Local Run Manager Small RNA Analysis Module Workflow Guide (1000000003345 v00)

Local Run Manager Small RNA Analysis Module Workflow Guide (1000000003345 v00)
Local Run Manager
Small RNA Analysis Module
Workflow Guide
For Research Use Only. Not for use in diagnostic procedures.
Overview
Set Parameters
Analysis Methods
View Analysis Results
Analysis Report
Analysis Output Files
Custom Analysis Settings
Technical Assistance
ILLUMINA PROPRIETARY
Document # 1000000003345 v00
January 2016
3
4
6
8
9
11
15
17
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the
contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This
document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed,
or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license
under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order
to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read
and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN
MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND
DAMAGE TO OTHER PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2016 Illumina, Inc. All rights reserved.
Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio,
Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect,
MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome,
TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the
streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the U.S. and/or other countries. All other
names, logos, and other trademarks are the property of their respective owners.
The Local Run Manager Small RNA analysis module uses Bowtie to align reads against
databases for contaminants, mature miRNA, small RNA, and a genomic reference, in
that order, and then measures abundance of short RNA sequences. It is suitable for
identifying and quantifying miRNA expression and comparing abundance across
samples. This workflow is designed specifically for RNA libraries prepared with the
TruSeq Small RNA kit.
Input Requirements
In addition to sequencing data files generated during the sequencing run, such as base
call files, the Small RNA analysis module requires the following references in FASTA file
format. References are included with the installation of the Small RNA analysis module.
} A list of contaminants
} A list of mature miRNA
} A list of small RNA
} A reference genome
About This Guide
This guide provides instructions for setting up run parameters for sequencing and
analysis parameters for the Small RNA analysis module. For information about the Local
Run Manager dashboard and system settings, see the Local Run Manager Software Guide
(document # 1000000002702).
Local Run Manager Small RNA Analysis Module Workflow Guide
3
Overview
Overview
Set Parameters
1
Click Create Run, and select Small RNA.
2
Enter a run name that identifies the run from sequencing through analysis.
Use alphanumeric characters, spaces, underscores, or dashes.
3
[Optional] Enter a run description to help identify the run.
Use alphanumeric characters.
Specify Run Settings
1
Specify the number of index reads.
} 0 for a run with no indexing
} 1 for a single-indexed run
2
Enter the number of cycles for the run, if other than the default setting of 36 cycles.
3
[Optional] Specify custom primers to be used for the run.
NOTE
By default, the Small RNA analysis module is set to the library type TruSeq Small RNA
and the read type Single Read. Read lengths are set to 36 cycles for Read 1 and 6 cycles for
Index 1 Read.
Specify Module-Specific Settings
By default, the Small RNA analysis module uses Bowtie for alignment.
No module-specific settings are required for the Small RNA analysis module.
Specify a Genome Reference
1
To view available reference genomes, click the Genome Folder drop-down list and
select a reference genome for the run.
Specify Samples for the Run
Specify samples for the run using the following options:
} Enter samples manually—Use the blank table on the Create Run screen.
} Import samples—Navigate to an external file in a comma-separated values (*.csv)
format. A template is available for download on the Create Run screen.
After you have populated the samples table, you can export the sample information to
an external file, and use the file as a reference when preparing libraries or import the file
for another run.
Enter Samples Manually
4
1
Adjust the samples table to an appropriate number of rows.
} Click the + icon to add a row.
} Use the up/down arrows to add multiple rows. Click the + icon.
} Click the x icon to delete a row.
} Right-click on a row in the table and use the commands in the drop-down menu.
2
Enter a unique sample ID in the Sample ID field.
Document # 1000000003345 v00
Set Parameters
Use alphanumeric characters, dashes, or underscores.
3
[Optional] Enter a sample description in the Sample Description field.
Use alphanumeric characters, dashes, underscores, or spaces.
4
Expand the Index 1 (i7) drop-down list and select an Index 1 adapter.
5
[Optional] Click the Export
6
When finished, click Save Run.
icon to export sample information in *.csv format.
Import Samples
1
Click Template. The template file contains the correct column headings for import.
2
Enter the sample information in each column for the samples in the run, and then
save the file.
3
Click Import Samples and browse to the location of the sample information file.
4
When finished, click Save Run.
Local Run Manager Small RNA Analysis Module Workflow Guide
5
Analysis Methods
The Small RNA analysis module performs the following analysis steps and then writes
analysis output files to the Alignment folder.
} Demultiplexes index reads
} Generates FASTQ files
} Aligns to a reference
} Measures the abundance of various types of short RNA sequences
Demultiplexing
Demultiplexing compares each Index Read sequence to the index sequences specified for
the run. No quality values are considered in this step.
Index reads are identified using the following steps:
} Samples are numbered starting from 1 based on the order they are listed for the run.
} Sample number 0 is reserved for clusters that were not assigned to a sample.
} Clusters are assigned to a sample when the index sequence matches exactly or when
there is up to a single mismatch per Index Read.
FASTQ File Generation
After demultiplexing, the software generates intermediate analysis files in the FASTQ
format, which is a text format used to represent sequences. FASTQ files contain reads for
each sample and the associated quality scores. Any controls used for the run and
clusters that did not pass filter are excluded.
Each FASTQ file contains reads for only 1 sample, and the name of that sample is
included in the FASTQ file name. FASTQ files are the primary input for alignment.
Adapter Trimming
The Small RNA analysis module performs adapter trimming by default.
During longer runs, clusters can sequence beyond the sample DNA and read bases from
a sequencing adapter. To prevent sequencing into the adapter, the adapter sequence is
trimmed before the sequence is written to the FASTQ file. Trimming the adapter sequence
avoids reporting false mismatches with the reference sequence and improves alignment
accuracy and performance.
Adapter Sequences
When using the Small RNA analysis module, the following adapter sequence is
trimmed:
TGGAATTCTCGGGTGCCAAGGC
Alignment
During the alignment step, the Bowtie alignment tool aligns clusters from each sample
against references in the order of contaminants, mature miRNA, and RNA. If a reference
genome was specified for the run, clusters are aligned to the full genome.
All samples are aligned to the same references. Alignment is performed using the
following criteria:
6
Document # 1000000003345 v00
}
}
}
Clusters that aligns to the contaminants reference is considered to be a contaminant,
even if the cluster also aligns to another reference.
Clusters that match the miRNA reference, but not the contaminants reference, are
considered to be miRNA. Only exact matches to the miRNA reference are counted.
To be considered a match, alignment begins at the start of the reference sequence,
must occur on the same strand, and be of an identical length. The length of a
sequence is measured against the reference sequence after adapter trimming.
If a sequence aligns to multiple references with the same number of mismatches,
counts are divided equally across references.
Local Run Manager Small RNA Analysis Module Workflow Guide
7
Analysis Methods
}
View Analysis Results
8
1
From the Local Run Manager dashboard, click the run name.
2
From the Run Overview tab, review the sequencing run metrics.
3
[Optional] Click the Copy to Clipboard
4
Click the Sequencing Information tab to review run parameters and consumables
information.
5
Click the Samples and Results tab to view the analysis report.
} If analysis was repeated, expand the Select Analysis drop-down and select the
appropriate analysis.
} From the left navigation bar, select a sample name to view the report for another
sample.
6
[Optional] Click the Copy to Clipboard
icon for access to the output run folder.
icon for access to the Analysis folder.
Document # 1000000003345 v00
Analysis results are summarized on the Samples and Results tab. The report is also
available in a PDF file format for each sample and as an aggregate report in the Analysis
folder.
Sample Information
Table 1 Sample Information Table
Column Heading
Description
Sample ID
The sample ID provided when the run was created.
Sample Name
The sample name provided when the run was created.
Run Folder
The name of the run folder.
Total PF Reads
The total number of reads passing filter.
Quality Control Statistics
Quality control statistics are provided in the form of graphs, such as a histogram or pie
charts. The following graphs report quality control statistics:
} Small RNA Length Distribution—A histogram showing the number of reads for
each read length after trimming.
} Read Distribution—A pie chart showing the number and percentage of reads in the
categories of abundant, genome, miRNA, other RNA, and unaligned.
} Abundant Distribution—A pie chart showing the number and percentage of reads
for abundant small RNA. Subcategories are species-dependent.
} miRNA Distribution—A pie chart showing the number and percentage of reads for
miRNA in the categories of isomiR (known precursor) and known mature miRNA.
Known precursors are listed in the miRNA database.
} Other RNA Distribution—A pie chart showing the number and percentage of reads
for other RNA. Subcategories are species-dependent. Precursors are reads that slign
to the precursor sequences, but are not mature miRNA or isomiRs.
Summary of Sequences
Summaries of the top-10 sequences with the most reads for the following small
RNA marker types are provided in the analysis report for each sample.
} Mature miRNA—Only exact matches to miRNA records are listed. For the full list,
see Hits.txt.
} IsomiR (known precursor)—Reads are counted if on the same strand of a precursor,
but not on the 5' or 3' mature miRNA sequence. IsomiR hits are filtered to remove
artifacts of PCR and sequencing errors. For the full list, see FilteredIsoHits.txt.
} Precursor group—Precursor reads are grouped based on the mature miRNA they
produce. For the full list, see PrecursorHits.txt.
} miRNA families—Reads are counted according to sequences listed in the miRBase.
For the full list, see FamilyHits.txt.
} piRNA—Reads are counted if they align to a piRNA sequence listed in the NCBI
Nucleotide database, but have not been counted as a isomiR. For the full list, see
PiRNAHits.txt.
For each category, data is provided in the following tables.
Local Run Manager Small RNA Analysis Module Workflow Guide
9
Analysis Report
Analysis Report
Table 2 Number of Marker Types Table
Column Heading
Description
Number of [marker type] The number of marker types matched in the run.
with Reads
Total Number of Reads
The total number of reads assigned to the marker type.
Table 3 Top 10 of Marker Type Table
Column Heading
Description
Top 10 [marker type]
The top 10 marker type sequences with the most matching
reads.
Number of Reads
The total number of reads assigned to each marker type
sequence.
10
Document # 1000000003345 v00
The following analysis output files are generated for the Small RNA analysis module
and provide analysis results for alignment and the number of reads counted for each
data type. Analysis output files are located in the Alignment folder.
File Name
Description
Demultiplexing (*.demux)
Intermediate files containing demultiplexing results.
FASTQ (*.fastq.gz)
Intermediate files containing quality scored base calls.
FASTQ files are the primary input for the alignment step.
Abundant alignment files
in the BAM format
(*abundant.bam)
Contains alignments against abundant sequences.
miRNA alignment files in
the BAM format
(*mirna.bam)
Contains alignments against mature miRNA sequences.
RNA alignment files in the
BAM format (*rna.bam)
Contains alignments against other RNA sequences.
Genome alignment files in
the BAM format
(*genome.bam)
Contains alignments against the reference genome, if
provided.
Hits.txt
Contains the number of reads counted for each mature
miRNA, for each sample.
FilteredIsoHits.txt
Contains the number of reads counted as filtered isomiR
listed, for each sample.
PrecursorHits.txt
Contains the number of reads counted for each precursor
group for each sample.
FamilyHits.txt
Contains the number of reads counted for each miRNA
family listed, for each sample.
PiRNAHits.txt
Contains the number of reads counted for each piRNA
listed, for each sample.
Demultiplexing File Format
The process of demultiplexing reads the index sequence attached to each cluster to
determine from which sample the cluster originated. The mapping between clusters and
sample number are written to 1 demultiplexing (*.demux) file for each tile of the flow
cell.
The demultiplexing file naming format is s_1_X.demux, where X is the tile number.
Demultiplexing files start with a header:
} Version (4 byte integer), currently 1
} Cluster count (4 byte integer)
The remainder of the file consists of sample numbers for each cluster from the tile.
When the demultiplexing step is complete, the software generates a demultiplexing file
named DemultiplexSummaryF1L1.txt.
Local Run Manager Small RNA Analysis Module Workflow Guide
11
Analysis Output Files
Analysis Output Files
}
}
}
}
In the file name, F1 represents the flow cell number.
In the file name, L1 represents the lane number.
Demultiplexing results in a table with 1 row per tile and 1 column per sample,
including sample 0.
The most commonly occurring sequences in index reads.
FASTQ File Format
FASTQ file is a text-based file format that contains base calls and quality values per read.
Each record contains 4 lines:
} The identifier
} The sequence
} A plus sign (+)
} The quality scores in an ASCII encoded format
The identifier is formatted as:
@Instrument:RunID:FlowCellID:Lane:Tile:X:Y ReadNum:FilterFlag:0:SampleNumber
Example:
@SIM:1:FCX:1:15:6329:1045 1:N:0:2
TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
+
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=
BAM File Format
A BAM file (*.bam) is the compressed binary version of a SAM file that is used to
represent aligned sequences up to 128 Mb. SAM and BAM formats are described in
detail at https://samtools.github.io/hts-specs/SAMv1.pdf.
BAM files use the file naming format of SampleName_S#.bam, where # is the sample
number determined by the order that samples are listed for the run.
BAM files contain a header section and an alignments section:
} Header—Contains information about the entire file, such as sample name, sample
length, and alignment method. Alignments in the alignments section are associated
with specific information in the header section.
} Alignments—Contains read name, read sequence, read quality, alignment
information, and custom tags. The read name includes the chromosome, start
coordinate, alignment quality, and the match descriptor string.
The alignments section includes the following information for each or read pair:
} RG: Read group, which indicates the number of reads for a specific sample.
} BC: Barcode tag, which indicates the demultiplexed sample ID associated with the
read.
} SM: Single-end alignment quality.
} AS: Paired-end alignment quality.
} NM: Edit distance tag, which records the Levenshtein distance between the read and
the reference.
} XN: Amplicon name tag, which records the amplicon tile ID associated with the
read.
BAM files are suitable for viewing with an external viewer such as IGV or the UCSC
Genome Browser.
BAM index files (*.bam.bai) provide an index of the corresponding BAM file.
12
Document # 1000000003345 v00
The following output files provide supplementary information, or summarize run results
and analysis errors. Although, these files are not required for assessing analysis results,
they can be used for troubleshooting purposes. All files are located in the Alignment
folder unless otherwise specified.
File Name
Description
AdapterTrimming.txt
Lists the number of trimmed bases and percentage of
bases for each tile. This file is present only if adapter
trimming was specified for the run.
AnalysisLog.txt
Processing log that describes every step that occurred
during analysis of the current run folder. This file does
not contain error messages.
Located in the root level of the run folder.
AnalysisError.txt
Processing log that lists any errors that occurred
during analysis. This file is present only if errors
occurred.
Located in the root level of the run folder.
CompletedJobInfo.xml
Written after analysis is complete, contains information
about the run, such as date, flow cell ID, software
version, and other parameters.
Located in the root level of the run folder.
DemultiplexSummaryF1L1.txt
Reports demultiplexing results in a table with 1 row
per tile and 1 column per sample.
SmallRNARunStatistics.xml
Contains summary statistics specific to the run.
Located in the root level of the run folder.
Analysis Folder
The analysis folder holds the files generated by the Local Run Manager software.
The relationship between the output folder and analysis folder is summarized as follows:
} During sequencing, Real-Time Analysis (RTA) populates the output folder with files
generated during image analysis, base calling, and quality scoring.
} RTA copies files to the analysis folder in real time. After RTA assigns a quality score
to each base for each cycle, the software writes the file RTAComplete.xml to both
folders.
} When the file RTAComplete.xml is present, analysis begins.
} As analysis continues, Local Run Manager writes output files to the analysis folder,
and then copies the files back to the output folder.
Folder Structure
Data
Intensities
BaseCalls
Alignment—Contains *.bam and *.vcf files, and files specific to the
analysis module.
Local Run Manager Small RNA Analysis Module Workflow Guide
13
Analysis Output Files
Supplementary Output Files
L001—Contains one subfolder per cycle, each containing *.bcl files.
Sample1_S1_L001_R1_001.fastq.gz
Sample2_S2_L001_R1_001.fastq.gz
Undetermined_S0_L001_R1_001.fastq.gz
L001—Contains *.locs files, 1 for each tile.
RTA Logs—Contains log files from RTA software analysis.
InterOp—Contains binary files used by Sequencing Analysis Viewer (SAV).
Logs—Contains log files describing steps performed during sequencing.
Queued—A working folder for software; also called the copy folder.
AnalysisError.txt
AnalysisLog.txt
CompletedJobInfo.xml
QueuedForAnalysis.txt
[WorkflowName]RunStatistics
RTAComplete.xml
RunInfo.xml
runParameters.xml
Alignment Folders
Each time that analysis is requeued, the Local Run Manager creates an Alignment folder
named AlignmentN, where N is a sequential number.
14
Document # 1000000003345 v00
Custom analysis settings are intended for technically advanced users. If settings are
applied incorrectly, serious problems can occur.
Add a Custom Analysis Setting
1
From the Module-Specific Settings section of the Create Run screen, click Show
advanced module settings.
2
Click Add custom setting.
3
In the custom setting field, enter the setting name as listed in the Available Analysis
Settings section.
4
In the setting value field, enter the setting value.
5
To remove a setting, click the x icon.
Available Analysis Settings
}
Adapter Trimming—By default, adapter trimming is enabled in the Small RNA
analysis module. To specify a different adapter, use the Adapter setting. The same
adapter sequence is trimmed for Read 1 and Read 2.
} To specify 2 adapter sequences, separate the sequences with a plus (+) sign.
} To specify a different adapter sequence for Read 2, use the AdapterRead2 setting.
Setting Name
Setting Value
Adapter
Enter the sequence of the adapter to be trimmed.
AdapterRead2
Enter the sequence of the adapter to be trimmed.
Local Run Manager Small RNA Analysis Module Workflow Guide
15
Custom Analysis Settings
Custom Analysis Settings
Notes
For technical assistance, contact Illumina Technical Support.
Table 4 Illumina General Contact Information
Website
Email
www.illumina.com
[email protected]
Table 5 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
North America
1.800.809.4566
Japan
Australia
1.800.775.688
Netherlands
Austria
0800.296575
New Zealand
Belgium
0800.81102
Norway
China
400.635.9898
Singapore
Denmark
80882346
Spain
Finland
0800.918363
Sweden
France
0800.911850
Switzerland
Germany
0800.180.8994
Taiwan
Hong Kong
800960230
United Kingdom
Ireland
1.800.812949
Other countries
Italy
800.874909
Contact Number
0800.111.5011
0800.0223859
0800.451.650
800.16836
1.800.579.2745
900.812168
020790181
0800.563118
00806651752
0800.917.0041
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at
support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go
to support.illumina.com, select a product, then select Documentation & Literature.
Local Run Manager Small RNA Analysis Module Workflow Guide
Technical Assistance
Technical Assistance
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement