MiSeq Reporter Software Reference Guide Translated into German (15038356 A DEU)

MiSeq Reporter Software Reference Guide Translated into German (15038356 A DEU)
MiSeq Reporter Software
Referenzhandbuch für
IVD-Assays
FÜR IN-VITRO-DIAGNOSTIK
ILLUMINA EIGENTUMSRECHTLICH GESCHÜTZT
Teile-Nr. 15038356 Rev. A DEU
März 2014
Dieses Dokument und dessen Inhalt sind Eigentum von Illumina, Inc. und verbundenen Unternehmen
(„Illumina“) und ausschließlich für den bestimmungsgemäßen Gebrauch durch den Kunden in Verbindung
mit dem Gebrauch des hier beschriebenen Produkts (der hier beschriebenen Produkte) und für keinen
anderen Bestimmungszweck ausgelegt. Dieses Dokument und dessen Inhalt dürfen ohne schriftliches
Einverständnis von Illumina nicht verwendet und zu keinem anderen Zweck verteilt bzw. anderweitig
übermittelt, offengelegt oder auf irgendeine Weise reproduziert werden. Illumina überträgt mit diesem
Dokument keine Lizenzen unter seinem Patent, Markenzeichen, Urheberrecht oder bürgerlichem Recht bzw.
ähnlichen Rechten an Drittparteien.
Die Anweisungen in diesem Dokument müssen von qualifiziertem und entsprechend ausgebildetem
Personal genau befolgt werden, damit die in diesem Dokument beschriebene Anwendung der Produkte
sicher und ordnungsgemäß erfolgt. Vor der Verwendung dieser Produkte muss der Inhalt dieses
Dokuments vollständig gelesen und verstanden worden sein.
FALLS NICHT ALLE HIERIN AUFGEFÜHRTEN ANWEISUNGEN VOLLSTÄNDIG GELESEN UND
BEFOLGT WERDEN, KÖNNEN PRODUKTSCHÄDEN, VERLETZUNGEN DER BENUTZER UND
ANDERER PERSONEN SOWIE ANDERWEITIGER SACHSCHADEN EINTRETEN.
ILLUMINA ÜBERNIMMT KEINERLEI HAFTUNG FÜR SCHÄDEN, DIE AUS DER
UNSACHGEMÄSSEN VERWENDUNG DER HIERIN BESCHRIEBENEN PRODUKTE
(EINSCHLIESSLICH TEILEN HIERVON ODER DER SOFTWARE) ENTSTEHEN, ODER JEDER
ANDEREN ART DER VERWENDUNG DER PRODUKTE AUSSERHALB DES
GÜLTIGKEITSBEREICHS DER AUSDRÜCKLICHEN SCHRIFTLICHEN LIZENZEN ODER DER
DURCH ILLUMINA GENEHMIGTEN ZULASSUNGEN IN VERBINDUNG MIT DEM ERWERB DER
PRODUKTE DURCH DEN KUNDEN.
FÜR IN-VITRO-DIAGNOSTIK
© 2012-2014 Illumina, Inc. Alle Rechte vorbehalten.
Illumina und MiSeqDx sind Marken oder eingetragene Marken von Illumina, Inc. Alle anderen hierin
enthaltenen Marken und Namen sind Eigentum der jeweiligen Eigentümer.
ii
Teile-Nr. 15038356 Rev. A DEU
Inhaltsverzeichnis
Inhaltsverzeichnis
Kapitel 1 Überblick
Einführung
Anzeigen von MiSeq Reporter
MiSeq Reporter-Konzepte
MiSeq Reporter-Benutzeroberfläche
Analyse erneut in die Warteschlange stellen
Analysekennzahlen
Analyseverfahren
MiSeqAnalysis-Ordner
Kapitel 2 Datendarstellung
Einführung
Anforderungen für die Eingabedatei
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Analyse-Ausgabedateien für die CF-Assays
Kapitel 3 Installation und Fehlerbehebung
MiSeq Reporter-Anforderungen bei Installation außerhalb des Geräts
Installieren von MiSeq Reporter außerhalb des Geräts
Verwenden von MiSeq Reporter außerhalb vom Gerät
Fehlerbehebung bei MiSeq Reporter
Anhang A Analyse-Ausgabedateien des Universal Kit 1.0
Arten von Analyse-Ausgabedateien
BAM-Dateiformat
VCF-Dateiformat
Amplikon-Abdeckungsdatei
Ergänzende Ausgabedateien
iii
1
2
3
4
5
13
14
16
17
19
20
21
22
35
37
38
39
41
42
45
46
47
48
51
52
Index
53
Technische Unterstützung
55
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
iii
[Diese Seite wurde absichtlich leer gelassen]
iv
Teile-Nr. 15038356 Rev. A DEU
Kapitel 1 Überblick
Einführung
Anzeigen von MiSeq Reporter
MiSeq Reporter-Konzepte
MiSeq Reporter-Benutzeroberfläche
Analyse erneut in die Warteschlange stellen
Analysekennzahlen
Analyseverfahren
MiSeqAnalysis-Ordner
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
2
3
4
5
13
14
16
17
1
Kapitel 1
Überblick
Überblick
Einführung
Das MiSeqDx™-Gerät enthält drei Software-Anwendungen, die nacheinander
ausgeführt werden, um Bilder von Clustern auf der Fließzelle herzustellen, die
Bildanalyse und das Base-Calling sowie eine Sekundäranalyse auf dem Gerät
durchzuführen.
} Während des Laufs erfasst die MiSeq Operating Software (MOS) Bilder von
Clustern auf der Fließzelle für die Bildanalyse, steuert den Fließzellentisch, gibt
Befehle zum Zuführen von Reagenzien und ändert die Temperaturen der Fließzelle.
} Die integrierte Primäranalysesoftware für die Echtzeitanalyse (RTA) führt die
Bildanalyse und das Base-Calling durch und weist während des Laufs jeder Base
für jeden Zyklus einen Qualitäts-Score zu. Nach dem Abschluss der Primäranalyse
von RTA wird MiSeq Reporter für den Beginn der Sekundäranalyse initiiert.
} MiSeq Reporter führt eine Sekundäranalyse auf Base-Calls und während des
Sequenzierungslaufs von RTA generierten Qualitäts-Scores auf dem Gerät durch.
MiSeq Reporter wird als Windows-Dienst ausgeführt, die Anzeige erfolgt über einen
Webbrowser. Die Software kann auch außerhalb des Geräts auf einem Computer
installiert werden. Weitere Informationen hierzu finden Sie unter Installieren von
MiSeq Reporter außerhalb des Geräts auf Seite 39.
Allgemeines zu Windows-Dienstanwendungen
Windows-Dienstanwendungen führen spezifische Funktionen ohne Benutzereingriff
durch und werden fortlaufend im Hintergrund ausgeführt, solange Windows
ausgeführt wird. Da MiSeq Reporter als ein Windows-Dienst ausgeführt wird, beginnt
er automatisch mit der Sekundäranalyse, wenn die Primäranalyse abgeschlossen ist.
Sequenzierung während der Analyse
Die Computing-Ressourcen des MiSeqDx-Geräts werden entweder für die
Sequenzierung oder für die Analyse verwendet. Wenn auf dem MiSeqDx-Gerät ein
neuer Sequenzierungslauf gestartet wird, bevor die Sekundäranalyse eines vorherigen
Laufs abgeschlossen ist, wird ein Bestätigungsdialogfeld angezeigt. Nach dem
Bestätigen des Sequenzierungslaufs wird die Sekundäranalyse gestoppt.
Verwenden Sie zum erneuten Starten einer Sekundäranalyse die Funktion Requeue
(Wieder in die Warteschlange stellen) auf der MiSeq Reporter-Benutzeroberfläche, wenn
der neue Sequenzierungslauf abgeschlossen ist. Zu diesem Zeitpunkt beginnt die
Sekundäranalyse wieder von vorne.
2
Teile-Nr. 15038356 Rev. A DEU
Die MiSeq Reporter-Benutzeroberfläche kann nur in einem Webbrowser angezeigt
werden. Um die Benutzeroberfläche von MiSeq Reporter anzuzeigen, öffnen Sie einen
Webbrowser auf einem Computer, der Zugriff auf dasselbe Netzwerk wie das MiSeqDxGerät hat. Stellen Sie dann unter Verwendung einer der aufgeführten Methoden eine
Verbindung zum HTTP-Dienst auf Port 8042 her:
} Verbinden unter Verwendung der Geräte-IP-Adresse, gefolgt von 8042.
IP-Adresse
10.10.10.10, z. B.
HTTP-Service-Port
8042
HTTP-Adresse
10.10.10.10:8042
} Verbinden unter Verwendung des Netzwerknamens für das MiSeqDx-Gerät, gefolgt
von 8042
Netzwerkname
MiSeqDx01, z. B.
HTTP-Service-Port
8042
HTTP-Adresse
MiSeqDx01:8042
Stellen Sie für Installationen von MiSeq Reporter außerhalb des Geräts eine Verbindung
unter Verwendung der Methode für lokal installierte Dienstanwendungen her: localhost,
gefolgt von 8042.
Außerhalb des Geräts
localhost
HTTP-Service-Port
8042
HTTP-Adresse
localhost:8042
Weitere Informationen hierzu finden Sie unter Installieren von MiSeq Reporter
außerhalb des Geräts auf Seite 39.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
3
Anzeigen von MiSeq Reporter
Anzeigen von MiSeq Reporter
Überblick
MiSeq Reporter-Konzepte
Die folgenden Begriffe und Konzepte gelten für MiSeq Reporter.
4
Konzept
Beschreibung
Manifest
Die Datei, die ein Referenzgenom und Ziel-Referenzregionen
angibt, die im Ausrichtungsschritt zu verwenden sind.
Die von den Mukoviszidose-Assays verwendete Manifestdatei ist
bereits auf dem MiSeqDx-Gerät geladen.
Repository
Ein Ordner, in dem die bei Sequenzierungsläufen generierten
Daten gespeichert werden. Jeder Laufordner ist ein Unterordner
im Repository.
Laufordner
Die von der RTA-Primäranalyse-Software gefüllte Ordnerstruktur
(MiSeqOutput-Ordner) oder der von MiSeq Reporter
(MiSeqAnalysis) gefüllte Ordner.
Sample Sheet
(Probenblatt)
Eine kommagetrennte Wertedatei (*.csv), die die zum Einrichten
und Analysieren eines Sequenzierungslaufs erforderlichen
Informationen enthält, darunter eine Liste von Proben und deren
Indexsequenzen. Sie wird außerhalb des Geräts mithilfe des
Illumina Worklist Manager erstellt.
Das Probenblatt muss während der Laufkonfigurationsschritte auf
dem MiSeqDx bereitgestellt werden. Nach dem Start des Laufs
wird das Probenblatt automatisch in SampleSheet.csv umbenannt
und in die Laufordner kopiert: MiSeqOutput und MiSeqAnalysis.
Workflow
Ein Sekundäranalyseverfahren, das von MiSeq Reporter
durchgeführt wird. Der Workflow für jeden Lauf wird im
Probenblatt angegeben.
Teile-Nr. 15038356 Rev. A DEU
Wenn MiSeq Reporter im Browser geöffnet wird, wird der Hauptbildschirm mit einem
Bild des Geräts in der Mitte angezeigt. Die Symbole „Settings“ (Einstellungen) und
„Help“ (Hilfe) befinden sich in der oberen rechten Ecke und die Registerkarte
„Analyses“ (Analysen) befindet sich in der oberen linken Ecke.
} MiSeq Reporter Help (MiSeq Reporter-Hilfe) – Wählen Sie das Symbol „Help“ (Hilfe), um die MiSeq Reporter-Dokumentation im Browserfenster zu öffnen.
} Settings (Einstellungen) – Wählen Sie das Symbol „Settings“ (Einstellungen) , um
die Server-URL und den Repository-Pfad zu ändern.
} Registerkarte „Analyses“ (Analysen) – Wählen Sie „Analyses“ (Analysen), um die
Registerkarte zu erweitern. Die Registerkarte „Analyses“ zeigt eine Liste der
Analyseläufe, die entweder abgeschlossen sind, zur Analyse in die Warteschlange
gestellt wurden oder aktuell verarbeitet werden.
Abbildung 1 MiSeq Reporter-Hauptbildschirm
Server-URL- oder Repository-Einstellungen
Verwenden Sie die Funktion „Settings“ (Einstellungen) , um die Server-URL und den
Repository-Pfad zu ändern:
} Server URL – Der Server, auf dem MiSeq Reporter ausgeführt wird.
} Repository path (Repository-Pfad) – Speicherort des Analyseordners, in dem die
Ausgabedateien gespeichert werden.
Abbildung 2 Einstellungen für Server-URL und Repository
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
5
MiSeq Reporter-Benutzeroberfläche
MiSeq Reporter-Benutzeroberfläche
Überblick
In der Regel müssen diese Einstellungen nicht geändert werden, es sei denn, MiSeq
Reporter wird außerhalb des Geräts ausgeführt. Stellen Sie in diesem Fall für den
Repository-Pfad den Speicherort des MiSeqOutput-Ordners im Netzwerk ein. Weitere
Informationen hierzu finden Sie unter Verwenden von MiSeq Reporter außerhalb vom Gerät
auf Seite 41.
Registerkarte „Analyses“ (Analysen)
Auf der Registerkarte „Analyses“ (Analysen) werden alle Sequenzierungsläufe
aufgelistet, die sich im angegebenen Repository befinden. Auf dieser Registerkarte
können die Ergebnisse aus einem der aufgelisteten Läufe geöffnet werden oder ein
ausgewählter Lauf kann zur Analyse erneut in die Warteschlange gestellt werden.
Klicken Sie in der oberen rechten Ecke auf das Symbol Refresh Analysis List (AnalyseListe aktualisieren) , um die Liste zu aktualisieren.
Abbildung 3 Erweiterte Registerkarte „Analyses“ (Analysen)
Die Spalten der Registerkarte „Analyses“ (Analysen) sind „State“ (Status), „Type“ (Typ),
„Run“ (Lauf), „Completed On“ (Abgeschlossen am) und „Requeue“ (Erneut in die
Warteschlange stellen):
} State (Status) – Zeigt den aktuellen Status der Analyse anhand eines von drei
Statussymbolen an.
Tabelle 1 Symbole für den Status der Analyse
Symbol Beschreibung
Gibt an, dass die Sekundäranalyse erfolgreich abgeschlossen
wurde.
Gibt an, dass die Sekundäranalyse noch durchgeführt wird.
Gibt an, dass Fehler aufgetreten sind und die Sekundäranalyse
daher fehlgeschlagen ist.
} Type (Typ) – Listet mittels eines Buchstabenbezeichners den Analyse-Workflow auf,
der mit dem jeweiligen Lauf verbunden ist. Für die CF-Assays und das Universal
Kit 1.0 ist der Buchstabenbezeichner C.
} Run (Lauf) – Der Name des Laufordners in den MiSeqOutput- und MiSeqAnalysisOrdnern.
} Completed On (Abgeschlossen am) – Das Datum, an dem die Sekundäranalyse
abgeschlossen wurde.
} Requeue (Erneut in die Warteschlange stellen) – Aktivieren Sie dieses
Kontrollkästchen, um einen Auftrag zur Analyse erneut in die Warteschlange zu
stellen. Die Schaltfläche „Requeue“ (Erneut in die Warteschlange stellen) wird
6
Teile-Nr. 15038356 Rev. A DEU
Wenn die Analyse in die Warteschlange gestellt wird, erscheint der Lauf im unteren Teil
der Registerkarte „Analyses“ (Analysen) mit dem Symbol, das angibt, dass die Analyse
noch durchgeführt wird .
Abbildung 4 Ein in die Warteschlange gestellter Lauf auf der Registerkarte „Analyses“ (Analysen)
Registerkarten für Informationen zur Analyse und deren Ergebnisse
Wenn auf der Registerkarte „Analyses“ (Analysen) ein Lauf ausgewählt wurde, werden
Informationen zum Lauf und dessen Ergebnisse auf mehreren Registerkarten der MiSeq
Reporter-Schnittstelle angezeigt: „Summary“ (Zusammenfassung), „Details“, „Analysis
Info“ (Informationen zur Analyse), „Sample Sheet“ (Probenblatt), „Logs“ (Protokolldateien) und „Errors“ (Fehler). Anfänglich erscheinen die Informationen auf
den Registerkarten „Analysis Info“ (Informationen zur Analyse) und „Sample Sheet“ (Probenblatt). Nach Abschluss der Analyse werden alle Registerkarten mit den
entsprechenden Daten gefüllt.
Abbildung 5 Registerkarten für Informationen und Ergebnisse
Registerkarte „Summary“ (Zusammenfassung)
Die Registerkarte „Summary“ (Zusammenfassung) enthält eine Zusammenfassung der
Analyseergebnisse. Vier Diagramme werden auf der Registerkarte „Summary“ (Zusammenfassung) angezeigt:
} Diagramm „Low Percentages“ (Niedrige Prozentwerte) – Zeigt Phasierung,
Vorphasierung und Nichtübereinstimmungen in Prozent an. Niedrige Prozentwerte
deuten auf gute Laufstatistiken hin. Weitere Informationen finden Sie unter
Phasierung und Vorphasierung auf Seite 14.
} Diagramm „High Percentages“ (Hohe Prozentwerte) – Zeigt Cluster nach Filterung,
Alignment auf der Basis einer Referenz und Intensitäten in Prozent an. Hohe
Prozentwerte deuten auf gute Laufstatistiken hin.
} Diagramm „Clusters“ (Cluster) – Zeigt die Anzahl der rohen Cluster, der Cluster
nach Filterung, der Cluster ohne Alignment, der Cluster, die keinem Index
zugeordnet sind, und der Duplikate an.
} Diagramm „Mismatch“ (Nichtübereinstimmungen) – Zeigt
Nichtübereinstimmungen pro Zyklus an. Eine Nichtübereinstimmung bezieht sich
auf eine Nichtübereinstimmung zwischen dem Sequenzierungs-Read und einem
Referenzgenom nach dem Alignment.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
7
MiSeq Reporter-Benutzeroberfläche
eingeblendet. Weitere Informationen finden Sie unter Analyse erneut in die
Warteschlange stellen auf Seite 13.
Überblick
Abbildung 6 Registerkarte „Summary“ (Zusammenfassung)
Registerkarte „Details“
Die Registerkarte „Details“ enthält Einzelheiten zu den Analyseergebnissen. Die
folgenden Tabellen und Diagramme werden möglicherweise auf der Registerkarte
„Details“ angezeigt. Dies hängt davon ab, welcher Assay oder welches Kit verwendet
wird:
} Probentabelle – Fasst die Sequenzierungsergebnisse für jede Probe zusammen.
} Targets-Tabelle – Zeigt die Statistik für die Zielregionen einer ausgewählten Probe
an. (Nur Universal Kit 1.0)
} Variantentabelle – Zeigt die Unterschiede zwischen der Proben-DNA und der
Referenz.
} Abdeckungsdiagramm – Zeigt, wie tief die Probe sequenziert wurde, indem die
Anzahl der in der Probensequenz vorhandenen Basen für jede Position der Referenz
gemessen wird.
} Qscore-Diagramm – Zeigt den durchschnittlichen Qualitäts-Score an, der die
geschätzte Wahrscheinlichkeit eines Base-Call-Fehlers darstellt. Weitere
Informationen hierzu finden Sie unter Qscore-Diagramm auf Seite 33.
} Varianten-Score-Diagramm – Zeigt die Position von SNVs und InDels.
Abbildung 7 Registerkarte „Details“ für CF 139-Varianten-Assay (Beispiel)
8
Teile-Nr. 15038356 Rev. A DEU
MiSeq Reporter-Benutzeroberfläche
Abbildung 8 Registerkarte „Details“ für Universal Kit 1.0 (Beispiel)
Die Ergebnisse in den Proben-, Target- oder Varianten-Tabellen können
durch Klicken auf das Symbol Export table data to text file (Tabellendaten
in Textdatei exportieren) einzeln in eine Textdatei exportiert werden. Dieser
Export ändert nicht die Analyseberichtsdatei.
Bei CF-Assays können Ergebnisse durch Klicken auf das Symbol Export data
to CF report (Daten in den CF-Analysebericht exportieren) in den CFAnalysebericht exportiert werden. Weitere Informationen hierzu finden Sie
unter Analyse-Ausgabedateien für die CF-Assays auf Seite 35.
Registerkarte „Analysis Info“ (Informationen zur Analyse)
Die Registerkarte „Analysis Info“ (Informationen zur Analyse) enthält logistische
Informationen über den Lauf und die Analyse.
Abbildung 9 Registerkarte „Analysis Info“ (Informationen zur Analyse)
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
9
Überblick
Tabelle 2 Inhalt der Registerkarte „Analysis Info“ (Informationen zur Analyse)
Zeile
Beschreibung
Read Cycles
(Read-Zyklen)
Eine Darstellung der Anzahl der Zyklen bei jedem Read, einschließlich
der Notation für alle Index-Reads. Wenn bei einem Lauf beispielsweise
„151, 8 (I), 8 (I), 151 angegeben ist, bedeutet dies, dass der erste Read
151 Zyklen, der erste Index-Read 8 Zyklen, der zweite Index-Read 8
Zyklen und der letzte Read wieder 151 Zyklen umfasst.
Start Time
(Gestartet um)
Die Uhrzeit, zu der die Sekundäranalyse gestartet wurde.
Completion Time
(Abgeschlossen
um)
Die Uhrzeit, zu der die Sekundäranalyse abgeschlossen wurde.
Data Folder
(Datenordner)
Die Stammebene des von der RTA-Primäranalyse-Software
angelegten Ausgabeordners (MiSeqOutput), der die Ausgabedaten
aller Primär- und Sekundäranalysen für den Lauf enthält.
Analysis Folder
(Analyseordner)
Der vollständige Pfad des Ordners „Alignment“ im MiSeqAnalysisOrdner (Data\Intensities\BaseCalls\Alignment).
Copy Folder
(Kopien-Ordner)
Der vollständige Pfad des Queued-Unterordners im MiSeqAnalysisOrdner.
Registerkarte „Sample Sheet“ (Probenblatt)
Die Registerkarte „Sample Sheet“ (Probenblatt) enthält Laufparameter aus dem
Probenblatt und stellt Tools zum Bearbeiten des Probenblatts und zum erneuten
Platzieren des Laufs in die Warteschlange zur Verfügung.
Abbildung 10 Registerkarte „Sample Sheet“ (Probenblatt), Beispiel Universal Kit 1.0
Tabelle 3 Inhalt der Registerkarte „Sample Sheet“ (Probenblatt)
10
Zeile
Beschreibung
Date (Datum)
Das Datum, an dem der Sequenzierungslauf durchgeführt wurde.
Workflow
Der Analyse-Workflow für den Lauf.
Teile-Nr. 15038356 Rev. A DEU
Zeile
Beschreibung
Für die CF-Assays und das Universal Kit 1.0 lautet der Name des
Workflows „Custom Amplicon“.
Application
(Anwendung)
Der Anwendungsname. Dieses Feld wird von der Illumina Worklist
Manager-Software verwendet und gibt an, welcher Assay oder welches
Kit für den Lauf verwendet wird.
Assay
Der Name des Assays oder Kits.
Chemistry
(Chemie)
Der Chemistry-Name gibt die Rezepturfragmente an, die zum Erstellen
der laufspezifischen Rezeptur verwendet werden. Für MiSeqDx-Läufe
ist der Chemistry-Name ein Amplikon.
Manifests
(Manifestdateien)
Der Name der Manifestdatei, die ein Referenzgenom und ZielReferenzregionen angibt, die im Ausrichtungsschritt zu verwenden
sind.
Reads
Die Anzahl der Zyklen, die in Read 1 und Read 2 durchgeführt werden.
Index-Reads sind in diesem Abschnitt nicht enthalten.
Settings
(Einstellungen)
Optionale Laufparameter.
Data
Die Proben-ID, der Probenname, die Indexsequenzen und der Pfad
zum Genomordner. Die Anforderungen variieren je nach Workflow.
Registerkarte „Logs“ (Protokolle)
Auf der Registerkarte „Logs“ (Protokolle) sind alle Schritte aufgeführt, die während der
Analyse durchgeführt werden. Dieses Schritte werden in Protokolldateien aufgezeichnet,
die sich im Protokollordner befinden. Eine Zusammenfassung wird in der Datei
„AnalysisLog.txt“, einer wichtigen Datei für die Fehlerbehebung, festgehalten.
Registerkarte „Errors“ (Fehler)
Auf der Registerkarte „Errors“ (Fehler) werden alle Fehler aufgeführt, die während der
Analyse aufgetreten sind. Eine Zusammenfassung wird in der Datei
„AnalysisError.txt“, einer wichtigen Datei für die Fehlerbehebung, festgehalten.
Bearbeiten des Probenblatts in MiSeq Reporter
Probenblattdaten können von der Registerkarte „Sample Sheet“ (Probenblatt) der WebOberfläche von MiSeq Reporter aus für einen bestimmten Lauf bearbeitet werden. Zum
Bearbeiten des Probenblatts werden eine Maus und eine Tastatur benötigt.
ACHTUNG!
Das Bearbeiten der Probenblattinformationen sollte mit äußerster Sorgfalt
und Vorsicht erfolgen. Die Probenverfolgung kann verändert werden und
möglicherweise zu falschen Ergebnisberichten führen.
