fornari francesca tesi

fornari francesca tesi
Alma Mater Studiorum – Università di Bologna
DOTTORATO DI RICERCA IN
BIOLOGIA FUNZIONALE DEI SISTEMI CELLULARI E
MOLECOLARI
Ciclo XXII
Settore scientifico disciplinare di afferenza: BIO/11
STUDIO DEI PROFILI DI ESPRESSIONE DEI MICRORNA
NELL’EPATOCARCINOMA UMANO
Presentata da:
Dr.ssa Francesca Fornari
Coordinatore Dottorato
Relatore
Prof. Vincenzo Scarlato
Prof. Giovanni Capranico
Correlatore
Prof. Luigi Bolondi
Esame finale anno 2009
INDICE
1
CAPITOLO 1: INTRODUZIONE ..........................................7
1.1
Il carcinoma epatocellulare...................................................................... 8
1.1.1
Classificazione molecolare del carcinoma epatocellulare ........................ 13
1.2
I microRNA ............................................................................................. 17
1.2.1
Biogenesi e ruolo biologico dei microRNA.............................................. 19
1.2.2
MicroRNA e cancro .................................................................................. 23
1.2.3
MicroRNA ed epatocarcinoma ................................................................. 27
1.2.4
MicroRNA e clinica: diagnosi, prognosi e nuovi trattamenti ................... 32
1.3
SCOPO DELLA RICERCA DI TESI.................................................... 37
CAPITOLO 2: MATERIALI E METODI...........................38
2.1
Raccolta di campioni di pazienti con epatocarcinoma ........................ 39
2.2
Microarray di microRNA....................................................................... 39
2.3
Northern blot........................................................................................... 41
2.4
Colture cellulari ...................................................................................... 46
2.5
Trasfezione cellulare............................................................................... 48
2.6
Preparazione di estratti proteici da linee cellulari e tessuti ................ 50
2.7
Dosaggio di estratti proteici tramite Lowry assay (Kit Biorad) ......... 51
2
2.8
Western blot ............................................................................................ 52
2.9
Estrazione di RNA da linee cellulari e tessuti ...................................... 55
2.10
Real time PCR ......................................................................................... 56
2.11
Trascrizione inversa................................................................................ 59
2.12
PCR semi-quantitativa ........................................................................... 61
2.13
Clonaggi .................................................................................................. 63
2.14
Saggio di luciferasi ................................................................................. 73
2.15
Citofluorimetria a flusso........................................................................ 74
2.16
Saggio di invasione cellulare ................................................................. 76
CAPITOLO 3: RISULTATI..................................................78
3.1
Individuazione
di
un
pannello
di
microRNA
deregolati
nell’epatocarcinoma umano tramite analisi di microarray ................ 79
3.1.1 Validazione dell’analisi di microarray tramite Northern blot.................... 83
3.1.2 Validazione dell’analisi di microarray tramite Real time PCR ................. 85
3.2
Studio del ruolo biologico del microRNA-122: regolazione della ciclina
G1 in linee cellulari di epatocarcinoma ................................................ 86
3.2.1
Il microRNA-122 regola l’espressione e la stabilità di p53 attraverso la
modulazione di ciclina G1 ........................................................................ 92
3
3.2.2
Il microRNA-122 e la ciclina G1 regolano il ciclo cellulare e l’invasione
della linea cellulare HepG2....................................................................... 98
3.2.3 Il microRNA-122 e la ciclina G1 sensibilizzano la linea cellulare HepG2 al
trattamento con Doxorubicina................................................................. 101
3.2.4 Il microRNA-122 e la ciclina G1 correlano con variabili clinico-patologiche
di pazienti con epatocarcinoma............................................................... 103
3.3
Studio del ruolo biologico del microRNA-221: regolazione di
CDKN1C/p57 e CDKN1B/p27 in linee cellulari di epatocarcinoma 107
3.3.1 Il microRNA-221 regola il ciclo cellulare e la crescita in linee cellulari di
epatocarcinoma ....................................................................................... 113
3.3.2 Correlazione inversa tra il microRNA-221 e i due target molecolari in
pazienti con epatocarcinoma................................................................... 115
3.3.3
Il microRNA-221 regola l’espressione di Bmf in linee cellulari di
epatocarcinoma ....................................................................................... 118
3.3.4
Il microRNA-221 è sovra-espresso in condizioni di non-adesione alla
matrice extra-cellulare e induce apoptosi tramite l’inibizione di Bmf ... 122
3.3.5
Ruolo prognostico del microRNA-221: correlazione con la focalità del
tumore ed il tempo di insorgenza di recidiva epatica in pazienti
chirurgicamente trattati per epatocarcinoma........................................... 126
3.4
Studio del ruolo biologico del microRNA-199a-3p: regolazione dei
pathway molecolari di mTOR e c-Met in linee cellulari di
epatocarcinoma ..................................................................................... 132
4
3.4.1
Il microRNA-199a-3p ed i suoi bersagli molecolari regolano il ciclo
cellulare in linee cellulari di epatocarcinoma ......................................... 137
3.4.2 Il microRNA-199a-3p regola la sensibilità alla Doxorubicina, l’apoptosi in
condizioni ipossiche e le capacità invasive in linee cellulari di
epatocarcinoma ....................................................................................... 141
3.4.3 Ruolo prognostico del microRNA-199a-3p: correlazione con il tempo di
insorgenza di recidiva epatica in pazienti chirurgicamente trattati per
epatocarcinoma ....................................................................................... 144
CAPITOLO 4 ........................................................................148
4.1
L’identificazione di un pannello di microRNA rappresenta un passaggio
fondamentale per l’individuazione di nuovi bersagli terapeutici per il
trattamento non-convenzionale di pazienti con epatocarcinoma in
stadio intermedio-avanzato .................................................................. 149
4.2
La regolazione del pathway ciclina G1/p53 da parte del microRNA-122
rappresenta un possibile meccanismo molecolare implicato nel
processo di epatocarcinogenesi, in grado di sensibilizzare le cellule di
epatocarcinoma al trattamento con Doxorubicina ............................ 151
4.3
La regolazione di importanti processi cellulari da parte del microRNA221 pone le basi per lo sviluppo di un possibile approccio terapeutico
con molecole antagoniste dei microRNA per il trattamento nonconvenzionale di pazienti con epatocarcinoma in stadio intermedioavanzato ................................................................................................. 154
5
4.4
La regolazione dei pathway molecolari di mTOR e c-Met da parte del
microRNA-199a-3p rappresenta un possibile meccanismo molecolare
implicato
nel
processo
di
epatocarcinogenesi,
in
grado
di
sensibilizzare le cellule di epatocarcinoma al trattamento con
Doxorubicina ......................................................................................... 155
4.5
Prospettive future................................................................................... 157
BIBLIOGRAFIA...................................................................160
6
CAPITOLO 1
INTRODUZIONE
7
1.1 Il carcinoma epatocellulare
Il carcinoma epatocellulare (HCC) è il più frequente tumore maligno del
fegato e rappresenta il sesto tipo di tumore più comune nel mondo. Inoltre,
essendo i pazienti diagnosticati a stadi piuttosto avanzati, l’epatocarcinoma
rappresenta la terza causa di mortalità associata a tumore, con un’incidenza in
aumento (1, 2). Nei paesi occidentali, l’insorgenza di epatocarcinoma è
strettamente correlata con la presenza di cirrosi epatica e circa l’80% dei tumori
insorgono su di fegato affetto da cirrosi o da epatite cronica (3).
L’epatocarcinoma è un tumore che presenta un’eziologia molto eterogenea:
l’HCC risulta infatti associato a differenti fattori di rischio molto ben
caratterizzati. I principali fattori di rischio includono il virus dell’epatite B
(HBV), il virus dell’epatite C (HCV), l’assunzione cronica di alcol, l’esposizione
alimentare prolungata all’aflatossina B1 (AFB1) e l’emocromatosi primaria. Nel
90% dei casi di HCC, almeno uno di questi fattori di rischio può essere
identificato, da solo o in combinazione con altri, e l’associazione con i differenti
fattore di rischio varia a seconda dell’origine geografica del paziente (4).
Lo sviluppo di HCC in un fegato con una patologia cronica è un processo
multistep,
noto
come
epatocarcinogenesi,
caratterizzato
dall’accumulo
progressivo di alterazioni genetiche che possono causare crescita cellulare
aberrante,
trasformazione maligna del
parenchima cellulare epatico, e
successivamente invasione vascolare e metastasi (Figura 1). Infezioni da HBV e
HCV ed esposizione cronica ad alcol sono tra i più comuni epatocarcinogeni
nell’uomo; la loro presenza è causa di danno al DNA degli epatociti, alterato
riparo dovuto a necro-infiammazione cronica ed infine rigenerazione tissutale
8
intensiva e fibrogenesi. L’insorgenza di epatocarcinoma è spesso preceduta da
lesioni preneoplastiche, le quali includono foci e noduli displastici. I foci
displastici si suddividono in piccoli foci (SCD) caratterizzati da epatociti con un
diminuito volume citoplasmatico, polimorfismo nucleare ed aumentato rapporto
nucleo/citoplasma, e grandi foci (LSD) caratterizzati da aumentate dimensioni
cellulari e nucleari, polimorfismo nucleare con nucleoli prominenti e normale
rapporto nucleo/citoplasma. I foci SCD hanno un elevato indice proliferativo con
caratteristiche morfologiche e istologiche simili all’HCC e di frequente danno
origine a noduli displastici (DN), i qualis vengono considerati come lesioni che
precedono l’epatocarcinoma a causa della loro frequente associazione con la sua
insorgenza (5). Al contrario, i foci LCD non presentano caratteristiche comuni
all’HCC ed è controverso se si possano considerare come lesioni preneoplastiche;
sembrano piuttosto derivare da epatociti senescenti con un’alterata proliferazione
cellulare dovuta alla presenza di infiammazione e rigenerazione cronica (6).
Figura 1. Meccanimo di epatocarcinogenesi. (Figura da: Teoh, NC. JGH.
2009. 24:1817-25).
9
Poiché la cirrosi è considerata una lesione epatica preneoplastica, i pazienti
cirrotici vengono inseriti in standardizzati programmi di screening per
l’individuazione precoce di HCC; tali programmi prevedono controlli periodici
(ogni 6 mesi) attraverso esami ecografici e determinazione dei livelli sierici di
alfa-fetoproteina (AFP), un marcatore circolante di HCC (7). Gli esami ecografici
hanno un ruolo chiave nella diagnosi dell’HCC, e sempre più spesso questo
tumore viene diagnosticato quando è ancora asintomatico, in pazienti portatori di
cirrosi epatica e soggetti a controlli frequenti (8). L’uso della tomografia
computerizzata e apparecchiature per la risonanza magnetica sempre più
sofisticate hanno portato ad una maggiore sensibilità e specificità delle tecniche
diagnostiche dell’HCC. La diagnosi precoce rimane un punto chiave per
migliorare la prognosi di questo tumore. Identificare la patologia quando sono
presenti tumori ancora piccoli e asintomatici comporta infatti migliori possibilità
di trattamento. Determinare accuratamente lo stadio dell’HCC è importante per
formulare la prognosi e per decidere la terapia migliore. Fattori importanti da
considerare per il trattamento del tumore sono la grandezza, la multifocalità, la
gravità di altre patologie epatiche sottostanti e lo stato di salute generale del
paziente.
In base allo stadio al quale vengono diagnosticati, gli epatocarcinomi vengono
suddivisi in tre grandi categorie: HCC precoci, HCC intermedi-avanzati e HCC
tardivi. Da un punto di vista clinico, lo stadio del tumore considerato precoce è
caratterizzato dalla presenza di un’unica massa inferiore ai 5 cm di diametro,
oppure 3 noduli minori di 3 cm di diametro e dalla assenza di invasione vascolare
e di metastatizzazione. Questi sono i requisiti necessari per poter ricevere
trattamenti curativi con discrete possibilità di successo. I trattamenti curativi per
10
l’HCC comprendono la resezione chirurgica, l’ablazione percutanea ed il
trapianto di fegato. Perché sia possibile una resezione chirurgica il paziente deve
avere una buona funzionalità epatica; in caso questa condizione non sia
soddisfatta, il miglior trattamento per gli HCC precoci non resecabili è l’ablazione
percutanea con la quale si ottiene la necrosi del tumore tramite l’iniezione di
agenti chimici, come l’alcol o l’acido acetico, o mediante l’uso di mezzi fisici
come la radiofrequenza. Il trapianto è indicato quando le funzioni epatiche sono
danneggiate, ed il tumore non ha raggiunto i vasi sanguigni con probabilità di aver
dato metastasi extraepatiche. Teoricamente il trapianto è il miglior trattamento per
l’HCC poiché permette la rimozione, non solo del tratto epatico invaso, ma anche
del tessuto circostante che è a rischio di sviluppare un altro cancro. Purtroppo il
numero di trapianti possibili è limitato dall’alta frequenza degli HCC e dalla
mancanza di un sufficiente numero di donatori, il che allunga notevolmente i
tempi di attesa. Durante questi ritardi, la progressione del tumore spesso fa si che
si esca dai parametri richiesti per il trattamento rendendo il paziente non più
idoneo per il trapianto. Inoltre, nonostante i trattamenti curativi offrano una
probabilità di sopravvivenza a 5 anni del 50-70% (9), l’insorgenza di recidiva
epatica supera il 70% entro i 5 anni ed è causata da tumori meta-cronici che
insorgono su fegato cirrotico oppure, nel 10-15% dei casi, a siti di disseminazione
del tumore non diagnosticati dagli studi di imaging pre-operatorio (10).
In caso di HCC in stadio intermedio (tumore multi-nodulare con assenza di
invasione vascolare) la chemioembolizzazione (TACE) della massa neoplastica è
risultato da studi clinici un trattamento in grado di espandere il tempo di
sopravvivenza medio dei pazienti (da 16 a 20 mesi), ed è considerato lo standard
di cura (11). L’ostruzione dell’arteria che nutre la zona del fegato sede della
11
massa tumorale, ottenuta con l’iniezione di agenti come la gelatina, arresta il
flusso ematico nei capillari del tumore, portandolo a necrosi. L’associazione a
questi agenti con chemioterapici, quali la doxorubicina, aumenta l’azione
antitumorale.
In caso di HCC in stadio avanzato (con tumore sintomatico, o invasione
vascolare o diffusione extra-epatica), l’unico trattamento in grado di incrementare
la sopravvivenza media dei pazienti (da 7.9 a 10.7 mesi) è il trattamento con
Sorafenib (12), un multi-inbitore di tirosina cinasi, approvato nel 2006 dalla Food
and Drug Administration (FDA) come trattamento di prima linea per HCC in
stadio avanzato. Questo composto inibisce la proliferazione delle cellule
neoplastiche e l’angiogenesi tumorale in un ampio spettro di tumori. Agisce
inibendo le cinasi Raf1 e B-Raf, le cinasi dei recettori 1, 2, 3 del fattore di
accrescimento endoteliale (VEGF) e la cinasi del recettore del fattore di crescita
di origine piastrinica (PDGF). Attraverso l’inibizione di vie molecolari che
giocano un ruolo importante nella patogenesi dell’epatocarcinoma, il Sorafenib è
probabilmente in grado di ritardare la progressione tumorale portando ad un
beneficio in termini di sopravvivenza. Oltre al Sorafenib, il trattamento dell’HCC
con convenzionali agenti chemiotrapici è poco efficace e causa pesanti effetti
tossici collaterali dovuti alla funzionalità epatica compressa a causa della
sottostante patologia epatica.
La prognosi di HCC tardivi è molto infausta (3-4 mesi) ed al momento attuale
non esistono trattamenti efficaci, ma solo cure palliative (Figura 2).
A fronte della scarsa efficacia della chemioterapia sistemica degli HCC con i
farmaci attualmente a disposizione e dell’altà incidenza di recidiva epatica in
pazienti curativamente trattati per epatocarcinoma, si evidenzia l’urgenza di
12
individuare nuovi bersagli molecolari e di sviluppare nuovi trattamenti per
l’epatocarcinoma umano.
Figura 2. Trattamenti di epatocarcinomi in differenti stadi di
progressione. Per ogni stadio è indicato lo standard di cura stabilto dalle linee
guida.
1.1.1
Classificazione molecolare del carcinoma epatocellulare
Lo sviluppo di epatocarcinoma in un fegato affetto da una patologia cronica è
un processo multifattoriale caratterizzato dall’accumulo progressivo di alterazioni
genetiche ed instabilità cromosomica. Nell’ultima decade numerosi studi sono
stati pubblicati nel tentativo di identificare firme molecolari di espressione genica
nell’epatocarcinoma. Tali studi risultano però altamente eterogenei dal punto di
vista dell’individuazione di un profilo comune di alterazioni genetiche, rendendo
difficile la definizione di una firma molecolare ‘signature’ di questo tumore.
Analizzando contemporaneamente questi studi di profiling, l’elemento più
significativo che emerge è la frequente sovraespressione di geni coinvolti nella
13
proliferazione cellulare e nella promozione della mitosi; gli HCC individuati da
tale signature vengono definiti come ‘gruppo proliferativo’ e sono caratterizzati
da una prognosi più infausta. In tale raggruppamento spiccano inoltre una serie di
consistenti riarrangiamenti genetici, associati ad una diminuita sopravvivenza del
paziente indipendentemente dall’eziologia del tumore. Alla luce di queste
osservazioni sembra ragionevole dedurre che elementi quali aumentata
proliferazione degli epatociti, incrementato indice mitotico e disregolazione di
geni modulatori del ciclo cellulare siano sinergicamente coinvolti nel processo di
epatocarcinogenesi (6).
Lo studio di Laurent-Puig e Zucman-Rossi (13) suddivide in due gruppi
principali le alterazione genetiche identificate in tessuti di HCC. Il primo gruppo
di alterazioni è specifico dei fattori di rischio associati al tumore, quali
integrazione
genomica
del
virus
dell’epatite
B,
mutazioni
nel
gene
oncosoppressore p53 successive all’esposizione prolungata all’aflatossina,
mutazioni nell’oncogene KRAS dovute all’esposizione al cloruro di vinile, e
mutazioni della linea germinale predisponenti all’epatoblastoma. Il secondo set di
alterazioni genetiche è indipendente dall’eziologia dell’HCC ed include
acquisizione o perdita cromosomica, alterazioni di p53, attivazione della via di
WNT/β-catenina, attivazione dei geni RB1, p16 ed IGFR2 (recettore per il fattore
di crescita 2 dell’insulina). Un’esaustiva analisi di queste alterazioni genetiche ha
consentito di definire due differenti percorsi molecolari di epatocarcinogenesi in
accordo alla presenza o meno di instabilità cromosomica. Tumori scarsamente
differenziati ed HBV positivi fanno parte del gruppo di tumori ad alta instabilità
cromosomica, associati a mutazioni di p53, mentre tumori ben differenziati e
14
HBV negativi sono stati
associati ad assenza di instabilità cromosomica ed
attivazione della via di β-catenina (Figura 3).
Figura 3. Principali pathway molecolari di epatocarcinogenesi. Gli HCC
vengono raggruppati in base alle alterazioni genetiche ed in relazione ai
parametri clinici. Le linee che uniscono i rettangoli indicano una correlazione
significativa. LOH: perdita di eterozigosi. (Figura da: Laurent-Puig, P. and
Zucman-Rossi, J. Oncogene. 2006. 25:3778-86).
Un’ulteriore classificazione molecolare dell’epatocarcinoma è stata eseguita
da Chaing et al (14), ed ha consentito di individuare cinque classi di espressione
genica che raggruppano univocamente i tessuti di HCC in stadio precoce ed HCV
positivi. In aggiunta, la combinazione di tali profili di espressione con analisi di
mutazioni, analisi immunoistochimiche e lo studio di pathway molecolari ha
consentito di associare tre di queste cinque classi di espresione genica ad
alterazioni di pathway di trasduzione del segnale già noti in letteratura. Ad
esempio nella classe con alto indice di proliferazione è stata osservata
un’aumentata fosforilazione di IGF-IR, AKT e RPS6, facendo supporre che
15
l’attivazione di molecole ad attività tirosina cinasica potesse essere l’elemento
scatenante dell’elevata proliferazione osservata in questo sottogruppo di tumori.
Alla luce della significativa concordanza con altri studi di espressione, queste
cinque classi potrebbero quindi essere utilizzate per la stratificazione dei pazienti
nei futuri trials clinici e per l’individuazione di potenziali target per la terapia
molecolare.
Gli studi di classificazione molecolare possiedono quindi
un’importante rilevanza clinica poiché potrebbero portare all’identificazione di
marcatori utili per la diagnosi precoce del tumore, per predire la prognosi o per
identificare nuovi bersagli terapeutici.
Il recente studio di Ladeiro et al (15) ha integrato la classificazione
molecolare dell’epatocarcinoma basata sulle alterazione geniche con lo studio dei
profili di espressione dei microRNA, al fine di individuare associazioni tra
mutazioni in oncogeni/geni oncosoppressori e caratteristiche clinico-patologiche.
L’analisi di profiling dei microRNA ha consentito di classificare univocamente i
campioni in esame in gruppi ben separati tra loro e contraddistinti da
caratteristiche istologiche (tumore/non tumore, tumore benigno/maligno),
caratteristiche cliniche (infezione da HBV, consumo di alcol) e mutazioni in
oncogeni/geni oncosoppressori (β-catenina, fattore epatico nucleare 1 (HFN1)).
Tale studio dimostra che l’epatocarcinoma possiede distinti profili di espressione
dei microRNA, i quali sono in relazione al grado di malignità, ai fattori di rischio
ed alle alterazioni geniche e fornisce una nuova ipotesi per comprendere l’impatto
funzionale della deregolazione dei microRNA nella tumorigenesi epatica e per il
loro utilizzo come marcatori diagnostici.
16
1.2 I microRNA
I microRNA (miRNA) sono delle piccole molecole di RNA non codificante,
della lunghezza di 19-22 nucleotidi, sono espressi in un numero molto elevato di
organismi, incluso l’Homo Sapiens, sono filogeneticamente molto conservati, e
possiedono un’elevata specificità di tessuto e dei vari stadi di sviluppo. E’ stato di
recente dimostrato il ruolo cruciale dei microRNA nella regolazione di importanti
processi fisiologici, quali lo sviluppo, la proliferazione, il differenziamento,
l’apoptosi e la risposta a differenti segnali extracellulari e di stress.
La scoperta dei microRNA è piuttosto recente, risale infatti al 1993 quando un
piccolo RNA codificato dal locus lin-4 fu associato al tempo di sviluppo del
nematode Caenorhabditis elegans, attraverso la modulazione della proteina lin14.1 (16); ma è solo negli ultimi anni che i miRNA sono entrati a far parte del
complesso circuito della biologia cellulare, rivelando il loro ruolo chiave come
modulatori dell’espressione genica.
Analisi computazionali indicano che i geni che codificano per i microRNA
rappresentano approssimativamente l’1% del genoma delle differenti specie, e che
ognuno di loro possiede sequenze conservate o non conservate in centinaia di
differenti geni bersaglio: è stato stimato infatti che circa il 30% dei geni sono
regolati da almeno un microRNA (17). Al momento attuale, centinaia di miRNA
sono stati predetti in animali, piante e virus attraverso differenti approcci (18), tra
cui metodi sperimentali (19), approcci computazionali (20) ed analisi di sequenze
genomiche ed EST (21, 22). Ad oggi sono stati individuati e validati
sperimentalmente 721 miRNA umani, come riportato dal database dei microRNA,
miRBase (http://www.mirbase.org).
17
La maggior parte dei geni che codificano per i microRNA hanno isoforme
multiple (paraloghi) che sono probabilmente il risultato della duplicazione genica;
per esempio il genoma umano possiede 12 loci per la famiglia del miRNA let-7. I
geni paraloghi hanno spesso una sequenza identica nella porzione 5’ relativa alle
posizioni nucleotidiche 2-7. Poiché questi sei nucleotidi ‘seed sequence’ sono
cruciali per l’appaiamento con l’mRNA bersaglio, si pensa che i geni paraloghi
agiscano in maniera ridondante. In realtà, essendo anche la porzione 3’ dei
miRNA importante per l’appaiamento con l’mRNA bersaglio, e poiché questi
miRNA hanno spesso pattern di espressione differenti, membri della famiglia con
la stessa ‘seed sequence’ possono avere ruoli distinti in vivo (23).
Approssimativamente il 50% dei loci dei miRNA nei mammiferi sono in stretta
vicinanza con altri miRNA e spesso questi cluster di microRNA sono trascritti
come singola unità trascrizionale (TU) policistronica (24); nonostante esistano
casi eccezionali nei quali tali microRNA vengono individualmente trascritti da
promotori separati. Alcuni microRNA sono generati da TU non codificanti,
mentre altri sono all’interno di TU codificanti proteine. Approssimativamente il
40% dei loci dei miRNA sono localizzati in regioni introniche di TU non
codificanti, mentre il 10% è situato in regioni esoniche. I loci dei miRNA che si
trovano in TU codificanti proteine sono localizzati generalmente in regioni
introniche, le quali rappresentano il 40% di tutti i loci dei microRNA (Figura 3).
Alcuni loci di miRNA vengono definiti ‘misti’, poiché la loro localizzazione è
intronica o esonica a seconda del pattern di splicing (25).
18
Figura 3. Localizzazione genomica e struttura dei microRNA. (Figura da:
Kim, VN. Nat Rev Mol Cell Biol. 2009. 10: 126-39).
1.2.1
Biogenesi e ruolo biologico dei microRNA
La maggior parte dei microRNA viene trascritta dalla RNA polimerasi II (Pol
II) (24, 26), sebbene un minor gruppo di miRNA associati a sequenze ripetute
(Alu) può essere trascritto dalla RNA polimerasi III (27). Un ampio numero di
fattori di trascrizione associati alla Pol II controllano la trascrizione genica dei
microRNA, consentendone una fine regolazione in specifiche condizioni e tipi
cellulari (28). I microRNA vengono codificati sotto forma di lunghi trascritti
primari caratterizzati da una complessa struttura a forcina (pri-miRNA) e sono
processati nel nucleo dalla RNasi III Drosha a formare un microRNA precursore
(pre-miRNA) della lunghezza di 70-100 nucleotidi. Queste molecole precursore
vengono esportate, attraverso un meccanismo mediato dall’Esportina 5, dal
nucleo al citoplasma dove un ulteriore step di maturazione mediato dall’RNasi III
19
Dicer genera un RNA a doppio filamento (dsRNA) della lunghezza di circa 22
nucleotidi, chiamato dsmiR/miR*. Tale dsRNA viene successivamente legato
dalla proteina Argonaute (Ago) ed incorporato nel complesso proteico noto come
‘complesso che induce il silenziamento di RNA’ (RISC). A questo punto, uno dei
due filamenti (filamento guida o miRNA) rimane legato ad Argonaute e costituirà
il miRNA maturo, mentre l’altro filamento (filamento passeggero o miRNA*)
sarà sottoposto a degradazione da parte di un enzima con attività di elicasi. La
stabilità termodinamica di entrambe le estremità del dsRNA è fondamentale nella
determinazione di quale sarà il filamento guida (29, 30). All’interno del
complesso proteico del RISC il miRNA maturo è in grado di appaiarsi a sequenze
complementari presenti nella regione 3’UTR di RNA messaggeri (mRNA) e di
regolarne l’espressione genica a livello post-trascrizionale. La regolazione da
parte dei miRNA avviene attraverso due differenti meccanismi d’azione che
variano a seconda della complementarietà della basi tra il microRNA ed il suo sito
bersaglio. Quando vi è il 100% di complementarietà, meccanismo che avviene più
di frequente nelle piante, l’appaiamento del microRNA determinerà la
degradazione dell’mRNA; viceversa, quando la complementarietà delle basi è
imperfetta, meccanismo che avviene più di frequente negli animali, l’appaiamento
del microRNA al suo sito bersaglio porterà più probabilmente al blocco della
traduzione, senza la degradazione dell’mRNA (Figura 4).
20
Figura 4. Biogenesi, processazione e maturazione dei microRNA (miR).
(Figura da: Iorio, MV et al. J Clin Oncol. 2009. 27:5848-5856).
Il pattern di espressione dei microRNA è regolato durante lo sviluppo ed è
generalmente tessuto specifico. Alcuni miRNA sono molto abbondanti, più di
10000 copie per cellula (31), mentre altri sono scarsamente rivelabili con tecniche
di ibridazione all’RNA totale (32). Esistono, infatti, microRNA organo-specifici
come il miR-122 nel fegato ed il miR-124 nel cervello che non presenti in altri
tessuti, mentre vi sono miRNA particolarmente abbondanti in un tessuto, come ad
esempio il miR-1 nel tessuto muscolare scheletrico (33), che possono tuttavia
essere ritrovati anche in altri tessuti. L’elevata conservazione di questi microRNA
21
organo-specifici tra le varie specie animali suggerisce che essi potrebbero giocare
un ruolo ben preciso e filogeneticamente conservato nella costituzione e/o
mantenimento di un tipo cellulare o tissutale di un determinato organo. A questo
proposito, è interessante notare che i miRNA sono stati individuati solo in
organismi multicellulari, mentre sono assenti in organismi unicellulari, e
potrebbero perciò essere essenziali per il differenziamento dei vari tipi di tessuto e
per il mantenimento dello stato differenziativo. Vi sono infatti evidenze
sperimentali che dimostrano l’importanza dei miRNA nello sviluppo precoce e
tardivo dei vertebrati (34). Negli ultimi anni sta quindi diventando sempre più
rilevante l’importanza dei microRNA nel controllo dello sviluppo, della fisiologia
e della patologia animale.
A questo riguardo, l’individuazione e la caratterizzazione dei bersagli e dei
pathway molecolari regolati dai miRNA rappresenta uno step fondamentale per
far luce sull’ampio spettro di azioni biologiche esercitate dai microRNA. A fianco
dell’analisi
genetica,
è
quindi
necessario
eseguire
un’accurata
analisi
computazionale ed una successiva analisi funzionale in vitro. L’analisi in silico
prevede
l’utilizzo
di
algoritmi
bioinformatici
quali
TargetScan
(http://genes.mit.edu/targetscan/), PicTar (http://pictar.bio.nyu.edu/) e miRanda
(http://cbio.mskcc.org/cgi-bin/mirnaviewer/mirnaviewer.pl)
che
vengono
utilizzati per la predizione dei target biologici dei microRNA. Tali algoritmi si
basano su programmi di allineamento che consentono di individuare sequenze
conservate di 7-8 nucleotidi con un’elevata complementarietà alle ‘seed sequence’
dei miRNA ed un’alta stabilità termodinamica, con punteggi che variano da 0 a
100,
dove
0
rappresenta
nessuna
complementarietà
e
100
perfetta
complementarietà. L’analisi in silico dovrà essere successivamente affiancata da
22
un’analisi funzionale in vitro, al fine di dimostrare l’effettiva regolazione dei geni
bersaglio da parte dei miRNA, e da studi con geni reporter al fine di dimostrare
l’interazione diretta tra il miRNA ed il sito complementare presente nel 3’UTR
dell’mRNA bersaglio.
1.2.2
MicroRNA e cancro
L’identificazione di due microRNA, miR-15a e miR-16a, localizzati in una
regione di delezione di 30 kb nel cromosoma 13q14, individuata nel 50% delle
leucemie linfatiche croniche (CLL) (35), è stata una delle prime indicazioni del
possibile coinvolgimento dei microRNA nella tumorigenesi umana.
Dopo questa prima evidenza sperimentale, è stata riportata la correlazione tra
le posizioni genomiche di un largo numero di miRNA e regioni genomiche
cancro-associate (36). In questo studio sono stati mappati 186 geni di miRNA ed è
stato osservato che la loro distribuzione non è casuale ed omogenea tra i vari
cromosomi; infatti, circa il 50% dei loci analizzati risultano localizzati in cluster,
con una media di 2.5 geni per cluster. Circa il 20% dei miRNA analizzati sono
stati associati a siti fragili del genoma umano (Figura 5) o siti di integrazione del
Papilloma Virus Umano (HPV). Molte evidenze sperimentali supportano la
correlazione tra siti fragili e l’instabilità del DNA nelle cellule cancerose. Infatti, i
siti fragili sono siti preferenziali per scambi di cromatidi fratelli, traslocazioni,
delezioni, amplificazioni o integrazioni di virus associati a tumori come l’HPV.
23
Figura 5. Correlazione tra siti fragili e microRNA. Cariotipo umano dove
sono mostrati 113 siti fragili e 186 microRNA. I miRNA che sono colocalizzati con i siti fragili sono in rosso. Le frecce rosse mostrano i siti fragili
osservati più di frequente nei tumori umani. (Figura da: Calin, GA et al.
PNAS. 2004. 101:2999-3004).
Oltre all’associazione con i siti fragili, i geni dei microRNA possono essere
coinvolti nel processo di tumorigenesi attraverso altri meccanismi, quali
mutazione puntiforme, delezione, amplificazione, traslocazione o modificazioni
epigenetiche. Circa il 50% dei 186 miRNA analizzati sono stati individuati
all’interno di regioni genomiche associate al cancro (CAGRs), tra cui regioni
minime di perdita di eterozigosi (LOH), nelle quali sono frequentemente ritrovati
geni oncosoppressori (TS), o regioni minime di amplificazione, dove sono spesso
localizzati oncogeni (OG). Da tale analisi risulta perciò evidente che i microRNA
24
possono comportarsi da oncogeni o geni oncosoppressori e, sorprendentemente, lo
stesso miRNA può comportarsi da TS od OG a seconda del tipo di alterazione,
tipo cellulare o regolazione trascrizionale/post-trascrizionale di geni target; infatti,
specifici miRNA sono stati infatti ritrovati sia in regioni di delezione che di
amplificazione a seconda del tipo di tumore analizzato.
Per
quanto
riguarda
le
modificazioni
epigenetiche,
quali
alterata
metilazione/acetilazione del DNA, un’estensiva analisi genomica delle sequenze
geniche che codificano per i miRNA ha evidenziato che circa il 50% dei loci sono
associati con isole CpG (37), facendo supporre che un alterato stato di metilazione
potrebbe essere responsabile della deregolazione di miRNA nei tumori (38).
Alla luce del meccanismo d’azione dei miRNA, la loro deregolazione
potrebbe causare un ‘collasso post-trascrizionale’, ovvero la misregolazione
contemporanea di molteplici TS ed OG che possiedono sequenze complementari a
quella del miRNA in questione (39). L’effetto globale in caso di inattivazione di
un miRNA sarà la sovraespressione dei suoi geni target, mentre la sua attivazione
porterà alla sottoespressione di centinaia di geni bersaglio. Qualora i geni target
dei miRNA deregolati siano coinvolti nella regolazione di importanti processi
biologici come apoptosi, ciclo cellulare, invasività od angiogenesi, vi sarà un
aumentato rischio di crescita incontrollata e di sviluppo dei tumori (Figura 6). In
aggiunta, essendo un singolo miRNA in grado di regolare l’espressione genica di
centinaia di geni bersaglio, la sua alterata espressione cellulare porterà alla
deregolazione di numerosi pathway molecolari che potrebbero contribuire,
separatamente o sinergicamente, all’instaurarsi di un fenotipo cellulare di natura
maligna.
25
Figura 6. Meccanismi di deregolazione dei microRNA nei tumori umani.
(Figura da: Calin, GA et al. PNAS. 2004. 101:2999-3004).
In aggiunta, l’individuazione di differenti profili di espressione dei microRNA
nel tessuto neoplastico rispetto alla sua controparte normale conferma l’ipotesi di
un probabile coinvolgimento dei miRNA nello sviluppo e nella progressione
tumorale. Nello studio di Volinia et al (40), un’analisi di microarray di microRNA
su 540 campioni provenienti da diversi tipi tumorali (polmone, mammella,
stomaco, prostata, colon e pancreas) ha consentito di individuare una signature di
microRNA in grado di accomunare tra loro differenti tumori solidi. A conferma
della significatività di questo studio, la variazione di espressione dei miRNA della
signature risulta spesso univoca tra i vari tipi di cancro, suggerendo un
meccanismo comune di coinvolgimento dei miRNA nella tumorigenesi umana. In
aggiunta, all’interno di questa signature sono stati ritrovati miRNA di cui era già
nota l’associazione con altri tumori umani, tra cui miR-17-5p, miR-20a, miR-21,
miR-92, miR-106a, e miR-155, ed i bersagli molecolari di questi miRNA
risultano significativamente arricchiti di TS ed OG. Tali dati suggeriscono il forte
26
coinvolgimento dei microRNA nella patogenesi dei tumori solidi e supportano la
funzione dei miRNA come geni tumorali sia di natura dominante che recessiva.
