mit dem
neuronalen Marker NSE ………………………………………………......
92
3.14: Immunfluoreszenz-Analyse von Gewebeschnitten der Medulla oblangata
mit dem neuronalen Marker ß-III-Tubulin …………………………....…
94
3.15: Immunfluoreszenz-Analyse von Gewebeschnitten der Mendulla oblangata
mit dem neuronalen Marker NSE …………………………………………
95
3.16: Analyse und Quantifizierung der Lipide des Gehirns von 12 und 20 Monate
alten C57BL/6 und 129/Ola Mäusen ……………………………………...
97
3.17: Analyse und Quantifizierung der Lipide der Niere von 12 und 20 Monate
alten C57BL/6 und 129/Ola..........................................................................
3.18: In-situ-Hybridisierung von Thy-1-CGT-Mäusen ………………………….
98
101
3.19: Überlebenskurve und letale audiogene Anfälle von transgenen
Thy-1-CGT-Mäusen ………………………………………………………..
103
3.20: Ergebnisse des „Open-field“-Verhaltenstests mit sechs bzw. 17 Monate alten
Thy-1 CGT Mäusen ………………………………………………….……..
3.21: c-Fos-Immunhistochemie des Colliculus inferior............................................
105
107
3.22: In situ-Hybridisierung mit c-Fos-Immunhistochemie im
Colliculus inferior …………………………………………..……………......
108
179
8 Abbildungsverzeichnis
3.23: Western-Blot und Lipid-Analyse des Gehirns von
Thy-1-CGT-transgenen Mäusen …………………………………………...
109
3.24: Quantitative Bestimmung der Sulfatid-Spezies in der Plasmamembran von
Thy-1-CGT Mäusen ………………………………………………………..
110
3.25: Analyse der Ganglioside von transgenen Thy-1-CGT-Mäusen ……………
112
3.26: Lipid-Analyse des Cortex und des Colliculus inferior von 120 Tage alten
Thy-1-CGT-Mäusen ………………………………………………………..
113
3.27: Aufreinigung und Lipid-Analyse der Plasmamembran von
transgenen Mäusen mit gemischtem Hintergrund C57BL/6 x 129 Ola……
116
3.28: Schematische Darstellung der CST-Konstrukte …………………………..
119
3.29: Expression der CST-Konstrukte und deren Aktivitäts-Nachweis …………
120
3.30: Expressions-Nachweis der Fusionsproteine im Lysat von CHO-K1-Zellen
121
3.31: Co-Färbung der CST mit MAL-HA in CHO-K1- und 39CST-CHO-Zellen
123
3.32: Co-Färbung der CST mit PLP-HA in CHO-K1- und 39CST-CHO-Zellen..
124
3.33: Expression der CST, MAL und PLP ………………………………………
125
3.34: Expressions-Nachweis der DPPIV(TM)-39CST-HA in CHO-K1-Zellen …
126
3.35: Subzelluläre Lokalisation des DPPIV(TM)-39CST-HA in CHO-K1-Zellen
127
3.36: Western-Blot-Nachweis der humanen Sulfotransferasen
Gal3ST1, Gal3ST2 und Gal3ST4 ……………………………………….…
129
3.37: Co-Färbung der humanen Sulfotransferasen Gal3ST1, Gal3ST2 und
Gal3St4 mit ER-und Golgi-Proteinen ………………………………………
131
9 Tabellenverzeichnis
1.1:
Verschiedene Glykosphingolipid-Speicherkrankheiten ................................
12
2.1:
Verzeichnis der genutzten Primer .................................................................
35
2.2:
Zusammensetzung der Trenngellösung .........................................................
59
2.3:
Zusammensetzung der 5 % Sammelgellösung...............................................
59
180
10 Plasmidkarten
10 Plasmidkarten
181
10 Plasmidkarten
182
10 Plasmidkarten
183
10 Plasmidkarten
184
11 Abkürzungsverzeichnis
11 Abkürzungsverzeichnis
Anm
Abb.
AK
Amp
APS
AS
ASA
ATP
Bp
BSA
cDNA
CGT
CST
CHCl3
CHO
DEPC
dH2O
DMEM
DMSO
DNA
Dnase
DNTP
DC
EDTA
ER
ESI-MS
EtOH
FCS
g
GalCer
GalT
GFP
GlcCer
h
HET
HRP
kb
kDa
kg
KO
Konz.
l
Lsg.
M
Absorption bei einer Wellenlänge
Abbildung
Antikörper
Ampicillin
Ammoniumpersulfat
Aminosäure
Arylsulfatase A
Adenosin-5‘- Triphosphat
Basenpaar
Rinderserumalbumin
komplementäre DNA
Ceramid-Galaktosyltransferase
Cerebrosid-Sulfotransferase
Chloroform
Ovarienzellen des Chinesischen Hamsters
Diethylpyrocarbonat
deionisiertes Wasser
Dulbecco`s Modified Eagle Medium
Dimethylsulfoxid
Desoxyribonukleinsäure
Desoxyribonuklease
Desoxyribonukleotidtriphosphat
Dünnschichtchromatographie
Ethylendiamintetraacetat
Endoplasmatisches Retikulum
Elektrospray Ionisation Massenspektroskopie
Ethanol
fötales Kälberserum
Gramm; Erdbeschleunigung
Galaktosylceramid
Galaktosyltransferase
grün fluoreszierendes Protein
Glukosylceramid
Stunde
heterozygot
Meerrettichperoxidase
Kilobasen
Kilodalton
Kilogramm
Knockout
Konzentration
Liter
Lösung
Molar; Masse
185
11 Abkürzungsverzeichnis
mA
MAG (S/L)
MALDI
MBP
MeOH
min
MLD
mRNA
MW
n
NADPH
NCAM
n.d.
NF
OD
PAGE
PBS
PC
PCR
PE
RNA
RNase
PLP
PNS
rpm
RT
SDS
sec
SEM
SM
ST
Sulf
TEMED
U
üN
UV
W
WB
WT
ZNS
Milli-Ampère
Myelin assoziiertes Glykoprotein (kurz/lang)
Matrixassoziierte Laser Desorption / Ionisation
Myelin basisches Protein
Methanol
Minute
metachromatische Leukodystrophie
Messenger RNA
Molekulargewicht; Mittelwert
Anzahl der Versuche
Nicotinamid-Adenin-Dinukleotidphosphat
Neurales Zelladhäsionsmolekül
nicht detektierbar
Neurofascin
optische Dichte
Polyacrylamidgelelektrophorese
Phosphat gepufferte Saline
Phosphatidylcholin
Polymerase Kettenreaktion
Phosphatidylethanolamin
Ribonukleinsäure
Ribonuklease
Proteolipid-Protein
Peripheres Nervensystem
Umdrehungen pro Minute
Raumtemperatur; Reverse Transkriptase
Natriumdodezylsulfat
Sekunde
Standardfehler des Mittelswerts
Sphingomyelin
Standardabweichung
Sulfatid
N,N,N‘,N‘-Tetramethylethylendiamin
Unit
über Nacht
Ultraviolett
Watt
Western Blot
Wildtyp
Zentrales Nervensystem
186
Danksagung
Die vorliegende Arbeit wurde am Institut für Biochemie und Molekularbiologie der
Rheinischen Friedrich-Wilhelms-Universität Bonn angefertigt.
Herrn Prof. Dr. V. Gieselmann danke ich für die Möglichkeit, meine Arbeit an seinem Institut
durchführen zu können und für die Übernahme des Korreferats.
Einen besonderen Dank richte ich an Dr. M. Eckhardt für seine engagierte und ausgezeichnete
Betreuung.
Danken möchte ich auch der Gieselmann-Gruppe für den regen Gedankenaustausch und die
Unterstützung, die sie mir während meiner Arbeit entgegen gebracht haben. Besonders
Danken möchte ich Annika, Christina, Frank, Ivonne, Lena, Lihua, Marion, Norbert und
Silvia.
Herrn Prof. Dr. G. Schwarz danke ich für die Betreuung durch die mathematischnaturwisschenschaftliche Fakultät der Universität zu Köln.
Herrn Prof. Dr. J. Howard danke ich für die Bereitschaft den Vorsitz der Prüfungskommission
zu bekleiden.
Bei meinen Freunden, vor allem Kirstin und Marcel bedanke ich mich für ihre
Aufmunterungen, Unterstützung und Verständnis.
Ich möchte mich auch ganz herzlich bei meiner Familie und meinem Ehemann bedanken für
ihre uneingeschränkte Hilfsbereitschaft und Geduld während der Promotion.
i
Eidesstattliche Erklärung
Ich versichere, dass ich die von mir vorgelegte Dissertation selbständig angefertigt, die
benutzten Quellen und Hilfsmittel vollständig angegeben und die Stellen der Arbeit –
einschließlich Tabellen und Abbildungen -, die anderen Werken im Wortlaut oder dem Sinn
nach entnommen sind, in jedem Einzelfall als Entlehnung kenntlich gemacht habe; dass diese
Dissertation noch keiner anderen Fakultät oder Universität zur Prüfung vorgelegen hat; dass
sie – abgesehen von unten angegebenen Teilpublikationen – noch nicht veröffentlicht worden
ist sowie, dass ich eine solche Veröffentlichung vor Abschluss des Promotionsverfahrens
nicht vornehmen werde.
Die Bestimmungen der Promotionsordnung sind mir bekannt. Die von mir vorgelegte
Dissertation ist von Prof. Dr. G. Schwarz betreut worden.
Köln, den
Teilpublikationen im Rahmen dieser Arbeit:
Rebekka van Zyl, V. Gieselmann; E.Eckhardt: "Elevated sulfatide levels in neurons causes
lethal audiogenic seizures in mice"; submitted to Journal of Neurochemistry July 2009
ii
Lebenslauf
Curriculum Vitae
Dipl. Biolog. Rebekka Maria van Zyl
PERSÖNLICHE DATEN
Name:
Rebekka Maria van Zyl (geb. Berger)
Adresse:
Mühlenstr. 76, 50321 Brühl
Telefon:
02232-90145
Familienstand :
verheiratet
Staatsangehörigkeit: deutsch
AUSBILDUNG
1989-1999 Gymnasium Erftstadt-Lechenich (Abitur)
1999-2005 Universität zu Köln
2005
Diplom in Biologie
Fächer: Genetik, Biochemie und Pharmakologie
2004-2005 Diplomarbeit im Institut für medizinische Mikrobiologie,
Immunologie und Hygiene, Universität Köln (AG O. Krut)
•
Thema: „Charakterisierung des phagosomalen Escape von zytotoxischen
S.aureus Stämmen“
2005-2009 Doktorarbeit am Institut für Biochemie und Molekularbiologie,
Rheinische Friedrich-Wilhelm-Universität Bonn
(AG Gieselmann, unter der Leitung von P.D. Dr. M. Eckhardt)
•
Thema: „Untersuchung zur Speicherung und Funktion von Sulfatid in
Neuronen anhand von transgenen Mäusen“
iii