} Um eine Zeile im Probenblatt zu bearbeiten, klicken Sie auf ein Feld und nehmen
Sie die gewünschten Änderungen vor.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
11
MiSeq Reporter-Benutzeroberfläche
Tabelle 3 Inhalt der Registerkarte „Sample Sheet“ (Probenblatt)
Überblick
} Um eine Zeile zum Probenblatt hinzuzufügen, klicken Sie auf die Zeile und wählen
Sie Add Row (Zeile hinzufügen). Die neue Zeile erscheint unterhalb der
ausgewählten Zeile.
} Um eine Zeile aus dem Probenblatt zu löschen, klicken Sie auf die Zeile und
wählen Sie Delete Row (Zeile löschen).
} Nachdem Sie alle Änderungen am Probenblatt vorgenommen haben, wählen Sie
Save and Requeue (Speichern und erneut in die Warteschlange stellen). Damit
werden die Änderungen gespeichert und es wird eine Sekundäranalyse unter
Verwendung des bearbeiteten Probenblatts gestartet.
} Falls versehentlich eine nicht gewünschte Änderung vorgenommen wurde, klicken
Sie auf eine benachbarte Registerkarte, bevor Sie die Änderungen speichern. Eine
Warnmeldung erscheint, die besagt, dass die Änderungen nicht gespeichert wurden.
Klicken Sie auf Discard (Verwerfen), um die Änderungen rückgängig zu machen.
Speichern von Diagrammen als Bilder
MiSeq Reporter bietet eine Option zum Speichern eines Bilds der Diagramme, die für
einen Lauf generiert wurden. Klicken Sie mit der rechten Maustaste in der Registerkarte
„Summary“ (Zusammenfassung) auf eine beliebige Position oder in der Registerkarte
„Details“ auf die Position der Diagramme und wählen Sie anschließend Save Image As
(Bild speichern unter). Geben Sie der Datei bei Aufforderung einen Namen und
navigieren Sie zu dem Speicherort, an dem die Datei gespeichert werden soll.
Alle Bilder werden im JPG-Format gespeichert. Alle auf der Registerkarte angezeigten
Diagramme werden zusammen als einzelnes Diagramm exportiert. Zur Verwendung
dieser Option ist eine Maus erforderlich.
12
Teile-Nr. 15038356 Rev. A DEU
Es ist möglich, die Analyse von der MiSeq Reporter-Web-Oberfläche erneut in die
Warteschlange zu stellen. Überprüfen Sie vor dem Fortfahren, dass kein
Sequenzierungslauf ausgeführt wird.
Jedes Mal, wenn die Analyse erneut in die Warteschlange gestellt wird, wird im
MiSeqAnalysis-Ordner ein neuer Alignment-Ordner mit einer fortlaufenden Zahl
erstellt, die an den Ordnernamen angehängt wird. Beispielsweise Alignment,
Alignment1, Alignment2.
MiSeqAnalysis\<RunFolderName>\Data\Intensities\BaseCalls\Alignment2
1
Klicken Sie in der MiSeq Reporter-Web-Oberfläche auf Analyses (Analysen).
2
Navigieren Sie zu dem Lauf in der Liste der verfügbaren Läufe und klicken Sie
neben dem Namen des Laufs auf das Kontrollkästchen „Requeue“ (Erneut in die
Warteschlange stellen).
Wenn der Lauf nicht aufgeführt ist, ändern Sie das angegebene Repository in den
korrekten Speicherort. Weitere Informationen finden Sie unter Server-URL- oder
Repository-Einstellungen auf Seite 5.
Abbildung 11 Analyse erneut in die Warteschlange stellen
3
Klicken Sie auf Requeue (Erneut in die Warteschlange stellen). Das Statussymbol
links neben dem Laufnamen ändert sich und zeigt an, dass die Analyse läuft .
HINWEIS
Falls die Analyse nicht gestartet wird, stellen Sie sicher, dass die folgenden
Eingabedateien im Analyselaufordner vorhanden sind: SampleSheet.csv,
RTAComplete.txt und RunInfo.xml.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
13
Analyse erneut in die Warteschlange stellen
Analyse erneut in die Warteschlange stellen
Überblick
Analysekennzahlen
Während des Sequenzierungslaufs generiert die Echtzeitanalyse (RTA) Datendateien,
die Analysekennzahlen enthalten, die von MiSeq Reporter für die Sekundäranalyse
verwendet werden. Kennzahlen, die in den Berichten der Sekundäranalyse enthalten
sind, sind Cluster nach Filterung, Base-Call-Qualitäts-Scores sowie Phasierungs- und
Vorphasierungswerte.
Cluster nach Filterung
Cluster nach Filterung ist eine Messung der Clusterqualität. Dieser Filter entfernt die am
wenigsten zuverlässigen Daten, indem die Rohdaten gefiltert werden, um alle Reads zu
entfernen, die den Qualitätsansprüchen nicht genügen. Cluster nach Filterung werden
in den Analyseberichten mit „PF“ (Passing Filter) bezeichnet.
Qualitäts-Scores
Ein Qualitäts-Score oder Q-Score ist eine Prognose über die Wahrscheinlichkeit eines
fehlerhaften Base-Calls. Während des Sequenzierungslaufs werden Base-Call-QualitätsScores für jeden Zyklus aufgezeichnet. Während der Analyse werden Qualitäts-Scores in
FASTQ-Dateien in einem ASCII-kodierten Format aufgezeichnet.
Die folgende Tabelle zeigt die Beziehung zwischen dem Qualitäts-Score und der
Fehlerwahrscheinlichkeit an.
Qualitäts-Score
Q40
Q30
Q20
Q10
Fehlerwahrscheinlichkeit
0,0001 (1 in 10.000)
0,001 (1 in 1.000)
0,01 (1 in 100)
0,1 (1 in 10)
Phasierung und Vorphasierung
Während der Sequenzierungsreaktion erweitert sich jeder DNA-Strang in einem Cluster
um eine Base pro Zyklus. Ein kleiner Anteil an Strängen kann mit dem aktuellen
Inkorporationszyklus außer Phase geraten, entweder durch Zurückfallen hinter eine
Base (Phasierung) oder durch Vorspringen um eine Base (Vorphasierung). Die Raten für
die Phasierung und Vorphasierung sind eine Schätzung des Bruchteils der Moleküle,
die in jedem Zyklus phasiert bzw. vorphasiert wurden.
Abbildung 12 Phasierung und Vorphasierung
A
B
14
Read mit einer phasierenden Base
Read mit einer vorphasierenden Base
Teile-Nr. 15038356 Rev. A DEU
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
15
Analysekennzahlen
Die Anzahl der in einem Read ausgeführten Zyklen ist um einen Zyklus höher als die
Anzahl der analysierten Zyklen. Beispiel: Bei einem Paired-End-Lauf mit 150 Zyklen
werden zwei Reads mit 151 Zyklen (2 x 151) ausgeführt, sodass sich eine
Gesamtanzahl von 302 Zyklen ergibt. Am Ende des Laufs werden 2 x 150 Zyklen
analysiert. Der eine Extrazyklus für Read 1 und Read 2 wird für
Vorphasierungsberechnungen benötigt.
Überblick
Analyseverfahren
MiSeq Reporter führt die Sekundäranalyse mithilfe einer Reihe von Analyseverfahren
durch, zu denen die Demultiplexierung, die Generierung der FASTQ-Dateien, das
Alignment und das Varianten-Calling gehören.
Demultiplexierung
Die Demultiplexierung ist der erste Schritt der Analyse, wenn im Probenblatt mehrere
Proben aufgelistet sind und der Lauf über Index-Reads verfügt.
Die Demultiplexierung trennt Daten von gepoolten Proben auf der Basis kurzer
Indexsequenzen, die Proben aus verschiedenen Bibliotheken markieren. Jede IndexRead-Sequenz wird mit den im Probenblatt angegebenen Index-Sequenzen verglichen.
Es werden in diesem Schritt keine Qualitätswerte berücksichtigt.
Generieren von FASTQ-Dateien
Nach der Demultiplexierung werden mit diesem Verfahren temporäre Dateien im
FASTQ-Dateiformat, dem Textformat für die Darstellung von Sequenzen, generiert.
FASTQ-Dateien enthalten die Reads für jede Probe sowie die Qualitäts-Scores
(ausgenommen Reads von Clustern, die den Filter nicht passiert haben).
Alignment
Beim Alignment werden Sequenzen mit der Referenz verglichen, um eine Beziehung
zwischen den Sequenzen zu identifizieren. Außerdem wird ein Score basierend auf
Ähnlichkeitsregionen zugewiesen. Ausgerichtete Reads werden im BAM-Format
gespeichert.
Bei Daten, die im MiSeq Reporter generiert wurden, verwendet MiSeqDx einen
„banded“ Smith-Waterman-Algorithmus, der lokale Sequenz-Alignments durchführt,
um ähnliche Regionen zwischen zwei Sequenzen festzustellen. Statt die gesamte
Sequenz zu betrachten, vergleicht der Smith-Waterman-Algorithmus Segmente aller
möglichen Längen. Lokale Alignments sind für unterschiedliche Sequenzen nützlich,
bei denen vermutet wird, dass sie ähnliche Regionen innerhalb der größeren Sequenz
enthalten.
Varianten-Calling
Beim Varianten-Calling werden Einzelnukleotid-Polymorphismen (Single Nucleotide
Polymorphisms, SNPs), Insertionen und Deletionen (Indels) und andere strukturelle
Varianten aufgezeichnet.
Bei Daten, die auf dem MiSeqDx-Gerät generiert wurden, wird das Varianten-Calling
vom Starling-Varianten-Caller in MiSeq Reporter durchgeführt. Starling führt Calls von
SNPs und kleinen Indels durch und gibt die Tiefe sowie die Fehlerwahrscheinlichkeit
für jede Stelle im Genom an. Bei jedem SNP- oder Indel-Call wird die
Wahrscheinlichkeit eines Fehlers als ein Varianten-Qualitäts-Score angegeben.
Am Ende des Vorgangs erstellt Starling Berichte über SNPs und Indels im HTMLFormat sowie Tabulator-getrennte Textdateien, die Varianten im Varianten-Call-Format
(VCF) enthalten. Weitere Informationen hierzu finden Sie unter VCF-Dateiformat auf Seite
48.
16
Teile-Nr. 15038356 Rev. A DEU
Der MiSeqAnalysis-Ordner ist der Hauptordner für Läufe für MiSeq Reporter. Die
Beziehung zwischen den MiSeqOutput- und MiSeqAnalysis-Laufordnern wird wie folgt
zusammengefasst:
} Während der Sequenzierung stellt die Echtzeitanalyse (RTA) die während der
Primäranalyse generierten Dateien in den MiSeqOutput-Ordner.
} Abgesehen von Fokus- und Miniaturbildern stellt die Echtzeitanalyse (RTA) Kopien
der Dateien in Echtzeit in den MiSeqAnalysis-Ordner. Nach Abschluss der
Primäranalyse legt die Echtzeitanalyse (RTA) die Datei RTAComplete.xml in beiden
Laufordnern an.
} MiSeq Reporter überwacht den MiSeqAnalysis-Ordner und startet die
Sekundäranalyse, sobald die Datei RTAComplete.xml vorhanden ist.
} Noch während der Ausführung der Sekundäranalyse erstellt MiSeq Reporter
Analyse-Ausgabedateien im MiSeqAnalysis-Ordner und kopiert sie anschließend in
den MiSeqOutput-Ordner.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
17
MiSeqAnalysis-Ordner
MiSeqAnalysis-Ordner
[Diese Seite wurde absichtlich leer gelassen]
18
Teile-Nr. 15038356 Rev. A DEU
Kapitel 2 Datendarstellung
Einführung
Anforderungen für die Eingabedatei
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Analyse-Ausgabedateien für die CF-Assays
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
20
21
22
35
19
Kapitel 2
Datendarstellung
Datendarstellung
Einführung
MiSeq Reporter führt eine Sekundäranalyse durch und generiert verschiedene
Informationstypen, die nach Abschluss der Analyse spezifisch für den Assay sind.
Ergebnisse werden für jeden Lauf in der MiSeq Reporter-Web-Oberfläche in Form von
Diagrammen und Tabellen angezeigt. MiSeqDx umfasst die in der folgenden Tabelle
aufgeführten Produkte:
20
Produkt
Beschreibung
139-VariantenAssay für
zystische
Fibrose
Erkennt 139 klinisch relevante Varianten im CFTR-Gen bei einem
Maximum von 48 Proben.
Klinischer
SequenzierungsAssay für
zystische
Fibrose
Erkennt Mutationen in den Protein-kodierenden Regionen einschließlich
Intron/Exon-Grenzen, zwei großen Deletionen und zweier tiefer
intronischer Mutationen im CFTR-Gen bei einem Maximum von acht
Proben.
Universal Kit
1.0
Satz an Reagenzien und Verbrauchsmaterialien, die zusammen mit
einem vom Benutzer bereitzustellenden anwendungsspezifischen Oligo
verwendet werden, um eine gezielte Resequenzierung spezifischer
genomischer Regionen von Interesse durchzuführen.
Teile-Nr. 15038356 Rev. A DEU
MiSeq Reporter benötigt die folgenden Primäranalysedateien, die während des
Sequenzierungslaufs generiert werden, um eine Sekundäranalyse durchzuführen oder
die Analyse erneut in die Warteschlange zu stellen. Primäranalysedateien, z. B. *.bcl,
*.filter und *.locs, werden zum Durchführen der Analyse benötigt.
Es ist nicht erforderlich, Dateien vor dem Beginn der Analyse an einen anderen
Speicherort zu verschieben oder zu kopieren. Erforderliche Dateien werden während des
Sequenzierungsprozesses automatisch in den MiSeqAnalysis-Ordner kopiert.
Dateiname
Beschreibung
RTAComplete.txt
Eine Markerdatei, die angibt, dass die RTA-Verarbeitung
abgeschlossen ist. Das Vorhandensein dieser Datei veranlasst MiSeq
Reporter dazu, die Analyse in die Warteschlange zu stellen.
SampleSheet.csv
Bietet Parameter für den Lauf und die nachfolgende Analyse. Zu
Beginn des Laufs wird das Probenblatt in den Stammordner des
Laufordners kopiert und in SampleSheet.csv umbenannt.
RunInfo.xml
Enthält Laufinformationen der höchsten Ebene, z. B. die Anzahl der
Reads und Zyklen im Sequenzierungslauf und die Angabe, ob ein
Read indiziert ist.
Vorinstallierte Datenbanken und Genome
Das MiSeqDx-Gerät verfügt über vorinstallierte Datenbanken und Genome.
Vorinstalliert
Beschreibung
Datenbanken
dbSNP für Mensch, Version 131
refGene für Mensch
Genome
Mensch (Homo sapiens) Build hg19
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
21
Anforderungen für die Eingabedatei
Anforderungen für die Eingabedatei
Datendarstellung
Custom Amplicon (Anwendungsspezifisches
Amplikon)-Workflow
Der Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow, der für die CFAssays und Universal Kit 1.0 verwendet wird, untersucht kurze Regionen amplifizierter
DNA, sogenannte Amplikone, auf Varianten. Das fokussierte Sequenzieren von
Amplikons ermöglicht eine hohe Abdeckung bestimmter Regionen über eine große
Anzahl von Proben hinweg.
Nach der Demultiplexierung und der Generierung der FASTQ-Dateien werden im
Rahmen des Workflows die folgenden Schritte durchgeführt:
} Alignment – Cluster von jeder Probe werden an den in der Manifestdatei
angegebenen Amplikon-Sequenzen ausgerichtet.
• Im Falle von Paired-End-Daten wird jeder Read zunächst in Bezug auf sein
Alignment mit den relevanten Probensequenzen für diesen Read ausgewertet.
Read 1 wird anhand des umgekehrten Komplements der stromabwärts
gelegenen lokusspezifischen Oligos (DLSO, downstream locus specific oligos)
und Read 2 anhand der stromaufwärts gelegenen lokusspezifischen Oligos
(ULSO, upstream locus specific oligos) ausgewertet. Wenn der Beginn einer
Read-Sequenz einer Probensequenz mit maximal einer Nichtübereinstimmung
entspricht, wird die volle Länge des Reads an der Amplikon-Zielsequenz für
diese Probensequenz ausgerichtet. Dieses Alignment wird mithilfe eines
„banded“ Smith-Waterman-Alignments längs der Amplikon-Zielsequenzen
durchgeführt.
• Indels innerhalb der DLSO und ULSO werden aufgrund der Assay-Chemie
nicht beobachtet.
} Paired-End-Auswertung – Im Falle von Paired-End-Läufen wird das Alignment mit
dem höchsten Score für jedes Read berücksichtigt. Falls das Alignment bei einem
der beiden Reads fehlgeschlagen oder mit anderen Chromosomen erfolgt ist, werden
die Reads als ungelöstes Paar markiert. Wenn darüber hinaus die beiden
Alignments aus unterschiedlichen Amplikonen stammen (d. h., unterschiedliche
Reihen im Abschnitt „Targets“ der Manifestdatei), werden die Reads als ungelöstes
Paar markiert.
} Behälter/Sortieren – Reads werden nach Probe und Chromosom gruppiert und
anschließend nach Chromosomposition sortiert. Die Ergebnisse werden in einer
BAM-Datei pro Probe festgehalten.
} Varianten-Calling – Mutationen werden vom Varianten-Caller identifiziert. Weitere
Informationen hierzu finden Sie unter Varianten-Calling auf Seite 16.
} Variantenanalyse und Annotation – Unter Verwendung einer vorinstallierten SNPDatenbank (dbsnp.txt) werden alle bekannten Mutationen in der
Analysenberichtsdatei markiert.
} Statistikberichte – Statistiken werden zusammengefasst und entsprechende Berichte
generiert.
22
Teile-Nr. 15038356 Rev. A DEU
Die Informationen, die auf der Registerkarte „Summary“ (Zusammenfassung) angezeigt
werden, umfassen ein Diagramm mit niedrigen Prozentwerten, ein Diagramm mit
hohen Prozentwerten, ein Clusterdiagramm und ein Diagramm mit
Nichtübereinstimmungen.
Abbildung 13 Registerkarte „Summary“ (Zusammenfassung), Beispiel
Diagramm „Low Percentages“ (Niedrige Prozentwerte)
Y-Achse
X-Achse
Percent
(Prozent)
Phasing 1 (Phasierung 1)
Phasing 2 (Phasierung 2)
PrePhasing 1
(Vorphasierung 1)
PrePhasing 2
(Vorphasierung 2)
Mismatch 1
(Nichtübereinstimmung 1)
Mismatch 2
(Nichtübereinstimmung 2)
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
Beschreibung
Der prozentuale Anteil von Molekülen in einem
Cluster, die hinter dem aktuellen Zyklus innerhalb
von Read 1 zurückbleiben.
Der prozentuale Anteil von Molekülen in einem
Cluster, die hinter dem aktuellen Zyklus innerhalb
von Read 2 zurückbleiben.
Der prozentuale Anteil von Molekülen in einem
Cluster, die dem aktuellen Zyklus innerhalb von
Read 1 vorauseilen.
Der prozentuale Anteil von Molekülen in einem
Cluster, die dem aktuellen Zyklus innerhalb von
Read 2 vorauseilen.
Der durchschnittliche prozentuale Anteil von
Nichtübereinstimmungen für Read 1 über alle
Zyklen hinweg.
Der durchschnittliche prozentuale Anteil von
Nichtübereinstimmungen für Read 2 über alle
Zyklen hinweg.
23
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Registerkarte „Summary“ (Zusammenfassung)
Datendarstellung
Diagramm „High Percentages“ (Hohe Prozentwerte)
Y-Achse
X-Achse
Percent
(Prozent)
PF
Align 1
(Ausrichtung 1)
Align 2
(Ausrichtung 2)
I20 / I1 1
I20 / I1 2
PE Resynthesis
(PE-Resynthese)
Beschreibung
Der prozentuale Anteil von Clustern nach Filterung.
Der Prozentsatz der Cluster, die auf die Referenz in Read 1
ausgerichtet wurden.
Der Prozentsatz der Cluster, die auf die Referenz in Read 2
ausgerichtet wurden.
Das Verhältnis der Intensitäten bei Zyklus 20 zu den
Intensitäten bei Zyklus 1 für Read 1.
Das Verhältnis der Intensitäten bei Zyklus 20 zu den
Intensitäten bei Zyklus 1 für Read 2.
Das Verhältnis der Erstzyklenintensitäten für Read 1 zu den
Erstzyklenintensitäten für Read 2.
Clusterdiagramm
Y-Achse
X-Achse
Cluster
Raw (Roh)
PF
Unaligned
(Nicht
ausgerichtet)
Unindexed
(Nicht
indiziert)
Duplicate
(Doppelt)
Beschreibung
Die Gesamtzahl der im Lauf erkannten Cluster.
Die Gesamtzahl der Cluster nach Filterung in diesem Lauf.
Die Gesamtzahl der Cluster nach Filterung, die ggf. kein Alignment
mit dem Referenzgenom aufweisen. Cluster, die nicht indiziert sind,
werden nicht in die Anzahl der nicht ausgerichteten Cluster
aufgenommen.
Die Gesamtzahl der Cluster nach Filterung, die keiner Indexsequenz
im Lauf zugeordnet waren.
Dieser Wert gilt nicht für CF-Assays oder das Universal Kit 1.0 und
wird daher immer 0 sein.
Diagramm „Mismatch“ (Nichtübereinstimmung)
Y-Achse
X-Achse
Percent
(Prozent)
Cycle
(Zyklus)
Beschreibung
Stellt den prozentualen Anteil der Nichtübereinstimmungen für alle
Cluster in einem Lauf nach Zyklen dar.
Registerkarte „Details“ für CF 139-Varianten-Assay
Die auf der Registerkarte „Details“ für den CF 139-Varianten-Assay angezeigten
Informationen umfassen eine Probentabelle und eine Variantentabelle.
24
Teile-Nr. 15038356 Rev. A DEU
Probentabelle für CF 139-Varianten-Assay
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID
(Proben-ID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer ein
eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Call Rate (CallRate)
Die Anzahl der Mutationspositionen, die den vordefinierten
Schwellenwert des Zuverlässigkeitswerts erfüllen, geteilt durch die
Gesamtzahl der analysierten Mutationspositionen.
Die Call-Rate wird auf einer Pro-Proben-Basis und als Prozentsatz
angegeben, der wie folgt berechnet wird: 1 minus [Anzahl der Positionen
mit unvollständigen Calls geteilt durch die Gesamtzahl der sequenzierten
Positionen].
Performance
(Leistung)
„Pass“- oder „Fail“-Bewertung auf Basis der Call-Rate.
Für eine positive Kontrollprobe:
• PASS – mit einer Call-Rate von ≥ 99 %
• FAIL – mit einer Call-Rate von < 99 %
Für eine negative Kontrollprobe:
• PASS – mit einer Call-Rate ≤ 10 %
• FAIL – mit einer Call-Rate von > 10 %
Für eine Probe, die nicht als positive oder negative Kontrollprobe
gekennzeichnet ist:
• PASS – mit einer Call-Rate ≥ 99 %
• FAIL – mit einer Call-Rate von < 99 %
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
25
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Abbildung 14 Registerkarte „Details“ für CF 139-Varianten-Assay (Beispiel)
Datendarstellung
Spalte
Beschreibung
Control
(Kontrollprobe)
Die Art der Kontrollprobe, wie im Probenblatt aufgelistet.
Die Werte sind positiv oder negativ. Ein leeres Feld bedeutet, dass es sich
um eine reine Probe handelt.
Comment
(Kommentar)
Ein optionales Textfeld für Kommentare. In dieses Feld eingegebene
Kommentare werden in der Analyseberichtsdatei
MiSeqDxCF139VariantAssay.txt gespeichert. Wenn die Analyse erneut in
die Warteschlange gestellt wird, wird eine neue Berichtsdatei erstellt.
Kommentare aus dem vorherigen Analyselauf werden nicht in den
nächsten Analyselauf übernommen.
Varianten-Tabelle für CF 139-Varianten-Assay
26
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID (ProbenID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer ein
eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Mutations
(Mutationen)
(Common Name)
(Allgemeiner Name)
Allgemeiner Name der Mukoviszidosevariante, wie in der CFTR2Datenbank beschrieben.
Mutation Type
(Mutationstyp)
Der Typ der Variante.
• SNV – Single Nucleotide Variant (einzelne Nukleotidvariante)
• DIV – Deletion Insertion Variant (Deletions-/Insertionsvariante)
• DEL – Große Deletion
• PolyTGPolyT – PolyTG/PolyT-Genotyp im ZF-Gen
dbSNP rsID
dbSNP rsID der Variante, sofern zutreffend.
CFTR Gene Region
(CFTR-Genregion)
CFTR-Genregion (Exon-Nummer oder Intron-Nummer), in der die
Variante vorhanden ist.
Genomic Location
(Genomischer Ort)
Genomischer Ort der Variante.
cDNA Name (cDNAName)
(HGVS)
Beschreibung einer Variante auf DNA-Ebene, die die coding DNA
(cDNA)-Sequenz-Nomenklatur verwendet, die von der Human
Genome Variation Society (HGVS) empfohlen wird.
Protein Name
(Proteinname)
(HGVS)
Beschreibung einer Variante auf Proteinebene, die die
Proteinsequenz-Nomenklatur verwendet, die von der Human
Genome Variation Society (HGVS) empfohlen wird.
Result (Ergebnis)
Variant-Genotyp.
Für SNVs, DIVs und DELs:
Teile-Nr. 15038356 Rev. A DEU
Beschreibung
• HET – Heterozygot
• HOM – Homozygot
Für die PolyTGPolyT-Variante wird der tatsächliche Genotyp
gemeldet.
HINWEIS: PolyTGPolyT wird nur gemeldet, wenn die R117HVariante entdeckt wird.
Registerkarte „Details“ für klinischen CF-Sequenzierungs-Assay
Die auf der Registerkarte „Details“ für den klinischen CF-Sequenzierungs-Assay
angezeigten Informationen umfassen eine Probentabelle, eine Variantentabelle, ein
Abdeckungsdiagramm, ein Qscore-Diagramm und ein Varianten-Score-Diagramm.
Abbildung 15 Registerkarte „Details“ für klinischen CF-Sequenzierungs-Assay (Beispiel)
Probentabelle für klinischen CF-Sequenzierungs-Assay
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID
(Proben-ID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer ein
eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Call Rate (CallRate)
Die Anzahl der Basen, die den Schwellenwert für den Qualitäts-Score
erfüllen, geteilt durch die Gesamtzahl der analysierten Basen.
Die Call-Rate wird auf einer Pro-Proben-Basis und als Prozentsatz
angegeben, der wie folgt berechnet wird: 1 minus [Anzahl der Positionen
mit unvollständigen Calls geteilt durch die Gesamtzahl der sequenzierten
Basen/Positionen].
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
27
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Spalte
Datendarstellung
Spalte
Beschreibung
Performance
(Leistung)
„Pass“- oder „Fail“-Bewertung auf Basis der Call-Rate.
Für eine positive Kontrollprobe:
• PASS – mit einer Call-Rate ≥ 99 %
• FAIL – mit einer Call-Rate von < 99 %
Für eine negative Kontrollprobe:
• PASS – mit einer Call-Rate ≤ 10 %
• FAIL – mit einer Call-Rate von > 10 %
Für eine Probe, die nicht als positive oder negative Kontrollprobe
gekennzeichnet ist:
• PASS – mit einer Call-Rate ≥ 99 %
• FAIL – mit einer Call-Rate von < 99 %
Control
(Kontrollprobe)
Die Art der Kontrollprobe, wie im Probenblatt aufgelistet.
Die Werte sind positiv oder negativ. Ein leeres Feld bedeutet, dass es sich
um eine reine Probe handelt.
Comment
(Kommentar)
Ein optionales Textfeld für Kommentare. In dieses Feld eingegebene
Kommentare werden in der Analyseberichtsdatei
MiSeqDxCFClinicalSequencing.txt gespeichert. Wenn die Analyse erneut
in die Warteschlange gestellt wird, wird eine neue Berichtsdatei erstellt.
Kommentare aus dem vorherigen Analyselauf werden nicht in den
nächsten Analyselauf übernommen.
Coordinates
Not Called
(Nicht
aufgerufene
Koordinaten)
Genomkoordinaten innerhalb der Zielregion, in der ein Call aufgrund
niedriger Zuverlässigkeitswerte nicht gemeldet wurde.
Varianten-Tabelle für klinischen CF-Sequenzierungs-Assay
28
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID (ProbenID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer ein
eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Chr
Das Referenzziel oder der Name des Chromosoms.
Position
Die Position, an der die Variante gefunden wurde.
Variant Type
(Variantentyp)
Der Typ der Variante.
• SNV – Single Nucleotide Variant (einzelne Nukleotidvariante)
• DIV – Deletion Insertion Variant (Deletions-/Insertionsvariante)
• DEL – Große Deletion
• PolyTGPolyT – PolyTG/PolyT-Genotyp im ZF-Gen
Teile-Nr. 15038356 Rev. A DEU
Beschreibung
Call
Eine Zeichenfolge, die angibt, wie sich die Base oder die Basen an
dieser Stelle in der Referenz geändert hat bzw. haben.
Frequency
(Häufigkeit)
Der Teil der Reads für die Probe, der die Variante enthält. Wenn
beispielsweise die Referenzbasis an einer bestimmten Position A ist
und Probe 1 60 A-Reads und 40 T-Reads hat, dann hat SNV eine
Variantenhäufigkeit von 0,4.
Depth (Tiefe)
Die Anzahl der Reads für eine Probe, die eine bestimmte Position
abdeckt.
Filter
Die Kriterien für eine gefilterte Variante.
dbSNP ID
Der dbSNP-Name der Variante.
RefGene
Das Gen gemäß RefGene, in dem diese Variante vorkommt.
cDNA Name (cDNAName)
(HGVS)
Beschreibung einer Variante auf DNA-Ebene, die die coding DNA
(cDNA)-Sequenz-Nomenklatur verwendet, die von der Human
Genome Variation Society (HGVS) empfohlen wird.
Protein Name
(Proteinname)
(HGVS)
Beschreibung einer Variante auf Proteinebene, die die
Proteinsequenz-Nomenklatur verwendet, die von der Human
Genome Variation Society (HGVS) empfohlen wird.
Interpretation
Dieses Feld ermöglicht es dem Medizingenetiker, eine klinische
Interpretation der Mutation für jede Probe anzubieten. Die
folgenden Optionen sind in der Dropdown-Liste für jede Probe
verfügbar:
• CF – CF causing (ZF verursachend)
• MVCC – Mutation of Varying Clinical Consequence (Mutation
mit variierender klinischer Konsequenz)
• MOUS – Mutation of Unknown Significance (Mutation mit
unbekannter Signifikanz)
• NCFCM – Non CF Causing Mutation (Mutation, die nicht ZF
verursacht)
• Unknown (Unbekannt)
Anhand des Symbols kann ein neuer Bericht generiert werden.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
29
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Spalte
Datendarstellung
Spalte „Interpretation“ der Varianten-Tabelle
Die Spalte „Interpretation“ bietet eine Auswahl, die es dem Medizingenetiker ermöglicht, eine
klinische Interpretation der Mutation für jede Probe anzubieten. Die folgenden Optionen sind in
der Dropdown-Liste „Interpretation“ verfügbar:
• CF – CF causing (ZF verursachend)
• MVCC – Mutation of Varying Clinical Consequence (Mutation mit variierender klinischer
Konsequenz)
• MOUS – Mutation of Unknown Significance (Mutation mit unbekannter Signifikanz)
• NCFCM – Non CF Causing Mutation (Mutation, die nicht ZF verursacht)
• Unknown (Unbekannt)
Abbildung 16 Spalte „Interpretation“
Die Ergebnisse in den Varianten-Tabellen können durch Klicken auf das
Symbol Export table data to text file (Tabellendaten in Textdatei
exportieren) einzeln in eine Textdatei exportiert werden. Dieser Export
ändert nicht die Analyseberichtsdatei.
Nachdem der Medizingenetiker die Variantensignifikanz ermittelt hat,
können die Interpretationseinstellungen im Analysebericht gespeichert
werden. Der Dateiname des ursprünglichen Analyseberichts wird
automatisch mit einem Zeit-/Datumsstempel versehen.
Abdeckungsdiagramm für klinischen CF-Sequenzierungs-Assay
Y-Achse
X-Achse
Beschreibung
Abdeckung
Position
Die grüne Kurve stellt die Anzahl der ausgerichteten Reads dar,
die jede Position in der Referenz abdecken.
Die rote Kurve stellt die Anzahl der ausgerichteten Reads dar, die
an dieser Position in der Referenz einen Miscall aufweisen. SNVs
und andere Varianten werden als Spitzen in der roten Kurve
dargestellt.
Qscore-Diagramm
Y-Achse
X-Achse
Qscore
Position
Beschreibung
Der durchschnittliche Qualitäts-Score der Basen an der gegebenen
Position der Referenz.
Varianten-Score-Diagramm für klinischen CF-SequenzierungsAssay
30
Y-Achse
X-Achse
Score
Position
Beschreibung
Stellt grafisch den Qualitäts-Score und die Position von SNVs und
InDels dar.
Teile-Nr. 15038356 Rev. A DEU
Die auf der Registerkarte „Details“ für den Universal Kit 1.0 angezeigten Informationen
umfassen eine Probentabelle, eine Targets-Tabelle, ein Abdeckungsdiagramm, ein
Qscore-Diagramm, ein Varianten-Score-Diagramm und eine Variantentabelle.
Abbildung 17 Registerkarte „Details“ für Universal Kit 1.0 (Beispiel)
Probentabelle für Universal Kit 1.0
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID (Proben-ID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer
ein eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Cluster PF (Cluster nach
Filterung)
Die Anzahl der Cluster nach Filterung in der Probe.
Cluster Align (ClusterAusrichtung)
Die Gesamtzahl der ausgerichteten PF-Cluster der Probe
(Read 1/Read 2).
Mismatch
(Nichtübereinstimmung)
Die prozentuale Nichtübereinstimmung mit der Referenz,
gemittelt über Zyklen pro Read (Read 1/Read 2).
No Call (Kein Call)
Der Prozentsatz an Basen der Probe, die nicht aufgerufen
werden konnten (No-Call), gemittelt über Zyklen pro Read
(Read 1/Read 2).
Coverage (Abdeckung)
Die mittlere Abdeckung (Anzahl an Basen, die an einer
bestimmten Referenzposition ausgerichtet sind), gemittelt über
alle Positionen.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
31
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Registerkarte „Details“ für Universal Kit 1.0
Datendarstellung
Spalte
Beschreibung
Het SNPs (Het-SNPs)
Die Anzahl der entdeckten heterozygoten SNPs in der Probe.
Hom SNPs (Hom-SNPs)
Die Anzahl der entdeckten homozygoten SNPs in der Probe.
Insertions (Insertionen)
Die Anzahl der entdeckten Insertionen in der Probe.
Deletions (Deletionen)
Die Anzahl der entdeckten Deletionen in der Probe.
Manifest
(Manifestdatei)
Die Datei, die ein Referenzgenom und Ziel-Referenzregionen
angibt, die im Ausrichtungsschritt zu verwenden sind.
Genome (Genom)
Der Name des Referenzgenoms.
Target-Tabelle für Universal Kit 1.0
32
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Target ID (Target-ID)
Der Name des Targets im Manifest.
Chr
Das Referenzziel oder der Name des Chromosoms.
Start Position
(Startposition)
Die Startposition der Target-Region.
End Position
(Endposition)
Die Endposition der Target-Region.
Cluster PF (Cluster nach
Filterung)
Die Anzahl der Cluster nach Filterung für das Target, angezeigt
pro Read (Read 1/Read 2).
Mismatch
(Nichtübereinstimmung)
Der Prozentsatz der nicht mit dem Target übereinstimmenden
Basen, gemittelt über alle Zyklen, angezeigt pro Read.
Nichtübereinstimmung = [mittlere (Fehleranzahl in Zyklen) /
Cluster PF] * 100.
No Call (Kein Call)
Der Prozentsatz der No-Call-Basen für das Target, gemittelt
über Zyklen, angezeigt pro Read.
Het SNPs (Het-SNPs)
Die Anzahl der für das Target entdeckten heterozygoten SNPs
in allen Proben.
Hom SNPs (Hom-SNPs)
Die Anzahl der für das Target entdeckten homozygoten SNPs in
allen Proben.
Insertions (Insertionen)
Die Anzahl der für das Target entdeckten Insertionen in allen
Proben.
Deletions (Deletionen)
Die Anzahl der für das Target erkannten Deletionen in allen
Proben.
Manifest
(Manifestdatei)
Die Datei, die ein Referenzgenom und Ziel-Referenzregionen
angibt, die im Ausrichtungsschritt zu verwenden sind.
Teile-Nr. 15038356 Rev. A DEU
Y-Achse
X-Achse
Beschreibung
Abdeckung
Position
Die grüne Kurve stellt die Anzahl der ausgerichteten Reads dar,
die jede Position in der Referenz abdecken.
Die rote Kurve stellt die Anzahl der ausgerichteten Reads dar, die
an dieser Position in der Referenz einen Miscall aufweisen. SNPs
und andere Varianten werden als Spitzen in der roten Kurve
dargestellt.
Qscore-Diagramm
Y-Achse
X-Achse
Qscore
Position
Beschreibung
Der durchschnittliche Qualitäts-Score der Basen an der gegebenen
Position der Referenz.
Varianten-Score-Diagramm für Universal Kit 1.0
Y-Achse
X-Achse
Score
Position
Beschreibung
Stellt grafisch den Varianten-Qualitäts-Score und die Position von SNPs
und Indels dar.
Varianten-Tabelle für Universal Kit 1.0
Spalte
Beschreibung
#
Eine Ordinalzahl in der Tabelle, die der Identifikation dient.
Sample ID
(Proben-ID)
Die Proben-ID aus dem Probenblatt. Die Proben-ID muss immer ein
eindeutiger Wert sein.
Sample Name
(Probenname)
Der Probenname aus dem Probenblatt.
Chr
Das Referenzziel oder der Name des Chromosoms.
Position
Die Position, an der die Variante gefunden wurde.
Score
Der Varianten-Qualitäts-Score für diese Variante.
Variant Type
(Variantentyp)
Der Variantentyp, entweder SNP oder Indel.
Call
Eine Darstellung davon, wie sich die Base oder die Basen an dieser Stelle
in der Referenz geändert hat bzw. haben.
• SNPs werden im Format „Referenz > AllelA/AllelB“ aufgeführt.
• Insertionen werden im Format „Referenz/Insertion“ aufgeführt.
„G-/GA“ gibt die Insertion von A an.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
33
Custom Amplicon (Anwendungsspezifisches Amplikon)-Workflow
Abdeckungsdiagramm für Universal Kit 1.0
Datendarstellung
Spalte
Beschreibung
• Deletionen werden im Format „Referenz/Deletion“ aufgeführt.
„AGG/A--“ gibt die Deletion von GG an.
34
Frequency
(Häufigkeit)
Der Teil der Reads für die Probe, der die Variante enthält. Wenn
beispielsweise die Referenzbasis A ist und Probe 1 60 A-Reads und 40 TReads hat, dann hat der SNP eine Variantenhäufigkeit von 0,4.
Depth (Tiefe)
Die Anzahl der Reads für eine Probe, die eine bestimmte Position
abdeckt.
Filter
Die Kriterien für eine gefilterte Variante. Wenn alle Filter passiert
werden, wird „PASS“ in die Filterspalte geschrieben. Weitere
Informationen finden Sie unter Überschriften und Anmerkungen in der
VCF-Datei auf Seite 49.
dbSNP
Der dbSNP-Name der Variante, sofern zutreffend.
RefGene
Das Gen gemäß RefGene, in dem diese Variante vorkommt.
Teile-Nr. 15038356 Rev. A DEU
Die Analysenergebnisse für die CF-Assays werden auf der Registerkarte „Details“ angezeigt.
Abbildung 18 Registerkarte „Details“ für CF 139-Varianten-Assay (Beispiel)
Die Ergebnisse in den Varianten-Tabellen können durch Klicken auf das
Symbol Export table data to text file (Tabellendaten in Textdatei
exportieren) einzeln in eine Textdatei exportiert werden. Dieser Export
ändert nicht die Analyseberichtsdatei.
Nachdem der Medizingenetiker die Variantensignifikanz ermittelt hat,
können die Interpretationseinstellungen im Analysebericht gespeichert
werden. Der Dateiname des ursprünglichen Analyseberichts wird
automatisch mit einem Zeit-/Datumsstempel versehen.
Die Ausgabedateien für die CF-Assays werden auch in einer durch Tabulatoren
getrennten Textdatei zusammengefasst, die nach dem für den Lauf verwendeten Assay
benannt wird. Diese Ergebnisse sind mit den Ergebnissen identisch, die auf der
Registerkarte „Details“ angezeigt werden.
} Beim CF 139-Varianten-Assay heißt die Datei MiSeqDxCF139VariantAssay.txt.
} Beim klinischen CF-Sequenzierungs-Assay heißt die Datei
MiSeqDxCFClinicalSequencingAssay.txt.
Nach Abschluss der Analyse wird die Ausgabedatei im Alignment-Ordner des Laufs
gespeichert. Beispiel:
MiSeqAnalysis\<RunFolderName>\Data\Intensities\BaseCalls\Alignment
Wenn die Analyse wiederholt oder erneut in die Warteschlange gestellt wurde, wird
eine neue Berichtsdatei generiert und im Alignment-Ordner des Analyselaufs
gespeichert. Weitere Informationen finden Sie unter Analyse erneut in die Warteschlange
stellen auf Seite 13.
Die Ausgabedatei enthält einen Kopfbereich mit folgenden Informationen über den Lauf:
Kopfbereich
Beschreibung
Test
Beschreibt den Test, der durchgeführt wurde.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
35
Analyse-Ausgabedateien für die CF-Assays
Analyse-Ausgabedateien für die CF-Assays
Datendarstellung
Kopfbereich
Beschreibung
Run ID (Lauf-ID)
Dies ist die Lauf-ID, die zu Beginn des Sequenzierungslaufs von
MOS generiert wurde.
Run Date (Laufdatum)
Das Datum (TTMMJJ), an dem der Sequenzierungslauf in MOS
gestartet wurde.
Analysis Version
(Analyseversion)
Die Version von MiSeq Reporter, die für die Analyse verwendet
wurde.
Abbildung 19 Kopfbereich für die Ausgabedatei des CF 139-Varianten-Assays (Beispiel)
Test CF 139-Varianten-Assay
For In Vitro Diagnostic Use.
Run ID 140212_M01018_0071_000000000-A2618
Run Date 140212
Analysis Version 2.2.31.1
Nach dem Kopfbereich folgt ein Abschnitt mit einer Zusammenfassung für jede ProbenID, der Spalten für jeden gemeldeten Wert enthält. Die Beschreibungen der Spalten sind
unter Registerkarte „Details“ für CF 139-Varianten-Assay auf Seite 24 und Registerkarte
„Details“ für klinischen CF-Sequenzierungs-Assay auf Seite 27 zu finden.
HINWEIS
Die Analyseverfahren, bei denen Ausgabedateien generiert werden, sind für die
CF-Assays und das Universal Kit 1.0 nicht identisch. Die für das Universal Kit 1.0
generierten Ausgabedateien sind *.bam-Dateien, *.vcf-Dateien und
AmpliconCoverage_M#.tsv-Dateien. Weitere Informationen zu Ausgabedateien
für das Universal Kit 1.0 finden Sie in Anhang A Analyse-Ausgabedateien des
Universal Kit 1.0.
36
Teile-Nr. 15038356 Rev. A DEU
Kapitel 3 Installation und Fehlerbehebung
MiSeq Reporter-Anforderungen bei Installation außerhalb des Geräts
Installieren von MiSeq Reporter außerhalb des Geräts
Verwenden von MiSeq Reporter außerhalb vom Gerät
Fehlerbehebung bei MiSeq Reporter
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
Kapitel 3
Installation und
Fehlerbehebung
38
39
41
42
37
Installation und Fehlerbehebung
MiSeq Reporter-Anforderungen bei Installation
außerhalb des Geräts
Durch das Installieren von MiSeq Reporter auf einem Windows-Computer außerhalb
des Geräts kann eine Sekundäranalyse von Sequenzierungsdaten durchgeführt werden,
während das MiSeqDx-Gerät einen nachfolgenden Sequenzierungslauf durchführt.
Weitere Informationen hierzu finden Sie unter Installieren von MiSeq Reporter außerhalb
des Geräts auf Seite 39.
IT-Anforderungen
Die MiSeq Reporter-Software benötigt die folgenden IT-Komponenten:
} 64-Bit-Version eines Windows-Betriebssystems (Vista, Windows 7,
Windows Server 2008 64-Bit)
} Mindestens 8 GB RAM; mindestens 16 GB RAM empfohlen
} Mindestens 1 TB Speicherplatz
} Quad Core-Prozessor (2,8 GHz oder höher)
} Microsoft .NET 4
Unterstützte Browser
MiSeq Reporter kann mit den folgenden Webbrowsern angezeigt werden:
} Safari 5.1.7 oder höher
} Chrome 20.0 oder höher
} Firefox 13.0.1 oder höher
} Internet Explorer 8 oder höher
Herunterladen und Lizenzierung
38
1
Laden Sie eine zweite Kopie der MiSeq Reporter-Software von der Illumina-Website
herunter. Hierfür müssen Sie sich bei MyIllumina anmelden.
2
Stimmen Sie der Endbenutzer-Lizenzvereinbarung (EULA) zu, wenn Sie während
des Installationsvorgangs dazu aufgefordert werden. Sie benötigen keinen
Lizenzschlüssel, da diese zusätzliche Kopie kostenlos ist.
Teile-Nr. 15038356 Rev. A DEU
Um MiSeq Reporter auf einem Windows-Computer (außerhalb des Geräts) zu
installieren, richten Sie zuerst die Berechtigung Als Dienst anmelden ein und führen
Sie dann den Installationsassistenten aus. Konfigurieren Sie anschließend die Software
so, dass sie auf das entsprechende Repository und den entsprechenden GenomePath
verweist.
Einrichten von Benutzer- oder Gruppenkonten auf Windows 7
Wenn Sie das Benutzer- oder Gruppenkonto zum Aktivieren der Berechtigung Als
Dienst anmelden konfigurieren möchten, benötigen Sie Administratorrechte. Wenden
Sie sich an den vor Ort zuständigen Administrator Ihres Unternehmens, falls Sie Hilfe
benötigen.
1
Wählen Sie im Startmenü von Windows die Option Systemsteuerung und klicken
Sie anschließend auf System und Sicherheit.
2
Klicken Sie auf Verwaltung und doppelklicken Sie dann auf Lokale
Sicherheitsrichtlinie.
3
Doppelklicken Sie links in der Verzeichnisstruktur „Sicherheitseinstellungen“ auf
Lokale Richtlinien und klicken Sie anschließend auf Zuweisen von
Benutzerrechten.
4
Doppelklicken Sie im Detailfenster rechts auf Als Dienst anmelden.
5
Klicken Sie im Windows-Dialogfeld auf Benutzer oder Gruppe hinzufügen.
6
Geben Sie den Namen des Benutzer- oder Gruppenkontos für diesen Computer ein.
Klicken Sie auf Namen überprüfen, um das Konto zu validieren.
7
Klicken Sie dann nacheinander in den geöffneten Dialogfeldern auf OK und
schließen Sie anschließend die Systemsteuerung.
Weitere Informationen finden Sie unter technet.microsoft.com/en-us/library/cc739424
(WS.10).aspx auf der Microsoft-Website.
Ausführen des MiSeq Reporter-Installationsassistenten
1
Laden Sie das MiSeq Reporter-Installationspaket von der Illumina-Website herunter
und entpacken Sie es.
2
Doppelklicken Sie auf die Datei setup.exe.
3
Klicken Sie bei den Aufforderungen im Installationsassistenten auf Next (Weiter).
4
Wenn Sie dazu aufgefordert werden, geben Sie den Benutzernamen und das
Kennwort eines Kontos mit der Berechtigung Als Dienst anmelden an, wie im
vorherigen Schritt eingerichtet.
5
Fahren Sie mit den verbleibenden Aufforderungen fort.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
39
Installieren von MiSeq Reporter außerhalb des Geräts
Installieren von MiSeq Reporter außerhalb des Geräts
Installation und Fehlerbehebung
Konfigurieren von MiSeq Reporter
Um MiSeq Reporter zum Auffinden des Laufordners und der Ordner des
Referenzgenoms zu konfigurieren, bearbeiten Sie die Konfigurationsdatei in einem
Texteditor, z. B. Notepad.
1
Navigieren Sie zum Installationsordner (standardmäßig C:\Illumina\MiSeq
Reporter) und öffnen Sie die Datei MiSeq Reporter.exe.config in einem Texteditor.
2
Suchen Sie das Tag Repository und ändern Sie den value (Wert) in den
Standardspeicherort für Daten auf dem (nicht im Gerät integrierten) Computer.
Beispiel:
<add key="Repository" value="E:\Data\Repository" />
Alternativ kann dieser Speicherort ein Speicherort im Netzwerk sein, auf den der
(nicht im Gerät integrierte) Computer zugreifen kann.
3
Suchen Sie das Tag GenomePath und ändern Sie den value (Wert) in den
Speicherort des Ordners mit den Referenzgenomdateien im FASTA-Format.
Beispiel:
<add key="GenomePath" value="E:\MyGenomes\FASTA" />
Starten des MiSeq Reporter-Diensts
Nach Abschluss der Installation wird der MiSeq Reporter-Dienst automatisch gestartet.
Falls der Dienst nicht gestartet wird, starten Sie ihn mithilfe der folgenden
Anweisungen manuell oder führen Sie einen Neustart des Computers durch.
40
1
Klicken Sie im Windows-Startmenü mit der rechten Maustaste auf Computer und
wählen Sie Verwalten.
2
Doppelklicken Sie links in der Verzeichnisstruktur „Computerverwaltung“ auf
Dienste und Anwendungen und klicken Sie anschließend auf Dienste.
3
Klicken Sie mit der rechten Maustaste auf MiSeq Reporter und wählen Sie
Eigenschaften.
4
Stellen Sie sicher, dass die Option Starttyp auf der Registerkarte „Allgemein“ auf
Automatisch eingestellt ist, und klicken Sie anschließend auf Start.
5
Legen Sie auf der Registerkarte „Anmelden“ den Benutzernamen und das
Kennwort für ein Dienstkonto fest, das über Schreibberechtigungen auf den Server
verfügt. Illumina empfiehlt für die meisten Benutzer das Konto Lokales System.
Wenden Sie sich an den vor Ort zuständigen Administrator Ihres Unternehmens,
falls Sie Hilfe zu standortspezifischen Netzwerkanforderungen benötigen.
6
Klicken Sie dann nacheinander in den geöffneten Dialogfeldern auf OK und
schließen Sie anschließend das Fenster „Computerverwaltung“.
7
Verbinden Sie nach dem Starten von MiSeq Reporter die Software durch die
Eingabe von localhost:8042 in einem Webbrowser lokal.
Teile-Nr. 15038356 Rev. A DEU
Um MiSeq Reporter außerhalb des Geräts zu verwenden, muss auf die Ordner mit den
Laufdaten und Referenzgenomen zugegriffen werden können.
1
Wenn kein Netzwerkspeicherort für die Sequenzierungsdaten und Referenzgenome
verwendet wird, kopieren Sie die folgenden Ordner auf den lokalen Computer:
• Kopieren Sie die Laufdaten vom MiSeqDx-Computer in
D:\MiSeqOutput\<Laufordner>.
• Kopieren Sie die Referenzgenome vom MiSeqDx-Computer in
C:\Illumina\MiSeq Reporter\Genomes.
2
Öffnen Sie einen Webbrowser auf http://localhost:8042, wodurch die MiSeq
Reporter-Web-Oberfläche geöffnet wird.
3
Ändern Sie den Pfad zum Repository mithilfe des Einstellungen-Symbols
sich in der oberen rechten Ecke der Web-Oberfläche befindet.
, das
HINWEIS
Der Repository-Pfad wird nur temporär in den Einstellungen angegeben. Beim
nächsten Neustart des Computers verweist der Pfad standardmäßig wieder auf
den Repository-Speicherort, der in MiSeq Reporter.exe.config angegeben ist.
4
Wählen Sie auf der linken Seite der Web-Oberfläche Analyses (Analysen), um die
am angegebenen Repository-Speicherort verfügbaren Läufe anzuzeigen.
5
Bevor die Analyse eines Laufs mit einer Installation von MiSeq Reporter außerhalb
des Geräts erneut in die Warteschlange gestellt werden kann, muss der
GenomeFolder-Pfad im Probenblatt aktualisiert werden. Dieser Vorgang kann auf
der Registerkarte „Sample Sheet“ (Probenblatt) durchgeführt werden. Klicken Sie
nach dem Aktualisieren des GenomeFolder-Pfads auf Save and Requeue
(Speichern und erneut in die Warteschlange stellen).
Weitere Informationen finden Sie unter Bearbeiten des Probenblatts in MiSeq Reporter
auf Seite 11.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
41
Verwenden von MiSeq Reporter außerhalb vom Gerät
Verwenden von MiSeq Reporter außerhalb vom
Gerät
Installation und Fehlerbehebung
Fehlerbehebung bei MiSeq Reporter
MiSeq Reporter wird als Windows-Dienst ausgeführt. Es müssen Benutzerkonten
konfiguriert sein, um die Berechtigung Als Dienst anmelden vor dem Installieren von
MiSeq Reporter aktivieren zu können. Weitere Informationen finden Sie unter Einrichten
von Benutzer- oder Gruppenkonten auf Windows 7 auf Seite 39.
Weitere Informationen finden Sie unter msdn.microsoft.com/enus/library/ms189964.aspx.
Starten des Diensts fehlgeschlagen
Wenn der Dienst nicht gestartet werden kann, überprüfen Sie im WindowsEreignisprotokoll die Details der Fehlermeldung.
1
Wählen Sie Systemsteuerung und anschließend Verwaltung.
2
Wählen Sie Ereignisanzeige.
3
Wählen Sie im Fenster „Ereignisanzeige“ Windows-Protokolle | Anwendung. Der
im Ereignisprotokoll aufgelistete Fehler bezieht sich auf Syntaxfehler in MiSeq
Reporter.exe.config. Eine fehlerhafte Syntax in der Datei MiSeq Reporter.exe.config
kann dazu führen, dass der Dienst fehlschlägt.
Dateien können nicht kopiert werden
Wenn Dateien nicht im beabsichtigten Speicherort gespeichert werden können, prüfen
Sie folgende Einstellungen:
42
1
Überprüfen Sie den Pfad zum angegebenen Repository-Ordner oder zum
MiSeqOutput-Ordner:
• Überprüfen Sie bei Installationen außerhalb des Geräts mithilfe von „Settings“ (Einstellungen)
in der MiSeq Reporter-Web-Oberfläche den RepositorySpeicherort.
• Überprüfen Sie bei Installationen auf dem Gerät den Speicherort des
MiSeqOutput-Ordners im Bildschirm „Run Options“ (MOS-Laufoptionen) von
MOS auf der Registerkarte „Folder Settings“ (Ordnereinstellungen).
Es muss der vollständige UNC-Pfad (z. B. \\server1\Runs) angegeben werden. Da
MiSeq Reporter als Windows-Dienst ausgeführt wird, erkennt er keine vom
Benutzer zugeordneten Laufwerke (z. B. Z:\Runs).
2
Vergewissern Sie sich, dass es Schreibzugriff auf den Ausgabeordner gibt. Wenden
Sie sich an den vor Ort zuständigen Administrator Ihres Unternehmens, falls Sie
Hilfe benötigen.
3
Stellen Sie sicher, dass das Kopieren in MiSeq Reporter.exe.config nicht deaktiviert
ist. Diese Einstellung befindet sich im Abschnitt <appSettings> und der Wert sollte
auf 1 eingestellt sein.
<add key="CopyToRTAOutputPath" value="1"/>
Teile-Nr. 15038356 Rev. A DEU
Der Inhalt der Protokolldateien kann beim Identifizieren spezifischer Fehler für
Fehlerbehebungszwecke hilfreich sein.
1
Um die Protokolldateien mithilfe der Webbrowser-Oberfläche von MiSeq Reporter
anzuzeigen, wählen Sie den Lauf in der Registerkarte „Analyses“ (Analysen) aus.
2
Wählen Sie die Registerkarte „Logs“ (Protokolle), um eine Liste aller Schritte
anzuzeigen, die während der Analyse durchgeführt wurden. Die
Protokollinformationen werden in der Datei AnalysisLog.txt aufgezeichnet, die sich
auf der Stammebene des MiSeqAnalysis-Ordners befindet.
3
Wählen Sie die Registerkarte „Errors“ (Fehler), um eine Liste der Fehler anzuzeigen,
die während der Analyse aufgetreten sind. Die Fehlerinformationen werden in der
Datei AnalysisError.txt aufgezeichnet, die sich auf der Stammebene des
MiSeqAnalysis-Ordners befindet.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
43
Fehlerbehebung bei MiSeq Reporter
Anzeigen von Protokolldateien für einen fehlgeschlagenen Lauf
[Diese Seite wurde absichtlich leer gelassen]
44
Teile-Nr. 15038356 Rev. A DEU
Analyse-Ausgabedateien des
Universal Kit 1.0
Arten von Analyse-Ausgabedateien
BAM-Dateiformat
VCF-Dateiformat
Amplikon-Abdeckungsdatei
Ergänzende Ausgabedateien
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
46
47
48
51
52
45
Anhang A
Anhang A Analyse-Ausgabedateien des Universal Kit 1.0
Analyse-Ausgabedateien des Universal Kit 1.0
Arten von Analyse-Ausgabedateien
Die folgende Tabelle beschreibt die Ausgabedateien, die für das Universal Kit 1.0
generiert werden. Sie enthalten Analysenergebnisse für das Alignment, VariantenCalling und die Abdeckung.
Dateiname
Beschreibung
*.bam-Datei
Enthält ausgerichtete Reads für eine bestimmte Probe.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
*.vcf-Datei
Enthält Informationen über Varianten, die an
bestimmten Positionen in einem Referenzgenom
gefunden wurden.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
AmpliconCoverage_M#.tsv
Enthält Details zur resultierenden Abdeckung pro
Amplikon pro Probe. M# steht für die Manifestnummer.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
HINWEIS
Die Analyseverfahren, bei denen diese Ausgabedateien generiert werden, sind für
die CF-Assays und das Universal Kit 1.0 nicht identisch. In diesem Abschnitt
werden nur die Analyse-Ausgabedateien für das Universal Kit 1.0 beschrieben.
46
Teile-Nr. 15038356 Rev. A DEU
Eine BAM-Datei (*.bam) ist die komprimierte Binärversion einer SAM-Datei, die für
ausgerichtete Sequenzen verwendet wird. SAM- und BAM-Formate werden ausführlich
auf der Website von SAMtools beschrieben: samtools.sourceforge.net.
BAM-Dateien werden im Alignment-Ordner unter
Data\Intensities\BaseCalls\Alignment in dem Dateinamenformat Probenname_S#.bam
gespeichert, wobei # für die Probennummer steht, die sich von der Reihenfolge ableitet,
in der die Proben im Probenblatt aufgeführt sind.
BAM-Dateien enthalten einen Kopfbereich und einen Alignment-Bereich:
} Kopfbereich – Enthält Informationen über die gesamte Datei, z. B. den
Probennamen und die Probenlänge. Alignments im Alignment-Bereich sind mit
spezifischen Informationen im Kopfbereich verbunden.
} Alignments – Enthält den Read-Namen, die Read-Sequenz, die Read-Qualität und
anwendungsspezifische Tags.
Abbildung 20 Alignment-Bereich einer BAM-Datei (Beispiel)
GA23_40:8:1:10271:11781 64 chr22 17552189 8 35M * 0 0
TACAGACATCCACCACCACACCCAGCTAATTTTTG
IIIII>FA?C::B=:GGGB>GGGEGIIIHI3EEE#
BC:Z:ATCACG XD:Z:55 SM:I:8
Der Read-Name enthält das Chromosom und die Startkoordinate (chr22 17552189),
die Alignment-Qualität (8) und den Übereinstimmungsdeskriptor (35M * 0 0).
BAM-Dateien können mit einem externen Viewer, z. B. IGV oder UCSC Genome
Browser, betrachtet werden.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
47
BAM-Dateiformat
BAM-Dateiformat
Analyse-Ausgabedateien des Universal Kit 1.0
VCF-Dateiformat
VCF ist ein gängiges Dateiformat, das von der Genomik-Wissenschaftsgemeinde
entwickelt wurde und Informationen über Varianten enthält, die an spezifischen
Positionen in einem Referenzgenom gefunden wurden.
VCF-Dateien verwenden das Dateinamensformat Probenname_S#.vcf, wobei # für die
Probennummer steht, die sich von der Reihenfolge ableitet, in der die Proben im
Probenblatt aufgeführt sind.
} Kopfbereich der VCF-Datei – Enthält die Version des VCF-Dateiformats und die
Version des Varianten-Callers. Außerdem enthält der Kopfbereich die
Anmerkungen, die im Rest der Datei verwendet werden. Die letzte Zeile im
Kopfbereich enthält die Spaltenüberschriften für die Datenzeilen. Weitere
Informationen finden Sie unter Überschriften und Anmerkungen in der VCF-Datei auf
Seite 49.
Abbildung 21 Kopfbereich der VCF-Datei (Beispiel)
##fileformat=VCFv4.1
##FORMAT=<ID=GQX,Number=1,Type=Integer,Description="Minimum of
{Genotype quality assuming variant position,Genotype
quality assuming non-variant position}">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype
Quality">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic
depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=VF,Number=1,Type=Float,Description="Variant
Frequency, the ratio of the sum of the called variant depth
to the total depth">
##INFO=<ID=TI,Number=.,Type=String,Description="Transcript
ID">
##INFO=<ID=GI,Number=.,Type=String,Description="Gene ID">
##INFO=<ID=EXON,Number=0,Type=Flag,Description="Exon Region">
##INFO=<ID=FC,Number=.,Type=String,Description="Functional
Consequence">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count
in genotypes, for each ALT allele, in the same order as
listed">
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele
Frequency, for each ALT allele, in the same order as
listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number
of alleles in called genotypes">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate
read depth; some reads may have been filtered">
##FILTER=<ID=LowVariantFreq,Description="Low variant frequency
< 0.20">
##FILTER=<ID=LowGQ,Description="GQ below < 20.00">
##FILTER=<ID=LowQual,Description="QUAL below < 100.00">
##FILTER=<ID=R8,Description="IndelRepeatLength is greater than
8">
##fileDate=20130506
48
Teile-Nr. 15038356 Rev. A DEU
} Datenzeilen der VCF-Datei – Jede Zeile enthält Informationen zu einer einzelnen
Variante. Die Datenzeilen befinden sich unter den Spaltenüberschriften im
Kopfbereich.
Überschriften und Anmerkungen in der VCF-Datei
Das VCF-Dateiformat ist flexibel und erweiterbar. In den folgenden Tabellen werden die
Überschriften und Anmerkungen der VCF-Datei beschrieben, die von MiSeq Reporter
generiert werden.
Überschriften der VCF-Datei
Überschrift
Beschreibung
CHROM
Das Chromosom des Referenzgenoms. Chromosomen werden in derselben
Reihenfolge wie in der FASTA-Referenzdatei aufgeführt.
POS
Die Einzelbasenposition der Variante im Referenzchromosom. Bei SNPs ist
diese Position die Referenzbase mit der Variante. Bei Indels oder Deletionen ist
diese Position die Referenzbase unmittelbar vor der Variante.
ID
Die rs-Nummer für den SNP aus dbSNP.txt, falls vorhanden. Wenn es
mehrere rs-Nummern an dieser Position gibt, wird die Liste durch Semikola
getrennt. Wenn an dieser Position kein dbSNP-Eintrag existiert, wird eine
Kennung für einen fehlenden Wert ('.') verwendet.
REF
Der Referenz-Genotyp. Beispielsweise wird die Deletion eines einzelnen T als
Referenz-TT und alternatives T dargestellt.
ALT
Die Allele, die sich vom Referenz-Read unterscheiden. Beispielsweise wird die
Insertion eines einzelnen T als Referenz-A und alternatives AT dargestellt.
QUAL
Ein vom Varianten-Caller zugewiesener Phred-skalierter Qualitäts-Score.
Höhere Scores weisen auf eine höhere Zuverlässigkeit der Variante und eine
geringere Fehlerwahrscheinlichkeit hin. Bei einem Qualitäts-Score von Q
beträgt die geschätzte Fehlerwahrscheinlichkeit 10-(Q/10). Beispielsweise hat
die Reihe der Q30-Calls eine Fehlerrate von 0,1 %. Viele Varianten-Caller
weisen Qualitäts-Scores auf Basis ihrer statistischen Modelle zu, die relativ zur
beobachteten Fehlerrate hoch sind.
Anmerkungen in der VCF-Datei
Überschrift
Beschreibung
FILTER
Wenn alle Filter passiert werden, wird „PASS“ in die Filterspalte geschrieben.
• LowDP – Angewendet auf Positionen, bei denen die Abdeckungstiefe unter
dem Cutoff liegt.
• LowGQ – Die Genotypisierungsqualität (GQ) liegt unter dem Cutoff.
• LowQual – Die Variantenqualität (QUAL) liegt unter dem Cutoff.
• LowVariantFreq – Die Variantenhäufigkeit liegt unter dem Schwellenwert.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
49
VCF-Dateiformat
##source=Starling 0.3
##phasing=none
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT
Analyse-Ausgabedateien des Universal Kit 1.0
Überschrift
Beschreibung
• R8 – Bei einem Indel ist die Anzahl der benachbarten Wiederholungen (1Base oder 2-Base) in der Referenz größer als 8.
50
INFO
• AC – Allelanzahl in Genotypen für jedes ALT-Allel, in derselben Reihenfolge
wie aufgeführt.
• AF – Allelhäufigkeit für jedes ALT-Allel, in derselben Reihenfolge wie
aufgeführt.
• AN – Die Gesamtzahl der Allele in aufgerufenen Genotypen.
• Exon – Eine kommagetrennte Liste der Exon-Regionen, die aus dem
RefGene gelesen wurden.
• FC – Funktionale Konsequenz.
• GI – Eine kommagetrennte Liste der Gen-IDs, die aus dem RefGene gelesen
wurden.
• TI – Eine kommagetrennte Liste der Transkript-IDs, die aus dem RefGene
gelesen wurden.
FORMAT
• AD – Eintrag im Format X,Y, wobei X für die Anzahl der Referenz-Calls und
Y für die Anzahl der alternativen Calls steht.
• DP – Ungefähre Read-Tiefe; Reads mit MQ=255 oder mit fehlerhaften
„Mates“ werden herausgefiltert.
• GQ – Genotypqualität.
• GQX – Genotypqualität. GQX ist das Minimum des GQ-Werts und der
QUAL-Spalte. In der Regel sind diese Werte ähnlich. Als Minimum ist GQX
der konservativere Messwert für die Genotypqualität.
• GT – Genotyp. 0 entspricht der Referenzbase, 1 entspricht dem ersten
Eintrag in der ALT-Spalte, usw. Der Schrägstrich (/) gibt an, dass keine
Phasierungsinformationen vorhanden sind.
• VF – Variant frequency (Variantenhäufigkeit); der Prozentsatz der Reads,
die das alternative Allel unterstützen.
SAMPLE
(PROBE)
Die Probenspalte enthält die Werte, die in der Spalte FORMAT angegeben
sind.
Teile-Nr. 15038356 Rev. A DEU
Für jedes Manifest wird eine Amplikon-Abdeckungsdatei generiert. Das „M#“ im
Dateinamen steht für die Manifestnummer, wie sie im Probenblatt aufgeführt ist.
Jede Datei beginnt mit einem Kopfbereich, der die mit dem Manifest verbundenen
Proben-IDs enthält. Die erste Spalte enthält die Target-IDs. Jede weitere Spalte enthält die
Abdeckungstiefe für die zugehörige Proben-ID.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
51
Amplikon-Abdeckungsdatei
Amplikon-Abdeckungsdatei
Analyse-Ausgabedateien des Universal Kit 1.0
Ergänzende Ausgabedateien
Die folgenden Ausgabedateien bieten ergänzende Informationen oder eine
Zusammenfassung von Laufergebnissen und Analysefehlern. Zwar sind diese Dateien
nicht für die Beurteilung der Analysenergebnisse erforderlich, können aber für die
Fehlerbehebung verwendet werden.
52
Dateiname
Beschreibung
AnalysisLog.txt
Verarbeitungsprotokoll, in dem jeder Schritt während
der Analyse des aktuellen Laufordners beschrieben ist.
Diese Datei enthält keine Fehlermeldungen.
Befindet sich auf der Stammebene des Laufordners.
AnalysisError.txt
Verarbeitungsprotokoll, in dem alle während der
Analyse aufgetretenen Fehler aufgeführt sind. Diese
Datei ist nur vorhanden, wenn Fehler aufgetreten sind.
Befindet sich auf der Stammebene des Laufordners.
AmpliconRunStatistics.xml
Enthält eine laufspezifische Zusammenfassungsstatistik.
Befindet sich auf der Stammebene des Laufordners.
CompletedJobInfo.xml
Wird nach Abschluss der Analyse erstellt, enthält
Informationen über den Lauf, z. B. Datum, FließzellenID, Softwareversion und andere Parameter.
Befindet sich auf der Stammebene des Laufordners.
DemultiplexSummaryF1L1.txt
Gibt die Demultiplexing-Ergebnisse in einer Tabelle mit
einer Zeile für jede Platte und einer Spalte für jede Probe
an.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
ErrorsAndNoCallsByLaneTile
ReadCycle.csv
Eine Datei mit kommagetrennten Werten, die den
Prozentsatz der Fehler und No-Calls für jede Platte,
jeden Read und jeden Zyklus enthält.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
Mismatch.htm
Enthält Histogramme von Nichtübereinstimmungen pro
Zyklus und von No-Calls pro Zyklus für jede Platte.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
Summary.xml
Enthält eine Zusammenfassung der
Nichtübereinstimmungsraten und anderer Base-CallingErgebnisse.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
Summary.htm
Enthält eine aus Summary.xml generierte
Zusammenfassungswebseite.
Befindet sich in Data\Intensities\BaseCalls\Alignment.
Teile-Nr. 15038356 Rev. A DEU
Index
Index
*.bam 47
*.bam.bai 47
*.vcf 48
den 42
Protokolldateien 43
Starten des Diensts fehlgeschlagen 42
Fehlerwahrscheinlichkeit 14
A
G
Abdeckungsdiagramm 8
Alignment 16
Als Dienst anmelden 39
Analyse
während der Sequenzierung 2
Analyse erneut in Warteschlange stellen 6, 11, 13
Analyseordner 9, 17
AnalysisError.txt 43
AnalysisLog.txt 43
Anzeigen von MiSeq Reporter 3
Assays 20
Genom-Pfad 40
GI Gen-ID 49
GT Genotyp 49
B
K
*
BAM-Dateien
Dateiformat 47
BAM-Indexdateien 47
Bearbeiten des Probenblatts 11
C
CF 139-Varianten-Assay 20
Cluster (Diagramm) 7
Cluster nach Filterung 14
Custom Amplicon-Workflow 22
D
Dateien können nicht kopiert
werden 42
Datenbank, vorinstalliert 21
Datenordner 9
dbsnp-Datenbank 21
Demultiplexierung 16
DLSO 22
Dokumentation 55
E
Eingabe-Dateien 21
F
FASTQ-Dateien 16
Fehlerbehebung
Dateien können nicht kopiert wer-
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
H
Hilfe, technisch 55
Hohe Prozentwerte (Diagramm) 7
I
Installation außerhalb des Geräts 39
IP-Adresse, MiSeq Reporter 3
IT-Anforderungen 38
Kit 20
Klinischer CF-SequenzierungsAssay 20
Kopien-Ordner 9
Kundendienst 55
L
Laufordner
Allgemeines 4
Beziehung 17
Lizenz (EULA) 38
localhost 3
Lokale Sicherheitsrichtlinie 39
Lokales Systemkonto 40
LowDP 49
LowGQ 49
LowVariantFreq 49
M
Manifestdatei 4, 10
MiSeqAnalysis-Ordner 17
MiSeqDxCF139VariantAssay.txt 35
MiSeqDxCFClinicalSequencingAssay.txt 35
MiSeqOutput-Ordner 17
53
Index
N
W
Nach Filterung (PF) 14
Nichtübereinstimmungen (Diagramm) 7
Niedrige Prozentwerte (Diagramm)
7
Windows-Dienst
Allgemeines 2
Als Dienst anmelden 42
Workflow
Custom Amplicon 22
MiSeqDx-Software 2
P
Phasierung, Vorphasierung 14
Probenblatt
Allgemeines 4
Bearbeiten 11
Probentabelle 8
Protokolldateien 43
Q
Q-Scores 14
Qscore-Diagramm 8
Qualitäts-Scores 14
R
r8 49
Read-Zyklen 9
Referenzgenome, vorinstalliert 21
refGene-Datenbank 21
Repository-Pfad 5, 40
RTAComplete.txt 21
RunInfo.xml 21
S
SAM-Tools 47
SampleSheet.csv 21
Server-URL 5
Smith-Waterman 16, 22
Starten des Diensts
fehlgeschlagen 42
Symbole, Status der Analyse 6
T
Technische Unterstützung 55
TI Transkript-ID 49
U
ULSO 22
Universal Kit 1.0 20
V
Varianten-Score-Diagramm 8
Variantentabelle 8
VCF-Dateien
Anmerkungen 49
Dateiformat 48
VF Variantenhäufigkeit 49
54
Teile-Nr. 15038356 Rev. A DEU
Wenn Sie technische Unterstützung benötigen, wenden Sie sich an den technischen
Support von Illumina.
Tabelle 4 Allgemeine Kontaktinformationen für Illumina
Illumina-Website
E-Mail
www.illumina.com
[email protected]
Tabelle 5 Telefonnummern des Illumina-Kundendiensts
Region
Telefonnummer
Region
Telefonnummer
Nordamerika
1.800.809.4566
Italien
800.874909
Belgien
0800.81102
Niederlande
0800.0223859
Dänemark
80882346
Norwegen
800.16836
Deutschland
0800.180.8994
Österreich
0800.296575
Finnland
0800.918363
Schweden
020790181
Frankreich
0800.911850
Schweiz
0800.563118
Großbritannien
0800.917.0041
Spanien
900.812168
Irland
1.800.812949
Andere Länder
+44.1799.534000
Materialsicherheitsdatenblätter
Wenden Sie sich bezüglich der Sicherheitsdatenblätter (SDSs) an den technischen
Support von Illumina.
Produktdokumentation
Die Produktdokumentation steht auf der Illumina-Website im PDF-Format zum
Herunterladen zur Verfügung. Gehen Sie zu www.illumina.com/support, wählen Sie
ein Produkt aus und klicken Sie anschließend auf Documentation & Literature.
MiSeq Reporter Software Referenzhandbuch für IVD-Assays
55
Technische Unterstützung
Technische Unterstützung
Illumina
San Diego, Kalifornien 92122, USA
+1.800.809.ILMN (4566)
+1.858.202.4566 (außerhalb von Nordamerika)
[email protected]
www.illumina.com
Emergo Europe
Molenstraat 15
2513 BH Den Haag
Niederlande
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Related manuals

Download PDF

advertisement