tesi definitiva siham AZ

tesi definitiva siham AZ
Alma Mater Studiorum – Università degli Studi di Bologna
FACOLTÁ DI AGRARIA
Dipartimento di Scienze Agrarie (DipSA)
DOTTORATO DI RICERCA IN
ECOLOGIA MICROBICA E PATOLOGIA VEGETALE
Ciclo XXV°
SCIENZE AGRARIE E VETERINARIE
Settore/i scientifico-disciplinare/i di afferenza:
AGR/12 PATOLOGIA VEGETALE
NUOVE BIOTECNOLOGIE PER LA
PRODUZIONE DI PIANTE MICORRIZATE
CON TARTUFO
Tutore:
Prof. Alessandra Zambonelli
Coordinatore:
Prof. Paolo Bertolini
Relatori:
Dott. Mirco Iotti
Dott.ssa Piattoni Federica
Tesi di dottorato di:
Siham BOUTAHIR
Aprile 2013
Bologna - Italia
2
Questa tesi é dedicata a un pezzo del mio cuore che non c’è più e da sempre
ha voluto vedermi un giorno dottoranda. Questo giorno é arrivato e spero con
tutto il mio cuore che lei da lassù possa guardarmi ed essere fiera di me.
Alla mia preziosa e amata Sorella, Fatima.
Grazie per aver creduto nelle mie scelte
Sei e sarai sempre nel mio cuore.
3
4
RINGRAZIAMENTI
Il presente lavoro è il risultato di un impegno durato tre anni. Durante
questo periodo ho avuto la fortuna di lavorare con persone che mi
hanno trasmesso uno straordinario patrimonio di valori e conoscenze.
A tutti loro vanno i miei ringraziamenti.
Ringrazio la Prof.ssa Alessandra Zambonelli, mia Tutrice del
Dottorato di Ricerca, che ha investito la sua conoscenza ed il suo
tempo in interessanti confronti e determinanti contributi sull’intero
lavoro
svolto,
consigliandomi
e
guidandomi
costantemente.
Ringrazio la Prof.ssa Zambonelli soprattutto per avermi trasmesso la
metodologia di lavoro, la rapidità e la capacità di affrontare
problematiche diverse. Desidero ringraziare Dott. Mirco Iotti e la
Dott.ssa Federica Piattoni per la costante disponibilità e appoggio che
mi hanno fornito durante tutto il corso del Dottorato, i loro preziosi
insegnamenti e consigli. Il loro aiuto è stato fondamentale nello
svolgimento di questa ricerca.
Vorrei anche ringraziare la Dott.ssa Antonella Amicucci e la
dottoranda Valentina Sparvoli per la collaborazione e l’aiuto nelle
analisi.
La mia esperienza all’estero presso l’INRA di Nancy in Francia
(Unità Interazioni Alberi-Microrganismi, IAM) è stata breve ma
intensa e per questo posso solo ringraziare il Dott. Claude Murat e la
Dott.ssa Annegret Kohler per i consigli preziosi, per il tempo e per
l’interesse che mi hanno dedicato.
5
Infine, l’ultimo ringraziamento va alle persone che mi sono state
vicine e hanno creduto in me per tutto questo tempo e che hanno fatto
in modo che questa “avventura” assumesse il giusto significato e la
giusta luce nella nostra vita insieme.
Un ringraziamento speciale a mia madre Mahjouba per essere stata al
mio fianco sempre e che, quando mi guarda negli occhi, non vede che
la sua bambina. A mio padre Mohammed, ai miei due fratelli Khalid
e Rachid, ed alla mia seconda sorella Monique per avermi saputo
comunicare la loro vicinanza emotiva ed il loro incrollabile sostegno
morale, senza i quali non avrei mai intrapreso questa strada e
raggiunto questo traguardo.
Un ringraziamento particolare va ad Andrea, mio marito, per essermi
stato sempre vicino e per avermi dato la sua profonda fiducia e la
partecipazione costante ad ogni mia difficoltà, come solo lui sa fare, e
per avermi incoraggiata in quei momenti in cui non si è certi di
potercela fare. Condensare in qualche riga tutto quello che ho
ricevuto da voi in questi anni non è umanamente possibile e sarebbe
riduttivo ed ingiusto, perciò mi limiterò a dire che avete continuato a
crederci anche quando non ci credevo più nemmeno io e di questo
non vi sarò mai abbastanza grata.
A tutti voi va il mio GRAZIE MILLE DI CUORE.
6
7
Sommario
1. INTRODUZIONE
13
1.1. Generalità sui funghi
13
1.2. Importanza ecologica dei funghi negli ecosistemi forestali
15
1.3. Interazione pianta- microrganismi
15
1.3.1. La simbiosi micorrizica
16
1.3.2. L’importanza della simbiosi micorrizica per la pianta
19
1.3.2.1. Nutrizione minerale
20
1.3.2.2. Tolleranza ai metalli pesanti nel suolo
21
1.3.2.3. Protezione dagli stress salini
22
1.3.2.4. Protezione dagli stress idrici
22
1.3.2.5. Protezione dalla malattie
23
1.4. Generalità su tartufo
24
1.4.1. Il ciclo biologico
26
1.4.2. Tassonomia
27
1.4.3. L’ecologia dei tartufi
30
1.4.4. Caratteristiche ecologiche delle principali specie di tartufi
32
1.4.5. Il tartufo e i batteri del suolo
33
1.5. La coltivazione del tartufo
33
1.5.1. La micorrizazione con tartufo e controllo delle piante tartufigene
35
1.5.2. Metodi di micorrizazione
35
1.6. Metodi molecolari e l’identificazione dei funghi del genere Tuber
37
1.7. Tuber magnatum Pico
38
2. SCOPO DELLA TESI
42
Capitolo 3
3. Isolamento e caratterizzazione morfologica di ceppi di Tuber magnatum
3.1. Introduzione
45
3.2. Materiali e metodi
46
3.2.1. Isolamento dei miceli
46
3.2.2. Caratterizzazione morfologica dei ceppi isolati
47
3.2.3. Identificazione molecolare
48
8
3.3. Risultati e discussione
48
3.4. Conclusioni
51
Capitolo 4
4. Miglioramento dello sviluppo del micelio di T. magnatum
4.1. Introduzione
54
4.2. Materiali e metodi
55
4.2.1. Ceppi fungini
55
4.2.2. Condizioni di coltura
55
4.3. Risultati e discussione
56
4.4. Conclusioni
57
Capitolo 5
5. Effetto degli estratti radicali e miceliari sullo sviluppo di miceli di Tuber
5.1. Introduzione
59
5.2. Materiali e metodi
60
5.2.1. Ceppi fungini e materiale vegetale
60
5.2.2. Preparazione dell’estratto radicale di nocciolo
61
5.2.3. Preparazione dell’estratto miceliare di specie Tuber
61
5.2.4. Prove di crescita del micelio di T. borchii in substrato arricchito dell’estratto
62
radicale di nocciolo
5.2.5. Analisi morfologica dei miceli di T. borchii cresciuti con l’estratto radicale di
62
nocciolo
5.2.6. Analisi degli estratti radicali di nocciolo e raccolta delle frazioni mediante HPLC-
63
DAD
5.2.7. Prova di crescita di T.borchii con le frazioni dell’estratto radicale raccolte
64
mediante HPLC
5.2.8. Analisi morfologiche dei miceli di T.borchii con le frazioni dell’estratto radicale
65
raccolte mediante HPLC
5.2.9. Elaborazione statistica dei risultati dell’analisi morfologica
65
5.2.10. Analisi molecolari dei miceli di T. borchii trattati con gli estratti radicali di
65
nocciolo e con le singole frazioni dell'estratto
5.2.10.1. Prelievo dei miceli ed estrazione dell'RNA totale
9
65
5.2.10.2. Sintesi del cDNA
66
5.2.10.3. Real time PCR
66
5.3. Risultati e Discussione
67
5.3.1. Analisi morfologiche dei miceli di T. magnatum incubati nell’estratto miceliare di
67
specie Tuber
5.3.2. Analisi morfologiche dei miceli di T. borchii trattati con gli estratti radicali di
68
nocciolo
5.3.3. Analisi morfologiche dei miceli di T. borchii trattati con le frazioni dell’estratto
70
radicale raccolte mediante HPLC
5.3.4. Analisi molecolari dei miceli di T. borchii trattati con gli estratti radicali di
73
nocciolo e con le singole frazioni dell'estratto
76
5.4. Conclusioni
Capitolo 6
6. Produzione di piantine micorizzate con T. magnatum ed altre specie di tartufo e
studio della dinamica della colonizzazione radicale
6.1. Introduzione
78
6.2. Materiali e metodi
79
6.2.1. Ceppi fungini e specie arboree
79
6.2.2. Preparazione degli inoculi sporali e miceliari, allevamento e controllo delle piante
80
micorrizate
6.2.3. Identificazione molecolare e descrizione delle micorrize
82
6.2.4. Verifica e quantificazione del micelio di T. magnatum
83
6.2.4.1. Prelievo dei campioni di suolo
83
6.2.4.2. Real time PCR
84
6.2.4.3. PCR qualitative sulle radici delle piante madri
85
6.3. Risultati e discussione
85
6.3.1. Colonizzazione radicale con T. magnatum, T. borchii e T. oligospermum
85
6.3.2. Caratterizzazione morfologica delle micorrize delle tre specie studiate
89
6.3.3. Verifica e quantificazione del micelio di T. magnatum
93
6.4. Conclusioni
94
Capitolo 7
10
7. Messa a punto di protocolli di conservazione per il mantenimento delle colture di
Tuber spp., per la crezione di una banca di germoplasma per tartufi
7.1. Introduzione
97
7.2. Materiali e metodi
101
7.2.1. Ceppi fungini utilizzati
101
7.2.2. Ultracongelamento a – 80 °C
102
7.2.3. Crioconservazione in azoto liquido (-196°C)
102
7.2.3.1. Fase di congelamento del micelio
103
7.2.3.2. Fase di scongelamento del micelio
103
7.2.4. Prove di verifica dell’infettività del micelio
104
7.3. Risultati e discussione
104
7.3.1. Ultracongelamento a -80°C
104
7.3.2. Crioconservazione in azoto liquido
105
7.4. Conclusioni
109
Conclusioni generali
111
Bibliografia
115
11
12
1. Introduzione
1.1. Generalità sui funghi
Il mondo dei funghi sia macroscopici che microscopici è un mondo vasto, in gran parte
sconosciuto, fondamentale per l’economia umana, e per l’equilibro degli ecosistemi. I funghi
sono organismi eucariotici appartenenti al regno Fungi. Sono privi di clorofilla e pertanto
sono eterotrofi, ossia usano la materia organica già sintetizzatada altri organismi
comportandosi da saprotrofi, parassiti o simbionti mutualistici di piante, come nelle
micorrize o nelle associazioni licheniche. I funghi nutrono per assorbimento e hanno la
parete cellulare costituita da chitina, il loro tallo è costituito da cellule allungate filamentose
(le ife) (che nel loro insieme costituiscono il micelio) e sono capaci di riprodursi
sessualmente e/o agamicamente (Alexopoulos et al. 1996). I funghi più semplici sono
organismi unicellulari come lieviti, ma la maggior parte sono in forma miceliale e
pluricellulari (Redecker, 2002). La forma miceliale permette al fungo di avere una crescita
radiale e colonizzare rapidamente e uniformemente un ambiente. La forma miceliale fornisce
quindi una superficie massima di contatto e permette l'esplorazione e la ricerca delle
sostanze nutritive in tre dimensioni (Jennings e Lysek, 1996). Essi si nutrono secernendo
enzimi nel terreno che digeriscono i composti organici riducendoli a piccole molecole
solubili (digestione extracellulare), queste molecole si diffondono poi all’interno delle loro
ife attraverso la parete (Alexopoulos et al., 1996). Generalmente la stima accreditata del
numero di specie di funghi sulla terra è 1,5 milioni (Hawksworth, 1991; Hawksworth, 1993;
Heywood, 1995), di cui si ritiene che sia stato scoperto solo il 5% delle specie esistenti
(70,000) (Hawksworth e Rossman, 1997); ciò significa che rimangono 1,43 milioni di specie
ancora sconosciute alla scienza.
Riportiamo in questo schema la recente classificazione dei funghi di Hibett et al. (2007).
13
Fig. 1- Classificazione del regno dei Funghi (da Hibett et al., 2007)
I funghi superiori sono compresi fra i Dikarya e sono divisi in due divisioni: Ascomiceti,
Basidiomiceti.
In questa tesi sono stati studiati esclusivamente gli ascomiceti ed in particolare il genere
Tuber. La divisione Ascomycota costituisce il più grande gruppo di funghi finora conosciuti,
questa divisione comprende oltre 32.000 specie, corrispondenti a circa il 40% di quelle fino
ad ora descritte (Hawksworth, 1991). Essi vivono in differenti habitat, infatti si possono
trovare sia in ambiente acquatico che terrestre, inoltre riescono a sopravvivere in condizioni
di moderato stress (Ahmed e Abdel Azeem, 2010), Molte specie di ascomiceti sono
economicamente importanti (Damm et al., 2009), mentre poche di queste specie devono la
loro importanza al fatto che sono commestibili come spugnole e i tartufi (Ahmed e Abdel
14
Azeem, 2010), molte altre sono utilizzate a scopi biotecnologici come la produzione di
alimenti, bevande, acidi organici, biofungicidi, biofertilizanti fungini, cosmetici e ormoni
(Hyde e al. 2010). Gli ascomiceti sono in grado di comportarsi da saprotrofi, da parassiti o
simbionti mutualistici.
1.2. Importanza ecologica dei funghi negli ecosistemi forestali
I funghi sono organismi chiave nel funzionamento degli ecosistemi e mentre noi possiamo
ammirare il loro gran numero, la conoscenza della loro "diversità funzionale" è
fondamentale per comprendere la loro importanza nella salute dell'ecosistema. Nell’ambito
dei bioriduttori o decompositori si ritrovano una miriade di organismi viventi che hanno il
compito di degradare la materia organica proveniente dai livelli trofici precedenti. Tutti
questi organismi non devono essere considerati come singoli elementi scollegati, ma come
componenti di un sistema vitale complesso, dove gli organismi presenti intrecciano rapporti
e relazioni sociali di vario genere ed interagiscono tra loro e con l’ambiente che li circonda,
determinandone caratteristiche ed equilibri che contribuiscono a mantenerne la loro
biodiversità. In questo contesto i funghi rivestono un ruolo fondamentale nei cicli naturali
per le loro peculiari modalità di nutrimento. In particolare sono fondamentali per la
degradazione e la mobilitazione dei recalcitranti composti organici del legno morto. I funghi
non solo contribuiscono al riciclo dei nutrienti attraverso la loro decomposizione, ma anche
riescono a trattenere i nutrienti all'interno della loro biomassa vivente nel suolo, riducendo
così la perdita di nutrienti attraverso la lisciviazione. Il micelio nel suolo è una presenza
molto importante, la biomassa fungina è infatti una fonte primaria di cibo per molti altri
organismi (Molina, 1994).
1.3. Interazione pianta- microrganismi
Nelle ultimi anni la ricerca ha dimostrato con sempre maggiore evidenza che la conoscenza
delle relazioni microorganismi - pianta è essenziale per un corretto funzionamento di tutti gli
15
ecosistemi terrestri al fine di ottimizzare le rese e nello stesso tempo salvaguardare
l’ambiente. I rapporti reciproci tra piante e microrganismi possono essere simbiotici
mutualistici o antagonistici; la maggior parte degli studi ha mostrato che molti
microrganismi hanno un effetto benefico per la pianta: essi promuovono la decomposizione e
la mineralizzazione dei residui organici e facilitano così l’assorbimento dei nutrienti,
promuovono la crescita, fissano l’azoto, e possono proteggere le piante dall’attacco dei
patogeni.
1.3.1. La simbiosi micorrizica
A livello della rizosfera possono instaurarsi molteplici tipi di interazioni (Fig.2) tra cui quelle
simbiotiche. Si definisce associazione micorrizia un’interazione simbiotica mutualistica tra
funghi micorrizici e piante superiori e costituisce la forma di simbiosi più diffusa su scala
globale (Jennings e Lysek, 1996). La simbiosi micorrizica, venne osservata per la prima
volta dall’italiano Gibelli (1879, 1883), ma la considerò come uno stato patologico,
successivamente solo il tedesco Frank (1885) ha dimostrato la natura simbiotica di queste
structure, a cui ha dato il nome di micorrize.
Il termine micorriza deriva dal greco mykes = fungo e
rhiza = radice e descrive
un’associazione intima strutturale e funzionale tra gli apici delle radici di una pianta e le ife
fungine. Come già detto la micorriza è una forma di simbiosi principalmente mutualistica,
per cui i due organismi portano avanti il loro ciclo vitale vivendo a stretto contatto e traendo
benefici reciproci. Si stima che circa il 90% delle piante effettuano spontaneamente questa
associazione (Smith e Read, 1997), in generale, sono presenti nell’83% delle dicotiledoni,
nel 79% delle monocotiledoni ed in tutte le gimnosperme (Wilcox, 1991). Hanno un ruolo
cruciale nello sviluppo e nel mantenimento di comunità di piante e perciò sono considerate
come “ecologicamente obbligate” e influenzano fortemente la diversità e la produttività delle
foreste e possono anche esercitare una pressione selettiva sui microrganismi del suolo, sia
sulla loro diversità genetica che sulla loro diversità funzionale (Klett et al., 2005). Una
16
pianta può essere micorrizata con diversi funghi ed un singolo fungo può infettare diverse
piante. Quindi, la complessità delle possibili combinazioni dalla simbiosi micorrizica è
enorme. Le micorrize vengono tradizionalmente classificate in base alle modalità di
colonizzazione (Fig.2), in:
endomicorrize [micorrize (VAM) arbuscolo – vescicolari o (AM) arbuscolari] quando il
fungo penetra all’interno dei tessuti e delle cellule corticali dell’ospite ma non forma un
mantello fungino esterno, le ife fungine s'insediano sulla parte corticale della radice
penetrandone le cellule e riempiendone gli spazi intercellulari senza però invadere mai il
cilindro centrale. All’interno delle cellule possono formare delle strutture ovoidali dette
vescicole e delle strutture ramificate dette arbuscoli. Gli arbuscoli penetrando nelle cellule
dell’ospite superano la parte cellulare ma non la membrana citoplasmatica che si invagina
seguendone lo sviluppo. Le micorrize VA sono le più diffuse nel mondo vegetale mentre i
funghi che formano micorrize VA sono esclusivamente Glomeromycota.
Le ectomicorrize (ECM) costituiscono l’altro principale tipo di associazione micorrizica.
Esse sono caratteristiche delle piante forestali e di funghi come i Basidiomiceti e gli
Ascomiceti (Buscot et al., 2000). Nelle ectomicorrize il fungo si sviluppa internamente alle
radice solo nell’apoplasto originando il cosiddetto reticolo di Hartig e forma un mantello
fungino ricoprente l’apice radicale detto micoclena. Esse inoltre sviluppano una rete
miceliare che si diparte dal mantello e esplora il terreno circonstante da cui si sviluppa il
corpo fruttifero che può essere epigeo o ipogeo (nei cosiddetti tartufi). I funghi ECM hanno
un ruolo importante per piante ospiti sia negli ecosistemi naturali sia in queli forestali (Grove
e Le Tacon, 1993). Le ectomicorrize interessano il 3% delle fanerogame (Meyer, 1973).
Molina et al. (1992) hanno stimato che circa 5.500 specie vegetali e circa 20,000-25,000
specie fungine sono in grado di formare la simbiosi ectomicorrizica (Rinaldi et al. 2008).
Attualmente non è stato ancora chiarito con certezza quando le ectomicorrize siano comparse
sulla terra; basandosi su dati molecolari, Berbee e Taylor (1993) hanno suggerito che i
17
funghi ectomicorrizici siano comparsi per la prima volta durante il cretaceo inferiore (130
milioni di anni fa), questa ipotesa è stata confermata dalle prime esame delle testimonianze
fossili di ectomicorrize in radici di Pinus (Alvin, 1960).
Nelle ectomicorrize il mantello fungino di spessore variabile (20-60 µm) costituisce dal 20 al
40% della massa totale di un’ectomicorriza (Vogt et al., 1991). Esso è considerato come un
sito di immagazzinamento per i nutrienti del fungo acquisiti dal suolo (Smith e Read, 1997)
e come una protezione della radice. Nei tessuti fungini infatti le concentrazioni di N e P
sono più alte da 4 a 5 volte rispetto a costituite presenti nelle piante (Vogt et al., 1981). Il
reticolo di Hartig è costituisce da un interfaccia tra i due simbionti quindi ha un ruolo chiave
nella micorriza funzionalmente attiva (Bonfante, 2001); esso é formato da ife che dal
mantello si estendono verso l’interno della radice, tra l’epidermide e le cellule corticali e che
si organizzano a formare un tessuto pseudoparenchimatoso che avvolge completamente le
cellule radicali. Questa struttura é molto importante poiché permette al fungo di mantenere la
continuità dello scambio di fotoassimilati, nutrienti e acqua tra la pianta ospite ed il suo
partner fungino. Le ife extraradicali formano un ponte di connessione fondamentale della
micorriza col suolo, da cui traggono i nutrienti. (Martin e Tagu, 1999) (Fig.2).
18
Ectomicorrize
Endomicorrize
Fig. 2 - I principali tipi di associazione micorrizica (da Selosse e Le Tacon, 1998).
1.3.2. L’importanza della simbiosi micorrizice per la pianta
Il termine rizosfera è stato introdotto nel 1904 da Lorenz Hiltner (Linser et al., 2006) e
definito come una regione di terreno direttamente influenzata delle radici e dai
microrganismi associati; questa piccola porzione è considerata come una zona ecologica
ricca di elementi nutritivi, microflora, microfauna. Fra i microrganismi della rizosfera i
funghi micorrizici hanno un ruolo fondamentale per lo sviluppo della pianta. Nella
micorrizosfera le micorrize incrementano notevolmente le capacità di esplorazione del suolo
19
dell’apparato radicale delle piante ospiti e creano condizioni particolarmente favorevoli per
le piante. A livello di ecosistema, l’effetto delle micorrize si traduce in un’importante
influenza, sui cicli dei nutrienti, sulle popolazioni microbiche, su un miglioramento della
struttura del suolo. L'uso di funghi micorrizici può ridurre l'uso di agrofarmaci, perché la
loro presenza protegge le radici contro agenti patogeni. A lungo termine, il loro uso riduce i
costi associati alla coltivazione, essendo un'ottima alternativa ai prodotti chimici, sia nei
paesi in via ai sviluppo sia nei paesi industrializzati (Dechamplain e Gosselin, 2002).
Inoltre le piante micorrizate si presentano spesso più competitive e più tolleranti nei
confronti degli stress ambientali rispetto alle piante non micorrizate.
1.3.2.1. Nutrizione minerale
Dal punto di visa nutritivo il partner fungino svolge un ruolo fondamentale, perché le ife si
espandono nel terreno circostante per diversi metri, questa ricerca porta ad un aumento della
superficie del sistema radicale della pianta (1000 metri di micelio per ogni metro di radice)
(Plassard et al. 2000) e consente di esplorare volumi maggiori di terreno con minore
dispendio energetico e quindi con una maggiore efficienza. Percò possono estrarre dal suolo
una maggiore quantità di nutrienti minerali. In particolare i funghi micorrizi sono in grado di
assorbire i composti azotati e fosfatici trasformarli in molecole facilmente utilizzabili dalla
radice della pianta ospite; questo si traduce in una maggiore crescita della pianta. L’“effetto
crescita” è evidente soprattutto nei terreni poveri di elementi minerali. Il fungo inoltre può
solubilizzare composti insolubili presenti nel terreno, aumentando la disponibilità di
elementi nutritivi. Dal punto di vista selettivo, perciò le piante micorriziche hanno un
vantaggio nei confronti delle piante non micorriziche essendo in grado di adattarsi anche in
terreni paticolmenti poveri di elementi nutritivi.
L’instaurarsi delle simbiosi micorrizici tra fungo e pianta é favorità dalle scarsità di azoto
nel suolo. Infatti se l’azoto è in eccesso, la pianta è in grado di assorbirne da sola una
sufficiente quantità senza l’aiuto del fungo e pertanto non metteno zuccheri a disposizione
20
del fungo (Buscot et al., 2000).
Da molto tempo é stato dimostrato che tra i simbionti micorrizici si verifica una
traslocazione bidirezionale di sostanze diverse. Già nei primi studi sulle micorrize alcuni
autori, che avevano somministrato alle ife fungine sostanze nutritive marcate isotopicamente
(ioni fosfato, ammonio, nitrato, sodio, calcio etc.) e le hanno ritrovate nelle foglie dei loro
ospiti (Melin e Nilsson, 1958; Melin e Nilsson, 1952; Melin e Nilsson, 1953). Oltre al
miglioramento della nutrizione minerale, le micorrize offrono altri benefici come la
tolleranza allo stress idrico (Lamhamedi et al., 1992), la tolleranza ai metalli pesanti (Read,
1999) e la protezione contro gli agenti patogeni (Aguilar-Azcon e Barea. 1996).
1.3.2.2. Tolleranza ai metalli pesanti nel suolo
All’interno del biota del suolo, i funghi micorrizici hanno evidenziato caratteristiche uniche
di assorbimento e tolleranza ai metalli pesanti e sono in grado di colonizzare aree che
presentano altissime concentrazioni di ioni metallici quali Pb2+, Zn2+, Cd2+. Questo
meccanismo non è facile da spiegare e presenta una notevole specificità a seconda del
metallo e della specie di fungo coinvolta (Hall, 2002). La resistenza al metalli pesanti può
essere acquista attraverso l’assorbimento dell’inquinante da parte delle ife e la chelazione da
parte di sostanze secrete dai funghi come la glomalina (Hall, 2002), o attraverso meccanismi
che permettono al fungo di tollerare e sopravvivere in presenza di concentrazioni elevate
dell’elemento tossico (Turnau et al., 1996). Essi non possono essere chimicamente degradati
e si accumulano nella biosfera, questi metalli possono essere sequestrati
dal mantello
fungino, possono altresì accumularsi nei corpi fruttiferi dei fungi, rendendoli inadatti al
consumo. L’unica soluzione per un completo biorisanamento è utilizare tecniche di
immobilizzazione e di estrazione del metallo dal suolo (Leyval et al., 1997). Nei suoli
inquinati è stato mostrato che i funghi AM, influenzano in più modi l’assorbimento e
alleviano gli effeti della tossicità del metallo tossico (Leyval et al., 1997). Dixon e
Buschema, (1988) hanno dimostrato che piante di Pinus banksiana e di Picea glauca
21
inoculate con il fungo ectomicorrizico Suillus luteus, erano protette dalla tossicità dei metalli
pesanti e la loro crescita era favorita. Le micorrize sono stati proposte come anche
bioindicatori della presenza di inquinanti nel suolo, infatti alcune specie o ceppi fungini
ectomicorrizici sono più sensibili di altre possono essere utilizzate come uno strumento
integrativo alle procedure chimiche di estrazione dei metalli dal suolo per verificarne la
presenza a livelli tossici..
1.3.2.3. Protezione dagli stress salini
Il beneficio delle micorrize verso le piante non si concretizza solamente nei confronti
dell’assorbimento di nutrienti e tolleranza ai metalli pesanti. Infatti le piante micorrizate
mostrano spesso una maggiore resistenza/tolleranza agli stress biotici (attacchi di funghi
patogeni e nematodi) e abiotici (stress idrico e salino). L’eccesiva salinità rappresenta spesso
una delle principali cause di stress limitanti la crescita e la produttività delle piante coltivate.
I funghi micorrizici hanno un ruolo positivo nella tolleranza della pianta alla salinità. Questa
resistenza viene indotta tramite una limitazione nell’assorbimento degli ioni Na e Cl presenti
nel terreno circostante, tramite il miglioramento delle condizioni osmotiche della pianta
(Azcon et al., 1996) e tramite un bilanciamento tra gli ioni meno facilmente disponibili,
quali il fosfato (Graham, 1986). Bedini et al. (2004) hanno scoperto una recente
glicoproteina dinominata, glomalina prodotta di due specie specie di funghi micorrizici
arbuscolari (AM), Glomus mosseae e Glomus intraradices che è in grado di chelare
fortemente non solo il ferro, ma anche metalli pesanti potenzialmente tossici, incluso il
sodio.
1.3.2.4. Protezione dagli stress idrico
Le micorizze possono essere considerate un prolungamento dell’ apparato radicale, per cui
garantiscono un resistenza allo stress idrico anche in condizioni di estrema secchezza; ciò é
dovuto a moltissimi fattori come l’aumento della conduttività idrica della pianta, la
diminuzione della resistenza al flusso dell’acqua che attraversa la pianta, ma soprattutto al
22
maggior assorbimento dell’acqua da parte delle ife extraradicali che si estendono oltre la
zona esplorata dalle radice. Coleman et al., (1990) hanno dimostrato che la conducibilità
idrica del sistema suolo – pianta é migliore nelle piante micorrizate.
1.3.2.5. Protezione della malattia
Molti microrganismi (funghi, batteri) come i funghi micorrizici possono proteggere la pianta
ospite attraverso meccanismi diversi quali la competizione con i patogeni per i siti di
infezione e per i nutrienti, la formazione di una barriera fisica intorno alle radici, l’induzione
di meccanismi di difesa. Nelle cellule contenenti gli arbuscoli, vengono infatti attivati di geni
codificanti per la resistenza ai patogeni. Inoltre, l’applicazione di funghi micorrizici è in
grado di attivare nei tessuti della pianta una resistenza sistemica efficace oltre che contro i
patogeni radicali, anche nei confronti di quelli della parte aerea e di organismi sistemici quali
i fitoplasmi (Romanazzi et al., 2009). I funghi micorrizi possono ridurre la gravità di alcune
avversità biotiche causate da nematodi e soprattutto da patogeni tellurici (Sclerotium
cepivorum, Fusarium oxysporum, Verticillium dahliae, Rhizoctonia solani, Phytophthora
capsici, Pythium spp., ecc.) (Whipps, 2004), alterando la fisiologia dell’ospite e rendendo le
radici più resistenti ai patogeni stessi. Le piante micorrizate resistono meglio all’attacco di
agenti patogeni e crescono meglio rispetto quelle non micorrizate (Andrade et al. 2009). Si
stima che le micorrize possono portare ad una riduzione della patologie fungine compresa tra
il 55% ed il 70% (Dehne, 1982). Infatti le radici micorrizate costituiscono una barriera fisica
contro i patogeni e possono secernere alcuni antibiotici che inibiscono i patogeni radicali
(Perrin, 1985). Pozo e Azcón-Aguilar (2007) hanno dimostrato, che la formazione delle
micorrize induce nella pianta una resistenza di tipo sistemico (ISR), simile a quella indotta a
seguito di risposta di ipersensibilità. In particolare alcuni enzimi idrolitici prodotti a seguito
dell’infezione micorrizica, quali chitinasi e ß- glucanasi hanno un ruolo protettivo; essi
infatti sono riconosciuti per la loro attività antifungina (Dalpé, 2005). In alcune associazioni
fungo - pianta si vede inoltre un aumento del livello di lignificazione della parete cellulare
23
dell’ endoderma, dei tessuti vascolari e un accumolo di callosio, questo permette la
formazione di una barriera contro la penetrazione di patogeni (Dalpé, 2005).
1.4. Generalità sul tartufo
Cenni storici
Il tartufo è un frutto della terra già conosciuto dai tempi più antichi; alcuni storici fanno
risalire la prima menzione del tartufo come alimento ai tempi di Giacobbe, circa
milleseicento anni prima di Cristo.
In un libro intitolato "Storia delle piante", Plinio il Vecchio afferma che i tartufi sono piante
senza radici originali dalla terra. Altri autori antichi pensavano che l’origine di questo
prezioso fungo fosse dovuta all’azione dell’acqua, del calore e dei fulmini (Pacioni, 1986).
Secondo Ravel (in Moigno, 1856) il tartufo nasce dalla puntura fatta da una mosca alla
radice di alcune specie di alberi, soprattutto querce. Solo recentemente Alfonso Ciccarello
nel 1564 in un piccolo libro, intitolato“l’opusculum de Tuberibus” considera per la prima
volta il tartufo come uno speciale tipo di fungo. Infine solo 19 ° secolo, (Frank, 1885) scopre
le micorrize.
Caratteristiche generali
Dal punto di vista della collocazione sistematica, il tartufo è un fungo ipogei appartenente
alla classe degli Ascomiceti, che forma ectomicorrize, come tutti i funghi non è in grado, per
la mancanza di clorofilla, di compiere la fotosintesi che produce le sostanze necessarie
all’accrescimento della pianta, cosicché per crescere e svilupparsi ha la necessità di trarre il
nutrimento da altre piante (piante simbionti): querce, pioppi, salici, noccioli, faggi, conifere.
Come tutti gli ascomiceti, i tartufi sono caratterizzati dalla presenza di strutture
microscopiche (aschi) che contengono spore (ascospore), cioè gli organi per la riproduzione
sessuata del fungo.. Le esigenze ecologiche dei tartufi sono molto specifiche . In generale, i
tartufi di maggiore pregio sono anche i più esigenti in fatto di temperatura, di quantità e
distribuzione delle piogge, di tipo di suolo, mentre quelli di minor pregio sono adattabili ad
24
una maggiore varietà di habitat. Nel mondo ci sono circa 60 specie di tartufi (Trappe, 1979),
di cui circa 20 crescono in Europa (Riousset et al., 2001) tutte presenti in Italia. In base alla
legge nazionale 752 del 16 dicembre 1985, che regolamenta la raccolta, la conservazione e la
commercializzazione dei tartufi in Italia, sono solo 9 i taxa (corrispondenti a 7 specie) che
possono essere commercializzati (fig.3).
Fig. 3: Tartufi che possono essere raccolti e commercializzati in Italia
Tuber magnatum Pico ( il tartufo bianco pregiato) all’estero conosciuto come “Italian white
truffle”e Tuber melanosporum Vittad. (il tartufo nero pregiato), “the black diamond of
Perigord sono le specie che raggiungono il più elevato valore commerciale e economico a
livello mondiale, mentre altre (Tuber borchii Vittad., Tuber macrosporum Vittad., Tuber
aestivum Vittad., Tuber. brumale Vittad. e Tuber. mesentericum Vittad.) sono meno
pregiate, ma hanno importanza a livello locale. Esistono inoltre altre specie di tartufi
provenienti da altri continenti e che sono localmente consumate, alcune delle quali hanno di
25
scarso valore commerciale, come Terfezia arenaria, (soprattutto nel nord dell’Africa e Siria),
Tuber oligospermum (Marocco), Tuber oregonense, Tuber griseum, Leucangium
carthusianum (nord America), Tuber indicum e Tuber pseudoexcavatum (Cina). Alcune di
queste specie in particolare T. indicum
e T. oligospermum vengono importate
clandestinamente in Italia e commercializzate come i tartufi più pregiati.
1.4.1. Il ciclo biologico
Il ciclo biologico dei tartufi è particolarmente complesso e presenta alcune fasi ancora non
del tutto chiarite. Sulla base di studi condotti principalmente su T. melanosporum è possibile
identificare tre fasi: la fase vegetativa, quella riproduttiva e quella simbiotica,; dopo un
periodo variabile di quiescenza e in condizioni pedoclimatiche più favorevoli, le spore
disseminate nel terreno da animali idnofagi cominciano a germinare, emettendo prima un
micelio momonucleato (micelio primario, fase vegetativa) che si accresce verso le giovani
radici delle piante formando le micorrize (fase simbiotica). In condizioni ecologiche ideali
quando la pianta ospite ha raggiunto la maturità fisiologica, la micorriza smettono di crescere
e si sviluppano il primordio del corpo fruttifero a seguito della gamia fra due miceli di
mating type diveso (fase di fruttificazione). In seguito il corpo fruttifero si rende
indipendente dalla pianta e continua il suo sviluppo, in modo autonomo mediante
l’assorbimento di nutrienti dal terreno con il proprio micelio peritrofico fino alla completa
naturazione. Parguey-Leduc et al., (1984) hanno dimostrato che quando l’ascocarpo
raggiugere le dimensioni di 1 mm di diametro, e circa 3 mg di peso, esso presenta già il
peridio formato e la gleba costituita da vene fertili e sterili.
26
Ciclo biologico del tartufo (www.tuber.it)
1.4.2. Tassonomia
Dopo il Rinascimento, l'Italia divenne la culla del lavoro di ricerca sul tartufo. De Borsch,
(1780) pubbicò a Milano un primo libro sul tartufo in cui riconosce tre specie di Tuber.
Sempre a Milano, nel 1787, il torinese Vittorio Pico, nella sua mirabile tesi di laurea in
medicina, intitolata “Melethemata inauguralia - Exphysica de fungorum generatione et
propagatione”,descrisse, per la prima volta i caratteri morfologici macro - e microscopici di
T. magnatum, e di T. rufum e T. albidum che sarà poi chiamato T. borchii (Riousset et al.,
27
2001). Carlo Vittadini (1800-1865), medico milanese e naturalista dell’Orto Botanico
dell’Università di Pavia, nella sua opera“Monographia tuberacearum” (1831), fece notevoli
progressi nella tassonomia dei tartufi e descrisse ben 51 specie. I tartufi
sono stati
considerati in un primo tempo appartenenti all’ordine delle Tuberales. Nel 1979, basandosi
su criteri morfologici e biochimici, Trappe inseriva la famiglia delle Tuberacee, di cui fanno
parte i tartufi, nell’ordine delle Pezizales, insieme alle famiglie delle Helvellaceae,
Pezizaceae, Ascobolaceae, ecc . In seguito le analisi filogenetiche codotte sulle regioni 18S
e 28S del DNA ribosomale da Percudani et al. (1999) hanno confermato la collocazione
sistematica dei tartufi nell’ordine delle Pezizales (fig.4). In fig.5 è riportata la più recente
classificazione dell’ordine Pezizales di Hansen e Pfister (2006).
28
Fig.4. Albero filogenetico dell’ordine delle Pezizales secondo Percudani et al., (1999)
29
Fig.5. Albero filogenetico dell’ordine delle Pezizales secondo Hansen e Pfister (2006)
1.4.3. Ecologia dei tartufi
L’ecologia è la scienza che studia le relazioni tra sistemi viventi e tra questi e l’ambiente
ovvero tra i fattori abiotici (condizioni fisico-chimiche, luce, temperatura, acqua,
composizione del suolo) e i fattori biotici (compendono tutti gli esseri viventi che vivono in
30
un ecosistema; essi interagiscono sia fra di loro sia con l’ambiente che li circonda).
Le ricerche ecologiche sui tartufi hanno permesso di studiare i caratteri degli ambienti dove i
tartufi nascono e si sviluppano spontaneamente; questi risultati hanno permesso di capire le
loro principali esigenze di cui tenere conto per la loro coltivazione e di individuare i più
importanti fattori ecologici responsabili della loro fruttificazione. Le esigenze ecologiche dei
tartufi riguardono il clima, con tutti i suoi componenti (altitudine, latitudine, venti,
temperature, precipitazioni, umidità dell’aria). Fra questi fattori climatici l’andamento delle
precipitazionie le temperature, hanno un effetto notevole sugli ecosistemi condizionando la
distribuzione e la composizione delle biocenosi e determinano condizioni favorevoli
sull’attività del micelio del tartufo, lo sviluppo e la formazione delle micorrize ed particolare
influenzano la composizione delle comunità fungine ectomicorriziche. Lo studio dei suoli è
estremamente importante. Il suolo infatti è la porzione interposta tra l’atmosfera e la
litosfera, che ospita sia la pianta sia il tartufo; in particolare i tartufi esigono terreno basico
(pH superiore a 7) e calcareo; se il pH è inferiore a 6 nessun tipo di tartufo potrà sciluppare.
Le specie microbiche del suolo possono inoltre influenzare la composizione delle comunità
fungine ectomicorriziche come sarà illustrato nel paragrafo successivo.
31
1.4.4. Caratteristiche ecologiche delle principali specie di tartufi
Distribuzione
geografica
caratteristiche
del suolo
Piante Simbionti
T. magnatum
Principale paese
produttore
di
questo tartufo è
l'Italia,
ma
possiamo
trovarlo in Istria,
Croazia, e in
piccole aree del
sud est della
Francia,
Ungheria,
Serbia, Slovenia
e CantonTicino
(Hall et al.,
2007)
Si ritrova sotto pioppo (in
particolare pioppo
bianco), salice, tiglio, querce
(roverella, leccio, farnia, e
cerro), altri simbionti sono il
nocciolo (Corylus avellana), il
carpino
nero
(Ostrya
carpinifolia),
(Riousset et al., 2001)
T. borchii
Ha una vasta
distribuzione
geografica
in
Europa,
della
Sicilia fino al
sud
della
Finlandia
(Riousset et al.,
2001)
Terreno
preferibilmente
marnosocalcareo, povero
di fosforo e di
azoto ma ricco di
potassio,
con
scarsa dotazione
di
sostanza
organica, con pH
tra 7-8,5.
I
terreni
favorevoli
a
T.magntum sono
ben
drenati
(Riousset et al.,
2001)
Caratterizzato da
terreni sabbiosi e
calcarei
tipici
delle pinete
litoranee,
ma
vegeta anche nei
terreni argillosi e
debolmente acidi
(Riousset et al.,
2001)
Terreno calcareo
breccioso
(permeabile),
con pH tra 7,5 e
8,0.
È
stato
trovato nei suoli
dell'era primaria,
secondaria,
terziaria
e
quaternaria
(Riousset et al.,
2001)
T .melanosporum Areale
di
diffusione molto
vasto, si trova in
Francia, Italia e
Spagna. è stato
trovato trovato
anche in Gran
Bretagna,
Svizzera,
Portogallo,
Serbia, Grecia,
Bulgaria
e
Turchia.
(Riousset et al.,
2001)
32
Si trova sotto , pino domestico
(Pinus pinea), pino marittimo
(Pinus
pinaster),
pino
d'Aleppo (Pinus halepensis),
simbionti sono anche le querce
sia rovere (Quercus sessiflora),
cerro (Quercus cerris) e
roverella (Quercus pubescens)
Si trova sotto le piante di
roverella , di leccio,
di
nocciolo, di carpino,
di pino domestico e di cisto
1.4.5. Il tartufo e i batteri del suolo
Il suolo è l’habitat d’elezione dei funghi, le comunità microbiche in esso presenti potrebbero
avere un impatto nella colonizzazione delle radici delle piante da parte dei funghi micorrizici
e alterare gli effetti che i funghi hanno sulla crescita della pianta stessa (Piculell, 2008).
Alcuni batteri presenti nella rizosfera sono in grado di favorire l’instaurarsi della
micorrizazione e di stimolare la capacità di infezione fra fungo e pianta ( Frey- klett et al.,
2007). Una ricerca condotta da Hodge et al. (2000), che riguarda le micorrize arbuscolari,
dimostra che la comunità microbica del suolo è in grado di influenzare la crescita del fungo e
lo stabilirsi del rapporto simbiotico con la pianta ospite in maniera positva, negativa o neutra.
In particolare, gli effetti negativi sul fungo si traducono con la riduzione del numero di spore
germinanti, della lunghezza delle ife, del grado di colonizzazione della radice della pianta
ospite. Gli effetti positivi indotti dalla componente microbica si esplicano in una maggior
crescita del micelio fungino e in un aumento della capacità iniziale del fungo di colonizzare
le radici della pianta, contribuendo quindi a migliorare lo sviluppo e il funzionamento della
simbiosi micorrizica.
1.5. La coltivazione del tartufo
Coltivare i tartufi è sempre stata l’aspirazione di molti studiosi a causa dell’alto valore
gastronomico e commerciale che hanno questi preziosi funghi. Nel tempo sono state provate
varie tecniche di coltivazione. All’inizio del XIX secolo i primi tentativi di coltivazione
risalgono ad un agricoltore francese Joseph Talon. Egli scoprì che era possibile creare nuove
tartufaie seminado ghiande in terreni idonei allo sviluppo del tartufo (Singer e Harris, 1987).
Verso la fine del XIX secolo, la produzione di tartufi in Francia aumentò notevolmente
(Chatin, 1892). In Italia tali ricerche furono riprese da Mattirolo (1928), che aveva già ben
chiaro il significato biologico delle micorrize; egli sosteneva che per coltivare il tartufo
bisognava rimboschire terreni adatti con determinate specie arboree, quali querce, salici e
noccioli. Nel 1931 Francolini, suggerì che per realizzare tartufaie artificiali bisognava
33
distribuire direttamente nel terreno frammenti di carpofori maturi (Francolini, 1931).
Purtroppo, gli impianti effettuati da Francolini non dettero i risultati produttivi attesi a causa
dei funghi ectomicorrizici antagonisti presenti nelle aree del impianto. Lorenzo Mannozzi
Torini Ispettore del Corpo Forestale dello Stato) (Mannozzi-Torini, 1976) può essere
considerato il padre della tartuficoltura moderna, infatti fu il primo ad ottenere, in
laboratorio, piantine micorrizate in condizioni controllate con Tuber spp. Nel corso degli
ultimi anni, grazie agli studi di numerosi ricercatori italiani e francesi, le tecniche di
coltivazione del tartufo si sono sempre più perfezionate. Oggi la tartuficoltura è
un’importante realtà produttiva per molte specie di tartufo. L’Italia è ricca di ambienti in cui
varie specie di tartufo potenzialmente possono essere coltivate con successo. Infatti, le specie
commercialmente più importanti sono presenti in tutte le regioni d’Italia: T. magnatum è
presente in tutta la penisola, T. melanosporum in tutto il centro-nord e nel sud, T. aestivum e
T. borchii si possono trovare oltre che in tutta la penisola anche in Sicilia e Sardegna. In
Italia, si stima che ogni anno siano messe a dimora circa 120000 piante micorrizate con T.
melanosporum (80%) e con T.aestivum (15%), il numero di piante micorrizate con T.
magnatum, T. brumale, T. borchii invece è minimo (solo il 5%) (Bencivenga et al., 2009).
La coltivazione del tartufo si configura come attività agricola produttiva in grado di
contribuire significativamente allo sviluppo socio-economico rurale, in particolare nei terreni
collinari e montani. Solo la coltivazione di T. magnatum presenta ancora notevoli problemi
sia per le difficoltà di ottenere le sue micorrize in serra, sia per le problematiche che si
incontrano a pieno campo. Le sue micorrize in campo, infatti, sembrano scomparire e
vengono sostitute da quelle di altri funghi ectomicorrizici. Una migliore conoscenza della
biologia del tartufo ed in particolare la comprensione dei meccanismi molecolari che portano
alla formazione delle micorrize e del carpoforo, l’individuazione dei fattori biotici ed abiotici
che attivano questi meccanismi è indispensabile per poter sviluppare moderne tecnologie per
la produzione di piantine micorrizate e per incrementare la produttività delle tartufaie di
34
T.magnatum.
1.5.1. La micorrizazione con tartufo e controllo delle piante tartufigene
La micorrizazione é fondamentale per la tartuficoltura. I problemi più rilevanti della
produzione vivaistica di piantine micorrizate con tartufo riguardano la contaminazione con
funghi simbionti antagonisti. In serra i contaminanti più comuni sono gli ascomiceti
Sphaerosporella brunnea e Pulvinula constellatio (Amicucci et al., 2001). Le
contaminazioni sono molto più pericolose quando sono causate da funghi ectomicorrizici
del genere Tuber di scarso pregio che possono essere presenti nell’inoculo. Infatti alcune
specie di tartufo danno luogo a micorrize molto simili tra loro difficilmente distinguibili
morfologicamente; per questo é importante effettuare un accurato controllo dell’inoculo ed
in seguito delle piantine prima della loro messa in pieno campo. L’identificazione delle
micorrize con il metodo morfologico é importante, ma non permette un riconoscimento
sicuro del fungo simbionte, per esempio alcune specie di scarso pregio quali T. maculatum e
T. indicum si possono facilmente confondere rispettivamente con quelle di T. magnatum e di
T. melanosporum (Zambonelli et al.,1999; Zambonelli et al., 1997) e micorrize di T.borchii
e T. maculatum con quelle di T. magnatum (Mello et al., 2001; Rubini et al., 2001)
1.5.2. Metodi di micorrizazione
Per ottenere delle piantine micorrizate è importante avere un ambiente il più possibile simile
a quello naturale ed eliminare la competizione di altri funghi micorrizici. Il processo richiede
la produzione delle piantine in serra in condizioni controllate. Le metodologie utilizzate per
la produzione di piante micorrizate sono diverse e sono rappresentate dall’inoculazione
sporale, per approssimazione radicale e miceliare.
Inoculazione sporale
Questo metodo è il più antico, ma ancora il più diffuso per la sua semplicità per produzione
di piantine micorrizate con tartufo. Secondo questa tecnica, piantine ottenute da seme o da
talea sono inoculate con corpi fruttiferi maturi spappolati con un pestello e un mortaio o con
35
un frullatore miscelati ad acqua sterile.
I semi delle piante ospiti devono essere sterilizzati prima del loro impiego per evitare le
contaminazioni; anche i carpofori dei tartufi impiegati per l’inoculazione devono essere
lavati e la superficie deve essere sterilizzata con un veloce passaggio alla fiamma. Le spore
contenute nel tartufo spappolato vengono messe a contatto con le radici, mediante
immersione degli apparti radicali nella sospensione sporale o mescolando la sospensione in
terreno. In seguito le piantine sono devono essere allevate in serra in vasi oppurtuni per
favorire il processo di micorrizazione. Il metodo di inoculazione sporale è particolarmente
idoneo per la produzione di piantine micorrizate con T. borchii, T. melanosporum T.
aestivum, mentre non è facile ottenere piantine ben micorrizate con T. magnatum, in quanto
le spore di questo tartufo germinano con difficoltà (Tibiletti e Zambonelli, 2000).
Approssimazione radicale
Questo metodo di inoculazione é meno costoso, permette di risparmiare sul costo d’acquisto
dei carpofori. Per l’applicazione di questo metodo si utilizza come fonte di inoculo o piante
madri micorrizate con la metodologia precedentemente descritta, le quali sono trapiantate in
grandi vasche riempite con del terreno sterile, circondate da giovani piantine che possono
provenire dai semenzali, da talee radicate o anche da colture in vitro. Il metodo si basa sulla
capacità del micelio di propagarsi per infettare le radici non micorrizate. In alternativa si
prelevano porzioni di radici ben micorrizate dalla pianta madre che sono avvolte sempre in
ambiente sterile, attorno a quelle di giovani piantine ottenute in condizioni di sterilità.
Questa procedura é molto laboriosa ed é necessario che questo metodo sia applicato solo da
personale specializzato, in grado di riconoscere le micorrize di tartufo presenti nella pianta
madre e valutare l’assenza di funghi ectomicorrizici, per evitare il rischio di propagare
micorrize di funghi inquinanti al posto di quelle del tartufo.
Inoculazione miceliare
La germinazione delle spore di tartufo é aleatoria, dipende da molti fattori biotici ed abiotici
36
ancora sconosciuti e il costo degli ascomi utilizzati per le inoculazioni è elevato. Solo
attraverso l’utilizzo delle nuove biotecnologie di micorrizazione miceliare che si stanno
sperimentando nel nostro laboratorio, si possono notevolmente migliorare le tecniche di
produzione delle piantine micorrizate con tartufo. Esse offrono la possibilità di utilizzare per
le inoculazioni, miceli in coltura pura geneticamente selezionati, sia per la loro affinità la
pianta ospite prescelta, sia per la loro adattabilità alle diverse condizioni ecologiche delle
zone di impianto e sia per la loro precocità produttiva. In passato sono stati fatti numerosi
tentativi di isolamento del micelio di Tuber spp in coltura pura, ma spesso i miceli ottenuti
crescevano troppo lentamente per riuscire ad inoculare le piantine. I primi tentativi utilizzare
colture pure miceliari per la produzione di piante tartufigene risalgono agli anni 70
(Chevalier 1973, Chevalier et al., 1973). Recentemente nei nostri laboratori sono state
ottenute colture pure di T. borchii, di T. macrosporum, di T. aestivum, di T.melanosporum,
di T. brumale e di T. rufum (lotti et al., 2002) sufficientemente vigorose per essere utilizzate
per ottenere micorrize in serra (Zambonelli e Iotti, 2006). Questo procedimento offre
numerosi vantaggi (oltre a quelli economici e produttivi già citati) tra cui quello di produrre
piantine con un grado di micorrizazione elevato e costante ed esenti da inquinamenti
(Zambonelli e Iotti, 2006). Infine poinché le piante vengono coltivate in laboratorio, si
possono produrre tutto l’anno.
1.6. Metodi molecolari e l’identificazione dei funghi del genere Tuber
L'identificazione di tartufi è tradizionalmente basata sulle caratteristiche morfologiche del
corpo fruttifero (aspetto, colore, dimensione), delle spore (forma, ornamentazioni) e delle
micorrize (Pegler, 1993). Spesso, tuttavia non è risolutiva, poinché la valutazione di tali
caratteri richiede operatori di notevole esperienza soprattutto per le micorrize. Le micorrize
che si trovano nel terreno sono infatti generalmente a diversi stadi di sviluppo e raramente
presentano tutte le caratteristiche necessarie per una corretta identificazione morfologica,
rendendo spesso impossibile l'identificazione morfologica. Inoltre come già detto alcune
37
specie presentano caratteristiche simili (Zambonelli et al., 1993). Per questo per confermare
l’appartenenza di micelio e micorrize ad una determinata specie è necessario utilizzare altri
metodi, come quelli molecolari che sono più affidabili, infatti permettono l’identificazione
delle varie specie di tartufo in tutte le fasi del ciclo biologico.
A partire da 1983, le tecniche molecolari hanno permesso di fare enorme passi avanti nella
comprensione del mondo dei funghi del genere Tuber. Le sequenze degli spaziatori interni
trascritti (ITS) del DNA ribosomale nucleare sono le più utilizzate, perché ci sono una serie
di primer universali per amplificale (White et al., 1990) e si ripetono nel genoma
facilitandone l’amplificazione (Cassidy et al., 1984). Il sequenziamento di questa regione
genica ha permesso inoltre di disegnare primers specifici da utilizzarsi in PCR semplice o in
PCR multiplex per una identificazione più rapida delle diverse specie di tartufo (Amicucci et
al., 1998; Amicucci et al., 2000)., E’ già stata sequenziata la regione ITS di ben 29 specie
del genere Tuber . L’analisi e la conoscenza di queste sequenze ha permesso, infatti, lo
sviluppo di queste tecniche molecolari permettono di identificare il tartufo utilizzato anche
nei cibi, per evitare una frodi commerciale a danno del consumatore. Per esempio, Tuber
brumale o T. indicum vengono spesso utilizzati al posto di T. melanosporum per cui Douet et
al. (2004), hanno designato primer PCR specifici per Tuber brumale, T. indicum e T.
melanosporum.
1.7. Tuber magnatum Pico
E’ l tartufo di maggior pregio come confermano anche i prezzi di mercato che per questa
specie sono da una a dieci volte superiori a quelli degli altri tartufi. E un tartufo tipicamente
italiano, si rinviene in quasi tutte le Regioni d’Italia, dal Piemonte alla Basilicata.
Nonostante sia la specie più pregiata a tutt’oggi le conescenze acquisite non sono ancora in
grado di comprendere completamente la sua biologia e ecologia. Queste carenze conoscitive
sono dovute a difficoltà oggettive legate alle caratteristiche eco-fisiologiche di questa specie
che ne rendono difficile lo studio sia in laboratorio sia in campo. T. magnatum è infatti un
38
fungo strettamente biotrofico che non sviluppa in assenza della pianta ospite. Inoltre le zone
di produzione naturale sono infatti estremamente eterogenee per produttività, solo alcune
piante sono micorrizate e la produzione di ascomi varia notevolmente nel tempo a seconda
delle condizioni climatiche stagionali. Altro aspetto da considerare è che nelle tartufaie di T.
magnatum, coltivate o naturali, oltre alla produzione di tartufi si verificano fruttificazioni di
altre specie fungine micorriziche e saprotrofe e generalmente i funghi ectomicorrizici
presenti sono ritenuti competitori nei confronti dei Tuber.
T. magnatum è caratterizzato da un ascoma di forma molto variabile da sferica a lobata. Il
corpo fruttifero ha dimensioni variabili da quella di un pisello a quella di una grossa arancia
e raramente è ancora più grande (sono stati raccolti carpofori di eccezionale grandezza e del
peso di oltre 2 kg) (Fig.6). Il peridio è liscio, di colore variabile dall'ocra pallido al giallo
chiaro al verde tenue e talora con sfumature rossastre. Anche la gleba è di colore variabile
dall'ocra chiaro al nocciola più o meno intenso ed è solcata da numerose vene bianche e
sottili che scompaiono con la cottura. Gli aschi sono globosi od obovati, sub-peduncolati,
contengono 1-4 spore e misurano in media 60-70 x 40-65 µm. Le spore sono di tipo
alveolato, rotonde o lievemente ellittiche, il diametro è mediamente di 21-30 µm e gli alveoli
sono grandi (10-20 µm di diametro), all’osservazione microscopica se ne contano 3-4. Il
periodo di fruttificazione si colloca da ottobre fino a dicembre. Il tartufo bianco è in grado di
svilupparsi solo in pedoambienti molto circoscritti. Il terreno delle tartufaie naturali deriva
da substrati composti da marne, calcari marnosi, marne argillose, arenarie, con pH neutro o
alcalino.
39
a
b
Fig.6. (a)-(b) Ascomi di Tuber magnatum
Dal punto di vista climatico, preferesce le aree con clima continentale, anche se talora si
trova in ambiente con clima mediterraneo. I cercatori di tartufi sanno che esiste una
correlazione molto significativa fra la pioggia estiva (mesi di giugno e luglio) e la
produzione dei tartufi. Le tartufaie si localizzano di prefrenza nei fondi valle freschi e lungo
i fossati in una fascia altimetrica ottimale da 100 a 600 m slm. In terreni umidi le piante
ospiti sono il pioppo (Populus spp., in particolare pioppo bianco) e salice (Salix spp.), in
pianura si trova spesso associato al tiglio (Tilia spp.) e, nei terreni di collina si lega spesso
con la roverella (Quercus pubescens) e talora al leccio (Quercus ilex). Altri simbionti sono il
nocciolo (Corylus avellana), il carpino nero (Ostrya carpinifolia), la farnia (Quercus robur)
e il cerro (Quercus cerris).
40
41
Scopo della tesi
I tartufi sono funghi ascomiceti caratterizzati da ascomi ipogei indeiscenti di forma sferica
più o meno regolare (Trappe et al., 2009). Da un punto di vista sistematico sono collocati in
numerose famiglie dell’ordine delle Pezizales (Pezizaceae, Morchellaceae, Discinaceae,
Helvellaceae, Tuberaceae e Pyronrmataceae). I tartufi possono essere coltivati in pieno
campo attraverso la produzione di piantine micorrizate e la loro messa a dimora in terreni
idonei (Hall et al., 2007). La produzione di piante micorrizate con tartufo è pertanto il primo
passo per poter realizzare la tartuficoltura. Purtroppo però, dal punto di vista sperimentale, il
genere Tuber presenta notevoli difficoltà di studio di ordine pratico che coinvolgono anche i
processi d’infezione delle piantine. Il T. magnatum, tartufo bianco pregiato, è la specie di
maggior pregio sia per il limitato areale di sviluppo, rappresentato solo dall’Italia ed alcune
aree dei Balcani, sia per le difficoltà che si incontrano nella sua coltivazione (Hall et al.,
2007). Gli studi su questa specie sono estremamente complessi in quanto finora era
impossibile disporre del suo micelio in vitro e per le difficoltà di ottenere piantine
micorrizate in serra. Per tali motivi i biologi hanno sempre fatto riferimento ad altre specie
fungine, da impiegare come modelli nello studio delle simbiosi ectomicorriziche, poiché
queste offrivano una maggiore certezza e rapidità nell’ottenimento dei risultati scientifici.
Una delle specie modello più impiegata è Tuber borchii, tartufo bianchetto, il cui micelio, a
differenza di quello delle altre specie, si coltiva facilmente in vitro (Iotti et al., 2002). Per
questo motivo spesso è stato utilizzato per lo studio della biologia dei tartufi e delle
interzioni con la pianta ospite.
L’obiettivo di questa tesi è stato quello di sperimentare nuove biotecnologia per migliorare le
tecniche di micorrizazione delle piantine con tartufo ed in particolare con T. magnatum che
come già menzionato sopra è la specie più difficile da coltivare.
42
La parte sprimentale delle presente tesi è stata articolata in 5 capitoli ciascuno inerente al
conseguimento dei seguenti obiettivi:
1. Isolamento e caratterizzazione di ceppi di T. magnatum;
2. Miglioramento dello sviluppo delle colture pure di T. magnatum;
3. Valutazione di estratti radicali sullo sviluppo dei miceli di Tuber;
4. Produzione di piantine miccorizzate con T. magnatum ed altre specie di tartufo e verifica
delle dinamiche d’infezione radicale;
5. Messa a punto di protocolli di conservazione a bassa temperatura per il mantenimento nel
tempo delle colture di Tuber spp;
43
44
Capitolo 3
3. Isolamento e caratterizzazione morfologica di colture pure di T.
magnatum
3.1. Introduzione
I funghi del genere Tuber sono funghi strettamente biotrofi, per cui non sono in grado di
completare il loro ciclo vitale in assenza della pianta ospite. Lo studio e l’approfondimento
della biologia e della fisiologia di un microrganismo traggono notevole vantaggio dall’avere
a disposizione miceli in coltura pura che producono un adeguata quantità di biomassa. In
passato sono stati fatti molti tentativi per isolare i miceli dei tartufi e produrre una quantità
adeguata di inoculo per infettare le piante (Fontana, 1971), ma essi crescevano molto
lentamente. Diverse specie di Tuber sono già state isolate in coltura pura ed utilizzate a scopi
sperimemtali, come è reportato da Sisti et al. (1998). Il micelio di T. borchii è stato prodotto
in sufficiente quantità per la produzione di micorrize in vitro (Giomaro et al., 2000). Altre
specie di tartufi come T. maculatum, T. melanosporum T. aestivum, T. macrosporum, T.
rufum e T. brumale sono state successivamente isolate e caratterizzate con metodi
morfologici e molecolari (Iotti et al., 2002). Isolare e successivamente mantenere in coltura
pura il micelio di T. magnatum rappresenterebbe il primo importante passo per studiarne in
laboratorio le caratteristiche fisiologiche e l’espressione di geni funzionali, sia durante la
fase saprotrofaria sia durante la fase simbiotica e pre simbiontica. Infatti, il micelio di T.
magnatum, diversamente da quello di altre specie di Tuber, è molto più difficile da isolare in
coltura pura. Il primo tentativo d’isolamento del micelio di T. magnatum, a partire dalle
micorrize, è stato realizzato da Mischiati e Fontana (1993). Tuttavia, successivamente, fu
dimostrato, attraverso l’analisi genetica, che il micelio ottenuto non appartenva a T.
magnatum ma a T. maculatum (Mello et al., 2001). Attualmente nessun ricercatore è stato in
45
grado di isolarlo e mantenrlo in coltura pura. Solamente Buee e Martin (2009) hanno
sviluppato un metodo per mantenere in vitro i miceli di T. magnatum utilizzando le radici
delle piante trasformate con Agrobacterium rhizogenes in coltura mista con batteri.
Per questi motivi la prima fase della sperimentazione si è basata sul tentativo d’isolamento e
moltiplicazione in coltura pura del micelio di T. magnatum e sulla sua caratterizzazione
morfologica e molecolare.
3.2. Materiali e metodi
3.2.1. Isolamento dei miceli
I corpi fruttiferi di T. magnatum (Tabella 1) impiegati in questa prova sono stati raccolti nel
periodo compreso fra il 18 agosto 2010 e il 24 dicembre 2011 ed identificati in base alle loro
caratteristiche anatomo-morfologiche secondo Pegler (1993). Una parte di ciascun corpo
fruttifero è stata essiccata e depositata presso l’erbario del Centro di Micologia di Bologna
(CMI-Unibo). L’isolamento è stato eseguito in condizioni asettiche asportando, dalle zone
più interne di ciascun carpoforo, piccole porzioni di gleba, successivamente mantenute sul
substrato nutritivo “Woody Plant Medium” (WPM), modificato secondo Iotti et al. (2002)
relativamente alla componente zuccherina (10 g/l di saccarosio) (Tabella 2). Le colture sono
state mantenute in termostato, all’oscurità, a 22 °C.
46
Tabella 1 - N° d’erbario, località e data di raccolta degli ascomi
Specie
Numero erbario
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
Tuber magnatum
3882
3992
4101
4112
4115
4119
4120
4121
4118
4142
4145
4162
4199
4184
4280
4281
4282
4283
4204
4341
Località di
raccolta
Argenta (Fe)
Cotignola (Ra)
Pianoro (Bo)
Pianoro (Bo)
Bologna (Bo)
S. Agostino (Fe)
S. Agostino (Fe)
S.Agostino (Fe)
Molinella (Fe)
S. Agostino (Fe)
Bologna (Bo)
Argenta (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
S. Agostino (Fe)
Data di raccolta
18-08-2010
25-08-2010
07-10-2010
12-10-2010
19-11-2010
23-11-2010
23-11-2010
23-11-2010
26-11-2010
06-12-2010
10-12-2010
17-12-2010
03-01-2011
07-01-2011
09-12-2011
09-12-2011
09-12-2011
09-12-2011
15-12-2011
24-12-2011
Tabella 2- composizione del mezzo nutritivo Woody Plant Medium
Costituenti
Concentrazione
KH2PO4
Ca (NO3)2 4H2O
Cal2 2H2O
MgSO4 7H2O
MnSO4 H2O
K2 SO4
NH4 NO3
F2SO4 7H2O
ZnSO4 7H2O
H3BO3
Na2MoO4 2H2O
CuSO4 5H2O
NaEDTA 2H2O
Myo-inositol
D(+)-Saccarosi
Agar
0.2 g/l
0.5 g/l
0.1 g/l
0.3 g/l
22.3 mg/l
0.9 g/l
0.4 g/l
0.014 mg/l
8.6 mg/l
6.2 mg/l
0.25 mg/l
0.025 mg/l
37.3 mg/l
0.1g/l
10 g/l
10 g/l
47
3.2.2. Caratterizzazione morfologica dei ceppi isolati
Gli accrescimenti delle colonie sono stati annalizzati e misurati con uno stereomicroscopio
(50X). La caratterizzazione morfologica è stata eseguita misurando l’indice d’accrescimento
ifale (Hyphal Growth Unit – HGU) (Trinci, 1973), il diametro delle ife e la distanza fra i
setti. Questi parametri sono dei validi indicatori della crescita ifale già utilizzati in letteratura
per la caratterizzazione morfologica dei miceli di Tuber spp. (Iotti et al., 2002). L’indice
HGU è stato calcolato come rapporto fra la sommatoria delle lunghezze di ciascuna
ramificazione e quella dell’asse principale ed il numero di apici.
HGU = (lunghezza ifa centrale + ∑ lunghezze ramificazioni)/(n° di ramificazioni +1)
Le osservazioni sono state effettuate utilizzando un microscopio ottico Laborlux 12 (Leitz)
(100X e 420X), dotato di video camera JVC e di programma di elaborazione di imagini Axio
Vision 2.05 (Zeiss).
3.2.3. Identificazione molecolare
I micelio di ciscuno dei ceppi isolati è stato amplificato con un approccio di PCR diretta
seguendo la procedura proposta da Bonuso et al. (2006). Sono stati impiegati i primer specie
specifici TMGI e TMGII e le condizioni di amplificazione individuate da Amicucci et al.
(1998).
3.3. Risultati e discussione
48
Fra tutti i corpi fruttiferi impiegati, è stato possibile isolare in coltura pura il micelio di T.
magnatum solo per quelli contrassegnati con il numero d’erbario 3882 (identificato come
ceppo Tmg2) e 4101 (Tmg5). I tentativi d’isolamento effettuati con tutti gli altri carpofori
sono falliti, principalmente a causa d’inquinamenti batterici endogeni agli ascomi stessi che,
probabilmente, hanno inibito lo sviluppo miceliare di T. magnatum. E’ noto, infatti, che
all’interno dei corpi fruttiferi di T. magnatum si sviluppano numerose specie batteriche,
coltivabili e non, presenti anche negli ascomi immaturi (Barbieri et al., 2010). I due ceppi
isolati con successo sono stati ottenuti entrambi da corpi fruttiferi completamente immaturi,
ossia privi di spore già formate all’interno degli aschi. Addirittura, il ceppo Tmg5 è stato
isolato prelevando ciuffi miceliari da cavità interne alla gleba in formazione. Al contrario,
tutti gli altri ascomi impiegati per gli isolamenti avevano spore già formate all’interno degli
aschi, con morfologia tipiche della specie, anche se in numero ridotto. L’amplificazione di
ampliconi di 173 bp, effettuata con i primer specifici TMAGI e TMAGII, ha confermato
l’appartenenza di entrambi i ceppi a T. magnatum. Le loro colonie mostravano un
accrescimento di tipo globulare (isodiametrico) in tutte le successive subculture, con un
aspetto, quindi, differente ed anomalo rispetto al tradizionale modo di sviluppo dei funghi
filamentosi in vitro, incluso quello delle altre specie di tartufo che è tipicamente di tipo
radiale. L’accrescimento ifale delle masserelle miceliari trapiantate in substrati freschi si
arrestava dopo uno sviluppo diametrale di circa 1-2 mm raggiunto in circa 4 settimane,
mentre la “lag” fase era paragonabile a quella delle altre specie di Tuber (7-10 giorni).
Questo tipo di sviluppo era difficile da apprezzare (e misurare) ad occhio nudo senza
l’ausilio dello stereomicroscopio. La moltiplicazione ed il mantenimento in coltura delle
colonie era effettuato mediante taglio delle masserelle miceliari con bisturi. I frammenti
ottenuti dovevano essere completamente immersi nel nuovo substrato agarizzato per evitare
l’arresto della crescita miceliare e l’imbrunimento (morte) delle nuove colonie, situazione
che si verificava nel caso in cui essi fossero appoggiati sulla superficie o solo parzialmente
49
immersi in esso. Questa caratteristica dimostra che il micelio di T. magnatum è molto più
sensibile alla disidratazione di quello delle altre specie specie di tartufo per le quali è solo
necessario sigillare le piastre petri con Parafilm per evitarne l’arresto di sviluppo dovuto a
disseccamento. Le caratteristiche morfologiche dei ceppi di T. magnatum sono riportati in
tabella 3. In particolare, è stato misurato un indice di accrescimento ifale medio di 23,07 µm,
un diametro ifale medio di 3,24 µm ed infine una distanza fra setti media di 12.82 µm.
Tabella 3- Caratteristiche biometriche del micelio di T. magnatum
Ceppo
Tmg5
Tmg2
Indice di sviluppo
ifale (µm)
24,41
21,72
Diametro ifale
(µm)
3,54
2,94
Distanza tra setti
(µm)
13,72
11,92
Il confronto di questi valori con quelli di altre specie di tatufo, pubblicati da Iotti et al.
(2002) ed ottenuti sul medesimo substrato, ha dimostrato che i valori dell’indice di
accrescimento ifale e della distanza fra setti di T. magnatum sono inferiori a quelli di T.
maculatum, T. melanosporum, T. aestivum, T. macrosporum, T. rufum e T. brumale. Al
contrario, il diametro ifale era superiore rispetto quello di T. rufum e T. melanosporum ma
inferiore a quello delle altre specie. Inoltre, similarmente alle altre specie di tartufi, entrambi
i miceli dei due ceppi di T. magnatum isolati producevano vescicole intercari lungo le ife e
formavano frequenti anastomosi (Fig. 7), come già riportato da alcuni autori che avevano
descritto le ife emanate dalle micorrize di tale specie (Mello et al., 2001; Rubini et al.,
2001). Le vescicole sono delle strutture caratteristiche dei miceli dei tartufi allevati in vitro e,
per la loro morfologia, è stato ipotizzato possano essere delle strutture di resistenza tipo le
clamidospore (Iotti et al., 2002). Inoltre, un incremento del numero di tali strutture è stato
rilevato nel micelio di T. borchii sviluppatosi in presenza di Pseudomonas spp, batteri isolati
50
da ascocarpo di T. borchii che hanno un attività antifungina e possono pertanto svolgere un
ruolo nel mantenimento della salute della ascocarpo (Sbrana et al., 2000).
a
b
b
Fig. 7 - Anastomosi (a) e vescicole (b) del micelio di T. magnatum
3.4. Conclusioni
Quest’esperienza ha dimostrato che è possibile isolare il micelio di T. magnatum e
mantenerlo vitale in coltura pura attraverso successivi trapianti, come già realizzato per tutte
le altre specie di tartufi pregiati. Comunque, nelle condizioni di crescita adottate in questa
prova non è stato possibile produrre significative quantità di biomassa miceliare tali da
poterne prevedere un utilizzo sperimentale. A tal riguardo, lo sviluppo dei miceli dei due
ceppi di T. magnatum è stato estremamente ridotto e sicuramente molto inferiore a quello dei
miceli delle altre specie di Tuber. In particolare sembra che tali ceppi mantengano ancora il
“ricordo”, e di conseguenza un quadro d’espressione genica, legato allo sviluppo del corpo
fruttifero.
La produzione di biomassa miceliare ha rappresentato spesso un fattore limitante per
sperimentazione nell’ambito del genere Tuber e, di conseguenza, per l’approfondimento
delle conoscenze sulla biologia e fisiologia di questi funghi. Tuttavia per T. borchii è stato
possibile creare un modello per studiare le interazioni molecolari pianta ospite / fungo
simbionte durante le prime fasi del processo di micorrizzazione (Sisti et al., 1998). Seppur T.
melanosporum manifesti un sviluppo più limitato, è stato possibile sequenziarne l’intero
51
genoma e studiarne l’espressione genica del micelio (Martin et al., 2010) oppure studiarne
l’incompatibilità vegetativa effettuando co-colture fra ceppi diversi di questa specie (Iotti et
al., 2012).
Proprio per questi motivi è cruciale trovare condizioni di sviluppo adeguate per migliorare la
crescita in vitro anche di T. magnatum, in modo da poterlo impiegare in sperimentazioni che
prevedono la sintesi delle sue micorrize in condizioni controllate, lo studio delle variazioni di
espressione genica e morfologica dei miceli sottoposti a stress ambientali, ecc.
52
53
Capitolo 4
4. Miglioramento dello sviluppo del micelio di T. magnatum
4.1. Introduzione
Il requisito principale che deve possedere una specie fungina per essere impiegata
sperimentalmente in laboratorio, riguarda la sua capacità di produrre biomassa su substrati
sintetici o semisintetici, in condizione perfettamente definite e facilmente riproducibili. Il
suo sviluppo vegetativo dovrebbe essere abbondante e rapido per soddisfare tutte le esigenze
operative. Infatti, un micelio che cresce lentamente e con ridotta densità ifale, non permette
d’ottenere una quantità di biomassa sufficiente per produrre degli inoculi in grado di
infettare piante. Proprio quest’ultimo fenomeno è una delle causa principali d’insuccesso
della micorrizazione delle piante con le specie del genere Tuber. Una limitata quantità di
micelio non permette inoltre sia di estrarre sufficiente quantità di DNA o RNA necessari per
applicare tutta una serie di studi molecolari e fisiologici.
Le scarse conoscenze sul metabolismo di Tuber spp, rappresentano il limite principale
all’utilizzo sperimentale della maggior parte delle specie appartenenti a questo genere.
Infatti, sono pochi i lavori che hanno esplorato le preferenze nutrizionali di queste specie, sia
per la mancanza di disponibilità del micelio, sia per le difficoltà di mantenerlo stabilmente in
coltura. I funghi micorrizici ricevono la maggior parte dei carboidrati dalla pianta come
glucosio e fruttosio (Nehls, 2008) e di conseguenza questi zuccheri sono spesso
comunemente utilizzati per il loro sviluppo in vitro. Altri studi hanno dimostrato che anche
altri zuccheri, come saccarosio e mannosio, sono in grado di far sviluppare il micelio di
molti funghi ectomicorrizici come T. melanosporum (Palmer e Hacskaylo, 1970).
Le notevoli difficoltà nell’isolare i miceli di T. magnatum hanno ulteriormente ostacolato la
ricerca sul metabolismo di tale specie. Scopo di questo lavoro è stato quello di testare per la
54
prima volta la capacità di sviluppo del micelio di T .magnatum in differenti condizioni di
substrato.
4.2. Materiali e metodi
4.2.1. Ceppo fungino
Il ceppo di T. magnatum impiegato in questa prova sperimentale è stato il Tmg5, isolato con
successo nella precedente fase sperimentale.
4.2.2. Condizioni di coltura
Gli inoculi utilizzati nelle prove di accrescimento sono stati ottenuti da colture mantenute e
moltiplicate su WPM modificato già descritto in precedenza. Tali colture sono state
moltiplicate per circa 1 anno tramite successive frammentazioni delle piccole masserelle
miceliari per poter avere sufficienti quantità di inoculi (ciascuno di diametro pari a circa 0.51 mm). Per verificare le migliori condizioni di sviluppo miceliare, Tmg5 è stato fatto
sviluppare su WPM modificato la cui variabile era rappresentata dalla componente
zuccherina utilizzata. In particolare sono stati testati alcuni degli zuccheri che hanno fornito
“performance” migliori fra quelli già impiegati nelle prove di sviluppo miceliare di altre
specie di tartufo (Iotti et al., 2002), come mannosio, mannitolo, glucosio, fruttosio oltre a
ribosio, cellobiosio e saccarosio quest’ultimo considerato come testimone perchè impiegato
nel mantenimento dei ceppi di T. magnatum.
Inoltre, sono state saggiati anche diversi aminoacidi (L-fenilalanina e L-serina) e 1Triacontanol (TRIA), composto utilizzato da Selegean (2009), avente ha un effetto
stimulante sulla crescita ifale di T. brumale. Queste sostanze sono state aggiunte al mezzo
nutritivo testimone in quantità di 0.1 g/L. Tutti i valori di pH (6.3) sono stati corretti prima
della sterilizzazione in autoclave effettuata per 20 minuti a 120 °C. Ciascuna tesi
sperimentale era composta da 5 ripetizioni in altrettante piastre petri di 6 cm di diametro (12
ml di substrato ciascuna) ed ogni prova è stata ripetuta due volte per confermarne i risultati.
Poiché le tesi sperimentali erano numerose in rapporto alla disponibilità dell’inoculo, le
55
prove sono state condotte in fasi successive e le masserelle miceliari sviluppatesi in ciascuna
serie di prove è stata riciclata per quella successiva. Le scatole Petri sono state sigillate con
PARAFILM® e mantenute in termostato, all’oscurità, ad una temperatura di 22 °C. Ogni
settimana venivano osservate sia ad occhio nudo sia allo stereomicroscopio per verificare lo
sviluppo miceliare.
4.3. Risultati e discussione
Nessuno degli zuccheri o delle altre sostanze aggiunte al mezzo nutritivo ha prodotto
apprezzabili accrescimenti rispetto alla tipologia di sviluppo delle colonie descritta nel
precedente capitolo. In tutte le tesi sperimentali, infatti, le colonie hanno mantenuto un tipico
aspetto globulare e lo sviluppo diametrale non ha mai superato i 2 mm. Solamente in alcune
ripetizioni contenenti mannosio, Tmg5 ha assunto un accrescimento radiale più marcato con
ife sviluppatesi anche sulla superficie del mezzo nutritivo agarizzato. Comunque, questo
comportamento non è stato confermato nella prova successiva e gli inoculi miceliari ottenuti
nelle zone periferiche di queste colonie non sono stati in grado di svilupparne delle nuove.
Tuttavia, questo dato conferma che il mannosio è una delle fonti di carbonio organico più
efficaci nello stimolare lo sviluppo dei miceli delle specie di tartufi (Iotti et al., 2002,
Mamoun e Olivier, 1991) anche se non è stato risolutivo per migliorare l’accrescimento di T.
magnatum. Anche la morfologia miceliare delle colonie sviluppatesi nelle diverse tesi
sperimentali non mostrava sostanziali modifiche, sia per l’entità della ramificazione e del
diametro ifale sia per la formazione di anastomosi e vescicole.
Lo sviluppo del micelio di T. magnatum, seppur limitato, è migliore in presenza degli stessi
zuccheri utilizzati da altre specie di tartufi per la crescita dei loro miceli (Iotti et al., 2002).
In particolare, dall’analisi degli accrescimenti si può dedurre che T. magnatum dovrebbe
possedere un invertasi attiva come T. melanosporum (Ceccaroli et al., 2011) ed altri Tuber
spp. ad eccezione di T. borchii (Ceccaroli et al. 2011). Questo enzima non è molto frequente
56
fra i funghi ectomicorrizici (Hacskaylo, 1973) ma particolarmente diffuso fra le specie di
tartufo.
4.4. Conclusioni
Fino a oggi, non erano mai state verificate le esigenze nutrizionali di T. magnatum. Quelli
eseguiti in questa prova sono stati i primi tentativi di mettere a punto un mezzo idoneo per lo
sviluppo in coltura pura del micelio di questa importante specie di tartufo. Anche se non
sono stati ottenuti risultati incoraggianti questo lavoro può rappresentare una base di
partenza per applicare approcci differenti e raggiungere questo obiettivo. Il micelio di questa
specie è molto diffuso nel suolo naturale più di quanto si possa presumere dalla frequenza
dei punti di raccolta dei suoi corpi fruttiferi o dall’abbondanza delle sue micorrize (Iotti et
al., 2012, Leonardi et al., 2013). La capacità di vivere come saprotrofo nel suolo è stata
ipotizzata (Barbieri et al., 2010) ma contrasta con le difficoltà di farlo crescere in vitro su
mezzi sintetici o semisintetici. Murat e colleghi (2005) hanno suggerito che il rapporto
simbiontico fra T. magnatum e la pianta ospite in condizioni naturali possa anche non
richiedere la formazione di ectomicorrize ben differenziate nonostante esso sia capace di
formarle (Mello et al., 2001; Rubini et al., 2001). Altre ipotesi suggeriscono che possa
vivere in simbiosi tripartite con altri funghi o microorganismi oltre alla pianta ospite
(Leonardi et al., 2013), comportarsi come un endofita seguendo l’esempio delle specie di
Terfezia, i cosiddetti “tartufi del deserto” (Morte et al., 2000), oppure formare altre tipi di
simbiosi come mostrato per altre specie di tartufi o per le Sebacinaceae (Selosse et al.,
2002). In ogni caso, per stimolarne lo sviluppo del micelio sono necessarie una o una serie di
composti chimici presenti nel suolo o prodotti da una pianta ospite od un altro
microrganismo simbionte. Non necessariamente potrebbe trattarsi di una fonte di carbonio
particolare per alimentare il suo metabolismo ma di molecole segnale che fungano da
interruttore per lo sviluppo miceliare e l’utilizzazione degli zuccheri che ha a disposizione.
57
58
Capitolo 5
5. Effetto degli estratti radicali e degli essudati miceliari sullo sviluppo dei
miceli di T. magnatum e T. borchii
5.1. Introduzione
I funghi, come tutti gli esseri viventi, necessitano di carboidrati in quanto queste sostanze
vengono impiegate come metaboliti per la sintesi dei componenti cellulari e come fonte
energetica per alimentare i processi metabolici. I principali idrati di carbonio a disposizione
del fungo a livello radicale sono quelli presenti negli essudati radicali delle piante ospite.
Questi hanno una struttura chimica diversa a seconda della specie che li produce e sono
fondamentali per la formazione delle simbiosi micorriziche. Molti studi hanno confermato il
ruolo importante di queste sostanze secrete dalle radici delle piante ospiti per la stimolazione
della crescita e della ramificazione ifale (Nagahashi e Douds, 2000; Buee et al., 2000). Sun
et al. (2012) hanno dimostrato che gli essudati radicali hanno un ruolo determinante già nella
fase di riconoscimento tra la pianta ospite e i funghi micorrizici arbuscolari ed agiscono
come segnali molecolari stimolando la crescita ifale. Oltre alle molecole rilasciate dalla
pianta anche quelle secrete da alcune specie fungine durante la loro fase vegetativa possono
avere un effetto positivo sullo sviluppo del micelio di altri funghi o microrganismi. Fraccia
et al. (2004) hanno dimostrato che gli essudati miceliari di Aspergillus niger e Penicillium
restrictum hanno un effetto stimolante sulla germinazione delle spore e la crescita ifale di
Glomus mosseae e Gigaspora rosea e sulla colonizzazione delle radici da parte di queste
specie. Studi eseguiti da Toljander et al. (2007) hanno confermato l’effetto positivo degli
essudati prodotti del micelio dei funghi micorrizici arbuscolari (AM) sulla crescita e lo
sviluppo in vitro di batteri. In passato si supponeva che T. magnatum subisse una forte
competizione da parte delle altre specie di tartufo (in particolare i tartufi bianchi) per
occupare gli “spazi” liberi sulle radici delle piante o colonizzare il suolo con i rispettivi
59
miceli. I più recenti studi condotti nelle tartufaie naturali con metodi molecolari hanno
invece dimostrato che nei punti dove si raccolgono gli ascomi di T. magnatum spesso sono
presenti anche altri tartufi come T. maculatum, T. rufum e T. borchii, sia come micorriza sia
come micelio libero nel suolo (Zampieri et al., 2010; Leonardi et al., 2013; Iotti e
Zambonelli, 2006). Anche le micorrize di Sebacina spp. spesso vengono trovate in
corrispondenza dei punti produttivi del tartufo bianco pregiato (Murat et al., 2005). Questo
comportamento potrebbe far supporre che T. magnatum possa trarre beneficio per il suo
sviluppo o la sua riproduzione dalla presenza di altre specie di tartufi o altre specie fungine.
Lo scopo di questa parte della tesi è stato quello di verificare l’effetto degli estratti radicali
ottenuti da piantine di nocciolo sullo sviluppo del micelio di T. borchii. Quest’ultima specie
è stata utilizzata come specie di confronto per la sua facilità di sviluppare in vitro. Inoltre,
per controllare l’effetto che il micelio di altre specie di tartufi possono avere su quello di T.
magnatum sono stati utilizzati essudati miceliari di T. borchii, T. brumale e T. rufum.
5.2. Materiali e metodi
5.2.1. Ceppi fungini e materiale vegetale
Per questa sperimentazione sono stati impiegati il ceppo Tmg5 (T. magnatum) e 17bo (T.
borchii). Il micelio di T. borchii è stato mantenuto in coltura pura in piastre Petri contenenti
20g/l di Potato Dextrose Agar (PDA, Difco), fatte crescere al buio alla temperatura di 22°C.
Le colture di questo ceppo sono state rinnovate ogni 60 giorni, prelevando dischetti di
micelio dalle porzioni più esterne delle colonie in crescita e trasferendoli in nuove piastre
contenenti PDA. Il micelio di T. magnatum è stato mantenuto come descritto nel capitolo
3.2.1. Gli estratti radicali sono stati ottenuti da piantine di nocciolo (Corylus avellana L.)
micropropagate in vitro, prodotte dalla ditta Vitroplant (Cesena) che ha collaborato nella
sperimentazione.
60
5.2.2. Preparazione dell’estratto radicale di nocciolo
Per la preparazione dell’estratto radicale, 0,66 g di radici sono state lavate con acqua
distillata, essiccate in stufa (60 °C per 2 ore) e polverizzate con azoto liquido ed un pestello.
Tredici ml di etanolo 80% sono stati aggiunti alla polvere e la miscela è stata lasciata in
agitazione per un’ora. Dopo una centrifugazione a 14.000 rpm per 10 minuti, il surnatante è
stato recuperato. La procedura di estrazione è stata ripetuta per altre due volte risospendendo
il pellet in 5 ml di etanolo 80% e lasciandolo in agitazione per 30 minuti. I surnatanti
recuperati sono stati riuniti e portati a secco utilizzando una Savant Vacuum Concentrator
(Savant Instruments). Infine l’estratto radicale è stato risolubilizzato in 1 ml di etanolo
assoluto e conservato a 4 °C fino al momento del suo impiego.
5.2.3. Preparazione degli essudati miceliari di Tuber spp.
Per la preparazione dell’estratto miceliare sono stati impiegati colture pure delle seguenti
specie di Tuber: T. brumale (ceppo Tbr1), T. borchii (ceppo 17bo) e T. rufum (ceppo Tru1),
in collezione presso il Centro di Micologia di Bologna (CMI-Unibo). I ceppi Tbr1 e Tru1
sono stati mantenuti in coltura su WPM modificato e rinnovati ogni 60 giorni.
Le colture liquide sono state preparate in boccetti contenenti 40 ml di WPM liquido
addizionato di 10 g/L di glucosio inoculati con due dischetti (0.7 cm di diametro) d’agar
infungato. Le colture sono state mantenute in termostato, all’oscurità, a 22 °C. Dopo 10
giorni (per 17bo) e 15 giorni (per Tbr1 e Tru1) di sviluppo sono state rimosse le colonie
fungine ed il liquido di coltura è stato filtrato utilizzando SterivexTM GP 0.22 µm Filter Unit
(Millipore) e successivamente impiegato come mezzo nutritivo per T. magnatum. Sono state
preparate 8 provette contenenti 10 ml di substrato liquido filtrato ottenuto da ciascuna delle
tre specie di Tuber utilizzate oltre a 8 provette contenenti 10 ml di WPM liquido fresco.
Le provette sono state mantenute in termostato, all’oscurità, a 22 °C e controllate sia ad
61
occhio nudo sia allo stereomicroscopio (50 X) ogni 3-4 giorni. I nuovi accrescimenti sono
stati valutati dopo un mese di coltura prelevando le masserelle di micelio dalla coltura
liquida, disponendole su di un vetrino e misurando la loro nuova espansione radiale
(dall’aspetto e colore del micelio si diversificano i nuovi accrescimenti dai vecchi) con un
oculare graduato ad uno stereomicroscopio (50X). HGU e diametro ifale sono stati invece
valutati al microscopio ottico come già riportato in precedenza.
5.2.4. Prove di crescita del micelio di T. borchii e T. magnatum in subtrato arricchito
dell’estratto radicale di nocciolo
Per valutare l’effetto dell’estratto radicale di nocciolo sullo sviluppo del micelio di T.
borchii, sono state allestite delle prove di crescita in terreno PDA in tre condizioni di crescita
differenti: i) TRATTATO CON GLI ESTRATTI (TE) (10 piastre), micelio cresciuto in
presenza di 50 µl di estratto radicale di nocciolo eluito con etanolo; ii) testimone
TRATTATO CON SOLVENTE (TS) (10 piastre), micelio cresciuto in presenza di 50 µl di
etanolo assoluto; iii) TESTIMONE (T) (10 piastre), micelio cresciuto in assenza di estratto
radicale e solvente. Le piastre sono state incubate a 22 °C al buio. L’HGU sono stati misurati
dopo10 giorni di sviluppo mentre il diametro delle colonie è stato valutato dopo 1 mese. Per
ciascuna condizione testata 5 piastre sono state destinate all’analisi morfologica e le restanti
sono state utilizzate per l’analisi molecolare. In queste ultime il micelio è stato fatto crescere
separato dal terreno da un disco di cellophane.
5.2.5. Analisi morfologica dei miceli di T. borchii cresciuti con l’estratto radicale di
nocciolo
L’analisi morfologica del micelio trattato con l’estratto radicale (TE) ed i rispettivi testimoni
(TS, T) è stata effettuata 15 giorni dopo l’inoculo misurando il diametro delle colonie e
l’indice di ramificazione ifale. Quest’ultimo è stato determinato scegliendo in ogni piastra tre
ife periferiche nella zona più esterna della colonia. Le osservazioni sono state effettuate con
62
un microscopio ottico come descritto nel capitolo 3.2.2. La determinazione dei valori di
accrescimento della colonie in ciascuna piastra é stata effettuata mediante la misurazione del
diametro verticale (oa) e longitudinale (ob) una e due settimane dall’inoculazione.
5.2.6. Analisi degli estratti radicali di nocciolo e raccolta delle frazioni mediante HPLCDAD
Gli estratti radicali di nocciolo sono stati analizzati mediante High Performance Liquid
Chromatography (HPLC) nel laboratorio dell’Università di Urbino. Questa tecnologia è
estremamente efficace e molto utilizzata per separare le diverse componenti chimiche di una
soluzione e permetterne il riconoscimento qualitativo e quantitativo. L’HPLC si basa sulla
distribuzione differenziale dei vari componenti fra due fasi, una chiamata fase fissa o fase
stazionaria e l’altra chiamata fase mobile o eluente, che fluisce in continuo attraverso la fase
fissa.
Per le analisi è stato utilizzato un sistema Beckman Coulter costituito da un modulo di
pompe per i solventi (System Gold 126), un rivelatore ad assorbanza (System Gold 168
Diode Array) con un range di lunghezza d’onda compreso tra 190 e 600 nm (UV-visibile),
con una valvola di iniezione BeckmanCoulter (modello Autex A210). La matrice
cromatografica utilizzata è una colonna Supelco C18 con particelle di 3µm (lunghezza 150
mm, diametro 4.6 mm) equipaggiata con una guard column Supelco (Supelguard, lunghezza
2cm). Per l’analisi sono stati usati, come solventi, acqua bidistillata (solvente A) e
acetonitrile (solvente B) e l’eluizione è stata eseguita ad un flusso di 1 ml/min secondo un
gradiente così strutturato:
63
•
0% di solvente B per 10 min
•
da 0% a 40% di solvente B in 30 min
•
dal 40% al 80% di solvente B in 5 min
•
80% di solvente B per 5 min
•
dal 80% al 0% di solvente B in 1 min
Terminata l’eluizione la colonna è stata riequilibrata in acqua prima della successiva analisi.
Gli estratti sono stati risospesi in acqua bidistillata e, prima dell’iniezione in colonna, sono
stati filtrati con filtri da siringa con pori di diametro 0,2 µm. Il volume del campioni
analizzato era di 450 µl.
I dati cromatografici sono stati salvati e analizzati utilizzando il software 32 Karat (Beckman
Coulter). Sulla base dell’elettroferogramma ottenuto sono state raccolte sei frazioni
impiegate successivamente per le prove di crescita sui miceli di T. borchii, come descritto
nel paragrafo successivo.
5.2.7. Prova di crescita di T .borchii con le frazioni dell’estratto radicale raccolte
mediante HPLC
Le singole frazioni dell’estratto radicale di nocciolo raccolte mediante HPLC sono state
portate a secco nella Savant Vacuum e risospese in 350 µl di etanolo assoluto. In tal modo la
concentrazione dei composti presenti in ogni frazione è identica a quella nell’estratto
iniziale. Per ogni frazione sono state allestite 7 piastre di PDA con il micelio di T. borchii
cresciuto in presenza di 50 µl di frazione risospesa. Per il testimone con solvente ed il
testimone sono state preparate rispettivamente 7 piastre con micelio cresciuto in presenza di
50 µl di etanolo assoluto, e 7 piastre con il micelio cresciuto in assenza di frazioni risospese
e solvente. Le piastre sono state incubate a 22°C al buio per 10 giorni. Per ciascuna
condizione testata 3 piastre sono state destinate all’analisi morfologica e le restanti sono state
utilizzate per l’analisi molecolare. In queste ultime il micelio è stato fatto crescere separato
dal terreno da un disco di cellophane.
64
5.2.8. Analisi morfologiche dei miceli di T. borchii con le frazioni dell’estratto radicale
raccolte mediante HPLC
L'analisi morfologica dei miceli con le frazioni dell’estratto radicale è stata eseguita
analizzando i parametri indicatori della crescita ifale precedentemente descritti:
accrescimento diametrale della colonia e HGU. In aggiunta è stato calcolato il diametro delle
ife e la distanza fra i setti. Il diametro delle ife e stato determinato al microscopio ottico
Laborlux 12 Leitz (320X). Tale misurazione e stata effettuata su tre piastre, per ciascuna
delle quali sono stati misurati i diametri di 30 ife, facendo attenzione di scegliere quelle più
esterne e di misurare il diametro dopo la prima ramificazione. La distanza fra i setti è stata
misurata tra quattro setti contigui di 10 ife, scelte nella stessa zona dove sono stati misurati i
diametri ifali.
5.2.9. Elaborazione statistica dei risultati dell’analisi morfologica
I dati ottenuti dall’analisi morfologica sono stati analizzati statisticamente mediante ANOVA
e le medie sono state confrontate mediate il Tukey test (p≤ 0,05) utilizzando il programma
XL STAT.
5.2.10. Analisi molecolari dei miceli di T. borchii trattati con gli estratti radicali di
nocciolo e con le singole frazioni dell'estratto
Per eseguire le analisi molecolari sono stati utilizzati i miceli cresciuti nelle piastre Petri
separati dal terreno PDA da un filtro di cellophane.
5.2.10.1. Prelievo dei miceli ed estrazione dell'RNA totale
Terminato il periodo di incubazione per ciascuna colonia è stata prelevata la porzione più
esterna, immersa in 400 µL di soluzione RLC (RNeasyPlant Mini Kit, Qiagen) e conservata
a -80 °C. Al momento dell'utilizzo i campioni sono stati scongelati, omogenati in ghiaccio
65
secco e l'RNA e stato estratto utilizzando il kit RNeasyPlant Mini Kit (Qiagen) seguendo il
protocollo della ditta produttrice.
5.2.10.2. Sintesi del cDNA
Gli estratti di RNA sono stati trattati con Dnase I (Ambion), e dosati al Nanodrop. Per
ciascun campione ad un volume corrispondente a 1 µg di mRNA è stata aggiunta la miscela
di primer oligo–dT 1µM (PROMEGA) ed è stato portato a 15 µL con acqua RNase-free.
Dopo un'incubazione di 2 minuti a 65 °C sono stati aggiunti 5 µL di mix contenente: Buffer
RT 1X, dNTPs 0,5 mM e 4 unità di trascrittasi inversa Omniscript. La reazione di
retrotrascizione è stata condotta alla temperatura di 37 °C per 60 minuti, seguita da una fase
di inattivazione a 72 °C per 10 minuti. Infine i campioni di cDNA ottenuti sono stati diluiti
aggiungendo 20 µL di acqua DEPC e successivamente conservati a – 20 °C.
5.2.10.3. Real time PCR
Nelle analisi di real time PCR, l'rRNA 18S di T. borchii è stato utilizzato come standard
interno e coppie di primer specifici per i target CDC42 e Rho-GDI sono stati impiegati per
studiare la variazione di espressione genica di tali geni (tabella.4). La PCR è stata eseguita in
un termociclatore StepOnePlus Real Time PCR System (Applied Biosystem) alle seguenti
condizioni di amplificazione: 95 °C per 20 s seguiti da 40 cicli composti da un primo step a
95 °C per 3 s ed un secondo step a 60 °C per 30 s. Ogni reazione di 20 µL è stata assemblata
con le seguenti concentrazioni finali dei reagenti: Fast SYBR ®Green Master Mix (Applied
Biosystem) 1X, primer forward e reverse 500 nM, 1 µL di cDNA. La specificità dei prodotti
di amplificazione ottenuti è stata confermata attraverso l'analisi delle curve di Melting e
successiva analisi elettroforetica in gel d'agarosio al 3%. La quantità di trascritto target è
stata messa in relazione con quella del gene di riferimento attraverso il metodo del ∆Ct (Ct
66
gene riferimento – Ct 18S) secondo il quale all’aumentare del valore diminuisce il livello di
espressione del gene.
Tabella. 4- I primer utilizzati per studiare l’espressione dei geni CDC42 E RhoGDI in real
time PCR
TARGET
PRIMER
SEQUENZA
LUNGHEZZA
AMPLIFICATO
(bp)
rRNA 18S
TB18F
TB18R
5' - ACTGGTCCGGTCGGATCTT - 3'
5' - TTCAAAGTAAAAGTCCTGGTTCCC - 3'
80
CDC42
RT_cdcf2
RT_cdcr1
5' – CAGCCGTCAAGTATGTCGAA - 3'
5' – TGTAGTGTAGGGGCTCCAG - 3'
65
RhoGDI
RT_gdif2
RT_gdir2
5' – ATCCACCACCGAAGGATACA - 3'
5' – TCTCCAAGAGAGCCACCAGT - 3'
141
5.3. Risultati e Discussione
5.3.1. Analisi morfologiche dei miceli di T. magnatum incubato nell’estratto miceliare
L’impiego degli essudati miceliari ha fornito risultati interessanti soprattutto con quelli
ottenuti dalle colture di T. brumale. Nuovi significativi accrescimenti oltre l’inoculo iniziale
sono stati ottenuti nei primi 10 giorni dalle colonie di Tmg5 inoculate nel mezzo liquido in
cui precedentemente si era sviluppato T. brumale. Durante questo lasso di tempo nei
substrati ottenuti da T. borchii e T. rufum sono stati rilevati accrescimenti miceliari non
differenti da quelli delle tesi testimone. Comunque, dopo 1 mese di sviluppo, dalle colonie
delle varie tesi sperimentali analizzate al microscopio ottico, non sono state rilevate
differenze statisticamente significative per lo sviluppo, la ramificazione ed il diametro ifale
(Tab. 5) anche se il testimone presentava colonie mediamente meno sviluppate radialmente.
Un effetto positivo sullo sviluppo del micelio di T. magnatum da parte di altri miceli di
Tuber sembra esserci, seppur poco evidente e per ora difficilmente interpretabile. In
particolare questo effetto sembra maggiormente indotto da T. brumale che normalmente, nel
suolo in pieno campo, non occupa le stesse nicchie di sviluppo di T magnatum (Leonardi et
al., 2013). Questo potrebbe essere anche dovuto ad un effetto di competizione fra queste due
67
specie che funzionerebbe da stimolo per il micelio di T. magnatum ad occupare lo spazio
disponibile. Comunque gli essudati miceliari delle altre specie di tartufo non hanno alcun
effetto inibente nei confronti del micelio del tartufo bianco pregiato.
Diversi studi hanno dimostrato l’esistenza di un rapporto diretto fra i funghi e la
fruttificazione del genre Tuber (Zacchi et al., 2003). Inoltre la co-presenza di altre specie di
Tuber nelle tartufaie di tartufo bianco, spesso nei punti di ritrovamento dei suoi corpi
fruttiferi (Leonardi et al., 2013), potrebbe avere un significato ancora sconosciuto ma molto
importante nella biologia di T. magnatum. Da questo studio in campo si nota che alcune
specie fungine ectomicorriziche che accompagnano T. magnatum potrebbero influire
positivamente sulla sua diffusione nelle tartufaie naturali ed addirittura favorirne la
fruttificazione.
Tabella. 5- Dati biometrici del micelio e di sviluppo radiale delle colonie di T. magnatum
sviluppatesi in colture liquide precedentemente inoculate con tre specie di Tuber e in
WPM liquido fresco
Colture liquide
T. brumale
T. rufum
T. borchii
WPM liquido fresco
Sviluppo radiale
(µm)†
610
580
560
550
HGU (µm)
Diametro ifale (µm)
28.61
20.2
25.5
24.41
3.57
3.31
3.74
3.54
†distanza misurate come nuovi accrescimenti delle masserelle miceliari estratte dalle colture
liquide
5.3.2. Analisi morfologiche dei miceli di T. borchii trattati con l’estratti radicali di
nocciolo
Dalle osservazioni ad occhio nudo, i miceli di T. borchii cresciuti nelle piastre TE (estratto)
mostravano un accrescimento maggiore di quelli cresciuti nelle piastre TS (solo solvente)
(fig. 8). Solamente le colonie testimoni (T) hanno mostrato uno sviluppo miceliare superiore
alle altre tesi, indice che il solvente utilizzato (etanolo) ha un forte potere inibente. Tutte le
68
differenze di sviluppo sono risultate statisticamente significative ed in media, il diametro
delle colonie del testimone T era di 4.7 cm, mentre per testimone TS di 2.5 cm e per il
tratatto TE di 3.1cm.
a
b
c
Fig. 8- Miceli di T. borchii cresciuti in presenza di estratto radicale di nocciolo dopo un mese
di sviluppo. a) micelio con estratto radicale, b) controllo con il solvente, c) Testimone.
Questi risultati sono stati confermati dalle analisi biometriche al microscopio ottico. Infatti
l’indice HGU dei miceli cresciuti nel substrato TE risultava significativamente inferiore (in
media 448) rispetto a quello del testimone TS (635) ma simile a quello del testimone T (450).
Tale risultato coincide con l'osservazione iniziale poiché, più l’indice di accrescimento ifale è
basso, più il micelio è ramificato e quindi più denso (fig.9). Questo valore è stato dimostrato
essere un utile indicatore dell’accrescimento miceliare di T. borchii direttamente correlato
anche con l’espressione dei geni coinvolti nello sviluppo ifale, nella detossificazione e del
metabolismo generale (Amicucci et al., 2010).
69
HGU µM
Fig. 9- Valori medi dell’indice di accrescimento ifale del micelio di T. borchii trattato con
estratto radicale e con solvente
5.3.3. Analisi morfologiche dei miceli di T. borchii trattati con le frazioni dell’estratto
radicale raccolte mediante HPLC
Le indagini morfologiche condotte sui miceli di T. borchii cresciuti in un terreno arricchito
con le frazioni dell’estratto radicale raccolte mediante HPLC, hanno evidenziato un loro
effetto stimolante sullo sviluppo ifale del fungo (Tabella 6). In particolare, nelle tesi trattate,
è stato evidenziato un HGU medio dei 6 diversi tipi di estratti (356) significativamente
inferiore al valore medio di quello dei miceli del testimone TS (570) e del testimone T (506).
Tutte le frazioni ottenute dagli estratti radicali impiegati in questa prova hanno un effetto
positivo sulla ramificazione miceliare di T. borchii senza alcuna differenza statisticamente
significativa fra di loro. Per quanto riguarda il diametro ifale, invece, sono state trovate
differenze statisticamente significative più controverse. Solo nella piastre addizionate della
frazione 3 é stato osservato uno sviluppo significativamente superiore rispetto i valori medi
dei miceli del testimone trattato con solvente e quelli cresciuti in substrati addizionati con le
frazioni 2, 4, 5 e 6. Infine per quanto riguarda la distanza tra i setti non sono state evidenziate
differenze statisticamente significative. Durante la prima settimana è stato identificato un
70
maggiore sviluppo del diametro delle colonie solo nella piastre addizionate della frazione 2,
rispetto al testimone con solvente. Per tale frazione l’effetto sullo sviluppo diametrale si
esauriva già nella seconda settimana. Comunque alla seconda settimana, tutti le colonie
sviluppate su tutte le frazioni, presentano un diametro superiore rispetto al testimone TS ma
inferiore a quello senza solvente (T) (Tabella 6).
Tabella 6. Valori medi di indice di ramificazione ifale, diametro delle ife, distanza tra i setti
e diametro colonia dei miceli di T. borchii arricchite con le frazioni dell’estratto radicale
(TE) e dei rispettivi controlli (TS e T). Valori seguiti da lettere diverse differiscono
statisticamente tra loro (p≤ 0,05).
Frazione 1
Frazione 2
Frazione 3
Frazione 4
Frazione 5
Frazione 6
Testimone 7
Testimone+etanolo8
HGU*
Diametro
ifale (µm)
Distanza tra
i setti
(µm)
367,887 c
344,046 c
359,605 c
367,582 c
351,830 c
347,298 c
506,508 b
570,616 a
5,978 ab
5,770 b
6,465 a
5,885 b
5,766 b
5,816 b
5,978 ab
5,758 b
60,744 a
72,776 a
67,160 a
63,318 a
58,832 a
77,103 a
66,816 a
75,938 a
Diametro colonia
(cm)
1
2
Settimana Settimana
1,100 ab 2,367 b
1,200 a
2,167 bc
1,167 ab 1,833 bc
1,167 ab 2,067 bc
1,133 ab 2,267 b
1,067 ab 2,000 bc
1,000 ab 3,133 a
0,933 b
1,567 c
Da questo studio preliminare è possibile evidenziare che negli estratti radicali di nocciolo
sono presenti sostanze che influiscono fortemente sulla morfologia del micelio. Molti studi
effettuati su funghi endomicorrizici, hanno dimostrano la presenza di molecole segnale
rilasciate dalla pianta ospite e che possono avere un effetto positivo di attrazione delle ife
verso le radici e sulla loro ramificazione (Bécard et al., 1995; Buee et al., 2000). La
stimolazione della crescita e la ramificazione ifale di funghi AM in simbiosi con la pianta
sono stati descritti come uno dei primi eventi di riconoscimento durante la fase presimbiotica. Diversi autori hanno suggerito che i composti specifici contenuti negli essudati
radicali hanno la capacità di stimolare la crescita ifale di funghi VAM (Bécard et Piché,
1990). Vi sono indicazioni che il fungo micorrizico possa riconoscere, come fanno i batteri
71
del gen. Rhizobium, delle sostanze liberate dalla radice con gli essudati radicali. Ipotesi
quest’ultima che scaturisce dalla constatazione che alcune sostanze di origine vegetale, in
particolare alcuni flavonoidi, favoriscono l’accrescimento dei funghi arbuscolari in coltura
axenica (Tsai e Phillips, 1991). Ad esempio i flavonoidi possono essere coinvolti nella
colonizzazione delle radice da parte dei funghi AM e svolgono un ruolo importante nella
fase presimbiotica (germinazione delle spore, ramificazione ifale, ecc.) e durante la fase
simbiotica (formazione dei punti di ingresso e la colonizzazione delle radice) (Morandi,
1996; Vierheilig et al., 1998). Buée et al., (2000) hanno dimostrato che la frazione semi
purificata degli essudati radicali di Daucus carota L. ha un effetto notevole sulla
germinazione delle spore di Gigaspora gigantea, G. rosea, e G. margarita. Altri studi hanno
dimostrato che alcuni flavonoli agliconi possono stimolare notevolmente la crescita ifale di
G. margarita (Bécard et al., 1992; Chabot et al., 1992). Alcuni studi effettuati utilizzando
funghi ectomicorrizici (Sisti et al., 2007) hanno evidenziato che la presenza di sostanze,
probabilmente lipofile, nelle estratti radicale di Tilia americana L. influenzano notevolmente
la morfologia del micelio di T. borchii. Altri studi hanno dimostrato che l’interazione in vitro
fra T. borchii e T. americana senza che avvenisse un contato fisico fra i due simbionti, si
verificava uno scambio di molecole segnale responsabili della crescita apicale del fungo e
dell’infezione dell’ospite (Menotta et al., 2004). Le frazioni isolate dalle radici di nocciolo in
questo caso hanno prodotto una maggior ramificazione dei miceli anche in assenza della
pianta ospite, fenomeno tipico delle fasi pre-simbiontiche. Nonostante l’effetto inibente del
solvente questo fenomeno è possibile verificarlo non solo nella morfologia miceliare ma
anche nello sviluppo diametrale delle colonie, probabilmente indice di un aumento del
metabolismo fungino quando viene simulata la presenza della pianta ospite.
72
5.3.4. Analisi molecolari dei miceli di T. borchii trattati con gli estratti radicali di
nocciolo e con le singole frazioni dell'estratto
È noto dalla letteratura che la small GTPase-CDC42 è implicata nella crescita apicale
polarizzata nei funghi filamentosi (Hazan et al., 2002): nella sua forma attiva si lega alla
membrana plasmatica con la coda isoprenica e la sua attivazione o disattivazione è regolata
dalla proteina Rho-GDI. Quest'ultima può legarsi alla coda isoprenica di CDC42 sia quando
questa è legata al GTP (forma attiva) sia quando è legata al GDP (forma inattiva) (Fig. 10).
Gdi
feromone
Actina citoscheletro
attivazione
trascrizional
e
crescita
filamento
sa
restrizione
della
Crescita
Crescita
polarizzato
Fig. 10- TbCdc42 e TbRhoGdi in Saccaromyces cerevisiae
Lavori precedenti hanno evidenziato che in miceli di T. borchii l'espressione di questi due
geni è sovra regolata in presenza della pianta ospite, degli essudati radicali e del glucosio
(Menotta et al., 2008; Menotta et al., 2007; Amicucci et al., 2010). In questa tesi indagini
preliminari sono state condotte tramite real time PCR al fine di valutare possibili effetti di
73
estratti radicali di nocciolo sulla crescita ifale. Dai risultati ottenuti si può osservare che si
assiste ad una maggiore espressione dei geni codificanti sia CDC42 sia RhoGDI rispetto ai
testimoni con etanolo (Fig. 11 e 12).
Δ Ct
CDC
Fig. 11 - Espressione del gene CDC42 nel micelio di T. borchii cresciuti in presenza di
estratto radicali di nocciolo ESTR (TE) e nei testimoni TS (ETOH) e T (TEST).
Δ Ct
GDI
Fig. 12 - Espressione del gene Rho-GDI nel micelio di T. borchii cresciuti in presenza di
estratto radicali di nocciolo ESTR (TE) e nei testimoni TS (ETOH) e T (TEST).
74
Analogalmente l'analisi dell'espressione dei geni CDC42 e Rho-GDI è stata eseguita sui
miceli cresciuti in presenza delle singole frazioni dell'estratto radicale, raccolte mediante
HPLC. Come riportato nel (fig. 13 e 14) l'andamento dell'espressione è abbastanza variabile
tra le diverse frazioni sia per gene CDC42 sia per Rho-GDI. Per entrambi i geni, i valori di
espressione misurate con i miceli cresciuti nelle frazioni 4, 5 e 6 non hanno manifestato
differenze significative con il testimone TS. Contrario è stato per l’andamento per le frazioni
1, 2 e 3 dell’estratto radicale. In particolare la frazione 3, che le misure morfologiche
attribuivano un diametro ifale significativamente superiore a quello delle altre tesi, mostra
valori di espressione superiori a quelli ottenuti per le altre frazioni per entrambi i geni
analizzati. Come evidenziato in parte anche dalle indagini morfologiche le singole frazioni
degli estratti radicali analizzate in questo lavoro hanno effetti differenti sullo sviluppo
miceliare di T. borchii.
Δ Ct
CDC
Fig. 13 - Espressione del gene CDC42 del micelio di T. borchii trattato con le frazioni
dell’estratto radicale raccolte mediante HPLC e nei testimoni TS (ETOHER) e T (CONTR).
75
Δ Ct
GDI
Fig. 14- Espressione del gene Rho-GDI nel micelio di T. borchii trattato con le frazioni
dell’estratto radicale raccolte mediante HPLC, e nei testimoni TS (ETOHER) e T (CONTR).
5.4. Conclusioni
Ad oggi sono ancora sconosciuti i meccanismi responsabili del riconoscimento fra i funghi
del genere Tuber e le sue piante ospiti. I dati preliminari ottenuti in questa tesi hanno
evidenziato che la crescita dei miceli di Tuber è influenzata dalle sostanze presenti nelle
radici poichè gli estratti radicali modificano la ramificazione e la morfologia ifale e la
capacità di sviluppo di Tuber. I risultati ottenuti da questa prova rappresentano una base di
partenza per ulteriori ricerche sull’espressione dei geni coinvolti nelle fasi di sviluppo
miceliare pre-simbiontico e potranno ampliare il quadro di conoscenze riguardo i
meccanismi di reazione del fungo in risposta a segnali emessi dalla pianta. Probabilmente il
riconoscimento tra il fungo e l'ospite non e mediato da una singola molecola, ma piuttosto
dall'azione sinergica di diversi composti, prodotti e rilasciati dalle radici della pianta, con
effetto chemiotropico e stimolante sulle ife di Tuber. Tutto cio potrebbe fornire utili
indicazioni di notevole impatto applicativo per sviluppare le tecnologie di micorrizzazione
che per certe specie di tartufi (T. magnatum) rappresentano il limite principale alla sua
coltivazione.
76
77
Capitolo 6
6. Produzione di piantine micorizzate con T. magnatum ed altre specie di
tartufo e studio della dinamica della colonizzazione radicale
6.1. Introduzione
Il requisito fondamentale per la coltivazione di un fungo micorrizico edule è la messa a
dimora in pieno campo di piantine il cui apparato radicale deve essere ben colonizzato con la
specie fungina d’interesse. Ad eccezione di T. magnatum, per tutti gli altri tartufi di pregio
(T. melanosporum, T. aestivum, T. borchii, T. mesentericum, ecc.) è possibile ottenere
piantine micorrizate su larga scala in vivaio, impiegando la tecnica d’inoculazione sporale.
Questo possibilità ha notevolmente favorito la loro coltivazione, tanto da diffonderla oltre i
confini dei paesi di origine (Francia, Italia e Spagna), sia nell’emisfero boreale sia in quello
australe (Hall e Haslam, 2013; Lefevre, 2013; Wang, 2013). Oltre alle difficolta d’isolarne e
moltiplicarne i miceli, le spore di T. magnatum germinano con enorme difficoltà (Gregori,
2002; Karwa et al., 2011) e ciò ha notevolmente ostacolato la possibilità di ottenere piantine
adeguatamente micorrizzate con questa specie di tartufo, lasciandone sostanzialmente
inalterato l’areale produttivo naturale. La difficoltà di ottenere micorrize di T. magnatum in
condizioni controllate ha rappresentato anche un grosso ostacolo per la ricerca scientifica che
inevitabilmente ne ha ostacolato i progressi cognitivi sulla sua biologia, fisiologia ed
ecologia.
Lo scopo di questa parte sperimentale è stato quello di ottenere piantine micorrizate con T.
magnatum in condizioni controllate impiegando un inoculo sporale, sia per caratterizzarne
morfologicamente le micorrize sia per verificarne il mantenimento e la dinamica di
propagazione in vaso. Parallelamente, a scopo di confronto, sono state condotte prove di
micorrizzazione utilizzando anche l’inoculo sporale di T. oligospermum ed inoculi miceliari
di T. borchii. Entrambe queste specie possono rappresentare pericolose fonti d’inquinamento
78
quando si vogliono ottenere piantine micorrizate di T. magnatum con il metodo sporale.
Infatti, durante la preparazione dell’inoculo, che spesso si ottiene impiegando corpi fruttiferi
immaturi o di scarsa qualità, ascomi di T. oligospermum, T. borchii o anche di altre specie di
tartufi bianchi possono essere scambiati con quelli di T. magnatum e finire nella massa in
preparazione. Queste specie di minor valore sono anche più aggressive ed occupano gli
apparati radicali “vergini” dei semenzali prodotti in vivaio a discapito di T. magnatum. Altro
scopo di questa prova è stato quello di valutare l’effetto dell’età del micelio sulla capacità di
infettare le radici delle piante ospite. Questo è stato realizzato impiegando diverse colture
pure di T. borchii isolate nel corso di più di 20 anni nel nostro laboratorio e mantenute in
coltura continuata su substrato agarizzato.
6.2. Materiali e metodi
6.2.1. Ceppi fungini e specie arboree
Le prove di micorrizzazione sono state condotte impiegando l’inoculo sporale per T.
magnatum e T. oligospermum e l’inoculo miceliare per T. borchii, mentre la specie ospite
selezionata è stata Quercus pubescens. Gli ascomi di T. magnatum sono stati raccolti in
Novembre 2010 a Valpiana (Pianoro) (peso totale 40 g), mentre quelli di T. oligospermum
sono stati raccolti in Marocco nella foresta della Mormora (Rabat) nel 2010 (peso totale 52g).
In laboratorio sono stati immediatamente lavati, sterilizzati in superficie tramite passaggio
veloce alla fiamma e successivamente conservati in frigorifero a 4 °C, in sabbia sterile e umida
all’interno di vasi di vetro richiusi con garza sterile, per un periodo di circa 2 mesi prima della
preparazione dell’inoculo. I dati relativi ai 10 ceppi miceliari di T. borchii impiegati nella
prova sono riportati in tabella 7. I miceli sono stati mantenuti tramite successive subculture
rinnovate ogni 2 mesi circa su PDA, dal momento dell’isolamento fino a quello della prova.
79
Tabella. 7- Data d’isolamento, provenienza dell’ascoma ed età (anni) dei 10 ceppi miceliari di
T. borchii
Ceppo
Data di
Provenienza ascoma
Età (anni)
isolamento
1Bo
03/1997
Ravenna
15
17Bo
02/1987
Ravenna
25
43Bo
02/1997
Ravenna
15
Tbo1/94
03/1998
Ravenna
14
Tbo2364
03/2004
Riva (RO)
7
Tbo2392
03/2004
Pavia (PA)
7
Tbo3035
02/2006
Pomposa (FE)
6
Tbo3067
02/2006
Mesola ( FE)
6
Tbo3840
04/2010
Pianoro (BO)
1
Tbo4284
03/2010
Ferrara
1
I semi di Q. pubescens sono stati raccolti da un unica pianta nell’ottobre 2010.
Successivamente sono stati sterilizzati in una soluzione d’ipoclorito di sodio all’1%,
risciacquati in acqua corrente e mantenuti a 4 °C stratificati fino al momento dell’utilizzo in
sabbia umida e sterile. I semenzali sono stati preparati circa un mese prima del momento
dell’inoculazione, utilizzando un substrato a base di torba e sabbia (1:9). Prima del trapianto il
loro apparato radicale è stato potato e lavato.
6.2.2. Preparazione degli inoculi sporali e miceliari, allevamento e controllo delle piante
micorrizate
Gli ascomi sono stati spappolati tramite l’utilizzo di un mortaio e pestello con aggiunta di
sabbia per facilitarne la disgregazione. La poltiglia creata è stata risospesa in acqua e
vermiculite sterili in modo da facilitare la distribuzione dell’inoculo in prossimità degli
80
apparati radicali dei singoli semenzali. Ad ogni piantina è stato fornito un quantitativo di
ascoma di circa 2.6 g corrispondenti a circa 105-106 spore. Gli inoculi miceliari di T. borchii
sono stati preparati tramite una prima fase di sviluppo in coltura liquida ed una seconda fase su
substrato solido secondo una metodologia simile a quella descritta da Molina et al., (1992).
Dischetti d’agar infungati di 0.7 cm di diametro prelevati alla periferia di colonie di 50 giorni
sono stati inseriti in vasetti di vetro contenenti 50 ml di WPM liquido (10 g/l glucosio) e fatti
sviluppare per 50 giorni a 22 °C all’oscurità. Successivamente le colonie miceliari sono state
frammentate meccanicamente tramite un omogenizzatore in 30 ml di WPM fresco e le
sospensioni miceliari cosi create sono state versate in contenitori di vetro contenenti 200 ml di
torba vermiculite (1:9) imbibiti con 70 ml di WPM ed autoclavati per 20 min a 120 °C. Dopo
circa 2 mesi di sviluppo a 22 °C all’oscurità i contenitori sono stati svuotati, il substrato
infungato da ciascun ceppo riunito assieme in una garza sterile e sottoposto a 5 cicli di
lavaggio e “squeezing” sotto acqua corrente per rimuovere i cataboliti prodotti dal fungo
durante il suo sviluppo. Ad ogni piantina è stato fornito un quantitativo d’inoculo di circa 70
ml depositato in prossimità dell’apparato radicale. Nel marzo 2011 sono state inoculate 20
piantine con ciascuna delle specie T. magnatum e T. oligospermum e 10 piantine per ciascuno
dei ceppi di T. borchii. Le piante inoculate sono state allevate in vasi (250 ml) riempiti con
terreno prelevato dalle tartufaia naturale in cui sono stati raccolti gli ascomi di T. magnatum
impiegati nelle prove di micorrizzazione. Il terreno è stato sterilizzato in autoclave tramite due
cicli di riscaldamento a 120°C per 1 ora. I vasi sono stati mantenuti in serra a 22-25 °C ed
innaffiati settimanalmente con 100 ml d’acqua. I controlli del grado d’infezione degli apparati
radicali sono stati effettuati dopo 1, 3, 6 e 9 mesi dall’inoculo. Le piantine sono state svasate,
lavati i loro apparati radicali, isolate 4 radichette di circa 3 cm ed analizzate con l’ausilio di
uno stereomicroscopio (20 X). La percentuale di micorrizzazione è stata espressa come
numero di micorrize osservate sul totale degli apici radicali contati. Le piante inoculate con T.
magnatum che hanno mostrato il livello di colonizzazione radicale più elevato sono state
81
impiegate quali piante madri per studiare le modalità di propagazione di questa specie di
tartufo fra semenzali cresciuti nello stesso vaso, sfruttando la metodologia di micorrizzazione
per approssimazione radicale. Ogni pianta madre selezionata è stata trapiantata al centro di un
vaso di diametro 24.5 cm ed altezza 17 cm, circondata da 6 semenzali ottenuti come descritto
nel paragrafo 6.2.1 e distanti circa 12.25 cm. La stesso terreno impiegato per la prima fase di
micorrizazione è stato usato anche in questa fase sperimentale. Il controllo del livello di
colonizzazione radicale delle piante madri e dei semenzali è stato effettuato 6 mesi dopo il
trapianto.
6.2.3. Identificazione molecolare e descrizione delle micorrize
L’identificazione delle micorrize delle tre specie inoculate è stata eseguita seguendo la tecnica
della PCR multiplex descritta da Amicucci et al. (2000). In particolare sono stati usati il primer
ITS4 (White et al., 1990) come unico innesco “reverse”, il primer forward TMGI specifico per
T. magnatum, rTboII specifico per T. borchii mentre per T. oligospermum è stato
appositamente disegnato un primer forward specifico non essendo già stato sviluppato
precedentemente per tale specie. TOLf (5’-CTCCTGAGCTGAGGTGTC-3’) è stato disegnato
in base all’allineamento delle sequenze ITS di T. oligospermum e quelle di altre specie di
Tuber. Le sequenze utilizzate per l’allineamento sono state ottenute sia dai corpi fruttiferi di T.
oligospermum impiegati in questo lavoro come inoculi sia dal database genetico pubblico
GenBank (NCBI, http://blast.ncbi.nlm.nih.gov/). La regione ITS1-5.8S-ITS2 di ciascun corpo
fruttifero di T. oligospermum è stata amplificata e sequenziata tramite la metodologia di PCR
diretta messa a punto da Bonuso et al. (2010) usando la coppia di primer universali ITS1fITS4 (Gardes e Bruns, 1993). Dall’allineamento delle sequenze, effettuato tramite il
programma Multalign (Corpet, 1988), è stato possibile identificare una porzione nucleotidica
in prossimità del terminale 3’ della regione ITS1 che presentava bassa variabilità intraspecifica
ma nel contempo garantiva un sufficiente grado di specificità del primer nei confronti delle
altre specie di tartufo e determinava la produzione di un amplicone di taglia tale da poterlo
82
facilmente distinguere da quelli prodotti dalle coppie di primer TMGI-ITS4 e rTboII-ITS4. Il
primer TOLf è stato poi disegnato con il software Primer3 (http://frodo.wi.mit.edu/primer3/)
usando parametri intermedi fra quelli che caratterizzavano gli altri primer co-impiegati nelle
reazioni di PCR multiplex. Strutture secondarie e formazione di dimeri sono stati verificati
utilizzando il software Oligo Analyzer 1.0.3 (Freeware, Teemu Kuulasmaa, Finlandia) e la
specificità del primer TOLf è stata valutata in primo luogo in silico utilizzando l’algoritmo
BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi) poi tramite amplificazione PCR di estratti di
DNA di diverse specie di Tuber (T. oligospermum, T. magnatum, T. borchii, T. maculatum, T.
dryophilum, T. aestivum, T. rufum, T. macrosporum, T. brumale, T. melanosporum). Le
reazioni PCR sono state effettuate in volumi di 30 µl contenenti i seguenti reagenti : 1x buffer
(Fermentas), 1 mM dNTPs, 0.5 mM per ciascun primer, 4 mM di MgCl2 e 1 unità della Taq
DNA polimerasi (Fermentas). Le condizioni d’amplificazione sono state: 30 cicli di 94 °C per
20 secondi, 62 °C per 20 secondi, 72 °C per 1 minuto, con una denaturazione iniziale a 95 °C
per 3 minuti ed un estensione finale a 72 °C per 10 minuti.
La descrizione morfologica delle micorrize delle diverse specie analizzate è stata eseguita
riportandone la forma, il colore, il tipo di ramificazione, la presenza di ife o cistidi. La struttura
anatomica ed i caratteri biometrici delle micorrize sono stati descritti e misurati con un
microscopio ottico come riportato al capitolo 3.2.2. Le caratteristiche misurate sono state:
l’area, il perimetro, l’asse maggiore e minore delle cellule del mantello fungino, le dimensioni
delle ife e cistidi. Per ciascuno dei parametri biometrici è stata calcolata la media relativa a 50
misurazioni ottenute da 3 micorrize diverse per ciascuna specie.
6.2.4. Verifica e quantificazione del micelio di T. magnatum
6.2.4.1. Prelievo dei campioni di suolo
A sei mesi dall’inoculazione per approssimazione radicale sono stati controllati gli apparati
radicali sia delle piante madri sia dei semenzali trapiantati nello stesso vaso, per verificarne lo
stato di micorrizzazione e sono stati prelevati campioni di suolo per rilevare lo sviluppo
83
miceliare tramite un approccio di PCR quantitativa. Per ciascun vaso sono stati prelevati due
campioni di suolo di circa 100 g, il primo in corrispondenza dell’apparato radicale della pianta
madre (al centro del vaso) ed il secondo nella zona periferica esterna in prossimità delle radici
dei semenzali (periferia del vaso). Successivamente i campioni di suolo sono stati liofilizzati
per tre giorni in un liofilizzatore Virtis Benchtop 2K (SP Industries). Dopo la liofilizzazione, i
campioni sono stati finemente polverizzati in un mortaio, mescolati accuratamente e conservati
a -20 ° C fino al momento dell’analisi. Da ciascun campione sono state preparate tre repliche di
5 g ciascuna in altrettanti tubi da 15 ml ed il DNA totale è stato estratto tramite il protocollo
sviluppato da Iotti et al., (2012). Ogni replica è stata risospesa in 6 ml del tampone di lisi (2%
CTAB, 2% Polyvinylpyrrolidon, 2 M di NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8). Gli
estratti grezzi di DNA sono stati purificati con il kit NucleoSpin Plant II (Macherey-Nagel)
secondo il protocollo della ditta produttrice. Infine il DNA totale di ciscuna reazione è stato
eluito in 65 µl di tampone (5 mM Tris / HCl, pH 8,5). La quantità di DNA in ciascun estratto è
stata quantificata usando uno spettrofotometro NanoDrop ND-1000 (Thermo Scientific). La
qualità del DNA totale è stata valutata con i rapporti OD 260/280 nm e 260/230 nm.
6.2.4.2. Real time PCR
Il DNA purificato è stato conservato a -80 °C fino al momento dell’analisi. Le reazioni di “realtime” PCR (chimica TaqMan) sono state effettuate secondo la metodologia proposta da Iotti et
al. (2012) in piastre da 96 pozzetti ottici (bioplastica) con un termociclatore Stratagene
Mx3000P QPCR system (Stratagene). L’amplificazione è stata effettuata in reazioni di 25µl
contenenti 12,5 µl di Maxima Probe qPCR Master Mix (Fermentas), 30 nM di ROX e 200 ng di
DNA totale. La concentrazione della sonda e dei primer sono stati 0,5 µM e 0,2 µM
rispettivamente. La sonda TaqMan è stata marcata all’estremità 5' con il reporter fluorescente
FAM (6-carbossi-fluorescin) mentre l'estremità 3' è stata modificata con il quencher TAMRA
(6-carbossi-tetramethylrhodamine) (MWG Biotech). Due repliche per ciascun campione di
suolo estratto e del controllo sono stati preparati per ogni piastra e le “real-time” PCR sono state
84
ripetute due volte per confermare i risultati. Le condizioni d’amplificazione sono state: 10
minuti di incubazione a 95 °C seguiti da 45 cicli di 95 °C per 15 s, 60 °C per 30 s, 72 °C per 30
s. Il livello di soglia di fluorescenza è stata determinata con l'algoritmo di default del software
MXpro (versione 4.10) (Agilent Technologies) ed i risultati dei valori di Ct sono stati
automaticamente convertiti in quantitativi di DNA di T. magnatum utilizzando il metodo della
curva standard. Una curva standard è stata generata per ciascuna corsa con una serie di otto
diluizioni serali di DNA genomico di T. magnatum (50, 10, 1, 0.1, 0.01, 0.001, 0.0005, 0.0001
ng DNA totale di T. magnatum) replicate in doppio. Tutte i prodotti PCR real time sono stati
visulizzati su gel dopo elettroforesi per escludere l'amplificazione di sequenze non bersaglio.
6.2.4.3. PCR qualitative sulle radici delle piante madri
Sono stati prelevati delle piante madri campioni di radici per verificare la presenza di T.
magnatum tramite un approccio di PCR qualitativa condotta sul DNA totale estratto. A tal
scopo, per ciascuna pianta, sono stati prelevati 3 campioni di radici micorrizate e non
micorrizate di circa 0.3 g. Le radici sono state sterilizzate esternamente per 30 s in una
soluzione di etanolo (72%) e successivamente in una soluzione d’ipoclorito di sodio (10%) per
10 min in agitazione, quindi sono state lavate per 4 volte in acqua sterile distilata. Dopo la
sterilizazione, i campioni sono stati finemente polverizzati in un mortaio con l’azoto liquido, il
DNA totale è stato estratto tramite il Kit NucleoSpin® Plant II secondo il protocollo della ditta
produttrice.
Il DNA estratto è stato amplificato secondo la metodologia proposta da Amicucci et al. (1998)
utilizzando i primer specie specifici TMGI e TMGII.
6.3. Risultati e discussione
6.3.1. Colonizzazione radicale con T. magnatum, T. borchii e T. oligospermum
Dopo un mese dall’inoculazione dei semenzali, solamente alcuni ceppi di T. borchii (Tbo2364,
Tbo3035, Tbo3067, Tbo3840, Tbo4284) mostravano rari apici radicali già formati e dotati di
cistidi, mentre nella maggior parte delle radichette infettate il mantello era in fase di formazione
85
ancora allo stato ifale e senza la tipica struttura di tipo pseudoparenchimatica, caratteristica
della specie. In questa fase nessuna micorriza è stata rilevata nelle radici dei semenzali inoculati
con T. magnatum e T. oligospermum. In tabella 8 sono riportate le percentuali di
micorrizzazione delle tre specie analizzate e la loro evoluzione nel tempo. Come si può notare
dalla tabella, l’evoluzione del processo di micorrizzazione è stato più rapido per T. borchii
rispetto alle altre specie. Questo aspetto è probabilmente dovuto al tipo d’inoculo impiegato. Il
micelio offre garanzie di un’immediata e più rapida colonizzazione radicale rispetto alle spore
che, come organi di resistenza, richiedono anche un certo intervallo di tempo per la
germinazione e la formazione del micelio primario. Comunque, la durata del mantenimento in
coltura dei miceli influisce enormemente sulla loro infettività. Fra i 10 ceppi di T. borchii
impiegati nelle prove, solo quelli isolati più recentemente sono stati in grado di colonizzare gli
apparati radicali dei semenzali anche se in alcune ripetizioni non sono state rilevate micorrize.
Questo è probabilmente dovuto alle caratteristiche di ciascun ceppo (vitalità ed infettività del
micelio) ma anche alla tecnologia impiegata per produrre gli inoculi miceliari che, per le specie
del genere Tuber, è ancora nelle fasi iniziali di sviluppo (Xiao et al., 2004). Anche se questo
periodo può variare in modo significativo fra gli isolati di una stessa specie, indicativamente,
almeno per T. borchii, dopo 10 anni di mantenimento in coltura di un ceppo è probabile che
questo non sia più in grado di infettare gli apparati radicali.
Nonostante il gap temporale iniziale probabilmente dovuto al diverso tipo di inoculo
impiegato, T. oligospermum ha manifestato un livello di infettività simile o superiore a quello
ottenuto per T. borchii. Questo tartufo è considerato una specie “aliena” per il territorio
italiano e quindi la sua introduzione nelle tartufaie coltivate, sottoforma di piantine micorrizate
erroneamente prodotte in vivaio, potrebbe rappresentare un serio rischio ecologico oltre ad un
pericolo per la tartuficoltura tradizionale. Infatti, questa specie è originaria del Marocco, non è
endemica in Europa ad eccezione del sud della Spagna (Alvarado et al., 2012), produce corpi
fruttiferi di scarso valore commerciale che vengono usati nelle frodi alimentari (Zambonelli et
86
al., 2000) e, come dimostrato in queste prove sperimentali, colonizza i semenzali molto
facilmente. Non è possibile ancora sapere se introdotto negli ambienti boschivi italiani possa
insediarvisi facilmente ed essere un forte competitore verso le altre specie di tartufi,
sostituendosi a loro sulle radici delle piante almeno in certe combinazioni pedoclimatiche.
Comunque, la possibilità che tartufi alieni siano introdotti in Italia è già stata dimostrata con
Tuber indicum, tartufo di origine cinese, la cui presenza in tartufaie coltivate è stata già
verificata da Murat et al., (2008).
L’impossibilità di ottenere idonei inoculi miceliari per T. magnatum ci ha obbligato ad
utilizzare il classico inoculo sporale per produrre micorrize con questa specie. In passato
questa tecnica si è rilevata molto spesso inadeguata per produrre piantine micorrizate sia per
scopi scientifici sia per scopi commerciali, ma successi sono stati ottenuti in alcuni casi (Mello
et al., 2001; Rubini et al., 2001). Anche nel corso di questa sperimentazione siamo riusciti ad
ottenere micorrize di questa specie di tartufo anche se il livello d’infezione variava
notevolmente da pianta a pianta. Solamente due piante mostravano una percentuale di
micorrizzazione superiore al 70% mentre per 5 semenzali sono state rilevate percentuali di
colonizzazione delle radichette comprese fra il 10 e 20%. Anche in condizioni di suolo ottimali
per lo sviluppo di T. magnatum la capacità d’infezione di questa specie è risultata essere più
bassa rispetto a quella delle altre due testate. Una spiegazione potrebbe essere attribuita alle
diverse esigenze ecologiche del tartufo bianco pregiato rispetto a T. borchii e T. oligosperum.
In passato è stato dimostrato che T. borchii è classificato come “early stage fungus” ossia una
specie fungina che si sviluppa su apparati radicali di piante giovani od alla periferia di quelli di
piante mature e, quando in pieno campo la copertura arborea diventa prossima al 100%, le sue
micorrize tendono a scomparire ed essere rimpiazzate da altre specie (Zambonelli et al., 2000).
Quindi è lecito supporre che su giovani semenzali, T. borchii, come pure T. oligospermum,
possono manifestare una maggiore aggressività. Al contrario, T. magntum potrebbe essere un
“late stage fungus” e svilupparsi preferibilmente su piante mature ed in condizioni di copertura
87
arborea elevata, come spesso confermato dai siti di raccolta dei suoi corpi fruttiferi (Pacioni,
2012). Un’altra spiegazione potrebbe essere dovuta alla morte, in seguito alla sterilizzazione
del suolo di allevamento delle piantine, di microrganismi che ne favoriscono lo sviluppo e la
diffusione negli ambienti naturali. Questa ipotesi potrebbe essere di supporto alla teoria della
simbiosi tripartita enunciata nel capitolo 4.4.
L’effettiva appartenenza delle micorrize ottenute con l’inoculo sporale a T. magnatum e T.
oligospermum è stata confermata dall’amplificazione tramite PCR multiplex dei rispettivi
morfotipi ectomicorrizici. Cinque-dieci apici infungati per ciascun morfotipo sono stati
amplificati in reazioni di PCR diretta contenenti i tre primer forward TMGI-TOLf-rTboII ed il
primer reverse ITS4 impiegando frammenti del mantello immessi direttamente nel tubo di
reazione. I frammenti specifici generati da TOLf-ITS4 sono di 513 bp, facilmente distinguibili
su gel da quelli generati da TmagI-ITS4 (595 bp) per T. magnatum e da rTboII-ITS4 per T.
borchii (Fig. 15)
M 1 2 3 4 5 6 7 8 M
Fig. 15- Prodotti di amplificazione (PCR multiplex) ottenuti con i primers specifici. Dalla
corsia 1 alla 4 sono stati impiegati i corpi fruttiferi delle rispettive specie, dalla corsia 5 alla 8
88
le micorrize ottenute in serra. Corsia 1 e 5: T. magnatum; corsie 2 e 6: T. oligospermum; corsie
3 e 7: T. borchii; corsie 4 e 8: tutte le specie.
Tabella. 8 - Percentuale di micorrizazione dopo 3, 6 e 9 mesi dall’inoculo dei semenzali di Q.
pubescens
Specie
Ceppo
Inoculo micorrizazione micorrizazione micorrizazione
3 mesi (%)
6 mesi (%)
9 mesi (%)
micorr.
PNI
micorr.
PNI
micorr.
PNI
PI (%)
(n°)
PI (%)
(n°)
PI (%)
(n°)
-
0
10
0
10
0
10
Testimone
-
T. borchii
1Bo
micelio
0
10
0
10
0
10
T. borchii
17Bo
micelio
0
10
0
10
0
10
T. borchii
43Bo
micelio
0
10
0
10
0
10
T. borchii
Tbo1/94
micelio
0
10
0
10
0
10
T. borchii
Tbo2364
micelio
15.9
2
47.5
2
61.2
2
T. borchii
Tbo2392
micelio
0
10
0
10
0
10
T. borchii
Tbo3035
micelio
23.4
0
49.7
0
65.8
0
T. borchii
Tbo3067
micelio
17.4
4
44.2
4
70.2
4
T. borchii
Tbo3840
micelio
28.0
3
55.2
3
72.1
3
T. borchii
Tbo4284
micelio
18.1
1
41.3
1
67.8
1
T. magnatum
spore
0
20
< 10
15
48.2
5
T. oligospermum
spore
0
20
37.8
18
76.8
18
PI = Piante Infettate; Piante non Infettate
6.3.2. Caratterizzazione morfologica delle micorrize delle tre specie studiate
T. magnatum (Fig. 16) - Le micorrize sono semplici o con ramificazione monopodiali pinnata.
I terminali non ramificati sono dritti, di aspetto lanoso e raramente lisci, di colore marrone con
89
apice più chiaro, generalemte ricoperti di cistidi ialini allungati. Il matello è di tipo
pseudoparenchimatico con cellule epidermoidi con accentuata lobatura. Le ife sono ialine
senza unioni a fibbia. Le caratteristiche morfologiche sono in linea con quelli ottenuti da Mello
et al. (2001).
Fig. 16- Micorrize di T. magnatum: a e b) apici radicali micorrizzati (barra = 1 mm); b)
anastomosi ifale (barra = 10 µm); d) cistidi (barra = 10 µm); e) anatomia del mantello (barra
= 10 µm)
T. oligospermum (Fig. 17) - Le micorrize sono semplici o con ramificazione monopodiali
pinnate. I terminali non ramificati sono clavati, hanno un colore ocra con apice più chiaro,
lisci o ricoperti di cistidi spinuliformi con base allargata ed apice arrotondato. Il mantello è di
tipo pseudoparenchimatico con cellule epidermoidi intercalate ad alcuni elementi ifali. Le ife
sono ialine prive di unioni a fibbia. La morfologia e l’anatomia delle micorrize di T.
oligospermum descritte in questo studio sono simili a quelle rilevate da Bencivenga et al.
(1997).
90
Fig. 17- Micorrize di T. oligospermum: A) radice micorrizata (barra = 300 µm); B) aspetto
della superficie esterna della micoclena (barra = 10 µm); C) cistidi con rigonfiamento basale
e setto ben visibile (barra = 10 µm); D) cistidi (barra = 10 µm); E) sezione trasversale della
micorriza (barra = 10 µm)
T. borchii (Fig. 18) - Le micorrize sono semplici o con ramificazione monopodiali pinnate. I
terminali non ramificati sono cilindrici o leggermente clavati con apice largo e arrotondato
hanno un colore ocra nocciola con apice più chiaro, ricoperti di cistidi spinuliformi ialini con
a volte la base allargata e apice arrotondato. Il mantello è di tipo pseudoparenchimatico con
cellule epidermoidi o arrotondate.
C
91
A
B
C
D
E
Fig. 18 - Micorrize di T.borchii: A e B) micorrize semplici o ramificate (barra = 1mm); C e
D) cistidi (barra = 10 µm); E) immagine della superficie esterna della micoclena con cellule
a contorno poco lobato (barra = 10 µm)
Le caratteristiche biometriche delle tre specie di Tuber sono riportate in tabella 9.
T. magnatum
T. borchii
T. oligospermun
(µm)
(µm)
(µm)
Tabella. 9 -Caratteristiche biometriche delle cellule del mantello e cistide di micorirrize
delle tre specie studiate
92
Area cellule
69.46 ± 30.39
79.54 ± 36.46
70.72 ± 28.46
*
Perimetro cellule
38.33 ± 11.05
40.79 ± 10.17
39.07 ± 9.72
Non
Asse maggiore
13.86 ± 4.20
14.75 ± 3.68
14.35 ± 3.15
è
Asse minore
8.22 ± 2.37
8.52 ± 2.38
8.36 ± 2.15
stato
Lunghezza dei cistidi
109.59 ± 41.42
65.01 ± 14.85
44.49 ± 12.21
rilev
Diametro dei cistidi
2.12 ± 0.36
3.44 ± 0.82
1.93 ± 0.52
ato
Diametro ifale
2.47 ± 0.44
4.87 ± 1.17
_*
in
quan
to non si sono mai osservate ife peritrofiche
6.3.3.Verifica e quantificazione del micelio di T. magnatum
Le due piante aventi una percentule di micorrizzazione con T. magnatum che superava il 70%
sono state selezionate come piante madri per indurre la colonizzazione in nuovi semenzali
tramite la tecnica per approssimazione radicale. A sei mesi dal trapianto una delle due piante
madri non presentava più alcun tipo di micorriza mentre l’apparato radicale dell’altra pianta
mostrava un 50% di apici colonizzati da Sphaerosporella brunnea, un comune contaminante
delle piantine micorrizate in vivaio (Amicucci et al., 2000) ed un 10% di micorrize attribuibili
a T. magnatum. Nessuna delle nuove piantine associate alle piante madri presentava micorrize
di T. magnatum.
Le reazioni di “real-time” PCR sui campioni di suolo prelevati nei vasi hanno evidenziato che
la quantità maggiore di micelio di T. magnatum era presente vicino agli apparati radicali delle
piante madri e diminuiva di circa un ordine di magnitudo nei campioni raccolti alla periferia
dei vasi (Fig. 19). Inoltre nel vaso in cui era presente la pianta madre ancora micorrizata, la
concentrazione del micelio di T. magnatum nel substrato era 25 volte superiore a quella del
vaso della pianta madre che aveva perso le micorrize. Dai risultati ottenuti scaturisce che le
ectomicorrize di T. magnatum supportano una quantità di micelio superiore rispetto a radici
93
senza ectomicorrize ma la loro scomparsa a livello radicale non è indice di assenza di questa
specie sugli apparati radicali. Il micelio tende a concentrarsi maggiormente in prossimità
dell’inoculo iniziale (pianta madre) ma si era anche sviluppato in tutto il volume di suolo
contenuto nel vaso pur senza formare nuove ectomicorrize. La velocità di diffusione nel suolo
è certamente superiore a quella delle colture pure. Infatti dopo 6 mesi dal trapianto il micelio
di T. magnatum nel suolo dei vasi di allevamento dell piantine si era propagato per una
distanza superiore ai 5 cm, distanza che in piastra necessiterebbe di alcuni anni e successive
subculture per essere coperta.
Questa capacità di diffusione del micelio del tartufo bianco pregiato nel suolo è stata
riscontrata anche in due ricerche effettuate su campioni di suolo naturali che hanno evidenziato
come esso si possa trovare anche molto distante dal punto di ritrovamento dei carpofori
(Zampieri et al., 2010; Iotti et al., 2012) mentre le sue micorrize in natura sono rarissime
(Leonardi et al., 2013).
Questi risultati sostengono l’ipotesi che T. magnatum rimane presente nelle radici delle piante
sottoforma di endofita o di un’altra tipologia di simbiosi micorrizica come anticipato nelle
conclusioni del capitolo 2. Le PCR qualitative condotte sul DNA totale estratto delle porzioni
di radici non micorrizate e dalle ectomicorrize di S. brunnea e di T. magnatum (queste ultime
usate come controllo positivo) prelevate dalle piante madri hanno infatti determinato
l’amplificazione di prodotti PCR specie-specifici in tutti i campioni estratti. Comunque sarà
necessario applicare altri approcci molecolari, come la PCR in situ, per confermare l’effettiva
presenza del micelio di T. magnatum all’interno dei tessuti corticali.
94
pg di DNA
Fig. 19- Quantità medie di DNA del micelio di T. magnatum nel suolo. i valori in ordinata
sono stati logaritmizzati.
6.4. Conclusioni
I risultati ottenuti rappresentano un buon punto di partenza per impostare future
sperimentazioni su questa specie di tartufo pregiata e risolvere i numerosi misteri che
riguardano la sua biologia. In primo luogo bisognerà confermare una delle ipotesi legate alla
strategia ecologica e biologica che impiega questo tartufo per mantenersi e diffondersi in
pieno campo. La possibilità di ottenere micorrize in condizioni controllate e verificarne
l’effettiva appartenenza a questa specie con metodi molecolari rende un po’ più concreta la
possibilità d’impostare specifici piani di produzione di piantine micorrizate. In passato fra i
principali fallimenti nel coltivare questo tartufo sono da annoverare l’utilizzo di piantine
micorrizate con altri tartufi che si sostituivano a T. magnatum sugli apparati radicali. Come
abbiamo dimostrato anche in questa prova le micorrize di T. oligosperum, T. magnatum e T.
borchii sono morfologicamente ed anatomicamente simili. A livello morfologico solamente i
cistidi possono differenziare queste tre specie fra loro ma non sempre questi elementi
anatomici sono presenti sulle micorrize. Lo sviluppo del primer specifico TOLf da impiegare in
PCR multiplex con gli altri primer disegnati e testati in passato permette una rapida e sicura
95
identificazione delle micorrize di T. oligosperum evitando possibili frodi alimentari o
l’introduzione nelle tartufaie italiane di questo potenziale fungo “alieno” che si aggiunge alle
altre specie di tartufi “minori” già presenti nel nostro territorio. Sicuramente l’impiego dei
miceli nei processi di micorrizzazione rappresenta l’obbiettivo principale per il futuro per
risolvere diversi problemi legati alla produzione di piantine micorrizate. Anche se la
produzione di inoculi miceliari su vasta scala è ancora in fase sperimentali, le prove
effettuate con T. borchii hanno evidenziato che questa metodologia produce piante ben
micorrizzate in tempi più brevi rispetto all’utilizzo dell’inoculo sporale. Inoltre i miceli
possono essere sottoposti a selezione genetica per migliorare la produttività, l’adattamento
ad uno specifico ambiente di coltura ed il processo di micorrizzazione e offrono la possibilità
di una migliore gestione dei mating type. Questo tipo di inoculi si potrebbero prestarsi anche
ad un facile impiego direttamente in campo bypassando la fase vivaistica. Comunque il
principale problema legato all’utilizzo dei miceli è la perdita delle capacità infettive se
mantenuti in coltura per lungo tempo.
96
Capitolo 7
7. Messa a punto di protocolli di conservazione per colture di Tuber spp. e
la crezione di una banca di germoplasma di tartufi
7.1. Introduzione
L’Italia è il paese dove si registra la crescita spontanea delle due specie di tartufo di maggior
pregio: il T. melanosporum (tartufo nero pregiato) e il T. magnatum (tartufo bianco pregiato)
insieme ad altre specie di minore ma pur sempre consistente interesse commerciale, come il
97
tartufo estivo (T. aestivum / uncinatum) ed il tartufo bianchetto (T. borchii). La raccolta e la
commercializzazione di queste specie rappresenta un’ importante fonte di reddito soprattutto
per le popolazioni collinari e montane. Purtroppo, nell’ultimo secolo, la produzione di tartufi
in Italia e nel resto d’Europa è in notevole calo a causa del disboscamento, del degrado del
territorio montano, della raccolta eccessiva e dei cambiamenti climatici (Hall et al., 2007).
Inoltre queste importanti specie autoctone rischiano di essere soppiantate da specie alloctone
più competitive (quali i tartufi cinesi T. indicum, T. hymalayense e T. sinense) con evidenti
rischi per la biodiversità fungina. Il tartufo non europeo, come il cinese T. indicum, è stato
esportato dalla Cina in Europa, Nord America e Australia (Garcia-Montero et al., 2010).
Tale tartufo é difficile da distinguere da T. melanosporum poinché hanno caratteristiche
organolettiche e morfologiche molto simili. Un grosso problema è rappresetato dal fatto che
T. indicum è spesso venduto come T. melanosporum e perciò potrebbe essere
(volontariamente o meno) utilizzato in vivaio come inoculo per la micorrizazione di piantine,
come peraltro precedentemente accaduto (Murat et al., 2008). Proteggere la biodiversità,
nonché la diversità genetica all’interno delle specie è nell’interesse di ogni Paese e, in questo
contesto, la creazione di una banca di germoplasma è di fondamentale importanza. Per far
ciò è necessario mettere a punto tecniche di conservazione adattate al materiale biologico da
conservare.
Le diverse tecniche di conservazione di materiale fungino: excursus storico
Le tecniche di conservazione di ceppi fungini devono garantire la loro purezza, vitalità e nel
contempo mantenere invariate nel tempo le loro caratteristiche morfologiche, fisiologiche e
genetiche.
Per la conservazione di materiale fungino, in passato, sono stati sviluppati molti metodi
(Nakasone et al., 2004), ma solo pochi di essi sono adatti ai funghi ectomicorrizici in
generale, ed alle specie di Tuber in particolare (dati non pubblicati).
98
La scelta del metodo di conservazione dipende dalla specie conivolta e dagli obiettivi che si
intendono raggiungere.
La conservazione a breve termine tramite rinnovi colturali ripetuti frequentemente è
semplice, economica ed idonea alla maggior parte dei funghi ectomicorrizici ma il rischio di
contaminazione nonché l'essiccamento del terreno di crescita sono sempre presenti. Inoltre,
la ripetizione continuativa dei trapianti può portare alla perdita dell’infettività per
l’insorgenza di mutazioni o a modifiche dell’espressione genica (Coughlan e Pichè, 2005).
Nel precedente capitolo è stato dimostrato che i ceppi di T. borchii più vecchi presenti nella
nostra collezione avevano perso la loro capacità di formare ectomicorrize in condizioni
controllate. In alcuni casi tale problema può essere risolto semplicemente modificando la
composizione del terreno nutritivo che può portare al ringiovanimento di vecchie culture e
alla riduzione della perdita di vitalità del fungo (Nakasone et al., 2004; Repac, 2011).
La conservazione a lungo termine in tubo sotto strato d’olio presenta il vantaggio
dell’economicità. Essa consiste nel sommergere completamente con uno strato d’olio di
vaselina, precedentemente sterilizzato, la colonia fungina sviluppatasi sul terreno nutritivo. I
tubi devono essere sigillati e il livello d'olio deve essere controllato periodicamente e, se
necessario, rimboccato. Analogamente, le colonie fungine possono essere conservate anche
in provette contenenti acqua distillata sterile: se conservate a 4 °C tali colture mantengono la
massima vitalità (Richter, 2008). E’ tuttavia fondamentale sottolineare che questi due
semplici metodi di conservazione a lungo termine di materiale fungino sono validi solo per
alcune specie di funghi ectomicorrizici. Ad esempio, alle suddette condizioni la vitalità a
lungo termine dei miceli di Tuber non è garantita (osservazione personale).
L’ultracongelamento a – 80 C° è una tecnica di conservazione a lungo termine che
garantisce elevati tassi di sopravvivenza (Kitamoto et al., 2002). Essa prevede la
conservazione di plug di micelio entro criotubi contenenti l’idoneo terreno nutritivo liquido
con l’aggiunta di un crioprotettore. I criotubi così preparati vengono poi posti direttamente
99
nell’ultracongelatore. Questa tecnica presenta il vantaggio di essere poco costosa, in quanto
la maggior parte dei laboratori possiede un ultracongelatore, ma ha lo svantaggio di non
essere applicabile a tutti i funghi ectomicorrizici, come dimostrato da Obase et al., (2011).
Un'altra innovativa tecnica di conservazione a lungo termine è la crioconservazione o
conservazione criogenica. Con tale termine ci si riferisce allo stoccaggio di materiale
biologico alla temperatura ultra-bassa dell’azoto in fase liquida (-196 °C). A tale temperatura
le cellule entrano in uno stato di “quiescenza assoluta”, in quanto tutte le reazioni fisiche e
biochimiche sono praticamente ferme a causa della mancanza di acqua allo stato liquido,
rendendo minima l’eventuale alterazione del loro potenziale vitale e della loro capacità
rigenerativa. In questa particolare condizione, i tempi di conservazione divengono
praticamente illimitati.
L 'esposizione al freddo intenso (-196 °C) comporta alterazioni dovute al congelamento
dell’acqua che si trova nei tessuti e nelle cellule. Infatti, l’esposizione a temperature sotto lo
zero porta alla formazione di cristalli aghiformi, che si accompagna ad un aumento di
volume del 9%, con conseguenti variazioni del metabolismo cellulare ed danni fisici
irreversibili. La cristallizzazione dell’acqua, in ambiente sia extracellulare che intracellulare,
senza passare attraverso una fase di disidratazione cellulare, provoca una perforazione delle
membrane e delle pareti dovuta all’azione meccanica di crescita dei cristalli ed è la causa
principale della morte delle cellule (Dereuddre e Gazeau, 1992).
L'esposizione al freddo intenso comporta anche alterazioni delle membrane. Tutte le
membrane cellulari e principalmente la membrana plasmatica, sono sensibili al freddo ed
alla disidratazione (Uemura e Steponkus, 1999). La sopravvivenza della cellula dipende
dall’integrità della membrana plasmatica, che gioca un ruolo fondamentale nel metabolismo
cellulare con la diffusione attiva o passiva delle molecole necessarie al funzionamento
cellulare (Robert e Roland, 1989). Un rapido abbassamento della temperatura può causare
una forte disidratazione delle cellule, l’esclusione delle proteine di membrana e steroli e la
100
separazione laterale e irreversibile dei fosfolipidi che, a sua volta, può provocare la
dislocazione del plasmalemma e, di conseguenza, la morte cellulare (Mazliak, 1999; Wolfe e
Bryant, 1999).
Per queste problematiche, in tale tecnica, l'uso di crioprotettori è indispensabile per
proteggere le cellule. In base al sito d’azione si distinguono due categorie di crioprotettori:
quelli che agiscono all’interno della cellula (crioprotettori intracellulari, come ad es. il
DMSO(dimetilsolfossido) e il glicerolo) e quelli che agiscono all’esterno della cellula
(crioprotettori extracellulari, come zuccheri quali sorbitolo, saccarosio, lattosio, trealosio ed
altri).
Entrando più nello specifico, con questa tecnica le ife fungine subiscono dapprima un
graduale ciclo di raffreddamento, che dura anche molte ore, al termine del quale vengono poi
trasferite in una bombola contenente azoto liquido, bloccando così le eventuali modificazioni
genetiche.
La crioconservazione, sperimentata per la prima volta nel 1953 su globuli rossi (Lovelock,
1953), si è poi largamente affermata in campo veterinario e botanico. Infatti, Hwang (1960)
dimostrò che la conservazione in azoto liquido è la tecnica migliore e più ampiamente
applicabile per la conservazione di funghi filamentosi (Smith, 1998). E’ utilizzata di routine
in America e l’American Type Culture Collection (ATCC) ne è l’esempio.
Il protocollo descritto da Smith (1998) è stato applicato nei primi anni del 2000 con successo
a spore di funghi micorrizici arbuscolari, ma sui miceli è di difficile applicazione (Homolka
et al., 2001). Se da un lato tale tecnica presenta il vantaggio di essere l’unica in grado di
assicurare una reale e affidabile conservazione a lungo termine, dall’altro presenta lo
svantaggio di essere costosa per l’elevato costo delle apparecchiature necessarie a
realizzarla.
Basandoci sui risultati ottenuti in passato su materiale fungino ectomicorrizico, in questo
lavoro abbiamo cercato di mettere a punto due metodi per la conservare a lungo termine i
101
miceli di Tuber e precisamente: quello dell’ultracongelamento a -80°C, come descritta da
Kitamoto et al. (2002), scelto per la facilità d’applicazione, il basso costo e la disponibilità
nella nostra struttura di un ultracongelatore e quello della crioconservazione in azoto liquido
modificando il protocollo di Danell e Flygh (2002).
7.2. Materiali e metodi
7.2.1. Ceppi fungini utilizzati
Le prove sono state condotte utilizzando miceli in coltura pura di T. borchii, T. aestivum e T.
macrosporum in collezione presso la micoteca del Centro di Micologia di Bologna (CMIUnibo) (Tabella 10). I miceli sono stati fatti crescere al buio a 22°C, in piastre Petri
contenenti PDA per T. borchii e WPM per T. aestivum e T. macrosporum. Il micelio e stato
propagato bimestralmente prelevando dei plug (Ø 7 mm) dal margine più esterno della
colonia.
Tabella. 10- Ceppi di micelio utilizzati
Ceppo
Data di racolta
N. erbario
T.borchii (2364)
12-03-2004
2364
T. aestivum (Tae2)
16-12-1999
1463
T. macrosporum (Tmc1)
01-12-1999
1461-2
7.2.2. Ultracongelamento a – 80 °C
In questo lavoro é stato applicato il metodo di ultracongelameto a -80°C descritto da
Kitamoto et al. (2002). Dal margine di una colonia di 50 giorni di T. borchii, T. aestivum e
T. macrosporum è stato prelevato 1 disco di micelio (3 mm) e trasferito in tubi contenenti il
102
mezzo di crescita (PDA o WPM), solidificato a becco di clarino, con l’aggiunta del 10% di
glicerolo come crioprotettore. I miceli sono stati fatti crescere in termostato a 22 °C ± 1 per
3-4 settimane dopodiché i tubi sono stati trasferiti direttamente nell’ultracongelatore a –80
°C per 60 giorni. Trascorso tale periodo i miceli sono stati scongelati a temperatura ambiente
per 3 ore dopodiché per ciascuna specie sono state allestite 4 piastre Petri contenenti
substrato agarizzato (PDA o WPM) e incubati al buio alla temperatura di 22 °C per 30
giorni. Parallelamente, è stato allestito un eguale numero di piastre con i corrispondenti
miceli freschi. Settimanalmente è stato misurato il diametro di tutte le colonie.
7.2.3. Crioconservazione a -196°C
Previe opportune modifiche, ci si è basati sul protocollo di Danell e Flygh (2002). Le
modifiche si sono rese necessarie in quanto tale protocollo è stato sviluppato per la
crioconservazione di Cantarellus cibarius, fungo epigeo, mentre noi ci siamo trovati ad
operare con Tuber spp. che presenta maggiori difficoltà di crescita in coltura pura (Iotti et
al., 2002). La modifica ha riguardato l’aggiunta di saccarosio per ridurre la tossicità del
crioprotettore dimetilsolfossido (DMSO) previsto dal protocollo. E’ infatti noto che il
saccarosio è un buon crioprotettore di tipo extracellulare.
7.2.3.1 Fase di congelamento del micelio
Dal margine di colture fungine di 30 gg di età di T. borchii, T. aestivum e T. macrosporum
sono stati campionati 10 plug (1 mm) di micelio. Questi sono stati posti in criotubi
contenenti 1,5 ml di mezzo di coltura liquido sterile (PDBroth, Difco e WPM a secondo
della specie di Tuber coinvolto ) cui è stato aggiunto sorbitolo (105 µl) e dimetilsolfossido
(DMSO) (117 µl) ogni 3 minuti per 10 volte. Le colture sono state quindi incubate per 24 ore
al buio a 22-23 °C su di un agitatore rotante. I criotubi contenenti le colture miceliari sono
stati inseriti in un apposito strumento (Kryo 10 series II, PlanerProducts) programmato col
seguente ciclo di raffreddamento: abbassamento della temperatura a –1 °C / 10’; successiva
103
diminuzione della temperatura di 0,3 °C / min fino al raggiungimento di –16 °C, mantenuti
per 15’; successiva diminuzione della temperatura di 0,3 °C / min fino ad arrivare a –35,5 °C
ed ulteriore abbassamento di 15 °C / min fino al raggiungimento di –50 °C. A questo punto i
criotubi sono stati immersi in azoto liquido (-196 °C) per 48 ore.
7.2.3.2. Fase di scongelamento del micelio
Subito dopo esser stati estratti dall’azoto liquido, i criotubi sono stati immersi in acqua a 35
°C al fine di provocarne il parziale scongelamento dopodiché sono stati lavati trasferendoli
entro tubi contenenti 15 ml del corrispondente mezzo nutritivo liquido. Tale operazione si
rende necessaria per eliminare il maggior quantitativo possibile di DMSO che diventa
tossico a temperatura ambiente. I campioni sono stati quindi trasferiti su piastre Petri
contenenti substrato agarizzato (PDA, Difco e WPM) e incubati al buio alla temperatura di
22° C. Settimanalmente è stato misurato lo sviluppo diametrale delle colonie per paragonarlo
a quello del corrispondente micelio fresco trapiantato al momento.
7.2.4. Prove di verifica dell’infettività del micelio
Micorrizazione di piantine con micelio crioconservato e fresco
Con questa prova si è inteso verificare se la crioconservazione modifichi l’infettività dei
miceli crioconservati rispetto a quelli freschi come risulta in alcuni casi riportati in
letteratura (Chetverikova, 2009). A tal fine, il micelio di T. borchii, T. aestivum e T.
macrosporum (Tabella 10) sviluppatosi in piastra dopo la crioconservazione è stato trasferito
entro provette di vetro (200 ml) contenenti 70 ml di vermiculite imbibita di WPM liquido.
Sono stati preparati 6 provette/ceppo crioconservato, per un totale di 18 provette ed un
uguale numero con micelio fresco dei medesimi ceppi. Il micelio è stato mantenuto in tali
condizioni per due mesi, al fine di permettere la colonizzazione del substrato.
Parallelamente, nel gennaio del 2011, un centinaio di ghiande di Quercus cerris, previa
104
sterilizzazione superficiale in soluzione acquosa di NaClO (1%) per 15’, sono state seminate
in un substrato sterile di vermiculite e torba in parti eguali (Bencivenga, 1982). A 2 mesi
dalla semina, sono state scelte casualmente 42 piantine inoculate con le provette di micelio
precedentemente preparato (6 piantine per tesi) e trapiantate in vasetti di plastica (250 ml)
riempiti con vermiculite/sabbia/terriccio vulcanico (30:30:40) sterili. Parallelamente sono
stati allestiti 6 vasetti testimone con piantine non inoculate. Le piante sono state allevate in
serra per 6 mesi (da marzo ad agosto 2011) ed irrigate settimanalmente.
Nei mesi di settembre - ottobre e novembre, cioè a sei - sette mesi dall’inoculo, le piantine
sono state svasate e gli apparati radicali sono stati lavati delicatamente sotto acqua corrente.
Il grado di micorrizazione è stato valutato al microscopio stereoscopico (20x).
7.3. Risultati e discussione
7.3.1. Ultracongelamento a -80°C
L’ultracongelamento a –80 °C ha fornito risultati positivi col micelio di T. borchii giorni
mentre per T. aestivum e T. macrosporum non si è ottenuto alcuno sviluppo miceliare. Nel
caso di T. borchii la lag-phase è durata 8 giorni: superata tale fase, l’accrescimento radiale
della colonie fungina è stato di circa 5-6 mm/settimana (fig. 20), assumendo un andamento
esponenziale del tutto simile a quello osservate per il micelio fresco. Questi risultati
rispecchiano le difficoltà di mantenimento in coltura pura per T. aestivum e T. macrosporum
in assenza della pianta simbionte. Il mancato sviluppo, dopo l’ultracongelamento, osservato
per T. aestivum e per T. macrosporum può anche esser spiegato col fatto che queste due
specie sono molto più sensibili al congelamento, caratteristica che si aggiunge alle maggiori
difficoltà di coltivarle in vitro rispetto a T. borchii.
105
mm
2364 congelato a -80C
2364 fresco
Giorni
Fig. 20- Grafico dei valori medi d’accrescimento del micelio di T. borchii ultracongelato e
fresco, una volta superata la lag-phase.
7.3.2. Crioconservazione in azoto liquido (-196°C)
In Tabella 11 vengono presentati i risultati relativi ai valori di accrescimento ifale dei miceli
crioconservati paragonati a quelli dei corrispondenti miceli freschi. I risultati dimostrano che
non sussistono differenze nell’accrescimento, indipendentemente dalla specie di Tuber
coinvolta. Inoltre, tale assenza di differenze si manifesta fin dalla prima data di controllo
dopo la lag fase e si protrae per tutta la durata della prova.
Tabella 11- Valori medi di accrescimento del micelio crioconservato e fresco di T. borchii,
T. aestivum e T. macrosporum (valori medi di 5 ripetizioni).
2364
Lag-phase
(gg)
Controlli (gg)
1
4
7
11
14
18
21
Tmc1
Tae2
crioconservato
fresco
cioconservato
35
6
70
10
70
10
0
10,5
19,38
26,3
33,8
40,5
49,8
0
9,88
19,3
26,63
33,95
40,88
49,3
0
2,75
8,13
14,3
17,8
23,6
28
0
3,5
9,3
15,12
18,62
23,75
28,23
0
1,88
9
12,8
17,3
20,33
31,3
0
2,3
9
12,38
16
19,63
29,63
106
fresco
crioconservato fresco
25
28
32
35
39
59,13
66,88
76
82,3
85
60,08
66,93
76,88
82,63
85
32,3
36,63
42,5
47,88
54,3
32,75
37,37
42,5
48,5
55,12
36,8
44
48,13
54,13
61,38
36,88
44,3
49,53
55
62,3
Tuttavia, occorre sottolineare che marcate differenze, tra micelio crioconservato e fresco,
sono state rilevate in termini di lag fase, per tutte e tre le specie di Tuber: il micelio
crioconservato di T. borchii ha sviluppato dopo 35 giorni (fig. 21), mentre quello
crioconservato di T. aestivum e T. macrosporum ha iniziato a svilupparsi dopo 70 giorni.
Questo risultato porterebbe a concludere che l’azione del freddo interferisce notevolmente
sulla lag fase del micelio conseguente ad un periodo di “risveglio” delle vie metaboliche
cellulari. Tuttavia, una volta superata tale fase, la crescita del micelio crioconservato e fresco
è uguale (Fig. 21 e 22). Occorre anche dire che differenze, in termini di lunghezza della lag
fase tra queste tre specie di tartufo si possono notare, anche se in scala ridotta, nel trapianto
dei miceli in condizioni standard. Infatti, durante i trapianti di routine per mantenimento
delle colture madri, il micelio di T. borchii impiega dai 5 ai 7 giorni prima di sviluppare
nuove ife mentre per T. aestivum e T. macrosporum questo lasso di tempo dura circa 10
giorni. Anche Nagai et al. (2000) arrivarono, infatti, alla conclusione che il successo della
crioconservazione di colture pure varia da specie a specie e da ceppo a ceppo.
107
Fresco
Crioconservato
Fig. 21- Grafico dei valori medi
d’accrescimento dei micelio di T. borchii pre e post
Giorni
crioconservazione
crioconservato
fresco
Fig. 22 - Confronto dopo 52 giorni di incubazione di micelio di T.borchii crioconservato e
fresco
In passato la crioconservazione aveva dato risultati positivi con spore di funghi micorrizici
arbuscolari, ma quando si cercò di applicarla alla conservazione di campioni di micelio, la
sua applicazione presentò notevoli difficoltà in quanto le strutture ifali risultarono essere più
sensibili al congelamento (Homolka et al., 2001), Infatti, i cristalli di ghiaccio si formano
preferenzialmente nel punto in cui la parete ifale è stata danneggiata, danni che possono
verificarsi durante la preparazione del campione (Tan e van Ingen, 2004) e che possono
portare a scarsa sopravvivenza o a uno scarso recupero dopo il congelamento (Corbery e Le
Tacon, 1997; Smith, 1998; Danell e Flygh, 2002). Nel nostro caso, pare che tali danni non si
108
siano verificati, in quanto l’accrescimento e la macro e micromorfologia delle colonie
fungine crioconservate in azoto liquido sono risultate uguali a quelle delle colonie testimone
non congelate e mantenute attivamente in coltura su substrato agarizzato (Tabella 11 e
Figura 22). I risultati ottenuti modificando il metodo di Danell e Flygh (2002) tramite
l’aggiunta di saccarosio, dimostrano che è possibile crioconservare i miceli di Tuber spp.,
nonostante le notevoli difficoltà nel mantenere in coltura pura questi funghi, superiori a
quelle che si incontrano per altre specie fungina ectomicorrizica (Iotti et al., 2002; Iotti et al.,
2005).
Per quanto riguarda i risultati inerenti le prove di micorrizzazione con micelio fresco e
crioconservato, 6 mesi dall’inoculazione solo le piante inoculate con T. borchii sono risultate
micorrizzate (percentuali di micorrizazione del 46.5% e 33.5%, rispettivamente per l’inoculo
col micelio fresco e crioconservato). Al contrario, per le piante inoculate col micelio di T.
aestivum e T. macrosporum non sono state ottenute micorrize, né con l’inoculo fresco né con
quello crioconservato. Quest’ultimo dato confermerebbe i risultati ottenuti nella precedente
prova di ultracongelamento: trattandosi di ceppi isolati 12 anni prima del loro impiego ed
essendo stati sottoposti a molteplici rinnovi, questi hanno perso la capacità di infettare le
radici delle piante ospiti. Osservazioni simili sono state riportate anche da Marx e Daniel
(1976), da Thomson et al., (1993) e da Giltrap, (1981) i quali hanno dimostrato una
diminuzione della capacità, da parte di diverse specie fungine, di formare associazioni ECM
dopo molti anni di trapianto delle stesse, difficoltà associata anche a una riduzione della loro
capacità di miglioramento della crescita delle piante. I risultati positivi ottenuti con le
piantine inoculate col micelio crioconservato di T. borchii confermano la validità della
tecnica di crioconservazione da noi messa a punto.
7.4. Conclusioni
109
In base ai nostri risultati, possiamo affermare che la crioconservazione in azoto liquido è una
tecnica di successo anche quando si tratta di micelio di funghi ectomicorrizici
particolarmente difficili da coltivare, quali quelli del genere Tuber, aprendo la possibilità alla
creazione di una prima banca di germoplasma di tartufo per poterne conservare la
biodiversità e per possibili sviluppi biotecnologici.
Al contrario la tecnica dell’ultracongelamento adottata in questa sperimentazione non si è
dimostrata idonea per conservare i miceli indipendentemente dalla specie in oggetto, anche
se questa è interessante poichè la lag fase risulta essere notevolmente ridotta. Probabilmente
ulteriori sviluppi di tale tecnica potrà consentire di essere applicata a qualsiasi specie di
tartufo.
110
Conclusioni generali
111
Il lavoro svolto durante questa tesi di dottorato pone le basi per lo sviluppo di nuove
biotecnologie della micorrizazione di piante forestali con tartufi pregiati ed in particolare con
T. magnatum.
Le tecniche di inoculazione miceliare che si stanno mettendo a punto presso i laboratori del
Centro di Micologia dell’Università di Bologna rappresentano un approccio innovativo per
la produzione di piante micorrizate tradizionalmente ottenute con metodo di inoculazione
sporale (Hall et al., 2007). Oltre a contenere i costi relativi alla produzione delle piante
micorrizate, poiché si evita l’acquisto di tartufi, si evitano inquinamenti, spesso dovuti ad
altre specie di Tuber che possono incidentalmente finire nell’inoculo e soprattutto si apre la
strada di effettuare una selezione genetica.
Durante questa tesi abbiamo descritto ottenuto e descritto le micorrize di T. magnatum e
quelle di altri tartufi “bianchi” (T. oligospermum, T. borchii) con caratteristiche
morfologiche simili che spesso vengono mescolati o addirittura commercializzati al posto di
quelli del tartufo bianco pregiato (Zambonelli e Iotti, 2005). Abbiamo disegnato primer
specie specifici in grado di identificare T. oligospermum e abbiamo verificato la possibiltà di
utilizzare questi primers in PCR multiplex con quelli di T. magnatum e di T. borchii al fine
di “scovare” sia frodi nella commercializzaione degli ascomi sia eventuali contaminazioni
nelle piante micorrizate. Quest’ultimo aspetto è particolarmente importante in quanto piante
micorrizate con T. oligospermum, specie esotica comune nel nord Africa, potrebbero
diffondersi nei nostri ambienti tartufigeni con conseguente rischio di contaminazione
ecologica.
Per la prima volta durante lo svolgimento di questa tesi di dottorato siamo riusciti ad isolare
e mantenere in coltura pura il micelio di T. magnatum e la sua identità è stata confermata
mediante utilizzo di primer specie specifici. Fino ad ora i tentativi di isolamento effettuati
erano falliti, in quanto le colture ottenute si perdevano al primo trapianto, oppure le colture
ottenute appartenevano ad altre specie di Tuber come scoperto in seguito attraverso
112
identificazione molecolare (Mello et al., 2001; Gregori, 2002). Tuttavia i miceli T.
magnatum da noi isolati crescevano troppo lentamente per permetterne l’utilizzo in tecniche
di inoculazione miceliare. Abbiamo pertanto cercato alternative per migliorare il mezzo
nutritivo per la crescita del micelio utilizzando: 1) fonti di carbonio diverse, 2) estratti
radicali di nocciolo (una delle piante ospiti preferite dal tartufo), 3) diverse frazioni degli
estratti radicali di nocciolo, 4) essudati di altri funghi del genere Tuber. Per queste prove
abbiamo utilizzato sia un ceppo T. magnatum da noi isolato e un ceppo di T. borchii, specie
modello per lo studio del tartufo in vitro. Da questi studi è emerso come gli estratti miceliari
ma soprattutto gli estratti radicali siano in grado di stimolare le crescita miceliare del tartufo
modello T. borchii. Non abbiamo tuttavia potuto apprezzare differenze significative fra le
singole frazioni dell’estratto radicale. Questo incremento nella crescita del micelio di T.
borchii in substrato arricchito con estratto radicale di nocciolo corrisponde ad un aumento
dell’espressione di geni CDC42 e Rho-GDI due geni legati alla crescita apicale polarizzata
delle ife dei funghi filamentosi.
Nell’ambito di questa tesi abbiamo evidenziato come il mantenimento in coltura per
numerosi anni di ceppi della specie modello T. borchii influenzi negativamente la loro
infettività nei confronti della pianta ospite (Coughlan e Piché, 2005). In questa tesi abbiamo
pertanto perfezionato tecniche di crioconservazione di ceppi di Tuber spp. che, come è noto
dalla letteratura (dati non pubblicati), permettono di mantenere stabili nel tempo le
caratteristiche genetiche degli organismi animali e vegetali e che recentemente sono state
applicate anche ai funghi (Smith, 1998; Danell e Flygh, 2002).
I risultati positivi da noi ottenuti con la crioconservazione pongono le basi per la creazione di
una banca di germoplasma di specie del genere Tuber che, oltre a rappresentare una riserva
di materiale genetico da cui selezionare i ceppi più idonei per l’inoculazione miceliare a
seconda delle diverse combinazioni pianta ospite-ambiente, costituisce l’unico mezzo
113
efficace per la salvaguardia della biodiversità dei tartufi. Il patrimonio tartuficolo italiano ed
europeo infatti si sta impoverendo a causa della raccolta indiscriminata. Inoltre anche se per
molte specie di tartufo la coltivazione è possibile (eccetto, per ora, T. magnatum) essa non
tiene conto delle caratteristiche genetiche del materiale fungino di base, con un rischio di
impoverimento della sua diversità (Hall e Zambonelli, 2012).
114
Bibliografia
Ahmed M., Abdel-Azeem. 2010. The history, fungal biodiversity, conservation, and future
perspectives for mycology in Egypt. IMA Fungus. 2: 123–142.
Alexopoulos C J., Mims C W., Blackwell M. 1996. Introductory Mycology (4th Ed.). John
Wiley and Sons, New York, USA. 868p.
115
Alvarado P., Moreno G., anjón J M. 2012. Comparison between Tuber gennadii and T.
oligospermum lineages reveals the existence of the new species T. cistophilum (Tuberaceae,
Pezizales). Mycologia, 10: 11-254.
Alvin K L. 1960. Further conifers of the pinaceae from the Wealden formation of
Belgium.In institut Royal des sciences naturelles de Belgique, Memoirs. 146: 1-39.
.
Amicucci A., Guidi C., Zambonelli A., Potenza L., Stocchi V. 2000. Multiplex PCR for
the identifi cation of white Tuber species. FEMS Microbiology letters, 189: 265-269.
Amicucci A., Zambonelli A., Giomaro G., Potenza L., Stocchi V. 1998 . Identification of
ectomycorrhizal fungi of the genus Tuber by species-specific ITS primers. Molecular
Ecology, 7: 273–277.
Amicucci A., Zambonelli A., Guidi C., Stocchi V. 2001. Morphological and molecular
charaterization of Pulvinula constellatio ecyomycorrhizae. FEMS Microbiology letters, 194:
121-125.
Amicucci A., Zambonelli A., Iotti M., Polidori E., Menotta M., Saltarelli R., Potenza L.,
Stocchi V. 2010. Morphological and Molecular Modifications Induced by Different
Carbohydrate Sources in Tuber borchii. J Mol Microbiol Biotechnol, 18: 120-128
Andrade S A L., Mazzaferai P., Schiavinato M A., Silveira A P D. 2009. Arbuscular
mycorrhizal association in coffee. Journal of Agricultural Science, 147: 105–115.
Azcón R., Gomez M., Tobar R. 1996. Physiological and nutritional responses by Lactuca
sativa L. to nitrogen sources and mycorrhizal fungi under drought conditions. Biol. Fert.
Soils, 22: 156–161.
Azcon-Aguilar C., Barea J M. 1996 . Arbuscular mycorrhizas and biological control of
soil-borne fungi: an overview of the mechanisms involved. Mycorrhiza 6: 457-464.
Barbieri E., Ceccaroli P., Saltarelli R., Guidi C., Potenza L., Basaglia M., Fontana F.,
Baldan E., Casella S., Ryahi O., Zambonelli A., Stocchi V. 2010. New evidence for
nitrogen fixation within the Italian white truffle Tuber magnatum. Fungal Biol 114:936–942.
Bécard G., Douds, D D., Pfeffer P E. 1992. Extensive In vitro growth of vesiculararbuscular mycorrhizal fungi in the presence of CO2 and flavonols. Appl. Environ.
MicrobioI. 58:821-825.
Bécard G., Piché Y., 1990. Physiological factors determining vesicular-arbuscular
mycorrhizal formation in host and nonhost Ri T-DNA transformed roots. Can. J. Bot.
68:1260-1264.
Becard G., Taylor L.P., Douds D D Jr., Pfeffer P E., Doner L W. 1995. Flovonoids are
not necessary plant signal compounds in arbuscular mycorrhizal symbioses. Mol. PlantMicrobe Interact, 8: 252-258.
116
Bedini S., Pellegrino E., Argese E., Giovannetti M. 2004 . Miglioramento del suolo e
biostabilizzazione di metalli pesanti mediati da glomalina.14th Meeting of the Italian Society
of Ecology, 4-6 October 2004, Siena.
Bencivenga M., Di Massimo G., Donnini D., Baciarelli F L. 2009. The cultivation of
Truffles in Italy. Acta Botanica Yunnanica. Suppl. ⅩⅥ - 021- 08.
Bencivenga M., Tanfulli M., Donni D. 1997. Micorrizazione di Quercus Cerris L. con
Tuber oligospermum (Tul. et Tul.) Trappe. Mic. Ital, 3: 89 – 93.
Berbee M L., Taylor J W. 1993. Dating the evolutionary radation of the true fungi. In
Canadian Journal of Botany. 71:1114-1127.
Bonfante P. 2001. At the interface between mycorrhizalfunghi and plants: The structural
organization of cell wall, plasma membrane and cytoskeleton. In the Mycota IX Fungal
Associations. Ed. B Hock, Sprinter Verlag, Berlin. Germany. 45-61.
Bonuso E., Iotti M., Macri A., Zambonelli A. 2006. Approccio innovativo per
l'identificazione molecolare di funghi filamentosi. Micologia Italiana, n. 3.
Bonuso E., Zambonelli A., Bergemann S., Iotti M., Garbelotto M. 2010. Multilocus
phylogenetic and coalescent analyses identify two cryptic species in the Italian bianchetto
truffle, Tuber borchii Vittad. Conserv Genet ,11:1453–1466.
Buee M., Martin F. 2009. Method for obtaining Tuber magnatum mycelium and mycelium
obtained by means of the method. Pub. No.: WO/2009/136049 International Application No:
PCT/FR2009/050582 [http://www.wipo.int/ patentscope/search/en/WO2009136049].
Buee M., Rossignol M., Jauneau A., Ranjeva R., Becard G. 2000 . The presymbiotic
growth of arbuscular mycorrhizal fungi is induced by a branching factor partially purified
from plant root exudates. Molec Plant Microbe Interact 13:693–698.
Buscot F., Munch J C., Charcosset J Y., Gardes M., Nehls U., Hampp R. 2000. Recent
advances in exploring physiology and biodiversity of ectomycorrhizas highlight the
functioning of these symbioses in ecosystems. FEMS Microbiol. 24: 601-614
Cassidy J R., Moore D., Lu B C., Pukkila P J. 1984. Unusualorganization and lack of
recombination in the ribosomal RNA genes of Coprinuscinereus. CurrentGenetics, 8: 607613.
Ceccaroli P., Buffalini M., Saltarelli R., Barbieri E., Polidori E., Ottonello S., Kohler A.,
Tisserant E., Martin F., Stocchi V. 2011. Genomic profiling of carbohydrate metabolism in
the ectomycorrhizal fungus Tuber melanosporum. New Phytologist. 189: 751-764.
Chabot S., Bel-Rhlid R., Chénevert R., Piché Y. 1992. Hyphal growth promotion in vitro
of the VA mycorrhizal fungus Gigaspora margarita by the activity of structurally specific
flavonoid compounds under COe enriched conditions. NewPhytol. 122:461-467.
117
Chatin G A., 1892. La truffe: botanique de la truffe et des plantes truffiaeres-sol-climat-pays
producteurs-conserves-prâeparations culinaires. Baillière, Paris.
Chetverikova E P. 2009. The Problem of Stability of Organisms after Cryopreservation
(Fungi as Example) Biophysics. 54: 626–630
Chevalier G., GRENTE J., Poollaksek A. 1973. Obtention de mycorhizes de différents Tuber
par synthèse à partir de spores en conditions gnotoxéniques et à partir de cultures pures du
mycélium an conditions axéniques et gnotoxéniques. Ann Phytopatho, l5: 107-108.
Chevalier G. 1973 . Synthèse axénique des mycorhizes de Tuber brumaleVitt. a partir de
cultures pures du champignon. Ann Phytopathol5: 163-182.
Ciccarelli A. 1564. Opusculum de Tuberibus.
Coleman M D., Bledsoe C., Smit B A. 1990. Root hydraulic conductivity and xylem
saplevel of zeating riboside and abscisic acid in ectomicorrhiza Douglas fir seedling. New
Phytol. 115 : 275 – 284.
Corbery Y., Le Tacon F. 1997. Storage of ectomycorrhizal fungi by freezing. Annales de
Sciences forestières 54 : 211-217.
Corpet F. 1988. “Multiple sequence alignment with hierarchical clustering" Nucl. Acids
Res., 16 (22), 10881-10890.
Coughlan AP., Piche Y. 2005. Cistus incanus root organ cultures: a valuable tool for
studying mycorrhizal associations. In: Declerck S, Strullu DG, Fortin JA (eds) In vitro
culture of mycorrhizas. Soil biology series. Springer, Berlin, 235–252.
Dalpé Y. 2005. Les mycorhizes : un outil de protection des plantes mais non une panacée.
Phytoprotection, 86: 53-59.
Damm U., Woudenberg J H C., Cannon P F., Crous P W. 2009. Colletotrichum species
with curved conidia from herbaceous hosts. Fungal Diversity 39: 45–87.
Danell E., Flygh G. 2002. Cryopreservation of the ectomycorrhizal mushroom Cantharellus
cibarius, Mycological Research 106: 1340–1342.
De Borsch. 1780. Lettres sur les truffes du piémont, Milan. 51p.
Dechamplain N., Gosselin L. 2002. Les champignons mycorhiziens (PISTES) (CRBF)
/Université Laval.
Dehne H W. 1982. Interaction between vesicular–arbuscular mycorrhizal fungi and plant
pathogens. Phytopathology 72:1115–1119.
Dereuddre J., Gazeau C. 1992. Les végétaux et les très basses températures, Les végétaux
et le Froid, Ed Herman. 107-175
118
Dixon R K., Buschena C A. 1988. Response of ectomycorrhizal Pinus banksiana and
Picea glauca to heavy metals in soil. Plant Soil, 105: 265-271
Douet J P., Castroviejo M., Mabru D., Chevalier G., Dupre C., Bergougnoux F.,
Ricard J M., Medina B. 2004. Rapid molecular typing of Tuber melanosporum, T.
brumale and T. indicum from tree seedlings and canned truffles. Analytical and Bioanalytical
Chemistry 379: 668-673.
Fontana A. 1971. Il micelio di Tuber melanosporum Vittd. In coltura pura. Allionia 17: 19 –
23.
Fracchia S., Sampedro I., Scervino J M., Garcia-Romera I., Ocampo J A., Godeas A.
2004. Influence of saprobe funghi and their exudates on arbuscular mycorrhizal symbioses.
Symbiosis, 36: 169-182
Francolini F. 1931. Tartufi coltura e rimboschimenti. Federazione italiana dei consorzi
agrari, Piacenza.
Frank A B. 1885. Ueber die auf Wurzelsymbiose beruhende Ernährung gewisser Bäume
durch unterirdische Pilze. Berichte der deutschen botanischen Gesellschaft 3: 128–145.
Frey-Klett P., Chavatte M., Clausse M L., Courrier S., Le Roux C., Raaijmakers J.,
Martinotti M G., Pierrat J C., Garbaye J. 2005. Ectomycorrhizal symbiosis affects
functional diversity of rhizospherefluorescent pseudomonads. New Phytologist 165: 317–
328.
Frey-Klett P., Pierrot J G., Garbaye J. 1997. Location and survival of mycorrhiza helper
Pseudomonas fluorescens during establishment of ectomycorrhizal symbiosis between
Laccaria bicolor and Douglas Fir. Applied and environmental Microbiology, 63: 139-144.
Garcia-Montero L G., Dfaz P., Di Massimo G., Garcia-Abril A. 2010. A review of
research on Chinese Tuber species, Mycological Progress 9: 315-335.
Gardes M., Bruns T D. 1993. ITS primers with enhanced specificity for basidiomycetes –
application to the identification of mycorrhizae and rusts. Molecular Ecology, 2: 113–118
Gibelli G. 1879. “La malattia del Castagno”. Bollettino Comizio Agrario Modena.
Gibelli G. 1883. “Nuovi studi sulla malattia del castagno detta dell’inchiostro”. Memorie
Acc. Sc. Bologna, 4: 287-314.
Giltrap N J. 1981. Formation of primordia and immature fruiting bodies by edomycorrhizal
fungi in culture. Transactions of the British Mycological Society 77:204-205.
Giomaro G., Zambonelli A., Sisti D., Cecchini M., Evangelista V., Stocchi V. 2000.
Anatomical and morphological characterization of mycorrhizas of five different strains of
Tuber borchiiVittad. Mycorrhiza 10: 107 – 114.
Graham J H. 1986. Citrus mycorrhizae: potentialbenefits and interactions withpathogens.
HortScience 21: 1302-1306.
119
Gregori G L. 2002. Problems and expectations with the cultivation of Tuber magnatum. In:
Hall, I.R., Wang, Y., Danell, E., Zambonelli, A., eds. Edible Mycorrhizal Mushrooms and
Their Cultivation: Proceedings of the Second International Conference on Edible
Mycorrhizal Mushrooms. Christchurch, New Zealand, 3–5 July 2001, CD-ROM.
Christchurch, New Zealand, Institute for Crop and Food Research Limited.
Grove T S., Le Tacon. 1993. Mycorrhiza in planctation forestry.In Advances Plant
Pathology.9 :191-227.
Guehl J M., Garbaye J., Wartinger A M. 1992 . The effectes of ectomycorrhizal status on
plant-water relations and sensitivity of leads gas exchange to soil drought in Doglas fir (
Pseudosuga menziesii) seedling. In: Read, D J., Lewis D H., Fitter A H., Alexander I J.
(Eds), Mycorrhizas in Ecosystems. CAB International, UK, PP. 323-332.
Hacskaylo E. 1973. Carbohydrate physiology of ectomycorrhizae. In: Ectomycorrhizae:
their Ecology and physiology (ed. G. C. Marks and T. T. Kozlowski), Academic Press, New
York and London: 207 - 230.
Hall I R., Brown G T., Zambonelli A. 2007. Taming the Truffle: The History, Lore and
Science of the Ultimate Mushroom. Timber Press, Portland.
Hall I R., Zambonelli A. 2012. The cultivation of mycorrhizal mushrooms - still the next
frontier! In: J. Zhang, H Wang & M Chen (Eds). Mushroom Science XVIII. Beijing, China
Agricultural Press. Pp 16-27.
Hall IR., Haslam W. 2013. Truffle cultivation in the southern hemisphere. In: Edible
Ectomycorrhizal Mushrooms, Zambonelli A. and Bonito G.M. (eds.), Soil Biology 34.
Springer-Verlag Berlin Heidelberg. DOI10.1007/978-3-642-33823-6-11.
Hall J L. 2002 . Cellular mechanism for heavy metal detoxification and tolerance. Journal
of experimental botany 53: 111.
Hansen K., Pfister D H. 2006. Systematics of the Pezizomycetes – the operculate
discomycetes. Micologia, 98: 1029 – 1040.
Hawksworth D L. 1991. The fungal dimension of biodiversity: Magnitude, significance,
and conservation. Mycol. Res. 95:641-655.
Hawksworth D L. 1993. The tropical fungal biota: Census, pertinence, prophylaxis, and
prognosis. Pages 265-293 in: Aspects of Tropical Mycology. S. Isaac, J. S. Frankland, R.
Watling, and A. J. S. Whalley, eds. Cambridge University Press, Cambridge.
Hawksworth D L., Rossman A Y. 1997. Where are all the undescribed fungi?
.Phytopathology 87:888-891.
Hazan I, Liu H. 2002. Hyphal tip-associated localization of Cdc42 is Factin dependent in
Candida albicans. Euk Cell, 1:856-864
Heywood V H. 1995.Global Biodiversity Assessment. Cambridge University Press,
Cambridge.
120
Hibbett D S., Binder M., Bischoff J F., Blackwell M., Cannon P F, Eriksson O E.,
Huhndorf S., James T., Kirk P M., Luecking R., et al. 2007. A higher-level phylogenetic
classification of the Fungi. Mycological Research.111:509–547.
Hiltner L. 1904. UberneueErfahrangen und Probleme auf demGebiet der
Bodenbakteriologie und unterbeson- deresBerucksichtgung der Grundungen und Brauche.
ARLDtschLasdwrtGesBerl 98: 59-78.
Hodge A. 2000. Microbial ecology of the arbuscular mycorrhiza, FEMS Microbiology
Ecology 32.
Hodge A., Robinson D., Fitter A H. 2000. An arbuscular mycorrhizal inoculum enhances
root proliferation in, but not nitrogen capture from, nutrient-rich patches in the soil. New
Phytologist 145: 575–584.
Homolka L., Lisà L., Eichlerovà I., Nerud F. 2001. Cryopreservation of basidiomycete
strains using perlite. Journal of Microbiological Methods 47: 307-313.
Hwang S W. 1960. Effects of ultra-low temperatures on the viability of selected fungus
strains. Mycologia 52: 527–529.
Hyde K D., Bahkali A H., Moslem M A. 2010. Fungi – an unusual source of cosmetics.
Fungal Diversity 43: 1–9.
Iotti M. 2002. Rapporti fra funghi ectomicorrizici, pianta ospite ed ambiente. Tesi di
dottorato in Patologia Vegetale – XIV°. Università degli studi di Bologna.
lotti M., Amicucci A., Stocchi V., Zambonelli A. 2002. Morphological and molecular
characterization of mycelia of some Tuber species in pure culture. New Phytologist 155:
499-505.
Iotti M., Zambonelli A . 2006. A quick and precise technique for identifying
ectomycorrhizas by PCR. Mycol Res 110: 60–65.
Iotti M., Leopardi M., Oddis M., Salerni E., Baraldi E., Zambonelli A. 2012.
Development and validation of a real-time PCR assay for detection and quantification of
Tuber magnatum in soil. BMC Microbiology, 12:93
Jennings D.H., Lysek G. 1996. Fungal biology: understanding the fungal lifestyle. (Bios
Scientific publishers eds).
Karwa A., Varma A., Rai M. 2011. Edible ectomycorrhizal fungi: cultivation, conservation
and challenges.In: Ray M, Varma A (eds), Soil biology 25: Diversity and Biotechnology of
Ectomycorrhizae. Springer, Berlin Heidelberg, pp. 429-453.
Kitamoto Y., Suzuki A., Shimada S.,Yamanaka K. 2002. A new method for the
preservation of fungus stock cultures by deep-freezing. Mycoscience, 43: 143–149.
Lamhamedi M S., Bernier PY., Fortin J A. 1992. Growth, nutrition and response to water
121
stress of Pinus pinaster inoculated with ten dikaryotic strains of Pisolithussp. Tree Physiol.
10: 153-167.
Lefevre C. 2013. Native and cultivated truffles of north America. In: Edible
Ectomycorrhizal Mushrooms, Zambonelli A. and Bonito G.M. (eds.), Soil Biology 34.
Springer-Verlag Berlin Heidelberg. DOI10.1007/978-3-642-33823-6-12.
Leonardi M., Iotti M., Oddis M., Lalli G., Pacioni G., Leonardi P., Maccherini S.,
Perini C., Salerni E., Zambonelli A. 2013. Assessment of ectomycorrhizal fungal
communities in the natural habitats of Tuber magnatum (Ascomycota, Pezizales).
Mycorrhiza, 0474:7.
Leyval C., Turnau K., Haselwandter K. 1997. Effect of heavy metal pollution on
mycorrhizal colonization and function: physiological, ecological and applied aspects.
Mycorrhiza 7: 139-153.
Linser A., Cazzara L., Barbieri G. 2006. Rizobatteri promotori di crescita, una nuova
opportunità per l’agricoltura sostenibile. FertilitasAgrorum 1: 65-75.
Lovelock L. 1953. The mecanism of the protective action of glycerol against haemolysis by
freezing and thawing, Biochim Buiphys Acta. vol 11: 28-36
Mamoun M., Olivier J M. 1991. Effect of carbon and nitrogen sources on in vitro growth
of Tuber melanosporum Vittad. Application to mycelia biomass production. Aronomie
11:521-527.
Mannozzi Torini L. 1976. Manuale di tartufi coltura: tartufi e tartufi coltura in Italia.
Edagricole, Bologna, 1976.
Martin F., Kohler A., Murat C., Balestrini R., Coutinho PM, Jaillon O, Montanini B,
Morin E, Noel B, Percudani R, Porcel B, Rubini A, Amicucci A, Amselem J, Anthouard
V, Arcioni S, Artiguenave F, Aury JM, Ballario P, Bolchi A, Brenna A, Brun A, Buée
M, Cantarel B, Chevalier G, Couloux A, Da Silva C, Denoeud F, Duplessis S, Ghignone
S, Hilselberger B, Iotti M, Marçais B, Mello A, Miranda M, Pacioni G, Quesneville H,
Riccioni C, Ruotolo R, Splivallo R, Stocchi V, Tisserant E Viscomi AR, Zambonelli A,
Zampieri E, Henrissat B, Lebrun MH, Paolocci F, Bonfante P, Ottonello S, Wincker P.
2010. Périgord black truffle genome uncovers evolutionary origins and mechanisms of
symbiosis. Nature 464 (7291):1033-8.
Martin F., Tagu D. 1999. Developmental biology of a Plant-Fungus Symbiosis: the
Ectomycorrhiza. In Mycorrhiza. Structure, function, molecular biology and
biotechnology.Varma, A., and Hock, B. (eds.) Heidelebrg: Springer-Verlag, pp. 51-73.
Marx D H., Daniel W J. 1976. Maintaining cultures of ectomycorrhizal and plant
pathogenic fungi in sterile water cold storage. Canadian Journal of Microbiology 22:338–
341.
Mattirolo o. 1928. La tartufi cultura e il rimboschimento. Tipo-lito L. Checchini.
Mazliak P. 1999. Les effets du froid sur les biomembranes, dans les végétaux et le froid, Ed
herman., p 3-26
122
Melin E., Nilsson H. 1952. Transport of labelled nitrogen from an ammonium source to
pine seedlings through mycorrhizal mycelium.SvenskBotaniskTidskrift 46, 281-285.
Melin E., Nilsson H. 1953. Transfer of labelled nitrogen from glutamic acid to pine
seedlings through the mycelium of Boletus variegatus (S.W.) Fr.Nature 171, 434.
Melin E., Nilsson H. 1958. Translocation of nutrient elements through mycorrhizal
mycelium to pine seedlings. Botaniska Notiser 111, 251-256.
Mello A., Fontana A., Meotto F., Comandini O., Bonfante P. 2001. Molecular and
morphological characterization of Tuber magnatum mycorrhizas in a long-term survey.
Microbiol Res, 155:279–284.
Mello A., Vizzini A., Longato S., Rollo F., Bonfante P et Trappe J M. 2000. Tuber
borchii versus Tuber maculatum: neotype studies and Dna analyses. Mycologia 92: 326-331.
Menotta M., Amicucci A.,Basili G., Polidori E., Stocchi V., Rivero F. 2008. Molecular
and functional characterization of a Rho GDP dissociation inhibitor in the filamentous
fungus Tuber borchii BMC Microbiology, 8:5
Menotta M., Amicucci A., Sisti D., Gioacchini A.M., Stocchi V. 2004. Differential gene
expression during pre-symbiotic interaction betwen Tuber borchii Vittad. and Tilia
americana L. Curr Genet, 46: 158–165.
Menotta M., Amicucci A., Basili G., Rivero F., Polidori E., Sisti D., Stocchi V. 2007 .
Molecular characterisation of the small GTPase CDC42 in the ectomycorrhizal fungus Tuber
borchii Vittad. Protoplasma, 231:227-237.
Meyer F H. 1973. Distribution of ectomycorrhizae in native and man-made forests. In:
Marks, G.C. and Kozlowski, T.T., (Eds.) Ectomycorrhizae.
Mischiati P., Fontana A. 1993, In vitro culture of Tuber magnatum mycelium isolated from
mycorrhizas. Mycological Research, 97: 40-44.
Moigno M. 1856. Analyses pupliées dans le cosmos et reproduite dans les annales
Forestières (n° 11 novembre 1856
Molina R. 1994. The Role of Mycorrhizal Symbioses in the Health of Giant Redwoods and
Other Forest Ecosystems. USDA Forest Service Gen. Tech. Rep.PSW-151.
Molina R., Massicotte H., Trappe J M. 1992. specificity phenomena in mycorrhizal
symbiosis community-ecological consequences and practical implications. In Mycorrhizal
Functioning, ed. M.F. Allen.Chapman and hall, London, UK. 357-423.
Morte A., Lovisolo C., Schubert A. 2000. Effect of drought stress on growth and water
relations of the mycorrhizal association Helianthemum almeriense-Terfezia claveryi.
Mycorrhiza 10 : 115–119
123
Morandi D. 1996. Occurrence of phytoalexins and phenolic compounds in endomycorrhizal
interactions, and their potential role in biological control. Plant and Soil. 185, 241-251.
Murat C., Vizzini A., Bonfante P., Mello A. 2005 . Morphological and molecular typing of
the below-ground fungal community in a natural Tuber magnatum truffle-ground. FEMS
Microbiol Lett 245: 307-313.
Murat C., Zampieri E., Vizzini A., Bonfante P. 2008. Is the Perigord black truffle
threatened by an invasive species? We dreaded it and it has happened!. New Phytologist
178: 699-702.
Nagahashi G., Douds DD Jr. 2000. Partial separation of root exudate components and their
effects upon the growth of germinated spores of AM fungi. Mycol Res 104:1453-1464.
Nagai T., Ideno A., Tsuge M., Oyanagi C., Oniki M., Kita K., Horita M., Aoki T.,
Kobayashi T., Tsuchiya K. 2000. Preservation of fungi in an atmosphere over liquid
nitrogen after uncontrolled freezing. Microbiol. Cult. Coll., 16: 13–22.
Nakasone K K., Peterson S W., Jong S C. 2004. Preservation anddistribution fungal
cultures. In: Mueller GM, Bills GF & Foster MS (eds.). Biodiversity of Fungi, pp. 37-47.
Amsterdam: Elsevier Academic Press.
Nehls U. 2008. Mastering ectomycorrhizal symbiosis the impact of carbohydrates. J Exp
Bot. 59:1097-1108.
Obase K., Lee S Y., Chun K W., Lee J K. 2011. Regeneration of ectomycorrhizal fungal
isolates following deep freezer storage. Mycobiology 39: 133-136.
Pacioni G. 2012. Effeto del diradamento selettivo della copertura vegetale. In progetto
magnatum: Montoraggio delle Attività di Gestione delle tartufaie Naturali di Tuber
magnatum .
Pacioni, G. 1986. La culture des truffes. Vecchi Ed, PARIS, 125 p.
Palmer J G., Hasckaylo E. 1970. Ectomycorrhizal fungi in pure culture, I. Growth on
single carbon sources. Physiol Plantarum. 23:1187-1197.
Parguey Leduc A., Montant C., Kulifaj M. 1984. “Structure et evolution de l’Ascocarpe
du Tuber melanosporum (Vitt.) “ . C.R.Ac. Sc. Paris Tome 299: 315-320.
Pegler D N., Spooner B M., Young T W K. 1993. British truffles. A revision of British
hypogeous fungi. Royal Botanic Gardens, Kew press.
Percudani R., Trevisi A., Zambonelli A., Ottonello S. 1999. Molecular phylogeny of
truffles ( Pezizales: Terfeziaceae, Tuberaceae) derived from nuclear rDNA sequence
analysis. Mol. Phylogenet. Evol, 1: 169 – 180.
Perrin R. 1985. L’aptitude des mycorhizes à proteger les plantes contre les maladies:
panacéeou chimère?.Ann. Sc. For., 42(4): 453-470.
Pico V. 1788. "Melethemata inauguralia" (Torino).
124
Piculell B., Hoeksema J., Thompson J. 2008. Interactions of biotic and abiotic
environmental factors in an ectomycorrhizal symbiosis, and the potential for selection
mosaics, BMC Biology, 6:23.
Pinochet J., Calvet C., Campruby A., Fernandez C. 1996 . Interactions between
migratory endoparasitic nematodes and arbuscular mycorrhizal fungi in perennial crops: a
review. Plant Soil 185 : 183–190.
Plassard C., Bonafos B., Touraine B. 2000. Differential effects of mineral and organic N
sources, and of ectomycorrhizal infection by Hebeloma cylindrosporum, on growth and N
utilization in Pinus pinaster, Plant Cell and Environment 23:1195-1205.
Podila G K., Zheng J., Balasubramanian S., Sundaram S., Hiremath S., Brand JH.,
Hymes MJ. 2002 . Fungal gene expression in early symbiotic interaction between Laccaria
bicolor and red pine. Plant Soil, 244:117-128.
Pozo M J., Azcón-Aguilar C. 2007. Un raveling mycorrhiza-induced resistance. Current
Opinion in Plant Biology, 10: 393–398.
Read D J. 1999. Mycorrhiza-the state of the art. In: Mycorrhiza, Varma A, Hock B,
Springer Verlag, Eds, Berlin, Germany, p. 3-34.
Redecker D. 2002. New views on fungal evolution based on DNA markers and the fossil.
Research in Microbiology. 153: 125-130.
Repa´cˇ I. 2011. Ectomycorrhizal inoculum and inoculation techniques. In: Rai R, Varma A
(eds) Diversity and biotechnology of ectomycorrhizae. Soil biology series. Springer, Berlin,
pp 43-63.
Richter D L. 2008. Revival of saprotrophic and mycorrhizal basidiomycete cultures after 20
years in cold storage in sterile water. Can J Microbiol 54: 595-599.
Riousset G., Riousset L., Chevalier G., Bardet M C. 2001. Truffe d’Europe et de la chine.
INRA Paris.
Robert D., Roland J C. 1989. Biologie Végétale – caractéristiques et stratégie évolutive des
plantes, 1989
Romanazzi 1 G., Musetti R., Marzachì C., Casati P. 2009. Induction of resistance in the
control of phytoplasma diseases. Petria 19 :113-129.
Grove T S., Le Tacon. 1993. Mycorrhiza in planctation forestry.In Advances Plant
Pathology.9 :191-227.
Rubini A., Paolocci F., Granetti B., Arcioni S. 2001. Morphological characterization of
molecular-typed Tuber magnatum ectomycorrhizae. Mycorrhiza, 11:179–185.
Sbrana C., Bagnoli G., Bedini S., Filippi M., Giovanetti M., Nuti M P. 2000. Adhesion to
hyphal matrix and antifungal activity of pseudomonas strains isolated from Tuber borchii
asocarps. Canadian journal of microbiology, 46: 259 - 268.
125
Selegean M. 2009. Study of different growth parameters in T.brumale.Ser. Biology, XII.
31-34.
Selosse M A. 2000. La Symbiose : structure et fonctions, rôle écologique et évolutif .
Vuibert, Paris.
Selosse M A., Bauer R., Moyersoen B. 2002. Basal hymenomycetes belonging to the
Sebacinaceae are ectomycorrhizal on temperate deciduous trees. New Phytologist 155: 183–
195.
Selosse M A., Le Tacon F. 1998 . The land flora: A phototroph – fungus partnership?
Trends in ecology and evolution 13: 15-20.
Singer R., Harris B. 1987. Mushrooms and Truffles: Botany, Cultivation and Utilization.
Koeltz, Koenigstein, Germany.
Sisti D., Giomaro G., Zambonelli A., Rossi I., Ceccaroli P., Citterio B., Stocchi V.,
Benedetti PA. 1998. In vitro mycorrhizal synthesis of micropropagated Tilia platyphyllos
Scop. plantlets with Tuber borchii Vittad. mycelium in pure culture. Acta Horticulturae 457:
379–387.
Sisti D., Mattucci M., Giovanna G. 2007. Effet of some substances produced in the presimbiontic phase on the morphology of Tuber borchii Vittad. Mycelium. Caryologia, 60:
196-198.
Smith D. 1998. The use of cryopreservation in the ex-situ conservation of fungi. CryoLetters
19: 79-90.
Smith S E., Read D J. 1997. Mycorrhizal Symbiosis (second edition).Academic Press, San
Diego, London, Boston, New York, Sydney, Tokyo, Toronto.
Sun S., Wang J., Zhu L., Liao D., Gu M., Ren L., Kapulnik Y., Xu G. 2012. An Active
Factor from Tomato Root Exudates Plays an Important Role in Efficient Establishment of
Mycorrhizal Symbiosis. Mycorrhizal Symbiosis. 7(8): 43385.
Tan C S., van Ingen C W. 2004. Preservation of Fungi and Yeasts. In: Fuller B, Lane N
and Benson E. (eds), Life in the Frozen state. CRC Press, Boca Raton, pp. 277-297.
Thomson B D., Malajczuk N., Grove T S., Hardy G E St J. 1993. Improving the
colonization capacity and effectiveness of ectomycorrhizal fungal cultures by association
with a host plant and re-isolation. Mycological research 97: 839-844.
Tibiletti E., Zambonelli A. 2000.
Bologna.
I Tartufi della provincia di Forlì-Cesena, Patron,
Toljander J F, Paul L, Lindahl B D, Elfstrand M, Finlay R D. 2007. Influence of AM
fungal exudates on bacterial community structure. FEMS Microbiology Ecology 61: 295304.
Trappe J M., Molina R., Luoma D L., Cázares C., Pilz D., Smith J E., Castellano M
A., Miller M L., Trappe M. 2009. Diversity, ecology and conservation of truffle fungi in
126
forests of the Pacific Northwest. USDA Forest Service, Pacific Northwest Research Station
Geneneral Technical.Report-GTR-772, Portland, OR. 195 pp.
Trappe J M. 1979. The orders , families and genera of hypogeousAscomycotina (truffles
and their relatives). Mycotaxon 9: 297- 340.
Trinci A P J. 1973. a study of the Kinetics of Hyphal Extension and Branch Initiation of
Fungal Mycelia. Journal of General Microbiology 81: 225-236
Tsai S M., Phillips D A. 1991. Flavonoids released naturally from alfalfa promote
development of symbiotic Glomus spores in vitro. Appl. Environm. Microbiol, 57: 14851488.
Turnau K., Kottke I., Dexheimer J. 1996. Toxic element filtering in Rhizopogon roseolus
/Pinus Sylvestri smycorrhizas collected from calamine dumps. Mycol Res 100: 16-22.
Uemura M., Steponkus P L. 1999. Cold acclimation in plants : relationship between the
lipid composition and the cryostability of the plasma membrane, J.Plant Res. 112: 245-254
Vierheilig H., Bago B., Albrecht C., Poulin M J., Piche Y. 1998. Flavonoids and
arbuscular mycorrhizal fungi. Flavonoids in the Living System. 439, 9-33.
Vittadini C. 1800-1865. Monogr. Tuber. [8J, 1-88. pl. 1-5. 1831.-Monographia
Tuberacearum.
Vittadini C. 1831. Monographia Tuberacearum. Ed. Felicis Rusconi; Milano: 88 pag.
Vogt K A., Publicover D A., Vogt D J. 1991. A critique of the role of ectomycorrhizas in
forest ecology. Agriculture, Ecosystems and Environment 35: 171 - 190
Vogt K A., Edmonds R L., Grier C C. 1981. Biomass and nutrient concentrations of
sporocarps produced by mycorrhizal and decomposer fungi in Abiesamabilis stands,
Oecologia 50: 170-175.
Wang X. 2013. Truffle cultivation in China. In: Edible Ectomycorrhizal Mushrooms,
Zambonelli A. and Bonito G.M. (eds.), Soil Biology 34. Springer-Verlag Berlin Heidelberg.
DOI10.1007/978-3-642-33823-6-13.
Whipps J M. 2004. Prospect and limitations for mycorrhizas in biocontrol of root
phatogens. Canadian Journal of Botany, 82: 1198-1227.
White T J., Bruns T D., Lee S B., Taylor J W. 1990. Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In Innis M.A., Gelfand D.H., Sninshy
J.J., White T.D. (Eds), PCR protocols: a guide to methods and Applications. Academic
press, London, 315-322.
Wilcox H E. 1991. Mycorrhizae. In Plant roots: the hidden half. Waisel Y, E.A., Kafkafi U,
Marcel Dekker (ed.) New York, 731-765.
Wolfe J., Bryant G. 1999. Freezing, drying, and/or vitrification of membrane-solute-water
systems, Cryobiology. 39: 103-129
127
Xiao J H., Chen D X., Liu J W., Liu Z L., Wan W H., Fang N., Xiao Y., Qi1 Y., Liang
Z Q. 2004. Optimization of submerged culture requirements for the production of mycelial
growth and exopolysaccharide by Cordyceps jiangxiensis JXPJ 0109.
Zacchi L., Vaughan-Martini A., Angelici P. 2003. Yeast distribution in a truffle-field
ecosystem. Ann Microbiol 53: 275–282.
Zambonelli A., Iotti M. 2005. Appennino modenese. Terre Da Tartufo. Giorgio Mondadori,
Milano.
Zambonelli A., Iotti M., Amicucci A., Pisi A. 1999. Caratterizzazione anato-momorfologica delle micorrize di Tuber maculatum Vittad. su Ostrya carpinifolia Scop.
Micologia Italiana 3: 29-35.
Zambonelli A., Iotti M., Rossi I., Hall I. 2000. Interactions between Tuber borchii and
other ectomycorrhizal fungi in a field plantation. Mycol. Res. 104: 698-702.
Zambonelli A., Iotti M. 2006. The pure culture of Tuber mycelia and their use in the
cultivation of the truffles.In KABAR, L. (Ed.) Actes du primier Symposium sur les
Champignons hypogés du Bassin Méditerranéen, 6-8 aprile 2004. Rabat, Maroc, pp. 244255.
Zambonelli A., Pisi A., Tibiletti A. 1997. Caratterizzazione anatomo-morfolo-gica delle
micorrize di Tuber indicum Cooke & Masee su Pinus pinea L. e Quercus cerris L. Micologia
Italiana, 1: 29-36.
Zambonelli A., Salomoni S., Pisi A. 1993. Caratterizzazione anatomomorfologica delle
micorrize di Tuber spp, su Quercus pubescens Wild. Micol, Ital, 22: 73-90.
Zampieri E., Murat C., Cagnasso M., Bonfante P., Mello A. 2010. Soil analysis reveals
the presence of an extended mycelial network in a Tuber magnatum truffle ground. FEMS
Microbiol Ecol, 71:43-49.
.
128
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising