Physiologische Funktion und Mechanismen der Inaktivierung

Dissertation zur Erlangung des Doktorgrades
der Fakultät für Chemie und Pharmazie
der Ludwig-Maximilians-Universität München
Die Rolle von Parkin bei der Parkinson-Erkrankung:
Physiologische Funktion und
Mechanismen der Inaktivierung
Iris H. Henn
aus
Miltenberg
2007
Erklärung
Diese Dissertation wurde im Sinne von § 13 Abs. 3 bzw. 4 der Promotionsordnung
vom 29. Januar 1998 am Max-Planck-Institut für Biochemie, Martinsried und am
Adolf-Butenandt-Institut
der
Ludwig-Maximilians-Universität,
durchgeführt und von Frau Priv. Doz. Dr. Konstanze F. Winklhofer betreut.
Ehrenwörtliche Versicherung
Diese Dissertation wurde selbständig, ohne unerlaubte Hilfe erarbeitet.
München, 05. April 2007
Dissertation eingereicht am 05. April 2007
1. Gutachter :
Priv. Doz. Dr. Konstanze F. Winklhofer
2. Gutachter:
Prof. Dr. F.-Ulrich Hartl
Mündliche Prüfung am 30. Mai 2007
München
Danksagung
Mein ganz herzlicher Dank gilt Priv. Doz. Dr. Konstanze F. Winklhofer für die
umfangreiche und hervorragende Betreuung dieser Arbeit, die fortwährende
Unterstützung und zahlreichen Diskussionen.
Prof. Dr. F.-Ulrich Hartl danke ich für die Übernahme des Zweitgutachtens.
Das gute Gelingen dieser Arbeit wäre ohne die sehr guten Arbeitsbedingungen in der
Abteilung von Prof. Dr. F.-Ulrich Hartl am Max-Planck-Institut für Biochemie und
der Abteilung von Prof. Dr. Christian Haass am Adolf-Butenandt-Institut der
Ludwig-Maximilians-Universität nicht möglich gewesen. Dafür, und für viele
anregende Fragen und Ideen möchte ich beiden herzlich danken.
Bei Prof. Dr. Jörg Tatzelt möchte ich mich für seine vielseitige Unterstützung und
Hilfe besonders bedanken.
Einzelne Bereiche dieser Arbeit wurden durch erfolgreiche Kooperationen
ermöglicht. So danke ich Dr. Carsten Culmsee für die Präparierung von primären
Neuronen, Dr. Daniel Krappmann für die Überlassung zahlreicher Plasmide und Dr.
Kazuhiro Nakaso für die Bereitstellung von Patienten-Fibroblasten.
Großer Dank gilt den Arbeitsgruppen Winklhofer und Tatzelt und allen Mitarbeitern
der Abteilungen Hartl und Haass für die gute Arbeitsatmosphäre, ihre
Hilfsbereitschaft und die schöne Zeit im sowie außerhalb des Labors. Besonders
danke ich Lena Bouman, Julia Schlehe und Anita Schlierf für ihre tatkräftige
Unterstützung im Labor, die zum Gelingen dieser Arbeit entscheidend beigetragen
hat.
Ein großes Dankeschön geht an alle meine Freunde für Motivation, Spass und
Unterstützung. Besonders danke ich Dr. Sophia Kiachopoulos, die mir immer mit
Rat und Tat zur Seite stand. Außerdem danke ich ihr für das Korrekturlesen dieser
Arbeit und anregende Kommentare.
Mein ganz besonderer Dank gilt meiner Familie, insbesondere meinen Eltern, die
mich mit voller Kraft unterstützt haben und immer für mich da sind.
Inhaltsverzeichnis
1. EINLEITUNG........................................................................................................ 1
1.1
Die Parkinson-Erkrankung .......................................................................... 1
1.1.1
Einführung ................................................................................................. 1
1.1.2
Neuropathologische und neurophysiologische Charakteristika................. 1
1.1.3
Klinische Charakteristika und Therapieansätze......................................... 4
1.1.4
Ätiologie und Pathogenese ........................................................................ 6
1.1.4.1
Oxidativer Stress und mitochondriale Dysfunktion ............................. 7
1.1.4.2
Proteinaggregation und proteasomale Fehlfunktion ............................ 8
1.1.5
Familiäre Formen der Parkinson-Erkrankung und ihre genetischen
Grundlagen ................................................................................................ 9
1.1.5.1
Autosomal-dominant erbliche Formen der Parkinson-Erkrankung ... 11
1.1.5.1.1
α-Synuclein ................................................................................. 11
1.1.5.1.2
UCH-L1 ....................................................................................... 12
1.1.5.1.3
LRRK2......................................................................................... 12
1.1.5.2
Autosomal-rezessiv erbliche Formen der Parkinson-Erkrankung ..... 13
1.1.5.2.1
Parkin........................................................................................... 13
1.1.5.2.2
PINK1 .......................................................................................... 13
1.1.5.2.3
DJ-1 ............................................................................................. 14
1.2
Parkin-assoziierte autosomal-rezessive Parkinson-Erkrankung ............ 15
1.2.1
Klinische und neuropathologische Charakteristika ................................. 15
1.2.2
Molekulargenetische und zellbiologische Charakteristika von Parkin.... 16
1.2.3
Physiologische Funktion von Parkin ....................................................... 19
1.2.3.1
Die E3-Ubiquitin-Ligase-Aktivität von Parkin.................................. 19
1.2.3.1.1
Das Ubiquitin-Proteasom-System ............................................... 19
1.2.3.1.2
Unterschiedliche Arten der Ubiquitin-Verknüpfung ................... 22
1.2.3.1.3
Potentielle Parkin-Substrate ........................................................ 22
1.2.3.2
Parkin besitzt neuroprotektives Potential........................................... 27
1.2.4
Parkin-Mutationen ................................................................................... 30
1.2.5
Parkin-Knock-out-Modelle ...................................................................... 31
1.2.5.1
Maus-Modelle .................................................................................... 31
1.2.5.2
Drosophila-Modell............................................................................. 32
1.3
1.3.1
Protektive Signaltransduktionswege.......................................................... 33
Molekulare Chaperone und die Hitzeschock-Antwort ............................ 33
I
Inhaltsverzeichnis
1.3.2
1.4
Die NF-κB-Signalkaskade....................................................................... 35
Zielsetzung.................................................................................................... 39
2. MATERIAL ......................................................................................................... 40
2.1
Biologisches Material................................................................................... 40
2.1.1
Zelllinien.................................................................................................. 40
2.1.2
Vektoren und Plasmide............................................................................ 40
2.1.3
Bakterienstämme ..................................................................................... 41
2.1.4
Antikörper................................................................................................ 41
2.1.5
Enzyme und Proteine............................................................................... 42
2.1.6
Standardgrößenmarker für Proteine und Nukleinsäuren ......................... 42
2.1.7
Synthetische Oligonukleotide.................................................................. 42
2.1.7.1
PCR-Primer........................................................................................ 42
2.1.7.2
RT-PCR-Primer ................................................................................. 44
2.1.7.3
siRNA ................................................................................................ 44
2.1.7.4
EMSA-Sonden................................................................................... 44
2.2
Chemikalien.................................................................................................. 44
2.3
Lösungen und Puffer ................................................................................... 47
2.4
Medien .......................................................................................................... 49
2.5
Kits ................................................................................................................ 50
2.6
Geräte............................................................................................................ 50
2.7
Sonstige Materialien .................................................................................... 52
3. METHODEN........................................................................................................ 54
3.1
Rekombinante Polymerase-Kettenreaktion (PCR) .................................. 54
3.1.1
Bedingungen für die PCR........................................................................ 55
3.1.2
Sequenzierungen...................................................................................... 55
3.1.3
Klonierung von Parkin-Mutanten ............................................................ 55
3.1.3.1
Parkin mit HA-Tag am N-Terminus: HA-hP-fl ................................. 56
3.1.3.2
Parkin mit verkürztem N-Terminus: hP-∆1-79.................................. 56
3.1.3.3
Parkin mit deletiertem C-Terminus: hP-N ......................................... 56
3.1.3.4
Parkin mit Punktmutationen............................................................... 56
II
Inhaltsverzeichnis
3.1.3.5
3.2
Parkin mit pathogenen C-terminalen Deletionsmutationen ............... 57
Bakterienkultur............................................................................................ 58
3.2.1
Herstellung kompetenter Bakterien ......................................................... 58
3.2.2
Transformation kompetenter Bakterien ................................................... 59
3.3
DNA-Präparation ........................................................................................ 59
3.4
RNA-Präparation ........................................................................................ 59
3.5
Zellkultur...................................................................................................... 59
3.5.1
Kultivierung von Zellen........................................................................... 59
3.5.2
Passagierung ............................................................................................ 60
3.5.3
Ausplattieren............................................................................................ 60
3.5.4
Transfektion............................................................................................. 61
3.5.5
Zellernte................................................................................................... 61
3.5.6
Herstellen eines nukleären Extrakts......................................................... 61
3.6
Präparierung und Kultivierung von primären kortikalen
Rattenneuronen............................................................................................ 61
3.7
Protein- und Nukleinsäureanalytik............................................................ 62
3.7.1
Nachweis der Löslichkeit ........................................................................ 62
3.7.2
Proteinkonzentration nach Bradford........................................................ 62
3.7.3
Native Polyacrylamid-Gelelektrophorese................................................ 63
3.7.4
SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE) ............................ 63
3.7.5
Proteintransfer auf Nitrozellulose (Western Blot) ................................... 63
3.7.6
Immundetektion von Proteinen................................................................ 63
3.7.7
Immunpräzipitation (IP) .......................................................................... 64
3.7.8
Co-Immunpräzipitation (Co-IP) .............................................................. 64
3.7.9
Radioaktive Markierung von Proteinen mit [35S] .................................... 64
3.7.10
Autoradiodiagramme und Phosphoimaging ............................................ 65
3.7.11
Behandlung mit proteasomalem Inhibitor ............................................... 65
3.7.12
TCA-Fällung............................................................................................ 66
3.7.13
In vitro Translation .................................................................................. 66
3.7.14
Indirekte Immunfluoreszenz.................................................................... 66
3.7.15
Nachweis von Apoptose .......................................................................... 67
3.7.15.1
Aktive Caspase-3 ............................................................................... 67
3.7.15.2
Hoechst 33342 ................................................................................... 67
3.8.18
Zellfraktionierung .................................................................................... 68
III
Inhaltsverzeichnis
3.8.18.1
Renografin-Gradient .......................................................................... 68
3.8.18.2
Sucrose-Gradient................................................................................ 68
3.8.19
Luciferase-Reporter-Assay ...................................................................... 69
3.8.20
Transienter Knock-down mittels RNA-Interferenz (siRNA) ................... 69
3.8.20.1
Luciferase-Reporter-Assay in Knock-down-Zellen............................ 69
3.8.20.2
Nachweis von Zelltod in Knock-down-Zellen mit Trypan blau......... 70
3.8.21
Nachweis der Ubiquitylierung................................................................. 70
3.8.21.1
Ubiquitylierung von IKKγ oder TRAF2 ............................................ 70
3.8.21.2
Ubiquitylierung von IKKγ mit Ubiquitin-Mutanten .......................... 70
3.8.22
Electrophoretic Mobility Shift Assay (EMSA) ........................................ 71
3.8.23
Real-Time quantitative PCR (RT-PCR)................................................... 71
3.9
Statistische Auswertung .............................................................................. 72
4. ERGEBNISSE...................................................................................................... 73
4.1
Teil 1: Mechanismen der Inaktivierung von Parkin ................................ 74
4.1.1
Inaktivierung von Parkin durch Missfaltung und Aggregation:
Charakterisierung pathogener C-terminaler Deletionsmutanten ............. 74
4.1.1.1
Löslichkeitsprofil der Parkin-Mutanten W453Stop, E409Stop
und Q311Stop .................................................................................... 75
4.1.1.2
Sedimentationsverhalten der Mutanten W453Stop und E409Stop.... 76
4.1.1.3
Zelluläre Lokalisierung von W453Stop, E409Stop und Q311Stop ... 77
4.1.1.4
Einfluss der Mutationen W453Stop, E409Stop und Q311Stop
auf die Assoziation von Parkin mit Zellmembranen ......................... 78
4.1.2
Inaktivierung von Parkin durch Destabilisierung und proteasomalen
Abbau:
Charakterisierung pathogener N-terminaler Punktmutanten ................... 80
4.1.2.1
Löslichkeitsprofil und zelluläre Lokalisierung der Parkin-Mutanten
R33Q, R42P, K48A und V56E.......................................................... 81
4.1.2.2
Biogenese einer N-terminal verkürzten Parkin-Spezies in vivo......... 82
4.1.2.3
Untersuchungen zur Stabilität der Parkin-Mutanten R33Q und
R42P .................................................................................................. 86
4.1.2.4
Einfluss der pathogenen Mutationen auf die E3-Ligase-Aktivität
von Parkin.......................................................................................... 88
4.1.3
4.2
Zusammenfassung Teil 1......................................................................... 89
Teil 2: Physiologische Funktion von Parkin.............................................. 90
4.2.1
Neuroprotektives Potential von Parkin.................................................... 90
4.2.2
Stress-induzierte Transkription und Translation von Parkin ................... 93
IV
Inhaltsverzeichnis
4.2.3
Aktivierung der NF-κB-abhängigen Transkription durch Parkin ........... 94
4.2.4
Kausaler Zusammenhang zwischen Neuroprotektion und
NF-κB-Aktivierung ............................................................................... 100
4.2.4.1
Pathogene Parkin-Mutanten sind in der Aktivierung der
NF-κB-regulierten Transkription beeinträchtigt.............................. 100
4.2.4.2
Untersuchungen des neuroprotektiven Potentials von Parkin in
Gegenwart von Repressoren der NF-κB-Signaltransduktion .......... 102
4.2.5
Parkin-mediierte Ubiquitylierung von Komponenten der NF-κBSignaltransduktionskaskade................................................................... 107
4.2.5.1
Ubiquitylierung von IKKγ und TRAF2 durch Parkin...................... 109
4.2.5.2
Parkin vermittelt die regulierende Ubiquitylierung von IKKγ
über Lysin-63................................................................................... 111
4.2.6
Interaktion von Parkin mit IKKγ und TRAF2 ....................................... 112
4.2.7
Der Knock-down von Parkin beeinflusst den Stress-induzierten
Zelltod und die Aktivierung der NF-κB-Signaltransduktion................. 115
4.2.7.1
Knock-down von endogenem Parkin in Zellkultur........................... 115
4.2.7.2
Analyse von PARK2 Patienten-Fibroblasten................................... 117
4.2.8
Zusammenfassung Teil 2....................................................................... 119
5. DISKUSSION..................................................................................................... 120
5.1
Pathogene Mutationen inaktivieren Parkin durch unterschiedliche
Mechanismen.............................................................................................. 120
5.1.1
Inaktivierung von Parkin durch Missfaltung und Aggregation ............. 121
5.1.2
Inaktivierung von Parkin durch Destabilisierung und vermehrte
proteasomale Degradierung ................................................................... 124
5.2
Eine N-terminal verkürzte Parkin-Spezies, der die UBL fehlt,
existiert in vivo............................................................................................ 125
5.3
Parkin schützt neuronale Zellen vor Stress-induziertem Zelltod ......... 128
5.3.1
Parkin ist ein stress-induzierbares Protein mit neuroprotektiver
Aktivität ................................................................................................. 128
5.3.2
Die Aktivierung der NF-κB-Signaltransduktion ist essentiell für
die neuroprotektive Aktivität von Parkin .............................................. 129
5.3.3
Parkin mediiert die regulierende Ubiquitylierung von zwei
Komponenten der NF-κB-Signaltransduktion: IKKγ und TRAF2........ 130
5.3.4
Die Rolle von Parkin in dopaminergen Neuronen - Implikationen
für die Parkinson-Erkrankung................................................................ 132
6. ZUSAMMENFASSUNG ................................................................................... 136
V
Inhaltsverzeichnis
7.GLOSSAR ........................................................................................................... 138
8. LITERATURVERZEICHNIS.......................................................................... 141
9. PUBLIKATIONEN ........................................................................................... 160
10. LEBENSLAUF................................................................................................. 161
VI
1. Einleitung
1. Einleitung
1.1. Die Parkinson-Erkrankung
1.1.1.
Einführung
Die Parkinson-Erkrankung ist die häufigste motorische und die zweithäufigste
neurodegenerative Erkrankung nach der Alzheimer-Erkrankung. Sie wurde nach dem
englischen Arzt James Parkinson benannt, der 1817 in seiner Monographie „Essay
on the Shaking Palsy“ (Abhandlung über die Schüttellähmung) erstmals die Paralysis
agitans oder Schüttellähmung als klinisch definiertes Krankheitsbild beschrieb.
Ruhetremor, Rigor, Brady- bzw. Akinese sind die Kardinalsymptome der ParkinsonErkrankung. Pathophysiologisch ist die Krankheit durch den progressiven und
weitgehend selektiven Verlust dopaminerger Neuronen in der Substantia nigra pars
compacta (SNpc) und den daraus resultierenden Dopaminmangel im Striatum
gekennzeichnet. Die Ursachen der sporadischen oder idiopathischen ParkinsonErkrankung sind weitgehend unbekannt. In den letzten zehn Jahren wurden mehrere
monogene familiäre Formen der Parkinson-Erkrankung identifiziert. Die funktionelle
Charkterisierung der dabei mutierten Genprodukte verspricht neue Einblicke in die
Pathogenese der Erkrankung.
1.1.2.
Neuropathologische und neurophysiologische Charakteristika
Die neuropathologischen Charakteristika der Parkinson-Erkrankung sind der
weitgehend selektive Verlust dopaminerger Neuronen in der SNpc sowie das
Auftreten von intraneuronalen zytosolischen Einschlüssen, den sog. Lewy-Körpern
(Lewy Bodies), in den betroffenen Hirnregionen (Baba, M. et al. 1998; Forno, L. S.
1996; Riess, O. et al. 2000; Spillantini, M. G. et al. 1998; Spillantini, M. G. et al.
1997). Degenerationen finden sich auch in noradrenergen (Locus coeruleus),
serotonergen (Raphe-Kerne) und cholinergen (Nucleus basalis Meynert, dorsaler
1
1. Einleitung
Vaguskern) Systemen des Gehirns sowie in den peripheren sympathischen Ganglien
(Dubois, B. et al. 1990; Forno, L. S. 1996; Hornykiewicz, O. und S. J. Kish 1987).
Die SNpc ist in zentraler Weise in diverse Schaltkreise des extrapyramidalmotorischen Systems eingegliedert. Aus ihr projizieren dopaminerge Neuronen über
das mediale Vorderhirnbündel in das Striatum und vermitteln Signale, die auf die
Kontrolle und Modulation von Bewegungsimpulsen und -abläufen Einfluss nehmen.
Das Absterben der dopaminergen Neuronen, die normalerweise das dunkle Pigment
Neuromelanin enthalten, führt zur charakteristischen Depigmentierung der SNpc und
zu einer reduzierten Innervation des Striatums, insbesondere des Putamens (Marsden,
C. D. 1983) (Abb. 1). Zum Zeitpunkt des Auftretens der ersten Symptome sind
bereits etwa 60% der dopaminergen Neuronen der SNpc degeneriert sowie nahezu
80% des striatalen Dopamingehalts verloren (Hornykiewicz, O. 1982).
A)
Normal
B)
Parkinson-Erkrankung
Nigrostriataler
Weg
Abbildung 1.
Schematische Darstellung der nigrostriatalen Projektion. A) Kontrollhirn mit
normaler nigrostriataler Projektion (durchgehende rote Linie). B) Gehirn eines Parkinson-Patienten
mit degenerierter nigrostriataler Projektion (gestrichelte rote Linie). Abbildung modifiziert nach
(Dauer, W. und S. Przedborski 2003).
Die
charakteristischen
Lewy-Körper
sind
sphärische,
eosinophile
Proteinaggregate, die aus zahlreichen Proteinen wie z.B. α-Synuclein, Ubiquitin,
Neurofilamenten und Hitzeschockproteinen bestehen. Die Lewy-Körper sind über 15
µm in ihrem Durchmesser und besitzen einen dichten Kern, welcher von einem
2
1. Einleitung
blassen Halo umgeben ist (Pappolla, M. A. 1986) (Abb. 2). Die Rolle der LewyKörper bei der Pathogenese der Parkinson-Erkrankung ist weitgehend unklar.
Abbildung 2.
Histologische Darstellung eines Lewy-Körpers. Lewy-Körper in einem Neuron
der SNpc eines Parkinson-Patienten. Links: Hämatoxylin-Eosin-Färbung, Pfeil: Pigment Melanin,
Doppelpfeil: Lewy-Körper, roter Kern von einem blassen Halo umgeben. Rechts: Anti-UbiquitinAntikörper, Pfeil: Lewy-Körper, immunopositiver Kern von einem blassen Halo umgeben. Abbildung
aus (Bogdanovic, N. 2001).
Um zu verstehen, welche therapeutischen Möglichkeiten für die Behandlung
der
Parkinson-Erkrankung
zur
Verfügung
stehen,
ist
es
hilfreich,
die
neuropathologischen Veränderungen in der Basalganglienschleife deutlich zu
machen (Abb. 3). Der Verlust der dopaminergen nigrostriatalen Projektionen bei der
Parkinson-Erkrankung führt zu einer Dysinhibierung der direkten Projektion vom
Striatum auf den Globus pallidus internus (GPi) mit der Folge einer Zunahme der
neuronalen Aktivität im GPi. Gleichzeitig nimmt die Inhibition von striatalen
Neuronen auf den Globus pallidus externus (GPe) zu, so dass die Aktivität der
Neurone im Nucleus subthalamicus (STN) durch den GPe nicht mehr suffizient
gehemmt wird. Folge der daraus resultierenden Aktivitätssteigerung im STN ist eine
Zunahme der Übererregung im GPi, welcher die wichtigste Ausflussstruktur
innerhalb der Basalganglienschleife darstellt. Aus der Übererregung des GPi
resultiert letztlich eine Hemmung der thalamocorticalen Projektionen, welche
Ursache zumindest für einen Teil der klinischen Symptome der ParkinsonErkrankung ist.
3
1. Einleitung
Normal
Parkinson-Erkrankung
Abbildung 3.
Aktivitätszustand der Basalganglien, Thalamus und Cortex. Links:
Normalzustand. Rechts: Parkinson-Erkrankung, gekennzeichnet durch den Verlust der dopaminergen
nigrostriatalen Projektion. SNc: Substantia nigra compacta, GPe: Globus pallidus externus, GPi:
Globus pallidus internus, STN: Nucleus subthalamicus. Abbildung aus (Herzog, J. und J. Volkmann
2006).
1.1.3.
Klinische Charakteristika und Therapieansätze
Die Parkinson-Erkrankung tritt im Durchschnitt mit einem Alter von 55 Jahren auf,
die Prävalenz steigt mit zunehmendem Lebensalter. Rund 1-2% der über 60-Jährigen
sind betroffen (Tanner, C. M. und Y. Ben-Shlomo 1999), bei den über 85-Jährigen
sind es bereits 4-5% (Giasson, B. I. und V. M. Lee 2001). In ca. 75% der ParkinsonFälle besteht keine familiäre Häufung; sie werden deshalb als sporadisch oder
idiopathisch bezeichnet. In ca. 10 % der Fälle handelt es sich um familiäre Formen
der Erkrankung mit autosomal dominantem oder rezessivem Erbgang. Die restlichen
Fälle verteilen sich auf symptomatische (sekundäre) Parkinson-Syndrome die durch
Entzündungen, Durchblutungsstörungen, Medikamente, Toxine, Tumore oder
Traumata hervorgerufen werden können (Dauer, W. und S. Przedborski 2003).
Charakteristische Symptome der Parkinson-Erkrankung sind Ruhetremor,
Rigor, Brady- oder Akinese, ferner kleinschrittiges Gangbild, Haltungsstörung
(Beugung im Bereich der Hals- und Brustwirbelsäule), Beeinträchtigung der Halteund Stellreflexe, Hypomimie und Mikrographie (Hughes, A. J. et al. 1991; Lang, A.
E. und A. M. Lozano 1998a; Lang, A. E. und A. M. Lozano 1998b). Hinzu treten
vegetative Störungen wie Seborrhö („Salbengesicht“, erhöhte Talgproduktion),
Hyperhidrosis (vermehrte Schweißsekretion), Obstipation (Verstopfung) und
Miktionsstörungen (Funktionsstörungen der Blase) sowie psychische Störungen wie
4
1. Einleitung
depressive Verstimmung, Schlafstörungen und Verlangsamung der Denkabläufe.
Gewöhnlich ist der Beginn der Erkrankung einseitig, im weiteren Verlauf wird auch
die Gegenseite mit einbezogen.
Die Diagnose der Parkinson-Erkrankung erfolgt in der Regel durch eine
klinisch-neurologische Untersuchung. Bildgebende Verfahren, wie z.B. die PositronEmissions-Tomographie (PET), können zur differentialdiagnostischen Abklärung
insbesondere bei jüngeren Patienten eingesetzt werden. Dabei werden präsynaptische
dopaminerge Terminale durch die Aufnahme von [18F]-Fluoro-L-Dopa visualisiert
(Abb. 4). Eine endgültige Diagnose kann allerdings erst post mortem gestellt werden.
Abbildung 4.
PET-Abbildung nach Applikation von [18F]-Fluoro-L-Dopa. Links: Kontrollhirn
nach Aufnahme von 18F-Dopa im Striatum (Gelb-/Rotfärbung). Rechts: Gehirn eines ParkinsonPatienten mit stark verminderter Aufnahme von 18F-Dopa v.a. im rechten Putamen. Abbildung aus
(www.parkinson.de).
Therapeutisch versucht man den Mangel an Dopamin (DA) und das daraus
resultierende Ungleichgewicht der Neurotransmitter medikamentös zu beeinflussen.
Basis der Therapie ist nach wie vor die Gabe von L-Dopa, der Vorstufe des DA, das
die Blut-Hirn-Schranke nicht passieren kann. L-Dopa wird über einen aktiven
Transporter ins Zentralnervensystem aufgenommen und in dopaminergen Neuronen
durch das Enzym Dopa-Decarboxylase in DA umgewandelt. Die Kombination von
L-Dopa
mit
peripher
wirksamen
Decarboxylasehemmern
ermöglicht
eine
nebenwirkungsärmere Behandlung und zudem eine Dosisreduktion vom L-Dopa.
Darüber
hinaus
kommen
Dopaminagonisten,
die
direkt
postsynaptische
Dopaminrezeptoren stimulieren, zum Einsatz. Monoaminoxidase (MAO)- oder
Catechol-O-Methyltransferase (COMT)-Inhibitoren erhöhen die DA-Konzentration
durch Hemmung des Abbaus von DA und dessen Vorläufermolekülen (Abb. 5).
5
1. Einleitung
MAO- und COMT-Inhibitoren können auch in Kombination mit L-Dopa eingesetzt
werden. Anticholinergika werden wegen ihres ungünstigen Nebenwirkungsprofils
nicht als Medikamente der 1. Wahl eingesetzt. Die Wahl der geeigneten
Wirkstoffgruppe(n) orientiert sich vornehmlich am Alter des Patienten (Fahn, S.
1998).
Abbildung 5.
Schematische Darstellung pharmakologischer Therapieansätze. MAO:
Monoaminoxidase, COMT: Catechol-O-Methyltransferase. Abbildung wurde freundlicherweise von
K. F. Winklhofer zur Verfügung gestellt.
Eine operative Therapie wie die Tiefenhirnstimulation ist insbesondere bei
medikamentös
nicht
(mehr)
behandelbaren
Symptomen
indiziert.
Durch
stereotaktische Implantation einer Mikroelektrode in eine bestimmte Region der
Basalganglien lassen sich die Kernsymptome der Parkinson-Erkrankung (v.a.
Tremor) positiv beeinflussen (Volkmann, J. 2004). Bis heute existiert jedoch keine
kurative Therapie; die derzeitige medikamentöse und operative Therapie ist rein
symptomatisch.
1.1.4
Ätiologie und Pathogenese
Die Ursache der sporadischen Parkinson-Erkrankung ist weitgehend unbekannt. Post
mortem-Untersuchungen an Mittelhirngewebe von Parkinson-Patienten lassen
allerdings vermuten, dass mitochondriale Dysfunktion und oxidativer Stress sowie
Proteinaggregation und eine Fehlfunktion des Ubiquitin-Proteasom-Systems dem
6
1. Einleitung
Absterben der dopaminergen Neuronen zugrunde liegen (Dauer, W. und S.
Przedborski 2003).
1.1.4.1
Oxidativer Stress und mitochondriale Dysfunktion
Im Organismus werden nahezu 100% des molekularen Sauerstoffs in der
Atmungskette der Mitochondien in Energie umgesetzt. Hierbei entstehen reaktive
Sauerstoffspezies (reactive oxygen species, ROS) als Nebenprodukt. ROS sind
toxische Formen des Sauerstoffs, zu welchen u.a. das Superoxid-Radikal (O2-.), das
hochreaktive
Hydroxyl-Radikal
(HO.)
und
stabile
Oxidantien
wie
Wasserstoffperoxid (H2O2) gehören. ROS können funktionelle Moleküle wie Lipide,
Proteine oder DNA attackieren und dabei inaktivieren. Der gesunde Körper verfügt
über ausreichend anti-oxidative Systeme wie u.a. Glutathion (GSH) und SuperoxidDismutasen (SOD), um diese aggressiven Verbindungen abzufangen und eine
oxidative Modifizierung von Biomolekülen zu verhindern.
Zahlreiche Studien lieferten Evidenz für erhöhten oxidativen Stress bei der
Parkinson-Erkrankung. So zeigt die SNpc von Parkinson-Patienten typischerweise
eine stark reduzierte Aktivität des Komplex I der mitochondrialen Atmungskette.
Eine reduzierte Komplex I-Aktivität führt zu einem Energiedefizit der Zelle und zu
erhöhtem oxidativem Stress, was schließlich zum Tod der Zelle führen kann. Zudem
zeigen post mortem-Analysen eine vermehrte oxidative Modifizierung von Lipiden
und Proteinen bei Parkinson-Patienten (Pearce, R. K. et al. 1997; Shapira, L. et al.
1998; Sherer, T. B. et al. 2002; Sian, J. et al. 1994). Tiermodelle der sporadischen
Parkinson-Erkrankung unterstützen die These, dass eine Dysfunktion der
Mitochondrien dem Zelltod vorausgeht. So induziert der mitochondriale Komplex IInhibitor 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridin (MPTP) in Mäusen und
Primaten einen spezifischen Verlust der dopaminergen Neuronen und ruft in Tieren
ein Krankheitsbild hervor, welches der menschlichen Parkinson-Erkrankung ähnlich
ist. (Bloem, B. R. et al. 1990; Dauer, W. und S. Przedborski 2003; Forno, L. S. et al.
1986; Greenamyre, J. T. et al. 2001; Sherer, T. B. et al. 2003; Vila, M. und S.
Przedborski 2003).
Eine Ursache für erhöhten oxidativen Stress in dopaminergen Neuronen ist der
Metabolismus von Dopamin. Der nicht-enzymatische Dopamin-Metabolismus
7
1. Einleitung
(Autooxidation) führt zur Generierung von toxischen Chinonen und Semi-Chinonen,
welche durch ihre Reaktion mit Cystein-Resten Proteine schädigen. Bei der
enzymatischen Metabolisierung von Dopamin durch die Monoaminoxidase (MAO)
entsteht neben den desaminierten Metaboliten 3,4-Dihydroxyphenylessigsäure
(DOPAC) und Homovanillinsäure (HVA) reaktives Hydrogenperoxid (H2O2)
(Abb. 6).
Abbildung 6.
Enzymatischer Abbau von Dopamin. MAO: Monoaminoxidase, COMT:
Catechol-O-Methyltransferase. Abbildung aus (www.chemsoc.org).
1.1.4.2
Proteinaggregation und proteasomale Fehlfunktion
Das Auftreten von Proteinaggregaten ist charakteristisch für alle neurodegenerativen
Erkrankungen. Neuere Studien weisen darauf hin, dass nicht die Endprodukte des
Aggregationsprozesses toxisch sind, sondern vielmehr oligomere Intermediate.
Proteinaggregate treten auch bei der Parkinson-Erkrankung auf und zwar in Form
von zytosolischen Lewy-Körpern. Die Bedeutung der Lewy-Körper ist weitgehend
unklar, es mehren sich allerdings Hinweise, dass Lewy-Körper kein toxisches
Potential haben und möglicherweise eher protektiv sein könnten (Ciechanover, A.
und P. Brundin 2003).
Der Abbau von intrazellulären Proteinen durch das Ubiquitin-ProteasomSystem (UPS) ist ein komplexer und streng regulierter Prozess, der essentiell für die
Zelle ist. Es wird spekuliert, dass eine Beeinträchtigung des UPS bei der ParkinsonErkrankung eine pathogenetische Rolle spielen könnte. Ratten, die mit Hemmstoffen
des Proteasoms behandelt wurden, entwickelten einen progredienten Verlust
dopaminerger Neuronen, α-Synuclein-positive Aggregate und Parkinson-ähnliche
8
1. Einleitung
motorische Symptome (McNaught, K. S. und C. W. Olanow 2006). Bisherige
Studien lieferten erste Hinweise für zwei mögliche Mechanismen. Bence et al.
zeigten, dass Proteinaggregate direkt das Proteasom hemmen können (Bence, N. F. et
al. 2001). Auch die Sequestrierung von Komponenten des UPS in Aggregate könnte
die
Beeinträchtigung
des
Proteasoms
erklären.
Die
Mengen
spezifischer
Untereinheiten des Proteasoms in der SNpc von Parkinson-Patienten war in einer
Untersuchung von McNaught et al. reduziert (McNaught, K. S. et al. 2002;
McNaught, K. S. und C. W. Olanow 2003).
Daneben könnte oxidativer Stress eine bedeutende Rolle bei der Schädigung
des Proteasoms spielen. Oxidativer Stress führt durch Schädigung der Mitochondrien
zur Reduktion der ATP-Produktion. Als Folge kommt es zur Beeinträchtigung des
ATP-abhängigen
Proteasoms.
Es
ensteht
ein
sog.
„Teufelskreis“:
Eine
Beeinträchtigung des Abbaus oxidierter Proteine führt zur Steigerung der ROS und
die vermehrte Bildung von ROS wiederum führt zu weiterer Schädigung der
Mitochondien (Abb. 7).
Abbildung 7.
Pathogeneseschema der Parkinson-Erkrankung. Mitochondriale Dysfunktion,
oxidativer Stress sowie Proteinaggregation und eine Fehlfunktion des Ubiquitin-Proteasom-Systems
spielen eine zentrale Rolle bei der Parkinson-Erkrankung. Die einzelnen Faktoren verstärken sich
innerhalb des Kreislaufs gegenseitig und führen zum Zelltod. UPS: Ubiquitin-Proteasom-System, ox:
oxidativ, ROS: reaktive Sauerstoffspezies.
1.1.5
Familiäre
Formen
der
Parkinson-Erkrankung
und
ihre
genetischen Grundlagen
Die Identifizierung mehrerer monogen-erblicher Formen der Parkinson-Erkrankung
revolutionierte die Parkinson-Forschung der letzten Jahre. Die krankheitsassoziierten
9
1. Einleitung
Gene können die Etablierung von Tier- und Zellkulturmodellen erleichtern und somit
neue Einblicke in die pathophysiologischen Mechanismen der Parkinson-Erkrankung
ermöglichen (Vila, M. und S. Przedborski 2004). Seit 1997 konnten mindestens zehn
Genloci
für
familiäre
Parkinson-Erkrankungen
identifiziert
werden,
die
entsprechenden Gene sind für sieben dieser Loci bekannt (Tab. 1).
Locus
Chromosom
Genprodukt
Erbgang
PARK1
4q21-q23
α-Synuclein
AD
PARK2
6q25.2-27
Parkin
AR
PARK3
2p13
?
AD
α-Synuclein
AD
PARK4
4p15
(Duplikation/Triplikation)
PARK5
4p14
UCH-L1
AD?
PARK6
1p35-36
PINK1
AR
PARK7
1p36
DJ-1
AR
PARK8
12p11.2-q13.1
LRRK2
AD
PARK9
1p36
ATP13A2
AR
PARK10
1p32
?
Suszeptibilitätsgen?
PARK11
2q34
?
AD?
PARK12
Xq21-q25
?
Suszeptibilitätsgen?
PARK13
2p12
HtrA2/Omi
Suszeptibilitätsgen?
Tabelle 1.
Genloci für monogen-erbliche Formen der PD. AD: autosomal-dominant, AR:
autosomal-rezessiv, UCH-L1: Ubiquitin C-terminal hydrolase-L1, PINK1: PTEN-induced kinase 1,
LRRK2: Leucin-rich repeat kinase 2, ATP13A2: P-Typ ATPase; HtrA2: High temperature
requirement protein A2.
10
1. Einleitung
1.1.5.1
Autosomal-dominant
erbliche
Formen
der
Parkinson-
Erkrankung
α-Synuclein (PARK1, PARK4)
1.1.5.1.1
Im Jahr 1997 wurde das erste Gen für eine dominante Form des Parkinson-Syndroms
auf Chromosom 4q21-23 (PARK1) kartiert (Polymeropoulos, M. H. et al. 1996).
Zwei Missense-Mutationen (A53T und A30P) wurden im Gen für α-Synuclein
identifiziert (Kruger, R. et al. 1998; Polymeropoulos, M. H. et al. 1997).
Interessanterweise
konnte
kurz
darauf
gezeigt
werden,
dass
α-Synuclein
Hauptbestandteil der Lewy-Körper ist, die ein neuropathologisches Charakteristikum
der Parkinson-Erkrankung sind (Spillantini, M. G. et al. 1997). Erst vor kurzem
wurde eine dritte α-Synuclein-Punktmutation (E46K) in einer spanischen Familie
identifiziert (Zarranz, J. J. et al. 2004). Darüber hinaus wurde als Ursache für eine
autosomal
dominante
Form
der
Parkinson-Erkrankung
eine
genomischen
Duplikation bzw. Triplikation beschrieben (PARK4) (Farrer, M. et al. 2004;
Singleton, A. B. et al. 2003).
Das α-Synuclein gehört zur Familie der Synucleine, die α-, β-, und γ-Synuclein
umfassen. Synucleine wurden bislang nur in Wirbeltieren beschrieben. α-Synuclein
ist ein lösliches, nativ ungefaltetes Protein von 14 kDa, das aus drei Regionen
aufgebaut ist. Die N-terminale Domäne nimmt nach Bindung an Membranen eine αhelikale Konformation an (Davidson, W. S. et al. 1998; Eliezer, D. et al. 2001). Die
zentrale hydrophobe NAC-Domäne (non-amyloid component of plaques) ist für das
fibrillogene Potential von α-Synuclein verantwortlich (Giasson, B. I. et al. 2001,
Bodles,
2004
#1206).
Die
azide
C-terminale
Domäne
enthält
mehrere
Phosphorylierungsstellen und könnte dem Protein eine Chaperon-ähnliche Aktivität
verleihen (Okochi, M. et al. 2000; Park, S. M. et al. 2002).
α-Synuclein ist ein präsynaptisch angereichertes Protein, dessen Funktion
noch wenig charakterisiert ist (Maroteaux, L. et al. 1988). Seine Assoziierung mit
synaptischen
Membranen
lässt
allerdings
eine
Rolle
bei
der
Neurotransmitterfreisetzung oder synaptischen Plastizität vermuten (Abeliovich, A.
et al. 2000).
11
1. Einleitung
1.1.5.1.2
UCH-L1 (PARK5)
Die Punktmutation I93M im Gen für die Ubiquitin C-terminale Hydrolase L1 (UCHL1) auf Chromosom 4 wurde in einer deutschen Familie identifiziert (Leroy, E. et al.
1998). Über die pathogenetische Rolle dieser Mutation herrscht bislang Unklarheit,
da bisher nur zwei Brüder erkrankt sind, während deren Eltern asymptomatisch sind.
Die UCH-L1 ist eine wichtige Komponente des Ubiquitin-Proteasom-Systems;
sie hydrolysiert kleine C-terminale Addukte von Ubiquitin, um monomeres Ubiquitin
zu generieren. Es wurde beobachtet, dass die Mutation I93M die Enzymaktivität der
Ubiquitin-Hydrolase in vitro reduziert (~50%). Außerdem wurde beschrieben, dass
UCH-L1
in
vitro
auch
eine
Ubiquitin-Ligase-Aktivität
besitzt
und
die
Polyubiquitylierung von mono- oder di-ubiquityliertem α-Synuclein verstärkt (Liu,
Y. et al. 2002). Beide Beobachtungen lassen einen Zusammenhang zwischen
proteasomaler Fehlfunktion und der Parkinson-Erkrankung vermuten. Neben der
I93M-Mutation konnte ein weit verbreiteter Polymorphismus (S18Y) identifiziert
werden, der mit einem verminderten Parkinson-Risiko assoziiert ist (Healy, D. G. et
al. 2004).
1.1.5.1.3
LRRK2 (PARK8)
Die Leucin-rich Repeat Kinase 2 (LRRK2) wurde erst vor kurzem als Parkinsonassoziiertes Gen identifiziert (Funayama, M. et al. 2002; Paisan-Ruiz, C. et al. 2005;
Zimprich, A. et al. 2004). Als Synonym für das Genprodukt ist auch der Name
Dardarin gebräuchlich. Die LRRK2 kodiert für ein 286 kDa Protein, das aus
mehreren funktionellen Domänen aufgebaut ist (Taylor, J. P. et al. 2006):
•
N-terminale Ankyrin-Domäne
•
Leucin-reiche Wiederholung von AS (leucin rich repeat)
•
Roc-Domäne (Ras in complex proteins)
•
COR-Domäne (C-terminal of Roc)
•
MAPKKK-Domäne (mitogen-activated protein kinase kinase kinase)
•
WD40-Domäne
12
1. Einleitung
LRRK2-Mutationen sind die häufigste Ursache für die dominante familiäre
Form der Parkinson-Erkrankung mit später Manifestation, die durch ein großes
Spektrum
an
unterschiedlich
ausgeprägten
pathologischen
Merkmalen
gekennzeichnet ist (+/- Lewy-Körper, Tau-Pathologie) (Wszolek, Z. K. et al. 2004).
Mittlerweile wurden 19 Missense-Mutationen identifiziert, wobei Mutationen in der
Kinasedomäne (z.B. G2019S) die Kinaseaktivität möglicherweise erhöhen
(Gloeckner, C. J. et al. 2006; West, A. B. et al. 2005). Die physiologische Funktion
der LRRK2 und die Rolle bei der Pathogenese der Parkinson-Erkrankung sind noch
unbekannt.
1.1.5.2
Autosomal-rezessiv
erbliche
Formen
der
Parkinson-
Erkrankung
1.1.5.2.1
Parkin (PARK2)
Mutationen im Parkin-Gen wurden 1998 als Ursache für eine rezessive Form der
Parkinson-Erkrankung mit juvenilem Krankheitsbeginn in japanischen Familien
identifiziert (Kitada, T. et al. 1998). Bis zum heutigen Zeitpunkt wurde weltweit ein
breites Spektrum von Parkin-Mutationen beschrieben. Parkin nimmt unter den
bereits bekannten Parkinson-assoziierten Genen eine besondere Stellung ein, da
Mutationen in diesem Gen für die Mehrheit der familiären Fälle mit früher
Manifestation verantwortlich sind.
Eine ausführliche Charakterisierung von Parkin folgt in Kapitel 1.2.
1.1.5.2.2
PINK1 (PARK6)
Initial wurden zwei homozygote Mutationen (G309D und W437Stop) im PINK1Gen (PTEN-induced kinase 1) in drei blutsverwandten Familien identifiziert
(Valente, E. M. et al. 2004). Mittlerweile wurden mehr als 20 pathogene Mutationen
beschrieben, welche die zweithäufigste Ursache für die rezessiv-vererbte Form der
Parkinson-Erkrankung darstellen. Die PINK1-assoziierten Fälle weisen ein breites
13
1. Einleitung
phänotypisches Spektrum auf, das von einer frühen Manifestation mit atypischen
Symptomen bis hin zu einer späten Manifestation mit dem typischen klinischen Bild
der Parkinson-Erkrankung reicht. Bislang gibt es noch keine Daten zur
Neuropathologie.
PINK1 kodiert für ein Protein von 581 Aminosäuren. Neben einer KinaseDomäne besitzt PINK1 ein mitochondriales Lokalisierungssignal (Nakajima, T. et al.
2003; Unoki, M. und Y. Nakamura 2001; Valente, E. M. et al. 2004). PINK1 vermag
Neuronen gegen zellulären Stress zu schützen. Mutationen verhindern, dass PINK1
die Stress-induzierte Apoptose hemmen kann (Hatano, Y. et al. 2004; Petit, A. et al.
2005).
Mehrere
Mutationen
betreffen
die
PINK1-Kinasedomäne,
weshalb
angenommen wird, dass die Kinase-Aktivität für die Schutzfunktion von PINK1
notwendig ist. Tatsächlich reduziert die L347P-Mutation die PINK1-KinaseAktivität und führt zur Destabilisierung von PINK1 (Beilina, A. et al. 2005). Bis
heute konnten weder PINK1-Substrate noch Interaktionspartner von PINK1 entdeckt
werden.
1.1.5.2.3
DJ-1 (PARK7)
Mutationen im DJ-1 Gen wurden erstmals als Ursache einer autosomal-rezessiven
Form der Parkinson-Erkrankung in jeweils einer Familie aus den Niederlanden und
aus Italien identifiziert (Bonifati, V. et al. 2003). Die beiden beschriebenen
Mutationen
repräsentieren
typische
loss-of-function
Mutationen.
In
der
niederländischen Familie wurde eine homozygote Deletion von Exon 1-5 gefunden,
während in der italienischen Familie eine homozygote L166P Missense-Mutation
identifiziert wurde (Bonifati, V. et al. 2004). Das DJ-1 Gen ist auf Chromosom 1p36
kartiert und kodiert ein aus 189 Aminosäuren bestehendes Protein, das ubiquitär
exprimiert wird (Bandopadhyay, R. et al. 2004).
Weiterführende Studien deuteten darauf hin, dass DJ-1 nur als Dimer
funktionell ist (Honbou, K. et al. 2003; Tao, X. und L. Tong 2003; Wilson, M. A. et
al. 2003). Für DJ-1 wurden verschiedene Funktionen beobachtet. So konnte DJ-1 als
Modulator für transkriptionelle Prozesse identifiziert werden (Hod, Y. et al. 1999;
Takahashi, K. et al. 2001). Darüber hinaus wurde gezeigt, dass DJ-1 ein redoxsensitives Protein mit zytoprotektivem Potential gegenüber oxidativem Stress ist.
14
1. Einleitung
Nach Behandlung von Zellen mit Wasserstoffperoxid verschiebt sich der
isoelektrischen Punkt von DJ-1 in den sauren Bereich, d.h. Cysteine und Methionine
von DJ-1 werden zu Cystein- bzw. Methionin-Sulfinsäuren und –sulfonsäuren
oxidiert (Martinat, C. et al. 2004; Mitsumoto, A. et al. 2001; Taira, T. et al. 2004;
Yokota, T. et al. 2003). Die Strukturhomologie zum E.coli Chaperon Hsp31 lässt
vermuten, dass DJ-1 eine Chaperon-ähnliche Funktion besitzt, was aber noch nicht
zweifelsfrei geklärt werden konnte (Lee, S. J. et al. 2003; Shendelman, S. et al.
2004).
1.2 Parkin-assoziierte autosomal-rezessive Parkinson-Erkrankung
1.2.1
Klinische und neuropathologische Charakteristika
Mutationen im Parkin-Gen sind verantwortlich für eine autosomal-rezessiv vererbte
Form der Parkinson-Erkrankung (Kitada, T. et al. 1998). In der Mehrzahl der Fälle
sind die Mutationen homozygot, einige Fälle zeigen zwei verschiedene monoallelische Mutationen und sehr selten treten heterozygote Mutationen auf. Das
klinische Erscheinungsbild ist in der Regel nicht von der sporadischen ParkinsonErkrankung zu unterscheiden und durch ein gutes Ansprechen auf L-Dopa
gekennzeichnet.
Bislang
konnten
nur
wenige
Parkin-assoziierte
Parkinson-Fälle
neuropathologisch analysiert werden. Hierbei zeigten Patienten mit homozygoten
Deletionen des PARK2-Gens einen weigehend selektiven Verlust von dopaminergen
Neuronen in der SNpc und im Locus coeruleus (Hayashi, S. et al. 2000; Ishikawa, A.
und H. Takahashi 1998; Matsumine, H. et al. 1998; Mori, H. et al. 1998). Initial
wurde beschrieben, dass Patienten mit Parkin-Mutationen keine Lewy-KörperPathologie aufweisen, kürzlich wurden jedoch Parkin-assoziierte Fälle mit LewyKörpern entdeckt, so dass die neuropathologischen Veränderungen - ähnlich wie bei
LRRK2-Patienten - vielfältig sind oder möglicherweise vom Alter des Patienten oder
von der Art der Mutation abhängen. Für eine eindeutige Schlussfolgerung bedarf es
weiterer Autopsien (Farrer, M. et al. 2001; Shimura, H. et al. 1999; Shimura, H. et
al. 2001; Takahashi, H. et al. 1994).
15
1. Einleitung
1.2.2
Molekulargenetische und zellbiologische Charakteristika von
Parkin
Parkin ist mit einer 1,3 Mb langen genomischen DNA eines der größten Gene des
humanen Genoms. Es ist auf Chromosom 6q25.2-q27 lokalisiert. Seine 12 Exons
kodieren ein Protein von 465 Aminosäuren mit einer Molekülmasse von 52 kDa
(Kitada, T. et al. 1998) (Abb. 8).
Abbildung 8.
Schematische Darstellung des Parkinlocus. Parkin ist auf Chromosom 6q25.2-27
lokalisiert. Seine 12 Exons kodieren für ein Protein mit folgenden Domänen: Ubiquitin-like-Domäne,
RING (really interesting new gene)-Domäne und In-between RING-Domäne. Abbildung aus (Mata, I.
F. et al. 2004).
Parkin ist in den verschiedensten Spezies hoch konserviert. Es wurde nicht nur
in Wirbeltieren wie Mensch, Ratte und Maus, sondern auch in wirbellosen Tieren
wie Caenorhabditis elegans und Drosophila melanogaster nachgewiesen. Beim
Vergleich der Aminosäuresequenz von Parkin lässt sich eine große Homologie
zwischen den verschiedenen Spezies feststellen (Haywood, A. F. und B. E. Staveley
2004). Das Maus- bzw. Ratten-Parkin-Ortholog zeigt 82% bzw. 83% Homologie zu
humanem Parkin. Interessanterweise sind insbesondere die funktionellen Domänen
stark konserviert (Abb. 9).
16
1. Einleitung
Abbildung 9.
Sequenzvergleich von Parkin verschiedener Spezies. ClustalW Alignment der
Parkin-Sequenzen von Drosophila melanogaster, Anopheles gambiae, Rattus norvegicus, Mus
musculus und Homo sapiens. Die Sterne markieren konservierte Aminosäuren. RING: really
intersting new gene. Abbildung aus (Haywood, A. F. und B. E. Staveley 2004).
Parkin wird ubiquitär exprimiert, u.a im Gehirn, Herz und in Skelettmuskeln
(Kitada, T. et al. 1998). Innerhalb des Gehirns wird Parkin in verschiedenen
Regionen exprimiert, interessanterweise aber nur schwach in der SNpc (Kitada, T. et
al. 1998). In der Zelle ist Parkin überwiegend im Zytoplasma zu finden (Shimura, H.
et al. 1999). Daneben wurde eine Assoziation mit dem trans-Golgi-Netzwerk (TGN)
(Kubo, S. I. et al. 2001), Actin- und Tubulin-Filamenten (Huynh, D. P. et al. 2003;
Ren, Y. et al. 2003) sowie synaptischen Vesikeln beschrieben (Fallon, L. et al. 2002;
Kubo, S. I. et al. 2001).
Analysen der Primärstruktur ermöglichen die Zuordnung verschiedener
Domänen innerhalb des Proteins. Neben der N-terminalen Ubiquitin-like (UBL)Domäne verfügt Parkin über eine C-terminale Really Interesting New Gene (RING)Box, bestehend aus zwei RING-Motiven und der dazwischen liegenden In-between
RING (IBR)-Domäne (Abb. 10).
17
1. Einleitung
Abbildung 10. Schematische Darstellung des Parkin-Proteins. Parkin besteht aus 465
Aminosäuren und weist eine Molekülmasse von 52 kDa auf. Innerhalb des Proteins lassen sich
verschiedene Regionen identifizieren: N-terminale UBL-Domäne und C-terminale RING-Box,
bestehend aus zwei RING-Motiven und der dazwischen liegenden IBR-Domäne. UBL: Ubiquitin-like,
RING: really interesting new gene, IBR: in-between RING.
Die N-terminale UBL-Domäne von Parkin umfasst die Aminosäuren 1-76 und
ist zu 62 % dem humanen Ubiquitin homolog (Kitada, T. et al. 1998) (Abb. 11).
Dem N-Terminus wird eine Funktion bei der Kontrolle der Parkin-Expression
(Finney, N. et al. 2003), Beteiligung bei der Substraterkennung (Shimura, H. et al.
2000) und Interaktion mit der Rpn10-Untereinheit des 26S Proteasoms (Sakata, E. et
al. 2003) zugeschrieben.
Abbildung 11. Die Ubiquitin-like (UBL)-Domäne von Parkin. Vergleich der UBL-Sequenz von
Parkin mit der Sequenz von Ubiquitin aus verschiedenen Spezies (Mensch, Hefe, Sojabohne). Rechts:
3D-Struktur der UBL von Parkin (NMR). Gelb: β-Faltblatt-Struktur, Pink: α-Helix. Abbildung aus
(Kitada, T. et al. 1998, Sakata, E. et al. 2003).
In der Nähe des C-Terminus finden sich zwei RING-Motive, die durch eine
Cystein-reiche IBR-Domäne voneinander getrennt sind (Kitada, T. et al. 1998;
Morett, E. und P. Bork 1999). Die C-terminalen Domänen werden zusammengefasst
auch als RING-Box bezeichnet und spielen vermutlich eine Rolle bei der Interaktion
mit Substraten und E2-Ubiquitin-konjugierenden Enzymen. Proteine mit dieser
RING-Konfiguration zeigen typischerweise eine Ubiquitin-E3-Ligase-Aktivität, d.h.
18
1. Einleitung
sie vermitteln das Anhängen von Ubiquitin-Einheiten an spezifische Substrate
(Joazeiro, C. A. und A. M. Weissman 2000).
1.2.3
Physiologische Funktion von Parkin
1.2.3.1
Die E3-Ubiquitin-Ligase-Aktivität von Parkin
Das Vorhandensein der C-terminalen RING-Box legte nahe, dass es sich bei Parkin
um eine E3-Ubiquitin-Ligase handeln könnte. Verschiedene Arbeitsgruppen konnten
zeigen, dass Parkin tatsächlich eine E3-Ligase-Aktivität aufweist (Imai, Y. et al.
2000; Shimura, H. et al. 2000; Zhang, Y. et al. 2000). Mittlerweile wurden einige
putative Parkin-Substrate beschrieben, die insbesondere durch Yeast Two-HybridStudien identifiziert wurden. Über die physiologische Relevanz dieser Proteine als
authentische Parkin-Substrate herrscht allerdings Unklarheit (siehe Punkt 1.2.3.1.3).
1.2.3.1.1
Das Ubiquitin-Proteasom-System
Das Ubiquitin-Proteasom-System (UPS) ist essentiell für die nicht-lysosomale
Degradierung von kurzlebigen, delokalisierten, missgefalteten, mutierten oder
beschädigten Proteinen und spielt somit eine wichtige Rolle für das Überleben der
eukaryontischen Zelle (Sherman, M. Y. und A. L. Goldberg 2001). Der Abbau von
Proteinen über das Ubiquitin-Proteasom-System (UPS) ist ein regulierter
Mehrstufenprozess, der von spezifischen Enzymen katalysiert wird (Ciechanover, A.
und P. Brundin 2003) (Abb. 12).
Ein Ubiquitin-aktivierendes Enzym E1 katalysiert die Ausbildung einer ATPabhängigen Thioester-Bindung zwischen dem C-Terminus des Ubiquitins und einem
reaktiven Cystein des E1. Das aktivierte Ubiquitin wird nun auf einen Cystein-Rest
des Ubiquitin-konjugierenden Enzyms E2 transferiert. Es kommt zur Ausbildung
einer Thioester-Bindung zwischen Ubiquitin und E2. Die Ubiquitinierung des
Zielproteins erfolgt durch den E2/E3-Komplex, der die Ausbildung einer IsoPeptidbindung zwischen dem C-terminalen Glycin des Ubiquitins und der
ε-Aminogruppe eines Lysins innerhalb des Substrates katalysiert. Die Spezifität des
19
1. Einleitung
Ubiquitylierungsprozesses wird durch funktionelle Interaktion des E2/E3-Komplexes
mit dem Substrat gewährleistet. Bei einer Polyubiquitylierung werden weitere
Ubiquitin-Einheiten
an
das
erste
Ubiquitin
angefügt.
Erfolgt
die
Ubiquitinverknüpfung über Lysin-48, so werden die markierten Proteine über das
26S-Proteasom abgebaut (DeMartino, G. N. und C. A. Slaughter 1999; Hershko, A.
und A. Ciechanover 1998; Hershko, A. et al. 2000; Hochstrasser, M. 1996; Pickart,
C. M. 2000).
Abbildung 12. Regulierter Mehrstufenprozess des E1/E2/E3-Systems. Ubiquitin-aktivierendes
Enzym E1, Ubiquitin-konjugierendes Enzym E2, E3-Ubiquitin-Ligase. Abbildung modifiziert nach
(Winklhofer, K. F. 2006).
Das Proteasom ist ein Multiproteinkomplex mit einem Molekulargewicht von
etwa zwei Mega-Dalton. Nach seinem Sedimentationskoeffizient wird das
Holoenzym auch 26S Proteasom genannt. Das Proteasom besteht aus zwei
Subkomplexen (Abb. 13).
Der proteolytisch aktive Teil ist das sogenannte 20S Proteasom. Es besteht aus
α- und β-Untereinheiten und hat die Form eines hohlen Zylinders, der aus vier
übereinanderliegenden Ringen (αββα) besteht (Baumeister, W. et al. 1998). Die
Ringe bestehen aus je sieben Proteinen, die proteolytische Aktivität ist an der
Innenseite der β-Ringe lokalisiert (Arendt, C. S. und M. Hochstrasser 1997). Das
Proteasom ist eine Threonin-Protease, bei der die Hydroxylgruppe des N-terminalen
20
1. Einleitung
Threonins der aktiven Untereinheiten die Carbonylgruppe der Peptidbindung
nukleophil angreift (Ditzel, L. et al. 1998; Fenteany, G. et al. 1995). Die Produkte
der Degradierung durch das Proteasom sind Peptide (etwa 4-9 Aminosäuren), die
durch zytosolische Peptidasen in ihre Aminosäuren zerlegt werden und für die
Synthese von Proteinen wiederverwendet werden.
Die zweite Untereinheit des Proteasoms ist der sogenannte 19S RegulatorKomplex oder 19S-Kappe (cap), die an beide äußeren Enden des 20S-Komplexes
bindet (Glickman, M. H. et al. 1998). Er besteht aus über 20 verschiedenen Proteinen
(Rpn und Rpt), wovon die sechs Rpt-Untereinheiten AAA-ATPasen (ATPases
associated with various activities) sind, die Chaperon-Aktivität besitzen (Braun, B.
C. et al. 1999; Rubin, D. M. et al. 1998). Der 19S Regulator-Komplex vermittelt die
Erkennung
und
Entfaltung
von
ubiquitylierten
Substraten
sowie
ihre
Deubiquitylierung vor dem Abbau (durch Rpn11). Die Ubiquitin-Ketten werden
durch Ubiquitin-Carboxy-terminale Hydrolasen in monomere Ubiquitin-Moleküle
zerlegt.
Abbildung 13. Das 26S-Proteasom. Das 26S-Proteasom besteht aus zwei Subkomplexen.
Dargestellt ist der 19S-Regulator-Komplex, bestehend aus Rpn- und Rpt-Untereinheiten, oberhalb und
unterhalb des 20S-Proteasoms. Das proteolytisch aktive 20S Proteasom besteht aus je zwei α- und βRingen. Der 19S-Regulator-Komplex vermittelt die Erkennung und Entfaltung von ubiquitylierten
Substraten und ihre Deubiquitylierung vor dem Abbau. Die Ubiquitin-Ketten werden durch UbiquitinCarboxy-terminale Hydrolasen in monomere Ubiquitin-Moleküle zerlegt. Die Produkte der
Degradierung durch das Proteasom sind Peptide. Abbildung modifiziert nach (Wolf, D. H. und W.
Hilt 2004).
21
1. Einleitung
1.2.3.1.2
Unterschiedliche Arten der Ubiquitin-Verknüpfung
Je nach Art der Ubiquitin-Verknüpfung und Anzahl der Ubiquitin-Einheiten wird das
modifizierte Substrat entweder vom Proteasom abgebaut oder es ändert seine
Funktion oder zelluläre Lokalisierung. Eine konventionelle Polyubiquitylierung über
Lysin-48 markiert Proteine für den proteasomalen Abbau. Dagegen ist die nichtkonventionelle
Ubiquitylierung
über
Lysin-63
für
verschiedene
zellulären
Funktionen verantwortlich, einschließlich Endozytose, DNA-Reparatur und zelluläre
Signaltransduktion (Abb. 14).
Abbildung 14. Arten der Ubiquitin-Verknüpfung. Proteine können an einem oder mehreren
Lysin (K)-Resten monoubiquityliert (A, B) oder polyubiquityliert (C, D) werden. (C)
Polyubiquitinketten über K48 markieren Proteine für die proteasomale Degradierung. (D)
Polyubiquitinketten über K63 haben eine regulierende Funktion. Abbildung modifiziert nach (Hicke,
L. 2001).
1.2.3.1.3
1.2.3.1.3.1
Potentielle Parkin-Substrate
Parkin-mediierte proteasomale Degradierung
Entsprechend seiner Funktion als E3-Ubiquitin-Ligase konnte gezeigt werden, dass
Parkin mit einigen E2-Ubiquitin-konjugierenden Enzymen interagiert (vgl. Tab. 2).
Neben den humanen E2-Ubiquitin-konjugierenden Enzymen UbcH7 und UbcH8
wurden die mit dem Endoplasmatischen Retikulum (ER)-assoziierten E2-Enzyme
Ubc6 und Ubc7 als Bindepartner identifiziert. Es wurde postuliert, dass der
22
1. Einleitung
E2/E3-Enzymkomplex die Ubiquitylierung über Lysin-48 katalysiert und die
Zielproteine für die proteasomale Degradierung markiert (Imai, Y. et al. 2001; Imai,
Y. et al. 2000; Shimura, H. et al. 2000; Shimura, H. et al. 2001; Zhang, Y. et al.
2000).
E2-Ubiquitin-
Modellsystem
konjugierendes Enzym
UbcH7, UbcH8
Zellkultur
(Shimura, H. et al. 2000;
(Überexpression)
Zhang, Y. et al. 2000;
Imai, Y. et al. 2000)
UbcH7
Humanes Gehirn
(Shimura, H. et al. 2001)
Ubc6, Ubc7
Zellkultur
(Imai, Y. et al. 2001)
(Überexpression)
Ubc13/Uev1a
in vitro
(Doss-Pepe, E. W. et al. 2005;
(rekombinante Proteine)
Matsuda, N. et al. 2006)
Tabelle 2.
Parkin-assoziierte E2-Ubiquitin-konjugierende Enzyme.
conjugating enzyme E2, Uev1a:.Ubiquitin conjugating enzyme E2 variant 1a.
Ubc:
Ubiquitin
Bislang wurden zahlreiche putative Parkin-Substrate durch Yeast-Two-Hybridoder Co-Immunopräzipitations-Studien identifiziert (vgl. Tab. 3). Die SubstratProteine erfüllen die unterschliedlichsten Funktionen in der Zelle. So finden sich
Proteine mit vesikulärer und synaptischer Funktion wie CDCrel-1 (Zhang, Y. et al.
2000), CDCrel-2a (cell division control-related protein) (Choi, P. et al. 2003),
Synaptotagmin XI (Huynh, D. P. et al. 2003), O-glykosyliertes α-Synuclein (αSp22)
(Shimura, H. et al. 2001), Synphilin-1 (Chung, K. K. et al. 2001) und der DopaminTransporter (DAT) (Jiang, H. et al. 2004), Kontrollproteine des Zellzyklus wie
Cyclin E (Staropoli, J. F. et al. 2003), Proteine der Protein-Biosynthese wie
p38/JTV-1 (Aminoacyl-tRNA Synthetase-Untereinheit) (Corti, O. et al. 2003; Ko, H.
S. et al. 2005), Transkriptionsfaktoren wie FBP1 (far upstream sequence elementbinding protein 1) (Ko, H. S. et al. 2006), Proteine des Zytoskeletts wie α/β-Tubulin
(Ren, Y. et al. 2003), Proteine der nukleären Export-Pore wie RanBP2 (Um, J. W. et
al. 2006) und Proteine der zellulären Signaltransduktion wie Pael-R (Parkin23
1. Einleitung
associated endothelin-like receptor) (Imai, Y. et al. 2001). Die Relevanz und
Authentizität der Mehrzahl dieser Substrate konnte bisher nicht konsistent gezeigt
werden. Neuropathologische Untersuchungen der Gehirne von Patienten mit Parkinassoziierter Parkinson-Erkrankung konnten zwar die geringfügige Akkumulation von
nicht-ubiquityliertem αSp22, Pael-R, Cyclin E, CDCrel-1 und CDCrel-2a, FBP1 und
p38/JTV-1 in einigen Gehirnen zeigen, aber nur für FBP1 und p38/JTV-1 wurde eine
Akkumulation im Gehirn von Parkin-Knock-out-Mäusen nachgewiesen (Choi, P. et
al. 2003; Imai, Y. et al. 2001 Staropoli, 2003 #582; Ko, H. S. et al. 2006; Ko, H. S.
et al. 2005).
Putative Parkin-Substrate
mögliche Bedeutung
vesikuläre & synaptische Funktionen
CDCrel-1
(Zhang, Y. et al. 2000)
CDCrel-2a
(Choi, P. et al. 2003)
Synaptotagmin XI
(Huynh, D. P. et al. 2003)
αSp22
(Shimura, H. et al. 2001)
Synphilin-1
(Chung, K. K. et al. 2001)
DAT
(Jiang, H. et al. 2004)
Zellzyklus
Cyclin E
(Staropoli, J. F. et al. 2003)
Protein-Biosynthese
p38/JTV-1
(Corti, O. et al. 2003;
Ko, H. S. et al. 2005)
FBP1
(Ko, H. S. et al. 2006)
Zytoskelett
α/β-Tubulin
(Ren, Y. et al. 2003)
Zelluläre Signaltransduktion
Pael-R
(Imai, Y. et al. 2001)
Kernexport
RanBP2
(Um, J. W. et al. 2006)
Tabelle 3.
Putative Parkin-Substrate und deren Bedeutung. CDCrel: cell division controlrelated protein, αSp22: O-glykosyliertes α-Synuclein, DAT: Dopamin-Transporter, FBP1: far
upstream sequence element-binding protein 1, Pael-R: Parkin-associated endothelin-like receptor,
RanBP2: Ran-binding protein 2.
24
1. Einleitung
1.2.3.1.3.2
Parkin-mediierte regulierende Ubiquitylierung
Erst vor kurzem konnte auch das heterodimere E2-Ubiquitin-konjugierende Enzym
UbcH13/Uev1a als Interaktionspartner von Parkin in vitro nachgewiesen werden
(Doss-Pepe, E. W. et al. 2005; Matsuda, N. et al. 2006). In früheren in vitro-Studien
wurde bereits beschrieben, dass UbcH13/Uev1a die Anheftung von Ubiquitin über
Lysin-63 katalysiert (McKenna, S. et al. 2001). Neuere in vivo-Studien zeigten, dass
Parkin neben der konventionellen Ubiquitylierung über Lysin-48 auch die
Ubiquitylierung über Lysin-63 katalysiert (Synphilin-1) (Lim, K. L. et al. 2005).
Zudem konnte eine Parkin-mediierte mehrfache Monoubiquitylierung beobachtet
werden (p38/JTV-1 und Hsp70) (Hampe, C. et al. 2006; Moore, D. J. et al. 2005a)
(vgl. Tab. 4). Welche physiologische Rolle die Parkin-mediierte regulierenden
Ubiquitylierung spielt, ist weitgehend unklar.
Putative Substrate für eine Parkin-mediierte
regulierende Ubiquitylierung
mögliche Bedeutung
EGFR-Endozytose
Eps15
(Fallon, L. et al. 2006)
Synaptische Funktion
Synphilin-1 (Poly-Ub)
(Lim, K. L. et al. 2005)
Biosynthese
p38/JTV-1 (Multi-Ub)
(Hampe, C. et al. 2006)
Chaperon
Hsp70 (Multi-Ub)
(Moore, D. J. et al. 2005a)
Tabelle 4.
Putative Substrate für eine Parkin-mediierte regulierende Ubiquitylierung und
deren Bedeutung. Eps15: Epidermal growth factor receptor pathway substrate 15, Hsp70: Heat
shock protein 70, Poly-Ub: Polyubiquitylierung, Multi-Ub: Monoubiquitylierung an mehreren LysinResten.
Es lässt sich festhalten, dass Parkin sowohl eine Polyubiquitylierung über
Lysin-48
und
Lysin-63
mediieren
kann,
als
auch
eine
mehrfache
Monoubiquitylierung. Somit könnte Parkin als multifunktionale E3-Ubiquitin-Ligase
fungieren. Basierend auf diesen Befunden wurde spekuliert, dass eine Akkumulation
25
1. Einleitung
von toxischen Substraten der Parkin-assoziierten Parkinson-Erkrankung zugrunde
liegen
könnte.
Weiterhin
könnte
auch
der
Verlust
einer
regulierenden
Ubiquitylierung zur Pathogenese der Erkrankung beitragen.
1.2.3.1.5
Weitere Parkin-interagierende Proteine
Neben den bereits genannten E2-Ubiquitin-konjugierenden Enzymen und putativen
Parkin-Substraten (siehe Punkt 1.2.3.1.3), wurden zahlreiche weitere Proteine als
Interaktionspartner von Parkin identifiziert (vgl. Tab. 5).
So ist es vorstellbar, dass Parkin als Bestandteil eines größeren LigaseKomplexes - dem Skp1-Cullin-F-Box (SCF)-Proteinkomplex - funktionell ist
(Staropoli, J. F. et al. 2003). Imai et al. beschrieben zudem eine Komplexbildung mit
den Chaperonen CHIP (Carboxyl terminus of the Hsc70-interacting protein) und
Hsp70 (Imai, Y. et al. 2002). Die Interaktion mit dem Gerüstprotein CASK (Ca2+calmodulin-dependent serine protein kinase) lässt Parkin als Bestandteil eines
postsynaptischen Komplexes vermuten, welcher mit postsynaptischen Membranen
und Lipid Rafts im Gehirn co-lokalisiert (Fallon, L. et al. 2002).
26
1. Einleitung
putative Parkininteragierende Proteine
mögliche
Bedeutung
Actin-Filamente
Zytoskelett
CASK/Lin2
postsynaptisches
PDZ-Gerüstprotein
(Huynh, D. P. et al. 2000)
(Fallon, L. et al. 2002)
Cullin-1
Multiprotein-Ligase
(Staropoli, J. F. et al. 2003)
γ-Tubulin
Zentrosom
(Zhao, J. et al. 2003)
Rpn-10
proteasomale
(Dachsel, J. C. et al. 2005;
α4
Untereinheit
Sakata, E. et al. 2003)
14-3-3η
Signalregulation
(Sato, S. et al. 2006)
BAG5
Co-Chaperon
(Kalia, S. K. et al. 2004)
CHIP
Chaperon
(Imai, Y. et al. 2002)
LRRK2
?
(Smith, W. W. et al. 2005)
DJ-1-Mutanten
?
(Moore, D. J. et al. 2005b)
PINK1
mitochondriale Kinase
(Moore, D. J. 2006)
Tabelle 5.
Potentielle Parkin-interagierende Proteine und deren Bedeutung. CASK: Ca2+calmodulin-dependent serine protein kinase, PDZ: Postsynaptic density-95, disc large, zona
occludens, BAG5: Bcl-2-associated athanogene 5, CHIP: Carboxyl terminus of the Hsc70-interacting
protein, LRRK2: Leucin-rich repeat kinase 2, PINK1: PTEN-induced kinase 1.
1.2.3.2
Parkin besitzt neuroprotektives Potential
In verschiedenen Zellkultursystemen und Tiermodellen wurde ein breites
neuroprotektives Potential von Parkin beobachtet (vgl. Tab. 6). So wurde gezeigt,
dass Parkin kultivierte Zellen schützt vor Zelltod induziert durch Kainat (Staropoli, J.
F. et al. 2003), proteasomale Inhibierung (Muqit, M. M. et al. 2004; Petrucelli, L. et
al. 2002), Ceramid (Darios, F. et al. 2003), Mangan (Higashi, Y. et al. 2004),
Dopamin (Jiang, H. et al. 2004) und Überexpression von Parkin-Substraten oder
anderen Proteinen wie α-Synuclein (Petrucelli, L. et al. 2002), Pael-R (Imai, Y. et al.
2001), p38/JTV-1, verlängertes Polyglutamin-Ataxin-3-Fragment (Tsai, Y. C. et al.
27
1. Einleitung
2003) und Ataxin-2 (Huynh, D. P. et al. 2007). In Drosophila konnte eine
Überexpression von Parkin den durch α-Synuclein und Pael-R induzierten Verlust
dopaminerger Neuronen hemmen (Yang, Y. et al. 2003). Darüber hinaus verhindert
eine virale Überexpression von Parkin die durch α-Synuclein oder Tau verursachte
dopaminerge Degeneration im Ratten-Modell und schützt die Skelettmuskeln der
Maus vor mitochondrialen Toxinen (Klein, R. L. et al. 2006; Lo Bianco, C. et al.
2004; Rosen, K. M. et al. 2006).
Parkin-vermittelte
Neuroprotektion
gegenüber
proteasomaler
Inhibierung
Modellsystem
• Primäre murine
Neuronen (viraler
Gentransfer)
(Petrucelli, L. et al.
2002)
• Zellkultur (SH-SY5Y)
(Muqit, M. M. et al.
2004)
Ceramid-mediierter
Apoptose
• Zellkultur (PC12)
(Darios, F. et al. 2003)
Kainat-induzierter
Exzitotoxizität
• Primäre murine
Neuronen (viraler
Gentransfer)
(Staropoli, J. F. et al.
2003)
Mangan-induzierter
Toxizität
• Zellkultur (SH-SY5Y)
(Higashi, Y. et al.
2004)
Dopamin-induzierter
Apoptose
• Zellkultur (SH-SY5Y)
(Jiang, H. et al. 2004)
mitochondrialen Toxinen:
• Parkin-Knock-outMäuse
(Casarejos, M. J. et al.
2006)
• Zellkultur (NT-2 and
SK-N-MC)
(Hyun, D. H. et al.
2005)
• Primäre Muskelzellen
(Rosen, K. M. et al.
2006)
+
MPP , Rotenon
28
1. Einleitung
Parkin-vermittelte
Neuroprotektion
gegenüber
Modellsystem
Toxizität, hervorgerufen
durch die Überexpression
von Parkin-Substraten oder
anderen Proteinen:
Pael-R
• Zellkultur (SH-SY5Y)
(Imai, Y. et al. 2001)
• Drosophila-Modell
(Yang, Y. et al. 2003)
• Zellkultur (SK-N-MC,
SH-SY5Y)
(Ko, H. S. et al. 2005)
(Corti, O. et al. 2003)
• Primäre murine
Neuronen (viraler
Gentransfer)
(Petrucelli, L. et al.
2002)
• Ratten-Modell (viraler
Gentransfer)
(Lo Bianco, C. et al.
2004)
• Drosophila-Modell
(Yang, Y. et al. 2003)
• Transgene Mäuse
(Parkin -/-/TauVLW)
(Menendez, J. et al.
2006)
• Ratten-Modell (viraler
Gentransfer)
(Klein, R. L. et al.
2006)
• Zellkultur (N18)
(Tsai, Y. C. et al. 2003)
Ataxin-2
• Zellkultur (PC12)
(Huynh, D. P. et al.
2007)
β-Amyloid
• Primäre Muskelzellen
(Rosen, K. M. et al.
2006)
p38/JTV-1
α-Synuclein (mutiert)
Tau (mutiert)
verlängertes PolyglutaminAtaxin-3-Fragment
Tabelle 6.
Neuroprotektives Potential von Parkin gegenüber verschiedenen Stressarten.
TauVLW: Tau mit einer dreifachen FTDP-17-Mutation (G272V, P301L und R406W), FTDP-17:
Frontotemporal dementia with parkinsonism-17.
Diese Beobachtungen lassen vermuten, dass Parkin eine entscheidende Rolle
für die neuronale Integrität unter Stressbedingungen spielt. Hinzu kommt, dass
dopaminerge Neuronen aufgrund des Dopamin-Metabolismus besonders hohem
29
1. Einleitung
oxidativen Stress ausgesetzt sind (siehe Punkt 1.1.4.1). Über den Mechanismus, der
dieses breite neuroprotektive Potential von Parkin erklären könnte, ist bislang nichts
bekannt.
1.2.4
Parkin-Mutationen
In einer japanischen Population wurden erstmals große homozygote Deletionen im
Parkin-Gen beschrieben (Kitada, T. et al. 1998). Durch nachfolgende Studien
konnten jedoch auch Multiplikationen, kleine Deletionen/Insertionen und eine
Vielzahl von Punktmutationen in den verschiedenen ethnischen Gruppen identifiziert
werden. Bis zum heutigen Zeitpunkt wurden über 100 verschiedene Mutationen in
Parkinson-Patienten beschrieben (Mata, I. F. et al. 2004; West, A. B. und N. T.
Maidment 2004). In Abb. 15 sind Missense- und Nonsense-Mutationen schematisch
dargestellt.
Abbildung 15. Punktmutationen im Parkin-Gen. Schematische Darstellung von Parkin mit
seinen funktionellen Domänen. Die Lokalisation von pathogenen Missense- und Nonsense-Mutationen
im Parkin-Gen ist durch Pfeile gekennzeichnet. UBL: Ubiquitin-like, RING: really interesting new
gene, IBR: in-between RING.
Obwohl Mutationen über die gesamte kodierende Region des Parkin-Gen
verteilt auftreten, lässt sich eine Anhäufung in den funktionellen Domänen des
Proteins beobachten. Die Lokalisierung von Mutationen und die Identifizierung und
Charakterisierung von Aminosäuren, die für die Funktion von Parkin essentiell sind,
können einen wichtigen Beitrag für die Erforschung der Rolle von Parkin bei der
Pathogenese des Parkinson-Syndroms liefern. Durch Interaktionsanalysen konnte
gezeigt werden, dass Mutationen in der RING-IBR-RING-Region die Interaktion mit
E2-Ubiquitin-konjugierenden
Enzymen
30
und/oder
die
Substratbindung
1. Einleitung
beeinträchtigen (Chung, K. K. et al. 2001; Hershko, A. et al. 2000; Imai, Y. et al.
2000; Shimura, H. et al. 2001; Zhang, Y. et al. 2000). Über biochemische
Grundlagen der Inaktivierung von Parkin durch pathogene Mutationen war zu
Beginn der vorliegenden Arbeit wenig bekannt.
1.2.5
Parkin-Knock-out-Modelle
Um die physiologische Rolle von Parkin in vivo aufzuklären, wurden
unterschiedliche Knock-out-Tiermodelle generiert.
1.2.5.1
Maus-Modelle
Parkin-Knock-out-Mäuse wurden generiert durch die gezielte Deletion von Exon 3
(Goldberg, M. S. et al. 2003; Itier, J. M. et al. 2003; Palacino, J. J. et al. 2004),
Exon 7 (Von Coelln, R. et al. 2004) oder Exon 2 (Perez, F. A. und R. D. Palmiter
2005) des Parkin-Gens der Maus. Alle Deletionen führten zum Verlust des ParkinProteins.
Alle bislang publizierten Parkin-Knock-out-Mäuse haben keinen signifikanten
Phänotyp,
sie
zeigen
lediglich
geringfügige
Auffälligkeiten
in
einigen
Verhaltenstests (z.B. reduziertes exploratives Verhalten). Die Tiere zeigen keine
Parkinson-spezifische Neuropathologie, insbesondere keinen Zelltod in der SNpc
bzw. keine nigrostriatale Degeneration. Allerdings lassen sich geringfügige
Veränderungen in einigen funktionellen Test feststellen. So zeigen sich
Abweichungen im DA-Metabolismus und der dopaminergen Neurotransmission
ebenso wie Defizite in der mitochondrialen Respiration (vgl. Tab. 7). Im Vergleich
zu Wildtyp-Mäusen sind dopaminerge Neuronen von Knock-out-Tieren wesentlich
anfälliger gegenüber oxidativem Stress (induziert durch Rotenon) (Casarejos, M. J. et
al. 2006).
Ein
weiteres
Parkin-Knock-out-Modell
hat
seine
Ursache
in
einer
Spontandeletion in der Promotorregion des Quaking-Gens, das auf Chromosom 17
der Maus lokalisiert ist. Homozygote Tiere sind durch Dysmyelinierung im zentralen
Nervensystem gekennzeichnet, was zu ihrem quaking-Phänotyp führt (Sidman, R. L.
31
1. Einleitung
et al. 1964). Die Deletion einer 1,17 Mb umfassenden Region führt auch zur
Deletion des kompletten Parkin-Promotors, der ersten fünf Exons des Parkin-Gens
und des Parkin-co-regulierten-Gens (PACRG) (Lockhart, P. J. et al. 2004;
Lorenzetti, D. et al. 2004). Phänotypisch sind die Tiere durch eine gestörte Motorik
und reduziertes exploraratives Verhalten gekennzeichnet. Die Tiere zeigen ebenfalls
keine
Parkinson-spezifischen
neuropathologischen
Veränderungen,
lediglich
geringfügige Veränderungen im DA-Metabolismus und der DA-Rezeptor-Expression
wurden beobachtet (Lorenzetti, D. et al. 2004; Nikulina, E. M. et al. 1995).
Mutation
Charakteristika
Deletion Exon 3
•
geringfügige Veränderungen der
dopaminergen Neurotransmission
• vermindertes Orientierungsverhalten
• verringerte mitochondriale
Respiration (Komplex I und IV ↓)
• gesteigerte Anfälligkeit gegenüber
oxidativem Stress
(Itier, J. M. et al.
2003)
(Goldberg, M. S.
et al. 2003)
(Palacino, J. J. et
al. 2004)
Deletion Exon 7
•
Verlust von catecholaminergen
Neuronen im Locus coeruleus
(Von Coelln, R. et
al. 2004)
Deletion Exon 2
•
keine
(Perez, F. A. und
R. D. Palmiter
2005)
Spontane
Deletion
•
gesteigerter Dopamin-Metabolismus
•
erhöhte Expression der Dopamin
D2-Rezeptoren
(Lorenzetti, D. et
al. 2004;
Nikulina, E. M. et
al. 1995)
(Quaking mouse)
Tabelle 7.
Knock-out-Maus-Modelle. Unterschiede bestehen in der Art der Mutation, im
Phänotyp und der Neuropathologie.
1.2.5.2
Drosophila-Modell
Greene und Kollegen (Greene, J. C. et al. 2003) generierten ein Parkin-Knock-outModell in Drosophila melanogaster. Hierfür wurde das hoch konservierte
Drosophila-Parkin-Ortholog (siehe Punkt 1.2.2) gezielt inaktiviert. Die Knock-outTiere sind lebensfähig, ihre Lebensdauer ist allerdings verkürzt. Der Verlust von
32
1. Einleitung
funktionellem Parkin führt zur Sterilität der männlichen Fliegen und einer
apoptotischen Muskeldegeneration. Zudem zeigen sich geringfügige strukturelle
Veränderungen in den dopaminergen Zellen wie Schrumpfen der Zellkörper. Die
lokomotorischen
Defizite
Muskeldegeneration
infolge
der
Fliegen
werden
mitochondrialer
durch
Schädigung
die
apoptotische
verursacht.
Diese
Beobachtungen lassen vermuten, dass der Drosophila-Parkin-Phänotyp durch
generelle mitochondriale Dysfunktion hervorgerufen wird.
1.3 Protektive Signaltransduktionswege
Die Parkinson-Erkrankung ist gekennzeichnet durch den neuronalen Zelltod in der
SNpc. Welche Art des Zelltodes – Apoptose oder Nekrose oder möglicherweise
beides – bei der Parkinson-Erkrankung auftritt, ist weitgehend unbekannt.
Dopaminerge Neuronen sind vielfältigen Stressbedingungen ausgesetzt, unter
anderem oxidativem Stress (DA-Metabolismus) und Exzitotoxizität (glutamaterge
Neurotransmission). Folglich sind neuroprotektive Strategien in diesem Zelltyp von
besonderer Bedeutung für die Integrität der Zelle. Nachfolgend sind zwei bedeutende
Stressantwortsysteme, die im Rahmen dieser Arbeit untersucht wurden, detaillierter
aufgeführt.
1.3.1
Molekulare Chaperone und die Hitzeschock-Antwort
Die Hitzeschock-Antwort ist eine komplexe Signaltransduktionskaskade, die in der
Regel durch intrazelluläre Akkumulation von nicht-nativ gefalteten Polypeptiden
ausgelöst wird und letztendlich zur verstärkten Transkription verschiedener
Hitzeschock-Gene führt, die für unterschiedliche Hitzeschock-Proteine (Hsp)
kodieren. Diese werden entsprechend ihres Molekulargewichtes in sechs Familien
klassifiziert: Hsp100, Hsp90, Hsp70, Hsp60, Hsp40 und kleine Hitzeschock-Proteine
(Morimoto, R. I. et al. 1994). Hitzeschock-Proteine fungieren als molekulare
Chaperone und sind essentiell für das Überleben der Zelle.
Im Rahmen der Translation werden Proteine von Ribosomen in ihrer
Primärstruktur als Aminosäureketten produziert. Die biologische Aktivität eines
33
1. Einleitung
Proteins wird durch seinen nativen Zustand festgelegt, der in der Regel einer
einzigartigen dreidimensionalen Struktur entspricht. Partiell gefaltete Intermediate,
wie sie auch während der Neusynthese von Proteinen in der Zelle auftreten, besitzen
eine hohe Tendenz zu unspezifischen Aggregationsreaktionen. Molekulare
Chaperone verhindern die Aggregation durch Bindung an nicht gefaltete
Polypeptidsegmente. Daneben übernehmen Chaperone zahlreiche weitere Aufgaben
in der Zelle. So spielen sie eine Rolle bei der Kompartimentierung von Proteinen
(z.B. Import in Mitochondrien und Endoplasmatisches Retikulum) und bei der
Aktivierung, Assemblierung und Maturierung von Komponenten zahlreicher
Proteinkomplexe u.a. im Rahmen der Zellzyklusregulation oder Signaltransduktion
(z.B. Tyrosinkinasen, Steroidhormonrezeptor). Ebenso sind sie wichtig bei der
Vermittlung des proteolytischen Abbaus unter Zuhilfenahme von Co-Chaperonen
(CHIP, BAG1) (Ellis, R. J. 1990, Ellis, R. J. und F. U. Hartl 1999; Hartl, F. U. 1996;
Hartl, F. U. und M. Hayer-Hartl 2002; Netzer, W. J. und F. U. Hartl 1998; Young, J.
C. et al. 2004). Daneben kommt den Chaperonen eine wichtige Aufgabe beim Schutz
der Zelle unter Stressbedingungen zu, die zur Entfaltung und Aggregation von
Proteinen führen. Um die Proteinhomöostase aufrecht zu erhalten, reagiert die Zelle
unter proteotoxischem Stress daher mit der verstärkten Synthese von molekularen
Chaperonen.
Das primäre Signal, das zur Auslösung der Hitzeschock-Antwort führt, ist die
intrazelluläre Akkumulation von nicht-nativ gefalteten Polypepiden. Dies führt zur
Aktivierung der Hitzeschock-Transkriptionsfaktoren (HSF). In humanen Zellen
existieren drei HSF-Isoformen (HSF1, HSF2 und HSF4). HSF1 wird ubiquitär
exprimiert und induziert die ’klassische’ Hitzeschockantwort (Nover, L. et al. 1996).
HSF1 erreicht seine aktive Form durch Trimerisierung der monomeren inaktiven
Form (Ananthan, J. et al. 1986; Pirkkala, L. et al. 2000). Nach Translokation in den
Nukleus bindet HSF1 an Promoterregionen mit Hitzeschock-Element (HSE)Sequenzen und induziert die Transkription von Hitzeschock-Proteinen (Abb. 16). Die
Hitzeschock-Antwort bewirkt unter anderem die Synthese von Hsp70, Hsp90 und
Hsp27 (Udelsman, R. et al. 1994).
34
1. Einleitung
Abbildung 16. Schematische Darstellung der HSF1-mediierten Hitzeschock-Antwort.
Verschiedene Stressstimuli wie z.B. Hitzeschock, Oxidantien oder Schwermetalle, induzieren die
Akkumulation von missgefalteten Proteinen. Dies führt zur Aktivierung von HSF1 durch
Trimerisierung und dessen anschließender Translokation in den Nukleus. Die Bindung von HSF1 an
HSE-Sequenzen induziert die Transkription von Hsp-Genen. HSF1: Hitzeschock-Transkriptionsfaktor
1, HSE: Hitzeschock-Element, Hsp: Hitzeschock-Protein. Abbildung modifiziert nach (Jolly, C. und
R. I. Morimoto 2000).
1.3.2
Die NF-κB-Signalkaskade
Der Nukleäre Faktor-kappa B (NF-κB) ist einer der wichtigsten spezifischen
Transkriptionsfaktoren des Organismus. Als solcher kann er an DNA binden und die
Transkription NF-κB-abhängiger Gene beeinflussen. NF-κB ist nicht nur von
zentraler Bedeutung für die Regulation von Immunantwort und Zellproliferation,
sondern auch für die Kontrolle des programmierten Zelltodes (Apoptose) (Baeuerle,
P. A. und T. Henkel 1994; Barnes, P. J. und M. Karin 1997; Ghosh, S. und M. Karin
2002). In Säugetieren existieren die fünf NF-κB-Gene RelA (p65), RelB, c-Rel, NFκB1 und NF-κB2, die für sieben Proteine (p105, p100, p50, p52, RelA, RelB und cRel) kodieren. Die Gene für NF-κB1 (p50/p105) und NF-κB2 (p52/p100) kodieren
35
1. Einleitung
jeweils für zwei Proteine, die sich in ihrer Länge unterscheiden und entsprechend
ihrem Molekulargewicht benannt sind. Allen Proteinen gemeinsam ist eine RelHomologie-Domäne (RHD) mit etwa 300 Aminosäuren, die für die DNA-Bindung,
Dimerisierung und Interaktion mit IκB-Proteinen verantwortlich ist. Daneben
besitzen RelA, RelB und c-Rel zusätzlich mindestens eine TransaktivierungsDomäne
(TAD)
am
C-Terminus,
welche
mit
Komponenten
des
Transkriptionsapparates interagieren kann. Es handelt sich bei NF-κB nicht um ein
einzelnes Protein. Vielmehr können jeweils zwei Untereinheiten in unterschiedlichen
Kombinationen aneinander binden und auf diese Weise Homo- oder Heterodimere
bilden. Der klassische NF-κB-Komplex ist das p50/RelA-Heterodimer (Chen, L. F.
und W. C. Greene 2004; Hayden, M. S. und S. Ghosh 2004; Karin, M. und Y. BenNeriah 2000).
In unstimulierten Zellen liegt NF-κB inaktiv im Zytoplasma vor. Diese
Retention im Zytoplasma wird durch inhibitorische κB-Proteine (IκB) erreicht, die an
NF-κB binden (Baldwin, A. S., Jr. 1996; Ghosh, S. et al. 1998). Zahlreiche Stimuli
aktivieren NF-κB, wobei mehrere Aktivierungwege existieren, die auf Höhe des IκBKinase-Komplexes (IKK) zusammenlaufen. Am häufigsten wird der kanonische oder
klassische Signalweg beobachtet, der durch Zytokine wie den Tumor-Nekrosefaktor
α (TNF-α) oder das Interleukin-1 (IL-1) ebenso wie durch bakterielle Antigene wie
Lipopolysaccharide (LPS) induziert wird (Hayden, M. S. und S. Ghosh 2004). Die
Aktivierung des IKK-Komplexes, bestehend aus IKKα, IKKβ und IKKγ, ist
essentiell für die Phosphorylierung von IκBα an Serin-32 und Serin-36. Der
phosphorylierte
Inhibitor
IκBα
wird
von
Ubiquitin-Ligasen
erkannt,
polyubiquityliert und schließlich durch das Proteasom degradiert. NF-κB-Moleküle
werden auf diesem Weg von ihren Inhibitoren freigesetzt und gelangen durch
Freilegung ihres Kernlokalisierungssignals in den Zellkern (Abb. 17) (Delhase, M. et
al. 1999; Karin, M. 1999a; Karin, M. 1999b). Damit ist die erste Phase der NF-κBAktivierung abgeschlossen. Die zweite Phase der NF-κB-Aktivierung findet im
Zellkern statt. Sie umfasst posttranslationale Modifikationen (Phosphorylierung,
Acetylierung) des NF-κB-Komplexes und der Histone, welche die verschiedenen
NF-κB-Zielgene umgeben (Sizemore, N. et al. 1999; Zhong, H. et al. 1997). Die
Bindung von NF-κB an Promotorregionen, die κB-Konsensussequenzen enthalten,
induziert die Transkription von Genen, welche unter anderem für zelluläre
36
1. Einleitung
Apoptoseinhibitoren (c-IAP, cellular inhibitors of apoptosis), anti-oxidierende
Enzyme (z.B. MnSOD, Mangan-Superoxid-Dismutase) und Proteine der Bcl-2Familie kodieren (Karin, M. und A. Lin 2002; Mattson, M. P. et al. 2000).
Entscheidend für die Aktivierung des IKK-Komplexes ist die regulatorische
Untereinheit IKKγ/NEMO (NF-κB essential modifier). Zu Beginn der kanonischen
Signaltransduktionskaskade induzieren aktivierende Stimuli die regulierende
Ubiquitylierung (über Lysin-63) von mehreren Signalmolekülen wie TRAF2 (TNF
receptor-associated factor) und TRAF6. Die Aktivierung dieser übergeordneten
Signalmoleküle führt zur Ubiquitylierung von IKKγ/NEMO (ebenfalls über Lysin63) und erlaubt die Interaktion des IKK-Komplexes mit Kinasen, die IKKβ
phosphorylieren. Das phosphorylierte IKKβ fungiert als IκB-Kinase (Abb. 17)
(Chen, Z. J. 2005; Haglund, K. und I. Dikic 2005; Krappmann, D. und C. Scheidereit
2005; Ravid, T. und M. Hochstrasser 2004).
Die transkriptionelle Aktivität wird durch einen negativen RückkopplungsMechanismus terminiert. NF-κB induziert die Synthese von IκBα-Proteinen, die an
deacetyliertes RelA binden und zum nukleären Export des NF-κB-Komplexes
führen. Somit wird die transkriptionelle Aktivität gestoppt und der Pool an inaktiven
NF-κB-Komplexen im Zytosol wiederhergestellt (Arenzana-Seisdedos, F. et al.
1995; Arenzana-Seisdedos, F. et al. 1997).
NF-κB-Moleküle sind im gesamten Nervensystem zu finden und scheinen eine
zentrale Rolle für die neuronale Intregrität und synaptische Plastizität zu spielen
(Karin, M. und A. Lin 2002). Neue Zellkulturstudien und Tiermodelle konnten
zeigen,
dass
die
NF-κB-Signaltransduktion
den
durch
oxidativen
Stress,
Exzitotoxizität oder Glucosemangel induzierten neuronalen Zelltod verhindern kann
(Kaltschmidt, B. et al. 2005; Mattson, M. P. et al. 2000). Diese Beobachtungen
bringen NF-κB in einen möglichen Zusammenhang mit neurodegenerativen
Erkrankungen wie der Parkinson-Erkrankung.
37
1. Einleitung
Abbildung 17. ’Klassischer’ NF-κB-Aktivierungsweg. Die zelluläre Aktivierung durch TNFα
(Tumor-Nekrose-Faktor α), LPS (Lipopolysaccharide) oder andere Stimuli wie IL-1 (Interleukin-1)
führen zur regulierenden Ubiquitylierung über Lysin (K)-63 von verschiedenen Signalmolekülen und
schließlich von IKKγ/NEMO (NF-κB essential modifier). Die Aktivierung des IKK (IκB-Kinase)Komplexes (bestehend aus den katalytischen Untereinheiten IKKα und IKKβ sowie der
regulatorischen Untereinheit IKKγ/NEMO) führt zur Phosphorylierung der IKKβ-Untereinheit. Die
nachfolgende IKKβ-mediierte Phosphorylierung von IκBα stimuliert dessen rasche Ubiquitylierung
und Degradierung durch das Proteasom. NF-κB-Moleküle werden somit vom Inhibitor freigesetzt und
translozieren in den Zellkern, wo sie die Transkription entsprechender Zielgene induzieren.
38
1. Einleitung
1.4 Zielsetzung
Ziel der vorliegenden Dokorarbeit war es, zwei fundamentale Fragestellungen der
Parkin-Forschung zu adressieren:
1. Welche Mechanismen sind für die Inaktivierung von pathogenen ParkinMutanten verantwortlich?
2. Was ist die physiologische Funktion von Parkin und warum führt der
Funktionsverlust von Parkin zur Parkinson-Erkrankung?
Im ersten Teil der Arbeit sollte eine biochemische und zellbiologische
Charakterisierung
verschiedener
krankheitsassoziierter
Parkin-Mutanten
in
Zellkultur-Modellen durchgeführt werden. Die Studie sollte in erster Linie eine
mechanistische Erklärung für die bei der autosomal-rezessiven ParkinsonErkrankung vorhandene Inaktivierung von Parkin geben. Hierfür sollten sowohl
pathogene C-terminale Deletionsmutanten als auch N-terminale Punktmutanten
analysiert werden.
Im zweiten Teil der Arbeit sollte die physiologische Rolle von Parkin
untersucht werden. Wir und andere Arbeitsgruppen haben für Parkin ein
neuroprotektives Potential beobachtet. Ziel der vorliegenden Arbeit war die
Aufklärung des zugrunde liegenden Mechanismus. Dabei war von Interesse, ob
Parkin einen Einfluss auf essentielle Stress-induzierte Signaltransduktionswege hat
und welche Rolle die E3-Ubiquitin-Ligase-Aktivität spielt.
Die Aufklärung der Funktion von Parkin sowie der Mechanismen, die zum
Funktionsverlust von Parkin führen, können neue Einblicke liefern in die
Pathomechanismen der Degeneration dopaminerger Neuronen und möglicherweise
Grundlagen schaffen für die Entwicklung neuer therapeutischer Strategien.
39
2. Material
2. Material
2.1 Biologisches Material
2.1.1
Zelllinien
SH-SY5Y
Typ: humane Neuroblastomzellen
DSMZ-Nr. ACC 209
N2a
Typ: murine Neuroblastomzellen
ATCC-Nr. CCL 131
HEK293T
Typ: humane embryonale
Nierenzellen
ATCC-Nr. CRL-1573
Primäre Fibroblasten
humane Haut-Fibroblasten eines
PARK2-Patienten (Deletion von
Exon 3-4/Exon3-5) und einer
Kontrollperson
(Nakaso, K. et al. 2006)
2.1.2
Vektoren und Plasmide
pcDNA3.1/ZEO(+)
Invitrogen, Karlsruhe
pEYFP, pEGFP
Clonetech, Mountain View,
Californien, USA
NF-κB-Luc
(Krappmann, D. et al. 2001)
HSE-Luc
(Winklhofer, K. F. et al. 2001)
HA-Ubiquitin, FLAG-IκB∆N
(Krappmann, D. et al. 1996)
HA-K48only-Ubiquitin,
(Evans, P. C. et al. 2004)
HA-K63only-Ubiquitin
FLAG-IKKγ
(Tegethoff, S. et al. 2003)
FLAG-IKKβ K/A, FLAG-TRAF2,
(Krappmann, D. et al. 2000)
FLAG-TRAF6
FLAG-TRAF2∆N
(Rothe, M. et al. 1995)
40
2. Material
2.1.3 Bakterienstämme
DH5α
2.1.4
Genotyp: supE44, ∆lac169,
(Φ80lacZ∆M15), hsdR17, recA1,
endA1, gyrA96, thi-1, relA1
Herkunft: Hanahan, 1983
Antikörper
Anti-Parkin hP1, polyklonal, (α-hP1)
Immunisierung eines Kaninchens mit
der rekombinanten, rückgefalteten Nterminalen Domäne von Parkin
Anti-Parkin PRK28, monoklonal
(Pawlyk, A. C. et al. 2003)
Anti-Parkin PRK8, monoklonal
(Pawlyk, A. C. et al. 2003)
Anti-Parkin, polyklonal (2132)
Cell Signaling, Danvers, MA, USA
Anti-HA, monoklonal (12CA5)
Hiss Diagnostics, Freiburg
Anti-HA, polykolonal
Sigma, Taufkirchen
Anti-FLAG M2, monoklonal
Sigma, Taufkirchen
Anti-α-Tubulin, monoklonal (N356)
Amersham Biosciences, Freiburg
Anti-β-Actin, monoklonal (AC-74)
Sigma, Taufkirchen
Anti-TRAF2, monoklonal (33a1293)
Abcam, Cambridge, Grossbritanien
Anti-TRAF2, polyklonal (C-20)
Santa Cruz, Californien, USA
Anti-IKKγ, monoklonal (B-3)
Santa Cruz, Californien, USA
Anti- IKKγ, polyklonal (FL-419)
Santa Cruz, Californien, USA
Anti-p65, polyklonal (C-20)
Santa Cruz, Californien, USA
Anti-aktive Caspase-3, polyklonal
Promega, Mannheim
Anti-Kaninchen Antikörper
(HRP-gekoppelt) aus Esel
Amersham Biosciences, Freiburg
Anti-Maus Antikörper
(HRP-gekoppelt) aus Schaf
Amersham Biosciences, Freiburg
Anti-Kaninchen Antikörper Cy3
Dianova, Hamburg
Anti-Maus Antikörper FITC
Sigma, Taufkirchen
41
2. Material
2.1.5
Enzyme und Proteine
Benzonase
Merck, Darmstadt
BSA
USB, Cleveland, OH, USA
DNase I
Sigma, Taufkirchen
Pfu-Polymerase
Promega, Mannheim
Restriktionsendonukleasen
New England Biolabs, Schwalbach
Shrimp-Alkaline-Phosphatase
Roche Diagnostics, Mannheim
T4-DNA-Ligase
New England Biolabs, Schwalbach
Trypsin
Invitrogen, Karlsruhe
2.1.6
Standardgrößenmarker für Proteine und Nukleinsäuren
Referenzproteine für SDS-Page:
See Blue Plus2
Invitrogen, Karlsruhe
DNA-Längenstandards:
1 kb DNA-Leiter
100 bp DNA-Leiter
MBI Fermentas, St. Leon-Rot
MBI Fermentas, St. Leon-Rot
2.1.7
Synthetische Oligonukleotide
2.1.7.1
PCR-Primer
Die Synthese der Primer wurde von der Firma Metabion, Martinsried durchgeführt.
Schnittstellen für Restriktionsendonukleasen sind unterstrichen.
Schnittstellen für Restriktionsendonukleasen:
G/GATCC
BamHI
A/AGCTT
Hind III
GC/GGCCGC
NotI
42
2. Material
Primer:
5´-Ende
3´-Ende
BamHI-5':
CGGGATCCATGATAGTGTTTGTCAGGTTC
NotI-3':
ATAAGAATGCGGCCGCCTACACGTCGAACCAGTGCTCCCC
HindIII-5’:
CCCAAGCTTATGATAGTGTTTGTCAGGTTC
N-3’:
ATAAGAATGCGGCCGCCTAAAAGAAAAATTCTGCACTAGTC
HA-3’:
CCCAAGCTTATGTACCCATACGATGTACCTG
HA-hP-5’:
CCTGACAAACACTATCATGGATCCCGCGTAATC
HA-hP-3’:
GATTACGCGGGATCCATGATAGTGTTTGTCAGG
M80T-5’:
TGGAGAAAAGGTCAAGAAACGAATGCAACTGGAGGCGAC
M80T-3’:
GTCGCCTCCAGTTGCATTCGTTTCTTGACCTTTTCTCCA
M80L-5’:
TGGAGAAAAGGTCAAGAATTGAATGCAACTGGAGGCGAC
M80L-3’:
GTCGCCTCCAGTTGCATTCAATTCTTGACCTTTTCTCCA
Q311Stop-3’: ATAAGAATGCGGCCGCCTACTCTTCTCCCAGAATCCTGAA
GTG
E409Stop-3’: ATAAGAATGCGGCCGCTTATTTGGAGGCTGCTTCCCA
W453Stop-3’: ATAAGAATGCGGCCGCCTACTCGCAGCCACAGTTCCAGCA
∆1-79-5’:
CCCAAGCTTATGAATGCAACTGGAGGC
R33Q-5’:
AAGGAGGTGGTTGCTAAGCAACAGGGGGTTCCGGCTGAC
R33Q-3’:
GTCAGCCGGAACCCCCTGTTGCTTAGCAACCACCTCCTT
R42P-5’:
GTTCCGGCTGACCAGTTGCCTGTGATTTTCGCAGGGAAG
R42P-3’:
CTTCCCTGCGAAAATCTCAGGCAACTGGTCAGCCG
K48A-5’:
CGTGTGATTTTCGCAGGGGCGGAGCTGAGGAATGACTGG
K48A-3’:
CCAGTCATTCCTCAGCTCCGCCCCTGCGAAAATCACACG
V56E-5’:
CTGAGGAATGACTGGACTGAGCAGAATTGTGACCTGGAT
V56E-3’:
ATCCAGGTCACAATTCTGCTCAGTCCAGTCATTCCTCAG
T415N-5’:
GAAACCATCAAGAAAACCAACAAGCCCTGTCCCCGCTGC
T415N-3’:
GCAGCGGGGACAGGGCTTGTTGGTTTTCTTGATGGTTTC
G430D-5’:
TGCCATGTACCAGTGGAAAAAAATGGAGACTGCATGC
G430D-3’:
GTGCATGCAGTCTCCATTTTTTTCCACTGGTACATGGCA
43
2. Material
2.1.7.2
RT-PCR-Primer
Die Synthese der RT-PCR-Primer wurde von der Firma Thermo Scientific
durchgeführt.
Parkin (Ratte)-5’: 5’-AGACAAGCAACCCTCACCTT-3’
Parkin (Ratte)-3’:
5’-TGGCACTCTCCACTCATCC-3’
β-Actin (Ratte)-5’: 5’-CTCTCTTCCAGCCTTCCTTC-3’
β-Actin (Ratte)-3’: 5’-GGTCTTTACGGATGTCAACG-3’
Die Synthese von TaqMan-Proben wurde von der Firma Applied Biosystems
durchgeführt.
Parkin:
Hs01038827-m1
β-Actin: P/N 4326315 E
2.1.7.3
siRNA
Die Synthese der siRNA wurde von der Firma Invitrogen durchgeführt.
Parkin StealthTM siRNA duplex 1: 5’-UUCGCAGGUGACUUUCCUCUGGUCA-3’
Negative control StealthTM siRNA
2.1.7.4
EMSA-Sonden
Die Synthese der Sonden wurde von der Firma Promega durchgeführt.
NF-κB Konsensus-Oligonukleotid: 5’-AGTTGAGGGTTTCCCAGGC-3’
OCT1 Konsensus-Oligonukleotid: 5’-TGTCGSATGCAAATCACTAGAA-3’
2.2 Chemikalien
Aceton
Merck, Darmstadt
Agarose
Serva, Heidelberg
Ampicillin
Boehringer Mannheim, Mannheim
Amplify
Amersham Biosciences, Freiburg
44
2. Material
APS
USB, Cleveland, OH, USA
B27-Supplement
Invitrogen, Karlsruhe
β-Mercaptoethanol
Merck, Darmstadt
Bacto Agar
Difco Laboratories, Detroit, MI, USA
Bromphenolblau
Merck, Darmstadt
Complete Protease-Inhibitor
Roche Diagnostics, Mannheim
Desoxycholat
Sigma, Taufkirchen
Desoxynucleosidtriphosphate
dATP, dCTP, dGTP, dTTP
Sigma, Taufkirchen
Dinatriumhydrogenphosphat
Merck, Darmstadt
Dithiothreitol
Sigma, Taufkirchen
EDTA
USB, Cleveland, OH, USA
Essigsäure
Merck, Darmstadt
Ethanol
Sigma, Taufkirchen
Ethidiumbromid
Sigma, Taufkirchen
FCS
Invitrogen, Karlsruhe
Ficoll 400
Merck, Darmstadt
Glutamin
Invitrogen, Karlsruhe
Glycerol
USB, Cleveland, OH, USA
Glycin
USB, Cleveland, OH, USA
GS (goat serum)
Sigma, Taufkirchen
Hefeextrakt
Difco Laboratories, Detroit, MI, USA
HEPES
Sigma, Taufkirchen
HS
Invitrogen, Karlsruhe
Immersionsöl
Merck, Darmstadt
Instant-Magermilchpulver
Uelzena, Uelzen
Kainat
Calbiochem, Darmstadt
Kaliumacetat
Sigma, Taufkirchen
Kaliumchlorid
USB, Cleveland, OH, USA
Kaliumdihydrogenphosphat
Merck, Darmstadt
Magnesiumchlorid
USB, Cleveland, OH, USA
Manganchlorid
Sigma, Taufkirchen
Meglumin-Diatrizoat
Sigma, Taufkirchen
Methanol
Merck, Darmstadt
45
2. Material
MG 132
Merck, Darmstadt
Natriumchlorid
Merck, Darmstadt
Natrium-Diatrizoat
Sigma, Taufkirchen
Natriumhydroxid-Plätzchen
Merck, Darmstadt
NEM
Sigma, Taufkirchen
Paraformaldehyd
Sigma, Taufkirchen
PBS Dulbecco’s +/+ Mg/Ca
Invitrogen, Karlsruhe
PBS Dulbecco’s -/- Mg/Ca
Invitrogen, Karlsruhe
Penicillin/Streptomycin/Glutamin
Invitrogen, Karlsruhe
Pepton
Difco Laboratories, Detroit, MI, USA
PMA
Sigma, Taufkirchen
Ponceau S
Sigma, Taufkirchen
Polyacrylamid/Bisacrylamid (29:1) 40%
Roth, Karlsruhe
Power SYBR Green PCR Mastermix
Applied Biosystems, Foster City,
USA
ProMix [35S]-Methionin/Cystein
Amersham Biosciences, Freiburg
L-[35S]-Methionin
Amersham Biosciences, Freiburg
Protein A-Agarose
Pierce, Perbio Science, Bonn
Protein A-Trisacryl-Matrix
Pierce, Perbio Science, Bonn
Protein G-Matrix
Pierce, Perbio Science, Bonn
Rotenon
Sigma, Taufkirchen
Rubidiumchlorid
Sigma, Taufkirchen
Salzsäure
Merck, Darmstadt
Sarkosyl
USB, Cleveland, OH, USA
SDS
Roth, Karlsruhe
Sucrose
Sigma, Taufkirchen
TaqMan Universal PCR Mastermix
Applied Biosystems, Foster City,
USA
TEMED
USB, Cleveland, OH, USA
TNFα
Biomol, Hamburg
Transfektionsreagenz:
Lipofectamine Reagent
Plus Reagenz
Lipofectamine 2000
Invitrogen, Karlsruhe
Invitrogen, Karlsruhe
Invitrogen, Karlsruhe
Trichloressigsäure
Merck, Darmstadt
46
2. Material
Tris
USB, Cleveland, OH, USA
Triton X-100
USB, Cleveland, OH, USA
Trypan Blau
Invitrogen, Karlsruhe
Trypton
Difco Laboratories, Detroit, MI, USA
Tween-20
USB, Cleveland, OH, USA
2.3 Lösungen und Puffer
APS-Lösung
10% Ammoniumperoxodisulfat in
PBS
Blocking Milk für Western Blot
5% Magermilchpulver in 1x PBST
Blockierunspuffer (IF)
5% Pferdeserum
0,1% Tween 20 in PBS
BSA 100x
New England Biolabs, Schwalbach
Coomassie-Entfärbelösung
40% Methanol
7% Essigsäure
DNA-Probenpuffer (6x)
0.25% Bromphenolblau
30% Glycerol
EMSA-Mix
10 mM HEPES pH 7,9
50 mM NaCl
5 mM MgCl2
2 mM DTT
0,1 mM EDTA
5 % Glycerol
0,5 µg/µl BSA
0,1 µg/µl poly dIdC in PBS
Hochsalzpuffer
20 mM HEPES pH 7,9
300 mM NaCl
10 mM KCl
5 mM MgCl2
0,5 mM EDTA
0,1 %Triton X-100
20 % Glycerol
2 mM DTT in PBS
IP-Lysepuffer
0,1% Triton X-100
Complete-Protease-Inhibitor in PBS
Kainat
50 mM Kainat in H2O
47
2. Material
Laemmli-Probenpuffer (2x)
120 mM Tris pH 6.8
2% SDS
20% Glycerol
0.5% Bromphenolblau
2% Mercaptoethanol
Laemmli-Probenpuffer (4x)
240 mM Tris pH 6.8
4% SDS
40% Glycerol
1% Bromphenolblau
4% Mercaptoethanol
Laufpuffer für SDS-Page (10x)
250 mM Tris, pH 6,8
1,9 M Glycin
1% SDS
Lysepuffer
0,1% Triton X-100 in PBS
Lysepuffer, denaturierend
50 mM Tris-HCl pH 7.4
5 mM EDTA
1% SDS
25 mM NEM
15 U/ml DNase I
Complete Protease-Inhibitor in PBS
Lysepuffer, nicht-denaturierend
50 mM Tris-HCl pH 7.4
300 mM NaCl
5 mM EDTA
1% Triton X-100
25 mM NEM
Complete-Protease-Inhibitor in PBS
Lysepuffer, hypoton
20 mM HEPES pH 7,9
10 mM KCl
5 mM MgCl2
0,5 mM EDTA
0,1 %Triton X-100
20 % Glycerol
2 mM DTT in PBS
MG132
10 mM MG132 in DMSO
NEM
1 M NEM in Ethanol
PBS (10x)
80 g NaCl
2 g KCl
14,4 g Na2HPO4 x 2 H2O
2,4 g KH2PO4
PBST (10x)
1% Tween 20 in 1 x PBS
Pfu-Polymerase-Puffer (10x)
Promega, Mannheim
Ponceau S – Färbelösung
0,2 g Ponceau S
5 ml Essigsäure
H2O ad 100 ml
48
2. Material
Renografin 76%
66% Meglumin-Diatrizoat
10% Natrium-Diatrizoat
TE pH 7,6
Reporter-Lysepuffer (5x)
Promega, Mannheim
Rotenon
0,5 mg/ml in DMSO
Sammelgelpuffer für SDS-Page
(Upper Tris)
0,5M Tris, pH 6,8
0,4% SDS
pH 6,8
Shrimp-Alkaline-Phosphatase-Puffer
Roche Diagnostics, Mannheim
T4-DNA-Ligase-Puffer (10x)
MBI Fermentas, St. Leon-Rot
TAE-Puffer (50x)
2 M Tris-Base
57,1 ml Eisessig
50 mM Na2 EDTA x 2H2O, pH 8,0
H2O ad 1000 ml
TBE
45 mM Trisborat
1 mM EDTA
TE-Puffer
10 mM Tris/HCl, pH 7,5
1 mM EDTA, pH 8,0
TFB1-Puffer
30 mM K-Acetat
100 mM RbCl
10 mM CaCl2
50 mM MnCl2
15% Glycerol
pH 5,8
TFB2-Puffer
10 mM MOPS
75 mM CaCl2
10 mM RbCl
15% Glycerol
pH 6,5
Transferpuffer für Western Blot
20 mM Tris-Base
150 mM Glycin
0,01% SDS
20% Methanol
Trenngelpuffer für SDS-Page
(Lower Tris)
1,5M Tris, pH 8,8
0,4% SDS
pH 8,8
2.4 Medien
Dulbecco’s Modified
Eagle’s Medium (DMEM)
Invitrogen, Karlsruhe
49
2. Material
Minimal Essential Medium (MEM)
Invitrogen, Karlsruhe
Minimal Essential Medium
ohne L-Methionin
Invitrogen, Karlsruhe
OPTIMEM 1
Invitrogen, Karlsruhe
LB-Medium
1% NaCl
1% Bacto Trypton
0,5% Hefeextrakt
Ampicillin bzw. Kanamycin wird
nach dem Autoklavieren (20 min 120
°C) in einer Endkonzentration von
100 µg/ml bzw.30 µg/ml zugegeben.
LB-Agar
LB-Medium + 1,5% Bacto Agar
Ampicillin bzw. Kanamycin wird
nach dem Autoklavieren (20 min 120
°C) in einer Endkonzentration von
100 µg/ml bzw.30 µg/ml zugegeben.
2.5 Kits
ECL RPN 2106
Amersham Biosciences, Freiburg
Immobilon Western Chemolumineszenz
HRP-Substrat
Millipore, Schwalbbach
Protein Assay Kit
Bio-Rad, München
QIAprep Spin Plasmidextraktionskit
Mini/Maxi/ EndoFree Maxi
Qiagen, Hilden
QIAquick Gelextraktionskit
Qiagen, Hilden
QIAquick PCR-Reinigungskit
Qiagen, Hilden
RNeasy Minikit
Qiagen, Hilden
iScript cDNA Snthesekit
Bio-Rad, München
2.6 Geräte
Agarosegel-Elektrophoresekammern
Zentralwerkstatt, Max-Planck-Institut,
Martinsried
Autoklav GE2606
Getinge Van Dilk, Straelen
Brutschränke
Heraeus, Hanau
RT-PCR-Gerät:
Fast Real Time System 7500
Applied Biosystems, Foster City,USA
50
2. Material
Filmentwickler X-Omat
Kodak, Stuttgart
Gefrierschränke:
Forma Scientific Bio Freezer (-80°C)
AEG Öko-Arctis (-20°C)
ThermoQuest, Egelsbach
AEG, Frankfurt am Main
Gelbetrachter
MWG Biotech, Ebersberg
Geltrockner SGD300
Savant, Holbrook, NY, USA
Kühlschrank AEG Öko Santo
AEG, Frankfurt am Main
Kultur-Schüttler Forma Scientific 4518
ThermoQuest, Egelsbach
Mikroskope:
Axiovert 25
Axiovert 200M
mit Software Axiovision
Leica DM IRE2
mit Software Leica confocal 2.6.1
Carl Zeiss, Göttingen
Carl Zeiss, Göttingen
Leica, Wetzlar
Mikrowelle M633
Samsung, Schwalbach
PCR-Gerät:
T3 Thermocycler
Biometra GmbH, Göttingen
pH-Meter
Fischer Scientific, Nidderau
Phosphoimager FLA-2000
mit Software AIDA
Fuji Photo Film, Düsseldorf
Pipetten Gilson
P2, P10, P20, P200, P1000
Abimed, Langenfeld
Pipettierhilfe pipet-aid Drummond
Scientific, Broomall, PA, USA
Polyacrylamidgel-Elektrophoresekammer Hoefer SE600
mit Power Supply EPS
Amersham Biosciences, Freiburg
Reinstwasseranlage Milli-QPLUS
Millipore, Eschborn
Schwenktisch GFL 3017
Merck eurolab, Ismaning
Spektralphotometer DU-640
Beckmann, Unterschleissheim
Thermoblöcke
Zentralwerkstatt, Max-Planck-Institut,
Martinsried
Transferkammer Hoefer TE-Serie
mit Power Supply EPS 2A200
Amersham Biosciences, Freiburg
Überkopfmischer Heidolph REAX 2
Merck eurolab, Ismaning
Ultraschallbad
Roth, Karlsruhe
UV-Tisch Foto/UV 21
Fotodyne, Hartland, WI, USA
Vortex
Bender & Hobein, Zürich, Schweiz
51
2. Material
Waagen:
Laborwaage Mettler Toledo PB602
Analysenwaage Mettler Toledo
AG285
Mettler-Toledo GmbH, Giessen
Mettler-Toledo GmbH, Giessen
Wasserbad MT
Roth, Karlsruhe
Zählkammer, Neubauer
Merck eurolab, Ismaning
Zellkulturschränke
ThermoQuest, Egelsbach
Zentrifugen:
Kühlzentrifuge GS-6R
mit Rotor GH3.8
Kühlzentrifuge J2-21M
mit Rotor JA-14
Tischzentrifuge Biofuge A
Tischzentrifuge Centrifuge 5415C
Ultrazentrifuge TLX-120
mit Rotor TLA-120.2
Beckmann, Unterschleissheim
Beckmann, Unterschleissheim
Heraeus, Hanau
Eppendorf, Hamburg
Beckman, Unterschleissheim
2.7 Sonstige Materialien
Deckgläschen
neoLab, Heidelberg
Einmalkanülen Neolus 26G 0.45mm
Terumo, Tokyo. Japan
Einmalpipetten, steril
Nunc, Wiesbaden
Einmalspritzen
Braun, Melsungen
Expositionskassetten
Fischer Scientific, Nidderau
Gelladespitzen Sörensen
MultiFlex Round Tips
Roth, Karlsruhe
Objektträger 76 x 26 mm
neoLab, Heidelberg
Petrischalen
Greiner, Frickenhausen
Pipettenspitzen für Gilson P-Serie
Continental Lab Products, San Diego,
CA, USA
Polypropylen-Zentrifugenröhren
Falcon, Heidelberg
Polysterol-Röhrchen, steril, 18 x 95 mm
Greiner, Frickenhausen
Protran Nitrocellulose
Nucleinsäure- und Proteintransfer
Schleicher & Schüll, Dassel
Röntgenfilme Kodak Biomax MR
Sigma, Deisenhofen
Reaktionsgefäße:
Safe-Lock Micro Test Tubes
1,5ml und 2ml
Eppendorf, Hamburg
52
2. Material
Schraubdeckel-Reaktionsgefäße
1,5ml und 2ml
PCR-Reaktionsgefäße 0,2ml
Sarstedt, Nürnbrecht
Abgene, Hamburg
Sterilfilter Millex®-HA 0,45µm
Millipore, Eschborn
Sterilfilter Millex®-GS 0,22µm
Millipore, Eschborn
Whatman Chromatographie-Papier
3MM Chr
Schleicher & Schüll, Dassel
Zellkulturflaschen
BD Biosciences Falcon, Heidelberg
Zellkulturschalen ∅3,5, 6 und 10 cm
BD Biosciences Falcon, Heidelberg
Zellschaber
Corning Inc., Corning, NY, USA
53
3. Methoden
3. Methoden
3.1 Rekombinante Polymerase-Kettenreaktion (PCR)
Die Polymerase-Kettenreaktion (polymerase chain reaction, PCR) (Saiki, R. K. et al.
1988)
dient
der
selektiven
Amplifikation
von
DNA-Fragmenten
mittels
thermostabiler DNA-Polymerase und spezifischer Oligonukleotide (Primer). Die in
der vorliegenden Arbeit durchgeführte rekombinante PCR wird eingesetzt, um
verschiedene
Genabschnitte
ohne
Einfügen
von
Restriktionsschnittstellen
miteinander zu verknüpfen (Higuchi, R. 1990). Dabei werden in zwei getrennten
Ansätzen Genfragmente mit Primern mit überlappender Sequenzhomologie
amplifiziert, welche dann in einer zweiten Reaktion als Matrize eingesetzt werden.
Die hybridisierenden Sequenzhomologien dienen als interne Primer. Durch
entsprechende Wahl der internen Primer können Mutationen, Insertionen oder
Deletionen in ein Gen eingefügt werden (Abb. 18). Die externen Primer enthalten
jeweils eine Schnittstelle für eine Restriktionsendonuklease und dienen der
Amplifikation des Produktes.
Abbildung 18. Klonierungsstrategie zur Einführung einer Punktmutation mittels
rekombinanter PCR. (A) Die beiden zu verknüpfenden Fragmente, die N- und C-terminal zur
Mutation liegen, werden separat per PCR amplifiziert (PCR1 und PCR2). Dabei enthalten die internen
Primer jeweils die Punktmutation (rot). (B) In der folgenden PCR-Reaktion (PCR3) lagern sich die
überlappenden Sequenzen aneinander und fungieren somit als interne Primer. Fragmente mit der
vollständigen Länge werden durch die externen Primer amplifiziert. Schwarz: Fragmente 1 bzw. 2,
blau und grün: nicht-homologe Sequenzen mit Restriktionsschnittstellen, rot: Mutation.
54
3. Methoden
3.1.1
Bedingungen für die PCR
Die PCR-Reaktionen wurden mit 15 pmol Primern, je 0,25 mM dNTP´s (dATP,
dCTP, dGTP und dTTP), 50 ng Matritzen-DNA, 2,5 U Pfu-DNA-Polymerase und
dem vom Hersteller gelieferten Reaktionspuffer durchgeführt. Nach dreiminütiger
Denaturierungsphase bei 96°C wurde folgender Zyklus 28-mal wiederholt:
Denaturierung
45 Sekunden bei 96°C
Primer-Anlagerung
45 Sekunden bei 50-55°C
(je nach Schmelztemperatur des Primers)
Elongation
2 Minuten/Kilobasenpaar zu
amplifizierender DNA bei 72°C
Abschließend wurde die Reaktion 10 Minuten bei 72°C inkubiert und bis zur
weiteren Verarbeitung auf 4°C gekühlt.
3.1.2
Sequenzierungen
Die DNA-Sequenzierungen wurden nach der Kettenabbruchmethode von Sanger
(Sanger, F. et al. 1977) von der Firma Medigenomix in Martinsried durchgeführt.
3.1.3
Klonierung von Parkin-Mutanten
Alle Parkin-Fragmente wurden in den Vektor pcDNA3.1/ZEO (+), der unter der
Kontrolle des CMV (Cytomegalievirus)-Promotors steht, ligiert, um eine Expression
in den verschiedenen Zelllinien zu ermöglichen. Als Matrize diente das Plasmid
pcDNA-hP-fl, das humanes Wildtyp-Parkin kodiert (Winklhofer, K. F. et al. 2003).
Die Klonierung der Parkin-Mutanten wurde, soweit nicht anders vermerkt, nach
folgenden Schemata durchgeführt:
C-terminale Deletionsmutanten wurden ausgehend vom Plasmid pcDNA-hP-fl
mit den Primern HindIII-5' (bzw. BamHI-5´) und X-3' amplifiziert. Der Buchstabe X
steht für die jeweilige Konstruktbezeichnung. Über die Schnittstellen HindIII (bzw.
BamHI-3´) und NotI wurde das Produkt in das Plasmid pcDNA3.1 ligiert.
55
3. Methoden
Zur Klonierung von Punktmutanten wurden ausgehend vom Plasmid pcDNAhP-fl das N-terminale Fragment mit den Primern HindIII-5' (bzw. BamHI-5´) und X3' und das C-terminale Fragment mit den Primern Not-3' und X-5' amplifiziert. Die
Amplifkation des Produkts erfolgte dann mit den externen Primern HindIII-5' (bzw.
BamHI-5´) und NotI-3'. Über die Schnittstellen HindIII (bzw. BamHI-3´) und NotI
wurde das Produkt in das Plasmid pcDNA3.1 ligiert.
3.1.3.1
Parkin mit HA-Tag am N-Terminus: HA-hP-fl
Ausgehend vom Plasmid pcDNA3.1-hP-fl wurde ein Parkin-Fragment mit
überhängender HA-Sequenzhomologie mittels der Primer HA-hP-5’ und NotI-3’
amplifiziert. Parallel wurde ein HA-Fragment mit überhängender ParkinSequenzhomologie mittels der Primer HindIII-5’ und HA-hP-3’ hergestellt. Die
beiden Fragmente wurden verknüpft und mit dem externen Primerpaar HindIII-5' /
NotI-3' amplifiziert. Das Konstrukt kodiert Wildtyp (wt)-Parkin mit N-terminalem
HA-Tag.
3.1.3.2
Parkin mit verkürztem N-Terminus: hP-∆1-79
Hergestellt wurde das Konstrukt unter Verwendung des Primerpaares BamHI-5' / ∆179-3'. Es wurden die Aminosäuren 1 bis einschließlich 79 deletiert. Die Deletion
umfasst die gesamte UBL-Domäne von Parkin.
3.1.3.3
Parkin mit deletiertem C-Terminus: hP-N
Hergestellt wurde das Konstrukt unter Verwendung des Primerpaares BamHI-5' / Ν3'. Das Konstrukt kodiert wt Parkin bis zur Aminosäure 210.
3.1.3.4
Parkin mit Punktmutationen
Hergestellt wurden die Konstrukte unter Verwendung der in Tabelle 9 aufgeführten
Primerpaare. Die pathogenen Mutationen R33Q, R42P, K48A und V56E liegen in
56
3. Methoden
der N-terminalen UBL-Domäne und G430D in der RING2-Domäne. Das Konstrukt
hP-M80T entspricht der Sequenz von Maus- und Ratten-Parkin.
Konstrukt
Primerpaare
HindIII-5' / R33Q-3’
hP-R33Q
NotI-3' / R33Q-5’
BamHI-5' / R42P-3’
hP-R42P
NotI-3' / R42P-5’
HindIII-5' / K48A-3’
hP-K48A
NotI-3' / K48A-5’
HindIII-5' / V56E-3’
hP-V56E
NotI-3' / V56E-5’
BamHI-5' / T415N-3’
hP-T415N
NotI-3' / T415N-5’
BamHI-5' / G430D-3’
hP-G430D
NotI-3' / G430D-5’
BamHI-5' / M80T-3'
hP-M80T
NotI-3' / M80T-5'
BamHI-5' / M80L-3'
hP-M80L
NotI-3' / M80L-5'
Tabelle 9.
3.1.3.5
Aminosäureaustausch
Arginin → Glutamin
Arginin → Prolin
Lysin → Alanin
Valin → Glutaminsäure
Threonin → Asparagin
Glycin → Aspartat
Methionin → Threonin
Methionin → Leucin
Primer für Punktmutanten von Parkin.
Parkin mit pathogenen C-terminalen Deletionsmutationen
Die Konstrukte hP-Q311Stop, hP-E409Stop und W453Stop wurden unter
Verwendung der in Tabelle 8 aufgeführten Primerpaare hergestellt. Durch
Basenaustausch an den entsprechenden Positionen entsteht ein Stopcodon.
57
3. Methoden
Konstrukt
Primerpaar
BamHI-5'
hP-Q311Stop
Q311Stop-3’
HindIII-5'
hP-E409Stop
E409Stop-3’
BamHI-5'
hP-W453Stop
W453Stop-3’
Basenaustausch
deletierte Domänen
CAG → TAG
IBR und RING2
GAA → TAA
RING2
TGG → TAG
13 AS
Tabelle 8.
Primer für pathogene C-terminalen Deletionsmutanten von Parkin. AS:
Aminosäure, IBR: in between RING, RING: really interesting new gene.
3.2 Bakterienkultur
3.2.1
Herstellung kompetenter Bakterien
Um Zellen von Escherichia coli (E.coli) kompetent zu machen, d.h. diese zur
Aufnahme von Plasmid-DNA zu befähigen, wird eine Kultur bis zur logarithmischen
Phase angezogen und mit divalenten Kationen behandelt. Dieses Verfahren führt zu
einer Destabilisierung der Zellwand (Sambrook, J. et al. 1989).
Zunächst wurde eine Vorkultur hergestellt: 2 ml Luria Broth (LB)-Medium
wurden mit einer Bakterienkolonie des E.coli-Stammes DH5α beimpft und über
Nacht bei 37°C geschüttelt. Der Ansatz wurde anschließend in 250 ml LB-Medium
gegeben und 2-3 h lang bis zu einem OD590-Wert zwischen 0,4 und 0,6 kultiviert.
Die Kultur wurde 5 min bei 4°C und 3750 rpm zentrifugiert. Das Bakterienpellet
wurde in 100 ml eiskalten TFB1-Puffer resuspendiert, die Suspension 5 min lang auf
Eis inkubiert und anschließend 5 min lang bei 4°C und 3750 rpm zentrifugiert. Das
Pellet wurde in 10 ml kaltem TFB2-Puffer resuspendiert, 15-60 min auf Eis inkubiert
und anschließend aliquotiert (100 µl/Reaktionsgefäß). Die Aliquote wurden in
flüssigem Stickstoff schockgefroren und bei -80°C gelagert.
58
3. Methoden
3.2.2
Transformation kompetenter Bakterien
Die Transformation (Sambrook, J. et al. 1989) dient der Aufnahme und
Amplifikation von Plasmiden durch E.coli.
Aliquote kompetenter Bakterien (100 µl/Reaktionsgefäß) wurden auf Eis
aufgetaut und mit 10 µl Ligationsansatz bzw. 1 µg Plasmid-DNA vermischt. Nach
30-minütiger Inkubation auf Eis wurde die Suspension 90 Sekunden bei 42°C
inkubiert (Hitzeschock) und anschließend 5 min auf Eis gestellt. Es wurden 400 µl
LB-Medium ohne Zusatz von Antibiotika zugegeben. Die Kulturen wurden 1 h bei
37°C geschüttelt und in unterschiedlichen Konzentrationen auf Antibiotika-haltigen
Agarplatten ausplattiert. Die Platten wurden 16-20 h lang bei 37°C inkubiert.
3.3 DNA-Präparation
Zur Herstellung von Plasmid-DNA wurde der Qiagen-Mini- bzw. Qiagen-Maxi-Kit
verwendet. Dabei wurde nach Angaben des Herstellers Qiagen verfahren.
3.4 RNA-Präparation
Zur Isolierung von Gesamt-RNA wurde der RNeasy Minikit verwendet. Dabei wurde
nach Angaben des Herstellers Qiagen verfahren.
3.5 Zellkultur
3.5.1
Kultivierung von Zellen
Alle verwendeten Zelllinien und primäre Zellkulturen (Fibroblasten) wurden als
adhärenter Einzelzellrasen kultiviert.
Humane Neuroblastomzellen (SH-SY5Y), humane embryonale Nierenzellen
(HEK293T) und humane Fibroblasten wurden in DMEM (Dulbecco´s Modified
Eagle´s Medium) unter Zusatz von 10% hitzeinaktiviertem fötalem Kälberserum und
59
3. Methoden
1% Antibiotika-Lösung (Endkonzentration: 1 U/ml Penicillin G, 1 µg/ml
Streptomycin und 2 mM Glutamin) in Zellkulturschalen bzw. -flaschen bei 37°C und
5% CO2 kultiviert.
Murine Neuroblastomzellen (N2a) wurden in MEM (Minimal Essential
Medium) unter Zusatz von 10% hitzeinaktiviertem fötalem Kälberserum und 1%
Antibiotika-Lösung (Endkonzentration: 1 U/ml Penicillin G, 1 µg/ml Streptomycin
und 2 mM Glutamin) in Zellkulturschalen bzw. -flaschen bei 37°C und 5% CO2
kultiviert.
3.5.2
Passagierung
Nach Abziehen des Kulturmediums wurden die Zellen mit PBS -/- (Phosphate
Buffered Saline) gespült und anschließend mit Trypsin (0,5 g/l Trypsin) einige
Minuten lang inkubiert. Die Zellen wurden leicht von ihrer Unterlage abgeklopft, in
vorgewärmtem Vollmedium sorgfältig resuspendiert und im gewünschten Verhältnis
aufgeteilt. Nach Zusatz von Vollmedium wurden die Zellen bei 37 °C und 5% CO2
inkubiert.
3.5.3
Ausplattieren
Zum Ausplattieren der Zellen wurde zunächst die vorhandene Zellmenge ermittelt.
Ein Aliquot der mit Trypsin gelösten Zellen (siehe 3.5.2.) wurde mit Hilfe einer
Neubauer-Kammer gezählt.
SH-SY5Y Zellen wurden in einer Dichte von 7 x 105 Zellen auf 3,5 cm-Schalen
ausplattiert. N2a- und HEK293T-Zellen wurden in einer Dichte von 1 x 106 Zellen
auf 3,5 cm-Schalen bzw. 2,6 x 106 Zellen auf 6 cm-Schalen ausplattiert. Fibroblasten
wurden in einer Dichte von 2 x 105 Zellen auf 3,5 cm-Schalen ausplattiert. Für
Immunfluoreszenz-Analysen wurden die Zellen dünner ausplattiert, um vereinzelte
Zellen besser zu erkennen. In diesem Fall wurden 5 x 105 SH-SY5Y Zellen auf
3,5 cm-Schalen, welche Deckgläschen enthielten, ausplattiert.
60
3. Methoden
3.5.4
Transfektion
24 Stunden nach dem Ausplattieren der Zellen wurden diese mit Medium gewaschen
und mit Plasmid-DNA mit dem Transfektions-Kit Lipofectamine plus nach Angaben
des Herstellers Invitrogen transfiziert. Nach 3-stündiger Inkubation bei 37°C und 5%
CO2 wurde 1 ml Vollmedium zugesetzt. Für die Reporter- und Apoptose-Versuche
wurde endotoxinfreie Plasmid-DNA verwendet (EndoFree Maxi, Qiagen). Die
Transfektion der HEK293T-Zellen mit siRNA erfolgte mit dem Transfektions-Kit
Lipofectamine 2000 nach Angaben des Herstellers Invitrogen.
3.5.5
Zellernte
24-72 Stunden nach der Transfektion wurden die Zellen geerntet. Hierzu wurden die
Zellen mit PBS -/- gewaschen und anschließend in PBS -/- mit einem Zellschaber
abgeschabt. Die Zellen wurden für 5 Minuten bei 1000 x g abzentrifugiert, das
Zellpellet auf Eis gestellt und entsprechend weiterverarbeitet.
3.5.6
Herstellen eines nukleären Extrakts
Das Zellpellet wurde im 3-fachen Volumen des Pellets mit hypotonem Lysepuffer
resuspendiert, 10 Minuten auf Eis inkubiert und für 5 Minuten bei 1000 rpm
zentrifugiert. Die Kerne wurden anschließend in ihrem 3-fachen Volumen in
Hochsalzpuffer
resuspendiert und für 15 Minuten bei 4°C inkubiert. Nach der
Zentrifugation (5 Minuten, 1000 rpm, 4 °C) wurde die Proteinkonzentration des
Überstandes nach Bradford (siehe 3.7.2) bestimmt.
3.6 Präparierung
und
Kultivierung
von
primären
kortikalen
Rattenneuronen
Zur Isolierung der Neuronen wurden die Cortices aus den Gehirnen von embryonalen
Ratten (E18) entfernt. Die Zellen wurden durch mildes Trypsinieren dissoziiert, auf
Polyethylen-beschichteten 6 cm Zellkulturschalen ausplattiert und in Neurobasal
61
3. Methoden
Medium (Invitrogen) (+ 5 mM HEPES, 1,2 mM Glutamin, B27-Supplement 20 ml/l,
Gentamicin 0,1 mg/ml) kultiviert. Die Stressbehandlung der Zellen erfolgte bei 8-10
Tage alten Kulturen. Zu diesem Zeitpunkt enthielten die Kulturen weniger als 5 %
Astrocyten.
Zur Induktion von Exzitotoxizität wurden die Zellen für 6 Stunden mit 5 oder
10 µM Glutamat in EBSS Medium (6800 mg/l NaCl, 400 mg/l KCl, 264 mg/l CaCl2,
200 mg/l MgCl2, 2200 mg/l NaHCO3, 140 mg/l NaH2PO4, pH 7.2) + 10 mM Glucose
inkubiert. Anschließend wurden die Zellen geerntet und die RNA isoliert (siehe 3.4).
3.7 Protein- und Nukleinsäureanalytik
3.7.1
Nachweis der Löslichkeit
Die Zellpellets (siehe 3.5.5) wurden in kaltem Lysepuffer resuspendiert, 5 Minuten
lang auf Eis inkubiert und für 20 Minuten bei 13000 rpm und 4°C zentrifugiert. Das
Zelllysat wurde in eine Detergenz-lösliche (Überstand, S) und eine Detergenzunlösliche (Pellet, P) Fraktion aufgetrennt, in Laemmli-Probenpuffer aufgenommen
und für 10 Minuten bei 100°C inkubiert. Die genomische DNA in der detergenzunlöslichen Fraktion wurde durch mehrmaliges Aufziehen der Probe in eine 1 mlEinwegspritze mit einer 26G-Kanüle geschert. Die Proben wurden auf einem SDSGel analysiert.
3.7.2
Proteinkonzentration nach Bradford
Nach der Zelllyse wurde die Gesamtproteinmenge des Überstandes mit Hilfe des
Protein Assay Kits nach der Methode von Bradford entsprechend den Angaben des
Herstellers Bio-Rad bestimmt.
62
3. Methoden
3.7.3
Native Polyacrylamid-Gelelektrophorese
Die Auftrennung von Protein-Nukleinsäurekomplexen erfolgte über ein 4%iges
Polyacrylamidgel in 0,5 x TBE-Puffer. Der Gellauf erfolgte bei 160 V und 4°C für 4
Stunden.
3.7.4
SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE)
Die Auftrennung von Proteine erfolgte durch eindimensionale, diskontinuierliche
SDS-PAGE (Laemmli, U. K. 1970). Je nach der Größe des zu untersuchenden
Proteins wurde eine Polyacrylamid-Konzentration von 8% oder 10% für das
Trenngel und 4% für das Sammelgel verwendet. Die Elektrophorese wurde bei 150250 V in einer Hoefer-SE600-Kammer durchgeführt.
3.7.5
Proteintransfer auf Nitrozellulose (Western Blot)
Die Proteine wurden zum Zwecke der Immundetektion (siehe 3.7.6) mit
Transferpuffer auf eine Nitrozellulose-Membran der Porengröße 0,45 µm transferiert
(Towbin, H. et al. 1979). Der Transfer erfolgte für 2 Stunden bei einer festen
Stromstärke von 1 A bei 4°C.
3.7.6
Immundetektion von Proteinen
Die Immundetektion wurden mit dem Enhanced Chemiluminescenc (ECL)-System
oder dem Immobilon Western Chemolumineszenz HRP-Substrat nach Angaben des
Herstellers detektiert. Die Nitrozellulose-Membran wurde eine Stunde in PBST mit
5% Milchpulver (Blocking Milk) bei Raumtemperatur blockiert und über Nacht bei
4°C mit dem primären Antikörper bzw. Antiserum inkubiert. Die Membran wurde
dreimal 10 Minuten mit PBST gewaschen und für 40 Minuten mit dem sekundären
Meerrettich-Peroxidase (HRP)-gekoppelten Schaf-Anti-Maus- bzw. Esel-AntiKaninchen-Antikörper (1:10.000 in PBST) inkubiert. Die Membran wurde erneut mit
63
3. Methoden
PBST gewaschen und mit HPR-Substrat inkubiert. Die Signale wurden durch
Exposition eines Röntgenfilms sichtbar gemacht.
3.7.7
Immunpräzipitation (IP)
Die Detergenz-lösliche Fraktion des Zelllysats (IP-Lysepuffer) wurde mit 1 µl
Antikörper bzw. Antiserum über Nacht bei 4°C in einem Überkopf-Dreher inkubiert.
Um die Protein-Antikörper-Komplexe zu isolieren, wurden 30 µl einer in IP-Puffer
gewaschenen Protein A-Trisacryl-Matrix bzw. Protein G-Matrix zugefügt und die
Inkubation bei 4°C für weitere 90 Minuten in einem Überkopf-Dreher fortgesetzt.
Die Komplexe wurden kurz abzentrifugiert, zweimal mit IP-Lysepuffer und zuletzt
mit PBS -/- gewaschen und in 50 µl Laemmli-Probenpuffer für 10 Minuten inkubiert.
Die Proben wurden auf einem SDS-Gel analysiert.
3.7.8
Co-Immunpräzipitation (Co-IP)
HEK293T-Zellen wurden mit Parkin und IKKγ oder TRAF2 co-transfiziert und am
nächsten Tag geerntet. Nach der Lyse in IP-Lysepuffer wurde der Ansatz für 5
Minuten bei 4°C inkubiert und anschließend für 5 Minuten bei 1000 x g und 4°C
zentrifugiert. Der Überstand wurde mit dem polyklonalen Antikörper Anti-IKKγ
oder Anti-TRAF2 über Nacht bei 4°C inkubiert. Anschließend wurde wie unter
Punkt 3.7.7 beschrieben verfahren. Für den Immunblot wurde der monoklonale AntiParkin Antikörper PRK28 verwendet.
Für die endogene Co-IP aus SH-SY5Y-Zellen wurde der Überstand mit dem
polyklonalen Anti-Parkin Antikörper hP1 (gekoppelt an Protein A-Agarose) über
Nacht bei 4°C inkubiert. Für den Immunblot wurden die monoklonalen Antikörper
Anti-IKKγ oder Anti-TRAF2 verwendet.
3.7.9
Radioaktive Markierung von Proteinen mit [35S]
Einen Tag nach der Transfektion wurden die Zellen mit PBS gewaschen und 30
Minuten in MEM ohne Methionin (+ 1x PenStrepGlu) inkubiert, um vorhandenes
64
3. Methoden
Methionin (Met) aufzubrauchen (Hungern). Für die radioaktive Markierung wurde
das Medium abgenommen und durch 500 µl frisches MEM ohne Methionin mit
[35S]-Met (ProMix, 150 µCi/ml) ersetzt. Nach 30 Minuten wurden die Schalen, die
zur Untersuchung der während der pulse-Phase synthetisierten Proteine bestimmt
waren, geerntet und die Zellen mit IP-Lysepuffer lysiert (pulse-Proben). Die
restlichen Schalen wurden für die angegebene Zeit mit Vollmedium bei 37°C
inkubiert und dann wie oben beschrieben lysiert (chase-Proben). Die Detergenzlösliche Fraktion wurde auf eine Endkonzentration von 0,5 % Sarkosyl gebracht und
mittels einer Immunpräzipitation analysiert. Die Pellet-Fraktion wurde verworfen.
3.7.10 Autoradiodiagramme und Phosphoimaging
Gele mit radioaktiv markierten Proteinen wurden 30 Minuten fixiert (40% Methanol,
7% Essigsäure) und weitere 30 Minuten mit Amplify inkubiert. Auf einem
Whatman-Papier wurden sie dann in einem Geltrockner für eine Stunde bei 72°C
unter Vakuum getrocknet. Die markierten Proteine wurden durch Exposition eines
Röntgenfilms visualisiert.
Eine
computergestützte
Visualisierung
und
Quantifizierung
radioaktiv
markierter Proteine wurde mittels Phosphoimaging durchgeführt. Auf die
getrockneten Gele wurde für 1-48 Stunden ein Phosphoimaging-Schirm aufgelegt.
Die Signale wurden von einem Phosphoimager ausgelesen und mit dem Programm
AIDA (Raytest) ausgewertet.
3.7.11 Behandlung mit proteasomalem Inhibitor
Um das Proteasom zu hemmen, wurden die Zellen mit dem proteasomalen Inhibitor
MG132 (Tsubuki, S. et al. 1993) behandelt. Für die Analyse radioaktiv markierter
Proteine wurde MG 132 in einer Konzentration von 50 µM während des Hungerns,
der pulse- und der chase-Phase zu den Zellen gegeben.
65
3. Methoden
3.7.12 TCA-Fällung
Die Proben wurden mit 1/10 Volumen einer 50%igen Trichloressigsäure (TCA)Lösung versetzt und für 10 Minuten auf Eis inkubiert. Anschließend wurde bei
13.000 rpm und 4°C für 10 Minuten zentrifugiert. Das erhaltene Pellet wurde
zweimal mit Aceton gewaschen, an der Luft getrocknet und in LaemmliProbenpuffer aufgenommen.
3.7.13 In vitro Translation
Die
in
vitro
Translation
wurde
mit
dem
TNT
T7
Quick
Coupled
Transcription/Translation System gemäß den Angaben des Herstellers Promega
durchgeführt. Nach 90-minütiger Translation wurde die Reaktion durch Zugabe von
Laemmli-Probenpuffer gestoppt und die Proben auf einem SDS-Gel analysiert.
3.7.14 Indirekte Immunfluoreszenz
Um die zelluläre Lokalisierung von Proteinen in lebenden Zellen zu bestimmen,
wurde eine indirekte Immunfluoreszenz mit permeabilisierten Zellen durchgeführt.
Dazu wurden SH-SY5Y-Zellen auf Glasdeckgläschen ausplattiert (siehe 3.5.3.) und
transfiziert (siehe 3.5.4). 24 Stunden nach der Transfektion wurden die Zellen zur
Permeabilisierung für 10 Minuten in Methanol (-20°C) fixiert und anschließend mit
dem Erstantikörper (1:200 in PBS -/-, 1% BSA) eine Stunde lang bei 37°C in einer
feuchten Kammer inkubiert. Die Zellen wurden mit PBS -/- gewaschen und mit dem
Fluoreszenz-markierten Zweitantikörper Cy3 oder FITC (1:200 in PBS -/-, 1% BSA)
versehen. Nach 30-minütiger Inkubation bei 37°C wurden die Präparate in Mowiol
(+ DAPI, 1µg/ml) eingebettet und am Fluoreszenzmikroskop ausgewertet.
Für Analysen am Konfokalmikroskop wurden die Zellen mit 3% PFA fixiert
und mit 0,1% Triton X-100 permeabilisiert.
66
3. Methoden
3.7.15 Nachweis von Apoptose
3.7.15.1 Aktive Caspase-3
Die Verwendung eines polyklonalen Antikörpers, der gegen aktive Caspase-3
gerichtet ist, ermöglicht die spezifische Detektion von apoptotischen Zellen. SHSY5Y-Zellen wurden auf Glasdeckgläschen aufplattiert (siehe 3.5.3.) und transfiziert
(siehe 3.5.4.). 24 Stunden nach der Transfektion wurden die Zellen für drei Stunden
mit Kainat (500 µM) oder Rotenon (10 µM) bei 37°C inkubiert. Anschließend
wurden die Zellen für 20 Minuten mit 3% Paraformaldehyd (PFA) fixiert, mit 0,2%
Triton X-100 für 10 Minuten permeabilisiert und für weitere 60-120 Minuten mit
Blockierungspuffer bei Raumtemperatur (RT) inkubiert. Die Inkubation des Antiaktive Caspase-3 Antikörpers (1:250 in Blockierungspuffer) erfolgte über Nacht bei
4°C in einer feuchten Kammer. Die Zellen wurden mit PBS -/- gewaschen und mit
dem Fluoreszenz-markierten Zweitantikörper Cy3 (1:500 in PBS -/-) versehen. Nach
2-stündiger Inkubation bei RT wurden die Zellen in Mowiol (+ DAPI, 1 µg/ml)
eingebettet und am Fluoreszenzmikroskop ausgewertet. Die apoptotischen Zellen
wurden durch Zählen der Caspase-positiven Zellen quantifiziert.
3.7.15.2 Hoechst 33342
SH-SY5Y-Zellen wurden auf Glasdeckgläschen ausplattiert und transfiziert. 24
Stunden nach der Transfektion wurden die Zellen für 18 Stunden mit Rotenon (0,25
µM) inkubiert. Anschließend wurden die Zellen für 10 Minuten mit 3% PFA fixiert
und für weitere 10 Minuten bei 37°C mit Hoechst 33342 (1 µM) angefärbt. Nach
dem Waschen in PBS wurden die Präparate in Mowiol eingebettet und am
Fluoreszenzmikroskop ausgewertet. Apoptotische Zellen wurden durch kondensierte
und fragmentierte Kerne identifiziert und quantifiziert.
67
3. Methoden
3.8.18 Zellfraktionierung
3.8.18.1
Renografin-Gradient
Die intrazelluläre Lokalisierung von Proteinen wurde mit einer modifizierten
Renografin-Dichtegradientenzentrifugation untersucht (Heller, U. et al. 2003; Henn,
I. H. et al. 2005; Heske, J. et al. 2004; Schandel, K. A. und D. D. Jenness 1994;
Wang, Q. und A. Chang 1999). Je drei 6 cm-Schalen mit transfizierten N2a-Zellen
wurden geerntet (siehe 3.5.5) und die Zellpellets vereint. Das Pellet wurde in 600 µl
TE-Puffer
mit
Complete
Protease-Inhibitor
aufgenommen,
auf
Trockeneis
eingefroren und anschließend bei 37°C aufgetaut. Dieser Vorhang wurde zweimal
wiederholt. Nach Zusatz von 1 µl Benzonase und 10-minütiger Inkubation bei 37°C,
wurde für vier Minuten bei 500 rpm zentrifugiert, um die Zellkerne abzutrennen. 500
µl des Lysats wurden mit 500 µl Renografin 76% vermischt und in einem
Zentrifugenröhrchen platziert. Die Probe wurde nun mit jeweils 1 ml 34%, 30%,
26% und 22% Renografin überschichtet und für 20 Stunden bei 150.000 x g und 4°C
zentrifugiert. Von den Gradienten wurden 13 Fraktionen à 350 µl von oben
abgenommen. Je 300 µl der Fraktionen wurden mit 700 µl TE verdünnt und für eine
Stunde bei 100.000 x g und 4°C zentrifugiert. Die Niederschläge wurden in 100 µl
Laemmli-Probenpuffer aufgenommen und auf einem SDS-Gel analysiert.
3.8.18.2
Sucrose-Gradient
Je eine 3,5 cm Schale mit transfizierten N2a-Zellen wurde geerntet (siehe 3.5.5) und
mittels einer Zentrifugation pelletiert. Das Zellpellet wurde mit 150 µl
Detergenzpuffer (0,1% Triton X-100, 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM
MgCl2, 1 mM DTT, 5 % Glycerol) resuspendiert und 5 Minuten lang auf Eis
inkubiert. In einem Zentrifugenröhrchen wurde ein 2 ml Stufengradient gegossen.
Hierzu wurden 0,5 ml einer 40%igen Sucroselösung (in Detergenzpuffer) mit 1,5 ml
einer 30%igen Sucroselösung (in Detergenzpuffer) überschichtet. 100 µl des
Zelllysat wurden auf den Sucrosegradienten pipettiert und anschließend bei 200.000
x g und 4°C für 90 Minuten zentrifugiert. Von dem Gradienten wurden 11
68
3. Methoden
Fraktionen à 200 µl von oben abgenommen. Die Proteine wurden mit
Trichloressigsäure (TCA) ausgefällt (siehe 3.7.13), in 90 µl Laemmli-Probenpuffer
aufgenommen und auf einem SDS-Gel analysiert.
3.8.19 Luciferase-Reporter-Assay
Es wurden die folgenden Reporter-Konstrukte verwendet:
HSE-Luc:
Expression des Luciferase-Reportergens unter Kontrolle einen HSF1regulierbaren Elementes (heat shock element, HSE)
NF-κB-Luc:
Expression
des
Luciferase-Reportergens
unter
Kontrolle
von
Bindeelementen für den Transkriptionsfaktor NF-κB
HEK293T- oder SH-SY5Y-Zellen wurden mit dem Luciferase-Reporter-Plasmid
(0,5 µg HSE-Luc bzw. 0,1 µg NF-κB-Luc/3,5cm-Schale) und Wildtyp-Parkin oder
den angegebenen Parkin-Mutanten (je 1 µg) co-transfiziert. 24 Stunden nach der
Transfektion mit HSE-Luc wurden die Zellen für 15 Minuten bei 42 °C inkubiert
(Hitzeschock) und nach weiteren 16 Stunden bei 37°C geerntet. Die mit NF-κB-Luc
transfizierten Zellen wurden mit PMA bzw. TNFα in den angegebenen
Konzentrationen für drei Stunden bei 37°C inkubiert und nach weiteren 8-16 Stunden
geerntet. Die Luciferase-Aktivität der Zelllysate wurde luminometrisch mit dem
Dual-Luciferase Assay System entsprechend den Angaben des Herstellers Promega
bestimmt.
3.8.20 Transienter Knock-down mittels RNA-Interferenz (siRNA)
Der Knock-down von endogenem Parkin wurde mit dem Parkin StealthTM siRNA
duplex 1 (Invitrogen) durchgeführt. Als Kontrolle diente die Negative control
StealthTM siRNA (Invitrogen).
3.8.20.1
Luciferase-Reporter-Assay in Knock-down-Zellen
HEK293T-Zellen wurden in einer Dichte von 8 x 105 Zellen auf 3,5 cm-Schalen
ausplattiert und nach sechs Stunden mit 50 pM Parkin-spezifischer siRNA und
69
3. Methoden
0,1 µg NF-κB-Luc transfiziert (siehe 3.5.4). 48 Stunden später wurden die Zellen für
drei Stunden mit PMA (10 bzw. 20 ng/ml) inkubiert und nach weiteren 5 Stunden die
Luciferase-Aktivität luminometrisch bestimmt.
3.8.20.2
Nachweis von Zelltod in Knock-down-Zellen mit Trypan blau
HEK293T-Zellen wurden in einer Dichte von 8 x 105 Zellen auf 3,5 cm-Schalen
ausplattiert und mit 500 pM Parkin-spezifischer siRNA transfiziert (siehe 3.5.4).
Nach 48 Stunden wurden die Zellen für drei Stunden mit 0,05 µM Rotenon inkubiert
und nach weiteren 24 Stunden mit Trypan Blau gefärbt. Die Fraktion der toten Zellen
wurde durch Zählen der blau angefärbten Zellen quantifiziert.
3.8.21 Nachweis der Ubiquitylierung
3.8.21.1
Ubiquitylierung von IKKγ oder TRAF2
Je zwei 6 cm-Schalen HEK293T-Zellen wurden mit Wildtyp-Parkin oder ParkinMutanten (5,2 µg), HA-Ubiquitin (0,65 µg) und entweder FLAG-IKKγ (4 µg),
FLAG-TRAF2 (1,3 µg) oder FLAG-TRAF2∆N (1,3 µg) co-transfiziert (siehe 3.5.4).
Am nächsten Tag wurden die Zellen geerntet und die Zellpellets vereinigt. Das Pellet
wurde in 300 µl denaturierendem Lysepuffer resuspendiert und für 5 Minuten bei
100°C gekocht. Anschließend wurden die Proteinextrakte 1:10 mit nichtdenaturierendem Lysepuffer verdünnt und mehrmals durch eine 26G Kanüle
gezogen. Die Lysate wurden für 20 Minuten bei 13.000 rpm und 4°C zentrifugiert
und die Überstände für eine Immunpräzipitation (siehe 3.7.7) mit dem Anti-FLAGAntikörper verwendet.
3.8.21.2
Ubiquitylierung von IKKγ mit Ubiquitin-Mutanten
Je zwei 6 cm-Schalen HEK293T-Zellen wurden mit Parkin (5,2 µg), HA-Ubiquitin
(0,65 µg), HA-K48only-Ubiquitin oder HA-K63only-Ubiquitin (2,5 µg) und FLAG-
70
3. Methoden
IKKγ (4 µg) co-transfiziert (siehe 3.5.4). Anschließend wurde wie unter Punkt
3.8.21.1 beschrieben verfahren.
3.8.22 Electrophoretic Mobility Shift Assay (EMSA)
Der EMSA dient zum Nachweis des Aktivierungssatus von DNA-bindenden
Proteinen, in diesem Fall der Transkriptionsfaktoren NF-κB und OCT1.
Zur Bindereaktion wurden 5 µg (Zellkultur) bzw. 10 µg (Fibroblasten) des
nukleären Extrakts (siehe 3.5.6) und 0,15 ng
32
P-markiertes NF-κB bzw. OCT1-
Konsensus-Oligonukleotid in einem Endvolumen von 20 µl EMSA-Mix für 30
Minuten auf Eis inkubiert. Für einen Supershift wurde zusätzlich ein Antikörper für
das Protein (NF-κB-Heterodimer: p50/p65) zugesetzt, hier Anti-p65. Die
Auftrennung
der
Protein-Nukleinsäurekomplexe
erfolgte
mittel
nativer
Polyacrylamid-Gelelektrophorese (siehe 3.7.3). Das Gel wurde anschließend
getrocknet und die markierten Komplexe durch Exposition eines Röntgenfilms bei
-80°C visualisiert.
3.8.23 Real-Time quantitative PCR (RT-PCR)
Die
Real-Time
quantitative
PCR
ist
eine
Vervielfältigungsmethode
für
Nukleinsäuren, die auf dem Prinzip der herkömmlichen PCR beruht und zusätzlich
die Möglichkeit der Quantifizierung bietet. Die Quantifizierung wird mit Hilfe von
Fluoreszenz-Messungen während eines PCR-Zykluses durchgeführt, wobei die
Fluoreszenz proportional mit der Menge der PCR-Produkte zunimmt.
Untransfizierte SH-SY5Y-Zellen wurden für 3 Stunden mit 1 µM Rotenon oder
50 µM Kainat inkubiert und nach weiteren 5, 8, 12 und 24 Stunden geerntet. Nach
der Isolierung der Gesamt-RNA (siehe 3.4) wurde die cDNA mit Hilfe des iScript
cDNA Synthese Kits nach Angaben des Herstellers Biorad synthetisiert. Es wurde
1 µg Gesamt-RNA eingesetzt. Die RT-PCR-Reaktion (20 µl) setzte sich
folgendermaßen zusammen: 2 µl cDNA-Lösung, 2 x TaqMan Universal PCR Master
Mix und TaqMan Gene Expression Assay (Parkin bzw. β-Actin). Es wurden jeweils
Triplikate für jede RNA-Probe durchgeführt. Die RNA-Expression wurde in Bezug
71
3. Methoden
auf das Haushaltsgen β-Actin normalisiert und die relative Expression jedes Gens
mit der ∆∆CT-Methode berechnet.
Im Fall von Rattenneuronen wurde die RT-PCR-Reaktion mit 2 x Power SYBR
Green PCR Master Mix und 1 µM jedes Primerpaares (Parkin bzw. β-Actin)
durchgeführt.
3.9 Statistische Auswertung
Die Daten wurden als Mittelwerte mit Standardabweichung angegeben. Alle
Transfektionen wurden in Triplikaten durchgeführt und mindestens dreimal
wiederholt.
Zur Berechung der Signifikanz wurde der T-Test angewendet. Die P-Werte
sind wie folgend definiert: * P< 0.01, ** P< 0.001 und *** P< 0.0001.
72
4. Ergebnisse
4. Ergebnisse
Mutationen im Parkin-Gen sind verantwortlich für eine autosomal rezessiv
vererbbare Form der Parkinson-Erkrankung (AR-PD) (Kitada, T. et al. 1998). Das
Vorhandensein der C-terminalen RING (really interesting new gene)-Konformation
legt nahe, dass Parkin eine E3-Ligase-Aktivität hat. Verschiedene Arbeitsgruppen
konnten tatsächlich diese Aktivität zeigen (Shimura, H. et al. 2000, Imai, 2000 #517;
Zhang, Y. et al. 2000). Mittlerweile wurden einige putative Parkin-Substrate
beschrieben. Über die physiologische Relevanz dieser Proteine als authentische
Parkin-Substrate herrscht allerings Unklarkeit.
Zu Beginn der vorliegenden Arbeit war lediglich bekannt, dass der
Funktionsverlust von Parkin offensichtlich zum dopaminergen Zelltod und somit zur
Parkinson-Erkrankung führen kann (Abb. 19). Die vorliegende Arbeit sollte zwei
fundamentale Fragen der Parkin-Forschung adressieren:
1. Welche Mechanismen sind für die Inaktivierung von Parkin verantwortlich?
(Teil 1 der Arbeit)
2. Was ist die physiologische Funktion von Parkin?
(Teil 2 der Arbeit)
Abbildung 19. Der Funktionsverlust von Parkin und die Parkinson-Erkrankung. Zielsetzung
der vorliegenden Arbeit.
73
4. Ergebnisse
4.1 Teil 1: Mechanismen der Inaktivierung von Parkin
Bis zum heutigen Zeitpunkt wurde eine große Anzahl (> 100) pathogener ParkinMutationen beschrieben, darunter Deletionen, Insertionen, Missense- und NonsenseMutationen (Abb. 20) sowie Multiplikationen. Die biochemischen Mechanismen der
Inaktivierung von Parkin sind jedoch weitgehend unbekannt.
Abbildung 20. Darstellung pathogener Missense- und Nonsense-Mutationen von Parkin. UBL:
Ubiquitin-like, RING: really interesting new gene, IBR: in-between RING.
4.1.1
Inaktivierung von Parkin durch Missfaltung und Aggregation:
Charakterisierung pathogener C-terminaler Deletionsmutanten
Eine frühere Studie unsere Arbeitsgruppe konnte erstmalig zeigen, dass Parkin durch
Missfaltung und Aggregation inaktiviert werden kann. So liegt die pathogene
Deletionsmutante W453Stop in einer konstitutiv missgefalteten Konformation vor
und massiver Stress induziert die Aggregation von Wildtyp-Parkin (Winklhofer, K.
F. et al. 2003).
Aufbauend
auf
diesen
Daten
wurden
weitergehende
zellbiologische
Untersuchungen mit pathogenen C-terminalen Deletionsmutanten von Parkin
durchgeführt.
74
4. Ergebnisse
4.1.1.1
Löslichkeitsprofil der Parkin-Mutanten W453Stop, E409Stop
und Q311Stop
Um die pathogenen C-terminalen Deletionsmutanten in Zellkultur zu untersuchen,
wurden die Konstrukte W453Stop (Winklhofer, K. F. et al. 2003), E409Stop und
Q311Stop (Hattori, N. et al. 1998; West, A. et al. 2002), sowie ein N-terminales
Fragment (K211Stop) von Parkin kloniert. Wie in Abb. 21 zu sehen, verfügt die
Mutante W453Stop über eine intakte RING (really interesting new gene)-Box
bestehend aus zwei RING-Domänen. Im Gegensatz dazu fehlt der Deletionsmutante
E409Stop die zweite RING-Domäne. Bei Q311Stop ist zusätzlich die IBR (inbetween RING)-Domäne und bei K211Stop die komplette RING-Box deletiert.
Abbildung 21. Schematische Darstellung der C-terminalen Deletionsmutanten von Parkin.
Dargestellt sind die funktionellen Domänen und die entsprechenden Aminosäurepositionen von
Wildtyp-Parkin und Parkin-Mutanten. UBL: Ubiquitin-like, RING: really interesting new gene, IBR:
in-between RING.
Eine vergleichende Analyse mit Wildtyp-Parkin und W453Stop sollte zunächst
klären, ob C-terminale Deletionen die Biogenese und Faltung von Parkin
beeinflussen. Hierfür wurden alle Mutanten auf ihre Detergenz-Löslichkeit
untersucht. Zum Erstellen des Löslichkeitsprofils wurden N2a-Zellen transient mit
Wildtyp-Parkin bzw. den Deletionsmutanten transfiziert. Nach der Lyse in 0,1%
Triton X-100 wurden die Lysate mittels Zentrifugation in eine Detergenz-lösliche (S)
und -unlösliche (P) Fraktion aufgeteilt. Die Proteine wurden mittels Western Blot
75
4. Ergebnisse
unter Verwendung des polyklonalen Anti-Parkin Antikörpers hP1 analysiert.
Wildtyp-Parkin (wt) war in Triton X-100 löslich und daher nahezu ausschließlich in
der löslichen (S) Fraktion zu finden. Im Gegensatz dazu waren alle C-terminalen
Deletionsmutanten in der Detergenz-unlöslichen (P) Fraktion detektierbar (Abb. 22
A). Die quantitative Analyse ergab, dass Wildtyp-Parkin (wt) zu 90% in einer
Detergenz-löslichen Konformation vorliegt, wohingegen sich über 80% der Cterminalen Deletionmutanten in der Pellet-Fraktion befinden (Abb. 22 B). Das Nterminale Fragment von Parkin K211Stop lag nahezu ausschließlich (98,4%) in einer
Detergenz-unlöslichen Konformation vor (Abb. 22).
Abbildung 22. C-terminale Deletionsmutaten liegen in einer Detergenz-unlöslichen
Konformation vor. (A) N2a-Zellen wurden transient mit Wildtyp-Parkin (wt) oder den DeletionsMutanten transfiziert und 48 Stunden später in 0,1% TritonX-100 lysiert. Nach der Zentrifugation
wurde die Detergenz-lösliche (S) und die Detergenz-unlösliche (P) Fraktion mittels Western Blot
unter Verwendung des polyklonalen Anti-Parkin Antikörpers hP1 analysiert. (B) Quantitative Analyse
der Proteinmengen von wt und der C-terminalen Deletionsmutanten in der Detergenz-löslichen
(Überstand) und der Detergenz-unlöslichen (Pellet) Fraktion. Die Gesamtproteinmenge von Parkin
(Überstand + Pellet) wurde als 100 % festgesetzt. Das Sternchen markiert eine unspezifische Bande.
4.1.1.2
Sedimentationsverhalten
der
Mutanten
W453Stop
und
E409Stop
Um weitere experimentelle Evidenz zu liefern, dass eine Detergenz-Unlöslichkeit
eine
Änderung
der
Sedimentationsverhalten
Protein-Konformation
der
Mutanten
in
widerspiegelt,
einem
wurde
das
Sucrose-Stufengradienten
untersucht. Hierfür wurden die Deletionsmutanten W453Stop und E409Stop ebenso
wie Wildtyp-Parkin in N2a-Zellen exprimiert und die Zelllysate in einem
76
4. Ergebnisse
30-40%igem Sucrose-Stufengradienten mittels Ultrazentrifugation analysiert. Aus
der Western Blot-Analyse der Fraktionen ging deutlich hervor, dass Wildtyp-Parkin
(wt) ausschließlich in den oberen Fraktion des Gradienten zu finden ist und mit dem
zytosolischen Protein Hsp70 co-lokalisiert. Im Gegensatz dazu waren die beiden
pathogenen Mutanten W453Stop und E409Stop nahezu vollständig in der untersten
Fraktion lokalisiert (Abb. 23).
Abbildung 23. Wildtyp-Parkin und die C-terminalen Deletionsmutanten W453Stop und
E409Stop zeigen unterschiedliches Sedimentationsverhalten. N2a-Zellen wurden transient mit
Wildtyp-Parkin (wt), W453Stop oder E409Stop transfiziert und in 0,1% TritonX-100 lysiert. Das
gesamte Zelllysat wurde in einem 30-40%igen Sucrose-Stufengradienten mittels Ultrazentrifugation
analysiert. Es wurden 11 Fraktionen von oben abgenommen, die Proteine mit Trichloressigsäure
(TCA) ausgefällt und mittels Western Blot unter Verwendung der Antikörper α-hP1 und α-Hsp70
(N27) analysiert. Die Sternchen markieren eine unspezifische Bande.
Die bisherigen Ergebnisse deuteten darauf hin, dass C-terminale Deletionen
eine Missfaltung von Parkin und die Ausbildung von Protein-Aggregaten induzieren.
4.1.1.3
Zelluläre
Lokalisierung
von
W453Stop,
E409Stop
und
Q311Stop
Nach der biochemischen Charkterisierung wurde die zelluläre Lokalisierung der
C-terminalen Deletionsmutanten in der intakten Zelle analysiert. Dazu wurde nach
der Transfektion eine indirekte Immunfluoreszenz in permeabilisierten humanen
77
4. Ergebnisse
Neuroblastomzellen (SH-SY5Y) vorgenommen und Parkin mit dem Antikörper αhP1 visualisiert. Wildtyp-Parkin (wt) zeigte eine relativ homogene Verteilung über
das gesamte Zytosol. Dagegen lagen alle C-terminalen Deletionsmutanten in Form
von zytosolischen Aggregaten vor (Abb.24).
Abbildung 24. C-terminale Deletionen führen zur Bildung von Parkin-Aggregaten im Zytosol.
SH-SY5Y-Zellen wurden auf Glasplättchen kultiviert und mit Wildtyp-Parkin (wt), W453Stop,
E409Stop oder Q311Stop transfiziert. Die Lokalisierung von Parkin wurde durch indirekte
Immunfluoreszenz in permeabilisierten Zellen unter Verwendung des polyklonalen Anti-Parkin
Antikörpers hP1 visualisiert.
Aus den biochemischen Untersuchungen sowie der Immunfluoreszenz-Analyse
ging hervor, dass die pathogenen C-terminalen Deletionsmutationen W453Stop,
E409Stop und Q311Stop zu einer Missfaltung und Aggregation von Parkin führen.
4.1.1.4
Einfluss der Mutationen W453Stop, E409Stop und Q311Stop
auf die Assoziation von Parkin mit Zellmembranen
In früheren Studien konnte eine Assoziation von Parkin mit zellulären Membranen
beobachtet werden. So zeigten Fallon et al., dass Parkin mit dem Gerüstprotein
CASK an postsynaptischen Membranen co-lokalisiert (Fallon, L. et al. 2002). Kubo
et al. beschrieben eine Co-Fraktionierung von Parkin mit dem trans-Golgi-Netzwerk
(TGN) und synaptischen Vesikeln (Kubo, S. I. et al. 2001).
78
4. Ergebnisse
Basierend auf diesen Beobachtungen wurde nun untersucht, ob die Cterminalen Deletionsmutanten in ihrer Fähigkeit, mit zellulären Membranen zu
assoziieren, beeinträchtigt sind. Hierfür wurden die Parkin-Konstrukte transient in
N2a-Zellen exprimiert und in einem Renografin-Dichtegradienten aufgetrennt (siehe
3.8.18.1). Dabei schwimmen die Membranvesikel je nach ihrer Dichte in dem
Gradienten auf (Heller, U. et al. 2003; Heske, J. et al. 2004; Schandel, K. A. und D.
D. Jenness 1994; Wang, Q. und A. Chang 1999). Zytosolische Proteine verbleiben
im unteren Bereich des Gradienten. Um die für das Zytosol spezifischen Fraktionen
zu
bestimmen,
wurden
Kontroll-Zellen
(Vektor-transfiziert)
nach
dem
Gradientenlauf mit Hilfe des Antikörpers α-Hsp70 analysiert. Das zytosolische
Protein Hsp70 war in den unteren vier Fraktionen detektierbar (Abb. 25, Hsp70, 1114). Über 50% von Wildtyp-Parkin (wt) wurde in einer für Membranen spezifischen
frühen Fraktion detektiert (Abb. 25, wt, Fraktion 3). Die beiden C-terminalen
Deletionsmutanten W453Stop und E409Stop hingegen waren ausschließlich in den
für das Zytosol spezifischen späteren Membranfraktionen zu finden (Abb. 25,
W453Stop, E409Stop, Fraktion 10-14). Interessanterweise hatten weder die Deletion
der N-terminalen Ubiquitin-like (UBL)-Domäne noch die pathogene Punktmutation
R42P innerhalb der UBL einen Einfluss auf die Membranassoziation von Parkin
(Abb. 25, ∆1-79, R42P, Fraktion 2-4).
Diese Experimente verdeutlichten, dass Deletionen des C-Terminus von Parkin
eine Assoziation mit zellulären Membranen verhindern.
79
4. Ergebnisse
Abbildung 25. C-terminale Deletionen verhindern die Assoziation von Parkin mit
Membranen. N2a-Zellen wurden transient mit Wildtyp-Parkin (wt) und den angegebenen ParkinKonstrukten transfiziert. Die Zellen wurden in TE resuspendiert und durch wiederholtes Einfrieren
und Auftauen lysiert. Die Zelllysate wurden in einem 22-34%igen Renografin-Stufengradienten
analysiert. Nach der Ultrazentrifugation wurden 14 Fraktionen von oben abgenommen und Parkin und
Hsp70 mittels Immunblot detektiert. Das Sternchen markiert eine unspezifische Bande.
4.1.2
Inaktivierung
proteasomalen
von
Parkin
Abbau:
durch
Destabilisierung
Charakterisierung
und
pathogener
N-terminaler Punktmutationen
Punktmutationen lassen sich gehäuft in der C-terminalen RING-Box von Parkin
beobachten, interessanterweise aber finden sich Mutationen über das gesamte Protein
verteilt. Neuere Studien konnten auch vermehrt Mutationen in der N-terminalen
UBL-Domäne identifizieren (vgl. Abb. 20). Die biochemischen Mechanismen der
80
4. Ergebnisse
Inaktivierung dieser Mutanten waren unbekannt und sollten in den folgenden
Untersuchungen geklärt werden.
Hierfür wurden die pathogenen Mutanten R33Q (Oliveira, S. A. et al. 2003),
R42P (Shimura, H. et al. 2000; Terreni, L. et al. 2001), K48A (Dev, K. K. et al.
2003) und V56E (Hoenicka, J. et al. 2002) (vgl. Abb. 26) kloniert und im
Zellkulturmodell biochemisch charakterisiert.
Abbildung 26. Aminosäuresequenz der UBL von Parkin. Die Pfeile markieren die hier
untersuchten Punktmutationen.
4.1.2.1
Löslichkeitsprofil und zelluläre Lokalisierung der ParkinMutanten R33Q, R42P, K48A und V56E
In einer vergleichenden Analyse mit Wildtyp-Parkin wurde zunächst untersucht, ob
N-terminale Mutationen einen Einfluss auf die Löslichkeit und zelluläre Lokalisation
von Parkin haben. Aus der durchgeführten indirekten Immunfluoreszenz-Studie ging
hervor, dass sich die Mutanten in Bezug auf ihre Lokalisierung nicht von WildtypParkin unterscheiden. Die N-terminalen Parkin-Mutanten zeigten ebenfalls eine
homogene Verteilung über das gesamte Zytosol (Ergebnisse nicht gezeigt).
Als nächstes sollte analysiert werden, ob die pathogenen Mutationen R33Q,
R42P, K48A und V56E die Faltung von Parkin beeinflussen. Hierfür wurden alle
Mutanten auf ihre Löslichkeit untersucht. Zum Erstellen des Löslichkeitsprofils
wurden N2a-Zellen transient entweder mit Wildtyp-Parkin (wt) oder den
Punktmutanten transfiziert. Nach der Lyse in 0,1% Triton X-100 wurden die Lysate
durch Zentrifugation in eine Detergenz-lösliche und -unlösliche Fraktion aufgeteilt
und Parkin mittels Western Blot unter Verwendung des polyklonalen Antikörpers
α-hP1 analysiert. Die Western Blot-Analyse zeigte, dass alle N-terminalen ParkinMutanten kaum in der Detergenz-löslichen (S) Fraktion detektierbar sind. Diese
lagen allerdings auch nicht in einer Detergenz-unlöslichen (P) Konformation vor
(Abb. 27).
81
4. Ergebnisse
Abbildung 27. N-terminale Punktmutationen in der UBL destabilisieren Volllängen-Parkin.
N2a-Zellen wurden transient mit Wildtyp-Parkin (wt) oder den Parkin-Mutanten transfiziert und 48
Stunden später in 0,1% TritonX-100 lysiert. Nach der Zentrifugation wurde die Detergenz-lösliche (S)
und die Detergenz-unlösliche (P) Fraktion mittels Western Blot unter Verwendung des polyklonalen
Anti-Parkin Antikörpers hP1 analysiert. Das Sternchen markiert eine unspezifische Bande.
Wie in den vorausgegangenen Experimenten bereits beobachtet, wurden bei
Parkin zwei distinkte Banden im Western Blot detektiert: eine größere Bande, die der
Größe von Volllängen-Parkin entspricht (52 kDa), und eine kleinere Bande (ca. 42
kDa) (vgl. Abb. 27, wt). In diesem Experiment fiel auf, dass im Gegensatz zu
Wildtyp-Parkin (wt) der Anteil an Volllängen-Parkin (obere Bande) bei den Nterminalen Mutanten signifikant verringert ist (Abb. 27).
Die bisherigen Ergebnisse zeigten, dass Punktmutationen innerhalb der UBL
die Faltung und zelluläre Lokalisierung von Parkin nicht beeinflussen. Da aber unter
steady state-Bedingungen Volllängen-Parkin kaum detektierbar war, wurden weitere
Untersuchungen zur Stabilität des Volllängen-Proteins durchgeführt.
4.1.2.2
Biogenese einer N-terminal verkürzten Parkin-Spezies in vivo
Nach transienter Transfektion von kultivierten Zellen mit humanem Wildtyp-Parkin
wird
neben
Volllängen-Parkin
eine
kleinere
Parkin-Spezies
exprimiert.
Interessanterweise ist diese kleinere Parkin-Spezies auch in humanem Gehirn zu
finden (Schlossmacher, M. G. et al. 2002; Shimura, H. et al. 1999; Staropoli, J. F. et
al. 2003) (vgl. Abb. 28). Die Existenz dieser Parkin-Spezies ist folglich kein Artefakt
der Überexpression in Zellkultur.
82
4. Ergebnisse
Abbildung 28. Expression einer N-terminal verkürzten Parkin-Spezies. Links: Expression von
Wildtyp-Parkin in humanen Neuroblastomzellen (SH-SY5Y). Analyse mittels Western Blot unter
Verwendung des Antikörpers α-hP1. Rechts: Proteinlysat aus humanem Gehirnmaterial, Abbildung
aus (Schlossmacher, M. G. et al. 2002).
Nachfolgend sollte nun die Frage geklärt werden, wie es zur Generierung der
kleineren Parkin-Spezies kommt. Unterschiedliche Mechanismen können die
Generierung der kleineren Parkin-Spezies erklären. So besteht die Möglichkeit einer
proteolytische Spaltung von Volllängen-Parkin oder aber die Expression als kleineres
Protein, z.B. als Splice-Variante. Wir beobachteten, dass die kleinere Spezies nur
nach Expression von humanem Parkin, nicht aber nach Expression von murinem
Parkin auftritt. Daher verglichen wir die beiden Parkin-Sequenzen und stellten fest,
dass sich an Aminosäureposition 80 der humanen Parkin-Sequenz ein ATG-Codon
befindet, welches als internes Translationssignal fungieren könnte. Um diese
Möglichkeit experimentell zu testen, wurden die beiden Punktmutanten M80L und
M80T hergestellt, bei welchen die Aminosäure Methionin an Position 80 der
humanen Parkin-Sequenz gegen Leucin oder Threonin ausgetauscht wurde. Der
Aminosäureaustausch gegen Threonin entspricht der Maus- bzw. Rattensequenz von
Parkin. Um selektiv N-terminal verkürztes Parkin zu exprimieren, wurde zusätzlich
die Deletionsmutante ∆1-79 hergestellt, der die ersten 79 Aminosäuren fehlen. Als
Startcodon
dient
hier
das
Methionin
83
an
Position
80
(Abb.
29).
4. Ergebnisse
Abbildung 29. Schematische Darstellung der Parkin-Punktmutanten M80L und M80T sowie
der Parkin Deletionsmutante ∆1-79. Bei Wildtyp (wt)-Parkin ist der Teil der Nukleotidsequenz zu
sehen, welche an Position 80 ein ATG-Codon enthält.
Die Konstrukte wurden in N2a-Zellen exprimiert und mittels Western Blot
analysiert. Die Proteinanalytik ergab, dass bei der Expression von M80L und M80T
lediglich eine Parkin-Spezies detektierbar ist. Diese entsprach in ihrem
Molekulargewicht dem Volllängen-Parkin (obere Bande, wt). Darüber hinaus zeigte
die N-terminal verkürzte Parkin-Mutante ∆1-79 das gleiche Molekulargewicht wie
die kleinere Parkin-Spezies (Abb. 30 A). Um die Ergebnisse der steady-stateAnalyse zu bestätigen, wurden N2a-Zellen transient transfiziert, metabolisch mit
[35S]-Methionin markiert und Parkin mittels Immunpräzipitation analysiert. Es
konnte gezeigt werden, dass die Mutation des internen Startcodons an Position 80 die
Generierung der 42-kDa Parkin-Spezies verhindert. Die ∆1-79 Mutante migrierte auf
selber Höhe wie die kleinere Parkin-Spezies (Abb. 30 B). Eine zusätzlich
durchgeführte in vitro-Translation der Parkin-Mutanten in Kaninchen-RetikulozytenLysat lieferte exakt die gleichen Resultate (Abb. 30 C). Interessanterweise konnte
nach metabolischer Markierung von Wildtyp-Parkin (wt) und ∆1-79 eine zusätzliche
Parkin-Spezies von 38 kDa detektiert werden (Abb. 30 B). Es ist anzunehmen, dass
diese Parkin-Spezies durch proteolytische Modifikation generiert wurde.
Um spezifisch Parkin mit intaktem N-Terminus detektieren zu können, wurde
Parkin mit N-terminalem HA-Tag generiert. Nach transienter Transfektion von HAParkin wurden die Proteine mittels Immunoblot analysiert. Hierbei zeigte sich, dass
der Antikörper α-HA ausschließlich Volllängen-Parkin erkennt (Abb. 30 E); der
Anti-Parkin Antikörper hP1 hingegen erkennt Volllängen-Parkin ebenso wie die 42-
84
4. Ergebnisse
kDa Spezies (Abb. 30 D). Diese Ergebnisse lieferten einen zusätzlichen Beweis
dafür, dass die kleinere Parkin-Spezies N-terminal deletiert ist.
Abbildung 30. Eine N-terminal verkürzte Parkin-Spezies wird über ein internes Startcodon
generiert. (A, B, C) Eine Mutation des Startcodons an Position 80 von Parkin verhindert die
Generierung der kleinen 42-kDa Parkin-Spezies. (A) N2a-Zellen wurden transient mit Wildtyp-Parkin
(wt) oder den angegebenen Parkin-Mutanten transfiziert. 48 Stunden später wurden die Zellen in 0,1%
Triton X-100 lysiert, durch Zentrifugation fraktioniert, und Parkin wurde mittels Western Blot unter
Verwendung des Antikörpers α-hP1 analysiert. (B) N2a-Zellen wurden transient mit wt oder den
angegebenen Parkin-Mutanten transfiziert und für 30 Minuten mit [35S]-Methionin radioaktiv
markiert. Parkin wurde mittels Immunpräzipitation unter Verwendung des Anti-Parkin Antikörpers
hP1 analysiert. (C) Die angegebenen Parkin-Konstrukte wurden in vitro translatiert. Radioaktive
Proteine wurden mittels SDS-PAGE aufgetrennt. (D, E) Expressionsanalyse von Parkin mit Nterminalem HA-Tag. Wt-Parkin und HA-Parkin wurden transient in N2a-Zellen exprimiert und mittels
Western Blot wie unter (A) beschrieben analysiert. Es wurde entweder der Antikörper α-hP1 (D) oder
α-HA (E) verwendet.
85
4. Ergebnisse
4.1.2.3
Untersuchungen zur Stabilität der Parkin-Mutanten R33Q und
R42P
Wie unter Kapitel 4.1.2.1 beschrieben, beeinflussen pathogene Punktmutationen in
der UBL weder Faltung noch zelluläre Lokalisierung von Parkin. Es konnte jedoch
beobachtet werden, dass die Volllängen-Spezies von Parkin in den Western BlotAnalysen kaum detektierbar ist.
Um dieses Phänomen näher zu untersuchen, wurde eine metabolische
Markierung
mit
anschließender
Immunpräzipitation
der
Parkin-Mutanten
durchgeführt. Die Ergebnisse zeigten, dass die Volllängen-Spezies der N-terminalen
Parkin-Mutanten deutlich weniger stabil ist als Wildtyp-Parkin. Nach einer 24stündigen chase-Periode war die Volllängen-Spezies der Mutanten kaum detektierbar
(Abb. 31 A, obere Bande). Die quantitative Analyse bestätigte diese Beobachtungen:
nach 24 Stunden war mehr als 70% von Wildtyp (wt)-Volllängen-Parkin aber
weniger als 10% der Volllängen-Spezies von R42P detektierbar (Abb 31 B).
Dagegen wurde die Stabilität der kleineren Parkin-Spezies nicht beeinflusst, da diese
die UBL-Mutationen nicht enthält (Quantifizierung nicht gezeigt). Die Ergebnisse
haben klar erkennen lassen, dass Punktmutationen in der UBL die Stabilität des
mutierten Proteins signifikant verringern.
Im nächsten Schritt sollte geklärt werden, ob die N-terminalen Parkin-Mutanten
proteasomal abgebaut werden. Proteine, die über diesen Degradierungsweg
eliminiert werden können, akkumulieren nach einer Behandlung mit dem
proteasomalen Inhibitor MG132, was durch Zunahme der Intensität der Proteinbande
auf dem SDS-Gel angezeigt wird. Um dies zu untersuchen, wurde eine metabolische
Markierung transfizierter N2a-Zellen in Gegenwart des proteasomalen Inhibitors
MG132 durchgeführt. Wie an der Zunahme der Intensität der Proteinbanden von
R42P zu erkennen ist, wurde diese Mutante in Gegenwart von MG132 stabilisiert
(Abb. 31 C, + MG132, chase).
86
4. Ergebnisse
Abbildung 31. Pathogene Punktmutationen in der UBL destabilisieren Parkin und führen zu
dessen proteasomaler Degradierung. (A) N2a-Zellen wurden transient mit Wildtyp-Parkin (wt) oder
den angegebenen Parkin-Mutanten transfiziert und 30 Minuten mit [35S]-Methionin radioaktiv
markiert. Die Zellen wurden entweder direkt geerntet (chase-) oder für weitere 2, 6 oder 24 Stunden in
frischem Medium inkubiert. Nach der Lyse in IP-Lysepuffer wurde Detergenz-lösliches Parkin mittels
Immunpräzipitation unter Verwendung des Antikörpers α-hP1 analysiert. (B) Quantitative Analyse
von (A). Die relative Proteinmenge von Parkin in der Detergenz-löslichen Fraktion wurde als 100%
festgesetzt. Zu sehen sind die verbleibenden Proteinmengen der Volllängen-Spezies von WildtypParkin (wt) und der Parkin-Mutanten nach 2, 6 und 24 Stunden chase. (C) N2a-Zellen wurden
transient mit R42P transfiziert, 30 Minuten mit [35S]-Methionin radioaktiv markiert und weitere 6
Stunden mit (MG132 +) und ohne (MG132 -) den proteasomalen Inhibitor MG132 inkubiert. Parkin
wurde wie unter (A) beschieben mittels Immunpräzipization analysiert.
Die Ergebnisse zeigten, dass N-terminale Mutationen in der UBL von Parkin
die Stabilität des Proteins signifikant reduzieren. Die mutierten Proteine werden
rasch über das Proteasom abgebaut. Folglich ist weniger funktionelles Parkin in der
Zelle vorhanden.
87
4. Ergebnisse
4.1.2.4
Einfluss der pathogenen Mutationen auf die E3-LigaseAktivität von Parkin
Schließlich sollte der Einfluss der pathogenen Mutationen auf die Aktivität von
Parkin als E3-Ubiquitin-Ligase im Ubiquitylierungs-Assay untersucht werden.
Aufgrund der bestehenden Unklarheit über authentische Parkin-Substrate wurde bei
den durchgeführten Experimenten die Ubiquitylierung des gesamten zellulären
Proteinlysats analysiert. Hierfür wurden N2a-Zellen mit FLAG-Ubiquitin und
Wildtyp-Parkin (wt) oder Parkin-Mutanten co-transfiziert. Die Zellen wurden
anschließend mit dem proteasomalen Inhibitor MG132 inkubiert und in
Detergenzpuffer (0,1% Triton X-100, NEM) lysiert. Die ubiquitylierten Proteine
wurden mittels Western Blot unter Verwendung des Antikörpers α-FLAG analysiert.
Wie in Abbildung 32 zu sehen, befanden sich bei Expression der pathogenen
Mutanten R42P und W453Stop deutlich weniger ubiquitylierte Proteine im Zelllysat
als bei Wildtyp-Parkin. Dies deutete auf eine reduzierte E3-Ligase-Aktivität der
Parkin-Mutanten hin. Interessanterweise beeinträchtigte auch eine Deletion der UBLDomäne die E3-Ligase-Aktivität von Parkin signifikant.
Abbildung 32. Pathogene Mutationen beeinflussen die E3 Ligase-Aktivität von Parkin. N2aZellen wurden transient mit FLAG-Ubiquitin und Wildtyp-Parkin (wt) oder den angegebenen ParkinMutanten co-transfiziert. Die Zellen wurden 6 Stunden mit MG132 inkubiert, anschließend geerntet
und in zwei Aliquote aufgeteilt. Ein Aliquot diente zur Analyse von ubiquitylierten Proteinen mittels
Western Blot unter Verwendung des Antikörpers α-FLAG. Das andere Aliquot wurde durch
Zentrifugation in eine Detergenz-lösliche (S) und –unlösliche (P) Fraktion aufgetrennt. In diesen
Fraktion wurde die Expression von Parkin und der Parkin-Mutanten mittels Western Blot unter
Verwendung des Antikörpers α-hP1 untersucht. Als Ladekontrolle wurde Hsp70 unter Verwendung
des monoklonalen Antikörpers α-Hsp70 (N27) detektiert.
88
4. Ergebnisse
4.1.3
Zusammenfassung Teil 1:
Mechanismen der Inaktivierung von Parkin
Mutationen im Parkin-Gen und ein daraus resultierender Verlust von funktionellem
Parkin stellen die molekulare Grundlage einer autosomal rezessiv vererbbaren Form
der Parkinson-Erkrankung dar. Die biochemischen Mechanismen der Inaktivierung
von Parkin sind jedoch unklar. Um neue Einblicke in die Mechanismen zu gewinnen,
die zum Funktionsverlust von Parkin führen, wurden in der vorliegenden Arbeit
pathogene C- und N-terminale Parkin-Mutationen analysiert.
In der Studie konnten verschiedene Mechanismen der Parkin-Inaktivierung
aufgeklärt werden:
•
Deletionen von C-terminalen Aminosäuren führen zur Missfaltung und
Aggregation von Parkin
•
N-terminale
Punktmutationen
in
der
Ubiquitin-like
(UBL)-Domäne
verringern die Stabilität von Parkin
In der zu Beginn dieser Arbeit durchgeführten vergleichenden Analyse der
pathogenen C-terminalen Deletionsmutanten W453Stop, E409Stop und Q311Stop
konnte gezeigt werden, dass der Verlust von C-terminalen Aminosäuren mit der
nativen Faltung von Parkin interferiert. Die Deletionsmutanten lagen in Form von
zytosolischen Aggregaten vor. Außerdem konnte gezeigt werden, dass C-terminale
Deletionen die Assoziation von Parkin mit Membranen verhindern. In der
nachfolgenden Untersuchung pathogener Punktmutationen in der N-terminalen UBLDomäne von Parkin konnte erstmalig nachgewiesen werden, dass diese die Stabilität
von Parkin signifikant verringern. Die Mutanten wurden rasch über das Proteasom
abgebaut. Zusammenfassend konnte festgestellt werden, dass verschiedene
pathogene Mutationen die E3- Ligase-Aktivität von Parkin durch Missfaltung oder
Destabilisierung beeinträchtigen.
Im Rahmen dieser Untersuchungen konnte ferner gezeigt werden, dass in vivo
zusätzlich zu Volllängen-Parkin eine kleinere Parkin-Spezies gebildet wird aufgrund
der Präsenz eines internen Initiationscodons an Position 80. Diese kleinere ParkinSpezies tritt nur bei der Expression von humanem Parkin auf und ist gekennzeichnet
durch das Fehlen der N-terminalen UBL-Domäne.
89
4. Ergebnisse
4.2 Teil 2: Physiologische Funktion von Parkin
Während über authentische Parkin-Substrate noch weitgehend Unklarheit herrscht,
wurde im Laufe dieser Arbeit beobachtet, dass Parkin Zellen vor Stress-induziertem
Zelltod schützen kann. Um Einblicke in den Mechanismus der neuroprotektiven
Wirkung zu gewinnen, wurde im zweiten Teil dieser Arbeit eine mögliche Rolle von
Parkin in protektiven Signaltransduktionswegen näher untersucht.
4.2.1
Neuroprotektives Potential von Parkin
Um eine mögliche Rolle von Parkin beim Stress-induzierten Zelltod zu untersuchen,
wurde der Effekt einer Parkin-Überexpression in verschiedenen Stress-Modellen
analysiert. Es wurden insbesondere solche Stressoren gewählt, die in dopaminergen
Neuronen auftreten und bei der Parkinson-Erkrankung eine pathophysiologische
Rolle spielen, nämlich Hemmung von Komplex I der mitochondrialen Atmungskette
(induziert durch Rotenon) sowie Exzitotoxizität, also eine Überstimutation von
Glutamat-Rezeptoren (induziert durch Kainat).
Humane Neuroblastomzellen (SH-SY5Y) wurden transient mit Wildtyp (wt)Parkin transfiziert und 24 Stunden später für 3 Stunden mit Kainat (500 µM) oder
Rotenon (10 µM) inkubiert. Da Parkin durch massiven Stress infolge von
Missfaltung inaktiviert wird (LaVoie, M. J. et al. 2005; Winklhofer, K. F. et al.
2003; Yao, D. et al. 2004), wurden hier moderate Stressbedingungen gewählt.
Apoptotische Zellen wurden anschließend mittels indirekter Immunfluoreszenz unter
Verwendung eines spezifischen Antikörpers gegen aktivierte Caspase-3 analysiert
und quantifiziert. In den Stress-behandelten Zellen konnte ein protektiver Effekt von
Parkin beobachtet werden. In Gegenwart von Wildtyp-Parkin ging der prozentuale
Anteil apoptotischer Zellen zurück von 17% auf 7% (Kainat-Behandlung) bzw. von
21% auf 12% (Rotenon-Behandlung) (Abb. 33 A). Die pathogenen Mutanten R42P
und G430D hingegen zeigten nach Behandlung mit Kainat ein um ca. 50%
reduziertes neuroprotektives Potential im Vergleich zu Wildtyp-Parkin (Abb. 33 B).
Interessanterweise war auch die kleinere Parkin-Spezies (vgl. 4.1.2.2) in ihrer
neuroprotektiven Kapazität deutlich beeinträchtigt (Abb. 33 B, ∆N Parkin = ∆1-79).
90
4. Ergebnisse
Zur Expressionkontrolle wurden Zelllysate mittels Western Blot unter Verwendung
des Anti-Parkin Antikörpers hP1 analysiert.
Die neuroprotektive Kapazität von Parkin konnte nicht nur kurz nach
Stressbehandlung (Caspase-3 Assay), sondern auch 24 Stunden später beobachtet
werden. Hierfür wurden SH-SY5Y-Zellen transient transfiziert und am nächsten Tag
für 18 Stunden mit Rotenon (0,25 µM) inkubiert. Anschließend wurden die Zellen
mit Hoechst 33342 angefärbt und quantifiziert. Der prozentuale Anteil an Zellen mit
kondensierten und fragmentierten Kernen, ein typisches Zeichen für apoptotische
Zellen, ging in Gegenwart von Parkin auf das Ausgangsniveau zurück (Abb. 33 C,
D).
91
4. Ergebnisse
Abbildung 33. Parkin besitzt ein neuroprotektives Potential. (A) SH-SY5Y-Zellen wurden mit
Wildtyp (wt)-Parkin oder Vektor transfiziert. 24 h später wurden die Zellen für 3 Stunden mit Kainat
(500 µM) oder Rotenon (10 µM) inkubiert, fixiert, permeabilisiert und mittels indirekter
Immunfluoreszenz analysiert. Apoptotische Zellen wurden mit dem spezifischen Antikörpers gegen
aktivierte Caspase-3 identifiziert. Zur Quantifizierung wurden die Caspase-positiven Zellen gezählt.
Zu sehen ist der prozentuale Anteil apoptotischer Zellen aus der Gesamtheit der transfizierten Zellen.
(B) SH-SY5Y-Zellen wurden mit wt-Parkin oder den angegebenen Parkin-Mutanten transfiziert. 24 h
später wurden die Zellen für 3 Stunden mit Kainat (500 µM) inkubiert und anschließend mittels
indirekter Immunfluoreszenz, wie unter (A) beschrieben, analysiert. *P<0,01, **P<0,001 im Vergeich
zu wt-exprimierenden Zellen. Zur Expressionskontrolle wurde ein Aliquot des Zelllysats mittels
Western Blot unter Verwendung des Anti-Parkin Antikörpers hP1 analysiert. (C, D) SH-SY5Y-Zellen
wurden mit wt-Parkin oder Vektor transfiziert. 24 h später wurden die Zellen für 18 Stunden mit
Rotenon (0,25 µM) inkubiert und mit Hoechst 33342 angefärbt (10 min, 37°C). (C) Zur
Quantifizierung wurden Zellen mit kondensierten und fragmentierten Kernen gezählt. Zu sehen ist der
prozentuale Anteil der Zellen mit kondensierten und fragmentierten Kernen aus der Gesamtheit der
transfizierten Zellen. (D) Immunfluoreszenzanalyse des unter (C) beschriebenen Experiments. Die
Pfeile markieren transfizierte Zellen mit kondensierten Kernen.
92
4. Ergebnisse
4.2.2
Stress-induzierte Transkription und Translation von Parkin
Um weitere Hinweise für eine mögliche Rolle von Parkin in der zellulären
Stressbewältigung zu erlangen, wurde die Transkription von endogenem Parkin unter
Stressbedingungen mittels Real-Time-PCR untersucht. Hierfür wurden SH-SY5YZellen mit Kainat (Exzitotoxizität) oder Rotenon (Hemmung von Komplex I der
mitochondrialen Atmungskette) behandelt. Anschließend wurde der Anteil von
Parkin-spezifischer mRNA mittels quantitativer Real-Time-PCR bestimmt (RT-PCRExperimente wurden freundlicherweise von Lena Bouman durchgeführt). Wie Abb.
34 zeigt, war die Transkription von Parkin-mRNA durch Stress induzierbar. Fünf bis
acht Stunden nach der Behandlung mit Kainat oder Rotenon war der maximale
Anstieg an mRNA zu verzeichnen (Abb. 34 A, B). Die Stress-Induzierbarkeit von
Parkin konnte auch in primären kortikalen Neuronen, die aus embryonalem
Rattengehirn präpariert wurden, beobachtet werden. Zur Stressinduktion wurde hier
Glutamat (5 oder 10 µM, 6 Stunden) verwendet (Abb. 34 C) (Präparierung und
Stressbehandlung der primären Neuronen wurden freundlicherweise in Kooperation
mit Dr. Carsten Culmsee, Department für Pharmazie, Pharmazeutische BiologieBiotechnologie, Ludwig-Maximilians-Universität München, durchgeführt).
Um sicherzustellen, dass dieser Effekt auch mit einer Erhöhung der
Proteinmenge von Parkin einhergeht, wurden untransfizierte SH-SY5Y-Zellen mit
Rotenon (1 µM, 3h) behandelt und mittels Western Blot unter Verwendung des
monoklonalen Anti-Parkin Antikörpers PRK8 analysiert. 24 Stunden nach der
Stressbehandlung konnte ein signifikanter Anstieg von endogenem Parkin auf
Proteinebene beobachtet werden (Abb. 34 D). Die Ergebnisse zeigten, dass Parkin
durch moderaten Stress induzierbar ist.
93
4. Ergebnisse
Abbildung 34. Hoch-Regulierung von endogenem Parkin nach zellulärem Stress. SH-SY5YZellen wurden für 3 Stunden mit 50 µM Kainat (A) oder 1 µM Rotenon (B) inkubiert. Die Zellen
wurden 5, 8, 12 und 24 Stunden nach der Behandlung geerntet. Gesamt-RNA wurde isoliert und
mittels RT-PCR unter Verwendung Parkin-spezifischer Primer analysiert. Die RNA-Mengen wurden
mit Hilfe des Kontrollgens β-Actin normalisiert. Zu sehen ist der relative Anteil an Parkin-mRNA.
(C) Primäre kortikale Neuronen, die aus embryonalem Rattengehirn (E18) präpariert wurden, wurden
für 6 Stunden mit Glutamat (5 oder 10 µM) inkubiert und wie unter (A) und (B) beschrieben
analysiert. (D) Untransfizierte SH-SY5Y-Zellen wurden mit Rotenon (1 µM, 3 h) behandelt. 24
Stunden später wurde endogenes Parkin mittels Western Blot unter Verwendung des Antikörpers
PRK8 analysiert.
4.2.3
Aktivierung der NF-κB-abhängigen Transkription durch Parkin
Das Spektrum an Stressoren, gegenüber denen Parkin protektiv wirkt, ist erstaunlich
breit und legt die Vermutung nahe, dass Parkin essentielle Signaltransduktionswege
beeinflussen könnte. Um dem zugrundeliegenden Mechanismus des protektiven
Effekts von Parkin näher zu kommen, wurde im Folgenden der Einfluss von Parkin
auf generelle Signalwege von Stress-Antworten analysiert.
Zunächst wurde ein zytosolisches Stress-Antwortsystem untersucht, das über
die Aktivierung des Hitzeschock-Transkriptionsfaktors (HSF1) zur vermehrten
94
4. Ergebnisse
Expression molekularer Chaperone führt (siehe Punkt 1.3.1) und somit eine wichtige
Rolle
bei
proteotoxischem
Stress
spielt.
Hiefür
wurde
ein
Luciferase-
Reporterkonstrukt eingesetzt, das unter Kontrolle eines HSF1-regulierbaren
Elementes (HSE) steht (HSE-Luc). HEK293T-Zellen wurden transient mit WildtypParkin und dem Reporterplasmid HSE-Luc transfiziert und anschließend in ReporterLysepuffer lysiert. Die Reportergen-Aktivität wurde durch die enzymatische
Umsetzung von Luciferin durch Luciferase bestimmt. Die dabei emittierenden
Photonen können luminometrisch quantifiziert werden. Als Positivkontrolle wurden
die Zellen einem moderaten Hitzeschock bei 42°C für 15 Minuten ausgesetzt. In
Abb. 36 A lässt sich deutlich erkennen, dass Parkin keinen Einfluss auf dieses
Stresssystem hat. Die Luciferase-Aktivität entsprach der von EYFP-exprimierenden
Zellen (Negativkontrolle). Die Positivkontrolle zeigte einen ca. 30-fachen Anstieg
der Luciferase-Aktivität.
Als weiteres Stress-Antwortsystem wurde der NF-κB-Signalweg untersucht,
der zur vermehrten Expression anti-apoptotischer Proteine führt (Abb. 35) (siehe
Punkt 1.3.2). Zahlreiche Stimuli (z.B. TNFα oder IL-1) induzieren die NF-κBSignaltransduktion und führen durch Ubiquitylierung und Phosphorylierung
zahlreicher Signalmoleküle zur Aktivierung des IκB-Kinase (IKK)-Komplexes
(bestehend aus den katalytischen Untereinheiten IKKα und IKKβ sowie der
regulatorischen Untereinheit IKKγ/NEMO). Die nachfolgende IKK-mediierte
Phosphorylierung
von
IκBα stimuliert
dessen
rasche
Ubiquitylierung
und
Degradierung durch das Proteasom. NF-κB-Moleküle (meist p65/p50-Heterodimere)
werden somit vom Inhibitor freigesetzt und translozieren in den Zellkern, wo sie die
Transkription entsprechender Zielgene induzieren.
95
4. Ergebnisse
Abbildung 35. Der NF-κB-Aktivierungsweg. Zahlreiche Stimuli (z.B. TNFα oder IL-1)
induzieren die NF-κB-Signaltransduktion und führen zur Aktivierung des IκB-Kinase-Komplexes
(bestehend aus den katalytischen Untereinheiten IKKα und IKKβ sowie der regulatorischen
Untereinheit IKKγ/NEMO). Die nachfolgende IKK-mediierte Phosphorylierung von IκBα stimuliert
dessen rasche Ubiquitylierung und Degradierung durch das Proteasom. NF-κB-Moleküle werden
somit vom Inhibitor freigesetzt und translozieren in den Zellkern, wo sie die Transkription
entsprechender Zielgene induzieren. IκB: inhibitorisches κB-Protein, IKK: IκB-Kinase, Ub:
Ubiquitylierung, P: Phosphorylierung.
Für die Analyse dieses Stress-Antwortsystems wurde ebenfalls ein LuciferaseReporterkostrukt
eingesetzt,
das
in
diesem
Fall
Bindeelemente
für
den
Transkriptionsfaktor NF-κB enthält (NF-κB-Luc). HEK293T-Zellen wurden
transient mit Wildtyp-Parkin und dem Reporterplasmid NF-κB-Luc transfiziert.
Nach der Zelllyse in Reporter-Lysepuffer wurde die Reportergen-Aktivität
luminometrisch bestimmt. Als Positivkontrolle wurden die Zellen für drei Stunden
mit 10 ng/ml Phorbol-Myristatacetat (PMA) behandelt. PMA aktiviert die
Proteinkinase C und beeinflusst so die zytosolische NF-κB-Signalkaskade. Im
Gegensatz zu EYFP-exprimierenden Zellen konnte in Gegenwart von Parkin ein 5facher Anstieg der Luciferase-Aktivität beobachtet werden. Die Positivkontrolle
induzierte den 7-fachen Anstieg der Luciferaseaktivität (Abb. 36 B). Um
sicherzustellen, dass der Parkin-induzierte Unterschied der Luciferase-Aktivität nicht
auf
Veränderungen
von
Faltung
oder
Stabilität
des
Luciferase-Proteins
zurückzuführen ist, wurde Luciferase-mRNA mittels RT-PCR analysiert. Die
96
4. Ergebnisse
Ergebnisse bestätigten einen Anstieg der mRNA-Mengen von Luciferase (Ergebnis
nicht gezeigt).
Abbildung 36. Parkin stimuliert die NF-κB-regulierte Transkription. (A) HEK293T-Zellen
wurden mit Wildtyp (wt)-Parkin und dem Luciferase-Reporterplasmid HSE-Luc co-transfiziert. Als
Positivkontrolle wurden die Zellen einem moderaten Hitzeschock ausgesetzt (42°C, 15 min) und
weitere 16 Stunden bei 37 °C inkubiert. Anschließend wurde die Reportergen-Aktivität
luminometrisch bestimmt. Zu sehen ist die relative Luciferase-Aktivität. (B) HEK293T-Zellen wurden
mit Wildtyp (wt)-Parkin und dem Luciferase-Reporterplasmid NF-κB-Luc co-transfiziert. Als
Positivkontrolle wurden die Zellen für drei Stunden mit PMA (10 ng/ml) behandelt und es wurde
weiter wie unter (A) beschrieben verfahren.
Es stellte sich nun die Frage, ob Parkin möglicherweise einen permissiven
Effekt auf die NF-κB-induzierte Transkription hat, d.h. ob es unter schwachen
Stressbedingungen den Schwellenwert für die Aktivierung von NF-κB senken kann.
Um diese Möglichkeit experimentell zu untersuchen, wurden transfizierte HEK293TZellen mit zwei klassischen NF-κB-Aktivatoren behandelt, nämlich dem TumorNekrosefaktor α (TNFα) oder PMA. TNFα induziert dabei eine Rezeptor-vermittelte
Aktivierung der Signalkaskade, PMA hingegen beeinflusst die zytosolische Kaskade
durch
Aktivierung
der
Proteinkinase
C
(Rezeptor-unabhängig).
Die
Stressbedingungen wurden jeweils so gewählt, dass NF-κB nur schwach aktiviert
wird. Die Ergebnisse zeigten, dass die Expression von Parkin in Stress-behandelten
Zellen zu einem supra-additiven Anstieg der NF-κB-abhängigen Transkription führt
(Abb. 37 A, B).
Um diese Resultate mit einem weiteren Assay zu bestätigen, wurde die
Bindeaktivität von NF-κB mit Hilfe eines Electrophoretic Mobility Shift Assays
(EMSA) untersucht. Der EMSA beruht darauf, dass ein an ein Protein gebundenes
97
4. Ergebnisse
DNA-Fragment bei der nativen Gelelekrophorese langsamer migriert als das
entsprechende freie DNA-Fragment. Im vorliegenden Assay wurde die Bindung des
Transkriptionsfaktors NF-κB an die entsprechende DNA-Konsensussequenz
(radioaktiv-markiertes Konsensus-Oligonukleotid) detektiert. NF-κB gelangt nach
Aktivierung in den Zellkern und bindet an die entsprechend Konsensus-DNA, womit
es zur transkriptionellen Aktivierung der zugrunde liegenden Gene kommt. Die
Ergebnisse verdeutlichten, dass Parkin die DNA-Bindeaktivität von NF-κB in
TNFα-stimulierten Zellen entscheidend steigern kann. Es lies sich die vermehrte
Bindung des Konsensus-Oligonukleotids an das p65-Protein (des NF-κBHeterodimers) beobachten. Eine Aktivierung von NF-κB konnte sogar bei einer sehr
geringen Konzentration von TNFα (0,0005 ng/ml) beobachtet werden. Diese war für
eine Aktivierung von NF-κB in Abwesenheit von Parkin nicht ausreichend
(Abb. 37 C) (EMSAs wurden freundlicherweise von Anita Schlierf durchgeführt).
Die bisherigen Untersuchungen zeigten, dass Parkin die NF-κB-abhängige
Transkription aktivieren kann. Darüber hinaus hat Parkin offensichtlich einen
permissiven Effekt auf die Aktivierung von NF-κB, d.h. es kann unter moderaten
Stressbedingungen den Schwellenwert für die Aktivierung der NF-κB-Signalkaskade
senken.
98
4. Ergebnisse
Abbildung 37. Parkin sensibilisiert Zellen für NF-κB-aktivierende Stimuli. (A, B) HEK293TZellen wurden mit NF-κB-Luc und Wildtyp (wt)-Parkin co-transfiziert. 24 Stunden später wurden die
Zellen für 3 Stunden mit TNFα (25 ng/ml) oder PMA (5 ng/ml) inkubiert und nach weiteren 5
Stunden geerntet. Anschließend wurde die Reportergen-Aktivität luminometrisch bestimmt. Zu sehen
ist die relative Luciferase-Aktivität. (C) HEK293T-Zellen wurden mit Wildtyp-Parkin oder Vektor
transfiziert und für 30 Minuten mit verschiedenen Konzentrationen an TNFα inkubiert. Kernextrakte
dieser Zellen wurden mittels EMSA auf die DNA-Bindeaktivität von NF-κB untersucht. Die p65Bande konnte mittels Supershift (Anti-p65 Antikörper) verifiziert werden.
99
4. Ergebnisse
4.2.4
Kausaler Zusammenhang zwischen Neuroprotektion und NF-κBAktivierung
Unsere bisherigen Untersuchungen haben zwei Eigenschaften von Parkin
aufgedeckt: Parkin zeigt unter moderaten Stressbedingungen eine protektive
Wirkung, und es kann die NF-κB-abhängige Transkription aktivieren. Es stellte sich
nun die Frage, ob zwischen beiden Beobachtungen ein Kausalzusammenhang
besteht. Zur Klärung dieser Fragestellung wurden drei experimentelle Ansätze
gewählt: 1. Die Analyse pathogener Parkin-Mutanten, 2. die Auswirkung von
Repressoren der NF-κB-Signaltransduktion und 3. die Analyse von Parkin-Knockdown-Zellen (RNA-Interferenz).
4.2.4.1
Pathogene Parkin-Mutanten sind in der Aktivierung der NF-κBregulierten Transkription beeinträchtigt
Wie bereits im ersten Teil dieser Arbeit gezeigt werden konnte, können dem
Funktionsverlust der Parkin-Mutanten verschiedene Mechanismen zugrunde liegen.
Für die funktionelle Analyse der pathogenen Parkin-Mutanten R42P und G430D
sowie ∆N Parkin (entspricht ∆1-79) wurde ein NF-κB-Reportergen-Assay
durchgeführt. Bei ∆N Parkin handelt es sich um die kleinere Parkin-Spezies, die
keine UBL-Domäne besitzt, aber physiologischerweise exprimiert wird (siehe Punkt
4.1.2.2). Im Gegensatz zu Wildtyp (wt)-Parkin waren die Mutanten ∆N, R42P und
G430D in ihrer Fähigkeit, die NF-κB-regulierte Transkription zu aktivieren,
signifikant beeinträchtigt. Interessanterweise zeigte ∆N Parkin das geringste
Potenial, NF-κB zu aktivieren. Da bei der Expression von Wildtyp-Parkin neben
Volllängen (fl)-Parkin auch N-terminal trunkiertes Parkin (∆N) generiert wird, wurde
zusätzlich die Aktivität von reinem Volllängen-Parkin (entspricht M80T) untersucht.
Im Reportergen-Assay zeigte Volllängen-Parkin die höchste Aktivierung der NF-κBregulierten Transkription (Abb. 38).
100
4. Ergebnisse
Die Ergebnisse führten zu zwei Schlussfolgerungen:
1. Es besteht in der Tat eine Korrelation zwischen Neuroprotektion und NF-κBaktivierendem Potential. Parkin-Mutanten, die eine geringere neuroprotektive
Aktivität zeigen (vgl. Abb. 33), haben auch eine geringere Fähigkeit, NF-κB zu
stimulieren.
2. Die N-terminale UBL-Domäne von Parkin scheint eine entscheidende Rolle bei
der Neuroprotektion (vgl. Abb. 33) und der Aktivierung der NF-κB-regulierten
Transkription zu spielen.
Abbildung 38. Pathogene Parkin-Mutationen verringern das Potential von Parkin, NF-κB zu
aktivieren. HEK293T-Zellen wurden mit dem Reporterplasmid NF-κB-Luc und Wildtyp (wt)-Parkin
oder den angegebenen Mutanten co-transfiziert und 24 Stunden später geerntet. Anschließend wurde
die Reportergen-Aktivität luminometrisch bestimmt. Zu sehen ist die relative Luciferase-Aktivität.
*P<0,01, **P<0,001 im Vergleich zu wt-exprimierenden Zellen. Zur Expressionskontrolle von Parkin
wurde ein Aliquot des Zelllysats mittels Western Blot unter Verwendung der Antikörpers α-hP1
analysiert. Das α-Tubulin dient als Ladekontrolle.
101
4. Ergebnisse
4.2.4.2
Untersuchungen des neuroprotektiven Potentials von Parkin
in Gegenwart von Repressoren der NF-κB-Signaltransduktion
4.2.4.2.1
Zwei transdominante Repressoren des NF-κB-Signalweges
(IκB∆N und IKKβ K/A) beeinträchtigen die Aktivierung der
NF-κB-regulierten Transkription durch Parkin
Um einen möglichen Kausalzusammenhang zwischen Neuroprotektion und NF-κBAktivierung zu untersuchen, wurde der Effekt von Parkin auf die Aktivierung der
NF-κB-regulierten
Transkription
in
Anwesenheit
von
dominant-negativen
Repressoren der NF-κB-Signaltransduktion analysiert.
Zunächst wurde der transdominante NF-κB-Repressor IκB∆N im LuciferaseReportergenassay untersucht. Der Mutante IκB∆N fehlt die N-terminale Domäne
(Aminosäuren 71-317), welche die IκB-Kinase (IKK)-Phosphoakzeptorstelle besitzt
(Krappmann, D. et al. 1996). IκB∆N kann daher nicht abgebaut werden und bindet
dauerhaft an NF-κB, so dass die Signalkaskade unterbrochen wird (Abb. 39).
Abbildung 39. Schematische Darstellung der Wirkung des transdominanten NF-κBRepressors IκB∆N. IκB: inhibitorisches κB-Protein, IKK: IκB-Kinase, Ub: Ubiquitylierung, P:
Phosphorylierung.
102
4. Ergebnisse
Wie in Abb. 41 A zu sehen, blockierte die Co-Transfektion von IκB∆N die Parkinmediierte Aktivierung der NF-κB-regulierten Transkription. Die Luciferase-Aktivität
ging auf das Grundniveau (EYFP + IκB∆N) zurück. Dieses Ergebnis zeigte, dass
Parkin keine eigene transkriptionelle Aktivität besitzt, sondern einen Effekt auf die
NF-κB-Aktivierungskaskade haben muss.
Um weitere Hinweise zu erlangen, auf welcher Ebene der NF-κBSignalkaskade Parkin eingreift, wurde ein NF-κB-Inhibitor gewählt, der den
Signalweg auf der Ebene der IκB-Kinase hemmt. Dazu wurde eine IKKβ-Mutante
eingesetzt, die zwei Mutationen in der Aktivierungsschleife von IKKβ trägt (Abb.
40) (Delhase, M. et al. 1999).
Abbildung 40. Schematische Darstellung der Wirkung des NF-κB-Repressors IKKβ K/A. IκB:
inhibitorisches κB-Protein, IKK: IκB-Kinase, Ub: Ubiquitylierung.
Zunächst wurde ein Luciferase-Reportergen-Assay durchgeführt. Die Ergebnisse
zeigten, dass auch IKKβ K/A den Effekt von Parkin auf die NF-κB-regulierte
Transkription aufhebt (Abb. 41 B).
Die bisherigen Experimente haben demonstriert, dass Repressoren des NF-κBSignalweges mit der Parkin-mediierten Aktivierung der NF-κB-regulierten
Transkription interferieren. Folglich wirkt Parkin aktivierend auf oder oberhalb der
Ebene des IKK-Signalosoms.
103
4. Ergebnisse
Abbildung 41. Dominant-negatives IκB oder Kinase-inaktives IKKβ hemmen den Effekt von
Parkin auf die NF-κB-regulierte Transkription. (A) HEK293T-Zellen wurden mit dem
Reporterplasmid NF-κB-Luc, Wildtyp (wt)-Parkin und dem NF-κB-Repressor IκB∆N co-transfiziert.
24 Stunden später wurde die Luciferase-Aktivität der Zelllysate luminometrisch analysiert. Zu sehen
ist die relative Luciferase-Aktivität. Zur Expressionskontrolle der Proteine wurden Aliquote des
Zelllysats mittels Western Blot unter Verwendung der Antikörpers α-hP1 oder α-FLAG analysiert.
Tubulin dient als Ladekontrolle. (B) HEK293T-Zellen wurden mit dem Reporterplasmid NF-κB-Luc,
Wildtyp-Parkin und der Kinase-inaktiven IKKβ-Mutante co-transfiziert. Luciferase-Assay und
Immunblot wurden wie unter (A) beschrieben durchgeführt.
4.2.4.2.2
IκB∆N und IKKβ K/A hemmen die neuroprotektive Wirkung
von Parkin
In einem weiteren Schritt sollte geklärt werden, ob ein direkter Zusammenhang
besteht zwischen dem neuroprotektiven Potential von Parkin und dessen Fähigkeit,
die NF-κB-Signaltransduktion zu aktivieren. Um dies zu untersuchen, wurde die
neuroprotektive Kapazität von Parkin unter Bedingungen analysiert, welche die
Aktivierung von NF-κB beeinträchtigen.
104
4. Ergebnisse
Zunächst wurde ein Apoptose-Assay in Gegenwart von IκB∆N durchgeführt.
Hierfür wurden humane Neuroblastomzellen (SH-SY5Y) transient mit Wildtyp (wt)Parkin und IκB∆N co-transfiziert und 24 Stunden später für drei Stunden mit Kainat
(500 µM) inkubiert. Apoptotische Zellen wurden anschließend mittels indirekter
Immunfluoreszenz unter Verwendung eines spezifischen Antikörpers gegen
aktivierte Caspase-3 analysiert und quantifiziert. In den Stress-behandelten Zellen
konnte ein eindeutiger protektiver Effekt von Parkin beobachtet werden (Abb. 42 A,
+ Kainat). In Gegenwart des NF-κB-Repressors IκB∆N zeigte Parkin jedoch keinen
anti-apoptotischen Effekt in Kainat-behandelten Zellen (Abb. 42 A, + Kainat, +
IκB∆N). Die insgesamt erhöhte Toxizität lässt sich dadurch erklären, dass alle
zellulären Aktivatoren des NF-κB-Signalweges gehemmt werden. Anschließend
wurde der oben beschriebene Versuch mit der Kinase-inaktiven IKKβ K/A-Mutante
durchgeführt. Ähnlich wie IκB∆N, inhibierte auch IKKβ K/A die neuroprotektive
Wirkung von Parkin nach Kainat-Behandlung (Abb. 42 B).
Diese Experimente haben verdeutlicht, dass in der Tat die Aktivierung der NFκB-Signalkaskade essentiell ist für die neuroprotektive Wirkung von Parkin.
105
4. Ergebnisse
Abbildung 42. Die Aktivierung von NF-κB ist essentiell für den neuroprotektiven Effekt von
Parkin. (A) SH-SY5Y-Zellen wurden mit EYFP, Wildtyp (wt)-Parkin und IκB∆N co-transfiziert. 24
Stunden später wurden die Zellen für 3 Stunden mit Kainat (500 µM) inkubiert und mittels indirekter
Immunfluoreszenz analysiert. Apoptotische Zellen wurden mit dem spezifischen Antikörper gegen
aktivierte Caspase-3 identifiziert. Zur Quantifizierung wurden die Caspase-positiven Zellen gezählt.
Zu sehen ist der prozentuale Anteil apoptotischer Zellen aus der Gesamtheit der transfizierten Zellen.
**P<0,001 im Vergeich zu EYFP-exprimierenden Zellen. (B) SH-SY5Y-Zellen wurden mit EYFP,
Wildtyp-Parkin und IKKβ K/A co-transfiziert und wie unter (A) beschrieben, analysiert. (C)
Immunfluoreszenz des unter (A) beschriebenen Experiments. Die Aktivierung von Caspase-3 wurde
mit dem spezifischen Antikörper gegen aktivierte Caspase-3 (rot) detektiert. Die Kerne wurden mit
DAPI angefärbt (blau).
106
4. Ergebnisse
4.2.5 Parkin-mediierte Ubiquitylierung von Komponenten der NF-κBSignaltransduktionskaskade
Neuere Studien konnten zeigen, dass Ubiquitylierung eine wichtige Rolle bei der
Regulierung der IKK/NF-κB-Signaltransduktion spielt (siehe Punkt 1.3.2) (Chen, Z.
J. 2005; Haglund, K. und I. Dikic 2005; Krappmann, D. und C. Scheidereit 2005;
Ravid, T. und M. Hochstrasser 2004). Dabei kann man zwei Arten der
Ubiquitylierung unterscheiden. Die konventionelle Polyubiquitylierung über Lysin48 spielt bei der Regulierung des IκB-Abbaus und der Proteolyse von VorläuferProteinen eine wichtige Rolle. Die Polyubiquitylierung über Lysin-63 hingegen ist
essentiell für die Aktivierung des IKK-Komplexes und anderer höher gelegener
Regulatoren wie TRAF2 (TNF receptor-associated factor), TRAF6 und RIP
(Receptor interacting protein) (vgl. Abb. 43).
107
4. Ergebnisse
Abbildung 43. Modell für die Rolle der Ubiquitylierung und Phosphorylierung bei der NFκB-Aktivierung. Die Bindung des Liganden an den Plasmamembranrezeptor, hier TNFα und der
TNFα-Rezeptor 1, induziert die Trimerisierung des Rezeptors und die Rekrutierung der Rezeptorassoziierten Proteine TRADD, RIP und TRAF2, welche dadurch aktiviert werden. Die
Polyubiquitylierung von RIP und TRAF2 über Lysin-63 scheint die Bindung des Kinase-Komplexes
TAK1-TAB1-TAB2 an den Membran-gebundenen Komplex zu stimulieren. TAK1 phosphoryliert
den IκB-Kinase (IKK)-Komplex und dieser anschließend IκBα. Dieser Schritt wird durch
IKKγ/NEMO reguliert, eine Untereinheit des IKK-Komplexes, die ihrerseits polyubiquityliert wird.
Phosphoryliertes IκBα wird über Lysin-48 ubiquityliert und durch das Proteasom abgebaut. NF-κBMoleküle werden somit vom Inhibitor freigesetzt und translozieren in den Zellkern, wo sie die
Transkription entsprechender Zielgene induzieren. TNFα: Tumor necrosis factor α, TNFR1: TNF
receptor 1, TRADD: TNF receptor-associated death domain protein, RIP: Receptor interacting
protein, TRAF: TNF receptor-associated factor , TAK: transforming growth factor-β-activated
kinase, TAB: TAK-binding protein. Abbildung modifiziert nach (Ravid, T. und M. Hochstrasser
2004).
108
4. Ergebnisse
4.2.5.1
Ubiquitylierung von IKKγ und TRAF2 durch Parkin
Die bisherigen Experimente haben deutlich gezeigt, dass die Aktivierung des NF-κBSignalweges eine essentielle Voraussetzung für die neuroprotektive Wirkung von
Parkin ist. Es stellte sich nun die Frage, welche Rolle die E3-Ligase-Aktivität von
Parkin spielt, d.h. ob es direkte Zielmoleküle von Parkin im NF-κB-Signalweg gibt.
Hierfür wurden die potentiellen Zielproteine TRAF2, TRAF6 und IKKγ in
Ubiquityierungsassays analysiert. HEK293T-Zellen wurden mit Volllängen (fl)Parkin, HA-Ubiquitin und entweder FLAG-TRAF2, FLAG-TRAF6 oder FLAGIKKγ co-transfiziert. Um eine mögliche Co-Präzipitation von ubiquitylierten
Interaktionspartner von TRAF2, TRAF6 und IKKγ zu verhindern, wurden
denaturierende
Bedingungen
gewählt,
die
mit
Protein-Protein-Interaktionen
interferieren. Hierfür wurde das Zellpellet in denaturierendem Lysepuffer (+ 1%
SDS) lysiert, kurz aufgekocht und mit nicht-denaturierendem Lysepuffer verdünnt.
Nach der Zentrifugation wurde der Überstand für eine Immunpräzipitation mit dem
Anti-FLAG Antikörper verwendet. Die Immunpellets wurden anschließend mittels
Western Blot unter Verwendung des Anti-HA Antikörpers analysiert. Wie aus Abb.
44 A hervorgeht, nahm die Ubiquitylierung von TRAF6 in Gegenwart von Parkin
nicht zu. Im Gegensatz dazu war in Gegenwart von Parkin die Menge an
ubiquityliertem IKKγ und TRAF2 erhöht. Die Parkin-Mutanten ∆N und R42P
hingegen waren in ihrer Fähigkeit, die Ubiquitylierung von IKKγ und TRAF2 zu
mediieren, beeinträchtigt (Abb. 44 B, C). Für die beiden Mutanten konnte bereits
eine geringere Aktivierung der NF-κB-regulierten Transkription sowie ein
verringertes neuroprotektives Potential gezeigt werden (siehe Punkt. 4.2.1 und 4.2.3).
Da TRAFs eine intrinsische E3-Ligase-Aktivität besitzen, sollte geklärt
werden, ob Parkin möglicherweise die E3-Ligase-Aktivität von TRAF2 stimuliert.
Hierfür wurde die Mutante TRAF2∆N in einem Ubiquityierungsassays untersucht.
Diesem Konstrukt fehlt die N-terminale RING-Domäne, die für seine E3-LigaseAktivität essentiell ist. Das Ergebnis verdeutlichte, dass die erhöhte Ubiquitylierung
von TRAF2 in Gegenwart von Parkin nicht durch die intrinsische E3-LigaseAktivität von TRAF2 vermittelt wird (Abb. 44 C).
109
4. Ergebnisse
Abbildung 44. Parkin erhöht die Ubiquitylierung von IKKγ und TRAF2. (A, B, C) HEK293TZellen wurden mit Parkin (fl) bzw. ∆N oder R42P, HA-Ubiquitin und FLAG-TRAF6 (A), FLAGIKKγ (B), FLAG-TRAF2 oder FLAG-TRAF2∆N (C) co-transfiziert. 24 Stunden später wurden die
Zellen geerntet, in denaturierendem Puffer (+ 1% SDS) lysiert, kurz aufgekocht und mit nichtdenaturierendem Puffer verdünnt. Nach der Zentrifugation wurden gleiche Proteinmengen des
Überstandes für eine Immunpräzipitation mit dem Anti-FLAG Antikörper verwendet. Die
Immunpellets wurden mittels Western Blot unter Verwendung des monklonalen Anti-HA Antikörpers
analysiert. Zur Expressionkontrolle wurden Aliquote des Überstands jeweils mit den Antikörpern αhP1, α-IKKγ und α-TRAF2 immundetektiert. Die Größenmarker sind jeweils links am Rand als
Striche dargestellt und repräsentieren 98, 64 und 50 kDa (B) oder 148, 98 und 64 kDa (A, C);
v: Vektor, b: Pufferkontrolle.
110
4. Ergebnisse
4.2.5.2
Parkin vermittelt die regulierende Ubiquitylierung von IKKγ
über Lysin-63
In einem nächsten Schritt sollte die Art der von Parkin induzierten UbiquitinVerknüpfung geklärt werden. Es wurde zunächst in Stabilitätsstudien untersucht, ob
die Parkin-mediierte Ubiquitylierung IKKγ und TRAF2 für den proteasomalen
Abbau markiert. Die durchgeführten pulse/chase-Experimente ließen keinen Effekt
von Parkin auf die Stabilität von IKKγ und TRAF2 über einen Zeitraum von 24
Stunden erkennen. In Gegenwart von Parkin war die Proteinmenge von TRAF2 bzw.
IKKγ unverändert (Abb. 45 A). Dieses Ergebnis deutete darauf hin, dass Parkin
keine degradierende Art der Ubiquitinverknüpfung vermittelt. Um weitere
experimentelle Evidenz für diese Vermutung zu erlangen, wurden im folgenden
Experiment Ubiquitin-Mutanten verwendet, die lediglich ein Lysin besitzen (HAK48only und HA-K63only). Diese Mutanten erlauben lediglich die Verknüpfung der
Ubiquitinkette über Lysin-48 (proteasomale Degradierung) oder aber über Lysin-63
(regulierende
Funktion)
(Pickart,
Ubiquitylierungsexperimente
wurden
C.
M.
wie
und
unter
D.
Fushman
Punkt
2004).
4.2.5.1
Die
beschrieben
durchgeführt und zeigten, dass die Expression der K48only-Mutante die Parkinmediierte Ubiquitylierung von IKKγ deutlich verringert (Abb. 45 B, K48only, fl). Im
Gegensatz dazu konnte Parkin in Gegenwart von K63only-Ubiquitin die
Ubiquitylierung von IKKγ weiterhin vermitteln (Abb. 45 B, K63only, fl).
Zusammenfassend haben die Experimente gezeigt, dass Parkin eine nichtproteolytische, regulierende Ubiquitylierung von IKKγ über Lysin-63 vermittelt.
111
4. Ergebnisse
Abbildung 45. Parkin mediiert die Ubiquitylierung von IKKγ und TRAF2 über Lysin-63. (A)
Parkin hat keinen Einfluss auf die Stabilität von IKKγ und TRAF2. HEK293T-Zellen wurden mit
Wildtyp-Parkin und FLAG-IKKγ oder FLAG-TRAF2 co-transfiziert und für 30 Minuten mit [35S]Methionin radioaktiv markiert. Die Zellen wurden entweder direkt geerntet (chase -) oder weitere 6,
12 oder 24 Stunden in frischem Medium inkubiert. Nach der Lyse in IP-Lysepuffer wurde Detergenzlösliches IKKγ oder TRAF2 mittels Immunpräzipitation unter Verwendung des anti-FLAG
Antikörpers analysiert. (B) Parkin vermittelt die Ubiquitylierung von IKKγ über Lysin-63. HEK293TZellen wurden mit Parkin (fl), FLAG-IKKγ und entweder mit HA-Ubiquitin, K48only- oder K63onlyUbiquitin co-transfiziert. 24 Stunden später wurden die Zellen geerntet, lysiert und mittels
Zentrifugation fraktioniert. Gleiche Proteinmengen des Überstandes wurden unter denaturierenden
Bedingungen einer Immunpräzipitation mit dem Anti-FLAG Antikörper unterzogen. Die
Immunpellets wurden mittels Western Blot unter Verwendung des monklonalen Anti-HA Antikörpers
analysiert. Zur Expressionkontrolle wurden Aliquote des Überstands jeweils mit den Antikörpern αhP1und α-IKKγ immundetektiert.
4.2.6
Interaktion von Parkin mit IKKγ und TRAF2
Die bisherigen Ergebnisse lassen vermuten, dass IKKγ und TRAF2 potentielle
Zielproteine der Parkin-mediierten Ubiquitylierung sind. Um eine physiologische
Relevanz der beobachteten Effekte zu erhärten, wurde eine mögliche Interaktion von
Parkin und IKKγ bzw. TRAF2 mit Hilfe von Co-Immunpräziptiationsexperimenten
untersucht. Hierfür wurden HEK293T-Zellen transient mit Parkin (fl) und IKKγ oder
TRAF2 transfiziert. Die Zellen wurden mit IP-Puffer lysiert, mittels Zentrifugation
fraktioniert, und der lösliche Überstand wurde einer Immunpräzipitation mit den
polyklonalen Antikörpern α-IKKγ oder α-TRAF2 unterworfen. Die Immunpellets
wurden anschließend mittels Western Blot unter Verwendung des monoklonalen
112
4. Ergebnisse
Anti-Parkin Antikörpers PRK28 analysiert. Die Ergebnisse zeigten, dass sich sowohl
IKKγ als auch TRAF2 in einem Komplex mit Parkin wiederfinden (Abb. 46 A). Um
nun die physiologische Relevanz dieser Interaktion zu bestätigen, wurde eine CoImmunpräzipitation mit endogenen Proteinen durchgeführt. Hiefür wurden
untransfizierte SH-SY5Y-Zellen mit IP-Puffer lysiert und mit dem polyklonalen
Anti-Parkin Antikörper hP1 über Nacht inkubiert. Zur Kontrolle möglicher
unspezifischer Bindungen wurde parallel eine IP mit polyklonalem Anti-HA
Antikörper durchgeführt. Die Immunpellets wurden anschließend mittels Western
Blot unter Verwendung der monoklonalen Antikörper α-IKKγ oder α-TRAF2
analysiert. Auch hier konnte eine eindeutige Interaktion beider Proteine beobachten
werden (Abb. 46 B).
Diese Resultate bestätigten eine direkte oder indirekte Interaktion beider
Proteine mit Parkin.
113
4. Ergebnisse
Abbildung 46. Parkin ist in einem Komplex mit IKKγ und TRAF2 zu finden. (A) HEK293TZellen wurden mit Parkin (fl) und IKKγ oder TRAF2 co-transfiziert. 24 Stunden später wurden die
Zellen geerntet, lysiert und mittels Zentrifugation fraktioniert. Gleiche Proteinmengen des
Überstandes wurden einer Immunpräzipitation mit den polyklonalen Antikörpern α-IKKγ oder αTRAF2 unterzogen. Die Immunpellets wurden mittels Western Blot unter Verwendung des
monklonalen Anti-Parkin Antikörpers PRK28 analysiert. Zur Expressionkontrolle wurden Aliquote
des Überstandes jeweils mit den Antikörpern α-hP1 (polyklonal) und α-IKKγ und TRAF2 (beide
monoklonal) detektiert. (B) Untransfizierte SH-SY5Y-Zellen wurden lysiert, zentrifugiert, und der
Überstand wurde über Nacht mit dem polyklonalen Anti-Parkin Antikörper hP1 oder einem
polyklonalen Anti-HA Antikörper (beide an Protein A-Agarose gekoppelt) inkubiert. Die
Immunpellets wurden mittels Western Blot unter Verwendung der monklonalen Antikörper α-IKKγ
oder α-TRAF2 analysiert. Zur Expressionskontrolle wurden die Proben mittels Immunpräzipitation
und anschießendem Immunblot gegen die entsprechenden Proteine analysiert.
Weiterhin wurde die zelluläre Lokalisierung von Parkin, IKKγ und TRAF2
untersucht. Hierfür wurden jeweils Parkin, IKKγ oder TRAF2 in SH-SY5Y-Zellen
exprimiert und mittels konfokaler Mikroskopie analysiert. Die Proteine zeigten eine
homogene Verteilung im Zytosol (Ergebnis nicht gezeigt). Interessanterweise konnte
bei der Co-Expression von Parkin und IKKγ bzw. TRAF2 eine Akkumulation von
IKKγ und TRAF2 in der perinukleären Region beobachtet werden. In dieser Region
114
4. Ergebnisse
kam es zu einer deutlichen Co-Lokalisierung mit Parkin (Abb. 47, merge)
(konfokalmikroskopische Analysen wurden freundlicherweise von Julia Schlehe
durchgeführt).
Abbildung 47. IKKγ und TRAF2 co-lokalisieren mit Parkin. SH-SY5Y-Zellen wurden mit
Wildtyp (wt)-Parkin und FLAG-IKKγ oder FLAG-TRAF2 co-transfiziert. 24 Stunden später wurden
die Zellen fixiert, permeabilisiert und mit folgenden Antikörpern angefärbt: Polyklonaler Anti-Parkin
Antikörper hP1 (rot) und monoklonaler Anti-FLAG Antikörper (grün). Die Kerne wurden mit DAPI
angefärbt (blau). Die roten Pfeile kennzeichnen die Regionen der Intensitätsprofile (untere
Abbildungen), die mittels Leica Confocal Software bestimmt wurden.
4.2.7
Der Knock-down von Parkin beeinflusst den Stress-induzierten
Zelltod und die Aktivierung der NF-κB-Signaltransduktion
4.2.7.1
Knock-down von endogenem Parkin in Zellkultur
Die bislang durchgeführten Experimente konnten das neuroprotektive Potential von
überexprimiertem Parkin unter Stressbedingungen zeigen. Um in einem nächsten
Schritt die Rolle von endogenem Parkin zu klären, wurde ein Knock-down von
Parkin mittels RNA-Interferenz durchgeführt. Zunächst wurde die Effizienz der
115
4. Ergebnisse
verwendeten siRNA bestimmt. Hierfür wurden HEK293T-Zellen mit Parkinspezifischer siRNA transfiziert. Anschließend wurde der Anteil von Parkinspezifischer mRNA mittels quantitativer Real-Time-PCR bestimmt. Wie Abb. 48 A
zeigt, war die Parkin-mRNA-Menge im Vergleich zur Kontroll-siRNA um ca. 80%
reduziert (RT-PCR-Experimente wurden freundlicherweise von Lena Bouman
durchgeführt). Parallel wurde endogenes Parkin mittels Western Blot unter
Verwendung des monoklonalen Anti-Parkin Antikörpers PRK8 analysiert. Nach
Behandlung der Zellen mit Parkin-siRNA war deutlich weniger Parkin-Protein
detektierbar (Abb. 48 B)
Abbildung 48. Effizienter Knock-down von Parkin mittels RNA-Interferenz. (A) HEK293TZellen wurden mit Parkin-spezifischer siRNA transfiziert. Gesamt-RNA wurde isoliert und Parkinspezifische mRNA Mengen mittels quantitativer RT-PCR bestimmt. Die RNA-Mengen wurden mit
Hilfe der Kontrollgene GAPDH und β-Actin normalisiert. Zu sehen ist die relative Menge an ParkinmRNA. (B) Parallel zu (A) wurde endogenes Parkin-Protein mittels Western Blot unter Verwendung
des monoklonalen Anti-Parkin Antikörpers PRK8 analysiert.
Als nächstes wurde die physiologische Rolle von endogenem Parkin bei der
Neuroprotektion untersucht. Hierfür wurden HEK293T-Zellen mit Parkinspezifischer siRNA transfiziert und 48 Stunden später mit Rotenon (0,05 µM, 3h)
behandelt. Nach weiteren 24 Stunden wurde der Zelltod mit dem Trypan BlauExklusionsassay analysiert. Die Zellpellets wurden in einer Trypan Blau-Lösung
resuspendiert und die blau angefärbten, toten Zellen ausgezählt. Im Vergleich zur
Kontroll-siRNA führte der Knock-down von Parkin zu einem signifikanten Anstieg
des Zelltods nach Rotenon-Behandlung (Abb. 49 A).
In einem zweiten Schritt sollte überprüft werden, ob der Anstieg des Zelltods
mit
Veränderungen
der
NF-κB-Signaltransduktion
116
einhergeht.
Es
wurden
4. Ergebnisse
Luciferase-Reportergenassays
mit
siRNA-behandelten
Zellen
durchgeführt.
HEK293T-Zellen wurden mit dem Plasmid NF-κB-Luc und Parkin-spezifischer
siRNA co-transfiziert und drei Stunden mit PMA (10 und 20 ng/ml) behandelt. Nach
weiteren fünf Stunden wurde die Luciferase-Aktivität luminometrisch bestimmt. Die
Ergebnisse zeigten, dass der Knock-down von Parkin die Stress-induzierte
Aktivierung von NF-κB signifikant beeinträchtigte. In Gegenwart von Parkinspezifischer siRNA konnte NF-κB nicht mehr effizient aktiviert werden (Abb. 49 B).
Abbildung 49. Knock-down von Parkin steigert den Zelltod und beeinträchtigt die Stressinduzierte Aktivierung von NF-κB. (A) HEK293T-Zellen wurden mit Parkin-spezifischer siRNA
transfiziert und 48 Stunden später mit Rotenon (0,05 µM, 3 h) behandelt. Nach weiteren 24 Stunden
wurde der Zelltod mit dem Trypan Blau-Exklusionsassay analysiert. Zu sehen ist der prozentuale
Anteil der toten Zellen. (B) HEK293T-Zellen wurden mit dem Plasmid NF-κB-Luc und Parkinspezifischer siRNA co-transfiziert und für 3 Stunden mit PMA (10 und 20 ng/ml) behandelt. Nach
weiteren 5 Stunden wurde die Luciferase-Aktivität luminometrisch bestimmt. Zu sehen ist die relative
Luciferase-Aktivität.
4.2.7.2
Analyse von PARK2 Patienten-Fibroblasten
Nachdem die Knock-down Experimente eindeutig gezeigt haben, dass Parkin
essentiell
für
die
Neuroprotektion
und
die
Aktivierung
der
NF-κB-
Signaltransduktion ist, sollten die Ergebnisse der Zellkultur-Experimente mit
Patientenmaterial verifiziert werden. Hierfür wurden primäre Hautfibroblasten eines
Patienten mit autosomal rezessiver Parkinson-Erkrankung (PARK2) verwendet
(Patienten- und Kontrollfibroblasten wurden freundlicherweise von Dr. Kazuhiro
Nakaso, Department für Neurologie, Tottori Universität, Japan, zur Verfügung
117
4. Ergebnisse
gestellt). Dieser Patient besitzt zwei verschiedene Deletionen im Parkin-Gen (del
Exon 3-4/del Exon 3-5), so dass kein Parkin-Protein exprimiert wird (Nakaso, K. et
al. 2006). Die PARK2-Patientenfibroblasten wurden mittels EMSA (siehe Punkt
3.8.22)
auf
die
Aktivierung
von
NF-κB
untersucht
(EMSAs
wurden
freundlicherweise von Anita Schlief durchgeführt). Die Ergebnisse zeigten, dass die
Patientenfibroblasten im Gegensatz zu den Kontrollfibroblasten nach verschiedenen
Stressstimuli in der Aktivierung von NF-κB deutlich beeinträchtigt sind. Signifikante
Unterschiede in der Stress-induzierten Aktivierung von NF-κB zeigten sich
insbesondere bei geringen Konzentrationen von PMA (30 min, 0,5-5 ng/mg, Abb. 50
A,
links).
Um
eine
generelle
transkriptionelle
Beeinträchtigung
der
Patienenfibroblasten auszuschließen, wurde die Aktivierung eines weiteren
Transkriptionsfaktors, nämlich von OCT1, in Kernextrakten von unbehandelten und
PMA-behandelten PARK2- und Kontroll-Fibroblasten analysiert. Es konnte kein
Unterschied beobachtet werden (Abb. 50 B).
Abbildung 50. Die Aktivierung von NF-κB ist in Patientenfibroblasten beeinträchtigt. (A)
Fibroblasten von einem PARK2-Patienten oder Kontrollfibroblasten wurden für 30 Minuten mit PMA
inkubiert. Die Kernextrakte wurden mittels EMSA auf die Bindeaktivität von NF-κB untersucht. Die
mittlere Abbildung zeigt den Supershift, hervorgerufen durch Zugabe des polyklonalen Anti-p65
Antikörper zu Kernextrakten von PMA-behandelten Kontroll-Fibroblasten. (B) Zur Kontrolle wurde
die Bindeaktivität von OCT1 in Kernextrakten von unbehandelten und PMA-behandelten PARK2Fibroblasten und Kontroll-Fibroblasten mittels EMSA analysiert.
Die Untersuchungen zeigten, dass die Aktivierung von NF-κB in Fibroblasten
eines Patienten, der kein Parkin exprimiert, deutlich reduziert ist. Damit wurde ein
erster Hinweis erbracht, dass die in dieser Arbeit erzielten Resultate aus dem
Zellkultur-Modell von pathophysiologischer Relevanz sind.
118
4. Ergebnisse
4.2.8
Zusammenfassung Teil 2:
Untersuchungen zur physiologischen Funktion von Parkin
Im Laufe dieser Arbeit wurde eine breite neuroprotektive Wirkung von Parkin
beobachtet. Um Einblicke in den Mechanismus dieses neuroprotektiven Potentials
von Parkin zu erlangen, wurde im zweiten Teil dieser Arbeit eine mögliche Rolle
von Parkin in protektiven Signaltransduktionswegen untersucht. Dabei konnten
folgende neue Einblicke in die physiologische Funktion von Parkin gewonnen
werden:
•
Parkin ist ein Stress-reguliertes Protein
•
Parkin aktiviert die NF-κB-regulierte Transkription
•
Die
Aktivierung
der
NF-κB-Signalkaskade
ist
essentiell
für
die
neuroprotektive Aktivität von Parkin
•
Parkin mediiert die nicht-proteolytische, regulierende Ubiquitylierung von
zwei Komponenten der NF-κB-Signalkaskade: IKKγ und TRAF2
In der zu Beginn durchgeführten Analyse der zytoprotektiven Aktivität von Parkin
gegenüber pathophysiologisch relevanten Stressoren bei der Parkinson-Erkrankung
(Hemmung von Komplex I der mitochondrialen Elektronen-Transportkette,
Exzitotoxizität), konnte neben der neuroprotektiven Kapazität von Parkin auch
dessen Stressinduzierbarkeit beobachtet werden. Es konnte gezeigt werden, dass die
Aktivierung der NF-κB-Signalkaskade essentiell ist für die neuroprotektive Wirkung
von Parkin. Repressoren der NF-κB-Signaltransduktion hemmen das neuroprotektive
Potential von Parkin und der Knock-down von endogenem Parkin führt zu
vermehrtem Zelltod und einer geringeren Aktivierung von NF-κB nach zellulärem
Stress.
Die Studie lieferte Evidenz für die Rolle der E3-Ligase Parkin innerhalb des
NF-κB Signalweges. Parkin vermittelt die nicht-proteolytische, regulierende
Ubiquitylierung von zwei Komponenten der NF-κB-Signalkaskade, IKKγ und
TRAF2. Beide Proteine finden sich in einem Komplex mit Parkin.
Somit konnte zum ersten Mal gezeigt werden, dass die Aktivierung der NF-κBSignaltransduktion essentiell für das neuroprotektive Potential von Parkin ist.
119
5. Diskussion
5. Diskussion
Die Ursachen der sporadischen Parkinson-Erkrankung sind weitgehend unbekannt.
Die Identifizierung mehrerer monogen-erblicher Formen der Parkinson-Erkrankung
revolutionierte die Forschung der letzten Jahre. Die Charakterisierung der dabei
mutierten Genprodukte verspricht neue Einblicke in die Pathomechanismen der
Parkinson-Erkrankung. Beide Formen – die sporadische und familiäre ParkinsonErkrankung – weisen gemeinsame neuropathologische und klinische Charateristika
auf, vor allem den spezifischen Verlust dopaminerger Neuronen.
Mutationen im Parkin-Gen (PARK2) sind verantwortlich für eine autosomal
rezessiv vererbbare Form der Parkinson-Erkrankung. Der Funktionsverlust von
Parkin führt offensichtlich zum dopaminergen Zelltod und somit zur ParkinsonErkrankung. Welche Mechanismen für die Inaktivierung von Parkin verantwortlich
sind und was die physiologische Funktion von Parkin insbesondere in dopaminergen
Neuronen ist, ist weitgehend unbekannt.
Die vorliegende Arbeit beschäftigte sich eingehend mit diesen fundamentalen
Fragen der Parkin-Forschung. Im ersten Teil konnten verschiedene Mechanismen der
Inaktivierung pathogener Parkin-Mutanten identifiziert werden (siehe Punkt 4.1). Im
zweiten Teil konnte gezeigt werden, dass Parkin ein neuroprotektives Potential
besitzt und welcher Mechanismus dieser Wirkung zugrunde liegt (siehe Punkt 4.2).
5.1 Pathogene Mutationen inaktivieren Parkin durch unterschiedliche
Mechanismen
Das Vorhandensein der RING (really interesting new gene)-Konformation (RING1IBR-RING2) legte nahe, dass Parkin eine E3-Ligase-Aktivität besitzt. Verschiedene
Arbeitsgruppen konnten diese Aktivität zeigen (Imai, Y. et al. 2000; Shimura, H. et
al. 2000; Zhang, Y. et al. 2000). Es ist vorstellbar, dass Mutationen, die zu einem
Funktionsverlust von Parkin führen, die katalytische Aktivität von Parkin
beeinträchtigen oder die Interaktion mit Substraten/E2-Ubiquitin-konjugierenden
Enzymen. Da bisher nur putative, jedoch keine authentischen Parkin-Substrate
identifiziert wurden, konnte die Wirkung von Mutationen im Parkin-Gen auf die
120
5. Diskussion
Substratubiquitylierung experimentell nicht untersucht werden. Deshalb wurde zu
Beginn dieser Arbeit eine biochemische Charakterisierung von Parkin und ParkinMutanten in verschiedenen Zellkulturmodellen durchgeführt.
Aus diesem Projekt ging hervor, dass sowohl Missfaltung und Aggregation als
auch
Destabilisierung
und
vermehrte proteasomale
Degradierung
für
die
Inaktivierung verschiedener pathogener N- und C-terminaler Parkin-Mutanten
verantwortlich sind.
5.1.1
Inaktivierung von Parkin durch Missfaltung und Aggregation
In einer vorangegangenen Studie konnte unsere Arbeitsgruppe zeigen, dass Parkin
ein Protein ist, das zu Missfaltung und Aggregation neigt. Massiver oxidativer und
thermischer Stress induziert die Missfaltung von Parkin und inaktiviert dieses somit
(Winklhofer, K. F. et al. 2003). Darüber hinaus wurde beschrieben, dass Parkin nach
proteasomaler Inhibierung in Aggresomen akkumuliert (Ardley, H. C. et al. 2003;
Junn, E. et al. 2002; Muqit, M. M. et al. 2004).
In der vorliegenden Arbeit wurden verschiedene humanpathogene C-terminale
Deletionsmutanten von Parkin im Zellkulturmodell untersucht. Die Ergebnisse
zeigten, dass der Funktionsverlust dieser Mutanten auf eine konstitutive Missfaltung
zurückzuführen ist. Nach transienter Expression in N2a-Zellen waren mehr als 80%
der C-terminalen Deletionsmutanten W453Stop, E409Stop oder Q311Stop in der
Detergenz-unlöslichen Fraktion, wohingegen mehr als 90% von Wildtyp-Parkin in
einer löslichen Konformation vorlag (vgl. Abb. 22). Entsprechend diesem
Löslichkeitsprofil zeigten die C-terminalen Deletionsmutanten ein verändertes
Sedimentationsverhalten. Während Wildtyp-Parkin ausschließlich in den oberen
Fraktionen eines Sucrose-Gradienten detektiert werden konnte, waren die Mutanten
W453Stop und E409Stop nahezu vollständig in der untersten Fraktion lokalisiert
(vgl. Abb. 23). Dies deutete auf die Bildung großer Proteinaggregate hin. Diese
Vermutung konnte in Immunfluoreszenzanalysen bestätigt werden. Die C-terminalen
Deletionsmutanten zeigten eine signifikant veränderte zelluläre Lokalisierung in
Vergleich zu Wildtyp-Parkin und lagen in Form von zytosolischen Aggregaten vor
(vgl. Abb. 24).
121
5. Diskussion
Diese Beobachtungen deuten darauf hin, dass die C-terminale Domäne für die
native Faltung von Parkin von Bedeutung ist. Von besonderem Interesse ist die
W453Stop-Mutante, der lediglich 13 C-terminale Aminosäuren fehlen, wobei die
Deletion nicht in die RING-Box reicht. Deshalb stellte sich die Frage, wie viele Cterminale Aminosäuren deletiert werden können, ohne mit der Faltung von Parkin zu
interferieren. Unsere Arbeitsgruppe konnte zeigen, dass die Deletion von bereits drei
Aminosäuren die Missfaltung von Parkin induziert (Winklhofer, K. F. et al. 2003).
Diese Erkenntnisse lassen vermuten, dass die C-terminale Domäne von Parkin von
Bedeutung
ist
für
intramolekulare
Stabilisierung/Wechselwirkungen
oder
intermolekulare Interaktionen.
Aus der zellbiologischen Charakterisierung der Parkin-Mutanten ging hervor,
dass die C-terminalen Deletionsmutanten nicht mit zellulären Membranen
assoziieren. Anders verhielt es sich für Wildtyp-Parkin, welches nach subzellulärer
Fraktionierung größtenteils in der Membran-Fraktion eines Dichtegradienten
nachweisbar war. Interessanterweise konnten die N-terminal verkürzte ParkinSpezies, der die Ubiquitin-like (UBL)-Domäne fehlt ebenso wie die pathogene
Parkin-Mutante R42P (Mutation innerhalb der UBL) in der gleichen Fraktion wie
Wildtyp-Parkin detektiert werden (vgl. Abb. 25). Die Ergebnisse lassen darauf
schließen, dass die UBL-Domäne keine Rolle für die Assoziation von Parkin mit
zellulären Membranen spielt. Es stellt sich die Frage, ob sich essentielle Strukturen
hierfür in der C-terminalen Region von Parkin befinden und ob die
Membranassoziierung von funktioneller Relevanz ist. Eine Membranassoziation von
Parkin wurde auch in anderen Studien beschrieben. Fallon et al. beschrieben die CoLokalisierung von Parkin mit dem Gerüst-Protein CASK an postsynaptischen
Membranen (Fallon, L. et al. 2002), und Kubo et al. beobachteten eine CoFraktionierung mit dem trans-Golgi-Netzwerk (TGN) und synaptischen Vesikeln
(Kubo, S. I. et al. 2001). Die Identifizierung von putativen Parkin-Substraten wie
CDCrel-1 und Synaptotagmin XI, welche mit synaptischen Vesikeln assoziiert sind
(Huynh, D. P. et al. 2003; Zhang, Y. et al. 2000), lassen eine funktionelle Relevanz
der subzellulären Lokalisierung von Parkin vermuten.
Unsere Ergebnisse zur Missfaltung von Parkin werfen folgende Fragen auf:
Treten Aggregate auch in vivo (im Patienten) auf und haben diese Aggregate
möglicherweise ein toxisches Potential? Bis jetzt gibt es noch keine Daten von
Patienten mit C-terminalen Parkin-Deletionsmutationen. Aus diesem Grund haben
122
5. Diskussion
wir ein transgenes Maus-Modell generiert (Expression von W453Stop), das derzeit
analysiert wird. In initialen Untersuchungen nach Überexpression von W453Stop in
Zellkultur konnte kein erhöhter Zelltod beobachtet werden.
Die vorliegende Zellkulturstudie lieferte experimentelle Evidenz dafür, dass die
Missfaltung von Parkin und seine Sequestrierung in Aggregate eine Ursache für den
Funktionsverlust von Parkin sein können. Neuere Studien konnten zeigen, dass auch
einige Parkin-Punktmutanten wie C289G, C418R und R475W in zellulären
Einschlüssen in der Zelle vorliegen (Ardley, H. C. et al. 2003; Cookson, M. R. et al.
2003; Gu, W. J. et al. 2003; Muqit, M. M. et al. 2004; Sriram, S. R. et al. 2005;
Wong, E. S. et al. 2007). Diese Beobachtungen zeigen, dass Missfaltung und
Aggregation von Parkin nicht auf C-terminale Deletionsmutanten beschränkt ist.
Unsere Arbeiten zeigten, dass nicht nur Mutationen im Parkin-Gen zur
Missfaltung von Parkin führen können, sondern auch massiver Stress (Henn, I. H. et
al. 2005; Winklhofer, K. F. et al. 2003). Da dopaminerge Neuronen in hohem Maße
oxidativem Stress ausgesetzt sind, liegt der Verdacht nahe, dass die Inaktivierung
von Parkin nicht auf familiäre Parkinson-Erkrankungen beschränkt ist, sondern
möglicherweise auch bei der sporadischen Parkinson-Erkrankung eine Rolle spielen
könnte. Eine kürzlich publizierte Arbeit unterstützt dieses Szenario. LaVoie et al.
beobachteten, dass Parkin in kultivierten dopaminergen Neuronen durch DopaminChinon kovalent modifiziert wird (LaVoie, M. J. et al. 2005). Als Folge davon
kommt es zur Missfaltung von Parkin und damit zu einem Verlust der E3-LigaseAktivität. Die Untersuchungen von post mortem-Hirngewebe bestätigten, dass
missgefaltetes Parkin auch in vivo auftritt. Patienten mit sporadischer ParkinsonErkrankung zeigen einen deutlich erhöhten Gehalt an missgefaltetem Parkin im
Striatum. Ebenso kann Parkin durch S-Nitrosylierung inaktiviert werden, und auch
diese Modifizierung konnte im Hirngewebe von Parkinson-Patienten nachgewiesen
werden (Chung, K. K. et al. 2004; Yao, D. et al. 2004).
123
5. Diskussion
5.1.2
Inaktivierung von Parkin durch Destabilisierung und vermehrte
proteasomale Degradierung
Die Mehrheit der Missense-Mutationen findet sich in der C-terminalen RING-Box
von Parkin. In den letzten Jahren konnten aber auch vermehrt Mutationen in der Nterminalen UBL-Domäne von Parkin identifiziert werden (siehe Punkt 1.2.4).
Deshalb stellte sich die interessante Frage, worauf der Funktionsverlust dieser Nterminalen Mutanten beruht.
In der vorliegenden Zellkulturstudie wurde festgestellt, dass N-terminale
Punktmutationen die Stabilität von Parkin beeinflussen. Nach transienter Expression
der N-terminalen Punktmutanten R33Q, R42P, K48A und V56E waren die mutierten
Proteine unter steady-state-Bedingungen, im Gegensatz zu Wildtyp-Parkin kaum
detektierbar
(vgl.
Abb
27).
Pulse/Chase-Experimente
nach
metabolischer
Markierung von Parkin zeigten, dass eine vermehrte Degradierung die Ursache der
reduzierten Proteinmengen ist. Während 24 Stunden nach der Proteinsynthese noch
mehr als 70% von Wildtyp-Volllängen-Parkin detektierbar war, ging die
Proteinmenge von Volllängen-R42P auf 5% zurück (vgl. Abb. 31). Die Stabilität der
kleineren Parkin-Spezies (∆1-79) wurde nicht beeinflusst, da diese die UBLMutationen nicht enthält. In Gegenwart des proteasomalen Inhibitors MG 132 konnte
eine Stabilisierung der Parkin-Mutante R42P beobachtet werden (vgl. Abb. 31 C).
Somit wurde Evidenz für eine erhöhte proteasomale Degradierung der Mutanten
erbracht.
Über die Funktion der UBL-Domäne von Parkin herrscht Unklarheit. Einige
Studien sprechen der UBL eine Rolle bei der Substrat-Erkennung (Shimura, H. et al.
2000) und Regulierung der Parkin-Expression (Finney, N. et al. 2003) zu. Es ist
vorstellbar, dass die UBL-Domäne Protein-Protein-Interaktionen mediiert, welche
einen Einfluss auf die Stabilität von Parkin haben. Diese Vermutung konnte jedoch
durch eine vergleichende Stabilitätsuntersuchung von Volllängen-Parkin und ∆UBLParkin widerlegt werden. Beide Proteine unterscheiden sich nicht bezüglich ihrer
Stabilität (Daten nicht gezeigt).
Alle in dieser Studie analysierten Missense-Mutationen innerhalb der UBL
führten zu einer veringerten Stabilität von Parkin und dessen rascher Degradierung
durch das Proteasom. Eine neuere strukturelle NMR-Analyse der UBL von Parkin
124
5. Diskussion
schlägt die Interaktion der UBL-Domäne mit der Rpn10-Untereinheit des 26SProteasoms vor (Sakata, E. et al. 2003). Dies konnte experimentell allerdings nicht
gezeigt werden. Interaktionen mit dem Proteasom wurden bereits für andere Proteine
mit UBL-Domänen beobachtet (Hiyama, H. et al. 1999; Walters, K. J. et al. 2002).
Interessanterweise
wurde
in
den
NMR-Analysen
beobachtet,
dass
die
Aminosäurepositionen 42 und 48 der UBL von Parkin innerhalb der putativen
Rpn10-Bindedomäne lokalisiert sind (Sakata, E. et al. 2003). Sakata et al. schlossen
daraus, dass die Substitution der ursprünglichen Aminosäuren Arginin-42 oder
Lysin-48
durch
Prolin
(R42P)
oder
Glutaminsäure
(K48E)
zu
einer
Konformationsänderung der UBL von Parkin führt und so die Interaktion mit dem
26S-Proteasom beeinträchtigen könnte. Die vermehrte proteasomale Degradierung
der
mutierten
Parkin-Formen
könnte
die
Folge
einer
möglichen
Konformationsänderung und Missfaltung sein.
5.2
Eine N-terminal verkürzte Parkin-Spezies, der die UBL fehlt,
existiert in vivo
Im Rahmen dieser Arbeit konnte gezeigt werden, dass in vivo zusätzlich zu
Volllängen-Parkin eine kleinere Parkin-Spezies aufgrund der Präsenz eines internen
Initiationscodons an Position 80 der humanen Aminosäure-Sequenz gebildet wird.
Diese kleinere Parkin-Spezies ist gekennzeichnet durch das Fehlen der N-terminalen
UBL-Domäne.
Interessanterweise ist die kleinere Parkin-Spezies auch in humanem Gehirn zu
finden (Schlossmacher, M. G. et al. 2002; Shimura, H. et al. 1999; Staropoli, J. F. et
al. 2003). Schlossmacher et al. diskutierten dabei die Möglichkeit, dass VolllängenParkin proteolytisch prozessiert wird und dadurch seine UBL-Domäne verliert. Dies
scheint jedoch nicht der Fall zu sein, da eine Mutation der putativen Schnittstelle die
Generierung der kleineren Parkin-Spezies nicht verhindert (Schlossmacher, M. G. et
al. 2002). Darüber hinaus wurde eine mögliche Schnittstelle für Caspasen
beschrieben. Nach der Induktion von Apoptose würde Parkin demnach von Caspasen
an der Peptidbindung Asp126-Ser127 geschnitten werden (Kahns, S. et al. 2003;
Kahns, S. et al. 2002). In diesem Zusammenhang muss erwähnt werden, dass eine
Caspase-Aktivität vermutlich nur während der Apoptose auftritt und zur Generierung
125
5. Diskussion
eines 38 kDa-Fragments führen würde. Die durch das zweite Startcodon entstandene
42 kDa Parkin-Spezies ist jedoch unter physiologischen Bedingungen existent.
Wir beobachteten, dass das Vorhandensein des kleineren Parkin-Proteins
spezifisch für humanes Parkin ist. Durch
einen
Parkin-Sequenzvergleich
verschiedener Spezies konnte festgestellt werden, dass sich an Aminosäureposition
80 der humanen Parkin-Sequenz ein Methionin befindet, welches als internes
Initiierungssignal fungieren könnte. Um diese Vermutung zu testen, wurde die
Aminosäure Methionin an Position 80 gegen Leucin oder Threonin (entsprechend
der Sequenz von Maus- bzw. Rattenparkin) ausgetauscht. Nach Expression dieser
Mutanten wurde ausschliesslich Volllängen-Parkin generiert (vgl. Abb. 30). Es
konnte somit gezeigt werden, dass in vivo zusätzlich zu Volllängen-Parkin eine
kleinere Parkin-Spezies gebildet wird aufgrund des Vorhandenseins eines internen
Initiationscodons an Position 80.
Welche Rolle könnte diese verkürzte Parkin-Spezies unter physiologischen
Bedingungen spielen?
Um die E3-Ubiquitin-Ligase-Aktivität dieser Parkin-Spezies zu untersuchen,
wurde ein Ubiquitylierungsassays mit zellulären Lysat durchgeführt. Da bisher kein
authentisches Substrat beschrieben wurde, wurde die Gesamtheit an ubiquitylierten
Proteinen analysiert. Diese Versuche zeigten, dass die kleinere Parkin-Spezies (∆179) in ihrer Ligasesaktivität signifikant beeinträchtigt ist. Im Gegensatz zu WildtypParkin ist bei ∆1-79-exprimierenden Zellen die Menge an ubiquitylierten Proteinen
wesentlich geringer (vgl. Abb. 32). Für einige putative Substrate konnte ebenfalls
gezeigt werden, dass ein Fehlen der UBL die Parkin-mediierte Ubiquitylierung
beeinträchtigt (Corti, O. et al. 2003; Huynh, D. P. et al. 2003).
Der Einfluss der UBL-Deletion auf die neuroprotektive Wirkung von Parkin
wurde mit Hilfe von Apoptose-Assays untersucht. Dabei konnte für die Mutante ∆179 nach der Stressbehandlung mit Kainat (Exzitotoxizität) ein um ca. 50%
reduziertes neuroprotektives Potenial im Vergleich zu Wildtyp-Parkin beobachtet
werden (vgl. Abb. 33). In Einklang mit unseren Beobachtungen konnte eine neuere
Studie bestätigen, dass die Deletion der UBL den neuroprotektiven Effekt von Parkin
gegenüber Ceramid-induziertem Zelltod aufhebt (Darios, F. et al. 2003).
126
5. Diskussion
Die bisherigen Ergebnisse haben demonstriert, dass die kleinere Parkin-Spezies
ebenso wie Volllängen-Parkin an Membranen binden kann (vgl. Abb. 25) und sich
beide Spezies in einem hochmolekularen Komplex finden (Winklhofer, K. F. et al.
2003). Somit stellt sich die Frage: Besitzt die die N-terminal verkürzte ParkinSpezies physiologische Relevanz und kann sie womöglich einen Effekt auf
Volllängen-Parkin ausüben? Es besteht die Möglichkeit, dass die kleinere Spezies
keine physiologische Rolle spielt und lediglich als „Beiprodukt“ generiert wird. Es
ist aber auch vorstellbar, dass die kleinere Parkin-Spezies einen regulierenden
Einfluss auf Parkin ausübt entweder direkt als Komplexbestandteil oder indirekt über
seine Genexpression (unterschiedliches Verhältnis der beiden Spezies). Ein
dominant-negativer Effekt auf Volllängen-Parkin ist eher unwahrscheinlich, da nach
heterologer Expression zum Teil 50% ∆UBL-Parkin und 50% Volllängen-Parkin
vorliegen. Zusätzliche Zellkultur-Analysen zeigten keinen Hinweis auf einen
dominant-negativen Effekt (Daten nicht gezeigt).
Es bleibt allerdings hervorzuheben, dass die kleinere Parkin-Spezies funktionell
weniger aktiv ist und ∆UBL-Parkin mit hoher Wahrscheinlichkeit eine „pathogene
Mutante“ darstellt. Eine Mutation im authentischen Startcodon von Parkin konnte
kürzlich identifiziert werden (Mata, I. F. et al. 2004; Rawal, N. et al. 2003) und lässt
die Generierung von N-terminal verkürztem Parkin vermuten. Die Spezifität des
internen Startcodons in der humanen Parkin-Sequenz führt dazu, dass in neuronalen
Zellen zwei Parkin-Spezies mit unterschiedlicher funktioneller Aktivität coexistieren. Dies könnte erklären, warum der Mensch besonders anfällig gegenüber
einer Inaktivierung von Parkin ist.
Der erste Teil dieser Arbeit lieferte experimentelle Evidenz dafür, dass
verschiedene
humanpathogene
Mutationen
Parkin
durch
Missfaltung
und
Aggregation oder Destabilisierung inaktivieren. Aus den vorliegenden Daten wird
ersichtlich, dass pathogene Mutationen die Funktion von Parkin durch verschiedene
Mechanismen beeinflussen, wodurch die variablen Phänotypen bei Patienten mit
autosomal-rezessiver Parkinson-Erkrankung erklärt werden könnten. Es bleibt zu
klären, ob die in Zellkultur beobachteten biochemischen Charkteristika auch bei
Parkinson-Patienten auftreten, welche die entsprechenden Mutationen tragen.
127
5. Diskussion
5.3 Parkin schützt neuronale Zellen vor Stress-induziertem Zelltod
Im zweiten Teil dieser Arbeit wurde die physiologische Funktion von Parkin
analysiert. Hierbei konnte gezeigt werden, dass Parkin eine protektive Wirkung
gegenüber verschiedenen Stressoren zeigt. Darüber hinaus lieferte diese Arbei eine
mechanistische Erklärung für die protektive Wirkung von Parkin. Es konnte
erstmalig gezeigt werden, dass die Aktivierung der NF-κB-Signaltransduktion
essentiell ist für das neuroprotektive Potential von Parkin.
5.3.1
Parkin ist ein stress-induzierbares Protein mit neuroprotektiver
Aktivität
Wir und andere Arbeitsgruppen konnten zeigen, dass Parkin Zellen vor Stressinduziertem Zelltod schützen kann. Da Parkin durch massiven Stress infolge von
Missfaltung inaktiviert wird (LaVoie, M. J. et al. 2005; Wang, C. et al. 2005;
Winklhofer, K. F. et al. 2003, Chung, 2004 #1056; Yao, D. et al. 2004), wurden in
der
vorliegenden
Studie
moderate
Stressbedingungen
gewählt,
die
unter
physiologischen Bedingungen auftreten. Zunächst konnte die neuroprotektive
Aktivität von Parkin gegenüber zwei Parkinson-relevanten Stressoren festgestellt
werden, nämlich der Hemmung von Komplex I der mitochondrialen Atmungskette
und Exzitotoxizität (siehe Punkt 4.2.1). Die Hemmung von Komplex I wurde in
unserem
Zellkultur-Modell
induziert
durch
Rotenon-Behandlung,
während
Exzitotoxizität durch Kainat-Behandlung ausgelöst wurde. In Gegenwart von
Wildtyp-Parkin
ging
der
prozentuale
Anteil
apoptotischer
Zellen
nach
Stressinduktion nahezu auf das Ausgangsniveau zurück. Im Vergleich dazu zeigten
die pathogenen Mutanten R42P, G430D und ∆N-Parkin nach der Stressbehandlung
ein um ca. 50% reduziertes neuroprotektives Potential (vgl. Abb. 33).
Um weitere Hinweise für eine mögliche Rolle von Parkin in der zellulären
Stressbewältigung zu erlangen, wurde die Transkription von endogenem Parkin unter
Stressbedingungen mittels Real-Time-PCR untersucht. Die Ergebnisse zeigten, dass
oxidativer Stress und Exzitotoxizität die Menge an Parkin-spezifischer mRNA
sowohl in kultivierten Neuroblastomzellen als auch in primären Neuronen signifikant
erhöhen. In Einklang mit der erhöhten Menge an Parkin-spezifischen Transkripten
128
5. Diskussion
konnte eine gesteigerte Expression des Parkin-Proteins festgestellt werden (vgl. Abb.
34). Die dargestellten Ergebnisse werden durch eine kürzlich publizierte Studie
unterstützt, welche eine Aktivierung des Parkin-Promotors nach Behandlung mit
Wasserstoffperoxid in einem Luciferase-Reporterassay beschreibt (Tan, E. K. et al.
2005). Diese Untersuchungen lieferten Evidenz dafür, dass Parkin ein stressinduzierbares Protein mit neuroprotektiver Aktivität ist.
5.3.2
Die Aktivierung der NF-κB-Signaltransduktion ist essentiell für
die neuroprotektive Aktivität von Parkin
Das erstaunlich breite zytoprotektive Potential von Parkin legte die Vermutung nahe,
dass Parkin essentielle protektive Signalwege beeinflussen kann. Eine Analyse
verschiedener Stress-induzierter Signaltransduktionswege konnte zeigen, dass Parkin
die NF-κB-mediierte Transkription aktivieren kann (siehe Punkt 4.2.3). Die im
Verlauf dieser Arbeit erzielten Ergebnisse lieferten Beweise dafür, dass die
Aktivierung der NF-κB-Signalkaskade essentiell ist für die neuroprotektive Aktivität
von Parkin.
Zunächst konnte ein Kausalzusammenhang zwischen der neuroprotektiven
Aktivität von Parkin und der Fähigkeit, NF-κB zu aktivieren, festgestellt werden.
Neuroprotektion und NF-κB-Aktivierung waren bei pathogenen Parkin-Mutanten
signifikant beeinträchtigt (siehe Punkt 4.2.1 und 4.2.4.1, Abb. 33 und 38). In diesem
Zusammenhang ist es wichtig zu erwähnen, dass pathogene Parkin-Mutationen
keinen kompletten Funktionsverlust zeigen, zumindest nicht nach Überexpression in
Zellkultur. Die feinen Aktivitätsunterschiede von Parkin können aber im Laufe von
Jahrzehnten durchaus pathophysiologisch relevant werden, besonders unter dem
Aspekt, dass im Alter zellulärer Stress zunimmt.
Ferner konnte gezeigt werden, dass eine Blockierung des NF-κB-Signalweges
zum Verlust der neuroprotektiven Aktivität von Parkin führt (siehe Punkt 4.2.4.2). In
Gegenwart des NF-κB-Superrepressors IκB∆N oder der Kinase-inaktiven IKKβMutante IKKβ K/A zeigte Parkin keine anti-apoptotischen Effekte unter
Stressbedingungen, vielmehr konnte ein signifikanter Anstieg des Zelltodes
beobachtet werden (vgl. Abb. 42).
129
5. Diskussion
Schließlich lieferten Knock-down-Analysen von Parkin weitere entscheidende
Beweise dafür, dass Parkin essentiell für die Neuroprotektion und die Aktivierung
der NF-κB-Signalkaskade ist. So zeigten Zellen, die mit Parkin-spezifischer siRNA
behandelt wurden, nach Stressbehandlung einen deutlichen Anstieg an Zelltod und
gleichzeitig eine reduzierte Aktivierung der NF-κB-Signaltransduktion (vgl. Abb.
49). Interessant ist hierbei, dass die kleinere Parkin-Spezies (siehe Punkt 4.1.2.2),
welche auch in humanem Gehirn auftritt, in ihrer Fähigkeit, NF-κB zu aktivieren
signifikant beeinträchtigt ist. Demzufolge zeigte sie auch ein vermindertes
neuroprotektives Potential (siehe Diskussion, Punkt 5.2).
Die dargestellten Ergebnisse zeigten erstmalig, dass die Aktivierung der NFκB-Signaltransduktion essentiell für das neuroprotektive Potential von Parkin ist. Es
stellte sich nun die Frage, auf welche Weise Parkin den NF-κB-Signalweg aktiviert
bzw. welche Rolle die E3-Ligase-Aktivität von Parkin spielt.
5.3.3
Parkin mediiert die regulierende Ubiquitylierung von zwei
Komponenten der NF-κB-Signaltransduktion: IKKγ und TRAF2
Die Forschung der letzten Jahre konnte zeigen, dass Ubiquitin ein sehr vielseitiges
Protein ist. Neben der konventionellen Ubiquitylierung, welche Proteine für den
proteasomalen Abbau markiert, spielt die regulierende Ubiquitylierung eine Rolle bei
zahlreichen zellulären Funktionen, einschließlich Endozytose, DNA-Reparatur und
zelluläre Signaltransduktion. Zudem kann eine beträchtliche Variabilität in der Art
der
Ubiquitylierung
festgestellt
werden.
So
werden
Mono-,
Multi
und
verschiedene
Arten
der
Polyubiquitylierungen beobachtet (siehe Punkt 1.2.3.1.1).
Der
NF-κB-Signalweg
ist
beispielhaft
für
Ubiquitinverknüpfung, die Degradierungs-abhängige und -unabhängige Funktionen
mediieren. Eine konventionelle Art der Ubiquitylierung im NF-κB-Signalweg stellt
die Markierung von IκB für die proteasomale Degradierung ebenso wie die
Induktion der proteasomalen Prozessierung der Vorläuferproteine p105 und p100
dar.
Eine
unkonventionelle,
Degradierungs-unabhängige
Anknüpfung
einer
Polyubiquitinkette ist essentiell für die Aktivierung des IκB-Kinase (IKK)Komplexes und erfordert die Ubiquitylierung von TRAF2 (TNF receptor-accociated
130
5. Diskussion
factor), TRAF6, RIP (receptor-interacting protein) und IKKγ/NEMO (NF-κB
essential modifier) (Chen, Z. J. 2005; Krappmann, D. und C. Scheidereit 2005).
Um eine mögliche Rolle der E3-Ubiquitin-Ligase Parkin im NF-κB-Signalweg
zu klären, wurde analysiert, ob Parkin die Ubiquitylierung von Komponenten der
Signalkaskade mediieren kann. Es zeigte sich, dass transdominante Repressoren des
NF-κB-Signalweges (IKKβ K/A, IκB∆N) mit der Parkin-mediierten Aktivierung der
NF-κB-regulierten Transkription interferieren (siehe Punkt 4.2.4.2). Dies ließ
vermuten, dass Parkin aktivierend auf den NF-κB-Signalwege auf oder oberhalb der
Ebene des IKK-Signalosoms wirkt. In der Tat wurde in einer vergleichenden
Analyse der Ubiquitylierung der Signalkomponenten TRAF2, TRAF6 und IKKγ die
Parkin-mediierte Ubiquitylierung von TRAF2 und IKKγ beobachtet. Im Gegensatz
zu Wildtyp-Parkin waren die pathogenen Mutanten ∆UBL und R42P in dieser
Fähigkeit signifikant beeinträchtigt (vgl. Abb. 44). Diese Mutanten sind
charakterisiert durch eine geringere Aktivierung der NF-κB-regulierten Transkription
sowie ein veringertes neuroprotektives Potential (siehe Punkt 4.2.1 und 4.2.3).
Mit Hilfe von Ubiquitin-Mutanten, welche die Verknüpfung der Ubiquitinkette
lediglich über Lysin-48 (K48only) oder Lysin-63 (K63only) erlauben, konnte die
Parkin-mediierte nicht-proteolytische, regulierende Ubiquitylierung von IKKγ über
Lysin-63 identifiziert werden (siehe Punkt 4.2.5.2). Während nach Expression von
K48only-Ubiquitin die Parkin-mediierte Ubiquitylierung von IKKγ deutlich
verringert war, konnte Parkin in Gegenwart von K63only-Ubiquitin die
Ubiquitylierung
von
IKKγ
weiterhin
vermitteln
(vgl.
Abb.
45).
Stabilitätsuntersuchungen von IKKγ bzw. TRAF2 in Gegenwart von Parkin
bestätigten, dass Parkin keine degradierende, sondern eine unkonventionelle,
regulierende Ubiquitylierung vermittelt.
Zum jetzigen Zeitpunkt ist jedoch nicht klar, ob Parkin die Ubiquitylierung von
IKKγ und TRAF2 direkt oder indirekt induziert. Co-ImmunpräzipitationsExperimente haben gezeigt, dass Parkin mit IKKγ und TRAF2 interagieren kann
(vgl. Abb. 46) und legen den Verdacht nahe, dass sich diese Proteine zu einem
Komplex assemblieren können. Unsere Untersuchungen konnten ausschließen, dass
die erhöhte Ubiquitylierung von IKKγ und TRAF2 in Gegenwart von Parkin durch
die intrinsische E3-Ligase-Aktivität von TRAF2 vermittelt wird. In Gegenwart von
131
5. Diskussion
Parkin wurde auch eine erhöhte Ubiquitylierungsrate von TRAF2∆N beobachtet
(vgl. Abb. 44), einer Mutante der die funktionelle N-terminale RING-Domäne fehlt.
Interessanterweise wurde kürzlich in vitro die Interaktion von Parkin mit dem E2Heterodimer Ubc13/Uev1a beschrieben (Doss-Pepe, E. W. et al. 2005; Matsuda, N.
et al. 2006), welches der essentielle E2-Komplex für die TRAF2- und TRAF6mediierte NF-κB-Aktivierung ist und die Polyubiquitylierung über Lysin-63
induziert (Andersen, P. L. et al. 2005; Deng, L. et al. 2000). Es bleibt in weiteren
Analysen - vor allem in-vivo-Analysen - zu klären, ob Ubc13/Uev1a ein möglicher
E2-Interaktionspartner von Parkin ist und dessen regulierende Ubiquitylierung von
NF-κB-Signalkomponenten katalysiert. Es stellt sich ferner die Frage, wie die
Parkin-vermittelte Ubiquitylierung (Lysin-48 oder Lysin-63) reguliert ist.
5.3.4
Die Rolle von Parkin in dopaminergen Neuronen - Implikationen
für die Parkinson-Erkrankung
In der vorliegenden Arbeit konnten neue Einblicke in die physiologische Funktion
von Parkin gewonnen werden, welche das breite neuroprotektive Potential von
Parkin erklären können.
Welche Rolle könnte Parkin speziell in dopaminergen Neuronen spielen? Die
mögliche in vivo-Situation lässt sich mit Hilfe des nachfolgend abgebildeten Modells
veranschaulichen (Abb. 51). Unter physiologischen Bedingungen kann moderater
Stress zu einer Aktivierung von Parkin und dessen transkriptioneller HochRegulierung führen. Der Mechanismus der Parkin-Aktivierung ist noch unbekannt,
doch ist es vorstellbar, dass posttranslationale Modifikationen eine unmittelbare und
schnelle Aktivierung bewerkstelligen könnten. Die Aktivierung des IKK-Komplexes
erfolgt durch erhöhte regulierende Ubiquitylierung von TRAF2 und IKKγ in
Gegenwart von aktivem Parkin. Folge ist die Aktivierung der nachfolgenden
Signalkaskade, die zur vermehrten Expression von anti-apoptotischen Genen führt.
Die vorliegende Studie konnte ferner zeigen, dass Parkin Zellen für bestimmte
Stimuli sensibilisieren kann, d.h. es kann unter moderaten Stressbedingungen den
Schwellenwert für die Aktivierung der NF-κB-Signalkaskade senken und so eine
supra-additive Stressantwort induzieren (siehe Punkt 4.2.3, Abb. 37). In Falle der
Parkinson-Erkrankung stellt sich eine andere Situation dar. Inaktivierende Parkin132
5. Diskussion
Mutationen und massiver Stress verursachen den Funktionsverlust von Parkin und
bedingen eine ineffiziente Aktivierung die neuroprotektiven NF-κB-Signalkaskade.
So ist es denkbar, dass die Inaktivierung von Parkin durch massiven Stress auch bei
der sporadischen Parkinson-Erkrankung eine Rolle spielen kann.
Abbildung 51. Modell der funktionellen Rolle von Parkin. Physiologische Bedingungen: Parkin
mediiert die regulierende Ubiquitylierung von TRAF2 und IKKγ nach einem moderaten
Stressstimulus und induziert so die Aktivierung von NF-κB. Als Folge kommt es zu einer HochRegulierung von anti-apoptotischen Genen. Für eine unmittelbare und schnelle Stressantwort ist es
vorstellbar, dass die Aktivität von Parkin durch posttranslationale Modifikationen reguliert wird.
Parkinson-Erkrankung: Inaktivierende Parkin-Mutationen und massiver Stress verursachen den
Funktionsverlust von Parkin und bedingen eine ineffiziente Aktivierung der neuroprotektiven NF-κBSignalkaskade.
133
5. Diskussion
Warum aber sind dopaminerge Neuronen besonders vulnerabel? Dopaminerge
Neuronen in der SNpc sind bereits unter physiologischen Bedingungen erhöhtem
Stress ausgesetzt. Neben oxidativem Stress durch den Metabolismus von Dopamin,
kommt es auch zu vermehrter Exzitotoxizität durch glutamaterge Neurotransmission
und ATP-Mangel. Ferner sind diese Neuronen charakterisiert durch ein geringeres
Expressionsniveau von Parkin.
Aufgrund der Beobachtung, dass Parkin ein stress-reguliertes Protein ist, stellte
sich die Frage, ob Parkin selbst durch NF-κB reguliert wird. In einer Analyse der
Sequenz der Promotorregion konnte wir zwar zahlreiche Stress-abhängige
Bindeelemente lokalisieren, aber keines für NF-κB. Wie aber ist die Aktivität von
Parkin reguliert? In dem hier verwendeten zellulären Modellsystem ist bereits die
Überexpression von Parkin ausreichend, um die NF-κB-Signalkaskade effizient zu
aktivieren (siehe Punkt 4.2.3). Unter physiologischen Bedingungen erscheint aber
eine regulierte E3-Ligase-Aktivität von Parkin plausibler als eine konstitutive.
Interessanterweise konnte in einer früheren Studie gezeigt werden, dass der
Phosphorylierungsstatus von Parkin Einfluss auf dessen Aktivität hat (Yamamoto, A.
et al. 2005). In wieweit diese oder noch unbekannte posttranslationale
Modifikationen oder Interaktionen die Funktion von Parkin regulieren können,
müssen zukünftige Untersuchungen klären.
Welche Implikationen ergeben sich aus der vorliegenden Arbeit für die
Parkinson-Erkrankung? Die Aufklärung der pathogenen Mechanismen und die
Entwicklung
effektiver
Therapiemöglichkeiten
stellen
die
größten
Herausforderungen in der Parkinsonforschung dar. Die vorliegende Studie schafft
einen Zusammenhang zwischen der Funktion von Parkin und der NF-κBSignaltransduktion, und deutet somit darauf hin, dass eine Fehlregulierung dieses
neuroprotektiven Signalweges eine pathophysiologische Rolle bei der ParkinsonErkrankung spielt. Dafür spricht auch eine kürzlich publizierte TranskriptomAnalyse von post mortem-Gehirn von Parkinson-Patienten (Moran, L. B. et al.
2007). Pathogene Parkin-Mutanten sind in der Fähigkeit, die neuroprotektive NF-κBSignaltransduktion zu aktivieren, signifikant beinträchtigt. Die in dieser Arbeit
dargestellten Ergebnisse ermöglichen neue Einblicke in die physiologische Funktion
von Parkin und könnten den Weg für neue pharmakologische Ansätze ebnen.
134
5. Diskussion
Besonders die Analyse möglicher Cross-Talks zu anderen Signaltransduktionswegen
verspricht die Entwicklung innovativer therapeutischer Strategien.
135
6. Zusammenfassung
6. Zusammenfassung
Mutationen im Parkin-Gen sind verantwortlich für eine autosomal rezessiv
vererbbare Form der Parkinson-Erkrankung. Der Funktionsverlust von Parkin spielt
eine zentrale Rolle bei der Pathogenese. Zu Beginn der vorliegenden Arbeit war
lediglich bekannt, dass Parkin eine E3-Ubiquitin-Ligase-Aktivität besitzt und dass
ein Funktionsverlust von Parkin offensichtlich zur Parkinson-Erkrankung führen
kann.
In der vorliegenden Doktorarbeit wurden zwei fundamentale Themenbereiche
der Parkin-Forschung bearbeitet:
1. Die Analyse der Mechanismen der Inaktivierung von pathogenen ParkinMutanten.
2. Untersuchungen zur physiologischen Funktion von Parkin.
Im ersten Teil dieser Arbeit konnten verschiedene Mechanismen der ParkinInaktivierung aufgeklärt werden, welche den Funktionsverlust von Parkin erklären.
Pathogene C-terminale Deletionsmutationen (W453Stop, E409Stop und Q311Stop)
führten zur Missfaltung und Aggregation von Parkin. Im Gegensatz zu WildtypParkin nahmen diese Mutanten spontan eine missgefaltete Konformation an und
lagen in Form von zytosolischen Aggregaten vor. Pathogene Punktmutationen in der
N-terminalen Ubiquitin-like (UBL)-Domäne (R33Q, R42P, K48A und V56E)
verringerten die Stabilität von Parkin. Diese Mutanten wurden rasch über das
Proteasom abgebaut. Im Rahmen dieser Untersuchungen konnte ferner gezeigt
werden, dass in vivo zusätzlich zu Volllängen-Parkin eine kleinere Parkin-Spezies
entsteht. Diese kleinere Parkin-Spezies ist gekennzeichnet durch das Fehlen der Nterminalen UBL-Domäne und wird aufgrund des Vorhandenseins eines internen
Startcodons an Position 80 der humanen Parkin-Sequenz gebildet.
Der zweite Teil der Arbeit konzentrierte sich auf die physiologische Funktion
von Parkin. In Zellkultur-Modellen konnte festgestellt werden, dass Parkin nach
Stressbehandlung hochreguliert wird und vor Stress-induziertem Zelltod schützt. Die
Analyse von protektiven Signaltransduktionswegen konnte erstmalig zeigen, dass die
Parkin-mediierte Aktivierung der NF-κB-Signaltransduktion essentiell ist für das
neuroprotektive Potential von Parkin. In Gegenwart von spezifischen Repressoren
136
6. Zusammenfassung
der NF-κB-Signalkaskade verlor Parkin seine protektive Wirkung in Stressbehandelten Zellen. Die vorliegende Arbeit lieferte Evidenz dafür, dass die E3Ubiquitin-Ligase
Parkin
die
NF-κB-Signalkaskade
durch
eine
vermehrte
regulierende Ubiquitylierung der zwei Signalmoleküle, IKKγ und TRAF2 aktiviert.
Die in dieser Doktorarbeit dargestellten Ergebnisse ermöglichen Einblicke in
die physiologische Funktion von Parkin sowie die Mechanismen, die zum
Funktionsverlust von Parkin führen. Darüber hinaus können diese neuen
Erkenntnisse einen Beitrag leisten zum besseren Verständnis pathogener
Mechanismen der Parkinson-Erkrankung.
137
7. Glossar
7.Glossar
Abb.
Abbildung
APS
Ammoniumperoxodisulfat
AS
Aminosäure
ATP
Adenosintriphosphat
bp
Basenpaare
BSA
Rinderserumalbumin (bovine serum albumin)
Ci
Curie
COMT
Catechol-O-Methyltransferase
Da
Dalton
DAPI
4', 6-Diamidino-2- phenylindoldihydrochlorid
dATP
Deoxyadenosintriphosphat
dCTP
Deoxycytosintriphosphat
dGTP
Deoxyguanosintriphosphat
dNTP
Deoxynukleotidtriphosphat
DMEM
Dulbecco’s Modified Eagle’s Medium
DMSO
Dimethylsufoxid
DNA
Desoxyribonukleinsäure
ds
Doppelstrang
DOC
Desoxycholat
DTT
Dithiothreitol
ECL
Enhances Chemiluminescence
E.coli
Escherichia coli
EDTA
Ethylendiamintetraessigsäure
EMSA
Electrophoretic Mobility Shift Assay
ER
Endoplasmatisches Retikulum
FCS
Fötales Kälberserum (fetal calf serum)
GS
Ziegenserum (goat serum)
hP
humanes Parkin
HRP
Meerrettich-Peroxidase (horseradish peroxidase)
HS
Pferdeserum (horse serum)
138
7. Glossar
HSF
Hitzeschock-Transkriptionsfaktor
Hsp
Hitzeschockprotein
IBR
In-between RING
IF
Immunfluoreszenz
IKK
IκB-Kinase
IP
Immunpräzipitation
JNK
c-Jun N-terminale Kinase
kb
Kilobasenpaare
kDa
103 Dalton, Molekulargewicht von Proteinen
LB
Lewy-Körper (lewy body)
MAO
Monoaminoxidase
MEM
Minimum Essential Medium
MG132
Carboxybenzoyl-L-Leucyl-L-Leucyl-L-Leucinal
NEM
N-Ethyl-Maleimid
NEMO
NF-κB essential modifier
NF-κB
Nukleärer Faktor -κB
NMR
Kernresonanzspektroskopie
ODx
optische Dichte bei λ = x nm
ORF
offener Leserahmen (open reading frame)
PAGE
Polyacrylamid-Gelelektrophorese
PBS
Phosphat gepufferte physiologische Kochsalzlösung
(phosphate buffered saline)
PCR
Polymerase Kettenreaktion (polymerase chain reaction)
PET
Positron-Emissions-Tomographie
pH
negativer dekadischer Logarithmus der H3O+Ionenkonzentration
PMA
Phorbol 12-Myristat 13-Acetat
Ponceau S
3-Hydroxy-4-[2-sulfo-4-(4-sulfophenylazo)-phenylazo]2,7-naphthalendisulfonsäure
RING
Really intersting new gene
RIP
Receptor interacting protein
RNA
Ribonukleinsäure
ROS
reaktive Sauerstoffspezies (reactive oxygen species)
139
7. Glossar
rpm
Umdrehungen pro Minute (rounds per minute)
RT
Raumtemperatur
SAP
Alkalische Phosphatase (shrimp alkaline phosphatase)
Sarkosyl
N-Lauroylsarkosin
SDS
Natriumdodecylsulfat (sodium dodecylsulfate)
SNpc
Substantia nigra pars compacta
SOD
Superoxiddismutase
siRNA
short interfering RNA
Tab.
Tabelle
TEMED
N,N,N’,N’-Tetramethylethylendiamin
TAE
Tris-Acetat-EDTA
TCA
Trichloressigsäure
TE
Tris-EDTA
TNFα
Tumor-Nekrosefaktor α
TRAF
TNF receptor-associated factor
Tris
Tris-(hydroxymethyl)-aminomethan
Triton X-100
t-Octyl-Phenoxy-Polyethoxyethanol
Tween 20
Polyoxyethylen-Sorbitan-Monolaurat
U
Enzymaktivität, Umsetzung von 1 µmol Substanz/min,
1U = 1,667 * 10-8 Kat
UBL
ubiquitin-like
UPR
Unfolded Protein Response
UPS
Ubiquitin-Proteasom-System
wt
Wildtyp
Aminosäuren wurden nach dem Einbuchstaben-Code bezeichnet. Gewichts- und
andere
Einheiten
wurden
nach
dem
140
internationalen
SI-System
benannt.
8. Literaturverzeichnis
8. Literaturverzeichnis
Abeliovich, A., Y. Schmitz, et al. (2000). "Mice lacking alpha-synuclein display
functional deficits in the nigrostriatal dopamine system." Neuron 25: 239-52.
Ananthan, J., A. L. Goldberg, et al. (1986). "Abnormal proteins serve as eukaryotic
stress signals and trigger the activation of heat shock genes." Science 232: 522-4.
Andersen, P. L., H. Zhou, et al. (2005). "Distinct regulation of Ubc13 functions by
the two ubiquitin-conjugating enzyme variants Mms2 and Uev1A." J Cell Biol 170:
745-55.
Ardley, H. C., G. B. Scott, et al. (2003). "Inhibition of proteasomal activity causes
inclusion formation in neuronal and non-neuronal cells overexpressing Parkin." Mol
Biol Cell 14: 4541-56.
Arendt, C. S. und M. Hochstrasser. (1997). "Identification of the yeast 20S
proteasome catalytic centers and subunit interactions required for active-site
formation." Proc Natl Acad Sci U S A 94: 7156-61.
Arenzana-Seisdedos, F., J. Thompson, et al. (1995). "Inducible nuclear expression of
newly synthesized I kappa B alpha negatively regulates DNA-binding and
transcriptional activities of NF-kappa B." Mol Cell Biol 15: 2689-96.
Arenzana-Seisdedos, F., P. Turpin, et al. (1997). "Nuclear localization of I kappa B
alpha promotes active transport of NF-kappa B from the nucleus to the cytoplasm." J
Cell Sci 110 ( Pt 3): 369-78.
Baba, M., S. Nakajo, et al. (1998). "Aggregation of alpha-synuclein in Lewy bodies
of sporadic Parkinson's disease and dementia with Lewy bodies." Am J Pathol 152:
879-84.
Baeuerle, P. A. und T. Henkel. (1994). "Function and activation of NF-kappa B in
the immune system." Annu Rev Immunol 12: 141-79.
Baldwin, A. S., Jr. (1996). "The NF-kappa B and I kappa B proteins: new discoveries
and insights." Annu Rev Immunol 14: 649-83.
Bandopadhyay, R., A. E. Kingsbury, et al. (2004). "The expression of DJ-1 (PARK7)
in normal human CNS and idiopathic Parkinson's disease." Brain 127: 420-30.
Barnes, P. J. und M. Karin. (1997). "Nuclear factor-kappaB: a pivotal transcription
factor in chronic inflammatory diseases." N Engl J Med 336: 1066-71.
141
8. Literaturverzeichnis
Baumeister, W., J. Walz, et al. (1998). "The proteasome: paradigm of a selfcompartmentalizing protease." Cell 92: 367-80.
Beilina, A., M. Van Der Brug, et al. (2005). "Mutations in PTEN-induced putative
kinase 1 associated with recessive parkinsonism have differential effects on protein
stability." Proc Natl Acad Sci U S A 102: 5703-8.
Bence, N. F., R. M. Sampat, et al. (2001). "Impairment of the ubiquitin-proteasome
system by protein aggregation." Science 292: 1552-5.
Bloem, B. R., I. Irwin, et al. (1990). "The MPTP model: versatile contributions to the
treatment of idiopathic Parkinson's disease." J Neurol Sci 97: 273-93.
Bonifati, V., B. A. Oostra, et al. (2004). "Linking DJ-1 to neurodegeneration offers
novel insights for understanding the pathogenesis of Parkinson's disease." J Mol Med
82: 163-74. Epub 2004 Jan 08.
Bonifati, V., P. Rizzu, et al. (2003). "Mutations in the DJ-1 gene associated with
autosomal recessive early-onset parkinsonism." Science 299: 256-9.
Braun, B. C., M. Glickman, et al. (1999). "The base of the proteasome regulatory
particle exhibits chaperone-like activity." Nat Cell Biol 1: 221-6.
Casarejos, M. J., J. Menendez, et al. (2006). "Susceptibility to rotenone is increased
in neurons from parkin null mice and is reduced by minocycline." J Neurochem 97:
934-46.
Chen, L. F. und W. C. Greene. (2004). "Shaping the nuclear action of NF-kappaB."
Nat Rev Mol Cell Biol 5: 392-401.
Chen, Z. J. (2005). "Ubiquitin signalling in the NF-kappaB pathway." Nat Cell Biol
7: 758-65.
Choi, P., H. Snyder, et al. (2003). "SEPT5_v2 is a parkin-binding protein." Brain Res
Mol Brain Res 117: 179-89.
Chung, K. K., B. Thomas, et al. (2004). "S-nitrosylation of parkin regulates
ubiquitination and compromises parkin's protective function." Science 304: 1328-31.
Chung, K. K., Y. Zhang, et al. (2001). "Parkin ubiquitinates the alpha-synucleininteracting protein, synphylin-1: implications for Lewy-body formation in Parkinson
disease." Nat Med 7: 1144-50.
Ciechanover, A. und P. Brundin. (2003). "The ubiquitin proteasome system in
neurodegenerative diseases: sometimes the chicken, sometimes the egg." Neuron 40:
427-46.
142
8. Literaturverzeichnis
Cookson, M. R., P. J. Lockhart, et al. (2003). "RING finger 1 mutations in Parkin
produce altered localization of the protein." Hum Mol Genet 12: 2957-65. Epub 003
Sep 30.
Corti, O., C. Hampe, et al. (2003). "The p38 subunit of the aminoacyl-tRNA
synthetase complex is a Parkin substrate: linking protein biosynthesis and
neurodegeneration." Hum Mol Genet 12: 1427-37.
Dachsel, J. C., C. B. Lucking, et al. (2005). "Parkin interacts with the proteasome
subunit alpha4." FEBS Lett 579: 3913-9.
Darios, F., O. Corti, et al. (2003). "Parkin prevents mitochondrial swelling and
cytochrome c release in mitochondria-dependent cell death." Hum Mol Genet 12:
517-26.
Dauer, W. und S. Przedborski. (2003). "Parkinson's disease: mechanisms and
models." Neuron 39: 889-909.
Davidson, W. S., A. Jonas, et al. (1998). "Stabilization of alpha-synuclein secondary
structure upon binding to synthetic membranes." J Biol Chem 273: 9443-9.
Delhase, M., M. Hayakawa, et al. (1999). "Positive and negative regulation of
IkappaB kinase activity through IKKbeta subunit phosphorylation." Science 284:
309-13.
DeMartino, G. N. und C. A. Slaughter. (1999). "The proteasome, a novel protease
regulated by multiple mechanisms." J Biol Chem 274: 22123-6.
Deng, L., C. Wang, et al. (2000). "Activation of the IkappaB kinase complex by
TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique
polyubiquitin chain." Cell 103: 351-61.
Dev, K. K., H. van der Putten, et al. (2003). "Part I: parkin-associated proteins and
Parkinson's disease." Neuropharmacology 45: 1-13.
Ditzel, L., R. Huber, et al. (1998). "Conformational constraints for protein selfcleavage in the proteasome." J Mol Biol 279: 1187-91.
Doss-Pepe, E. W., L. Chen, et al. (2005). "Alpha-synuclein and parkin contribute to
the assembly of ubiquitin lysine 63-linked multiubiquitin chains." J Biol Chem 280:
16619-24.
Dubois, B., B. Pilon, et al. (1990). "Cholinergic deficiency and frontal dysfunction in
Parkinson's disease." Ann Neurol 28: 117-21.
143
8. Literaturverzeichnis
Eliezer, D., E. Kutluay, et al. (2001). "Conformational properties of alpha-synuclein
in its free and lipid-associated states." J Mol Biol 307: 1061-73.
Ellis, R. J. (1990). "The molecular chaperone concept." Semin Cell Biol 1: 1-9.
Ellis, R. J. und F. U. Hartl. (1999). "Principles of protein folding in the cellular
environment." Curr Opin Struct Biol 9: 102-10.
Evans, P. C., H. Ovaa, et al. (2004). "Zinc-finger protein A20, a regulator of
inflammation and cell survival, has de-ubiquitinating activity." Biochem J 378: 72734.
Fahn, S. (1998). "Medical treatment of Parkinson's disease." J Neurol 245: P15-24.
Fallon, L., C. M. Belanger, et al. (2006). "A regulated interaction with the UIM
protein Eps15 implicates parkin in EGF receptor trafficking and PI(3)K-Akt
signalling." Nat Cell Biol 8: 834-42.
Fallon, L., F. Moreau, et al. (2002). "Parkin and CASK/LIN-2 associate via a PDZmediated interaction and are co-localized in lipid rafts and postsynaptic densities in
brain." J Biol Chem 277: 486-91.
Farrer, M., P. Chan, et al. (2001). "Lewy bodies and parkinsonism in families with
parkin mutations." Ann Neurol 50: 293-300.
Farrer, M., J. Kachergus, et al. (2004). "Comparison of kindreds with parkinsonism
and alpha-synuclein genomic multiplications." Ann Neurol 55: 174-9.
Fenteany, G., R. F. Standaert, et al. (1995). "Inhibition of proteasome activities and
subunit-specific amino-terminal threonine modification by lactacystin." Science 268:
726-31.
Finney, N., F. Walther, et al. (2003). "The cellular protein level of parkin is regulated
by its ubiquitin-like domain." J Biol Chem 278: 16054-8.
Forno, L. S. (1996). "Neuropathology of Parkinson's disease." J Neuropathol Exp
Neurol 55: 259-72.
Forno, L. S., J. W. Langston, et al. (1986). "Locus ceruleus lesions and eosinophilic
inclusions in MPTP-treated monkeys." Ann Neurol 20: 449-55.
Funayama, M., K. Hasegawa, et al. (2002). "A new locus for Parkinson's disease
(PARK8) maps to chromosome 12p11.2-q13.1." Ann Neurol 51: 296-301.
Ghosh, S. und M. Karin. (2002). "Missing pieces in the NF-kappaB puzzle." Cell 109
Suppl: S81-96.
144
8. Literaturverzeichnis
Ghosh, S., M. J. May, et al. (1998). "NF-kappa B and Rel proteins: evolutionarily
conserved mediators of immune responses." Annu Rev Immunol 16: 225-60.
Giasson, B. I. und V. M. Lee. (2001). "Parkin and the molecular pathways of
Parkinson's disease." Neuron 31: 885-8.
Giasson, B. I., I. V. Murray, et al. (2001). "A hydrophobic stretch of 12 amino acid
residues in the middle of alpha-synuclein is essential for filament assembly." J Biol
Chem 276: 2380-6.
Glickman, M. H., D. M. Rubin, et al. (1998). "A subcomplex of the proteasome
regulatory particle required for ubiquitin-conjugate degradation and related to the
COP9-signalosome and eIF3." Cell 94: 615-23.
Gloeckner, C. J., N. Kinkl, et al. (2006). "The Parkinson disease causing LRRK2
mutation I2020T is associated with increased kinase activity." Hum Mol Genet 15:
223-32.
Goldberg, M. S., S. M. Fleming, et al. (2003). "Parkin-deficient mice exhibit
nigrostriatal deficits but not loss of dopaminergic neurons." J Biol Chem 20: 20.
Greenamyre, J. T., T. B. Sherer, et al. (2001). "Complex I and Parkinson's disease."
IUBMB Life 52: 135-41.
Greene, J. C., A. J. Whitworth, et al. (2003). "Mitochondrial pathology and apoptotic
muscle degeneration in Drosophila parkin mutants." Proc Natl Acad Sci U S A 100:
4078-83.
Gu, W. J., O. Corti, et al. (2003). "The C289G and C418R missense mutations cause
rapid sequestration of human Parkin into insoluble aggregates." Neurobiol Dis 14:
357-64.
Haglund, K. und I. Dikic. (2005). "Ubiquitylation and cell signaling." Embo J 24:
3353-9.
Hampe, C., H. Ardila-Osorio, et al. (2006). "Biochemical analysis of Parkinson's
disease-causing variants of Parkin, an E3 ubiquitin-protein ligase with
monoubiquitylation capacity." Hum Mol Genet 15: 2059-75.
Hartl, F. U. (1996). "Molecular chaperones in cellular protein folding." Nature 381:
571-9.
Hartl, F. U. und M. Hayer-Hartl. (2002). "Molecular chaperones in the cytosol: from
nascent chain to folded protein." Science 295: 1852-8.
145
8. Literaturverzeichnis
Hatano, Y., Y. Li, et al. (2004). "Novel PINK1 mutations in early-onset
parkinsonism." Ann Neurol 56: 424-7.
Hattori, N., H. Matsumine, et al. (1998). "Point mutations (Thr240Arg and
Gln311Stop) [correction of Thr240Arg and Ala311Stop] in the Parkin gene."
Biochem Biophys Res Commun 249: 754-8.
Hayashi, S., K. Wakabayashi, et al. (2000). "An autopsy case of autosomal-recessive
juvenile parkinsonism with a homozygous exon 4 deletion in the parkin gene." Mov
Disord 15: 884-8.
Hayden, M. S. und S. Ghosh. (2004). "Signaling to NF-kappaB." Genes Dev 18:
2195-224.
Haywood, A. F. und B. E. Staveley. (2004). "Parkin counteracts symptoms in a
Drosophila model of Parkinson's disease." BMC Neurosci 5: 14.
Healy, D. G., P. M. Abou-Sleiman, et al. (2004). "Genetic causes of Parkinson's
disease: UCHL-1." Cell Tissue Res 318: 189-94.
Heller, U., K. F. Winklhofer, et al. (2003). "Post-translational import of the prion
protein into the endoplasmic reticulum interferes with cell viability: a critical role for
the putative transmembrane domain." J Biol Chem 278: 36139-47.
Henn, I. H., J. M. Gostner, et al. (2005). "Pathogenic mutations inactivate parkin by
distinct mechanisms." J Neurochem 92: 114-22.
Hershko, A. und A. Ciechanover. (1998). "The ubiquitin system." Annu Rev
Biochem 67: 425-79.
Hershko, A., A. Ciechanover, et al. (2000). "Basic Medical Research Award. The
ubiquitin system." Nat Med 6: 1073-81.
Herzog, J. und J. Volkmann. (2006). "[Non-medical neurosurgical Parkinson
treatment]." Pharm Unserer Zeit 35: 234-40.
Heske, J., U. Heller, et al. (2004). "The C-terminal domain of the prion protein is
necessary and sufficient for import into the endoplasmic reticulum." J Biol Chem
279: 5435-43.
Hicke, L. (2001). "Protein regulation by monoubiquitin." Nat Rev Mol Cell Biol 2:
195-201.
Higashi, Y., M. Asanuma, et al. (2004). "Parkin attenuates manganese-induced
dopaminergic cell death." J Neurochem 89: 1490-7.
146
8. Literaturverzeichnis
Higuchi, R. (1990). Recombinant PCR. PCR Protocols: A Guide to Methods and
Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky und T. J. White. San Diego,
CA, USA, Academic Press: 177-83.
Hiyama, H., M. Yokoi, et al. (1999). "Interaction of hHR23 with S5a. The ubiquitinlike domain of hHR23 mediates interaction with S5a subunit of 26 S proteasome." J
Biol Chem 274: 28019-25.
Hochstrasser, M. (1996). "Ubiquitin-dependent protein degradation." Annu Rev
Genet 30: 405-39.
Hod, Y., S. N. Pentyala, et al. (1999). "Identification and characterization of a novel
protein that regulates RNA-protein interaction." J Cell Biochem 72: 435-44.
Hoenicka, J., L. Vidal, et al. (2002). "Molecular findings in familial Parkinson
disease in Spain." Arch Neurol 59: 966-70.
Honbou, K., N. N. Suzuki, et al. (2003). "The crystal structure of DJ-1, a protein
related to male fertility and Parkinson's disease." J Biol Chem 278: 31380-4.
Hornykiewicz, O. (1982). "Imbalance of brain monoamines and clinical disorders."
Prog Brain Res 55: 419-29.
Hornykiewicz, O. und S. J. Kish. (1987). "Biochemical pathophysiology of
Parkinson's disease." Adv Neurol 45: 19-34.
Hughes, A. J., S. E. Daniel, et al. (1991). "Idiopathic Parkinson's disease combined
with multiple system atrophy. A clinicopathological report." Mov Disord 6: 342-6.
Huynh, D. P., D. T. Nguyen, et al. (2007). "Parkin is an E3 ubiquitin-ligase for
normal and mutant ataxin-2 and prevents ataxin-2-induced cell death." Exp Neurol
203: 531-41.
Huynh, D. P., D. R. Scoles, et al. (2000). "Parkin is associated with actin filaments in
neuronal and nonneural cells." Ann Neurol 48: 737-44.
Huynh, D. P., D. R. Scoles, et al. (2003). "The autosomal recessive juvenile
Parkinson disease gene product, parkin, interacts with and ubiquitinates
synaptotagmin XI." Hum Mol Genet 12: 2587-97.
Hyun, D. H., M. Lee, et al. (2005). "Effect of overexpression of wild-type or mutant
parkin on the cellular response induced by toxic insults." J Neurosci Res 82: 232-44.
Imai, Y., M. Soda, et al. (2002). "CHIP is associated with Parkin, a gene responsible
for familial Parkinson's disease, and enhances its ubiquitin ligase activity." Mol Cell
10: 55-67.
147
8. Literaturverzeichnis
Imai, Y., M. Soda, et al. (2001). "An unfolded putative transmembrane polypeptide,
which can lead to endoplasmic reticulum stress, is a substrate of parkin." Cell 105:
891-902.
Imai, Y., M. Soda, et al. (2000). "Parkin suppresses unfolded protein stress-induced
cell death through its E3 ubiquitin-protein ligase activity." J Biol Chem 275: 356614.
Ishikawa, A. und H. Takahashi. (1998). "Clinical and neuropathological aspects of
autosomal recessive juvenile parkinsonism." J Neurol 245: P4-9.
Itier, J. M., P. Ibanez, et al. (2003). "Parkin gene inactivation alters behaviour and
dopamine neurotransmission in the mouse." Hum Mol Genet 12: 2277-91.
Jiang, H., Y. Ren, et al. (2004). "Parkin protects human dopaminergic neuroblastoma
cells against dopamine-induced apoptosis." Hum Mol Genet 13: 1745-54.
Joazeiro, C. A. und A. M. Weissman. (2000). "RING finger proteins: mediators of
ubiquitin ligase activity." Cell 102: 549-52.
Jolly, C. und R. I. Morimoto. (2000). "Role of the heat shock response and molecular
chaperones in oncogenesis and cell death." J Natl Cancer Inst 92: 1564-72.
Junn, E., S. S. Lee, et al. (2002). "Parkin accumulation in aggresomes due to
proteasome impairment." J Biol Chem 277: 47870-7.
Kahns, S., M. Kalai, et al. (2003). "Caspase-1 and caspase-8 cleave and inactivate
cellular parkin." J Biol Chem 278: 23376-80.
Kahns, S., S. Lykkebo, et al. (2002). "Caspase-mediated parkin cleavage in apoptotic
cell death." J Biol Chem 277: 15303-8.
Kalia, S. K., S. Lee, et al. (2004). "BAG5 inhibits parkin and enhances dopaminergic
neuron degeneration." Neuron 44: 931-45.
Kaltschmidt, B., D. Widera, et al. (2005). "Signaling via NF-kappaB in the nervous
system." Biochim Biophys Acta 1745: 287-99.
Karin, M. (1999a). "The beginning of the end: IkappaB kinase (IKK) and NFkappaB activation." J Biol Chem 274: 27339-42.
Karin, M. (1999b). "How NF-kappaB is activated: the role of the IkappaB kinase
(IKK) complex." Oncogene 18: 6867-74.
Karin, M. und Y. Ben-Neriah. (2000). "Phosphorylation meets ubiquitination: the
control of NF-[kappa]B activity." Annu Rev Immunol 18: 621-63.
148
8. Literaturverzeichnis
Karin, M. und A. Lin. (2002). "NF-kappaB at the crossroads of life and death." Nat
Immunol 3: 221-7.
Kitada, T., S. Asakawa, et al. (1998). "Mutations in the parkin gene cause autosomal
parkinsonism." Nature 392: 605-8.
Klein, R. L., R. D. Dayton, et al. (2006). "Parkin is protective for substantia nigra
dopamine neurons in a tau gene transfer neurodegeneration model." Neurosci Lett
401: 130-5.
Ko, H. S., S. W. Kim, et al. (2006). "Identification of far upstream element-binding
protein-1 as an authentic Parkin substrate." J Biol Chem 281: 16193-6.
Ko, H. S., R. von Coelln, et al. (2005). "Accumulation of the authentic parkin
substrate aminoacyl-tRNA synthetase cofactor, p38/JTV-1, leads to
catecholaminergic cell death." J Neurosci 25: 7968-78.
Krappmann, D., E. N. Hatada, et al. (2000). "The I kappa B kinase (IKK) complex is
tripartite and contains IKK gamma but not IKAP as a regular component." J Biol
Chem 275: 29779-87.
Krappmann, D., A. Patke, et al. (2001). "B-cell receptor- and phorbol ester-induced
NF-kappaB and c-Jun N-terminal kinase activation in B cells requires novel protein
kinase C's." Mol Cell Biol 21: 6640-50.
Krappmann, D. und C. Scheidereit. (2005). "A pervasive role of ubiquitin
conjugation in activation and termination of IkappaB kinase pathways." EMBO Rep
6: 321-6.
Krappmann, D., F. G. Wulczyn, et al. (1996). "Different mechanisms control signalinduced degradation and basal turnover of the NF-kappaB inhibitor IkappaB alpha in
vivo." Embo J 15: 6716-26.
Kruger, R., W. Kuhn, et al. (1998). "Ala30Pro mutation in the gene encoding alphasynuclein in Parkinson's disease." Nat Genet 18: 106-8.
Kubo, S. I., T. Kitami, et al. (2001). "Parkin is associated with cellular vesicles." J
Neurochem 78: 42-54.
Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the
head of bacteriophage T-4." Nature 227: 680-5.
Lang, A. E. und A. M. Lozano. (1998a). "Parkinson's disease. First of two parts." N
Engl J Med 339: 1044-53.
149
8. Literaturverzeichnis
Lang, A. E. und A. M. Lozano. (1998b). "Parkinson's disease. Second of two parts."
N Engl J Med 339: 1130-43.
LaVoie, M. J., B. L. Ostaszewski, et al. (2005). "Dopamine covalently modifies and
functionally inactivates parkin." Nat Med 11: 1214-21.
Lee, S. J., S. J. Kim, et al. (2003). "Crystal structures of human DJ-1 and Escherichia
coli Hsp31, which share an evolutionarily conserved domain." J Biol Chem 278:
44552-9. Epub 2003 Aug 25.
Leroy, E., R. Boyer, et al. (1998). "The ubiquitin pathway in Parkinson's disease."
Nature 395: 451-2.
Lim, K. L., K. C. Chew, et al. (2005). "Parkin mediates nonclassical, proteasomalindependent ubiquitination of synphilin-1: implications for Lewy body formation." J
Neurosci 25: 2002-9.
Liu, Y., L. Fallon, et al. (2002). "The UCH-L1 gene encodes two opposing
enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease
susceptibility." Cell 111: 209-18.
Lo Bianco, C., B. L. Schneider, et al. (2004). "Lentiviral vector delivery of parkin
prevents dopaminergic degeneration in an alpha-synuclein rat model of Parkinson's
disease." Proc Natl Acad Sci U S A 101: 17510-5.
Lockhart, P. J., R. Bounds, et al. (2004). "Lack of mutations in DJ-1 in a cohort of
Taiwanese ethnic Chinese with early-onset parkinsonism." Mov Disord 19: 1065-9.
Lorenzetti, D., B. Antalffy, et al. (2004). "The neurological mutant quaking(viable)
is Parkin deficient." Mamm Genome 15: 210-7.
Maroteaux, L., J. T. Campanelli, et al. (1988). "Synuclein: a neuron-specific protein
localized to the nucleus and presynaptic nerve terminal." J Neurosci 8: 2804-15.
Marsden, C. D. (1983). "Neuromelanin and Parkinson's disease." J Neural Transm
Suppl 19: 121-41.
Martinat, C., S. Shendelman, et al. (2004). "Sensitivity to oxidative stress in DJ-1deficient dopamine neurons: an ES- derived cell model of primary parkinsonism."
PLoS Biol 2: e327.
Mata, I. F., P. J. Lockhart, et al. (2004). "Parkin genetics: one model for Parkinson's
disease." Hum Mol Genet 13 Spec No 1: R127-33.
Matsuda, N., T. Kitami, et al. (2006). "Diverse effects of pathogenic mutations of
Parkin that catalyze multiple monoubiquitylation in vitro." J Biol Chem 281: 3204-9.
150
8. Literaturverzeichnis
Matsumine, H., Y. Yamamura, et al. (1998). "Early onset parkinsonism with diurnal
fluctuation maps to a locus for juvenile parkinsonism." Neurology 50: 1340-5.
Mattson, M. P., C. Culmsee, et al. (2000). "Roles of nuclear factor kappaB in
neuronal survival and plasticity." J Neurochem 74: 443-56.
McCormack, A. L., M. Thiruchelvam, et al. (2002). "Environmental risk factors and
Parkinson's disease: selective degeneration of nigral dopaminergic neurons caused by
the herbicide paraquat." Neurobiol Dis 10: 119-27.
McKenna, S., L. Spyracopoulos, et al. (2001). "Noncovalent interaction between
ubiquitin and the human DNA repair protein Mms2 is required for Ubc13-mediated
polyubiquitination." J Biol Chem 276: 40120-6.
McNaught, K. S., C. Mytilineou, et al. (2002). "Impairment of the ubiquitinproteasome system causes dopaminergic cell death and inclusion body formation in
ventral mesencephalic cultures." J Neurochem 81: 301-6.
McNaught, K. S. und C. W. Olanow. (2003). "Proteolytic stress: a unifying concept
for the etiopathogenesis of Parkinson's disease." Ann Neurol 53 Suppl 3: S73-84;
discussion S-6.
McNaught, K. S. und C. W. Olanow. (2006). "Protein aggregation in the
pathogenesis of familial and sporadic Parkinson's disease." Neurobiol Aging 27: 53045.
Menendez, J., J. A. Rodriguez-Navarro, et al. (2006). "Suppression of Parkin
enhances nigrostriatal and motor neuron lesion in mice over-expressing humanmutated tau protein." Hum Mol Genet 15: 2045-58.
Mitsumoto, A., Y. Nakagawa, et al. (2001). "Oxidized forms of peroxiredoxins and
DJ-1 on two-dimensional gels increased in response to sublethal levels of paraquat."
Free Radic Res 35: 301-10.
Moore, D. J. (2006). "Parkin: a multifaceted ubiquitin ligase." Biochem Soc Trans
34: 749-53.
Moore, D. J., A. B. West, et al. (2005a). "Molecular Pathophysiology of Parkinson's
Disease." Annu Rev Neurosci 28: 57-87.
Moore, D. J., L. Zhang, et al. (2005b). "Association of DJ-1 and parkin mediated by
pathogenic DJ-1 mutations and oxidative stress." Hum Mol Genet 14: 71-84.
Moran, L. B., E. Croisier, et al. (2007). "Analysis of alpha-synuclein, dopamine and
parkin pathways in neuropathologically confirmed parkinsonian nigra." Acta
Neuropathol (Berl) 113: 253-63.
151
8. Literaturverzeichnis
Morett, E. und P. Bork. (1999). "A novel transactivation domain in parkin." Trends
Biochem Sci 24: 229-31.
Mori, H., T. Kondo, et al. (1998). "Pathologic and biochemical studies of juvenile
parkinsonism linked to chromosome 6q." Neurology 51: 890-2.
Morimoto, R. I., D. A. Jurivich, et al. (1994). Regulation of heat shock gene
transcription by a family of heat shock factors. R. I. Morimoto, A. Tissieres, et al.,
New York, Cold Spring Harbor Laboratory Press.
Muqit, M. M., S. M. Davidson, et al. (2004). "Parkin is recruited into aggresomes in
a stress-specific manner: over-expression of parkin reduces aggresome formation but
can be dissociated from parkin's effect on neuronal survival." Hum Mol Genet 13:
117-35. Epub 2003 Nov 25.
Nakajima, T., T. Nimura, et al. (2003). "The impact of stereotactic pallidal surgery
on the dopamine D2 receptor in Parkinson disease: a positron emission tomography
study." J Neurosurg 98: 57-63.
Nakaso, K., Y. Adachi, et al. (2006). "Detection of compound heterozygous
deletions in the parkin gene of fibroblasts in patients with autosomal recessive
hereditary parkinsonism (PARK2)." Neurosci Lett 400: 44-7.
Netzer, W. J. und F. U. Hartl. (1998). "Protein folding in the cytosol: chaperonindependent and -independent mechanisms." Trends Biochem Sci 23: 68-73.
Nikulina, E. M., J. A. Skrinskaya, et al. (1995). "Dopaminergic brain system in the
quaking mutant mouse." Pharmacol Biochem Behav 50: 333-7.
Nover, L., K. D. Scharf, et al. (1996). "The Hsf world: classification and properties
of plant heat stress transcription factors." Cell Stress Chaperones 1: 215-23.
Okochi, M., J. Walter, et al. (2000). "Constitutive phosphorylation of the Parkinson's
disease associated alpha-synuclein." J Biol Chem 275: 390-7.
Oliveira, S. A., W. K. Scott, et al. (2003). "Parkin mutations and susceptibility alleles
in late-onset Parkinson's disease." Ann Neurol. 53: 624-9.
Paisan-Ruiz, C., A. E. Lang, et al. (2005). "LRRK2 gene in Parkinson disease:
mutation analysis and case control association study." Neurology 65: 696-700.
Palacino, J. J., D. Sagi, et al. (2004). "Mitochondrial dysfunction and oxidative
damage in parkin-deficient mice." J Biol Chem 279: 18614-22.
152
8. Literaturverzeichnis
Pappolla, M. A. (1986). "Lewy bodies of Parkinson's disease. Immune electron
microscopic demonstration of neurofilament antigens in constituent filaments." Arch
Pathol Lab Med 110: 1160-3.
Park, S. M., H. Y. Jung, et al. (2002). "Distinct roles of the N-terminal-binding
domain and the C-terminal-solubilizing domain of alpha-synuclein, a molecular
chaperone." J Biol Chem 277: 28512-20.
Pawlyk, A. C., B. I. Giasson, et al. (2003). "Novel monoclonal antibodies
demonstrate biochemical variation of brain parkin with age." J Biol Chem 278:
48120-8. Epub 2003 Sep 12.
Pearce, R. K., A. Owen, et al. (1997). "Alterations in the distribution of glutathione
in the substantia nigra in Parkinson's disease." J Neural Transm 104: 661-77.
Perez, F. A. und R. D. Palmiter. (2005). "Parkin-deficient mice are not a robust
model of parkinsonism." Proc Natl Acad Sci U S A 102: 2174-9.
Petit, A., T. Kawarai, et al. (2005). "Wild-type PINK1 prevents basal and induced
neuronal apoptosis, a protective effect abrogated by Parkinson disease-related
mutations." J Biol Chem 280: 34025-32.
Petrucelli, L., C. O'Farrell, et al. (2002). "Parkin protects against the toxicity
associated with mutant alpha-synuclein: proteasome dysfunction selectively affects
catecholaminergic neurons." Neuron 36: 1007-19.
Pickart, C. M. (2000). "Ubiquitin in chains." Trends Biochem Sci 25: 544-8.
Pickart, C. M. und D. Fushman. (2004). "Polyubiquitin chains: polymeric protein
signals." Curr Opin Chem Biol 8: 610-6.
Pirkkala, L., T. P. Alastalo, et al. (2000). "Disruption of heat shock factor 1 reveals
an essential role in the ubiquitin proteolytic pathway." Mol Cell Biol 20: 2670-5.
Polymeropoulos, M. H., J. J. Higgins, et al. (1996). "Mapping of a gene for
Parkinson's disease to chromosome 4q21-q23." Science 274: 1197-9.
Polymeropoulos, M. H., C. Lavedan, et al. (1997). "Mutation in the alpha-synuclein
gene identified in families with Parkinson's disease." Science 276: 2045-7.
Ravid, T. und M. Hochstrasser. (2004). "NF-kappaB signaling: flipping the switch
with polyubiquitin chains." Curr Biol 14: R898-900.
Rawal, N., M. Periquet, et al. (2003). "New parkin mutations and atypical
phenotypes in families with autosomal recessive parkinsonism." Neurology 60:
1378-81.
153
8. Literaturverzeichnis
Ren, Y., J. Zhao, et al. (2003). "Parkin binds to alpha/beta tubulin and increases their
ubiquitination and degradation." J Neurosci 23: 3316-24.
Riess, O., W. Kuhn, et al. (2000). "Genetic influence on the development of
Parkinson's disease." J Neurol 247 Suppl 2: II69-74.
Rosen, K. M., V. Veereshwarayya, et al. (2006). "Parkin protects against
mitochondrial toxins and beta-amyloid accumulation in skeletal muscle cells." J Biol
Chem 281: 12809-16.
Rothe, M., V. Sarma, et al. (1995). "TRAF2-mediated activation of NF-kappa B by
TNF receptor 2 and CD40." Science 269: 1424-7.
Rubin, D. M., M. H. Glickman, et al. (1998). "Active site mutants in the six
regulatory particle ATPases reveal multiple roles for ATP in the proteasome." Embo
J 17: 4909-19.
Saiki, R. K., D. H. Gelfand, et al. (1988). "Primer-directed enzymatic amplification
of DNA with a thermostable DNA polymerase." Science 239: 487-91.
Sakata, E., Y. Yamaguchi, et al. (2003). "Parkin binds the Rpn10 subunit of 26S
proteasomes through its ubiquitin-like domain." EMBO Rep. 4: 301-6.
Sambrook, J., E. Fritsch, et al. (1989). "Molecular Cloning: A Laboratory Manual."
New York, Cold Spring Harbor Press.
Sanger, F., S. Nicklen, et al. (1977). "DNA sequencing with chain-terminating
inhibitors." Proc Natl Acad Sci U S A 74: 5463-7.
Sato, S., T. Chiba, et al. (2006). "14-3-3eta is a novel regulator of parkin ubiquitin
ligase." Embo J 25: 211-21.
Schandel, K. A. und D. D. Jenness. (1994). "Direct evidence for ligand-induced
internalization of the yeast alpha-factor pheromone receptor." Mol Cell Biol 14:
7245-55.
Schlossmacher, M. G., M. P. Frosch, et al. (2002). "Parkin localizes to the Lewy
bodies of Parkinson disease and dementia with Lewy bodies." Am J Pathol 160:
1655-67.
Shapira, L., V. Barak, et al. (1998). "Effects of tetracyclines on the pathologic
activity of endotoxin: in vitro and in vivo studies." Adv Dent Res 12: 119-22.
Shendelman, S., A. Jonason, et al. (2004). "DJ-1 is a redox-dependent molecular
chaperone that inhibits alpha-synuclein aggregate formation." PLoS Biol 2: e362.
154
8. Literaturverzeichnis
Sherer, T. B., R. Betarbet, et al. (2003). "Selective microglial activation in the rat
rotenone model of Parkinson's disease." Neurosci Lett 341: 87-90.
Sherer, T. B., R. Betarbet, et al. (2002). "An in vitro model of Parkinson's disease:
linking mitochondrial impairment to altered alpha-synuclein metabolism and
oxidative damage." J Neurosci 22: 7006-15.
Sherman, M. Y. und A. L. Goldberg. (2001). "Cellular defenses against unfolded
proteins: a cell biologist thinks about neurodegenerative diseases." Neuron 29: 15-32.
Shimura, H., N. Hattori, et al. (2000). "Familial Parkinson disease gene product,
parkin, is a ubiquitin-protein ligase." Nat Genet 25: 302-5.
Shimura, H., N. Hattori, et al. (1999). "Immunohistochemical and subcellular
localization of Parkin protein: absence of protein in autosomal recessive juvenile
parkinsonism patients." Ann Neurol 45: 668-72.
Shimura, H., M. G. Schlossmacher, et al. (2001). "Ubiquitination of a new form of
alpha- brain: implications for Parkinson's disease." Science 293: 263-9.
Sian, J., D. T. Dexter, et al. (1994). "Alterations in glutathione levels in Parkinson's
disease and other neurodegenerative disorders affecting basal ganglia." Ann Neurol
36: 348-55.
Sidman, R. L., M. M. Dickie, et al. (1964). "Mutant Mice (Quaking and Jimpy) with
Deficient Myelination in the Central Nervous System." Science 144: 309-11.
Singleton, A. B., M. Farrer, et al. (2003). "alpha-Synuclein locus triplication causes
Parkinson's disease." Science 302: 841.
Sizemore, N., S. Leung, et al. (1999). "Activation of phosphatidylinositol 3-kinase in
response to interleukin-1 leads to phosphorylation and activation of the NF-kappaB
p65/RelA subunit." Mol Cell Biol 19: 4798-805.
Smith, W. W., Z. Pei, et al. (2005). "Leucine-rich repeat kinase 2 (LRRK2) interacts
with parkin, and mutant LRRK2 induces neuronal degeneration." Proc Natl Acad Sci
U S A 102: 18676-81.
Spillantini, M. G., R. A. Crowther, et al. (1998). "alpha-Synuclein in filamentous
inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies."
Proc Natl Acad Sci U S A 95: 6469-73.
Spillantini, M. G., M. L. Schmidt, et al. (1997). "Alpha-synuclein in Lewy bodies."
Nature 388: 839-40.
155
8. Literaturverzeichnis
Sriram, S. R., X. Li, et al. (2005). "Familial-associated mutations differentially
disrupt the solubility, localization, binding and ubiquitination properties of parkin."
Hum Mol Genet 14: 2571-86.
Staropoli, J. F., C. McDermott, et al. (2003). "Parkin is a component of an SCF-like
ubiquitin ligase complex and protects postmitotic neurons from kainate
excitotoxicity." Neuron 37: 735-49.
Taira, T., Y. Saito, et al. (2004). "DJ-1 has a role in antioxidative stress to prevent
cell death." EMBO Rep 5: 213-8.
Takahashi, H., E. Ohama, et al. (1994). "Familial juvenile parkinsonism: clinical and
pathologic study in a family." Neurology 44: 437-41.
Takahashi, K., T. Taira, et al. (2001). "DJ-1 positively regulates the androgen
receptor by impairing the binding of PIASx alpha to the receptor." J Biol Chem 276:
37556-63.
Tan, E. K., K. Y. Puong, et al. (2005). "Impaired transcriptional upregulation of
Parkin promoter variant under oxidative stress and proteasomal inhibition: clinical
association." Hum Genet 118: 484-8.
Tanner, C. M. und Y. Ben-Shlomo. (1999). "Epidemiology of Parkinson's disease."
Adv Neurol 80: 153-9.
Tao, X. und L. Tong. (2003). "Crystal structure of human DJ-1, a protein associated
with early onset Parkinson's disease." J Biol Chem 278: 31372-9.
Taylor, J. P., I. F. Mata, et al. (2006). "LRRK2: a common pathway for
parkinsonism, pathogenesis and prevention?" Trends Mol Med 12: 76-82.
Tegethoff, S., J. Behlke, et al. (2003). "Tetrameric oligomerization of IkappaB
kinase gamma (IKKgamma) is obligatory for IKK complex activity and NF-kappaB
activation." Mol Cell Biol 23: 2029-41.
Terreni, L., E. Calabrese, et al. (2001). "New mutation (R42P) of the parkin gene in
the ubiquitinlike domain associated with parkinsonism." Neurology 56: 463-6.
Towbin, H., T. Staehelin, et al. (1979). "Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications." Proc
Natl Acad Sci U S A 76: 4350-4.
Tsai, Y. C., P. S. Fishman, et al. (2003). "Parkin facilitates the elimination of
expanded polyglutamine proteins and leads to preservation of proteasome function."
J Biol Chem 278: 22044-55.
156
8. Literaturverzeichnis
Tsubuki, S., H. Kawasaki, et al. (1993). "Purification and characterization of a ZLeu-Leu-Leu-MCA degrading protease expected to regulate neurite formation: a
novel catalytic activity in proteasome." Biochem Biophys Res Commun 196: 1195201.
Udelsman, R., M. J. Blake, et al. (1994). "Endocrine control of stress-induced heat
shock protein 70 expression in vivo." Surgery 115: 611-6.
Um, J. W., D. S. Min, et al. (2006). "Parkin ubiquitinates and promotes the
degradation of RanBP2." J Biol Chem 281: 3595-603.
Unoki, M. und Y. Nakamura. (2001). "Growth-suppressive effects of BPOZ and
EGR2, two genes involved in the PTEN signaling pathway." Oncogene 20: 4457-65.
Valente, E. M., P. M. Abou-Sleiman, et al. (2004). "Hereditary early-onset
Parkinson's disease caused by mutations in PINK1." Science 304: 1158-60.
Vila, M. und S. Przedborski. (2003). "Targeting programmed cell death in
neurodegenerative diseases." Nat Rev Neurosci 4: 365-75.
Vila, M. und S. Przedborski. (2004). "Genetic clues to the pathogenesis of
Parkinson's disease." Nat Med 10: S58-62.
Volkmann, J. (2004). "Deep brain stimulation for the treatment of Parkinson's
disease." J Clin Neurophysiol 21: 6-17.
Von Coelln, R., B. Thomas, et al. (2004). "Loss of locus coeruleus neurons and
reduced startle in parkin null mice." Proc Natl Acad Sci U S A 101: 10744-9.
Walters, K. J., M. F. Kleijnen, et al. (2002). "Structural studies of the interaction
between ubiquitin family proteins and proteasome subunit S5a." Biochemistry 41:
1767-77.
Wang, C., H. S. Ko, et al. (2005). "Stress-induced alterations in parkin solubility
promote parkin aggregation and compromise parkin's protective function." Hum Mol
Genet 14: 3885-97.
Wang, Q. und A. Chang. (1999). "Eps1, a novel PDI-related protein involved in ER
quality control in yeast." EMBO J 18: 5972-82.
West, A., M. Periquet, et al. (2002). "Complex relationship between Parkin
mutations." Am J Med Genet 114: 584-91.
West, A. B. und N. T. Maidment. (2004). "Genetics of parkin-linked disease." Hum
Genet 114: 327-36.
157
8. Literaturverzeichnis
West, A. B., D. J. Moore, et al. (2005). "Parkinson's disease-associated mutations in
leucine-rich repeat kinase 2 augment kinase activity." Proc Natl Acad Sci U S A 102:
16842-7.
Wilson, M. A., J. L. Collins, et al. (2003). "The 1.1-A resolution crystal structure of
DJ-1, the protein mutated in autosomal recessive early onset Parkinson's disease."
Proc Natl Acad Sci U S A 100: 9256-61.
Winklhofer, K. F. (2006). "[Inactivation of parkin in Parkinson disease]." Pharm
Unserer Zeit 35: 186-7.
Winklhofer, K. F., A. Reintjes, et al. (2001). "Geldanamycin restores a defective heat
shock response in vivo." J Biol Chem 276: 45160-7.
Winklhofer, K. F., I. H. Henn, et al. (2003). "Inactivation of parkin by oxidative
stress and C-terminal truncations; a protective role of molecular chaperones." J Biol
Chem 278: 47199-208.
Wolf, D. H. und W. Hilt. (2004). "The proteasome: a proteolytic nanomachine of cell
regulation and waste disposal." Biochim Biophys Acta 1695: 19-31.
Wong, E. S., J. M. Tan, et al. (2007). "Relative sensitivity of parkin and other
cysteine-containing enzymes to stress-induced solubility alterations." J Biol Chem.
Wszolek, Z. K., R. F. Pfeiffer, et al. (2004). "Autosomal dominant parkinsonism
associated with variable synuclein and tau pathology." Neurology 62: 1619-22.
Yamamoto, A., A. Friedlein, et al. (2005). "Parkin phosphorylation and modulation
of its E3 ubiquitin ligase activity." J Biol Chem 280: 3390-9.
Yang, Y., I. Nishimura, et al. (2003). "Parkin suppresses dopaminergic neuronselective neurotoxicity induced by Pael-R in Drosophila." Neuron 37: 911-24.
Yao, D., Z. Gu, et al. (2004). "Nitrosative stress linked to sporadic Parkinson's
disease: S-nitrosylation of parkin regulates its E3 ubiquitin ligase activity." Proc Natl
Acad Sci U S A 101: 10810-4.
Yokota, T., K. Sugawara, et al. (2003). "Down regulation of DJ-1 enhances cell
death by oxidative stress, ER stress, and proteasome inhibition." Biochem Biophys
Res Commun 312: 1342-8.
Young, J. C., V. R. Agashe, et al. (2004). "Pathways of chaperone-mediated protein
folding in the cytosol." Nat Rev Mol Cell Biol 5: 781-91.
Zarranz, J. J., J. Alegre, et al. (2004). "The new mutation, E46K, of alpha-synuclein
causes Parkinson and Lewy body dementia." Ann Neurol 55: 164-73.
158
8. Literaturverzeichnis
Zhang, Y., J. Gao, et al. (2000). "Parkin functions as an E2-dependent ubiquitinprotein ligase and promotes the degradation of the synaptic vesicle-associated
protein, CDCrel-1." Proc Natl Acad Sci U S A 97: 13354-9.
Zhao, J., Y. Ren, et al. (2003). "Parkin is recruited to the centrosome in response to
inhibition of proteasomes." J Cell Sci 116: 4011-9. Epub 2003 Aug 19.
Zhong, H., H. SuYang, et al. (1997). "The transcriptional activity of NF-kappaB is
regulated by the IkappaB-associated PKAc subunit through a cyclic AMPindependent mechanism." Cell 89: 413-24.
Zimprich, A., B. Muller-Myhsok, et al. (2004). "The PARK8 locus in autosomal
dominant parkinsonism: confirmation of linkage and further delineation of the
disease-containing interval." Am J Hum Genet 74: 11-9.
159
9. Publikationen
9. Publikationen
Konstanze F. Winklhofer, Iris H. Henn, Penelope C. Kay-Jackson, Ulrich Heller
und Jörg Tatzelt (2003). "Inactivation of parkin by oxidative stress and C-terminal
truncations: a protective role of molecular chaperones." Journal of Biological
Chemistry 278: 47199-208.
Iris H. Henn, Johanna M. Gostner, Peter Lackner, Jörg Tatzelt und Konstanze F.
Winklhofer
(2005).
"Pathogenic
mutations
inactivate
parkin
by
distinct
mechanisms." Journal of Neurochemistry 92: 114-121.
Iris H. Henn, Lena Bouman, Julia S. Schlehe, Anita Schlierf, Julia E. Schramm,
Elmar Wegener, Kazuhiro Nakaso, Carsten Culmsee, Benedikt Berninger, Daniel
Krappmann, Jörg Tatzelt und Konstanze F. Winklhofer (2007). "Parkin mediates
neuroprotection
through
activation
of
Neuroscience 27: 1868-1878.
160
IKK/NF-κB
signaling."
Journal
of
10. Lebenslauf
10. Lebenslauf
Name:
Iris H. Henn
Geburtstag:
19.10.1978
Geburtsort
Miltenberg
Staatsangehörigkeit:
Deutsch
Familienstand
Ledig
1985-1989
Grundschule, Miltenberg
1989-1998
Johannes-Butzbach-Gymnasium, Miltenberg
1998-2002
Studium
der
Pharmazeutischen
Chemie
an
der
Fachhochschule Isny der Naturwissenschaftlich-Technischen
Akademie Prof. Dr. Grübler gGmbH, Isny/Allgäu
09/2000-02/2001
Praxissemester bei der Fresenius Kabi Deutschland GmbH,
Friedberg,
Praktische
Ausbildung
in
der
pharmazeutischen
Qualitätskontrolle und Qualitätssicherung
03/2002 bis 11/2002
Diplomarbeit
am
Max-Planck-Institut
für
Biochemie,
Martinsried, Abteilung Zelluläre Biochemie (F.-U. Hartl),
Arbeitsgruppe: J. Tatzelt
Thema: Biochemische und zellbiologische Charakterisierung
von Parkin und krankheitsassoziierter Parkin-Mutanten
12/2002
Diplom [Dipl.-Ing. (FH) Pharmazeutische Chemie]
02/2003-03/2007
Doktorarbeit
am
Max-Planck-Institut
für
Biochemie,
Martinsried, Abteilung Zelluläre Biochemie (F.-U. Hartl),
seit 01/2006
Adolf-Butenandt-Institut
der
Ludwig-Maximilians-
Universität, München, Abteilung Biochemie (C. Haass),
Arbeitsgruppe: K.F. Winklhofer
Thema: Die Rolle von Parkin bei der Parkinson-Erkrankung:
Physiologische Funktion und Mechanismen der Inaktivierung
161