MiSeq Reporter Amplicon DS
Workflow Guide
For Research Use Only. Not for use in diagnostic procedures.
Introduction
Amplicon DS Workflow Overview
Optional Settings for the Amplicon DS Workflow
Analysis Output Files
Manifest File Format
Revision History
Technical Assistance
ILLUMINA PROPRIETARY
Document # 15042903 v02
February 2016
3
4
7
9
18
20
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the
contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This
document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed,
or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license
under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order
to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read
and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN
MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND
DAMAGE TO OTHER PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2016 Illumina, Inc. All rights reserved.
Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio,
Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect,
MiniSeq, MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA,
TruGenome, TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color,
and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the U.S. and/or other countries. All
other names, logos, and other trademarks are the property of their respective owners.
This guide describes the analysis steps performed in the Amplicon DS workflow, and the
types of information and analysis files generated by the workflow.
Plug-In Workflow
The Amplicon DS workflow is provided as a software plug-in for MiSeq Reporter. A run
folder associated with the Amplicon DS workflow is represented with the letter U in the
MiSeq Reporter Analyses tab. Workflows marked as the letter U indicate a plug-in
workflow.
Data do not appear in the form of graphs and tables on the MiSeq Reporter Summary tab
and Details tab for plug-in workflows. However, the Analysis Info tab, Sample Sheet tab,
Logs tab, and Errors tab are populated with information from the run and subsequent
analysis. For more information about the MiSeq Reporter interface, see the MiSeq Reporter
Software Guide (document # 15042295).
Workflow Requirements
} Two manifest files—The Amplicon DS workflow requires 2 assay-specific manifest
files, TruSightTumor-FPA-Manifest and TruSightTumor-FPB-Manifest. Download the
manifest files from the Illumina website. If using DesignStudio with TruSeq Custom
Amplicon and the design dual pools option, download the manifest files for pool A
and pool B from MyIllumina.
} Reference genome—In addition to the manifest files, the Amplicon DS workflow
requires the hg19 reference genome for coordinates and chromosome mapping. By
default, this reference is included with the MiSeq Reporter software.
Specify the path to the genome folder in the sample sheet. For more information, see
the MiSeq Sample Sheet Quick Reference Guide.
} MiSeq Reporter v2.2.29, or later—Previous versions of MiSeq Reporter software are
not compatible with the Amplicon DS software plug-in. MiSeq Reporter v2.3, or later
does not require the software plug-in to perform the Amplicon DS workflow.
MiSeq Reporter is available from the MiSeq Reporter support page on the Illumina
website.
MiSeq Reporter Amplicon DS Workflow Guide
3
Introduction
Introduction
Amplicon DS Workflow Overview
The Amplicon DS workflow is uniquely suited for detection of somatic mutations in
formalin-fixed paraffin-embedded (FFPE) samples.
This workflow independently processes variants from the forward and reverse strands of
the sample material, and then algorithmically reconciles the calls.
The Amplicon DS workflow demultiplexes indexed reads, generates FASTQ files, aligns
reads to a reference, identifies variants, and writes output files to the Alignment folder.
Demultiplexing
Demultiplexing separates data from pooled samples based on short index sequences that
tag samples from different libraries. Index reads are identified using the following steps:
} Samples are numbered starting from 1 based on the order they are listed in the
sample sheet.
} Sample number 0 is reserved for clusters that were not successfully assigned to a
sample.
} Clusters are assigned to a sample when the index sequence matches exactly or there
is up to a single mismatch per Index Read.
NOTE
Illumina indexes are designed so that any index pair differs by ≥ 3 bases, allowing for a
single mismatch in index recognition. Index sets that are not from Illumina can include
pairs of indexes that differ by < 3 bases. In such cases, the software detects the insufficient
difference and modifies the default index recognition (mismatch=1). Instead, the software
performs demultiplexing using only perfect index matches (mismatch=0).
When demultiplexing is complete, 1 demultiplexing file named
DemultiplexSummaryF1L1.txt is written to the Alignment folder with the following
information:
} In the file name, F1 represents the flow cell number.
} In the file name, L1 represents the lane number, which is always L1 for MiSeq.
} A table of demultiplexing results with 1 row per tile and 1 column per sample,
including sample 0.
} The most commonly occurring sequences for the index reads.
FASTQ File Generation
MiSeq Reporter generates intermediate analysis files in the FASTQ format, which is a text
format used to represent sequences. FASTQ files contain reads for each sample and their
quality scores, excluding reads identified as inline controls and clusters that did not pass
filter.
FASTQ files are the primary input for alignment. The files are written to the BaseCalls
folder (Data\Intensities\BaseCalls) in the MiSeqAnalysis folder, and then copied to the
BaseCalls folder in the MiSeqOutput folder. Each FASTQ file contains reads for only 1
sample, and the name of that sample is included in the FASTQ file name. For more
information about FASTQ files, see the MiSeq Reporter Software Guide (document #
15042295).
Alignment
During the alignment step, the banded Smith-Waterman algorithm aligns clusters from
each sample against amplicon sequences specified in the manifest file.
4
Document # 15042903 v02
Each paired-end read is evaluated in terms of its alignment to the relevant probe
sequences for that read.
} Read 1 is evaluated against the reverse complement of the Downstream LocusSpecific Oligos (DLSO).
} Read 2 is evaluated against the Upstream Locus-Specific Oligos (ULSO).
} If the start of a read matches a probe sequence with no more than 1 mismatch, the
full length of the read is aligned against the amplicon target for that sequence.
Alignments that include more than 3 indels are filtered from alignment results. Filtered
alignments are written in alignment files as unaligned and are not used in variant
calling.
Paired-End Evaluation
For paired-end runs, the top-scoring alignment for each read is considered. Reads are
flagged as an unresolved pair under the following conditions:
} If either read did not align, or the paired reads aligned to different chromosomes.
} If 2 alignments come from different amplicons or different rows in the Targets
section of the manifest.
Bin/Sort
The bin/sort step groups reads by sample and chromosome, and then sorts by
chromosome position. Results are written to 1 BAM file per sample.
Variant Calling
SNPs and short indels are identified using the somatic variant caller. Developed by
Illumina, the somatic variant caller identifies variants present at low frequency in the
DNA sample and minimizes false positives.
The somatic variant caller identifies SNPs in 3 steps:
} Considers each position in the reference genome separately
} Counts bases at the given position for aligned reads that overlap the position
} Computes a variant score that measures the quality of the call.
Variant scores are computed using a Poisson model that excludes variants with a
quality score below Q20. Additionally, the model only calls variants for bases that are
covered at 300x or greater for a single amplicon.
Variants are first called for each pool separately. Then, variants from the 2 pools are
compared and combined into a single output file.
If a
}
}
}
variant meets the following criteria, the variant is marked as PASS in the variant file:
Must be present in both pools
Cumulatively have a depth of 1000 or an average depth of 500x per pool
Have variant frequency of 3% or greater as reported in the merged variant call (VCF)
files
For more information, see the Amplicon DS Variant Caller Technical Note on the TruSight
Tumor 26 Kit support page.
MiSeq Reporter Amplicon DS Workflow Guide
5
Amplicon DS Workflow Overview
The banded Smith-Waterman algorithm performs local sequence alignments to
determine similar regions between 2 sequences. Instead of comparing the total sequence,
the Smith-Waterman algorithm compares segments of all possible lengths. Local
alignments are useful for dissimilar sequences that are suspected to contain regions of
similarity within the larger sequence. This process allows alignment across small
amplicon targets, often less than 10 bp.
Statistics Reporting
Statistics are summarized and reported, and written to the Alignment folder.
6
Document # 15042903 v02
Sample sheet settings are optional commands that control various analysis parameters.
Settings are used in the Settings section of the sample sheet and require a setting name
and a setting value.
If you are viewing or editing the sample sheet in Excel, the setting name resides in the
first column and the setting value in the second column.
If you are viewing or editing the sample sheet in a text editor such as Notepad, follow
the setting name is by a comma and a setting value. Do not include a space between the
comma and the setting value.
Example: StitchReads,1
The following optional settings are compatible with the Amplicon DS workflow.
Sample Sheet Settings for Analysis
Parameter
Description
StitchReads
Settings are 0 or 1. Default is 0, paired-end reads are not
stitched.
If set to true (1), paired-end reads that overlap are
stitched to form a single read. To be stitched, a minimum
of 10 bases must overlap between Read 1 and Read 2.
Paired-end reads that cannot be stitched are converted to
2 single reads.
This setting requires MiSeq Reporter v2.3, or later.
Read Stitching
MiSeq Reporter v2.3, or later, is required to use the optional StitchReads setting.
When set to true (1), paired-end reads that overlap are stitched to form a single read in
the FASTQ file. At each overlap position, the consensus stitched read has the base call
and quality score of the read with higher Q-score.
For each paired read, a minimum of 10 bases must overlap between Read 1 and Read 2
to be a candidate for read stitching. The minimum threshold of 10 bases minimizes the
number of reads that are stitched incorrectly due to a chance match. Candidates for read
stitching are scored as follows:
} For each possible overlap of 10 base pairs or more, a score of 1 – MismatchRate is
calculated.
} Perfectly matched overlaps have a MismatchRate of 0, resulting in a score of 1.
} Random sequences have an expected score of 0.25.
} If the best overlap has a score of ≥ 0.9 and the score is ≥ 0.1 higher than any other
candidate, then the reads are stitched together at this overlap.
Although the stitched reads are aligned as one, in the BAM file the stitched alignment is
split into individual alignments.
During variant calling, stitched reads are processed together. A consensus read is
generated by taking the base call and quality score of the read with the higher Q-score in
the overlap region. When the Q-score is the same, but the base call differs, a “no call” is
used at that position. Sometimes read stitching can improve the accuracy of variant
calling.
MiSeq Reporter Amplicon DS Workflow Guide
7
Optional Settings for the Amplicon DS Workflow
Optional Settings for the Amplicon DS Workflow
Paired-end reads that cannot be stitched are converted to 2 single reads in the FASTQ
file.
8
Document # 15042903 v02
The following analysis output files are generated for the Amplicon DS workflow and
provide analysis results for alignment, variant calling, and coverage.
File Name
Description
BAM files (*.bam)
Contains aligned reads for a given sample.
Located in Data\Intensities\BaseCalls\Alignment.
VCF files (*.vcf)
Contains information about variants found at specific positions in
a reference genome.
Per-pool files are located in
Data\Intensities\BaseCalls\Alignment\Variants.
Consensus files are located in
Data\Intensities\BaseCalls\Alignment.
gVCF files
(*.genome.vcf)
Contains the genotype for each position, whether called as a
variant or called as a reference. For more information, see Genome
VCF Files on page 15.
The genome VCF files generated for the Amplicon DS workflow
are of a size that does not require block compression.
Per-pool files are located in
Data\Intensities\BaseCalls\Alignment\VariantCallingLogs.
Consensus files are located in
Data\Intensities\BaseCalls\Alignment.
AmpliconCoverage_
M#.tsv
Contains details about the resulting coverage per amplicon per
sample. M# represents the manifest number.
Located in Data\Intensities\BaseCalls\Alignment.
Alignment Files
Alignment files contain the aligned read sequence and quality score. MiSeq Reporter
generates alignment files in the BAM (*.bam) file format.
BAM File Format
A BAM file (*.bam) is the compressed binary version of a SAM file that is used to
represent aligned sequences. SAM and BAM formats are described in detail at
https://samtools.github.io/hts-specs/SAMv1.pdf.
BAM files are written to the alignment folder in Data\Intensities\BaseCalls\Alignment.
BAM files use the file naming format of SampleName_S#.bam, where # is the sample
number determined by the order that samples are listed in the sample sheet.
BAM files contain a header section and an alignments section:
} Header—Contains information about the entire file, such as sample name, sample
length, and alignment method. Alignments in the alignments section are associated
with specific information in the header section.
Alignment methods include banded Smith-Waterman, Burrows-Wheeler Aligner
(BWA), and Bowtie. The term Isis indicates that an Illumina alignment method is in
use, which is the banded Smith-Waterman method.
} Alignments—Contains read name, read sequence, read quality, alignment
information, and custom tags.
GA23_40:8:1:10271:11781 64 chr22 17552189 8 35M * 0 0
MiSeq Reporter Amplicon DS Workflow Guide
9
Analysis Output Files
Analysis Output Files
TACAGACATCCACCACCACACCCAGCTAATTTTTG
IIIII>FA?C::B=:GGGB>GGGEGIIIHI3EEE#
BC:Z:ATCACG XD:Z:55 SM:I:8
The read name maps to the chromosome and start coordinate chr22 17552189, with
alignment quality 8, and the match descriptor CIGAR string 35M.
BAM files are suitable for viewing with an external viewer such as IGV or the UCSC
Genome Browser.
BAM index files (*.bam.bai) provide an index of the corresponding BAM file.
Variant Call Files
Variant call files contain all called variants. For the Amplicon DS workflow, MiSeq
Reporter generates variant call files as VCF files and genome VCF files:
} VCF files contain information about variants found at specific positions.
} gVCF files contain information about all sites within the region of interest.
Per-Pool and Consensus VCF Files
The Amplicon DS workflow generates 2 sets of variant call files:
} Per-pool VCF and gVCF files that are written to the VariantCallingLogs folder
} Consensus VCF and gVCF files that are written to the Alignments folder.
Base Calls
Alignment—Contains consensus VCF (*.vcf) and gVCF (*.genome.vcf) files.
VariantCallingLogs—Contains per-pool VCF (*.vcf) and gVCF (*.genome.vcf)
files
Per-Pool VCF Files
Using the somatic variant caller, variants are called in the forward pool and the reverse
pool to produce an independent set of VCF files for each pool. The set of per-pool VCF
files include both VCF and gVCF files.
Per-pool VCF files are written to a subfolder of the Alignments folder named Variants.
Per-pool VCF files use the following naming convention, where S# represents the order
the sample is listed in the sample sheet:
} SampleName_S#.genome.vcf—Reports all sites
} SampleName_S#.vcf—Reports variants only
Merged VCF Files
MiSeq Reporter compares the per-pool VCF files generated for the forward and reverse
pools, and combines the data at each position to create a final merged VCF file for the
sample.
Merged VCF files are written to the Alignment folder. Merged VCF files use the following
naming convention, where S# represents the order the sample is listed in the sample
sheet:
} SampleName_S#.genome.vcf—Reports for all sites
} SampleName_S#.vcf—Reports variants only
The VCF file lists all called variants, including variants that were flagged as filtered, but
not variants with a variant frequency of less than 3%. For variants that pass filters, PASS
is written in the FILTER column of the VCF file. For variants that fail 1 or more filters,
the filter name is written in the FILTER column. In particular, variants are filtered due to
10
Document # 15042903 v02
Variant calls from the 2 pools are merged using the following criteria.
Criteria
A reference call in each pool
A reference call in 1 pool and a variant call in the other pool
Two matching variant calls with similar frequencies in each pool
Two matching variant calls with significantly different frequencies in each
pool
Unmatched variant calls in each pool
Result
Reference call
Filtered variant
call
Variant call
Filtered variant
call
Filtered variant
call
Metrics from the 2 pools are merged using the following schema.
Metric
Depth
Variant Frequency
Q-Score
Schema
Addition of depths from both pools
Total variant counts/total coverage depth
Minimum value of both pools
VCF File Format
VCF is a widely used file format developed by the genomics scientific community that
contains information about variants found at specific positions in a reference genome.
VCF files use the file naming format SampleName_S#.vcf, where # is the sample number
determined by the order that samples are listed in the sample sheet.
VCF File Header—Includes the VCF file format version and the variant caller version.
The header lists the annotations used in the remainder of the file. If MARS is listed as
the annotator, the Illumina internal annotation algorithm is in use to annotate the VCF
file. The VCF header also contains the command line call used by MiSeq Reporter to run
the variant caller. The command-line call specifies all parameters used by the variant
caller, including the reference genome file and .bam file. The last line in the header is
column headings for the data lines. For more information, see VCF File Annotations on
page 14.
##fileformat=VCFv4.1
##FORMAT=<ID=GQX,Number=1,Type=Integer,Description="Minimum of
{Genotype quality assuming variant position,Genotype quality
assuming non-variant position}">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype
Quality">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allele
Depth">
##FORMAT=<ID=VF,Number=1,Type=Float,Description="Variant
Frequency">
##FORMAT=<ID=NL,Number=1,Type=Integer,Description="Applied
BaseCall Noise Level">
##FORMAT=<ID=SB,Number=1,Type=Float,Description="StrandBias
Score">
##FORMAT=<ID=PB,Number=1,Type=Float,Description="Probe-pool
bias. Values closer to 0 indicate more bias toward one probe
pool (and less confidence in a variant call)">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
MiSeq Reporter Amplicon DS Workflow Guide
11
Analysis Output Files
probe bias (PB) when the variant frequency differs significantly between the 2 pools. For
more information, see VCF File Annotations on page 14.
##INFO=<ID=TI,Number=.,Type=String,Description="Transcript ID">
##INFO=<ID=GI,Number=.,Type=String,Description="Gene ID">
##INFO=<ID=EXON,Number=0,Type=Flag,Description="Exon Region">
##INFO=<ID=FC,Number=.,Type=String,Description="Functional
Consequence">
##FILTER=<ID=LowVariantFreq,Description="Low variant frequency
< 0.01">
##FILTER=<ID=LowGQ,Description="GQ below < 30.00">
##FILTER=<ID=R8,Description="IndelRepeatLength is greater than
8">
##FILTER=<ID=LowDP,Description="Low coverage (DP tag),
therefore no genotype called">
##FILTER=<ID=SB,Description="Variant strand bias too high">
##FILTER=<ID=PB,Description="Probe pool bias - variant not
found, or found with low frequency, in one of two probe
pools">
##fileDate=20130320
##source=CallSomaticVariantsv3.1.1.0
##annotator=MARS
##CallSomaticVariants_cmdline=" -B D:\Amplicon_DS_Soma2\121017_
M00948_0054_000000000A2676_Binf02\Data\Intensities\BaseCalls\Alignment3_Tamsen_
SomaWorker -g [D:\Genomes\Homo_sapiens
\UCSC\hg19\Sequence\WholeGenomeFASTA,] -f 0.01 -fo False -b 20
-q 100 -c 300 -s 0.5 -a 20 -F 20 -gVCF
True -i true -PhaseSNPs true -MaxPhaseSNPLength 100 -r D:
\Amplicon_DS_Soma2\121017_M00948_0054_000000000-A2676_Binf02"
##reference=\\ussdfile\Depts\LifeSci\Bioinformatics\Genomes\Homo_
sapiens\UCSC\hg19\Sequence\WholeGenomeFASTA
##phasing=none
##contig=<ID=chr1,length=249250621>
##contig=<ID=chr2,length=243199373>
##contig=<ID=chr3,length=198022430>
##contig=<ID=chr4,length=191154276>
##contig=<ID=chr5,length=180915260>
##contig=<ID=chr7,length=159138663>
##contig=<ID=chr9,length=141213431>
##contig=<ID=chr10,length=135534747>
##contig=<ID=chr12,length=133851895>
##contig=<ID=chr14,length=107349540>
##contig=<ID=chr15,length=102531392>
##contig=<ID=chr16,length=90354753>
##contig=<ID=chr17,length=81195210>
##contig=<ID=chr18,length=78077248>
##contig=<ID=chr19,length=59128983>
##contig=<ID=chr20,length=63025520>
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 3
VCF File Data Lines—Contains information about a single variant. Data lines are listed
under the column headings included in the header.
12
Document # 15042903 v02
The VCF file format is flexible and extensible, so not all VCF files contain the same fields.
The following tables describe VCF files generated by MiSeq Reporter.
Heading
Description
CHROM
The chromosome of the reference genome. Chromosomes appear in the same
order as the reference FASTA file.
POS
The single-base position of the variant in the reference chromosome.
For SNPs, this position is the reference base with the variant; for indels or deletions,
this position is the reference base immediately before the variant.
ID
The rs number for the SNP obtained from dbSNP.txt, if applicable.
If there are multiple rs numbers at this location, the list is semicolon delimited. If
no dbSNP entry exists at this position, a missing value marker ('.') is used.
REF
The reference genotype. For example, a deletion of a single T is represented as
reference TT and alternate T. An A to T single nucleotide variant is represented as
reference A and alternate T.
ALT
The alleles that differ from the reference read.
For example, an insertion of a single T is represented as reference A and alternate
AT. An A to T single nucleotide variant is represented as reference A and alternate
T.
QUAL
A Phred-scaled quality score assigned by the variant caller.
Higher scores indicate higher confidence in the variant and lower probability of
-(Q/10)
errors. For a quality score of Q, the estimated probability of an error is 10
. For
example, the set of Q30 calls has a 0.1% error rate. Many variant callers assign
quality scores based on their statistical models, which are high relative to the error
rate observed.
MiSeq Reporter Amplicon DS Workflow Guide
13
Analysis Output Files
VCF File Headings
VCF File Annotations
Heading
Description
FILTER
If all filters are passed, PASS is written in the filter column.
• LowDP—Applied to sites with depth of coverage below a cutoff. Configure
cutoff using the MinimumCoverageDepth sample sheet setting.
• LowGQ—The genotyping quality (GQ) is below a cutoff. Configure cutoff
using the VariantMinimumGQCutoff sample sheet setting.
• LowQual—The variant quality (QUAL) is below a cutoff. Configure using the
VariantMinimumQualCutoff sample sheet setting.
• LowVariantFreq—The variant frequency is less than the given threshold.
Configure using the VariantFrequencyFilterCutoff sample sheet setting.
• PB—The prevalence of the variant is significantly biased between the 2
forward and reverse probe pools.
• R8—For an indel, the number of adjacent repeats (1-base or 2-base) in the
reference is greater than 8. This filter is configurable using the
IndelRepeatFilterCutoff setting in the config file or the sample sheet.
• SB—The strand bias is more than the given threshold. This filter is
configurable using the StrandBiasFilter sample sheet setting; available only for
somatic variant caller and GATK.
For more information about sample sheet settings, see MiSeq Sample Sheet Quick
Reference Guide.
INFO
Possible entries in the INFO column include:
• AC—Allele count in genotypes for each ALT allele, in the same order as listed.
• AF—Allele Frequency for each ALT allele, in the same order as listed.
• AN—The total number of alleles in called genotypes.
• CD—A flag indicating that the SNP occurs within the coding region of at least
1 RefGene entry.
• DP—The depth (number of base calls aligned to a position and used in variant
calling). In regions of high coverage, GATK down-samples the available reads.
• Exon—A comma-separated list of exon regions read from RefGene.
• FC—Functional Consequence.
• GI—A comma-separated list of gene IDs read from RefGene.
• QD—Variant Confidence/Quality by Depth.
• TI—A comma-separated list of transcript IDs read from RefGene.
14
Document # 15042903 v02
Description
FORMAT
The format column lists fields separated by colons. For example, GT:GQ. The list
of fields provided depends on the variant caller used. Available fields include:
• AD—Entry of the form X,Y, where X is the number of reference calls, and Y is
the number of alternate calls.
• DP—Approximate read depth; reads with MQ=255 or with bad mates are
filtered.
• GQ—Genotype quality.
• GQX—Genotype quality. GQX is the minimum of the GQ value and the QUAL
column. In general, these values are similar; however, taking the minimum
makes GQX the more conservative measure of genotype quality.
• GT—Genotype. 0 corresponds to the reference base, 1 corresponds to the first
entry in the ALT column, and so on. The forward slash (/) indicates that no
phasing information is available.
• NL—Noise level; an estimate of base calling noise at this position.
• PB—The probe pool bias score assigned at a position. Larger negative values
indicated less bias.
• PL—Normalized, Phred-scaled likelihoods for genotypes.
• SB—Strand bias at this position. Larger negative values indicate less bias;
values near 0 indicate more bias.
• VF—Variant frequency; the percentage of reads supporting the alternate allele.
SAMPLE
The sample column gives the values specified in the FORMAT column.
Genome VCF Files
Genome VCF (gVCF) files are VCF v4.1 files that follow a set of conventions for
representing all sites within the genome in a reasonably compact format. The gVCF files
generated in the Amplicon DS workflow include all sites within the region of interest
specified in the manifest file.
For more information, see sites.google.com/site/gvcftools/home/about-gvcf.
The following example illustrates the convention for representing nonvariant and
variant sites in a gVCF file.
Figure 1 Example gVCF File
NOTE
The gVCF file shows no-calls at positions with low coverage, or where a low-frequency
variant (< 3%) occurs often enough (> 1%) that the position cannot be called to the
reference. A genotype (GT) tag of ./. indicates a no-call.
Amplicon Coverage File
One amplicon coverage file is generated for each manifest. The M# in the file name
represents the manifest number as it is listed in the sample sheet.
MiSeq Reporter Amplicon DS Workflow Guide
15
Analysis Output Files
Heading
Each file begins with a header row that contains the sample IDs associated with the
manifest. In the following example, sample ID 1 and sample ID 3 use one the first
manifest in the sample sheet.
Figure 2 AmpliconCoverage_M1.tsv File
Below the header rows are 3 columns:
}
}
}
The first column is the Target ID as it is listed in the manifest.
The second column is the coverage depth of reads passing filter.
The third column is the total coverage depth.
Supplementary Output Files
The following output files provide supplementary information, or summarize run results
and analysis errors. Although, these files are not required for assessing analysis results,
they can be used for troubleshooting purposes.
16
File Name
Description
AdapterTrimming.txt
Lists the number of trimmed bases and percentage of
bases for each tile. This file is present only if adapter
trimming was specified for the run.
Located in Data\Intensities\BaseCalls\Alignment.
AnalysisLog.txt
Processing log that describes every step that occurred
during analysis of the current run folder. This file does not
contain error messages.
Located in the root level of the run folder.
AnalysisError.txt
Processing log that lists any errors that occurred during
analysis. This file is present only if errors occurred.
Located in the root level of the run folder.
AmpliconRunStatistics.xml
Contains summary statistics specific to the run.
Located in the root level of the run folder.
Document # 15042903 v02
Description
CompletedJobInfo.xml
Written after analysis is complete, contains information
about the run, such as date, flow cell ID, software version,
and other parameters.
Located in the root level of the run folder.
DemultiplexSummaryF1L1.txt
Reports demultiplexing results in a table with 1 row per
tile and 1 column per sample.
Located in Data\Intensities\BaseCalls\Alignment.
ErrorsAndNoCallsByLaneTile
ReadCycle.csv
A comma-separated values file that contains the
percentage of errors and no-calls for each tile, read, and
cycle.
Located in Data\Intensities\BaseCalls\Alignment.
Mismatch.htm
Contains histograms of mismatches per cycle and no-calls
per cycle for each tile.
Located in Data\Intensities\BaseCalls\Alignment.
Summary.xml
Contains a summary of mismatch rates and other base
calling results.
Located in Data\Intensities\BaseCalls\Alignment.
Summary.htm
Contains a summary web page generated from
Summary.xml.
Located in Data\Intensities\BaseCalls\Alignment.
MiSeq Reporter Amplicon DS Workflow Guide
17
Analysis Output Files
File Name
Manifest File Format
The Amplicon DS workflow requires 2 manifest files supplied by Illumina, 1 for the
forward pool and 1 for the reverse pool. The manifest files use a *.txt file format.
NOTE
There is no need to modify manifests files. The following manifest file description is
provided for reference only.
The Amplicon DS manifest file contains a header section followed by 3 blocks of rows
beginning with column headings: Probes, Targets, and Intervals.
} Probes—The Probes section has 1 entry for each pair of probes.
}
18
Column Heading
Description
Target ID
A unique identifier consisting of numbers and letters, and used
as the display name of the amplicon.
ULSO Sequence
Sequence of the upstream primer, or Upstream Locus-Specific
Oligo, which is sequenced during Read 2 of a paired-end run.
DLSO Sequence
Sequence of the downstream primer, or Downstream LocusSpecific Oligo. The reverse complement of this sequence forms
the start of the first read. This sequence comes from the same
strand as the ULSO sequence.
Targets—The Targets section includes 1 entry for each amplicon amplified by a
probe-pair. An expected off-target region is included in addition to the submitted
genomic region.
Column Heading
Description
TargetA
Matches a target ID in the Probes section that corresponds to
the ULSO probe sequence in Read 1.
TargetB
Matches a target ID in the Probes section that corresponds to
the DLSO probe sequence in Read 2.
TargetNumber
Number of the targeted genomic region. The target region for
a probe pair has index of 1. Any off-target amplicons have an
index of 2, 3, and so on.
Chromosome
The chromosome of the amplicon that matches the reference
chromosome.
Start Position, End
Position
1-based chromosome endpoints of the entire amplicon
including the sequence matching the probes. For example, if
chromosome 1 started with ACGTACACGT, then a sequence
with a Start Position of 2 and an End Position of 5 would be
CGTA.
Probe Strand
The strand of the amplicon indicated as a plus (+) or minus (-).
Sequence
Sequence of the amplified region between the ULSO and
DLSO. This sequence comes from the forward strand if Probe
Strand is plus (+) or from the reverse strand if Probe Strand is
minus (–).
Document # 15042903 v02
Description
Clip Read Direction
Indicates the read direction and position relative to the
reference chromosome where soft-clipping occurs.
A plus (+) sign indicates read direction for the forward strand.
A minus (-) sign indicates read direction for the reverse strand.
Position is indicated in the Clip Upstream and Clip
Downstream columns. Position numbers are inclusive relative
to the soft-clipping, 1-based.
Intervals—The Intervals section has 1 entry for each interval of interest, and restricts
variant calling to these intervals. The Intervals section is organized with the
following headings: Species, Build ID, Chromosome, Target Start, and Target Stop.
MiSeq Reporter Amplicon DS Workflow Guide
19
Manifest File Format
}
Column Heading
Revision History
Document #
20
Date
Description of Change
Document # 15042903
v02
February
2016
Updated the Workflow Requirements section
with information on how to access manifest
files when using DesignStudio with TruSeq
Custom Amplicon.
Removed compatibility information stating
that the Amplicon DS workflow can only be
used with the TruSight Tumor assay.
Document # 15042903
v01
September
2015
Changed the name of the guide from MiSeq
Reporter Amplicon-DS Workflow Reference
Guide to the MiSeq Reporter Amplicon DS
Workflow Guide.
Removed the Installation section because
MiSeq Reporter v2.3 and later does not
require a separate plug-in installer.
In the BAM File Format section, revised the
description of the alignment information in
the file header, and updated the link for SAM
format specifications.
Updated the read stitching description to
include information on what occurs when the
Q-score is the same in an overlap region, and
information on alignment in the BAM file for
stitched reads.
Part # 15042903 Rev. D
December
2014
Added a note in the Demultiplexing section
about the default index recognition for index
pairs that differ by < 3 bases.
Part # 15042903 Rev. C
February
2014
Updated to changes introduced in MiSeq
Reporter v2.4:
• Added alignment method to the description
of the BAM file header.
• Added the command line and annotation
algorithm to the description of VCF file
header.
Part # 15042903 Rev. B
August 2013
Part # 15042903 Rev. A
May 2013
• Updated to MiSeq Reporter v2.3: added
sample sheet setting StitchReads; added
description of read stitching.
• Noted that MiSeq Reporter v2.3 does not
require the Amplicon DS software plug-in
to perform analysis of TruSight® Tumor
libraries.
Initial release.
Document # 15042903 v02
For technical assistance, contact Illumina Technical Support.
Table 1 Illumina General Contact Information
Website
Email
www.illumina.com
[email protected]
Table 2 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
North America
1.800.809.4566
Japan
Australia
1.800.775.688
Netherlands
Austria
0800.296575
New Zealand
Belgium
0800.81102
Norway
China
400.635.9898
Singapore
Denmark
80882346
Spain
Finland
0800.918363
Sweden
France
0800.911850
Switzerland
Germany
0800.180.8994
Taiwan
Hong Kong
800960230
United Kingdom
Ireland
1.800.812949
Other countries
Italy
800.874909
Contact Number
0800.111.5011
0800.0223859
0800.451.650
800.16836
1.800.579.2745
900.812168
020790181
0800.563118
00806651752
0800.917.0041
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at
support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go
to support.illumina.com, select a product, then select Documentation & Literature.
MiSeq Reporter Amplicon DS Workflow Guide
Technical Assistance
Technical Assistance
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
advertisement
© 2021