WGDASL HT Assay Guide (15018210 D)

WGDASL HT Assay Guide (15018210 D)
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual
use of its customer in connection with the use of the product(s) described herein and for no other purpose. This document and its contents
shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever
without the prior written consent of Illumina. Illumina does not convey any license under its patent, trademark, copyright, or commonlaw rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure
the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read and understood prior
to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT
IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER
PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED
HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) OR ANY USE OF SUCH PRODUCT(S) OUTSIDE THE SCOPE OF THE
EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER'S ACQUISITION
OF SUCH PRODUCT(S).
FOR RESEARCH USE ONLY
© 2010-2012 Illumina, Inc. All rights reserved.
Illumina, illuminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome
Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, Sentrix, SeqMonitor, Solexa, TruSeq,
VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of
Illumina, Inc. All other brands and names contained herein are the property of their respective owners.
ii
Part # 15018210 Rev. D
Revision History
Part #
Revision
Date
15018210
D
April 2012
15018210
C
December 2011
15018210
15018210
B
A
December 2010
December 2010
Whole-Genome Gene Expression DASL HT Assay Guide
Description of Change
• Corrected ratio of MCS4 and RTE
reagent tubes per sample in the PreQualify cDNA Samples procedure's
consumables table.
• Removed WG-DASL HT Assay Guide
catalog number.
• MCS3 reagent replaced with MCS4 and
RTE and the protocol revised.
• DASL Single-Use cDNA Synthesis Kit
renamed to cDNA Synth MCS4 SingleUse Kit.
• AM1 Washes - Added step to place
ASE plate on magnetic plate.
Specify Image Beadchip scan settings.
Initial release
iii
iv
Part # 15018210 Rev. D
Table of Contents
Revision History
Table of Contents
List of Tables
Chapter 1 Overview
Introduction
WG-DASL HT Assay
RNA Samples
WG-DASL HT Assay Workflow
BeadChips
HiScan, iScan, BeadArray Reader, AutoLoader and AutoLoader2
GenomeStudio
Illumina Lab Protocols
Chapter 2 Standard Operating Procedures
Introduction
Acronyms
Lab Setup
Lab Maintenance
Safety Precautions
Best Practices
RNase-Free Techniques
Standard Lab Procedures
Tracking Tools
Equipment, Materials, and Reagents
Chapter 3 WG-DASL HT Assay Lab Protocols
Introduction
Quantitate RNA (Optional)
Whole-Genome Gene Expression DASL HT Assay Guide
iii
v
vii
1
2
3
4
6
11
12
13
14
15
16
17
20
22
24
25
28
29
31
34
43
44
45
v
Pre-Qualify cDNA Samples (Optional)
Make Single-Use RNA (SUR) Plate
Make Assay-Specific Extension (ASE) Plate
Add Master Mix for Extension & Ligation (MEL)
Make PCR Plate
Inoculate PCR Plate
Thermal Cycle PCR Plate
Bind PCR Products
Make Intermediate (INT) Plate
Precipitate and Wash INT Plate
Hybridize BeadChip
Wash BeadChip
Image BeadChip
GenomeStudio
Appendix A WG-DASL HT AssayControls
113
Introduction
View the Control Report
Negative Controls
Oligo Annealing Controls
Array Hybridization Controls
Gene Intensity (Housekeeping and All Genes)
114
115
116
117
118
119
Appendix B Assay Qualification Using gDNA
121
Introduction
Make Single-Use DNA (SUD) Plate
Data Analysis
vi
56
60
63
66
70
72
76
77
80
83
87
95
111
112
122
123
126
Index
127
Technical Assistance
131
Part # 15018210 Rev. D
List of Tables
Table 1 AutoLoader and AutoLoader2 Features
Table 2 WG-DASL HT AssayAcronyms
Table 3 Vortexer Calibration Speeds
Table 4 Sample Sheet Guidelines
Table 5 Illumina Equipment Options for the WG-DASL HT Assay
Table 6 User-Supplied Equipment
Table 7 User-Supplied Materials
Table 8 WG-DASL HT Assay Kits
Table 9 WG-DASL HT Assay Kit Contents
Table 10 User-Supplied Reagents
Table 11 Concentrations of Standard Ribosomal RNA
Table 12 Volumes for RiboGreen Reagents
Table 13 Primers for qPCR using SYBR Green Detection
Table 14 Thermal Cycler Program
Table 15 WG-DASL HT Assay Scan Settings
Table 16 Illumina General Contact Information
Table 17 Illumina Customer Support Telephone Numbers
Whole-Genome Gene Expression DASL HT Assay Guide
12
17
29
31
34
35
36
38
39
40
47
49
56
76
111
131
131
vii
viii
Part # 15018210 Rev. D
Chapter 1 Overview
Introduction
WG-DASL HT Assay
RNA Samples
WG-DASL HT Assay Workflow
BeadChips
HiScan, iScan, BeadArray Reader, AutoLoader and AutoLoader2
GenomeStudio
Illumina Lab Protocols
Whole-Genome Gene Expression DASL HT Assay Guide
2
3
4
6
11
12
13
14
1
Chapter 1
Overview
Overview
Introduction
The Illumina® BeadStation, equipped for the Illumina Whole-Genome Gene Expression
DASL® (cDNA-mediated Annealing, Selection, Extension, and Ligation) High
Throughput (HT) Assay, is an efficient and cost-effective gene expression system. The
system combines a novel, highly multiplexed expression assay, BeadChips, and a
precise confocal scanning system (the Illumina HiScan® or iScan System or the Illumina
BeadArray™ Reader) to deliver unparalleled data quality, sample throughput, and cost
savings. The WG-DASL HT Assay incorporates unique methodologies enabling
expression measurements in RNA samples that have undergone partial degradation,
such as RNAs derived from formalin-fixed, paraffin-embedded tissues. The WG-DASL
HT Assay offers parallel analysis of up to 12 samples at once, and is adaptable to high
throughput automation.
The WG-DASL HT Assay offers:
} Sample throughput of 12 samples on a BeadChip
} Highest built-in feature redundancy of any currently available array platform
} Low sample requirements (approximately 100 ng intact RNA or 200 ng partially
degraded RNA per multiplexed assay)
} Quality controlled reagent set for consistent assay performance
2
Part # 15018210 Rev. D
The WG-DASL HT Assay uses biochemistry similar to that in the Illumina DASL
process. RNA is first converted to cDNA through a reverse transcription reaction with
biotinylated primers. The biotinylated cDNA is then annealed to assay oligonucleotides
(oligos), and bound to streptavidin conjugated paramagnetic particles (SA-PMPs). After
the oligo hybridization, mis-hybridized and non-hybridized oligos are washed away.
The hybridized oligos are then extended and ligated. These products form a synthetic
template that is transferred to a PCR reaction containing a fluorescently labeled primer.
The labeled PCR product strand is then isolated and the fluorescent products
hybridized to a whole-genome expression BeadChip. The BeadChip is then washed and
imaged on the HiScan or iScan System or BeadArray Reader.
Whole-Genome Gene Expression DASL HT Assay Guide
3
WG-DASL HT Assay
WG-DASL HT Assay
Overview
RNA Samples
Because the WG-DASL HT Assay begins with a reverse transcription reaction, input
RNA must be free of enzymatic inhibitors such as guanidine or formamide. The RNA
from tissue or cell samples is purified using any standard method, followed by
resuspension in DEPC-treated water. The WG-DASL HT Assay can accept intact total
RNAs in concentrations ranging from 20–100 ng/µl. Lower levels of RNA input
decrease reproducibility among replicates, and are not conducive to optimal assay
performance.
Partially Degraded RNAs
The WG-DASL HT Assay can also be used to monitor gene expression in partially
degraded RNAs, such as those derived from formalin-fixed, paraffin embedded (FFPE)
tissues. For these RNAs, the WG-DASL HT Assay performs best with FFPE-derived
RNAs ranging from 40 to 200 ng/µl, to compensate for the reduced abundance of intact
target sequences.
Recommended Purification Kit
The method used for purification of RNA derived from FFPE tissues substantially
impacts both the degree of RNA degradation and the performance of the RNA in the
WG-DASL HT Assay. Illumina recommends the High Pure RNA Paraffin Kit from
Roche Applied Science.
NOTE
In our experience, the Roche kit results in superior quality RNA as
compared to other commercially available kits for RNA preparation
from FFPE samples.
In brief, RNA purification using the High Pure RNA Paraffin Kit includes these steps:
4
1
FFPE tissues are cut into 5 µm sections, then deparaffinized.
2
Sections are extracted in ethanol, then homogenized by overnight incubation in
Proteinase K.
3
Nucleic acids are bound to a glass fiber filter in the presence of guanidine salts.
4
Bound nucleic acids are washed, and RNA is preferentially eluted.
Part # 15018210 Rev. D
Residual DNA is digested using DNase I, followed by an additional Proteinase K
digestion.
6
The RNA is bound to another glass fiber filter, washed, and eluted.
7
RNA yield is measured and the RNA is stored at -80°C.
Illumina recommends strict adherence to the High Pure RNA Paraffin Kit protocol.
Based on our experience, important parameters include the following:
} Paraffin sections should not exceed 5 µm thickness, to allow adequate penetration
by Proteinase K.
} Proteinase K should be freshly prepared. Frozen aliquots of Proteinase K are
acceptable only if they have been stored for less than 1 month.
} Freshly cut sections are preferred, but sections may be stored for up to 1 week in
xylene at room temperature. The xylene should be replaced before ethanol
extraction.
} RNA yields are higher if 4 or 5 thin sections are pooled into one tube for RNA
purification.
} Complete homogenization of the tissue during the first proteinase K digestion is a
good predictor of adequate RNA yield.
Storing Paraffin Sections
In accumulating paraffin sections for batch RNA extraction, store sections in xylene,
rather than exposed to air. Sections may be stored in xylene for up to 1 week, then
washed in fresh xylene to begin the RNA extraction with the High Pure RNA Paraffin
Kit.
Whole-Genome Gene Expression DASL HT Assay Guide
5
RNA Samples
5
Overview
WG-DASL HT Assay Workflow
This section describes the overall Illumina WG-DASL HT Assay workflow.
Figure 1 WG-DASL HT Assay Workflow
6
Part # 15018210 Rev. D
The assay starts by reverse transcribing sufficient RNA with a SUR enzyme (Master
Mix cDNA Synthesis for Single Use 3) from each individual sample to be used in the
WG-DASL HT Assay.
Figure 2 Reverse Transcribe RNA with SUR enzyme
See Make Single-Use RNA (SUR) Plate on page 60.
Hybridize cDNA to Oligos (Make ASE)
The WG-DASL HT Assay monitors gene expression by targeting sequences with
chimeric-oligos containing universal PCR amplification primer sites. Two assay-specific
oligos (ASOs) are used to assay each transcript: an upstream-specific oligo (USO) and a
downstream-specific oligo (DSO), each of which contains a universal PCR priming site
and a gene-specific sequence that complements a corresponding capture sequence on
the BeadChip.
29,285 unique assay probes are used, corresponding to up-to-date content derived from
the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq)
database (Release 38 (Nov 7, 2009).
In this process, the biotinylated cDNA is annealed to the query ASOs. This mixture is
bound to streptavidin-conjugated paramagnetic particles (SA-PMPs) to select the
cDNA/oligo complexes.
Figure 3 Hybridize cDNA to Assay Oligonucleotides
Whole-Genome Gene Expression DASL HT Assay Guide
7
WG-DASL HT Assay Workflow
Reverse Transcribe RNA (Make SUR)
Overview
See Make Assay-Specific Extension (ASE) Plate on page 63.
Assay-Specific Primer Extension (Add MEL)
cDNA templates are hybridized with the set of ASOs that corresponds to all the targeted
transcripts. After the oligo annealing, mis-hybridized and non-hybridized oligos are
washed away. A polymerase is then added, causing the USOs to undergo extension (i.e.,
second-strand cDNA synthesis) and ligation to its corresponding DSO, thereby creating
a template for PCR. The USOs are extended only if their 3’ bases are complementary to
the cognate sequence in the cDNA template.
Figure 4 Extend Assay-Specific Primers
See Add MEL on page 69.
Universal PCR (Make, Inoc, Cycle PCR)
Because all query oligos share the same universal primer landing sites, the cDNA
templates are all amplified with a pair of common PCR primers. The primer on the
strand that is complementary to the array is fluorescently labelled.
8
Part # 15018210 Rev. D
WG-DASL HT Assay Workflow
Figure 5 Universal PCR
See:
} Make PCR Plate on page 70
} Inoculate PCR Plate on page 72
} Thermal Cycle PCR Plate on page 76
Bind PCR Product
After PCR amplification, the labelled, single-stranded product is prepared for
hybridization to the BeadChip.
Figure 6 Bind PCR Product
See Bind PCR Products on page 77.
Whole-Genome Gene Expression DASL HT Assay Guide
9
Overview
Hybridize Dye-Labelled Strand (Make, Precip and Wash INT, Hyb
BeadChip)
The labelled strand is hybridized to the bead on the BeadChip containing the
complementary gene-specific sequence.
Figure 7 Hybridize Strand to BeadChip
See:
} Make Intermediate (INT) Plate on page 80
} Hybridize BeadChip on page 87
Wash, Image BeadChip
The Illumina iScan System or BeadArray Reader measures fluorescence intensity at
each addressed bead location. The intensity of the signal corresponds to the quantity of
the respective transcript in the original sample.
See:
} Wash BeadChip on page 95
} Image BeadChip on page 111
10
Part # 15018210 Rev. D
The 12-sample BeadChip platform is composed of individual arrays manufactured on a
microscope slide-shaped substrate. Each individual array on the BeadChip holds
thousands to tens of thousands of different oligonucleotide probe sequences that are in
turn attached to 3-micron beads assembled into the micro-wells of the BeadChip
substrate. Because the micro-wells outnumber probe sequences, multiple copies of each
bead type are present in the array. This built-in redundancy improves robustness and
measurement precision. The BeadChip manufacturing process includes hybridizationbased quality control of each array feature, allowing consistent production of highquality, reproducible arrays.
Whole-Genome Gene Expression DASL HT Assay Guide
11
BeadChips
BeadChips
Overview
HiScan, iScan, BeadArray Reader, AutoLoader and
AutoLoader2
BeadChips are imaged using the Illumina HiScan or iScan System or BeadArray Reader.
Each of these is a high-resolution laser imager that scans BeadChips and creates an
image file for each channel. The HiScan or iScan System incorporate advanced optics
and sensors to support higher throughput than the BeadArray Reader, while providing
equally high data quality.
The iScan Control Software, also known as GenomeScan (or BeadScan, for BeadArray
Reader), determines intensity values for each bead type and creates data files.
GenomeStudio® uses this data file in conjunction with the individual manifest file
(*.bgx) to analyze the data from the assay.
Loading and unloading of BeadChips into the HiScan or iScan System or BeadArray
Reader can be automated with the optional AutoLoader2 or AutoLoader respectively.
Both AutoLoaders support unattended processing by placing BeadChips carriers in the
imaging system’s tray, so that it can scan the BeadChips. Features include:
Table 1 AutoLoader and AutoLoader2 Features
AutoLoader
Integrated with iScan Control Software
12
AutoLoader2
X
Integrated with BeadScan software
X
Integrated with Illumina LIMS
X
X
Email alert system
X
X
Single-reader or dual-reader configuration
X
X
Number of BeadChips supported per
carrier
2
4
Number of carriers processed at a time
20
48
Part # 15018210 Rev. D
GenomeStudio, Illumina’s new integrated data analysis software platform, provides a
common environment for analyzing data obtained from microarray and sequencing
technologies. Within this common environment, or framework, the GenomeStudio
software modules allow you to perform application-specific analyses.
The GenomeStudio Gene Expression Module is an application for analyzing mRNA
expression data from scanned microarray images collected from systems such as the
Illumina HiScan or iScan System or BeadArray Reader. Experiment performance is
based on built-in controls that accompany each experiment. GenomeStudio Gene
Expression Module results can be exported and analyzed by most standard gene
expression analysis programs. You can perform these analyses on individual arrays or
on groups of arrays treated as replicates.
Data analysis features of the GenomeStudio Gene Expression Module include:
} Choice of assay analysis within a single application
} Data tables for information management and manipulation
} Plotting and graphing tools
} Whole-genome display of sample data in the IGV (Illumina Genome Viewer)
} Data visualization of one or more samples in the ICB (Illumina Chromosome
Browser)
} Data normalization
} Custom report file formats
} Gene expression and differential expression analysis
} Outlier removal for negative controls
} Ability to combine/merge methylation data into a gene expression project
} Ability to combine/merge mRNA data into a miRNA project
} Data imputation for missing probes on an array
} Assay-specific controls dashboards
For feature descriptions and instructions on using the GenomeStudio platform to
visualize and analyze miRNA data, see the GenomeStudio Framework User Guide and the
GenomeStudio Gene Expression Module User Guide.
Whole-Genome Gene Expression DASL HT Assay Guide
13
GenomeStudio
GenomeStudio
Overview
Illumina Lab Protocols
Illumina lab protocols are designed to promote efficiency and minimize the risk of
contamination. Chapter 2 Standard Operating Procedures describes the standard
operating procedures and tools for an Illumina assay lab and explains how to set up
and maintain separate pre- and post-PCR areas.
For instructions on how to perform the WG-DASL HT Assay protocol on BeadChips, see
Chapter 3 WG-DASL HT Assay Lab Protocols.
14
Part # 15018210 Rev. D
Chapter 2 Standard Operating Procedures
Chapter 2
Standard Operating
Procedures
Introduction
Acronyms
Lab Setup
Lab Maintenance
Safety Precautions
Best Practices
RNase-Free Techniques
Standard Lab Procedures
Tracking Tools
Equipment, Materials, and Reagents
Whole-Genome Gene Expression DASL HT Assay Guide
16
17
20
22
24
25
28
29
31
34
15
Standard Operating Procedures
Introduction
This chapter explains standard operating procedures and precautions for operating an
Illumina assay lab. You will also find lists of standard equipment, materials, and
reagents.
The assay protocols described in the rest of this guide assume that you are familiar with
the contents of this chapter, have implemented all the recommendations, and have
obtained all of the requisite equipment, materials, and reagents.
16
Part # 15018210 Rev. D
Acronyms
Acronyms
Table 2 WG-DASL HT AssayAcronyms
Acronym
Definition
AM1
Add MEL 1 Reagent
ASE
Assay-Specific Extension Plate
ASO
Assay Specific Oligo
cDNA
Complementary DNA
DAP
DASL Assay Pool
DASL
cDNA Mediated Annealing, Selection, Extension, and
Ligation
DEPC
Diethyl Pyrocarbonate
DNA
Deoxyribonucleic Acid
DSO
Downstream-Specific Oligo
E1BC
Wash Buffer
EtOH
Ethanol
HCB
Humidity Control Buffer
HT
High Throughput
HTW
High Temperature Wash Buffer
Hyb
Hybridize or Hybridization
HYB
Hybridization Buffer
INT
Intermediate Plate
Whole-Genome Gene Expression DASL HT Assay Guide
17
Standard Operating Procedures
Acronym
IP1
Inoc PCR 1 Reagent
MCS4
Master Mix cDNA Synthesis for Single Use 4
MEL
Master Mix for Extension/Ligation Reagent
MH1
Make Hyb 1 Reagent
MPB
Magnetic Particle B Reagent
NaOH
Sodium Hydroxide
OB1
Oligo Hybridization & DNA Binding Buffer 1 Reagent
PB1
Reagent used to prepare BeadChips for hybridization
PCR
Polymerase Chain Reaction Plate
PMPs
Paramagnetic Particles
PS1
QRNA
RNA
RNase
18
Definition
Precipitation Solution Reagent
RNA Quantification
Ribonucleic Acid
Ribonuclease
RTE
Reverse Transcriptase Enzyme
SCM
Single Color Master Mix
SDS
Sodium Dodecyl Sulfate
SUR
Single-Use RNA Plate
UB1
Universal Buffer 1 Reagent
UB2
Universal Buffer 2 Reagent
Part # 15018210 Rev. D
Definition
UDG
Uracil DNA Glycosylase
USO
Upstream-Specific Oligo
WG-DASL
XC4
xg
Acronyms
Acronym
Whole-Genome Gene Expression DASL
XStain BeadChip Solution 4
Multiple of Gravitational Acceleration
Whole-Genome Gene Expression DASL HT Assay Guide
19
Standard Operating Procedures
Lab Setup
Lab setup procedures should be performed for WG-DASL HT Assay labs.
Separate Pre- and Post-PCR Areas
The WG-DASL HT Assay uses a PCR process to amplify specific sample sequences. The
laboratory space where pre-PCR processes (including sample extraction, quantification
and normalization) are performed should be physically separated from the laboratory
space where amplified products are made and processed (post-PCR processes).
Prevent PCR Product Contamination
Unless sufficient caution is exercised, PCR products may contaminate reagents,
instrumentation, and samples, causing inaccurate and unreliable results. PCR product
contamination can shut down lab processes and significantly delay resumption of
normal operations.
If possible, perform the pre-PCR processes in a separate, dedicated laboratory space.
CAUTION
It is imperative to establish procedures for preventing PCR product
contamination before working in the lab.
Dedicated Equipment and Supplies
Dedicate separate sets of instruments (pipettes, centrifuges, oven, heat block, etc.) to the
pre-PCR and post-PCR areas. Never share the instruments between areas.
Follow these rules to avoid contaminating the pre-PCR area:
} Never use the same sink to wash pre-PCR and post-PCR reservoirs.
} Never share the same water purification system for pre-PCR and post-PCR
processes.
} Store all assay protocol supplies in the pre-PCR area, and transfer to the post-PCR
area as needed.
20
Part # 15018210 Rev. D
To minimize errors in preparing 0.1N NaOH fresh each day, prepare it in large batches
and aliquot it into 50 ml sealed tubes. These aliquots may be stored up to 6 months at
2° to 8°C and used in the protocol as needed. Once you open an aliquot, use it on the
same day that it was opened. Discard any reagent that is left at the end of the day.
FIFO
It is important to keep a ‘first in, first out’ or FIFO system for reagents. Rotating the
stock of the remaining reagents will help to avoid accidentally using expired reagents.
Whole-Genome Gene Expression DASL HT Assay Guide
21
Lab Setup
Prepare Batches of 0.1N NaOH
Standard Operating Procedures
Lab Maintenance
Standard lab maintenance procedures should be performed for WG-DASL HT Assay
labs.
Daily and Weekly Cleaning
CAUTION
To prevent sample or reagent degradation, ensure all sodium
hypochlorite (bleach) vapors have fully dissipated before starting any
processes.
Post-PCR Area
Reducing the amount of product in the post-PCR area helps reduce the risk of
contamination in the pre-PCR area.
Identify post-PCR area “hot spots” that pose the highest risk of contamination, and
clean these items daily with a solution of 0.5% sodium hypochlorite (10% bleach).
Typical hot spots include:
} Bench space
} Door handles
} Refrigerator/freezer door handles
} Computer mouse
} Keyboards
} Centrifuges
} Vortexers
} Thermal cyclers
Once a week, thoroughly clean the entire post-PCR area, including all of the bench tops
and instruments that are not cleaned daily. Mop the floors with a 0.5% sodium
hypochlorite (10% bleach) solution as well.
Provide training for personnel responsible for cleaning the lab areas so that they know
how to prevent PCR product contamination.
22
Part # 15018210 Rev. D
Establish a daily and weekly cleaning schedule for the pre-PCR area similar to the one
in post-PCR. This will help to eliminate product that may have entered the pre-PCR
area.
Identify high-risk pre-PCR items such as the ones listed below, and clean them with a
0.5% sodium hypochlorite (10% bleach) solution each morning before beginning any
pre-PCR processes:
} Bench tops
} Door handles
} Refrigerator/freezer door handles
} Computer mouse
} Keyboards
Once a week, thoroughly clean the entire pre-PCR area, including all of the bench tops
and instruments that are not cleaned daily. Mop the floors with a 0.5% sodium
hypochlorite (10% bleach) solution as well.
Provide training for personnel responsible for cleaning the lab areas so that they know
how to prevent PCR product contamination.
Whole-Genome Gene Expression DASL HT Assay Guide
23
Lab Maintenance
Pre-PCR Area
Standard Operating Procedures
Safety Precautions
CAUTION
The protocols described in this guide should be performed by qualified
laboratory personnel only. Exercise caution when handling biological
samples to avoid cross-contamination among pre-amp and post-amp
samples.
WARNING
This protocol involves the use of an aliphatic amide that is a probable
reproductive toxin. Personal injury can occur through inhalation,
ingestion, skin contact, and eye contact. Dispose of containers and any
unused contents in accordance with the governmental safety standards
for your region. For more information, see the MSDS for this kit, which
is available at http://www.illumina.com/msds.
References
Please visit http://www.illumina.com/msds to see the latest material data safety sheets.
CAUTION
Please refer to governmental and facility safety standards applicable to your site.
24
Part # 15018210 Rev. D
To optimize your data and minimize errors and waste, read and follow best practices
whenever performing the WG-DASL HT Assay protocols.
Items Falling to the Floor
The floor is contaminated with PCR product transferred on the shoes of individuals
coming from the post-PCR area. Therefore, treat anything falling to the floor as if it were
contaminated.
Disposable items falling to the ground, such as empty tubes, pipette tips, gloves, or lab
coat hangers should be thrown away at the end of the day or at the completion of the
assay. During the assay, never touch any items that have fallen to the ground.
Non-disposable items falling to the ground, such as pipettes or important sample
containers, should be immediately and thoroughly cleaned with a 0.5% sodium
hypochlorite (10% bleach) solution to remove product contamination.
Use a 0.5% sodium hypochlorite (10% bleach) solution to clean any lab surface that has
contacted the contaminated item.
Individuals handling anything that has fallen to the floor, disposable or not, must
throw away their lab gloves and put on a new pair.
Applying Barcode Labels to Plates
As a convention, apply barcode labels to the right side of plate (column #12 end).
Reagent Reuse
Never reuse excess reagents. Discard according to your facility requirements.
Handling Cap Mats
Orient the cap mat so that A1 on the cap matches A1 on the plate.
CAUTION
To prevent evaporation and spills, which could lead to assay variability
and cross-contamination, ensure that all 96 caps are securely seated in
the wells.
Whole-Genome Gene Expression DASL HT Assay Guide
25
Best Practices
Best Practices
Standard Operating Procedures
When you remove a cap mat, do so carefully and slowly to avoid splashing the
contents. Set the cap mat aside, upside down, in a safe location for use later in the
protocol. When you place the cap mat back on the plate, be sure to match it to its
original plate and orient it correctly.
Pipette Carefully
Perform all pipette dispenses carefully and slowly to avoid creating turbulence within
the plate wells and Flow-Through Chambers.
BeadChip Handling
Avoid touching the BeadChip anywhere other than at the barcode end or on the edges.
Preparing Fewer than 96 Samples
Each reagent tube supplied for your WG-DASL HT Assay contains enough volume to
process 96 samples at once, using a multichannel pipette and a reservoir.
When processing fewer than 96 samples using a reagent reservoir, dead volume and
pipetting error losses can increase. To ensure accurate reagent volume for all samples,
single-pipette reagent into each well.
When using reagents to process fewer than 96 samples, it is best practice to aliquot the
frozen reagents to minimize the number of freeze/thaw cycles. Multiple freeze/thaw
cycles could potentially impact the quality of data generated by your assay.
Uracil DNA Glycosylase & dUTP
You can add Uracil DNA Glycosylase (UDG) to the PCR master mix to help prevent
PCR product contamination.
You can purchase the WG-DASL HT Assay with or without UDG.
The PCR master mix contains a balanced mixture of the following items:
} Universal PCR primers
} PCR buffer
} dUTP
} dATP
} dGTP
26
Part # 15018210 Rev. D
The dUTP is incorporated into the post-PCR products. UDG targets dUTP for specific
degradation in subsequent PCR reactions, thus reducing the chance for PCR products to
contaminate the Pre-PCR products.
The kit does not contain a thermostable DNA polymerase. We recommend that you add
an Illumina-recommended DNA polymerase (Titanium Taq DNA polymerase) to the
PCR master mix before using the master mix in the WG-DASL HT Assay.
Whole-Genome Gene Expression DASL HT Assay Guide
27
Best Practices
} dCTP
Standard Operating Procedures
RNase-Free Techniques
Take the following precautions while working with RNA:
} Wear gloves throughout experiments to prevent contamination from the RNases
found on most human hands.
} Use a solution of 0.1% SDS and 0.1N NaOH to decontaminate surfaces that are
potentially contaminated with RNase.
} Change gloves after touching skin (e.g., your face or hair), door knobs, common
surfaces, or other surfaces that have not been decontaminated.
} Use a dedicated set of pipettes for RNA work.
} Use freshly opened aerosol filter tips and tubes that are tested and guaranteed to be
RNase-free.
} Use RNase-free chemicals and reagents, and DEPC-treated water.
} Designate a “low-traffic” area of the lab that is away or shielded from air vents or
open windows.
} Do not leave RNase-free containers open when engaged in conversation.
28
Part # 15018210 Rev. D
Running the WG-DASL HT Assay protocols requires that you perform some basic setup
and familiarize yourself with standard procedures.
Calibrating and Using the Vortexer
Calibration
The vortexer’s displayed speed may vary from the actual vortex speed. Illumina
recommends using a digital stroboscope to determine the actual vortex speed. Once you
have determined the actual vortex speed, record it along with the displayed speed and
use these measurements for reference throughout the assay.
1
Set the digital stroboscope display speed to 1600 rpm.
2
Turn the vortexer on and adjust the vortexer speed until the actual speed reaches
1600 rpm.
3
Record the displayed vortexer speed and note down that it represents an actual
speed of 1600 rpm.
4
Use the same method described above to determine the displayed speed for the
actual vortex speeds of 1,800, 2,000, and 2,200 rpm. These vortex speeds are used in
the WG-DASL HT Assay.
5
Place a label on the vortexer with the calibration information. The following is an
example of a vortexer calibration label you can create and affix to your vortexer.
Table 3 Vortexer Calibration Speeds
Display Speed
Actual Vortex Speed
Calibration Date
1450 rpm
1600 rpm
xx-xx-xx
1625 rpm
1800 rpm
xx-xx-xx
1800 rpm
2000 rpm
xx-xx-xx
1975 rpm
2200 rpm
xx-xx-xx
Whole-Genome Gene Expression DASL HT Assay Guide
29
Standard Lab Procedures
Standard Lab Procedures
Standard Operating Procedures
Using Velcro Straps for Security
1
Replace the vortexer’s top tray, which is used to secure the plate, with three Velcro
straps for securing 96-well plates, as follows:
a Cut six 2-inch lengths of adhesive backed Velcro hooks. Attach these hooks to
the underside of the shaker platform bottom tray.
b Cut three 20-inch lengths of Velcro loops. Use these as straps to secure plates
onto the vortexer platform.
Figure 8 Velcro Straps on Vortexer Platform
CAUTION
Whenever you use the vortexer, secure the plates with the Velcro straps.
Balancing the Centrifuge
Whenever you centrifuge plates, place a balance plate opposite each plate being
centrifuged. The weights should be as similar as possible.
Cleaning and Calibrating Pipettes
Ensure that pipettes are properly calibrated, clean, and decontaminated. Where possible,
use a multi-channel pipette to dispense reagents.
30
Part # 15018210 Rev. D
Illumina provides the following tools for sample tracking and guidance in the lab:
} Experienced User Card – guides you through the protocols.
} Lab Tracking Form – allows you to map RNA samples from plate to plate, or from
plate to BeadChip. Record the position of DAPs in the plate wells, and the barcode
of each reagent used in the protocol.
} Sample Sheet template – used to record information about your samples for later
use in data analysis.
Lab Tracking Form
Create a copy of the lab tracking form for each run. Use it to track information such as
operator ID, start and stop times, reagent lot numbers and barcodes, and to record
which samples are placed on which arrays. This form can be filled out and saved
online or printed and filled in by hand.
NOTE
Lab Tracking Forms can be downloaded via
http://www.illumina.com/documentation.
Sample Sheet
To effectively track your samples and assay, Illumina recommends you create a sample
sheet. The sample sheet will later be used by the GenomeStudio application for data
analysis. For instructions on data analysis, see the GenomeStudio Gene Expression Module
User Guide. Create your sample sheet according to the following guidelines:
Table 4 Sample Sheet Guidelines
Column Description
Heading
Sample_ Name of the sample. Used only for display in the table.
Name If not user-specified, the GenomeStudio application will
assign a default sample name, concatenating the sample
plate and sample well names.
Example: S12345
Whole-Genome Gene Expression DASL HT Assay Guide
Optional (O) or
Required (R)
O
31
Tracking Tools
Tracking Tools
Standard Operating Procedures
Column
Heading
Description
Optional (O) or
Required (R)
The well containing the specific sample in the 96-well RNA
O
plate.
Example: A01
O
Sample_ User-specified name for the plate containing RNA samples.
Plate Used only for display in the table.
Example: XS0005623-SUR
O
Sample_ User-specified name of the sample group. If the Sample_
Group Group is missing, GenomeStudio creates one group and
assigns it a default name.
Example: Group 1
O
Pool_ID Name of the DAP.
Example: XS0007005-DAP
R
Sentrix_ BeadChip ID.
ID Example: 1529221001
R
Sentrix_ The BeadChip section to which the sample is hybridized.
Position Example: A1
Notes Your sample sheet header may contain whatever information you choose.
Your sample sheet may contain any number of columns you choose.
Your sample sheet must be in a comma-delimited (.csv) file format.
Save the sample sheet under any name you wish; for example, the user-defined
experiment name.
Sample_
Well
The following is an example of the Sample Sheet format. The electronic sample sheet
template can be downloaded via http://www.illumina.com/documentation.
32
Part # 15018210 Rev. D
Tracking Tools
Figure 9 Sample Sheet
The Sentrix_Position name corresponds to the *.idat file naming conventions for the
format being analyzed (BeadChip).
Whole-Genome Gene Expression DASL HT Assay Guide
33
Standard Operating Procedures
Equipment, Materials, and Reagents
The equipment, materials, and reagents listed in this section are all required for the WGDASL HT Assay. Remember to maintain separate stocks, as necessary, for pre- and
post-PCR areas.
Equipment
Illumina-Supplied Equipment
To perform the WG-DASL HT Assay, you need either a HiScan, iScan or BeadArray
Reader System and either the Universal Starter Kit or both the GoldenGate and Gene
Expression Option kits. For details on current configuration and kit options, consult
your Illumina account representative or the latest Illumina product guide (available at
http://www.illumina.com/literature).
Table 5 Illumina Equipment Options for the WG-DASL HT Assay
Item
Illumina Catalog #
HiScan System
or
iScan System
SY-103-1001
AutoLoader2 (optional)
Single-Scanner, SY-201-1001
Dual-Scanner, SY-201-1002
Universal Starter Kit
or, both of the following:
SE-101-1006 (110V)
SE-101-1007 (220V)
GoldenGate Product Option Kit
and
SY-101-1001
SE-101-1001 (110V)
SE-101-1002 (220V)
Gene Expression (IVT) Product Option Kit
SE-101-1003 (110V)
SE-101-1004 (220V)
34
Part # 15018210 Rev. D
The following user-supplied equipment is required.
Table 6 User-Supplied Equipment
Item
Source
8-channel precision pipettes (5 µl to 200 µl)
General lab supplier
96-well thermal cycler with heated lid
General lab supplier
Aerosol filter pipette tips
General lab supplier
[Optional] Fluorometer)
Molecular Devices, Gemini XS or
XPS,
www.moleculardevices.com
Heat sealer (Combi Heat Sealing Unit)
Matrix Tech Corp.,
catalog # ab-0384/110,
www.matrixtechcorp.com
Heat sealer adapter plate
(Combi Heat Sealing Unit adapter plate)
ABgene, catalog # 0563,
www.abgene.com
Lab coats
General lab supplier
Microtiter plate centrifuges (2, capable of 8–3000 xg,
4°C)
Note: Make sure this is 8-3000 xg, not 8-3000 rpm
General lab supplier
Orbital shaker
General lab supplier
Protective gloves
General lab supplier
Safety glasses
General lab supplier
Serological pipettes (50 ml)
General lab supplier
Stopwatch/timer
General lab supplier
Stroboscope
Cole-Parmer, A-87700-06,
Whole-Genome Gene Expression DASL HT Assay Guide
35
Equipment, Materials, and Reagents
User-Supplied Equipment
Standard Operating Procedures
Item
Source
www.coleparmer.com
Tachometer/stroboscope, combination optical
Cole-Parmer, catalog # A-87700-06,
www.coleparmer.com
Thermal Cycler
General lab supplier
Tube vortexer
General lab supplier
Materials
The following user-supplied materials are required.
Table 7 User-Supplied Materials
36
Item
Source
96-well skirted microplates, 8x12 well array
MJ Research, catalog #
MSP-9601, www.mjr.com
ABgene, catalog # AB-0800,
www.abgene.com
96-well V-bottom plates
VWR International, catalog #
29444-102,
www.vwr.com
96-well black, flat-bottom Fluotrac 200 plates
Greiner, catalog # 655076,
www.gbo.com
Absorbent pads
General lab supplier
Aluminum foil
General lab supplier
Canned air (such as Aerosol Whoosh-Duster)
VWR International, catalog #
16650-027,
www.vwr.com
Part # 15018210 Rev. D
Source
Cap mats (for deep-well plates, polypropylene, pierceable,
non-autoclavable)
ABgene, catalog # AB-0566,
www.abgene.com
Costar* 96-well plates, polypropylene, non-sterile, without
lids, V-bottom
VWR International, catalog #
29444-102,
www.vwr.com
Filter plate adaptor
Centrifuge Alignment Frames,
Millipore,
catalog # MACF09604,
www.millipore.com
Filter plates
Millipore, catalog #
MAHV-N45 10/50,
www.millipore.com
[Optional] Foil stripper
ABgene, catalog # AB-0592,
www.abgene.com
Microplate clear adhesive film
(2 mil sealplate adhesive film, non-sterile)
Phenix Research Products,
catalog # LMT-SEAL-EX,
www.phenix.com
Microplate heat seals
(heat sealing, EZ peel, clear for polypropylene &
polystyrene plates)
ABgene, catalog # AB-0812,
www.abgene.com
Microseal “A” PCR plate-sealing film
MJ Research, catalog #
MSA-5001, www.mjr.com
Microseal “F” film
MJ Research, catalog #
MSF-1001, www.mjr.com
Non-sterile solution basins (55 ml)
Labcor Products, Inc., catalog #
730-001,
www.labcorproducts.com
VWA International, catalog #
21007-970,
www.vwa.com
Whole-Genome Gene Expression DASL HT Assay Guide
37
Equipment, Materials, and Reagents
Item
Standard Operating Procedures
Item
Source
Sterile plastic containers (100 ml capacity)
General lab supplier
Sterile reservoirs (quarter reservoir)
Beckman Coulter, catalog #
372790,
www.beckmancoulter.com
Thermo-Seal Heat-sealing foil sheets
ABgene, catalog # AB-0559,
www.abgene.com
Tweezers
General lab supplier
Reagents
Illumina-Supplied Reagents
This section describes the consumables in the WG-DASL HT Assay kits. For exact
details on current configuration and kit options, consult your Illumina account
representative or the latest Illumina product catalog. For ordering information, see the
appropriate data sheet at http://www.illumina.com/literature.
Table 8 WG-DASL HT Assay Kits
Kit Name
38
Catalog #
WG-DASL Pre 1 MCS4
DA-905-0024
WG-DASL Pre 1 MCS4 w/UDG
DA-905-1024
WG-DASL Pre 1 MCS4
DA-905-0096
WG-DASL Pre 1 MCS4 w/UDG
DA-905-1096
With
UDG
X
X
Samples
Sets of
Beadchips
24
2
24
2
96
8
96
8
Part # 15018210 Rev. D
Equipment, Materials, and Reagents
Table 9 WG-DASL HT Assay Kit Contents
Item
Quantity
WG-DASL HT Assay Pool (DAP)
(Based on up-to-date content derived from the NCBI RefSeq
Database (Release 38 (Nov 7, 2009))
—
Add MEL 1 Reagent (AM1)
15 ml
Barcode labels for the QRNA, SUR, ASE, PCR, and INT plates
3 X each
BeadChip Solution (E1BC)
5 ml
High Temperature Wash Buffer (HTW)
500 ml
HumanHT-12 v4 BeadChips
12 samples each
with 29,285 assays
per sample
Humidity Control Buffer (HCB)
2.8 ml
Hybridization Buffer Reagent (HYB)
1.7 ml
Inoc PCR Reagent (IP1)
3.8 ml
Magnetic Particle B Reagent (MPB)
2.2 ml
Make Hyb 1 Reagent (MH1)
3.5 ml
Master Mix for Extension Ligation Reagent (MEL)
4.0 ml
Master Mix cDNA Synthesis for Single Use 4 (MCS4)
288 µl
Oligo Hybridization & DNA Binding Buffer 1 Reagent (OB1)
3.5 ml
Precipitation Solution Reagent (PS1)
30 ml
Reagent used to prepare BeadChips for hybridization (PB1)
950 ml
Reverse Transcriptase Enzyme (RTE)
32 µl
Single Color Master Mix Reagent (SCM)
3.2 ml
Whole-Genome Gene Expression DASL HT Assay Guide
39
Standard Operating Procedures
Item
Quantity
Universal Buffer 1 Reagent (UB1)
25 ml
Universal Buffer 2 Reagent (UB2)
300 ml
Uracil DNA Glycosylase (UDG)
not included
in all kits
XStain BeadChip Solution 4 (XC4)
350 ml when
reconstituted with EtOH
User-Supplied Reagents
The following user-supplied reagents are required.
Table 10 User-Supplied Reagents
Item
Source
0.1N NaOH (sodium hydroxide)
Sigma-Aldrich, catalog #
S0899,
www.sigmaaldrich.com
2-propanol
General lab supplier
70% and100% EtOH (Ethanol)
General lab supplier
0.5% sodium hypochlorite (10% bleach)
General lab supplier
cDNA Synth MCS4 Single-Use Kit
(for Pre-Qualify cDNA Samples (Optional):
96 samples, or
576 samples
Illumina-recommended DNA Polymerase
(Titanium Taq DNA polymerase)
40
Illumina, catalog #
DA-950-6010
Illumina, catalog #
DA-950-6020
Clontech, catalog # 639220,
www.clontech.com
Part # 15018210 Rev. D
Source
Illumina-recommended High Pure RNA Paraffin
Kit
Roche Applied Science,
catalog # 03 270 289 001
Quant-iT RiboGreen RNA Assay Kit
Invitrogen, catalog # R11490,
www.invitrogen.com
Whole-Genome Gene Expression DASL HT Assay Guide
Equipment, Materials, and Reagents
Item
41
42
Part # 15018210 Rev. D
Chapter 3 WG-DASL HT Assay Lab Protocols
Chapter 3
WG-DASL HT Assay
Lab Protocols
Introduction
Quantitate RNA (Optional)
Pre-Qualify cDNA Samples (Optional)
Make Single-Use RNA (SUR) Plate
Make Assay-Specific Extension (ASE) Plate
Add Master Mix for Extension & Ligation (MEL)
Make PCR Plate
Inoculate PCR Plate
Thermal Cycle PCR Plate
Bind PCR Products
Make Intermediate (INT) Plate
Precipitate and Wash INT Plate
Hybridize BeadChip
Wash BeadChip
Image BeadChip
GenomeStudio
Whole-Genome Gene Expression DASL HT Assay Guide
44
45
56
60
63
66
70
72
76
77
80
83
87
95
111
112
43
WG-DASL HT Assay Lab Protocols
Introduction
This chapter provides detailed pre- and post-PCR laboratory protocols for preparing
24 samples for BeadChips. If you are preparing fewer samples, scale down the protocols
accordingly. Perform each protocol in the order shown.
The instructions in this chapter assume that you have already familiarized yourself
with Chapter 2 Standard Operating Procedures and have set up the lab area
appropriately.
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
44
Part # 15018210 Rev. D
This process uses the RiboGreen RNA quantitation kit to quantitate RNA samples for
the WG-DASL HT Assay. You can quantitate up to six plates, each containing up to
96 samples. If you already know the concentration, proceed to Make Single-Use RNA
(SUR) Plate on page 60.
Illumina recommends the Quant-iT RiboGreen RNA Assay Kit to quantitate RNA
samples. The RiboGreen assay can quantitate small RNA volumes, and measures RNA
directly. Other techniques may pick up contamination such as small molecules and
proteins. Illumina recommends using a fluorometer because fluorometry provides RNAspecific quantification. Spectrophotometry might also measure DNA and yield values
that are too high.
CAUTION
RiboGreen is susceptible to chemical contaminants. For more
information, see the Invitrogen website (www.invitrogen.com).
Estimated Time
Hands-on time: ~30 minutes
Fluorometer read time: ~5 minutes per plate
Consumables
Item
Quantity
Storage
Quant-iT RiboGreen RNA Assay Kit, containing
RiboGreen quantitation reagent, 20X TE, and
Ribosomal RNA Standard
RNA sample plate
1
2° to 8°C
Supplied
By
User
Up to 96
samples
-80°C
User
Whole-Genome Gene Expression DASL HT Assay Guide
45
Quantitate RNA (Optional)
Quantitate RNA (Optional)
WG-DASL HT Assay Lab Protocols
Item
Quantity
96-well 0.65 ml microtiter plate
1 per 96
See
samples
manufacturer’s
instructions
1 per Std
User
RNA plate
1 per
Sample
RNA plate
1 per
User
RiboGreen
kit
Fluotrac 200 96-well flat-bottom plate
100 ml or 250 ml Nalgene bottle
Storage
Supplied
By
User
Preparation
}
}
}
}
Thaw all reagents to room temperature and then vortex to mix.
Hand-label the microtiter plate “Standard RNA.”
Hand-label one of the Fluotrac plates “Standard QRNA.”
Hand-label the other Fluotrac plate “Sample QRNA.” This plate will contain the
quantitated RNA.
} In the Sample Sheet, enter the Sample_Name (optional) and Sample_Plate for each
Sample_Well.
Make Standard RNA Plate
In this process, you create a Standard RNA plate with serial dilutions of standard
ribosomal RNA in the wells of column 1.
46
1
Add 10 µl 1X TE (supplied in RiboGreen kit at 20X) to B1–H1 in the plate labeled
“Standard RNA”.
2
Add 20 µl ribosomal RNA to well A1.
Part # 15018210 Rev. D
3
Transfer 10 µl from well A1 to well B1. Pipette up and down several times.
4
Change tips. Transfer 10 µl from well B1 to well C1. Pipette up and down several
times.
5
Repeat for wells C1, D1, E1, F1, and G1, changing tips each time. Do not transfer
from well G1 to H1.
Table 11 Concentrations of Standard Ribosomal RNA
RowConcentration
Final Volume in Well
Column
(ng/µl)
(µl)
A1
100
10
B1
50
10
C1
25
10
D1
12.5
10
E1
6.25
10
F1
3.125
10
G1
1.5262
20
H1
0
10
Whole-Genome Gene Expression DASL HT Assay Guide
47
Quantitate RNA (Optional)
Figure 10 Dilution of Ribosomal RNA Standard
WG-DASL HT Assay Lab Protocols
Figure 11 Serial Dilutions of Ribosomal RNA
6
Cover the Standard RNA plate with an adhesive seal.
7
Proceed to Dilute RiboGreen on page 48.
Dilute RiboGreen
The diluted RiboGreen will be added to both the Standard QRNA and Sample QRNA
plates, to make the RNA fluoresce when read with the fluorometer.
1
48
Prepare a 1:200 dilution of RiboGreen into 1X TE, using the kit supplies and a
sealed 100 ml or 250 ml Nalgene bottle wrapped in aluminum foil.
Use 115 µl RiboGreen and 23 ml 1X TE for 1 plate, 215 µl RiboGreen and 43 ml 1X
TE for 2 plates, and so on up to 6 plates.
The following table identifies the volumes needed to produce diluted reagent for
multiple 96-well QRNA plates. For fewer than 96 RNA samples, scale down the
volumes.
Part # 15018210 Rev. D
2
Cap the foil-wrapped bottle and vortex to mix.
Create Standard QRNA Plate with Diluted RiboGreen
In this process you transfer the serial dilutions from the Standard RNA plate into the
Standard QRNA Fluotrac plate and add diluted RiboGreen.
1
Pour the RiboGreen/1X TE dilution into a clean reagent reservoir.
2
Using a multichannel pipette, transfer 195 µl RiboGreen/1X TE dilution into each
well of columns 1 and 2 of the Fluotrac plate labelled “Standard QRNA“.
3
Add 2 µl of each standard ribosomal RNA dilution from the Standard RNA plate to
columns 1 and 2 of the Standard QRNA Fluotrac plate.
Whole-Genome Gene Expression DASL HT Assay Guide
49
Quantitate RNA (Optional)
Table 12 Volumes for RiboGreen Reagents
# QRNA
RiboGreen Volume
1X TE Volume
Plates
(µl)
(ml)
1
115
23
2
215
43
3
315
63
4
415
83
6
615
123
WG-DASL HT Assay Lab Protocols
Figure 12 Standard QRNA Plate with RiboGreen
4
Immediately cover the plate with an adhesive aluminum seal.
5
Proceed to Prepare Sample QRNA Plate with RiboGreen and RNA on page 50.
Prepare Sample QRNA Plate with RiboGreen and RNA
In this process, you create a new Sample QRNA plate that contains RNA sample and
RiboGreen.
50
1
Using a multichannel pipette, transfer 195 µl RiboGreen/1X TE dilution into each
well of columns 1 and 2 of the Fluotrac plate labelled “Sample QRNA“.
2
Add 2 µl of RNA sample to all 96 wells of the Sample QRNA plate. Only the first
two columns will also contain RiboGreen/1X TE dilution.
Part # 15018210 Rev. D
Quantitate RNA (Optional)
Figure 13 Sample QRNA Plate with RiboGreen
NOTE
For fewer than 96 RNA samples, add the diluted RiboGreen reagent into
the number of wells needed.
3
Immediately cover the plate with an adhesive aluminum seal.
4
Proceed to Read QRNA Plate on page 51.
Read QRNA Plate
In this process, you use the Gemini XS or XPS Spectrofluorometer to read the Standard
QRNA and Sample QRNA plates. The spectrofluorometer creates a standard curve from
the known concentrations in the Standard QRNA plate, which you use to determine the
concentration of RNA in the Sample QRNA plates.
1
Turn on the fluorometer. At the PC, open the SoftMax Pro program.
2
Load the Illumina QRNA.ppr file from the installation CD that came with your
system.
3
Select Assays | Illumina | Illumina QRNA.
Whole-Genome Gene Expression DASL HT Assay Guide
51
WG-DASL HT Assay Lab Protocols
Figure 14 Load the Illumina QRNA Protocol in SoftMax Pro
4
Place the Standard QRNA Fluotrac Plate into the fluorometer loading rack with well
A1 in the upper left corner.
5
Click the blue arrow next to Standard RNA.
Figure 15 Select the Standard RNA Screen
6
52
Click Read in the SoftMax Pro interface to begin reading the Standard QRNA Plate.
Part # 15018210 Rev. D
Quantitate RNA (Optional)
Figure 16 Read the Standard QRNA Plate
7
When the software finishes reading the data, remove the plate from the drawer.
8
Click the blue arrow next to Standard Curve to view the standard curve graph.
Whole-Genome Gene Expression DASL HT Assay Guide
53
WG-DASL HT Assay Lab Protocols
Figure 17 View Standard Curve
9
If the standard curve is acceptable, continue with the sample plate. Otherwise, click
Standard Curve again.
10 Place the first Sample QRNA plate in the fluorometer with well A1 in the upper left
corner.
11 Click the blue arrow next to QRNA#1 and click Read.
54
Part # 15018210 Rev. D
Quantitate RNA (Optional)
Figure 18 Read the Sample QRNA Plate
12 When the software finishes reading the plate, remove the plate from the drawer.
13 Repeat steps 9 through 12 to quantitate all Sample QRNA plates.
14 Once all plates have been read, click File | Save to save the output data file (*.pda).
15 When you have saved the *.pda file, click File | Import/Export | Export and export
the file as a *.txt file. You can open the *.txt file in Microsoft Excel for data analysis.
16 Do one of the following:
• Proceed to Pre-Qualify cDNA Samples (Optional) on page 56
• Proceed to Make Single-Use RNA (SUR) Plate on page 60
• Store the quantitated RNA at 2° to 8°C for up to one month.
Whole-Genome Gene Expression DASL HT Assay Guide
55
WG-DASL HT Assay Lab Protocols
Pre-Qualify cDNA Samples (Optional)
This process guides you to determine if it is necessary to run replicates of poor quality
RNA samples. RNAs derived from formalin-fixed, paraffin-embedded (FFPE) tissues are
commonly degraded. The WG-DASL HT Assay can be used for partially degraded
RNAs, but not for entirely degraded RNAs. To obtain a relative measure of RNA quality
prior to WG-DASL HT Assay analysis, samples may be analyzed by qPCR. If your
cDNA does not require pre-qualification, proceed to Make Single-Use RNA (SUR) Plate on
page 60.
The process is based on amplification of a fragment of the highly expressed RPL13A
ribosomal protein gene with detection by SYBR Green. The RPL13A primers amplify a
90 base pair fragment (GenBank accession # NM_012423.2). These primers are designed
to span an intron and should produce a correctly amplified product only from cDNA,
not genomic DNA.
Table 13 Primers for qPCR using SYBR Green Detection
Primer
Sequence
Forward 5' GTACGCTGTGAAGGCATCAA 3'
Reverse 5' GTTGGTGTTCATCCGCTTG 3'
Estimated Time
Hands-on time: ~15 minutes
Incubation time: 10–60 minutes
Consumables
56
Item
Quantity
Storage
MCS4 reagent from cDNA Synth
MCS4 Single-Use Kit
RTE reagent from cDNA Synth MCS4
Single-Use Kit
Total RNA
1 tube per
24 samples
1 tube per
24 samples
200 ng
-15° to -25°C
Supplied
By
User
-15° to -25°C
User
User
96-well 0.2 ml skirted microplate
1 plate per
24 samples
See manufacturer’s
instructions
See manufacturer’s
instructions
User
Part # 15018210 Rev. D
Preparation
} Preheat the heat sealer.
} Preheat a heat block to 42°C and allow the temperature to stabilize.
} Thaw the MCS4 tube to room temperature.
NOTE
Be sure to use RNase-free materials and techniques and change pipette
tips between RNA sample dispenses.
Steps
1
Normalize intact RNA samples to 20–100 ng/µl (or partially degraded RNA
samples to 40-200 ng/µl) with DEPC-treated H2 O.
2
Add 32 µl RTE to 288 µl MCS4 and mix well.
3
Pour the entire contents of the MCS4 and RTE tube mixture into a new, nonsterile,
disposable reservoir.
NOTE
Due to the small volume, you may wish to single-pipette directly out of
the tube.
4
Add 5 µl MCS4 and RTE mixture to each well of the SUR plate that will contain a
normalized RNA sample.
5
Quickly add 5 µl of normalized RNA sample to each well of the SUR plate
containing 5 µl of the MCS4 and RTE mixture. Change tips between RNA sample
dispenses.
6
Seal the SUR plate with a microplate heat seal. Ensure that all wells are completely
sealed.
7
Vortex the sealed plate at 2,300 rpm for 20 seconds.
8
Pulse centrifuge the samples to 250 xg for 1 minute.
CAUTION
It is important to centrifuge the SUR plate to 250 xg before the 42°C
incubation to prevent the wells from drying out.
Whole-Genome Gene Expression DASL HT Assay Guide
57
Pre-Qualify cDNA Samples (Optional)
NOTE
In the Pre-Qualify cDNA protocol, you may use three 8-well strip tubes
instead of a 96-well microplate.
WG-DASL HT Assay Lab Protocols
9
Incubate the SUR plate at room temperature at least 10 minutes (up to 1 hour).
10 Place the SUR plate on the preheated heat block and close the lid to reduce
condensation on the plate seal. Incubate at 42°C for 1 hour.
11 Pulse centrifuge the SUR plate to 250 xg for 1 minute to remove condensation from
the walls of each well.
NOTE
If you are not proceeding to the qPCR step on the same day, cDNA
samples can be stored after the 42°C incubation for up to four hours at
2° to 8°C or overnight at -15° to -25°C.
12 Assemble the duplicate PCR reactions appropriate for your qPCR instrument using
SYBR Green detection and 1 µl of a 1:10 dilution of the cDNA product as a
template.
For example, if you are using the ABI Prism 7900HT Sequence Detection System
(Applied Biosystems), the reaction should contain:
• 5 µl SYBR Green PCR Master Mix • 1 µl diluted cDNA product
• 250 nM each forward and reserve primers
The total reaction volume should be 10 µl.
13 Cycle according to the manufacturer’s instructions for your instrument, and include
a dissociation curve, if available, to assess the uniformity of the PCR product. For
example, place the sealed plate into the thermal cycler and run the thermal cycler
program as follows:
Temperature
95°C
94°C
Time
12 minutes
20 seconds
54°C
20 seconds
72°C
1 minute
Illumina routinely measures a crossover threshold (Ct) value of about 19 cycles for
Universal Human Reference Total RNA (Stratagene, catalog # 740000) using
RPL13A primers and the reagents listed above with a detection threshold set at 0.2
58
Part # 15018210 Rev. D
Figure 19 qPCR vs. WG-DASL: RPL13A 90nt
If you use other qPCR systems, you may expect a variation from these values, but in
general, if the difference in cycle number at detection between cryo-preserved and
paraffin-derived RNAs exceeds 7 cycles, then running technical replicates for those
samples is recommended.
Whole-Genome Gene Expression DASL HT Assay Guide
59
Pre-Qualify cDNA Samples (Optional)
for the ABI Prism. We then compare the WG-DASL HT Assay self-reproducibility
(r2), and qPCR Ct values.
When the difference in Ct value between the UHR intact RNA sample and FFPE
samples increases beyond seven, reproducibility for the WG-DASL HT Assay
declines. As a result, Illumina recommends that you perform a pre-qualification
qPCR screen with RPL13A for all FFPE samples along with an intact RNA sample
as a reference. If ∆Ct > 7 between the reference and any of the FFPE samples, then
running technical replicates for those samples is recommended to ensure the WGDASL HT Assay results will be reliable.
WG-DASL HT Assay Lab Protocols
Make Single-Use RNA (SUR) Plate
This process reverse transcribes sufficient RNA from each individual sample to be used
once in the WG-DASL HT Assay.
Figure 20 Make SUR
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~15 minutes
Incubation time: One 10-minute incubation, one 1-hour incubation
Consumables
Item
Quantity
Storage
MCS4 reagent
1 tube per
24 samples
1 tube per
24 samples
24
1 plate per
24 samples
-15° to -25°C
Supplied
By
Illumina
-15° to -25°C
Illumina
-80°C
See manufacturer’s
instructions
User
User
RTE reagent
RNA samples
96-well 0.2 ml skirted
microplate
NOTE
In the Make SUR Plate protocol, you may use three 8-well strip tubes
instead of a 96-well microplate.
60
Part # 15018210 Rev. D
Preparation
}
}
}
}
Preheat the heat sealer.
Preheat a heat block to 42°C and allow the temperature to stabilize.
Thaw the MCS4 tube to room temperature.
Apply a SUR barcode label to a new 96-well microplate.
Steps
1
Normalize intact RNA samples to 20–100 ng/µl (or partially degraded RNA
samples to 40-200 ng/µl) with DEPC-treated H2 O.
2
Add 32 µl RTE to the MCS4 tube (288 µl) and mix well.
3
Pour the entire contents of the MCS4 and RTE tube mixture into a new, nonsterile,
disposable reservoir.
NOTE
Due to the small volume, you may wish to single-pipette directly out of
the tube.
4
Add 5 µl MCS4 and RTE mixture to each well of columns 1, 2, and 3 of the SUR
plate.
5
Quickly add 5 µl of normalized RNA sample to each well of columns 1, 2, and 3 of
the SUR plate. Change tips between RNA sample dispenses.
6
Seal the SUR plate with a microplate heat seal. Ensure that all wells are completely
sealed.
7
Vortex the sealed plate at 2,300 rpm for 20 seconds.
8
Pulse centrifuge to 250 xg for 1 minute.
CAUTION
It is important to centrifuge the SUR plate to 250 xg before the 42°C
incubation to prevent the wells from drying out.
9
Incubate the SUR plate at room temperature at least 10 minutes (up to 1 hour).
Whole-Genome Gene Expression DASL HT Assay Guide
61
Make Single-Use RNA (SUR) Plate
NOTE
Be sure to use RNase-free materials and techniques throughout the Make
SUR process.
WG-DASL HT Assay Lab Protocols
10 Place the SUR plate on the preheated heat block and close the lid to reduce
condensation on the plate seal. Incubate at 42°C for 1 hour.
11 Pulse centrifuge the SUR plate to 250 xg for 1 minute to remove condensation from
the walls of each well.
12 Do one of the following:
• Immediately set a heat block to 70°C and proceed to Make Assay-Specific
Extension (ASE) Plate on page 63. Start thawing the DAP and OB1 reagents.
• If you do not plan to proceed immediately to Make Assay-Specific Extension (ASE)
Plate on page 63, then store the sealed SUR plate after the 42°C incubation up to
four hours at 2° to 8°C or up to 24 hours at -15° to -25°C.
62
Part # 15018210 Rev. D
This process combines the biotinylated cDNAs with Assay-specific oligos (ASOs),
hybridization reagents, and paramagnetic particles in an Assay Specific Extension
(ASE) plate. The plate is then placed in a heat block and the ASOs for each sequence
target of interest are allowed to anneal to the biotinylated cDNA samples. The cDNA is
simultaneously captured by paramagnetic particles. The resulting ASE plate is ready for
the extension and ligation of the hybridized oligos on the bound cDNAs.
Figure 21 Make ASE
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~30 minutes
Incubation time: 14–20 hours
Consumables
Item
OB1 reagent
DAP reagent
96-well 0.2 ml skirted
microplate
Quantity (per SUR
plate)
1 tube
1 tube
1 plate
Whole-Genome Gene Expression DASL HT Assay Guide
Storage
-15° to -25°C
2° to 8°C or
-15° to -25°C
See manufacturer’s
instructions
Supplied
By
Illumina
Illumina
User
63
Make Assay-Specific Extension (ASE) Plate
Make Assay-Specific Extension (ASE) Plate
WG-DASL HT Assay Lab Protocols
Preparation
} In the Pool_ID column of the Sample Sheet, enter the DAP for each Sample_Well.
For more information, see Sample Sheet on page 31.
} Preheat the heat sealer.
} Preheat the heat block to 70°C and allow the temperature to stabilize.
} If the SUR plate was stored at -15° to -25°C overnight, thaw it to room temperature
and then pulse-centrifuge to 250 xg for 1 minute.
} Thaw the DAP reagent tube to room temperature and vortex the contents to mix
completely, then pulse centrifuge to collect the contents at the bottom of the tube.
Pour the entire contents of the tube into a sterile reservoir.
} Thaw the OB1 tube to room temperature. Vortex to completely resuspend the
solution. Invert the tube to verify that all paramagnetic particles are evenly
suspended in solution. Pour the entire contents of the OB1 tube into a sterile
reservoir.
CAUTION
Do not centrifuge the OB1 tube.
} Apply an ASE barcode label to a new 96-well microplate.
Steps
1
Add 10 µl DAP to each well of columns 1, 2, and 3 of the ASE plate.
2
Add 30 µl OB1 to each well of columns 1, 2, and 3 of the ASE plate.
3
Carefully remove the heat seal from the SUR plate. Take care to avoid splashing
from the wells.
4
Transfer 10 µl biotinylated cDNA from each occupied well of the SUR plate to the
corresponding well of the ASE plate.
NOTE
Transfer the entire contents of each well from the SUR plate to the ASE
plate.
64
5
Heat-seal the ASE plate with a microplate heat sealer. Ensure that all wells are
completely sealed.
6
Pulse centrifuge the ASE plate to 250 xg for 1 minute.
Part # 15018210 Rev. D
Vortex the ASE plate at 1,600 rpm for 1 minute or until all beads are completely
resuspended.
8
Place the sealed ASE plate on the preheated 70°C heat block and close the lid.
9
Immediately change the set temperature of the heat block to 30°C. Leave the ASE
plate in the heat block for 14–20 hours while it cools to 30°C.
10 Proceed to Add Master Mix for Extension & Ligation (MEL) on page 66.
Whole-Genome Gene Expression DASL HT Assay Guide
65
Make Assay-Specific Extension (ASE) Plate
7
WG-DASL HT Assay Lab Protocols
Add Master Mix for Extension & Ligation (MEL)
After the oligos are hybridized to the cDNA, mis-hybridized and excess oligos are
washed away. Next, an extension and ligation master mix (MEL) (consisting of
extension and ligation enzymes) is added to each cDNA sample. The extension and
ligation reaction occurs at 45°C.
Figure 22 Add MEL
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
CAUTION
In this process, the bead pellet may be difficult to resuspend. Follow the
vortexing instructions to break up the pellet. If necessary, you can also
shuttle the plate rapidly back and forth over the magnetic bars, so that
the pellet is pulled first to one side and then to the other.
Estimated Time
Hands-on time: ~45 minutes
Incubation time: 15 minutes
66
Part # 15018210 Rev. D
Item
Quantity
Storage
AM1
reagent
UB1
reagent
MEL
reagent
Bottle
2° to 8°C
Supplied
By
Illumina
Bottle
2° to 8°C a
Illumina
1 tube per ASE
plate
-15° to -25°C
Illumina
Preparation
} Thaw the MEL tube to room temperature. Pour the entire contents of the tube into a
sterile reservoir right before using it.
} Remove the AM1 bottle from the refrigerator and leave it at room temperature for
10 minutes. Pour 11 ml AM1 into a second sterile reservoir. Add 10 ml for each
additional plate.
} Remove the UB1 bottle from the refrigerator. Pour 11 ml UB1 into a third sterile
reservoir.
} Remove the IP1 and SCM tubes from the freezer and let them thaw.
AM1 Washes
1
Remove the ASE plate from the heat block and reset the heat block to 45°C.
2
Centrifuge the ASE plate to 250 xg.
NOTE
To avoid tip contamination and sample loss during this procedure, slant
the pipette tips so that they draw liquid from the side of the well
opposite the beads.
3
Immediately place the ASE plate on the raised-bar magnetic plate for 2 minutes or
until the beads are completely captured.
a-15° to -25°C for long-term storage
Whole-Genome Gene Expression DASL HT Assay Guide
67
Add Master Mix for Extension & Ligation (MEL)
Consumables
WG-DASL HT Assay Lab Protocols
4
Carefully remove the heat seal from the ASE plate. Take care not to splash sample
out of the wells.
5
Using an 8-channel pipette with new tips, remove all the liquid (~50 µl) from the
occupied wells and discard it. Leave the beads in the wells.
NOTE
To avoid disturbing the pellet or contaminating the tips, place the tips
against the top edge of the well.
Visually inspect the pipette tips after removing liquid from each column to ensure
no beads have been removed. If beads are visible in pipette tips, return the solution
to the same wells, allow the magnet to re-collect beads, and change the pipette tips.
You do not need to change pipette tips again until you have removed the liquid
from all 3 columns.
6
With the ASE plate on the raised-bar magnetic plate, use an 8-channel pipette with
new tips to add 50 µl AM1 to each occupied well of the ASE plate.
Figure 23 Avoid Tip Contamination
7
Seal the ASE plate with clear adhesive film.
8
Vortex the ASE plate at 1,600 rpm for 20 seconds or until all beads are resuspended.
9
Place the ASE plate on the raised-bar magnetic plate for approximately 2 minutes or
until the beads are completely captured.
10 Remove the seal from the ASE plate, taking care to avoid splashing from the wells.
68
Part # 15018210 Rev. D
12 Repeat steps 6 through 11 once.
UB1 Washes
1
Remove the ASE plate from the raised-bar magnetic plate.
2
Using an 8-channel pipette with new tips, add 50 µl UB1 to each occupied well of
the ASE plate.
3
Place the ASE plate onto the raised-bar magnetic plate for approximately 2 minutes
or until the beads are completely captured.
4
Using the same 8-channel pipette with the same tips, remove all UB1 reagent from
each occupied well. Leave the beads in the wells.
You do not need to change pipette tips again until you have removed the liquid
from all 3 columns.
5
Repeat steps 1 through 4 once.
Add MEL
1
Using an 8-channel pipette with new tips, add 37 µl MEL to each occupied well of
the ASE plate.
2
Seal the plate with clear adhesive film.
3
Vortex the plate at 1,600 rpm for 1 minute to resuspend the beads.
4
Incubate the ASE plate on the preheated 45°C heat block for exactly 15 minutes.
During the incubation, perform Make PCR Plate on page 70.
CAUTION
Do not allow the ASE plate to incubate at 45°C for any longer than 15 minutes.
Whole-Genome Gene Expression DASL HT Assay Guide
69
Add Master Mix for Extension & Ligation (MEL)
11 Using the same 8-channel pipette with the same tips, remove all AM1 reagent from
each occupied well. Leave the beads in the wells.
You do not need to change pipette tips again until you have removed the liquid
from all 3 columns.
WG-DASL HT Assay Lab Protocols
Make PCR Plate
This process adds the Illumina-recommended DNA Polymerase and the optional Uracil
DNA Glycosylase to the SCM master mix for PCR. It creates a 24-sample plate for the
Inoc PCR process.
Figure 24 Make, Inoculate, and Cycle PCR
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~15 minutes
70
Part # 15018210 Rev. D
Item
Quantity
Storage
Illumina-recommended
DNA Polymerase
Uracil DNA Glycosylase
(Optional)
SCM reagent
Tube
-15° to -25°C
Supplied
By
User
Tube
-15° to -25°C
User
1 tube per PCR
plate
1 per ASE plate
-15° to -25°C
Illumina
See manufacturer’s
instructions
User
96-well 0.2 ml skirted
microplate
Preparation
} Apply a PCR barcode label to a new 96-well 0.2 ml skirted microplate.
} Invert the thawed SCM tube 10 times to mix.
Steps
1
Add 800 µl SCM and 16 µl Illumina-recommended DNA Polymerase to a clean 1.5
ml tube.
2
Add 12.5 µl Uracil DNA glycosylase to the SCM/Polymerase mixture.
3
Invert the tube several times to mix the contents and pipette the contents into a
sterile reservoir.
4
Using an 8-channel pipette, add 30 µl of the SCM mixture to each well of columns
1, 2, and 3 of the PCR plate.
5
Seal the PCR plate with clear adhesive film.
6
As soon as the 15 minute ASE plate incubation is complete, proceed immediately to
Inoculate PCR Plate on page 72.
Whole-Genome Gene Expression DASL HT Assay Guide
71
Make PCR Plate
Consumables
WG-DASL HT Assay Lab Protocols
Inoculate PCR Plate
This process uses the template formed during the extension and ligation process in a
PCR reaction. This PCR reaction uses two universal primers. One is labeled with a
fluorescent dye and the other is biotinylated. The biotinylated primer captures the PCR
product and allows the strand containing the fluorescent signal to be eluted.
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
CAUTION
In this process, the bead pellet may be difficult to resuspend. Follow the
vortexing instructions to break up the pellet. If necessary, you can also
shuttle the plate rapidly back and forth over the magnetic bars, so that
the pellet is pulled first to one side and then to the other.
Estimated Time
Hands-on time: ~30 minutes
Consumables
Item
Quantity
Storage
UB1
reagent
IP1
reagent
Bottle
2° to 8°C a
Supplied
By
Illumina
1 tube per PCR
plate
-15° to -25°C
Illumina
Preparation
} Pour 6 ml UB1 into a sterile reservoir.
} Pour the entire contents of the IP1 tube into a second sterile reservoir.
a-15° to -25°C for long-term storage
72
Part # 15018210 Rev. D
1
Remove the ASE plate from the heat block.
2
Reset the heat block to 95°C.
3
Place the ASE plate on the raised-bar magnetic plate for 2 minutes or until the
beads are completely captured.
4
Remove the clear adhesive film from the plate.
5
Using an 8-channel pipette, remove and discard the supernatant (~50 µl) from all
occupied wells of the ASE plate. Leave the beads in the wells.
NOTE
The amount of supernatant in this step is less than 50 µl. However,
setting the pipette to that volume ensures that it is set correctly for the
later washes, which require the full 50 µl.
NOTE
To avoid tip contamination and sample loss during this procedure, slant
the pipette tips so that they draw liquid from the side of the well
opposite the beads. If you suspect that the tips are contaminated with
the contents of the well, discard the tips and use new ones.
Visually inspect the pipette tips after removing liquid from each column to ensure
no beads have been removed. If beads are visible in pipette tips, return the solution
to the same wells, allow the magnet to re-collect beads, and change the pipette tips.
You do not need to change pipette tips again until you have removed the liquid
from all 3 columns.
UB1 Wash
1
Leaving the plate on the magnet and using an 8-channel pipette with new tips, add
50 µl UB1 to each occupied well of the ASE plate.
2
Leave the ASE plate on the raised-bar magnetic plate for 2 minutes or until the
beads are completely captured.
3
Remove and discard the supernatant (~50 µl) from all occupied wells of the ASE
plate. Leave the beads in the wells.
Whole-Genome Gene Expression DASL HT Assay Guide
73
Inoculate PCR Plate
Remove Supernatant
WG-DASL HT Assay Lab Protocols
You do not need to change pipette tips until you have removed the liquid from all
3 columns.
Add IP1
1
Using an 8-channel pipette with new tips, add 35 µl IP1 to each occupied well of
the ASE plate.
2
Seal the plate with clear adhesive film.
3
Vortex at 1,800 rpm for 1 minute or until all beads are resuspended.
4
Place the plate on the preheated 95°C heat block for 1 minute.
5
Place the ASE plate on the raised-bar magnetic plate for 2 minutes or until the
beads are completely captured.
CAUTION
Remove the adhesive seal very carefully so that the evaporation on the
seal does not drip and cause cross-contamination.
Add Supernatant to PCR Plate
1
Remove the seal from the PCR plate.
2
Using an 8-channel pipette with new tips, transfer 30 µl supernatant from each
occupied well of the ASE plate to the corresponding well of the PCR plate. Pipette
the contents of the PCR plate wells up and down 3–4 times.
Change tips between column dispenses.
CAUTION
Take special care not to disturb or transfer the beads when aspirating the
eluted product.
74
3
Seal the PCR plate with the appropriate PCR plate-sealing film for your thermal
cycler.
4
Pulse centrifuge the plate to 250 xg for 1 minute.
5
Immediately transfer the PCR plate to the thermal cycler. Discard the ASE plate.
6
Proceed to Thermal Cycle PCR Plate on page 76.
Part # 15018210 Rev. D
Whole-Genome Gene Expression DASL HT Assay Guide
75
Inoculate PCR Plate
This concludes the Pre-PCR processes for the Whole-Genome Gene Expression DASL
Assay. If you remove materials such as experienced user cards from the Pre-PCR lab, do
not return with them in to the Pre-PCR lab at any time.
WG-DASL HT Assay Lab Protocols
Thermal Cycle PCR Plate
This process thermal cycles the PCR plate to fluorescently label and amplify the
templates generated in the pre-PCR process.
Estimated Time
Cycle time: ~2 hours 45 minutes
Steps
1
Place the sealed plate into the thermal cycler and run the thermal cycler program
shown in this table.
Table 14 Thermal Cycler Program
Temperature Time
37°C
10 minutes
95°C
3 minutes
95°C
35 seconds
2
76
56°C
35 seconds
72°C
2 minutes
72°C
4°C
10 minutes
5 minutes
Do one of the following:
• Proceed immediately to Bind PCR Products on page 77.
• Seal and store the PCR plate at -15° to -25°C.
Part # 15018210 Rev. D
In this step, the double-stranded PCR products are immobilized by binding the
biotinylated strand to paramagnetic particles. The solution is transferred to a filter plate
and incubated at room temperature so that the PCR product may bind to the
paramagnetic particles.
Figure 25 Bind PCR Products
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~20 minutes
Incubation time: 1 hour
Consumables
Item
Quantity
Storage
MPB reagent
1 tube per PCR
plate
1 per PCR plate
2° to 8°C
Filter plate with
lid
Whole-Genome Gene Expression DASL HT Assay Guide
See manufacturer’s
instructions
Supplied
By
Illumina
User
77
Bind PCR Products
Bind PCR Products
WG-DASL HT Assay Lab Protocols
Preparation
} Vortex the MPB tube several times or until the beads are completely resuspended.
Pour the entire contents of the MPB tube into a sterile reservoir.
} Write the PCR plate barcode number in the space provided on the filter plate label.
Apply the filter plate label to the top of the filter plate next to column 12.
Figure 26 Apply Label to Filter Plate
Steps
1
Pulse centrifuge the PCR plate to 250 xg for 1 minute.
2
Place new tips onto a 5–50 µl multichannel pipette and transfer 20 µl resuspended
MPB from the reservoir into each occupied well of the PCR plate.
It is not necessary to change pipette tips until liquid has been transferred to all
3 columns.
NOTE
To avoid tip contamination and sample loss during this procedure, slant
the pipette tips so that they draw liquid from the side of the well opposite
the beads. If you suspect that the tips are contaminated with the contents
of the well, discard the tips and use new ones.
3
78
Place new tips on an 8-channel pipette and set it to 85 µl. Place the PCR and filter
plates next to each other with the A1 wells in the upper left corner.
Part # 15018210 Rev. D
Pipette the solution in the PCR plate up and down several times to mix the beads
with the PCR product. Transfer the mixed solution from each occupied well of the
PCR plate into the corresponding well of the filter plate.
Change pipette tips between column dispenses.
5
Discard the empty PCR plate.
6
Cover the filter plate with the filter plate lid.
7
Store at room temperature, protected from light, for 1 hour.
8
Proceed to Make Intermediate (INT) Plate on page 80.
Whole-Genome Gene Expression DASL HT Assay Guide
79
Bind PCR Products
4
WG-DASL HT Assay Lab Protocols
Make Intermediate (INT) Plate
In this step, the single-stranded fluor-labeled PCR product from the filter plate is
washed and then eluted into an intermediate (INT) plate.
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~20 minutes
Consumables
Item
Quantity
Storage
0.1N NaOH
UB2 reagent
MH1 reagent
Bottle
Bottle
1 tube per INT
plate
1 per filter plate
1 per filter plate
2° to 8°C
Room temperature
Room temperature
Supplied
By
User
Illumina
Illumina
See manufacturer’s
instructions
User
User
96-well V-bottom plate
96-well 0.2 ml skirted
microplate
Filter plate adapter
1 per filter plate
User
Preparation
}
}
}
}
Apply a INT barcode label to a new 96-well 0.2 ml skirted microplate.
Using a serological pipette, transfer 10 ml UB2 into a sterile reservoir.
Pour 5 ml 0.1N NaOH into a second sterile reservoir.
Pour the contents of an MH1 tube into a third sterile reservoir.
Steps
1
80
Place the filter plate adapter on an empty, unlabeled 96-well V-bottom plate (waste
plate).
Part # 15018210 Rev. D
Make Intermediate (INT) Plate
2
Place the filter plate containing the bound PCR products onto the filter plate
adapter.
Figure 27 Assemble Filter Plate
A
B
C
Place adapter on waste plate
Place filter plate on adapter
Completed Assembly
3
Centrifuge to 1000 xg for 5 minutes at 25°C.
4
Remove the filter plate lid.
5
Using an 8-channel pipette with new tips, add 50 µl UB2 to each well of columns 1,
2, and 3 of the filter plate. Dispense slowly to avoid disturbing the beads.
CAUTION
To avoid disturbing the pellet or contaminating the tips, place the tips
against the top edge of the well.
6
Replace the filter plate lid.
7
Centrifuge to 1000 xg for 5 minutes at 25°C.
8
Using an 8-channel pipette with new tips, add 30 µl MH1 to each well of columns
1, 2, and 3 of the INT plate.
9
Replace the waste plate with the INT plate. Orient the INT plate so that well A1 of
the filter plate matches well A1 of the INT plate.
CAUTION
Be sure to replace the waste plate with the INT plate. Failure to replace
the waste plate will result in loss of samples.
Whole-Genome Gene Expression DASL HT Assay Guide
81
WG-DASL HT Assay Lab Protocols
10 Discard the waste plate.
11 Using an 8-channel pipette with new tips, add 30 µl 0.1N NaOH to each occupied
well of the filter plate.
12 Replace the filter plate lid.
CAUTION
Due to the sensitivity of the dyes to 0.1N NaOH, proceed quickly.
Prolonged incubation with NaOH is unnecessary; less than 5 minutes is
sufficient. The DNA is denatured almost instantly.)
13 Centrifuge immediately to 1000 xg for 5 minutes at 25°C. At the end, no beads
should be visible in the wells of the INT plate.
14 Discard the filter plate. Save the adapter for later use in other protocols.
15 Gently mix the contents of the INT plate by moving it from side to side without
splashing.
16 Seal the INT plate with a 96-well cap mat. Store the plate in the dark until ready to
proceed with precipitation of samples.
17 Do one of the following:
• Proceed to Precipitate and Wash INT Plate on page 83.
• If you do not plan to use the INT plate immediately in the protocol, store it at
-15° to -25°C for up to 24 hours.
82
Part # 15018210 Rev. D
In this step the single-stranded product from the INT plate is precipitated, washed and
resuspended. The product from this plate is hybridized to the BeadChip.
Figure 28 Hybridize to BeadChip
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on: ~1 hour
Consumables
Item
Quantity
Storage
PS1
reagent
2-propanol
3.2 ml per INT
plate
Bottle
2° to 8°C
Whole-Genome Gene Expression DASL HT Assay Guide
Room
temperature
Supplied
By
Illumina
User
83
Precipitate and Wash INT Plate
Precipitate and Wash INT Plate
WG-DASL HT Assay Lab Protocols
Item
Quantity
Storage
70% EtOH
Bottle
MH1
300 µl per INT
plate
1.2 ml per INT
plate
Room
temperature
Room
temperature
-15° to -25°C
HYB
reagent
Supplied
By
User
Illumina
Illumina
WARNING
This protocol involves the use of an aliphatic amide that is a probable
reproductive toxin. Personal injury can occur through inhalation,
ingestion, skin contact, and eye contact. Dispose of containers and any
unused contents in accordance with the governmental safety standards
for your region. For more information, see the MSDS for this kit, which is
available at http://www.illumina.com/msds.
Preparation
} Calibrate the Illumina Hybridization Oven with the Full-Scale Plus digital
thermometer supplied with your system.
} Preheat the Illumina Hybridization Oven to 58°C. Allow 30 minutes for it to
equilibrate.
} Place the HYB tube in the 58°C oven for 10 minutes to dissolve any salts that may
have precipitated in storage. If any salts remain undissolved, incubate at 58°C for
another 10 minutes. Cool to room temperature and mix thoroughly before using.
} Preheat a heat block to 65°C and allow the temperature to stabilize.
} Vortex PS1 bottle then transfer 3.2 ml into a sterile reservoir.
} Pour 10 ml 2-propanol into a second sterile reservoir.
} Pour 20 ml 70% EtOH into a third sterile reservoir.
} In a sterile 15 ml centrifuge tube combine 300 µl MH1, 300 µl nuclease-free water
and 1.2 ml HYB. Mix well by vortexing, followed by pulse centrifugation.
} Pour the MH1/water/HYB mix into a fourth sterile reservoir.
Steps
84
1
Remove the seal from the INT plate, taking care to avoid splashing from the wells.
2
Add 30 µl PS1 reagent to each well of the INT plate.
Part # 15018210 Rev. D
Using a multichannel pipette, thoroughly mix the contents by pipetting the solution
up and down several times until the solution is uniformly blue.
4
Add 90 µl 2-propanol to each well of the INT plate.
5
Using a multichannel pipette, thoroughly mix the contents by pipetting the solution
up and down several times until the solution is uniformly blue.
CAUTION
It is important to mix the contents thoroughly to ensure efficient
precipitation of the DNA pellet.
6
Seal the INT plate with clear adhesive film.
7
Centrifuge the plate to 3000 xg at 2° to 8°C for 20 minutes.
8
Remove the INT plate from the centrifuge.
9
Remove the INT plate seal and decant the supernatant by inverting the INT plate
and smacking it down onto an absorbent pad.
CAUTION
Do not tilt the plate, as this can cause cross-contamination between wells.
Tap the plate firmly enough to decant all the supernatant; tapping lightly
does not work as well.
10 Tap the inverted plate onto the pad to blot excess supernatant.
11 Add 150 µl 70% EtOH to each well of the INT plate.
12 Using a multichannel pipette, thoroughly wash the blue pellet in 70% EtOH by
pipetting up and down several times.
13 Seal the INT plate with clear adhesive film.
14 Centrifuge the plate to 3000 xg at 2° to 8°C for 10 minutes.
15 Remove the INT plate from the centrifuge.
16 Remove the INT plate seal and decant the supernatant by inverting the INT plate
and smacking it down onto an absorbent pad.
CAUTION
Do not tilt the plate, as this can cause cross-contamination between wells.
Tap the plate firmly enough to decant all the supernatant; tapping lightly
does not work as well.
17 Tap the inverted plate onto the pad to blot excess supernatant.
Whole-Genome Gene Expression DASL HT Assay Guide
85
Precipitate and Wash INT Plate
3
WG-DASL HT Assay Lab Protocols
18 Place the INT plate in the preheated heat block and close the lid.
19 Incubate the INT plate at 65°C for 5 minutes or until the residual EtOH has
evaporated.
20 Add 15 µl of the MH1/water/HYB mix to each well of the INT plate.
21 Seal the INT plate with clear adhesive film.
22 Pulse centrifuge the plate to 250 xg.
23 Remove the INT plate seal.
24 Using a multichannel pipet, thoroughly dissolve the pellets by pipetting the
solution up and down several times.
25 Seal the INT plate with a 96-well cap mat. Store the plate in the dark until ready to
dispense sample onto a BeadChip.
26 Do one of the following:
• Proceed to Hybridize BeadChip on page 87.
• If you do not plan to use the INT plate immediately in the protocol, store it at
-15° to -25°C for up to 24 hours.
86
Part # 15018210 Rev. D
In this process the BeadChips are hybridized using the Hyb Chamber. After the Hyb
Chamber has been assembled, the samples are ready for hybridization. The BeadChip is
hybridized overnight in the Illumina Hybridization Oven at 58°C.
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on time: ~30 minutes
Incubation time: 14–20 hours
Consumables and Equipment
Item
Quantity
Storage
HCB reagent
Hyb Chamber
Tube
1 per
4 BeadChips
2 per 24 samples
-15° to -25°C
Room
temperature
2° to 8°C
BeadChips
(12x1)
Supplied
By
Illumina
Illumina
Illumina
Preparation
} In the Sentrix_ID column of the Sample Sheet, enter the BeadChip ID for each
BeadChip section. For more information, see Sample Sheet on page 31.
} Calibrate the Illumina Hybridization Oven with the Full-Scale Plus digital
thermometer supplied with your system.
} Preheat the Illumina Hybridization Oven to 58°C. Allow 30 minutes for it to
equilibrate.
} Place the HCB tube in the 58°C oven for 10 minutes to dissolve any salts that may
have precipitated in storage. If any salts remain undissolved, incubate at 58°C for
another 10 minutes. Cool to room temperature and mix thoroughly before using.
Whole-Genome Gene Expression DASL HT Assay Guide
87
Hybridize BeadChip
Hybridize BeadChip
WG-DASL HT Assay Lab Protocols
} If the INT plate has been frozen, thaw it completely at room temperature in a lightprotected drawer, and then pulse centrifuge it to 250 xg for 1 minute.
Assemble Hybridization Chambers
1
Place the following items on the bench top:
• BeadChip Hyb Chamber (1 per 4 BeadChips)
• BeadChip Hyb Chamber gasket (1 per Hyb Chamber)
• BeadChip Hyb Chamber inserts (4 per Hyb Chamber)
Figure 29 BeadChip Hyb Chamber Components
A
B
C
Hyb Chamber
Hyb Chamber Gasket
Hyb Chamber Inserts
NOTE
To ensure optimal results from Hyb Chambers keep the Hyb Chamber lids
and bases together. Adopt a labeling convention that keeps each Hyb
Chamber base paired with its original lid. Check Hyb Chamber lid-base
pairs regularly to ensure that the fit remains secure. Check hinges regularly
for any signs of abnormal wear or loose fittings. It is important that the
hinges provide adequate clamping strength to ensure an airtight seal
between the lid and the base. Record the Hyb Chamber that was used for
each BeadChip, so that Hyb Chambers can be investigated and evaluated in
the event of sample evaporation or other lab processing anomalies.
88
Part # 15018210 Rev. D
Place the BeadChip Hyb Chamber gaskets into the BeadChip Hyb Chambers as
shown.
a Match the wider edge of the Hyb Chamber gasket to the barcode-ridge side of
the Hyb Chamber.
Figure 30 Hyb Chamber and Gasket
A
B
C
D
b
Reservoirs
Barcode Ridges
Narrower Edges
Wider Edges
Lay the gasket into the Hyb Chamber, and then press it down all around.
Figure 31 Placing Gasket into Hyb Chamber
c
Make sure the Hyb Chamber gaskets are properly seated.
Whole-Genome Gene Expression DASL HT Assay Guide
89
Hybridize BeadChip
2
WG-DASL HT Assay Lab Protocols
Figure 32 Hyb Chamber with Gasket in Place
3
Add 200 µl HCB into the eight humidifying buffer reservoirs in the Hyb Chamber.
Only fill the reservoirs of sections that will contain BeadChips.
Figure 33 Dispensing HCB into Hyb Chamber Reservoir
4
90
Close and lock the BeadChip Hyb Chamber lid.
a Seat the lid securely on the bottom plate.
Part # 15018210 Rev. D
Hybridize BeadChip
b
c
Snap two clamps shut, kitty-corner across from each other.
Snap the other two clamps.
Figure 34 Sealing the Hyb Chamber
5
Leave the closed Hyb Chambers on the bench at room temperature until the
BeadChips are loaded with DNA sample.
Prepare BeadChip for Hybridization
CAUTION
Do not unpackage BeadChips unless you are ready to begin hybridization.
1
Remove all the BeadChips from their packages.
2
Place each BeadChip in a Hyb Chamber Insert, orienting the barcode end so that it
matches the barcode symbol on the Hyb Chamber Insert.
Figure 35 Place BeadChips into Hyb Chamber Inserts
Whole-Genome Gene Expression DASL HT Assay Guide
91
WG-DASL HT Assay Lab Protocols
Load Sample
1
Using a single-channel precision pipette, add 15 µl sample onto the center of each
inlet port.
NOTE
Load samples by directly placing pipette tips to the array surface. To
avoid contamination/evaporation, proceed immediately to the next step
as soon as all arrays have received sample.
Figure 36 Dispense Sample onto BeadChip
2
Visually inspect all sections. Ensure sample covers all of the sections of the stripe.
Record any sections that are not covered.
Some residual sample may still remain in the inlet port. This is normal.
3
Open the Hyb Chamber.
4
Load 4 Hyb Chamber Inserts containing sample-laden BeadChips into each Hyb
Chamber.
Figure 37 BeadChips in BeadChip Hyb Chamber
92
Part # 15018210 Rev. D
Position the barcode end over the ridges indicated on the Hyb Chamber and ensure
the inserts are securely seated.
Hybridize BeadChips
1
Close and lock the BeadChip Hyb Chamber lid.
a Seat the lid securely on the bottom plate.
b Snap two clamps shut, diagonally across from each other.
c Snap the other two clamps.
Figure 38 Secure Lid
2
Place the Hyb Chamber into the 58°C Illumina Hybridization Oven.
3
Start the rocker by turning on the switch just above the power
switch (optional).
4
Incubate for 16 hours at 58°C.
5
In preparation for the next day’s washes, prepare 1X High-Temp Wash buffer from
the 10X stock by adding 50 ml 10x High-Temp Wash buffer to 450 ml nuclease-free
water.
6
Place the Hybex Waterbath insert into the Hybex Heating Base.
7
Add 500 ml prepared 1X High-Temp Wash buffer to the Hybex Waterbath insert.
Whole-Genome Gene Expression DASL HT Assay Guide
93
Hybridize BeadChip
5
WG-DASL HT Assay Lab Protocols
Figure 39 Adding High-Temp Buffer to Hybex Waterbath Insert
8
Set the Hybex Heating Base temperature to 55°C.
9
Close the Hybex Heating Base lid and leave the High Temp Wash buffer to warm
overnight.
10 Proceed to Wash BeadChip on page 95 the next day.
94
Part # 15018210 Rev. D
Wash BeadChip
Wash BeadChip
In this process, prepare for the wash steps by removing the BeadChips from the
overnight hybridization. Remove the BeadChip coverseals and then wash the
BeadChips.
NOTE
These procedures describe preparing 24 samples using a 24 sample WGDASL HT Assay Profiling Reagent Kit. If you are using a 96 sample WGDASL HT Assay Profiling Reagent Kit, the kit provides enough reagent
to prepare 96 samples at once.
Estimated Time
Hands-on: 30 minutes
Incubation: Two 5 minute washes, one 10 minute wash, one 1 hour incubation
Consumables
Item
Quantity
Storage
100% EtOH
Bottle
High Temperature Wash
Buffer
PB1
Bottle
Wash E1BC Buffer
Tube
XC4
Bottle
Room
temperature
Room
temperature
Room
temperature
Room
temperature
Room
temperature
Bottle
Supplied
By
User
Illumina
Illumina
Illumina
Illumina
Preparation
} In preparation for the Coat BeadChip protocol, follow these steps to resuspend the
XC4 reagent:
• Add 335 ml 100% EtOH to the XC4 bottle. The final volume is 350 ml.
— Each XC4 bottle contains enough to process up to 24 BeadChips.
Whole-Genome Gene Expression DASL HT Assay Guide
95
WG-DASL HT Assay Lab Protocols
• Re-cap the bottle, shake vigorously for 15 seconds, and place on a rocker for 30–
40 minutes to resuspend. Place the bottle on the side opposite to the frozen
pellet if possible.
• After 30–40 minutes, shake the bottle vigorously by hand to ensure all XC4 is in
suspension and none is still coating the container. If coating is visible, vortex at
1,625 rpm until the XC4 is in complete suspension.
• Once resuspended, use XC4 at room temperature. You can store it at 2° to 8°C
overnight. Keep the XC4 in the bottle in which it was shipped until ready for
use.
} Add 6 ml E1BC buffer to 2 L RNase-free water to make the Wash E1BC solution.
} Place 1 L of diluted Wash E1BC buffer in a Pyrex No. 3140 beaker.
NOTE
A Pyrex No. 3140 beaker comes with the purchase of a Gene Expression
(IVT) Product Option Kit or Universal Starter Kit. If you have not
purchased one recently, please contact Illumina Customer Service to
obtain a beaker.
Remove Seal
1
Remove the Hyb Chamber from the oven and place it on the lab bench.
Disassemble the chamber.
NOTE
If you are processing multiple chambers, remove them from the oven
and process the BeadChips one at a time. Process all BeadChips in the
first chamber as described in steps 2–5 below, then remove second
chamber from the oven, process all of its BeadChips, and so on until all
chambers are processed.
2
96
Using powder-free gloved hands, remove all BeadChips from the Hyb Chamber and
submerge them face up at the bottom of the beaker.
Part # 15018210 Rev. D
Wash BeadChip
Figure 40 BeadChips Submerged Face Up in Beaker
3
Using powder-free gloved hands, remove the coverseal from the first BeadChip.
This may require significant force, due to the strength of the adhesive. Ensure that
the entire BeadChip remains submerged during removal.
Figure 41 Removing the Coverseal
4
Using tweezers or powder-free gloved hands, transfer the BeadChip to the slide rack
submerged in the dish containing 250 ml Wash E1BC solution.
Whole-Genome Gene Expression DASL HT Assay Guide
97
WG-DASL HT Assay Lab Protocols
Figure 42 Submerging BeadChips in Wash Dish Containing E1BC Buffer
5
Repeat steps 3 and 4 for all BeadChips from the same Hyb Chamber.
NOTE
Ensure the BeadChip is completely submerged in the diluted Wash
E1BC buffer. When processing multiple BeadChips, submerge each
BeadChip in Wash E1BC buffer before removing the next BeadChip
from its Hyb Chamber Insert.
High Temp Wash
98
1
Using the slide rack handle, transfer the rack into the Hybex Waterbath insert
containing High-Temp Wash buffer.
2
Close the Hybex lid.
Part # 15018210 Rev. D
Wash BeadChip
Figure 43 Transfer Wash Rack to Waterbath Insert
A
B
3
Slide rack handle attached
Transfer to Hybex Waterbath insert
Incubate static for 10 minutes with the Hybex lid closed.
Whole-Genome Gene Expression DASL HT Assay Guide
99
WG-DASL HT Assay Lab Protocols
Figure 44 Static Incubation in High-Temp Wash Buffer
First Room-Temp Wash
1
After the 10 minute incubation in High-Temp Wash buffer is complete, immediately
transfer the slide rack back into a dish containing 250 ml fresh Wash E1BC buffer.
Figure 45 Washing BeadChip in Diluted Wash E1BC Buffer
100
Part # 15018210 Rev. D
2
Using the slide rack handle, plunge the rack in and out of the solution 5–10 times.
3
Set the orbital shaker to medium-low.
4
Place the dish on the orbital shaker and shake at room temperature for 5 minutes.
Shake at as high a speed as possible without allowing the solution to splash out of
the dish.
Figure 46 Washing Dish/BeadChip on Orbital Shaker
Ethanol Wash
1
Transfer the rack to a clean dish containing 250 ml fresh 100% Ethanol.
2
Using the slide rack handle, plunge the rack in and out of the solution 5–10 times.
3
Place the dish on the orbital shaker and shake at room temperature for 10 minutes.
Whole-Genome Gene Expression DASL HT Assay Guide
101
Wash BeadChip
NOTE
When processing multiple BeadChips, submerge each in the Wash E1BC
buffer before removing the next BeadChip from its Hyb Chamber.
WG-DASL HT Assay Lab Protocols
Coat BeadChip
Prepare Wash Dishes and Tube Racks
Before starting the Coat BeadChip process, please read these important notes:
• Take the utmost care to minimize the chance of lint or dust entering the wash
dishes, which could transfer to the BeadChips. Place wash dish covers on wash
dishes when stored or not in use. Clean wash dishes with low-pressure air to
remove particulates prior to use.
• In preparation for XC4 BeadChip coating, wash tube racks and wash dishes
thoroughly before and after use. Rinse with DI water. Immediately following
wash, place racks and wash dishes upside down on a wash rack to dry.
• Place Kimwipes in three layers on the lab bench. Place a tube rack on top of the
Kimwipe layers. Do not place on absorbent lab diapers. You will place the
staining rack containing BeadChips on this tube rack after removing it from the
XC4 wash dish.
• Prepare an additional clean tube rack that fits the internal dimensions of the
vacuum desiccator for removal of the BeadChips. Allow one rack per
8 BeadChips. No Kimwipes are required under this tube rack.
102
1
Lay out the following equipment on the lab bench:
• 1 staining rack
• 1 vacuum desiccator
• 1 tube rack
• Self-locking tweezers
• Large Kimwipes
• Vacuum hose
2
Shake the XC4 bottle vigorously to ensure complete resuspension. If necessary,
vortex until completely dissolved.
3
Set up two top-loading wash dishes, labeled as PB1 and XC4.
Part # 15018210 Rev. D
Wash BeadChip
Figure 47 PB1 and XC4 Wash Dishes with Staining Rack
A
B
Wash Dishes
Staining Rack
4
To indicate the fill volume before filling wash dishes with PB1 and XC4, pour
310 ml water into the wash dishes and mark the water level on the side. Empty the
water from the wash dish. This enables you to pour reagent directly from the PB1
and XC4 bottles into the wash dishes, minimizing contaminant transfer from
labware to wash dishes.
5
Pour 310 ml PB1 into the wash dish labeled “PB1.”
6
Submerge the unloaded staining rack into the wash dish with the locking arms and
tab facing you. This orients the staining rack so that you can safely remove the
BeadChips.
Whole-Genome Gene Expression DASL HT Assay Guide
103
WG-DASL HT Assay Lab Protocols
Figure 48 Staining Rack Locking Arms and Tab
A
B
Locking Arms
Tab
CAUTION
If the staining rack handle is not correctly oriented, the BeadChips may
be damaged when you remove the staining rack handle before
removing the BeadChips.
Let the staining rack sit in the wash dish. You will use it to carry the BeadChips.
7
Quickly transfer each BeadChip from the EtOH wash to the staining rack while it is
submerged in PB1.
CAUTION
Do not touch the face of the BeadChips. Handle them by the barcode
end or by the edges.
8
104
Place the BeadChips in the staining rack while it is submerged in PB1. Put four
BeadChips above the staining rack handle and four below. The BeadChip barcodes
should face away from you, while the locking arms on the handle face towards you.
If necessary, briefly lift the staining rack out of the wash dish to seat the BeadChip.
Replace it immediately after inserting the BeadChip.
Part # 15018210 Rev. D
9
Move the staining rack up and down 10 times, breaking the surface of the PB1.
Figure 49 Washing BeadChips in PB1
NOTE
If the top edges of the BeadChips begin to touch during either PB1 or
XC4 washes, gently move the staining rack back and forth to separate
the slides. It is important for the solution to circulate freely between all
BeadChips.
10 Allow the BeadChips to soak for an additional 5 minutes.
CAUTION
Do not leave the BeadChips submerged in PB1 for longer than 30 minutes.
11 Pour 310 ml XC4 into the dish labeled “XC4,” and cover the dish to prevent any
lint or dust from falling into the solution.
NOTE
Use the XC4 within 10 minutes after filling the wash dish.
12 Place the bottle with excess XC4 in a readily available location for topping off the
XC4 wash dish during the coating procedure.
13 Remove the staining rack from the dish containing PB1 and place it directly into the
wash dish containing XC4. The barcode labels on the BeadChips must face away
from you, while the locking arms on the handle face towards you, for proper
handling and coating.
Whole-Genome Gene Expression DASL HT Assay Guide
105
Wash BeadChip
CAUTION
Do not allow the BeadChips to dry. Submerge each BeadChip in the wash dish
as soon as possible.
WG-DASL HT Assay Lab Protocols
Figure 50 Moving BeadChips from PB1 to XC4
14 Move the staining rack up and down 10 times, breaking the surface of the XC4.
NOTE
If the top edges of the BeadChips begin to touch during either PB1 or
XC4 washes, gently move the staining rack back and forth to separate
the slides. It is important for the solution to circulate freely between all
BeadChips.
15 Allow the BeadChips to soak for an additional 5 minutes.
CAUTION
Use XC4 only once. To process subsequent BeadChips, use a new, clean
wash dish with fresh XC4.
16 Prepare a clean tube rack for the staining rack by placing two folded Kimwipes
under the tube rack.
17 Prepare one additional tube rack per 8 BeadChips that fits the internal dimensions
of the vacuum desiccator.
18 Remove the staining rack in one smooth, rapid motion and place it directly on the
prepared tube rack, making sure the barcodes face up and the locking arms and tab
face down.
106
Part # 15018210 Rev. D
Wash BeadChip
Figure 51 Staining Rack in Correct Orientation
19 To ensure uniform coating, place the staining rack on the center of the tube rack,
avoiding the raised edges.
Figure 52 Moving the Staining Rack from XC4 to Tube Rack
20 For the top four BeadChips, working top to bottom:
a Continuing to hold the staining rack handle, carefully grip each BeadChip at its
barcode end with self-locking tweezers.
Whole-Genome Gene Expression DASL HT Assay Guide
107
WG-DASL HT Assay Lab Protocols
NOTE
The XC4 coat is slippery and makes the BeadChips difficult to hold. The
self-locking tweezers grip the BeadChip firmly and help prevent
damage.
b
Place the BeadChip on a tube rack with the barcode facing up and towards you.
21 Holding the top of the staining rack in position, grasp the handle between your
thumb and forefinger. Push the tab up with your thumb and push the handle away
from you to unlock it. Pull up the handle and remove.
Figure 53 Removing Staining Rack Handle
A
B
Tab
Handle
22 Remove the remaining BeadChips to the tube rack with six BeadChips on top of the
rack and two BeadChips on the bottom. The barcode ends should be towards you,
and the BeadChips should be completely horizontal.
108
Part # 15018210 Rev. D
Wash BeadChip
Figure 54 Placing BeadChips on Tube Rack
To prevent wicking and uneven drying, do not allow the BeadChips to rest on the
edge of the tube rack or to touch each other while drying.
23 Place the tube rack in the vacuum desiccator. Each dessicator can hold one tube
rack (8 BeadChips).
24 Ensure the vacuum valve is seated tightly and securely.
25 Remove the red plug from the three-way valve before applying vacuum pressure.
26 Start the vacuum, using at least 508 mm Hg (0.68 bar).
27 To ensure that the dessicator is properly sealed, gently lift the lid of the vacuum
desiccator. It should not lift off the desiccator base.
Figure 55 Testing Vacuum Seal
28 Dry under vacuum for 50–55 minutes.
Drying times may vary according to room temperature and humidity.
Whole-Genome Gene Expression DASL HT Assay Guide
109
WG-DASL HT Assay Lab Protocols
29 Release the vacuum by turning the handle very slowly.
WARNING
Air should enter the desiccator very slowly to avoid disturbing the
contents. Improper use of the vacuum desiccator can result in damage to
the BeadChips. This is especially true if you remove the valve plug while
a vacuum is applied. For detailed vacuum desiccator instructions, see the
documentation included with the desiccator.
30 Store the desiccator with the red valve plug in the desiccator’s three-way valve to
stop accumulation of dust and lint within the valve port. Remove the red plug from
the three-way valve before applying vacuum pressure.
31 Touch the borders of the chips (do not touch the stripes) to ensure that the etched,
bar-coded side of the BeadChips are dry to the touch.
32 If the underside feels tacky, manually clean the underside of the BeadChip to
remove any excess XC4. The bottom two BeadChips are the most likely to have
some excess.
a Hold the BeadChip at a downward angle to prevent excess EtOH from dripping
onto the stripes.
b Wrap a pre-saturated Prostat EtOH Wipe around your index finger.
c Wipe along the underside of the BeadChip five or six times, until the surface is
clean and smooth.
CAUTION
Do not touch the stripes.
33 Clean the Hyb Chambers:
a Remove the rubber gaskets from the Hyb Chambers.
b Rinse all Hyb Chamber components with DI water.
c Thoroughly rinse the eight humidifying buffer reservoirs.
34 Discard unused reagents in accordance with facility standards.
35 Proceed to Image BeadChip on page 111.
110
Part # 15018210 Rev. D
Proceed to scanning the BeadChips. See the BeadArray Reader User Guide, iScan System
User Guide, or the HiScanSQ System User Guide for general instructions on scanning your
BeadChips. For specific scan settings refer to the following table:
Table 15 WG-DASL HT Assay Scan Settings
Scanner
iScan or HiScan
BeadArray Reader
Whole-Genome Gene Expression DASL HT Assay Guide
Scan Setting
Direct Hyb
DirectHyb Gene Expression
111
Image BeadChip
Image BeadChip
WG-DASL HT Assay Lab Protocols
GenomeStudio
The GenomeStudioGene Expression Module is an application for analyzing gene
expression data from scanned microarray images collected from systems, such as the
Illumina HiScan or iScan System or BeadArray Reader.
For feature descriptions and instructions on using the GenomeStudio platform to
visualize and analyze gene expression data, see the GenomeStudio Framework User
Guide and the GenomeStudio Gene Expression Module User Guide.
112
Part # 15018210 Rev. D
Appendix A WG-DASL HT AssayControls
Introduction
View the Control Report
Negative Controls
Oligo Annealing Controls
Array Hybridization Controls
Gene Intensity (Housekeeping and All Genes)
Whole-Genome Gene Expression DASL HT Assay Guide
114
115
116
117
118
119
113
Appendix A
WG-DASL HT
AssayControls
WG-DASL HT AssayControls
Introduction
This appendix describes the control oligos for the WG-DASL HT Assay and how to
view them. The control oligos include:
} Negative Controls on page 116
} Oligo Annealing Controls on page 117
} Array Hybridization Controls on page 118
} Gene Intensity (Housekeeping and All Genes) on page 119
114
Part # 15018210 Rev. D
The GenomeStudio software platform tracks the performance of these controls and
generates a report across all arrays on the BeadChip.
For more information, see the GenomeStudio Framework User Guide and the GenomeStudio
Gene Expression Module User Guide.
Whole-Genome Gene Expression DASL HT Assay Guide
115
View the Control Report
View the Control Report
WG-DASL HT AssayControls
Negative Controls
This category consists of query oligos targeting ~300 random sequences that do not
appear in the human genome. The mean signal of these probes defines the system
background. This background is represented by both the imaging system background
and by any signal resulting from cross-hybridization or non-specific binding of dye. The
GenomeStudio software platform uses the signals and signal standard deviation of
these probes to establish gene expression detection limits.
Figure 56 Negative Control Diagram
116
Part # 15018210 Rev. D
The oligo annealing controls test the efficiency of annealing ASOs with different Tms to
the same cDNA target. In each case, the higher Tm ASO should give higher signals than
the lower Tm ASO.
Figure 57 Oligo Annealing Controls
Whole-Genome Gene Expression DASL HT Assay Guide
117
Oligo Annealing Controls
Oligo Annealing Controls
WG-DASL HT AssayControls
Array Hybridization Controls
The array hybridization controls test the hybridization of single-stranded assay
products to the array beads. The controls consist of 50-mer oligos labeled with Cy3 dye
included in the HYB reagent.
Two types of controls comprise this category:
} Cy3-Labeled Hyb Control
} Low Stringency Hyb Control
Cy3-Labeled Hyb Controls
These controls consist of six probes with corresponding Cy3-labeled oligonucleotides
present in the HYB. Following successful hybridization, they produce a signal
independent of both the cellular RNA quality and success of the sample prep reactions.
Target oligonucleotides for the Cy3 Hyb controls are present at three concentrations
(low, medium, and high), yielding gradient hybridization responses.
Figure 58 Cy3-Labeled Hyb Control Diagram
Low Stringency Hyb Control
This control category contains four probes, corresponding to the medium- and highconcentration Cy3 Hyb control targets. In this case, each probe has two mismatch bases
distributed in its sequence. If stringency is adequate, these controls yield very low
signal. If stringency is too low, they yield signal approaching that of their perfect match
counterparts in the Cy3 Hyb control category.
Figure 59 Low Stringency Hyb Control Diagram
118
Part # 15018210 Rev. D
The intactness of the biological specimen can be monitored by housekeeping gene
controls. These controls consist of probes to housekeeping genes that typically are
expressed in most samples.
Figure 60 WG-DASL HT Control Summary
Whole-Genome Gene Expression DASL HT Assay Guide
119
Gene Intensity (Housekeeping and All Genes)
Gene Intensity (Housekeeping and All Genes)
120
Part # 15018210 Rev. D
Appendix B Assay Qualification Using gDNA
Introduction
Make Single-Use DNA (SUD) Plate
Data Analysis
Whole-Genome Gene Expression DASL HT Assay Guide
122
123
126
121
Appendix B
Assay Qualification Using
gDNA
Assay Qualification Using gDNA
Introduction
One unique feature of the WG-DASL HT Assay is that the performance of each target
site can be tested using genomic DNA as a sample. This is possible because the oligos
used in the WG-DASL HT Assay are designed to fall within exon boundaries.
As an option, the WG-DASL HT Assay user can use the Make SUD (Make Single-Use
DNA) process to prepare activated gDNA to include as a positive control sample.
The data derived from the gDNA samples can then be used to qualify individual target
assays during data analysis in the GenomeStudio software platform.
122
Part # 15018210 Rev. D
This process activates sufficient DNA of each individual sample to be used once in the
WG-DASL HT Assay.
Estimated Time
Hands-on: ~15 minutes
Incubation: 30 minutes
Consumables
Item
Quantity
Storage
10 mM Tris-HCl pH 8.0, 1 mM
EDTA (TE)
MS1 reagent
See instructions
Room temperature
Supplied
By
User
1 tube per SUD
plate
50 ng/µl
1 per sample
plate
-15° to -25°C
Illumina
-15° to -25°C
See manufacturer’s
instructions
User
User
Human genomic DNA
96-well 0.2 ml skirted microplate
Preparation
} In the appropriate columns of the Sample Sheet, enter the Sample_Name and
Sample_Plate for each Sample_Well defined in the Sample Sheet. See Sample Sheet
on page 31.
} Preheat the heat block to 95°C and allow the temperature to stabilize.
} Turn on the heat sealer to preheat it. Allow 15 minutes.
} Thaw the MS1 reagent tube to room temperature. Vortex to mix the contents, and
pour the entire tube into a new, non-sterile reservoir.
} Thaw the DNA samples and controls to room temperature and vortex to mix the
contents.
} Apply a SUD barcode label to a new 96-well microplate.
} On the lab tracking form, record:
• Date and time
• Operator
Whole-Genome Gene Expression DASL HT Assay Guide
123
Make Single-Use DNA (SUD) Plate
Make Single-Use DNA (SUD) Plate
Assay Qualification Using gDNA
• SUD plate barcode
• MS1 reagent barcode
NOTE
To record information about your assay such as operator information,
start and stop times, and barcodes, use the lab tracking form. This form
can be filled out and saved online, or printed and filled in by hand. Go to
http://www.illumina.com/documentation to download the lab tracking
form.
Make SUD
1
Normalize DNA samples to 50 ng/µl with 10 mM Tris-HCl pH 8.0, 1 mM EDTA.
2
Add 5 µl MS1 reagent to each well of the SUD plate.
3
Using an 8-channel pipette, transfer 5 µl normalized DNA sample to each well of
the SUD plate. Change tips between column dispenses.
4
Apply a microplate foil heat seal to the SUD plate and seal it with the heat sealer (3
seconds). Ensure that all wells are completely sealed.
5
Pulse centrifuge the SUD plate to 250 xg.
6
Vortex at 2300 rpm for 20 seconds, making sure the plate is firmly strapped to the
vortexer platform to prevent plate movement.
7
Pulse centrifuge to 250 xg.
NOTE
It is important to centrifuge the SUD plate to 250 xg before the 95°C
incubation to prevent the wells from drying out during incubation.
8
Place the SUD plate in the preheated heat block and close the lid.
9
Incubate the SUD plate at 95°C for exactly 30 minutes. Using the heat block cover,
cover the SUD plate to reduce condensation on the plate seal.
CAUTION
Do not allow the 95°C incubation period to exceed 30 minutes.
10 Record the start and stop times on the lab tracking form.
11 Pulse centrifuge the plate to 250 xg.
124
Part # 15018210 Rev. D
13 To use the activated gDNA in the Make ASE protocol, substitute 10 µl of the Make
SUD product in place of the usual 10 µl of the Make SUR product. Each well of the
ASE plate will contain 10 µl DAP, 30 µl OB1, and 10 µl of either SUR or SUD.
Whole-Genome Gene Expression DASL HT Assay Guide
125
Make Single-Use DNA (SUD) Plate
12 If you plan to perform the Make ASE protocol today, then immediately set the heat
block to 70°C.
Assay Qualification Using gDNA
Data Analysis
The GenomeStudio software platform will extract array intensity data from the gDNA
samples in the same way as for the cDNA samples. A description of how this data is
used to eliminate suboptimal probes is provided in the GenomeStudio Framework User
Guide.
126
Part # 15018210 Rev. D
A
acronyms 17
AM1 17, 39
amplification contamination 25
array hybridization controls
Gene Expression 118
ASE plate 17, 39, 63
ASO 17
assay
equipment 34
optional stopping points 62, 76
UDG, with or without 26
workflow 6
Assay-specific oligos 63
Assay Specific Oligo (ASO) 17
AutoLoader 12
AutoLoader2 12
B
balance centrifuge 30
barcodes
labels 25
BeadArray Reader 12, 112
best practices 25
bind PCR products 77
bleaching procedures 22
C
calibrate
pipettes 30
cap mats 25
handling techniques 25
cDNA 17
Whole-Genome Gene Expression DASL HT Assay Guide
Index
Index
cDNA Synth MCS4 Kit 40
centrifuge, balance 30
cleaning procedures 22
configuration 34
contamination
cap mats 25
PCR product 25
pipetting technique 67
seal removal tips 74
UDG 26
control oligos 56
Gene Expression 114
customer support 131
cycle PCR 76
D
DAP 17, 31-32, 39, 63
DASL 17
data analysis 13, 112
Deoxyribonucleic Acid (DNA) 17
DEPC 17
differential analysis 13, 112
dispense speed 81
DNA 17
amplification contamination 25
DNA polymerase 27
DNA Polymerase 40
documentation 131
Downstream-Specific Oligo 17
DSO 17
dUTP 26
127
Index
E
K
E1BC 17, 39
equipment 34
Ethanol 17
EtOH 17
extension and ligation 66
kit options 34
F
lab tracking form 31
M
fluorescently labelled primers 72
fluorometer 35
form, lab tracking 31
formamide 4
formamide warning 24
MCS3 iii
MCS4 iii, 18, 39, 56, 60
MEL 18, 39, 66
MH1 18, 39
MPB 18, 39, 77
MSDS for formamide 24
G
N
gene analysis 13, 112
GenomeScan 12
GenomeStudio 13, 112
guanidine 4
NaOH 18
NCBI RefSeq 7, 39
negative controls
Gene Expression 116
H
O
HCB 17, 39
heat sealer 35
help, technical 131
High Pure RNA Paraffin Kit 4, 41
HiScan 12, 112
HTW 17, 39
Hyb 17
HYB 17, 39
Hybridization 17
Hybridization Buffer 17
Hybridize 17
OB1 18, 39, 63
oligo annealing controls
Gene Expression 117
oligos, mis-hybridized or excess 66
I
Illumina product guide 34
INT plate 17, 39
Invitrogen 45
IP1 18, 39, 72
iScan System 10, 12, 34, 112
128
L
P
paramagnetic particles 63, 77
pause points 62, 76
PB1 18, 39
PCR
bind products 77
pre- and post-PCR areas 20
primer site 63
primers 72
product contamination 25
thermal cycler 35, 76
PCR plate 18, 39, 70
Part # 15018210 Rev. D
QRNA 18, 39
Quant-iT Assay Kit 41, 45
quantification
RNA 18
quantitate RNA 45
safety in lab procedures 16
Sample QRNA plate 45
sample sheet 31
samples
input amount 6
number of 26
overview 4
SCM 18, 39, 70
SDS 18, 28
signal intensity 10
Single-Use RNA (SUR) Plate 60
Sodium Hydroxide (NaOH) 18
spectrofluorometer 35
Standard QRNA plate 45
stop, optional 62, 76
SUR 18, 39
R
T
reagents
dispense technique 26
names 17
reuse 25
RiboGreen 41, 45
RiboGreen RNA quantitation kit 45
Ribonuclease (RNase) 18
Ribonucleic Acid (RNA) 18
RNA 18
quantification 18
ribosomal RNA 45
samples 4
RNA Paraffin Kit 4, 41
RNase 18
RNase-Free techniques 28
RTE iii, 18, 39
technical assistance 131
thermal cycler 35, 76
Titanium Taq 26-27, 40
S
W
safety
cap mats, handling 25
contamination 24
formamide 24
government standards 24
workflow 6
Q
Whole-Genome Gene Expression DASL HT Assay Guide
U
UB1 18, 40, 72
UB2 18, 40
UDG 19, 40
UHR Total RNA 59
Universal Starter Kit 34
Uracil DNA Glycosylase (UDG) 26,
70
USO 19
V
vortexer 29
X
XC4 solution 19, 40
xg 19
129
Index
pipettes
clean and calibrate 30
contamination prevention 67
dispense technique 26
plate labels 25
plates
cap mats 25
PMPs 18
PS1 18, 39
Index
130
Part # 15018210 Rev. D
For technical assistance, contact Illumina Customer Support.
Table 16 Illumina General Contact Information
Illumina Website
Email
http://www.illumina.com
[email protected]
Table 17 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
Contact Number
North America
1.800.809.4566
Italy
800.874909
Austria
0800.296575
Netherlands
0800.0223859
Belgium
0800.81102
Norway
800.16836
Denmark
80882346
Spain
900.812168
Finland
0800.918363
Sweden
020790181
France
0800.911850
Switzerland
0800.563118
Germany
0800.180.8994
United Kingdom
0800.917.0041
Ireland
1.800.812949
Other countries
+44.1799.534000
MSDSs
Material safety data sheets (MSDSs) are available on the Illumina website at
http://www.illumina.com/msds.
Product Documentation
You can obtain PDFs of additional product documentation from the Illumina website.
Go to http://www.illumina.com/support and select a product. To download
documentation, you will be asked to log in to MyIllumina. After you log in, you can
view or save the PDF. To register for a MyIllumina account, please visit
https://my.illumina.com/Account/Register.
Whole-Genome Gene Expression DASL HT Assay Guide
131
Technical Assistance
Technical Assistance
Illumina
Headquartered in San Diego, California, U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement