everything

everything
Dissertation
Submitted to the
Combined Faculties for the Natural Sciences and for Mathematics
Of the Ruperto-Carola University of Heidelberg, Germany
For the degree of
Doctor of Natural Sciences
Presented by
Diplom-Biologe Dominique Manu
Born in Toulouse
Oral examination:
Characterization of Estrogen Receptor α in
Mouse Osteoblasts
Referees:
Prof. Dr. Thomas Braunbeck
Dr. Jürg Müller
2
3
Table of contents
TABLE OF CONTENTS .......................................................................................... 4
AKNOWLEDGEMENTS ......................................................................................... 7
SUMMARY................................................................................................................ 8
INTRODUCTION ..................................................................................................... 9
1.
INTRODUCTION: A HISTORICAL OVERVIEW ...................................................... 10
2.
STRUCTURAL AND FUNCTIONAL ASPECTS OF ER Α .......................................... 12
2.1.
ER α functional domains........................................................................ 13
2.2.
Interaction between N-and C- terminal domains and the basis of ligand
dependent activity.............................................................................................. 18
3.
4.
ER Α MEDIATED TRANSCRIPTION .................................................................... 20
3.1.
Mechanism of ER α mediated transcription ........................................... 20
3.2.
Regulation of ER α action ...................................................................... 24
GENOMIC ORGANIZATION AND EXPRESSION OF ER Α....................................... 32
4.1.
Genomic organization of the ER α gene................................................. 32
4.2.
Multiple promoters and the transcriptional regulation of ER α expression
34
4.3.
Functional implications of alternative splicing and alternative promoter
usage 35
4.4.
5.
ER α protein turnover ............................................................................ 36
PHYSIOLOGY OF ESTROGENS ........................................................................... 37
5.1.
Ligand nature and availability............................................................... 37
5.2.
Estrogen function................................................................................... 38
5.3.
Tissue distribution of estrogen receptors ............................................... 39
4
5.4.
Non-reproductive sites of action: the example of bone .......................... 40
OBJECTIVES.......................................................................................................... 48
RESULTS................................................................................................................. 50
1.
IN VITRO DIFFERENTIATION OF AN OSTEOBLASTIC CELL LINE AND OF PRIMARY
OSTEOBLASTS ......................................................................................................... 51
2.
3.
ER ALPHA EXPRESSION IN OSTEOBLASTS......................................................... 54
2.1.
Characterisation of ER α protein isoforms in osteoblasts...................... 54
2.2.
The expression of ER α in osteoblasts is not sex specific ....................... 58
2.3.
ER α expression in osteoblasts is low compared to uterus ..................... 59
ER ALPHA EXPRESSION DURING OSTEOBLAST DIFFERENTIATION ..................... 60
3.1.
ER α expression increases with osteoblast differentiation ..................... 60
3.2.
Inhibiting osteoblast differentiation with TGF β does not impair ER α
expression.......................................................................................................... 62
3.3.
ER α expression during osteoblastic and myogenic differentiation of
C2C12 cells. ...................................................................................................... 65
4.
ESTROGEN RECEPTOR TRANSCRIPTIONAL ACTIVITY IN MOUSE OSTEOBLASTS .. 69
4.1.
The transcriptional activity of the estrogen receptor increases with
differentiation and displays high levels in the absence of ligand ....................... 69
4.2.
ER α shows high activity in the absence of ligand in 2T3 cells. ............. 71
4.3.
Molecular analysis of the “ligand-independent activity” of ER α.......... 74
4.4.
The “ligand independent” activity of mER α arises from residual
estrogens the culture medium ............................................................................ 76
5.
ESTROGEN SIGNALLING IS NOT NECESSARY AND DOES NOT AFFECT
DIFFERENTIATION OF 2T3 CELLS ............................................................................. 78
5
6.
THE EFFECT OF TGF BETA ON ER ALPHA EXPRESSION AND TRANSACTIVATION
FUNCTION ............................................................................................................... 80
7.
HUMAN ER ALPHA REFERENCED AS WILD TYPE CONTAINS THE MUTATION
G400V................................................................................................................... 83
DISCUSSION .......................................................................................................... 88
1.
ER ALPHA IS EXPRESSED AND IS FUNCTIONAL IN MOUSE OSTEOBLASTS ........... 89
2.
ER ALPHA EXISTS AS TWO ISOFORMS IN MOUSE OSTEOBLASTS ........................ 90
3.
ER ALPHA EXPRESSION IN THE MESENCHYMAL LINEAGE IS NOT SPECIFIC TO
OSTEOBLASTS AND IS LOWER THAN IN REPRODUCTIVE TISSUES. .............................. 93
4.
INVOLVEMENT OF ESTROGEN SIGNALLING IN OSTEOBLAST DIFFERENTIATION .. 97
5.
ACTIVITY OF ER ALPHA IN OSTEOBLASTS ..................................................... 100
6.
EFFECT OF TGF BETA FAMILY MEMBERS ON ER ALPHA EXPRESSION ............. 103
7.
HUMAN ER ALPHA REFERENCED AS WILD TYPE CONTAINS THE G400V
MUTATION ............................................................................................................ 105
MATERIALS AND METHODS .......................................................................... 107
REFERENCES ...................................................................................................... 119
6
Aknowledgements
I first would like to thank Frank Gannon for giving me the opportunity to do my PhD
in his lab. I am also very grareful to all the past and present members of the Gannon
lab. Martin Koš, George Reid, Stefanie Denger, Heike Brant, Michael Hübner, David
Vanneste, Nancy Bretschneider.
I am also grateful to other people at EMBL for the time they spent trying to help me. I
would like to particularly thank, Joel Beaudoin, Bruno Galy, Peter Lenart, Gustave
Goutierre.
Among the excellent services provided by the EMBL I would especially like to thank,
Wladimir Benes and the members of the Gene Core facility.
Thanks also to the members of my thesis committee, Juan Valcárcel, Angel Nebreda
and Jürg Müller.
7
Titel: Characterization of Estrogen Receptor alpha in Mouse Osteoblasts
Name: Dominique Manu
Betreuer: Prof. Frank Gannon
Zusammenfassung
Östrogene sind für die Koordinierung der reproduktiven Organe verantwortlich.
Zusätzlich beeinflussen sie nichtreproduktive Organe wie Knochen durch die
Regulierung von Osteoblasten und Osteoklasten, die die Knochenhomöostasis
kontrollieren. Östrogene können zwei nukleäre Rezeptoren aktivieren, Östrogen Rezeptor
(ER) alpha und ER beta. Nach Östrogenbindung aktivieren ERs direkt die Transkription
von Zielgenen, welche das Zellschicksal bestimmen. Osteoblasten exprimieren ER alpha
und wurden als direktes Target und Haupteffektor von Östrogen vorgeschlagen.
Um die Osteoblastenregulation besser verstehen zu können, wurden in dieser Studie die
Funktion von ER alpha in primär kultivierten Mausosteoblasten und mesenchymalen
Zellinien charakterisiert. Unsere Ergebnisse bestätigen, dass ER alpha in Osteoblasten
exprimiert wird und dass transkriptionelle Aktivierung durch ER alpha stattfinden kann.
Allerdings waren die Expressionslevels sehr viel niedriger als in reproduktiven Geweben.
Zu unserer Überraschung hatte ER alpha in Osteoblasten eine hohe transkriptionelle
Aktivität,
was
allerdings
Wachstumsmedium
abhing.
von
ER
niedrigen
alpha
Konzentrationen
Expression
erhöht
von
sich
Östrogen
im
wärend
der
Zelldifferenzierung. In früheren Studien wurde vermutet, dass dies die Spezifität von ER
alpha Expression in Osteoblasten widerspiegelt. Unsere Ergebnisse zeigen allerdings,
dass ER alpha Expression auch in anderen Zelltypen wärend der Differenzierung
induziert
wird.
Ausserdem
konnte
kein
Einfluss
von
Östrogen
auf
die
Osteoblastendifferenzierung festgestellt werden. Zusammengefasst bestätigt diese Studie,
dass funktionelle ER in Osteoblasten exprimiert werden. Allerdings stellen unsere
Ergebnisse die Hypothese in Frage, dass Osteoblasten als direkte Mediatoren für
Östrogen in der Regulation der Knochenhomöostasis agieren.
Summary
Estrogens are commonly known for coordinating reproductive function. However,
they also affect the physiology of non-reproductive tissues such as bone. In particular,
they regulate two cell types that control bone homeostasis, osteoblasts and osteoclasts.
Estrogens can activate two nuclear receptors, Estrogen Receptor (ER) alpha and ER
beta. After binding to estrogen, ERs directly activate transcription target genes that
determine cell fate. osteoblasts express ER alpha and have been suggested as the
direct target of estrogens that mediates most effects estrogens have on bone.
To better understand Osteoblast regulation by estrogen, we characterized ER alpha in
primary mouse osteoblasts and mesenchymal cell lines. This study confirms that ER
alpha is expressed in osteoblasts and that it can mediate transcriptional activation.
However, the expression level of ER alpha is very low as compared to reproductive
tissues. Surprisingly, ER alpha in osteoblasts still has a high residual transcriptional
activity, which depends on low concentration of estrogens in the growth medium.
ER alpha expression increases during differentiation of mouse osteoblasts. Previous
studies suggested that this might reflect the specificity of ER alpha expression in
osteoblasts. However, our results demonstrate that induction of ER alpha expression
upon differentiation is not limited to osteoblasts as differentiation of a mesenchymal
cell line into myoblasts also increases the levels of ER alpha expression. Finally,
Estrogens did not influence osteoblast differentiation. In conclusion, these results
confirm the presence of a functional ER in osteoblasts, but challenge the view that
osteoblasts act as direct mediators of estrogen action on bone homeostasis.
8
Introduction
9
1. Introduction: a historical overview
It was in the 1920’s that a hormone present in the ovaries, able to induce estrus or
ovulation as well as a swelling of the uterus and the vagina, was isolated (Allen and
doisy, 1923). This hormone was, as a result of its effects, termed estrogen. The
principal physiological form of the hormone is 17-β-Estradiol (E2). It remained
however unknown how estrogen could achieve its effects on the reproductive tract
until the early 1960’s, when the use of radiolabeled E2 with high specific activity
allowed the localization of an estrogen binding protein or estrogen receptor (ER) to
target tissues mostly the uterus vagina and the anterior pituitary (Jensen and Jacobson,
1962). Estrogens were later found to alter RNA polymerase II (RNA pol II)
transcription in target tissues suggesting ER was a transcription factor (O'Malley and
McGuire, 1968). Following progress in molecular biology techniques, the cDNA of
the first ER was then cloned (Green et al., 1986;Greene et al., 1986). The cloning of
ER followed that of other intracellular hormone receptors, namely the glucocorticoid
receptor (Weinberger et al., 1985) and the thyroid receptor (Sap et al.,
1986;Weinberger et al., 1986) which all shared homologous sequences. Collectively,
sequence comparisons determined the existence of a family of ligand-regulated
transcription factors that shared a conserved sequence and apparently modular
organization
(Evans,
1988).
Nuclear
receptors,
including
ER,
become
transcriptionally active upon ligand binding. They generally bind to DNA as dimers,
thereby recognizing a cognate palindromic DNA sequence, and thereafter recruit the
transcriptional machinery to a target promoter (Kumar et al., 1987).
In the late 80’s, in a process termed “squelching”, it was found that transcription
factors could compete for limiting factors of the intermediate transcription machinery,
10
thereby inhibiting the transcriptional capacity of each other (Meyer et al., 1989).
These shared factors required for nuclear receptor transcriptional activation were
termed coactivators. The 90’s were dedicated to the identification of these
coactivators. The first coactivators were isolated in 1994 (Halachmi et al.,
1994;Cavailles et al., 1994). Their cloning was achieved a year later (Cavailles et al.,
1995;Onate et al., 1995). A multitude of coactivators was subsequently cloned
(McKenna et al., 1999). It was realized that some coactivators had enzymatic activity
and could covalently modify histones or remodel chromatin around the binding site of
ER (Fryer and Archer, 1998;Blanco et al., 1998). Other coactivators forming the
mediator complex and involved in promoting the activation of polII on the promoter,
do not contain any enzymatic activity but directly contact and recruit the
transcriptional machinery to the remodeled chromatin (Malik and Roeder, 2000).
Corepressors were also concomitantly identified and showed opposite enzymatic
activity to that of coactivators thus opposing their effects (Heinzel et al., 1997;Nagy et
al., 1997).
The development of chromatin immunoprecipitation (ChIP) in mammalian cells
allowed the characterization of the binding kinetics of the different factors to the
promoter of a target gene and revealed the dynamic nature of transcription activation
(Shang et al., 2000;Metivier et al., 2003). The use of GFP tagged nuclear receptors
confirmed the dynamism of the interaction between nuclear receptors and a promoter
(McNally et al., 2000).
Cloning of a second, genetically distinct ER (coined ER β, ER α corresponding to the
first ER cloned), raised the question as to which one of the two ERs mediated which
effects of estrogens (Kuiper et al., 1996). The use of gene-targeting technology
confirmed that most of the effects of estrogens on the reproductive tract are mediated
11
by ER α with ER β playing a mostly redundant function (Dupont et al., 2000).
Additionally, knockout mice devoid of either ER α, ER β or both confirmed that the
physiological effects of estrogens as anticipated, are mediated by estrogen receptors
with ER α having the major physiological influence.
2. Structural and functional aspects of ER α
Estrogen receptor α belongs to the super-family of nuclear receptors. Nuclear
receptors share a common modular and functional organization. This was revealed by
multiple sequence alignment of the predicted primary sequence of nuclear receptors,
where six different regions with different extent of sequence conservation were
delineated. These regions correspond approximately to different functional domains
of the receptor (Krust et al., 1986;Evans, 1988). These domains were defined as A to
F and this terminology is used here. The numbering of residues corresponds, unless
otherwise mentioned, to the human ER α protein. The location of the different
domains and functions of ER α are depicted in figure 1.
It has not, to date, been possible to determine the tertiary structure of the whole ER α
or for that matter of any other nuclear receptor. As a result, direct structural evidence
is not available on the interplay between different domains. Although these domains
display a certain functional autonomy it was realized that the steroid receptor protein
functioned as a whole and that different domains could interact either directly or
allosterically to influence each other’s function. One example of intramolecular
interaction will be detailed also be detailed here.
12
Figure 1. Functional Domains of ER α
The different domains of ER α are represented with their associated functions. Residues targets of
posttranslational modifications are indicated below. Numbering corresponds to the position of the
domains in the human receptor in amino acids.
2.1.
ER α functional domains
Domain A (Amino Acids 1-37)
The A domain is not found in every nuclear receptor and, previously, no function had
been assigned to it (Metzger et al., 1995). Very recently however, it was found that
the A domain, and more precisely a LLxxI motif within the A domain, interacts with
the E domain, and by doing so inhibits, through direct competition, ligandindependent recruitment of coregulatros by the activation functions of ER α (Metivier
et al., 2002f). This motif is not found in other nuclear receptors and is not even
present in the closely related ER β; this function therefore constitutes a unique feature
of ER α (Metivier et al., 2002e). The interaction between the A and E domains will be
detailed later in the introduction.
13
Domain B (Amino Acids 38-180)
This domain is present in most nuclear receptors; it is however very variable both in
length and composition (Evans, 1988). The B domain contains the first activation
function of nuclear receptors (AF-1). Although the whole receptor is generally
inactive in the absence of hormone, the isolated A/B domain can transactivate
constitutively when fused to a DNA binding domain (Kumar et al., 1987;Tora et al.,
1989b;Berry et al., 1990;Metzger et al., 1995). The AF-1 of ER α and other nuclear
receptors is unlike the activation domains of other transcription factors (Tasset et al.,
1990). Despite this distinct primary structure, ER α AF-1 functions like other
transcription factors, by recruiting coactivators and does so in a ligand independent
manner when isolated from the rest of the receptor (Tasset et al., 1990;Webb et al.,
1998).
Conflicting data are available as to the precise location of AF-1 within the B domain,
but at most it spans the region from residue 38 to 127 (Metzger et al.,
1995;McInerney and Katzenellenbogen, 1996;Webb et al., 1998). The activity of AF1 was also shown to be entirely dependent on the integrity of an evolutionary
conserved putative α-helix (amino acids 39-44; Metivier et al., 2000). The structural
basis of coactivator binding is also not known and would involve a different type of
interaction as to what as been characterized for AF-2. Different discreet binding sites
have been mapped on ER α for different categories of coactivators and would
encompass residues 38-127 (Webb et al., 1998;Endoh et al., 1999;Kobayashi et al.,
2000).
The B domain also contains several residues that can be phosphorylated. Best
characterized are serine residues 104, 106, 118 and 167. Phosphorylation of these
14
residues have been shown to be important for receptor functions ranging from
dimerization to transcriptional activation (Lannigan, 2003).
Domain C (Amino Acids 181-263)
The C domain is the most conserved among nuclear receptors (Evans, 1988). This
domain contains the DNA-binding domain (DBD; Kumar et al., 1987). ER α, like
other class I nuclear receptors, binds to a palindromic DNA sequence, consequent on
dimerization (Kumar and Chambon, 1988;Green et al., 1988). The consensus
sequence of the estrogen response element (ERE) to which ER α binds is
AGAACAnnnTGTTCT, n being any nucleotide constituting the spacer (Klein-Hitpass
et al., 1988;Klinge, 2001).
The structure of the DBD is organized around two zinc-binding Cys2-Cys2 sequence
motifs, known as zinc fingers. This widespread DNA binding motif is conserved in
every nuclear receptor (Freedman et al., 1988;Schwabe et al., 1990). The structure of
domain C was the first to be solved for ER α (Schwabe et al., 1990;Schwabe et al.,
1993). The 3D structure confirmed the presence of the two zinc fingers and revealed
two amphipathic α-helices adjacent C-terminal to them (Schwabe et al., 1993). Each
module, consisting of a single zinc finger and one α-helix, is joined with one β-turn.
The binding to DNA is achieved through the first α-helix that binds in the major
groove of target DNA. The D-box, in the C-terminal part of the second zinc finger,
generates the dimerisation interface between two DBD monomers.
The responsive elements within promoters influenced by different nuclear receptors
are very similar in sequence but yet specifically associate with their respective
receptors. The specificity of binding is achieved by the so-called P-box located in
15
helix I. Mutation of three residues changes, for instance, the binding characteristics of
the ER α DBD into that of the glucocorticoid receptor (Mader et al., 1989).
In terms of posttranslational modification, serine 236 has been shown to be the target
of phosphorylation thereby affecting receptor dimerization (Chen et al., 1999).
Domain D (Amino Acids 264-302)
This domain is also called the hinge region and is variable in size and sequence (Krust
et al., 1986;Evans, 1988). In terms of function, the domain D harbours most of the
constitutive nuclear localization signal, comprised between residues 256 and 303
(Picard et al., 1990;Ylikomi et al., 1992). The C-terminal part of the hinge region in
ER α contains part of an ill-characterized activation function called AF-2a (Norris et
al., 1997).
Domain E (Amino Acids 303-553)
This domain, although variable in terms of sequence, is structurally very well
conserved among nuclear receptors (Wurtz et al., 1996). Domain E corresponds to the
ligand-binding domain (LBD; Kumar et al., 1987) and also harbours the liganddependent activation function (Kumar et al., 1987;Bocquel et al., 1989). AF-2
interacts with coactivators in the presence of estradiol (McKenna et al., 1999) while
in the presence of an antagonist like tamoxifen, it associates with corepressors (Smith
et al., 1997;Metivier et al., 2002b;Liu and Bagchi, 2004). In the absence of ligand the
AF-2 binds neither coactivators nor corepressors. The binding of coactivators and
corepressors to ER α relies on an LxxLL motif (NR box) predicted to form an
amphipathic helix, within the interacting protein (Heery et al., 1997;Shiau et al.,
1998;Hu and Lazar, 1999). Coactivators and corepressors associate with an
16
overlapping but distinct surface on the activated nuclear receptor and as a result their
binding is exclusive (Nagy et al., 1999).
The crystal structure of ER α LBD has been determined in the presence of E2 and in
association with the antagonists tamoxifen and raloxifene (Brzozowski et al.,
1997;Shiau et al., 1998). The structure of the unliganded LBD is however not
available. Co-crystals of E2 bound ER α LBD and of a short peptide corresponding to
an NR box have also been obtained and the structure solved (Shiau et al., 1998).
These structural data reveal that the LBD forms a three-layer α helical sandwich. The
hydrophobic ligand is found within a cavity that mainly consists of non-polar amino
acids. In the agonist bound conformation, helix 12 of the ER α LBD forms a
hydrophobic groove into which the NR box α helix, defined by the LxxLL motif, can
bind. However, in the antagonist bound conformation, helix 12 is displaced to cover
this hydrophobic groove, thereby preventing interaction with the NR box. It is
however not clear if the structural data obtained can be extrapolated to the unliganded
LBD of ER α, although as with the antagonist bound receptor, unliganded ER α also
bind corepressors in the absence of its N-terminal domain (Metivier et al., 2002b).
The E domain also regulates dimerization following ligand binding (Kumar et al.,
1988). The crystal structure of E2 liganded ER α revealed that two LBDs arrange
themselves in a head to head manner (Brzozowski et al., 1997).
Several residues within the E domain have been shown to be the target of
posttranslational modifications. Serine 305 can be phosphorylated, while lysines 302
and 303 can be acetylated. These modifications affect transcriptional activation by the
receptor (Wang et al., 2001;Wang et al., 2002;Balasenthil et al., 2004;Michalides et
al., 2004). Threonine 311 can be phosphorylated and regulates nuclear export of the
receptor (Bai et al., 1997). Finally tyrosine 537 has been shown to be an important
17
regulator of receptor functioning and has been shown to be phosphorylated (Arnold et
al., 1995).
Domain F (549-595)
This domain is very variable, even between the same nuclear receptor within different
species, in terms of sequence but is however very well conserved in terms of length
(Nichols et al., 1998). The F domain is not required for the transcriptional activity of
ER α (Kumar et al., 1987). However, as it could interact with the LBD it may, in
certain contexts, modulate the response to ER α antagonists (Montano et al.,
1995;Nichols et al., 1998).
2.2.
Interaction between N-and C- terminal domains and the basis
of ligand dependent activity
Although the structure of the whole receptor has not been solved, functional
interactions have however revealed that both physical and allosteric interactions occur
within ER α. One example of physical interaction between two distant domains is
described here.
As a result of the deletion of the A domain of ER α, the unliganded receptor can
recruit coactivators to its AF-1 and corepressors to the unliganded AF-2 (figure 2;
Metivier et al., 2002b). The ligand-independent transactivation and transrepression
functions of the receptor are inhibited in the whole ER α, because the A domain
interacts with the distant E domain. As a result of the folding of the protein and the
intramolecular interactions, in the whole receptor, neither AF-1 nor AF-2 are
accessible for protein interactions. The interaction between the two domains is
18
disrupted upon ligand binding, which then allows binding of coactivators to AF-1 and
AF-2. On the other hand binding to a partial antagonist like tamoxifen although it
disrupts the interaction between the A and E domains, permits binding of corepressors
to AF-2 and binding of coactivators to the newly accessible AF-1.
Figure 2. Interaction between the distant A and E domains
In the absence of ligand, the A domain and the AF-2 containing E domain interact with each other.
This interaction prevents recruitment of transcription coregulators. The binding of E2 disrupts the
interaction and allows the AF-2 and the AF-1 to recruit coactivators. In the presence of the antagonist
tamoxifen or after deletion of the A domain, the interaction between the A and E domains does not take
place but the AF-2 displays a corepressor binding surface. In this case, the AF-1 can recruit
coactivators as long the interaction between the N- and C-terminus is disrupted. Note that a receptor
dimer only binds one molecule of coactivator or one of corepressor at a time. As a result depending on
the concentrations of corepressor and coactivator in the cell tamoxifen will either recruit coactivators
through the AF-1 or corepressors through the AF-2. Two molecules are represented to represent
different possibilities.
The A domain directly interacts with the C-terminal region of the receptor; this
involves an interaction between an ELE sequence present in the A domain with a
19
KCK sequence within the E domain (Metivier et al., 2002b). The interaction between
the A and E domains permits binding of a LLxxI putative α-helix, present in the A
domain of ER α, into the hydrophobic groove of the E domain. The A domain would
thereby function as an internal corepressor, competing both with helix 12 corepressors
for binding in this cleft. Consequent to the folding of the protein, the AF-1 would not
be accessible either to coactivators and would thus be silenced This interaction is
predicted to be disrupted upon ligand binding. Consequently, AF-1 and AF-2 can
recruit coactivators.
3. ER α mediated transcription
3.1.
Mechanism of ER α mediated transcription
When genes are silent, DNA is packaged into a highly organized and compact
nucleoprotein structure known as chromatin, which impinge all the transcription steps.
The basic unit of the chromatin is the nucleosome, which consists of DNA wrapped
twice around an octamer protein core containing two copies each of four histone
proteins, H2a, H2b, H3 and H4. Protruding from the nucleosomes are N-terminal
histone tails whose interaction with DNA can be modulated upon covalent
modifications (Peterson and Laniel, 2004).
20
Figure 3. Mechanism of ER α action
Upon ligand binding, coactivators are recruited displaying histone acetyltransferase activity (HAT),
methylstransferase, kinase or ATP-dependent remodeling (SWI/SNF) activities, that decompact
repressive chromatin. Reruitment of the mediator complex allows entry of the basal transcription
machinery which is followed by transcription initiation (adapted from, Bastien and Rochette-Egly,
2004).
To permit transcription, ER α, as with other transcription factors, must initially
remodel the chromatin structure surrounding the promoter to allow binding of the
transcriptional machinery. To effect chromatin remodeling, the liganded receptor
recruits, directly or indirectly, coactivators which covalently modify histones and
which induce nucleosome rearrangements (figure 3; Khorasanizadeh, 2004). The
covalent modification of histone tails by coactivators is believed to relieve their
interactions with the nucleosome DNA, through the acetylation of lysine residues and
the methylation of arginine residues. p300/CBP and pCAF possess histone
acetyltransferases (HAT) activity that acetylates lysine residues on the histone tails.
21
CARM-1 acts through its histone methyltransferase activity (HMT) methylating
arginine or lysine residues on histone tails. Coactivators of the p160 family like SRC1, although they display a weak HAT activity, are believed to act as a scaffold protein
that recruits other coactivators. ATP-dependent chromatin remodelers (SWI/SNF) are
also recruited to ER α activated promoters and reposition nucleosomes at the
promoter. The combined action of these coactivators would prepare the chromatin for
subsequent binding of the transcription machinery (Narlikar et al., 2002;Metivier et
al., 2003).
Once repressive chromatin has been decondensed, the complex induced by activated
ER α then recruits the basal transcription machinery. Although ER α can contact
members of the RNA pol II complex, it is likely that the productive interaction is
indirect, through a protein complex known as the mediator (Malik et al., 2000). Once
the transcriptional initiation complex is assembled on the promoter, transcription then
initiates.
Kinetically, ChIP analysis performed at short intervals revealed that transcription
factors, coregulators and the transcriptional machinery cycle on the promoter in a
sequential way (Shang et al., 2000;Hatzis and Talianidis, 2002;Agalioti et al.,
2002;Metivier et al., 2003). Modification of local histones was also found to be
dynamic and sequential (Metivier et al., 2003). The kinetics of ER α mediated
coregulator recruitment was studied in details on the estrogen-responsive pS2
promoter (Metivier et al., 2003). ER α cycles on the pS2 promoter in the absence of
ligand confirming that ligand binding is not required for DNA binding (Reid et al.,
2003;Metivier et al., 2004). The unliganded receptor however does not recruit the
transcriptional machinery to the pS2 promoter. Upon binding E2, cycling of ER α
becomes slower. A first transcriptionally unproductive cycle immediately after E2
22
treatment results in the remodeling of the local nucleosomes and acts to generate a
transcriptionally competent conformation. An initial recruitment of the ATPdependent remodeling factor SWI/SNF occurs, followed by recruitment of HMTs and
HATs. Remodeling of chromatin is then followed by recruitment RNA pol II and the
mediator complex. Following transcription initiation, ER α and chromatin remodeling
complexes are removed from the promoter allowing subsequent cycles to proceed.
The histones are then deacetylated by histone deacetylases (HDAC) and remodeled
and a new cycle can begin. Inherent in these transcriptional cycles are (i) functional
redundancy, where multiple protein complexes act sequentially to promote each stage
in the cycle (Metivier, 2003) and (ii) limitation to the action of estrogen through a
restriction in the duration that either ER α or polymerase act on an individual
promoter (Reid, 2002; Reid, 2003; Metivier, 2003). This latter restriction ensures that
estrogen responsive promoters continuously respond to fluctuations in the level of E2.
At least two different and perhaps complementary mechanisms contribute to the
limitation of estrogen signaling. One mechanism involves targeting of ER α for
proteasomal degradation concomitant with transcription (Metivier et al., 2003;Reid et
al., 2003;Metivier et al., 2004). This involves the cyclical recruitment of potential E3
ligases to the promoter and ubiquitination of ER α (Reid, 2003). Also, a molecular
chaperone complex consisting of heat shock proteins (HSPs) may contribute to
clearance of the steroid receptor and associated proteins from the target promoter
(Freeman and Yamamoto, 2002). Interestingly, components of the proteasome and of
the HSP complex are recruited to the promoter at the end of each cycle (Reid et al.,
2003).
ER α can access a target promoter in two ways: either through direct interaction with
DNA or indirectly by docking onto proteins already bound to DNA, for example with
23
the AP-1 complex bound to responsive promoters (figure 4). Although the mechanism
of transcriptional regulation through indirect promoter binding has not been studied in
detail, it is believed to take involve the recruitment of coregulators and eventually the
transcriptional machinery, as with ER α associating to a cognate DNA element
(Jakacka et al., 2001;Shang and Brown, 2002).
3.2.
Regulation of ER α action
The transcriptional output of ER α can be regulated at multiple levels as summarized
in figure 4. This section far from being exhaustive describes a few examples of
regulation of ER α.
ER α protein level
Regulation of ER α activity can be achieved by regulation of its expression. The
levels of ER α are, to certain limits, directly related to its activity (Webb et al.,
1992;Lopez et al., 1999). The response to a given amount of ER α also depends on the
profile of interacting proteins within cell types and is, as a result, cell type dependent
(Webb et al., 1992). Regulation of ER α expression will be detailed later in the
introduction.
24
Figure 4. Regulation of ER α action
Examples of steps where ER α action can be modulated starting with localization of the receptor to
dimerization ligand binding and promoter binding. All these steps have been shown to be affected
under specific cellular condicitons and affect the transcriptional output of ER α.
25
Localization
To achieve a direct effect on transcription ER α needs to locate to the nucleus.
Following the model for glucocorticoid receptor action, it was and still is generally
believed that nuclear receptors, including ER α, are located in the cytoplasm prior to
ligand activation and that they translocate to the nucleus thereupon. It has repeatedly
been shown that ER is located mostly if not exclusively in the nucleus whether or not
complexed to its ligand.
The localization of ER α however, is open to regulation. For instance a variant of the
metastatic tumour antigen 1 (MTA1) lacking a nuclear localization signal, was found
to sequester ER α in the cytoplasm of MCF7 cells (Kumar et al., 2002). This MTA1
variant interacts directly with the AF2 of ER α through a LxxLL NR box like motif
(Kumar et al., 2002). Posttranslational modifications of ER α have also been reported
to affect localization. Phosphorylation of threonine 311, located in the NLS of ER α,
by p38 MAPK, promotes nuclear localization (Lee and Bai, 2002). This data indicate
that ER α is normally found in the cell nucleus, although, in certain cellular contexts,
it can be present in the cytoplasm. Interestingly, localization of coactivator and
corepressors is also the target of regulation and affects ER α transcriptional activity
(Baek and Rosenfeld, 2004).
Dimerization
Although the ER α DBD can bind to DNA as a monomer with low affinity in vitro
(Kumar et al., 1988), ER α exclusively binds DNA as a dimer in vivo (Lees et al.,
1990). Ligand binding was shown not to be strictly required for dimerization, at least
in mammalian cells (Zhuang et al., 1995). However dimer formation of ER α LBD in
vitro is stabilized by ligands (Tamrazi et al., 2002).
26
Protein-protein interactions impact on dimerization; it was, for instance, reported that
the orphan nuclear receptors TR2 and 4 (testicular orphan receptor 2, and 4) dimerize
with ER α. Because TR2 and 4 recognize different DNA sequences they prevent
binding of the heterodimer to an ERE (Shyr et al., 2002;Hu et al., 2002).
Posttranslational modification of ER α can also affect dimerization. Phosphorylation
of serine 239 was shown for instance to regulate dimerization (Chen et al., 1999).
DNA binding
Perfect EREs are rarely found in estrogen responsive promoters. Several sequences
give rise to estrogen responsivity to a promoter, ranging from perfectly palindromic
EREs, an imperfect palindrome or even a half ERE. Most estrogen responsive genes
contain EREs that are mostly imperfect (O'Lone et al., 2004). Although there is no
linear correlation, the binding affinity of ER and its transcriptional output are linked
in a given cellular environment (Klinge, 2001;Klinge et al., 2001). DNA binding is
not strictly dependent on ligand but interaction with DNA is stabilized by ligand
binding (Zhuang et al., 1995). Although fairly stable in vitro, association of nuclear
receptor with DNA appears to be transient in vivo as monitored by ChIP and
microscopy (McNally et al., 2000;Reid et al., 2003).
High mobility group (HMG) proteins directly contact steroid receptors, and by doing
so facilitate and stabilize the interaction between the receptor and its response
element, allowing binding to imperfect palindromes or half binding sites (Melvin et
al., 2004). Moreover, ER α synergizes with SP1 proteins to bind to an ERE half site
when an SP1 site is located nearby (Porter et al., 1997;Safe and Kim, 2004). Often
more than one ERE-like sequence is present in an estrogen responsive promoter. The
27
binding of ER α is cooperative since several EREs synergize to allow ER binding
(Klinge, 2001).
Ligand Binding
Ligand binding is a prerequisite in most cases for transcriptional activation, as ligand
induced conformation stabilizes a conformation that interacts with coactivators.
Ligand binding is also regulated. Association of ER α with an ERE stabilizes the
ligand-ER interaction (Klinge, 1999). Protein-protein interactions also affect ligand
binding. Coactivators stabilize the interaction of ER α with its ligand (Gee et al.,
1999;Watkins et al., 2003). The heat shock protein HSP90 and the HSP90 associated
protein p23 also sensitize ER α to estradiol binding (Knoblauch and Garabedian,
1999;Fliss et al., 2000). Finally, Tyrsoine 537 is involved in ligand binding, although
it is not sure if this particular phosphorylation is indeed implicated in stabilization of
ligand association (Arnold et al., 1997).
Coactivator recruitment
Coactivator recruitment is necessary for ER α action as coactivators mediate
chromatin remodeling and the eventual recruitment of the transcription machinery.
The main determinant of coactivator binding is the generation of surfaces on ER α
that coactivators can interact with, which is promoted by binding of ligand. However
many other criteria influence the recruitment of coactivators to a given promoter. The
DBD signals allosterically to the LBD and, as a result, the sequence of the ERE bound
influences the strength and nature of the interaction of coactivators with nuclear
receptors (Wood et al., 2001;Hall et al., 2002).
28
Posttranslational modifications of ER α also modify coactivator interactions. Indeed,
phosphorylation of serine 118 potentiates the interaction of ER α with the AF-1
specific coactivators p68 and p72 (Endoh et al., 1999;Watanabe et al., 2001).
Moreover, coactivators can be themselves subject to regulation. For instance
SRC3/AIB1, a member of the p160 coactivator family, is phosphorylated in response
to extracellular signals and this phosphorylation is necessary for its coactivator
function with ER α (Wu et al., 2004). Phosphorylation of SRC3/AIB1 was also shown
to relocate the coactivator to the nucleus, were it efficiently interacts with nuclear
receptors (Wu et al., 2002).
Other protein interactions can interfere with the binding to coactivators. A decoy
coactivator, REA (repressor of estrogen receptor activity), can bind to liganded ER α
and compete with SRC-1 preventing its recruitment (Montano et al., 1999). Likewise,
coactivators can also compete with LxxLL-motif-containing orphan nuclear receptors
SHP and DAX1, which bind the liganded ER LBD but do not have histone modifying
activities and thus inhibit ER transactivation (Zhang et al., 2000;Johansson et al.,
2000).
Differential recruitment of coactivators by AF-1 and AF-2
As mentioned previously, two distinct activation functions are responsible for the
transcriptional activation achieved by ER α. The two AFs are very different in nature
but rely on the recruitment of chromatin remodeling coactivators to function. The
activity of the two AFs however are cell context and promoter dependent (Tora et al.,
1989b;Berry et al., 1990;Metzger et al., 1995;Merot et al., 2004). A given context can
be AF-1 permissive, AF-2 permissive or allow both functions to transactivate.
29
To assess the AF permissiveness of a given cell and promoter context, truncated ERs
lacking either AF function are used. Such studies determined a good correlation
between an AF-1 permissive context and a context in which tamoxifen works as an
agonist (Berry et al., 1990). This situation arises as tamoxifen, while able to inactivate
AF-2 through the recruitment of corepressors, activates AF-1 by preventing the
repressive interaction between the A and E domains (Metivier et al., 2002b).
Consequently, cellular or promoter contexts where tamoxifen functions as an agonist
attests to an AF-1 context.
One ER dimer can accommodate one molecule of coactivator or one corepressor, with
association mutually exclusive for each dimer (Margeat et al., 2001;Germain et al.,
2002). As AF-2 complexed with tamoxifen can bind corepressors at AF-2 or
coactivators at AF-1, competition occurs between coactivators and corepressors in
binding to tamoxifen-liganded ER α. When excess coactivator over corepressor is
present, tamoxifen-liganded ER α dimers preferentially associate with coactivator,
whereas in a context where corepressors are in excess, an ER α dimer will more likely
bind corepressor. This model has been confirmed experimentally, where it was shown
that the over-expression of SRC-1 in cells with an AF-2 context transformed
tamoxifen from an antagonist into an agonist (Smith et al., 1997;Shang et al.,
2002;Fujita et al., 2002). Likewise, increasing or decreasing the levels or binding of
the corepressors N-CoR or SMRT results in a respective decrease or increase of the
agonistic activity of tamoxifen (Lavinsky et al., 1998;Fujita et al., 2003).
The agonist activity of tamoxifen can also be modulated through phosphorylation of
ER α. Phosphorylation of serine 305 by PKA is absolutely required to allow
tamoxifen to induce agonistic activity, even in the presence of elevated levels of
coactivators (Michalides et al., 2004).
30
Although certain coactivators associate with both AF-1 and AF-2, some coactivators,
for example p68, are AF-1 specific. Although these coactivators are ubiquitously
present in cells their recruitment is enhanced when ER α is phosphorylated on serine
118 (Endoh et al., 1999;Watanabe et al., 2001). However, no strict correlation
between the phosphorylation status of ER α and the AF permissiveness has been
established. In conclusion, the activity of the two AFs in ER α are regulated through
coregulator expression or availability and by post-translational modifications.
Ligand independent recruitment of coactivators: ligandindependent activity
Treatment of cells grown in the absence of ligand with dopamine, IGF-1and EGF
results in activation of ER α (Smith et al., 1993;Bunone et al., 1996;Ignar-Trowbridge
et al., 1996). An intact AF-1 is required for ligand independent activation of ER α
(Bunone et al., 1996;Ignar-Trowbridge et al., 1996), which results from
phosphorylation of the receptor. In response to extracellular signals, ER α becomes
phosphorylated on several residues (Ali et al., 1993). Phosphorylation of serine 118,
by MAPK, activates the receptor in a ligand independent manner, through recruitment
of coactivators to AF-1 (Endoh et al., 1999;Metivier et al., 2002a;Deblois and
Giguere, 2003;Dutertre and Smith, 2003c). Furthermore, the cyclin A/CDK2 complex
phosphorylates serine 104 and serine 106, resulting in an enhancement of the activity
of ER α in the presence and absence of ligand (Rogatsky et al., 1999).
Other transcription factors, exemplified by cyclin D1 and the activated dioxin
receptor, bind to unliganded receptor and recruit coactivators, thereby conferring
ligand independency on ER α (Zwijsen et al., 1998;Ohtake et al., 2003). Finally,
31
overexpression of coactivators, such as SRC-1, also induces ligand-independent
activation of ER α (Kalkhoven et al., 1998).
As previously discussed, deletion of the A domain, which contains an intramolecular
corepressor, allows recruitment of coactivator complexes to ER in AF-1 permissive
cell contexts (Metivier et al., 2002d). It is therefore also possible that regulation of the
interaction between the A and E domains results in ligand-independent activity of ER
α.
This notwithstanding, it is important to note that in the majority of studies conducted
it is not possible to rule out the possibility that increases observed in transcriptional
activity results from an increase in sensitivity to residual estrogens present in the
growth medium, rather than a genuine ligand-independent activity. ER α is sensitive
to low concentrations of estrogens and for that matter, it is known that estrogenic
compounds can contaminate growth media for both yeast and mammalian cells
(Mattick et al., 1997;Liu and Picard, 1998).
4. Genomic organization and expression of ER α
4.1.
Genomic organization of the ER α gene.
Our appreciation of the complexity of the ER α gene unit continues to increase as time
passes. Since the cloning of the first human ER α cDNA in 1986 (Green et al.,
1986;Greene et al., 1986), numerous cDNA variants, divergent in their 5’ untranslated
region (UTR), have been identified. This reflects alternative promoter usage and
extends the number of exons associated with the generation of ER α mRNA. The
availability of the human genome sequence has revealed that the promoter regions
32
associated with the ER α gene now spans ~ 300 kb, instead of the 140 kb initially
thought (Kos et al., 2001). Most exons and their associated promoters, including
upstream non-coding exons, are conserved between man and mouse and extend over a
similar genomic stretch (figure 5B; Kos et al., 2001;Swope et al., 2002).
Figure 5 Genomic organization of the ER α gene
A. The coding region of ER α spans 8 exons. B. Both mouse and human ER α genes comprise multiple
5’ untranslated exons. All these exons splice to a common acceptor splice site in exon one either
directly or indirectly. Most of them are conserved between the two species.
The coding sequence of ER α comprises 8 exons, numbered 1 to 8 (figure 5A).
Upstream exons are designated with a letter (figure 5B). These 5’ non-coding exons
generally splice to a common acceptor splice site located in exon 1. The most
33
proximal exon, exon A, is a component of exon 1. Further complexity exists with
exons E1 and F, as they initially splice to exon E2 prior to splicing to the common
splice site. Consequently, the resulting 5’ non-coding sequence is a hybrid between
two or three non coding exons; the very 5’ sequence arising from promoter activity, a
middle sequence derived from exon E2 and the 3’ sequence downstream from the
common splice acceptor site of exon1. A similar situation occurs in mouse where
exon F1 the ortholog of exon F splices to exon F2 before it slices to the common
splice site (Kos et al., 2001).
4.2.
Multiple promoters and the transcriptional regulation of ER α
expression
Very little is known about the promoters both in terms of organization and regulation.
Most ER α promoters do not display any obvious TATA box, CCAAT box, or GC
box, although the testis specific promoter T1, contains all of these features (Brand et
al., 2002). As a result, the start of transcription for each variant is relatively loose and
ER α promoters tend to show a very weak activity in transcription assays (Kos et al.,
2001 ; our own unpublished data).
Two studies have compared the expression of different variants in different tissues.
Although a direct quantitative methodology of promoter usage was not employed in
these studies, it was found that most promoters were used in most tissues tested
(Flouriot et al., 1998;Kos et al., 2000). Apart from the E promoter in human or the H
promoter in mouse which seem to be specifically employed in liver, the other variants
show very little specificity (Flouriot et al., 1998;Kos et al., 2000). Interestingly, it was
also found that variants detected in the same tissues were different between mouse
and human. The A and B variants, which are the most abundant variants expressed in
34
human tissues, are absent from mouse tissues, with the most abundant in mouse being
the C variant.
In human A, B, C and F mRNA variants are regulated by E2, either in a positive or
negative way, depending on cell type (Donaghue et al., 1999;Denger et al., 2001). In
mammary epithelial cells, it was shown that the transcription factor AP2 gamma plays
an essential role in ER α expression (Schuur et al., 2001). In MCF-7 cells, Akt kinase
signals to the ER α B promoter, through negative regulation of the transcription factor
FOXO3a to downregulate ER α expression (Guo and Sonenshein, 2004). However,
despite these tantalizing reports, little is known of the extracellular signals, the
promoters or transcription factors that direct cell-type specific expression of ER α.
Moreover, in all studies on ER α promoter activity, weak intrinsic expression
compromises detailed analysis of effects.
4.3.
Functional implications of alternative splicing and alternative
promoter usage
Almost every possibility of alternative splicing of ER α has been detected at the level
of mRNA(Lu et al., 1999;Hirata et al., 2003). Alternative splicing and exon skipping
of non-coding upstream exons and coding exons are known to occur. Relatively few
of the resulting transcripts can be translated into a functional protein. Accordingly,
despite the plethora of mRNA transcripts, only few proteins counterparts are known
to exist.
In human however it was found that upstream exons E and F can not only splice to the
common acceptor splice site of exon 1 but also to the acceptor splice site of exon 2
(Flouriot et al., 2000). The variant generated can be translated into a 46 KDa protein
using two AUGs present in exon 2. These AUGs are present in a good Kozak
35
sequence for the promotion of ribosome assembly. The corresponding protein has the
C-terminal sequence of the full-length ER α but lacks the first 173 amino acids,
including AF-1. As a result this ER α isoform exhibits dominant negative activities in
cells where the AF-1 of ER α is used (Flouriot et al., 2000).
4.4.
ER α protein turnover
Every protein in the cell is subject to renewal and constant degradation. Degradation
of short-lived molecules like transcription factors is often effected by the ubiquitinproteasome pathway (Ciechanover et al., 1984;Pickart, 2004). ER α is no exception to
the rule and is also ubiquitinated and degraded by the proteasome (Alarid et al.,
1999;El Khissiin and Leclercq, 1999;Nawaz et al., 1999). Ligand binding can
incredibly shorten the half-life of ER α and accordingly increases receptor
ubiquitination (Nawaz et al., 1999;Reid et al., 2003). Ligand-induced proteasome
degradation is linked to transcription as transcription is required for ligand to target
the receptor for proteasomal degradation (Lonard et al., 2000;Reid et al., 2003).
Every nuclear receptor analyzed so far is downregulated in a protesome-dependent
manner after ligand activation (Zhu et al., 1999;Hauser et al., 2000;Lin et al.,
2002;Blanquart et al., 2004). Likewise transcription factors are also targeted for
proteasomal degradation upon activation by phosphorylation (Fuchs et al.,
2000;Bauer et al., 2002). This would point out towards a general mechanism coupling
transcription and degradation.
A common machinery is involved in the addition of a ubiquitin chain to a protein
target. Only the E3 ligase is believed to be specific to the substrate and recognizes the
target to be ubiquitinated (Pickart, 2004). No E3 ligase of ER α has been identified to
date. However MDM2 was shown to catalyse the ubiquitination of the related
36
androgen receptor (Lin et al., 2002). In any case it seems unlikely that only one E3
ligase regulates ubiquitination of ER α. The analysis of the turnover of p53 reveals
that many E3 ligases can regulate the turnover of a given transcription factor (Dornan
et al., 2004).
The ER α antagonist ICI 182,780 can not only compete with estradiol for binding to
the LBD, thereby preventing DNA binding and transcriptional activation but was also
found to potently decrease the half life of ER α by targeting the receptor to
proteasomal degradation (Dauvois et al., 1992;Wijayaratne and McDonnell, 2001).
The fact that ICI 182,780 does not allow ER α to transactivate but still targets the
receptor for proteasomal degradation which would suggest that at least two distinct
mechanisms of turnover exist (Wijayaratne et al., 2001).
Extracellular signals and signal transduction pathways were reported to affect
proteasomal degradation of ER α. TGF β was shown to decrease ER α protein
stability in a proteasome dependent manner in breast cancer cell lines (Petrel and
Brueggemeier, 2003). Also, the kinase ERK 7 stimulates proteasomal degradation of
ER α (Henrich et al., 2003). Conversely, activation of PKA by the Akt/Pi3K pathway
protects the receptor from ligand-induced degradation (Marsaud et al., 2003;Tsai et
al., 2004).
5. Physiology of estrogens
5.1.
Ligand nature and availability
Recruitment of coactivators occurs when ER α is complexed to one of its agonistic
ligands. However, the levels of estrogens are not constant in an organism and vary
37
greatly throughout time. As a result ER α is not activated to the same extent sensing
the variations in plasma E2 levels.
The primary source of E2 in females is the ovary. Synthesis of E2 occurs from the
aromatisation of androgens by the enzyme P450 Aromatase. Aromatase activity has
also been detected in extragonadal tissues and most notably in the adipose tissue.
Extragonadal sites would be the most important source of E2 in males and in females
after the menopause when ovaries stop producing E2 (Simpson et al., 2000). Although
there are several different estrogens produced by the body, including estrone and
estriol as well as E2, they all act as agonists although they bind ER α with different
affinities (Kuiper et al., 1997).
The plasma levels of estrogens increase at puberty and vary thereupon throughout the
menstrual cycle, estrogen levels being highest prior to ovulation (Gruber et al., 2002).
At the menopause, depletion of the ovarian follicles leads to a steady decline in
ovarian E2 production. In the male, although estrogens also play a physiological role
nothing is known of the regulation of E2 production by extragonadal tissues.
5.2.
Estrogen function
Deletion of both ERs or of aromatase that synthesizes estrogens from androgens has
allowed a detailed characterization of estrogen function. The sterility phenotype of ER
and aromatase knockouts confirmed the importance of estrogens in the reproductive
function (Dupont et al., 2000). Estrogens however are not involved in morphogenesis
or sex determination. Both male and female knockout mice develop normally up to
puberty (Dupont et al., 2000). Differentiation of the reproductive tract is impaired in
mice deficient for either ER but no other obvious phenotype could then be
characterized.
38
At the menopause estrogen levels drop dramatically and is concomitant with several
dysfunctions in non-reproductive tissues. Also, the existence of gender specific
diseases not related to the reproductive function pointed out that estrogens could have
a broad effect on non-reproductive function. Non-reproductive tissues affected by
estrogens include most notably the brain, the vascular system and bone (Manolagas
and Kousteni, 2001).
Using mouse ER deficient mice, it was determined that most responses to estrogens
are mediated by ER α. ER β plays a compensatory role in the ovary and in the
osteoportective action of estrogens in females, and only shows an idiosyncratic
function in the response to anxiety in female mice (Krezel et al., 2001).
5.3.
Tissue distribution of estrogen receptors
The use of high activity radiolabeled estradiol allowed the identification of the main
estrogen binding tissues. These corresponded to the main responsive tissues namely
the uterus, the vagina and the anterior pituitary (Jensen et al., 1962;Jensen and
DeSombre, 1972). Since then, a multitude of approaches have been used to detect ERs
in tissues (Warner et al., 2003). The discovery of ER β prompted the comparison of
the tissue distribution of the two ERs (Kuiper et al., 1996;Kuiper et al., 1997). This
was done with sensitive techniques compared to the use of radiolabeled ligands 10-20
years earlier and led to the identifcation of the ER protein or its mRNA in a plethora
of tissues (Kuiper et al., 1997;Couse et al., 1997;Lemmen et al., 1999). In fact there
might not be a single tissue or cell type that has not been shown to express either or
both ERs.
In addition, several transgenic mice strains containing a reporter gene under the
transcriptional control of an ERE were developed (Nagel et al., 2001;Ciana et al.,
39
2001;Toda et al., 2004;Lemmen et al., 2004). This approach allowed the identification
of tissues in which ER α or ER β can be activated by its ligand and affect
transcription. This method confirmed that many tissues are able to respond
transcriptionally to estrogens consistent with the expression pattern of both ERs.
These studies were however very divergent regarding the nature of the estrogen
responsive tissues, questioning the relevance of these results.
5.4.
Non-reproductive sites of action: the example of bone
Bone Physiology
The skeleton is formed of two different tissues; cartilage and bone. Each tissue has its
own specialized cell types: the chondrocyte in cartilage and the osteoblast and
osteoclast in bone. Bone is mainly formed of collagen fibers (type I collagen
represents 90% of the total protein) that fix hydroxyapatite (calcium phosphate)
crystals that compose mineralized bone. At the cellular level, the two cell types
present in bone have opposite roles. The osteoblast deposits and mineralizes the bone
matrix while osteoclast readsorbs bone. Osteoblasts and osteoclasts originate from
different stem cell lineages, with osteoblasts derived from the mesenchymal lineage
and osteoclasts belong to the hematopoeitic compartment (Karsenty, 1999). A balance
between anabolism and catabolism is required for the maintenance of a healthy bone
structure. Osteoblasts and osteoclasts are present in the same environment.
Consequently, both cell types communicate to regulate each other’s differentiation
and function. Bone is a dynamic tissue under constant renewal with new bone being
made, opposing the continuous resorption. Local and systemic factors impact on bone
40
remodeling and affect bone density by regulating the function of either or both
osteoblasts and osteoclasts.
Skeletal development starts in the embryo with the formation of mesenchymal
condensations that prefigure the future skeletal elements they will later form (Olsen et
al., 2000). In the case of intramembranous ossification, cells from the mesenchymal
condensations differentiate into osteoblasts that constitute part of the skull and the
clavicles. For the other skeletal elements, the mesenchymal cells of the condensations
differentiate into chondrocytes that constitute a cartilage anlage of future bones. The
anlage becomes vascularized, with chondocytes subsequently replaced by osteoblasts.
Bone cells therefore have different developmental origins depending on the skeletal
element they construct. Bone cells have however very similar phenotypes independent
of which part of the skeleton they come from.
Osteoblast differentiation
Differentiated cells are characterized by a phenotype that mirrors their function. With
osteoblasts, the most obvious terminal phenotype is an ability to deposit calcium
phosphate crystals. Osteoblast progenitors can be isolated from bone and
differentiated in vitro in a manner consistent with the in vivo process. Perhaps not
surprisingly, one of the first extracellular markers present in differentiating
osteoblasts is collagen type I, which is laid down as an extra-cellular matrix and
constitutes the target structure for subsequent mineralization. Additional markers have
been identified; namely alkaline phosphatase (ALP), which appears at the early stages
of differentiation, and osteocalcin, which is expressed later, concomitant with
mineralization (Owen et al., 1990;Aronow et al., 1990). The function of these two
41
secreted proteins is not clear but their expression is tightly linked to osteoblastic
differentiation and as a result characterizes the osteoblast phenotype.
Differentiation of a progenitor cell requires triggering of specific genetic programme
that lead to the expression of proteins required to cell-type specific function. The
induction of a genetic programme is controlled by extracellular cues and is transduced
by transcription factors. Many transcription factors involved in osteoblast
differentiation have been identified although the precise although their functional
hierarchy is still poorly understood (Stains and Civitelli, 2003). The transcription
factor Cbfa1 is absolutely required for osteoblast differentiation and bone formation.
It is also sufficient to induce expression of osteoblast specific genes in ectopic cell
types (Ducy et al., 1997). Cbfa1 acts in concert with other osteoblast-specific
transcription factors such as osterix to induce osteoblast differentiation (Nakashima et
al., 2002).
The expression of CBFa1 is under control of extracellular signals that are affect bone
formation Locally produced growth factors play a pivotal function in orchestrating the
differentiation of osteoblasts. In particular, BMP’s (bone morphogenetic proteins) are
the most efficient promoters of osteoblast differentiation known, with BMP-2
stimulating preosteoblast proliferation, extracellular matrix production and eventually
mineralization. It does so, at least partly, by stimulating both CBFa1 expression and
function (Lee et al., 2000;Lee et al., 2002). Although it exerts complex effects in vivo,
TGF β potently and consistently inhibits osteoblast differentiation in vitro (Centrella
et al., 1994;Alliston et al., 2001). Moreover, TGF β promotes the expression of
collagen type I by osteoblast precursors but prevents the proceeding of differentiation
(Centrella et al., 1994).
42
Figure 6. Differentiation of mesenchymal progenitor cells
Mesenchymal cells can differentiate into different cell types. Differentiation triggers the expression of
a genetic programme characterized by the expression of lineage specific transcription factors leading to
the expression of the differentiated phenotype. Myoblasts fuse to form multinucleated myocytes,
adipocytes store lipid drolplets, chondorcytes deposit a collagen type X extracellular matrix while
osteoblasts deposit a collagen type I matrix (adapted from Stains et al., 2003)
Osteoblasts arise from mesenchymal stem cells. These cells, when cultured ex vivo
have the potential to differentiate into numerous cell types (figure 6). With different
extracellular cues, mesenchymal stem cells can differentiate into myocytes,
adipocytes, chondrocytes and osteoblasts. Differentiation is however exclusive and a
cells do not usually expresses markers of two different cell types. Undifferentiated
osteoblast progenitors have low levels of transcription factors involved in the
43
differentiation of myocytes, adipocytes, and osteoblasts (Garcia et al., 2002). With
differentiation, osteoblasts suppress expression of markers of other cell types (Garcia
et al., 2002). Osteoblast and adipocyte differentiation is exclusive with suppression of
adipocyte differentiation resulting in an increase in osteoblast differentiation (Akune
et al., 2004).
Members of the TGF β family of cytokines are important regulators of mesenchyaml
cell differentiation. Among them, the BMPs (bone morphogenetic proteins) are potent
promoters of the osteoblast phenotype. BMP2 not only increases the differentiation of
osteoblast but also directs multipotential mesenchymal cells towards the osteoblast
lineage (Katagiri et al., 1994;Katagiri et al., 1997). The action of BMP2 on osteoblasts
is mediated by Cbfa1 (Lee et al., 2003). On the other hand TGF β prevents the
expression of osteoblast specific genes like ALP and osteocalcin although it promotes
expression of collagen type I (Centrella et al., 1994;Alliston et al., 2001). It is also a
general inhibitor of mesenchymal cells, preventing differentiation of adipocytes and
myoblasts (Choy et al., 2000;Liu et al., 2001).
Estrogens and bone
After menopause, the levels of serum sex steroids, including estrogens, become
reduced. This reduction in estrogen levels is associated with a time dependent
decrease in bone density, that can eventually result in osteoporosis (Riggs et al.,
2002). Postmenopausal bone loss can often be improved by estrogen treatment
(Lindsay et al., 1976;Riggs et al., 2002). This effect made it clear that estrogens are
involved in bone homeostasis. Additionally, gonadectomy in rodents is able to
reproduce bone loss observed in postmenopausal osteoporosis, and is also prevented
by estrogen replacement. Gonadectomy was thereafter used as a model for
44
osteoporosis. Both menopause and gonadectomy result in an increase in osteoclast
and osteoblast activity with an imbalance towards resorption, progressively resulting
in bone loss. This increase in bone turnover is ameliorated by estrogen treatment,
which suppresses the activity of both osteoclasts and osteoblasts (Riggs et al., 2002).
The function of estrogens and their receptors in bone homeostasis has been further
investigated using knock-out mouse models deficient either in the estrogen
synthesizing enzyme aromatase or in ER α or β (Oz et al., 2000;Sims et al.,
2002;Sims et al., 2003). The loss of both receptors or of aromatase in female mice
mimicked the effects of ovariectomy (Oz et al., 2000;Sims et al., 2002;Sims et al.,
2003). In female, single ER knockout mice loose bone after ovariectomy, whereas the
double knockout shows a reduced bone density that is not further decreased by
ovariectomy. This suggests that the maintenance of bone density is mediated by the
two ERs in female (Sims et al., 2003). In male orchidectomy also induces bone loss
but the phenotypes are complicated by the involvement of androgens and the
androgen receptor as both androgens and estrogens are important for bone
maintenance (Sims et al., 2003). Upon overiectomy or orchidectomy, both osteoblasts
and osteoclasts are activated increasing bone trunover. Estrogen treatment of
overiectomized or orchidectomized mice results in a decrease in activity of both
osteoblasts and osteoclasts. This osteoprotective effect is mediated essentially by ER
α in female mice, ER β playing a small redundant role (Sims et al., 2003). In males,
only ER α mediates the osteoprotective effect of estrogens (Sims et al., 2003).
However it is not possible from these studies to know whether the osteoprotective
action of estrogens affects bone directly or if intermediary systems are involved. In
this regard, targeted, cell type specific knockouts will be very informative to
determine the cell types mediating this effect.
45
At high doses, estrogens not only prevent gonadectomy-induced bone loss but also act
to increase bone density, even in intact animals. This anabolic response to estrogens
solely relies on ER α in both males and in females (McDougall et al.,
2002;McDougall et al., 2003). This effect, as opposed to osteoprotection, is mostly
mediated by an increase in osteoblast function (Samuels et al., 1999). Although celltype specific knockouts would confirm whether this effect is direct or indirect, an
earlier study indicates that the anabolic effect of high estrogen doses is direct, as it
affects bone density locally (Takano-Yamamoto and Rodan, 1990). However it might
not be possible to extrapolate from this result to mice as the osteogenic response in
rats is achieved with lower concentrations of estrogens as opposed to the
supraphysiological concentrations needed in mice to elicit this response (Turner,
1999). As a result the osteogenic response in mouse and rat might occur through
distinct processes.
Estrogens and osteoblasts
There is considerable debate about the expression of functional estrogen receptors in
osteoblasts. Although estrogen binding sites have been reported (Komm et al.,
1988;Eriksen et al., 1988), the number of binding sites in osteoblasts are however
very low ranging from a few hundred to a thousand sites per cell, as compared to
known estrogen target tissues like uterus which comprise 15,000 sites/cell (Eriksen et
al., 1988;Davis et al., 1994). Still, the number of binding sites in osteoblasts is
significantly higher than in fibroblasts (Eriksen et al., 1988). In addition to the full
length receptor, the N-terminally truncated 46 KDa isoform of ER α was detected in
primary human osteoblasts at similar levels as full length receptor (Denger et al.,
2001). The receptors present in osteoblast are anticipated to be functional and
46
correspondingly could activate an exogenous estrogen responsive reporter gene (Ernst
et al., 1991). It is not clear however whether the expression level of ER α in
osteoblasts would be sufficient to allow the mediation of estrogen effects in vivo
(Karsenty, 1999).
ER α mRNA was found to be upregulated on development of the osteoblast
phenotype (Bodine et al., 1998;Wiren et al., 2002;Bonnelye and Aubin, 2002). This
observation indicated that ER α is expressed specifically in osteoblasts and that its
expression is part of the osteoblast differentiation programme. The involvement of ER
α in osteoblast function was further pointed out by the fact that it can interact with the
osteoblast transcription factor Cbfa1, thereby enhancing its transcription activation
(McCarthy et al., 2003).
In terms of response estrogens conflicting reports exist. Estrogens could slightly
enhance differentiation of osteoblasts cultured ex vivo while others report that
estrogens had no effects on osteoblast differentiation (Keeting et al., 1991;Scheven et
al., 1992;Qu et al., 1998). Estrogens have also been reported to promote osteoblast
differentiation of mesenchymal stem cells as opposed to adipocytic differentiation
(Dang et al., 2002;Okazaki et al., 2002).
Although ER α is present in osteoblasts and estrogens can have a mild effect on
osteoblast differentiation ex vivo it is not sure to what extent these results are
physiologically relevant. It is also not sure whether ER α expression is specific to
osteoblast considering the broad expression pattern that has been described.
47
Objectives
48
Since their involvement in post-menopausal osteoporosis has been identified,
estrogens have been shown to be crucial for bone homeostasis. Estrogens can affect
both osteoblast and osteoclast function in the bone environment. ER α is present in
osteoblasts and it was suggested to affect directly osteoblast growth and function.
ER α expression is also upreglated during osteoblast differentiation and it can interact
with osteoblast specific transcription factors. This made it clear, that ER α was as a
transcription factor involved in osteoblast function.
Nothing was known about the specificity and regulation of the 7 ER α promoters.
osteoblasts presented the unique advantage of keeping their phenotype in vitro and of
growing as a very homogeneous cell population. As a result, osteoblasts would have
been ideal to examine the specificity of ER α promoter(s) usage. Confident that ER α
expression was under the control of osteoblast specific factors, I was therefore
planning to identify the promoter(s) responsible for osteoblast specific expression to
then further study their regulation.
I planned to develop an in vitro assay for osteoblast differentiation using cell lines for
molecular studies and confirm the results obtained with mouse primary osteoblasts. I
then wanted to develop assays that would allow detection of ER α mRNA, protein and
activity in osteoblasts. To control for the specificity of ER α promoters in osteoblasts,
I also wanted to use the ability of mesenchymal stem cells to differentiate into other
cell types.
As desribed below, as I developed the experimental system, many surprises came
along that challenged many of the beliefs I had when I started this project.
49
Results
50
1. In vitro differentiation of an osteoblastic cell line and of
primary osteoblasts
Several tissue culture systems have been developed to study osteoblast differentiation
in vitro. Several osteogenic cell lines are available and it is also possible to work with
primary cells, which can be obtained from newborn mouse calvaria by serial
enzymatic digestions or flushed from the bone marrow of new born and adult mice.
Committed osteogenic cells can develop the osteoblast phenotype in vitro with
increasing cell contacts (Owen et al., 1990). A few days after confluency has been
reached, osteogenic cells increase production of collagen type I, which constitutes the
basic extracellular component of bone matrix. The deposition of a collagen matrix is
followed by the deposition of non-collagenous proteins like alkaline phospahtase
(ALP) and osteocalcin (Owen et al., 1990). The addition of ascorbic acid and of a
phosphate source such as β-glycerophosphate allows osteoblasts to mineraliz the
depositied collagen matrix (Owen et al., 1990;Aronow et al., 1990).
Three histochemical markers, followed over time, were used to determine the purity
of cultured osteoblasts and their ability to differentiate. ALP, an early differentiation
marker, was monitored using a colorimetric assay. Additionally, the Van Giesson and
Von Kossa assays were used to stain the extracellular collagen matrix and
mineralization respectively.
The three cellular systems mentioned earlier, available to study osteoblast
differentiation in vitro were evaluated for their ability to grow and differentiate in
vitro. The isolation of mouse bone marrow mesenchymal stem cells from adult mice
proved difficult. Cellular survival was low as was the purity of cultures as determined
51
by alkaline phosphatase expression (data not shown). Consequently, this procedure
was not used.
Figure 7. In vitro differentiation of mouse primary osteoblasts and of 2T3 cells
A. Primary mouse osteoblasts and B. 2T3 cells were monitored for differentiation using three different
stains. The ALP is stained in purple. The orange Van Giesson stain shows the extracellular collagen
matrix while the silver nitrate Von Kossa assay stains in black mineralized bone nodules.
Differentiation occurs with growing cells contacts and is first characterized by the apparition of ALP
positive cells. The deposition of the collagen matrix is followed by its mineralization.
52
Mouse calvarial osteoblasts have been extensively used ex vivo to study the genetics
of osteoblasts as they recapitulate the in vivo differentiation process. Indeed, a bone
phenotype resulting from a cell-autonomous osteoblast defect, is usually mirrored by
deficient in vitro differentiation of calvarial osteoblasts (Li et al., 2000;Kim et al.,
2003;Kenner et al., 2004). The development of the osteoblastic phenotype in mouse
calvarial osteoblasts is shown in figure 7A. Alkaline phosphatase expression was first
detected 2 days after confluency was achieved. Most cells became alkaline
phosphatase positive 8 days after confluency. Addition of β-glycerophosphate and
ascorbic acid allowed the cells to mineralize the collagen matrix. The first collagen
nodules (orange stain) were readily detectable 4 days post confluency. The matrix
became more visible by day 10 and became mineralized 15 days after confluency, as
detected by the dark silver staining.
Osteogenic cell lines are more amenable than primary osteoblasts to generate the
number of cells required for molecular studies; moreover, they can easily be
transfected. The mouse 2T3 cell line has been shown to function like primary
calvarial osteoblasts, and differentiates into osteoblasts after confluency is reached
(Ghosh-Choudhury et al., 1996). The kinetics of differentiation and mineralization of
the 2T3 line were assessed, as previously described for primary osteoblasts (figure
7B). ALP positive cells were first detected 2 days after confluency. At day 4, most
cells were ALP positive and remained positive throughout the assay period. Collagen
nodules were first detectable at day 2 and became mineralized from day 8 with
mineralization increasing to day 10.
These results indicate that both 2T3 cells and primary calvarial cells differentiate into
mineralizing osteoblasts in vitro. 2T3 cells, however, are entirely homogeneous,
synchronized and differentiate to osteoblasts more quickly. In light of these
53
observations, we therefore chose to utilize the 2T3 cell line preferentially in the
following experiments but to verify key results, when possible, with primary
osteoblasts, to exclude artifacts arising from use of an immortalized cell line.
2. ER alpha expression in osteoblasts
2.1.
Characterisation of ER α protein isoforms in osteoblasts
The mouse ER α gene generates multiple mRNAs and protein products through
alternative promoter usage and alternative splicing (Kos et al., 2000). In addition to
the full-length ER α of 66 KDa, shorter isoforms have been characterized both at the
protein and mRNA levels. Notably, two in frame ATGs located in exon 2, generate a
46 KDa protein. In man, this isoform is produced through splicing of exon F to exon 2
and also by internal ribosome entry (Barraille et al., 1999;Flouriot et al., 2000).
Interestingly, expression of ER α 46 in human primary osteoblasts occurs at the same
level as full-length ER α (Denger et al., 2001). Although the 46 KDa protein isoform
of ER α has never been detected in mouse, its corresponding transcript has been
identified and the two ATGs are conserved between human and mouse exon 2
(Denger et al., 2001).
To evaluate whether ER α or any of its shorter isoforms were expressed in osteoblasts,
western blot analysis was performed using a mouse specific ER α C-terminal antibody
(MC-20) of cell extracts prepared from differentiated ALP positive (6 days postconfluency) 2T3 cells. Mouse uterus cell extracts that contain high levels of ER α and
in vitro translated mouse ER α (mER α) 66 kDa and 46 KDa were used as controls. In
order to identify non-specific immunoreactive products, cell extracts from the murine
54
fibroblastic NIH 3T3 cell line were also analysed. NIH 3T3 cells are ER α negative
and do not support expression of estrogen responsive reporter constructs (Castoria et
al., 1999).
Three major immunoreactive species were detected by MC-20 in 2T3 cell extracts
(figure 8A and B). A doublet running approximately at the same size as full-length
ER α as compared to in vitro translated full length mER α or from uterus extracts,
with another band migrating above 49 KDa. A very faint product migrated at the same
size as the in vitro translated 46 KDa isoform of mER α (figure 8A). The product
migrating above 49 KDa is unlikely to be derived from mER α as it is present in the
ER α negative NIH 3T3 cells.
ER α specifically associates with agonists (e.g. β-2-estradiol (E2)) and antagonists
(e.g. ICI 187,780) in the ligand binding domain, located in the C-terminal half of the
protein. Binding of either E2 or ICI 187,780 specifically targets the receptor for
proteasomal degradation and decreases receptor half-life from 4-5 h in the absence of
ligand to ~3 h on binding of E2 and to 30 min in the presence of ICI 187,780
(Dauvois et al., 1992;Wijayaratne et al., 2001). This property was used to ascertain
that the bands observed corresponded to ER α. Figure 8B shows that in 2T3 cells,
treatment with E2 or with ICI 182,780 for 24 h induced a reduction in the doublet at
66 KDa. The unspecific lower product was however not affected by any of the
treatments showing that this effect is specific. As previously reported (Alarid et al.,
1999;El Khissiin et al., 1999;Nawaz et al., 1999), co-treatment with the proteasome
inhibitor MG 132 blocked downregulation of ER α by E2 and ICI 182,780 (figure
8B). This indicates that ligand-induced downregulation of the 66 KDa doublet is
indeed dependent on proteasome activity.
55
Figure 8. Western blot analysis of mER α in osteoblasts
A. western blot analysis of in vitro translated (IVT) mER α 46 and 66 KDa isforoms, mouse uterus
protein extracts (Ut), mER α negative NIH 3T3 cells and differentiated day 6 2T3 cells. B. Western
blot analysis of mER α in 2T3 cells treated with E2 and the antagonist ICI 182,780 (ICI) run alongside
uterus extracts (Ut). Ligand-induced degradation was blocked using the proteasome inhibitor MG 132.
Equal cell number (600,000) was loaded in each lane for 2T3 cell extracts C. Western blot analysis of
endogenous mER α in day 6 2T3 cells with the N-terminal H-184 antibody and the C-terminal MC-20
antibody. Transfected HA-tagged mER α was detected using an HA antibody (H-11). The 64 and 49
KDa marks correspond to marker sizes.
56
The two bands migrating at 66 KDa may arise either from different transcripts or by
post-translational modification. This was addressed by expressing epitope tagged
transgenes of ER α in 2T3 cells. If post-translational modification gives rise to the
different migratory forms of ER α, the tagged version should also appear as two
forms. Conversely, the occurrence of a single migratory epitope tagged species would
indicate that alternative transcripts or alternative translational events give rise to two
species of slightly different molecular weight. Constructs expressing ER α, tagged N
or C-terminally with a single HA epitope, were transfected into 2T3 cells, which were
then analyzed 6 days after confluency occured. The two constructs had the same
transactivation ability as wild type (WT) mER α showing that the tags did not affect
receptor function (data not shown). In contrast to endogenous ER α, expression of the
tagged ER α in day 6 2T3 cells did not exhibit dimorphism (figure 8C). In addition,
we used an antibody (H-184) raised against the first 184 amino acids of ER α. This
antibody detected only one immunoreactive band by western blot with differentiated
2T3 samples (figure 8C).
Together, these results indicate that ER α is expressed in mouse osteoblasts in two
forms whose size is around 66 KDa. Both species have biochemical characteristics of
ER α as they are specifically degraded by the proteasome after treatment with ER
specific ligands. As only one of the two species reacts with an N-terminal antibody
the unreactive species would differ with its N-terminus from full length ER α. The
difference in migration is unlikely to be due to post-translational modification of the
full-length receptor, as transfected HA-tagged ER α appeared as a single migratory
form. These results suggest that osteoblasts express two isoforms of ER α that are of a
similar size as known full-length ER α but would differ in their N-termini. The 46
KDa isoform of ER α that was previously detected in human osteoblasts was not
57
readily detectable in mouse osteoblasts and is unlikely to play a significant role as
compared to the other forms of mER α.
2.2.
The expression of ER α in osteoblasts is not sex specific
Estrogens and their receptors are generally regarded as female specific. However, in
non-reproductive tissues, such as bone, the effects of estrogens do not depend on the
sex of the animal (McDougall et al., 2002;McDougall et al., 2003;Sims et al., 2003).
We confirmed this observation through comparing the expression of ER α in
differentiated male and female primary osteoblasts. Male osteoblasts did not differ
phenotypically from female osteoblasts and had similar differentiation kinetics in
vitro (data not shown). As shown in figure 9, no difference exists in ER α expression
between male and female osteoblasts, indicating that the expression of ER α in
osteoblasts is not sex specific.
Figure 9. Expression of mER α in male and female mouse primary osteoblasts.
Western blot analysis of mER α using the C-terminal antibody MC-20. Protein extracts were obtained
from in vitro differentiated male and female primary osteoblasts 10 days after confluency. 600,000
cells were loaded in each well.
58
2.3.
ER α expression in osteoblasts is low compared to uterus
One function of estrogens is to induce endometrial proliferation prior to implantation
of fertilized eggs. Uterus is a direct target tissue of estrogens and ER α is absolutely
required for this process (Dupont et al., 2000). Consequently, large amounts of ER α
are present in the different cell types of the uterus (Jensen et al., 1972). The
comparative level of ER α expression in extracts prepared from female mouse
osteoblasts and from mouse uterus was estimated by western blot analysis. Loading
was normalized to DNA content rather than protein content, thereby ensuring that
identical cell numbers were analysed in this comparison. As shown in figure 10, ER α
expression is, although detectable, negligible in osteoblasts as compared to the large
quantity detected in uterus.
Figure 10. Comparative expression of mER α in osteoblasts and in uterus
Osteoblast protein extracts were from differentiated female primary osteoblasts 10 days
postconfluency. Whole Uterus were dissected from 6 day-old female mice and protein extract prepared
from them. 100 µg of osteoblast protein were loaded as reference. The amounts of samples loaded were
normalized to DNA content to insure that each well contained the same number of cells.
59
3. ER alpha expression during osteoblast differentiation
3.1.
ER α expression increases with osteoblast differentiation
The onset of osteoblast differentiation reflects the activation of a genetic programme
in which transcription factors and structural proteins are sequentially induced. One of
the earliest events, is the apparition of the transcription factor Cbfa1 which triggers
the ordered expression of the osteoblast phenotype together with other transcription
factors (Stains et al., 2003). Interestingly, in rat and man, ER α protein levels were
also reported to increase with osteoblast differentiation, raising the possibility that ER
α expression is integrated in an osteoblast specific differentiation programme (Arts et
al., 1997;Bodine et al., 1998;Wiren et al., 2002).
We therefore wanted to evaluate the kinetics of ER α expression throughout the
differentiation process and functional activity of osteoblast derived from animals or
from 2T3 cell line. Total protein was isolated from 2T3 cells one day before
confluency and 4 and 6 days post confluency and one day before confluency and 10
days postconfluency for primary osteoblasts. Protein prepared from an equal number
of cells was loaded with β-actin used as a loading control. 2T3 and primary osteoblast
protein extracts contain the same immunoreactive doublet at 66 KDa (figure 11A).
The ER α doublet was visible in undifferentiated subconfluent primary osteblasts and
2T3 cells. In 2T3 cells, expression of the mER α doublet increased from day -1 to day
4 slightly decreasing at day 6. Increase in mER α expression also occurred between
day -1 and day 10.
To determine if increased ER α protein correlates with increased mRNA expression,
total RNA from undifferentiated and differentiated 2T3 cells, one day prior to
60
confluency and 2,4 and 6 days after confluency, was isolated and quantitative RTPCR performed using primers encompassing exons 5 and 6 (figure 11B). ER α
mRNA does indeed increase with differentiation, with a 5-fold increase in ER α
mRNA occurring, paralleling increased protein levels.
Figrue 11. mER α expression during osteoblast differentiation
A. Western blot analysis of mER α during osteoblas differentiation. Equal number of cells (600,000)
was loaded per well and even loading was controlled with an anti-β-actin antibody. mER α protein
expression was assessed with MC-20 in undifferentiated and differentiated 2T3 cells. Day –1 2T3 cells
and primary osteoblast are ALP negative while day 4 and 6 2T3 cells and day 10 are mostly ALP
positive. B. RT-PCR analysis of mER α mRNA expression throughout osteoblast differentiation of 2T3
cells. Primers were located in exon 5 and 6. Expression of mER α transcript increased during
differentiation as opposed to expression of GAPDH transcript.
61
In conclusion, ER α expression increases with osteoblastic differentiation at the
mRNA and protein levels. Expression of both protein isoforms at 66 KDa is
upregulated with differentiation. It is however, not possible to say if upregulation is a
direct consequence of differentiation or if the observed increase arises from nonspecific effects, such as the increased cell contact that occurs between cells as
confluency is achieved.
3.2.
Inhibiting osteoblast differentiation with TGF β does not
impair ER α expression
To distinguish between the possibilities that ER α is specifically up-regulated during
osteoblast differentiation and that it is regulated by other unspecific signals, we made
use of the impact TGF β has on osteoblast differentiation. TGF β plays indeed a
central role in the regulation of osteoblast differentiation. Although it increases type I
collagen production in prevents terminal differentiation and expression of ALP and
osteocalcin (Centrella et al., 1994;Alliston et al., 2001;Sowa et al., 2002). TGF β
however does not promote the differentiation of mesenchymal cells into other cell
types, but acts as a general inhibitor of mesenchymal cell differentiation (Choy et al.,
2000). Although the action of TGF β on proliferation varies, depending on the origin
of the osteogenic cells, there appears to be no direct connection between the effects of
TGF β on differentiation and proliferation (Centrella et al., 1994). As TGF β is able to
specifically target differentiation, it can be used to dissociate the development of the
osteoblast phenotype from the increase in cell contacts and thereby determine if ER α
expression is linked to differentiation.
As seen on figure 12A, ALP expression and mineralization of 2T3 cells are both
inhibited after continuous treatment with TGF β. In contrast, a single 24 hours of TGF
62
β treatment did not affect ALP expression in day 6 osteoblasts (figure 12A). To
determine the effect of TGF β on 2T3 cell proliferation, cell number was assessed by
quantifying DNA amounts. Although continuous TGF β treatment slightly increased
cell numbers in the early stages of culture, it did not have any significant effect on cell
number in postconfluent cells (figure 12B).
The effect of TGF β treatment on the expression of ER α was then determined. To
differentiate between possible direct effects of TGF β on ER α expression and the
effects linked to TGF β induced changes in the differentiation status of the cells,
protein were isolated both from 24h treated cells and from continuously treated cells.
As seen earlier, ER α expression increased between day –2 and day 6 with respect to
confluency (figure 12C). TGF β had indeed an effect on mER α protein expression
that was unrelated to osteoblast differentiation. A 24h treatment of subconfluent 2T3
cells or 6 days postconfluency induced a downregualtion of ER α (figure 12C).
Continuous TGF β treatment for 6 days however did not affect ER α expression
(figure 12C). Although differentiation is blocked with continuous (6 days) TGF β
treatment there is no variation in ER α expression.
The analysis of these results is complicated by the fact that ER α expression is the
target of TGF β independently of osteoblast differentiation. Still, expression of mER α
increases from day -1 to day 10 whether or not the cells are continuously treated with
TGF β, that is whether the cells are ALP positive or not. As a result we can conclude
that ER α expression does not correlate with the expression ALP, raising the
possibility that ER α expression is not linked to osteoblast differentiation.
63
Figure 12. Inhibition of osteoblast differentiation with TGF β does not affect ER α expression
A. Differentiating 2T3 cells in the presence or absence of TGF β were submitted to a colorimetric ALP
assay. Subconfluent undifferentiated 2T3 cells (-1) do not express ALP. At day 6 2T3 cells are ALP
positive (+6), continuous TGF β (5 ng/ml) treament (+ 6 days) inhibits ALP expression. A transient 24
hr TGF β treatment (+ 24h) does not affect ALP expression. B. Cell number during 2T3 cells
osteoblastic differentiation was assessed by quantifying DNA and shows that TGF β does not affect
significantly cell number. C. Protein were isolated from 2T3 cells one day prior to confluency and 6
days after confluency, run alongside uterus (Ut) extract, and submitted to western blot analysis using
MC-20. Equal cell number (600,000) was loaded in each well. Legend is as in A.
64
TGF β induced down-regulation of endogenous ER α has been previously
reported in several breast adenocarcinoma cell lines (Stoica et al., 1997;Petrel et
al., 2003). However, this is the first report of TGF β induced down regulation of
ER α expression in osteoblasts. This effect will be discussed later in more detail.
In contrast, exposure to continuous TGF β treatment that blocks osteoblastic
differentiation does not impair ER α expression. The discrepancy between the
effect of a single 24h TGF β treatment and that of a continuous treatment can be
explained by the fact that TGF β induces inactivation of its receptors and
components of its signaling pathways (Zhang and Laiho, 2003;Shi and Massague,
2003). A single TGF β treatment will directly and reversibly downregulate ER α
while continuous TGF β prevents osteoblastic differentiation and also inactivates
its signalling. As a result, continuous TGF β treatment is ineffective at
downregulating ER α.
3.3.
ER α expression during osteoblastic and myogenic
differentiation of C2C12 cells.
The use of TGF β does not dismiss the possibility that expression of mER α in
osteoblasts occurs in the early steps of differentiation prior to ALP expression. To
determine whether mER α expression is genuinely osteoblast specific we used the
ability of mesenchymal progenitor cells to differentiate into several cell-types. Indeed,
pluripotential mesenchymal cells can not only differentiate into osteoblasts but also
into adipocytes, myoblasts or chondroblasts (Phinney et al., 1999;Pittenger et al.,
1999). C2C12 cells are a well-characterized mesenchymal cell line, which can
differentiate into osteoblasts in the presence of BMP2, although they preferentially
differentiate into myoblast (Katagiri et al., 1994). High doses of BMP2 are required to
65
redirect C2C12 cells towards the osteoblastic lineage while they spontaneously fuse
into myotubes in low serum medium (Katagiri et al., 1994). The resulting population
produces an extracellular collagen matrix and express specific osteoblast
differentiation markers, including Cbfa1, ALP and osteocalcin (Katagiri et al.,
1994;Lee et al., 2000;Maeda et al., 2004). We therefore used the dual differentiation
potential of C2C12 cells to further evaluate the association of ER α expression and
osteoblastic differentiation.
C2C12 cells were grown to confluency whereupon the serum content of the growth
medium was lowered from 15% to 5%. Under these conditions, C2C12 differentiated
spontaneously into multinucleated myotubes. Subconfluent undifferentiated cells were
neither multinucleated nor did they express ALP (figure 13). Figure 13A shows that
the first multinucleated myotubes appeared 3 days after confluency while most cells
had fused into myotubes at day 6. Nonetheless, C2C12 cells induced to differentiate
into myoblasts did not express ALP either at day 3 or day 6 (figure 13A). In contrast,
the addition of 300 ng/ml BMP2 at confluency induced osteoblastic differentiation.
ALP was expressed by most cells at day 3 and day 6 and no multinucleated myoblasts
were visible (figure 13A). Transient 24h treatment with BMP 2 did not reverse the
formation of myotubes although it induced ALP expression in a few cells (figure
13A).
66
Figure 13. mER α expression during osteoblast and myobast differentiation of C2C12 cells.
A. The upper panel shows ALP assay of differentiating C2C12 cells in the presence or absence of
BMP2 (300 ng/ml) up to 6 days after confluency. The lower panel is a close up of the wells presented
in the upper panel. In the absence of BMP2, C2C12 cells differentiate into multinucleated myoblasts
and do not express ALP. Transient 24h BMP2 treatment at day 3 and day 6 only induces a few cells to
express ALP. Continuous BMP2 treatment induces ALP expression and no multinucleated myoblasts
are visible. B. Western blot analysis of mER α using MC-20. Proteins were isolated at the different
stages showed in A. 100 ug of protein loaded in each well for C2C12 cells and run alongside uterus
sample (Ut).
67
ER α was detectable in C2C12 cells. Like for TGF β however, BMP2 treatment
induced a decrease in ER α expression that was independent of the differentiation
status of C2C12 cells (figure 13B). 24h treatment of C2C12 cells at day -1 and day 3
dramatically decreased the levels of mER α protein, the same occurred at day 6 but to
a lesser extent. A three-day continuous treatment with BMP2 was also able to reduce
the level of mER α but not as much as a 24h treatment. Most importantly, a 6 day
long BMP2 treatment did not affect the levels of mER α as compared to untreated
cells. This last result shows that untreated C2C12 cells that have a myoblastic
phenotype express as much mER α as ALP positive C2C12 cells. Although the
expression of ER α increased between day -1 and day 6, the increase was not a
specific consequence of osteoblast differentiation (figure 13B).
As for TGF β, BMP2 is able to downregulate mER α independently of the
differentiation phenotype. Similarly, continuous treatment attenuates the BMP2induced downregulation of ER α as BMP2 is less capable of downregulating mER α
after three days of treatment and has no effect after 6 days of continuous treatment.
The fact that continuous BMP2 treatment fails to affect mER α expression suggests
like for TGF β that BMP2 inactivates its own signalling. BMP2 and TGF β, although
they have divergent effects on mesenchymal cell differentiation, belong to the same
family of cytokines and have a common mechanism of action and share common
effectors (Lee et al., 2002;Lai and Cheng, 2002;Shi et al., 2003).
68
4. Estrogen
receptor
transcriptional
activity
in
mouse
osteoblasts
4.1.
The transcriptional activity of the estrogen receptor increases
with differentiation and displays high levels in the absence of ligand
ER α is expressed in osteoblasts, and its expression increases with differentiation
(figure 5A). We then wished to define if ER α in osteoblasts is transcriptionally active
and if transcriptional activity correlates with expression level.
To monitor mER α transcriptional activity, we first isolated primary mouse
osteoblasts from newborn transgenic mice that express β-galactosidase under the
control of three tandem EREs (Nagel et al., 2001). The isolated osteoblasts
differentiated in vitro as monitored by ALP activity, and ER α protein expression
increased with differentiation, as observed with wild-type osteoblasts (figure 14A). ßgalactosidase activity was determined in undifferentiated subconfluent and in
differentiated osteoblast cell extracts. As ICI 182,780 not only competes with E2 in
binding to ER but also targets the receptor for proteasomal degradation, the values
obtained were nomalized to that of ICI 182,780 treated cells. Figure 14A shows that
in subconfluent cells there is no difference in the induction of β-galactosidase activity
in the presence of E2 as compared to ICI 182,780. However, in differentiated primary
osteoblasts, a significant increase in activity occurs with both vehicle and E2
treatments, as compared to ICI 182,780 treated cells. Surprisingly, no significant
induction of β-galactosidase activity by E2 occurred, as compared to treatment with
vehicle alone.
69
Figure 14. Estrogen receptor transcriptional activity in osteoblasts
Cells were allowed to differentiate in vitro. Protein expression of mER α was assessed by western
blotting with the H-184 antibody. The transcriptional output of mER α was assayed for the
corresponding reporter after 24h treatment with vehicle, 10 nM E2 or 0.1 µM ICI 182,780. Activity is
represented as fold of ICI 182,780 treated cells. A. Primary osteoblasts were isolated from transgenic
mice containing a β-galactosidase (β-Gal) transgene under the control of 3 EREs and the minimal Tk
promoter. Primary cells were analyzed for β-Gal activity at subconfluency or 10 days postconfluency.
B. 2T3 cells were transfected with the ERE-tk-luciferase reporter 48h before harvest. Cells were
analyzed for luciferase activity and activity was normalized to transfection efficiency with renilla
activity.
70
These findings were then confirmed in 2T3 cells, transiently transfected with an
estrogen responsive ERE-tk-luciferase construct, either at subconfluency or 5 days
post confluency. Luciferase activity was again normalized to the mean values
obtained from cells treated with ICI 182,780. As with primary osteoblasts in
undifferentiated, subconfluent cells., reporter expression does not increase
significantly above that of ICI 182,780 treated cells (figure 14B). In contrast,
luciferase activity in differentiated 2T3 cells is significantly higher in both vehicle and
E2 conditions than in cells treated with ICI 182,780 (figure 14B).
The increase in transcriptional activity monitored in osteoblasts with respect to
differentiation is likely to be consequent on the elevation of mER α levels that occurs.
However, ligand dependent steroid receptors are generally not active in the absence of
ligand. In contrast, orphan receptors known as estrogen related receptors (ERRs) bind
to EREs and activate transcription in the absence of any estrogens. One of them, ERR
α has been shown to be active in osteoblasts (Bonnelye et al., 2001). However,
because their ligand binding domain cannot accommodate ligand, ERRs do not bind
and therefore are not inhibited by ICI 182,780 (Vanacker et al., 1999). The results
presented are normalized to activities seen when cells are treated with ICI 182,870,
where a significant increase is seen in the absence and presence of E2. ERRs are, as a
result, unlikely to be responsible for transcriptionally activating ERE dependent
expression in osteoblasts.
4.2.
ER α shows high activity in the absence of ligand in 2T3 cells.
The activity activity of estrogen responsive reporters showed high activity in the
absence of ligand. To determine if ER α could activate responsive promoters in the
absence of ligand, a construct expressing mER α was co-transfected with ERE-tk71
luciferase reporter construct into subconfluent 2T3 cells. While sub-confluent, these
cells express little ER α and consequently, induce little endogenous reporter gene
activity (figure 14B). It is therefore possible to study a transfected ER α in this
context without the contaminating activity of endogenous ER α.
Transfected mER α induced transcription of luciferase without addition of E2, to ~
40% of the level obtained in the presence of saturating amounts of E2 (figure 15A).
Furthermore, the human ER α receptor was also able to transactivate reporter gene
expression in 2T3 cells, indicating that this phenomenon is not specific to the mouse
receptor (figure 15A).
As the context and specific sequence of individual ERE’s can greatly affect
transactivation by estrogen receptors (Hall et al., 2002), we wondered if activity
observed in the absence of E2 was consequent on the reporter construct used. To
evaluate this, a construct where luciferase expression was determined by the action of
the pS2 promoter was used. The pS2 promoter is specifically responsive to estradiol
bound ER (Masiakowski et al., 1982). Its activation by ER arises from an imperfect
palindromic ERE, at position -393 respective to the major transcriptional start site,
which differs from the ERE previously used at 2 bases (Berry et al., 1989).mER α
achieved a similar level of ligand-independent activity on the pS2 promoter as on the
ERE-tk-luciferase reporter indicating that the high constitutive activity of ER α is
independent the promoter used and the ERE sequence (figure 15B).
72
Figure 15. mER α constitutive activity is not promoter dependent but varies between cell lines.
A. Empty pSG5 vector as well as mER α, and hER α were transiently transfected in subconfluent 2T3
cells together with ERE-tk-luciferase reporter. Cells were treated 24h before harvest with vehicle, E2
or ICI 182,780. B. Subconfluent 2T3 cells were transiently transfected with the pGL3-pS2 promoter
reporter construct and mER α or empty pSG5. Cells were treated as in A. C. Different cell lines were
transiently transfected with mER α and the ERE-tk-luciferase. Results are plotted as % of maximum to
show the variation in basal activity with vehicle alone.
73
Constitutive activity of ER has been observed in several contexts as upon growth
factor treatment but rarely in untreated cells, at least not to such an extent. It was
therefore of interest to determine if high constitutive activity could be obtained in cell
lines in addition to the 2T3 line. Figure 15C depicts the percentage of ligandindependent activity obtained when several ER α negative cells lines were transfected
with mER α. Constitutive activity ranges from ~ 40% in 2T3 cells to 2% in HepG2
cells. There is no apparent correlation between AF context and activity in the absence
of ligand, as MDA-MB231 cells and 2T3 cells both support AF2 derived activity to
similar levels (data not shown) but have yet very different reporter activities in the
absence of ligand (47 and 12% respectively).
These data indicate that the constitutive estrogenic activity observed in osteoblasts is
likely mediated by mER α. Moreover, ER α mediated constitutive activity varies
between different cell contexts, however, within all cell types evaluated, it is highest
in osteoblasts.
4.3.
Molecular analysis of the “ligand-independent activity” of ER α
As outlined in the introduction, the ligand-independent activity of ER α has been
extensively studied. In summary, the signal transduction pathways of several growth
factors converge to activate ER α mediated signaling either directly by
phosphorylation of the receptor or indirectly through phosphorylation of associated
coactivators (Weigel and Zhang, 1998;Lopez et al., 2001;Dutertre and Smith, 2003b).
Many of the phosphorylation events that achieve ligand-independent activity occur on
serine residues located in the N-terminal part of the receptor (Dutertre and Smith,
2003a). In addition, a potential α-helix in the A domain was shown to preclude the
active conformation of ER α in the absence of hormone, through occupying the
74
surface groove in the E domain that associates with the LXXLL motif of intermediate
transcription factors (Metivier et al., 2002b). To identify regions that have a role in
the constitutive activity of ER α, a series of deletion mutants were constructed (figure
16). These constructs were then evaluated in transient transfection assays for their
ability to induce estrogen dependent gene activation, using ERE-tk-luciferase as a
reporter construct. As seen in figure 16, deletion of the A domain, although it was
reported to increase ligand-independent activity (Metivier et al., 2002b), did not affect
activities either in the presence or absence of ligand. Likewise, deletion of both A and
B domains had no effect on the activity of the receptor in the absence of hormone
(figure 16). Deletion of the F domain also failed to affect the activity of the receptor
both in the presence and absence of E2. These data show that the constitutive activity
of ER α is unlikely to involve the A domain or phosphorylations in the B domain
since a truncated receptor missing these domains still exhibits activity in the absence
of ligand.
Figure 16. Ligand-independent activity of ER α truncation mutants
Several truncation mutants of mER α were transfected in subconfluent 2T3 cells and their
transcriptional output was analyzed using the ERE-tk-luciferase reporter as previously described. The
values are plotted as % of maximum.
75
4.4.
The “ligand independent” activity of mER α arises from
residual estrogens the culture medium
The constitutive activity of mER α may arise from estrogens remaining in the culture
medium. These estrogens could come from the serum or from estrogenic
contaminants present in the medium. Although the serum used was charcoal stripped,
that is, estrogens and many other small, hydrophobic molecules removed by
adsorption onto dextran-coated carbon, it is never completely devoid of steroids. It is
possible that, in certain cell contexts, ER α is hypersensitive to little concentrations of
contaminating estrogens.
To determine whether the high constitutive ER α activity observed in osteoblasts
arises from estrogens present in the culture medium, we made use of a mutant ER α.
Mutation of glycine 400, within the ligand binding domain, to valine (hERα G400V)
decreases hER α affinity towards ligand (Tora et al., 1989a). Although binding
affinity is decreased, hER α G400V transactivates responsive promoters to the same
extent as hER WT at saturating hormone concentrations, indicating that coactivator
binding is not directly affected by the mutation (Tora et al., 1989a). Furthermore, this
mutation was shown not to affect the induction of ligand-independent activity by EGF
and forskoline/IBMX (Bunone et al., 1996;el Tanani and Green, 1997). Taken
together, hER α G400V is a good tool that distinguishes between hormone sensitivity
and ligand-independent activity, in the analysis of the constitutive activity of ER α in
osteoblasts.
As previously reported, mutation of Glycine 400 into valine did not affect induction
of the reporter in the presence of saturating amounts of E2 (figure 17). However there
was no induction of the reporter in the absence of hormone above the levels of ICI
182,780 treated cells. This result indicates that the apparent constitutive activity of ER
76
α observed in osteoblasts comes from residual estrogens present in the growth
medium. The high residual activtity of ER α can result from higher estrogen levels in
the culture medium of osteoblasts because they do not metabolize estrogens as
efficiently as other cell types. Alternatively, the residual estrogen levels present in the
growth medium might be the same as for other cell types, but ER α in osteoblasts is
hypersensitive to estrogens and can respond to low estrogen concentrations.
Figure 17. ER α G400V does not have any basal activity
Empty pSG5 vector, hER α G400V , and mER α were transiently transfected in subconfluent 2T3 cells
and transcriptional activity was assessed on the reporter ERE-tk-luciferase after 24h treatment with
vehicle, E2 or ICI 182,780.
77
5. Estrogen signalling is not necessary and does not affect
differentiation of 2T3 cells
Because osteoblasts express a functional ER α, it is expected that estrogens can
directly affect osteoblast differentiation or function. Several studies report a positive
effect of estrogens on osteoblast differentiation while others show no effects (Keeting
et al., 1991;Scheven et al., 1992;Qu et al., 1998).
We therefore wanted to investigate whether 2T3 cells were able to react to continuous
E2 treatment. Cells were kept in low estrogenic charcoal stripped medium and
assayed for ALP activity every second day over a period of 8 days after confluency.
The appearance of ALP positive cells was delayed in charcoal stripped medium as
compared to cells grown in unstripped medium (compare figure 18A and 7B).
However the continuous addition of 10 nM E2 did not modify the kinetics of ALP
expression.
To determine whether estrogen signalling is necessary to osteoblastic differentiation,
we also allowed 2T3 cells to differentiate in culture medium containing unstripped
serum in the continuous presence 10 µM ICI 182,780. Figure 18B shows that there is
no difference in the kinetics of ALP expression whether or not ICI 182,780 is added
to the culture medium. We previously showed that ICI 182,780 is functional in
inhibiting estrogen signalling in 2T3 cells as assessed by the transcription assays
presented previously (figure 14B).
This assay would be able to detect possible effects of estrogens on proliferation, cell
death, and differentiation alike. Modifying proliferation or cell survival will modify
the rate of differentiation as differentiation is governed by cell contacts (Owen et al.,
1990;Aronow et al., 1990). However, 2T3 cells are committed to the osteoblast
78
lineage and do not differentiate into other cell types in the absence of additional
factors (Chen et al., 1998). It is therefore unlikely that the ALP assay can assess the
possible ability of E2 to influence commitment of 2T3 cells to different mesenchymal
cell lineages. Altogether these data indicate that estrogen signalling is not required for
the process of osteoblast differentiation. Also, estrogens do not accelarate osteoblast
differentiation at least as far as ALP expression is concerned.
Figure 18. Estrogen signalling does not affect osteoblast differentiation
A. 2T3 cells were assessed for ALP expression over a period of 8 days postconfluency in charcoal
stripped medium in the presence or absence of 10 nM E2. B. ALP expression of 2T3 cells grown up to
6 days postconfluency in normal medium containing vehicle or 1 µM ICI 182,780.
79
6. The effect of TGF beta on ER alpha expression and
transactivation function
As we have seen, transient treatment with TGF β was able to downregulate mER α in
2T3 cells. We decided to investigate this phenomenon further. Interestingly, TGF β
treatment was previously shown to affect ER α expression. Two different mechanisms
have been described (Stoica et al., 1997;Petrel et al., 2003). One way would be
through silencing of transcription from the A promoter of the ER α gene (Stoica et al.,
1997). The alternative mechanism involves increased proteasome mediated
degradation of the receptor (Petrel et al., 2003).
We initially determined if TGF β triggers proteasomal degradation of ER α. The
results showed in figure 19A confirm as previously shown that degradation induced
both by E2 and ICI 182,780 is proteasome mediated, as MG132, an inhibitor of
proteasome activity, prevents these effects. TGF β also downregulates ER α, however,
this downregulation is not accentuated when the cells are co-treated with E2 or ICI
182,780. Surprisingly, Treatment with TGF β and MG 132 resulted in a complete
disappearance of ER α. Although the disappearance of mER α upon combined TGF β
and MG 132 treatment cannot be explained, these results show that in 2T3 cells, TGF
β mediated downregulation of mER α does not involve proteasome activity.
To find out whether TGF β induced downregulation correlated with decreased mRNA
levels, total RNA was isolated from day 6 2T3 cells treated or not with TGF β. The
result shows that treatment with TGF β decreases more than 30 folds the amount of
ER α mRNA as compared to GAPDH mRNA (figure 19B).
Finally we determined if a decrease in mER α transcriptional activity ensues from the
decrease in mER α levels following TGF β treatment. Accordingly, TGF β treatment
80
was able to diminish ER α mediated induction of the ERE-tk-luciferase reporter, both
in the absence and presence of E2 and to levels below that of cells treated with ICI
182,780 (figure 19C).
In conclusion, downregulation of mER α induced by TGF β is not due to increased
proteasome mediated degradation as MG 132 fails to block this process. Further
confirmation that the proteasome is not involved in TGF β induced downregulation of
ER α, is illustrated by the lack of synergism between TGF β and either E2 or ICI
182,780 in decreasing mER α levels. The TGF β-induced downregulation also occurs
at the mRNA level and could involve transcriptional regulation of ER α expression as
was previously suggested (Stoica et al., 1997). Decrease in mER α protein levels was
mirrored by a decline in transactivation activity.
81
Figure 19. Decrease in mER α protein, mRNA and signalling after transient TGF β treatment.
A. Western blot analysis of endogenous mER α expression in 2T3 cells 6 days postconfluency with
MC-20. Cells were treated concomitantly with ethanol vehicle, E2 (10 nM) or ICI 182,780 (0.1 µM)
and DMSO or MG132 () and TGF β (5 ng/ml). 100 µg of protein was loaded per well. B. Total RNA
was isolated from 2T3 cells 6 days after confluency treated or not with 5 ng/ml TGF β and subjected to
quantitative RT-PCR analysis. The values obtained were normalized to GAPDH expression. C. 2T3
cells 6 days postconfluency were transfected with ERE-tk-luciferase reporter construct and treated for
24h with ethanol vehicle, E2, ICI 182,780 and TGF β (5ng/ml).
82
7. Human ER alpha referenced as wild type contains the
mutation G400V
In the course of this study we analyzed the high constitutive activity of the mouse ER
α in 2T3 cells and compared to the human receptor. We were initially using a mutated
form of hER α thinking we were using WT receptor. The mutated hER α was mutated
on glycine 400. The mutation G400V that we have described previously renders hER
α less sensitive to ligand. As a result the ligand-independent activity seemed to be
mouse specific as the mutated human receptor did not display any activity in the
absence of E2. Unwittingly, as the reference sequence of wild type hER α cDNA
available in databases corresponds to this mutated receptor, the G400V mutation was
never identified after sequencing as being erroneous. This appendix describes the
work done that led to the identification of this mutation.
As hER G400V was used, we tried to map the apparently mouse specific highconstitutive activity. To achieve this, a series of chimeras of mER α and hER α were
constructed. Chimeras indicated that the E domain, encompassing residues 362 and
533 of mER α and residues 357 and 537 of hER α, were sufficient to confer or
abrogate constitutive activity in hER α and mER α respectively (figure 20).
83
Figure 20. The apparent ligand-independent activity of mER α is localized to the E domain
(amino acids 362-533).
Chimeras were constructed between hER α and mER α as depicted on the left. hER α mER α and the
multiple chimeras were transfected in subconfluent 2T3 cells and luciferase expression assessed from
the ERE-tk-luciferase reporter after 24h vehicle, E2 or ICI 182,780 treatment. The results are plotted as
% of maximum.
Comparison of the protein sequences in the region responsible for the different
constitutive activities, revealed two divergent amino acids between the mouse and the
human receptors that were responsible for the constitutive activity of the human and
mouse ER α (figure 21A). Single and compound mutations of these amino acids to
their human or mouse counterparts were then generated. None of the mutations either
single or compound were able to change the activity of the receptor in the absence of
ligand.
84
Figure 21. Mutation of the divergent amino acids between hER α and mER α to their mouse and
human counterparts does not affect ligand-independent activity.
A. Alignment of hER α and mER α of the region defined as necessary and sufficient for ligandindepdent activity showing the two divergent amino acids in red. B. Analysis of single of compound
mutations of the two divergent amino acids. The different mutants were transfected in subconfluent
2T3 cells and transactivation assessed on the ERE-tk-luciferase after treatment with vehicle, E2 and ICI
182,780 as previously described.
85
Figure 22. Mouse and human ER α have the same responsivity to E2.
A. Empty pSG5, hER α G400V, hER α WT and mER α were transfected in subconfluent 2T3 cells
and luciferase activity from the reporter ERE-tk-luciferase assayed. B. Dose response assay of hER
α and mER α in MDA-231 and Hela cells. Cells were transfected with WT hER α and mER α and
increasing concentration of E2 were used. ICI 182,780 was used to determine basal level. The
values are plotted as % of maximum.
86
Since mutations of mER α or hER α were not able to revert either of the phenotypes,
it was hypothesized that the constructs used could have been mutated on other
residues within the region mapped. Every construct used was sequence validated and
found to be correct; the only possibility left was therefore that database reference
sequences were incorrect. Alignment of the translated cDNA sequences used
(Reference number NM_000125) to validate our constructs indeed revealed a
divergence at residue 400 of hER α (residue 404 of mER α). This divergence does not
appear when directly aligning the protein sequences available.
The sequence of hER α corresponds to the original isolate that was subsequently
shown to be mutated at position 400 from glycine to valine. This mutation was shown
to affect affinity to the ligand and consequently sensitivity to E2 (Tora et al., 1989a).
Using a non-mutated hER α cDNA showed that human and mouse receptors had the
same activity in the absence of estradiol in 2T3 cells and the same sensitivity to
estradiol in MDA-MB231 and HeLa cells (figure 22A and B).
87
Discussion
88
1. ER alpha is expressed and is functional in mouse osteoblasts
Osteoblasts are believed to be the direct target of estrogens since the discovery of a
small number of E2 binding sites (Komm et al., 1988;Eriksen et al., 1988). The
expression of ER α has been extensively studied at the mRNA level; however
detection of the protein is difficult because of the low expression levels. Nevertheless,
it is assumed that, despite the low amounts of ER α present, osteoblasts mediate some
if not all of the effects of estrogens on bone (Spelsberg et al., 1999;Riggs et al.,
2002;Manolagas et al., 2002). It is still controversial however as to whether the
amounts present are sufficient to respond to estrogens (Karsenty, 1999).
Using a well-characterized in vitro differentiation system, we describe here the
expression of ER α in murine osteoblasts. This work demonstrates that two protein
products with the biochemical characteristics of ER α are expressed both in primary
osteoblasts and in the osteoblastic 2T3 cell line (figure 8,).
This endogenous ER α could specifically transactivate an ERE-tk-luciferase reporter
construct, demonstrating that functional signalling occurs in these cell types (figure
14). There are good indications that the endogenous activity detected in osteoblasts
results from the presence of ER α. Indeed, there is an excellent correlation between
ER α expression and inducibility of the reporter. Firstly, the activity in osteblasts
increases with differentiation concomitantly with ER α expression (figure 14).
Moreover, downregulation of ER α expression by TGF β induces a decrease in overall
reproter activity (figure 19). The data presented does not absolutely rule out that ER β
is involved in the transcriptional activity observed. When ER β was transfected in 2T3
cells, it displayed the same residual activity as ER α in the absence of additional E2.
89
Therefore, ligand-independency could not be used to discriminate between ER α and
ER β (data not shown). ER β expression is however low in osteoblasts and does not
vary with differentiation and would therefore not correlate with the activity of the
ERE-tk-luciferase reporter (Zhou et al., 2001;Wiren et al., 2002).
On the other hand, the orphan nuclear receptor ERR α has been detected in osteoblasts
and shown to be active (Bonnelye et al., 2001). ERRs, like ERs recognize EREs, but
do not bind ligands and have constitutive activity (Vanacker et al., 1999).
Interestingly, endogenous transcriptional activity detected in osteoblasts was also
mainly constitutive. However, ERRs do not to respond pure antagonists of estrogen,
like ICI 182,780 (Vanacker et al., 1999). However, ICI 182,780 decreased the
transcriptional activity observed in osteoblasts, indicating that an ER is responsible
for transactivation of ERE dependent promoters.
Altogether, the data presented here prove that ER α is expressed and transcriptionally
active in murine osteoblasts.
2. ER alpha exists as two isoforms in mouse osteoblasts
The ER α gene is a complex genetic unit consisting of several promoters and multiple
exons. Alternative promoter usage and alternative splicing generates different
transcripts, some of which giving rise to shorter isoforms. The best documented
isoform of ER α is ER α 46, which has been reported to result either from the splicing
of one of the upstream exons to exon 2, or from internal ribosome entry (Barraille et
al., 1999;Flouriot et al., 2000). The ER α 46 protein isoform has been detected in the
human breast carcinoma cell line MCF7 and in human primary osteoblasts (Flouriot et
al., 2000;Denger et al., 2001). In human osteoblasts, ER α 46 is expressed at a similar
90
level to the full-length protein (Denger et al., 2001). ER α 46 lacks the A and B
domains including the entire AF1. ER α 46 can still dimerize and bind to DNA. ER α
46 can dimerize with the full-length receptor and inhibit its transcriptional activity as
a result of the AF-1 supporting context found in human osteoblasts (Denger et al.,
2001). In addition, the transcript resulting from the splicing of upstream exon F to
exon 2 that would code for the ER α 46 was identified in mouse bone (Denger et al.,
2001). Together, these data suggest that ER α 46 could play a major role in the
response of osteoblasts to estrogens.
Here, no evidence of a 46 KDa ER α isoform in murine cells was found, either in
uterus or in osteoblasts although the corresponding transcripts were detected (figure 8
and data not shown). It could be that in mouse osteoblasts the amounts of
corresponding transcript are so low compared to full-length transcript that the
corresponding protein cannot be detected. Alternatively, the two initiating AUGs in
exon 2, which are also present in the mouse ER apha, might not be effective at
initiating translation. These results, however, rule out a possible involvement of ER α
46 in the regulation of osteoblast physiology in the mouse.
This notwithstanding, mER α runs as a doublet on SDS-PAGE, suggesting that it
exists as two molecular entities of similar molecular weight. A comparable doublet
was also detected on a western blot of the endogenous mER α from mouse ES cells,
using the same antibody as in this study, but was not commented upon (Perissi et al.,
2004). The doublet is not present in preparations from uterus but this may be a
consequence of the larger amounts of mER α present in this tissue. Both bands are
degraded in response to E2 or ICI 182,780 confirming that the two products are mER
α (figure 8A). The nature of the two products can only be speculated upon. ER α was
previously shown to migrate as a doublet on SDS-PAGE (Golding and Korach, 1988).
91
This was found to result, at least partly, from phosphorylation of ER α on serine 118
induced by E2 treatment (Joel et al., 1995;Joel et al., 1998). It is however improbable
that the dimorphism of mER α results from phosphorylation of serine 122 (the mouse
ortholog of serine 118) as E2 treatment that would promote its phosphrylation, does
not affect specifically one of the two bands (figure 8A). Moreover, exogenously
expressed HA-tagged construct does not display dimorphism further indicating that it
is unlikely that phosphorylation is responsible for the appearance of the upper band
(figure 8C). The absence of the doublet with the HA-tagged mER α also rules out any
other posttranslational modification as the cause of dimorphism.
Because an N-terminal antibody recognizes both bands but only one is recognized by
a C-terminal antibody, it is plausible that the lower band corresponds to an Nterminally deleted form of ER α (figure 8C). No ER α mRNA variant has been
identified to date that could account for an N-terminally-truncated isoform of this
size. Interestingly, a similar doublet has never been observed in tissues or cells of
human origin (unpublished observations). This mouse specific effect may be
explained by the presence of two ATGs in exon 1 that occur in mouse but not in
human 87 base pairs downstream of the AUGs used to produce full-length ER α. The
use of these AUGs would give rise to a protein of 63.5 KDa, as opposed to the 67
KDa predicted for the mouse full-length ER α. This size difference is consistent with
what is seen on a western blot. There is evidence that translation by ribosome
scanning occurs with the human and mouse ER α transcripts (Kos et al., 2002). As a
result, leaky scanning of the initating AUGs would allow translation to start from the
downstream AUGs in exon 1. It may be argued that the lower band should occur on
expression of the HA-tagged ER αs, however theoretical considerations indicate that
this is unlikely. Since the initiating AUG in the HA-tagged constructs is within a
92
strong consensus Kozak sequence and, if translation initiation occurs by ribosome
scanning, the strong initiating AUG will prevent alternative scanning and translation
initiation from the downstream AUGs thereby occluding translational initiation on
alternative AUG’s. Interestingly, the truncated receptor would be devoid of A domain
and would be predicted to have high levels of activity in the absence of ligand in AF-1
promoting contexts while it would repress transcription in AF-2 permissive contexts
(Metivier et al., 2002c). This shorter product however would not be responsible for
the high basal transcriptional activity of ER α in osteoblasts, as deletion of the A
domain of ectopically expressed ER α does not alter its activity in 2T3 cells (figure
16). Although this assumption is very speculative it merits further investigation.
3. ER alpha expression in the mesenchymal lineage is not
specific to osteoblasts and is lower than in reproductive tissues.
Osteoblasts arise from pluripotent mesenchymal cells. These cells differentiate not
only into osteoblasts but also into myocytes, adipocytes and chondrocytes given
appropriate extracellular cues. Mesenchymal stem cells differentiate in accordance
with the multi-lineage priming model (Hu et al., 1997). This model states that pluripotent progenitor cells express low level of genes specific to all the lineages they can
differentiate into. Upon differentiation into a given cell type, genes corresponding to
other lineages are repressed, while expression of lineage specific genes increases.
This model applies to osteoblast progenitors which express low levels of myogenic
and adipogenic markers prior to the onset of osteoblastic differentiation (Garcia et al.,
2002). The inception of osteoblast differentiation corresponds to activation of the
93
osteoblast specific transcription factor Cbfa1 (Ducy et al., 1997). Upon activation by
increased expression and by phosphorylation, Cbfa1 triggers an osteoblast-specific
genetic programme, which results in the sequential expression of osteoblast-specific
transcription factors and proteins involved in osteoblast function, such as matrix
synthesis and mineralization (Ducy et al., 1997;Lee et al., 2000;Alliston et al., 2001).
There are some indications that ER α could be involved in an osteoblast specific
genetic programme and participate in the regulation of osteoblast differentiation. First,
there are several reports showing that ER α expression is amplified with osteoblast
differentiation both in human and rat (Komm et al., 1988;Arts et al., 1997;Wiren et
al., 2002). This indicated that ER α is up-regulated by osteoblast differentiation
signals and integrated in the osteoblast-specific genetic programme. Moreover,
transfected ER α interacts with Cbfa1 to enhance its activity in osteoblasts,
confirming the integration of ER α in osteoblast differentiation (McCarthy et al.,
2003). On the other hand, ER α expression is relatively low in osteoblasts and ER α is
ubiquitously expressed at a low level which argues against a specificity of ER α
expression in osteoblasts (Eriksen et al., 1988;Davis et al., 1994;Couse et al.,
1997;Karsenty, 1999).
According to the multi-lineage priming model, we expected ER α to be expressed at a
low level in undifferentiated osteoblasts and its expression to increase with
differentiation. Conversely, blocking differentiation or differentiation into another cell
type should result in the suppression of ER α expression.
In accordance with the studies mentioned above, we found that ER α expression
increased concomitantly with osteoblast differentiation both at the protein and mRNA
level (figure 11A and 11B). This increase was mirrored by an increase in the
activation of an estrogen responsive ERE-tk-luciferase reporter construct (figure 14).
94
TGF β can provide competence for early stages of osteoblastic differentiation, but it
inhibits myogenesis, adipogenesis, and late-stage osteoblast differentiation. Although
it promotes the expression of collagen type I, it prevents the expression of osteoblast
markers such as ALP and osteocalcin (Centrella et al., 1994;Alliston et al.,
2001;Spinella-Jaegle et al., 2001). In preventing osteoblast differentiation, it
functionally blocks activation of Cbfa1 on certain promoters, thereby stopping
differentiation from proceeding (Alliston et al., 2001). Using 2T3 cells, we found that,
continuous TGF β treatment blocks differentiation of 2T3 cells in an ALP negative
stage without affecting cell proliferation (figure 12A and 12B). We therefore used this
model system to investigate whether ER α expression was linked to osteoblast
differentiation and if TGF β treatment prevented its up-regulation. TGF β was able to
down-regulate ER α expression but only when cells were treated for 24h and not after
long-term (6 days) continuous treatment. The effect of transient TGF β treatment on
ER α expression will be discussed later, as it is not related to differentiation. We
found however that ER α expression increased whether or not the cells had been
treated continuously with TGF β, that is, independently of ALP expression (figure
12C). This result suggests that ER α expression does not correlate with osteoblast
differentiation. It was however still possible that ER α expression increased with the
early stages of osteoblastic differentiation.
To further examine the premise that ER α expression is not tied to osteoblast
differentiation, we used the pluripotent C2C12 cell line that differentiates with
confluency into myoblasts but can be efficiently induced to differentiate into ALP
positive osteoblasts with high doses of BMP2 (Katagiri et al., 1994). Like TGF β,
BMP2 down-regulated ER α protein levels after transient treatment. This phenomenon
will be discussed later together with the effects of transient TGF β treatment on ER α
95
expression. The expression of ER α increased whether cells progressed to
multinucleated myotubes or differentiated into ALP positive osteoblasts (figure 13B).
There was moreover no difference in ER α expression between myoblastdifferentiated C2C12 cells and osteoblast-differentiated C2C12 cells at day 6 with
respect to confluency (figure 13B). The increase in ER α levels during osteoblast
differentiation is not a direct consequence of osteoblast differentiation since it also
occurs during myoblastic differentiation. It is interesting to note that increase in ER α
expression is not a specificity of the mesenchymal lineage as an increase in ER α
levels has also been detected during the differentiation of the mammary epithelial cell
line HC-11 and during the maturation of B cells (Grimaldi et al., 2002;Faulds et al.,
2004). It is not known whether a common mechanism is responsible for the
upregulation of ER α expression in these unrelated cell types.
Although osteoblasts contain more ER than fibroblasts (Eriksen et al., 1988), they
nevertheless contain at least a thousand fold less than an estrogen target tissue like
uterus (Davis et al., 1994). We confirmed these results in mouse by directly
comparing the amounts of ER α protein in mouse primary osteoblasts and in uterus
(figure 10). As we found here, the level of expression of ER α between an
unambiguous target tissue like uterus and osteoblasts or myoblasts is indeed
considerable.
These results tally with the concept that ER α is expressed ubiquitously in an
unspecific way at a low level. As mentioned in the introduction ER α has been
detected in numerous if not all tissues and cell types examined so far. On the other
hand, in specific target tissues like the reproductive tract high levels of ER α are
present.
96
What could direct the ubiquitous low level expression of ER α? As detailed in the
introduction, the ER alpha mRNA can be transcribed from at least 7 different
promoters. Interestingly, in mouse the F promoter seems to be expressed at a similar
level in every tissue examined included in (Kos et al., 2000). In contrast, the C variant
although it is detectable in many tissues, constitutes the main mRNA variant in uterus
(Kos et al., 2000). Consequently, it is plausible that the F promoter is responsible for
ubiquitous ER α expression, while the C promoter directs the high level expression of
ER α in tissues like uterus. It will be very informative to determine quantitatively the
variants expressed in mouse osteoblasts. However, experimental data is still missing
concerning the determinants of tissue-specific ER α expression.
Independent of the fact that ER α expression in osteoblasts is unspecific, the question
remains: Can the low levels of ER α in osteoblasts mediate a response to estrogens?
4. Involvement of estrogen signalling in osteoblast
differentiation
Estrogens have two different effects on bone: The osteogenic effect in which
estrogens affect osteoblast number and function resulting in increased bone mass and
the osteoprotective effect in which estrogens counteract the increase in osteclast and
osteoblast number and function following estrogen deprivation. We wanted to
investigate whether these two effects could be directly mediated by osteoblasts.
It is well accepted that estrogens can in vivo induce de novo bone synthesis (Samuels
et al., 1999). This action is largely a consequence of increased osteoblastic cellular
number and activity (Samuels et al., 1999). This so-called osteogenic effect of
97
estrogens is entirely dependent on ER α both in males and females (McDougall et al.,
2002;McDougall et al., 2003). In vitro however, conflicting results have been
reported. It was found that estrogens could enhance the number and activity of
purified mouse bone marrow osteoblasts however others did not monitor any changes
(Keeting et al., 1991;Qu et al., 1998;Qu et al., 1999). Because the little effect
estrogens can have on osteoblasts in vitro does not mirror the effects estrogens have
on osteoblast in vivo, it is still disputed whether the osteogenic action of estrogens is
the consequence of a direct effect on osteoblasts (Takano-Yamamoto et al., 1990).
Having found that 2T3 cells and primary osteoblasts contained ER α that could
transactivate, we wanted to examine whether estrogens could affect osteoblast
differentiation. Using 2T3 cells and monitoring ALP activity over time, we were not
able to see any effect of E2 on osteoblast differentiation (figure 18A).
It is possible that the presence of residual estrogens in our system at near saturating
concentrations for ER α as detected in the transcription assays would impair the
detection of effects additional estrogens could have. However, if this were the case,
the antagonist ICI 182,780 should have been able to counteract the effects of residual
estrogens and consequently to inhibit differentiation, which was not the case (figure
18B). It could be argued that estrogens affect osteoblasts at steps distinct from ALP
expression. Estrogens can indeed increase osteoblast function by increasing cell
number, modulating cell survival, and proliferation (Qu et al., 1998;Damien et al.,
2000;Zhou et al., 2001). Because cell number is crucial to the onset of differentiation,
this assay should, however, be able to monitor defects upstream of differentiation, like
proliferation and cell death (Aronow et al., 1990). Alternatively, it is possible that
estrogens influence osteoblast differentiation at an earlier commitment step that
cannot be appreciated using 2T3 cells. It has been proposed that estrogens promote
98
osteoblast differentiation as opposed to adipocyte differentiation of mesenchymal
progenitor cells in the bone marrow, hence increasing the number the number of
osteoblasts (Dang et al., 2002;Okazaki et al., 2002).
As mentioned earlier, this result is however not entirely surprising, as estrogens were
shown in many instances not to affect osteoblasts in vitro (Canalis and Raisz,
1978;Keeting et al., 1991;Spelsberg et al., 1999). This raises the question as to
whether osteoblasts are the direct mediators of estrogen action during the osteogenic
response. In rat, the osteogenic effects of estrogens were reported to be direct without
central relays as local estrogen application affects bone density in one limb without
affecting the contralateral one (Takano-Yamamoto et al., 1990). It is therefore
possible that another cell type in the bone environment signals to the osteoblasts upon
estrogen treatment. It is however noteworthy that the osteogenic response to estrogens
in rat requires much lower concentrations than in mice and could therefore involve an
entirely different mechanism (Turner, 1999).
Our study confirms however that estrogen signalling is not necessary to osteoblast
differentiation. Indeed growth of cells in the presence of the pure antiestrogen ICI
182,780 did not affect ALP expression in 2T3 cells (figure 18B). This supports the
observation that ER α and ER β deficient primary mouse osteoblasts develop
normally ex vivo (S. Dupont, personal communication). Decreasing estrogen levels by
gonadectomy, or ablation of their two receptors results in an increase in osteoblast and
osteoclast numbers and activities with osteoclast resorption overpowering bone
deposition, eventually leading to bone loss (Oz et al., 2000;Sims et al., 2002;Sims et
al., 2003). Addition of estrogens can in this low estrogen context reverse bone loss,
decreasing both osteoblast and osteoclast activities .The osteoprotective effect is
essentially mediated by ER α, ER β playing a small redundant role in female (Sims et
99
al., 2003). If this osteoprotective effect on osteoblasts were direct, one would expect
that inhibition of estrogen signalling would result in an increase in osteoblast
differentiation. It is therefore probable that the increase in osteoblast number and
function arising from deficient estrogen signalling is not directly mediated by
osteoblasts.
Since the discovery of estrogen receptors in osteoblasts and osteoclasts it has been
taken for granted that estrogens affect bone metabolism in a direct way. However
estrogens can have pleiotropic effects and affect homeostasis by regulating the
expression of other hormones and not necessarily in a direct way. Estrogens act on the
pituitary, which secretes numerous hormones. Estrogens play a crucial role in
regulating the levels of other hormones that are known to affect bone metabolism in a
direct manner. Examples are GH (Leung et al., 2004) and Prolactin (Clement-Lacroix
et al., 1999). There is now also good evidence that the endocrine control of
metabolism and reproduction are interconnected (Takeda et al., 2003). Even if some
of the effects of estrogens on bone are direct, indirect effects mediated by other
hormones are bound to play a crucial role. Cell-type specific knockouts would help
characterizing the place and mechanism of action of estrogens on bone.
5. Activity of ER alpha in osteoblasts
The ligand-independent activity of steroid receptors has been an issue for more than
10 years, since the discovery that certain growth factors and hormones could activate
receptors without addition of ligand (Power et al., 1991;Smith et al., 1993). This
phenomenon was also found to occur in vivo as growth factors elicit an estrogenic
response in the uterus requiring ER α (Ignar-Trowbridge et al., 1992;Curtis et al.,
100
1996). Ligand-independent activity would involve the phosphorylation of serine
residues in the B domain leading to ligand-independent recruitment of coactivators
(Lannigan, 2003;Dutertre et al., 2003c). Interaction of the A and E domains of ER α is
also important in suppressing activity of the receptor in the absence of ligand
(Metivier et al., 2002b). Importantly, any event that triggers activity in the absence of
ligand must directly or indirectly disrupt the interaction between the A and E domains
to allow coactivator recruitment.
Interestingly, the activity of ER α has high levels of activity even in the absence of
estradiol both in primary osteoblasts and 2T3 cells (figure 14). This high constitutive
activity was also present when ER α was transfected into undifferentiated 2T3 cells
albeit to a lesser extent (figure15A). The high basal activity of ER is unlikely to be a
reporter-related or transfection-related artefact. Firstly, a transiently transfected
reporter and a stably integrated transgene showed the same high residual activity with
the endogenous ER α (figure 14). Furthermore, the use of a different promoter
upstream of the luciferase reporter did not influence this seemingly ligandindependent activity (figure 15B).
This high basal activity was neither altered by the deletion of domains A, B or F
(figure 16). This result rules out any involvement of the serines located in the B
domain in the constitutive activity. It also dismisses a possible role of the A domain in
the ligand-independent activity observed in osteoblasts.
The ligand-independent activity varied however greatly between different cell lines,
being highest in osteoblasts and lowest in the hepatic cell line HepG2 (figure 15).
Interestingly, HepG2 cells because of their liver origin possess the enzyme necessary
to metabolise estrogens (Mattick et al., 1997). It was therefore possible that ER α in
HepG2 cells does not display any ligand-independent activity because estrogens
101
present in the culture medium are efficiently metabolised, and that the high activity
observed in the absence of ligand in osteoblasts is the result of residual estrogens.
To examine the possibility that residual estrogens are responsible for the high
constitutive activity in osteoblasts, we used a mutant ER α that is less sensitive to
estrogens. The G400V mutant ER α, although it does not transactivate in the presence
of low estrogen concentrations, can however be activated to the same extent as WT
ER α in the presence of saturating E2 concentrations (Tora et al., 1989a). Importantly,
the G400V mutant receptor is still activated by growth factors in a ligand-independent
manner, indicating that this function is still active in the mutant receptor (Bunone et
al., 1996). If the high basal activity of ER α in osteoblasts is due to residual estrogens
the G400V mutant should not be activated by the low concentrations present in the
culture medium. ER α G400V did not show any activity as opposed to WT in the
absence of additional E2 strongly indicating that the basal activity is the result of
estrogens present in the growth medium.
The fact that osteoblasts specifically support such a high basal activity however does
not necessarily mean that they do not metabolise estrogens and that there is as a result
a higher estrogen concentration in the culture medium. It is also possible that ER α in
this cell type is highly sensitive to estrogens and reacts to the low estrogen
concentrations present in the medium.
The sensitivity of nuclear receptors can be for instance modulated by coactivator and
corepressor levels, which vary between different cell types (Herdick and Carlberg,
2000). The number of receptors per cell is also an important factor and could explain
why endogenous ER α shows higher basal activity than transfected ER α (Webb et al.,
1992).
102
Interestingly, using transgenic mice containing a estrogen responsive promoter it was
found that non-reproductive tissues like brain and bone displayed high levels of
luciferase reporter activity (Ciana et al., 2003). The basal activity observed was
decreased after treating the mice with ICI 182,780. The authors concluded that ERs
could function in a ligand-independent manner. Our results indicate however, that this
high activity could be due to the high sensitivity of ER alpha or to higher local
estrogen concentrations in these tissues.
6. Effect of TGF beta family members on ER alpha expression
The TGF β family of cytokines controls a diverse set of cellular processes. They exert
potent effects on bone metabolism and directly affect osteoblast differentiation. While
using TGF β to inhibit osteoblast differentiation, we found that a 24 h treatment with
TGF β of 2T3 cells, whether differentiated or not induced a decrease in ER α protein
levels. TGF β and estrogen signalling have long been known to interact (Knabbe et
al., 1987). Two different mechanisms for down-regulation of ER α by TGF β in
human breast carcinoma cell lines have been proposed. Firstly, ER α A promoter
activity is reduced by TGF β in the human MCF7 cell line (Stoica et al., 1997).
Secondly, using several different human breast carcinoma cell lines, it was shown that
TGF β induced proteasome-dependent ER α downregulation by TGF β was not at the
transcriptional level but involved proteasome-dependent degradation of the receptor
(Petrel et al., 2003). In 2T3 cells, downregulation invoked by TGF β correlated with a
decrease in ER α mRNA levels. In our hands, blocking proteasome activity did not
prevent downregulation of the receptor but instead intensified the decrease in
103
intracellular level of ER α. Also, TGF β mediated downregulation of ER α protein
levels resulted in a decrease in ER α transcriptional activity.
Although it has not been investigated further, a single 24h treatment of C2C12 cells
with BMP 2 also decreased ER α protein amounts, independent of the differentiation
status of the cells. It is appealing to postulate that downregulation of ER α by BMP2
involves a mechanism similar to that of TGF β. TGF β and BMP2 belong to the same
cytokine family and upon binding to their receptors activate common intracellular
effectors (Shi et al., 2003). Interestingly, although they have antagonistic effects on
osteoblasts, BMP2 and TGF β both up-regulate Cbfa1 expression in C2C12 cells (Lee
et al., 2000;Spinella-Jaegle et al., 2001;Lee et al., 2002). It is therefore possible that
TGF β and BMP2 regulate ER α expression in osteoblasts through a common
mechanism. It would be interesting to determine if this observation can be extended to
other cell types in which ER α expression is pathological and to further characterize
the mechanism(s) involved in ER α down-regulation.
Chronic TGF β and BMP-2 treatments did not however affect ER α expression.
Although it has never been reported in osteoblasts, it is known from other cell types
that activation of the TGF β receptors results in ligand-mediated receptor inactivation.
This is achieved either through proteasomal degradation of the receptor or of its
downstream effectors (Shi et al., 2003). In 2T3 cells or C2C12 cells, chronic
treatment with TGF β or BMP 2 would inactivate cognate signalling and as a result
down-regulation of ER α would no longer occur.
104
7. Human ER alpha referenced as wild type contains the
G400V mutation
The human ER α cDNA was isolated from a cDNA library of the human breast
carcinoma cell line MCF7 (Walter et al., 1985). In 1986, the sequence of the newly
cloned human ER α cDNA was published by two different laboratories (Green et al.,
1986;Greene et al., 1986). Three years later however, it was reported that the original
cDNA cloned contained the mutation G400V that renders the receptor less sensitive to
estrogens (Tora et al., 1989a). Since then however, the most cited cDNA sequence for
hER α still corresponds to the mutated receptor hER α G400V that was initially
cloned (Green et al., 1986;Tora et al., 1989a). Unfortunately, the hER α G400V
sequence also refers to the WT protein sequence in the NCBI database (reference
number NP_000116). Conversely, the WT protein sequence in the NCBI database
refers to the mutated receptor.
In the course of this study, when we realized that mER α displayed such activity in
osteoblasts without additional ligand, we compared the transcriptional output of mER
α with that of hER α in transient transfections. We used what we thought was the WT
hER α that was obtained by previous lab members from the Chambon laboratory. As a
result, hER α did not display any residual activity when no ligand was added (figure
22). We therefore thought that the mER α and hER α had a different ability to convey
ligand-independent activity and decided to investigate further the molecular basis of
this difference.
Chimeras between hER α and mER α were constructed and the determinant of the
ligand-independent activity was found to be entirely localized to a discreet region of
domain E (figure 20). The mouse and human receptors differed in four amino acids in
105
this region when comparing the two WT sequences (figure 21A). However, single and
compound mutations of the four divergent amino acids into their mouse or human
counterparts failed to affect the activity of the receptor in the absence of ligand (figure
21B). Upon comparing the translation of the cDNA sequences we realized that what
we thought to be hER α WT was in fact hER α G400V. G400 is indeed contained in
the region where the divergent “ligand-independent activity” was localized.
Eventually, the comparison of WT mER α and WT hER α revealed an identical
behaviour as far as transcriptional activation is concerned.
It is troublesome that so many laboratories that claim to be using WT hER α refer in
their published work to a mutated sequence. This might come from sheer carelessness
as most labs might genuinely be working with a WT receptor. It is however also
possible that some labs like ours used hER α G400V without being aware of it.
106
Materials and Methods
107
Constructs
The ERE-tk-luciferase was a gift from Dr. Paul Webb (Webb et al., 1992). The
Renilla expression vector was obtained from Dr. Hentze and contains the Renilla
luciferase coding sequence cloned between the SmaI and BamHI site of pSG5. hERα
(HEG0) and hER α G400V (HE0) were a kind gift of Prof. Chambon (Tora et al.,
1989a). The pGL3-PS2 construct has been described before (Metivier et al., 2002b).
mERα (pMOR) was a kind gift of Dr MG Parker (Fawell et al., 1990) and was
subcloned into the EcoRI and BamHI sites of pSG5 using the following primers:
mERforEcoRI: 5’TCGAATTCATATGACCATGACCCTTCACACC3’
mERrevBamHI: 5’ . 5’ CCGGATCCTCAGATCGTGTTGGGGAAGCCC 3’
The resulting construct was used as a template to generate all other construct
involving mouse ER α.
Truncation mutants:
These mutants were generated by PCR amplification using primers inside the coding
sequence of either hER α or mER α. The primers contained adapters that allowed
subcloning into the EcoRI and BamHI sites of pSG5. The primers used for each
construct were as follows.
mER α deltaA:
mERalphab-ffor: 5’ TCGAATTCTCCACCATGCTGGGCGAGGTATACGTG 3’
mERrevbam: 5’ CCGGATCCTCAGATCGTGTTGGGGAAGCCC 3’
hER alpha deltaA:
Obtained from Dr. Metivier (Metivier et al., 2000)
mER alpha deltaF:
mERforEcoRI: 5’CGAATTCATATGACCCTTCACACCAAAGCC 3’
108
mERDeltaFrev: 5’GGATCCTCAGGCATGAAGGCGGTGGGCATCC 3’
hERdeltaF:
hERforEcoRI: 5’ TCGAATTCATATGACCATGACCCTCCACACC 3’
hERDeltaFrev: 5’GGATCCTCACGCATGTAGGCGGTGGGCGTCC3’
mER alpha C-F:
EX2-atg: 5’ TCGAATTCATGATCATGGAGTCTGCCAAG 3’
mERrevbam: 5’ CCGGATCCTCAGATCGTGTTGGGGAAGCCC 3’
hER alpha C-F:
Obtained from Dr. Metivier (Metivier et al., 2000)
HA-tagged mER α
A 5’ or 3’ primer coding for the HA epitope was used to amplify the entire mER α.
The resulting product was cloned into the EcoRI and BamHI sites of pSG5. The
primers used are:
mERHANterm:
5’CCGAATTCCCACCATGTACCCATACGACGTCCCAGACTACGCTATGACC
ATGACCCTTCACACCAAAGC 3’
mERHACterm:
5’CGCGGATCCTCAAGCGTAGTCTGGGACGTCGTAGGGTAGATCGTGTTGG
GGAAGCCCTCTGC 3’
all the constructs generated were sequence validated.
109
Site directed mutagenesis
Site directed mutagenesis was performed according to the procedure described in the
QuickChange Site-directed Mutagenesis Kit (Stratagene). The primers used to
generate the different point mutants are listed below:
mERαN375T
mERN375Tfor: 5’ TTGGGGACTTGACTCTTCATGATCAGGTCC 3’
mERN375Trev: 5’TGGACCTGATCATGAAGAGTCAAGTCCCC 3’
mERαG372V
mERG372Vfor: 5’ AGGCTTTGTCGACTTGAATCTCCATGATCAG 3’
mERG372Vrev: 5’ TCATGGAGATTCAAGTCGACAAAGCCTGGC 3’
mERαG372VN375T
mERG372VN375Tfor: 5’ AGGCTTTGTCGACTTGACTCTCCATGATCAG 3’
mERG372VN375Trev: 5’ TCATGGAGAGTCAAGTCGACAAAGCCTGGC 3’
hERαV368G
hERV368Gfor: 5’ AGGCTTTGGAGATCTGACCCTCCATGATC 3’
hERV368Grev: 5’ TCATGGAGGGTCAGATCTCCAAAGCCTGGC 3’
hERαT371N
hERT371Nfor: 5’ AGGCTTTGTGGATTTAAACCTCCATGATC 3’
hERT371Nrev: 5’ TCATGGAGGTTTAAATCCACAAAGCCTGGC 3’
hERαV368GT371N
hERV368GT371Nfor: 5’ AGGCTTTGGGGATTTAAACCTCCATGATC 3’
hERV368GT371Nrev: 5’ TCATGGAGGTTTAAATCCCCAAAGCCTGGC 3’
mERαR507Q
110
mERR507Qfor: 5’ AGCAGCATCGCCAGCTGGCTCAGCTCCTTC 3’
mERR507Qrev: 5’ CCGGAATTCTCAGATCGTGTTGGGGAAGCCC 3’
mERαN531S
mERN531Sfor: 5’ ATGGAGCATCTGTACAGCATGAAATGCAAG 3’
mERN531Srev: 5’ TGCATTTCATGCTGTACAGATGCTCCATGCC 3’
hERαR503Q
hERR503Qfor: 5’ TGCAGCAGCAGCACCGCCGGCTGGCCCAGC 3’
hERR503Qrev: 5’ TGGGCCAGCCGGCGGTGCTGCTGCTGCAGG 3’
hERαS527N
hERS527Nfor: 5’ ATGGAGCATCTTTATAACATGAAGTGCAAG 3’
hERS527Nrev: 5’ TTGCACTTCATGTTATAAAGATGCTCCATG 3’
Cell culture
HeLa, MDA-MB231, HepG2, and NIH 3T3 cells were maintained in DMEM
supplemented with 10% FCS and 100 U/ml penicillin and 100 µg/ml streptomycin
(Invitrogen) and glutamine (2 mM, Invitrogen) at 37ºC in a 5% CO2 incubator. The
2T3 cell line was isolated and cloned from a transgenic mouse containing BMP-2
promoter driving the SV-40 T antigen transgene and has been characterized
previously (Ghosh-Choudhury et al., 1996). 2T3 cells were routinely maintained in αMEM supplemented with 10% FCS supplemented with antibiotics and glutamine
never allowed to reach confluence. There differentiation status as assessed by their
ALP expression was always determined prior to analysis.
For analysis either by reporter assay or western blot, cells were plated at a density of
1600 cells/cm2 for 2T3 cells, 5,000 cells/cm2 for primary calvarial osteoblasts, 8,000
cells/cm2 for C2C12 cells, For cells that needed to be kept in culture beyond
111
confluence medium was changed every other day. Two days before analysis, cells
were washed twice in PBS and medium was changed to phenol red free medium
supplemented with 2.5% FCS and 100 U/ml penicillin and 100 µg/ml streptomycin
(Invitrogen).
Isolation of primary osteoblasts
Skulls were dissected from 4-6 day-old mice aseptically and placed in 10 ml per skull
HBSS with pencillin (100 U/ml; Invitrogen) and streptomycin (100 µg/ml;
Invitrogen). The skulls were cleaned from surrounding tissues in a tissue culture hood.
Two skulls were placed in 5ml of 0.01% trypsin (Invitrogen), 0.1mM EDTA (4ml of
gibco trypsin in 100ml HBSS) and 0.5 mg/ml collagenase P (Roche) and icubated at
37 ºC for 10 min on a rotary shaker. The skulls were thouroughly vortexed and the
supernatant discarded. The skulls were incubated for 10 min in 5 ml of the
aforementioned trypsin/collagenase mix and this for another 4 cycles. Supernatants
from the 4 cycles were pooled into to a 50 ml tube containing 10-15ml of α-MEM
supplemented with 10% FCS (Invitrogen), 100 U/ml penicillin and 100 µg/ml
streptomycin (Invitrogen). At the end of the 4 cycles the digested cells were spun
down at 400xg and resuspended in 2 ml of FCS. The number of cells was counted
using a hemocytometer and diluted to a concentration of 15,000 cells/cm2 and plated
in an appropriate culture dish. Once the cells reached confluency they were frozen in
FCS/10%DMSO. Primary osteoblast were thawed and amplified. Primary osteoblast
were then only passaged once more. The differentiation potential and the purity of the
cultures were always assessed by staining the cells for ALP expression.
112
Assessment of cell number
Cell number was determined in triplicate wells at various time points. The cell layer
was washed with PBS, and the cells were then incubated with 0.1-0.5 ml of 0.05%
trypsin-25 mM EDTA (Gibco) at 37ºC for 10-40 min (until the cells in the wells
visibly rounded up). An equal volume of FCS was then added and the cells were then
dispersed to a single cell suspension with 25 up/down strokes using a 1 ml automatic
pipetting device. Cell number was determined using a hemocytometer.
Protein isolation and western blot analysis
Cells were washed once in PBS and scraped into 1 ml of ice-cold PBS. Cells were
peleted at 400xg for 4 min at 4ºC. 2T3 cells and primary osteoblasts were grown in
duplicates and cell number was assessed in the duplicate culture as mentioned above.
The supernatant was carefully removed and the cells pellet was resuspended in 30
ul/600,000cells of RIPA buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% NP40,
0.5% Na-Deoxycholate, 0.1% SDS) with the protease inhibitor cocktail Complete
Mini (Roche). Cells were allowed to lyse at 4ºC for 30 min and spun at 14,000 rpm
for 15 min on a tabletop centrifuge at 4ºC. The supernatant was used immediately or
frozen at -70ºC for later use. Proteins amount were quantified by Bradford assay
(BioRad). Isolated uteri from 6 week-old female mice frozen in liquid N2 and kept at 70ºC before use. Protein from uteri wAS then powdered in liquid nitrogen using
pestle and mortar. The powdered tissue was transferred into RIPA buffer and the
samples were processed as described for cultured cells.
Aliquots of 100 µg protein were resolved on a 10% SDS-PAGE gel alongside the
rainbow protein marker (Invitrogen). To separate the doublet of ER α, the gels were
run for 24h before blotting, for standard western blot analyses, gel were run over
113
shorter time periods. Proteins were transferred on PVDF membranes (Millipore)
overnight at 50V.
Membranes were blocked in 5% milk PBS-T (PBS and 0.05% Tween 20, Sigma) for
20 min. Following blocking membranes were incubated with primary antibodies in
5% milk PBS-T. The primary antibodies used in this study and the concentrations
used were as follows: MC-20 (1:2000, Santa Cruz), H-184 (1:2000, Santa Cruz),
mouse monoclonal anti β-Actin (1:5000, Sigma), H-11 (1:2000, Santacruz). After 14h incubation the primary antibodies were removed and the membrane washed three
times with PBS-T. Secondary antibodies in 5% milk PBS-T were added to the
membrane for 1.5h. The horse-radish peroxidase conjugates were purchased from
DiaNova.
Transfections
Subconfluent and confluent cells were transfected with Fugene 6 reagent according to
the manufacturer’s instructions (Roche). If cells were to be used for western analysis,
they were grown in 6-well plates (Nunc). Cells used for luciferase assays were grown
in 24-well plates (Nunc). Transfections were performed as follows. 20 min before
transfections cells were washed twice in PBS and growth medium was changed to
phenol red free medium with 2.5% FCS and antibiotics. Cells were placed back in the
incubator and the transfection mix prepared. 0.3 ug/well was transfected in 24-well
plates while 1.5 µg/well was transfected in 6-well plates. The ratio µg DNA/ µl
Fugene 6 was kept at 1:6 and the ratio Fugene 6/ serum free medium at 1:35. For
luciferase assays the ratio of the different plasmids were: Estrogen receptor construct
or empty vector: ERE-tk-luciferase: renilla, 1:50:0.06. For westerns, ERE-luciferase
and renilla were replaced by empty vector.
114
On the following day medium was replaced for fresh phenol red free medium with
2.5% FCS containing the appropriate concentrations of erthanol vehicle estradiol
(Sigma), ICI 182,780 (?). MG132 (Sigma) was added concomitantly.
Luciferase assay
Cultured cells were washed twice in PBS. Apart from subconfluent 2T3 cells which
were lysed in 80 µl active lysis buffer (Roche), other cells were lysed in 100 µl of
lysis buffer. Cells were allowed to lyse at room temperature for 3h in the case of 2T3
cells and for 1h for every other cell line. 10 µl of each lysate was used in the Dual
Luciferase assay (Promega) with 10s emission measurements and 2s delays after the
injection of 50 µl luciferase assay reagent and injection of 50 µl Stop&Glow reagent.
Measurement was performed in 96-well micrplates (nunc) using the EG&G Berthold
Microplate Luminometer LB 96V.
RNA and DNA isolation
Uteri from 6-week old female mice were frozen in liquid N2 and kept at –70ºC until
use. Uteri were ground with pestle and mortar in liquid N2 and the powdered tissue
was transferred into TRIzol (Invitrogen). The RNA and DNA isolation procedure
were performed as recommended by the manufacturer. DNA was resuspended in
water and concentration was determined by the absorbance at 260 nm. RNA was
resuspended in water and kept at -70ºC until it was used. Concentration was
determined by absorbance at 260 nm and quality of the RNA was assessed by agarose
gel electrophoresis.
115
Β-galactosidase reporter gene assay
Primary osteoblasts from the ERE-tk-bet-Galactosidase ERIN mice (Nagel et al.,
2001) were isolated as described above. The detection of β-galactosidase was
performed with the Galacto-starTM chemiluminescent reporter gene assay (Tropix).
Cells were plated in 6-well plates. Subconfluent cells were used the day after for the
assay while cells were kept up to 5 days after confluency was reached for
differentiated cells. Cells were rinsed once with PBS and subsequently scraped into
100 µl of lysis buffer for subconfluent cells or 500 µl for confluent cells and cells
were incubated at room temperature for 10 min. 10 ul of each lysates were transferred
into 96-well microplates (nunc) and measurement was performed after addition of 100
µl of substrate with a EG&G Berthold Microplate Luminometer LB 96V for 10 sec.
Osteogenic differentiation of 2T3 and primary calvarial
osteoblasts
2T3 cells and primary calvarial osteoblasts were plated at 1600 cells/cm2 and 5,000
cells/cm2 respectively in α-MEM supplemented with 10% FCS supplemented with
antibiotics and glutamine. For cells with an undifferentiated phenotype, cells were
washed twice with PBS and the medium was changed the day after to phenol red free
medium with 2.5% charcoal-stripped FCS, antibiotics and glutamine. Two days
afterwards the cells were still subconfluent and undifferentiated as assessed by their
ALP negative phenotype. For differentiation, cells were kept in 10% α-MEM until 2
days prior to analysis when the medium was switched to phenol red free medium with
2.5% charcoal-stripped FCS. Differentiation was assessed by ALP staining.
TGF β
116
Differentiation of C2C12 cells
C2C12 cells were plated at 8,000 cells/cm2 in DMEM with 10% FCS, antibiotics and
glutamine. Cells reached confluence two days afterwards. The medium was then
changed to DMEM with 5% FCS. Cells spontaneously differentiated into
multinucleated myoblasts as soon as three days after confluency was reached under
these conditions. To induce osteogenic differentiation, BMP2 (300 ng/ml, Genetics
institute) was added on the day confluency was reached and thereafter every other
day. Osteogenic differentiation was assessed by ALP staining.
Alkaline phosphatase assay
Cells were plated at the appropriate density in 24-well plates (Nunc). The Alkaline
Phosphatase detection kit was used and performed according to the manufacturer’s
instructions (Sigma-diagnostics). Cells were washed twice in PBS directly in the 24well plates and fixed in 1ml of fixing solution. Cells were then washed twice in water
and incubated with 1ml of substrate solution for 15 min at room temperature in the
dark. Following staining, the cells were washed twice with water and air-dried.
Mineralized Bone Matrix Formation Assay
Bone cell differentiation was monitored using a mineralized matrix formation assay as
described previously (Chen et al., 1998).Von Kossa stain of mineralized bone matrix
was performed as follows. The cell cultures were washed with PBS twice, fixed in
phosphate-buffered formalin for 10 min and then washed with water, and serially
dehydrated in 70, 95, and 100% ethanol, twice each, and then air dried. The plates
were rehydrated from 100 to 95 to 80% ethanol/water before staining. The water was
removed, a 2% silver nitrate (Sigma) solution was added, and then the plates were
117
exposed to sunlight for 20 min after which the plates were rinsed with water. 5%
sodium thiosulfate (Sigma) was added for 3 min and the plates were then rinsed with
water. The modified van Gieson stain was then used as a counterstain after the von
Kossa stain. The unmineralized collagen matrix can be recognized by the yellow-red
van Gieson stain. The acid fuchsin solution (5 parts of 1% acid fuchsin (Sigma), 95
parts of picric acid (Sigma), and 0.25 part of 12 M HCl) was added for 5 min. The
plates were washed with water and then with 2× 95% ethanol, 2× 100% ethanol and
then air dried.
Quantitative RT-PCR
RNA were prepared form sampled cells by the TriZol Reagent (Invitrogen). Reversetranscription using poly-dT oligos (Roche) was then performed on 8 µg RNA treated
with DNAse (Roche). The 5’ to 3’ sequences of the primers used in the PCR (MWG
GmbH) were:
GAPDH:
GAPDHup 5' GAGGCCGCCGCACGACAACCGCA 3'
GAPDHdown 5' ACGGTGGGGAAGACTGTCCTGCCTG 3'
mER α:
ex5-1u: 5’ AGTGTGCCTGGCGGAGATTCTGATGATTG
ex6-1: 5’ AGATCTCCACCATGCCTTCCACAC 3’
Quantitative PCR were performed using SybrGreen (Molecular Probes) as marker for
DNA amplification on a SmartCycler (Eurogentec) with 40 cycles. Detectable
amplification of specific products arose between 13 to 28 cycles.
118
References
119
Agalioti,T., Chen,G., and Thanos,D. (2002). Deciphering the transcriptional
histone acetylation code for a human gene. Cell, 111, 381-392.
Akune,T., Ohba,S., Kamekura,S., Yamaguchi,M., Chung,U.I., Kubota,N.,
Terauchi,Y., Harada,Y., Azuma,Y., Nakamura,K., Kadowaki,T., and
Kawaguchi,H. (2004). PPARgamma insufficiency enhances osteogenesis through
osteoblast formation from bone marrow progenitors. J. Clin. Invest, 113, 846855.
Alarid,E.T., Bakopoulos,N., and Solodin,N. (1999). Proteasome-mediated
proteolysis of estrogen receptor: a novel component in autologous downregulation. Mol. Endocrinol., 13, 1522-1534.
Ali,S., Metzger,D., Bornert,J.M., and Chambon,P. (1993). Modulation of
transcriptional activation by ligand-dependent phosphorylation of the human
oestrogen receptor A/B region. EMBO J., 12, 1153-1160.
Allen,E. and doisy,E. (1923). An ovarian hormone: Preliminary reports on its
localization, extraction and partial purification and action in test animals.
JAMA, 81, 810-821.
Alliston,T., Choy,L., Ducy,P., Karsenty,G., and Derynck,R. (2001). TGF-betainduced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin
expression and inhibits osteoblast differentiation. EMBO J., 20, 2254-2272.
Arnold,S.F., Melamed,M., Vorojeikina,D.P., Notides,A.C., and Sasson,S. (1997).
Estradiol-binding mechanism and binding capacity of the human estrogen
receptor is regulated by tyrosine phosphorylation. Mol. Endocrinol., 11, 48-53.
Arnold,S.F., Obourn,J.D., Jaffe,H., and Notides,A.C. (1995). Phosphorylation of
the human estrogen receptor on tyrosine 537 in vivo and by src family tyrosine
kinases in vitro. Mol. Endocrinol., 9, 24-33.
Aronow,M.A., Gerstenfeld,L.C., Owen,T.A., Tassinari,M.S., Stein,G.S., and
Lian,J.B. (1990). Factors that promote progressive development of the osteoblast
phenotype in cultured fetal rat calvaria cells. J. Cell Physiol, 143, 213-221.
Arts,J., Kuiper,G.G., Janssen,J.M., Gustafsson,J.A., Lowik,C.W., Pols,H.A., and
van Leeuwen,J.P. (1997). Differential expression of estrogen receptors alpha and
beta mRNA during differentiation of human osteoblast SV-HFO cells.
Endocrinology, 138, 5067-5070.
Baek,S.H. and Rosenfeld,M.G. (2004). Nuclear receptor coregulators: their
modification codes and regulatory mechanism by translocation. Biochem.
Biophys. Res. Commun., 319, 707-714.
Bai,W., Rowan,B.G., Allgood,V.E., O'Malley,B.W., and Weigel,N.L. (1997).
Differential phosphorylation of chicken progesterone receptor in hormonedependent and ligand-independent activation. J. Biol. Chem., 272, 10457-10463.
120
Balasenthil,S., Barnes,C.J., Rayala,S.K., and Kumar,R. (2004). Estrogen
receptor activation at serine 305 is sufficient to upregulate cyclin D1 in breast
cancer cells. FEBS Lett., 567, 243-247.
Barraille,P., Chinestra,P., Bayard,F., and Faye,J.C. (1999). Alternative initiation
of translation accounts for a 67/45 kDa dimorphism of the human estrogen
receptor ERalpha. Biochem. Biophys. Res. Commun., 257, 84-88.
Bastien,J. and Rochette-Egly,C. (2004). Nuclear retinoid receptors and the
transcription of retinoid-target genes. Gene, 328, 1-16.
Bauer,U.M., Daujat,S., Nielsen,S.J., Nightingale,K., and Kouzarides,T. (2002).
Methylation at arginine 17 of histone H3 is linked to gene activation. EMBO
Rep., 3, 39-44.
Berry,M., Metzger,D., and Chambon,P. (1990). Role of the two activating
domains of the oestrogen receptor in the cell-type and promoter-context
dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J.,
9, 2811-2818.
Berry,M., Nunez,A.M., and Chambon,P. (1989). Estrogen-responsive element of
the human pS2 gene is an imperfectly palindromic sequence. Proc. Natl. Acad.
Sci. U. S. A, 86, 1218-1222.
Blanco,J.C., Minucci,S., Lu,J., Yang,X.J., Walker,K.K., Chen,H., Evans,R.M.,
Nakatani,Y., and Ozato,K. (1998). The histone acetylase PCAF is a nuclear
receptor coactivator. Genes Dev., 12, 1638-1651.
Blanquart,C., Mansouri,R., Fruchart,J.C., Staels,B., and Glineur,C. (2004).
Different ways to regulate the PPARalpha stability. Biochem. Biophys. Res
Commun., 319, 663-670.
Bocquel,M.T., Kumar,V., Stricker,C., Chambon,P., and Gronemeyer,H. (1989).
The contribution of the N- and C-terminal regions of steroid receptors to
activation of transcription is both receptor and cell-specific. Nucleic Acids Res.,
17, 2581-2595.
Bodine,P.V., Henderson,R.A., Green,J., Aronow,M., Owen,T., Stein,G.S.,
Lian,J.B., and Komm,B.S. (1998). Estrogen receptor-alpha is developmentally
regulated during osteoblast differentiation and contributes to selective
responsiveness of gene expression. Endocrinology, 139, 2048-2057.
Bonnelye,E. and Aubin,J.E. (2002). Differential expression of estrogen receptorrelated receptor alpha and estrogen receptors alpha and beta in osteoblasts in
vivo and in vitro. J. Bone Miner. Res., 17, 1392-1400.
Bonnelye,E., Merdad,L., Kung,V., and Aubin,J.E. (2001). The orphan nuclear
estrogen receptor-related receptor alpha (ERRalpha) is expressed throughout
osteoblast differentiation and regulates bone formation in vitro. J. Cell Biol., 153,
971-984.
121
Brand,H., Kos,M., Denger,S., Flouriot,G., Gromoll,J., Gannon,F., and Reid,G.
(2002). A novel promoter is involved in the expression of estrogen receptor alpha
in human testis and epididymis. Endocrinology, 143, 3397-3404.
Brzozowski,A.M., Pike,A.C., Dauter,Z., Hubbard,R.E., Bonn,T., Engstrom,O.,
Ohman,L., Greene,G.L., Gustafsson,J.A., and Carlquist,M. (1997). Molecular
basis of agonism and antagonism in the oestrogen receptor. Nature, 389, 753-758.
Bunone,G., Briand,P.A., Miksicek,R.J., and Picard,D. (1996). Activation of the
unliganded estrogen receptor by EGF involves the MAP kinase pathway and
direct phosphorylation. EMBO J., 15, 2174-2183.
Canalis,E. and Raisz,L.G. (1978). Effect of sex steroids on bone collagen
synthesis in vitro. Calcif. Tissue Res, 25, 105-110.
Castoria,G., Barone,M.V., Di Domenico,M., Bilancio,A., Ametrano,D.,
Migliaccio,A., and Auricchio,F. (1999). Non-transcriptional action of oestradiol
and progestin triggers DNA synthesis. EMBO J., 18, 2500-2510.
Cavailles,V., Dauvois,S., Danielian,P.S., and Parker,M.G. (1994). Interaction of
proteins with transcriptionally active estrogen receptors. Proc. Natl. Acad. Sci. U.
S. A, 91, 10009-10013.
Cavailles,V., Dauvois,S., L'Horset,F., Lopez,G., Hoare,S., Kushner,P.J., and
Parker,M.G. (1995). Nuclear factor RIP140 modulates transcriptional activation
by the estrogen receptor. EMBO J., 14, 3741-3751.
Centrella,M., Horowitz,M.C., Wozney,J.M., and McCarthy,T.L. (1994).
Transforming growth factor-beta gene family members and bone. Endocr. Rev.,
15, 27-39.
Chen,D., Ji,X., Harris,M.A., Feng,J.Q., Karsenty,G., Celeste,A.J., Rosen,V.,
Mundy,G.R., and Harris,S.E. (1998). Differential roles for bone morphogenetic
protein (BMP) receptor type IB and IA in differentiation and specification of
mesenchymal precursor cells to osteoblast and adipocyte lineages. J. Cell Biol.,
142, 295-305.
Chen,D., Pace,P.E., Coombes,R.C., and Ali,S. (1999). Phosphorylation of human
estrogen receptor alpha by protein kinase A regulates dimerization. Mol. Cell
Biol., 19, 1002-1015.
Choy,L., Skillington,J., and Derynck,R. (2000). Roles of autocrine TGF-beta
receptor and Smad signaling in adipocyte differentiation. J. Cell Biol., 149, 667682.
Ciana,P., Di Luccio,G., Belcredito,S., Pollio,G., Vegeto,E., Tatangelo,L.,
Tiveron,C., and Maggi,A. (2001). Engineering of a mouse for the in vivo profiling
of estrogen receptor activity. Mol. Endocrinol., 15, 1104-1113.
Ciana,P., Raviscioni,M., Mussi,P., Vegeto,E., Que,I., Parker,M.G., Lowik,C., and
Maggi,A. (2003). In vivo imaging of transcriptionally active estrogen receptors.
Nat. Med., 9, 82-86.
122
Ciechanover,A., Finley,D., and Varshavsky,A. (1984). Ubiquitin dependence of
selective protein degradation demonstrated in the mammalian cell cycle mutant
ts85. Cell, 37, 57-66.
Clement-Lacroix,P., Ormandy,C., Lepescheux,L., Ammann,P., Damotte,D.,
Goffin,V., Bouchard,B., Amling,M., Gaillard-Kelly,M., Binart,N., Baron,R., and
Kelly,P.A. (1999). Osteoblasts are a new target for prolactin: analysis of bone
formation in prolactin receptor knockout mice. Endocrinology, 140, 96-105.
Couse,J.F., Lindzey,J., Grandien,K., Gustafsson,J.A., and Korach,K.S. (1997).
Tissue distribution and quantitative analysis of estrogen receptor-alpha
(ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in
the wild-type and ERalpha-knockout mouse. Endocrinology, 138, 4613-4621.
Curtis,S.W., Washburn,T., Sewall,C., DiAugustine,R., Lindzey,J., Couse,J.F.,
and Korach,K.S. (1996). Physiological coupling of growth factor and steroid
receptor signaling pathways: estrogen receptor knockout mice lack estrogen-like
response to epidermal growth factor. Proc. Natl. Acad. Sci. U. S. A, 93, 1262612630.
Damien,E., Price,J.S., and Lanyon,L.E. (2000). Mechanical strain stimulates
osteoblast proliferation through the estrogen receptor in males as well as
females. J. Bone Miner. Res, 15, 2169-2177.
Dang,Z.C., van Bezooijen,R.L., Karperien,M., Papapoulos,S.E., and Lowik,C.W.
(2002). Exposure of KS483 cells to estrogen enhances osteogenesis and inhibits
adipogenesis. J. Bone Miner. Res, 17, 394-405.
Dauvois,S., Danielian,P.S., White,R., and Parker,M.G. (1992). Antiestrogen ICI
164,384 reduces cellular estrogen receptor content by increasing its turnover.
Proc. Natl. Acad. Sci. U. S. A, 89, 4037-4041.
Davis,V.L., Couse,J.F., Gray,T.K., and Korach,K.S. (1994). Correlation between
low levels of estrogen receptors and estrogen responsiveness in two rat
osteoblast-like cell lines. J. Bone Miner. Res., 9, 983-991.
Deblois,G. and Giguere,V. (2003). Ligand-independent coactivation of ERalpha
AF-1 by steroid receptor RNA activator (SRA) via MAPK activation. J. Steroid
Biochem. Mol. Biol., 85, 123-131.
Denger,S., Reid,G., Kos,M., Flouriot,G., Parsch,D., Brand,H., Korach,K.S.,
Sonntag-Buck,V., and Gannon,F. (2001). ERalpha gene expression in human
primary osteoblasts: evidence for the expression of two receptor proteins. Mol.
Endocrinol., 15, 2064-2077.
Donaghue,C., Westley,B.R., and May,F.E. (1999). Selective promoter usage of
the human estrogen receptor-alpha gene and its regulation by estrogen. Mol.
Endocrinol., 13, 1934-1950.
Dornan,D., Wertz,I., Shimizu,H., Arnott,D., Frantz,G.D., Dowd,P., O'Rourke,K.,
Koeppen,H., and Dixit,V.M. (2004). The ubiquitin ligase COP1 is a critical
negative regulator of p53. Nature, 429, 86-92.
123
Ducy,P., Zhang,R., Geoffroy,V., Ridall,A.L., and Karsenty,G. (1997).
Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell, 89,
747-754.
Dupont,S., Krust,A., Gansmuller,A., Dierich,A., Chambon,P., and Mark,M.
(2000). Effect of single and compound knockouts of estrogen receptors alpha
(ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development,
127, 4277-4291.
Dutertre,M. and Smith,C.L. (2003c). Ligand-independent interactions of
p160/steroid receptor coactivators and CREB-binding protein (CBP) with
estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region
depends on other receptor domains. Mol. Endocrinol., 17, 1296-1314.
Dutertre,M. and Smith,C.L. (2003a). Ligand-independent interactions of
p160/steroid receptor coactivators and CREB-binding protein (CBP) with
estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region
depends on other receptor domains. Mol. Endocrinol., 17, 1296-1314.
Dutertre,M. and Smith,C.L. (2003b). Ligand-independent interactions of
p160/steroid receptor coactivators and CREB-binding protein (CBP) with
estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region
depends on other receptor domains. Mol. Endocrinol., 17, 1296-1314.
El Khissiin,A. and Leclercq,G. (1999). Implication of proteasome in estrogen
receptor degradation. FEBS Lett., 448, 160-166.
el Tanani,M.K. and Green,C.D. (1997). Two separate mechanisms for ligandindependent activation of the estrogen receptor. Mol. Endocrinol., 11, 928-937.
Endoh,H., Maruyama,K., Masuhiro,Y., Kobayashi,Y., Goto,M., Tai,H.,
Yanagisawa,J., Metzger,D., Hashimoto,S., and Kato,S. (1999). Purification and
identification of p68 RNA helicase acting as a transcriptional coactivator specific
for the activation function 1 of human estrogen receptor alpha. Mol. Cell Biol.,
19, 5363-5372.
Eriksen,E.F., Colvard,D.S., Berg,N.J., Graham,M.L., Mann,K.G.,
Spelsberg,T.C., and Riggs,B.L. (1988). Evidence of estrogen receptors in normal
human osteoblast-like cells. Science, 241, 84-86.
Ernst,M., Parker,M.G., and Rodan,G.A. (1991). Functional estrogen receptors in
osteoblastic cells demonstrated by transfection with a reporter gene containing
an estrogen response element. Mol. Endocrinol., 5, 1597-1606.
Evans,R.M. (1988). The steroid and thyroid hormone receptor superfamily.
Science, 240, 889-895.
Faulds,M.H., Olsen,H., Helguero,L.A., Gustafsson,J.A., and Haldosen,L.A.
(2004). Estrogen receptor functional activity changes during differentiation of
mammary epithelial cells. Mol. Endocrinol., 18, 412-421.
124
Fawell,S.E., Lees,J.A., White,R., and Parker,M.G. (1990). Characterization and
colocalization of steroid binding and dimerization activities in the mouse
estrogen receptor. Cell, 60, 953-962.
Fliss,A.E., Benzeno,S., Rao,J., and Caplan,A.J. (2000). Control of estrogen
receptor ligand binding by Hsp90. J. Steroid Biochem. Mol. Biol., 72, 223-230.
Flouriot,G., Brand,H., Denger,S., Metivier,R., Kos,M., Reid,G., SonntagBuck,V., and Gannon,F. (2000). Identification of a new isoform of the human
estrogen receptor-alpha (hER-alpha) that is encoded by distinct transcripts and
that is able to repress hER-alpha activation function 1. EMBO J., 19, 4688-4700.
Flouriot,G., Griffin,C., Kenealy,M., Sonntag-Buck,V., and Gannon,F. (1998).
Differentially expressed messenger RNA isoforms of the human estrogen
receptor-alpha gene are generated by alternative splicing and promoter usage.
Mol. Endocrinol., 12, 1939-1954.
Freedman,L.P., Yamamoto,K.R., Luisi,B.F., and Sigler,P.B. (1988). More fingers
in hand. Cell, 54, 444.
Freeman,B.C. and Yamamoto,K.R. (2002). Disassembly of transcriptional
regulatory complexes by molecular chaperones. Science, 296, 2232-2235.
Fryer,C.J. and Archer,T.K. (1998). Chromatin remodelling by the glucocorticoid
receptor requires the BRG1 complex. Nature, 393, 88-91.
Fuchs,S.Y., Tappin,I., and Ronai,Z. (2000). Stability of the ATF2 transcription
factor is regulated by phosphorylation and dephosphorylation. J. Biol. Chem.,
275, 12560-12564.
Fujita,M., Urano,T., Horie,K., Ikeda,K., Tsukui,T., Fukuoka,H., Tsutsumi,O.,
Ouchi,Y., and Inoue,S. (2002). Estrogen activates cyclin-dependent kinases 4 and
6 through induction of cyclin D in rat primary osteoblasts. Biochem. Biophys.
Res. Commun., 299, 222-228.
Fujita,T., Kobayashi,Y., Wada,O., Tateishi,Y., Kitada,L., Yamamoto,Y.,
Takashima,H., Murayama,A., Yano,T., Baba,T., Kato,S., Kawabe,Y., and
Yanagisawa,J. (2003). Full activation of estrogen receptor alpha activation
function-1 induces proliferation of breast cancer cells. J. Biol. Chem., 278, 2670426714.
Garcia,T., Roman-Roman,S., Jackson,A., Theilhaber,J., Connolly,T., SpinellaJaegle,S., Kawai,S., Courtois,B., Bushnell,S., Auberval,M., Call,K., and Baron,R.
(2002). Behavior of osteoblast, adipocyte, and myoblast markers in genome-wide
expression analysis of mouse calvaria primary osteoblasts in vitro. Bone, 31, 205211.
Gee,A.C., Carlson,K.E., Martini,P.G., Katzenellenbogen,B.S., and
Katzenellenbogen,J.A. (1999). Coactivator peptides have a differential stabilizing
effect on the binding of estrogens and antiestrogens with the estrogen receptor.
Mol. Endocrinol., 13, 1912-1923.
125
Germain,P., Iyer,J., Zechel,C., and Gronemeyer,H. (2002). Co-regulator
recruitment and the mechanism of retinoic acid receptor synergy. Nature, 415,
187-192.
Ghosh-Choudhury,N., Windle,J.J., Koop,B.A., Harris,M.A., Guerrero,D.L.,
Wozney,J.M., Mundy,G.R., and Harris,S.E. (1996). Immortalized murine
osteoblasts derived from BMP 2-T-antigen expressing transgenic mice.
Endocrinology, 137, 331-339.
Golding,T.S. and Korach,K.S. (1988). Nuclear estrogen receptor molecular
heterogeneity in the mouse uterus. Proc. Natl. Acad. Sci. U. S. A, 85, 69-73.
Green,S., Kumar,V., Theulaz,I., Wahli,W., and Chambon,P. (1988). The Nterminal DNA-binding 'zinc finger' of the oestrogen and glucocorticoid receptors
determines target gene specificity. EMBO J., 7, 3037-3044.
Green,S., Walter,P., Kumar,V., Krust,A., Bornert,J.M., Argos,P., and
Chambon,P. (1986). Human oestrogen receptor cDNA: sequence, expression and
homology to v- erb-A. Nature, 320, 134-139.
Greene,G.L., Gilna,P., Waterfield,M., Baker,A., Hort,Y., and Shine,J. (1986).
Sequence and expression of human estrogen receptor complementary DNA.
Science, 231, 1150-1154.
Grimaldi,C.M., Cleary,J., Dagtas,A.S., Moussai,D., and Diamond,B. (2002).
Estrogen alters thresholds for B cell apoptosis and activation. J. Clin. Invest, 109,
1625-1633.
Gruber,C.J., Tschugguel,W., Schneeberger,C., and Huber,J.C. (2002).
Production and actions of estrogens. N. Engl. J. Med., 346, 340-352.
Guo,S. and Sonenshein,G.E. (2004). Forkhead box transcription factor FOXO3a
regulates estrogen receptor alpha expression and is repressed by the Her2/neu/phosphatidylinositol 3-kinase/Akt signaling pathway. Mol. Cell Biol., 24,
8681-8690.
Halachmi,S., Marden,E., Martin,G., MacKay,H., Abbondanza,C., and Brown,M.
(1994). Estrogen receptor-associated proteins: possible mediators of hormoneinduced transcription. Science, 264, 1455-1458.
Hall,J.M., McDonnell,D.P., and Korach,K.S. (2002). Allosteric regulation of
estrogen receptor structure, function, and coactivator recruitment by different
estrogen response elements. Mol. Endocrinol., 16, 469-486.
Hatzis,P. and Talianidis,I. (2002). Dynamics of enhancer-promoter
communication during differentiation-induced gene activation. Mol. Cell, 10,
1467-1477.
Hauser,S., Adelmant,G., Sarraf,P., Wright,H.M., Mueller,E., and
Spiegelman,B.M. (2000). Degradation of the peroxisome proliferator-activated
receptor gamma is linked to ligand-dependent activation. J. Biol. Chem., 275,
18527-18533.
126
Heery,D.M., Kalkhoven,E., Hoare,S., and Parker,M.G. (1997). A signature motif
in transcriptional co-activators mediates binding to nuclear receptors. Nature,
387, 733-736.
Heinzel,T., Lavinsky,R.M., Mullen,T.M., Soderstrom,M., Laherty,C.D.,
Torchia,J., Yang,W.M., Brard,G., Ngo,S.D., Davie,J.R., Seto,E., Eisenman,R.N.,
Rose,D.W., Glass,C.K., and Rosenfeld,M.G. (1997). A complex containing NCoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature,
387, 43-48.
Henrich,L.M., Smith,J.A., Kitt,D., Errington,T.M., Nguyen,B., Traish,A.M., and
Lannigan,D.A. (2003). Extracellular signal-regulated kinase 7, a regulator of
hormone-dependent estrogen receptor destruction. Mol. Cell Biol., 23, 5979-5988.
Herdick,M. and Carlberg,C. (2000). Agonist-triggered modulation of the
activated and silent state of the vitamin D(3) receptor by interaction with corepressors and co-activators. J. Mol. Biol., 304, 793-801.
Hirata,S., Shoda,T., Kato,J., and Hoshi,K. (2003). Isoform/variant mRNAs for
sex steroid hormone receptors in humans. Trends Endocrinol. Metab, 14, 124-129.
Hu,M., Krause,D., Greaves,M., Sharkis,S., Dexter,M., Heyworth,C., and
Enver,T. (1997). Multilineage gene expression precedes commitment in the
hemopoietic system. Genes Dev., 11, 774-785.
Hu,X. and Lazar,M.A. (1999). The CoRNR motif controls the recruitment of
corepressors by nuclear hormone receptors. Nature, 402, 93-96.
Hu,Y.C., Shyr,C.R., Che,W., Mu,X.M., Kim,E., and Chang,C. (2002).
Suppression of estrogen receptor-mediated transcription and cell growth by
interaction with TR2 orphan receptor. J. Biol. Chem., 277, 33571-33579.
Ignar-Trowbridge,D.M., Nelson,K.G., Bidwell,M.C., Curtis,S.W.,
Washburn,T.F., McLachlan,J.A., and Korach,K.S. (1992). Coupling of dual
signaling pathways: epidermal growth factor action involves the estrogen
receptor. Proc. Natl. Acad. Sci. U. S. A, 89, 4658-4662.
Ignar-Trowbridge,D.M., Pimentel,M., Parker,M.G., McLachlan,J.A., and
Korach,K.S. (1996). Peptide growth factor cross-talk with the estrogen receptor
requires the A/B domain and occurs independently of protein kinase C or
estradiol. Endocrinology, 137, 1735-1744.
Jakacka,M., Ito,M., Weiss,J., Chien,P.Y., Gehm,B.D., and Jameson,J.L. (2001).
Estrogen receptor binding to DNA is not required for its activity through the
nonclassical AP1 pathway. J. Biol. Chem., 276, 13615-13621.
Jensen,E.V. and DeSombre,E.R. (1972). Mechanism of action of the female sex
hormones. Annu. Rev. Biochem., 41, 203-230.
Jensen, E. and Jacobson, H. Basic guides to the mechanism of estrogen action.
Recent Prog Horm Res 18, 387-414. 1962.
Ref Type: Generic
127
Joel,P.B., Traish,A.M., and Lannigan,D.A. (1995). Estradiol and phorbol ester
cause phosphorylation of serine 118 in the human estrogen receptor. Mol.
Endocrinol., 9, 1041-1052.
Joel,P.B., Traish,A.M., and Lannigan,D.A. (1998). Estradiol-induced
phosphorylation of serine 118 in the estrogen receptor is independent of p42/p44
mitogen-activated protein kinase. J. Biol. Chem., 273, 13317-13323.
Johansson,L., Bavner,A., Thomsen,J.S., Farnegardh,M., Gustafsson,J.A., and
Treuter,E. (2000). The orphan nuclear receptor SHP utilizes conserved LXXLLrelated motifs for interactions with ligand-activated estrogen receptors. Mol. Cell
Biol., 20, 1124-1133.
Kalkhoven,E., Valentine,J.E., Heery,D.M., and Parker,M.G. (1998). Isoforms of
steroid receptor co-activator 1 differ in their ability to potentiate transcription
by the oestrogen receptor. EMBO J., 17, 232-243.
Karsenty,G. (1999). The genetic transformation of bone biology. Genes Dev., 13,
3037-3051.
Katagiri,T., Akiyama,S., Namiki,M., Komaki,M., Yamaguchi,A., Rosen,V.,
Wozney,J.M., Fujisawa-Sehara,A., and Suda,T. (1997). Bone morphogenetic
protein-2 inhibits terminal differentiation of myogenic cells by suppressing the
transcriptional activity of MyoD and myogenin. Exp. Cell Res., 230, 342-351.
Katagiri,T., Yamaguchi,A., Komaki,M., Abe,E., Takahashi,N., Ikeda,T.,
Rosen,V., Wozney,J.M., Fujisawa-Sehara,A., and Suda,T. (1994). Bone
morphogenetic protein-2 converts the differentiation pathway of C2C12
myoblasts into the osteoblast lineage. J. Cell Biol., 127, 1755-1766.
Keeting,P.E., Scott,R.E., Colvard,D.S., Han,I.K., Spelsberg,T.C., and Riggs,B.L.
(1991). Lack of a direct effect of estrogen on proliferation and differentiation of
normal human osteoblast-like cells. J. Bone Miner. Res, 6, 297-304.
Kenner,L., Hoebertz,A., Beil,T., Keon,N., Karreth,F., Eferl,R., Scheuch,H.,
Szremska,A., Amling,M., Schorpp-Kistner,M., Angel,P., and Wagner,E.F.
(2004). Mice lacking JunB are osteopenic due to cell-autonomous osteoblast and
osteoclast defects. J. Cell Biol., 164, 613-623.
Khorasanizadeh,S. (2004). The nucleosome: from genomic organization to
genomic regulation. Cell, 116, 259-272.
Kim,S., Koga,T., Isobe,M., Kern,B.E., Yokochi,T., Chin,Y.E., Karsenty,G.,
Taniguchi,T., and Takayanagi,H. (2003). Stat1 functions as a cytoplasmic
attenuator of Runx2 in the transcriptional program of osteoblast differentiation.
Genes Dev., 17, 1979-1991.
Klein-Hitpass,L., Ryffel,G.U., Heitlinger,E., and Cato,A.C. (1988). A 13 bp
palindrome is a functional estrogen responsive element and interacts specifically
with estrogen receptor. Nucleic Acids Res., 16, 647-663.
128
Klinge,C.M. (1999). Estrogen receptor binding to estrogen response elements
slows ligand dissociation and synergistically activates reporter gene expression.
Mol. Cell Endocrinol., 150, 99-111.
Klinge,C.M. (2001). Estrogen receptor interaction with estrogen response
elements. Nucleic Acids Res., 29, 2905-2919.
Klinge,C.M., Jernigan,S.C., Smith,S.L., Tyulmenkov,V.V., and Kulakosky,P.C.
(2001). Estrogen response element sequence impacts the conformation and
transcriptional activity of estrogen receptor alpha. Mol. Cell Endocrinol., 174,
151-166.
Knabbe,C., Lippman,M.E., Wakefield,L.M., Flanders,K.C., Kasid,A.,
Derynck,R., and Dickson,R.B. (1987). Evidence that transforming growth factorbeta is a hormonally regulated negative growth factor in human breast cancer
cells. Cell, 48, 417-428.
Knoblauch,R. and Garabedian,M.J. (1999). Role for Hsp90-associated
cochaperone p23 in estrogen receptor signal transduction. Mol. Cell Biol., 19,
3748-3759.
Kobayashi,Y., Kitamoto,T., Masuhiro,Y., Watanabe,M., Kase,T., Metzger,D.,
Yanagisawa,J., and Kato,S. (2000). p300 mediates functional synergism between
AF-1 and AF-2 of estrogen receptor alpha and beta by interacting directly with
the N-terminal A/B domains. J. Biol. Chem., 275, 15645-15651.
Komm,B.S., Terpening,C.M., Benz,D.J., Graeme,K.A., Gallegos,A., Korc,M.,
Greene,G.L., O'Malley,B.W., and Haussler,M.R. (1988). Estrogen binding,
receptor mRNA, and biologic response in osteoblast-like osteosarcoma cells.
Science, 241, 81-84.
Kos,M., Denger,S., Reid,G., and Gannon,F. (2002). Upstream open reading
frames regulate the translation of the multiple mRNA variants of the estrogen
receptor alpha. J. Biol. Chem., 277, 37131-37138.
Kos,M., O'Brien,S., Flouriot,G., and Gannon,F. (2000). Tissue-specific
expression of multiple mRNA variants of the mouse estrogen receptor alpha
gene. FEBS Lett., 477, 15-20.
Kos,M., Reid,G., Denger,S., and Gannon,F. (2001). Minireview: genomic
organization of the human ERalpha gene promoter region. Mol. Endocrinol., 15,
2057-2063.
Krezel,W., Dupont,S., Krust,A., Chambon,P., and Chapman,P.F. (2001).
Increased anxiety and synaptic plasticity in estrogen receptor beta -deficient
mice. Proc. Natl. Acad. Sci. U. S. A, 98, 12278-12282.
Krust,A., Green,S., Argos,P., Kumar,V., Walter,P., Bornert,J.M., and
Chambon,P. (1986). The chicken oestrogen receptor sequence: homology with verbA and the human oestrogen and glucocorticoid receptors. EMBO J., 5, 891897.
129
Kuiper,G.G., Carlsson,B., Grandien,K., Enmark,E., Haggblad,J., Nilsson,S., and
Gustafsson,J.A. (1997). Comparison of the ligand binding specificity and
transcript tissue distribution of estrogen receptors alpha and beta.
Endocrinology, 138, 863-870.
Kuiper,G.G., Enmark,E., Pelto-Huikko,M., Nilsson,S., and Gustafsson,J.A.
(1996). Cloning of a novel receptor expressed in rat prostate and ovary. Proc.
Natl. Acad. Sci. U. S. A, 93, 5925-5930.
Kumar,R., Wang,R.A., Mazumdar,A., Talukder,A.H., Mandal,M., Yang,Z.,
Bagheri-Yarmand,R., Sahin,A., Hortobagyi,G., Adam,L., Barnes,C.J., and
Vadlamudi,R.K. (2002). A naturally occurring MTA1 variant sequesters
oestrogen receptor-alpha in the cytoplasm. Nature, 418, 654-657.
Kumar,V. and Chambon,P. (1988). The estrogen receptor binds tightly to its
responsive element as a ligand-induced homodimer. Cell, 55, 145-156.
Kumar,V., Green,S., Stack,G., Berry,M., Jin,J.R., and Chambon,P. (1987).
Functional domains of the human estrogen receptor. Cell, 51, 941-951.
Lai,C.F. and Cheng,S.L. (2002). Signal transductions induced by bone
morphogenetic protein-2 and transforming growth factor-beta in normal human
osteoblastic cells. J. Biol. Chem., 277, 15514-15522.
Lannigan,D.A. (2003). Estrogen receptor phosphorylation. Steroids, 68, 1-9.
Lavinsky,R.M., Jepsen,K., Heinzel,T., Torchia,J., Mullen,T.M., Schiff,R., Del
Rio,A.L., Ricote,M., Ngo,S., Gemsch,J., Hilsenbeck,S.G., Osborne,C.K.,
Glass,C.K., Rosenfeld,M.G., and Rose,D.W. (1998). Diverse signaling pathways
modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc.
Natl. Acad. Sci. U. S. A, 95, 2920-2925.
Lee,H. and Bai,W. (2002). Regulation of estrogen receptor nuclear export by
ligand-induced and p38-mediated receptor phosphorylation. Mol. Cell Biol., 22,
5835-5845.
Lee,K.S., Hong,S.H., and Bae,S.C. (2002). Both the Smad and p38 MAPK
pathways play a crucial role in Runx2 expression following induction by
transforming growth factor-beta and bone morphogenetic protein. Oncogene, 21,
7156-7163.
Lee,K.S., Kim,H.J., Li,Q.L., Chi,X.Z., Ueta,C., Komori,T., Wozney,J.M.,
Kim,E.G., Choi,J.Y., Ryoo,H.M., and Bae,S.C. (2000). Runx2 is a common target
of transforming growth factor beta1 and bone morphogenetic protein 2, and
cooperation between Runx2 and Smad5 induces osteoblast-specific gene
expression in the pluripotent mesenchymal precursor cell line C2C12. Mol. Cell
Biol., 20, 8783-8792.
Lee,M.H., Kim,Y.J., Kim,H.J., Park,H.D., Kang,A.R., Kyung,H.M., Sung,J.H.,
Wozney,J.M., Kim,H.J., and Ryoo,H.M. (2003). BMP-2-induced Runx2
expression is mediated by Dlx5, and TGF-beta 1 opposes the BMP-2-induced
130
osteoblast differentiation by suppression of Dlx5 expression. J. Biol. Chem., 278,
34387-34394.
Lees,J.A., Fawell,S.E., White,R., and Parker,M.G. (1990). A 22-amino-acid
peptide restores DNA-binding activity to dimerization-defective mutants of the
estrogen receptor. Mol. Cell Biol., 10, 5529-5531.
Lemmen,J.G., Arends,R.J., van Boxtel,A.L., van der Saag,P.T., and van der,B.B.
(2004). Tissue- and time-dependent estrogen receptor activation in estrogen
reporter mice. J. Mol. Endocrinol., 32, 689-701.
Lemmen,J.G., Broekhof,J.L., Kuiper,G.G., Gustafsson,J.A., van der Saag,P.T.,
and van der,B.B. (1999). Expression of estrogen receptor alpha and beta during
mouse embryogenesis. Mech. Dev., 81, 163-167.
Leung,K.C., Johannsson,G., Leong,G.M., and Ho,K.K. (2004). Estrogen
regulation of growth hormone action. Endocr. Rev., 25, 693-721.
Li,B., Boast,S., de los,S.K., Schieren,I., Quiroz,M., Teitelbaum,S.L.,
Tondravi,M.M., and Goff,S.P. (2000). Mice deficient in Abl are osteoporotic and
have defects in osteoblast maturation. Nat. Genet., 24, 304-308.
Lin,H.K., Wang,L., Hu,Y.C., Altuwaijri,S., and Chang,C. (2002).
Phosphorylation-dependent ubiquitylation and degradation of androgen
receptor by Akt require Mdm2 E3 ligase. EMBO J., 21, 4037-4048.
Lindsay,R., Hart,D.M., Aitken,J.M., MacDonald,E.B., Anderson,J.B., and
Clarke,A.C. (1976). Long-term prevention of postmenopausal osteoporosis by
oestrogen. Evidence for an increased bone mass after delayed onset of oestrogen
treatment. Lancet, 1, 1038-1041.
Liu,D., Black,B.L., and Derynck,R. (2001). TGF-beta inhibits muscle
differentiation through functional repression of myogenic transcription factors
by Smad3. Genes Dev., 15, 2950-2966.
Liu,J.W. and Picard,D. (1998). Bioactive steroids as contaminants of the
common carbon source galactose. FEMS Microbiol. Lett., 159, 167-171.
Liu,X.F. and Bagchi,M.K. (2004). Recruitment of distinct chromatin-modifying
complexes by tamoxifen-complexed estrogen receptor at natural target gene
promoters in vivo. J. Biol. Chem., 279, 15050-15058.
Lonard,D.M., Nawaz,Z., Smith,C.L., and O'Malley,B.W. (2000). The 26S
proteasome is required for estrogen receptor-alpha and coactivator turnover and
for efficient estrogen receptor-alpha transactivation. Mol. Cell, 5, 939-948.
Lopez,G.N., Turck,C.W., Schaufele,F., Stallcup,M.R., and Kushner,P.J. (2001).
Growth factors signal to steroid receptors through mitogen-activated protein
kinase regulation of p160 coactivator activity. J. Biol. Chem., 276, 22177-22182.
131
Lopez,G.N., Webb,P., Shinsako,J.H., Baxter,J.D., Greene,G.L., and Kushner,P.J.
(1999). Titration by estrogen receptor activation function-2 of targets that are
downstream from coactivators. Mol. Endocrinol., 13, 897-909.
Lu,B., Dotzlaw,H., Leygue,E., Murphy,L.J., Watson,P.H., and Murphy,L.C.
(1999). Estrogen receptor-alpha mRNA variants in murine and human tissues.
Mol. Cell Endocrinol., 158, 153-161.
Mader,S., Kumar,V., de Verneuil,H., and Chambon,P. (1989). Three amino acids
of the oestrogen receptor are essential to its ability to distinguish an oestrogen
from a glucocorticoid-responsive element. Nature, 338, 271-274.
Maeda,S., Hayashi,M., Komiya,S., Imamura,T., and Miyazono,K. (2004).
Endogenous TGF-beta signaling suppresses maturation of osteoblastic
mesenchymal cells. EMBO J., 23, 552-563.
Malik,S. and Roeder,R.G. (2000). Transcriptional regulation through Mediatorlike coactivators in yeast and metazoan cells. Trends Biochem. Sci., 25, 277-283.
Manolagas,S.C. and Kousteni,S. (2001). Perspective: nonreproductive sites of
action of reproductive hormones. Endocrinology, 142, 2200-2204.
Manolagas,S.C., Kousteni,S., and Jilka,R.L. (2002). Sex steroids and bone.
Recent Prog Horm Res, 57, 385-409.
Margeat,E., Poujol,N., Boulahtouf,A., Chen,Y., Muller,J.D., Gratton,E.,
Cavailles,V., and Royer,C.A. (2001). The human estrogen receptor alpha dimer
binds a single SRC-1 coactivator molecule with an affinity dictated by agonist
structure. J. Mol. Biol., 306, 433-442.
Marsaud,V., Gougelet,A., Maillard,S., and Renoir,J.M. (2003). Various
phosphorylation pathways, depending on agonist and antagonist binding to
endogenous estrogen receptor alpha (ERalpha), differentially affect ERalpha
extractability, proteasome-mediated stability, and transcriptional activity in
human breast cancer cells. Mol. Endocrinol., 17, 2013-2027.
Masiakowski,P., Breathnach,R., Bloch,J., Gannon,F., Krust,A., and Chambon,P.
(1982). Cloning of cDNA sequences of hormone-regulated genes from the MCF-7
human breast cancer cell line. Nucleic Acids Res., 10, 7895-7903.
Mattick,S., Glenn,K., de Haan,G., and Shapiro,D.J. (1997). Analysis of ligand
dependence and hormone response element synergy in transcription by estrogen
receptor. J. Steroid Biochem. Mol. Biol., 60, 285-294.
McCarthy,T.L., Chang,W.Z., Liu,Y., and Centrella,M. (2003). Runx2 integrates
estrogen activity in osteoblasts. J. Biol. Chem., 278, 43121-43129.
McDougall,K.E., Perry,M.J., Gibson,R.L., Bright,J.M., Colley,S.M., Hodgin,J.B.,
Smithies,O., and Tobias,J.H. (2002). Estrogen-induced osteogenesis in intact
female mice lacking ERbeta. Am. J. Physiol Endocrinol. Metab, 283, E817-E823.
132
McDougall,K.E., Perry,M.J., Gibson,R.L., Colley,S.M., Korach,K.S., and
Tobias,J.H. (2003). Estrogen receptor-alpha dependency of estrogen's
stimulatory action on cancellous bone formation in male mice. Endocrinology,
144, 1994-1999.
McInerney,E.M. and Katzenellenbogen,B.S. (1996). Different regions in
activation function-1 of the human estrogen receptor required for antiestrogenand estradiol-dependent transcription activation. J. Biol. Chem., 271, 2417224178.
McKenna,N.J., Xu,J., Nawaz,Z., Tsai,S.Y., Tsai,M.J., and O'Malley,B.W. (1999).
Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple
functions. J. Steroid Biochem. Mol. Biol., 69, 3-12.
McNally,J.G., Muller,W.G., Walker,D., Wolford,R., and Hager,G.L. (2000). The
glucocorticoid receptor: rapid exchange with regulatory sites in living cells.
Science, 287, 1262-1265.
Melvin,V.S., Harrell,C., Adelman,J.S., Kraus,W.L., Churchill,M., and
Edwards,D.P. (2004). The role of the C-terminal extension (CTE) of the estrogen
receptor alpha and beta DNA binding domain in DNA binding and interaction
with HMGB. J. Biol. Chem., 279, 14763-14771.
Merot,Y., Metivier,R., Penot,G., Manu,D., Saligaut,C., Gannon,F., Pakdel,F.,
Kah,O., and Flouriot,G. (2004). The relative contribution exerted by AF-1 and
AF-2 transactivation functions in estrogen receptor alpha transcriptional activity
depends upon the differentiation stage of the cell. J. Biol. Chem., 279, 2618426191.
Metivier,R., Gay,F.A., Hubner,M.R., Flouriot,G., Salbert,G., Gannon,F., Kah,O.,
and Pakdel,F. (2002a). Formation of an hER alpha-COUP-TFI complex
enhances hER alpha AF-1 through Ser118 phosphorylation by MAPK. EMBO J.,
21, 3443-3453.
Metivier,R., Penot,G., Carmouche,R.P., Hubner,M.R., Reid,G., Denger,S.,
Manu,D., Brand,H., Kos,M., Benes,V., and Gannon,F. (2004). Transcriptional
complexes engaged by apo-estrogen receptor-alpha isoforms have divergent
outcomes. EMBO J., 23, 3653-3666.
Metivier,R., Penot,G., Hubner,M.R., Reid,G., Brand,H., Kos,M., and Gannon,F.
(2003). Estrogen Receptor-alpha Directs Ordered, Cyclical, and Combinatorial
Recruitment of Cofactors on a Natural Target Promoter. Cell, 115, 751-763.
Metivier,R., Petit,F.G., Valotaire,Y., and Pakdel,F. (2000). Function of Nterminal transactivation domain of the estrogen receptor requires a potential
alpha-helical structure and is negatively regulated by the A domain. Mol.
Endocrinol., 14, 1849-1871.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F.
(2002b). A Dynamic Structural Model for Estrogen Receptor-alpha Activation
133
by Ligands, Emphasizing the Role of Interactions between Distant A and E
Domains. Mol. Cell, 10, 1019-1032.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F.
(2002d). A dynamic structural model for estrogen receptor-alpha activation by
ligands, emphasizing the role of interactions between distant A and E domains.
Mol. Cell, 10, 1019-1032.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F.
(2002f). A dynamic structural model for estrogen receptor-alpha activation by
ligands, emphasizing the role of interactions between distant A and E domains.
Mol. Cell, 10, 1019-1032.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F.
(2002e). A dynamic structural model for estrogen receptor-alpha activation by
ligands, emphasizing the role of interactions between distant A and E domains.
Mol. Cell, 10, 1019-1032.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F.
(2002c). A dynamic structural model for estrogen receptor-alpha activation by
ligands, emphasizing the role of interactions between distant A and E domains.
Mol. Cell, 10, 1019-1032.
Metzger,D., Ali,S., Bornert,J.M., and Chambon,P. (1995). Characterization of
the amino-terminal transcriptional activation function of the human estrogen
receptor in animal and yeast cells. J. Biol. Chem., 270, 9535-9542.
Meyer,M.E., Gronemeyer,H., Turcotte,B., Bocquel,M.T., Tasset,D., and
Chambon,P. (1989). Steroid hormone receptors compete for factors that mediate
their enhancer function. Cell, 57, 433-442.
Michalides,R., Griekspoor,A., Balkenende,A., Verwoerd,D., Janssen,L.,
Jalink,K., Floore,A., Velds,A., van't Veer,L., and Neefjes,J. (2004). Tamoxifen
resistance by a conformational arrest of the estrogen receptor alpha after PKA
activation in breast cancer. Cancer Cell, 5, 597-605.
Montano,M.M., Ekena,K., Delage-Mourroux,R., Chang,W., Martini,P., and
Katzenellenbogen,B.S. (1999). An estrogen receptor-selective coregulator that
potentiates the effectiveness of antiestrogens and represses the activity of
estrogens. Proc. Natl. Acad. Sci. U. S. A, 96, 6947-6952.
Montano,M.M., Muller,V., Trobaugh,A., and Katzenellenbogen,B.S. (1995). The
carboxy-terminal F domain of the human estrogen receptor: role in the
transcriptional activity of the receptor and the effectiveness of antiestrogens as
estrogen antagonists. Mol. Endocrinol., 9, 814-825.
134
Nagel,S.C., Hagelbarger,J.L., and McDonnell,D.P. (2001). Development of an ER
action indicator mouse for the study of estrogens, selective ER modulators
(SERMs), and Xenobiotics. Endocrinology, 142, 4721-4728.
Nagy,L., Kao,H.Y., Chakravarti,D., Lin,R.J., Hassig,C.A., Ayer,D.E.,
Schreiber,S.L., and Evans,R.M. (1997). Nuclear receptor repression mediated by
a complex containing SMRT, mSin3A, and histone deacetylase. Cell, 89, 373-380.
Nagy,L., Kao,H.Y., Love,J.D., Li,C., Banayo,E., Gooch,J.T., Krishna,V.,
Chatterjee,K., Evans,R.M., and Schwabe,J.W. (1999). Mechanism of corepressor
binding and release from nuclear hormone receptors. Genes Dev., 13, 3209-3216.
Nakashima,K., Zhou,X., Kunkel,G., Zhang,Z., Deng,J.M., Behringer,R.R., and
de Crombrugghe,B. (2002). The novel zinc finger-containing transcription factor
osterix is required for osteoblast differentiation and bone formation. Cell, 108,
17-29.
Narlikar,G.J., Fan,H.Y., and Kingston,R.E. (2002). Cooperation between
complexes that regulate chromatin structure and transcription. Cell, 108, 475487.
Nawaz,Z., Lonard,D.M., Dennis,A.P., Smith,C.L., and O'Malley,B.W. (1999).
Proteasome-dependent degradation of the human estrogen receptor. Proc. Natl.
Acad. Sci. U. S. A, 96, 1858-1862.
Nichols,M., Rientjes,J.M., and Stewart,A.F. (1998). Different positioning of the
ligand-binding domain helix 12 and the F domain of the estrogen receptor
accounts for functional differences between agonists and antagonists. EMBO J.,
17, 765-773.
Norris,J.D., Fan,D., Kerner,S.A., and McDonnell,D.P. (1997). Identification of a
third autonomous activation domain within the human estrogen receptor. Mol.
Endocrinol., 11, 747-754.
O'Lone,R., Frith,M.C., Karlsson,E.K., and Hansen,U. (2004). Genomic targets of
nuclear estrogen receptors. Mol. Endocrinol., 18, 1859-1875.
O'Malley,B.W. and McGuire,W.L. (1968). Studies on the mechanism of
estrogen-mediated tissue differentiation: regulation of nuclear transcription and
induction of new RNA species. Proc. Natl. Acad. Sci. U. S. A, 60, 1527-1534.
Ohtake,F., Takeyama,K., Matsumoto,T., Kitagawa,H., Yamamoto,Y.,
Nohara,K., Tohyama,C., Krust,A., Mimura,J., Chambon,P., Yanagisawa,J.,
Fujii-Kuriyama,Y., and Kato,S. (2003). Modulation of oestrogen receptor
signalling by association with the activated dioxin receptor. Nature, 423, 545-550.
Okazaki,R., Inoue,D., Shibata,M., Saika,M., Kido,S., Ooka,H., Tomiyama,H.,
Sakamoto,Y., and Matsumoto,T. (2002). Estrogen promotes early osteoblast
differentiation and inhibits adipocyte differentiation in mouse bone marrow
stromal cell lines that express estrogen receptor (ER) alpha or beta.
Endocrinology, 143, 2349-2356.
135
Olsen,B.R., Reginato,A.M., and Wang,W. (2000). Bone development. Annu. Rev.
Cell Dev. Biol., 16, 191-220.
Onate,S.A., Tsai,S.Y., Tsai,M.J., and O'Malley,B.W. (1995). Sequence and
characterization of a coactivator for the steroid hormone receptor superfamily.
Science, 270, 1354-1357.
Owen,T.A., Aronow,M., Shalhoub,V., Barone,L.M., Wilming,L., Tassinari,M.S.,
Kennedy,M.B., Pockwinse,S., Lian,J.B., and Stein,G.S. (1990). Progressive
development of the rat osteoblast phenotype in vitro: reciprocal relationships in
expression of genes associated with osteoblast proliferation and differentiation
during formation of the bone extracellular matrix. J. Cell Physiol, 143, 420-430.
Oz,O.K., Zerwekh,J.E., Fisher,C., Graves,K., Nanu,L., Millsaps,R., and
Simpson,E.R. (2000). Bone has a sexually dimorphic response to aromatase
deficiency. J. Bone Miner. Res., 15, 507-514.
Perissi,V., Aggarwal,A., Glass,C.K., Rose,D.W., and Rosenfeld,M.G. (2004). A
corepressor/coactivator exchange complex required for transcriptional
activation by nuclear receptors and other regulated transcription factors. Cell,
116, 511-526.
Peterson,C.L. and Laniel,M.A. (2004). Histones and histone modifications. Curr.
Biol., 14, R546-R551.
Petrel,T.A. and Brueggemeier,R.W. (2003). Increased proteasome-dependent
degradation of estrogen receptor-alpha by TGF-beta1 in breast cancer cell lines.
J. Cell Biochem., 88, 181-190.
Phinney,D.G., Kopen,G., Isaacson,R.L., and Prockop,D.J. (1999). Plastic
adherent stromal cells from the bone marrow of commonly used strains of
inbred mice: variations in yield, growth, and differentiation. J. Cell Biochem., 72,
570-585.
Picard,D., Kumar,V., Chambon,P., and Yamamoto,K.R. (1990). Signal
transduction by steroid hormones: nuclear localization is differentially regulated
in estrogen and glucocorticoid receptors. Cell Regul., 1, 291-299.
Pickart,C.M. (2004). Back to the future with ubiquitin. Cell, 116, 181-190.
Pittenger,M.F., Mackay,A.M., Beck,S.C., Jaiswal,R.K., Douglas,R., Mosca,J.D.,
Moorman,M.A., Simonetti,D.W., Craig,S., and Marshak,D.R. (1999).
Multilineage potential of adult human mesenchymal stem cells. Science, 284, 143147.
Porter,W., Saville,B., Hoivik,D., and Safe,S. (1997). Functional synergy between
the transcription factor Sp1 and the estrogen receptor. Mol. Endocrinol., 11,
1569-1580.
Power,R.F., Mani,S.K., Codina,J., Conneely,O.M., and O'Malley,B.W. (1991).
Dopaminergic and ligand-independent activation of steroid hormone receptors.
Science, 254, 1636-1639.
136
Qu,Q., Harkonen,P.L., and Vaananen,H.K. (1999). Comparative effects of
estrogen and antiestrogens on differentiation of osteoblasts in mouse bone
marrow culture. J. Cell Biochem., 73, 500-507.
Qu,Q., Perala-Heape,M., Kapanen,A., Dahllund,J., Salo,J., Vaananen,H.K., and
Harkonen,P. (1998). Estrogen enhances differentiation of osteoblasts in mouse
bone marrow culture. Bone, 22, 201-209.
Reid,G., Hubner,M.R., Metivier,R., Brand,H., Denger,S., Manu,D.,
Beaudouin,J., Ellenberg,J., and Gannon,F. (2003). Cyclic, proteasome-mediated
turnover of unliganded and liganded ERα
α on responsive promoters is an integral
feature of estrogen signalling. Mol. Cell, 11, 695-707.
Riggs,B.L., Khosla,S., and Melton,L.J., III (2002). Sex steroids and the
construction and conservation of the adult skeleton. Endocr. Rev., 23, 279-302.
Rogatsky,I., Trowbridge,J.M., and Garabedian,M.J. (1999). Potentiation of
human estrogen receptor alpha transcriptional activation through
phosphorylation of serines 104 and 106 by the cyclin A-CDK2 complex. J. Biol.
Chem., 274, 22296-22302.
Safe,S. and Kim,K. (2004). Nuclear receptor-mediated transactivation through
interaction with Sp proteins. Prog. Nucleic Acid Res. Mol. Biol., 77, 1-36.
Samuels,A., Perry,M.J., and Tobias,J.H. (1999). High-dose estrogen induces de
novo medullary bone formation in female mice. J. Bone Miner. Res., 14, 178-186.
Sap,J., Munoz,A., Damm,K., Goldberg,Y., Ghysdael,J., Leutz,A., Beug,H., and
Vennstrom,B. (1986). The c-erb-A protein is a high-affinity receptor for thyroid
hormone. Nature, 324, 635-640.
Scheven,B.A., Damen,C.A., Hamilton,N.J., Verhaar,H.J., and Duursma,S.A.
(1992). Stimulatory effects of estrogen and progesterone on proliferation and
differentiation of normal human osteoblast-like cells in vitro. Biochem. Biophys.
Res Commun., 186, 54-60.
Schuur,E.R., McPherson,L.A., Yang,G.P., and Weigel,R.J. (2001). Genomic
structure of the promoters of the human estrogen receptor-alpha gene
demonstrate changes in chromatin structure induced by AP2gamma. J. Biol.
Chem., 276, 15519-15526.
Schwabe,J.W., Chapman,L., Finch,J.T., and Rhodes,D. (1993). The crystal
structure of the estrogen receptor DNA-binding domain bound to DNA: how
receptors discriminate between their response elements. Cell, 75, 567-578.
Schwabe,J.W., Neuhaus,D., and Rhodes,D. (1990). Solution structure of the
DNA-binding domain of the oestrogen receptor. Nature, 348, 458-461.
Shang,Y. and Brown,M. (2002). Molecular determinants for the tissue specificity
of SERMs. Science, 295, 2465-2468.
137
Shang,Y., Hu,X., DiRenzo,J., Lazar,M.A., and Brown,M. (2000). Cofactor
dynamics and sufficiency in estrogen receptor-regulated transcription. Cell, 103,
843-852.
Shi,Y. and Massague,J. (2003). Mechanisms of TGF-beta signaling from cell
membrane to the nucleus. Cell, 113, 685-700.
Shiau,A.K., Barstad,D., Loria,P.M., Cheng,L., Kushner,P.J., Agard,D.A., and
Greene,G.L. (1998). The structural basis of estrogen receptor/coactivator
recognition and the antagonism of this interaction by tamoxifen. Cell, 95, 927937.
Shyr,C.R., Hu,Y.C., Kim,E., and Chang,C. (2002). Modulation of estrogen
receptor-mediated transactivation by orphan receptor TR4 in MCF-7 cells. J.
Biol. Chem., 277, 14622-14628.
Simpson,E., Rubin,G., Clyne,C., Robertson,K., O'Donnell,L., Jones,M., and
Davis,S. (2000). The role of local estrogen biosynthesis in males and females.
Trends Endocrinol. Metab, 11, 184-188.
Sims,N.A., Clement-Lacroix,P., Minet,D., Fraslon-Vanhulle,C., GaillardKelly,M., Resche-Rigon,M., and Baron,R. (2003). A functional androgen
receptor is not sufficient to allow estradiol to protect bone after gonadectomy in
estradiol receptor-deficient mice. J. Clin. Invest, 111, 1319-1327.
Sims,N.A., Dupont,S., Krust,A., Clement-Lacroix,P., Minet,D., Resche-Rigon,M.,
Gaillard-Kelly,M., and Baron,R. (2002). Deletion of estrogen receptors reveals a
regulatory role for estrogen receptors-beta in bone remodeling in females but not
in males. Bone, 30, 18-25.
Smith,C.L., Conneely,O.M., and O'Malley,B.W. (1993). Modulation of the
ligand-independent activation of the human estrogen receptor by hormone and
antihormone. Proc. Natl. Acad. Sci. U. S. A, 90, 6120-6124.
Smith,C.L., Nawaz,Z., and O'Malley,B.W. (1997). Coactivator and corepressor
regulation of the agonist/antagonist activity of the mixed antiestrogen, 4hydroxytamoxifen. Mol. Endocrinol., 11, 657-666.
Sowa,H., Kaji,H., Yamaguchi,T., Sugimoto,T., and Chihara,K. (2002).
Activations of ERK1/2 and JNK by transforming growth factor beta negatively
regulate Smad3-induced alkaline phosphatase activity and mineralization in
mouse osteoblastic cells. J. Biol. Chem., 277, 36024-36031.
Spelsberg,T.C., Subramaniam,M., Riggs,B.L., and Khosla,S. (1999). The actions
and interactions of sex steroids and growth factors/cytokines on the skeleton.
Mol. Endocrinol., 13, 819-828.
Spinella-Jaegle,S., Roman-Roman,S., Faucheu,C., Dunn,F.W., Kawai,S.,
Gallea,S., Stiot,V., Blanchet,A.M., Courtois,B., Baron,R., and Rawadi,G. (2001).
Opposite effects of bone morphogenetic protein-2 and transforming growth
factor-beta1 on osteoblast differentiation. Bone, 29, 323-330.
138
Stains,J.P. and Civitelli,R. (2003). Genomic approaches to identifying
transcriptional regulators of osteoblast differentiation. Genome Biol., 4, 222.
Stoica,A., Saceda,M., Fakhro,A., Solomon,H.B., Fenster,B.D., and Martin,M.B.
(1997). The role of transforming growth factor-beta in the regulation of estrogen
receptor expression in the MCF-7 breast cancer cell line. Endocrinology, 138,
1498-1505.
Swope,D., Harrell,J.C., Mahato,D., and Korach,K.S. (2002). Genomic structure
and identification of a truncated variant message of the mouse estrogen receptor
alpha gene. Gene, 294, 239-247.
Takano-Yamamoto,T. and Rodan,G.A. (1990). Direct effects of 17 beta-estradiol
on trabecular bone in ovariectomized rats. Proc. Natl. Acad. Sci. U. S. A, 87,
2172-2176.
Takeda,S., Elefteriou,F., and Karsenty,G. (2003). Common endocrine control of
body weight, reproduction, and bone mass. Annu. Rev. Nutr., 23, 403-411.
Tamrazi,A., Carlson,K.E., Daniels,J.R., Hurth,K.M., and Katzenellenbogen,J.A.
(2002). Estrogen receptor dimerization: ligand binding regulates dimer affinity
and dimer dissociation rate. Mol. Endocrinol., 16, 2706-2719.
Tasset,D., Tora,L., Fromental,C., Scheer,E., and Chambon,P. (1990). Distinct
classes of transcriptional activating domains function by different mechanisms.
Cell, 62, 1177-1187.
Toda,K., Okada,Y., Zubair,M., Morohashi,K., Saibara,T., and Okada,T. (2004).
Aromatase-knockout mouse carrying an estrogen-inducible enhanced green
fluorescent protein gene facilitates detection of estrogen actions in vivo.
Endocrinology, 145, 1880-1888.
Tora,L., Mullick,A., Metzger,D., Ponglikitmongkol,M., Park,I., and Chambon,P.
(1989a). The cloned human oestrogen receptor contains a mutation which alters
its hormone binding properties. EMBO J., 8, 1981-1986.
Tora,L., White,J., Brou,C., Tasset,D., Webster,N., Scheer,E., and Chambon,P.
(1989b). The human estrogen receptor has two independent nonacidic
transcriptional activation functions. Cell, 59, 477-487.
Tsai,H.W., Katzenellenbogen,J.A., Katzenellenbogen,B.S., and Shupnik,M.A.
(2004). Protein kinase A activation of estrogen receptor alpha transcription does
not require proteasome activity and protects the receptor from ligand-mediated
degradation. Endocrinology, 145, 2730-2738.
Turner,R.T. (1999). Mice, estrogen, and postmenopausal osteoporosis. J. Bone
Miner. Res, 14, 187-191.
Vanacker,J.M., Pettersson,K., Gustafsson,J.A., and Laudet,V. (1999).
Transcriptional targets shared by estrogen receptor- related receptors (ERRs)
and estrogen receptor (ER) alpha, but not by ERbeta. EMBO J., 18, 4270-4279.
139
Walter,P., Green,S., Greene,G., Krust,A., Bornert,J.M., Jeltsch,J.M., Staub,A.,
Jensen,E., Scrace,G., and Waterfield,M. (1985). Cloning of the human estrogen
receptor cDNA. Proc. Natl. Acad. Sci. U. S. A, 82, 7889-7893.
Wang,C., Fu,M., Angeletti,R.H., Siconolfi-Baez,L., Reutens,A.T., Albanese,C.,
Lisanti,M.P., Katzenellenbogen,B.S., Kato,S., Hopp,T., Fuqua,S.A., Lopez,G.N.,
Kushner,P.J., and Pestell,R.G. (2001). Direct acetylation of the estrogen receptor
alpha hinge region by p300 regulates transactivation and hormone sensitivity. J.
Biol. Chem., 276, 18375-18383.
Wang,R.A., Mazumdar,A., Vadlamudi,R.K., and Kumar,R. (2002). P21activated kinase-1 phosphorylates and transactivates estrogen receptor-alpha
and promotes hyperplasia in mammary epithelium. EMBO J., 21, 5437-5447.
Warner,M., Wang,L., Weihua,Z., Cheng,G., Sakaguchi,H., Saji,S., Nilsson,S.,
Kiesselbach,T., and Gustafsson,J.A. (2003). Analysis of estrogen receptor
expression in tissues. Methods Enzymol., 364, 448-463.
Watanabe,M., Yanagisawa,J., Kitagawa,H., Takeyama,K., Ogawa,S., Arao,Y.,
Suzawa,M., Kobayashi,Y., Yano,T., Yoshikawa,H., Masuhiro,Y., and Kato,S.
(2001). A subfamily of RNA-binding DEAD-box proteins acts as an estrogen
receptor alpha coactivator through the N-terminal activation domain (AF-1)
with an RNA coactivator, SRA. EMBO J., 20, 1341-1352.
Watkins,R.E., Davis-Searles,P.R., Lambert,M.H., and Redinbo,M.R. (2003).
Coactivator binding promotes the specific interaction between ligand and the
pregnane X receptor. J. Mol. Biol., 331, 815-828.
Webb,P., Lopez,G.N., Greene,G.L., Baxter,J.D., and Kushner,P.J. (1992). The
limits of the cellular capacity to mediate an estrogen response. Mol. Endocrinol.,
6, 157-167.
Webb,P., Nguyen,P., Shinsako,J., Anderson,C., Feng,W., Nguyen,M.P., Chen,D.,
Huang,S.M., Subramanian,S., McKinerney,E., Katzenellenbogen,B.S.,
Stallcup,M.R., and Kushner,P.J. (1998). Estrogen receptor activation function 1
works by binding p160 coactivator proteins. Mol. Endocrinol., 12, 1605-1618.
Weigel,N.L. and Zhang,Y. (1998). Ligand-independent activation of steroid
hormone receptors. J. Mol. Med., 76, 469-479.
Weinberger,C., Hollenberg,S.M., Rosenfeld,M.G., and Evans,R.M. (1985).
Domain structure of human glucocorticoid receptor and its relationship to the verb-A oncogene product. Nature, 318, 670-672.
Weinberger,C., Thompson,C.C., Ong,E.S., Lebo,R., Gruol,D.J., and Evans,R.M.
(1986). The c-erb-A gene encodes a thyroid hormone receptor. Nature, 324, 641646.
Wijayaratne,A.L. and McDonnell,D.P. (2001). The human estrogen receptoralpha is a ubiquitinated protein whose stability is affected differentially by
agonists, antagonists, and selective estrogen receptor modulators. J. Biol. Chem.,
276, 35684-35692.
140
Wiren,K.M., Chapman,E.A., and Zhang,X.W. (2002). Osteoblast differentiation
influences androgen and estrogen receptor-alpha and -beta expression. J.
Endocrinol., 175, 683-694.
Wood,J.R., Likhite,V.S., Loven,M.A., and Nardulli,A.M. (2001). Allosteric
modulation of estrogen receptor conformation by different estrogen response
elements. Mol. Endocrinol., 15, 1114-1126.
Wu,R.C., Qin,J., Hashimoto,Y., Wong,J., Xu,J., Tsai,S.Y., Tsai,M.J., and
O'Malley,B.W. (2002). Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM1) Coactivator activity by I kappa B kinase. Mol. Cell Biol., 22, 3549-3561.
Wu,R.C., Qin,J., Yi,P., Wong,J., Tsai,S.Y., Tsai,M.J., and O'Malley,B.W. (2004).
Selective Phosphorylations of the SRC-3/AIB1 Coactivator Integrate Genomic
Reponses to Multiple Cellular Signaling Pathways. Mol. Cell, 15, 937-949.
Wurtz,J.M., Bourguet,W., Renaud,J.P., Vivat,V., Chambon,P., Moras,D., and
Gronemeyer,H. (1996). A canonical structure for the ligand-binding domain of
nuclear receptors. Nat. Struct. Biol., 3, 87-94.
Ylikomi,T., Bocquel,M.T., Berry,M., Gronemeyer,H., and Chambon,P. (1992).
Cooperation of proto-signals for nuclear accumulation of estrogen and
progesterone receptors. EMBO J., 11, 3681-3694.
Zhang,F. and Laiho,M. (2003). On and off: proteasome and TGF-beta signaling.
Exp. Cell Res., 291, 275-281.
Zhang,H., Thomsen,J.S., Johansson,L., Gustafsson,J.A., and Treuter,E. (2000).
DAX-1 functions as an LXXLL-containing corepressor for activated estrogen
receptors. J. Biol. Chem., 275, 39855-39859.
Zhou,S., Zilberman,Y., Wassermann,K., Bain,S.D., Sadovsky,Y., and Gazit,D.
(2001). Estrogen modulates estrogen receptor alpha and beta expression,
osteogenic activity, and apoptosis in mesenchymal stem cells (MSCs) of
osteoporotic mice. J. Cell Biochem., 81, 144-155.
Zhu,J., Gianni,M., Kopf,E., Honore,N., Chelbi-Alix,M., Koken,M., Quignon,F.,
Rochette-Egly,C., and de The,H. (1999). Retinoic acid induces proteasomedependent degradation of retinoic acid receptor alpha (RARalpha) and
oncogenic RARalpha fusion proteins. Proc. Natl. Acad. Sci. U. S. A, 96, 1480714812.
Zhuang,Y., Katzenellenbogen,B.S., and Shapiro,D.J. (1995). Estrogen receptor
mutants which do not bind 17 beta-estradiol dimerize and bind to the estrogen
response element in vivo. Mol. Endocrinol., 9, 457-466.
Zwijsen,R.M., Buckle,R.S., Hijmans,E.M., Loomans,C.J., and Bernards,R.
(1998). Ligand-independent recruitment of steroid receptor coactivators to
estrogen receptor by cyclin D1. Genes Dev., 12, 3488-3498.
141
List of Publications
Merot,Y., Metivier,R., Penot,G., Manu,D., Saligaut,C., Gannon,F., Pakdel,F.,
Kah,O., and Flouriot,G. (2004). The relative contribution exerted by AF-1 and AF-2
transactivation functions in estrogen receptor alpha transcriptional activity depends
upon the differentiation stage of the cell. J. Biol. Chem., 279, 26184-26191.
Metivier,R., Penot,G., Carmouche,R.P., Hubner,M.R., Reid,G., Denger,S., Manu,D.,
Brand,H., Kos,M., Benes,V., and Gannon,F. (2004). Transcriptional complexes
engaged by apo-estrogen receptor-alpha isoforms have divergent outcomes. EMBO J.,
23, 3653-3666.
Metivier,R., Stark,A., Flouriot,G., Hubner,M.R., Brand,H., Penot,G., Manu,D.,
Denger,S., Reid,G., Kos,M., Russell,R.B., Kah,O., Pakdel,F., and Gannon,F. (2002).
A Dynamic Structural Model for Estrogen Receptor-alpha Activation by Ligands,
Emphasizing the Role of Interactions between Distant A and E Domains. Mol. Cell,
10, 1019-1032.
Reid,G., Hubner,M.R., Metivier,R., Brand,H., Denger,S., Manu,D., Beaudouin,J.,
Ellenberg,J., and Gannon,F. (2003). Cyclic, proteasome-mediated turnover of
unliganded and liganded ERα on responsive promoters is an integral feature of
estrogen signalling. Mol. Cell, 11, 695-707.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising