Local Run Manager Targeted RNA Analysis Module Workflow Guide (1000000003340 v00)

Local Run Manager Targeted RNA Analysis Module Workflow Guide (1000000003340 v00)
Local Run Manager
Targeted RNA Analysis Module
Workflow Guide
For Research Use Only. Not for use in diagnostic procedures.
Overview
Set Parameters
Analysis Methods
View Analysis Results
Analysis Report
Analysis Output Files
Technical Assistance
ILLUMINA PROPRIETARY
Document # 1000000003340 v00
January 2016
3
4
6
7
8
11
17
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the
contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This
document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed,
or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license
under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order
to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read
and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN
MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND
DAMAGE TO OTHER PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2016 Illumina, Inc. All rights reserved.
Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio,
Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect,
MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome,
TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the
streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the U.S. and/or other countries. All other
names, logos, and other trademarks are the property of their respective owners.
The Local Run Manager Targeted RNA analysis module aligns reads specified in the
manifest file, quantifies the relative expression of genes and isoforms between samples,
and then compares abundance across samples. This workflow is designed specifically
for RNA libraries prepared with the TruSeq Targeted RNA Expression Kit.
Input Requirements
In addition to sequencing data files generated during the sequencing run, such as base
call files, the Targeted RNA analysis module requires the following files.
} Manifest file—The Targeted RNA analysis module requires at least 1 manifest file.
The manifest files are provided with your Targeted Oligo Pool.
} Reference genome—The Targeted RNA analysis module requires the reference
genome specified in the manifest file. The reference genome sets the chromosome
sizes in the BAM output files and provides variant annotations.
Uploading Manifests
To import a manifest for all runs using the Targeted RNA analysis module, use the
Module Settings command from the Local Run Manager navigation bar. For more
information, see the Local Run Manager Software Guide (document # 1000000002702).
Alternatively, you can import a manifest for the current run only using the Import
Manifests command on the Create Run screen.
About This Guide
This guide provides instructions for setting up run parameters for sequencing and
analysis parameters for the Targeted RNA analysis module. For information about the
Local Run Manager dashboard and system settings, see the Local Run Manager Software
Guide (document # 1000000002702).
Local Run Manager Targeted RNA Analysis Module Workflow Guide
3
Overview
Overview
Set Parameters
1
Click Create Run, and select Targeted RNA.
2
Enter a run name that identifies the run from sequencing through analysis.
Use alphanumeric characters, spaces, underscores, or dashes.
3
[Optional] Enter a run description to help identify the run.
Use alphanumeric characters.
Specify Run Settings
1
Enter the number of cycles for the run, if other than the default setting of 51 cycles.
2
[Optional] Specify custom primers to be used for the run.
NOTE
By default, the Targeted RNA analysis module is set to the library type TruSeq Targeted
RNA Expression and the read type Single Read. Read lengths are set to 51 cycles for Read
1, 6 cycles for Index 1 Read, and 8 cycles for Index 2 Read.
Specify Module-Specific Settings
By default, the Targeted RNA analysis module uses the banded Smith-Waterman
algorithm for alignment.
No module-specific settings are required for the Targeted RNA analysis module.
Import Manifest Files for the Run
1
Make sure that the manifests you want to import are available in an accessible
network location or on a USB drive.
2
Click Import Manifests.
3
Navigate to the manifest file and select the manifest that you want to add.
NOTE
To import manifests for any run using the Targeted RNA analysis module, use the Module
Settings feature from the navigation bar.
Specify Samples for the Run
Specify samples for the run using the following options:
} Enter samples manually—Use the blank table on the Create Run screen.
} Import samples—Navigate to an external file in a comma-separated values (*.csv)
format. A template is available for download on the Create Run screen.
After you have populated the samples table, you can export the sample information to
an external file, and use the file as a reference when preparing libraries or import the file
for another run.
Enter Samples Manually
1
4
Adjust the samples table to an appropriate number of rows.
} Click the + icon to add a row.
} Use the up/down arrows to add multiple rows. Click the + icon.
Document # 1000000003340 v00
2
Enter a unique sample ID in the Sample ID field.
Use alphanumeric characters, dashes, or underscores.
3
Enter a sample name in the Sample Name field.
Use alphanumeric characters, dashes, or underscores.
4
[Optional] Enter a sample description in the Sample Description field.
Use alphanumeric characters, dashes, underscores, or spaces.
5
Expand the Index 1 (i7) drop-down list and select an Index 1 adapter.
6
Expand the Index 2 (i5) drop-down list and select an Index 2 adapter.
7
Expand the Manifest drop-down list and select a manifest file.
8
In the Gene Normalization field, enter a list of gene names to be used for
normalization. Separate each gene name with a semi-colon.
9
[Optional] Click the Export
icon to export sample information in *.csv format.
10 When finished, click Save Run.
Import Samples
1
Click Template. The template file contains the correct column headings for import.
2
Enter the sample information in each column for the samples in the run, and then
save the file.
3
Click Import Samples and browse to the location of the sample information file.
4
When finished, click Save Run.
Local Run Manager Targeted RNA Analysis Module Workflow Guide
5
Set Parameters
} Click the x icon to delete a row.
} Right-click on a row in the table and use the commands in the drop-down menu.
Analysis Methods
The Targeted RNA analysis module performs the following analysis steps and then
writes analysis output files to the Alignment folder.
} Demultiplexes index reads
} Generates FASTQ files
} Aligns to a reference
} Performs differential expression analysis
Demultiplexing
Demultiplexing compares each Index Read sequence to the index sequences specified for
the run. No quality values are considered in this step.
Index reads are identified using the following steps:
} Samples are numbered starting from 1 based on the order they are listed for the run.
} Sample number 0 is reserved for clusters that were not assigned to a sample.
} Clusters are assigned to a sample when the index sequence matches exactly or when
there is up to a single mismatch per Index Read.
FASTQ File Generation
After demultiplexing, the software generates intermediate analysis files in the FASTQ
format, which is a text format used to represent sequences. FASTQ files contain reads for
each sample and the associated quality scores. Any controls used for the run and
clusters that did not pass filter are excluded.
Each FASTQ file contains reads for only 1 sample, and the name of that sample is
included in the FASTQ file name. FASTQ files are the primary input for alignment.
Alignment
During the alignment step, the banded Smith-Waterman algorithm aligns clusters from
each sample against references specified in the manifest file.
The banded Smith-Waterman algorithm performs local sequence alignments to
determine similar regions between 2 sequences. Instead of looking at the total sequence,
the Smith-Waterman algorithm compares segments of all possible lengths. Local
alignments are useful for dissimilar sequences that are suspected to contain regions of
similarity within the larger sequence. This process allows alignment across small
amplicon targets, often less than 10 bp.
Additionally, the software generates target hits files that contain raw aligned replicate
counts for each transcript.
6
Document # 1000000003340 v00
1
From the Local Run Manager dashboard, click the run name.
2
From the Run Overview tab, review the sequencing run metrics.
3
[Optional] Click the Copy to Clipboard
4
Click the Sequencing Information tab to review run parameters and consumables
information.
5
Click the Samples and Results tab to view the analysis report.
} If analysis was repeated, expand the Select Analysis drop-down and select the
appropriate analysis.
6
[Optional] Click the Copy to Clipboard
Local Run Manager Targeted RNA Analysis Module Workflow Guide
icon for access to the output run folder.
icon for access to the Analysis folder.
7
View Analysis Results
View Analysis Results
Analysis Report
The following results are provided on the Samples and Results tab. Use the toggle button
to view results as Individual Samples or Sample Groups.
View Alignment Summary as Individual Samples
1
From the Samples and Results tab, click View As Individual Samples.
2
To filter the list, enter a Sample ID or Sample Group name in the Search field, and
then press Enter. You can enter any part of the ID or name.
3
To view all, clear the Search field.
4
[Optional] Click Export All (TSV) to export the alignment summary results.
Alignment Summary in Individual Sample View
Table 1 Alignment Summary Table
Column Heading Description
Sample Index
An sample number based on the order the sample was listed for the
run.
Sample ID
The sample name provided when the run was created.
Sample Group
The number of biological replicate samples grouped by sample name.
Total Aligned
The total count of reads passing filter that align for the sample.
Reads (R1)
Percent Aligned
The percentage of reads passing filter that align for the sample.
Reads (R1)
Select Replicate Pair
1
Select a sample name from each drop-down list to view the relative abundance of
each RNA transcript between the selected samples.
} Data points close to the diagonal line represent transcripts with similar
abundance.
} Points distant from the line represent transcripts expressed at different levels.
Figure 1 Replicate Pair Graph (Example)
2
8
Hover over a point in the graph to view the unique assay ID for the transcript.
Document # 1000000003340 v00
Click an individual assay ID point on the graph to view the corresponding transcript
in the Replicate Results table.
4
From the Replicate Results table, select another gene or transcript from the dropdown list. Highlight the resulting row in the table to view the corresponding location
on Replicate Pair graph.
5
[Optional] Click Export All (TSV) to export the differential expression results.
Replicate Results
When viewing results as individual samples, the Targeted RNA analysis module
provides a replicate results table for each target in the selected comparison.
Table 2 Replicate Results Table
Column Heading
Description
Assay ID
A unique ID for each amplicon.
Gene
The gene targeted by the assay.
Transcript
The transcript targeted by the assay.
Left Exon
The left exon of targeted region.
Right Exon
The right exon of targeted region.
Sample 1 Count
The raw read count for sample 1.
Sample 2 Count
The raw read count for sample 2.
Log Ratio
The percentage of reads passing filter that align for the group.
View Alignment Summary as Sample Group
1
From the Samples and Results tab, click View As Sample Groups.
2
To filter the alignment summary list, enter a Sample Group name in the Search field,
and then press Enter. You can enter any part of the name.
3
To view all, clear the Search field.
4
[Optional] Click Export All (TSV) to export the alignment summary results.
Alignment Summary in Sample Group View
Table 3 Alignment Summary Table
Column Heading
Description
Group Index
A unique number for the group.
Sample Group
The sample name provided when the run was created.
# Replicates
The number of biological replicate samples grouped by sample
name.
Total Aligned Reads (R1)
The total count of reads passing filter that align for the group.
Percent Aligned Reads
The percentage of reads passing filter that align for the group.
(R1)
Select Comparison
1
Select a pair of sample groups from the Select Comparison drop-down list to view
the normalized read counts between the selected sample groups on the Normalized
Read Count Comparison graph.
Local Run Manager Targeted RNA Analysis Module Workflow Guide
9
Analysis Report
3
Figure 2 Normalized Read Count Comparison Graph (Example)
2
Hover over a point in the graph to view the unique assay ID for the transcript.
3
Click an individual assay ID point on the graph to view the corresponding transcript
in the Differential Expression Results table.
4
From the Differential Expression Results table, select another gene or transcript from
the drop-down list. Highlight the resulting row in the table to view the
corresponding location on Normalized Read Count Comparison graph.
5
[Optional] Click Export All (TSV) to export the differential expression results.
Differential Expression Results
When viewing results as sample groups, the Targeted RNA analysis module provides a
differential expression table for each target in the selected comparison.
Table 4 Differential Expression Results Table
Column Heading
Description
Assay ID
A unique ID for each amplicon.
Gene
The gene targeted by the assay.
Transcript
The transcript targeted by the assay.
Left Exon
The left exon of targeted region.
Right Exon
The right exon of targeted region.
Normalized Count 1
The mean raw read counts for sample 1 after library size
normalization.
Normalized Count 2
The mean raw read counts for sample 2 after library size
normalization.
Fold Change
The ratio of mean normalized counts for sample 2 divided by
mean normalized counts for sample 1.
P-Value
The statistical significance of the differential expression.
Q-Value
The p-value adjusted for false discovery rate (FDR) using the
Benjamini-Hochberg method.
10
Document # 1000000003340 v00
The following analysis output files are generated for the Targeted RNA analysis module
and provide analysis results for alignment. Analysis output files are located in the
Alignment folder.
File Name
Description
Demultiplexing (*.demux)
Intermediate files containing demultiplexing results.
FASTQ (*.fastq.gz)
Intermediate files containing quality scored base
calls. FASTQ files are the primary input for the
alignment step.
Alignment files in the
BAM format (*.bam)
Contains aligned reads for a given sample.
TargetHitsPerSample_M#.tsv
Contains the raw aligned replicate counts for each
transcript.
TargetedRNASeqGeneExpression.tsv
Contains the genes used for normalization and
normalization results.
TargetedRNASeqGeneExpression_M#.tsv
Contains sample correlation and differential
expression results.
Demultiplexing File Format
The process of demultiplexing reads the index sequence attached to each cluster to
determine from which sample the cluster originated. The mapping between clusters and
sample number are written to 1 demultiplexing (*.demux) file for each tile of the flow
cell.
The demultiplexing file naming format is s_1_X.demux, where X is the tile number.
Demultiplexing files start with a header:
} Version (4 byte integer), currently 1
} Cluster count (4 byte integer)
The remainder of the file consists of sample numbers for each cluster from the tile.
When the demultiplexing step is complete, the software generates a demultiplexing file
named DemultiplexSummaryF1L1.txt.
} In the file name, F1 represents the flow cell number.
} In the file name, L1 represents the lane number.
} Demultiplexing results in a table with 1 row per tile and 1 column per sample,
including sample 0.
} The most commonly occurring sequences in index reads.
FASTQ File Format
FASTQ file is a text-based file format that contains base calls and quality values per read.
Each record contains 4 lines:
} The identifier
} The sequence
} A plus sign (+)
} The quality scores in an ASCII encoded format
Local Run Manager Targeted RNA Analysis Module Workflow Guide
11
Analysis Output Files
Analysis Output Files
The identifier is formatted as:
@Instrument:RunID:FlowCellID:Lane:Tile:X:Y ReadNum:FilterFlag:0:SampleNumber
Example:
@SIM:1:FCX:1:15:6329:1045 1:N:0:2
TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
+
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=
BAM File Format
A BAM file (*.bam) is the compressed binary version of a SAM file that is used to
represent aligned sequences up to 128 Mb. SAM and BAM formats are described in
detail at https://samtools.github.io/hts-specs/SAMv1.pdf.
BAM files use the file naming format of SampleName_S#.bam, where # is the sample
number determined by the order that samples are listed for the run.
BAM files contain a header section and an alignments section:
} Header—Contains information about the entire file, such as sample name, sample
length, and alignment method. Alignments in the alignments section are associated
with specific information in the header section.
} Alignments—Contains read name, read sequence, read quality, alignment
information, and custom tags. The read name includes the chromosome, start
coordinate, alignment quality, and the match descriptor string.
The alignments section includes the following information for each or read pair:
} RG: Read group, which indicates the number of reads for a specific sample.
} BC: Barcode tag, which indicates the demultiplexed sample ID associated with the
read.
} SM: Single-end alignment quality.
} AS: Paired-end alignment quality.
} NM: Edit distance tag, which records the Levenshtein distance between the read and
the reference.
} XN: Amplicon name tag, which records the amplicon tile ID associated with the
read.
BAM files are suitable for viewing with an external viewer such as IGV or the UCSC
Genome Browser.
BAM index files (*.bam.bai) provide an index of the corresponding BAM file.
Target Hits File Format
The target hits file, TargetHitsPerSample_M#.tsv, is a tab-delimited file that contains the
raw aligned replicate counts for each transcript. An output file is created for each
manifest.
12
Column Heading
Description
Gene Name
The name of the gene.
Amplicon ID
The amplicon identifier constructed from the gene name,
transcript ID, left exon, right exon, and assay ID.
Document # 1000000003340 v00
Description
Assay ID
The unique identifier for the probe set.
Sample ID
Aligned count for all transcripts for this sample. There is a
column for each sample using this manifest.
Gene Expression File Format
The gene expression file, TargetedRNASeqGeneExpression.tsv, is a tab-delimited text file
that is organized into the following sections: Sample Correlation and Differential
Expression. This file is the final result of the Targeted RNA workflow.
Sample Correlation Section
Column Heading
Description
Sample Name 1
The first sample (one or more replicates) being compared.
Sample Name 2
The second sample (one or more replicates) being compared.
R^2
The square of the correlation coefficient.
Differential Expression Section
Column Heading
Description
Gene Name
The name of the gene.
Amplicon ID
The amplicon identifier constructed from the gene name,
transcript ID, left exon, right exon, and assay ID.
Assay ID
The unique identifier for the probe set.
Sample Name 1
The first sample being compared, which can be 1 or more
replicates.
Sample Name 2
The second sample being compared, which can be 1 or more
replicates.
Raw Mean Counts 1
The mean of counts for sample 1 across replicates.
Raw Mean Counts 2
The mean of counts for sample 2 across replicates.
Normalized Mean
Counts 1
The mean raw read counts for sample 1 after library size
normalization.
Normalized Mean
Counts 2
The mean raw read counts for sample 2 after library size
normalization.
Fold Change
The ratio of mean normalized counts for sample 2 divided by
mean normalized counts for sample 1 (mnc2/mnc1).
log2(Fold Change)
The log2 (ratio of mnc2/mnc1).
Local Run Manager Targeted RNA Analysis Module Workflow Guide
13
Analysis Output Files
Column Heading
Column Heading
Description
P-value
The statistical significance of the differential expression.
Q-value
The p-value adjusted for false discovery rate (FDR) using the
Benjamini-Hochberg method.
Supplementary Output Files
The following output files provide supplementary information, or summarize run results
and analysis errors. Although, these files are not required for assessing analysis results,
they can be used for troubleshooting purposes. All files are located in the Alignment
folder unless otherwise specified.
File Name
Description
AnalysisLog.txt
Processing log that describes every step that occurred
during analysis of the current run folder. This file
does not contain error messages.
Located in the root level of the run folder.
AnalysisError.txt
Processing log that lists any errors that occurred
during analysis. This file is present only if errors
occurred.
Located in the root level of the run folder.
CompletedJobInfo.xml
Written after analysis is complete, contains
information about the run, such as date, flow cell ID,
software version, and other parameters.
Located in the root level of the run folder.
DemultiplexSummaryF1L1.txt
Reports demultiplexing results in a table with 1 row
per tile and 1 column per sample.
ErrorsAndNoCallsByLaneTile
ReadCycle.csv
A comma-separated values file that contains the
percentage of errors and no-calls for each tile, read,
and cycle.
Mismatch.htm
Contains histograms of mismatches per cycle and nocalls per cycle for each tile.
TargetedRNARunStatistics.xml
Contains summary statistics specific to the run.
Located in the root level of the run folder.
Summary.xml
Contains a summary of mismatch rates and other
base calling results.
Summary.htm
Contains a summary web page generated from
Summary.xml.
Analysis Folder
The analysis folder holds the files generated by the Local Run Manager software.
The relationship between the output folder and analysis folder is summarized as follows:
} During sequencing, Real-Time Analysis (RTA) populates the output folder with files
generated during image analysis, base calling, and quality scoring.
14
Document # 1000000003340 v00
}
}
RTA copies files to the analysis folder in real time. After RTA assigns a quality score
to each base for each cycle, the software writes the file RTAComplete.xml to both
folders.
When the file RTAComplete.xml is present, analysis begins.
As analysis continues, Local Run Manager writes output files to the analysis folder,
and then copies the files back to the output folder.
Folder Structure
Data
Intensities
BaseCalls
Alignment—Contains *.bam and *.vcf files, and files specific to the
analysis module.
L001—Contains one subfolder per cycle, each containing *.bcl files.
Sample1_S1_L001_R1_001.fastq.gz
Sample2_S2_L001_R1_001.fastq.gz
Undetermined_S0_L001_R1_001.fastq.gz
L001—Contains *.locs files, 1 for each tile.
RTA Logs—Contains log files from RTA software analysis.
InterOp—Contains binary files used by Sequencing Analysis Viewer (SAV).
Logs—Contains log files describing steps performed during sequencing.
Queued—A working folder for software; also called the copy folder.
AnalysisError.txt
AnalysisLog.txt
CompletedJobInfo.xml
QueuedForAnalysis.txt
[WorkflowName]RunStatistics
RTAComplete.xml
RunInfo.xml
runParameters.xml
Alignment Folders
Each time that analysis is requeued, the Local Run Manager creates an Alignment folder
named AlignmentN, where N is a sequential number.
Local Run Manager Targeted RNA Analysis Module Workflow Guide
15
Analysis Output Files
}
Notes
For technical assistance, contact Illumina Technical Support.
Table 5 Illumina General Contact Information
Website
Email
www.illumina.com
[email protected]
Table 6 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
North America
1.800.809.4566
Japan
Australia
1.800.775.688
Netherlands
Austria
0800.296575
New Zealand
Belgium
0800.81102
Norway
China
400.635.9898
Singapore
Denmark
80882346
Spain
Finland
0800.918363
Sweden
France
0800.911850
Switzerland
Germany
0800.180.8994
Taiwan
Hong Kong
800960230
United Kingdom
Ireland
1.800.812949
Other countries
Italy
800.874909
Contact Number
0800.111.5011
0800.0223859
0800.451.650
800.16836
1.800.579.2745
900.812168
020790181
0800.563118
00806651752
0800.917.0041
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at
support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go
to support.illumina.com, select a product, then select Documentation & Literature.
Local Run Manager Targeted RNA Analysis Module Workflow Guide
Technical Assistance
Technical Assistance
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement