molcellbiol_selpub_golderer_2001

molcellbiol_selpub_golderer_2001
Nitric oxide synthase is induced in
sporulation of Physarum polycephalum
Georg Golderer, Ernst R. Werner, Stefan Leitner, Peter Gröbner, and Gabriele Werner-Felmayer1
Institute of Medical Chemistry and Biochemistry, University of Innsbruck, A-6020 Innsbruck, Austria
The myxomycete Physarum polycephalum expresses a calcium-independent nitric oxide (NO) synthase (NOS)
resembling the inducible NOS isoenzyme in mammals. We have now cloned and sequenced this, the first
nonanimal NOS to be identified, showing that it shares < 39% amino acid identity with known NOSs but
contains conserved binding motifs for all NOS cofactors. It lacks the sequence insert responsible for calcium
dependence in the calcium-dependent NOS isoenzymes. NOS expression was strongly up-regulated in
Physarum macroplasmodia during the 5-day starvation period needed to induce sporulation competence.
Induction of both NOS and sporulation competence were inhibited by glucose, a growth signal and known
repressor of sporulation, and by L-N6–(1-iminoethyl)-lysine (NIL), an inhibitor of inducible NOS. Sporulation,
which is triggered after the starvation period by light exposure, was also prevented by
1H-[1,2,4]oxadiazolo-[4,3-a]quinoxalin-1-one (ODQ), an inhibitor of NO-sensitive guanylate cyclase. In
addition, also expression of lig1, a sporulation-specific gene, was strongly attenuated by NIL or ODQ.
8-Bromo-cGMP, added 2 h before the light exposure, restored the capacity of NIL-treated macroplasmodia to
express lig1 and to sporulate. This indicates that the second messenger used for NO signaling in sporulation of
Physarum is cGMP and links this signaling pathway to expression of lig1.
[Key Words: nitric oxide synthase; cGMP; glucose; sporulation; Physarum polycephalum]
Received December 6, 2000; revised version accepted March 9, 2001.
Physarum polycephalum is a plasmodial slime mold or
myxomycete and is also classified as Mycetozoa (Baldauf
and Doolittle 1997). It has a life cycle involving both
mobile and stationary stages (Raub and Aldrich 1982;
Wick and Sauer 1982). Macroplasmodia are giant, single
multinuclear cells. They live in the dark on moist organic matter, feed by phagocytosis, and move by creeping. The nuclei undergo naturally synchronous mitosis
without cell division. On maturation or when food becomes limited, macroplasmodia differentiate into sporangia, a process that depends on migration toward light.
After meiosis, the sporangia release haploid spores,
which germinate into flagellated myxamoebae. Myxamoebae—usually from different plasmodia, thus allowing for genetic recombination—can fuse into a zygote,
which grows into a new plasmodium. Alternatively, in
response to adverse environmental conditions, Physarum plasmodia can encyst into dormant multinucleated
macrocysts (or sclerotia). These remain viable for several
years. In vitro, plasmodia grown in shaken liquid culture
instead of on solid surfaces form so-called microplasmodia, which differentiate into microsclerotia or spherules,
analogous structures to the naturally occurring sclerotia.
1
Corresponding author.
E-MAIL gabriele.werner-felmayer@uibk.ac.at; FAX 43-512-507-2865.
Article and publication are at www.genesdev.org/cgi/doi/10.1101/
gad.890501.
Plasmodia can also reversibly fragment within 5 h when
challenged with low temperatures (Kakiuchi and Ueda
1999).
Because nuclear division in the plasmodium is uncoupled from cell division and the unicellular state cannot be overcome, Physarum is considered a ‘lower eukaryote’, although it is clearly more complex than protists. Molecular phylogenetic studies place Physarum
together with the cellular slime mold Dictyostelium discoideum and other members of the Mycetozoans among
the multicellular eukaryotes, representing a group more
closely related to the animal-fungal clade than green
plants (Baldauf and Doolittle 1997).
In the developmental cycle of Physarum, the different
stages clearly involve differential expression of genes,
some of which have been characterized (Bailey 1995;
Kroneder 1999). In higher animals, one signaling molecule that has been found to have roles in proliferation,
apoptosis, differentiation, and development is nitric oxide (NO; Peunova and Enikolopov 1995; Peunova et al.
1996; Beck et al. 1999; Kim et al. 1999). In previous work,
we detected NO synthase (NOS) activity in Physarum
and showed that this organism has biosynthetic activities for the production of folic acid as well as of 5,6,7,8tetrahydrobiopterin (H4-biopterin; Werner-Felmayer et
al. 1994), an essential cofactor of all known NOS isoenzymes (Mayer and Hemmens 1997). Biochemically, purified Physarum NOS shares a number of features with
GENES & DEVELOPMENT 15:1299–1309 © 2001 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/01 $5.00; www.genesdev.org
1299
Golderer et al.
inducible NOS (NOS 2) from mammals, the most prominent one being independence from exogenous calcium
(Werner-Felmayer et al. 1994). In the present study, we
aimed to clarify whether the observed biochemical similarity of the Physarum NOS to the inducible NOS isoenzyme from mammals reflected a high degree of molecular conservation during evolution of this protein. We
also wished to define conditions inducing Physarum
NOS and, if possible, to identify a biological role for endogenous NO formation.
Results
Analysis of Physarum NOS sequences
Scaling up the purification protocol for Physarum NOS
(Werner-Felmayer et al. 1994) allowed the internal peptide sequences to be determined, and primers were designed to recognize either nucleotide sequences deduced
from these peptide sequences or consensus regions of
other available NOS sequences from mammals, birds,
insects, and a mollusc. A 600-bp probe for Physarum
NOS was generated by polymerase chain reaction (PCR)
and was used for screening a Physarum cDNA library
(detailed in Materials and Methods). Two NOS cDNAs,
designated physnosa and physnosb, were isolated. Both
clones contained complete reading frames for NOS: The
3571-bp physnosa clone (GenBank accession no.
AF145041) encoded a 1055 amino acid protein with a
calculated molecular mass of 118,180.89 Da; the 3316-bp
physnosb clone (GenBank accession no. AF145040) encoded a 1046 amino acid protein of 117,566.52 Da. This
agrees with results obtained by denaturing-gel electrophoresis of Physarum NOS purified according to the optimized protocol, which ran at about 120 kD (see Materials and Methods). Physnosb lacked amino acids at positions 726, 1040–1043, and 1050–1055 of physnosa but
otherwise shared 82% amino acid identity with physnosa. Northern blot analysis showed that both mRNA
species were similarly expressed during cell cycle,
spherulation, and sporulation of Physarum (data not
shown).
A PILEUP of the deduced protein sequences with consensus sequences of the three NOS isoenzymes (Fig. 1A)
shows that like mammalian inducible NOS, both Physarum NOS proteins lacked the spacer sequence responsible for the calcium dependence of neuronal and endothelial NOS from mammals (Salerno et al. 1997). The
established binding motifs of mammalian NOSs for
FMN, FAD, NADPH, calmodulin (Bredt et al. 1991),
heme (Chen et al. 1994), H4-biopterin (Cho et al. 1995;
Crane et al. 1998), zinc (Raman et al. 1998; Fishmann et
al. 1999), and caveolin (Garcia-Cardena et al. 1997; Crane
et al. 1998) were all conserved in both Physarum NOS
proteins. The conserved binding domains for physnosa
are shown in Figure 1B. Of the 27 residues reported to be
in contact with heme, H4-biopterin, and arginine (closer
than 3.6 Å; Fischmann et al. 1999), 24 (89%) were conserved in both Physarum NOS cDNAs. One of the replacements, T157, was conservative, leaving only two
1300
GENES & DEVELOPMENT
nonconservative replacements (L393 and P406; Fig. 1B).
The overall identity to NOS protein sequences from
other species, however, was less than 39%. In accordance with this low degree of identity, antisera raised
versus mammalian endothelial, neuronal, or inducible
NOS did not stain purified Physarum NOS in Western
blots (data not shown). Transient transfection of Sf9 cells
by baculovirus carrying the physnosa cDNA, modified at
the Kozak motif (see Materials and Methods), yielded a
specific activity (measured as formation of 3H-citrulline)
of 517 pmol/(mg•min) versus 28 pmol/(mg•min) found
in mock-transfected cells. This verifies that the physnosa cDNA encoded a functional NOS.
Despite the lack of the spacer sequence responsible for
calcium dependence, Physarum NOSs were similarly remote from all three NOS isoenzymes of higher eukaryotes. Phylogenetic tree analysis of a 295-amino-acid,
highly conserved region of the oxygenase domain of NOS
protein sequences by the DISTANCES program placed
Physarum NOS on an individual branch evolving from a
low position of the tree (Fig. 2). The distance of Physarum NOSs to NOSs from other species was comparable
to the one observed for the not further characterized
reading frame designated YflM from Bacillus subtilis,
which is homologous to the NOS oxygenase domain (Yamamoto et al. 1997).
NOS expression is induced during achievement of
sporulation competence
To make them competent for sporulation, Physarum
macroplasmodia were starved for 5 d in the dark. During
this period, NOS mRNA levels (Fig. 3A) and activity, as
determined by accumulation of nitrite plus nitrate (Fig.
3B) were strongly induced from 0.1 mM to 9 mM at the
end of the starvation phase (120 h), the time at which the
light pulse was set, which then triggered formation of
sporangia within the following 14 h. Thus, Physarum
NOS is an inducible isoenzyme.
We also checked the mRNA expression of GTP cyclohydrolase I, the enzyme of pteridine biosynthesis that
can limit the supply of the H4-biopterin cofactor for
NOS. In mammalian cells, GTP cyclohydrolase I is induced in parallel with NOS (for review, see Werner et al.
1998). In contrast, mRNA levels of GTP cyclohydrolase
I mRNA decreased during starvation of Physarum (Fig.
3A). Intracellular H4-biopterin amounts also declined,
from 1.7 nmol/mg of protein to about 500 pmol/mg (Fig.
3B). However, even this final amount is higher than the
maximal level reported for induced cytokine-activated
mammalian cells (Werner et al. 1998) and, thus, is more
than sufficient for NO synthesis.
L-N6–(1-iminoethyl)-lysine (NIL), a selective inhibitor
of inducible NOS (Moore et al. 1994), efficiently inhibited NOS activity (Fig. 3B) without affecting NOS
mRNA expression or pteridine biosynthesis (Fig. 3A,B).
The concentration causing half-maximal inhibition was
200 µM both for NOS activity in homogenates and accumulation of nitrite plus nitrate in supernatants from
intact macroplasmodia (data not shown).
NO synthase in Physarum polycephalum
Figure 1. Physarum nitric oxide synthase (NOS) sequences do not contain the spacer sequence conferring calcium dependence and
show high conservation of various binding domains. (A) Alignments of Physarum NOS forms a [AF145041] and b [AF145040] with
inoscons (consensus sequence of inducible NOSs from man [L09210], rat [L12562], mouse [M87039], guinea pig [AF027180], and
chicken [U56540]), with nnoscons (consensus sequence of neuronal NOSs from man [L02881], mouse [D14552], rat [X59949], and
rabbit [U91584]), and with enoscons (consensus sequence of endothelial NOSs from man [M95296], mouse [ U53142], bovine [M89952],
and pig [U59924]) have been created using the PILEUP program. Only the region containing the spacer conferring calcium dependence
and the FMN-binding domain is shown. A postscript file of the complete alignment of physnosa and physnosb with the three
isoenzyme consensus sequences is available on request (gabriele.werner-felmayer@uibk.ac.at). Amino acids in inverse mode are
conserved in more than three of the compared sequences. Similar amino acids are painted gray. Similarity is assumed for all pairs with
positive elements in the amino acid substitution matrix (Henikoff and Henikoff 1992). Capital letters in consensus sequences denote
conserved amino acids; small letters, amino acids conserved in a majority of the sequences; and x, a nonconserved amino acid. (B) Parts
of the amino acid sequence of physnosa are shown, and conserved residues are displayed as detailed for A. The motifs were assigned
according to Bredt et al. (1991) for the reductase domain (downstream position 425). Motifs in the oxygenase domain (upstream
position 425) were assigned on the basis of NOS oxygenase domain crystal structures (Crane et al. 1998; Raman et al. 1998; Fischmann
et al. 1999). The arrows indicate the 27 residues, which in the NOS oxygenase domain crystal structures are closer than 3.6 Å to the
functional groups zinc, heme, H4-biopterin (H4bip), and/or L-arginine (Fischmann et al. 1999). cav denotes the caveolin binding region
(Garcia-Cardena et al. 1997).
Glucose is a repressor of NOS induction and
of sporulation
For the Physarum isolate used in this study, starting
starvation to obtain sporulation competence in presence
of reduced nutrients (see Materials and Methods), in-
stead of completely removing nutrients (Daniel and
Rusch 1962a), turned out to yield optimal sporulation
ratios. Nitrite plus nitrate levels in supernatants started
to increase ∼ 30 h after beginning starvation and reached
7 mM at 120 h in the experiment shown in Figure 4. The
7.8-mM glucose present at the beginning of sporulation
GENES & DEVELOPMENT
1301
Golderer et al.
Figure 2. Phylogenetic tree of nitric oxide synthases (NOSs). A
295– amino acid– long, highly conserved region, including the
heme-binding domain, was aligned using PILEUP, and this
alignment was used to calculate phylogenetic distances using
Kimura’s method (Kimura 1983) with the DISTANCE program.
From the calculated distances, a tree was assembled by
GROWTREE. The following sequences (species, accession number) have been included (ordered alphabetically by abbreviation;
i is for inducible; n, neuronal; and e, endothelial): ANOPHNOS
[Anopheles stephensi, AF053344] CANiNOS [Canis familiaris,
AF077821], CAViNOS [Cavia porcellus, AF027190], CYPiNOS
[Cyprinos carpio, AJ242906], DROSNOS [Drosophila melanogaster, U25117], GALiNOS [Gallus gallus, U46504], HOMeNOS [Homo sapiens, M95296], HOMiNOS [Homo sapiens,
L09210], HOMnNOS [Homo sapiens, L02881], LYMNOS [Lymnaea stagnalis, AF012531], MANDNOS [Manduca sexta,
AF062749], MUSeNOS [Mus musculus, U53412], MUSiNOS
[Mus musculus, M87039], MUSnNOS [Mus musculus, D14552],
ORYnNOS [Oryctolagus cuniculus, U91584], PHYSNOSa
[Physarum polycephalum, AF145041], PHYSNOSb [Physarum
polycephalum, AF145040], RATiNOS [Rattus rattus, L12562],
RATnNOS [Rattus rattus, X59949], RHODNOS [Rhodnius prolixus, U59389], SUSeNOS [Sus scrofa, U59924], YflM [Bacillus
subtilis, D86417]. The inserted scale shows the distance of 10
Kimura units.
experiments was completely consumed within 48 to 72
h (Fig. 4A). Maintaining glucose levels at 62.4 mM, the
usual concentration for promoting growth, effectively
inhibited NOS activity (Fig. 4A) by suppressing induction of NOS mRNA expression (Fig. 4B). In contrast,
GTP cyclohydrolase I mRNA expression was strongly
induced by glucose (Fig. 4B).
cGMP is the second messenger used for NO signaling in
lig 1 mRNA expression and in sporulation of Physarum
We then were interested to see whether the strong in-
1302
GENES & DEVELOPMENT
duction of NOS during development of sporulation competence was functionally linked to sporulation and
whether cGMP was used as a second messenger. We
therefore studied the effect of different drugs interfering
with NO/cGMP signaling on sporulation rates of macroplasmodia, as well as on lig1 mRNA expression. Lig1 is
a recently discovered early gene expressed during phytochrome-controlled sporulation. Its expression level correlates positively with the probability to sporulate (Kroneder et al. 1999). In addition, we tested the effect of
glucose, a physiological repressor of sporulation (Daniel
and Rusch 1962a).
Macroplasmodia treated with NIL were no longer able
to sporulate (Fig. 5). Also, lig1 mRNA expression was
strongly reduced in NIL-treated plasmodia compared
with untreated control plasmodia (Fig. 5). Macroscopically, NIL-treated cultures looked identical to untreated
cultures, and activity of glucose-6-phosphate dehydrogenase remained unaffected by NIL, indicating that the
lack of sporulation is not caused by possible toxic side
effects of NIL (data not shown). Inhibition of sporulation
was only observed if NIL was added at the beginning of
starvation. Addition of the inhibitor at 45 h and 118 h
(i.e., 2 h before exposing the cultures to the sporangiainducing light stimulus) could not prevent sporulation
Figure 3. Nitric oxide synthase (NOS) and GTP cyclohydrolase
I expression during starvation and sporulation of Physarum in
absence or presence of NIL. (A) Northern blots for NOS, GTP
cyclohydrolase I (GTP-CH I), and the ribosomal protein S11 at
different times in absence or presence of 5 mM NIL. (B) Data on
nitrite plus nitrate accumulation in supernatants and intracellular H4-biopterin levels at different times. Closed symbols
with a full line indicate untreated controls; open symbols with
a dashed line, results in presence of 5 mM NIL.
NO synthase in Physarum polycephalum
Figure 4. Effects of glucose on nitric oxide synthase (NOS) and
GTP cyclohydrolase I expression. (A) Accumulation of nitrite
plus nitrate in cultures supplemented with glucose (left panel)
and glucose levels (right panel) during the starvation period inducing sporulation competence. Macroplasmodia were inoculated in sporulation medium containing 7.8 mM glucose. At the
time points labeled by arrows (24, 48, 72, 96 h), glucose was
added to half of the cultures to 62.4 mM, the concentration used
in growth medium. At 0 and 24 h as well as 24 h after each
glucose addition (48, 72, 96, 120 h), nitrite plus nitrate (left
panel) and glucose (right panel) were measured in supernatants
from both control and glucose-supplemented cultures. Data
from control cultures are shown in filled circles with solid lines;
data from glucose-treated cultures, in open circles with dotted
lines. Values are means of three independent cultures. (B) NOS
and GTP cyclohydrolase I mRNA expression in starved or glucose-treated cultures. Macroplasmodia were harvested for RNA
extraction at the times indicated. In the case of glucose treatment, RNA was extracted 24 h after each glucose addition (compare with A). Northern blots were hybridized with probes for
NOS, GTP cyclohydrolase I (GTP-CHI), and the ribosomal protein S11.
(data not shown). Complete (100%) inhibition of sporulation was caused by 250 µM NIL. With 100 µM of NIL,
three of 15 cultures (20%) sporulated. Aminoguanidine
(1 mM), another NOS inhibitor preferentially affecting
inducible NOS (Misko et al. 1993), also inhibited sporulation (two of 19 cultures [10%] sporulated).
Complete (100%) inhibition of sporulation and a
strong decrease of lig1 mRNA levels were also caused by
150 µM ODQ, a selective inhibitor of NO-sensitive guanylate cyclase (Fig. 5; Garthwaite et al. 1995). In the presence of 100 µM ODQ, nine of 28 cultures (32%) sporulated.
8-bromo-cGMP (500 µM), a nonhydrolysable cGMP
analog (Francis et al. 1988), added to NIL-treated macroplasmodia at 118 h of starvation (2 h before the light
pulse) effectively reversed inhibition of sporulation by
250 µM NIL (Fig. 5). Also lig1 mRNA levels were clearly
restored (Fig. 5). Adding only 250 µM of 8-bromo-cGMP
to cultures treated with 250 µM NIL resulted in sporulation of four of 11 macroplasmodia (36%). 8-BromocGMP could not trigger NIL-treated macroplasmodia to
sporulate when added 12 h before or immediately at the
beginning of the light pulse. Also, addition of 8-bromocGMP at the end of the 4 h of light treatment, or 6 h or
12 h thereafter, could not reverse inhibition of sporulation by NIL (data not shown). Furthermore, 8-bromocGMP had no effect on sporulation or lig1 mRNA expression of otherwise untreated macroplasmodia (Fig. 5)
and could not accelerate sporulation when added on day
2 or 4 of the starvation period (data not shown).
Macroplasmodia were unable to sporulate and to express lig1 mRNA in presence of glucose (Fig. 5). The
effects of 250 µM NIL, 150 µM ODQ, and 500 µM
8-bromo-cGMP in presence of 250 µM NIL and of glucose on sporulation (shown in Fig. 5) are highly significant as determined by Kruskal-Wallis analysis (calculated using SPSS for Windows 9.0.1): P is <1.0 × 10−14 for
NIL versus controls and for ODQ versus controls,
4.43 × 10−9 for 8-bromo-cGMP plus NIL versus NIL
alone, and 2.25 × 10−14 for glucose-treated versus starved
plasmodia. Also, the attenuation of lig1 mRNA expression by NIL, ODQ, or glucose (P<0.0001), as well as the
reversal of the NIL effect by 8-bromo-cGMP on lig1
mRNA expression (P<0.001) shown in Figure 5, were
highly significant (Student’s t-test).
Figure 5. Manipulation of sporulation and lig1 mRNA levels
in Physarum polycephalum by drugs affecting nitric oxide
(NO)/cGMP signaling and by glucose. Macroplasmodia were inoculated in sporulation medium without further supplements
(A) or were supplemented with NIL (an inhibitor of iNOS, 250
µM) (B) or ODQ (an inhibitor of soluble, NO-sensitive guanylate
cyclase, 150 µM) (C). 8-Bromo-cGMP (a cGMP substitute, 500
µM) was added to NIL-treated cultures (D) or to control cultures
(E) at 118 h, which is 2 h before the light pulse triggering formation of mature sporangia. Some cultures were supplemented
with glucose to 62.4 mM at 24, 48, 72, and 120 h (F). Sporulation
(gray bars) is shown as percentage of the cultures sporulating
(left y-axis), number of cultures tested were 72 (A), 36 (B), 35 (C),
16 (D), 21 (E), and 24 (F). Lig1 mRNA levels (black bars, right
y-axis) were quantified using real-time PCR (Taqman technology). Values show lig1 mRNA levels at 8 h after setting the light
pulse and are means from triplicate PCR reactions of one of
two similar experiments (for details, see Materials and Methods).
GENES & DEVELOPMENT
1303
Golderer et al.
Discussion
For mammals, the biological significance of endogenously formed NO as a signal molecule in vasodilation
(Moncada and Higgs 1995), neurotransmission (Bredt
1996), gene regulation (Hentze and Kuhn 1996; Beck et
al. 1999), and development (Peunova et al. 1996; Kim et
al. 1999), as well as its janus-faced role as a cytotoxic/
cytoprotective agent in host defense, is well established
(Nathan 1997; Kim et al. 1999). In recent years, NOS has
been discovered in a variety of nonmammalian animals,
including birds (Lin et al. 1996), fish (Laing et al. 1996,
1999; Saeij et al. 2000), insects (for review, see Müller
1997), and molluscs (Korneev et al. 1998). There is also
evidence that NOS is not restricted to the animal kingdom; NOS or NOS-like activity has been detected in
slime molds (Werner-Felmayer et al. 1994; Ninnemann
and Maier 1996; Tao et al. 1997), fungi (Ninnemann and
Maier 1996), plants (Ninnemann and Maier 1996; Delledonne et al. 1998; Durner et al. 1998), and parasitic protists (Ghigo et al. 1995; Paveto et al. 1995; Basu et al.
1997). NOS also seems to occur in bacteria (Chen and
Rosazza 1995; Morita et al. 1997; Sari et al. 1998). However, until now, full-length NOS sequences have only
been reported for animals.
Here, two distinct cDNA clones encoding calcium-independent NOS with similar size and characteristics
sharing 82% amino acid identity were isolated from
Physarum; this is a similar degree of difference as exists
between human and canine inducible NOSs. Parallel occurrence of two types of the same NOS isoenzyme has
not been described for other species. Interestingly, the
plasmodium-specific mRNA hapP from Physarum,
which encodes for a protein of unknown function, occurs
in two forms differing by 9.6% (predicted amino acid
sequence), which were traced to two alleles of the same
gene. Both heterozygous plasmodia expressing both
forms and homozygous plasmodia were identified
(Lépine et al. 1995). Although it remains to be determined whether the two NOS sequences observed in the
diploid Physarum isolate used in this work are products
from two differing alleles of the same gene, such a hypothesis is supported by the observation that the two
NOS forms of Physarum are not differentially regulated
during cell cycle, spherulation, and sporulation. Also,
protein sequencing data indicated that NOS purified
from Physarum macroplasmodia was a mixture of physnosa and physnosb. Neither cDNA analysis (this study)
nor enzyme purification (Werner-Felmayer et al. 1994)
yielded any hints of additional NOS isoenzymes, that is,
calcium-dependent NOSs in Physarum.
The N terminus of the proteins encoded by the two
Physarum mRNAs corresponded to position 75 of mammalian inducible NOSs. Still, it extended 30 amino acids
upstream of the fully conserved zinc binding motif (Raman et al. 1998; Fischmann et al. 1999). As can be concluded from investigations on the oxygenase domain of
mammalian inducible NOS, where catalytic properties
of deletion mutants lacking amino acids 1–65 were
equivalent to the wild-type protein (Ghosh et al. 1997),
1304
GENES & DEVELOPMENT
Physarum NOS contains all sequence sections essential
for function.
Phylogenetic tree analysis places Physarum NOSs on
an individual and low branch distant from mollusc, insect, bird, and mammalian NOSs. In fact, B. subtilis
YflM, a characterized sequence homologous to the oxygenase domain of mammalian NOSs (Yamamoto et al.
1997), and the same region of Physarum NOSs are comparably distant from NOSs of other species. However, in
line with our finding that the biochemistry of Physarum
NOS is strikingly similar to that of mammalian inducible NOS (Werner-Felmayer et al. 1994), motifs and residues essential for NOS function are highly conserved in
Physarum NOS despite a comparatively small overall
homology to NOS from other species. Data from molecular phylogenetic analysis group Physarum and other
Mycetozoa, including D. discoideum among the eukaryote crown taxa between fungi and green plants (Baldauf
and Doolittle 1997). Thus, the Physarum NOS sequences might provide a link to a still hypothetical NOS
from green plants, in which endogenous NO has been
identified as a signal in host defense (Delledonne et al.
1998; Durner et al. 1998; Hausladen and Stamler 1998).
In D. discoideum (Tao et al. 1997), as well as in Neurospora crassa (Ninnemann and Maier 1996), endogenous NO and NO gas in Dictyostelium or sodium nitroprusside in Neurospora inhibited differentiation. In
contrast, NO is a differentiation-promoting signal in
nerve growth factor–induced differentiation of PC12
cells into neurons (Peunova and Enikolopov 1995). In
Physarum, we found that NO is formed during differentiation of macroplasmodia into the sporulation competent state, a process that includes growth arrest, condensation of cellular material, a mitosis, migration, and development of light-sensitivity. The light pulse triggering
sporulation is processed by a phytochrome-type photoreceptor (Starostzik and Marwan 1995). Stimulation of
this photoreceptor induces expression of several genes,
of which one, lig1, has been characterized recently (Kroneder et al. 1999). Thus, we performed experiments to
see if the NO was playing a signaling role and checked
for a possible link to lig1 expression. We manipulated
NOS activity and endogenous cGMP levels during this
differentiation process using NIL, an inhibitor of inducible NOS, by ODQ, a selective inhibitor of NO-sensitive
soluble guanylate cyclase; by 8-bromo-cGMP, a nonhydrolysable analog of cGMP; and by glucose, a physiological repressor of Physarum sporulation. A schematic
summary of our results and conclusions is shown in Figure 6.
Macroplasmodia are obtained by fusion of microplasmodia grown for 3 d in the dark and under optimal
growth-promoting conditions. Under limiting glucose in
the dark, these macroplasmodia develop from a giant cell
into a characteristic plasmodial net within 5 d. Sporangia
formation is accomplished 14 to 16 h after setting the
essential light pulse. Refeeding with glucose, but not
with other nutrients such as tryptone or tryptone plus
yeast extract has been shown to inhibit sporulation
(Daniel and Rusch 1962a). As we found here, NOS
NO synthase in Physarum polycephalum
Figure 6. Schematic presentation of morphological and biochemical changes during
sporulation of Physarum polycephalum. Starvation of macroplasmodia in the dark for 5 d
induces sporulation competence. During this
phase, the plasmodium develops into a net of
condensed cellular matrix. Biochemically,
this phase is associated with glucose limitation which caused induction of nitric oxide
synthase (NOS) and repression of GTP cyclohydrolase I (GTP-CH I). Although intracellular H4-biopterin levels were still high enough
to support NOS activity, this repression of
GTP cyclohydrolase I might affect proliferation via decreasing folate availability. Having
attained sporulation competence at the end of
the 5 d starvation period, a light pulse then
induces formation of sporangia, a process paralleled by phytochrome-dependent induction
of lig1. NIL and ODQ interfere with NO/
cGMP signaling by inhibiting NOS and NOsensitive guanylate cyclase, respectively. NIL
and ODQ as well as glucose, which prevented NOS induction, suppressed both sporulation and lig1 expression. 8-Bromo-cGMP
counteracted the inhibitory effect of NIL on sporulation and lig1 expression.
mRNA expression and activity were inversely linked,
and GTP cyclohydrolase I mRNA expression directly
linked, to the available glucose concentration. Consumption of glucose during the 5-d starvation period that
induces sporulation competence resulted in strongly upregulated NOS and down-regulated GTP cyclohydrolase
I. In Physarum, GTP cyclohydrolase I is essential for
biosynthesis not only of H4-biopterin but also of folic
acid (Werner-Felmayer et al. 1994). Growth arrest and
physical condensation of macroplasmodia are prerequisites for obtaining sporulation competence (Daniel and
Rusch 1962a). It is therefore conceivable that GTP cyclohydrolase I is down-regulated to limit the supply of a
cofactor essential for cell proliferation (i.e., folic acid),
while still providing enough H4-biopterin for NOS to
function (see Results). Only starved but not glucose-fed
plasmodia expressed lig1 mRNA and sporulated in response to the light pulse. Inhibition of endogenous NO
or cGMP formation throughout the starvation period impaired light-induced lig1 mRNA expression and prevented sporulation. When added 2 h before the light
pulse, 8-bromo-cGMP restored the capacity of NILtreated macroplasmodia to express lig1 mRNA and to
sporulate. These findings support the hypothesis that
NO-mediated cGMP formation is functionally linked to
processing the light signal, which then triggers phytochrome-induced lig1 expression and sporulation.
In higher plants, cGMP mediates phototransduction
by modulating gene expression of phytochromes (Bowler
et al. 1994), prominent partners in a complicated network of photoreceptors (for review, see Mustilli and
Bowler 1997). In a not yet understood way, sugar-dependent signaling pathways interact with phytochromeregulated pathways (Mustilli and Bowler 1997). Future
work will analyze how NO/cGMP contribute to phytochrome-dependent phototransduction in sporulation of
Physarum, a process that involves NOS induction by
glucose limitation and phytochrome-dependent expression of lig1.
Materials and methods
Conditions for growing Physarum vegetative states and for
inducing sporulation
Microplasmodia of P. polycephalum strain M3b, a Wis 1 isolate,
were cultured in submersed shake-culture in semi-defined medium (Daniel and Baldwin 1964), supplemented with 0.013%
(w/v) hemoglobin instead of hematin. Macroplasmodia were
prepared by coalescence of exponentially growing microplasmodia and were cultured in the same medium as microplasmodia
but grown in plastic dishes on filter paper supported by glass
beads. Both micro- and macroplasmodia were grown in the dark
at 25°C.
Sporulation is achieved by reduction of nutrients at low pH
and strictly depends on addition of niacin and a daylight pulse
(Daniel and Rusch 1962a,b). As a modification, macroplasmodia
prepared by coalescence (3 h) from microplasmodia grown for 72
h (Affolter et al. 1979) were directly put into sporulation medium, a salt solution of pH 4.6 supplemented with peptone from
meat (10 g/L), yeast extract (1.5 g/L), and glucose (7.8 mM), as
well as 0.01% (w/v) nicotinamide, 0.1% (w/v) CaCO3, and 0.14
mM CuCl2. In some experiments, glucose was added to 62.4
mM, the growth medium concentration, at 24, 48, 72 and 96 h
of the starvation period. After 120 h in the dark at 25°C, cultures were exposed to daylight (OSRAM L8W/12) for 4 h. About
12 to 14 h after the light treatment, sporangia were formed and
differentiation was completed when the spores had developed
their characteristic dark melanin color.
Treatment of macroplasmodia with NOS inhibitors, ODQ
and 8-bromo-cGMP
NIL (0.1 to 5 mM), aminoguanidine (1 mM), and ODQ (100–250
µM), all obtained from Alexis Corporation, were added at time
0 of the starvation phase necessary for inducing sporulation
competence. 8-bromo-cGMP (10 to 500 µM) (Sigma) was added
2 h before the light pulse, that is, 118 h after starting starvation
GENES & DEVELOPMENT
1305
Golderer et al.
and addition of NIL. In some experiments, 8-bromo-cGMP was
added 12 h before, at the beginning of, and at the end (4 h) of the
light treatment, and 6 and 12 h afterwards.
Purification of NOS
To obtain enough purified Physarum NOS for sequencing, the
purification protocol detailed in Werner-Felmayer et al. (1994)
was scaled up and modified as follows: Microplasmodia were
disintegrated by means of a French press (16,000 psi). A 50,000 g
supernatant was prepared by centrifugation and precipitated by
50% (w/v) ammonium sulfate. The precipitate was dissolved in
50 mM Tris.HCl (pH 8.0), containing 10% (v/v) glycerol, 1 mM
phenylmethanesulphonyl fluoride, 5 mM 1,4-dithioerythritol,
10 µM H4-biopterin, 50 µM L-arginine, and 10 mM 2-mercaptoethanol, subjected to affinity chromatography with 2⬘-5⬘ADP-Sepharose 4B (Amersham Pharmacia Biotech) and eluted
with 10 mM NADPH. This was followed by gelfiltration with
Sephacryl S-300 HR (28 × 540 mm, Amersham Pharmacia Biotech) and ion exchange chromatography with Q-Sepharose (fast
flow, 10 × 100 mm, Amersham Pharmacia Biotech). The protein
was eluted with a gradient of 0 to 0.5 M NaCl. Active fractions
were concentrated with Amicon 100 filters (Amicon Inc.),
supplemented with 25% (v/v) glycerol and stored at −80°C. The
purification factor achieved by this modified protocol was about
16,000-fold. In one run, about 15 µg (∼ 125 pmol) of NOS could
be isolated from 1200 mL of microplasmodia, corresponding to
∼ 10 g of total protein. As observed before (Werner-Felmayer et
al. 1994), the protein ran as a double band in 7.5% denaturing
polyacrylamide gels. The size of the more abundant larger band
was estimated to be approximately 120 kD from comparison
with a 116-kD protein marker (Sigma C3312, 29 to 205 kD). The
smaller band was most likely a degradation product of the 120kD band, because it occured in varying amounts in different
preparations and because two internal peptide sequences were
identical to those identified for the 120-kD band (WITA sequencing service). Furthermore, the two bands showed an identical isoelectric point of 6.6, as determined by isoelectric focusing with a pH gradient of 3 to 10. A similar double band, in
which the smaller band turned out to be a proteolytic degradation fragment from the intact enzyme, was also observed for
inducible NOS from murine macrophages (Vodovotz et al.
1995). From the 120-kD band, eight internal peptide sequences
were obtained from custom sequencing at the Harvard Microchemistry Facility (Harvard University). Four of these could be
unambigously aligned to NOS consensus sequences from other
species and were therefore used for primer design. The N terminus of Physarum NOS is blocked, and therefore, no N-terminal sequence could be identified. The purified protein was subjected to Western blot analysis, according to standard procedures using the ECL Plus detection system (Amersham
Pharmacia Biotech). Antisera raised to mouse inducible NOS (a
kind gift from Q. Xie and C. Nathan, Cornell University), recombinant neuronal NOS from rat, and recombinant endothelial NOS from man (kindly provided by B. Mayer, University of
Graz) were tested, and cell extracts from interferon-␥/lipopolysaccharide-treated RAW264.7 mouse macrophages, recombinant neuronal NOS from rat, or recombinant human endothelial NOS were used as positive controls.
Cloning of Physarum NOS
To obtain poly-A+ RNA, S-phase macroplasmodia were ground
in liquid nitrogen, total RNA was isolated using the RNeasy
Plant Mini kit from Qiagen, and mRNA was isolated using the
Oligotex mRNA kit from Qiagen. A library was produced by
ligation of oligo-(dT)-primed cDNA into the Lambda ZapII vec-
1306
GENES & DEVELOPMENT
tor (digested with Eco RI and dephosphorylated) using the Gigapack II packaging kit from Stratagene.
The amplified library had a titer of 2.7 × 109 plaque-forming
units/mL. For screening, a NOS-specific probe was generated by
PCR using degenerate primers. The primers that succeeded
were directed to the nucleotide sequence deduced from one of
the internal peptide sequences identified from purified NOS
(sense primer termed pnos30B) and to a consensus sequence
from all available NOS sequences (antisense primer termed
pnos31D). Primer pnos30B was designed for the nucleotide sequence of peptide P6 (TGTYFQTIEEL) in the sense direction
and had the sequence 5⬘-ACIGGIACNTAYTTCCAAAC-3⬘.
Primer pnos31D bound to the nucleotide sequence corresponding to the consensus amino acid sequence GWYMGT in the
antisense direction and had the sequence 5⬘-GTGTCCATR
WACCATCC-3⬘. PCR conditions were 40 cycles of denaturation at 94°C (30 sec), annealing at 50°C (1 min), and extension
at 72°C (1 min), with an initial step at 95°C for 10 min to
activate AmpliTaq Gold DNA polymerase (Perkin Elmer) and a
final step of 7 min at 72°C using a GeneAmp9600 PCR instrument from Perkin Elmer. Reverse transcribed (SuperScript
RNase H− reverse transcriptase, Life Technologies) poly-A+
RNA (500 ng in a final volume of 50 µL) was used for PCR,
which was performed in presence of 5% (v/v) of dimethylsulfoxide. A 600-bp fragment was amplified, and sequence analysis
clearly showed that it was a partial NOS sequence. Using this
probe, two types of Physarum NOS were isolated and termed
physnosa and physnosb (see Results). The abundance of Physarum NOS in the cDNA library was about 1 in 2 × 105 clones, as
estimated from various rounds of screening. As it turned out,
the 600-bp fragment was part of the physnosb type that crossreacted with physnosa. Nucleotide sequencing and primer synthesis were performed by custom service (Microsynth). Analysis
showed that the NOS probe bound to a region from nucleotides
587 to 1188, corresponding to amino acids 91 to 291 of the
physnosa clone.
Sequence analysis
Sequences were analyzed using the Wisconsin Sequence Analysis Package version 9.1 from the Genetics Computer Group.
Functional expression of Physarum NOS
The physnosa cDNA was cloned into the pFastBac1 vector
(GIBCO BRL) using the SalI and XbaI restriction sites. An optimized Kozak sequence (GCCATGG) was introduced by PCRbased mutagenesis (QuickChange, Stratagene). The plasmid
was then transformed into baculovirus using the Bac-to-Bac expression system (GIBCO BRL), and the transposition was confirmed by PCR. Sf9 cells grown in TC100 (Sigma) were transfected with baculovirus, according to the manufacturer’s instructions. After 72 h, cells were harvested and assayed for NOS
activity by the 3H-citrulline assay, essentially as outlined in
Werner-Felmayer et al. (1994).
Northern blot analysis
Total RNA was isolated from macroplasmodia at different
times during sporulation experiments and on different treatments. Samples frozen in liquid nitrogen were ground and homogenized using the RNeasy Plant Mini kit from Qiagen. Ten
or 20 µg of total RNA were resolved in 1% agarose/6% formaldehyde gels, vacuum-blotted onto Duralon-UV nylon membranes (Stratagene), and cross-linked using ultraviolet irradiation (Stratalinker, Stratagene). Blots were hybridized overnight
with 106 cpm/mL of 32P-dCTP-labeled probes at 65°C, according
to standard protocols, and exposed to PhosphoImager Screens.
NO synthase in Physarum polycephalum
For detection of NOS mRNA, blots were hybridized with the
600-bp PCR fragment generated as detailed above. To discriminate between physnosa and physnosb, PCR fragments from the
untranslated 3⬘-ends of the two types of Physarum clones,
which differed considerably, were generated. Primers physnosa1
(5⬘-CCATCCAAGAAAGCCGATGC-3⬘, sense) and physnosa2
(5⬘-CAGGAATTCCGGTGGTACAG-3⬘, antisense) amplified a
157-bp fragment of physnosa. Primers physnosb1 (5⬘-CCTAAA
TAGGTTCGGCTAGGC-3⬘, sense) and physnosb2 (5⬘-CTTTG
CAAGGTCTGGAGTGG-3⬘, antisense) amplified 168 bp of
physnosb. Two nanograms of plasmid DNA from physnosa and
physnosb, respectively, were used in a final volume of 50 µL.
PCR conditions were: 2 min at 94°C, 30 cycles of 30 sec at 94°C,
1 min at 57°C, 1 min at 72°C, and a final step of 7 min at 72°C.
GTP cyclohydrolase I mRNA was detected by a PCR-generated 282-bp probe that was obtained using consensus primers 3
(sense) and 8 (antisense) for GTP cyclohydrolase I from different
species (Maier et al. 1995). PCR was done by 30 cycles of 30 sec
at 94°C, 1 min at 55°C, and 1 min at 72°C, with an initial
denaturation step at 94°C for 2 min. Having verified that the
PCR fragment is homologous to GTP cyclohydrolase I from
other species, this probe was also used for cloning the fulllength Physarum GTP cyclohydrolase I sequence from the
cDNA library that was functionally active as was verified by
recombinant expression in baculovirus-transfected Sf9 cells
(Golderer et al. 2001). The sequence was deposited to the GenBank (accession no. AF177165).
For use as a control, a 500-bp cDNA fragment with high homology to ribosomal protein S11 (63% amino acid sequence
identity with S11 from Xenopus laevis [GenBank accession no.
X78805]) was amplified. The putative Physarum S11 sequence
is available from GenBank (accession no. AF177283).
Quantification of lig1 mRNA levels using real-time PCR
Total RNA was isolated from macroplasmodia at the beginning
and at the end of the 4-h light treatment and 4, 8, and 12 h
thereafter using the RNeasy Plant Mini kit from Qiagen (see
above). Because of condensation of the plasmodium, cellular
material is very limited at this stage of the experiment. It therefore was pooled from 5 plasmodia treated in parallel. Further, 5
to 10 parallel cultures were used to determine sporulation rates.
Random hexamer-primed cDNAs were prepared from 500 ng of
total RNA using Superscript II RNase H− reverse transcriptase.
Real-time PCR analysis was performed using the Taqman technology (AbiPrism 7700 sequence detector, Applied Biosystems)
and the Brilliant Quantitative PCR Core Reagent kit from
Stratagene. Probes (5⬘-FAM/3⬘-TAMRA label) and primers, both
synthesized by Microsynth, were selected using the Primer Express software (Applied Biosystems). Sequences (5⬘-3⬘ direction)
of probes and primers were as follows: lig1 probe, TGGCGCA
AGCGTGAATCTATTATTCGA; lig1–136F (sense), GATGGC
ATGCAGGTTTGGA; lig1–212R (antisense), CCATTGTTCA
AACTCTCTATTCTGTACTC; 19 S probe, CCCGTGTTGAG
TCAAATTAAGCCGCA; 19S-1273F (sense), ACGGAAGGG
CACACAAAGCG; 19S-1350R (antisense), CGTGTATCCGG
ACCTGGTG. Lig1 mRNA levels were related to 19 S ribosomal
RNA levels. In accordance with previous work (Kroneder et al.
1999), lig1 mRNA levels increased up to 50-fold at 8 and 12 h
after setting the light pulse as compared to the levels found at
the beginning of the light treatment.
Determination of intracellular H4-biopterin and of nitrite
plus nitrate in supernatants
Intracellular H4-biopterin was quantified as detailed before
(Werner-Felmayer et al. 1994; Werner et al. 1997) by high per-
formance liquid chromatography (HPLC) after oxidation with
iodine in acidic (total biopterin) or alkaline (7,8-dihydrobiopterin plus biopterin) media. The amount of H4-biopterin is given
in pmol per mg of protein. Nitrite plus nitrate was determined
in supernatants as outlined previously (Werner-Felmayer et al.
1994). Briefly, samples were applied to reversed phase HPLC and
eluted with 5% NH4Cl (pH 7.0). Nitrate was reduced to nitrite
using a cadmium reactor. Nitrite was quantified by measuring
ultraviolet absorption at 546 nm after post-column mixing with
the Griess-Ilosvay reagent from Merck.
Determination of glucose
Glucose in supernatants at different times of sporulation experiments was determined using the glucose/GOD-Perid kit from
Boehringer Mannheim (Roche Diagnostics).
Acknowledgments
We are indebted to Christine Heufler-Tiefenthaler, Department
of Dermatology, University of Innsbruck, for her help with
preparation of the Physarum cDNA library. Thanks are also
owed to Emanuela Felley-Bosco, Institut de Pharmacologie et de
Toxicologie, Université de Lausanne, for discussions on evolutionary tree analysis; to Bernd Mayer, Institut für Pharmakogie
und Toxikologie, University of Graz, for his generous help on
various aspects of this work; and to Ben Hemmens, Graz, for
critical reading of the manuscript. The excellent technical assistance of Renate Kaus, Petra Höfler, Anabella Weisskopf, and
Bettina Fritz is gratefully acknowledged. This work was supported by the Austrian Funds “Zur Förderung der wissenschaftlichen Forschung”, project P13580-MOB.
The publication costs of this article were defrayed in part by
payment of page charges. This article must therefore be hereby
marked “advertisement” in accordance with 18 USC section
1734 solely to indicate this fact.
References
Affolter, H.U., Behrens, K., Seebeck, T., and Braun, R. 1979.
Large scale isolation of ribosomal DNA from giant surface
cultures of Physarum polycephalum. FEBS Lett. 107: 340–
342.
Bailey, J. 1995. Plasmodium development in the myxomycete
Physarum polycephalum: Genetic control and cellular
events. Microbiology 141: 2355–2365.
Baldauf, S.L. and Doolittle, W.F. 1997. Origin and evolution of
the slime molds (Mycetozoa). Proc. Natl. Acad. Sci.
94: 12007–12012.
Basu, N.K., Kole, L., Ghosh, A., and Das, P.K. 1997. Isolation of
a nitric oxide synthase from the protozoan parasite, Leishmania donovani. FEMS Microbiol. Lett. 156: 43–47.
Beck, K.F., Eberhardt, W., Frank, S., Huviler, A., Messmer, U.K.,
Mühl, H., and Pfeilschifter, J. 1999. Inducible NO synthase:
Role in cellular signalling. J. Exp. Biol. 202: 645–653.
Bowler, C., Neuhaus, G., Yamagata, H., and Chua, N.H. 1994.
Cyclic GMP and calcium mediate phytochrome phototransduction. Cell 77: 73–81.
Bredt, D.S. 1996. Targeting nitric oxide to its targets. Proc. Soc.
Exp. Biol. Med. 211: 41–48.
Bredt, D.S., Hwang, P.M., Glatt, C.E., Lowenstein, C., Reed,
R.R., and Snyder, S.H. 1991. Cloned and expressed nitric
oxide synthase structurally resembles cytochrome P-450 reductase. Nature 351: 714–718.
Chen, P.F., Tsai, A.L., and Wu, K.K. 1994. Cystein 184 of endo-
GENES & DEVELOPMENT
1307
Golderer et al.
thelial nitric oxide synthase is involved in heme coordination and catalytic activity. J. Biol. Chem. 269: 25062–25066.
Chen, Y. and Rosazza, J.P.N. 1995. Purification and characterization of nitric oxide synthase (NOSNoc) from a Nocardia
species. J. Bacteriol. 177: 5122–5128.
Cho, H.J., Martin, E., Xie, Q.W., Sassa, S., and Nathan, C. 1995.
Inducible nitric oxide synthase: Identification of amino acid
residues essential for dimerization and binding of tetrahydrobiopterin. Proc. Natl. Acad. Sci. 92: 11514–11518.
Crane, B.R., Arvai, A.S., Ghosh, D.K., Wu, C., Getzoff, E.D.,
Stuehr, D.J., and Tainer, J.A. 1998. Structure of nitric oxide
synthase oxygenase dimer with pterin and substrate. Science
279: 2121–2126.
Daniel, J.W. and Rusch, H.P. 1962a. Method for inducing sporulation of pure cultures of the myxomycete Physarum polycephalum. J. Bacteriol. 83: 234–240.
———. 1962b. Niacin requirement for sporulation of Physarum
polycephalum. J. Bacteriol. 83: 1244–1250.
Delledonne, M., Xia, Y., Dixon, R.A., and Lamb, C. 1998. Nitric
oxide functions as a signal in plant disease resistance. Nature 394: 585–588.
Durner, J., Wendehenne, D., and Klessig, D.F. 1998. Defense
gene induction in tobacco by nitric oxide, cyclic GMP, and
cyclic ADP-ribose. Proc. Natl. Acad. Sci. 95: 10328–10333.
Fischmann, T.O., Hruza, A., Niu, X.D., Fossetta, J.D., Lunn,
C.A., Dolphin, E., Prongay, A.J., Reichert, P., Lundell, D.J.,
Narula, S.K., et al. 1999. Structural characterization of nitric
oxide synthase isoforms reveals striking active-site conservation. Nature Struct. Biol. 6: 233–242.
Francis, S.H., Noblett, B.D., Todd, B.W., Wells, J.N., and Corbin,
J.D. 1988. Relaxation of vascular and tracheal smooth
muscle by cyclic nucleotide analogs that preferentially activate purified cGMP-dependent protein kinase. Mol. Pharmacol. 34: 506–517.
Garcia-Cardena, G., Martasek, P., Masters, B.S., Skidd, P.M.,
Couet, J., Li, S., Lisanti, M.P., and Sessa, W.C. 1997. Dissecting the interaction between nitric oxide synthase (NOS) and
caveolin binding domain in vivo. J. Biol. Chem. 272: 25437–
25440.
Garthwaite, J., Southam, E., Boulton, C.L., Nielsen, E.B.,
Schmidt, K., and Mayer, B. 1995. Potent and selective inhibition of nitric oxide-sensitive guanylyl cyclase by 1H[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one. Mol. Pharmacol.
48: 184–188.
Ghigo, D., Todde, R., Ginsburg, H., Costamagna, C., Gautret, P.,
Bussolino, F., Ulliers, D., Giribaldi, G., Deharo, E., Gabrielli,
G., et al. 1995. Erythrocyte stages of Plasmodium falciparum show a high nitric oxide synthase (NOS) activity and
release an NOS-inducing soluble factor. J. Exp. Med.
182: 677–688.
Ghosh, D.K., Wu, C., Pitters, E., Moloney, M., Werner, E.R.,
Mayer, B., and Stuehr, D.J. 1997. Characterization of the
inducible nitric oxide synthase oxygenase domain identifies
a 49 amino acid segment required for subunit dimerization
and tetrahydrobiopterin interaction. Biochemistry 36:
10609–10619.
Golderer, G., Werner, E.R., Heufler, C., Strohmaier, W., Gröbner, P., and Werner-Felmayer, G. 2001. GT cyclohydrolase I
mRNA: Novel splice variants in the slime mold Physarum
polycephalum and in human monocytes (THP-1) indicate
conservation of mRNA processing. Biochem J. 355: 499–507.
Hausladen, A. and Stamler, J.S. 1998. Nitric oxide in plant immunity. Proc. Natl. Acad. Sci. 95: 10345–10347.
Henikoff, S. and Henikoff, J.G. 1992. Amino acid substitution
matrices from protein blocks. Proc. Natl. Acad. Sci. 89:
10915–10919.
1308
GENES & DEVELOPMENT
Hentze, M.W. and Kuhn, L.C. 1996. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits
by iron, nitric oxide, and oxidative stress. Proc. Natl. Acad.
Sci. 93: 8175–8182.
Kakiuchi, Y. and Ueda, T. 1999. Fragmentation of the plasmodium into equally sized pieces by low temperatures in the
true slime mold Physarum polycephalum: A new morphogenesis. Protoplasma 206: 131–136.
Kim, Y.M., Bombeck, C.A., and Billiar, T.R. 1999. Nitric oxide
as a bifunctional regulator of apoptosis. Circ. Res. 84: 253–
256.
Kimura, M. 1983. In The neutral theory of molecular evolution.
Cambridge University Press, Cambridge, UK.
Korneev, S.A., Piper, M.R., Picot, J., Phillips, R., Korneeva, E.I.,
and O’Shea, M. 1998. Molecular characterization of NOS in
a mollusc: Expression in a giant modulatory neuron. J. Neurobiol. 35: 65–76.
Kroneder, R., Cashmore, A.R., and Marwan, W. 1999. Phytochrome-induced expression of lig1, a homologue of the fission yeast cell-cycle checkpoint gene hus1, is associated
with the developmental switch in Physarum polycephalum
plasmodia. Curr. Genet. 36: 86–93.
Laing, K.J., Grabowski, P.S., Belosevic, M., and Secombes, C.J.
1996. A partial sequence for nitric oxide synthase from a
goldfish (Carassius auratus) macrophage cell line. Immunol.
Cell Biol. 74: 374–379.
Laing, K.J., Hardie, L.J., Aartsen, W., Grabowski, P.S., and Secombes, C.J. 1999. Expression of an inducible nitric oxide
synthase gene in rainbow trout Oncorhynchus mykiss. Dev.
Comp. Immunol. 23: 71–85.
Lépine, G., Laroch, A., Lemieux, G., and Pallotta, D. 1995. The
two alleles of the hapP gene in Physarum polycephalum
code for different proteins. Biochim. Biophys. Acta 1264:
271–274.
Lin, A.W., Chang, C.C., and McCormick, C.C. 1996. Molecular
cloning and expression of an avian macrophage nitric-oxide
synthase cDNA and the analysis of the genomic 5⬘-flanking
region. J. Biol. Chem. 271: 11911–11919.
Maier, J., Witter, K., Gütlich, M., Ziegler, I., Werner, T., and
Ninnemann, H. 1995. Homology cloning of GTP-cyclohydrolase I from various unrelated eukaryotes by reverse-transcription polymerase chain reaction using a general set of
degenerate primers. Biochem. Biophys. Res. Commun. 212:
705–711.
Mayer, B. and Hemmens, B. 1997. Biosynthesis and action of
nitric oxide in mammalian cells. Trends Biochem. Sci.
22: 477–481.
Misko, T.P., Moore, W.M., Kasten, T.P., Nickols, G.A., Corbett,
J.A., Tilton, R.G., McDaniel, M.L., Williamson, J.R., and
Currie, M.G. 1993. Selective inhibition of the inducible nitric oxide synthase by aminoguanidine. Eur. J. Pharmacol.
233: 119–125.
Moncada, S. and Higgs, E.A. 1995. Molecular mechanisms and
therapeutic strategies related to nitric oxide. FASEB J.
9: 1319–1330.
Moore, W.M., Webber, R.K., Jerome, G.M., Tjoeng, F.S., Misko,
T.P., and Currie, M.G. 1994. L-N6–(1-iminoethyl)lysine: A
selective inhibitor of inducible nitric oxide synthase. J. Med.
Chem. 37: 3886–3888.
Morita, H., Yoshikawa, H., Sakata, R., Nagata, Y., and Tanaka,
H. 1997. Synthesis of nitric oxide from the two equivalent
guanidino nitrogens of L-arginine by Lactobacillus fermentum. J. Bacteriol. 179: 7812–7815.
Müller, U. 1997. The nitric oxide system in insects. Prog. Neurobiol. 51: 363–381.
Mustilli, A.C. and Bowler, C. 1997. Tuning in to the signals
NO synthase in Physarum polycephalum
controlling photoregulated gene expression in plants. EMBO
J. 19: 5801–5806.
Nathan, C. 1997. Inducible nitric oxide synthase: What difference does it make? J. Clin. Invest. 100: 2417–2423.
Ninnemann, H. and Maier, J. 1996. Indications of the occurrence of nitric oxide synthases in fungi and plants and the
involvement in photoconidiation of Neurospora crassa. Photochem. Photobiol. 64: 393–398.
Paveto, C., Pereira, C., Espinosa, J., Montagna, A.E., Farber, M.,
Esteva, M., Flawiá, M.M., and Torres, H.N. 1995. The nitric
oxide transduction pathway in Trypanosoma cruzi. J. Biol.
Chem. 270: 16576–16579.
Peunova, N. and Enikolopov, G. 1995. Nitric oxide triggers a
switch to growth arrest during differentiation of neuronal
cells. Nature. 375: 68–73.
Peunova, N., Kuzin, B., Roberts, I., O’Kane, C., and Enikolopov,
G. 1996. Nitric oxide, cell multiplication, and cell survival.
Cold Spring Harbor Symp. Quant. Biol. 61: 417–426.
Raman, C.S., Li, H., Martasek, P., Kral, V., Masters, B.S., and
Poulos, T.L. 1998. Crystal structure of constitutive endothelial nitric oxide synthase: A paradigm for pterin function
involving a novel metal center. Cell 95: 939–950.
Raub, T.J. and Aldrich, H.C. 1982. Sporangia, spherules, and
microcysts. In Cell biology of Physarum and Didymium
(eds. H.C. Aldrich and J.W. Daniel), pp. 21–75. Academic
Press, New York.
Saeij, J.P., Stet, R.J., Groeneveld, A., Verburg-van Kemenade,
L.B., van Muiswinkel, W.B., and Wiegertjes, G.F. 2000. Molecular and functional characterization of a fish inducibletype nitric oxide synthase. Immunogenetics 51: 339–346.
Salerno, J.C., Harris, D.E., Irizarry, K., Patel, B., Morales, A.J.,
Smith, S.M.E., Martasek, P., Roman, L.J., Masters, B.S.S.,
Jones, C.L., et al. An autoinhibitory control element defines
calcium-regulated isoforms of nitric oxide synthase. J. Biol.
Chem. 272: 29769–29777.
Sari, M.A., Moali, C., Boucher, J.L., Jaouen, M., and Mansuy, D.
1998. Detection of a nitric oxide synthase possibly involved
in the regulation of the Rhodococcus sp R312 nitrile hydratase. Biochem. Biophys. Res. Commun. 250: 364–368.
Starostzik, C. and Marwan, W. 1995. A photoreceptor with
characteristics of phytochrome triggers sporulation in the
true slime mold Physarum polycephalum. FEBS Lett. 370:
146–148.
Tao, Y.P., Misko, T.P., Howlett, A.C., and Klein, C. 1997. Nitric
oxide, an endogenous regulator of Dictyostelium discoideum differentiation. Development 124: 3587–3595.
Vodovotz, Y., Russell, D., Xie, Q.W., Bogdan, C., and Nathan, C.
1995. Vesicle membrane association of nitric oxide synthase
in primary mouse macrophages. J. Immunol. 154: 2914–
2925.
Werner, E.R., Wachter, H., and Werner-Felmayer, G. 1997. Determination of tetrahydrobiopterin biosynthetic activities
by high-performance liquid chromatography with fluorescence detection. Meth. Enzymol. 281: 53–61.
Werner, E.R., Werner-Felmayer, G., and Mayer, B. 1998. Tetrahydrobiopterin, cytokines, and nitric oxide synthesis. Proc.
Soc. Exp. Biol. Med. 219: 171–182.
Werner-Felmayer, G., Golderer, G., Werner, E.R., Gröbner, P.,
and Wachter, H. 1994. Pteridine biosynthesis and nitric oxide synthase in Physarum polycephalum. Biochem. J.
304: 105–111.
Wick, R.J. and Sauer, H.W. 1982. Developmental biology of
slime molds: An overview. In Cell biology of Physarum and
Didymium (eds. H.C. Aldrich and J.W. Daniel), pp. 3–20.
Academic Press, New York.
Yamamoto, H., Uchiyama, S., Nugroho, F.A., and Sekiguchi, J.
1997. Cloning and sequencing of a 35.7 kb in the 70⌭-73⌭
region of the Bacillus subtilis genome reveal genes for a new
two-component system, three spore germination proteins,
an iron uptake system and a general stress response protein.
Gene 194: 191–199.
GENES & DEVELOPMENT
1309
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising