Dissertation2006 01 26

Dissertation2006 01 26

INAUGURAL-DISSERTATION zur

Erlangung der Doktorwürde der

Naturwissenschaftlich-Mathematischen Gesamtfakultät der

Ruprecht-Karls-Universität

Heidelberg vorgelegt von

Diplom-Biologin Katja Lauer aus Nürnberg

Tag der mündlichen Prüfung:

Nt-VIF – ein proteinogener Inhibitor der Vakuolären Invertasen in Tabak

Gutachter:

Prof. Dr. Thomas Rausch

Prof. Dr. Michael Wink

Inhaltsverzeichnis

__________________________________________________________________________________________________________________

1.

ZUSAMMENFASSUNG........................................................................ 1

2. EINLEITUNG ........................................................................................ 3

Nt-VIF ist ein Inhibitor von Vakuolären Invertasen ................................................................................................................................. 3

A INVERTASEN...................................................................................................................................... 4

2.1

D

AS

D

ISACCHARID

S

ACCHAROSE IM PFLANZLICHEN

Z

UCKERSTOFFWECHSEL

...........................................................................4

2.1.1

Aufbau und Synthese der Saccharose ......................................................................................................................4

2.1.2

Bedeutung der Saccharose im pflanzlichen Stoffwechsel.........................................................................................4

2.1.3

Enzymatische Saccharose-Spaltung.........................................................................................................................5

2.2

E

INTEILUNG DER

I

NVERTASE

-I

SOFORMEN

..............................................................................................................................5

2.3

I

NVERTASE

-S

EQUENZEN UND IHRE

E

IGENSCHAFTEN

..............................................................................................................6

2.3.1

Primärsequenzen Saurer Invertasen.........................................................................................................................6

2.3.2

Proteinstruktur Saurer Invertasen..............................................................................................................................8

2.3.3

Primärsequenzen Neutraler und Alkalischer Invertasen............................................................................................9

2.4

E

NZYMATISCHE

E

IGENSCHAFTEN VON

I

NVERTASEN

...............................................................................................................9

2.4.1

Substratspezifität und –affinität von Invertasen.........................................................................................................9

2.4.2

Effektoren der Enzymaktivität..................................................................................................................................10

Produkthemmung.................................................................................................................................................................................. 10 pH-Wert................................................................................................................................................................................................. 10

Substanzen, die Sulfhydryl-Gruppen zerstören.................................................................................................................................... 11

2.5

E

XPRESSIONSMUSTER UND

E

XPRESSIONSKONTROLLE

.........................................................................................................11

2.5.1

Die Expression von Invertasen ist streng reguliert ..................................................................................................11

2.5.2

Die einzelnen Invertase-Isoformen haben individuelle Expressionsprofile..............................................................12

2.5.3

Saure Invertasen sind vornehmlich in sink-Geweben lokalisiert..............................................................................12

2.5.4

Regulation durch Phytohormone .............................................................................................................................13

2.5.5

Mechanische Verwundung induziert Vakuoläre und apoplastische Invertasen.......................................................14

2.5.6

Induktion von Invertasen durch Pathogeninfektion..................................................................................................14

2.5.7

Zucker beeinflussen die Expression von Invertasen ...............................................................................................15

2.5.8

Kälte-Induktion von Vakuolären Invertasen.............................................................................................................16

2.5.9

Trockenstress ..........................................................................................................................................................17

2.5.10

Sauerstoffmangel.....................................................................................................................................................17

2.6

P

HYSIOLOGISCHE

B

EDEUTUNG VON

I

NVERTASEN

.................................................................................................................17

2.6.1

Die Funktionen von Invertasen sind vielfältig ..........................................................................................................17

2.6.2

Saure Invertasen und ihre Funktion bei der Assimilat-Verteilung............................................................................19

Die Assimilat-Verteilung wird über die Phloementladung reguliert....................................................................................................... 19

Saure Invertasen korrelieren mit der sink-Stärke ................................................................................................................................. 19

CWI als Schlüsselenzym der apoplastischen Phloementladung.......................................................................................................... 20

Die Rolle der VI bei der Assimilatverteilung.......................................................................................................................................... 21

2.6.3

Zucker-Gehalt und -Zusammensetzung werden von Invertasen beeinflusst...........................................................22

Beteiligung an der Regulation des Zuckergehalts ................................................................................................................................ 22

I

Inhaltsverzeichnis

__________________________________________________________________________________________________________________

Vakuoläre Invertasen bestimmen die Zucker-Zusammensetzung ....................................................................................................... 22

2.6.4

Invertasen haben Signalwirkung bei der Steuerung des Stoffwechsels..................................................................23

Lösliche Zucker als Signalmoleküle...................................................................................................................................................... 23

Invertasen beeinflussen die Entwicklung.............................................................................................................................................. 24

Invertasen bewirken eine erhöhte systemische Resistenz (SAR)........................................................................................................ 24

Verzögerung der Seneszenz ................................................................................................................................................................ 25

B INVERTASE-INHIBITOREN.............................................................................................................. 26

Was sind Invertase-Inhibitoren? ........................................................................................................................................................... 26

2.7

E

NTDECKUNG UND

P

HYLOGENETISCHE

E

INORDNUNG DER

I

NVERTASE

-I

NHIBITOREN

..............................................................26

2.7.1

Die Entdeckung der Invertase-Inhibitoren ...............................................................................................................26

2.7.2

Die Proteinfamilie der PMEI-RP ..............................................................................................................................27

2.8

E

IGENSCHAFTEN DER

I

NVERTASE

-I

NHIBITOREN

....................................................................................................................28

2.8.1

Sequenzen und davon abgeleitete Eigenschaften ..................................................................................................28

2.8.2

Proteinstruktur der Inhibitoren .................................................................................................................................28

2.8.3

Physikochemische Eigenschaften der Inhibitor-Proteine.........................................................................................29

Invertase-Inhibitoren sind nicht glykosyliert.......................................................................................................................................... 29

Säurestabilität ....................................................................................................................................................................................... 29

Hitzestabilität......................................................................................................................................................................................... 29

Reduktionsmittel zerstören die inhibitorische Aktivität.......................................................................................................................... 30

2.9

E

XPRESSION VON

I

NHIBITOREN

...........................................................................................................................................30

2.9.1

Die Expression der Invertase-Inhibitoren ist reguliert..............................................................................................30

2.9.2

Wo werden Invertase-Inhibitoren exprimiert?..........................................................................................................30

2.9.3

Modulatoren der Expression von Inhibitoren ...........................................................................................................31

2.10

K

OMPLEXBILDUNG UND

I

NHIBITION

......................................................................................................................................31

2.10.1

Invertase und Inhibitor bilden einen Komplex..........................................................................................................31

2.10.2

Der Invertase-Inhibitor-Komplex kann in unterschiedlichen Formen vorliegen .......................................................32

pH-Wert................................................................................................................................................................................................. 33

Temperatur ........................................................................................................................................................................................... 33

Zweiwertige Ionen................................................................................................................................................................................. 33

Das Substrat Saccharose schützt vor der Inhibition............................................................................................................................. 34

2.10.3

Spezifität von Inhibitoren .........................................................................................................................................34

2.11

P

HYSIOLOGISCHE

B

EDEUTUNG VON

I

NVERTASE

-I

NHIBITOREN

...............................................................................................35

2.11.1 Proteinogene Inhibitoren als posttranslationale Regulatoren von Invertasen..........................................................35

2.11.2

Hinweise auf inhibitorische Funktion in vivo ............................................................................................................35

Kolokalisation von Invertasen und Inhibitoren, Komplexbildung in vivo ............................................................................................... 35

Anhaltspunkte für Inhibition in vivo ....................................................................................................................................................... 36

2.12 B

IOTECHNOLOGISCHE

B

EDEUTUNG VON

I

NVERTASE

-I

NHIBITOREN

.........................................................................................36

Haben Invertase-Inhibitoren biotechnologisches Potential?................................................................................................................. 36

Manipulation von Erträgen aus sink-Geweben..................................................................................................................................... 37

Manipulation der Zuckerzusammensetzung......................................................................................................................................... 37

Reduktion von Lagerverlusten .............................................................................................................................................................. 37

C ZIELSETZUNG .................................................................................................................................. 38

II

Inhaltsverzeichnis

__________________________________________________________________________________________________________________

3. ERGEBNISSE..................................................................................... 39

A ÜBERBLICK...................................................................................................................................... 39

B CHARAKTERISIERUNG EINES VAKUOLÄREN INVERTASE-INHIBITORS AUS TABAK .......... 40

3.1 E

TABLIERUNG EINES

V

ERFAHRENS ZUR RENATURIERENDEN

A

UFREINIGUNG VON REKOMBINANTEM

I

NHIBITOR

-P

ROTEIN

N

T

-VIF

.........................................................................................................................................................................................40

3.1.1 Informationen zum Inhibitor-Konstrukt V0 ...............................................................................................................40

3.1.2 Die Wahl des Expressionssystems pQE .................................................................................................................40

3.1.3 Überexpression in Bakterien und Renaturierung.....................................................................................................41

3.2 I

NHIBITOR

-M

UTANTEN

........................................................................................................................................................42

3.2.1 Klonierung der Inhibitor-Mutanten ...........................................................................................................................42

3.2.2 Überexpression und Aufreinigung der rekombinanten Proteine..............................................................................43

3.2.3 Elutionsprofil der Inhibitor-Proteine..........................................................................................................................43

3.2.4 Konzentrationsbestimmung der rekombinanten Proteine........................................................................................45

3.2.5 Die Mutationen ändern den Einfluss der Inhibitoren auf die VI................................................................................46

3.3 R

EDOXSTATUS DES

I

NHIBITORS

..........................................................................................................................................48

3.3.1 Reduktives Erhitzen zerstört die Aktivität von Nt-VIF ..............................................................................................48

3.3.2 Aktivierende Inhibitoren sind nicht zwangsläufig reduziert ......................................................................................50

3.4 S

PEZIFITÄT DER

I

NHIBITOREN

.............................................................................................................................................51

3.4.1 Nt-VIF, Nt-CIF und ihre Wirkung auf Invertasen......................................................................................................51

3.4.2 Inhibitor-Chimären ...................................................................................................................................................52

3.5 N

ACHWEIS DES

I

NHIBITOR

-P

ROTEINS

..................................................................................................................................54

3.5.1 Affinitätsreinigung des Antiserums ..........................................................................................................................54

3.5.2 Der vakuoläre Inhibitor in planta..............................................................................................................................55

C VAKUOLÄRE INVERTASEN DER SOLANACEEN......................................................................... 56

3.6 V

ERVOLLSTÄNDIGUNG DER C

DNA

S VON

VI

S AUS

T

ABAK UND

K

ARTOFFEL

.............................................................................56

3.7 VI-P

ROTEIN UND

VI-A

KTIVITÄTEN IN VERSCHIEDENEN

G

EWEBEN VON

T

ABAK

........................................................................58

3.7.1 VIs werden als Proteinfragmente detektiert.............................................................................................................58

3.7.2 Die VI-Aktivitäten sind in den Geweben unterschiedlich hoch.................................................................................59

4. DISKUSSION...................................................................................... 60

A INHIBITOREN.................................................................................................................................... 60

4.1 S

TUDIEN AM REKOMBINANTEN

N

T

-VIF.................................................................................................................................60

4.1.1 Die Renaturierung von Nt-VIF erfordert besondere Pufferbedingungen .................................................................60

4.1.2

Die strukturelle Ähnlichkeit von Nt-VIF und Nt-CIF..................................................................................................61

4.1.3

Deletionen führen schnell zum Aktivitätsverlust der Inhibitoren ..............................................................................63

III

Inhaltsverzeichnis

__________________________________________________________________________________________________________________

4.1.4

Bedeutung der Disulfidbrücken für die strukturelle Integrität...................................................................................64

4.1.5

Spezifität von Inhibitoren gegenüber Invertase-Isoformen ......................................................................................64

4.2 D

AS

A

KTIVIERUNGSPHÄNOMEN

...........................................................................................................................................65

Welche Inhibitoren wirken aktivierend? ................................................................................................................................................ 65

Wie könnten aktivierende Inhibitor-Proteine wirken? ........................................................................................................................... 66

Wie ließe sich die Wirkweise nachprüfen? ........................................................................................................................................... 66

4.3 N

T

-VIF

IN PLANTA

..............................................................................................................................................................67

4.3.1

Nt-VIF – ein sehr spezielles Protein? ......................................................................................................................67

Ein Nachweis von Nt-VIF in Wildtyp-Pflanzen ist bisher nicht möglich ................................................................................................ 67

Nt-VIF – ein zelltyp-spezifisches Protein? ............................................................................................................................................ 68

Welche Zelltypen könnten Nt-VIF exprimieren? ................................................................................................................................... 69

4.3.2

Inhibitoren als biologische Schalter .........................................................................................................................69

B INVERTASEN.................................................................................................................................... 70

4.4 V

ERVOLLSTÄNDIGUNG DER

I

NVERTASE

-S

EQUENZEN

............................................................................................................70

4.5 V

ERSCHIEDENE

VI

S IM

S

EQUENZVERGLEICH

........................................................................................................................71

4.6 D

IE

N

T

-VI

IN PLANTA

..........................................................................................................................................................73

4.6.1

Die VI aus Tabak wird in Fragmenten detektiert......................................................................................................73

4.6.2

Invertase-Aktivitäten in verschiedenen Geweben....................................................................................................74

5.1 RACE-T

ECHNIK ZUR

V

ERVOLLSTÄNDIGUNG VON C

DNA-E

NDEN

...........................................................................................76

5.2 K

LONIERUNG VON

DNA-F

RAGMENTEN

................................................................................................................................76

5.2.1 Klonierung der Inhibitor-Mutanten ...........................................................................................................................76

Primer für die Deletionsklone................................................................................................................................................................ 76

Klonierung in den Überexpressionsvektor............................................................................................................................................ 78

5.2.2 Klonierung der Inhibitor-Chimären...........................................................................................................................78

Prinzip der Klonierung........................................................................................................................................................................... 78

Primer für die soeing-PCR.................................................................................................................................................................... 79

elektrokompetenter

5.3 H

ERSTELLUNG REKOMINANTER

P

ROTEINE

...........................................................................................................................80

5.3.1 Überexpression in Bakterien....................................................................................................................................80

5.3.2 Extraktion und Renaturierung rekombinanter Proteine............................................................................................80

5.4 C

HEMISCHE

R

EDUKTION REKOMBINANTER

P

ROTEINE

...........................................................................................................80

5.5 P

ROTEIN

-P

RÄPARATION AUS PFLANZLICHEN

G

EWEBEN

........................................................................................................81

5.5.1 Herstellung von löslichen Protein-Rohextrakten......................................................................................................81

5.5.2 ConA-Chromatographie...........................................................................................................................................81

5.6 B

ESTIMMUNG DER

I

NVERTASEAKTIVITÄT

..............................................................................................................................81

5.7 P

ROTEIN

-G

ELELEKTROPHORESE

........................................................................................................................................82

5.7.1 SDS-PAGE ..............................................................................................................................................................82

5.7.2 Coomassie-Färbung ................................................................................................................................................82

IV

Inhaltsverzeichnis

__________________________________________________________________________________________________________________

5.8 W

ESTERN

B

LOT

A

NALYSE

..................................................................................................................................................83

5.8.1 Antiseren..................................................................................................................................................................83

Antiserum gegen eine vakuoläre Invertase aus Beta vulgaris.............................................................................................................. 83

Antiserum gegen Nt-VIF – Affinitätsreinigung....................................................................................................................................... 83

5.8.2 Western Blot Verfahren ...........................................................................................................................................83

5.8.3 Amidoschwarzfärbung .............................................................................................................................................84

5.9 S

EQUENZANALYSEN

...........................................................................................................................................................84

6. LITERATURVERZEICHNIS................................................................ 85

7.

ANHANG ............................................................................................ 92

7.1 A

BKÜRZUNGSVERZEICHNIS

.................................................................................................................................................92

7.2 O

RIGINALDATEN

.................................................................................................................................................................93

7.2.1 Proteinkonzentration der Inhibitor-Mutanten und -Chimären...................................................................................93

7.2.2 Elutionsprofil der Inhibitormutanten .........................................................................................................................94

7.2.3

Einfluss der Inhibitoren auf die Invertaseaktivität ....................................................................................................94

7.2.4

Dosisabhängigkeit der Inhibition..............................................................................................................................95

7.2.5

Redoxstatus des Inhibitors Nt-VIF...........................................................................................................................96

7.2.6

Spezifität der Inhibitoren..........................................................................................................................................97

7.2.7

Vervollständigung der VI-Sequenzen ......................................................................................................................99

7.2.8

Aktivität der Nt-VI in verschiedenen Geweben ......................................................................................................101

V

Zusammenfassung

__________________________________________________________________________________________________________________

1. Z

USAMMENFASSUNG

Saure Invertasen haben im pflanzlichen Stoffwechsel eine große Bedeutung. Sie spielen eine wichtige

Rolle bei der Regulation sink-Stärke und damit zusammenhängend der Assimilatverteilung in der Pflanze.

Darüber hinaus beeinflussen sie die Zusammensetzung löslicher Zucker. Nachdem diese auch als Signale für verschiedene Stoffwechselprozesse dienen, kommt den Sauren Invertasen auch eine Funktion bei der pflanzlichen Entwicklung sowie verschiedenen Stressreaktionen zu. Eine Komponente der posttranslationalen Regulation der Invertasen stellen die Invertase-Inhibitoren dar, kleine Proteine, die spezifische

Komplexe mit den Enzymen bilden und ihre Aktivität herabsetzen.

Sowohl die Vakuolären Invertasen (VIs) der Solanaceen sowie insbesondere der vakuoläre Inhibitor

Nt-VIF der Modellpflanze Nicotiana tabacum (Tabak) wurden im Rahmen dieser Arbeit molekularbiologisch und biochemisch näher charakterisiert. Die partiellen Sequenzen von VIs aus Tabak (Nt-VI) und

Kartoffel (St-VI) wurden vervollständigt. Bei etwa konstanter Proteinmenge unterscheidet sich die Aktivität der löslichen Invertasen in den vegetativen Geweben bei Tabak erheblich, was auf regulierende Mechanismen hinweist.

Der Inhibitor Nt-VIF wurde in dieser Arbeit erstmals als funktionelles Protein rekombinant hergestellt.

Anders als die apoplastische Isoform Nt-CIF, der die Invertasen beider Kompartimente gleichermaßen zu hemmen vermag, inhibiert Nt-VIF nur die Vakuoläre Invertase. Durch Experimente mit chimären

Proteinen, die zu je einer Hälfte aus der einen und anderen Isoform bestehen, konnte ermittelt werden, dass der N-Terminus für die Spezifität verantwortlich ist. Eine Deletion weniger Aminosäuren an diesem

Ende führt zur Inaktivierung von Nt-VIF. C-terminal können über 18 Aminosäuren fehlen, ohne dass die

Inhibitonsfähigkeit beeinträchtigt wird.

Die Mutation bereits eines der konservierten Cysteine führt ebenso wie die chemische Reduktion am rekombinanten Nt-VIF zur Inaktivität des Inhibitors. Die postulierte Bedeutung von Disulfidbrücken für die strukturelle Integrität des Proteins konnte dadurch experimentell bestätigt werden.

Paradoxerweise fördern viele nicht aktive rekombinante Inhibitoren in dieser wie auch in anderen Arbeiten die Aktivität der Invertasen. Die Analysen sprechen für ein Artefakt, das durch nicht nativ gefaltete rekombinante Proteine ausgelöst wird. Sie aggregieren wahrscheinlich mit den endogenen Inhibitoren der

Invertase-Präparation und führen so zu einer scheinbaren Erhöhung der Aktivität.

Der endogene Nt-VIF konnte bisher nicht in Pflanzen nachgewiesen werden, obwohl das Gen transkribiert wird. Die Expression wird daher nur in speziellen Gewebebereichen vermutet.

1

Zusammenfassung

__________________________________________________________________________________________________________________

Acid invertases play a crucial role in plant metabolism. They strongly influence sink strength and assimilate partitioning. Additionally they are involved in regulation of sugar composition. As soluble sugars function as signals, these enzymes are connected with several developmental processes and stress reactions. One component in posttranslational regulation are invertase inhibitors, small proteins that form specific complexes with invertases and lower their activity.

This work investigates vacuolar invertases (VI) of the solanaceae family with special emphasis on the vacuolar inhibitor Nt-VIF of the model plant Nicotiana tabacum (tobacco). The partial sequences of a tobacco (Nt-VI) and a potato (St-VI) invertase have been completed. Although different vegetative tissues show similar protein amounts the activity differs strongly indicating regulatory mechanisms.

The inhibitor Nt-VIF was overexpressed and renaturated as a functional recombinant protein for the first time and shown to exclusively inhibit the vacuolar invertase. On the other hand the apoplastic isoform

Nt-CIF inhibits the enzymes of both compartments. Chimeric proteins consisting of the combined halves of both inhibitors showed the significance of the N-terminus for enzyme specificity. A relatively short deletion in this region therefore inactivates Nt-VIF, whereas a C-terminal deletion of more than 18 amino acids is tolerated.

Mutation of one of the four strongly conserved cystein residues inactivates the protein completely.

Treatment with reducing agents has the same effect confirming the postulated importance of disulfid bridges for structural integrity.

Paradoxically, many inactive recombinant inhibitors increase invertase activity. This can be interpreted as an artefact of denatured protein leading to inactivation of endogenous inhibitors through aggregation.

Although Northern Blot studies show specific transcription of the endogenous inhibitor Nt-VIF, the protein could not be detected so far. This could be due to expression limited to special cell types.

2

Einleitung

__________________________________________________________________________________________________________________

2. E

INLEITUNG

Nt-VIF ist ein Inhibitor von Vakuolären Invertasen

Das in dieser Arbeit untersuchte Protein Nt-VIF

1

aus Tabak gehört zur Gruppe der Invertase-Inhibito-

ren. Diese fungieren als regulatorische Elemente im Zuckerstoffwechsel: Sie hemmen posttranslational die hydrolytische Aktivität von Invertasen, die nach der offiziellen IUBMB-Enzym-Nomenklatur

2

als

β-Fruktofuranosid-Fruktohydrolasen (EC 3.2.1.26

3

) bezeichnet werden. Im Gegensatz zum apoplastisch lokalisierten NtCIF

4

, der als erster Vertreter aus dieser Proteinfamilie kloniert wurde (Greiner et al. 1998), handelt es sich bei Nt-VIF um ein vakuoläres Protein.

Die durch Invertasen katalysierte Hydrolyse von Saccharose wird an verschiedenen Stellen des pflanzlichen Metabolismus notwendig. Daher finden sich in pflanzlichen Genomen eine Reihe von Invertase-

Isoformen mit streng regulierten Expressionsmustern. Nur die so genannten Sauren Isoformen (siehe

Kapitel 2.2, Seite 5) können von den hier untersuchten proteinogenen Inhibitoren reguliert werden. Neutrale und Alkalische Invertasen werden daher nur am Rande vorgestellt.

Besonderes Interesse gilt im Rahmen dieser Arbeit denjenigen Isoformen, die in der Vakuole lokalisiert sind (Vakuoläre Invertase = VI) und somit als Zielenzym des Inhibitors Nt-VIF, beziehungsweise seiner in anderen Spezies postulierten Homologe in Frage kommen.

1

Nt-VIF = engl.: Nicotiana tabacum vacuolar inhibitor of

β-fructosidase, Inhibitor der β-Fruktosidasen in der Vakuole

2

IUBMB = International Union of Biochemistry and Molecular Biology

3

http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/2/1/26.html

4

Nt-CIF = engl.: Nicotiana tabacum cell wall inhibitor of

β-fructosidase, Inhibitor der β-Fruktosidasen in der Zellwand

3

Einleitung

__________________________________________________________________________________________________________________

A I

NVERTASEN

2.1 Das Disaccharid Saccharose im pflanzlichen Zuckerstoffwechsel

2.1.1 Aufbau und Synthese der Saccharose

Invertasen setzen in erster Linie das Zucker-Dimer Saccharose um (zur Substratspezifität siehe Kapitel

2.4, Seite 9). Das Molekül besteht aus den Monomerzuckern Glukose (Glk) und Fruktose (Frk), die über eine α,β-1,2-glykosidische Bindung miteinander verknüpft sind (siehe Abbildung 2.1, Seite 10).

Die Saccharose-Synthese findet im Zytosol statt. Ausgangsstoffe sind reduzierte Kohlenhydrate, die in

Form von Triosephosphaten im Antiport gegen anorganisches Phosphat aus Plastiden exportiert werden.

Die Triosephosphate stammen dabei entweder unmittelbar aus dem Calvin-Zyklus der Photosynthese oder aus dem phosphorylytischen Abbau von Speicher-Stärke. Beim Stärke-Abbau fällt außerdem Glukose an, die von Amylasen durch Hydrolyse erzeugt wird, über einen eigenen Translokator ins Zytosol gelangt und von einer Hexokinase aktiviert in die Saccharose-Synthese einfließt.

Wie viele der zur Verfügung stehenden Kohlenhydrate in die Synthese von Saccharose einfließen ist streng reguliert. Konkurrenz-Reaktionen sind zum einen anabole Prozesse wie etwa die Zellulose-Synthese oder die Glykolyse zur Energiegewinnung. Verminderte Metabolisierung der Triosephosphate im

Zytosol führt dagegen zu einem Anstau im Chloroplasten, der durch Aufbau von transitorischer Stärke abgepuffert wird. Die Verteilung der Assimilate auf die verschiedenen Stoffwechselprozesse wird als

Allokation bezeichnet.

2.1.2 Bedeutung der Saccharose im pflanzlichen Stoffwechsel

Saccharose ist die im Pflanzenreich vorherrschende Transportform für Kohlenstoff-Assimilate. Ausnahmen bilden die Familien des Raffinose-Typs (Cucurbitaceae, Scrophulariaceae, Verbenaceae), die

Tri- oder Tetrasaccharide wie Raffinose (siehe Abbildung 2.1, Seite 10) oder Stachyose transportieren, sowie einige Familien, bei denen die Assimilate zu Zuckeralkoholen wie Sorbitol (Rosaceae) oder Mannitol (Apiaceae) umgewandelt werden. Der Vorteil der Mehrfachzucker gegenüber den Monomeren, aus denen sie zusammengesetzt sind, ist die höhere chemische Stabilität. Durch die glykosidische Bindung sind die reduzierenden C-Atome maskiert und so vor Oxidation geschützt. Saccharose dient außerdem der

Speicherung von Assimilaten in der Vakuole, in den meisten Fällen nur kurzfristig und in geringen

Konzentrationen. In manchen Spezies stellt Saccharose aber auch die Langzeit-Speicherform für Kohlenhydrate dar. In den Internodien des Zuckerrohrs (Saccharum spec.) beispielsweise können Konzentrationen von 0,8 M erreicht werden (Zhu et al. 2000), in modernen Zuchtsorten der Zuckerrübe (Beta vulga-

ris) sogar über 20% w/w des Trockengewichts (Leigh et al. 1979).

4

Einleitung

__________________________________________________________________________________________________________________

Saccharose fungiert darüber hinaus als Signal für den Zuckerstatus (Roitsch 1999) und beeinflusst die

Genexpression (Koch et al. 1996). Entscheidend ist in diesem Zusammenhang jedoch nicht die absolute

Konzentration des Dimers, sondern vielmehr der Konzentrations-Quotient Hexosen/Saccharose. Demnach hat Saccharose eine regulatorische Funktion.

2.1.3 Enzymatische Saccharose-Spaltung

Die vielfältigen Funktionen des Saccharose-Moleküls im pflanzlichen Stoffwechsel erfordern eine strenge

Regulation, die neben Synthese und Translokation auch den Abbau des Moleküls einschließt. In Pflanzen sind zwei Reaktionstypen für die Saccharose-Spaltung bekannt, die durch verschiedene Enzymklassen katalysiert werden:

Die Saccharose-Synthase (EC 2.4.1.13) ist im chemischen Sinn eine Glykosyltransferase: Der Glukoserest der Saccharose wird auf UDP übertragen, Fruktose wird freigesetzt. Unter physiologischen Bedingungen entspricht die Bindungsenergie in dem Produkt UDP-Glukose der glykosidischen Bindung des

Zucker-Dimers. Die Reaktion ist somit theoretisch reversibel (Geigenberger und Stitt 1993), dient jedoch

– anders als ihr Name vermuten lässt – im zellulären Kontext vornehmlich zur Gewinnung von UDP-

Glukose (Winter et al. 1997). Auf diese Weise aktiviert fließt der Zucker hauptsächlich in anabole Prozesse ein, wie zum Beispiel in die Synthese von Zellulose für die Zellwand (Amor et al. 1995, Winter et

al. 1997, 1998).

Demgegenüber spalten Invertasen (EC 3.2.1.26) die Saccharose hydrolytisch unter Verbrauch eines

Wassermoleküls und setzen die Monosaccharide Glukose und Fruktose frei. Die in der glykosidischen

Bindung gespeicherte Energie geht dabei verloren, die Reaktion ist irreversibel (Geigenberger und Stitt

1993).

2.2 Einteilung der Invertase-Isoformen

Bei den verschiedenen Invertase-Isoformen unterscheidet man die Sauren Invertasen (SI), von denen in dieser Arbeit hauptsächlich die Rede sein soll, von den neutralen und alkalischen Invertasen (NAI), die nur am Rande erwähnt werden. Diese Einteilung nach dem pH-Optimum ihrer Aktivität wird durch weitere physikochemische und biologische Eigenschaften untermauert:

NAI und SI sind in unterschiedlichen Kompartimenten lokalisiert, deren pH-Wert weitgehend dem

Aktivitätsoptimum der Enzyme entspricht. Während die NAI im Zytosol zu finden sind, handelt es sich bei Sauren Invertasen entweder um lösliche Vakuoläre Invertasen (VI) oder um apoplastisch lokalisierte

Isoformen, die über ionische Wechselwirkungen an die Zellwand gebunden sind (CWI

1

). Ihr meist stark

1

CWI = engl.: cell wall invertase, Zellwandinvertase

5

Einleitung

__________________________________________________________________________________________________________________ im Alkalischen gelegener isoelektrischer Punkt (Unger et al. 1994, Sturm 1999, de Coninck et al. 2005) ermöglicht im sauren extrazellulären Milieu die ionische Bindung an negativ geladene Zellwandstrukturen. Demgegenüber liegt der der Vakuolären Invertasen in der Regel im Sauren (Unger et al. 1994).

Saure Invertasen durchlaufen den sekretorischen Weg und sind N-glykosyliert (Sturm 1999). Diese Eigenschaft macht man sich im Rahmen der Proteinaufreinigung zunutze, bei der die NAI zusammen mit allen anderen zytosolischen Proteinen entfernt werden, da sie keine Affinität zu einer Lektin-gebundenen

Matrix (ConA-Matrix) haben.

2.3 Invertase-Sequenzen und ihre Eigenschaften

2.3.1 Primärsequenzen Saurer Invertasen

Ihre starken Sequenzhomologien legen die Vermutung nahe, dass alle Sauren Invertasen auf ein

Ursprungsgen zurückgehen, welches nicht nur den Pflanzen, sondern auch den Hefen und Bakterien gemeinsam ist (Sturm und Tang 1999). Sie bilden eine kleine Genfamilie, zu der auch die Fruktosyltransferasen im engeren Sinne, sowie die Fruktan-Exohydrolasen gehören (siehe unten): Im vollständig sequenzierten Genom von A. thaliana sind vier Sequenzen als CWIs und zwei als VIs annotiert (de Coninck

et al. 2005).

Das Molekulargewicht Saurer Invertasen liegt etwa zwischen 55-70 kD (Sturm 1999).

Saure Invertasen werden als Präproproteine synthetisiert, die N-terminal bis zu 100 Aminosäuren länger sind als das reife Protein (Sturm und Chrispeels 1990, Unger et al. 1994, Sturm 1999). Während das

Prä-Peptid als sekretorisches Signalpeptid für den Transit in das ER verantwortlich ist, ist die Funktion der anschließenden propeptidischen Sequenz noch unklar. Sowohl ein stabilisierender Effekt auf die Proteinstruktur, die Regulation der Enzymaktivität oder eine Beteiligung am vakuolären Targeting der VIs sind denkbar (Tymowska-Lalanne und Kreis 1998).

Eine Funktion im Rahmen des Transits in die Vakuole wird auch für C-terminale hydrophobe Exten-

sionen diskutiert, die sich bei den meisten der bisher untersuchten Vakuolären Invertasen finden. Eine solche wurde auch für andere vakuoläre Proteine nachgewiesen (Bednarek und Raikhel 1992).

Alle Sauren Invertasen haben zwei konservierte Motive: zum einen das nahe dem N-Terminus gelegene

β-Fruktosidase-Motiv NPDN (Sturm und Chrispeels 1990), welches maßgeblich für die Erkennung von

β-ständiger Fruktose verantwortlich ist; zum anderen ein Motiv mit der Sequenz WEC-P/V-D (Sturm und Chrispeels 1990), dessen Lage im katalytischen Zentrum bestätigt wurde (siehe Kapitel 2.3.2,

Seite 8). Die alternative vierte Stelle des Motivs ist in Zellwandinvertasen generell durch Prolin, bei VIs mit Valin besetzt. Dieser Unterschied alleine ist für die höhere Umsatzrate von Raffinose sowie das wei-

6

Einleitung

__________________________________________________________________________________________________________________ ter im Sauren gelegene pH-Optimum (siehe Kapitel 2.4.2, Seite 10) der apoplastischen gegenüber den vakuolären Invertasen verantwortlich (Goetz und Roitsch 1999).

Die abgeleiteten Proteinsequenzen der Sauren Invertasen clustern in zwei Gruppen, in denen die Vertreter je eines Kompartiments zusammengefasst sind: die Vakuolären und die Zellwand-Invertasen (Godt und Roitsch 1997, Tymowska-Lalanne und Kreis 1998, Goetz und Roitsch 1999, van den Ende et al.

2000). Das bedeutet, die Isoformen verschiedener Kompartimente innerhalb einer Art unterscheiden sich stärker voneinander als zwei Isoformen desselben Kompartiments, selbst wenn sie aus verschiedenen

Spezies stammen. Dies gilt über die Grenzen der systematischen Familien und Klassen hinaus selbst für

Vertreter aus monokotylen verglichen mit dikotylen Spezies (Goetz und Roitsch 1999, Unger et al. 1994).

Stammesgeschichtlich muss demnach die Spezialisierung der Invertasen auf verschiedene Kompartimente vor der Entwicklung der Arten erfolgt sein.

Neben Invertasen gruppieren auch Vertreter anderer Enzymklassen mit den Sauren Invertasen (van den

Ende et al. 2000, de Coninck et al. 2005):

Im Alignment der abgeleiteten Proteinsequenzen finden sich die Vakuolären Invertasen in einer Gruppe mit den Fruktosyltransferasen im engeren Sinne (van den Ende et al. 2000, Lüscher et al. 1996). Diese vakuolären Enzyme übertragen β2-Fruktosylreste auf andere Zuckermoleküle. Die meisten von ihnen haben keine sukrolytische Aktivität (Hellwege et al. 2000, Lüscher et al. 1996), manche können Saccharose jedoch hydrolysieren (Sprenger et al. 1995). Fruktosyltransferasen dienen der Synthese von Fruktanen (Edelmann und Jefford 1968, Vijn und Smeekens 1999), bei der ein Saccharose-Molekül mit unterschiedlich vielen Fruktosyleinheiten verknüpft wird. Die meisten Invertasen im engeren Sinne können neben ihrer sukrolytischen Aktivität auch das Fruktan 1-Kestose bilden, indem sie den Fruktosylrest statt auf Wasser auf ein weiteres Molekül Saccharose übertragen (1-SST

1

Aktivität, siehe Kapitel 2.4.1, Seite

9). Diese Fähigkeit zur Fruktosyl-Übertragung untermauert die gemeinsame evolutionäre Herkunft von

VIs und Fruktosyltransferasen i. e. S. auf enzymatischer Ebene.

Zellwandinvertasen sind demgegenüber Fruktan-Exohydrolasen (FEHs) ähnlich, die nicht zur Spaltung der glykosidischen β-(1,2) Bindung in Saccharose fähig sind, sondern als Substrat nur die komplexeren Fruktane akzeptieren. Anders als die apoplastischen CWIs sind sie in der Vakuole lokalisiert (van den

Ende et al. 2000, de Coninck et al. 2005).

Die Sauren Invertasen werden mit den anderen genannten und vielen weiteren Enzymen aufgrund ihrer

Sequenzähnlichkeiten in der Familie Nr. 32 der Glykosid-Hydrolasen (GH32) zusammengefasst (Henrissat 1991).

1

1-SST = Saccharose-Saccharose-1-Fruktosyltransferase (überträgt Fruktosylrest von einem Molekül

Saccharose auf das C1-Atom eines anderen Saccharose-Moleküls)

7

Einleitung

__________________________________________________________________________________________________________________

2.3.2 Proteinstruktur Saurer Invertasen

Bisher wurde allein die Proteinstruktur einer Invertase aus dem Bakterium Thermotoga maritima aufgeklärt, wonach sich das Enzym aus zwei Domänen zusammensetzt: Fünf β-Faltblatt-Strukturen sind wie

Rotorblätter zu einem Propeller angeordnet. Sie bestehen aus jeweils vier antiparallelen β-Strängen, die nur teilweise durch kurze helikale Abschnitte unterbrochen werden. Dies ist jedoch typisch für solche

Propellerblätter, da für ihre klassische W-Form, bei der die β-Strang-Paare etwa im rechten Winkel zueinander stehen, eine Drehung der Stränge gegeneinander erforderlich ist. Im Zentrum der Propeller-Domäne wird von allen N-terminal ersten β-Strängen der Rotorblätter eine trichterförmige Einbuchtung gebildet. Hier liegt das Aktive Zentrum. Dessen negative Ladung kommt durch drei saure Aminosäuren zustande, die unmittelbar für die Katalyse verantwortlich sind und daher nicht nur bei den Invertasen und ihren verwandten Enzymen, sondern in zwei weiteren Glykosid-Hydrolase Familien hochkonserviert sind. Es handelt sich um die Aspartatreste (D) des NDPN- sowie FRDP-Motivs, sowie das Glutamat (E) des WEC/PD- Motivs (siehe Kapitel 2.3.1, Seite 6). Eine Anzahl weiterer Aminosäuren bewerkstelligen die Bindung des Substrats. Sie sind teilweise weniger stark konserviert und verteilen sich über die gesamte Sequenz. C-terminal schließt sich an den Propeller nach einem zehn Aminosäuren langen linker eine β-Sandwich-Domäne an, die etwa ein Viertel des gesamten Proteins ausmacht. Sie besteht aus zwei

Blättern zu je sechs β-Strängen. Die Sequenz der β-Sandwich-Domäne ist innerhalb der GH32-Familie weit weniger konserviert als die katalytische β-Propeller-Domäne. Im strukturellen Vergleich zeigt sie starke Ähnlichkeiten mit anderen β-Sandwich-Domänen, vor allem derjenigen eines humanen Galektins.

Das Struktur-Motiv ist darüber hinaus auch aus Lektinen, Kohlenhydrat-Binde-Domänen und weiteren

Proteinen bekannt. Die Funktion der β-Sandwich-Domäne wird im Rahmen der Zucker-Oligomerisierung vermutet, auch wenn sie anscheinend nicht mehr bei allen Enzymen der Familie funktionsfähig ist (Alberto et al. 2004).

Bei beiden Domänen handelt es sich um bekannte Struktur-Motive. Neben verschiedenen Proteinen mit sechs- oder sieben-blättrigen Propellern, wie etwa bei dem Enzym Sialidase aus Vibrio cholerae (sechsblättriger Propeller), sind auch einige mit fünf-gliedrigen Propellern bekannt. Neben dem Protein Tachylektin finden sie sich in verschiedenen Glykosid-Hydrolasen, wie etwa einer Arabinase und einer Levansukrase, die zu anderen GH-Familien als die Sauren Invertasen gehören.

Die Struktur dieser Invertase ist nahezu identisch mit denen einer Inulinase sowie einer Levanase. Nachdem diese Enzyme alle in der Glykosid Hydrolase Familie GH32 zusammengefasst sind (siehe Kapitel

2.3.1, Seite 6) kann man davon ausgehen, dass alle Saure Invertasen derart aufgebaut sind (Verhaest et al.

2005).

8

Einleitung

__________________________________________________________________________________________________________________

2.3.3 Primärsequenzen Neutraler und Alkalischer Invertasen

Obwohl sie aufgrund ihrer gemeinsamen Lokalisation im Zytoplasma häufig zusammengefasst werden, teilen Neutrale und Alkalische Invertasen keine großen Sequenzhomologien. Ihre Sequenzen unterscheiden sich außerdem deutlich von denen der SI. Während man Homologe zu den SI in (nicht photosynthetischen) Bakterien und Hefen findet, können die NAI mit Invertasen aus photosynthetisch aktiven Bakte-

rien verglichen werden. Den NAI fehlen zudem das bei Sauren Invertasen streng konservierte Motiv

WEC-P/V-D(F) und in der Regel auch das β-Fruktosidase-Motiv NPDN(G). Daher wird für diese Enzyme ein anderer Katalysemechanismus postuliert (Sturm 1999).

Die Monomere von Neutralen und Alkalischen Invertasen sind in der Regel mit 54-65 kD etwas kleiner als die SI (Ross et al. 1996). Sie sind jedoch nur als Homo-Tetramere aktiv.

2.4 Enzymatische Eigenschaften von Invertasen

2.4.1 Substratspezifität und –affinität von Invertasen

Während Alkalische Invertasen in der Regel nur Saccharose als Substrat akzeptieren (Lee und Sturm

1996, Ross et al. 1996), gelten die Neutralen und die Sauren Invertasen nicht als Saccharose-spezifisch.

Die Substrate werden an ihrer endständigen β-Fruktose erkannt, deren C-Atom 2 mit dem nächsten

Zucker-Monomer glykosidisch verbunden ist. Daher gehören Saure Invertasen zu den β-Fruktosidasen.

Diesen steht die Gruppe der α-Glukosidasen gegenüber, die wie die β-Fruktosidasen zu den Glykosid-

Hydrolasen (= Glykosidasen) gehören und die die glykosidische Bindung von der α-ständigen Glukose her spalten.

Viele Invertasen akzeptieren als Substrate die Oligosaccharide der Raffinosefamilie wie Raffinose (siehe

Abbildung 2.1, Seite 10), Stachyose, Verbascose und andere. Bei diesen Oligomeren sind an den

Glykosylrest der Saccharose ein oder mehrere Galaktose-Monomere angeknüpft. Die Aktivitäten erreichen jedoch nur circa 10-20% des Umsatzes von Saccharose (Burch et al. 1992, Obenland et al. 1993,

Goetz und Roitsch 1999).

Neben der hydrolytischen Spaltung der Saccharose, die einer Übertragung des Fruktosylrestes auf ein

Wassermolekül entspricht, sind manche Invertasen auch in der Lage, die Fruktose auf ein weiteres Molekül Saccharose zu übertragen (1-SST

1

-Aktivität, Obenland et al. 1993, Miller und Ranwala 1994, Vijn et

al. 1998), was jedoch erheblich höhere Substratkonzentrationen erfordert. Dieser Fruktosyl-Transfer ist für die Synthese von Fruktanen erforderlich, die in manchen Gruppen (Compositae, Alliaceae, Poaceae und andere) als alternative Speicherform für Kohlenhydrate dienen (Hendry 1993). Diese Aufgabe wird

1

1-SST = Saccharose:Saccharose-1-Fruktosyltransferase (überträgt Fruktosylrest von einem Molekül

Saccharose auf das C1-Atom eines anderen Saccharose-Moleküls)

9

Einleitung

__________________________________________________________________________________________________________________ jedoch zumindest nicht nur von Invertasen übernommen, da nicht alle Enzyme mit 1-SST-Aktivität auch

Saccharose hydrolysieren können (Lüscher et al. 1996).

Manche Invertasen spalten zudem das Substrat Laktose (Gal-(1β → 4)-Glk), das nicht zu den

β-Fruktosen gehört (Burch et al. 1992).

Für die hydrolytische Spaltung von Saccharose liegt der K

M

von Invertasen im niedrigen millimolaren

Bereich von etwa 1-30 mM Saccharose, sowohl für Saure (Obenland et al. 1993, Krishnan und Pueppke

1990, Miller und Ranwala 1994, Isla et al. 1999, Tang et al. 1996) als auch für Neutrale und Alkalische

Invertasen (Ross et al. 1996), Lee und Sturm 1996). Für andere Substrate wie Raffinose, Stachyose haben

Invertasen in der Regel niedrigere Affinitäten.

Abbildung 2.1: Saccharose und Raffinose als Substrate von Invertasen (Haworth-Strukturformeln)

2.4.2 Effektoren der Enzymaktivität

Neben den inhibitorischen Proteinen (siehe Abschnitt B, Seite 26) beeinflussen eine Reihe weiterer

Moleküle und Faktoren die Aktivität von Invertasen:

Produkthemmung

Von den meisten Invertasen wird die Hemmung durch mindestens eines ihrer Produkte berichtet. Das gilt sowohl für SI (Burch et al. 1992, Isla et al. 1991) wie auch für NAI (Ross et al. 1996, Lee und Sturm

1996, Gallagher und Pollock 1998) aus verschiedenen Spezies.

Für Glukose wurde ein nicht-kompetitiver Inhibitionsmechanismus nachgewiesen (Sampietro et al. 1980,

Isla et al. 1999, Burch et al. 1992), der die Existenz eines allosterischen Bindezentrums voraussetzt. Fruktose hemmt dagegen kompetitiv, konkurriert also mit dem Substrat um die Bindung im aktiven Zentrum. pH-Wert

Die Aktivität von Invertasen ist stark vom pH-Wert abhängig (Obenland et al. 1993, Tang et al. 1995,

Goetz und Roitsch 1999).

10

Einleitung

__________________________________________________________________________________________________________________

Die Sauren Invertasen sind bei pH-Werten von 4,0 bis 5,0 maximal aktiv (Obenland et al. 1993, Tang et

al. 1995, Krishnan und Pueppke 1990, Sturm 1999). Das Optimum der VIs liegt in der Regel um 0,6 bis

0,9 pH-Einheiten höher als das ihrer apoplastischen Homologe. Dieser Unterschied ist alleine von der für die Untergruppe typischen Aminosäure des WEC-P/V-D-Motivs abhängig (Goetz und Roitsch 1999, siehe Kapitel 2.3.1, Seite 6).

Neutrale Invertasen haben zwischen pH 7,0 und 7,8 (Ross et al. 1996, Tymowska-Lalanne und Kreis

1998), alkalische Invertasen um pH 8,5 ihr Aktivitäts-Maximum.

Bei allen Invertasen fällt die Aktivität außerhalb ihres Optimums sehr schnell unter die Nachweisgrenze.

Eine in vivo-Regulation über Änderungen des pH-Werts wird vor allem für Zellwandinvertasen diskutiert (Roitsch et al. 1995, Goetz und Roitsch 1999, Blee und Anderson 1998), da der Apoplast entwicklungsabhängig Unterschiede im pH-Wert aufweist (Almeida und Huber 1999). Dies kann beispielsweise im Rahmen der Zellstreckung relevant sein, die mit einer Ansäuerung der Zellwand einhergeht.

Substanzen, die Sulfhydryl-Gruppen zerstören

Saure Invertasen werden durch Reagenzien wie Hg+, Ag+ und Pyridoxal inaktiviert (Obenland et al.

1993, Krishnan und Pueppke 1990, Sturm 1999). Durch diese Substanzen wird eine für den Katalysemechanismus essentielle Sulfhydrylgruppe im aktiven Zentrum zerstört, die durch das Cystein im Motiv

WEC-P/V-D gestellt wird. Nachdem NAI dieses Motiv nicht besitzen (siehe Kapitel 2.3.3, Seite 9) kann durch Sulfhydryl-Angreifer hier keine Wirkung erzielt werden.

2.5 Expressionsmuster und Expressionskontrolle

2.5.1 Die Expression von Invertasen ist streng reguliert

Invertasen unterliegen einer starken Expressionskontrolle. Dabei ist das Expressionsmuster für jede Isoform individuell und sowohl entwicklungs- sowie gewebespezifisch reguliert. Des Weiteren hängt die

Expression von verschiedenen biotischen und abiotischen Faktoren ab, die im Folgenden dargestellt werden. Deren Wirkung ist jedoch nicht voneinander isoliert zu betrachten. Die Signaltransduktionswege sind vielfältig miteinander vernetzt, wodurch additive und synergistische Effekte entstehen, die heute erst in den Anfängen verstanden sind (Ehneß et al. 1997, Roitsch et al. 2003). Insbesondere im Falle der

Phytohormone, die eine wichtige Signalfunktion bei der Regulation des Zellstoffwechsels haben, spielen

Wechselwirkungen eine große Rolle. Aus Gründen der Übersichtlichkeit werden die einzelnen Faktoren jedoch in getrennten Abschnitten behandelt.

11

Einleitung

__________________________________________________________________________________________________________________

2.5.2 Die einzelnen Invertase-Isoformen haben individuelle Expressionsprofile

Die verschiedenen Isoformen werden unabhängig voneinander in bestimmten Zelltypen und Entwicklungsphasen exprimiert (Godt und Roitsch 1997). Für apoplastische Invertasen ist eine Lokalisation in

Geweben des Zuckertransports im weiteren Sinne typisch. Sie werden selten zusammen mit vakuolären

Invertasen exprimiert.

Die differentielle Expression verschiedener Isoformen lässt sich anhand der vakuolären Invertasen Ivr1 und Ivr2 aus Zea mays veranschaulichen: Während beispielsweise in Wurzelspitzen und Pollen beide

Isoformen zusammen vorkommen, wird besonders bei jungen Samen eine lokal unterschiedliche Expression deutlich: Das Transkript der Isoform Ivr1 beschränkt sich auf das untere Drittel des sich entwickelnden Samens. Ivr2 kann dagegen in den oberen zwei Dritteln, das heisst im Perikarp und Nucellus detektiert werden (Xu et al. 1996).

Auch in Lycopersicon esculentum konnte eine spezifische lokale und temporäre Verteilung der Isoformen nachgewiesen werden. Isoform LIN5 ist hauptsächlich in Ovarien und Früchten detektierbar, wo keine andere der untersuchten Isoformen exprimiert ist. Dagegen findet sich LIN7 speziell in Stamina und Pollen. LIN8 ist für Blätter und Wurzeln typisch. Die vakuoläre Isoform TIV1 findet sich ausschließlich in roten Früchten und LIN6 kommt als einzige Isoform in den Wurzeln von Keimlingen, jungen Blütenknospen und von A. tumefaciens verursachten Tumoren vor (Godt und Roitsch 1997, Fridman und Zamir

2003).

2.5.3 Saure Invertasen sind vornehmlich in sink-Geweben lokalisiert

Saure Invertasen werden häufig als rein sink-spezifisch angesehen (Sturm 1999, Godt und Roitsch 1997), da hier die meisten Isoformen gefunden werden. In vegetativen Organen finden sich Transkript und

Aktivität daher vor allem in Wurzeln, jungen Blättern und verschiedenen Speicherorganen. So ist beispielsweise das Transkript der CWI-Isoform CIN1 nur in den Wurzeln von Chenopodium rubrum, nicht jedoch in den Blättern oder Stängeln detektierbar (Roitsch et al. 1995). Auch die Vakuolären Invertasen

Ivr1 und Ivr2 werden nicht in source-Blättern exprimiert, jedoch beide in Wurzeln und Ivr2 darüber hinaus in jungen Sprossen und jungen Blättern (Xu et al. 1996). Des Weiteren findet sich keine der vier untersuchten VI- oder CWI-Isoformen aus Tomate in Blättern (Godt und Roitsch 1997, siehe Kapitel 2.5.2,

Seite 12). In verschiedenen Spezies werden jedoch auch in source-Blättern Saure Invertasen nachgewiesen. Die reifen Blätter von Lolium temulentum beispielsweise zeigen sowohl lösliche wie auch nicht lösliche Invertaseaktivität (Kingston-Smith et al. 1999). Über real time PCR weisen Fridman und Zamir

(2003) das Transkript der apoplastischen Invertase AtβFruct6 in A. thaliana, sowie der Invertasen Lin6 und Lin8 in L. esculentum nach.

Neben den vegetativen sink-Geweben werden die Sauren Invertasen jedoch auch in reproduktiven Or-

ganen exprimiert. In vielen Arbeiten wird von der Expression in den verschiedenen Blütenorganen berichtet (Xu et al. 1996, Fridman und Zamir 2003, siehe Kapitel 2.5.2, Seite 12). Aber auch mit der Ent-

12

Einleitung

__________________________________________________________________________________________________________________ wicklung von Samen und Früchten werden Saure Invertasen häufig in Verbindung gebracht, wie bereits oben für die Expression zweier vakuolärer Isoformen in Mais-Samen veranschaulicht wurde (siehe Kapitel 2.5.2, Seite 12). Nach Andersen et al. (2002) spielt in späteren Entwicklungsstadien dieser Samen aber auch eine apoplastische Invertase Incw2 eine Rolle. Des Weiteren wird die vakuoläre Isoform TIV1 beispielsweise ausschließlich in roten Tomatenfrüchten detektiert (Godt und Roitsch 1997), wo auch Husain

et al. (2001) hohe Aktivitäten löslicher und unlöslicher Saurer Invertasen finden.

2.5.4 Regulation durch Phytohormone

Phytohormone spielen eine zentrale Rolle in der Regulation des pflanzlichen Stoffwechsels, sowohl bei der Steuerung entwicklungsabhängiger Vorgänge, sowie der Übermittlung von endogenen und exogenen

Faktoren. Für einige von ihnen ist ein unmittelbarer Einfluss auf die Expression bestimmter Invertase-

Isoformen bekannt:

Proels et al. (2003) berichten von der Induktion eines CWI-Promotors (Isoform Lin5) unter dem Einfluss von Abszisinsäure (ABA

1

) in transient transformierten Tabak-Blättern. Ein ähnlicher Effekt kann durch die Phytohormone Gibberellinsäure und Auxin erzielt werden.

Das Phytohormon ABA beeinflusst auch die Expression einer vakuolären Invertase. Über das Hydrokultur-Medium verabreicht bewirkt es einen Anstieg der Isoform Ivr2 in Mais-Keimlingen, sowohl in der

Wurzel wie auch im Blatt. Die lösliche Invertase-Aktivität steigt gleichermaßen (Trouverie et al. 2004).

Morris und Arthur (1984) beschreiben einen Zusammenhang zwischen der Aktivität einer Sauren Invertase und der Internodien-Streckung in Stängeln von Phaseolus vulgaris, ein Effekt, der durch ein Auxin induzierbar ist.

In Suspensionskultur-Zellen von L. esculentum wird durch das Cytokinin Zeatin die Transkription der

CWI LIN6 induziert. Dagegen bleibt unter denselben Bedingungen die mRNA-Menge der vakuolären

Invertase TIV1 unverändert (Godt und Roitsch 1997). Ebenso verhält sich eine CWI in Chenopodium

rubrum Zellkultur: Durch verschiedene Cytokinine kann die Induktion von CIN1 erreicht werden, und zwar sowohl auf mRNA- wie auch auf Proteinebene (Ehness und Roitsch 1997). Die gleiche Wirkung des

Phytohormons auf eine CWI finden Lara et al. (2004) in Nicotiana tabacum. Die Aktivität des Enzyms steigt hier nicht nur nach exogener Applikation, sondern auch durch die Einwirkung von endogen synthetisiertem Cytokinin in transgenen Pflanzen.

Durch die exogene Applikation von verschiedenen Brassinosteroiden in physiologisch relevanten Konzentrationen kann in autotrophen Suspensionskultur-Zellen von L. esculentum die CWI-Isoform Lin6 induziert werden, während andere Zellwand- sowie intrazelluläre Invertasen unverändert bleiben. Dies

1

ABA = engl.: abscisic acid, Abszisinsäure

13

Einleitung

__________________________________________________________________________________________________________________ zeigt sich sowohl an einem Anstieg des Transkripts wie auch der gemessenen Aktivität (Goetz et al.

2000).

2.5.5 Mechanische Verwundung induziert Vakuoläre und apoplastische Invertasen

Der Einfluss von mechanischer Verwundung auf Invertasen wurde in vielen Pflanzen und verschiedenen

Geweben beobachtet. Auch hier wird klar, dass es sich um Isoformen-spezifische Reaktionen handelt:

In Hypokotyl-Rüben von Beta vulgaris, die in Scheiben geschnitten und damit verwundet wurden, werden zwei Invertase-Isoformen sequentiell induziert (Rosenkranz et al. 2001), was sowohl an einer Zunahme des Transkripts, des Proteins und der sukrolytischen Aktivität festgestellt werden kann. Auf allen

Ebenen nimmt zunächst eine apoplastische Isoform zu, danach eine VI-Isoform. Zwei andere Invertase-

Isoformen – je eine CWI und eine VI – bleiben dagegen weitgehend unverändert. Als Folge der erhöhten

Invertase-Aktivitäten steigen darüber hinaus auch die Hexosen im Rübengewebe signifikant an.

Eine ähnliche gestaffelte Induktion zweier Isoformen finden Godt und Roitsch (1997) in Blättern von

Lycopersicon esculentum, die in Stücke geschnitten und anschließend in zuckerfreiem Medium inkubiert wurden. Auf transkriptioneller Ebene wird dadurch innerhalb von einer Stunde die VI-Isoform TIV1 induziert. Die mRNA der CWI-Isoform Lin6 kann erst nach 24 h detektiert werden und erreicht ihren höchsten Stand nach 33 h, wenn das Transkript der wundinduzierten VI zurückgegangen ist. In dieser

Arbeit werden außerdem drei weitere CWI-Isoformen untersucht, die auf Verwundung nicht reagieren.

Ehneß et al. (1997) induzieren durch die gleiche Behandlung eine CWI in Chenopodium rubrum Blät-

tern, deren mRNA nach 3-6 h detektiert werden kann.

Auch bei Karotten-Wurzeln steigen die Invertase-Aktivitäten nach mechanischer Verwundung sowohl im Apoplasten als auch in der Vakuole transient an. Nach drei Stunden ist das Transkript einer CWI nachweisbar, ab etwa 12 h nach Verwundung steigen die Aktivitäten in der unlöslichen sowie in der löslichen Fraktion, erreichen nach etwa 60 h ihren Höhepunkt und fallen danach wieder ab (Sturm und

Chrispeels 1990).

2.5.6 Induktion von Invertasen durch Pathogeninfektion

Der Anstieg von Invertase-Aktivität nach Infektion durch phytopathogene Pilze kann in verschiedenen

Pflanzen beobachtet werden: Billet et al. (1977) untersuchten beispielsweise Mais, Clancy und Coffey

(1980) Leinpflanzen und Hwang et al. (1989) Reis. Benhamou et al. (1991) weisen über Immunlokalisation vermehrt CWI in Blättern von Tomatenpflanzen nach, die mit Fusarium—Sporen inokuliert worden sind. Während dieser Effekt im kompatiblen Pathogen-Wirt-System auf das infizierte Gewebe beschränkt ist, findet man in resistenten Sorten auch systemisch in nicht infizierten Geweben einen Anstieg der Invertase-Aktivität. In A. thaliana wird nach Infektion mit dem phytopathogenen Pilz Erysiphe cichoracea-

rum eine extrazelluläre Invertase zusammen mit einem Hexose-Transporter induziert (Fotopoulos et al.

2003).

14

Einleitung

__________________________________________________________________________________________________________________

Häufig findet man Isoformen, die sowohl durch mechanische Verwundung als auch durch Pathogeninfektion induzierbar sind (Sturm und Chrispeels 1990, Roitsch 1999, Ehneß et al. 1997, Godt und Roitsch

1997): Das Transkript der oben beschriebenen wundinduzierten CWI-Isoform aus Daucus carota (Sturm und Chrispeels 1990) steigt ebenso nach Infektion von Wurzeln und Blättern mit dem Pilz Erwinia ca-

rotovora an. Die Reaktion auf das Pathogen ist schneller als die Wundinduktion - nach einer Stunde ist bereits die maximale Transkriptmenge erreicht - und klingt früher ab als nach Wundinduktion- nach 12 h ist kein Transkript mehr nachweisbar. Des weiteren zeigen Ehneß et al. (1997), dass die Induktion einer

CWI (Isoform CIN1) durch mechanische Verwundung von Blättern sowie durch Gabe des pilzlichen

Elicitors Chitosan in Suspensionskultur induziert werden kann. Auch der Elicitor PGA

1

bewirkt bei der

Suspensionszellkultur von L. esculentum einen Anstieg von Invertase-mRNAs, wie er auch durch die oben beschriebene mechanische Verwundung von Blättern erzielt werden kann (Godt und Roitsch 1997, siehe Kapitel 2.5.5, Seite 14).

Ramloch-Lorenz et al. (1993) untermauern den Zusammenhang Invertase-Induktion und verschiedene

Stress-Stimuli durch Sequenzvergleiche von Promotoren: Bei einer CWI aus D. carota finden sich ähnliche Promotorelemente wie bei dem an diversen Abwehrreaktionen beteiligten Enzym PAL

2

, was auf eine

Steuerung durch gleiche oder ähnlich Transkriptionsfaktoren hinweist.

2.5.7 Zucker beeinflussen die Expression von Invertasen

Zucker stellen nicht nur die Kohlenhydratquelle für heterotrophes Wachstum. Sie fungieren darüber hinaus als Regulatoren der Genexpression (siehe Kapitel 2.6.4, Seite 23). Evolutionär gesehen handelt es sich um einen sehr alten Sachverhalt, der bereits in Prokaryonten die Anpassung des enzymatischen Apparates an das Nahrungsangebot gewährleistet. In höheren Pflanzen werden neben eine Reihe weiterer

Gene auch einige Invertasen durch Zucker gesteuert (Koch et al. 1996). Sie führen entweder zur Induktion oder zur Verminderung der Transkriptmenge.

Die gegensätzliche Reaktion zweier vakuolärer Isoformen aus Mais beschreiben Xu et al. 1996. In den

Wurzelspitzen junger Keimlinge nimmt das Transkript der VI Ivr1 durch 200 mM Glukose im Medium ab, während sich die mRNA von Ivr2 erhöht. Letzteren Effekt können Trouverie et al. 2004 jedoch für

Wurzeln von intakten Keimlingen nicht bestätigen, obwohl sich durch die Inkubation mit Zucker auch die

Hexose-Konzentrationen im Gewebe erhöhen. Dies zeigt die Schwierigkeit der Applikation dieser Substanzen, ohne die Gewebe zu verletzen.

Diese Problematik umgehen Roitsch et al. (1995) durch Verwendung einer Chenopodium rubrum Zellkultur. Hier können sie die Induktion einer CWI durch exogene Applikation von Zuckern zeigen. Im

Experiment sind sowohl Saccharose wie auch Glukose und Fruktose (Sturm 1999, Roitsch et al. 1995)

1

PGA = engl.: polygalacturonic acid, Polygalakturonsäure

2

PAL = Phenylalanin-Ammonium-Lyase

15

Einleitung

__________________________________________________________________________________________________________________ wirksam. Vieles spricht dafür, dass zumindest in diesem System Glukose als Signalmolekül rezipiert wird (Roitsch et al. 1995):

Die Reaktion ist in gleichem Maße durch das nicht metabolisierbare Zuckeranalogon 6-Desoxy-Glukose auslösbar. Metaboliten der Glukose können daher als Signal ausgeschlossen werden.

Nach Induktion mit Saccharose steigt die zelluläre Glukose-Konzentration auf ein signalfähiges Niveau.

Der Zuckeralkohol Mannitol führt zu einer wesentlich schwächeren Geninduktion als entsprechende

Konzentrationen von Glukose oder Glukose-haltigen Zuckern. Glukose wirkt also nicht als Osmotikum.

Es wird diskutiert, ob es dabei die Invertasen selbst sind, die als Rezeptoren fungieren, möglicherweise dann, wenn sie sich noch im sekretorischen Pfad befinden (Herbers et al. 1996). In diesem Zusammenhang wird jedoch über einige weitere Proteine spekuliert, die ebenso diese Funktion einnehmen könnten, wie zum Beispiel Glukokinase und Hexokinase (Ehness et al. 1997, Jang et al. 1997).

Eine Besonderheit gegenüber allen anderen Faktoren, die die Expression von Invertasen beeinflussen, ist die Rückwirkung ihrer Aktivität auf die eigene Expression. Zucker-induzierte Invertasen fördern durch

Veränderung der relativen Zuckerkonzentrationen in einem feed-forward-Mechanismus ihre

Transkriptmenge. Zucker-reprimierte Isoformen reduzieren diese jedoch.

Andere Invertase-Isoformen zeigen dagegen überhaupt keine sugar response (Sturm und Chrispeels

1990, Weil und Rausch 1990). Dies gilt beispielsweise auch für eine VI aus Chenopodium rubrum

(Roitsch et al. 1995).

Während in den meisten Pflanzen Zucker-abhängige und –unabhängige Isoformen nebeneinander existieren, scheinen in manchen Spezies alle Isoformen unabhängig vom Zuckerstatus zu sein. In Daucus

carota etwa wurde bisher für keine der untersuchten SI-Transskripte eine Zuckerabhängigkeit festgestellt

(Sturm und Chrispeels 1990, Sturm 1999). Ein Zusammenhang besteht möglicherweise mit dem vergleichsweise hohen Gehalt an löslichen Zuckern in diesen Spezies, der die physiologischen Änderungen der Zuckerkonzentrationen prozentual gesehen irrelevant macht.

2.5.8 Kälte-Induktion von Vakuolären Invertasen

Wie bereits Ende des 19. Jahrhunderts beobachtet wurde, erhöht sich in verschiedenen Kohlenhydratspeichernden Pflanzenorganen nach Kälte-Lagerung die Konzentration an reduzierenden Zuckern (Müller-Thurgau 1882, Burton 1969, Samotus et al. 1974). Dieser mit dem englischen Begriff cold sweetening bezeichnete Vorgang ist zurückzuführen auf die Aktivität einer vakuolären Invertase, wie an der Kartoffelknolle beispielhaft untersucht wurde (Zrenner et al. 1996): Die Kälte-Induktion der Invertase der VI, die auch Gegenstand einiger anderer Arbeiten ist (Pressey 1966, Zhou et al. 1994), korreliert mit der Erhöhung des Konzentrations-Quotienten Hexosen/Saccharose, während die Gesamtkonzentration der löslichen Zucker unbeeinflusst bleibt (Zrenner et al. 1996).

16

Einleitung

__________________________________________________________________________________________________________________

2.5.9 Trockenstress

Je nach Gewebe kann Trockenstress die Expression von bestimmten Invertase-Isoformen in die eine oder andere Richtung beeinflussen.

Pelleschi et al. (1999) untersuchten verschiedene Invertase-Isoformen aus Zea mays. In adulten Mais-

Blättern steigen mRNA und Aktivität der vakuolären Isoform Ivr2 unter dem Einfluss von Trockenstress an, was mit einem Anstieg der Hexosen Fruktose und Glukose korreliert. Dagegen bleibt die apoplastische Invertase-Aktivität unverändert.

Von der Induktion der selben VI nach Trockenstress in verschiedenen vegetativen Geweben berichten

Kim et al. (2000). In source-Blättern, deren Blattscheiden und in Primärwurzeln steigen bis etwa 6

Tage nach Stresseinwirkung sowohl mRNA, Proteinmenge, Aktivität der VI-Isoform Ivr2 und die Konzentration an Glukose kontinuierlich an. Darüber hinaus konnten diese Veränderungen in situ lokalisiert werden. Im Blatt beschränkt sich die Induktion auf Bereiche in den Leitbündeln. In der Primärwurzel wird die VI in erster Linie im Cortex induziert, wo unter normalen Bedingungen nur im Apoplasten Invertase-Aktivität nachgewiesen werden kann, sowie im peripheren Bereich des Zentralzylinders.

Bei der Samenentwicklung stellt sich die Situation der VI Ivr2 jedoch anders dar. Während nach der

Bestäubung normalerweise Transkript und Aktivität rapide ansteigen, bleibt dieser Effekt unter Trockenstress völlig aus (Zinselmeier et al. 1995 + 1999, Andersen et al. 2002). Möglicherweise beruht diese

Reaktion jedoch nicht direkt auf den Wassermangel, sondern wird sekundär durch den dadurch verursachten geringeren Kohlenstoff-Flux in die Ovarien verursacht (Mäkelä et al. 2005).

Weitere von Andersen et al. (2002) untersuchte Isoformen – die vakuoläre Ivr1, sowie zwei apoplastische

Formen Incw1 und Incw2 – bleiben nach Trockenstress dagegen unverändert.

2.5.10 Sauerstoffmangel

Die Auswirkung von Sauerstoffmangel auf Enzyme des Zuckerstoffwechsels untersuchten Zeng et al.

(1999). Bei Mais-Keimlingen konnte mit sinkendem Sauerstoff-Partialdruck für zwei vakuoläre Invertasen Ivr1 und Ivr2 eine schnelle Abnahme von Transkriptmenge sowie Aktivität nachgewiesen werden, die jedoch auf die Wurzelspitzen beschränkt ist.

2.6 Physiologische Bedeutung von Invertasen

2.6.1 Die Funktionen von Invertasen sind vielfältig

Wie in den letzten Kapiteln deutlich wurde, beinhaltet die Proteinfamilie der Invertasen eine Vielzahl von

Isoformen. Diese unterscheiden sich in vielerlei Hinsicht voneinander – von der subzellulären Lokalisation bis hin zu biochemischen Eigenschaften. Daher werden für die verschiedenen Proteine auch indivi-

17

Einleitung

__________________________________________________________________________________________________________________

duell unterschiedliche Funktionen im pflanzlichen Stoffwechsel postuliert, die bisher jedoch nur teilweise aufgeklärt sind. Folgende Eigenschaften dieser Enzymgruppe legen diese Forderung insbesondere nahe:

individuelle Expressionskontrolle: Invertase-Isoformen haben spezifische Expressionsmuster, die jeweils von unterschiedlichen Faktoren beeinflusst werden (siehe Kapitel 2.5, Seite 11).

posttranslationale Regulation: Über die enzymatische Aktivität entscheiden eine Reihe von Faktoren wie die Verfügbarkeit und Konzentration von Substraten, die Anwesenheit verschiedener Effektoren

(siehe Kapitel 2.4, Seite 9) und posttranslationale Protein-Modifikationen (Phosphorylierung, Glykosylierung, etc.).

Bedeutung der Reaktanden für den Zellstoffwechsel: Die von Invertasen freigesetzten Hexosen liefern

- abhängig von der subzellulären Lokalisation und dem Stoffwechsel eines Gewebes - Energie und Kohlenstoffgerüste. Darüber hinaus können sie auch als Signal für Entwicklung und Zelldifferenzierung dienen. Insbesondere gilt das für das von Invertasen eingestellte Konzentrationsverhältnis zwischen Saccharose und Hexosen.

Die weitreichenden Effekte, die die generelle Überexpression, bzw. die Expression ektopischer Invertasen in Pflanzen hervorruft, weisen zudem auf wichtige und vielfältige Funktionen dieser Enzyme hin: Die transgene Überexpression einer Hefe-Invertase beispielsweise führt zu einem stark verminderten Wachstum, verringerter Wurzelbildung und erhöhten Mengen an Stärke und löslichen Zuckern in den Blättern, unabhängig davon, in welchem Kompartiment die Invertasen exprimiert werden (Sonnewald et al. 1991).

Tendenziell kommen den Isoformen innerhalb der subzellulären Gruppen ähnliche Aufgaben zu. Durch die Anwesenheit von Zuckertransportern, die einen Austausch von Substraten und Produkten zwischen den Kompartimenten ermöglichen, werden die Grenzen jedoch verwischt. Außerdem erfüllen dieselben

Kompartimente je nach Aufgabe des jeweiligen Gewebes unterschiedliche Funktionen. Dieselbe enzymatische Reaktion kann in einem anderen Kontext daher auch eine andere Bedeutung haben.

Die Funktion der Zellwandinvertasen liegt hauptsächlich im Bereich des Zuckertransports über das

Phloem. Sie spielen eine Schlüsselrolle bei der Verteilung des Assimilats Saccharose auf verschiedene

Pflanzenorgane (engl: sucrose partitioning), beeinflussen die sink-Stärke von Geweben und sind maßgeblich an source-sink-Übergängen beteiligt. Vakuoläre Invertasen sind eng mit der Speicherung von

Zuckern verknüpft. Sie kontrollieren die Zusammensetzung löslicher Zucker (Hexosen/Saccharose-Quotient) in der Zelle. Daher stehen sie in engem Zusammenhang mit der Osmoregulation und dem Turgorabhängigen Zellwachstum. Eine weitere Funktion kommt diesen Isoformen bei der Anpassung an Kältestress zu. Bei verschiedenen Prozessen haben Invertasen außerdem eine regulatorische Funktion. Sie sind sowohl an der Steuerung von Zelldifferenzierung im Rahmen der pflanzlichen Entwicklung wie auch der Transduktion von Signalen beteiligt.

18

Einleitung

__________________________________________________________________________________________________________________

Die Funktion der NAI soll hier nur am Rande erwähnt werden. Diese zytosolischen Isoformen werden mit Zellwachstum in Verbindung gebracht. Sie stellen vor allem in reifen Geweben, die kaum oder wenig

SI-Aktivitäten aufweisen, Substrate für die Respiration sowie Kohlenstoffgerüste für den Aufbau von

Biomolekülen. Die freigesetzten Hexosen beeinflussen darüber hinaus die Expression Zucker-regulierter

Gene.

2.6.2 Saure Invertasen und ihre Funktion bei der Assimilat-Verteilung

Die Assimilat-Verteilung wird über die Phloementladung reguliert

Die Saccharose als wichtigstes Kohlenstoff-Assimilat der höheren Pflanzen wird von den so genannten

source-Geweben, die einen Netto-Kohlenstoff-Überschuss haben, in das Phloem als Langstreckentransportsystem eingespeist und von hier aus den sink-Organen zur Verfügung gestellt, die sich nicht ausreichend selbst versorgen können. Nach den Hypothesen von Münch (1930), bzw. Eschrich (1984) erfolgt der Transport der Substanzen in der symplastischen Einheit des Phloems passiv, was als Druck- oder

Volumenstrom bezeichnet wird. Treibende Kraft ist der Druckgradient (Wright und Fisher 1980), der durch Einspeisung (Phloembeladung) in source-Geweben beziehungsweise die Entnahme (Phloementladung) aufgebaut wird. Diese aktiven Vorgänge verbrauchen Energie und stellen die Angriffspunkte für die Regulation dar.

Während das Ausmaß der Phloembeladung in den jeweiligen source-Geweben selbst über das Angebot an

Assimilaten reguliert wird, stehen bei der Entladung alle sink-Gewebe miteinander in Konkurrenz um die verfügbaren Ressourcen. Die Entladungskapazität ist daher eine Größe des jeweiligen sink-Gewebes und wird als sink-Stärke bezeichnet. Die Entladung der Zuckermoleküle aus dem Phloem spielt daher eine eine entscheidende Rolle beim assimilate partitioning, der Verteilung von Assimilaten in der Pflanze.

Anders als die Beladung, die im Falle der Saccharose in der Regel mit einem apoplastischen Zwischenschritt erfolgt, sind bei der Entladung sowohl ein symplastischer wie auch ein apoplastischer Weg möglich, abhängig vom Gewebe und dem jeweiligen Entwicklungsstand.

Saure Invertasen korrelieren mit der sink-Stärke

Unter verschiedensten physiologischen Bedingungen wurde beobachtet, dass der Bedarf an Kohlenhydraten mit der Expression von Sauren Invertasen korreliert. Diese Tatsache legt nahe, dass diese Isoformen bei der Induktion und Aufrechterhaltung des sink-Metabolismus eine Rolle spielen.

Erste Hinweise bieten Expressionsstudien, bei denen deutlich wird, dass Saure Invertasen unter normalen

Bedingungen hauptsächlich in sink-Geweben exprimiert werden (siehe Kapitel 2.5.3, Seite 12). Darüber hinaus werden sie induziert, wenn sich der Kohlenhydrat-Bedarf eines Gewebes erhöht, was zum Beispiel nach Pathogeninfektion oder Verwundung der Fall ist (siehe Kapitel 2.5.5, Seite 14 und 2.5.6, Seite 14).

Im Extremfall wird dabei ein im source-Status befindliches Blatt auf sink-Metabolismus umgestellt. Auch die Formation eines Mykorrhiza-Arbuskels im Wurzelgewebe der symbiontischen Pflanze geht mit er-

19

Einleitung

__________________________________________________________________________________________________________________ höhtem Kohlenhydrat-Eintrag in die Wurzel einher. In diesem Zusammenhang wird eine vakuoläre Isoform induziert (Blee und Anderson 1998).

Wird der Übergang vom source- in den sink-Status künstlich herbeigeführt, findet man ebenfalls eine

Veränderung in der Invertase-Expression. Roitsch et al. (1995) stellen eine zunächst photoautotroph wachsende Chenopodium rubrum Zellkultur auf mixotrophes Wachstum um. Dadurch erhöht sich das

Transkript der CWI-Isoform CIN1, korrelierend mit einem Anstieg der extrazellulären Invertase-Aktivität. Zytosolische und vakuoläre Aktivitäten bleiben dabei unverändert. Bei einem ähnlichen Experiment mit einer Tomaten-Suspensionskultur, deren heterotrophes Wachstum durch Brassinosteroide induziert wird, ist es die CWI-Isoform Lin6, deren Transkript und Aktivität erhöht wird (Goetz et al. 2000).

Umgekehrt vermindert sich der Eintrag von Kohlenhydraten in sink-Gewebe, wenn die Aktivität Saurer

Invertasen gentechnisch herabgesetzt wird: Transgene Karottenpflanzen beispielsweise, bei denen eine

CWI-Isoform über antisense-Repression ausgeschaltet wurde, können – neben verschiedenen anderen

Effekten - keine Speicherwurzel ausbilden. Auch im Falle einer VI-Isoform ist das Wachstum der Wurzel gegenüber dem Wildtyp stark eingeschränkt. Beide Linien akkumulieren stattdessen Kohlenhydrate in den Blättern (Tang et al. 1999).

CWI als Schlüsselenzym der apoplastischen Phloementladung

Die Funktion der Zellwandinvertasen bei der Assimilatverteilung wird mit ihrer Rolle bei der apoplastischen Phloementladung erklärt: Bei diesem Vorgang wird die Saccharose aus dem Symplasten des

Phloemgewebes zunächst in den Apoplasten entlassen. Nach der Hydrolyse des Dimers durch die hier lokalisierten CWI-Isoformen werden die entstandenen Hexosen durch spezifische Transporter in den

Symplasten des sink-Gewebes aufgenommen. Die irreversible Spaltung des Transportzuckers ermöglicht das Nachfließen von Saccharose aus dem Phloem. Dadurch wird die Entladung aufrechterhalten, die wiederum ein Maß für die sink-Stärke des Gewebes darstellt.

Die Rolle der CWI als Phloementlader wird besonders dann deutlich, wenn zusammen mit ihr Hexo-

setransporter induziert werden, die als weitere Komponente des apoplastischen Entladeprozesses notwendig sind. Fotopoulos et al. (2003) finden beispielsweise in A. thaliana Blättern nach Pilzinfektion nicht nur Transkript und Aktivität einer CWI erhöht, sondern auch die mRNA des Monosaccharid-Transporter AtSTP4. Die Aufnahme von Glukose ins Gewebe wird dadurch effizient gesteigert. Auch nach der oben beschriebenen künstlichen Umstellung einer Chenopodium rubrum Zellkultur von autotroph auf mixotroph (siehe Kapitel 2.5.4, Seite 13) durch Cytokinine wird neben einer Zellwandinvertase ein

Glukosetransporter induziert (Ehness und Roitsch 1997).

Weitere Experimente, die die Schlüsselrolle der Zellwandinvertasen bei der Phloementladung untermauern, wurden an Geweben durchgeführt, die aufgrund der anatomischen Konstellation auf apoplastische

Phloementladung angewiesen sind. Dazu zählen grundsätzlich sich entwickelnde Samen, da diese immer symplastisch vom versorgenden maternalen Gewebe isoliert sind. Ein als Invertase identifiziertes Enzym wird im Apoplasten von sich entwickelnden Mais-Samen lokalisiert (Miller und Chourey 1992, Cheng et

20

Einleitung

__________________________________________________________________________________________________________________

al. 1996, Cheng und Chourey 1999), und zwar ausschließlich in solchen Geweben, die mit der apoplastischen Entladung assoziiert sind: in den Transferzellen des basalen Endosperms und im Leitgewebe des

Pedicellus. Die so genannten Miniature1 Mutanten, bei denen dieses Enzym nicht funktionstüchtig ist, haben ein um 70-80 %, d.h. drastisch vermindertes Samengewicht, was auf die Reduktion des Speicher-

Endosperm zurückzuführen ist.

Ebenfalls symplastisch isoliert findet die Entwicklung von Pollenkörnern statt. Die für die Kohlenhydrat-

Versorgung essentielle Funktion einer Antheren-spezifischen Zellwandinvertase, die nur im Tapetum und den sich entwickelnden Mikrosporen exprimiert wird, zeigen Goetz et al. (2001) durch selektive anti-

sense-Repression dieser Isoform unter Kontrolle des eigenen Promotors. Die Pollenkörner der transgenen

Linien mit schwacher oder nicht nachweisbarer Invertase-Aktivität sind nicht keimfähig. Ihr stark reduziertes zytoplasmatisches Volumen und das Fehlen der sonst typischen Stärkekörner werden als ein Entwicklungsstop interpretiert, der durch mangelnde Kohlenhydratversorgung verursacht wird.

Die Funktion der CWIs als Phloementlader wird darüber hinaus in Experimenten deutlich, bei denen ihre

Aktivität gentechnisch erhöht wird. Die heterologe Überexpression einer Hefe-Invertase im Apoplasten führt in verschiedenen unabhängigen Studien zu schweren Effekten, die mit einer Blockade der Phloembeladung im source-Gewebe erklärt werden können: Anreicherung von Photoassimilaten im Mesophyll, starke Reduktion von Photosyntheserate, erheblich vermindertes Wachstum, sowie eine Zunahme des relativen Proteingehalts in sink-Geweben (Dickinson et al. 1991, von Schaewen et al. 1990, Heineke et

al. 1992). Die Anwesenheit des Enzyms im Phloem des source-Gewebes programmiert das Gewebe gewissermaßen auf ein sink-Verhalten um: Statt ins Phloem geladen zu werden, wird die Saccharose hydrolysiert und zurück in den Symplasten des Blattes transportiert.

Die Rolle der VI bei der Assimilatverteilung

Neben den Zellwandinvertasen, deren Rolle bei der apoplastischen Phloementladung plausibel wird, spielen häufig auch Vakuoläre Invertasen für den Assimilat-Eintrag in sink-Gewebe eine entscheidende

Rolle. Dies wird einerseits in solchen Geweben oder Entwicklungsstadien deutlich, in denen keine CWI exprimiert wird, wie etwa bei der Entwicklung der Mykorrhiza-Arbuskel (Blee und Anderson 1998), oder diese nur eine untergeordnete Rolle spielt. Das ist zum Beispiel in den frühen Stadien der Samenentwicklung bei Zea mays der Fall (Andersen et al. 2002). In manchen Systemen scheinen Invertasen in beiden Kompartimenten gleichermaßen relevant zu sein: sowohl die Ausschaltung einer CWI wie auch einer VI führen zu einer ähnlich drastischen Unterentwicklung der Speicherwurzeln in Karotte (Tang et

al. 1999, siehe oben).

Über die Art und Weise, wie die vakuolären Invertasen die Assimilatverteilung beeinflussen, kann bisher nur spekuliert werden. Sie wirken möglicherweise ebenso wie ihre apoplastischen Pendants über die Aufrechterhaltung eines Saccharose-Gradienten gegenüber dem Phloem und den source-Geweben, um die weitere Entladung aus dem Phloem zu gewährleisten (Tang et al. 1999). In situ Studien an Mais-Samen

21

Einleitung

__________________________________________________________________________________________________________________ weisen Transkript und Aktivität einer VI tatsächlich in solchen Gewebebereichen nach, die als relevant für die Phloementladung angesehen werden (Andersen et al. 2002). Denkbar ist jedoch auch, dass sich ihr

Einfluss über das osmotische Potential erklärt, das sie durch die Spaltung des Dimers in zwei Zucker-

Monomere erhöhen. Ihre Expression wird nämlich häufig in Geweben beobachtet, in denen sich die Zellen in einer Phase der Streckung befinden (Andersen 2002). Schließlich könnte sich der Einfluss der VIs

über die Signalwirkung erklären, die die produzierten Hexosen auf den Stoffwechsel im sink-Gewebe haben (siehe auch Kapitel 2.6.4, Seite 23).

2.6.3 Zucker-Gehalt und -Zusammensetzung werden von Invertasen beeinflusst

Beteiligung an der Regulation des Zuckergehalts

Saure Invertasen sind an der Kontrolle über die Menge an löslichen Zuckern in verschiedenen Geweben beteiligt, sind jedoch nicht alleine dafür verantwortlich. Vielmehr sind an der Regulation des Zuckergehalts eine Reihe weiterer Enzyme beteiligt: die Saccharose-Phosphat-Synthase (SPS), die Saccharose-

Synthase (Susy), die Enzyme zur Synthese und zum Abbau von Stärke in den Plastiden sowie verschiedene Transporter, die den Austausch der Zucker zwischen den Kompartimenten ermöglichen (Nguyen-

Quoc und Foyer 2001). Während der Susy in Speicherorganen verschiedenen Typs allgemein eine große

Rolle zugeschrieben wird (Zrenner et al. 1995), scheinen die Vakuolären Invertasen insbesondere in

Saccharose speichernden Geweben stärkeren Einfluss zu haben: In den verschiedenen Zuchtsorten des

Zuckerrohrs Saccharum spec. beispielsweise korrelieren hohe Saccharose-Gehalte immer mit einer niedrigen VI-Aktivität, ein notwendiges aber nicht ausreichendes Kriterium für die Speicherung von großen

Mengen dieses Zuckers (Zhu et al. 1997).

Vakuoläre Invertasen bestimmen die Zucker-Zusammensetzung

Bestimmte Isoformen von Vakuolären Invertasen sind verantwortlich für die Zuckerzusammensetzung in

Geweben wie Früchten, Samen, Speicherorganen und auch Blättern. Die Enzyme beeinflussen dabei nicht die Gesamtmenge der löslichen Zucker, sondern alleine ihr Verhältnis zueinander. Je höher die Aktivität der VI, desto größer ist der Quotient Hexosen/Saccharose.

Die Akkumulation löslicher Zucker wird häufig an Tomatenfrüchten untersucht, da der Zuckergehalt hier ein entscheidendes Kriterium für die Qualität der Früchte darstellt. Klann et al. (1993) beobachten nur in der Zuchtform Lycopersicon esculentum eine Erhöhung der VI-Aktivität zu Beginn der Fruchtreifung.

Dies steht im Gegensatz zur Wildform L. chmielewskii, die auch - anders als die Zuchtform - gar keine

Hexosen, sondern nur Saccharose im Fruchtfleisch speichert. Wird in L. esculentum die Aktivität der löslichen Sauren Invertase mit Hilfe des antisense-Verfahrens herabgesetzt (Klann et al. 1996, Ohyama et

al. 1995), verschiebt sich das Verhältnis der löslichen Zucker von den Hexosen hin zur Saccharose.

Aber auch in Kartoffelknollen wurde dieses Phänomen beobachtet. Unter normalen Bedingungen werden hier die Kohlenhydrate in erster Linie in Form von Stärke gespeichert. Nach Kältelagerung jedoch

22

Einleitung

__________________________________________________________________________________________________________________ spielen auch Saccharose und Hexosen eine Rolle, was man als Kälteverzuckerung bezeichnet. Die Menge sowie die Zusammensetzung unterscheiden sich dabei je nach Kultivar erheblich. Während die Aktivität von löslicher Saurer Invertase in keinerlei Zusammenhang mit der absoluten Menge zu stehen scheint, kann auch hier eine Korrelation mit dem Hexosen/Saccharose-Quotienten festgestellt, sowie durch anti-

sense-Repression der verantwortlichen VI-Isoform bestätigt wird (Zrenner et al. 1996).

Andersen et al. (2002) beobachten diesen Zusammenhang zwischen VI-Aktivität und Hexosen/Saccharose-Verhältnis, die sich sowohl entwicklungsabhängig wie auch nach Trockenstress verändern, darüber hinaus bei der frühen Samenentwicklung von Zea mays.

Über den Vorteil, den die Lagerung der Hexosen in der Vakuole gegenüber der Saccharose hat, kann nur spekuliert werden (Nguyen-Quoc und Foyer 2001). Möglicherweise erhöht sich dadurch das Speicherpotential dieses Zellorganells, worauf eine für Hexosen geringere Netto-Export-Rate hinweist (Milner et al.

1995). Es könnte aber auch ein Zusammenhang mit dem nach der Hydrolyse des Dimers höheren osmotischen Potential bestehen, welches einen Einfluss auf die Nährstoffaufnahme der Zelle haben könnte. Relevant für die Pflanze scheinen diese Effekte jedoch nur unter solchen Bedingungen zu werden, unter denen Saccharose nicht im Überfluss vorhanden ist, wie etwa gegen Ende der Nacht, wenn die temporären Kohlenhydratspeicher in den Blättern erschöpft sind. In Experimenten produzieren die transgenen

Pflanzen mit erniedrigter VI-Aktivität auch nur dann weniger Früchte als der Wildtyp, wenn sie unter schlechten Lichtverhältnissen oder bei niedrigen Temperaturen angezogen werden (Klann et al. 1996).

2.6.4 Invertasen haben Signalwirkung bei der Steuerung des Stoffwechsels

Lösliche Zucker als Signalmoleküle

Wie bereits in Kapitel 2.5.7 (Seite 15) deutlich wird, haben die löslichen Zucker Saccharose und Hexosen

Signalcharakter. Sie beeinflussen neben der Expression der Invertasen selbst eine Vielzahl weiterer Gene und sind so an der Steuerung verschiedenster Prozesse im pflanzlichen Stoffwechsel beteiligt (Jang und

Sheen 1997, Smeekens 1998, Koch et al. 1996, Wobus und Weber 1999). Die durch Zucker regulierten

Gene werden in zwei Klassen eingeteilt: sogenannte feast

1

Gene werden durch hohe Zuckerkonzentrationen induziert und durch niedrige reprimiert, die famine

2

Gene entsprechend umgekehrt.

Dabei scheinen sowohl die absoluten Konzentrationen der einzelnen Zucker wie auch ihr Verhältnis zueinander relevant zu sein. Während Hexosen Wachstum und mitotische Aktivität fördern, induziert

Saccharose die Differenzierung von Zellen und die Einlagerung von Speicherstoffen (Roitsch et al. 1999,

Wobus und Weber 1999, Hill et al. 2003). Indem Invertasen durch ihre Aktivität die relativen Konzentrationen von Saccharose und Hexosen beeinflussen, verändern sie die Signalwirkung der Zucker und haben eine wichtige regulatorische Funktion.

1

feast = engl.: Fest, Festmahl

2

famine = engl.: Hungersnot

23

Einleitung

__________________________________________________________________________________________________________________

Über die Veränderung der Zuckerkonzentrationen hinaus scheinen Invertasen auch eine Rolle bei der

Signaltransduktion eben dieser Signalmoleküle zu spielen. Herbers et al. 1996 diskutieren Vakuoläre und Apoplastische Invertasen als Rezeptoren, die innerhalb des sekretorischen Weges wirksam sind.

Invertasen beeinflussen die Entwicklung

Viele transgenen Pflanzen, bei denen Invertase-Aktivitäten in die eine oder andere Richtung manipuliert sind, zeigen Veränderungen in verschiedenen Abschnitten der Entwicklung: Bei den bereits mehrmals erwähnten antisense-VI oder –CWI Karottenpflanzen (siehe Kapitel 2.6.2, Seite 19) sind außer bei den

Speicherwurzeln weitere Anomalien zu beobachten (Tang et al. 1999): Somatische Embryos aus transgenen Zelllinien unterscheiden sich im späten Keimblattstadium morphologisch von denen aus WT-Zellen.

Sie haben entweder vergrößerte Keimblätter bei sonst gestauchter Größe (antisense-VI) oder die Keimblätter trennen sich nicht ordnungsgemäß (antisense-CWI). In beiden Fällen entwickeln sich daraus auf rein Saccharose-haltigem Medium keine Pflanzen, sondern gestauchte, kallöse Gebilde. Durch exogene

Applikation eines Zuckergemischs, das aus Saccharose und Hexosen im Verhältnis 1:2:2 besteht, werden die Effekte gemindert und die Zellen differenzieren sich zu relativ normalen Pflanzen. Die Entwicklungsstörungen der transgenen Pflanzen werden daher auf die Veränderungen in der Zusammensetzung der löslichen Zucker zurückgeführt, die wiederum eine direkte Folge der manipulierten Invertase-Aktivitäten sind.

Cheng und Chourey (1997) sowie Miller und Chourey (1992) beobachten ebenfalls Entwicklungsstörungen bei den Samen von mutierten Maispflanzen (siehe Kapitel 2.6.2, Seite 19). Diese lassen sich nicht vollständig durch exogene Applikation von Zuckern kompensieren. Das macht deutlich, dass die Aktivität der Invertasen an sich eine regulatorische Funktion erfüllt und nicht nur als erster Schritt des Saccharose-

Katabolismus verstanden werden kann. Vilhar et al. (2002) belegen durch zytometrische Messungen eine geringere Zellteilungsrate bei der Mutante.

Der Einfluss von Invertasen auf die Entwicklung wird jedoch auch dann deutlich, wenn ihre Aktivität gezielt in einem bestimmten Gewebe manipuliert wird: A. thaliana Pflanzen, die eine ektopische Hefe-

Invertase im floralen Meristem exprimieren, blühen früher, haben mehr Schoten und einen um 30 % höheren Samenertrag (Heyer et al. 2004).

Invertasen bewirken eine erhöhte systemische Resistenz (SAR)

Neben den vorher beschriebenen Effekten auf den Kohlenhydratstoffwechsel hat die Überexpression von

Invertasen auch Einfluss auf die pflanzliche Abwehrkraft gegenüber Phytopathogenen. Transgene Tabak-

Pflanzen, die eine Hefe-Invertase im Apoplasten oder der Vakuole exprimieren, zeigen spontane nekrotische Läsionen an den Blättern, die der Hypersensitiven Reaktion gegenüber avirulenten mikrobiellen

Krankheitserregern ähneln (Herbers et al. 1996). Auf molekularer Ebene sind Veränderungen in der Ex-

24

Einleitung

__________________________________________________________________________________________________________________ pression verschiedener Gene zu beobachten: Die Transkripte einiger so genannter PR-Gene

1

, die mit

Pathogenabwehr in Verbindung gebracht werden, sind erhöht. Dagegen werden weniger für die Photosynthese relevante Chlorophyll-Binde-Proteine synthetisiert. Weiterhin haben die transgenen Pflanzen einen höheren Gehalt an Kallose und Salicylsäure sowie erhöhte Peroxidase-Aktivitäten. Alle diese Aspekte deuten auf eine verstärkte Abwehrkraft, die tatsächlich gegenüber einem phytopathogenen Virus zu beobachten ist. Diese systemische erworbene Resistenz (SAR) wird jedoch nicht durch die Expression der

Hefe-Invertase im Zytosol erreicht, obwohl die Pflanzen im Hinblick auf die Zucker, die in allen drei

Fällen in der Vakuole akkumulieren, nicht zu unterscheiden sind. Daher wird die Rezeption des Signals im sekretorischen Pfad vermutet, den nur die apoplastische oder vakuoläre Form durchlaufen.

Verzögerung der Seneszenz

Die Seneszenz kann als letzte Stufe der Blattentwicklung verstanden werden, bei der die im Gewebe enthaltenen Resourcen remobilisiert und exportiert werden. Neben äußeren Faktoren wird dieser Vorgang vor allem durch die Phytohormone ABA, Ethylen und Jasmonsäure (He et al. 2002) gefördert, durch Cytokinine hingegen verlangsamt.

Dass eine CWI durch exogene Gabe oder Erhöhung des endogenen Cytokininspiegels induziert wird, kann in verschiedenen Spezies nachgewiesen werden (Ehness und Roitsch 1997). Lara et al. (2004) zeigen, dass das Phytohormon ohne die Aktivität der Zellwandinvertase die Seneszenz nicht verzögert. Die

CWI-Isoform ist nicht nur ein essentieller Bestandteil bei der Umsetzung des Signals, sie ist sogar alleine ausreichend, um diesen Effekt auszulösen.

1

PR Gene = engl.: pathogenesis related genes, mit Pathogenabwehr assoziierte Gene

25

Einleitung

__________________________________________________________________________________________________________________

B I

NVERTASE

-I

NHIBITOREN

Was sind Invertase-Inhibitoren?

Invertase-Inhibitoren bilden mit Invertasen einen reversiblen Komplex und hemmen deren Aktivität spezifisch. Je nach ihrer subzellulären Lokalisation werden sie mit VIF oder CIF (Vakuolärer, bzw. cell wall

Inhibitor von β-Fruktosidasen) abgekürzt. Auch wenn ihre Bedeutung in vivo noch unklar ist, so weisen doch zahlreiche Arbeiten auf einen Einfluss dieser Proteine hin.

Die Invertase-Inhibitoren gehören zu einer Familie kleiner Proteine, deren Funktion nur teilweise bekannt ist. Neben der Gruppe der Invertase-Inhibitoren C/VIF zählen dazu noch spezifische Inhibitoren der PME

(Pektin-Methyl-Esterase), die mit PMEI abgekürzt werden, und weitere Proteine mit möglicherweise anderen Zielenzymen.

2.7 Entdeckung und Phylogenetische Einordnung der Invertase-Inhibitoren

2.7.1 Die Entdeckung der Invertase-Inhibitoren

Die Existenz dieser posttranslationalen Regulatoren wurde bereits in den 1960er Jahren postuliert, da

Proteinmengen und Aktivitäten von Invertasen unter bestimmten Bedingungen nicht korrelieren. Zunächst wurden aus Kartoffelknollen Proteinfraktionen aufgereinigt, die in der Lage waren, Invertase-Präparationen zu hemmen (Schwimmer et al. 1961, Pressey 1966 - 1967). In den darauf folgenden Jahren wurden solche Proteine auch aus anderen vegetativen Speichergeweben isoliert, darunter die Hypokotylrüben von Zuckerrübe und Rote Beete (beide Beta vulgaris) und die Speicherwurzel der Süßkartoffel

Ipomoea batatas (Pressey 1968; Dubinina 1969; Kursanov et al. 1971; Dubinina 1979), sowie das Endosperm von Maissamen (Zea mays, Jaynes und Nelson, 1971). Den ersten partiellen Proteinsequenzen von Nt-CIF (Weil et al. 1994, Greiner et al. 1998) und einem Inhibitor aus Tomatenfrüchten (Pressey

1994) folgte die Klonierung der vollständigen DNA-Sequenzen zweier Isoformen aus Tabak Nt-CIF und

Nt-VIF (Y12805

1

und Y12806, Greiner et al. 1998 + 1999) sowie aus Tomate (AJ010943

2

). Diese Arbeiten dienen als Grundlage für Studien an transgenen Pflanzen sowie an rekombinant erzeugten Proteinen.

Datenbanksuchen lieferten weitere Kandidaten: Beispielsweise zeigen die EST-Sequenzen

3

aus Pisum

sativum (AA430943

2

) und Arabidopsis thaliana (Y12807

1

) starke Ähnlichkeiten ihrer abgeleiteten Proteinsequenzen mit den Tabak-Inhibitoren (Greiner et al. 2000).

1

Zugangsnummer in der EMBL-Datenbank

2

Zugangsnummer in der Gene Bank Datenbank (Zugang über NCBI)

3

EST = engl.: expressed sequence tag, cDNA-Sequenzen von Genen unbekannter Funktion

26

Einleitung

__________________________________________________________________________________________________________________

Mit Hilfe der Antiseren gegen Nt-CIF wurden in weiteren Pflanzen Proteine mit entsprechender Größe entdeckt, bei denen es sich um Invertase-Inhibitoren handeln könnte. Darunter finden sich Chenopodium

rubrum, die Karotte Daucus carota und die Tomate Lycopersicon esculentum (Greiner et al. 2000).

2.7.2 Die Proteinfamilie der PMEI-RP

Wie oben gezeigt, wurden im Laufe der Zeit aus diversen Spezies Proteine isoliert, die inhibitorische

Wirkung auf Invertasen zeigen. Außerdem wurden zu den ersten bekannten Sequenzen aus Tabak Homologe in unterschiedlichen Pflanzenfamilien gefunden, darunter neben den Solanaceae (L. esculentum) auch Fabaceae (P. sativum), Chenopodiaceae (B. vulgaris, C. rubrum), Asteraceae (D. carota) und die monokotylen Poaceae (Z. mays). Dies spricht dafür, dass diese Proteine – zumindest was höhere Pflanzen anbetrifft - ubiquitär vorkommen.

Die Klonierung zweier Inhibitoren aus Tabak, deren Funktion als Invertase-Inhibitoren an rekombinanten

Proteinen bestätigt wurde (Greiner et al. 1998, Greiner 1999), weist auf die Existenz mehrerer verwandter

Sequenzen innerhalb einer Spezies hin. Aus dem vollständig sequenzierten Genom von A. thaliana konnten schließlich insgesamt 39 Sequenzen mit den bekannten Inhibitoren in Verbindung gebracht werden (Rausch und Greiner 2004, Greiner, persönliche Mitteilung). In funktionellen Analysen wurden allerdings kürzlich einige Vertreter dieser Gruppe als spezifische Inhibitoren von Pektin-Methyl-Esterasen identifiziert und als PMEIs

1

bezeichnet (Camardella et al. 2000, Wolf et al. 2003, Giovane et al. 2004,

Raiola et al. 2004). Obwohl Nt-CIF und ein PMEI aus A. thaliana auf Proteinebene nur etwa 20% Prozent

Identität aufweisen, ist ihre Proteinstruktur sehr ähnlich (Hothorn et al. 2004-B, Scognamiglio et al.

2003). Daher geht man heute davon aus, dass es sich hier um eine Proteinfamilie handelt, der regulatorische Proteine mit verschiedenen Zielenzymen des Zuckerstoffwechsels, jedoch sehr ähnlicher Proteinstruktur angehören (siehe Kapitel 2.8.2, Seite 28). Die Bezeichnung PMEI-verwandte Proteine

(PMEI-RP

2

) wurde aus folgendem Grund gewählt: Die Prodomäne der Typ 1 PME ähnelt in ihrer

Sequenz den PMEI-RP und wird daher als möglicher Ursprung dieser Genfamilie angesehen (Giovane et

al. 2004). Welches Zielenzym ein Vertreter dieser Familie hat, ist alleine aufgrund der Sequenz nicht feststellbar. Zur Aufklärung sind daher für jedes Gen funktionelle Studien mit dem rekombinanten

Protein notwendig.

1

PMEI = Pektin-Methyl-Esterase-Inhibitor

2

PMEI-RP = engl.: PMEI-related proteins, den PMEIs verwandte Proteine

27

Einleitung

__________________________________________________________________________________________________________________

2.8 Eigenschaften der Invertase-Inhibitoren

2.8.1 Sequenzen und davon abgeleitete Eigenschaften

Die Homologien innerhalb der Genfamilie der PMEI-RP, zu denen man die Invertase-Inhibitoren zählt

(siehe Kapitel 2.7.2, Seite 27) sind ungewöhnlich niedrig. Streng konserviert sind nur vier Cysteinreste, von denen heute bekannt ist, dass die über sie gebildeten Disulfidbrücken eine wichtige Funktion für die strukturelle Integrität der Inhibitoren haben (siehe unten). Eine Sequenz ist ohne funktionelle Studien am

Protein nicht einer der Subfamilien Invertase- oder PME-Inhibitoren zuzuordnen.

Die beiden aus Tabak klonierten Isoformen Nt-CIF und Nt-VIF beispielsweise sind nur zu 47% Prozent identisch (Rausch und Greiner 2004). Die funktionell noch nicht bestätigte Sequenz aus Tomate LeINH ist der apoplastischen Isoform Nt-CIF ähnlicher als Nt-VIF (Greiner et al. 2000). Möglicherweise sind sich daher Inhibitoren im selben Kompartiment ähnlicher, selbst wenn sie verschiedenen Spezies angehören, wie das etwa auch bei den subzellulären Gruppen der Invertasen der Fall ist (siehe Kapitel 2.3.1,

Seite 6).

Die abgeleiteten Proteinsequenzen aller bisher bekannten Inhibitoren haben eine Länge von etwa 175

Aminosäuren und beginnen N-terminal mit einem Signalpeptid, das ihren Synthese in das ER gewährleistet. Für Nt-CIF konnte das Fehlen dieser Sequenz am reifen Protein durch N-terminale Sequenzierung bestätigt werden (Weil et al. 1994). Die Proteingrößen reichen etwa von 16-20 kD.

2.8.2 Proteinstruktur der Inhibitoren

Aus der Gruppe der Invertase-Inhibitoren kennt man zum heutigen Zeitpunkt nur die Röntgenstruktur des auch biochemisch am besten charakterisierten Proteins Nt-CIF: Nach Hothorn et al. (2004-A) nimmt ein

4-Helix-Bündel den größten Teil ein. Den N-Terminus bildet ein wie eine Haarnadel geformtes Anhängsel, der so genannte hairpin

1

.

Das 4-Helix-Bündel ist ein auch aus anderen Proteinen bekanntes strukturelles Motiv (Kamtekar und

Hecht 1995). Es besteht aus vier α-Helices, die gegenläufig orientiert sind, und in ihrem Kern durch hydrophobe Wechselwirkungen stabilisiert werden. Außerdem sorgt eine Disulfidbrücke zwischen zwei der

Helices für Zusammenhalt. Sie wird von den letzten beiden der vier bei allen Inhibitoren konservierten

Cysteinresten gebildet.

Der N-terminale hairpin beinhaltet ebenfalls drei kurze helikale Strukturen, die in einer Ebene liegen und dem 4-Helix-Bündel seitlich wie ein kleines Schild aufliegen. Auch hier halten hydrophobe Wechselwirkungen die beiden Strukturen zusammen, wobei auch der C-Terminus in diesen Zusammenhang eine

Rolle spielt. Innerhalb des hairpins verbinden die ersten beiden Cysteine im Protein zwei der Helices über eine Disulfidbrücke miteinander (Hothorn et al. 2004-A). Weil es sich beim hairpin im Gegensatz zum

1

hairpin (engl.) = Haarnadelstruktur

28

Einleitung

__________________________________________________________________________________________________________________

4-Helix—Bündel um die individuellere Struktur handelt, wird hier auch die Ursache für die Spezifität der

Inhibitoren auf Invertasen, beziehungsweise bestimmte Isoformen dieser Enzyme vermutet (siehe Kapitel

2.10.3, Seite 34). Eine Chimäre aus dem hairpin eines PMEI aus A. thaliana mit dem 4-Helix-Bündel von

Nt-CIF ist tatsächlich in der Lage, eine PME zu inhibieren (Hothorn et al. 2004-B).

Auf der Oberfläche des Proteins wurde eine Fläche mit einer Häufung von sauren Aminosäuren identifiziert. Hier wird eine Funktion bei der Bindung an die Invertase vermutet. Außerdem gibt es zwei

Bindestellen für zweiwertige Kationen (siehe Kapitel 2.10.2, Seite 32).

2.8.3 Physikochemische Eigenschaften der Inhibitor-Proteine

Invertase-Inhibitoren sind nicht glykosyliert

Obwohl sie in nicht zytosolischen Kompartimenten wie der Vakuole und dem Apoplasten lokalisiert sind, tragen Inhibitoren allen bisherigen Untersuchungen zur Folge keine Glykosylierungen. Dies wurde in einigen Fällen experimentell am aufgereinigten Protein gezeigt (Pressey 1994, Weil et al. 1994). Zum anderen besitzen die bekannten Sequenzen auch keine für die Glykosylierung notwendigen Sequenzmotive.

Nachdem ihre Zielenzyme, die Sauren Invertasen, grundsätzlich glykosyliert sind, lieferte diese Eigenschaft der Inhibitoren einen Hinweis auf die Komplexbildung zwischen den beiden Proteinen lange bevor spezifische Antiseren zur Verfügung standen (siehe Kapitel 2.10.1, Seite 31).

Säurestabilität

Invertase-Inhibitoren sind sehr stabil gegenüber niedrigen pH-Werten. Häufig wurde diese Eigenschaft als effektiver Schritt bei der Aufreinigung aus Pflanzenextrakten genutzt (Pressey 1967+1994, Ovalle et

al. 1995), weil dabei eine große Anzahl anderer Proteine - darunter die Invertasen - irreversibel gefällt oder zumindest inaktiviert werden. Ein aus Tomatenfrüchten isolierter Inhibitor ist beispielsweise noch löslich und aktiv nach einer Behandlung bei pH 1,6 (Pressey 1994).

Hitzestabilität

Daneben sind Invertase-Inhibitoren sehr stabil gegenüber Hitzeeinwirkung, wie beispielsweise Pressey

(1994) an Inhibitor-Präparation aus Tomaten-Früchten nachweist. Hothorn et al. (2004-A) bestätigen solche Experimente am rekombinanten Protein: Für Nt-CIF wird eine Schmelztemperatur von etwa 70°C gemessen. Erhitzen auf 95°C für mehrere Minuten führt zu keinem Verlust der inhibitorischen Aktivität nach dem Abkühlen. Strukturell wird diese Stabilität damit begründet, dass das Protein über zwei Disulfidbrücken stabilisiert wird, nur sehr kurze loops vorhanden sind und N- und C-Terminus gut ins Protein integriert sind.

29

Einleitung

__________________________________________________________________________________________________________________

Reduktionsmittel zerstören die inhibitorische Aktivität

Die Behandlung mit Reduktionsmitteln wie DTT oder β-Mercaptoethanol und anschließender Erwärmung auf 65°C zerstört die Aktivität der Invertase- sowie der PME-Inhibitoren (Greiner et al. 2000, Wolf et al.

2003). Dies wird erklärt mit der Lösung von stabilisierenden Disulfidbrücken, wodurch das Protein seine

Hitzestabilität verliert.

2.9 Expression von Inhibitoren

2.9.1 Die Expression der Invertase-Inhibitoren ist reguliert

Bisher liegen nur wenige Untersuchungen vor, die die Expression von Invertase-Inhibitoren in verschiedenen Geweben und Entwicklungsstadien vergleichen. Daraus wird jedoch bereits klar, dass auch diese

Proteine– ähnlich wie die der Invertasen - nicht konstitutiv, sondern reguliert exprimiert werden und jede

Isoform ihr charakteristisches Expressionsmuster besitzt. Dieses stimmt dabei nicht immer mit den Mustern der bisher untersuchten Invertase-Isoformen überein. Welche Faktoren die Expression der Inhibitoren beeinflussen, ist erst in den Anfängen verstanden.

2.9.2 Wo werden Invertase-Inhibitoren exprimiert?

In vielen Fällen wurden Invertase-Inhibitoren aus Speichergeweben isoliert, die Kohlenhydrate akkumulieren, wie Kartoffel, Zuckerrübe, Rote Beete (siehe Kapitel 2.7.1, Seite 26). Auch das Endosperm von

Mais-Samen zählt hierzu (Jaynes und Nelson 1971). Bate et al. zeigen 2004 für einen apoplastischen Inhibitor, dass das Transkript ausschließlich in sehr jungen Samen vier bis zehn Tage nach dem Aufblühen exprimiert ist. Aus Blättern, Wurzeln und Stempeln kann über RT-PCR kein Signal amplifiziert werden.

In situ-Studien lokalisieren das Transkript nur in Zellen des sich entwickelnden Endosperms, die den

Embryo umgeben.

Umfangreiche Expressionsstudien gibt es zu den Inhibitoren aus Tabak: Das Transkript des apoplastischen Inhibitors Nt-CIF ist mit Abstand am stärksten in Blütengeweben. In vegetativen Geweben findet es sich in erster Linie im Stängel, in Blättern steigt die Menge von sink- über source-Blätter hin zu seneszenten Blättern an. Im Wurzelgewebe ist es nur äußerst schwach ausgeprägt (Greiner et al. 1998). Dies entspricht nur zum Teil der Expression der untersuchten CWI-Isoformen in Tabak (siehe Kapitel 2.11.2,

Seite 35). Der vakuoläre Inhibitor Nt-VIF zeigt ein vollständig anderes Expressionsmuster (Lauer 1999) als sein apoplastisches Pendant. Er ist am stärksten in Wurzel, wo sich Nt-CIF kaum nachweisen lässt, und deutlich schwächer als dieser in den Blütengeweben. Beide Isoformen sind im Stängel zu finden. Ein

ähnlich unterschiedliches Expressionsprofil wie die beiden Inhibitoren aus Tabak zeigen Link et al.

(2004) für zwei Isoformen At-C/VIF1 und 2 aus A. thaliana.

30

Einleitung

__________________________________________________________________________________________________________________

Mit Hilfe eines Antiserums gegen Nt-CIF wurden außerdem verschiedene Gewebe der Tomate nach potentiellen Inhibitoren durchsucht (Greiner et al. 2000). Ein für Inhibitoren der Größe nach plausibles Signal konnte bei 20 kD detektiert werden, und zwar in sink-Blättern, hier schwächer als in source-Blättern, sowie in Blüten. Des Weiteren wurden mit dem Alter steigende Mengen des Proteins im Perikarp von sich entwickelnden Früchten gemessen.

2.9.3 Modulatoren der Expression von Inhibitoren

Welche endogenen und exogenen Faktoren und Bedingungen die Expression von Invertase-Inhibitoren beeinflussen, ist noch weitgehend ungeklärt. Im Falle des apoplastischen Inhibitors Nt-CIF wurde der

Einfluss zweier Faktoren nachgewiesen (Greiner und Rausch 2004): Ab einer Konzentration von 10 µM des Phytohormons ABA

1

in der Hydrokultur-Nährlösung steigt das Transkript des Inhibitors in den

source-Blättern von 5 Wochen alten Tabak-Pflanzen innerhalb von 24 h an. Gibt man 20% des Osmotikums PEG 6000 in die Nährlösung, ist die mRNA bereits nach 6 h deutlich erhöht, ab 18 h kann darüber hinaus ein deutlicher Anstieg des spezifischen Proteins festgestellt werden.

2.10 Komplexbildung und Inhibition

2.10.1 Invertase und Inhibitor bilden einen Komplex

Bereits die Beobachtung, dass partiell aufgereinigte Inhibitoren Invertasen in einem nicht kompetitiven

Mechanismus hemmen können, weist auf eine Bindung zwischen den beiden Proteinen hin. Die Theorie einer Komplexbildung in vivo wird insbesondere unterstützt durch solche Experimente, bei denen zur

Aufreinigung von Invertasen Lektine eingesetzt werden. Wie beispielsweise das häufig verwendete ConcanavalinA (ConA), das zu diesem Zweck an eine Sepharose-Matrix gekoppelt vorliegt, binden diese

Substanzen spezifisch an die Zuckerseitenketten von Proteinen, die so von allen nicht glykosylierten

Proteinen separiert werden können. In vielen Fällen konnten dabei die Inhibitoren, obwohl sie keine Glykosylierung tragen, auch in der ConA-gebundenen Fraktion in signifikanten Mengen detektiert werden

(Krausgrill et al. 1998, Greiner et al. 2000). Diese Tatsache wird mit einer stabilen Bindung der Inhibitoren an ihre glykosylierten Zielenzyme interpretiert:

In allen untersuchten Entwicklungsstadien von Tomatenfrüchten ist mit dem Antiserum gegen Nt-CIF sowohl in der ConA-bindenden wie auch in der nicht bindenden Fraktion ein Protein von etwa 20 kDa detektierbar (Greiner et al. 2000). Ebenso weisen Bate et al. (2004) mit einem gegen ein rekombinantes

1

ABA = engl.: abscisic acid, Abszisinsäure

31

Einleitung

__________________________________________________________________________________________________________________

Inhibitor-Protein aus Mais gerichteten Antiserum einen endogenen Inhibitor in jungen Mais-Samen nach:

Das Signal ist dabei im ConA-Durchlauf nur unwesentlich stärker als in der ConA-gebundenen Fraktion.

Die Assoziation einer CWI mit einem Inhibitor wurde außerdem eingehend an Tabak-Suspensionskulturzellen (TSCC

1

) untersucht (Weil und Rausch 1994, Weil et al. 1994, Krausgrill et al. 1996). Neben dem

Nachweis des Inhibitors in ConA-bindenden Fraktionen wurde der Komplex darin über eine native Gelelektrophorese gezeigt: Eine entsprechend große Proteinbande reagiert sowohl mit dem Antiserum gegen die CWI wie auch gegen Nt-CIF. Durch anschließende Auftrennung über SDS-PAGE zerfällt der Komplex in seine Bestandteile und im Western Blot entsprechen die Signale den bekannten Größen für Invertase und Inhibitor (Krausgrill et al. 1998).

2.10.2 Der Invertase-Inhibitor-Komplex kann in unterschiedlichen Formen vorliegen

Aus vielen Untersuchungen wird deutlich, dass der Komplex zwischen Invertase und Inhibitor in Abhängigkeit äußerer Faktoren seine Eigenschaften verändert. Zu beobachten sind vor allem Unterschiede in der Stabilität und/oder der Inhibitionsfähigkeit, die durch pH-Wert, Temperatur, das Substrat Saccharose und die Anwesenheit zweiwertiger Ionen beeinflusst werden, wie unten im Einzelnen erläutert werden soll. Wahrscheinlich werden dadurch Veränderungen in der Konformation von einem oder beiden Proteinen verursacht, die wiederum Einfluss auf die Binde- und/oder Inhibitionsfähigkeit haben.

Des Weiteren bestehen zumindest in vitro Unterschiede in der Komplexbildung je nachdem mit welcher

Invertase-Isoform sie eingegangen wird (siehe auch Kapitel 2.10.3, Seite 34). Die in vitro Inhibition durch aus TSCC aufgereinigte Inhibitoren geht bei der aufgereinigten CWI schneller vonstatten als bei der VI aus Tomate (Sander et al. 1996), obwohl beide Enzyme im Endeffekt etwa im gleichen Ausmaß gehemmt werden.

Ob die unterschiedlichen Komplex-Formen auch in vivo eine Bedeutung haben, ist nicht eindeutig geklärt, wird aber vermutet, da die Faktoren, die in vitro Einfluss nehmen, auch im zellulären Kontext relevant sind. Außerdem gibt es Hinweise, dass verschiedene Komplex-Formen auch in planta existieren: Im

Apoplasten von TSCC sind beide Proteine über die gesamte Kulturperiode hinweg gleichmäßig stark vertreten. Trotzdem fällt die Invertase-Aktivität im Laufe der Zeit stark ab. Über ConA-Aufreinigung und anschließende Western Blot Analyse kann nachgewiesen werden, dass zu jeder Zeit Komplexe vorliegen, auch wenn der Anteil des freien Inhibitors gegen Ende der Kulturperiode abnimmt (Krausgrill et al.

1998). Die Ausbildung unterschiedlich stabiler und inhibitorisch aktiver Komplexe bietet hier eine plausible Erklärung.

Auch in transgenen Kartoffelpflanzen, die den vakuolären Inhibitor Nt-VIF unter dem CaMV 35S Promotor überexprimieren, verhalten sich die isolierten VIs in vitro verschieden: in Blattextrakten ist die

Aktivität vollständig inhibiert, während in kältegelagerten Knollen gegenüber dem Wildtyp sogar eine

1

TSCC = engl.: tobacco suspension culture cells, Tabak-Suspensionskulturzellen

32

Einleitung

__________________________________________________________________________________________________________________ leicht erhöhte Invertase-Aktivität messbar ist, obwohl die reduzierenden Zucker hier stark vermindert sind. Da es sich in beiden Geweben um dieselbe Isoform handelt, geht man auch hier davon aus, dass sich die Proteinkomplexe aufgrund anderer Faktoren in den Geweben in ihrer Stabilität unterscheiden (Greiner

et al. 1999). pH-Wert

Der Einfluss des pH-Wertes auf die Inhibition ist Gegenstand vieler Arbeiten (Pressey 1967 und 1994,

Anderson et al. 1980, Jaynes und Nelson 1971), die ähnliche Ergebnisse liefern, und wird ausführlich in

Weil et al. (1994) an aus TSCC aufgereinigten CWI und Inhibitor-Proteinen untersucht. Er ist nur dann signifikant, wenn Invertase und Inhibitor vor der Bestimmung der Aktivität ohne das Substrat Saccharose inkubiert werden, da sonst der Schutzmechanismus des Substrates überwiegt (siehe unten). Die Inhibition ist bei pH 4,5 am stärksten, wo auch die Invertase ihr Aktivitätsoptimum hat, und nimmt bis pH 6,5 kontinuierlich ab. Die höheren pH-Werte verhindern anscheinend bereits die Bindung des Inhibitors: Nach

Einstellen des pH-Wertes auf 4,5 nach der Vorinkubation wird in der anschließenden Aktivitätsbestimmung nahezu derselbe Wert gemessen wie ohne Vorinkubation (Weil et al. 1994). Pressey finden 1994 auch eine Reduktion der Inhibition vom Optimum bei pH 5 in Richtung der saureren Werte bis pH 3. Die

Ergebnisse der Röntgenstruktur-Untersuchung von Nt-CIF weisen ebenfalls in diese Richtung (Hothorn et

al. 2004): Es ergeben sich keine Hinweise auf eine strukturelle Veränderung am Inhibitor. Daher wird vermutet, dass der pH-Wert an der Invertase die Voraussetzungen für die Bindung des Inhibitors verändert.

Es liegt nahe, dass der pH-Wert auch in vivo relevant ist für die Regulation der Invertase-Aktivität: Sowohl für den Apoplasten wie auch die Vakuole sind physiologische Schwankungen im Säuregrad bekannt.

Temperatur

Es existieren wenige Studien zu der Wirkung verschiedener Temperaturen auf die Komplexbildung, wie etwa von Jaynes und Nelson (1971). Sie stellen nach Vorinkubation von Inhibitor- und Invertase-Präparation bei 0°C eine geringere Inhibition fest als bei 37°C. Einen Effekt in vivo vermuten Zrenner et al.

(1995) und Greiner et al. (1999), da in kaltgelagerten Kartoffelknollen die Stabilität und Inhibition des

Komplexes vermindert scheint.

Zweiwertige Ionen

Zweiwertige Kationen wie Mg

2+

, Zn

2+

und vor allem Ca

2+

reduzieren die Inhibitionsfähigkeit der Inhibitoren erheblich (Anderson et al. 1980, Weil et al. 1994), während sie auf Invertase-Präparationen allein nur eine schwach aktivitätsfördernde Wirkung haben. Ähnlich wie bei den unterschiedlichen pH-Werten ist auch hier der Effekt am stärksten, wenn die Salze zusammen mit Inhibitor und Invertase vorinkubiert

33

Einleitung

__________________________________________________________________________________________________________________ werden (Weil et al. 1994). Strukturelle Untersuchungen an Nt-CIF zeigen, dass Inhibitoren zwei Ionen komplexieren können (Hothorn et al. 2004-A).

In der Zelle sind Änderungen im Ionenhaushalt im Hinblick auf Signaltransduktion bekannt, vor allem was Calcium angeht. Daher ist auch hier ein in vivo Effekt auf die Regulation der Invertase-Aktivität denkbar.

Das Substrat Saccharose schützt vor der Inhibition

Manche Invertasen werden durch das Substrat Saccharose vor der Inhibition geschützt. Andere Zucker, wie etwa die Produkte Fruktose und Glukose, oder das Zuckeranalogon 3-OMG zeigen diese Wirkung dagegen nicht (Anderson et al. 1980, Weil et al. 1994). Die Schützbarkeit ist dabei eine Eigenschaft der

Invertase-Isoform: Sander et al. (1996) vergleichen Invertase- und Inhibitorpräparationen aus TSCC und

Tomatenfrüchten miteinander. Die Saccharose hat nur auf die Inhibition der Tabak-CWI Auswirkungen, jedoch nicht auf die Tomaten-VI, egal welcher Inhibitor eingesetzt wird.

Der Schutz vor Inhibition ist konzentrationsabhängig und sättigbar (Weil et al. 1994, Bate et al. 2004).

Die K m

-Werte für den Substratschutz liegen im selben Bereich wie diejenigen für die Hydrolyse, weshalb eine physiologische Relevanz dieses Effektes sehr wahrscheinlich ist. Es wird vermutet, dass er in TSCC eine große Rolle spielt. Die Abnahme der Invertase-Aktivität im Laufe der Kulturperiode korreliert mit der Abnahme der Saccharose-Konzentration im Medium, ohne dass sich die Proteinmengen der beiden

Proteine signifikant ändern (Krausgrill et al. 1998).

2.10.3 Spezifität von Inhibitoren

Alle bisher untersuchten Invertase-Inhibitoren sind spezifisch für pflanzliche Invertasen. Es wurde weder eine inhibitorische Wirkung auf pilzliche Invertasen (Pressey 1967, Jaynes und Nelson 1971, Greiner et

al. 1998), noch auf andere Enzyme des Zuckerstoffwechsels wie zum Beispiel Amylasen (Pressey 1994) oder PMEs (Wolf et al. 2003) gemessen.

Die pflanzlichen Invertasen sind jedoch nicht alle gleich sensibel gegenüber den verschiedenen Inhibitoren, wie an partiell aufgereinigten (Pressey 1967, Jaynes und Nelson 1971) sowie auch an einigen rekombinanten (Bate et al. 2004, Greiner et al. 1998, Link et al. 2004) Inhibitoren untersucht wurde. Nach Link

et al. 2004 beispielsweise hemmt die eine Isoform At-C/VIF2 aus A. thaliana sowohl eine apoplastische wie auch eine vakuoläre Invertase-Präparation fast vollständig. Dagegen inhibiert At-C/VIF1 zwar in der höchsten Inhibitor-Konzentration die vakuolären Invertasen auf unter 10% Restaktivität, die CWI-Präparation jedoch nur schwach auf etwa 80%.

Trotz ihrer strukturellen Ähnlichkeit mit den Invertase-Inhibitoren scheinen nach bisherigen Untersuchungen auch die PMEIs spezifisch für ihre Zielenzyme zu sein. Für keines dieser Proteine wurde eine

Wirkung auf Invertasen festgestellt (Wolf et al. 2003, Scognamiglio et al. 2003). Die ersten strukturellen

Vergleiche zwischen PMEIs und Invertase-Inhibitoren weisen darauf hin, dass sich die Spezifität für das

34

Einleitung

__________________________________________________________________________________________________________________

Zielenzym in dem N-terminalen Abschnitt des Proteins, dem hairpin manifestiert (Hothorn et al. 2004-B, siehe Kapitel 2.8.2, Seite 28).

2.11 Physiologische Bedeutung von Invertase-Inhibitoren

2.11.1 Proteinogene Inhibitoren als posttranslationale Regulatoren von Invertasen

Wie die obigen Kapitel verdeutlichen (siehe Kapitel 2.5, Seite 11), handelt es sich bei Invertasen um stark regulierte Proteine. Sie sind sensitiv gegenüber einer ganzen Reihe Signalen, von denen viele eine mitunter sehr schnelle Induktion auf transkriptioneller Ebene bewirken. Unter verschiedenen Bedingungen ist jedoch auch eine rasche Reduktion der Invertase-Aktivität notwendig. Aufgrund ihres Glykosylierungszustands sind Invertasen sehr stabil gegenüber Proteinabbau (Yamaguchi 2002). Daher kommen nur andere posttranslationale Mechanismen in Frage. Neben dem Einfluss verschiedener nicht proteinogener

Effektoren (siehe Kapitel 2.4.2, Seite 10) bietet die Bindung der spezifischen Inhibitoren eine effektive

Möglichkeit der posttranslationalen Hemmung der Aktivität. Ob diese Proteine in vivo eine Rolle spielen, ist noch nicht abschließend geklärt. Verschiedene Ergebnisse aus experimentellen Untersuchungen legen jedoch eine Funktion im pflanzlichen Stoffwechsel nahe.

2.11.2 Hinweise auf inhibitorische Funktion in vivo

Kolokalisation von Invertasen und Inhibitoren, Komplexbildung in vivo

Invertasen und Inhibitoren werden häufig in denselben Geweben gefunden. Dies gilt für viele Speichergewebe, in denen die Inhibitoren im Rahmen von Untersuchungen an Invertasen entdeckt wurden (siehe

Kapitel 2.7.1, Seite 26), aber auch für die mehrfach erwähnte Tabak-Suspensionszellkultur (siehe Kapitel

2.10.1, Seite 31 und 2.10.2, Seite 32). Für dieses System konnte zudem nachgewiesen werden, dass sich beide Proteine im selben Kompartiment - hier im Apoplasten – befinden (Weil und Rausch 1994).

Ein Vergleich der Expressionsmuster zwischen Invertasen und Inhibitoren zeigt jedoch nicht immer nur

Übereinstimmungen: Beispielsweise sind der apoplastische Inhibitor Nt-CIF und eine Zellwandinvertase koexprimiert in älteren source- und seneszenten Blättern (Greiner et al. 1998). Dagegen sind die Verhältnisse extrem ungleich in Wurzel, wo das Transkript der CWI im Gegensatz zum Inhibitor sehr stark ist.

Insbesondere fallen zudem die Blütengewebe auf: Hier ist der Inhibitor im Vergleich zu anderen Geweben mit Abstand am stärksten exprimiert, während die hier untersuchte CWI kaum oder nur sehr schwach detektiert werden kann.

Die Hinweise über eine Komplexbildung von Invertasen und Inhibitoren sind in Kapitel 2.10.1 (Seite 31) dargelegt.

35

Einleitung

__________________________________________________________________________________________________________________

Anhaltspunkte für Inhibition in vivo

In verschiedenen Systemen wird es als Produkt des Einflusses von inhibitorischen Proteinen angesehen, wenn sich Invertase-Aktivitäten im Laufe der Zeit ändern, während die Proteinmengen des Enzyms stabil bleiben. Ausgiebige Untersuchungen dazu wurden an TSCC durchgeführt (siehe Kapitel 2.10.1, Seite 31 und 2.10.2, Seite 32). Aber auch bei der Fruchtentwicklung bei Tomate (Husain et al. 2001) und Kirsche

(Krishnan und Pueppke 1990) wurde Ähnliches beobachtet.

Die Schwierigkeit bei der Frage der in vivo Inhibition ist die Tatsache, dass weder Kolokalisation im selben Gewebe und Kompartiment noch eine nachgewiesene in vivo Komplexbildung Beweis genug sind.

Dies wird in den in vitro-Studien zur Inhibition deutlich, die durch viele verschiedene Faktoren beeinflussbar ist (siehe Kapitel 2.10.2, Seite 32). Die Verhältnisse in der TSCC zeigen dies besonders deutlich:

Über die gesamte Kulturperiode werden beide Proteine im Apoplasten detektiert und Komplexe nachgewiesen. Der Inhibitionsstatus ist dadurch aber noch nicht geklärt (Krausgrill et al. 1998).

In den wenigen bisher veröffentlichten transgenen Ansätzen, bei denen die Expression von endogenen

Inhibitoren ausgeschaltet wird, sind auf den ersten Blick keine stark vom Wildtyp abweichenden Phänotypen erkennbar. Dies steht im Kontrast zu den schweren Effekten, die durch Manipulationen an Invertasen häufig verursacht werden (siehe Kapitel 2.6, Seite 17). Eine KO-Mutante von At-C/VIF1 beispielsweise zeigt unter optimalen Wachstumsbedingungen keine Anomalien in Wachstum und Entwicklung

(Link et al. 2004). Jedoch sind um 43% erhöhte VI-Aktivitäten im Blattgewebe messbar. Der Hexosen/Saccharose-Quotient steigt dadurch von 3,7 im Wildtyp auf 4,4. Der scheinbar kleine Effekt wird als signifikant eingestuft, da VIs zwar über die gesamte Blattspreite verteilt, die Inhibitor-Isoform jedoch auf das Leitgewebe beschränkt ist. Da die Invertasen stark auf äußere Faktoren reagieren wird ein stärkerer phänotypischer Einfluss der genetischen Manipulation unter Stressbedingungen erwartet.

2.12 Biotechnologische Bedeutung von Invertase-Inhibitoren

Haben Invertase-Inhibitoren biotechnologisches Potential?

Invertasen besitzen weitreichende Funktionen im pflanzlichen Stoffwechsel und haben Einfluss auf verschiedene Wachstums- und Entwicklungsprozesse (siehe Kapitel 2.6, Seite 17). Gentechnische

Veränderungen in der Expression dieser Enzyme haben daher in vielen Fällen zu starken phänotypischen

Abweichungen bis hin zu enormen Entwicklungsstörungen geführt (siehe Kapitel 2.6, Seite 17). Die

Manipulation an Inhibitoren ist möglicherweise gezielter und greift weniger stark in grundlegende Prozesse ein. Die ersten Experimente mit transgenen Überexprimierern oder antisense-Ansätzen weisen in diese Richtung: Wachstum und Entwicklung weichen nicht in auffälliger Weise ab (siehe Kapitel 2.11.2,

Seite 35).

36

Einleitung

__________________________________________________________________________________________________________________

Manipulation von Erträgen aus sink-Geweben

Invertasen sind wichtige Faktoren bei der Entwicklung von sink-Geweben und der Ausprägung der sink-

Stärke (siehe Kapitel 2.6.2, Seite 19). Über die gezielte Ausschaltung von eventuell vorhandenen endogenen Inhibitoren könnte der Einfluss der Invertasen verstärkt und/oder verlängert werden. Ein dadurch verursachter erhöhter Kohlenhydrateintrag könnte in verschiedenen Arten von Früchten und Speicherorganen Erträge steigern oder die Qualität verbessern. In diesem Zusammenhang ist aber auch speziell die

Entwicklung von Samen interessant, bei deren Entwicklung der große Einfluss von Invertasen bekannt ist

(siehe Kapitel 2.6.2, Seite 19). Tatsächlich konnte in Tabak als experimentelles System durch antisense-

Expression des apoplastischen Inhibitors NtCIF das Gewicht der Samen erhöht werden (Rausch und

Greiner 2004).

Manipulation der Zuckerzusammensetzung

Der Zuckergehalt ist in vielen Fällen ein entscheidendes Kriterium für Fruchtqualität. Aber nicht nur die

Menge, sondern auch die Zusammensetzung spielt dabei eine Rolle. Aus folgenden Gründen ist dabei häufig die Saccharose den Hexosen überlegen: Sie besitzt nur die Hälfte des osmotischen Potentials und ist metabolisch weniger aktiv als die Einfachzucker. Daher kann das Dimer in größerem Umfang gespeichert werden. Für die Einstellung des Hexosen/Saccharose-Quotienten sind häufig Vakuoläre Invertasen verantwortlich (siehe Kapitel 2.6.3, Seite 22). Speziell Inhibitoren der Vakuolären Invertasen bieten daher die Chance einer gentechnischen Verbesserung der Fruchtqualität.

Des Weiteren ist die Zuckerzusammensetzung beim Phänomen des cold sweetening (siehe Kapitel 2.5.8,

Seite 16) relevant. Diese Anhäufung von Hexosen in kalt gelagerten Kartoffeln konnte durch die heterologe Überexpression des vakuolären Inhibitors Nt-VIF aus Tabak stark reduziert werden (Greiner et al.

1999). Dadurch verbräunen die Kartoffelstücke beim Frittieren nicht mehr, was eine entscheidende Qualitätsverbesserung bedeutet. Anzahl und Größe der Knollen sind in den transgenen Pflanzen nicht verändert.

Reduktion von Lagerverlusten

Durch Verwundung bei der Ernte werden in Zuckerrüben Invertasen induziert, die die im Gewebe gespeicherte Saccharose um bis zu 30% reduzieren und so zu enormen Verlusten für die Zuckerindustrie führen.

Nach Rosenkranz et al. (2001) ist dafür in erster Linie eine wundinduzierte VI verantwortlich. In vitro ist diese Isoform durch den vakuolären Inhibitor Nt-VIF aus Tabak hemmbar (Rausch und Greiner 2004).

Die heterologe Überexpression dieses Proteins im Rübengewebe könnte also auch in vivo die Zuckerverluste verringern.

37

Einleitung

__________________________________________________________________________________________________________________

C Z

IELSETZUNG

Gegenstand dieser Arbeit ist der vakuoläre Inhibitor Nt-VIF, der aufgrund seiner Sequenzähnlichkeit als potentielle Isoform zum apoplastischen Inhibitor Nt-CIF kloniert worden war (Greiner 1999). Hinweise auf die Wirksamkeit des in verschiedenen Geweben transkribierten Nt-VIF in der Pflanze lieferte die transgene Überexpression, die zu einer deutlichen Reduktion der Vakuolären Invertasen führt. Dieser

Effekt zeigte sich nicht nur in Tabak, sondern auch im heterologen System Kartoffel, wo durch Nt-VIF die kälteinduzierte Verzuckerung stark vermindert werden konnte (Lauer 1999, Greiner et al. 1999). Die

Funktion dieses biotechnologisch interessanten Proteins sollte daher nach rekombinanter Expression in

Bakterien bestätigt werden. Nachdem in den transgenen Pflanzen ausschließlich die Aktivität der Vakuolären, nicht jedoch der Zellwandinvertasen herabgesetzt worden war, sollte insbesondere untersucht werden, ob Nt-VIF spezifischer auf die Zielenzyme wirkt als die apoplastische Isoform, welche die Invertasen beider Kompartimente gleichermaßen hemmt. Über Punktmutationen und Deletionen sollten einige strukturelle Eigenschaften aufgeklärt, bzw. eine funktionsfähige Minimalform des Inhibitors gefunden werden, die für weitere gentechnische Ansätze interessant sein könnte.

38

Ergebnisse

__________________________________________________________________________________________________________________

3. E

RGEBNISSE

A Ü

BERBLICK

Die im Rahmen dieser Arbeit durchgeführten Experimente sollen hier in einem kurzen Überblick dargestellt werden: Zunächst werden die Klonierungsstrategie und das Verfahren zur renaturierenden Aufreinigung des rekombinanten Volllänge-Proteins Nt-VIF erläutert (Kapitel 3.1). Kapitel 3.2 beschreibt die

Klonierung und Überexpression von Inhibitor-Mutanten. Diese sind entweder N- oder C-terminal deletiert oder enthalten zusätzlich eine Punktmutation vom Cystein zum Serin. Ihre inhibitorische Aktivität ist dadurch unterschiedlich stark beeinträchtigt. In Kapitel 3.3 wird der Redoxstatus des vakuolären Inhibitors untersucht. Wie die apoplastische Isoform wird seine Aktivität durch Reduktion und anschließendes

Erhitzen zerstört. Das so behandelte Protein ist in einer nativen Gelelektrophorese deutlich retardiert. Dies weist auf eine Entfaltung des Proteins hin, was wiederum auf die Existenz von Disulfidbrücken im nativen Protein schließen lässt. Kapitel 3.4 befasst sich mit der Spezifität der beiden Inhibitoren in ihrer Wirkung auf Invertasen. Während Nt-CIF die Isoformen beider Kompartimente gleichermaßen hemmt, wirkt

Nt-VIF ausschließlich auf die Vakuolären Invertasen. Ein chimäres Protein, das jeweils aus der Hälfte von Nt-VIF (N-terminal) und der apoplastischen Isoform (C-terminal) besteht, hemmt ebenfalls nur VIs.

Daher wird der N-Terminus für die Spezifität der Inhibitoren verantwortlich gemacht. In Kapitel 3.5 wird der Nachweis des Proteins Nt-VIF in der Pflanze mit Hilfe eines spezifischen Antiserums erbracht.

Der letzte Abschnitt befasst sich mit den Zielenzymen des Inhibitors Nt-VIF, den Vakuolären Invertasen.

Partielle Sequenzen einer Isoform aus Tabak (Nt-VI) und Kartoffel (St-VI) werden mit Hilfe des RACE-

Verfahrens vervollständigt (Kapitel 3.6). Mit verschiedenen Antiseren, die gegen artfremde Isoformen hergestellt worden waren, werden Fragmente der Nt-VI in verschiedenen Tabak-Geweben detektiert. Die

Aktivitäten der Nt-VI in vegetativen Geweben wird ebenfalls in Kapitel 3.7 gezeigt.

39

Ergebnisse

__________________________________________________________________________________________________________________

B C

HARAKTERISIERUNG EINES VAKUOLÄREN

I

NVERTASE

-

I

NHIBITORS AUS

T

ABAK

3.1 Etablierung eines Verfahrens zur renaturierenden Aufreinigung von rekombinantem Inhibitor-Protein Nt-VIF

3.1.1 Informationen zum Inhibitor-Konstrukt V0

Die Überexpression, Aufreinigung und Renaturierung wurde an dem Nt-VIF Konstrukt V0 etabliert. V0 stellt das potentielle reife Protein in der Pflanze dar. Die Sequenz beginnt 22 Aminosäuren downstream vom Start-Methionin der cDNA-Sequenz. Die ersten 15 Aminosäuren bilden die postulierte ER-Signalsequenz. Weitere 7 Aminosäuren wurden entfernt, um eine dem apoplastischen Inhibitor Nt-CIF entsprechende Startposition zu erreichen. Möglicherweise beinhaltet dieser Abschnitt das Signal für das Targeting in die Vakuole. Diese Deletion hat keinen Einfluss auf die Aktivität des Proteins (Greiner, persönliche Mitteilung). Der C-Terminus wird vom natürlichen Stopcodon bestimmt.

Weitere Modifikationen ergeben sich aus der Verwendung des Vektors pQE-30 (siehe unten): Dadurch werden N-terminal 12 Aminsäuren an das Inhibitor-Protein angefügt, die ein Startcodon, das RGS-His-

Epitop und einen Anteil der MCS enthalten (siehe Abbildung 3.1, Seite 41).

Damit hat das rekombinante Protein eine Länge von 12+150=162 Aminosäuren und ein errechnetes Molekulargewicht von 1,4+16,5=17,9 kDa. Der berechnete Isoelektrische Punkt des Inhibitor-Anteils ohne das N-terminal angefügte Peptid liegt bei pH 5,8.

3.1.2 Die Wahl des Expressionssystems pQE

Zur Überexpression rekombinanter Proteine wurde das pQE-Expressionssystem von Quiagen (Hilden) eingesetzt. Der pQE-Vektor ist mit dem starken Phagenpromotor T5 (PT5) ausgestattet. Über die beiden lac-Operator-Sequenzen kann die Promotoraktivität durch Bindung des lac-Repressors nahezu vollständig inhibiert werden. Bei dem verwendeten E. coli Stamm M15 ist der Repressor auf dem Plasmid pREP4 kodiert. Die Expression des rekombinanten Proteins wird bei entsprechender Bakteriendichte durch Gabe von IPTG induziert.

Nach dem Startcodon und den drei Aminosäurecodons Arginin, Glycin und Serin befindet sich eine Folge von sechs Histidincodons (siehe folgende Abbildung 3.1), die als so genanntes His-Tag die chromatographische Reinigung der rekombinanten Proteins über Ni

2+

-NTA-Agarose ermöglichen. Die

40

Ergebnisse

__________________________________________________________________________________________________________________

Stopcodons downstream der MCS im Vektor wurden nicht genutzt. Jedes Fragment wurde am 3´-Ende mit einem eigenen Stopcodon ausgestattet.

DNA-Sequenz

ATG ATAGGATCT CACCACCACCACCACCAC GGATCC ...............TGA GTCGAC

Protein-Sequenz

M R G S H H H H H H G S Inhibitor Stop

Abbildung 3.1: Aufbau des ORF der rekombinanten Proteine

Startmethionin und das sich anschließende RGS-His-Tag werden vom Vektor pQE30 kodiert. Die spezifische Inhibitor-Sequenz, die mit einem eigenen Stopcodon abschließt, wurde über die Schnittstellen

BamHI und SalI in die MCS des Vektors kloniert.

3.1.3 Überexpression in Bakterien und Renaturierung

Die Expression des rekombinanten Proteins wurde in der logarithmischen Wachstumsphase der Bakterienkultur mit IPTG induziert. Nach 4-6 h wurden die Bakterien geerntet und mit einer French Press aufgeschlossen. Im löslichen Überstand war das rekombinante Protein über SDS-Gelelektrophorese und Coomassie-Färbung nicht nachweisbar. Deshalb wurden die nicht löslichen inclusion bodies, die hauptsächlich aus rekombinantem Protein bestehen, in einem denaturierenden Harnstoffpuffer gelöst. Nach der

Bindung an die Nickel-Affinitätsmatrix wurde auf der Säule renaturiert. Bei der Zusammensetzung des

Renaturierungspuffers wurde insbesondere auf stabilisierende Eigenschaften geachtet, die die korrekte

Proteinfaltung fördern. Mit HEPES als Puffer wurde eine kationische Substanz verwendet. Der Inhibitor mit einem vorausgesagten pI von 5,8 ist bei pH 7,5 anionisch. Daher ist eine Stabilisierung durch ionische

Wechselwirkung zwischen Inhibitor und Puffersubstanz denkbar. HEPES vermittelt außerdem durch seine amphoteren Eigenschaften die Löslichkeit denaturierter Proteine (Cosolvent). Die gleiche Funktion erfüllt das Detergenz Tween 20, welches zu diesem Zweck jedoch nur in sehr niedrigen Konzentrationen eingesetzt wird (hier: 0,005 %). Verschiedene Ionen dienen außerdem zur Stabilisierung: 100 mM KCl, 2 mM MgCl, 150 mM NaCl. 1994 wiesen Weil et al. den Einfluss von Ionen auf die Stabilität nach. Bereits zu Beginn der Arbeit wurde dem Redoxstatus von Invertase-Inhibitoren große Bedeutung beigemessen.

Zum einen sind in allen bisher bekannten Invertase-Inhibitoren 4 Cysteine konserviert. Darüber hinaus wurde für den apoplastischen Inhibitor gezeigt, dass nur die oxidierte Form inhibitorisch aktiv ist (Greiner

1999). Daher diente Glutathion in seiner oxidierten (GSSG) und reduzierten (GSH) Form als Redoxvermittler (Fischer 1994, Suenaga et al. 1998). Mit Hilfe der freien Sulfhydrylgruppe im GSH können Disulfidbrücken im Protein immer wieder neu geknüpft und gelöst werden, bis der energetisch günstigste Zustand der Proteinfaltung erreicht ist. Bei dem verwendeten Verhältnis GSH:GSSG von 1:2 liegt das

Gleichgewicht zugunsten der Disulfidbindung. Der Proteaseinhibitor PMSF schützt das rekombinante

Protein vor dem Abbau.

41

Ergebnisse

__________________________________________________________________________________________________________________

3.2 Inhibitor-Mutanten

3.2.1 Klonierung der Inhibitor-Mutanten

Mit Hilfe der Inhibitor-Mutanten sollte geklärt werden, ob es eine Minimalform eines noch aktiven Inhibitors gibt, die kleiner ist als die natürliche Form, indem N- und C-Terminus schrittweise deletiert wurden. Außerdem wurden Punktmutationen eingeführt, die zu einem Aminosäureaustausch von Cystein nach Serin führen. Die chemischen Eigenschaften dieser Aminosäuren sind so ähnlich, dass ein Austausch kaum zu Unterschieden bei den schwachen Wechselwirkungen im Protein führen wird. Die Fähigkeit zur Disulfidbrückenbildung geht jedoch verloren. Durch diesen Aminosäureaustausch gewinnt man also Informationen darüber, welche Bedeutung Disulfidbrücken für die Struktur des aktiven Inhibitor-

Proteins haben.

Die DNA-Fragmente wurden mittels PCR aus der Nt-VIF cDNA amplifiziert. Die linken Primer wurden so gewählt, dass die Sequenz im Leseraster des vektoriellen Start-Methionins liegt. Für die 3’-seitig deletierten Klone wurden die rechten Primer mit einem Stopcodon ausgestattet. Über die Restriktionsschnittstellen (5’-seitig: BamH1; 3’-seitig: SalI) im Überhang der Primer konnten die Fragmente direktional in den Vektor pQE30 (Quiagen, Hilden) kloniert werden.

Die einzelnen Inhibitor-Konstrukte sind in Abbildung 3.2 schematisch dargestellt.

V0

V1

V2

V3

V4

V9

V10

C C

C C

S C

C

S

C C

C C

C

C

C

C

C

C

C

C

C

C

C

C

C

S

V11

C C C C

V12

C C C C

Abbildung 3.2: Schematische Darstellung der Inhibitor-Mutanten

V0 stellt das vollständige reife Protein dar. Das Protein besitzt 4 Cysteinreste, deren Positionen mit C gekennzeichnet sind. Die anderen Konstrukte sind entsprechend verkürzt. Außerdem sind die Mutationen vom Cystein zum Serin S eingezeichnet.

42

Ergebnisse

__________________________________________________________________________________________________________________

3.2.2 Überexpression und Aufreinigung der rekombinanten Proteine

Die rekombinanten Proteine stehen im Vektor pQE30 unter der Kontrolle des Lac-Promotors. Ihre Expression wurde in der logarithmischen Wachstumsphase der Bakterienkultur mit dem Lactose-Derivat

IPTG induziert und die Bakterien nach 4-6stündiger Inkubation geerntet. Über ein SDS-Gel wurde das

Gesamtprotein aufgetrennt.

Abbildung 3.3: Überexpression der Inhibitor-Mutanten V1, V3 und V9, SDS-Gel nach Coomassie-

Färbung

Aufgetragen ist das Gesamtprotein aus 50 µl Bakterienkultur nach Induktion der Genexpression und

5stündiger Inkubation

Die Abbildung zeigt, dass die Bakterien nach Induktion der Expression innerhalb einiger Stunden eine große Menge an rekombinantem Protein produzieren. Die unterschiedliche Größe der Mutanten spiegelt sich im Laufverhalten der Proteine wieder.

3.2.3 Elutionsprofil der Inhibitor-Proteine

Nach der renaturierenden Affinitätsreinigung über eine Nickel-Affinitäts-Säule (siehe Kapitel 3.1.3 Seite

41) wurden die löslichen rekombinanten Proteine in bis zu zehn Elutionsfraktionen von je einem

Säulenvolumen gesammelt. Um einen Anhaltspunkt über die eluierten Proteinmengen zu erhalten, wurde ein Aliquot jeder Fraktion wurde auf einem SDS-Gel aufgetrennt und anschließend mit Coomassie-Blau sichtbar gemacht.

43

Ergebnisse

__________________________________________________________________________________________________________________

250

148

60

1 2 3 4 5 6 7 8 9

42

30

22

17

Abbildung 3.4: SDS-PAGE aller Elutionsfraktionen des Inhibitor-Konstrukts V0

Von jeder renaturierten Elutionsfraktion (Nummern 1-9) wurden 50 µl in einer SDS-PAGE aufgetrennt und anschließend mit Coomassie sichtbar gemacht. Links sind die Größen des Proteinstandards (LMW) in kD angegeben.

Abbildung 3.4 zeigt, dass die Konzentration des rekombinanten Proteins in den ersten drei

Elutionsfraktionen am größten ist. Anschließend wurden die inhibitorischen Aktivitäten auf die Nt-VI der einzelnen Elutionsfraktionen bestimmt, wie in folgender Abbildung für Konstrukt V0 beispielhaft dargestellt ist.

160

140

120

100

80

60

40

20

0

1 2 3 4 5

Elutionsfraktionen

6 7 8 9

Abbildung 3.5: Relative Aktivität der einzelnen Elutions-Fraktionen von V0

Die inhibitorische Aktivität von jeweils 50 µl der Elutionsfraktionen wurde in einem Aktivitätsassay mit

Nt-VI ermittelt. Dargestellt sind die relativen Aktivitäten bezogen auf den Kontrollansatz ohne Inhibitor-

Protein, dessen Aktivität 53 pkat betrug.

Die einzelnen Elutionsfraktionen unterscheiden sich deutlich in ihrer Aktivität, wie hier beispielhaft anhand des Konstrukts V0 gezeigt ist. Obwohl die Proteinmengen der Fraktionen 1-3 (siehe Abbildung 3.4

Seite 44) vergleichbar sind, ist Fraktion 1 überhaupt nicht inhibitorisch aktiv, während die Fraktionen 2 und 3 eine nahezu vollständige Hemmung der Invertase bewirken. Fraktion 4 inhibiert wiederum nur auf etwa 90 % Restaktivität, hier wurden außerdem wesentlich geringere Proteinmengen eluiert. Alle anderen

44

Ergebnisse

__________________________________________________________________________________________________________________

Fraktionen haben keinen inhibitorischen Einfluss auf die Invertase Nt-VI. Manche bewirken sogar eine

Aktivierung der Invertase. Dieses Phänomen wurde näher untersucht (siehe Kapitel 0, Seite 50).

Das Profil der Proteinmengen und Aktivität der einzelnen Elutionsfraktionen ist repräsentativ für alle anderen Konstrukte. Falls eine inhibitorische Aktivität vorhanden ist, ist diese Fraktion 2 am stärksten

(Originaldaten im Anhang, siehe Abbildung 7.2). Fraktion 2 enthält demnach neben der größten Proteinmenge auch die meiste Aktivität. Weitergehende Experimente wurden daher bei allen Konstrukten mit

Elutionsfraktion 2 durchgeführt.

3.2.4 Konzentrationsbestimmung der rekombinanten Proteine

Die Proteinkonzentration der renaturierten Inhibitor-Lösungen wurde nach Bradford ermittelt (Bradford

1976, Holbrook und Leaver 1976). Bei dieser Methode wird die Entstehung eines Farbstoff-Protein-

Komplexes photometrisch bestimmt und mit einer Eichgerade verglichen, die mit einer BSA-Verdünnungsreihe erstellt wurde.

Inhibitor- kon-

Standard- abweichung

Abbildung 3.6: Proteinkonzentration der Inhibitor-Mutanten (Elutionsfraktion 2) nach Bradford

Die Werte sind errechnet aus 3 unabhängigen Messungen (bei V3 und V4 Einfachmessung aufgrund der geringen Proteinmenge).

Originalwerte im Anhang (siehe Abbildung 7.1)

Die Konzentrationen der renaturierten rekombinanten Proteine sind sehr unterschiedlich. Sie schwanken zwischen 2 und 451 ng Protein pro µl.

45

Ergebnisse

__________________________________________________________________________________________________________________

3.2.5 Die Mutationen ändern den Einfluss der Inhibitoren auf die VI

Die Mutanten wurden hinsichtlich ihrer Inhibitionsfähigkeit gegenüber einer Präparation der Nt-VI untersucht (Abbildung 3.7). Außerdem wurde für einzelne Konstrukte die Dosisabhängigkeit der Inhibition bestimmt (Abbildung 3.8, Seite 47).

140

120

100

100

111

127

139

140

84

80

60

40

20

17

6

2

0 ohne Inh V0 V1 V2 V3 V9 V10 V11 V12

Abbildung 3.7: Aktivitäten der Inhibitor-Proteine im Vergleich zur Nullkontrolle

Alle Werte sind als prozentualer Anteil von der Aktivität des Ansatzes ohne Inhibitor angegeben. Die

Zahlen über den Balken geben den genauen Wert an. Die eingesetzte Invertaseaktivität betrug jeweils

90 pkat. Von allen Inhibitoren wurden jeweils 2 µg Protein (Elutionsfraktion 2) eingesetzt.

Konstrukt V4 konnte wegen zu geringer Konzentration nicht reproduziert werden und ist daher nicht in die

Abbildung aufgenommen. ohne Inh: ohne Inhibitor

V0 etc.: verschiedene Inhibitor-Konstrukte (siehe Abbildung 3.2)

Originalwerte im Anhang (siehe Abbildung 7.3)

Die Abbildung zeigt die unterschiedliche Inhibitionsfähigkeit der Mutanten: Das Volllängekonstrukt V0 und das Konstrukt V11, das C-terminal um 18 Aminosäuren kürzer ist als V0, inhibieren die Invertase

Nt-VI nahezu vollständig. Eine N-terminale Verkürzung des Inhibitors um 5 Aminosäuren bis kurz vor das erste Cystein schränkt die Inhibitionsfähigkeit nur geringfügig ein: statt auf 6 % wie durch V0 wird

Nt-VI durch V1 nur noch auf 17 % gehemmt. Abbildung 3.8 zeigt kaum einen Unterschied im Verlauf der

Inhibitionskurve.

Zu einer deutlichen Abnahme der Inhibitionsfähigkeit kommt es durch die Mutation des ersten Cysteins zum Serin (C8S), wie sie in Konstrukt V2 vorliegt. Die Invertase ist noch zu 84 % aktiv. Der Kurvenverlauf von V2 unterscheidet sich deutlicher von Konstrukt V0 als V1.

V3 ist N-terminal stärker verkürzt als V1. Hier sind 14 statt 5 Aminosäuren deletiert. Das Konstrukt beginnt erst mit dem zweiten Cystein (C17). Die Inhibitionsfähigkeit geht dadurch völlig verloren. Es ist

46

Ergebnisse

__________________________________________________________________________________________________________________ eine leichte Aktivierung der Invertase zu verzeichnen (Abbildung 3.7: 111 %). Eine Inhibition ist auch durch Erhöhung der Proteinkonzentration nicht zu erreichen (Abbildung 3.8). Die Werte betragen immer rund 100 %. Sehr ähnlich verhält sich das Konstrukt V4, das sich von V3 durch die Mutation des Cysteins

(C17S) unterscheidet. Hier ist die Aktivierung noch stärker (Abbildung 3.8).

140

120

100

80

60

40

20

V0

V1

V2

V3

V4

0

0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 4,0 4,5 5,0

µg Protein

Abbildung 3.8: Dosisabhängigkeit der Inhibition bei V0 und den Mutanten V1, V2, V3 und V4

Die Nt-VI wurde mit verschiedenen Mengen der rekombinanten Inhibitoren inkubiert. Die Aktivität ist als prozentualer Anteil des Ansatzes ohne Inhibitor dargestellt. Die Ausgangsaktivitäten betrugen 165 pkat

(V0), bzw. 111 pkat (alle anderen Konstrukte).

Originaldaten im Anhang (siehe Abbildung 7.4)

Auch auf eine C-terminale Verkürzung reagiert Nt-CIF stufenweise mit Verlust der Aktivität: Während bei V11 18 Aminosäuren noch ohne Einfluss auf die Inhibitionsfähigkeit bleiben, führt die Deletion direkt nach dem letzten Cystein (33 Aminosäuren) zum völligen Aktivitätsverlust. Das ist bei den Konstrukten

V9 und V12 der Fall, welches zudem noch N-terminal bis zum ersten Cystein deletiert wurde, sowie bei

Konstrukt V10, das sich von V9 durch die Mutation des letzten Cystein unterscheidet.

47

Ergebnisse

__________________________________________________________________________________________________________________

3.3 Redoxstatus des Inhibitors

3.3.1 Reduktives Erhitzen zerstört die Aktivität von Nt-VIF

Für die apoplastische Isoform des vakuolären Inhibitors konnte bereits gezeigt werden, dass die Reduktion des Proteins zu einer starken Verminderung der inhibitorischen Aktivität führt. Außerdem wird dadurch die Mobilität des Proteins in einer nicht reduzierenden SDS-PAGE verringert. Eine oxidative Behandlung dagegen ändert weder das Laufverhalten, noch die Aktivität des Proteins (Greiner 1999). Nachdem der vakuoläre Inhibitor, wie alle unter der Genfamilie der Invertase-Inhibitoren zusammengefassten

Gene, die gleiche Zahl und Anordnung der Cysteine besitzt, wird für das vakuoläre Protein ein ähnliches

Verhalten erwartet.

Das rekombinante Protein V0, welches die potentielle reife Form des vakuolären Inhibitors in der Pflanze darstellt, wurde zur Reduktion zunächst auf pH 7 gebracht und mit DTT versetzt (Endkonzentration

4 mM). Die Inkubation erfolgte bei Raumtemperatur oder bei 65

°C für 10 min und wurde durch einen pH-Sprung auf pH 4,7 abgestoppt. Alternativ wurde V0 durch

β-Mercaptoethanol im reduzierenden Auftragspuffer reduziert.

Die beiden Redoxstadien des Inhibitors V0 wurden im Hinblick auf ihre Aktivität (Abbildung 3.9

Seite 48) sowie auf ihr Laufverhalten in einer nicht reduzierenden SDS-PAGE mit anschließendem

Western Blot miteinander verglichen (Abbildung 3.10).

160

140

120

100

80

60

40 ohne DTT mit DTT

145

145

20

0

RT 65 °C

Abbildung 3.9: Einfluss von Reduktion und Wärmebehandlung auf die Aktivität des Inhibitors V0

Der vakuoläre Inhibitor Nt-VIF (Volllänge-Konstrukt V0, je 1,5 µg

)

wurde bei pH 7 mit 4 mM DTT behandelt und bei Raumtemperatur (RT) oder 65

°C inkubiert. Anschließend wurden die Ansätze wieder auf pH

4,7 gebracht und ihre inhibitorische Aktivität gegenüber der Vakuolären Invertase Nt-VI bestimmt.

Die Zahlen über den Balken geben den prozentualen Anteil an der Ausgangsaktivität von 124 pkat an.

Originalwerte im Anhang (siehe Abbildung 7.5)

48

Ergebnisse

__________________________________________________________________________________________________________________ unbehandelt

DTT beta M

30

22

17

6

Abbildung 3.10: Western Blot nach Reduktion des vakuolären Inhibitors

Der rekombinante Inhibitor V0 wurde durch DTT oder durch

βM-haltigen Auftragspuffer reduziert und im

Vergleich zu nicht behandeltem Protein auf einem nicht reduzierenden SDS-PAG (20 % PAA) aufgetrennt. Die Western-Membran wurde mit dem affinitätsgereinigten Antiserum

αNt-VIF 1:100 (siehe Kapitel

3.5.1, Seite 54) inkubiert. Die Größen der Markerproteine sind in kD angegeben.

Spur 1: V0 unbehandelt

Spur 2: V0 ohne DTT bei RT im Reduktionsassay inkubiert

Spur 3: V0 mit DTT bei 65

°C inkubiert

Spur 4: V0 mit reduzierendem Auftragspuffer (enthält

β-Mercaptoethanol)

Der rekombinante Inhibitor V0 verliert nach Reduktion durch DTT seine inhibitorische Aktivität, wenn bei einer Temperatur von 65°C inkubiert wird (Abbildung 3.9). Statt einer Reduktion überschreitet die gemessene Invertaseaktivität nach dieser Behandlung die Ausgangsaktivität um 45 %. Die Wärmebehandlung allein führt nur zu einer kleinen Einbuße der inhibitorischen Aktivität: von rund 5 % durch das nicht behandelte Protein erhöht sich die Restaktivität der Invertase auf 18 %.

Nach Reduktion und Wärmebehandlung verliert das Inhibitor-Protein außerdem deutlich an Mobilität im

Gel (siehe Abbildung 3.10 oben). Dabei wirken DTT und

β-Mercaptoethanol gleichermaßen, ein Zeichen dafür, dass allein der reduzierende Charakter der Reagenzien ausschlaggebend ist. Unter Assaybedingungen ohne reduzierendes Agens wird kein Effekt erzielt.

Diese Ergebnisse legen die Existenz von Disulfidbrücken im Inhibitor-Molekül nahe. Sie stabilisieren die aktive Konformation des Inhibitors und werden durch Reduktion zerstört. Die Wärmebehandlung beschleunigt anschließend die Entfaltung des Moleküls, die zum Aktivitätsverlust des Inhibitors führt. Nach der Entfaltung liegt das Protein in einem offenkettigen Zustand vor, bei dem mehr Epitope für das polyklonale Antiserum zugänglich sind. Man beobachtet daher ein stärkeres Immunosignal nach Reduktion, obwohl die Proteinmengen identisch sind (siehe Abbildung 3.10).

49

Ergebnisse

__________________________________________________________________________________________________________________

3.3.2 Aktivierende Inhibitoren sind nicht zwangsläufig reduziert

In Abschnitt 3.3.1 wurde gezeigt, dass der Volllänge-Inhibitor V0 nach Reduktion nicht mehr inhibitorisch aktiv ist, sondern im Gegenteil eine Aktivierung der VI-Präparation bewirkt. Die Aktivierung von

Invertasen durch rekombinante Inhibitoren ist im Rahmen dieser Arbeit mehrfach beobachtet worden.

Verschiedene Inhibitor-Mutanten zeigen dieses Phänomen (siehe Kapitel 3.2.5 Seite 50). Außerdem unterscheiden sich die späten Elutionsfraktionen nach der Affinitätsreinigung dadurch von den ersten, dass sie nicht inhibierend, sondern aktivierend wirken (siehe Abbildung 3.5 Seite 44). Hier soll der Frage nachgegangen werden, ob sich die Proteine V0 aus der zweiten (inhibierenden) und der siebten (aktivierenden) Fraktion bezüglich ihres Redoxzustands unterscheiden.

Abbildung 3.11: Redoxzustand des Inhibitors V0 aus verschiedenen Elutionsfraktionen

Die zweite (inhibierende) Elutionsfraktion E2 und die siebte (aktivierende) Fraktion E7 einer renaturierenden V0-Aufreinigung wurden im nicht behandelten Zustand und mit DTT reduziert auf ein nicht reduzierendes 20%iges PAA-Gel geladen. Die geblottete Membran des Gels wurde mit affinitätsgereinigtem

Antiserum

αNt-VIF 1:100 detektiert.

Das Inhibitor-Protein aus der Elutionsfraktion E7 verhält sich in der nicht reduzierenden Gelelektrophorese wie das Protein aus Fraktion E2: Es ist nach derselben Laufstrecke detektierbar. Beide sind auch nach der Reduktion mit DTT in gleichem Maße retardiert. Die Proteine haben also denselben Redoxzustand. Ihr unterschiedliches Elutionsverhalten von der Affinitätsmatrix kann daher nicht im Redoxzustand begründet liegen.

50

Ergebnisse

__________________________________________________________________________________________________________________

3.4 Spezifität der Inhibitoren

3.4.1 Nt-VIF, Nt-CIF und ihre Wirkung auf Invertasen

Beide bisher aus Tabak bekannten Inhibitoren sind rekombinant als funktionsfähige Proteine verfügbar:

Nt-CIF, der im Apoplasten lokalisiert ist, und Nt-VIF in der Vakuole. Die Inhibitionsfähigkeit von Nt-CIF wurde bereits mit Zellwandinvertasen aus verschiedenen Spezies ermittelt (Greiner 1999). In allen Fällen wurde eine vollständige Inhibition beobachtet, das Phänomen der Substratschützbarkeit jedoch nur im

Zusammenhang mit der CWI-Präparation aus der eigenen Spezies. Darüber hinaus wurde eine VI aus

Tomate (Le-VI) vollständig inhibiert. Auch diese wurde nicht durch Saccharose vor der Inhibition geschützt.

Es stellte sich demnach die Frage, inwieweit der rekombinante vakuoläre Inhibitor Nt-VIF in der Lage ist, andere Invertasen als die Nt-VI zu inhibieren, insbesondere die Isoform aus der Zellwand, und ob das

Substrat Saccharose vor der Inhibition schützen kann. Im Vergleich dazu wurden alle Messungen auch mit dem apoplastischen Inhibitor durchgeführt. Die Invertasen wurden zum einen aus Tabakblättern isoliert (vakuoläre Präparation Nt-VI), zum anderen aus Kallussuspensionskulturen (apoplastische Präparation Nt-CWI, zur Verfügung gestellt von S. Grsic-Rausch).

200

Vakuoläre Invertase Nt-VI

128

100

66

A0

A0 mit Vorinkubation

V0

0

0,0 1,0 2,0 3,0

µg rekombinantes Protein

4,0 5,0 9,5 10,0

Abbildung 3.12: Inhibitorische Aktivität der rekombinanten Inhibitoren Nt-CIF und Nt-VIF auf eine

VI-Präparation aus Tabak Nt-VI

Vorinkubation: 1 h Vorinkubation unter Assaybedingungen, jedoch ohne Saccharose

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF

V0: Volllänge-Konstrukt des vakuolären Inhibitors Nt-VIF

Originalwerte im Anhang (siehe Abbildungen 7.4 und 7.6)

51

Ergebnisse

__________________________________________________________________________________________________________________

Die inhibitorische Wirkung des apoplastischen Nt-CIF auf die Vakuoläre Invertase Nt-VI ist vergleichbar mit der des vakuolären Inhibitors Nt-VIF. Die Hemmung durch Inhibitor Nt-CIF ist sogar stärker als durch den vakuolären Inhibitor. Beispielsweise wird die Aktivität der VI durch 0,2 µg Nt-VIF von zunächst etwa 155 pkat auf 128 pkat herabgesetzt, durch dieselbe Menge Nt-CIF auf 66 pkat. Bemerkenswert ist außerdem, dass der apoplastische Inhibitor Nt-CIF nicht auf eine Vorinkubation ohne Substrat angewiesen ist. Auch im homologen System wird damit bestätigt, dass dieses Phänomen nicht vom Inhibitor, sondern von der Invertase abhängig ist (s.o.).

40

30

20

10

Zellwandinvertase Nt-CWI

A0

A0 mit Vorinkubation

V0

V0 mit Vorinkubation

0

0,0 1,0 2,0 3,0

µg rekombinantes Protein

4,0 5,0 9,5 10,0

Abbildung 3.13: Inhibitorische Aktivität der rekombinant erzeugten Inhibitoren Nt-CIF und Nt-VIF auf die Zellwandinvertase Nt-CWI

Vorinkubation: 1 h Vorinkubation unter Assaybedingungen, jedoch ohne Saccharose

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF

V0: Volllänge-Konstrukt des vakuolären Inhibitors Nt-VIF

Originalwerte im Anhang (siehe Abbildung 7.7)

Ein deutlicher Unterschied besteht zwischen der Wirkung der beiden Inhibitoren auf die Zellwandinvertase aus Tabak. Der apoplastische Inhibitor Nt-CIF hemmt diese vollständig, vorausgesetzt der Assay wurde ohne Substrat vorinkubiert. Die vakuoläre Isoform inhibiert die Zellwandinvertase überhaupt nicht.

Dabei spielt es keine Rolle, ob ohne Saccharose vorinkubiert wurde oder nicht.

3.4.2 Inhibitor-Chimären

In Kapitel 3.7.1 wird deutlich, dass die Inhibitoren Nt-CIF und Nt-VIF unterschiedlich auf Invertasen reagieren, insbesondere auf die Zellwandinvertase. Um zu testen, ob die Grundlage für die Spezifität im

N- oder C-terminalen Abschnitt des Proteins zu suchen ist, wurden die Hälften der beiden Inhibitoren wechselseitig miteinander kombiniert und folgendermaßen bezeichnet: VIF(N)::CIF(C) für die Chimäre aus dem N-terminalen Anteil von Nt-VIF und dem C-terminalen Anteil von Nt-CIF, bzw. CIF(N)::VIF(C) entsprechend umgekehrt. Diese so genannten Chimären wurden in Bakterien überexprimiert und renatu-

52

Ergebnisse

__________________________________________________________________________________________________________________ rierend aufgereinigt (siehe Kapitel 3.3.3 Seite 46). Die Konzentration der Proteinlösungen wurde nach

Bradford und die inhibitorische Aktivität auf verschiedene Invertasen bestimmt.

200

100

Vakuoläre Invertase Nt-VI

A0

A0 mit Vorinkubation

V0

VIF(N)::CIF(C)

CIF(N)::VIF(C)

0

0,0 1,0 2,0 3,0

µg rekombinantes Protein

4,0 5,0 9,5 10,0

Abbildung 3.14: Wirkung der Inhibitor-Chimären auf die Vakuoläre Invertase Nt-VI

Diese Abbildung enthält zusätzlich alle Plots aus Abbildung 3.12.Die Aktivitätswerte in pkat geben die

Gesamtaktivität der Invertase in einem Messansatz wieder.

Vorinkubation: 1 h Vorinkubation unter Assaybedingungen, jedoch ohne Saccharose

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF

V0: Volllänge-Konstrukt des vakuolären Inhibitors Nt-VIF

VIF(N)::CIF(C), CIF(N)::VIF(C): rekombinante Inhibitor-Chimären

Originalwerte im Anhang (siehe Abbildungen 7.4 und 7.6)

40

Zellwandinvertase Nt-CWI

30

20

10

A0

A0 mit Vorinkubation

V0

V0 mit Vorinkubation

VIF(N)::CIF(C) mit Vorinkubation

CIF(N)::VIF(C) mit Vorinkubation

0

0,0 1,0 2,0 3,0

µg rekombinantes Protein

4,0 5,0 9,5 10,0

Abbildung 3.15: Wirkung der Inhibitor-Chimären auf die Zellwandinvertase Nt-CWI

Diese Abbildung enthält zusätzlich alle Plots aus Abbildung 3.13. Die Aktivitätswerte in pkat geben die

Gesamtaktivität der Invertase in einem Messansatz wieder.

Vorinkubation: 1 h Vorinkubation unter Assaybedingungen, jedoch ohne Saccharose

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF

V0: Volllänge-Konstrukt des vakuolären Inhibitors Nt-VIF

VIF(N)::CIF(C), CIF(N)::VIF(C): rekombinante Inhibitor-Chimären

Originalwerte im Anhang (siehe Abbildung 7.7)

53

Ergebnisse

__________________________________________________________________________________________________________________

Die Chimäre VIF(N)::CIF(C) zeigt dasselbe Verhalten wie der vakuoläre Inhibitor Nt-VIF, sowohl in

Verbindung mit der Vakuolären, als auch mit der Zellwandinvertase: Wie durch Nt-VIF wird durch

VIF(N)::CIF(C) die Invertase Nt-VI ohne Vorinkubation vollständig gehemmt. Die Inhibitionskurven sind identisch (Abbildung 3.14). Die Zellwandinvertase lässt sich weder durch Nt-VIF noch durch die

Chimäre VIF(N)::CIF(C) hemmen (Abbildung 3.15). Daraus kann man schließen, dass in der

N-terminalen Hälfte des Proteins, die der Sequenz des vakuolären Inhibitors Nt-VIF entspricht, Eigenschaften liegen, die für die Spezifität des Proteins verantwortlich sind. Die C-terminale Hälfte alleine

übermittelt dagegen nicht die speziellen Eigenschaften des apoplastischen Inhibitors: es ist keine Hemmung der Nt-CWI zu verzeichnen.

Die Chimäre CIF(N)::VIF(C) hat überhaupt keine inhibitorische Aktivität, weder auf die Vakuoläre noch die Zellwandinvertase.

3.5 Nachweis des Inhibitor-Proteins

3.5.1 Affinitätsreinigung des Antiserums

Das polyklonale Antiserum gegen Nt-VIF – künftig als

αNt-VIF bezeichnet - wurde gegen ein Fusionsprotein von Nt-VIF mit Thioredoxin hergestellt (Greiner, S. 1999).

Im Western Blot zeigt dieses Antiserum verschiedene unspezifische Kreuzreaktionen. In Abbildung 3.16

A ist eine Verdünnungsreihe des rekombinanten Proteins V0 gezeigt, die mit

αNt-VIF detektiert wurde.

Die Proteinbanden sind wegen des starken Hintergrunds schwer zu erkennen. Außerdem werden verschiedene bakterielle Proteine mit nahezu gleicher Signalstärke erkannt. Letzteres ändert sich auch nicht, wenn die Konzentration des Antiserums herabgesetzt wird (Ergebnisse nicht gezeigt). Bei über ConA gereinigten Pflanzenextrakten finden sich ebenso viele unspezifische Banden (siehe Abbildung 3.17 A,

Seite 56).

Daher wurde das Antiserum gegen das rekombinante Protein Nt-VIF gereinigt. Dieses wurde zunächst

über SDS-PAGE von anderen bakteriellen Proteinen getrennt, die bei der Immunisierung zur Bildung unspezifischer Antikörper hatten führen können.

54

Ergebnisse

__________________________________________________________________________________________________________________

Abbildung 3.16: Effekt der Affinitätsreinigung des Antiserums αNt-VIF im Western Blot

Eine Verdünnungsreihe des rekombinanten Inhibitors V0 mit 10, 5, 1 und 0,1 ng Protein wurde mit dem

Antiserum αNt-VIF vor (Abbildung A) und nach Affinitätsreinigung gegen V0 (Abbildung B) detektiert.

Beide Antiseren wurden in einer Endverdünnung von 1:100 eingesetzt. Der Doppelpfeil markiert die

Bande des rekombinanten Inhibitors. Die Größen der Markerproteine sind in kD angegeben (links).

Nach der Affinitätsreinigung zeigt das Antiserum eine höhere Spezifität gegenüber dem Inhibitor-Protein.

Die Kreuzreaktionen mit bakteriellen Proteinen sind nach der Affinitätsreinigung schwächer ausgeprägt als die Reaktion mit dem rekombinanten Inhibitor-Protein. Außerdem konnte der starke Hintergrund reduziert werden. Das Antiserum ist jedoch nach der Affinitätsreinigung etwa zehnmal weniger sensitiv.

Das ungereinigte Antiserum erkennt noch 0,1 ng rekombinantes Protein, das affinitätsgereinigte minimal

1 ng.

Der rekombinante Inhibitor V0 hat in der SDS-PAGE eine apparente Größe von etwa 20 kD.

3.5.2 Der vakuoläre Inhibitor in planta

In Proteinrohextrakten mit einem Äquivalent von bis zu 40 mg Frischgewebe konnte mit dem Antiserum

αNt-VIF (siehe oben) kein spezifisches Signal erzielt werden, und zwar weder in den Geweben Blatt im

source Status noch im Internodium oder Wurzel (Daten nicht gezeigt). Daher wurde die Detektion des

Proteins zunächst in Nt-VIF Überexprimierern versucht, bei denen gegenüber dem Wildtyp die

Transkriptmengen stark erhöht und die VI-Aktivitäten deutlich herabgesetzt sind (Lauer 1999). Auch hier konnte der Inhibitor im Rohextrakt aus Blättern jedoch nicht eindeutig nachgewiesen werden (nicht gezeigt). Die Rohextrakte wurden deshalb über eine ConA-Matrix gereinigt, die alle glykosylierten Proteine bindet. Das führt zu einer Anreicherung der VI-Inhibitor-Komplexe. Durch die Reduktion der Proteinmenge soll zum einen die Auftrennung im Gel verbessert, zum anderen eine potentielle Überlagerung des

Inhibitors durch ähnlich große Proteine verhindert werden.

55

Ergebnisse

__________________________________________________________________________________________________________________

Abbildung 3.17: Nachweis des vakuolären Inhibitors in Nt-VIF Überexprimierern vor und nach

Affinitätsreinigung des Antiserums

Aufgetragen ist jeweils das Äquivalent von 200 mg Blattgewebe nach Reinigung über ConA-Chromatographie.

WT5, WT6: nicht transformierte Wildtyp-Pflanzen

S33-4, S33-7: Pflanzen der transgenen Überexprimierer-Linie #33

S39-2: Pflanze der transgenen Überexprimierer-Linie #39

In den Blättern der Nt-VIF Überexprimierer wird mit dem affinitätsgereinigten Antiserum

αNt-VIF ein

Protein mit einer apparenten Größe von etwa 10 kD detektiert. Im Wildtyp ist dagegen kein Signal zu beobachten.

C V

AKUOLÄRE

I

NVERTASEN DER

S

OLANACEEN

3.6 Vervollständigung der cDNAs von VIs aus Tabak und Kartoffel

Partielle Klone von zwei Vakuolären Invertasen aus Tabak (Nt-VI) und Kartoffel (St-VI) standen bereits zu Beginn der Arbeit zur Verfügung (Sonnewald und Herbers unveröffentlicht). Die abgeleiteten Proteinsequenzen der VIs waren im Vergleich zu homologen Invertasen aus anderen Solanaceen (siehe Kapitel

4.5) N-terminal um einige Aminosäuren verkürzt. Außerdem begannen sie nicht mit einem Methionin und eine 5´-UTR fehlte völlig. Daraus wurde geschlossen, dass sie 5´-seitig nicht der kompletten mRNA der

Invertasen entsprechen. Bei der Nt-VI endete die abgeleitete Proteinsequenz darüber hinaus C-terminal etwa 70 Aminosäuren vor anderen VIs, während die nachfolgende Sequenz auf Proteinebene über 90 %

56

Ergebnisse

__________________________________________________________________________________________________________________ identisch war. Die neue Amplifizierung sollte aufklären, ob die Proteinsequenz der Nt-VI tatsächlich an dieser Stelle endet oder das Stopcodon der partiellen Sequenz an dieser Stelle fehlerhaft ist.

Die Sequenzen wurden mittels RNA-Ligase-vermittelter RACE-Technik vervollständigt. Das hier verwendete Verfahren (GeneRacer Kit, Invitrogen) ist speziell auf die Gewinnung vollständiger 5´-Enden ausgelegt, da ausschließlich mRNAs mit 7-Methylguanosin-Cap zur Amplifizierung gelangen. Für beide

Invertasen wurde das RACE für das 5`-Ende durchgeführt, bei der Nt-VI wurde auch die 3´-seitige Sequenz aufgeklärt. Die Sequenzen sind im Anhang aufgeführt (siehe Abbildungen 7.8-7.10).

Das RACE-Fragment im 5´-Bereich der Nt-VI hat eine Länge von 430 Basen (siehe Anhang, Abbildung

7.8). Davon überlappen 379 Basen mit der partiellen cDNA-Sequenz der Nt-VI, die zu 100 % mit dieser

übereinstimmen. Die durch das Race-Verfahren gewonnenen 51 Basen enthalten ein Methionin-Codon, das mit hoher Wahrscheinlichkeit als Startcodon der VI fungiert, da homologe Sequenzen ebenfalls in dieser Position beginnen (siehe Kapitel 4.5). Die 24 Basen upstream dieser Sequenz bilden die 5´-UTR.

Da bei dem verwendeten RACE-Verfahren nur mRNAs mit 7-Methylguanosin-Cap amplifiziert werden, ist davon auszugehen, dass die UTR trotz ihrer Kürze vollständig ist.

Das Fragment aus dem 3´-Race der Nt-VI umfasst 295 bp, die innerhalb der partiellen Sequenz liegen

(siehe Anhang, Abbildung 7.9). Damit wird die Sequenz zwar 3´-seitig nicht erweitert, aber es ergeben sich einige Änderungen: Die Sequenzen unterscheiden sich in 8 Basen. Fünfmal bilden sich nach einem

Basenaustausch Codons, die für dieselbe Aminosäure stehen (blau markierte Basen). In drei Fällen entstehen Codons, die auch einen Aminosäureaustausch bewirken (rot markierte Basen). Ein Aspartat wurde zu Glutamat (D617G) und ein Arginin zu Glycin (R666G) korrigiert. Insbesondere wird auch das Stopcodon des partiellen Klons zu Glutamat (Stop618E), was die abgeleitete Proteinsequenz um 73 Aminosäuren verlängert. Das Stopcodon der korrigierten Sequenz liegt an derselben Position wie bei homologen

VIs (siehe Kapitel 4.5).

Das Race-Fragment der St-VI ist 5´-seitig um 27 Basen länger als der partielle Klon (siehe Anhang, Abbildung 7.10). Wie auch bei der Nt-VI beinhaltet es ein ATG in einer Position, die verglichen mit anderen

VIs (siehe Kapitel 4.5) sehr plausibel für ein Startcodon ist. Das offene Leseraster der Invertase konnte außer um das Startcodon um zwei weitere Aminosäurecodons erweitert werden, die restlichen 18 Basen bilden die 5´-UTR. Bei einer Gesamtlänge von 884 bp überlappt die Sequenz 857 bp mit dem partiellen

Klon. In diesem Bereich finden sich sieben Basenaustausche, von denen vier alternative Codons für dieselbe Aminosäure bilden (blau markierte Basen). In drei Fällen führen sie aber zu Aminosäureaustauschen: zweimal wird Valin zu Isoleucin (V298I und V736I), die beide zu den hydrophoben Aminosäuren zählen. Einmal wird ein Lysin von einem Prolin ersetzt (L50P). Dieser einzig nicht neutrale Austausch befindet sich wahrscheinlich innerhalb des Signalpeptids (Schnittstelle vorhergesagt nach Aminosäure 49, entspricht in DNA-Sequenz Position 165) und hat daher keinen Einfluss auf das reife Protein.

57

Ergebnisse

__________________________________________________________________________________________________________________

3.7 VI-Protein und VI-Aktivitäten in verschiedenen Geweben von Tabak

3.7.1 VIs werden als Proteinfragmente detektiert

Bisher ist kein Antiserum gegen eine VI aus der Spezies Nicotiana tabacum verfügbar. Die Invertasen anderer Spezies weisen aber einen sehr hohen Homologiegrad auf, wie in dem Alignment in Kapitel 4.2

(Seite 62) erkennbar ist. Daher ist eine Kreuzreaktion der Antiseren gegen diese Proteine mit artfremden

Invertasen zu erwarten. In diesem Fall wurde ein Antiserum gegen eine VI aus Beta vulgarisBv-VIwit) verwendet, deren Expression im Rübengewebe nach Verwundung induziert wird. Dieses Antiserum war gegen ein etwa 140 AS langes rekombinant erzeugtes Fragment des Proteins hergestellt worden (Rosenkranz et al. 2001).

Aus Blättern im source Status, Internodien und Wurzeln von Wildtyp-Pflanzen, sowie aus source-Blättern eines Nt-VIF- Überexprimierers (F0-Generation) wurden Proteinrohextrakte gewonnen. Die lösliche

Fraktion wurde über ConA-Sepharose gereinigt, um alle nicht-glykosylierten Proteine zu entfernen.

Abbildung 3.18: Nachweis Vakuolärer Invertasen in Tabak-Extrakten

Western Blot mit einem Antiserum gegen die wundinduzierte VI aus Beta vulgaris αBv-VIwit. Es wurden die Rohextrakte aus source Blatt (source), Wurzel, Internodium und dem source Blatt eines Nt-VIF

Überexprimierers (source sense) mit je 20 mg FGÄ eingesetzt, sowie eine ConA-bindende Präparation aus source Blatt mit 300 mg FGÄ (source ConA+).

In den Rohextrakten aller untersuchten Gewebe lassen sich mit dem Antiserum gegen die VI aus

B. vulgaris verschieden große Proteine detektieren, deren Signalstärken im Verhältnis zueinander in jeder

Spur vergleichbar sind. Mit Ausnahme der Präparation aus Internodium, wo Bande 3 geringer konzentriert ist, sind die Banden 2 und 3 bei etwa 23 kD und 35 kD am stärksten vertreten, während ein circa 15 kD großes Protein verhältnismäßig gering konzentriert ist (Bande 4). Ein etwa 50 kD großes Protein

58

Ergebnisse

__________________________________________________________________________________________________________________

(Bande 1) taucht vor allem in den Rohextrakten auf, ist aber in der ConA

+

-Fraktion nicht wie alle anderen angereichert. Die detektierten Banden fallen nicht mit besonders starken Banden auf der rückgefärbten

Blot-Membran zusammen. Daher ist davon auszugehen, dass es sich um spezifische Antikörperreaktionen handelt.

3.7.2 Die VI-Aktivitäten sind in den Geweben unterschiedlich hoch

In diesem Experiment sollten die gewebeabhängigen Unterschiede in der Invertaseaktivität aufgeklärt werden. Dazu wurden die löslichen, ConA-bindenden Proteinfraktionen aus folgenden vegetativen Geweben präpariert: Blatt im source und sink-Status, Internodium und Wurzel. Die Präparationen wurden in einen Invertase-Aktivitätsassay eingesetzt und die Aktivität im Verhältnis zur Proteingesamtmenge im

Extrakt berechnet.

500

400

300

484

200

100

241

162

0 source sink

53

Internodium Wurzel

Abbildung 3.19: Aktivität der Nt-VI in vegetativen Geweben

Von den Geweben wurden lösliche Rohextrakte präpariert, die über ConA gereinigt wurden. Die Invertaseaktivität wurde in der ConA-bindenden Fraktion bestimmt und bezüglich der Proteinkonzentration (gemessen nach Bradford) dargestellt.

Originalwerte im Anhang (siehe Abbildung 7.11)

In den verschiedenen Geweben misst man deutlich unterschiedliche Aktivitäten. In Wurzelgewebe sind es

53 nkat pro Gramm glykosyliertes Protein. Eine mit 241 nkat/g um fast Faktor 5 höhere Aktivität lässt sich in Blättern im source Status nachweisen. Etwas weniger aktiv ist die Nt-VI im sink-Blatt

(162 nkat/g). Der höchste Wert konnte in Internodien gemessen werden.

59

Diskussion

__________________________________________________________________________________________________________________

4. D

ISKUSSION

A I

NHIBITOREN

4.1 Studien am rekombinanten N

T

-VIF

4.1.1 Die Renaturierung von Nt-VIF erfordert besondere Pufferbedingungen

Nach der Überexpression von Nt-VIF in E. coli konnte rekombinantes Protein nur in unlöslicher Form aus so genannten inclusion bodies isoliert werden. In löslicher Form war der Inhibitor über SDS-PAGE nicht nachweisbar. Es ist bekannt, dass herkömmliche Bakterienstämme keine günstigen Bedingungen für die

Faltung von Proteinen mit Disulfidbrücken bieten: Während sich diese im sekretorischen Weg des Eukaryonten bei niedrigerem Redoxpotential bilden, herrschen im prokaryontischen Cytoplasma zu stark reduzierende Bedingungen (Hwang et al. 1992). Daher wurde Nt-VIF in Anlehnung an das Verfahren für den apoplastischen Inhibitor Nt-CIF (Greiner 1999) nachträglich in vitro renaturiert. Während sich Nt-CIF jedoch in einem einfachen TBS-Puffer in eine funktionelle Konformation faltet, kann man den denaturiert aufgereinigten Nt-VIF unter diesen Bedingungen nicht in eine aktive Konformation überführen. Daher wurden dem Renaturierungspuffer neben verschiedenen stabilisierenden Substanzen auch Glutathion in reduzierter und oxidierter Form beigegeben. Die Gesamtkonzentration von 1 mM und das Verhältnis von reduziertem GSH zu oxidiertem GSSG von 1:2 sind an die Bedingungen im ER-Lumen angelehnt

(Hwang et al. 1992).

Die in vitro Renaturierung ist ein langsamer Prozess. Im Laufe von 24h erhöht sich die Menge an löslichem Protein, wie im SDS-Gel mit anschließender Coomassie-Färbung sichtbar ist (nicht gezeigt). Nicht alle durch diesen Prozess in Lösung übergegangenen Proteine haben zwangsläufig eine native Konformation. Möglicherweise ist der Anteil an nicht nativen, löslichen Molekülen sogar sehr hoch. Die spezifische

Aktivität von Inhibitoren, die in vivo rückgefaltet wurden, ist nämlich wesentlich höher. Beispielsweise trifft dies für zwei Inhibioren aus A. thaliana zu, die in einem Bakterienstamm mit oxidierendem Milieu rekombinant übexprimiert und nativ aufgereinigt wurden (Link et al. 2004). Auch der rekombinante Inhibitor Nt-CIF hat eine zehnmal höhere spezifische Aktivität, wenn er auf diese Weise hergestellt wird

(Hothorn et al. 2003), als nach Expression in herkömmlichen Stämmen in Form von inclusion bodies und anschließender Rückfaltung in vitro (Greiner et al. 1998).

Darüber hinaus ist die native Proteinfaltung allein noch kein ausreichendes Kriterium für die Aktivität von Invertase-Inhibitoren. Es wird spekuliert, dass auch in planta aktive neben nicht-aktiven Kon-

60

Diskussion

__________________________________________________________________________________________________________________ formationen existieren könnten. Es ist daher nicht ausgeschlossen, dass korrekt gefaltete Proteine nicht inhibitorisch aktiv sind.

Der Grad der Rückfaltung unterscheidet sich für die einzelnen Inhibitor-Konstrukte. Auffällig ist in diesem Zusammenhang, dass die Konstrukte V9, V10 und V12 nach der Renaturierung eine etwa zehnfach höhere Konzentration an löslichem Protein aufweisen als alle anderen Konstrukte. Die drei sind C-terminal gleichermaßen verkürzt, beinhalten aber noch das letzte der konservierten Cysteine (C117). Unter der

Annahme, dass sich die Strukturen von Nt-VIF und Nt-CIF direkt vergleichen lassen (siehe unten), fehlt diesen deletierten Proteinen die letzte Helix α7 des 4-Helix-Bündels sowie die linker-Struktur zur vorhergehenden Helix α6. Auch bei V11 fehlt fast die gesamte vierte Helix, der linker-Abschnitt ist jedoch vorhanden. Anscheinend behindert eben diese linker-Sequenz in den anderen Konstrukten eine Löslichkeit vermittelnde Proteinfaltung. Im zellulären Kontext ist dies wahrscheinlich irrelevant, da sich Proteine generell beginnend vom N-Terminus falten, während C-terminale Abschnitte erst synthetisiert werden.

Für eine lösliche Konformation scheint die zweite Disulfid-Brücke des Proteins nicht wichtig zu sein, nachdem auch V10, bei dem das vierte Cystein zu Serin mutiert ist (C117S), diese hohe Renaturierungsrate besitzt.

4.1.2 Die strukturelle Ähnlichkeit von Nt-VIF und Nt-CIF

Innerhalb der Proteinfamilie der PMEI-RP herrschen zwar nur relativ geringe Sequenzhomologien.

Trotzdem wird angenommen, dass sich diese Proteine in ihrer Struktur sehr stark ähneln. Dies wird im

Vergleich der Röntgenstrukturen des Invertase-Inhibitors Nt-CIF mit einem PMEI aus A. thaliana deutlich (Hothorn et al. 2004-B), die sich auf Proteinebene nur zu 20% gleichen (siehe Kapitel 2.7.2 Seite 27).

Daher kann man auch für den vakuolären Inhibitor Nt-VIF, der Nt-CIF auf Proteinebene mit 46% stärker gleicht als der untersuchte PMEI, eine sehr ähnliche dreidimensionale Struktur annehmen. Um die vermutliche Lage der α-Helices in Nt-VIF einschätzen zu können, wurden in folgender Abbildung die für

Nt-CIF bekannten helikalen Abschnitte unter das Sequenzalignment beider Proteine positioniert:

61

Diskussion

__________________________________________________________________________________________________________________

Abbildung 4.1: Protein-Alignment der Deletionsklone von Nt-VIF mit Nt-CIF, Darstellung der

α-helikalen Abschnitte von Nt-CIF

Die blauen Balken unter den Proteinsequenzen zeigen die Positionen der α-helikalen Abschnitte in

Nt-CIF (nach Hothorn et al. 2004-A).

C: konservierter Cysteinrest

S: eingeführte Mutation von Cystein zum Serin

Der senkrechte Strich markiert die Position, an der C- und N-Terminus zur Herstellung der Chimären getrennt wurden.

Abbildung 4.2: Protein-Struktur des apoplastischen Inhibitors Nt-CIF (nach Hothorn et al. 2004-A)

Entsprechend den Balken in Abbildung 4.2 ist die N-terminale Extension hellblau, das 4-Helix-Bündel in

Dunkelblau dargestellt.

62

Diskussion

__________________________________________________________________________________________________________________

4.1.3 Deletionen führen schnell zum Aktivitätsverlust der Inhibitoren

Bereits die Deletion von vergleichsweise kurzen Proteinabschnitten führt zum Verlust der inhibitorischen

Aktivität: Die Deletion der ersten fünf Aminosäuren am N-Terminus des potentiell reifen Proteins wird gut toleriert. Das Protein V1 verhält sich im Inhibitionstest kaum anders als der Volllänge-Inhibitor V0.

Die Nt-VI Präparation wird durch V1 in entsprechend hohen Mengen vollständig inhibiert. Die Inhibitionsfähigkeit selbst wird durch die Deletion demnach nicht beeinträchtigt, und das obwohl die erste Helix des hairpin-Motivs - unter der Annahme der Strukturhomologie mit Nt-CIF - mit drei von sieben

Aminosäuren um fast die Hälfte verkürzt ist. Für die gleiche Hemmung muss jedoch geringfügig mehr

Protein eingesetzt werden. Dies deutet auf eine etwas schlechtere Renaturierung des Proteins mit leicht geringerem Anteil an nativem Protein hin.

Durch die zusätzliche Mutation des ersten Cysteins zum Serin (C8S) in Konstrukt V2 wird ein wesentlich stärkerer Effekt als durch die Deletion allein verursacht. Eine Inhibition der Nt-VI wird erst durch sehr viel höhere Proteinkonzentrationen erreicht als sie von V0 oder V1 benötigt werden. Für eine

50%ige Inhibition der Nt-VI werden beispielsweise etwa dreimal mehr V2 benötigt als V1. Der im Vergleich zu V1 größere Anteil an nicht nativ gefalteten Proteinen löst anscheinend nicht eine Inhibition sondern die Aktivierung der Invertase-Präparation aus, wie sie bei niedrigeren Konzentrationen der V2-

Lösung zu beobachten ist. Es werden bis zu 140 % der ursprünglichen Aktivität gemessen. Auf diese

Aktivierung wird in Kapitel 4.2 (Seite 65) eingegangen. Dadurch wird klar, dass die erste Disulfidbrücke einen entscheidenden Beitrag zur strukturellen Stabilisierung des N-Terminus und damit zur Ausbildung der inhibierenden Konformation des Inhibitor-Moleküls leistet.

Das Konstrukt V3 ist N-terminal um 14 Aminosäuren verkürzt. Es fehlen dadurch die gesamte erste

Helix mit dem ersten Cystein (C8), sowie die linker-Sequenz zur Helix 2, die bis auf die erste Aminosäure komplett ist. Die Inhibitionsfähigkeit geht dadurch komplett verloren. Sie kann auch durch Erhöhung der Proteinkonzentration nicht erreicht werden. Dementsprechend ist auch die um nur eine weitere

Aminosäure kürzere Deletion ∆1-15 von Nt-CIF völlig inaktiv (Hothorn et al. 2004-A). Bei V4 wurde zusätzlich ein Cystein durch Serin ersetzt (C17S). Wie in Abbildung 3.8 (Seite 47) zu sehen ist, ist auch dieses Konstrukt bei keiner der getesteten Proteinkonzentrationen aktiv. Im Gegenteil aktiviert dieses

Protein die Invertase stärker und bei niedrigeren Konzentrationen als dies V3 tut.

Eine C-terminale Deletion um 18 Aminosäuren, wie sie in Konstrukt V11 vorliegt, führt zu keiner Reduktion der inhibitorischen Aktivität. Es sind zwar alle vier Cysteine vorhanden, ein Großteil der

C-terminalen Helix des 4-Helix-Bündels fehlt jedoch. Dieser Bereich steht - nach der Struktur von Nt-CIF zu urteilen - in Kontakt mit dem N-terminalen hairpin. Es stellt sich daher die Frage, ob dieser Bereich tatsächlich eine so große Rolle bei der Stabilisierung des N-Terminus hat, wie Hothorn et al. (2004-A) vermuten. Eine weitere Deletion um insgesamt 33 Aminosäuren bei Konstrukt V9 ist aber nicht mehr inhibierend, sondern aktiviert im Gegenteil die Invertase-Aktivität, wie das auch bei zusätzlicher Mutation des vierten Cysteins (C117S) zum Serin in V10 der Fall ist. Im Gegensatz dazu sind alle entsprechenden C-terminalen Deletionen bei Nt-CIF inaktiv (Hothorn et al. 2004-A, Greiner, persönliche Mit-

63

Diskussion

__________________________________________________________________________________________________________________ teilung). Zusammenfassend kann gesagt werden, dass N-terminal kaum mehr als fünf, C-terminal mindestens 18 und höchstens 32 Aminosäuren Deletion toleriert werden. In diesen Bereichen können also keine für die Bindung oder Hemmung essentiellen Abschnitte sein. Die erste Disulfidbrücke trägt einen großen Teil zur Stabilität bei. Trotzdem funktioniert der Inhibitor auch ohne sie in gewissem Umfang, wenn dazu auch weit höhere Proteinkonzentrationen notwendig sind. Wahrscheinlich reichen die hydrophoben Wechselwirkungen der N-terminalen Extension aus, um zumindest einen Anteil der Proteine nativ rückzufalten. Der andere Teil neigt zur Aggregation und löst bei niedriger Konzentration im Invertase-

Assay die Aktivierung aus. Ein wichtiger Abschnitt liegt zwischen den Aminosäuren Thr6 und Phe15, da ohne sie keine Inhibition mehr möglich ist. Ebenso verhält es sich mit dem nahe am C-Terminus befindlichen Abschnitt zwischen Ser122 und Arg134.

4.1.4 Bedeutung der Disulfidbrücken für die strukturelle Integrität

Der aktive rekombinante Nt-VIF verliert seine Aktivität, wenn er chemisch reduziert und anschließend erhitzt wird (siehe Kapitel 3.3, Seite 48). Alle anderen bisher daraufhin untersuchten Invertase- sowie

PME-Inhibitoren reagieren auf dieselbe Weise (siehe Kapitel 2.8.3, Seite 29). Dies wird auf die Zerstörung der beiden Disulfidbrücken zurückgeführt, deren Existenz für den apoplastischen Nt-CIF durch

Auflösung der Röntgenstruktur bestätigt werden konnte (Hothorn et al. 2004-A). Unter nicht reduzierenden Bedingungen sind die Inhibitoren sehr stabil gegenüber Hitzebehandlung (siehe Kapitel 2.8.3, Seite

29). Die Disulfidbrücken vermitteln demnach die Hitzestabilität dieser Proteine. Aus der Mutation der randständigen Cysteine (C8 und C117) in Nt-VIF wird deutlich, dass diese auch unter normalen Bedingungen für die native Faltung des Proteins eine enorme Bedeutung haben.

Des Weiteren werden nach der Reduktion des Proteins im Western Blot nicht nur eine Bande bei 20 kD detektiert, sondern bis zu drei weitere, die nur etwa 6-10 kD groß sind (siehe Abbildung 3.10 und 3.11,

Seite 49 und 50). Es handelt sich hierbei wahrscheinlich um Zerfallsprodukte. Dies ist ein weiterer Hinweis darauf, dass das Protein ohne Disulfidbrücken weniger stabil ist. Möglicherweise beginnt auch der

Proteinabbau in planta mit diesem Zerfall. In den Überexprimierern konnte nämlich nur ein Protein von etwa 7 kD Größe detektiert werden (siehe Abbildung 3.17, Seite 56). Auch bei endogenen Inhibitoren aus

Daucus carota konnte dies beobachtet werden (Greiner 2000). Ob dieses Verhalten eine weitere physiologische Bedeutung hat oder nicht bleibt dabei jedoch unklar.

4.1.5 Spezifität von Inhibitoren gegenüber Invertase-Isoformen

Nt-CIF kann nicht nur CWIs aus Tabak, sondern aus vielen anderen Pflanzen inhibieren (Greiner 1999).

Das Protein ist zudem in der Lage, die Nt-VI aus dem fremden Kompartiment vollständig zu inhibieren

(siehe Abbildung 3.12, Seite 51), die nicht wie die Nt-CWI durch Saccharose schützbar ist. Die gleiche

Inhibition wird sogar bei geringeren Proteinmengen erreicht, was wahrscheinlich auf eine im Vergleich

64

Diskussion

__________________________________________________________________________________________________________________ zu Nt-VIF bessere Rückfaltung des Proteins zurückzuführen ist. Umgekehrt inhibiert Nt-VIF (siehe Abbildung 3.13, Seite 52) die Nt-CWI nicht, weder mit noch ohne Vorinkubation.

Die ungefähre Lage der Domäne für die Spezifität lässt sich anhand der Experimente mit den chimären

Proteinen abschätzen, die je zur Hälfte aus Nt-VIF und Nt-CIF bestehen. Das Protein VIF(N)::CIF(C) verhält sich im Inhibitionsassay exakt wie Nt-VIF: Es inhibiert die Nt-VI, ohne das eine Vorinkubation ohne Saccharose nötig wäre, die Nt-CWI jedoch nicht. Nachdem die N-terminale Hälfte dem chimären

Protein die Eigenschaften des vakuolären Inhibitors vermittelt, muss die Domäne, die für die Spezifität der Inhibitoren verantwortlich ist, hier zu suchen sein. Dieses Ergebnis stimmt überein mit Experimenten von Hothorn et al. (2004-B). Hier wird die N-terminale hairpin-Domäne eines PMEI mit dem Vier-Helix-

Bündel von Nt-CIF kombiniert. Diese Chimäre wirkt nur auf die PME, nicht auf die CWI. Leider konnte diese Hypothese nicht anhand der anderen Chimäre CIF(N)::VIF(C) bestätigt werden, da diese vollkommen inaktiv ist. Ähnlich verhält es sich jedoch auch mit der umgekehrten Kombination bei

Hothorn et al. (2004-B), bei der das hairpin-Motiv von Nt-CIF mit dem Vier-Helix-Bündel des PMEI verknüpft ist: Das Protein ist bezüglich beider Enzyme inaktiv. Möglicherweise erfüllt das Vier-Helix-

Bündel bei Nt-CIF also eine zusätzliche Funktion, die bei Nt-VIF und dem verwendeten PMEI nicht erforderlich ist. Denkbar wäre eine besondere Positionierung des hairpin-Motivs am Zielenzym oder ein essentieller Einfluss auf die Konformation dieser Domäne.

4.2 Das Aktivierungsphänomen

Welche Inhibitoren wirken aktivierend?

Einige rekombinante Inhibitoren bewirken statt einer Inhibition die Steigerung der Invertase-Aktivität um bis zu 50 %. Dies gilt in unterschiedlichem Ausmaß für die verschiedenen Ansätze. Alle rekombinanten

Proteine wirken aktivierend, wenn sie aus späten Elutionsfraktionen ab E6 stammen (siehe Anhang,

Abbildung 7.2), und zwar sowohl beim Volllänge-Inhibitor V0 wie auch bei den ersten Fraktionen der inhibitorischen Konstrukte V1 und V11. Bei den anderen, nicht inhibitorischen Deletionskonstrukten

V2, V3, V9, V10 und V12 aktivieren alle Fraktionen mehr oder weniger stark.

Des Weiteren führen auch inhibitorische Proteine, die durch DTT reduziert, anschließend erhitzt und wieder abgekühlt wurden, zu einer Aktivierung der Invertase-Aktivität (siehe Kapitel 3.3.1 Seite 48).

Nicht alle aktivierenden Inhibitoren sind jedoch auch reduziert, wie Abbildung 3.10 (Seite 49) zeigt. Die

Reduktion und Entfaltung ist also hinreichend, aber nicht unbedingt notwendig für die Aktivierung.

Die Aktivierung von Invertasen wurde außerdem bei anderen potentiellen Inhibitoren beobachtet. Das rekombinante Protein Zm-inhh1 aus Mais beispielsweise aktiviert eine VI-Präparation aus Tomatenfrüchten auf das Fünffache (Grsic-Rausch, persönliche Mitteilung).

Vermutlich hängen Inhibition und Aktivierung allein mit der Proteinfaltung zusammen. Der Verlust der

Aktivität nach Reduktion und Erhitzen wird mit der Zerstörung der nativen Konformation erklärt. Aber

65

Diskussion

__________________________________________________________________________________________________________________ auch die späte Elution der aktivierenden Moleküle von der Affinitätsmatrix kann bedeuten, dass es sich hier um schlechter lösliche Proteine handelt, bei denen stärker hydrophobe Aminosäure-Seitenketten nach außen gekehrt sind. Dafür spricht auch, dass das Deletionskonstrukt V2 sehr viel stärker aktivierend wirkt als V1 (siehe Abbildung 3.8 Seite 47). Diese N-terminal im selben Maß verkürzten Proteine unterscheiden sich nur in der Mutation des ersten Cysteins zum Serin (C8S). Dadurch wird die erste

Disulfidbrücke verhindert, die entscheidend für die Stabilität des Proteins mitverantwortlich ist.

Wahrscheinlich handelt bei den aktivierenden Proteinen also um entfaltete Proteine.

Wie könnten aktivierende Inhibitor-Proteine wirken?

Über die Wirkweise der aktivierenden Inhibitor-Proteine kann nur spekuliert werden.

Man nimmt an, dass Invertase-Inhibitor-Komplexe in aktiver und inaktiver Form existieren (siehe Kapitel

2.10.2 Seite 32). Von daher ist es denkbar, dass es inaktive oder sogar aktivierende Zustände bei den

Inhibitoren gibt, die sich nur in der Proteinfaltung von den inhibierenden Molekülen unterscheiden. Sie könnten dieselbe oder aber auch eine andere Bindestelle an der Invertase besetzen. Es ist allerdings sehr unwahrscheinlich, dass ein Protein durch reduktives Erhitzen in eine andere wirksame Form umgewandelt wird, da durch einen solchen Prozess die Proteinstruktur und damit die biologische Aktivität normalerweise völlig zerstört werden.

Eine andere Möglichkeit ist die nur scheinbare Aktivierung der Invertase durch Verdrängen oder Ent-

fernen von endogenen Inhibitoren, die an die präparierten Invertasen gebunden sind. Die an sich inhibitorisch inaktiven Proteine könnten entweder noch ausreichend Affinität zur Inhibitoren-Bindestelle an der Invertase besitzen, um den endogenen Inhibitor von hier zu vertreiben. Geht man jedoch bei den aktivierenden Molekülen von nicht nativ gefalteten Proteinen aus, so ist die eine Zerstörung der endogenen Inhibitoren durch Aggregation wahrscheinlicher.

Wie ließe sich die Wirkweise nachprüfen?

Leider stehen bisher noch keine aktiven rekombinanten Invertasen zur Verfügung. Hier kann die Anwesenheit endogener Inhibitoren ausgeschlossen werden und eine direkte Wirkung der aktivierenden Moleküle wäre eindeutig nachweisbar. Hier ließe sich auch klären, ob die aktivierenden Proteine überhaupt an die Invertase binden, ohne eine direkte Auswirkung auf die Aktivität zu haben.

Unter Verwendung von Invertasen ex planta müssten im Falle der Verdrängung nach Zugabe der aktivierenden Proteine in der Lösung freie inhibitorische Proteine nachweisbar sein. Sie könnten etwa durch

Kopplung der Invertase an eine ConA-Matrix extrahiert werden und anschließend auf ihre inhibierende

Wirkung getestet werden. Grunze (2001) konnte mit dem potentiellen Inhibitor Zm-inhh1, der stark aktivierend wirkt (siehe oben), allerdings keine Verdrängung nachweisen.

Bei einer Aggregation von Inhibitor-Molekülen müssten verstärkt Protein-Aggregate zu finden sein.

Hothorn et al. (2004-A) finden nach der Mutation des ersten Cysteins (C8S) in Nt-CIF verstärkt Aggregate, die sich noch in Lösung befinden. Außerdem sollten anschließend mehr freie Invertase-Moleküle in

66

Diskussion

__________________________________________________________________________________________________________________

Lösung sein, worüber eventuell eine native Gelelektrophorese und ein anschließender Western Blot Auskunft geben könnte. Es stellt sich außerdem die Frage, ob man die Aggregation aktiver Inhibitoren auch ohne die Beteiligung einer Invertase-Präparation auslösen kann. Dann sollte eine Lösung inhibitorisch aktiver Proteine durch Zugabe der aktivierenden Moleküle und nach Inkubation unter Assay-Bedingungen inaktiviert werden. Ungeklärt bleibt dann allerdings die Frage, wie eine Lösung rekombinanter Proteine bei steigender Konzentration zuerst aktivierend und dann inhibierend wirken kann, wie vor allem bei V2, aber auch bei V1 und V0 zu beobachten ist. Dann müssten beide Formen nebeneinander vorliegen können und die Aggregation ausschließlich mit gebundenen Inhibitoren vonstatten gehen.

Trifft die Theorie der Verdrängung oder Entfernung zu, muss das Ausmaß der Aktivierung abhängig sein von der Menge an endogenen Inhibitoren. Je höher deren Anteil ist, desto stärker sollte die Aktivierung ausfallen. Tatsächlich lassen sich bei stark Inhibitor-haltigen VI-Präparationen aus Tomatenfrüchten starke Aktivierungen erreichen (Grsic-Rausch, persönliche Mitteilung, Greiner 2000). Oben wurde bereits die Fünffache Aktivierung durch den rekombinanten Zm-inhh1 aus Mais erwähnt. Auch mit dem aktivierenden Nt-VIF aus Elutionsfraktion 7 kann man die Invertase-Aktivität um das bis zu Achtfache steigern (Daten nicht gezeigt). Nachdem der vakuoläre Inhibitor Nt-VIF in planta nicht ohne weiteres nachweisbar und so allenfalls anhand der Northern-Blot-Daten abschätzbar ist (siehe Kapitel 4.3.1, unten), könnten für diesen Zweck beispielsweise auch transgene Überexprimierer verwendet werden. Des

Weiteren könnten die Experimente auch mit CWI-Präparationen und dem apoplastischen Inhibitor Nt-CIF durchgeführt werden.

4.3 Nt-VIF in planta

4.3.1 Nt-VIF – ein sehr spezielles Protein?

Ein Nachweis von Nt-VIF in Wildtyp-Pflanzen ist bisher nicht möglich

Aus Northern Blot Studien war bekannt, dass die für Nt-VIF spezifische mRNA vor allem in Internodien und Wurzeln stark, aber auch im Androeceum exprimiert wird (Lauer 1999). Das Antiserum αNt-VIF erkennt das rekombinante Protein (siehe Abbildung 3.16 Seite 55). Die endogene Form konnte jedoch nicht in den Rohextrakten der verschiedenen Gewebe nachgewiesen werden. Daher wurden Methoden zur

Anreicherung des Proteins versucht. Nach einer ConA-Chromatografie wurden alle nicht glykosylierten

Proteine verworfen. Die als Komplex gebundenen Inhibitoren sollten zusammen mit den vakuolären Invertasen in der ConA-bindenden Fraktion enthalten sein. Das Äquivalent von bis zu 350 mg Frischgewicht reichte jedoch nicht für ein spezifisches Signal im Western Blot aus. Als nächstes wurde daher eine spezifischere Anreicherung mit Hilfe des Antiserums versucht. Der affinitätsgereinigte Antikörper wurde kovalent an eine CarboLink

- Matrix gekoppelt. Die Matrix wurde anschließend mit dem Äquivalent von 4 g Wurzelgewebe inkubiert, gewaschen und die gebundenen Proteine sauer eluiert. Trotzdem konnte im anschließenden Western Blot kein Signal detektiert werden.

67

Diskussion

__________________________________________________________________________________________________________________

Einen Hinweis liefert jedoch ein Experiment mit verwundeten Tabak-Wurzeln. Aus dem Kartoffelsystem ist bekannt, dass eine Verwundung des Knollengewebes zu einem Anstieg der sauren Invertaseaktivität im löslichen Überstand des Zellextraktes führt (Pfister 2003). Denkbar wäre unter diesen Bedingungen auch ein Hochregulieren des zugehörigen Inhibitors. Verhält es sich bei Tabak genauso, so könnte durch eine Verwundung des Gewebes eventuell die Menge an Inhibitorprotein erhöht werden. Daher wurde dieselbe Anreicherung wie oben auch mit verwundeten Tabak-Wurzeln durchgeführt. Dafür wurden diese in circa 1 cm lange Stücke geschnitten und über mehrere Tage auf einem feuchten Filterpapier in einer geschlossenen Petrischale inkubiert. Im Western Blot mit 1,6 g FGÄ konnte daraufhin ein Signal bei etwa

19 kD detektiert werden, was für Nt-VIF plausibel wäre (siehe Abbildung 4.3 unten). Die Fraktion zeigte jedoch keine inhibitorische Aktivität auf die Nt-VI. Eine Wiederholung des Experiments ist daher notwendig.

1 2 3 4

5

20

17

14

Abbildung 4.3: Immunologischer Nachweis von Nt-VIF in verwundeten Tabak-Wurzeln

Der affinitätsgereinigte Antikörper αNt-VIF wurde kovalent an eine CarboLink Matrix gebunden. Die Matrix wurde mit einem Proteinrohextrakt aus 4 g verwundetem Wurzelmaterial inkubiert. Das gebundene

Protein wurde in 5 Fraktionen eluiert. Die Menge, die 1,6 g FGÄ entspricht wurde in einen Western Blot eingesetzt und mit αNt-VIF detektiert.

Nt-VIF – ein zelltyp-spezifisches Protein?

In Anbetracht der Schwierigkeiten bei der Detektion des Proteins in Wildtyp-Pflanzen muss man davon ausgehen, dass das Protein nur in sehr kleinen Mengen in den Geweben vorhanden ist. Nachdem für die

Inhibition jedoch eine 1:1-Bindung erforderlich ist, müssen für eine effektive Regulation der entsprechenden Invertase-Isoform in einer Zelle auch entsprechend viele Moleküle des Inhibitors vorhanden sein. Möglicherweise werden die Inhibitoren also nur in bestimmten Zelltypen exprimiert. Dort kann die

Anzahl der Proteine zwar groß sein, bei Extraktion eines Gewebes würden sie aber entsprechend verdünnt, so dass ihre Konzentration unter die Nachweisgrenze fällt.

Einen solchen Sachverhalt beschreiben Bate et al. (2004) für den apoplastischen Inhibitor Zm-INVINH1 aus Zea mays. Obwohl diese Isoform aus einer EST-Datenbank stammt, die Klone aus jungen Samen 4

Tage nach dem Aufblühen enthält, ist im Northern Blot keine spezifische mRNA nachweisbar. Erst mit der sensitiveren RT-PCR Methode wird Transkript detektiert, und zwar ausschließlich in sich entwickelnden Samen. In situ Studien zeigen eine lokal sehr begrenzte Expression des Transkripts in den Zellen um

68

Diskussion

__________________________________________________________________________________________________________________ das sich entwickelnde Endosperm. Eine streng auf bestimmte Zelltypen beschränkte Expression wird außerdem für einen Inhibitor aus A. thaliana gezeigt (Link et al. 2004).

Welche Zelltypen könnten Nt-VIF exprimieren?

Für Nt-VIF wären folgende Szenarien denkbar: In Wurzelspitzen differenzieren sich die in der meristematischen Zone gebildeten Zellen zu verschiedene Zelltypen aus. Es ist bekannt, dass der Hexosen/Saccharose-Quotient bei der Differenzierung abnimmt. Nt-VIF könnte hier also eine Rolle spielen, indem er die Aktivität der VIs zu einem bestimmten Zeitpunkt inhibiert. Ein Zusammenhang mit der Differenzierung der Zellen könnte auch im Androeceum bestehen, wo Nt-VIF laut Northern Studien ebenfalls exprimiert wird. In Internodien könnte die Funktion von Nt-VIF im Zusammenhang mit dem Stoppen der Zellstreckung stehen. Eine Inhibition der VIs könnte hier den osmotischen Wert in der Vakuole herabsetzen und so das Zellwachstum verlangsamen. In diesem Fall wäre auch die Reversibilität der Enzym-Hemmung sinnvoll, die durch die posttranslationale Aktivität der Inhibitoren gegeben ist. Wird nach einem Stillstand das Signal für die weitere Streckung gegeben, könnten die VIs durch Abschalten der

Inhibitoren schnell wieder aktiviert werden.

4.3.2 Inhibitoren als biologische Schalter

Derzeit wird vermutet, dass Invertase-Inhibitoren als Schalter zwischen verschiedenen Stoffwechselvorgängen dienen könnten. Im ausgeschalteten Zustand könnten sie, ohne die Aktivität der Invertasen zu beeinträchtigen, neben den Enzymen oder als inaktiver Komplex gebunden vorliegen. Eine Änderung derjenigen äußeren Bedingungen, die die inhibitorische Aktivität beeinflussen (siehe Kapitel 2.10.2 Seite

32), würde die Enzyme innerhalb kurzer Zeit inhibieren. Dieser Vorgang ist auch umgekehrt denkbar, was eine rasche Aktivierung von Invertasen ermöglichen würde.

Das Ab- oder Anschalten von Invertasen führt zunächst zu einer Änderung im Verhältnis der löslichen

Zucker Hexosen und Saccharose zueinander, was für den Stoffwechsel wiederum verschiedene Folgen haben kann, je nachdem in welchem Gewebe- oder Zelltyp und in welchem subzellulären Kompartiment es stattfindet. Diese Auswirkungen sind in Kapitel 2.6 (Seite 17) über die physiologische Bedeutung der

Invertasen bereits ausführlich geschildert.

Eine Rolle der Invertase-Inhibitoren wäre daher bei der Phloementladung von Saccharose denkbar. In diesem Zusammenhang interessant ist die Lokalisation zweier Isoformen über Promotor-GUS-Studien:

Sowohl At-C/VIF1 aus A. thaliana wie auch Nt-CIF sind im Leitgewebe lokalisiert (Link et al. 2004,

Rausch und Greiner 2004). Mit der Steuerung der Entladung einhergehend ist auch ein Einfluss auf die

Ausprägung der sink-Stärke von Geweben plausibel. In Samen wurde Nt-CIF beispielsweise im Funiculus nachgewiesen (Rausch und Greiner 2004). Antisense-Nt-CIF Pflanzen haben ein leicht erhöhtes Samengewicht, was ebenfalls in diese Richtung weist (Rausch und Greiner 2004).

69

Diskussion

__________________________________________________________________________________________________________________

Der Signalcharakter der löslichen Zucker legt zudem einen Einfluss von Inhibitoren auf verschiedene

Entwicklungsvorgänge nahe. Oftmals geht der Übergang von Phasen hoher meristematischer Aktivität zu Differenzierung und Akkumulation von Speicherstoffen mit einer raschen Reduktion des Hexosen/Saccharose-Quotienten einher (Wobus und Weber 1999, Hill et al. 2003). Tatsächlich findet man

Inhibitoren in den verschiedensten Speicherorganen von der Kartoffelknolle über die Zuckerrübe und in sich entwickelnden Früchten und Samen, wie etwa im Endosperm von Getreidesamen (siehe Kapitel 2.9.2

Seite 30).

Über osmotische Effekte ist auch ein Einfluss der Inhibitoren auf das Streckungswachstum von Zellen möglich.

Unter Stressbedingungen könnten Inhibitoren für ein rasches Umschalten des Stoffwechsels als Anpassung an die neue Situation sorgen. Expressionsstudien legen einen Einfluss zumindest unter Trockenstress nahe (siehe Kapitel 2.9.3 Seite 31).

B I

NVERTASEN

4.4 Vervollständigung der Invertase-Sequenzen

Die vakuolären Invertasen aus Tabak und Kartoffel waren zu Beginn der Arbeit nur partiell bekannt. Beiden Sequenzen fehlte ein Startcodon für Methionin, was auf eine 5´-seitig deletierte cDNA hinweist. Aus einem Vergleich der abgeleiteten Proteinsequenzen mit Invertasen aus verwandten Spezies wurde zu dem

N-terminalen Defizit bei der Nt-VI eine deutliche C-terminale Verkürzung erkannt. Im Rahmen dieser

Arbeit wurden die fehlenden Sequenzabschnitte mit Hilfe eines RACE-Verfahrens ergänzt, beziehungsweise korrigiert (siehe Kapitel 3.6 Seite 56). Einige Basenaustausche weisen darauf hin, dass es sich bei den neu amplifizierten Fragmenten entweder um andere Allele derselben Isoform handelt, die sich aufgrund der amphidiploiden Chromosomenkonstellation von N. tabacum unterscheiden, oder aber für die

Klonierungen unterschiedliche Tabak-Sorten verwendet wurden. Die Frage nach der Sorte konnte jedoch für die bereits vorhandenen Sequenzabschnitte nicht geklärt werden.

Mit 24 Basen bei der Nt-VI, bzw. 18 Basen bei der St-VI sind die 5´-UTRs sehr kurz. Es stellt sich daher die Frage, ob diese wirklich vollständig sind, wie bei dem verwendeten RACE-Verfahren zu erwarten ist.

Beim GeneRACER sollten nämlich nur solche RNAs kloniert werden, die eine 5´-Methylguanosin-Kappe tragen. Allerdings sind auch andere VI-mRNAs mit ähnlich kurzen 5´-UTR-Bereichen notiert:

70

Diskussion

__________________________________________________________________________________________________________________

Beispielsweise kann man alle VIs im Alignment (siehe Abbildung 4.4, Seite 72) anführen, die auf einer mRNA-Sequenz basieren: Le-VI (0 Basen), Lp-VI (13 Basen), St-VI2 (8 Basen), Ca-AI (8 Basen),

Dc-VI1 (40 Basen), Dc-VI (30 Basen) und Vr-VI (160 Basen).

4.5 Verschiedene VIs im Sequenzvergleich

Im folgenden Alignment werden verschiedene abgeleitete Proteinsequenzen miteinander verglichen. Besonderer Wert wurde auf Invertasen aus der Familie der Solanaceen gelegt: Neben den aus Kapitel 3.6

(Seite 56) bekannten Sequenzen aus N. tabacum (Nt-VI) und Solanum tuberosum (St-VI) sind Vertreter aus den nahe verwandten Spezies Lycopersicon esculentum (Le-VI) und L. pimpinellifolium (Lp-VI) angeführt, sowie aus der Paprika Capsicum annuum (Ca-VI). Demgegenüber stehen zwei Sequenzen aus der Karotte (Daucus carota, Asteraceae), sowie aus der Mungbohne Vigna radiata, einem Vertreter der

Fabaceae. Außerdem wurden zwei Vakuoläre Invertasen aus Beta vulgaris (Chenopodiaceae) aufgenommen, die konstitutiv (Bv-VInit

1

) und nach Wundinduktion (Bv-VIwit

2

) exprimiert werden.

Abbildung 4.4 (nächste Seite): Alignment abgeleiteter Proteinsequenzen von Invertasen verschiedener Spezies

Le-VI: VI aus Lycopersicon esculentum, D11350

Lp-VI: VI aus Lycopersicon pimpinellifolium, Z12026

St-VI1: VI aus Solanum tuberosum X70368, vervollständigt

St-VI2: VI aus Solanum tuberosum L29099

Ca-AI: saure Invertase aus Capsicum annuum, U87849

Nt-VI: VI aus Nicotiana tabacum (Solanaceae, Asteridae), AJ305044, vervollständigt

Dc-VI: VI1 aus Daucus carota (Apiaceae, Asteridae), X75351

Bv-VIwit: wundinduzierte VI aus Beta vulgaris (Chenopodiaceae, Caryophyllidae), AJ277457, vervollständigt nach Greiner (unveröffentlicht)

Vr-I: Invertase aus Vigna radiata (Fabaceae, Rosidae), D10265

Bv-VInit: nicht wundinduzierte VI aus Beta vulgaris(Chenopodiaceae, Caryophyllidae), AJ277455

Die roten Buchstaben markieren die konservierten Motive: das

β-Fruktosidase-Motiv NDPN, sowie die

Motive FRDP und WECVD (nach Sturm und Chrispeels 1990, bzw. Pons et al. 1998). Grün hinterlegt in

Bv-VIwit sind N- und C-Terminus des für die Immunisierung verwendeten Proteins.Das Alignment wurde erstellt mit dem Programm ClustalW nach Higgings et al. 1994.

1

Bv-VInit = nicht wundinduzierte VI aus B. vulgaris

2

Bv-VIwit = wundinduzierte VI aus B. vulgaris

71

Diskussion

__________________________________________________________________________________________________________________

72

Diskussion

__________________________________________________________________________________________________________________

4.6 Die Nt-VI in planta

4.6.1 Die VI aus Tabak wird in Fragmenten detektiert

Der Nachweis Vakuolärer Invertasen in Tabak-Geweben wurde mit Hilfe einesAntiserums gegen die wundinduzierte VI-Isoform Bv-VIwit aus Beta vulgaris erbracht. Dieses war gegen ein 142 Aminosäuren langes rekombinantes Proteinfragment hergestellt worden (Rosenkranz et al. 2001). Die Isoform

Bv-VIwit und die bekannte Nt-VI sind in diesem Bereich im Hinblick auf die abgeleitete Proteinsequenz circa zu 73 % identisch. Dies macht eine Kreuzreaktion mit dem heterologen Protein aus Tabak sehr wahrscheinlich.

Im Western Blot mit Nt-VI Präparationen aus verschiedenen Geweben werden Proteine von 50 kD,

35 kD, 23 kD und 15 kD detektiert. Die nach der abgeleiteten Proteinsequenz berechnete Größe des Proteins beträgt ohne Signalpeptid jedoch 65 kD.

Die Detektion mehrerer kleiner Proteine ist für Invertasen typisch. Häufig addieren sich ihre Massen zu der berechneten Proteingröße. Daher geht man von einer Fragmentierung der Invertasen aus. Eine 70 kD große VI aus L. esculentum beispielsweise zerfällt in Fragmente von 50 kD und 23 kD (Greiner et al.

2000). In Keimlingen der Karotte werden Bruchstücke zu 43 kD und 25 kD detektiert und einer 68 kD großen Invertase zugeordnet (Unger et al. 1992 und 1994). Arai et al. (1991 und 1992) konnten zwei

Fragmente zu 30 kD und 38 kD durch N-terminale Sequenzierung eindeutig als Bruchstücke eines 70 kD großen Enzyms aus Vigna radiata identifizieren.

In der löslichen Präparation aus Tabak werden jedoch nicht nur zwei Fragmente detektiert. αBv-VIwit erkennt 4 Banden. Ein 50 kD und 32 kD großes Protein werden mit demselben Antiserum nach Wundinduktion auch im B. v. Rübengewebe detektiert (Rosenkranz, persönliche Mitteilung). Es könnte sich hier also um die entsprechendeIsoform in Tabak handeln. Allerdings ist das 50 kD große Protein in der ConA-

Fraktion nicht im selben Maß angereichert wie die kleineren Proteine, was auf eine unspezifische Reaktion hinweist. Die Nt-VI Isoform könnte jedoch auch anders fragmentieren und aus diesem Grund ein anderes Bandenmuster zeigen. Denkbar ist auch die Existenz einer weiteren Isoform, der die anderen

Proteinbanden zuzuordnen wären. Aus B. vulgaris sowie im vollständig sequenzierten Genom von

A. thaliana sind bereits zwei VI-Isoformen bekannt. Ebenso ist eine Verunreinigung mit Invertasen aus der Zellwand denkbar, obwohl hier nur der lösliche Überstand des Rohextrakts präpariert wurde. Die löslichen Präparationen sind jedoch teilweise mit Zellwandproteinen kontaminiert (Chourey, persönliche

Mitteilung).

Der Zerfall der Invertasen lässt sich nicht mit der generell für Proteine unter SDS-Behandlung typischen

Labilität zwischen den Aminosäuren Aspartat und Prolin (DP-Labilität, Kubo 1995) erklären, da die tatsächlichen Fragmente nicht den dabei erwarteten Größen entsprechen. Darüber hinaus stabilisiert der verwendete Auftragspuffer die Proteine dahingehend. Sturm (1999) geht zudem nicht von einem Artefakt aus, da die Fragmentierung entwicklungsabhängig variabel scheint. In Keimlingen von D. carota sowie im Hypokotyl der Mungbohne steigt beispielsweise mit dem Alter auch die Fragmentierung. Auch in

73

Diskussion

__________________________________________________________________________________________________________________

Tomatenfrüchten ändert sich die Fragmentierung im Laufe der Entwicklung (Greiner et al. 2000). Die

Bruchstücke sind als solche nicht enzymatisch aktiv (Sturm 1999). Die physiologische Bedeutung der

Fragmentierung ist daher bis heute unklar.

4.6.2 Invertase-Aktivitäten in verschiedenen Geweben

Die Aktivität der Nt-VI wurde im löslichen Überstand des Proteinextrakts bestimmt (siehe Abbildung

3.19, Seite 59). Die über ionische Wechselwirkungen an die Zellwand gebundenen CWIs sind darin nicht enthalten. In einem weiteren Schritt wurden alle nicht glykosylierten Proteine chromatografisch über

ConA-Sepharose abgetrennt. Die Bestimmung der Invertaseaktivität erfolgte im sauren Milieu. Wegen ihrer engen pH-Optima werden dadurch nur die sauren Invertasen gemessen, die cytosolischen NAI sind nicht aktiv.

Demnach findet sich die höchste Nt-VI Aktivität in Internodien. In source-Blättern ist das Enzym etwa halb so aktiv und etwa zehnmal weniger in Wurzel. Nach dem Western Blot (siehe Kapitel 4.3.1 Seite 65) ist jedoch die Proteinmenge des Enzyms in allen Geweben etwa gleich. Die Aktivität muss daher posttranslational reguliert sein. Neben dem Einfluss des vakuolären pH-Wertes und der

Reaktionsprodukte Glukose und Fruktose, die die Aktivität in vivo beeinflussen können, spielen eventuell auch endogene Inhibitoren eine Rolle. Die vakuoläre Isoform Nt-VIF ist gemäß Northern Blot Studien

(Lauer 1999) am stärksten in Wurzel exprimiert. Das Protein könnte hier also für eine Reduktion der

Invertase-Aktivität sorgen. In Blättern kann keine spezifische mRNA von Nt-VIF detektiert werden. Die immer noch starke Expression des Proteins in Internodien hat aber anscheinend keine Auswirkung auf die

Invertase. Dafür gibt es verschiedene Erklärungs-Ansätze: Die vorhandene mRNA wird möglicherweise gar nicht zur Herstellung des Inhibitor-Proteins herangezogen. Denkbar ist auch, dass das Protein zwar exprimiert wird, aber in einer nicht aktiven Form vorliegt. Schließlich ist auch eine Expression von

Invertase und Inhibitor in verschiedenen Zelltypen denkbar, so dass sich die Proteine nicht beeinflussen können.

Saure Invertasen gelten als sink-spezifisch (siehe Kapitel 2.5.3 Seite 12). Trotzdem wurde hier eine starke

Aktivität der Nt-VI in source-Blättern gemessen. Dies ist auch in vielen anderen Arbeiten der Fall, in denen andere Spezies untersucht wurden. In Lolium temulentum beispielsweise fallen die löslichen Sauren

Invertasen im Verlauf des sink-Stadiums kontinuierlich ab, steigen nach dem Übergang in den source-

Status aber wieder stark an (Kingston-Smith et al. 1999). Für diesen Sachverhalt gibt es mehrere mögliche Erklärungen: Zum einen könnten die VIs in anabolen Geweben eine Funktion als Signalgeber erfüllen. Zum anderen gibt es auch in source-Blättern Gewebebereiche, die entweder nicht selbst photosynthetisch aktiv sind oder ihren Bedarf nicht vollständig decken können. Dazu gehören zum

Beispiel die Epidermis, das Leitgewebe oder Wachstumszonen am Rand des Blattes. Hier wäre neben der rein katabolen Funktion auch eine Beteiligung der VIs an der Regulation des osmotischen Turgors

74

Diskussion

__________________________________________________________________________________________________________________ denkbar, der für die Zellstreckung erforderlich ist. Kingston-Smith und Pollock (1996) weisen eine VI-

Isoform über ein tissue print Verfahren tatsächlich im Bereich der Leitgewebe nach.

75

__________________________________________________________________________________________________________________

5. M

ATERIAL UND

M

ETHODEN

5.1 RACE-Technik zur Vervollständigung von cDNA-Enden

Die Verlängerung der cDNA-Enden wurde mit Hilfe des GeneRACER Kit (Invitrogen, www.invitrogen.com) nach Angaben des Herstellers durchgeführt. Bei dieser sogenannten RLM-RACE-

Technik wird ein Oligonukleotid an das Ende der cDNA ligiert. Im Falle des 5`-RACE wird vorher sichergestellt, dass nur vollständige cDNAs als Ligationspartner dienen, indem nach kompletter

Dephosphorylierung aller Enden das 7-Methylguanosin-Nukleotid entfernt wird, das die vollständigen 5`-

Enden vor der Dephosphorylierung schützt. Danach liegen also nur noch die Enden phosphoryliert vor, die vorher ein 7-Methylguanosin-Cap hatten, und somit ligationsfähig sind. Beim 3´-Race dagegen kann das Oligonukleotid mit jedem cDNA-Molekül eine Bindung eingehen.

Das Oligonukleotid beinhaltet Bindestellen für zwei nebeneinander liegende Primer. Außerdem werden zwei Primer im bereits bekannten Teil der cDNA gewählt, die ebenfalls in `nested-Position` zueinander liegen. Das gewünschte Fragment wird in 2 PCR-Schritten amplifiziert. Die zweite Reaktion spezifiziert dabei die erste, da die Primer innerhalb des ersten Amplifikats liegen. Schließlich wird die Länge des erhaltenen Fragments auf einem DNA-Gel überprüft. Anschließend wurde das Fragment in einen Vektor kloniert. Sequenzierung und Vergleich des Ergebnisses mit dem bereits bekannten Teil der cDNA geben

Aufschluß darüber, ob das richtige Fragment kloniert wurde und die Verlängerung der Sequenz erfolgreich war.

5.2 Klonierung von DNA-Fragmenten

5.2.1 Klonierung der Inhibitor-Mutanten

Primer für die Deletionsklone

Die Bezeichnung der Primer enthält folgende Informationen: Das V gibt an, dass die vakuoläre Isoform des Inhibitors gemeint ist. Die Zahl gibt die äußerste Position des Primers in der cDNA an. Wurde in dieser Primerposition eine Mutation eingeführt, so gibt der Buchtstabe C an, dass das ursprüngliche Codon für Cystein vorhanden ist, der Buchstabe S steht für die Mutation vom Cystein zum Serin. L oder R steht für linker (sense) oder rechter (antisense) Primer.

Alle Primer besitzen Überhänge, die der cDNA-Sequenz nicht homolog sind. Sie enthalten eine Restriktionsschnittstelle. Das ist bei den linken Primern BamHI, bei den rechten SalI. Im Falle der rechten Primer, die nicht mit dem Stopcodon der cDNA enden, enthält der Überhang außerdem ein Stopcodon. Die restli-

76

__________________________________________________________________________________________________________________ chen Basen der Primer sorgen dafür, dass die Restriktionsschnittstellen nicht am Ende des PCR-Fragments liegen und ermöglichen so den Verdau durch die Restriktionsenzyme.

BamHI

5’- TA CTA TAT GGA TCC AAT AAT ATC ATC AAC ACG ACC-3’ V163L

VC175L

VC178L

VS178L

VC205L

V S 205L

VC513R

VC516R

V S 513R

V558R

V615R

5’- TA CTA TAT GGA TCC AAC ACG ACC TGC AGA GCC AC-3’

5’- TA CTA TAT GGA TCC ACG ACC TGC AGA GCC AC-3’

5’- TA CTA TAT GGA TCC ACG ACC TCC AGA GCC AC-3’

5’- TA CTA TAT GGA TCC CCC TTG TGC CTC ACC AC-3’

5’- TA CTA TAT GGA TCC CCC TTG TCC CTC ACC AC-3’

SalI Stop

5’- TA CAC AAT GTC GAC TCA AAA CTC ACA AGT TTC TGC TTC-3’

5’- TA CAC AAT GTC GAC TCA ACT AAA CTC ACA AGT TTC TGC-3’

5’- TA CAC AAT GTC GAC TCA AAA CTC AGA AGT TTC TGC TTC-3’

5’- TA CAC AAT GTC GAC TCA ATT CAT ATC AGA AAC TGG AG-3’

5’- TA CAC AAT GTC GAC TCA TAA TAG CAT TCT AAT AAT AG-3’

Abbildung 5.1: Sequenzen der Primer zur Herstellung der Inhibitor-Mutanten

Die fettgedruckten Basen stimmen mit der cDNA-Sequenz des Inhibitors überein. Nicht fett gedruckt sind die Überhänge und Stellen, an denen Veränderungen vorgenommen wurden. Die Bezeichnungen für die

Primer sind im obigen Text erklärt.

XXX: natürliches Cystein-Codon

XXX

: durch Mutation eingeführtes Serin-Codon

Stop: Stopcodon

SalI, BamHI: Schnittstellen für Restriktionsenzyme

Die Primer wurden folgendermaßen kombiniert, um die einzelnen Konstrukte herzustellen:

Konstrukt linker Primer rechter Primer

V0

V1

V2

V3

V4

V9

V10

V11

V12

V163L V615R

VC175L V615R

VS178L V615R

VC205L V615R

VS205L V615R

V163L VC513R

V163L VS513R

V163L V558R

VC175L VC516R

Abbildung 5.2: Zusammenstellung der Primerpaare zur Klonierung der Inhibitor-Mutanten

77

__________________________________________________________________________________________________________________

Klonierung in den Überexpressionsvektor

Die über PCR amplifizierten DNA-Fragmente wurden über die in den Primer-Überhängen befindlichen

Schnittstellen BamH1 und Sal1 in den Überexpressions-Vektor pQE-30 (QIAGEN) kloniert.

Abbildung 3: Schematische Darstellung des Klonierungsvektors pQE

PT5: Promotor T5 lacO: Lac

RBS: Ribosomenbindestelle

ATG: Start-Methionin

6xHis: sechs hintereinander geschaltete His-Codons (bilden das His-Tag)

MCS: multiple cloning site mit Restriktionsschnittstellen

(aus: The QIAexpressionist, Handbuch zu den Expressionsvektoren Qiagen, Hilden)

5.2.2 Klonierung der Inhibitor-Chimären

Prinzip der Klonierung

Bei den Inhibitor-Chimären wurde jeweils die N-terminale Hälfte des einen Inhibitors mit der

C-terminalen Hälfte des anderen kombiniert und folgendermaßen bezeichnet: VIF(N)::CIF(C) für die

Chimäre aus dem N-terminalen Anteil von Nt-VIF und dem C-terminalen Anteil von Nt-CIF, bzw.

CIF(N)::VIF(C) entsprechend umgekehrt (zur genauen Position der Teile siehe Abbildung 4.1, Seite 62).

78

__________________________________________________________________________________________________________________

Das verwendete Klonierungsverfahren nennt man soeing PCR

1

. Dazu werden spezielle Primer benötigt, die die Nahtstelle beider Fragmente bilden. Sie überlappen mit beiden Fragmenten gerade so weit, wie es für das Annealing mit dem jeweiligen Fragment nötig ist. Das aus einer ersten PCR mit dem soeing Primer und dem Templat des einen Fragments hervorgehende Amplifikat fungiert als linker Primer in einer anschließenden PCR, in der das Amplifikat um den zweiten Teil erweitert wird. Es entsteht die gewünschte Chimäre.

Primer für die soeing-PCR

Die speziellen Primer zur Herstellung der Chimären lauten:

ChimVC-R 5`- GGGGTTCGATTTTTCGAGTTT-3`

ChimCV-R 5`- GCTAAGAGGTAGTCTCAACTC TGCAGGGGGATTCGAATGC-3`

Abbildung 5.4: Spezielle Primer für die Chimären-Herstellung

Im Primernamen sind ist die Bezeichnung für die Chimären folgendermaßen abgekürzt:

VC: VIF(N)::CIF(C)

CV: CIF(N)::VIF(C) rot : Sequenzabschnitt von Nt-VIF blau : Sequenzabschnitt von Nt-CIF

In folgender Tabelle ist ersichtlich, welche Primer in die unterschiedlichen Reaktionen eingesetzt wurden:

Chimäre

VIF(N)::CIF(C)

CIF(N)::VIF(C)

Reaktion Primer links Primer rechts Templat

ChimVC-R

1 A550R Nt-CIF

Abbildung 5.5: Zusammenstellung der Primerpaare für die Chimärenherstellung

Die Sequenz der nicht Chimären-spezifischen Primer ist in Abbildung 5.1 Seite 77 zu finden.

5.2.3 Transformation elektrokompetenter Bakterien

SOC-Medium: 20 g/l Bacto Trypton (Difco) / 0,5 g/l Bacto Yeast Extract (Difco) / 0,5 g/l NaCl /

0,186 g/l KCl / 2,03 g/l MgCl / 3,96 g/l Glucose (Monohydrat) / pH 7,0

Die Plasmide mit den klonierten DNA-Sequenzen wurden mittels Elektroporation in elektro-kompetente

E. coli Bakterien des Stammes M15[pREP4] (Qiagen) überführt. Dabei wurden folgende Einstellungen am Elektroporator (Gene Pulser

®

II, BIO-RAD, München) vorgenommen: 25 µF, 200 Ω, 1,8 kV. Die transformierten Bakterien wurden sofort in 1 ml SOC-Medium resuspendiert, 30 min lang bei 37°C inkubiert und auf LB-Agar-Platten gebracht.

1

engl: to soe = nähen

79

__________________________________________________________________________________________________________________

5.3 Herstellung rekominanter Proteine

5.3.1 Überexpression in Bakterien

LB-Medium: 1 % Bactotrypton / 0,5 % Hefeextrakt / 1 % NaCl / pH 7,0 (NaOH)

Die Anzucht der Bakterien des Stammes M15[pREP4] erfolgte in LB-Medium bei 37°C und 180 rpm mit den Antibiotika Ampicillin (100 mg/l) und Kanamycin (25 mg/l), deren Resistenzgene auf den Plasmiden pQE30 und pREP4 kodiert sind. Bei einer Optischen Dichte der Bakterien bei 600 nm von 0,7 wurde die

Expression des rekombinanten Proteins mit 1 mM IPTG induziert. Nach weiteren 4-6 Stunden Inkubation wurden die Bakterien 5 min bei 10 000xg sedimentiert.

5.3.2 Extraktion und Renaturierung rekombinanter Proteine

TBS-Puffer: 100 mM NaCl / 20 mM Tris-Base / 1 mM EDTA / pH 7,5

TBST: TBS / 0,05 % Tween 20

Lysispuffer: 8 M Harnstoff / 0,1 M Naphosphat / 0,01 M Tris/HCl, pH 8

Die sedimentierten Zellen (3800xg, 4°C, 10 min) wurden einmal in TBS-Puffer gewaschen, anschließend resuspendiert und mit der French Press bei 1200 PSI aufgeschlossen. Zur Reinigung der inclusion bodies wurde die Suspension abzentrifugiert (35 000xg, 4°C, 20 min) und in TBST, sowie in TBS-Puffer gewaschen. Nach dem Lösen der Proteine in Lysispuffer wurde erneut abzentrifugiert und der Überstand nach

Angaben des Herstellers auf die Affinitätsmatrix gebracht. Die Renaturierung ist in Kapitel 3.1.3 (Seite

41) beschrieben.

5.4 Chemische Reduktion rekombinanter Proteine

Der rekombinante Inhibitor wurde auf zwei verschiedene Weisen reduziert. Einmal mit Hilfe des Reduktionsmittels DTT in einem eigenständigen Assay, zum anderen aber auch durch Verwendung eines

β-

Mercaptoethanol-haltigen Probenpuffers bei der Vorbereitung der Proben für die nicht-reduzierende SDS-

PAGE.

Für die Reduktion mit DTT wurden 100 µl des renaturierten Proteins V0 (entspricht etwa 3 µg Protein) in

10 mM NaAc (pH 4,7) mit 4 µl 1 M Tris-HCl (pH 9,5, Endkonzentration 38 mM) auf pH 7 eingestellt und mit 4 mM DTT (Endkonzentration) versetzt. Die Inkubation erfolgte für 10 min bei Raumtemperatur oder bei 65

°C. Danach wurde die Reaktion durch Zugabe von 3 µl 1M Essigsäure abgestoppt und auf pH 5,0 gebracht. Das ist erforderlich, damit durch die Zugabe des Inhibitor-Ansatzes keine Änderung des pH-Werts im Hydrolyseansatz der Invertase-Aktivitätsmessung verursacht wird.

80

__________________________________________________________________________________________________________________

5.5 Protein-Präparation aus pflanzlichen Geweben

5.5.1 Herstellung von löslichen Protein-Rohextrakten

Protein-Extraktionspuffer: 30 mM MOPS / 250 mM Sorbitol / 10 mM MgCl2 / 10 mM KCl /

1 mM PMSF / pH 6

Das Pflanzenmaterial wurde in flüssigem Stickstoff schockgefroren und in einem vorgekühlten Mörser zusammen mit 1,5 ml Protein-Extraktionspuffer je g Frischgewicht sorgfältig zerkleinert. Nach dem Auftauen wurde der unlösliche Anteil in einer Beckman Kühlzentrifuge bei 4 °C und abzentrifugiert

(11500

×g, 4°C, 10 min). Die so gewonnenen Rohextrakte können für die Bestimmung der Invertase-

Aktivität herangezogen oder über ConA-Chromatographie und/oder Western Blot weiterverarbeitet werden.

5.5.2 ConA-Chromatographie

Mit Hilfe des Lektins ConcanavalinA wurden glykosylierte Proteine angereichert. Die gebundene Fraktion, die die glykosylierten Proteine enthält, wird als ConA

+

, die nicht bindende als ConA

-

bezeichnet.

Das Verfahren wurde nach Weil et al. (1994) durchgeführt.

5.6 Bestimmung der Invertaseaktivität

Hydrolysepuffer: 30 mM NaAc / 30 mM Saccharose / pH 4,7

Stoppuffer: 1 M Na2HPO4 / pH 7,2

Reaktionspuffer: 40 mM Triethanolamin / 8 mM MgSO4 / pH 7,5

NADP-Lösung: 30mM NADP / 1 % Na2HCO3

Die Invertase-Aktivität wird in zwei Schritten bestimmt. Bei der Hydrolyse wird durch die Aktivität der

Invertasen Saccharose zu Hexosen umgesetzt. Deren Konzentration wird in einem zweiten Schritt, im so genannten Reaktionsansatz, durch einen gekoppelten enzymatischen Assay photometrisch bestimmt.

Je nach erwarteter Aktivität werden 20-50 µl Proteinextrakt (Volumen v

H

) in die Hydrolyse eingesetzt.

Das Volumen wird mit Reaktionspuffer auf 300 µl (Volumen V

Hges

) aufgefüllt und das Gemisch anschlie-

ßend 60 min lang bei 37 °C inkubiert. Dann wird die Hydrolyse durch Zugabe von 30 µl Stoppuffer gestoppt. Dadurch erhöht sich das Volumen V

Hges

auf 330 µl. Die Ansätze werden anschließend für 5 min bei 95 °C denaturiert.

50 µl der Hydrolyse werden in einen Reaktionsansatz eingesetzt. Dazu werden weiterhin 15µl NADP-

Lösung und 2µl Hexokinase/Glucose-6-phosphat-Dehydrogenase (kombinierte Enzymsuspension, Boehringer Mannheim) pipettiert und mit Reaktionspuffer ad 1 ml ergänzt. Mit 15 µl ATP-Lösung (36 mM) wird die Reaktion gestartet. Nach 10 min wird die Extinktion des entstandenen NADPH im Photometer

81

__________________________________________________________________________________________________________________ bei 340 nm bestimmt und nach Abzug der Null-Kontrolle folgendermaßen in die umgesetzte Glukosemenge umgerechnet:

(

∆E

=

340nm

)

×

V

Rges

ε

×

d

×

v

R

×

V

Hges



Abbildung 6.6: Formel zur Berechnung der im Hydrolyse-Ansatz freigesetzten Glukose

N: Menge der im Hydrolyseansatz freigesetzten Glukose in µmol

∆E

340nm:

: Differenz der Extinktion von Reaktionsansatz und Null-Kontrolle

ε: Extinktionskoeffizient für NADPH bei 340 nm: 6200 µl/(cm × µmol) d: Schichtdicke der Küvette: 1 cm

V

V

Hges v

R

Rges

: Gesamtvolumen des Reaktionsansatzes in µl

: Gesamtvolumen des Hydrolyseansatzes in µl

: Volumen des in den Reaktionsansatz eingesetzten Hydrolyseansatzes in µl

5.7 Protein-Gelelektrophorese

5.7.1 SDS-PAGE

SDS-Probenpuffer: 250 mM Tris-Base / 9,2 % SDS / 20 % Mercaptoethanol / 40 % Glyzerin /

0,1 % Bromphenolblau / pH 6,8

Proteinstandards:

LMW Calibration KIT (Pharmacia, Freiburg): 14,4 / 20,1 / 30 / 43 / 67 / 94 kDa

MultiMark

Multi-Coloured Standard (Novex, USA): 4 / 6 / 17 / 22 / 30 / 42 / 60 /148 / 250 kDa

Die SDS-PAGE wurde nach Laemmli (1970) durchgeführt. Oben genannte Proteinstandards wurden als

Größenmarker verwendet. Die Gele wurden entweder zur Sichtbarmachung der Proteinbanden mit Coomassie gefärbt (siehe unten) oder für die Western Blot Analyse (siehe Kapitel 5.8, Seite 83) verwendet.

5.7.2 Coomassie-Färbung

Coomassie-Färbelösung: 45 % Methanol / 10 % Essigsäure / 0,25 % Coomassie Blue (Sigma,

Deisenhofen)

Entfärber: 20 % Methanol / 7 % Essigsäure

Aufbewahrungs-Lösung: 45 % Methanol / 2,5 % Glyzerin

Die Proteinbanden in SDS-Gelen wurden mit der Coomassie-Färbung sichtbar gemacht. Dazu wurde das

Gel nach der Elektrophorese 30-60 min lang in Färbelösung und anschließend in Entfärber so lange geschwenkt, bis der erwünschte Kontrast zwischen Proteinbanden und Hintergrund erreicht war. Die Gele können anschließend in Aufbewahrungs-Lösung äquilibriert und anschließend zwischen zwei Cellophan-

Folien getrocknet werden.

82

__________________________________________________________________________________________________________________

5.8 Western Blot Analyse

5.8.1 Antiseren

Antiserum gegen eine vakuoläre Invertase aus Beta vulgaris

Das polyklonale Antiserum αBv-VIwit wurde gegen ein 142 Aminosäuren langes rekombinantes Proteinfragment der wundinduzierten VI aus Beta vulgaris (siehe Abbildung 4.2 Seite 62) hergestellt und gegen das rekombinante Protein affinitätsgereinigt (von H. Rosenkranz zur Verfügung gestellt, Rosenkranz et

al. 2001). Es wurde in einer Endkonzentration von 1:100 000 eingesetzt.

Antiserum gegen Nt-VIF – Affinitätsreinigung

TBST: 100 mM NaCl / 20 mM Tris-Base / 1 mM EDTA / 0,05 % Tween 20 / pH 7,5

Block-Lösung: TBST / 5 % Magermilchpulver

Glycinpuffer: 0,1 M Glycin / 0,5M NaCl / 0,05 % Tween20 / pH 2,8

Antikörper-Lösung: 300 µl spezifisches Antiserum / 300 µl 10 % BSA / ad 30 ml TBST

Neutralisations-Lösung: 1 M Tris / pH 8,1

Zur Reduktion unspezifischer Banden wurde das polyklonale Antiserum gegen Nt-VIF gegen rekombinantes Protein (V0-Konstrukt) affinitätsgereinigt. Die Methode basiert auf einer Anleitung nach Tang

(1993).

Zur Vorbereitung der Antigen-Membran wurden ca. 50 µg denaturierend aufgereinigtes V0-Protein in einem 14%igen PAA-Gel aufgetrennt und auf eine PVDF-Membran geblottet. Ein schmaler Streifen am

Rand der Membran wurde mit Amidoschwarz angefärbt (siehe Kapitel 5.8.3, Seite 84) und die Inhibitor-

Bande als stärkste Bande bei etwa 20 kD identifiziert. Auf dieser Höhe wurde auf dem nicht gefärbten

Teil des Blots ein Streifen von ca. 1 cm Breite ausgeschnitten.

Für die eigentliche Affinitätsreinigung wurde der Membranstreifen zunächst für 30 min in Block-Lösung geblockt, 3 mal für 5 min in TBST gewaschen und schließlich mit der Antikörper-Lösung für 2 h inkubiert. Nach einem weiteren Waschschritt wurde zweimal mit 12 ml eisgekühltem Glycinpuffer eluiert und das Eluat sofort mit jeweils 1,8 ml Neutralisations-Lösung versetzt, mit TBST ad 30 ml aufgefüllt und mit 30 µl NaN3 konserviert. Man erhält ein affinitätsgereinigtes Antiserum in einer Verdünnung von

1:100. Es wird in dieser Arbeit als

αNt-VIF bezeichnet.

5.8.2 Western Blot Verfahren

TBST: 100 mM NaCl / 20 mM Tris-Base / 1 mM EDTA / 0,05 % Tween 20 / pH 7,5

Block-Lösung: TBST / 5 % Magermilchpulver

Erstantikörper: TBST / 1 % Magermilchpulver / 1 mM NaN3 / spezifisches Antiserum (siehe oben)

sekundärer Antikörper: Anti-rabbit-IgG, mit Alkalische-Phosphatase gekoppelt, Verdünnung

1:20 000 in 1 % Magermilchpulver/TBST

Für den Proteintransfer aus dem SDS-Gel auf eine PVDF-Membran (Immobilon P, Millipore, Eschborn) wurde das semi-dry Elektro-Blot-Verfahren angewandt, welches nach Towbin et al. (1979) verändert ist.

Zur genauen Durchführung siehe Weil und Rausch (1994).

83

__________________________________________________________________________________________________________________

Die geblottete Membran wird 2 mal 5 min in TBST gewaschen, dann 30 min in Block-Lösung geblockt und anschließend mindestens 1 h lang mit dem spezifischen Antikörper inkubiert (siehe oben). Nach erneutem Waschen für 3 mal 5 min in TBST wird die Membran 1,5 h lang in der Lösung mit dem sekundären Antikörper geschwenkt und auf die gleiche Weise gewaschen. Die Signale wurden nach SuperSignal

Western Blotting Kit (Pierce, Rockford) entwickelt.

5.8.3 Amidoschwarzfärbung

Amidoschwarz-Färbelösung: 0,1 % Amidoschwarz (Naphthol Blue Black, Sigma, Deisenhofen) /

20 % Methanol / 7 % Essigsäure

Entfärber: 20 % Methanol / 7 % Essigsäure

Nicht mehr für Western Blot Analysen benötigte Membranen wurden zur Rückfärbung einige Minuten in

Amidoschwarzlösung geschwenkt und mit Entfärber bis zur gewünschten Farbintensität entfärbt.

5.9 Sequenzanalysen

Die Sequenzen wurden auf dem EXPASY-Server (Expert Protein Analysis System, www.expasy.org/tools) des Schweizer Instituts für Bioinformatik (SIB) analysiert.

Insbesondere wurden die Programme CLUSTALW und GAP mit Standardeinstellungen benutzt

84

Literaturverzeichnis

__________________________________________________________________________________________________________________

6. L

ITERATURVERZEICHNIS

Alberto F, Bignon C, Sulzenbacher G,

Henrissat B, Czjzek M (2004) The threedimensional structure of invertase (betafructosidase) from Thermotoga maritima reveals a bimodular arrangement and an evolutionary relationship between retaining and inverting glycosidases. J Biol Chem 279: 18903-10

Almeida DPF, Huber DH (1999) Apoplastic pH and inorganic ion levels in tomato fruit: a potential means for regulation of cell wall metabolism during ripening. Physiologia

Plantarum 105: 506-512

Amor Y, Haigler CH, Johnson S, Wainscott

M, Delmer DP (1995) A membrane-associated form of sucrose synthase and its potential role in synthesis of cellulose and callose in plants. Proc

Natl Acad Sci U S A 92: 9353-7

Andersen MN, Asch F, Wu Y, Jensen CR,

Naested H, Mogensen VO, Koch KE (2002)

Soluble invertase expression is an early target of drought stress during the critical, abortionsensitive phase of young ovary development in maize. Low Water Potential Disrupts

Carbohydrate Metabolism in Maize (Zea mays

L.) Ovaries. Plant Physiol 130: 591-604

Arai M, Mori H, Imaseki H (1992) Cloning and

Sequence of cDNAs for an Intracellular Acid

Invertase from Etiolated Hypocotyls of Mung

Bean and Expression of the Gene During

Growth of Seedlings. Plant & Cell Physiology 33:

245-252

Bate NJ, Niu X, Wang Y, Reimann KS,

Helentjaris TG (2004) An Invertase Inhibitor from Maize Localizes to the Embryo

Surrounding Region during Early Kernel

Development. Plant Physiol 134: 246-54

Bednarek SY, Raikhel NV (1992) Intracellular trafficking of secretory proteins. Plant Mol Biol

20: 133-150

Benhamou N, Grenier J, Chrispeels MJ

(1991) Accumulation of Beta Fructosidase in the

Cell Walls of Tomato Roots Following Infection by a Fungal Wilt Pathogen. Plant Physiol 97:

739-750

Billet EE, Billet MA, Burnett JM (1977)

Stimulation of maize invertase activity following infection by Ustilago maydis. Phytochemistry 16:

Blee KA, Anderson AJ (1998) Regulation of arbuscule formation by carbon in the plant. Plant

Journal 16: 523-530

Burch LR, Davies HV, Cuthbert EM, Machray

GC, Hedley P, Waugh R (1992) Purification of soluble invertase from potato. Phytochemistry 6:

1901-1904

Burton WG (1969) The sugar balance in some british potato varieties durng storage. II. The effects of tuber age, previous storage temperature, and intermittent refrigeration upon low-temperature sweetening. Eur Potato J 12:

81-95

Camardella L, Carratore V, Ciardiello MA,

Servillo L, Balestrieri C, Giovane A (2000)

Kiwi protein inhibitor of pectin methylesterase: amino-acid sequence and structural importance of two disulfide bridges. Eur J Biochem 267:

4561-5

Carrari F, Fernie A, Iusem N (2004) Heard it through the grapevine?ABA and sugar crosstalk: the ASR story. TIPS 9: 57-59

Cheng WH, Taliercio EW, Chourey PS (1999)

Sugars modulate an unusual mode of control of the cell-wall invertase gene (Incw1) through its 3' untranslated region in a cell suspension culture of maize. Proc Natl Acad Sci U S A 96: 10512-7

Cheng W-H, Chourey PS (1999) Genetic evidence that invertase-mediated release of hexoses is critical for appropriate carbon partitioning and normal seed development in maize. Theor Appl Genet 98: 485-495

Cheng W-H, Taliercio Earl W, Chourey Prem

S (1996) The Miniature1 seed locus of maize encodes a cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell 8: 971-983

Clancy FG, Coffey MG (1980) Patterns of translocation, changes in invertase activity, and polyol formation in susceptible and resistant flax infected with the rust fungus Melampsora lini.

Physiol Mol Plant Pathol 17: 41-52

De Coninck B, Le Roy K, Francis I, Clerens S,

Vergauwen R, Halliday AM, Smith SM, Van

Laere A, Van den Ende W (2005) Arabidopsis

AtcwINV3 and 6 are not invertases but are fructan exohydrolases (FEHs) with different substrate specificities. Plant, Cell and

Environment 28: 432

Dickinson CD, Altabella T, Chrispeels MJ

(1991) Slow-Growth Phenotype of Transgenic

Tomato Expressing Apoplastic Invertase. Plant

Physiol 95: 420-425

85

Literaturverzeichnis

__________________________________________________________________________________________________________________

Edelman J, Jefford TG (1968) The mechnism of fructosan metabolism in plants as exemplifid in Helianthuus tuberosus. New Phytologist 67:

517-531

Ehness R, Ecker M, Godt DE, Roitsch T

(1997) Glucose and Stress Independently

Regulate Source and Sink Metabolism and

Defense Mechanisms via Signal Transduction

Pathways Involving Protein Phosphorylation.

Plant Cell 9: 1825-1841

Ehness R, Roitsch T (1997) Co-ordinated induction of mRNAs for extracellular invertase and a glucose transporter in Chenopodium

rubrum by cytokinins. Plant J 11: 539-48

Eschrich W (1984) Untersuchungen zur

Regulation des Assimilattransports. Ber Dt Bot

Ges 97: 5-14

Fotopoulos V, Gilbert MJ, Pittman JK,

Marvier AC, Buchanan AJ, Sauer N, Hall JL,

Williams LE (2003) The monosaccharide transporter gene, AtSTP4, and the cell-wall invertase, Atbetafruct1, are induced in

Arabidopsis during infection with the fungal biotroph Erysiphe cichoracearum. Plant Physiol

132: 821-9

Fridman E, Zamir D (2003) Functional divergence of a syntenic invertase gene family in tomato, potato, and Arabidopsis. Plant Physiol

131: 603-9

Gallagher JA, Pollock CJ (1998) Isolation and characterization of a cDNA clone from Lolium

temulentum L. encoding for a sucrose hydrolytic enzyme which shows alkaline/neutral invertase activity. J Exp Bot 49: 789-795

Geigenberger P, Stitt M (1993) Sucrose synthase catalyses a readily reversible reaction in vivo in developing potato tubers and other plant tissues. Plant Physiol 189: 329-339

Giovane A, Servillo L, Balestrieri C, Raiola A,

D´Avino R, Tamburrini M, Ciardiallo MA,

Camardella L (2004) Pectin methylesterase inhibitor. Biochimica et Biophysica Acta 1696:

245-252

Godt DE, Roitsch T (1997) Regulation and tissue-specific distribution of mRNAs for three extracellular invertase isoenzymes of tomato suggests an important function in establishing and maintaining sink metabolism. Plant Physiol

115: 273-82

Goetz M, Godt DE, Guivarch A, Kahmann U,

Chriqui D, Roitsch T (2001) Induction of male sterility in plants by metabolic engineering of the carbohydrate supply. Proc Natl Acad Sci U S A

98: 6522-7

Goetz M, Godt DE, Roitsch T (2000) Tissuespecific induction of the mRNA for an extracellular invertase isoenzyme of tomato by brassinosteroids suggests a role for steroid hormones in assimilate partitioning. Plant

Journal 22: 515-22

Greiner S (1999) Invertase-Inhibitoren

(Inhibitorische Invertasebindeproteine) in höheren Pflanzen: Eine neue Genfamilie.

Dissertation, Ruprecht-Karls-Universität

Heidelberg

Greiner S, Köster U, Lauer K, Rosenkranz H,

Vogel R, Rausch T (2000) Plant invertase inhibitors: Expression in cell culture and during plant development. Aust J Plant Phys 27: 807-

814

Greiner S, Krausgrill S, Rausch T (1998)

Cloning of a tobacco apoplasmic invertase inhibitor. Proof of function of the recombinant protein and expression analysis during plant development. Plant Physiol 116: 733-42

Greiner S, Rausch T, Sonnewald U, Herbers

K (1999) Ectopic expression of a tobacco invertase inhibitor homolog prevents coldinduced sweetening of potato tubers. Nat

Biotechnol 17: 708-11

Greiner S, Weil M, Krausgrill S, Rausch T

(1995) A tobacco cDNA coding for cell-wall invertase. Plant Physiol 108: 825-6

Grunze N (2001) Posttranslationale

Regulationsmechanismen der

Zellwandinvertasen im sich entwickelnden

Maiskorn. Diplomarbeit, Ruprecht- Karls-

Universität Heidelberg

He Y, Fukushige H, Hildebrand DF, Gan S

(2002) Evidence supporting a role of jasmonic acid in Arabidopsis leaf senescence. Plant

Physiol 128: 876-84

Heineke D, Sonnewald U, Büssis D, Günter G,

Leidreiter K, Wilke I, Raschke K, Willmitzer L,

Heldt HW (1992) Apoplastic expression of yeastderived invertase in potato. Plant Physiol 100:

301-8

Hellwege EM, Czapla S, Jahnke A, Willmitzer

L, Heyer AG (2000) Transgenic potato

(Solanum tuberosum) tubers synthesize the full spectrum of inulin molecules naturally occurring in globe artichoke (Cynara scolymus) roots. Proc

Natl Acad Sci U S A 97: 8699-704

Hendry G (1993) Evolutionary origins and natural functions of fructans. A climatological, biogeographic and mechanistic appraisal. New

Phytologist 123: 3-14

Henrissat B (1991) A classification of glycosyl

86

Literaturverzeichnis

__________________________________________________________________________________________________________________ hydrolases based on amino acid sequence similarity. Biochem J 280: 309-316

Herbers K, Meuwly P, Frommer Wolf B,

Metraux J-P, Sonnewald U (1996) Systemic acquired resistance mediated by the ectopic expression of invertase: Possible hexose sensing in the secretory pathway. Plant Cell 8:

793-803

Heyer AG, Raap M, Schroeer B, Marty B,

Willmitzer L (2004) Cell wall invertase expression at the apical meristem alters floral, architectural, and reproductive traits in

Arabidopsis thaliana. The Plant Journal 39: 161-

169

Higgins D, Thompson J, Gibson T,

Thompson JD, Higgins DG, Gibson TJ (1994)

CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic

Acids Res 22: 4673-4680

Hill LM, Morley-Smith ER, Rawsthorne S

(2003) Metabolism of sugars in the endosperm of developing seeds of oilseed rape. Plant

Physiol 131: 228-236

Hothorn M, Bonneau F, Stier G, Greiner S,

Scheffzek K (2003) Bacterial expression, purification and preliminary X-ray crystallographic characterization of the invertase inhibitor Nt-CIF from tobacco. Acta Cryst D59:

2279-82

Hothorn M, D'Angelo I, Marquez JA, Greiner

S, Scheffzek K (2004-A) The invertase inhibitor

Nt-CIF from tobacco: a highly thermostable fourhelix bundle with an unusual N-terminal extension. J Mol Biol 335: 987-95

Hothorn M, Wolf S, Aloy P, Greiner S,

Scheffzek K (2004-B) Structural insights into the target specificity of plant invertase and pectin methylesterase inhibitory proteins. Plant

Cell 16: 3437-47

Husain S, Thomas B, Kingston-Smith A,

Foyer C (2001) Invertase protein, but not activity, is present throughout development of

Lycopersicon esculentum and L. pimpinellifolium fruit. New Phytologist 150: 73-81

Hwang BK, Kim KD, Kim YB (1989)

Carbohydrate composition and acid invertase activity in rice leaves infected with Pyricularia

oryzae. J Phytopathol 125: 124-132

Isla MI, Vattuone MA, Ordonez RM,

Sampietro AR (1999) Invertase activity associated with the walls of Solanum tuberosum tubers. Phytochemistry 50: 525-34

Isla MI, Vattuone MA, Sampietro AR (1991)

Modulation of potato invertase activity by fructose. Phytochemistry 30: 423-426

Jang J-C, Leon P, Zhou L, Sheen J (1997)

Hexokinase as a sugar sensor in higher plants.

Plant Cell 9: 5-19

Jang J-C, Sheen J (1997) Sugar sensing in higher plants. TIPS 2: 208-214

Jaynes TA, Nelson OE (1971) An invertase inactivator in maize endosperm and factors affecting inactivation. Plant Physiol 47: 629-634

Kamtekar S, Hecht MH (1995) Protein Motifs 7.

The four-helix bundle: what determines a fold?

FASEB Journal 9: 1013–1022

Kim JY, Mahe A, Brangeon J, Prioul JL (2000)

A maize vacuolar invertase, IVR2, is induced by water stress. Organ/tissue specificity and diurnal modulation of expression. Plant Physiol 124: 71-

84

Kingston-Smith AH, Pollock CJ (1996) Effect of acid invertase localization on carbon metabolism in mature leaves. J Exp Bot 47:

1308-1309

Kingston-Smith AH, Walker RP, Pollock CJ

(1999) Invertase in leaves: conundrum or control point? J Exp Bot 50: 735-743

Klann EM, Chetelat RT, Bennett AB (1993)

Expression of acid invertase gene controls sugar composition in tomato (Lycopersicon) fruit. Plant

Physiol 103: 863-70

Klann EM, Hall B, Bennett AB (1996)

Antisense acid invertase (TIV1) gene alters soluble sugar composition and size in transgenic tomato fruit. Plant Physiol 112: 1321-30

Koch KE, Wu, Y., Xu, J. (1996) Sugar and metabolic regulation of genes for sucrose metabolism: potential influence of maize sucrose synthase and soluble invertase responses on carbon partitioning and sugar sensing. J Exp Bot

47: 1179-1185

Koch KE (1996) Carbohydrate modulated gene expression in plants. Annu Rev Plant Physiol

Plant Mol Biol 47: 509-540

Krishnan H, Pueppke, SG (1990) Cherry fruit invertase: partial purification, characterization and activity during fruit development. J Plant

Phys 135: 662-666

Kubo K (1995) Effect of incubation of solutions of proteins containing dodecyl sulfate on the cleavage of peptide bonds in boiling. Anal

Biochem 225: 351-353

87

Literaturverzeichnis

__________________________________________________________________________________________________________________

Laemmli UK (1970) Cleavage of structural proteins during assembly of the head of bakteriophage T4. Nature 227: 680-685

Lara MEB, Garcia M-CG, Fatima T, Ehness R,

Lee TK, Proels R, Tanner W, Roitsch T (2004)

Extracellular Invertase Is an Essential

Component of Cytokinin-Mediated Delay of

Senescence. Plant Cell 16: 1276-87

Lauer K (1999) Das Invertase-Inhibitor-Homolog

Nt-inhh aus Tabak. Diplomarbeit, Ruprecht-

Karls-Universität Heidelberg

Lee HS, Sturm A (1996) Purification and characterization of neutral and alkaline invertase from carrot. Plant Physiol 112: 1513-22

Leigh RA, Rees T, Fuller WA, Banfield J

(1979) The location of acid invertase activity and sucrose in the vacuoles of storage roots of beetroot (Beta vulgaris). Biochem J 178: 539-47

Lerchl J, Geigenberger P, Stitt M, Sonnewald

U (1995) Impaired photoassimilate partitioning caused by phloem-specific removal of pyrophosphate can be complemented by a phloem-specific cytosolic yeast-derived invertase in transgenic plants. Plant Cell 7: 259-

70

Link M, Rausch T, Greiner S (2004) In

Arabidopsis thaliana, the invertase inhibitors

AtC/VIF1 and 2 exhibit distinct target enzyme specificities and expression profiles. FEBS

Letters 573: 105-9

Lüscher M, Erdin C, Sprenger N,

Hochstrasser U, Boller T, Wiemken A (1996)

Inulin synthesis by a combination of purified fructosyltransferases from tubers of Helianthus

tuberosus. FEBS Letters 385: 39-42

Mäkelä P, McLaughlin JE, Boyer JS (2005)

Imaging and Quantifying Carbohydrate

Transport to the Developing Ovaries of Maize.

Ann Bot 96: 939-949

Miller ME, Chourey PS (1992) The Maize

Invertase-Deficient Miniature-1 Seed Mutation Is

Associated with Aberrant Pedicel and

Endosperm Development. Plant Cell 4: 297-305

Milner ID, Ho LC, Hall JL (1995) Properties of proton sugar-transport at the tonoplast of tomato

(Lycopersicon esculentum) fruit. Physiologia

Plantarum 94: 399-410

Morris D, Arthur, ED (1984) Invertase and auxin-induced elongation in internodal segments of Phaseolus vulgaris. Phytochemistry 23:

Müller-Thurgau (1882) Über Zuckeranhäufung in Pflanzentheilen in Folge niederer Temperatur.

Landwirtsch Jahrb Schweiz 11: 751-828

Münch E (1930) Die Stoffbewegungen in der

Pflanze. Gustav Fischer Verlag, Jena

Nguyen-Quoc B, Foyer CH (2001) A role for

'futile cycles' involving invertase and sucrose synthase in sucrose metabolism of tomato fruit.

J Exp Bot 52: 881-889

Obenland DM, Simmen U, Boller T, Wiemken

A (1993) Purification and characterization of three soluble invertases from barley (Hordeum

vulgare L.) leaves. Plant Physiol 101: 1331-9

Ohyama A, Ito H, Sato T, Nishimura S, Imai T,

Hirai M (1995) Suppression of acid invertase activity by antisense RNA modifies the sugar composition of tomato fruit. Plant & Cell

Physiology 369-367:

Pelleschi S, Guy S, Kim JY, Pointe C, Mahe

A, Barthes L, Leonardi A, Prioul JL (1999)

Ivr2, a candidate gene for a QTL of vacuolar invertase activity in maize leaves. Gene-specific expression under water stress. Plant Mol Biol

39: 373-80

Pfister M (2002) Ektopische Expression von Nt-

CIF und Nt-VIF in Kartoffelpflanzen:

Posttranslationale Inhibition der wundinduzierten

ZWI- und VI-Aktivitäten zur Aufklärung ihrer in

vivo-Funktionen. Dissertation, Ruprecht-Karls-

Universität Heidelberg

Pressey R (1966) Separation and properties of potato invertase and invertase inhibitor. Arch

Biochem Biophys 113: 667-74

Proels RK, Hause B, Berger S, Roitsch T

(2003) Novel mode of hormone induction of tandem tomato invertase genes in floral tissues.

Plant Mol Biol 52: 191-201

QIAGEN GmbH, The QIAexpressionist, A handbook for high-level expression and purification of 6xHis-tagged proteins, 5 th

03/2001

edition

Raiola A, Camardella L, Giovane A, Mattei B,

De Lorenzo G, Cervone F, Bellincampi D

(2004) Two Arabidopsis thaliana genes encode functional pectin methylesterase inhibitors.

FEBS Lett 557: 199-203

Ramloch-Lorenz K, Knudsen S, Sturm A

(1993) Molecular characterization of the gene for carrot cell wall beta-fructosidase. Plant J 4: 545-

54

Ranwala A, Baird, WV, Miller, WB (1998)

Organ-specific localization and molecular properties of three soluble invertases from Lilium

longiflorum flower buds. Physiologia Plantarum

103: 551-559

Rausch T, Greiner, S. (2004) Plant protein inhibitors of invertases. Biochimica et Biophysica

Acta 1696: 253-261

88

Literaturverzeichnis

__________________________________________________________________________________________________________________

Roitsch T (1999) Source-sink regulation by sugar and stress. Curr Opin Plant Biol 2: 198-

206

Roitsch T, Balibrea ME, Hofmann M, Proels

R, Sinha AK (2003) Extracellular invertase: key metabolic enzyme and PR protein. J Exp Bot 54:

513-24

Roitsch T, Bittner M, Godt DE (1995) Induction of apoplastic invertase of Chenopodium rubrum by D-glucose and a glucose analog and tissuespecific expression suggest a role in sink-source regulation. Plant Physiol 108: 285-94

Rosenkranz H, Vogel R, Greiner S, Rausch T

(2001) In wounded sugar beet (Beta vulgaris L.) tap-root, hexose accumulation correlates with the induction of a vacuolar invertase isoform. J

Exp Bot 52: 2381-5

Ross HA, McRae D, Davies HV (1996)

Sucrolytic enzyme activities in cotyledons of the

Faba bean. Developmental changes and purification of alkaline invertase. Plant Physiol

111: 329-338

Samotus B, Niedzwiedz M, Kolodziej Z, Leja

M, Czajkowska B (1974) Storage and reconditioning of tubers of polish potato varieties and strains. Influence of storage temperature on sugar level in potato tubers of different varieties and strains. Potato Res 17: 84-81

Sampietro AR, Vattuone MA, Prado FE (1980)

A regulatory invertase from sugar cane leafsheaths. Phytochemistry 19: 1637-1642

Sander A, Krausgrill S, Greiner S, Weil M,

Rausch T (1996) Sucrose protects cell wall invertase but not vacuolar invertase against proteinaceous inhibitors. FEBS Lett 385: 171-5

Scognamiglio MA, Ciardiello MA, Tamburrini

M, Carratore V, Rausch T, Camardella L

(2003) The plant invertase inhibitor shares structural properties and disulfide bridges arrangement with the pectin methylesterase inhibitor. J Protein Chem 22: 363-9

Smeekens S (1998) Sugar regulation of gene expression in plants. Curr Opin Plant Biol 1:

230-4

Sonnewald U, Brauer M, von Schaewen A,

Stitt M, Willmitzer L (1991) Transgenic tobacco plants expressing yeast-derived invertase in either the cytosol, vacuole or apoplast: a powerful tool for studying sucrose metabolism and sink/source interactions. Plant Journal 1:

95-106

Sprenger N, Bortlik K, Brandt A, Boller T,

Wiemken A (1995) Purification, cloning, and functional expression of sucrose:fructan-6fructosyltransferase, a key enzyme of fructan synthesis in barley. Proc Natl Acad Sci U S A

92: 11625–11656

Sprenger N, Bortlik K, Brandt A, Boller T,

Wiemken A (1999) Purification, cloning and functional expression of sucrose:fructan 6fructosyltransferase, a key enzyme of fructan synthesis in barley. Proc Natl Acad Sci U S A

92: 11652-11656

Sturm A (1996) Molecular characterization and functional analysis of sucrose-cleaving enzymes in carrot (Daucus carota L.). J Exp Bot 47: 1187-

1192

Sturm A (1999) Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiol 121: 1-8

Sturm A, Chrispeels MJ (1990) cDNA cloning of carrot extracellular beta-fructosidase and its expression in response to wounding and bacterial infection. Plant Cell 2: 1107-19

Sturm A, Tang GQ (1999) The sucrosecleaving enzymes of plants are crucial for development, growth and carbon partitioning.

Trends Plant Sci 4: 401-407

Tang WJ (1993) Blot affinity purification of antibodies. Methods in Cell Biology 37: 95-104

Tang GQ, Luscher M, Sturm A (1999)

Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell

11: 177-89

Tang X, Ruffner HP, Scholes JD, Rolfe SA

(1996) Purification and characterization of soluble invertases from leaves of Arabidopsis

thaliana. Planta 198: 17-23

Towbin H, Staehelin T, Gordon J (1979)

Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl

Acad Sci U S A 76:

Trouverie J, Chateau-Joubert C, Thevenot C,

Jacquemot M-P, Prioul J-L (2004) Regulation of vacuolar invertase by abscisic acid or glucose in leaves and roots from maize plantlets. Planta

219: 894-905

Tymowska-Lalanne Z, Kreis M (1998) The plant invertases: Physiology, biochemistry and molecular biology. Advances in Botanical

Research 28: 71-117

89

Literaturverzeichnis

__________________________________________________________________________________________________________________

Unger C, Hardegger M, Lienhard S, Sturm A

(1994) cDNA cloning of carrot (Daucus carota) soluble acid beta-fructofuranosidases and comparison with the cell wall isoenzyme. Plant

Physiol 104: 1351-7

Unger C, Hofsteenge J, Sturm A (1992)

Purification and characterization of a soluble beta-fructofuranosidase from Daucus carota.

Eur J Biochem 204: 915-21

Van den Ende W, Michiels A, De Roover J,

Verhaert P, Van Laere A (2000) Cloning and functional analysis of chicory root fructan 1exohydrolase I (1-FEH I): a vacuolar enzyme derived from a cell-wall-invertase ancestor?

Mass fingerprint of the 1-FEH I enzyme. The

Plant Journal 24: 447-456

Verhaest M, Van den Ende W, Roy KE, De

Ranter CJ, Van Laere A, Rabijns A (2005) Xray diffraction structure of a plant glycolsyl hydrolase family 32 protein: fructan 1exohydrolase IIa of Cichorium intybus. Plant

Journal 41: 400-411

Vijn I, Smeekens S (1999) Fructan: more than a reserve carbohydrate? Plant Physiol 120: 351-

60

Vijn I, van Dijken A, Luscher M, Bos A,

Smeets E, Weisbeek P, Wiemken A,

Smeekens S (1998) Cloning of sucrose:sucrose

1-fructosyltransferase from onion and synthesis of structurally defined fructan molecules from sucrose. Plant Physiol 117: 1507-13

Vilhar B, Kladnik A, Blejec A, Chourey PS,

Dermastia M (2002) Cytometrical evidence that the loss of seed weight in the miniature1 seed mutant of maize is associated with reduced mitotic activity in the developing endosperm.

Plant Physiol 129: 23-30

von Schaewen A, Stitt M, Schmidt R,

Sonnewald U, Willmitzer L (1990) Expression of a yeast-derived invertase in the cell wall of tobacco and Arabidopsis plants leads to accumulation of carbohydrate and inhibition of photosynthesis and strongly influences growth and phenotype of transgenic tobacco plants.

Embo J 9: 3033-44

Vorster DJ, Botha FC (1998) Partial purification and characterisation of sugarcane neutral invertase. Phytochemistry 49: 651-5

Weil M, Krausgrill S, Schuster A, Rausch T

(1994) A 17-kDa Nicotiana tabacum cell-wall peptide acts as an in-vitro inhibitor of the cellwall isoform of acid invertase. Planta 193: 438-

45

Weil M, Rausch T (1990) Cell Wall Invertase in

Tobacco Crown Gall Cells Enzyme Properties and Regulation by Auxin. Plant Physiol 94:

1575-1581

Winter H, Huber JL, Huber SH (1997)

Membrane association of sucrose synthase: changes during the graviresponse and possible control by protein phosphorylation. FEBS Lett

420: 151-155

Wobus U, Weber H (1999) Sugars as signal molecules in plant seed development. Biol

Chem 380: 937-44

Wolf S, Grsic-Rausch S, Rausch T, Greiner S

(2003) Identification of pollen-expressed pectin methylesterase inhibitors in Arabidopsis. FEBS

Lett 555: 551-5

Wright JP, Fisher DB (1980) Direct

Measurement of Sieve Tube Turgor Pressure

Using Severed Aphid Stylets. Plant Physiol 65:

1133-1135

Wu LL, Mitchell JP, Cohn NS, Kaufman PB

(1993) Gibberellin (GA3) enhances cell wall invertase activity and mRNA levels in elongating dwarf pea (Pisum sativum) shoots. Int J Plant

Sci 154: 280-9

Xu J, Avigne WT, McCarty DR, Koch KE

(1996) A Similar Dichotomy of Sugar Modulation and Developmental Expression Affects Both

Paths of Sucrose Metabolism: Evidence from a

Maize Invertase Gene Family. Plant Cell 8:

1209-1220

Yamaguchi H, Uchida M (1996) A chaperonelike function of intramolecular high-mannose chains in the oxidative refolding of bovine pancreatic RNase B. J Biochem (Tokyo) 120:

474-7

Zeng Y, Wu Y, Avigne WT, Koch KE (1999)

Rapid repression of maize invertases by low oxygen. Invertase/sucrose synthase balance, sugar signaling potential, and seedling survival.

Plant Physiol 121: 599-608

Zhou D, Mattoo A, Li N, Imaseki H, Solomos

T (1994) Complete nucleotide sequence of potato tuber acid invertase cDNA. Plant Physiol

106: 397-8

Zhou L, Jang JC, Jones TL, Sheen J (1998)

Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucoseinsensitive mutant. Proc Natl Acad Sci U S A 95:

10294-9

Zhu JY, Albert HH, Moore PH (2000)

Differential expression of soluble acid invertase genes in the shoots of high-sucrose and lowsucose species of Saccharum and their hybrids.

Aust J Plant Phys 27: 193-199

90

Literaturverzeichnis

__________________________________________________________________________________________________________________

Zhu YJ, Komor E, Moore PH (1997) Sucrose

Accumulation in the Sugarcane Stem Is

Regulated by the Difference between the

Activities of Soluble Acid Invertase and Sucrose

Phosphate Synthase. Plant Physiol 115: 609-

616

Zinselmeier C, Jeong BR, Boyer JS (1999)

Starch and the control of kernel number in maize at low water potentials. Plant Physiol 121: 25-36

Zinselmeier C, Westgate ME, Schussler JR,

Jones RJ (1995) Low Water Potential Disrupts

Carbohydrate Metabolism in Maize (Zea mays

L.) Ovaries. Plant Physiol 107: 385-391

Zrenner R, Salanoubat M, Willmitzer L,

Sonnewald U (1995) Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum

L.). Plant Journal 7: 97-107

Zrenner R, Schuler K, Sonnewald U (1996)

Soluble acid invertase determines the hexoseto-sucrose ratio in cold-stored potato tubers.

Planta 198: 246-52

91

Anhang

__________________________________________________________________________________________________________________

7. A

NHANG

7.1 Abkürzungsverzeichnis

3-OMG

β-M

AS

Bv

3-O-Methyl-Glukose

β-Mercaptoethanol, ein Reduktionsmittel

Antiserum

Beta vulgaris, botanischer Name der Zuckerrübe

IPTG

Le

MCS

MMP

NAI

Nt

Nt-CIF

Nt-VIF

C, Cys cDNA

Cystein komplementäre DNA (engl.: complementary DNA)

DTT

Dc

E.coli

FG

FGÄ

Dithiothreitol, ein Reduktionsmittel

Daucus carota, botanischer Name der Karotte

Escherichia coli, ein Bakterium

Frischgewicht (eines Gewebes vor der Extraktion)

Frischgewichtsäquivalente; die Menge an Frischmaterial, die der Präparation zu

Grunde liegt

Fruktose Frk

GH32, GH43 etc. sequenzbasierte Familien von Glykosid-Hydrolasen

Glk Glukose

GSH Glutathion, reduzierte Form

His Histidin, eine Aminosäure

Affinitätschromatographie

Isopropylthiogalactosid

Lycopersicon esculentum, botanischer Name der Tomate multiple Klonierungsstelle (engl: muliple cloning site)

Magermilchpulver

Neutrale und Alkalische Invertase(n)

Nicotiana tabacum, botanischer Name des Tabak

Nicotiana tabacum – apoplastischer (engl.: cell wall) Inhibitor der

β-Fruktosidasen

Nicotiana tabacum - vakuolärer Inhibitor der

β-Fruktosidasen

92

SI

UTR

VI

Anhang

__________________________________________________________________________________________________________________

ORF

PAGE

PMSF

PT5

RLM-RACE

RT

S, Ser offenes Leseraster eines Gens (engl.: open reading frame)

Polyacrylamidgelelektrophorese

Phenylmethylsulfonylfluorid, ein Proteaseinhibitor

Phagenpromotor, gentechnisch in bakteriellen Promotoren eingesetzt

RNA Ligase vermittelte schnelle Amplifizierung von cDNA-Enden

(engl.: RNA ligase-mediated rapid amplification of cDNA ends)

Raumtemperatur

Serin

Saure Invertase(n) nicht translatierter Bereich der mRNA (engl.: untranslated region)

Vakuoläre Invertase

7.2 Originaldaten

7.2.1 Proteinkonzentration der Inhibitor-Mutanten und -Chimären

Konstrukt

V0

V1

V2

V3

V4

V9

V10

V11

V12

VIF(N)::CIF(C)

CIF(N)::VIF(C)

Messung 1 Messung 2 Messung 3 Messung 4 Durchschnitt

Standardabweichung

32 30 31 --- 31 1,0

12 11 12 --- 12 0,6

11 9 10 --- 10 0,7

9 --- --- --- 9 ---

2 --- --- --- 2 ---

438 434 447 --- 440 6,8

256 260 271 --- 262 7,8

14 13 13 --- 13 0,9

481 447 426 --- 451 27,4

101 96 94 97 97 2,9

175 173 164 158 168 7,9

Abbildung 7.1: Proteinkonzentration der Inhibitormutanten nach Bradford

Dargestellt sind die Ergebnisse aus 3, bzw. 4 unabhängigen Messungen (bei V3 und V4 Einfachmessung aufgrund der geringen Proteinmenge). Außerdem sind der Durchschnitt aller Messungen und die

Standardabweichung angegeben. Die Zahlen geben die Konzentration in ng/µl an.

93

Anhang

__________________________________________________________________________________________________________________

7.2.2 Elutionsprofil der Inhibitormutanten

V0 V1 V2 V3 V9 V10 V11 V12

E % E % E % E % E % E % E % E %

o Inh 0,181 100 0,568 100 0,568 100 0,410 100 0,425 100 0,425 100 0,373 100 0,373 100

pkat

53 167 167 121 125 125 110 110

E1

0,253 139 0,701 123 0,800 141 0,541 131 0,566 133 0,584 137 0,198 51 0,520 135

E2

0,008 0 0,239 42 0,730 128 0,517 126 0,514 121 0,580 136 0,033 9 0,659 171

E3

0,008 4 0,737 130 0,798 140 0,544 132 0,591 139 0,560 132 0,044 11 0,540 140

E4

0,160 88 0,767 135 0,787 138 0,559 136 0,588 138 0,576 135 0,125 33 0,596 154

E5

0,186 103 0,697 122 0,713 125 0,554 135 0,575 135 0,551 129 0,379 98 0,594 154

E6

0,238 131 0,721 127 0,823 145 0,558 136 0,519 122 0,578 136 0,482 125 0,544 141

0,434 112 0,497 129

E7

0,247 136 0,746 131 0,805 141

E8

0,261 144 0,752 132 0,785 138

E9

0,249 137 0,732 129 0,812 143

E10

0,468 121 0,492 127

0,462 120 0,506 131

Abbildung 7.2: Aktivitäten aller Elutionsfraktionen der Deletionskonstrukte

Es wurden jeweils 50 µl der jeweiligen Elutionsfraktion (E1-10) mit sehr unterschiedlichen

Proteinkonzentrationen (siehe Abbildung 7.1) in einen Aktivitätsassay eingesetzt. Dargestellt sind die

Messwerte bei 340 nm (Extinktion E) abzüglich des jeweiligen Blindwerts. Die Aktivität der Nt-VI ohne

Zugabe eines rekombinanten Inhibitors (o Inh) ist außerdem in pkat angegeben. Die in Prozent angegebenen Aktivitäten beziehen sich auf diese Ausgangsaktivität, die willkürlich auf 100 % gesetzt wurde. Die Messreihe dient ausschließlich zur Einschätzung der Fraktion mit der stärksten Aktivität.

7.2.3 Einfluss der Inhibitoren auf die Invertaseaktivität

Messreihe 1

Messreihe 2

Mittelwert

Abweichung in %

Aktivität in pkat

% von ohne Inh

0,302 0,017 0,050 0,269 0,344 0,391 0,417 0,004 0,424

0,309 0,019 0,054 0,246 0,337 0,387 0,432 0,011 0,434

0,306 0,018 0,052 0,258 0,341 0,389 0,425 0,008 0,429

2 11 7 9 2 1 3

90

100

5

6

15

17

80

84

102 116 123

111 127 139

(64)

1 125

2 140

Abbildung 7.3: Aktivitäten der rekombinanten Inhibitorproteine: Reduktion oder Erhöhung der

Hydrolyseaktivität einer Nt-VI aus source Blatt

Von den rekombinanten Proteinen wurden jeweils 2 µg eingesetzt. Die Ausgangsaktivität betrug 90 pkat

(ConA+-Fraktion der löslichen Fraktion aus Tabak-Blattextrakten). Die Abweichung der Messwerte zwischen den beiden unabhängigen Messreihen ist in Prozent angegeben. Die letzte Zeile gibt die

Aktivitäten prozentual im Vergleich zum Ansatz ohne Inhibitorprotein an. ohne Inh: ohne Inhibitor

V0, V1 etc.: verschiedene Inhibitorkonstrukte

94

Anhang

__________________________________________________________________________________________________________________

7.2.4 Dosisabhängigkeit der Inhibition

V0 auf VI

V0

0 31 165 310 620 930 1240 1650 2325 3100 4750

0,543 0,640 0,455 0,360 0,214 0,096 0,085 0,043 0,035 0,022 0,011

0,570

Durchschn

0,557

Akt in pkat 165 189 135 107 63 28 25 13 10 7 3

V1 auf VI

Durchschnitt

Aktivität pkat

Aktivität %

0

V1

60 300 600 1200 1800 2400 3000

0,391

0,334

0,480 0,380 0,240 0,066 0,035 0,018 0,019

0,376

111 142 112 71 20 10 5 6

100 128 101 64 18 9 5 5

V2 auf VI

Durchschnitt

Aktivität pkat

Aktivität %

V3 auf VI ng Inh

Durchschnitt

Aktivität pkat

Aktivität %

0

V2

50 250 500 1000 1500 2000 2500

0,391 0,334 0,477 0,535 0,513 0,431 0,317 0,198 0,133

0,376

0

111

100

V3

2250 4500

0,371 0,377 0,443 0,353

0,378

0,375

111

100

90

112

101

141

127

158

143

131

118

152

137

104

94

128

115

94

85

59

53

39

35

V4 auf VI ng Inh

Durchschnitt

Aktivität pkat

Aktivität %

0

111

100

20

0,371 0,368 0,531 0,544 0,521

0,378

0,375

109

98

V4

500

157

142

1000

161

145

2000

154

139

Abbildung 7.4: Dosisabhängige Inhibition der Nt-VI durch die Inhibitorkonstrukte V0, V1, V2, V3 und V4.

Die Aktivitäten sind in pkat, beziehungsweise als prozentualer Anteil von der Ausgangsaktivität der

Invertase ohne Zugabe eines Inhibitors angegeben (%). Alle Messungen wurden ohne Vorinkubation durchgeführt.

95

Anhang

__________________________________________________________________________________________________________________

7.2.5 Redoxstatus des Inhibitors Nt-VIF

Durchschnitt

Aktivität in pkat

Aktivität % ohne DTT mit DTT ohne DTT mit DTT

0,407 0,027 0,022 0,099 0,614

0,452 0,017 0,023 0,061 0,617

0,376 0,016 0,587

0,413

0,440

0,418 0,022 0,020 0,080 0,606

124

100

7

5

6

5

24

19

179

145

Abbildung 7.5: Chemische Reduktion des Inhibitors V0 auf die Nt-VI

Je 1,5 µg Volllänge-Konstrukt V0 des vakuolären Inhibitors Nt-VIF wurde bei pH 7 mit 4 mM DTT behandelt und bei Raumtemperatur (RT) oder 65

°C inkubiert. Anschließend wurden die Ansätze wieder auf pH 4,7 gebracht und ihre inhibitorische Aktivität gegenüber der Vakuolären Invertase Nt-VI bestimmt.

Die Zahlen über den Balken geben den prozentualen Anteil an der Ausgangsaktivität von 124 pkat an.

96

Anhang

__________________________________________________________________________________________________________________

7.2.6 Spezifität der Inhibitoren

Die Tabelle zur Inhibition der Nt-VI durch V0 ist unter Kapitel 7.2.4 (Seite 95) zu finden.

A0 auf VI oV ng Inh

Durchschnitt

Aktivität in pkat

A0 auf VI mV ng Inh

Durchschnitt

Aktivität in pkat

CIF::VIF auf VI oV

0 10

A0

50 100 150 1000

0,426 0,502 0,409 0,259 0,238 0,019

0,530

0,508

0,507

0,493

146 149 121 77 70 6

0 10

A0

50 100

VIF(N)::CIF(C)

150

0,438 0,416 0,321 0,298 0,222

0,411

0,425

126 123 95 88 66

0 0,5 1 1,5 2 4 8 10

Durchschnitt

Akt in pkat

145 89 35 21 19 9 4 4

CIF(N)::VIF(C)

0 0,5 1 1,5 2 4 8 10

Durchschnitt

Akt in pkat 145 199 198 195 198 192 170 164

Abbildung 7.6: Wirkung der rekombinanten Inhibitoren auf die auf die Nt-VI (VI)

ng/µg Inh: Menge des eingesetzen Inhibitors

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF oV: ohne Vorinkubation mV: mit Vorinkubation

CIF::VIF: Chimäre CIF(N)::VIF(C)

VIF::CIF: Chimäre VIF(N)::CIF(C)

97

Anhang

__________________________________________________________________________________________________________________

V0 auf CWI oV

µg Inh

Durchschnitt

Akt in pkat

0

V0

2

0,285 0,267

0,256 0,243

0,271 0,255

40 38

V0 auf CWI mV

µg Inh

Durchschnitt

Akt in pkat

0

37

V0

2

37

4,1

0,248 0,230 0,254 0,235

0,239 0,254 0,248 0,22

0,239 0,270

0,264

0,217

33

A0 auf CWI oV ng Inh

Durchschnitt

Akt in pkat

0

A0

200

0,244 0,234

0,256 0,245

0,250 0,240

37 35

A0 auf CWI mV

0

A0

100 200 400 600 1000

Durchschnitt

Akt in pkat

VIF::CIF auf CWI mV

µg Inh

Durchschnitt

Akt in pkat

CIF::VIF auf CWI mV

µg Inh

Durchschnitt

Akt in pkat

0,236

0,231

0,247 0,122 0,090 0,024 0,020 0,012

37 18 13 3 3 2

0

0,238

35

0

0,238

35

VIF(N)::CIF(C)

2

0,229 0,231 0,228 0,226

34

CIF(N)::VIF(C)

2

4

34

4

8

34

10

33

8 10

0,229 0,216 0,228 0,229

34 32 34 34

Abbildung 7.7: Wirkung der rekombinanten Inhibitoren auf die auf die Nt-CWI (CWI)

ng/µg Inh: Menge des eingesetzen Inhibitors

V0: Volllänge-Konstrukt des vakuolären Inhibitors Nt-VIF

A0: Volllänge-Konstrukt des apoplastischen Inhibitors Nt-CIF oV: ohne Vorinkubation mV: mit Vorinkubation

CIF::VIF: Chimäre CIF(N)::VIF(C)

VIF::CIF: Chimäre VIF(N)::CIF(C)

98

Anhang

__________________________________________________________________________________________________________________

7.2.7 Vervollständigung der VI-Sequenzen

1 70

5´-Race ATTCCTTCTT CTCTATCTTC CATTATGGCC ACCCACCATT CCCATTATGA CCCGGAAAAC TCCACGACCC

Nt-VI ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~CCGGAAAAC TCCACGACCC

71 140

5´-Race ATTACACTGT CCTGCCGGAC CAACCCGAAT CCGCCGGGTC CGGTCACCGG AAATCCCTCA AAGTCGTCTC

Nt-VI ATTACACTGT CCTGCCGGAC CAACCCGAAT CCGCCGGGTC CGGTCACCGG AAATCCCTCA AAGTCGTCTC

141 210

5´-Race CGGCATTCTT CTCTCCTCCT TCTTTTTGCT TTCTTTAGTC TTTGTGATCG TCAACCAATC TTCAGACTTA

Nt-VI CGGCATTCTT CTCTCCTCCT TCTTTTTGCT TTCTTTAGTC TTTGTGATCG TCAACCAATC TTCAGACTTA

211 280

5´-Race TCACAAAAAA ACTCCCACTC GTCGGAGACC TTGACGCCGG CGTTGTCAAG AGGTGTATCT CAGGGAGTTT

Nt-VI TCACAAAAAA ACTCCCACTC GTCGGAGACC TTGACGCCGG CGTTGTCAAG AGGTGTATCT CAGGGAGTTT

281 350

5´-Race CCGAGAAGAC TTTCAGGGAT GTGTCCGGTG GAAGCCTTTC GTACTACCCG TGGACTAATG CTATGCTTAC

Nt-VI CCGAGAAGAC TTTCAGGGAT GTGTCCGGTG GAAGCCTTTC GTACTACCCG TGGACTAATG CTATGCTTAC

351 420

5´-Race TTGGCAAAGA ACTGCTTACC ATTTTCAACC TCAAAAGAAT TGGATGAACG ATCCTAATGG TCCATTATAC

Nt-VI TTGGCAAAGA ACTGCTTACC ATTTTCAACC TCAAAAGAAT TGGATGAACG ATCCTAATGG TCCATTATAC

421 430

5´-Race CACAAAGGAT

Nt-VI CACAAAGGAT

Abbildung 7.8: Vergleich der 5´-Race Sequenz mit dem überlappenden Abschnitt des partiellen

Nt-VI Klons

5´-Race: Sequenz des durch 5´-Race erhaltenen Fragments

Nt-VI: überlappender Abschnitt des partiellen Klons

ATG: Startcodon des offenen Leserasters

1610 1679

3´-Race .......... .GGACCTGAT GGCCGAGCTG AAACCTACTT CTGCGCTGAT GAAACTAGAT CCTCAGAGGC

Nt-VI ACATTGCCAA AGGACCTGAT GGCCGAGCTG AAACCTACTT CTGTGCTGAT GAAACTAGAT CCTCAGAGGC

1680 D617G Stop618E 1729

3´-Race TCCTGGAGTT GCTAAACAAG TGTATGGTAG TTCAGTACCA GTGTTAGATG GTGAACAACA CTCAATGAGA

Nt-VI TCCTGGAGTT GCTAAACAAG TGTATGGTAG TTCAGTACCA GTGTTAGATG ATTAACAACA CTCAATGAGA

1750 1799

3´-Race TTATTGGTGG ACCACTCAAT TGTGGAAAGC TTTGCTCAAG GAGGAAGAAC AGTCATAACA TCGCGAATTT

Nt-VI TTATTGGTGG ACCACTCAAT TGTGGAGAGC TTTGCTCAAG GAGGAAGAAC AGTCATAACA TCGCGAATTT

1820 R666G 1889

3´-Race ACCCAACAAA AGCAATCAAT GGAGCAGCAC GACTGTTCGT TTTCAACAAT GCCACCGGGG CTAGTGTGAC

Nt-VI ACCCAACAAA GGCAATCAAT GGAGCAGCAC GACTGTTCGT TTTCAACAAT GCCACGAGGG CAAGTGTGAC

1890 1959

3´-Race TGCCTCCCTC AAGATTTGGT CACTC..... .......... .......... .......... .........

Nt-VI TGCCTCCCTG AAGATTTGGT CACTCGAATC AGCTGATATT CGATCCTTCC CCTTGGACCA GTTGTAATT

Abbildung 7.9: Vergleich des 3´-Race-Fragments mit dem überlappenden Abschnitt des partiellen

Nt-VI Klons

3´-Race: Sequenz des 3´-Race-Fragments

Nt-VI: Sequenz des partiellen Nt-VI Klons

TAA: Stopcodon eingerahmt rot: nicht übereinstimmende Basen, die einen Aminosäureaustausch bewirken blau: nicht übereinstimmende Basen, die keinen Aminosäureaustausch bewirken

99

Anhang

__________________________________________________________________________________________________________________

1 L50P 70

5´-Race AATCCTCTAC CTTCCATTAT GGCCACCCAG TACCATTCCA GTTATGACCT GGAAAACTCC GCCTCCCATT

St-VI ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~CAG TACCATTCCA GTTATGACCC GGAAAACTCC GCCTCCCATT

71 140

5´-Race ACACATTCCT CCCGGATCAA CCTGATTCCG GCCACCGGAA GTCCCTTAAA ATCATCTCCG GCATTTTCCT

St-VI ACACATTCCT CCCGGATCAA CCCGATTCCG GCCACCGGAA GTCCCTTAAA ATCATCTCCG GCATTTTCCT

141 210

5´-Race CTCCTCTTTC CTTTTGCTTT CTGTAGCCTT CTTTCCGATC CTCAACAACC AATCACCGGA CTTGCAGAGT

St-VI CTCCTCTTTC CTTTTGCTTT CTGTAGCCTT CTTTCCGATC CTCAACAACC AGTCACCGGA CTTGCAGAGT

211 280

5´-Race AACTCCCGTT CGCCGGCGCC GCCGTCAAGA GGTGTTTCTC AGGGAGTCTC CGATAAGACT TTTCGAGATG

St-VI AACTCCCGTT CGCCGGCGCC GCCGTCAAGA GGTGTTTCTC AGGGAGTCTC CGATAAGACT TTTCGAGATG

281 V298I 350

5´-Race TCGTCAATGC TAGTCACGTT TCTTATGCGT GGTCCAATGC TATGCTTAGC TGGCAAAGAA CTGCTTACCA

St-VI TCGTCAATGC TAGTCACATT TCTTATGCGT GGTCCAATGC TATGCTTAGC TGGCAAAGAA CTGCTTACCA

351 420

5´-Race TTTTCAACCT CAAAAAAATT GGATGAACGA TCCTAATGGT CCATTGTACC ACAAGGGATG GTATCATCTT

St-VI TTTTCAACCT CAAAAAAATT GGATGAACGA TCCTAATGGT CCATTGTACC ACAAGGGATG GTATCATCTT

421 490

5´-Race TTTTATCAAT ACAATCCAGA TTCAGCTATT TGGGGAAATA TCACATGGGG CCATGCCGTA TCCAAGGACT

St-VI TTTTATCAAT ACAATCCAGA TTCAGCTATT TGGGGAAATA TCACATGGGG CCATGCCGTA TCCAAGGACT

491 560

5´-Race TGATCCACTG GCTCTACTTG CCTTTTGCCA TGGTTCCTGA TCAATGGTAC GATATAAACG GTGTCTGGAC

St-VI TGATCCACTG GCTCTACTTG CCTTTTGCCA TGGTTCCTGA TCAATGGTAC GATATTAACG GTGTCTGGAC

561 630

5´-Race TGGGTCCGCT ACCATCCTAC CCGATGGTCA GATCATGATG CTTTATACCG GTGACACTGA TGATTATGTA

St-VI TGGGTCCGCC ACCATCCTAC CCGATGGTCA GATCATGATG CTTTATACCG GTGACACTGA TGATTATGTA

631 700

5´-Race CAAGTGCAAA ATCTTGCGTA CCCCACCAAC TTATCTGATC CTCTCCTTCT AGACTGGGTC AAGTACAAAG

St-VI CAAGTGCAAA ATCTTGCGTA CCCCACCAAC TTATCTGATC CTCTCCTTCT AGACTGGGTC AAGTACAAAG

701 V736I 770

5´-Race GCAACCCGGT TCTGGTTCCT CCACCCGGCA TTGGTGTCAA GGACTTTAGA GACCCGACCA CTGCTTGGAC

St-VI GCAACCCGGT TCTGGTTCCT CCACCCGGCA TTGGTATCAA GGACTTTAGA GACCCGACCA CTGCTTGGAC

771 840

5´-Race CGGACCCCAA AATGGGCAAT GGCTTTTAAC AATCGGGTCT AAGATTGGTA AAACGGGTAT TGCACTTGTT

St-VI CGGACCCCAA AATGGGCAAT GGCTTTTAAC AATCGGGTCT AAGATTGGTA AAACGGGTAT TGCACTTGTT

841 884

5´-Race TATGAAACTT CCAACTTCAC AAGCTTTAAG CTATTGGATG AAGT......

St-VI TATGAAACTT CCAACTTCAC AAGCTTTAAG CTATTGGATG AAGTGCTGCA

Abbildung 7.10: DNA-Alignment des 5´-Race-Fragments mit dem entsprechenden Teil der partiellen St-VI

5´-Race: Sequenz des durch 5´-Race erhaltenen Fragments

St-VI: homologer Abschnitt der partiellen Sequenz

ATG: Startcodon des offenen Leserasters rot: nicht übereinstimmende Basen, die einen Aminosäureaustausch bewirken blau: nicht übereinstimmende Basen, die keinen Aminosäureaustausch bewirken

100

Anhang

__________________________________________________________________________________________________________________

7.2.8 Aktivität der Nt-VI in verschiedenen Geweben

Messwert 1

Messwert 2

Durchschnitt nkat/g Prot

source Blatt sink Blatt Internodium Wurzel

0,702 0,487 0,219 0,099

0,711 0,463 0,199 0,101

0,707 0,475 0,209 0,100

241 162 484 53

Abbildung 7.11: Originalmesswerte und Aktivitäten von VIs aus verschiedenen Tabak-Geweben

Angegeben sind die Extinktionswerte (abzüglich des Blindwerts) zweier unabhängiger Messreihen und die Aktivität in nkat pro g glykosyliertes Protein.

101

Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement

Table of contents