E’ stato inoltre dimostrato il ruolo dei microRNA non solo nelle fasi iniziali di
sviluppo dei tumori primari, ma anche nelle fasi di progressione e
metastatizzazione della malattia. Infatti, numerose evidenze sperimentali
mostrano il coinvolgimento dei miRNA nella regolazione di processi biologici
che portano all’acquisizione del potenziale metastatico, tra cui l’adesione,
l’invasione, la migrazione, la transizione epiteliale-mesenchimale (EMT) e
l’angiogenesi (41, 42).
I microRNA possono quindi essere considerati a tutti gli effetti come dei veri
e propri oncogeni o geni oncosoppressori, ed attualmente è stato ampiamente
riportato il loro coinvolgimento in tutte le fasi di sviluppo di un tumore umano.
1.2.3
MicroRNA ed epatocarcinoma
Ad oggi numerosi studi riportano l’analisi dei profili di espressione dei
microRNA nell’epatocarcinoma umano ed in modelli sperimentali di HCC (4349). Questi studi riportano l’espressione aberrante di specifici microRNA nelle
cellule o nei tessuti di HCC se confrontati ad epatociti o tessuti di natura non
maligna. Tra i microRNA sovraespressi nell’HCC sono stati riportati il miR-21, i
miR-221/222 ed il miR-224, mentre tra i miRNA sottoespressi nel tumore vi sono
il miR-122, il miR-145, il miR-34a ed il miR-199a. Da notare il fatto che,
nonostante l’eterogeneità dell’HCC legata ai numerosi fattori di rischio, alcuni
miRNA aberrantemente espressi sono stati ritrovati da più gruppi di ricerca,
avvalorando il loro ruolo bio-patologico ed il loro coinvolgimento nel processo di
27
epatocarcinogenesi, indipendentemente dai meccanismi di trasformazione degli
HCC analizzati.
Per quel che riguarda l’eziologia ed i fattori di rischio dell’HCC, numerosi
studi riportano la deregolazione di specifici miRNA in fegati cirrotici ed in fegati
affetti da epatiti virali. Nello studio di Jiang et al (50) è stata riportata
un’associazione tra gli aumentati livelli di espressione di numerosi miRNA e la
co-presenza di cirrosi ed infezioni da virus dell’epatite. In accordo con tali dati,
sono stati individuati miRNA differenzialmente espressi in pazienti con HCC in
base al tipo di infezione virale sottostante, HBV o HCV. Un’analisi
computazionale dei geni target dei miRNA associati all’infezione virale ha inoltre
messo in evidenza l’attivazione di pathway relativi alla morte cellulare, al danno
al DNA, alla ricombinazione in fegati infetti da HBV e, viceversa, all’attivazione
di pathway connessi alla risposta immunitaria, al ciclo cellulare, alla proteolisi ed
al metabolismo lipidico in fegati infetti da HCV (51).
Relativamente al coinvolgimento dei miRNA nei diversi stadi della
progressione tumorale dell’HCC, Murakami et al (43) ha mostrato una
correlazione tra i miR-222, miR-106a, miR-92, miR-17-5p, miR-20 e miR-18 ed
il grado di differenziamento degli HCC, suggerendo un coinvolgimento di un
ristretto numero di miRNA nella progressione della patologia. In accordo con
questo dato, Budhu et al (47) ha riportato una signature di 20 miRNA in grado di
distinguere i tessuti di HCC primario con metastasi venose dai tumori solitari
privi di metastasi. In aggiunta, un’analisi predittiva ha rivelato che la maggior
parte dei 20 miRNA di questa signature sono associati con la sopravvivenza dei
pazienti. Tali 20 miRNA potrebbero quindi rappresentare un semplice metodo di
profiling diagnostico/prognostico in grado di identificare pazienti con HCC che
28
probabilmente svilupperanno metastasi e/o recidiva epatica. Un altro studio ha
riportato
differenti
profili
di
espressione
tra
l’epatocarcinoma
ed
il
colangiocarinoma, un tumore epatico delle vie biliari, dato che sottolinea
l’importanza dei miRNA come nuovi marcatori molecolari e come utili strumenti
per definire il fenotipo clinico di un tumore epatico primario (52).
Allo scopo di caratterizzare il ruolo biologico e funzionale dei singoli miRNA
nel processo di epatocarcinogenesi sono stati individuati alcuni dei pathway
molecolari modulati da singoli miRNA deregolati nell’HCC. Uno dei miRNA
maggiormente caratterizzato nell’HCC è il microRNA epatospecifico, miR-122, il
quale rappresenta il 70% di tutti i miRNA espressi nel fegato ed è sottoespresso
nella maggior parte degli HCC sia umani che murini. La sua deregolazione
provoca importanti conseguenze su varie funzioni epatiche, infatti tra i suoi target
molecolari sono inclusi numerosi geni relativi al fenotipo degli epatociti adulti, al
metabolismo lipidico (53) ed alla sintesi del colesterolo (54); tali dati fanno
ipotizzare una correlazione tra la diminuita espressione del miR-122 nell’HCC e
la perdita del differenziamento epatico delle cellule tumorali. In aggiunta, Jopling
et al (55) hanno dimostrato che il miR-122 è in grado di legarsi alla regione
5’UTR dell’RNA del virus dell’HCV, regione conservata in tutti e sei i genotipi
virali, suggerendo che il miR-122 è un elemento essenziale per la replicazione del
virus negli epatociti. E’ stato infatti dimostrato che l’inattivazione funzionale del
miR-122 porta all’80% di riduzione della replicazione virale; facendo ipotizzare
che la perdita del miR-122 nell’HCC potrebbe aumentare la resistenza delle
cellule cancerose alla replicazione dell’HCV.
Un secondo miRNA che sembra giocare un ruolo chiave nel processo di
epatocarcinogenesi è il miR-21; analisi di microarray dimostrano infatti che tale
29
miRNA è spesso sovraespresso nei tumori e nelle linee cellulari di HCC. Lo
studio di Meng et al (44) ha individuato il gene oncosoppressore PTEN tra i
bersagli molecolari del miR-21. Analisi in vitro, mostrano come la sua inibizione
sia associata ad un’aumentata espressione di PTEN e porti ad una diminuita
proliferazione ed invasione delle cellule tumorali. L’inibizione del miR-21 induce
inoltre un’alterata espressione delle metallo-proteinasi 2 e 9, entrambi mediatori a
valle di PTEN con un noto ruolo nei processi di migrazione ed invasione
cellulare. Tali dati suggeriscono che l’aberrante espressione del miR-21 possa
contribuire alla crescita ed alla diffusione dell’HCC attraverso la modulazione
dell’espressione di PTEN e dei pathway PTEN-dipendenti coinvolti nella
modulazione delle caratteristiche fenotipiche delle cellule cancerose, quali
proliferazione, migrazione ed invasione.
Un altro miRNA coinvolto nella progressione e diffusione tumorale dell’HCC
è il miR-34a, un bersaglio trascrizionale di p53 che risulta deleto in numerosi tipi
di tumore umano. Oltre a bersagli molecolari coinvolti nella progressione del
ciclo cellulare, il miR-34a regola l’espressione dell’oncoproteina c-Met, un
recettore con attività di tirosina cinasi attivato dal legame del fattore di crescita
epatico (HGF) in grado di indurre la fosforilazione di molecole responsabili della
traduzione del segnale, quali ERK1/2, e che rappresentano fattori chiave nella
regolazione dell’invasione e della migrazione tumorale. Lo studio di Li et al (42)
ha riportato una significativa diminuzione dell’espressione del miR-34a nella
maggior parte dei tessuti di HCC rispetto all’adiacente fegato sano ed una
correlazione inversa tra il miR-34a ed i livelli di espressione del’oncoproteina cMet. In aggiunta, bassi livelli di miR-34a correlano positivamente con la
mestatizzazione e l’invasione vascolare del tumore e studi in vitro mostrano una
30
diminuita capacità migratoria ed invasiva delle cellule tumorali in seguito
all’espressione ectopica del miR-34a, in maniera c-Met dipendente. Da notare che
un secondo miRNA diminuito nella maggior parte degli HCC (50), miR-199a-3p,
è in grado di regolare l’espressione dell’oncogene c-Met (56); tale dato suggerisce
che più miRNA deregolati in un tumore possono modulare sinergicamente il
medesimo gene bersaglio, portando ad una forte alterazione del pathway
molecolare a valle del gene target e favorendo il processo di progressione
tumorale.
Presi insieme, tutti questi studi dimostrano il ruolo chiave dei microRNA nei
diversi stadi di iniziazione e progressione dell’epatocarcinoma e pongono le basi
per lo sviluppo di nuovi trattamenti terapeutici per l’HCC. A tale scopo, la
ricostituzione di miRNA sottoespressi od il silenziamento di miRNA sovraspressi
nelle cellule cancerose rappresenta un promettente tool terapeutico per la terapia
genica del cancro, ed offre la possibilità di modulare il fenotipo tumorale maligno
regolando contemporaneamente più di un gene target. A tal proposito, il fegato
risulta estremamente ricettivo nell’assorbimento di oligonucleotidi somministrati
periferalmente, e rappresenta perciò un organo ideale per la terapia genica.
Inoltre, efficienti vie per la somministrazione selettiva di farmaci direttamente
all’interno dell’arteria che alimenta il nodulo tumorale sono state sviluppate e
routinariamente utilizzate nella pratica clinica, consentendo una maggiore
efficacia e minore tossicità sistemica dei trattamenti somministrati.
31
1.2.4
MicroRNA e clinica: diagnosi, prognosi e nuovi trattamenti
Le evidenze sperimentali raccolte sino ad oggi dimostrano che i microRNA
possono rappresentare dei validi marcatori diagnostici e prognostici nei tumori
umani. L’espressione aberrante dei miRNA nei differenti tipi di tumore è stata
infatti correlata a specifiche caratteristiche bio-patologiche, all’esito della malattia
ed alla risposta a trattamenti farmacologici.
•
Ruolo diagnostico dei microRNA
L’analisi dei profili di espressione dei miRNA in un elevato numero di
campioni tumorali ha recentemente mostrato il potenziale diagnostico delle firme
molecolari dei microRNA nell’individuazione di un determinato fenotipo
tumorale (40, 57). Nello studio di Fulci et al (58) sono stati ad esempio analizzati
campioni provenienti da pazienti con leucemia acuta ed in essi sono stati
individuati distinti pattern di espressione dei miRNA corrispondenti a differenti
meccanismi di trasformazione tumorale. In questo studio l’utilizzo dei profili di
espressione dei miRNA è risultato perciò un ottimo strumento per stabilire la
corretta diagnosi di pazienti con tumori poco differenziati ed altrimenti non
diagnosticabili dalla sola analisi isto-patologica.
•
Ruolo prognostico dei microRNA
L’utilità dei profili di espressione dei miRNA è al momento evidente per la
prognosi di alcuni tipi di neoplasia; ad esempio nella leucemia linfatica cronica
(CLL) e nel tumore del polmone specifiche signature di espressione sono state
associate ad una prognosi di tipo favorevole o sfavorevole (58-60). Nello studio
condotto da Takamizawa et al (61) è stato dimostrato che 143 casi di tumore del
polmone possono essere classificati in due grandi gruppi in base alla sola
32
espressione del microRNA let-7, ed in aggiunta è stata osservata una correlazione
tra bassi livelli di let-7 ed una significativa diminuzione del tempo di
sopravvivenza dei pazienti. Sorprendentemente, i livelli di espressione di let-7
sono risultati un più potente fattore di predizione rispetto all’età, all’istologia del
tumore ed al fumo. Una possibile spiegazione molecolare a questa correlazione
proviene dallo studio di Johnson et al (62) nel quale è stata riportata la
correlazione tra let-7 e l’oncogene RAS, un noto marcatore prognostico di
pazienti con tumore al polmone. Un’ulteriore prova a sostegno del ruolo prooncogenico di let-7 nel cancro del polmone proviene da studi funzionali in vitro,
nei quali la ri-espressione di let-7 in linee cellulari ha portato all’inibizione di
pathway coinvolti nella proliferazione cellulare (63).
•
Ruolo dei microRNA nella resistenza a trattamenti farmacologici
Uno dei più importanti fattori che influisce sulla probabilità di sopravvivenza
di pazienti con neoplasia è la resistenza ai trattamenti terapeutici ed a questo
riguardo lo sviluppo di approcci farmacolgici efficaci è uno step necessario per la
terapia dei differenti tipi di cancro.
In base alla loro tossicità specifica contro le cellule maligne, diverse forme
ricombinanti di TRAIL risultano tra i più promettenti agenti anti-tumorali basati
sull’induzione di apoptosi di cellule cancerose. Nonostante questo, molte cellule
tumorali umane risultano resistenti all’apoptosi indotta dal TRAIL ed inoltre il
meccanismo di tale resistenza è ad oggi ancora poco chiaro. Lo studio condotto da
Garofano et al (64) ha dimostrato che i miR-221/222, attraverso la regolazione dei
due target molecolari PTEN e TIMP3, inducono la resistenza al trattamento con
TRAIL ricombinante ed aumentano la migrazione cellulare in seguito
all’attivazione del pathway di AKT e delle metallopeptidasi. Tali microRNA
33
risultano sovraespressi in numerosi tipi di cancro tra cui l’epatocarcinoma ed il
tumore del polmone (NSCLC) se confrontati con i rispettivi tessuti sani. Tale
studio dimostra che l’alta espressione dei miR-221/222 è indice di resistenza al
trattamento con TRAIL in questi due tipi di tumore, e conferma precedenti
evidenze sperimentali nelle quali veniva ipotizzata l’associazione tra un numero
ristretto di microRNA e la sensibilità delle cellule tumorali alla morte cellulare
farmaco-indotta. In particolare, la stratificazione tumorale sulla base dei livelli di
espressione di miR-221/222 potrebbe essere uno strumento prognostico utile per
predire la resistenza o la sensibilità al trattamento con TRAIL. In aggiunta,
l’utilizzo di microRNA come innovativo trattamento terapeutico, potrebbe non
solo sensibilizzare le cellule tumorali all’apoptosi farmaco-indotta (64, 65), ma
anche inibirne la sopravvivenza, la proliferazione e la capacità invasiva.
E’ stato inoltre dimostrato che alcuni microRNA possono modulare la
sensibilità alla radioterapia, come di recente riportato da Slack et al (66) nel
cancro del polmone; la ri-espressione di let-7 è infatti in grado di sopprimere la
resistenza alla radioterapia, probabilmente attraverso la regolazione dell’oncogene
RAS. Tali dati offrono le basi sperimentali per l’uso dei microRNA come nuovi
target terapeutici in associazione con i tradizionali trattamenti anti-tumorali.
•
Ruolo dei microRNA come target terapeutici
Considerata l’importanza dei microRNA nello sviluppo, progressione e
trattamento del cancro, il loro potenziale utilizzo nella terapia tumorale è al
momento attuale oggetto di studio di numerosi gruppi di ricerca. Lo scopo è
quello di modularne l’espressione introducendo miRNA sottoespressi nel cancro o
inibendo l’espressione di oncomiR tramite molecole antagoniste. Il razionale
teorico per il loro utilizzo si basa sul fatto che i miRNA sono molecole endogene
34
con azione di antisenso in grado di regolare l’espressione di numerosi geni
coinvolti nella sopravvivenza, proliferazione e differenziamento delle cellule
eucariote.
Lo sviluppo di molecole simili ai microRNA ma con una più elevata emivita
ed aumentatat efficacia in vivo, quali oligonucleotidi modificati utilizzando acidi
nucleici con struttura ad anello (LNA) (67), oligonucleotidi anti-miR (AMO) (68)
e ‘antagomirs’ coniugati a molecole di colesterolo (54), è stato il primo passo
nella traslazione dei progressi scientifici dell’ultimo decennio all’interno della
pratica clinica. Attualmente i due principali ostacoli all’utilizzo di queste
molecole in clinica sono rappresentati dallo sviluppo di modelli animali
ingegnerizzati che consentano di studiare approfonditamente i microRNA cancroassociati ed il miglioramento dell’efficienza della somministrazione di
oligoncleotidi in vivo. Per migliorare il delivery dei miRNA in vivo, i metodi
testati negli studi pre-clinici per gli ‘short-interfering RNA’ (siRNA) o ‘short
heteroduplex RNA’ (shRNA) (69) potrebbero essere applicati anche ai miRNA,
con il vantaggio che questi ultimi sono in grado di regolare bersagli multipli in
una sola volta, modulando un intero network di molecole. Alla luce del complesso
scenario di regolazione in cui sono coinvolti i microRNA, sarà tuttavia necessario
un ulteriore sforzo al fine di elucidare e caratterizzare il potenziale oncogenico od
oncosoppressore di ciascun miRNA.
Dati ad oggi disponibili chiaramente supportano il ruolo dei miRNA
nell’eziologia del cancro e suggeriscono un possibile impiego di queste molecole
come marcatori diagnostici e prognostici e nuovi target o strumenti terapeutici. Il
passaggio dal bancone di laboratorio all’impiego dei microRNA nelle
35
applicazioni cliniche potrebbe quindi rappresentare la sfida futura in ambito
scientifico.
36
1.3 SCOPO DELLA RICERCA DI TESI
Il carcinoma epatocellulare (HCC) è il più frequente tumore maligno del
fegato e rappresenta il sesto tipo di tumore più comune nel mondo. Spesso i
pazienti con HCC vengono diagnosticati a stadi piuttosto avanzati, quando le
uniche opzioni terapeutiche in grado di migliorarne la sopravvivenza sono la
chemoembolizzazione dell’arteria epatica ed il trattamento con l’inibitore multicinasico, Sorafenib. In questo contesto, la scoperta del ruolo centrale dei
microRNA (miRNA) nella tumorigenesi umana risulta di fondamentale
importanza per lo sviluppo di nuovi marcatori diagnostici e bersagli terapeutici.
I microRNA (miRNA) sono delle piccole molecole di RNA non codificante,
della lunghezza di 19-22 nucleotidi, filogeneticamente molto conservati, ed
esercitano un ruolo cruciale nella regolazione di importanti processi fisiologici,
quali sviluppo, proliferazione, differenziamento, apoptosi e risposta a numerosi
segnali extracellulari e di stress. I miRNA sono inoltre responsabile della fine
regolazione dell’espressione di centinaia di geni bersaglio attraverso il blocco
della traduzione o la degradazione dell’mRNA target. Studi di profiling hanno
evidenziato l’espressione aberrante di specifici miRNA in numerosi tipi di tumore
umano.
Lo scopo del presente lavoro è stato quello di individuare un pannello di
miRNA deregolati nell’epatocarcinoma umano e di caratterizzare il ruolo
biologico di tre miRNA deregolati nell’HCC, al fine di individuare alcuni dei
meccanismi molecolari alla base della trasformazione maligna miRNA-associata.
La nostra ricerca è stata inoltre focalizzata nell’individuazione di nuovi bersagli e
strumenti terapeutici, quali i microRNA, per il trattamento combinato di HCC in
stadio intermedio-avanzato.
37
CAPITOLO 2
MATERIALI E METODI
38
2.1 Raccolta di campioni di pazienti con epatocarcinoma
I campioni biologici utilizzati in questo studio provengono da pazienti sottoposti a
resezione epatica per carcinoma epatocellulare insorto su fegato cirrotico. I
campioni tissutali sono stati raccolti immediatamente dopo la resezione epatica
effettuata presso il reparto di Chirurgia Generale e Trapianti del Policlinico
Sant’Orsola di Bologna. I campioni sono stati tagliati, inseriti all’interno di
cryovials, immediatamente congelati in azoto liquido e conservati a –80°.
I criteri di esclusione di pazienti dallo studio sono stati i seguenti: 1)
precedente storia di trattamento locale o sistemico per HCC 2) presenza di tessuto
non cirrotico circostante il nodulo di HCC.
2.2 Microarray di microRNA
•
Marcatura degli RNA con biotina
Procedura:
Aggiungere 5µg di RNA totale ad una miscela di reazione contenente 1 µg di
primer oligonucleotidico marcato con [3′-(N)8-(A)12-biotin-(A)12-biotin-5′], in
un volume finale di 12 µl.
Incubare la miscela per 10’ a 70°C e raffreddare in ghiaccio.
Mantenendo la miscela in ghiaccio, aggiungere 4 µl di 5X First-Strand Buffer
(250 mM Tris-HCL pH 8.3, 375 mM Cloruro di Potassio,15 mM Cloruro di
Magnesio, 50 mM DTT), 2 µl di DTT (0.1 M), 1 µl di dNTP mix (10 mM) e 1 µl
di SuperScript II RNaseH- reverse transcriptase (200 Units/µl, Invitrogen) in un
volume finale di 20 µl.
Incubare la miscela di reazione per 90’ in un bagnetto a 37°C, per consentire la
sintesi del primo filamento di cDNA.
Dopo l’incubazione, aggiungere 3.5 µl di NaOH (0.5 M)/EDTA (50 mM) ai 20 µl
della miscela di reazione.
39
Incubare a 65°C per 15’ per consentire la denaturazione degli ibridi di RNA/DNA
e la degradazione degli stampi di RNA.
Aggiungere 5 µl di Tris-HCI (pH 7.6, 1 M) per neutralizzare la miscela di
reazione.
I campioni di RNA (target) così marcati sono stati conservati a -80°C fino
all’ibridazione su chip.
•
Ibridazione su array
Microarray chip: il microarray di miRNA utilizzato per l’analisi di profiling
contiene 381 sonde spottate in triplicato, corrispondenti alle sequenze di 238
microRNA maturi e 143 precursori di microRNA umani. Tutte le sonde presenti
sul microchip sono oligonucleotidi di 40-mer spottati tramite tecnologie di
contatto e legati covalentemente ad una matrice polimerica.
Procedura:
Ibridizzare i target marcati su microarray in 6X SSPE (0.9 M Cloruro di Sodio/60
mM Fosfato di Sodio/8 mM EDTA, pH 7.4)/30% Formamide a 25°C per 18 h.
Fare un lavaggio in 0.75X TNT (Tris·HCl/Cloruro di Sodio/Tween 20) a 37°C per
40’.
Processare i chip usando una rivelazione diretta dei trascritti marcati con biotina
tramite la formazione di un coniugato con Streptavidin-Alexa647.
I vetrini sono stati processati tramite GenePix 4000B scanner (Axon Instruments).
Le immagini sono state quantificate tramite GenePix Pro 6.0 (Axon Instruments).
•
Analisi dei dati di microarray
I dati grezzi provenienti dai microarray di microRNA, lettura ad un colore, sono
stati normalizzati ed analizzati attraverso il software GeneSpring® GX versione
7.3 (Agilent Technologies). Il software GeneSpring genera un unico valore per
ogni miRNA, eseguendo la media dei replicati delle sonde presenti sul chip. I
40
campioni sono stati normalizzati utilizzando la normalizzazione mediana. Ogni
campione proveniente da tessuto tumorale è stato normalizzato sul campione di
fegato cirrotico proveniente dallo stesso paziente, quando disponibile, oppure
sulla media dei campioni di cirrosi. MicroRNA differenzialmente espressi sono
stati individuati utilizzando un filtro basato su di un ‘fold change’ di 1.3
combinato con un’ANOVA (Analysis of Variance) per il confronto di campioni di
HCC contro i campioni di CE (p<0.05), con una correzione Benjamini and
Hochberg per la riduzione dei falsi positivi. La lista dei miRNA differenzialmente
espressi è stata testata per il suo valore predittivo con i seguenti algoritmi:
Prediction Analysis of Microarrays (PAM) (70) e Support Vector Machine (SVM)
(71). L’analisi di ‘unsupervised hierarchical cluster’ è stata eseguita dopo il
centramento mediano su ogni chip utilizzando associazione mediana e
correlazione Standard come misure di similarità. Il raggruppamento controllato è
stato eseguito dopo la normalizzazione sulla mediana dei geni per sottolineare
differenze tra i campioni.
2.3 Northern blot
•
Corsa elettroforetica e trasferimento su nitrocellulosa
Materiali:
15% acrylamide, 7 M urea Criterion precasted gels (Biorad)
Criterion Cell (Biorad)
Criterion Blotter (Biorad)
Hybond N+ membrane (Amersham)
Di-ethyl-pyro-carbonate (DEPC) (Sigma)
SDS (Biorad)
TBE-Urea Sample Buffer (Biorad)
41
TrackIt 25bp DNA ladder (Invitrogen)
TrackIt 10bp DNA ladder (Invitrogen)
TBE 10X (1 L)
Tris base
107.8 g
Acido Borico
55.0 g
EDTA 0,5 M
40 ml
Autoclavare la soluzione per 30’ a 121°C.
Diluire il TBE 10X in H2O DEPC per ottenere TBE 1X.
H2O DEPC (1 L)
Aggiungere 1 ml di di-ethyl-pyro-carbonate ad 1 L di H2O milliQ.
Miscelare per inversione ed incubare overnight a temperatura ambiente (RT).
Autoclavare la soluzione per 30’ a 121°C.
Procedura:
Prelevare un volume di RNA pari a 10 µg per ciascun campione e portare ad un
volume di 15 µl con H2O DEPC.
Aggiungere un ugual volume di 2X Sample Buffer.
Denaturare a 70°C per 10’.
Posizionare il gel precast nell’apparato per elettroforesi e riempire la vaschetta col
Buffer di corsa, TBE 1X.
Caricare i campioni ed i marker di peso molecolare utilizzando puntali a capillare.
Correre il gel a 120V per 90’.
Rimuovere il gel dal supporto immergendolo in TBE 1X.
Colorare il gel con Etidio-Bromuro (Et-Br) per 30’ in agitazione e fotografarlo al
Fluor-S (Biorad).
Decolorare il gel in TBE 1X ed equilibrarlo in TBE 1X per il blotting.
Equilibrare anche la membrana in TBE 1X.
Montare l’apparato di trasferimento ed effettuare il blotting in TBE 1X freddo a
20V, overnight a 4°C.
Mettere la membrana per 30’ in stufa a 80°C per cross-linkare l’RNA alla
membrana.
42
•
Pre-ibridazione della membrana
Materiali:
SDS (Biorad)
Dextran Sulphate (Sigma)
SSPE 20X (1L)
NaH2PO4 (0.1M)
27.6 g
NaCl (1.8 M)
175.3 g
EDTA (0.01 M)
9.4 g
Aggiungere 800 ml di H20 DEPC e sciogliere in agitazione.
Portare a pH 7.4 con HaOH.
Autoclavare la soluzione per 30’ a 121°C.
SDS 20% (200 ml)
SDS
40.0 g
Aggiungere 150 ml di H20 DEPC e sciogliere a 50°C in agitazione.
Portare a volume.
Soluzione di ibridazione (500 ml)
NaH2PO4 (0.2 M)
27.6 g
SDS (7%)
175.0 ml di SDS 20%
Aggiungere 400 ml di H20 DEPC e sciogliere in agitazione.
Portare a pH 7.0 e portare a volume con H2O DEPC.
NB: filtrare la soluzione con filtro da 0.22 µm prima dell’uso.
Procedura:
Bagnare la membrana con SSPE 2X in una vaschetta.
Per la pre-ibridazione, trasferire la membrana nella soluzione di ibridazione
filtrata a 37°C in agitazione per 1h.
43
•
Marcatura della sonda e purificazione su colonna
Materiali:
P32-gamma-ATP (Amersham)
G25 Quick spin columns (Roche)
Kit: End labelling kit with polinucleotide kinase (PNK) (Roche)
La sequenza delle sonde oligonucleotidiche a DNA è riportata in Tabella 1.
Tabella 1. Sequenza delle sonde oligonucleotodiche.
Nome sonda
Sequenza
MiR-221
5’-GAAACCCAGCAGACAATGTAGCT-3’
MiR-122
5’-ACAAACACCATTGTCACACTCCA-3’
Let-7a-1
5’-AACTATACAACCTACTACCTCA-3’
U6RNA
5’-GCAGGGGCCATGCTAATCTTCTCTGTATCG-3’
Procedura:
Lavorare in una stanza adibita ad utilizzo di materiale radioattivo ed utilizzare le
schermature in plexiglass.
Preparare la mix per la marcatura utilizzando End labelling kit with polinucleotide
kinase (PNK) e procedere secondo il seguente schema:
Oligonucleotide (50ng/µl)
4 µl
PNK Buffer 10X
4 µl
PNK (10U/µl)
2 µl
Gamma ATP P32 (10 µCi/µl)
10 µl
H20 DEPC
20 µl
TOT
40 µl
Incubare per 1h a 37oC.
Bloccare la reazione in ghiaccio.
Prendere la colonna dal contenitore (4°C) ed invertirla 5-6 volte per risospendere
la matrice.
Rimuovere il cappuccio superiore e poi la punta inferiore. Lasciar scendere il
buffer per gravità e scartarlo.
44
Posizionare la colonna sul tubo e centrifugare 2’ a 1100 g dentro una provetta da
15 ml.
Mantenere la colonna in posizione verticale, posizionare il DNA marcato (sonda)
al centro della colonna.
Posizionare la colonna su di un nuovo tubo.
Centrifugare 4’ a 1100 g per eluire il campione contenente la sonda marcata.
Scartare la colonna nel contenitore del radioattivo.
•
Ibridazione della sonda su membrana e rilevazione del segnale radioattivo
Procedura:
Aggiungere alla sonda purificata 1 ml di soluzione di ibridazione e denaturare in
H2O bollente per 2’.
Aggiungere la sonda denaturata a 20 ml di soluzione di ibridazione filtrata.
Rimuovere la soluzione di pre-ibridazione dalla membrana.
Coprire la membrana con la soluzione di ibridazione a cui è stata aggiunta la
sonda.
Incubare overnight in un bagnetto termostatato a 42oC in leggera agitazione.
Svuotare la soluzione di ibridazione contenente la sonda radioattiva in una
provetta da 50 ml e conservarla a –20°C.
Posizionare la membrana in una vaschetta più capiente e fare 2 lavaggi con 300
ml di soluzione di lavaggio (2X SSPE + 0.1% SDS) per 30’ a 37°C.
Posizionare la membrana su di un contenitore apposito e far impressionare una
lastra fotografica (Kodak). Posizionare la cassetta a –80°C per 20’.
Sviluppare la lastra in camera oscura utilizzando i liquidi di sviluppo Developer
1X e Fixer 1X (Kodak).
Acquisire le immagini digitali tramite Fluor-S MultiImager (Biorad) e
quantificare l’intensità delle bande tramite il software Quantity-one (Biorad).
•
Stripping
Posizionare la membrana all’interno di una vaschetta ed aggiungere una soluzione
bollente di 0.1% SDS in H2O DEPC per 10’.
Fare un lavaggio in SSPE 2X e re-incubare la membrana con una nuova sonda.
45
2.4 Colture cellulari
Materiali:
Tutte le linee cellulari utilizzate in questo lavoro di tesi sono linee derivate da
carcinoma epatocellulare e sono state acquistate presso la American Type
Culture Collection (ATCC).
Linee cellulari:
HepG2 (ATCC, HB-8065)
Hep3B (ATCC, HB-8064)
SNU398 (ATCC, CRL-2233)
SNU449 (ATCC, CRL-2234)
SNU182 (ATCC, CRL-2235)
SNU475 (ATCC Number CRL-2236)
Huh-7 (Provenienti dal Laboratorio del Prof. Alberti, Università di Padova)
Terreni di coltura:
•
RPMI-1640 (ATCC): SNU398, SNU449, SNU182, SNU475, Huh-7
•
Minimum Essential Medium (Eagle) (ATCC): HepG2, Hep3B
Fetal bovine serum (FBS) (ATCC)
PBS (1X) (ATCC)
Tripsina (ATCC)
Penicillina-Streptomicina (100X) (ATCC)
L-Glutamina (100X) (ATCC)
Fiasche colturali (Corning)
Doxorubicina (Pfizer)
Deferoxamina (Sigma)
Rapamicina (Sigma)
Polyhema (Sigma)
46
Procedure:
Le cellule sono state coltivate ed espanse a 37°C, in atmosfera al 5% di CO2 in
terreno contenente 10% FBS, L-Glutamina 2mM ed antibiotici 1X.
I diversi trattamenti farmacologici sono stati effettuati a 37°C in atmosfera al 5%
di CO2 su cellule in fase di crescita esponenziale.
Quando è previsto pre-trattamento con:
•
Doxorubicina, usare il composto alla concentrazione di 2.5-5 µg/ml per 24h
•
Deferoxamina, usare il composto alle concentrazioni di 250 µM per 24h
•
Rapamicina, usare il composto alle concentrazioni di 10 ng/ml per 24-48h.
•
Tripsinizzazione
Eliminare il terreno di crescita da ciascuna fiasca.
Fare un lavaggio delle cellule con 3 ml di PBS.
Aggiungere 3 ml di tripsina.
Incubare le cellule per 5’ a 37°C e 5% CO2.
Aggiungere 3 ml di terreno di coltura per disattivare la tripsina.
Raccogliere le cellule in provette da 15 ml.
Centrifugare per 5’ a 1200 rpm.
Scartare il sovranatante.
Risospendere il pellet cellulare in 5 ml di terreno.
Aggiungere in nuova fiasca di coltura 1 ml della sospensione cellulare e 9 ml di
terreno di coltura (diluizione 1:5).
•
Pellet cellulari
Centrifugare le cellule tripsinizzate per 5’ a 1200 rpm a 4°C.
Eliminare il sovranatante.
Risospendere le cellule in 1 ml di PBS e trasferire in provette da 1.5 ml.
Centrifugare a 7500 rpm per 2’ a 4°C. Eliminare il sovranatante.
Congelare il pellet cellulare in azoto liquido e conservare a -80°C.
47
2.5 Trasfezione cellulare
Materiali:
Lipofectamine 2000 (Invitrogen)
OPTI-MEM I Reduced Serum Medium (GIBCO)
Piastre per colture cellulari da 6 e 24 pozzetti (Corning)
Pre-miR miRNA precursor, 5 nmol (Ambion)
Anti-miR miRNA inhibitor, 5 nmol (Ambion)
Pre-miR Negative Control #1, 5nmol (Ambion)
Anti-miR Negative Control #1, 5nmol (Ambion)
Small interfering RNA (siRNA) (vedi Tabella 2)
Vettori plasmidici: pGL3, pRL-TK (Promega), pp53TA, pTA (Clonotech),
pGL3+regione 3’UTR clonata (vedi Paragrafo 2.13)
Tutti gli oligonucleotidi a RNA utilizzati per la sovra-espressione (pre-miR) o per
il silenziamento (anti-miR) dei microRNA ed i loro controlli negativi sono stati
utilizzati ad una concentrazione finale di 100 nM.
La sequenza e la concentrazione finale dei siRNA utilizzati per il silenziamento
dei singoli geni sono riportate nella Tabella 2.
La trasfezione dei vettori plasmidici è stata eseguita in piastre da 24 pozzetti per
la successiva esecuzione del saggio di luciferasi (Paragrafo 2.14). I vettori pGL3,
pGL3-3’UTR, pp53TA e pTA sono stati utilizzati ad una concentrazione finale di
1.0 µg/ml; il vettore pRL-TK ad una concentrazione di 0.1 µg /ml.
48
Tabella 2. SiRNA utilizzati.
Gene
SiRNA
Sequenza (5’->3’)
Conc.
Produttore
(nM)
Cyclin G1
G1/238
TGGCCTCAGAATGACTGCAAGACTA-
40
Invitrogen
Cyclin G1
G1/832
GCAAGAGCTTGTATCCAAATGTTTA
40
Invitrogen
PPP2R5B
PPP2R5B-1
CGTCAGGAGTTATGGCAAGGTCTGG
10
IDT
Bmf
Bmf-1
GGAAATAGGAGGAGTCTAGAGTAGA
20
IDT
Puma
Puma
CACCATGTAGCATACTGGATT
20
Sigma
mTOR
mTOR
ACCATGAACCATGTCCTAAGCTGTG
20
IDT
c-Met
c-Met
GCCCAACTACAGAAATGGTTT
20
Sigma
Procedura:
Ventiquattro ore prima della trasfezione piastrare le linee cellulari ad una
confluenza del 50% in terreno senza antibiotici in piastre da 24 o 6 pozzetti.
•
Preparazione dei complessi con Lipofectamine 2000:
Aggiungere 50 µl (piastra da 24 pozzetti) o 250 µl (piastra da 6 pozzetti) di OPTIMEM in due provette separate.
Aggiungere nella prima provetta un volume di oligonucleotidi (o vettore
plasmidico, piastra da 24 pozzetti) al fine di ottenere le concentrazioni finali sopra
indicate.
Aggiungere 1 µl (piastra da 24 pozzetti) o 5 µl (piastra da 6 pozzetti) di
Lipofectamine 2000 nella seconda provetta, miscelare per inversione (4-6 volte)
ed incubare a RT per 5’.
Centrifugare brevemente entrambe le provette (4000 rpm per 5’’).
Prelevare i 50 µl o 250 µl di OPTI-MEM contenenti la Lipofectamine 2000 ed
aggiungerli alla provetta contenente gli oligonucleotidi (o vettori plasmidici).
Miscelare per inversione ed incubare la provetta a RT per 20’.
Eliminare 100 µl (piastra da 24 pozzetti) o 500 µl (piastra da 6 pozzetti) di terreno
da ciascun pozzetto contenente le cellule da trasfettare.
49
Centrifugare brevemente la provette ed aggiungere, goccia a goccia, i complessi
oligonucleotide-Lipofectamine al pozzetto.
Incubare le cellule in incubatore a 37°C, 5% CO2.
Dopo 6h sostituire il terreno alle cellule trasfettate con terreno di coltura
contenente antibiotici e re-incubare a 37°C, 5% CO2.
2.6 Preparazione di estratti proteici da linee cellulari e tessuti
Buffer di lisi
Tris-HCl (pH 7.6)
0.01 M
NaCl
0.1 M
EDTA (pH 8.0)
0.01 M
Triton X-100
0.1%
DTT
1 mM
PMSF
1 mM
Orto-fosfo-vanadato
1 mM
Mix inibitori (Roche)
1X
NB: aggiungere DTT, PMSF, orto-fosfo-vanadato e mix di inibitori solo
immediatamente prima dell’uso.
Procedura:
•
Linee cellulari
Aggiungere a ciasun pellet cellulare, mantenuto in ghiaccio secco per evitare lo
scongelamento, 25 µl di Buffer di lisi freddo, risospendere i pellet vortexando per
10’’ e lasciare in ghiaccio per 30’.
Centrifugare a 13000 rpm per 15’ a 4°C.
Prelevare il sovranatante e trasferirlo in una nuova provetta.
Quantificare i campioni tramite saggio di Lowry (Paragrafo 2.7).
Conservare i campioni a –20°C.
50
•
Tessuti
Posizionare il pezzo chirurgico su di una piastra Petri di vetro appoggiata su di un
blocco di ghiaccio secco.
Polverizzare il tessuto con un bisturi fino a riempire mezza provetta da 1.5 ml.
Aggiungere al tessuto ploverizzato100 µl di Buffer di lisi e procedere come sopra
descritto.
2.7 Dosaggio di estratti proteici tramite Lowry assay (Kit Biorad)
Materiali:
DC Protein Assay (Biorad)
BSA (Sigma)
Cuvette di plastica
Procedura:
Risospendere 1.5 mg di BSA in 1 ml di acqua bi-distillata sterile (BDW) e fare le
seguenti diluizioni in BDW (20 µl):
- 1,5 mg/ml
- 0,75 mg/ml
- 0,15 mg/ml
Queste diluizioni rappresentano gli standard proteici a concentrazione nota.
Diluire ciascun campione 1:10 in BDW, volume finale 20 µl.
Preparare per ciascun campione 100 µl di soluzione A+S: 98 µl Buffer A + 2 µl
Buffer S.
Addizionare 100 µl della soluzione A+S ad ogni standard e campione.
Vortexare per 10’’.
Aggiungere 800 µl di Soluzione B.
Miscelare per inversione ed incubare a RT per 15’.
Leggere l’assorbanza a 500 nm.
51
2.8 Western blot
Materiali:
30% Acrylamide/Bis Solution (29:1) (Biorad)
2-mercapto-etanolo (Biorad)
TEMED (Biorad)
Ammonium Persulfate (APS) (Biorad)
Bromofenolblu (Biorad)
Hybond ECL-Nitrocellulosa (Amersham)
Rosso Ponceau (Sigma)
Latte in polvere (Nestlè)
Hyperfilm ECL (Amersham)
Developer Solution (5X) (Kodak)
Fixing Solution (5X) (Kodak)
ECL Advance Western Blotting Detection Kit (Amersham)
Anticorpi (vedi Tabella 3)
Tabella 3. Anticorpi primari e diluizioni utilizzate.
Tipo
mAb anti-Cyclin G1 (F-5)
mAb anti-p53 (DO-7)
mAb anti-p21 (F-5)
mAb anti-β-actin
Ab anti-cleaved caspase-3
Ab anti-Puma
Ab anti-PPP2R5B
Ab anti-p57 (C-20)
mAb anti-p27 (57)
Ab anti-Bmf
Ab anti-mTOR
Ab anti-c-Met
Ab anti-phospho-S6 (Ser-240/244)
Dilizione Ab
primario
1:100
1:1000
1:100
1:1000
1:1000
1:1000
1:200
1:500
1:1000
1:200
1:1000
1:1000
1:1000
52
Dilizione Ab
secondario
1:10000
1:10000
1:7500
1:10000
1:7500
1:7000
1:7500
1:10000
1:10000
1:10000
1:7500
1:7500
1:10000
Produttore
SantaCruz Biotecnology
DakoCytomation
SantaCruz Biotecnology
SantaCruz Biotecnology
Cell Signaling
Cell Signaling
ABR
SantaCruz Biotecnology
BD Biosciences
Novus Biologicals
Cell Signaling
Cell Signaling
Cell Signaling
RESOLVING GEL
Per un volume finale di 7 ml, vedi Tabella 4.
Tabella 4. Resolving gel a diversa percentuale di Acrilamide.
% Acrilamide
8%
10%
12%
14%
H2O (ml)
3.22
2.82
2.35
1.88
30% Acrilamide/Bis (ml)
1.87
2.33
2.80
3.27
Tris-HCl, pH 8.8, 1.5 M (ml)
1.75
1.75
1.75
1.75
SDS 10% (µl)
70
70
70
70
TEMED (µl)
35
35
35
35
APS 10% (µl)
3.5
3.5
3.5
3.5
Componente
STACKING GEL
Per un volume finale di 5 ml:
H2O
3.0 ml
Acrilammide:Bisacrilammide
665 µl
Tris-HCl, pH 6.8, 0.5M
1.25 ml
SDS 10%
50 µl
TEMED
5.0 µl
APS 10%
100 µl
RUNNING BUFFER 1X
TRIZMA-Base
3.0 g
Glicina
15.0 g
SDS 10%
10 ml
Portare ad 1 L con BDW.
TRANSFER BUFFER 1X
TRIZMA-Base
3.0 g
Glicina
15.0 g
Metanolo
20%
Portare ad 1 L con BDW.
53
LAEMMLI BUFFER 2X
Tris-HCl
0.1 M
SDS
4.0%
Bromofenolblu
0.2%
Glicerolo
20%
2-mercapto-etanolo
5.0%
Portare a pH 6.8 con HCl 1 M e portare a volume (10 ml) con BDW.
Fare aliquote monouso da 100 µl e conservare a –20°C.
TBS
Tris-HCl (0.5 M)
7.88 g
NaCl (1.5 M)
8.77 g
Portare a pH 7.5 con NaOH 1 M e portare ad 1 L con BDW.
Procedura:
Prelevare un volume di estratto proteico pari a 50 µg.
Aggiungere un ugual volume di Laemmli buffer 2X.
Bollire i campioni per 10’.
Caricare i campioni ed il marker di pesi molecolari sul gel di poliacrilammide
utilizzando puntali a capillare.
Effettuare la corsa elettroforetica in Running Buffer 1X a 15 mA per 3h a RT.
Equilibrare il gel per 1’ in Transfer Buffer 1X.
Lavare la membrana di nitrocellulosa per 5’ in BDW ed equilibrarla per 1’ in
Transfer Buffer 1X.
Montare l’apparato di trasferimento ed effettuare il trasferimento su membrana in
Transfer Buffer 1X a 250 mA per 2.5h a 4°C.
Smontare l’apparato e colorare la membrana con rosso Ponceau per verificare
l’avvento trasferimento delle proteine.
Decolorare la membrana in PBS.
Lavare la membranea in TBS più Tween 20 allo 0.1% (TBS-T)
Bloccare la membrana in 5% (w/v) latte in polvere in TBS-T per 1h a RT in
leggera agitazione.
54
Lavare la membrana per 1’ in TBS-T.
Incubare la membrana overnight a 4°C in agitazione con l’anticorpo primario
diluito in TBS-T (Vedi Tabella 3).
Fare 3 lavaggi della membrana in TBS-T per 10’ a RT in agitazione.
Incubare la membrana per 1h a RT in agitazione con l’anticorpo secondario
diluito in TBS-T (Vedi Tabella 3).
Rivelare con ECL Advance Western Blotting Detection Kit.
In camera oscura aggiungere una lastre fotografica e, dopo il tempo di
impressionamento ottimale per ciascun anticorpo primario, procedere con lo
sviluppo della lastra fotografica.
Acquisire l’immagine digitale delle lastre tramite Fluor-S MultiImager (Biorad) e
quantificare le bande tramite il software densitometrico Quantity-one (Biorad).
2.9 Estrazione di RNA da linee cellulari e tessuti
Materiali:
Trizol (Invitrogen)
Cloroformio (Carlo Erba)
Isopropanolo (Carlo Erba)
Di-ethyl-pyro-carbonate (DEPC) (Sigma)
Etanolo assoluto (Carlo Erba)
Procedura:
Aggiungere a ciasun pellet cellulare, mantenuto in ghiaccio secco per evitare lo
scongelamento, 700 µl di Trizol.
Risospendere il pellet con una siringa da 2.5 ml ed incubare a RT per 10’.
Aggiungere 140 µl di Cloroformio, miscelare vigorosamente per inversione;
incubare per 3’ a RT.
Centrifugare i campioni a 12500 rpm per 15’ a 4°C.
Prelevare la fase acquosa facendo attenzione a non toccare l’anello bianco di
DNA e riporre il sovranatante in una nuova provetta.
55
Aggiungere 350 µl di Isopropanolo e miscelare delicatamente per inversione (4-6
volte); incubare a RT per 10’.
Centrifugare a 12500 rpm per 10’ a 4°C.
Eliminare sovranatante facendo attenzione a non disturbare il pellet; asciugare i
bordi della provetta con carta assorbente.
Fare un lavaggio del pellet con 700 µl di Etanolo al 70% in acqua DEPC.
Centrifugare i campioni a 7500 rpm per 5’ a 4°C.
Eliminare il sovranatante facendo attenzione a non disturbare il pellet; asciugare i
bordi della provetta con carta assorbente.
Lasciare asciugare il pellet a RT e successivamente risospenderlo in un adeguato
volume di H2O DEPC (10-30 µl).
Quantificare
la
concentrazione
di
RNA
estratto
mediante
lettura
spettrofotometrica utilizzando lo strumento NanoDrop ND-420 (Celbio) e il
software NanoDrop (versione 3.0.0).
NB: Per l’estrazione dell’RNA da tessuto, polverizzare il campione come
descritto nel Paragrafo 2.6. Aggiungere 700 µl di Trizol e procedere come sopra
descritto.
2.10 Real time PCR
La quantificazione di microRNA maturi tramite analisi di Real Time PCR viene
eseguita usando il kit ‘TaqMan MicroRNA Assay’ e prevede due passaggi
principali:
Step 1. Trascrizione inversa (RT). Il filamento di cDNA viene inversamente
trascritto a partire da un campione di RNA totale usando un primer miRNAspecifico con struttura a forcina presente nel kit TaqMan MicroRNA Assay e
utilizzando i reagenti provenienti dal kit ‘TaqMan® MicroRNA Reverse
Transcription’. L’utilizzo di questo primer miRNA-specifico consente di
retrotrascrivere solo il microRNA maturo e non i suoi precursori, i quali
possiedono una complessa struttura secondaria.
56
Step 2. Real time PCR. I campioni di cDNA vengono successivamente
amplificati utilizzando il secondo reagente del kit ‘TaqMan MicroRNA Assay’,
contenente una sonda TaqMan e i primer Forward e Reverse miRNA-specifici,
insieme al reagente ‘TaqMan® Universal PCR Master Mix’.
I due step sono schematizzati in Figura 7.
Step 1
Primer a forcina
MicroRNA maturo
Step 2
Primer Forward
Primer Reverse
Sonda TaqMan
Figura. 7: Procedura di Real time PCR con kit ‘TaqMan MicroRNA Assay’.
Procedura:
•
Step 1
In una provetta da 0.2 ml aggiungere un volume pari a 50 ng di RNA.
Portare i campioni ad un volume di 5 µl con H2O DEPC.
Preparare la mix per la retro-trascrizione utilizzando i reagenti del kit ‘TaqMan®
MicroRNA Reverse Transcription’ ed il Primer 5X contenuto nel kit ‘TaqMan
MicroRNA Assay’, come indicato in Tabella 5.
57
Tabella 5. Mix di retro-trascrizione (1 campione).
Componenti
H2O DEPC
10X Reverse Transcription Buffer
100nM dNTPs
Rnase Inhibitor
MultiScribe reverse transcriptase
Primer 5X
Volume (µl)
4.16
1.5
0.15
0.19
1.0
3.0
Aggiungere 10 µl di mix di retrotrascrizione a ciascun campione di RNA.
Incubare in ghiaccio per 5’.
Posizionare i campioni nel Thermal Cycler ‘GeneAmp PCR system 9700’
(Applied Biosystems) ed eseguire il programma di retrotrascrizione come
riportato in Tabella 6.
Tabella 6. Termociclo per la retrotracsrizione con TaqMan microRNA assay.
Step
1
2
3
4
•
Tempo (min)
30
30
5
∞
Temp (°C)
16
42
85
4
Step 2
Strumento: iCycler iQ™ Real-Time PCR Detection System (Biorad)
Terminata la reazione di retro-trascrizione, porre i campioni di cDNA in ghiaccio
e preparare la mix per la reazione di Real Time PCR come indicato in Tabella 7.
Analizzare ogni campione in triplicato.
Tabella 7. Composizione mix di Real time PCR con ‘TaqMan microRNA
assay’ (1 campione).
Componenti
H2O DEPC
TaqMan 2X Universal PCR master mix
TaqMan MicroRNA Assay Probe 20X
58
Volume (µl)
7.67
10.0
1.0
NB: Ricoprire il tubo contenente la sonda TaqMan con carta stagnola e tenere al
buio.
Aggiungere 18.67 µl della master mix in ogni pozzetto della piastra.
Aggiungere 1.33 µl di cDNA a ciascun pozzetto.
Coprire la piastra con il coperchio adesivo e centrifugarla brevemente (2000 rpm,
30’’).
Impostare lo schema corrispondente alla piastra di reazione tramite il software
iCycler iQ Detection System Versione 3.0 (Biorad).
Impostare il programma di amplificazione come riportato in Tabella 8.
Tabella 8. Termociclo di Real time PCR con ‘TaqMan microRNA assay’.
Step
Attivazione
dell’enzima
ampliTaq gold
Tempo (sec)
Temperatura
(°C)
Real Time PCR
Cicli (N=40)
Denaturazione Annealing/Estensione
600
95
15
95
60
60
Posizionare la piastra nella macchina di Real Time PCR e far partire la corsa.
Analizzare i dati su foglio Excel tramite metodo del 2-(∆∆Ct), utilizzando come
gene housekeeping la subunità ribosomale, U6RNA.
2.11 Trascrizione inversa
Questo procedura consente di sintetizzare cDNA a singolo filamento a partire da
un campione di RNA totale.
Strumento: GeneAmp PCR system 9700 (Applied Biosystems)
Kit: ImProm-II™ Reverse Transcription System (Promega)
59
Procedura:
In una provetta da 0.2 ml aggiungere un volume pari ad 1 µg di RNA e portare il
campione ad un volume di 5 µl con H2O DEPC.
Aggiungere ad ogni campione 1 µl della seguente mix di reazione:
PRIMER MIX (1 campione)
Oligo-dT Primer
0.5 µl
Random Primers
0.5 µl
Incubare a 70°C per 5’.
Raffreddare a 4°C per 5’.
Aggiungere ad ogni campione 15 µl della mix di retrotrascrizione (Tabella 9).
Tabella 9. Composizione mix di retro-trascrizione (1 campione).
Componenti
Volume (µl)
Conc. finale
H2O DEPC
6.6
Improm-II 5X Buffer
4.0
MgCl2 (25 mM)
2.4
3.0 mM
dNTPs mix (10mM)
1.0
0.5 mM
RNasin Inhibitor
0.5
Improm-II RT
0.5
Posizionare i campioni nel Thermal Cycler ed eseguire il programma di
retrotrascrizione come riportato in Tabella 10.
Tabella 10. Termociclo di retrotrascrizione.
Step
1
2
3
4
Tempo (min)
5
60
15
∞
Temp (°C)
25
42
70
4
Conservare i campioni di cDNA a –20°C.
60
2.12 PCR semi-quantitativa
La PCR è stata utilizzata per analizzare variazioni dell’espressione genica di
mRNA di interesse in seguito a specifici trattamenti cellulari o nei campioni di
tessuto provenienti da HCC. Tutte le PCR sono state condotte in un range lineare
di amplificazione, consentendo un’analisi semi-quantitativa dell’espressione
genica. La β-actina è stata utilizzata come gene housekeeping per la
normalizzazione dei campioni. L’intensità delle bande è stata misurata utilizzando
il Software Quantity-One (Biorad).
Le coppie di primer utilizzate e le condizioni di PCR sono riportate in Tabella 11.
Tabella 11. Coppie di primers utilizzate. Nella tabella sono riportate le
sequenze dei primer utilizzati con le corrispondenti lunghezze (L)
dell’amplificato, temperature di annealing (Ta) e numero di cicli (N) di
amplificazione.
Gene
Sequenza Primer
Cyclin G1
Fw 5’-AATGAAGGTACAGCCCAAGCA-3’
Rv 5’-GCTTTGACTTTCCAACACACC-3’
Fw 5’-TCCTCAGCCCTCGCTCTC-3’
Rv 5’-TTGTCTCCGCCGGCTCGTA-3’
Fw 5’-TGCTTCAGGGTTTCATCCAG-3’
Rv 5’-TCATCCTCTGCAGCTCCATG-3’
Fw 5’-TCCTGGGCAGAGTGAATTTTGA-3’
Rv 5’-GCGTGAGAGAAGAGAGTGTATGTGG-3’
Fw 5’-GGCCTCTGATCTCCGATTTCT-3’
Rv 5’- -CACTTTGGGACCAGTGTACCTTCT-3’
Fw 5’-TAACCCGGGACTTGGAGAAG-3’
Rv 5’-GCTTCTTGGGCGTCTGCTC-3’
Fw 5’-ATGGAGCCATCTCAGTGTGTG-3’
Rv 5’-CCCCGTTCCTGTTCTCTTCT-3’
Fw 5’-ACATGCAGCTGTCCTGGTTC-3’
Rv 5’-TGAGGCTTCTGCATCTCCTT-3’
Fw 5’-AGGGCAGTGCAGCATGTAGT -3’
Rv 5’-GATGATTCCCTCGGTCAGAA-3’
Fw 5’-AAGACCATGTGGACCTGTCA-3’
Rv 5’-GGCTTCCTCTTGGAGAAGAT-3’
Fw 5’-CAAGAATGGCCACGGCTGCT-3’
Rv 5’-TCCTTCTGCATCCTGTCGGCA-3’
Puma
Bax
E-caderina
p57
p27
Bmf
mTOR
c-Met
p21
ß-actin
Amp (bp)
(L)
195
Ta
(C°)
63
Cicli
(N)
27
197
61
31
162
61
31
550
56
29
375
63
28
449
62
30
540
56.5
30
201
61
29
200
61
29
174
55
30
275
55
25
Aggiungere in provette da 0.2 ml 24 µl della mix di PCR (Tabella 12) ed 1 µl di
cDNA.
61
Tabella 12. Composizione mix di PCR (1 campione).
Componenti
Volume (µl)
Concentrazione
finale
H2O DEPC
15.0
Gold Buffer (10X)
2.5
1X
MgCl2 (25 mM)
2.5
2.5 mM
dNTPs mix (2.5 mM)
1.75
0.175 mM
Primer F
1.0
400 nM
Primer R
1.0
400 nM
Taq Gold (Applied Biosystems)
0.25
cDNA
1.0
Posizionare le provette da 0.2 ml nel Thermal Cycler GeneAmp PCR system 9700
(Applied Biosystems) ed impostare il termociclo utilizzando le temperature di
annealing (Ta) ed il numero di cicli (N) riportati in Tabella 11.
Termociclo:
1. 95°C
10’ attivazione Taq Gold
2. 95°C
30’’ denaturazione
3. Ta°C
30’’ annealing
4. 72°C
30’’-1.0’ elongazione
5. Step 2 per N volte
6. 72°C
7’ elongazione finale
7. 4°C
for ever
8. end
Il prodotto amplificato è stato sottoposto a corsa elettroforetica in gel di Agarosio
al 2.0% con Etidio Bromuro allo 0.01%. La corsa è stata eseguita in TBE 1X
(Sigma) a 120V per 45’.
Le immagini digitali delle bande sono state acquisite con Fluor-S MultiImager e
l’analisi quantitativa del segnale è stata condotta con il software Quantity-one
(Biorad).
62
2.13 Clonaggi
In questo lavoro di tesi è stata utilizzata la tecnica del clonaggio per l’inserimento
di regioni 3’UTR a valle del gene reporter contenuto all’interno del plasmide
pGL3 Control Vector. L’inserimento dei siti di restrizione ad entrambe le
estremità della regione 3’UTR è stato ottenuto tramite amplificazione del
frammento con primer specifici contenenti all’estremità 5’ i sei nucleotidi
corrispondenti alla sequenza consensus dell’enzima XbaI. I primer utilizzati sono
riportati in Tabella 13. Il frammento amplificato tramite PCR è stato ligato
all’interno del vettore TA-cloning, pGEM-T Easy Vector, la cui mappa è riportata
in Figura 8. Il vettore pGEM ricombinante è stato sottoposto a digestione
enzimatica con XbaI ed il frammento purificato da gel di Agarosio. Il frammento
corrispondente alla regione 3’UTR è stato successivamente clonato all’interno del
vettore pGL3 Control Vector, utilizzando il sito unico di restrizione XbaI. La
mappa di pGL3 Control Vector è riportata in Figura 9. Il costrutto plasmidico così
ottenuto è stato utilizzato per l’esecuzione del saggio di Luciferasi (Paragrafo
2.14).
63
Materiali:
•
•
Enzimi di restrizione
Tipo
Produttore
XbaI
Invitrogen
EcoRI
Invitrogen
Enzimi vari
Tipo
Produttore
AmpliTaq Gold
Applied Biosystems
Calf Intestinal Alkaline Phosphatase (CIAP) 20 U/µl
Promega
T4 DNA ligase 3U/µl
•
Plasmidi
Tipo
•
Produttore
pGEM
Promega
pGL3
Promega
Farmaci
Tipo
Produttore
Ampicillina
•
Invitrogen
Sigma
Tipi cellulari
Tipo
Produttore
JM109 batteri competenti
Promega
64
Figura 8: Mappa del plasmide pGEM-T Easy Vector. Il plasmide contiene
due CDS (Ampr: che codifica per l’enzima ß-lattamasi; lacZ: che codifica per
l’enzima β-galattosidasi), un’origine di replicazione di origine fagica (f1 ori),
un’origine (ori) per la replicazione in E. coli. Il plasmide è stato linearizzato
con l’enzima di restrizione EcoRV alla base 60 e le basi T sono state aggiunte
a ciascuna estremità 3’.
Figura 9. Mappa del plasmide pGL3 Control Vector. Il plasmide contiene
2 CDS (Ampr: che codifica per l’enzima ß-lattamasi; luc+: che codifica per la
luciferasi di Lucciola), un’origine di replicazione di origine fagica (f1 ori),
un’origine (ori) per la replicazione in E. coli.
65
•
Terreni di coltura
LB liquido (1 L) :
-LB broth base (Invirogen) 20.0 g
-Portare a volume con BDW
LB Agar (1 L) :
-LB Agar (Invirogen) 32.0 g
-Portare a volume con BDW
SOC (1 L) :
-Tryptone (Sigma) 20 g
-Yest Extract (Sigma) 5 g
-NaCl (Sigma) 0.5 g
-Sciogliere in 950 mL H2O
-Glucosio (Sigma) 20mM
-Aggiungere 10 mL di soluzione KCl (Carlo Erba) 250 mM
-Portare a pH 7.0 con NaOH (Carlo Erba) 5N
-Portare a volume con BDW
•
Gel d’agarosio
-Agarose (Amresco) da 0.8% a 2.0%
-TAE 1X
TAE 5X (1 L):
-Tris Base (Sigma) 242 g
-Acido Acetico Glaciale (Sigma) 57.1 mL
-EDTA (Sigma) pH 8, 0.5M, 100ml
-Portare a volume con BDW
Marker
Bench Top 100 bp DNA ladder (Promega)
66
Metodi:
Tabella 13. Coppie di primer utilizzate per l’amplificazione di regioni 3’UTR
di Ciclina G1, CDKN1C/p57, Bmf, mTOR. Nella tabella sono riportate le
sequenze dei primer utilizzati nelle PCR con le corrispondenti lunghezze (L)
dell’amplificato, temperature di annealing (Ta) e numero di cicli (N) di
amplificazione.
Regione da
clonare
Ciclina G1
3’UTR
CDKN1C/p57
3’UTR
Bmf
3’UTR
mTOR
3’UTR
Sequenze Primer
L (bp)
Fw 5’-TTTCTAGAAAACAGGTGACATTTGTATC-3’
Rv 5’-TTGTCTAGATTACCTCTGCCAAC-3’
Fw 5’-TCTAGAGCCCAAAGAGCCC-3’
Rv 5’-TCTAGAGATTAAACATTTTATATAAATGAC-3’
Fw 5’-TTTCTAGAAGTTGGTCAACAGATCTG-3’
Rv 5’-ATGTCTAGAACATAAACACATAAAGCC-3’
Fw 5’-CTTTCTAGAAACTGGAGGCCCAG-3’
Rv 5’-TGGTGTCTAGACATGGCTACACTTTATAC-3’
Mix di PCR, vedi Tabella 12.
Termociclo:
1. 95°C
10’ attivazione AmpliTaq Gold
2. 95°C
30’’ denaturazione
3. Ta°C
30’’ annealing
4. 72°C
1.0’ elongazione
5. step 2 per 34 volte
6. 72°C
7’ elongazione finale
7. 4°C
for ever
8. end
•
Protocollo di ligasi
Tabella 14. Composizione mix di ligasi (1 campione).
Componenti
H2O DEPC
Buffer 2X
pGEM/pGL3 vector
(50 ng/µl)
DNA*
T4 DNA ligase
Volume (µl)
2 µl
5.0
1.0
1.0
1.0
*Prodotto di PCR per la ligasi in pGEM vector.
*DNA eluito da gel di agarosio per la ligasi in pGL3 vector.
Incubare la mix di ligasi 1h a RT.
67
744
Ta
(C°)
58
Cicli
(N)
35
295
56
35
977
60
35
908
58
35
•
Protocollo di trasformazione batterica
-
Trasferire in una provetta da 15 ml con fondo tondeggiante 100 µl di
batteri competenti JM109 e mantenere in ghiaccio.
-
Aggiungere ai batteri 2 µl di mix di ligasi.
-
Incubare 20’ in ghiaccio.
-
Incubare 1’ a 42°C.
-
Incubare 2’ in ghiaccio.
-
Aggiungere 900 µl di SOC freddo.
-
Incubare 1.5h a 37°C, 225 rpm.
-
Piastrare separatamente 100 µl e 900 µl di sospensione batterica in piastre
contenenti LB Agar + Ampicillina 100 µg/ml.
-
Incubare a 37°C per 16h.
•
Protocollo per mini prep
Buffer P1 :
-Tris-HCl pH 8
-EDTA
-RNase A
NB: aggiungere RNase A al momento dell’uso.
50 mM
10 mM
100 µg/ml
Buffer P2 :
-NaOH
-SDS
200 mM
1%
Buffer P3 :
-Potassio acetato
-Portare a pH 5.5
3.0 M
Buffer TE :
-Tris-HCl, pH 8.0
-EDTA
10 mM
1.0 mM
-
Inoculare una singola colonia in 2 ml di LB + Ampicillina 100 µg/ml.
-
Incubare a 37°C, 225 rpm, per 16h.
-
Trasferire 1.0 ml della coltura batterica in una provetta da 1.5 ml,
conservare il restante 1 ml di coltura a + 4°C.
-
Centrifugare la coltura batterica a 13000 rpm per 2’.
68
-
Eliminare il sovranatante.
-
Risospendere il pellet batterico in 100 µl di Buffer P1 freddo, a cui è stata
aggiunta RNase A 100 µg/ml.
-
Risospendere il pellet vortexando.
-
Aggiungere 200 µl di Buffer P2.
-
Risospendere per inversione, incubare 5’ a RT.
-
Aggiungere 165 µl di Buffer P3 freddo.
-
Risospendere per inversione.
-
Centrifugare a 13000 rpm per 8’.
-
Trasferire il sovranatante in una provetta da 1.5 ml.
-
Aggiungere 450 µl di isopropanolo.
-
Risospendere per inversione.
-
Centrifugare a 13000 rpm per 8’.
-
Eliminare il sovranatante.
-
Fare un lavaggio con 500 µl di etanolo al 70%.
-
Centrifugare a 13000 rpm per 5’.
-
Eliminare il sovranatante.
-
Asciugare il pellet per 10’ a RT.
-
Risospendere il pellet in 20 µl di Buffer TE.
-
Digerire i DNA plasmidici con gli enzimi di restrizione per verificare la
presenza dell’inserto.
•
Protocolli di digestione enzimatica
Dopo miniprep
Enzimi XbaI/EcoRI
Componenti
H2O DEPC
Buffer 10X
DNA plasmidico
Enzima di restrizione
Volume (µl)
14.5
2.0
3.0
0.5
Incubare 2h a 37°C.
Analizzare le digestioni dei DNA plasmidici tramite corsa elettroforetica su
gel di Agarosio in TAE, 0.01% Etidio-Bromuro, a 120V per 45’.
Selezionare il clone batterico contenente l’inserto, amplificarlo e purificare il
DNA plasmidico tramite maxi prep.
69
•
Protocollo per maxi prep Qiagen
-
Inoculare 100 µl della sospensione batterica del clone selezionato in 200
ml di LB + Ampicillina 100 µg/ml.
-
Incubare 16 h a 37°C, 225 rpm.
-
Centrifugare la sospensione batterica a 4000 rpm per 15’ a + 4°C.
-
Eliminare il sovranatante.
-
Risospendere il pellet batterico in 10 ml di Buffer P1 freddo, a cui è stata
aggiunta RNase A 100 µg/ml.
-
Risospendere il pellet vortexando.
-
Aggiungere 10 ml di Buffer P2.
-
Risospendere per inversione, incubare 5’ a RT.
-
Aggiungere 10 ml di Buffer P3 freddo.
-
Risospendere per inversione, incubare in ghiaccio per 20’.
-
Centrifugare a 12000 rpm per 30’.
-
Trasferire il sovranatante in un nuovo tubo.
-
Centrifugare a 12000 rpm per 15’.
-
Equilibrare una colonna QIAGEN-tip 500 con 10 ml di Buffer QBT.
-
Aggiungere il sovranatante alla colonna e lasciare entrare nella resina per
gravità.
-
Fare 2 lavaggi con 30 ml di Buffer QC.
-
Fluire con 15 ml di Buffer QF.
-
Precipitare il DNA plasmidico aggiungendo 10.5 ml di isopropanolo.
-
Mischiare per inversione e centrifugare a 8000 rpm per 15’.
-
Eliminare il sovranatante.
-
Fare un lavaggio con 5.0 ml di etanolo al 70%.
-
Centrifugare a 8000 rpm per 10’.
-
Eliminare il sovranatante.
-
Asciugare il pellet per 10 minuti a RT.
-
Rispendere il pellet in 200 µl di TE.
-
Conservare il DNA plasmidico a –20°C.
70
•
Protocolli di digestione enzimatica
Dopo maxiprep
Enzima XbaI
Componenti
Volume (µl)
H2O DEPC
14.0
Buffer 10X
2.0
DNA plasmidico (1 µg/µl)
1.0
Enzima di restrizione
3.0
Incubare 2h a 37°C.
NB: Per la linearizzazione del plasmide pGL3 Control vector aggiungere 1 µl
di CIAP ed incubare per altri 5’ a 37°C.
Analizzare le digestioni dei DNA plasmidici tramite corsa elettroforetica su
gel di Agarosio in TAE, 0.01% Etidio-Bromuro, a 120V per 45’.
Procedere all’eluizione dell’inserto da gel.
•
Eluizione di DNA da gel di agarosio
Kit: Wizard® SV Gel and PCR Clean-Up System (Promega).
-
Pesare una provetta da 1.5 ml con bilancia analitica.
-
Visualizzare il DNA usando una lamapada UV a bassa lunghezza d’onda
ed excidere la banda d’interesse con un bisturi monouso.
-
Trasferire la il frammento di gel contenente il DNA nella provetta prepesata e ri-pesare la provetta. Fare la tara per calcolare il peso del gel.
-
Aggiungere Membrane Binding Solution in un rapporto di 10 µl ogni 10
mg di gel di agarosio.
-
Vortexare ed incubare a 50°C per 10’ o fino che il gel è completamente
sciolto.
-
Trasferire la miscela contenente il gel disciolto in una SV Minicolumn
posta in una provetta di raccolta.
-
Centrifugare a 14000 rpm per 1’ a RT.
-
Eliminare il liquido di scarto.
-
Fare un lavaggio con 700 µl Membrane Wash Solution.
-
Centrifugare a 14000 rpm per 1’ a RT.
-
Eliminare il liquido di scarto.
-
Ripetere il lavaggio con 500 µl Membrane Wash Solution.
71
-
Centrifugare a 14000 rpm per 1’ a RT.
-
Eliminare il liquido di scarto.
-
Trasferire la colonnina in una provetta da 1.5 ml.
-
Aggiungere 30 µl di H2O DEPC al centro della colonna.
-
Incubare 1’ a RT.
-
Centrifugare a 14000 rpm per 1’ a RT.
-
Analizzare la qualità e la quantità del DNA eluito da gel tramite corsa
elettroforetica su gel di Agarosio in TAE 1X, 0.01% Etidio-Bromuro, a
120V per 45’.
-
Eseguire la ligasi del frammento eluito da gel in pGL3 vector linearizzato
con l’enzima XbaI come indicato in Tabella 14. Procedere con i protocolli
di trasformazione batterica, mini prep come sopra descritto.
•
PCR di direzionalità in vettore pGL3
Poiché il frammento 3’UTR viene clonato nel vettore pGL3 utilizzando un unico
sito di restrizione, XbaI, per la scelta del vettore ricombinante con il frammento
inserito in direzione 5’->3’ è necessario sottoporre i DNA plasmidici estratti
tramite mini prep a 2 PCR di direzionalità. Per l’esecuzione delle PCR di
direzionalità il primer Forward utilizzato per il clonaggio della regione 3’UTR è
sato accoppiato con il primer Reverse che riconosce la sequenza del plasmide
pGL3 Control Vector in prossimità del sito di restrizione XbaI (Tabella 15), e
viceversa. Solo i cloni in cui il frammento 3’UTR si è inserito in direzione 5’->3’
daranno luogo ad un amplificato in entrambe le PCR di direzionalità. La
lunghezza dell’amplificato dipenderà dalla lunghezza della regione clonata in
pGL3 vector.
72
Tabella 15. Coppia di primer per il plasmide pGL3 Control Vector. Nella
tabella sono riportate le sequenze dei primer con la corrispondente lunghezza (L)
dell’amplificato, temperatura di annealing (Ta) e numero di cicli (N) di
amplificazione.
Vettore
Sequenze Primer
L (bp)
pGL3 Control
Vector
Fw 5’-AGGAGTTGTGTTTGTGGACGAAGTACCG-3’
Rv 5’-TCACTGCATTCTAGTTGTGGTTTGTCC-3’
199
Ta
(C°)
60
Cicli
(N)
35
Mix di PCR, vedi Tabella 12.
Termociclo:
1. 95°C
10’ attivazione AmpliTaq Gold
2. 95°C
30’’ denaturazione
3. 60°C
30’’ annealing
4. 72°C
1.0’ elongazione
5. step 2 per 34 volte
6. 72°C
7’ elongazione finale
7. 4°C
for ever
8. end
Analizzare gli amplificati tramite corsa elettroforetica su gel di Agarosio in TAE
1X, 0.01% Etidio-Bromuro, a 120V per 45’.
Scegliere il clone con il frammento inserito in direzione 5’->3’ e procedere
all’amplificazione ed alla purificazione del vettore tramite maxi prep, come sopra
descritto.
2.14 Saggio di luciferasi
Kit: Dual Luciferase Assay (Promega)
Strumento: Luminometro GLOMAX (Promega)
Passive Lysis Buffer
Aggiungere un volume di Passive Lysis Buffer (5X) a 4 volumi di BDW.
Preparare fresco.
Luciferase Assay Reagent II (LAR II)
Risospendere il liofilizzato Luciferase Assay Substrate in 10 ml di Luciferase
Assay Buffer II. Fare aliquote da 650 µl e conservare a –80°C.
73
Stop&Glo Reagent
Aggiungere un volume di Stop&Glo Substrate (50X) a 50 volumi di Stop&Glo
Buffer. Preparare fresco.
Procedura:
Dopo 24h dalla trasfezione cellulare (Paragrafo 2.5), eliminare il sovranatante da
ciascun pozzetto (piastra da 24 pozzetti).
Fare un lavaggio con 500 µl di PBS.
Aggiungere 100 µl di Passive Lysis Buffer a ciascun pozzetto.
Incubare per 15’ a temperatura ambiente in leggera agitazione.
Raccogliere i lisati cellulari in provette da 1.5 ml e mantenere in ghiaccio.
Accendere il luminometro ed impostare il seguente programma:
-
Periodo di ritardo pre-misura del campione: 2’’
-
Periodo di misura del campione: 10’’
Aggiungere 100 µl di LAR II a ciascun tubo da 1.5 ml.
Aggiungere 20 µl di campione al primo tubo ed effettuare la lettura.
Trascrivere il valore fornito dal luminometro.
Aggiungere 100 µl di Stop&Glo Reagent, vortexare il campione ed effettuare la
seconda lettura.
Trascrivere il valore fornito dal luminometro.
Eseguire la lettura di tutti i campioni procedendo come sopra.
2.15 Citofluorimetria a flusso
Strumento: FACSAria cell sorter (BD Biosciences)
•
Analisi del ciclo cellulare con Propidio Ioduro (PI)
Materiali:
Propidio Iodide Solution 1.0 mg/ml (Sigma)
RNase A (Sigma)
Etanolo assoluto (Carlo Erba)
74
Procedura:
Tripsinizzare le cellule e raccoglierle in una provetta da 15 ml.
Centrifugare a 1200 rpm per 5’ a RT.
Eliminare il sovranatante e fare un lavaggio con 1 ml di PBS.
Risospendere le cellule in 1 ml di PBS.
Aggiungere goccia a goccia 2.5 ml di etanolo assoluto freddo, vortexando il
campione durante l’aggiunta per non far precipitare le cellule.
Fissare le cellule per 16h a –20°C.
Centrifugare a 1200 rpm per 5’ a RT.
Fare un lavaggio in PBS.
Risospendere le cellule in 500 µl di PBS contenenti 100 µg/ml di RNase A e 5
µl di PI.
Incubare per 30’ a RT al buio.
Centrifugare a 1200 rpm per 5’ a RT.
Risospendere in 500 µl di PBS.
Leggere al FACS.
•
Analisi dell’apoptosi
Kit: Annexin V/Propidium Iodide detection kit (Bender MedSystems).
Procedura:
Tripsinizzare le cellule e raccoglierle in una provetta da 15 ml.
Centrifugare a 1200 rpm per 5’ a RT.
Eliminare il sovranatante e fare un lavaggio con 1 ml di PBS.
Risospendere le cellule in 1 ml di PBS.
Contare le cellule con camera di Bunker.
Risospendere le cellule in PBS ad una concentrazione di 500000 cellule/ml.
Prelevare 195 µl di sospensione cellulare e trasferirle in una provetta da 1.5
ml.
Aggiungere 5.0 µl di anticorpo anti-Anexina marcato con FITC.
Incubare in theromixer per1h a 22°C, 400rpm.
Cenrifugare 5’ a 1500 rpm, RT.
Eliminare il sovranatante.
75
Risospendere il pellet in 190 µl di Binding Buffer (1X) + 10 vl di PI.
Analizzare al FACS.
2.16 Saggio di invasione cellulare
Materiali:
ECM gel (Matrigel) (Sigma)
Boyden blind-well chambers (New Technologies Group)
Poly-vinyl-pyrrolidone free polycarbonate filters (Neuro Probe)
Etanolo assoluto (Carlo Erba)
Giemsa Solution (Sigma)
Procedura:
Disporre i filtri con la parte opaca rivolta verso l’alto in una piastra Petri.
Aggiungervi 50 µl di una soluzione acquosa di Matrigel (1.0 mg/ml) e lasciare
asciugare.
Tripsinizzare le cellule e raccoglierle in una provetta da 15 ml.
Centrifugare a 1200 rpm per 5’ a RT.
Eliminare il sovranatante e fare un lavaggio con 1 ml di PBS.
Risospendere le cellule in 1 ml di terreno senza siero.
Contare le cellule con camera di Burker.
Risospendere le cellule in terreno senza siero ad una concentrazione di 30-50000
cellule/ml.
Prelevare 100 µl di sospensione cellulare e trasferirle in una provetta da 1.5 ml.
Aggiungere alla sospensione cellulare 100 µl di terreno senza siero.
Aggiungere 35 µl di terreno con 30% FBS nella parte inferiore della cameretta di
Boyden e posizionare il filtro con la parte ricoperta dal Matrigel rivolta verso
l’alto. Chiudere la cameretta di Boyden con l’apposito tappo a vite.
Aggiungere 200 µl della sospensione cellulare nella parte superiore della
cameretta di Boyden.
Incubare per 24-48h in incubatore a 37°C, 5% CO2.
76
Smontare le camerette di Boyden, recuperare il filtro e posizionarlo con la parte
lucida rivolta verso l’alto su di un supporto di polistirolo, fissarlo con un ago da
siringa.
Fissare le cellule con etanolo assoluto per 1’ a RT.
Lavare i filtri con abbondante H2O distillata.
Diluire 1:10 la soluzione di Giemsa in H2O distillata e filtrare con filtro da 0.2
µm.
Ricoprire i filtri con la soluzione di Giemsa ed incubare 20’ a RT.
Lavare i filtri con abbondante H2O distillata.
Posizionare i filtri su di un vetrino porta-oggetti con la parte lucida, contenente le
cellule che hanno migrato, rivolta verso il basso.
Lasciare asciugare i filtri per 15’ a RT.
Pulire la parte opaca dei filtri, contenenti le cellule che non hanno invaso lo strato
di matrice, con un cotton fioc.
Aggiungere una goccia di montante (DPX Mountant for hystology, Fluka) e
posizionare un vetrino copri-oggetto sopra il filtro.
Osservare al microscopio e contare le cellule in 10 campi random ad un
ingrandimento 25X.
77
CAPITOLO 3
RISULTATI
78
3.1
Individuazione
di
un
pannello
di
microRNA
deregolati
nell’epatocarcinoma umano tramite analisi di microarray
Nell’ultimo decennio è stato ampiamente dimostrato il ruolo dei microRNA
nello sviluppo e nella progressione tumorale (72). Analisi ‘genome-wide’
attraverso l’utilizzo di piattaforme microarray hanno evidenziato la presenza di
firme molecolari di microRNA cancro-specifiche, in grado di differenziare i
tessuti di natura tumorale dalle loro controparti di tipo normale (40).
Allo scopo di individuare un pannello di microRNA deregolati nel carcinoma
epatocellulare, abbiamo eseguito un’analisi di microarray di miRNA su 17 tessuti
di carcinoma epatocellulare (HCC) e 21 tessuti provenienti da fegato cirrotico
(CE). Dal momento che, nei paesi occidentali, l’epatocarcinoma insorge nell’80%
dei casi su di un fegato con cirrosi epatica cronca (73), abbiamo deciso di
analizzare come gruppo di controllo campioni provenienti da fegato cirrotico e
non da fegato sano, in quanto più rappresentativi della patologia. Le
caratteristiche dei pazienti arruolati in questo studio sono elencate in Tabella 16.
79
Tabella 16. Caratteristiche di pazienti con epatocarcinoma arruolati per
l’analisi di microarray, Northern blot e Real time PCR.
Genere
1
Eziologia
2
Focalità
Dimensioni
3
Grado
Alfa-feto
4
proteina
Maschio
Femmina
HCV
HCV+BAb
HBV+HCV
HBV
Etanolo
HCV+Etanolo
HBV+Etanolo
Bab
Criptogenica
Unifocal
Multifocal
≤ 3 cm
> 3 cm
G1
G2
G3
G4
≤ 20 ng/dL
20-400 ng/dL
> 400 ng/dL
45
15
31
6
5
5
3
2
1
1
6
42
18
16
44
1
20
32
7
26
19
15
1) HBV: Virus Epatite B; HCV: Virus Epatite B; BAb: anticorpi contro HBV; Etanolo: storia di
abuso di alcol; Criptogenici sono quei casi in cui sono stati esclusi: infezioni virali, abuso di alcol,
emocromatosi, patologia di Wilson, deficienza di α1-anti-tripsina, cirrosi biliare primaria, epatite
autoimmune e colangite sclerosante primaria.
2) Uni-o multifocalità è stata assegnata sulla base di tecniche di imaging precedenti l’intervento
chirurgico.
3) Grado di HCC è stato assegnato attraverso i criteri di Edmonson e Steiner’s (74).
4) Livelli di alfa-fetoproteina sono stati misurati prima dell’intervento.
Per l’analisi del profilo di espressione dei miRNA è stata utilizzta una
piattaforma microarray contenente 381 sonde per il riconoscimento di 238
microRNA umani maturi e 143 precursori di miRNA (75). In seguito
all’ibridazione dei campioni su chip ed all’acquisizione dei dati è stata eseguita
una complessa analisi statistica tra i due gruppi di campioni posti a confronto
(vedi Paragrafo 2.2), la quale ha consentito di individuare un pannello di miRNA
deregolati nell’epatocarcinoma umano. Da tale analisi 35 miRNAs sono risulatati
essere differenzialmente espressi nei campioni di HCC rispetto ai campioni
provenienti da fegato cirrotico (Tabella 17).
80
Tabella 17. MicroRNA differenzialmente espressi tra tessuti di HCC e CE.
MicroRNA
Simbolo
Mappa
Rapporto
medio HCC/CE
(a)
Regulazione
Up o Down
in HCC
P-value
(b)
let-7a-1
MIRNLET7A1
9q22.2
0,68
DOWN
0,0127
let-7a-2
MIRNLET7A2
11q24.2
0,59
DOWN
0,0136
let-7a-3
MIRNLET7A3
22q13.3
0,63
DOWN
0,0160
let-7b
MIRNLET7B
22q13.3
0,74
DOWN
0,0149
let-7c
MIRNLET7C
21q11.2
0,62
DOWN
0,0193
let-7d
MIRNLET7D
9q22.2
0,66
DOWN
0,0168
let-7d
MIRNLET7D
9q22.2
0,70
DOWN
0,0307
let-7e
MIRNLET7E
19q13.4
0,77
DOWN
0,0245
let-7f-2
MIRNLET7F2
Xp11.2
0,70
DOWN
0,0356
let-7g
MIRNLET7G
3p21.3
0,71
DOWN
0,0307
miR-122a
MIRN122A
18q21
0,63
DOWN
0,0135
miR-124a-2
MIRN124A2
8q12.2
0,69
DOWN
0,0135
miR-130a
MIRN130A
11q12
0,50
DOWN
0,0339
miR-132
MIRN132
17p13.3
0,75
DOWN
0,0152
miR-136
MIRN136
14q32
0,58
DOWN
0,0191
miR-141
MIRN141
12p13
0,74
DOWN
0,0389
miR-142
MIRN142
17q23
0,51
DOWN
0,0082
miR-143
MIRN143
5q32-33
0,72
DOWN
0,0127
miR-145
MIRN145
5q32-33
0,53
DOWN
0,0126
miR-146
MIRN146A
5q34
0,59
DOWN
0,0439
miR-150
MIRN150
19q13
0,47
DOWN
0,0101
miR-155(BIC)
MIRN155
21q21
0,57
DOWN
0,0168
miR-181a-1
MIRN213
1q31.2-q32.1
0,68
DOWN
0,0439
miR-181a-2
MIRN181A
9q33.1-34.13
0,64
DOWN
0,0439
miR-181c
MIRN181C
19p13.3
0,67
DOWN
0,0339
miR-195
MIRN195
17p13
0,75
DOWN
0,0307
miR-199a-1-5p
MIRN199A1
19p13.2
0,45
DOWN
0,0100
miR-199a-2-5p
MIRN199A2
1q24.3
0,43
DOWN
0,0082
miR-199b
MIRN199B
9q34
0,49
DOWN
0,0082
miR-200b
MIRN200B
1p36.33
0,69
DOWN
0,0120
miR-200b
MIRN200B
1p36.3
0,74
DOWN
0,0135
miR-214
MIRN214
1q23.3
0,59
DOWN
0,0124
miR-221
MIRN221
Xp11.3
1,49
UP
0,0339
miR-223
MIRN223
Xq12-13.3
0,44
DOWN
0,0135
pre-mir-594
MIRN594
7q34
0,55
DOWN
0,0500
a. P-value derivante da Analysis of Variance (ANOVA nel software Genespring)
b. I dati di microarray di HCC, per ogni microRNA, sono stati normalizzati utilizzando il tessuto
di fegato cirrotico proveniente dallo stesso paziente; se non disponibile, il valore è stato
normalizzato utilizzando la media dei tessuti di CE.
81
Utilizzando questo pannello di miRNA deregolati nell’HCC, è stata effettuata
un’analisi di raggruppamento gerarchico la quale ha consentito di ottenenere una
buona separazione tra i campioni di HCC e di CE (Figura 10). In particolare sono
emersi due gruppi principali di raggruppamento, uno rappresentato in prevalenza
da campioni di HCC e l’altro da campioni di fegato cirrotico. Qualche campione
di HCC e di CE è stato incluso nel raggruppamento sbagliato, probabilmente a
causa del fatto che i campioni analizzati tendono a raggrupparsi sulla base del
profilo individuale del paziente invece che sulla base del tipo di tessuto. I
campioni di HCC inclusi nei 2 differenti raggruppamenti non mostrano differenze
significative di eziologia, focalità, dimensioni, grado ed espressione di alfafetoproteina (AFP), un marcatore circolante di carcinoma epatocellulare.
Sofisticate analisi statistiche hanno consentito di evidenziare che la firma
molecolare di miRNA è in grado di predire correttamente la maggior parte dei
campioni di HCC e di CE, con un’accuratezza dell’86% (algoritmo PAM) (70) e
del 91% (algoritmo SVM) (71).
82
Figura 10. Classificazione di tessuti di HCC e CE in base alla signature di
35 miRNA. File: microRNA. Colonne: campioni biologici. Per ogni miRNA,
il colore rosso significa un valore di espressione più alto del valore di
espressione medio tra tutti i campioni, mentre verde significa un valore di
espressione più basso. Nella barra in basso i campioni di HCC sono
rappresentati con un quadrato blu, mentre le CE con un quadrato azzurro.
3.1.1 Validazione dell’analisi di microarray tramite Northern blot
Allo scopo di validare i dati ottenuti dall’analisi di microarray e di ampliare la
casistica dei pazienti sottoposti a resezione epatica per HCC, sono state utilizzate
due tecnologie alternative, Northern blot e Real time PCR. Entrambe le
metodologie utilizzate sono in grado di quantificare, in maniera relativa, i livelli
di espressione dei microRNA maturi all’interno di campioni biologici.
Per la validazione dei dati di microarray abbiamo scelto tre miRNA deregolati nell’HCC (miR-221, let-7a-1, miR-122). In particolare, dall’analisi di
microarray il miR-122 e let-7a-1 risultavano essere sotto-espressi nei campioni di
83
HCC rispetto ai campioni di CE, mentre il miR-221 risultava sovra-espresso nei
campioni di HCC. Tra i 35 miRNA della signature, abbiamo deciso di analizzare
questi tre miRNA per le seguenti ragioni: il miR-122 rappresenta il 70% di tutti i
microRNA espressi nel fegato ed è in grado di modulare l’espressione del virus
dell’epatite C (HCV) (55), il miR-221 e let-7a sono deregolati anche in altri tipi di
tumore umano (62, 76).
L’analisi di Northern blot, eseguita su di una serie di 40 tessuti di HCC e
circostante fegato cirrotico (Tabella 16), ha confermato i risultati ottenuti tramite
microarray. I casi analizzati sia tramite microarray che Northern blot hanno
mostrato un identico profilo di espressione dei miRNA in esame. Inoltre, l’analisi
di Northern blot ha rivelato una sovra-espressione del miR-221 nell’ 83% dei casi
di HCCs se confrontati con i corrispondenti campioni di cirrosi epatica, mentre ha
mostrato una sotto-espressione di let-7a-1 e miR-122 nel 70% dei campioni di
HCC. Una selezione dei campioni analizzati trmite Northern blot è mostrata in
Figura 11.
84
CE
CE
CE
CE
CE
CE
CE
CE
CE
CE
CE
CE
Figura 11. Risultati rappresentativi dell’analisi di Northern blot di let-7a,
miR-122 e miR-221. Analisi effettata su 8 campioni di HCC e circostante CE.
3.1.2 Validazione dell’analisi di microarray tramite Real time PCR
I livelli di espressione degli stessi tre microRNA validati tramite analisi di
Northern blot sono stati valutati tramite Real time PCR con TaqMan microRNA
assay su 38 campioni di HCC e CE (Tabella 16). I risultati di tale analisi hanno
confermato la sotto-espressione di miR-122 and let-7a e la sovra-espressione di
miR-221 nei campioni di HCC quando confrontati con i rispettivi campioni di CE
(Tabella 18).
85
Tabella 18. Espressione di microRNA in HCC e CE valutata tramite analisi
di Real time PCR e microarray. La media dei valori è riportata. I p-value
riportati sono stati calcolati tramite t-test.
miR
miR-122
miR-221
let-7a-1
CE
0,71
0,65
2,35
Real-Time
HCC HCC/CE
0,35
0,49
1,23
1,89
1,42
0,60
p-value
0,00956
0,00536
0,00918
CE
0,99
1,01
1,02
Microarray
HCC HCC/CE p-value
0,63
0,63
0,00352
1,52
1,49
0,0312
0,69
0,68
0,00869
3.2 Studio del ruolo biologico del microRNA-122: regolazione della ciclina
G1 in linee cellulari di epatocarcinoma
Terminata la validazione dei dati di microarray, abbiamo eseguito un’analisi
funzionale per caratterizzare il ruolo bio-patologico dei microRNA nel processo
di epatocarcinogenesi.
Abbiamo inizialmente focalizzato la nostra attenzione sul miR-122, il quale
risultava sotto-espresso nel 70% dei campioni provenienti da tessuto neoplastico
rispetto ai campioni provenienti dal fegato cirrotico circostante. Il miR-122 è un
microRNA epato-specifico, infatti rappresenta il 70% circa di tutti i miRNA
espressi nel fegato (77). Dati di letteratura riportano il ruolo del miR-122 nella
regolazione di importanti vie metaboliche quali la biosintesi del colesterolo ed il
metabolismo lipidico (53, 54) ed il ruolo nella modulazione della replicazione del
virus dell’epatite C (HCV), tramite appaiamento ad una sequenza complementare
presente nella porzione 5’ dell’RNA virale (55).
Poiché l’individuazione di geni regolati dai microRNA è uno step necessario
per studiare la loro funzione biologica ed il loro coinvolgimento nel processo di
carcinogenesi, abbiamo eseguito un’iniziale analisi bio-informatica al fine di
individuare putativi geni bersaglio del microRNA-122. In particolare, per la
86
predizione di ipotetici geni target ci siamo avvalsi di algoritmi predittivi quali
miRanda, TargetScan e PicTar. Successivamente, tramite l’utilizzo del software
MatchMiner abbiamo eseguito un’analisi di intersezione degli out-put provenienti
da due o più algoritmi al fine di individuare i bersagli molecolari più significativi
e con un valore predittivo più elevato. Tra gli RNA messaggeri (mRNA) regolati
dal miR-122, il gene della ciclina G1 (CCGN1) risultava un out-put sia
dell’algoritmo PicTar che di TargetScan (Figura 12A).
La ciclina G1 è stata inizialmente scoperta come un nuovo membro della
famiglia delle cicline con omologia al gene c-src e, successivamente, è stata
identificata come bersaglio trascrizionale di p53, possedendo due siti di legame
per questo fattore di trascrizione (78, 79). Inoltre, la ciclina G1 esercita una
regolazione a feedback negativo sulla proteina p53 attraverso il reclutamento della
subunità β’ della fosfatasi 2a (PP2A) determinando la defosforilazione di Mdm-2
(80). Ad oggi, il ruolo preciso della ciclina G1 sulla crescita cellulare è ancora
controverso (81). Alcuni studi, basati sull’osservazione che la sovra-espressione
della ciclina G1 aumenta la crescita cellulare di cellule cancerose e che il suo
silenziamento determina arresto della crescita (82), riportano un’attività di
promozione della proliferazione cellulare da parte della ciclina G1. In linea con
questi dati, la sovra-espressione della ciclina G1 è stata ritrovata in numerosi
tumori umani tra cui l’osteosarcoma, il cancro della mammella ed il leiomioma
(82-84). Al contrario, l’induzione della ciclina G1 in seguito a danno al DNA ed il
suo ruolo nell’arresto del ciclo cellulare nella fase G2/M suggeriscono una
possibile attività di inibizione della crescita da parte della ciclina G1 (85, 86).
Uno studio recente indica che il ruolo della ciclina G1 nel processo di
proliferazione cellulare è dipendente dai livelli di espressione della proteina stessa
87
(87), fornendo una possibile spiegazione ai controversi dati riportati in letteratura.
In aggiunta, è stato precedentemente dimostrato che topi knock-out per la ciclina
G1 successivamente trattati con un potente epato-carcinogeno, N-dietilnitrosamina, mostrano una ridotta incidenza di tumori, probabilmente dovuta ad
un’incrementata attività di p53 (88).
Alla luce di questi dati ed al fine di caratterizzare il meccanismo di
regolazione della ciclina G1 da parte del miR-122, abbiamo analizzato tramite
Northern blot e Real time PCR l’espressione del miR-122 in 4 linee di HCC:
Hep3B, SNU182, SNU398 e SNU449. Entrambe le tecniche hanno mostrato
un’assenza di espressione costitutiva del miR-122 in tutte e quattro le linee
cellulari testate; i livelli di miR in tali linee sono risultati infatti non rilevabili
quando confrontati con un campione di riferimento rappresentato da tessuto
proveniente da fegato sano (FS) (Figura 12B, C). Inoltre, abbiamo analizzato
tramite Western blot i livelli proteici di ciclina G1 nelle stesse quattro linee ed
abbiamo osservato un’elevata espressione basale della ciclina G1 in tutte le linee
cellulari analizzate (Figura 12D). Abbiamo quindi selezionato le linee Hep3B e
SNU449 per i successivi saggi funzionali.
88
Figura 12. La ciclina G1 è un ipotetico target del miR-122. (A) Ipotetico
sito bersaglio del miR-122 nella regione 3’UTR della ciclina G1 (CCGN1),
come predetto dall’algoritmo TargetScan. (B) Analisi Northern blot del miR122 su 4 linee di HCC e su un campione di fegato sano (FS). La sonda
U6RNA è stata utilizzata come gene housekeeping. (C) Analisi di Real time
PCR del miR-122. La sonda U6RNA è stata utilizzata come gene
housekeeping. Nell’asse delle ordinate è riportato il valore di 2(-δδCt) in scala
lineare. Un pool di tre FS è stato utilizzato come campione di riferimento per
il calcolo del δδCt. Ogni campione è stato analizzato in triplicato. Nel grafico
è riportato il valore medio e la deviazione standard (SD) di ciascun campione.
(D) Analisi Western blot della ciclina G1 su linee di HCC e un FS. La βactina è stata utilizzata come gene housekeeping per la normalizzazione dei
campioni.
In particolare, al fine di studiare la regolazione dell’espressione genica della
ciclina G1 da parte del miR-122 abbiamo trasfettato entrambe le linee con un
oligonucleotide precursore del miR-122 (pre-miR-122) o con un oligonucleotide
di controllo (NC) ed abbiamo analizzato la variazione dei livelli di ciclina G1
tramite Western blot. Dopo 24h dalla trasfezione, abbiamo misurato i livelli di
miR-122 tramite Real time PCR in entrambe le linee trasfettate. Come mostrato in
89
Figura 13A, i livelli di miR nelle cellule trasfettate con il miR-122 risultano simili
a quelli del fegato sano, perciò il ripristino dei livelli di miR-122 in vitro porta al
ripristino dei livelli fisiologici del miR-122. La trasfezione del miR-122 in Hep3B
e SNU449 ha determinato una riduzione dei livelli di espressione della ciclina G1
del 55% e 25%, rispettivamente (Figura 13B).
Per determinare se il predetto sito del miR-122 presente nel 3’UTR della
ciclina G1 (CCGN1) era effettivamente responsabile della sua regolazione,
abbiamo clonato un’ampia porzione del 3’UTR di ciclina G1, contenente la
regione complementare al miR-122, a valle del gene reporter presente nel vettore
pGL3. Abbiamo nominato tale vettore ricombinante pGL3-CCGN1 e l’abbiamo
utilizzato in esperimenti di co-trasfezione con il miR-122 o con un controllo
negativo nelle cellule Hep3B. Il vettore pRL-TK, contenente il gene di Luciferasi
di Renilla, è stato utilizzato come vettore di controllo per la normalizzazione
dell’attività luciferasica con il saggio Dual Luciferase assay (Promega). Come
mostrato in figura 13C, l’attività luciferasica è diminuita di 2 volte nelle cellule
co-trasfettate con il miR-122 (miR) rispetto alle cellule trasfettate con il vettore da
solo (p=0.0008, t test) e di 1.5 volte rispetto alle cellule co-trasfettate con il
controllo negativo (NC) (p=0.0038, t test). Presi insieme, tali dati dimostrano che
la ciclina G1 è un bersaglio diretto del miR-122 nelle linee cellulari di HCC.
90
Figura 13. La ciclina G1 è un target del miR-122. (A) Analisi di Real time
PCR del miR-122 in Hep3B e SNU449 trasfettate con il miR-122 o con un
controllo negativo (NC). Il campione di fegato sano (FS) è stato utilizzato
come campione di riferimento per i livelli fisiologici di miR-122. La sonda
U6RNA è stata utilizzata come gene housekeeping. Nell’asse delle ordinate è
riportato il valore di 2-(δδCt) in scala lineare. Ogni campione è stato analizzato
in triplicato. Nel grafico è riportato il valore medio e la deviazione standard
(SD) di ciascun campione. (B) Analisi di Western blot della ciclina G1
(CCGN1) nelle linee Hep3B e SNU449 trasfettate con miR-122 (miR) o con il
controllo negativo (NC). La β-actina è stata utilizzata come gene
housekeeping. (C) Saggio di luciferasi nelle cellule Hep3B. L’attività
luciferasica del vettore pGL3-CCGN1 è significativamente ridotta in presenza
del miR-122 (miR) rispetto al controllo negativo (NC) o al vettore da solo.
L’attività di luciferasi di Lucciola è stata normalizzata con l’attività di
luciferasi di Renilla contenuta nel vettore pRL-TK. Ogni campione è stato
analizzato in triplicato in due esperimenti diversi. Colonne: valore medio;
barre: deviazione standard.
Successivamente, i livelli di espressione del miR-122 e del suo bersaglio,
ciclina G1, sono stati analizzati in campioni provenienti da HCC e da tessuto
cirrotico circostante la neoplasia. L’analisi ex vivo ha mostrato la presenza di una
correlazione inversa tra miR-122 e ciclina G1 in campioni di HCC (Figura 14).
Tale dato suggerisce che il miR-122 potrebbe giocare un ruolo importante nella
91
regolazione dei livelli di ciclina G1 nel tessuto epatico ed avere un ruolo chiave
nel processo di epatocarcinogenesi.
Ciclina
β-actina
Figura 14. Correlazione inversa tra ciclina G1 e miR-122 in tumori
primari di HCC. I livelli di miR-122 nei campioni di HCC sono stati
analizzati tramite Northern blot e normalizzati sulla base dei livelli del gene
housekeeping U6RNA. I livelli di ciclina G1 sono stati analizzati tramite
Western blot e normalizzati sulla base del gene housekeeping β-actina. I valori
percentuale rappresentano l’incremento o la diminuzione di miR-122 e della
ciclina G1 nei campioni di HCC rispetto al circostante fegato cirrotico (LC).
3.2.1 Il microRNA-122 regola l’espressione e la stabilità di p53 attraverso la
modulazione di ciclina G1
Dati di letteratura dimostrano che la ciclina G1, attraverso il reclutamento
della fosfatasi 2a (PP2A), è in grado di regolare negativamente la stabilità della
proteina p53 (80). Sulla base di queste osservazioni, abbiamo deciso di
investigare il ruolo del miR-122 nella modulazione di p53 in linee cellulari
derivate da epatocarcinoma.
La linea cellulare HepG2 è stata selezionata per la sovra-espressione del miR122 in quanto non esprime tale miR a livello basale, mentre possiede un’isoforma
wild-type di p53 ed alti livelli proteici di ciclina G1 (Figura 15A, B). Quarantotto
ore dopo la trasfezione, l’espressione del miR-122 è stata valutata tramite Real
time PCR e paragonata a quella di tessuti provenienti da fegato sano, HCC e
92
fegato cirrotico. Le cellule trasfettate mostrano livelli di miR-122 paragonabili a
quelli del fegato sano (5.5 verso 4.7, rispettivamente), mentre le cellule trasfettate
con il controllo negativo, mostrano livelli non rilevabili di miR-122 (Figura
15A). Al contrario, il silenziamento del miR-122 è stato eseguito nella linea
cellulare Huh-7 in quanto essa è l’unica linea di HCC che esprime
costitutivamente il miR-122 (55) in presenza di bassi livelli di ciclina G1 (Figura
15A, B). Inoltre, la linea cellulare Huh-7 possiede un’isoforma mutata della
proteina p53, come nel 30% dei casi di HCC (89). Una riduzione di 3.2 volte dei
livelli di miR-122 è stata osservata dopo trasfezione delle cellule Huh-7 con
l’anti-miR-122 quando confrontato con cellule trasfettate con un oligonucleotide
di controllo (Figura 15A).
Ciclina G1
β-actina
Figura 15. Espressione del miR-122 in linee cellulari e campioni di HCC.
(A) Real time PCR del miR-122 in cellule trasfettate, campioni provenienti da
fegato sano, HCC e fegato cirrotico (LC) di due pazienti (Tabella 19, N° 1 e
24). I pool di HCC e LC si riferiscono a pool di 4 campioni di HCC e di LC
(Tabella 19, N°: 5, 21, 38 e 56). Il gene U6RNA è stato utilizzato come gene
housekeeping. Nell’asse delle ordinate è riportato il valore di 2(-δδCt) in scala
lineare.Ogni campione è stato analizzato in triplicato. Colonne: valore medio;
Barre: deviazione standard. (B) Analisi Western blot per la ciclina G1 sulle
linee Huh-7 e HepG2. La β-actina è stata utilizzata come gene housekeeping. I
valori riportati indicano il rapporto tra il valore di densitometria della ciclina
G1 e quello della β-actina.
93
In seguito abbiamo valutato tramite analisi diWestern blot i livelli di
espressione della ciclina G1 in seguito a trasfezione delle cellule col miR-122.
Una diminuzione di 2.0 volte dei livelli di espressione della ciclina G1ed un
incremento dei livelli proteici di p53 pari a 2.1 volte è stato osservato nelle cellule
HepG2 trasfettate con il miR-122 rispetto alle cellule trattate con un
oligonucleotide di controllo (NC) (Figura 16A). Al contrario il silenziamento del
miR-122 nelle cellule Huh-7 ha portato ad un incremento di 2.2 volte dei livelli di
espressione della ciclina G1 (Figura 16B). L’espressione di p53 non è stata
analizzata poichè le cellule Huh-7 esprimono un’isoforma mutata di p53 cheporta
ad accumulo della stessa a livello nucleare.
Per verificare che la ciclina G1 fosse direttamente responsabile della
modulazione di p53 in seguito a trasfezione del miR-122, abbiamo silenziato il
gene della ciclina G1 attraverso due differenti sequenze di small interfering RNA
(G1/238 e G1/832 siRNA) nella linea cellulare HepG2. La figura 16C mostra una
significativa diminuzione dei livelli di mRNA della ciclina G1 in seguito a
trasfezione con entrambi i siRNA G1/238 e G1/832. Il silenziamento della ciclina
G1 attraverso due diverse sequenze nucleotidiche dimostra che la sua regolazione
è specifica e non dovuta ad effetto ‘off-target’. Abbiamo scelto il siRNA G1/832
per i successivi esperimenti in quanto esso si è dimostrato più efficace nel
silenziamento della ciclina G1. Il silenziamento di ciclina G1 nelle cellule HepG2
ha portato ad una diminuzione di 1.5 volte dei livelli proteici di ciclina G1 ed un
aumento di 1.4 volte nei livelli della proteina p53 (Figura 16D). Presi insieme,
questi dati suggeriscono che, attraverso la regolazione di ciclina G1, il miR-122
modula l’espressione di p53.
94
B
Figura 16. Il miR-122 e la ciclina G1 regolano l’espressione di p53. (A, B)
Analisi di Western blot di ciclina G1 e p53 in seguito a trasfezione con il miR122 o l’anti-miR-122 in cellule HepG2 e Huh-7. (C) Analisi di RT-PCR in
seguito a silenziamento con G1/238 e G1/832 siRNA o controllo negativo
(Scramble) in cellule HepG2. (D) Analisi di Western blot di ciclina G1 e p53
in seguito a silenziamento con G1/832 siRNA in cellule HepG2. La β-actina è
stata utilizzata come gene housekeeping sia nell’analisi di WB che di RTPCR. I valori riportati indicano il rapporto tra il valore di densitometria della
ciclina G1, di p53 e quello della β-actina.
Poiché la fosforilazione di p53 a livello del residuo aminoacidico Ser-20
modula l’interazione con l’inibitore Mdm-2, aumentando l’emivita e l’attività
trascrizionale di p53 (90), abbiamo testato l’effetto del miR-122 e della ciclina G1
sui livelli di fosforilazione della Ser-20. L’analisi di Western blot ha mostrato un
aumento della fosforilazione della Ser-20 nelle sia cellule HepG2 trasfettate col
miR-122 che in quelle silenziate per la ciclina G1 (5.0 e 3.0 volte,
rispettivamente) (Figura 17A). Per valutare il ruolo del miR-122 e della ciclina
G1 sull’attività trascrizionale di p53, abbiamo misurato l’attività luciferasica di un
vettore reporter contenente elementi responsivi a p53 (pp53-TA-luc) in seguito a
co-trasfezione col miR-122 o con il siRNA G1/832 per la ciclna G1 nella linea
95
cellulare HepG2. Un aumento significativo (p<0.01, t-test) dell’attività
luciferasica è stato osservato sia nelle cellule sovra-esprimenti il miR-122 che in
quelle silenziate per la ciclina G1 (2.6 e 1.5 volte, rispettivamente), rispetto alle
cellle co-trasfettate con oligonucleotidi di controllo (Figura 17B). Per confermare
l’aumento di attività trascrizionale di p53, abbiamo valutato l’espressione degli
mRNA di due geni target di p53, Bax e Puma. Come mostrato in Figura 17C,
entrambi i target trascrizionali di p53 risultano sovra-espressi sia nelle cellule
trasfettate col miR-122 che in quelle silenziate per la ciclina G1. Presi insieme,
questi dati dimostrano che il miR-122 induce l’aumento dell’attività trascrizionale
di p53, almeno in parte, attraverso la regolazione della ciclina G1.
Figura 17. Il miR-122 e la ciclina G1 regolano l’attività trascrizionale di
p53. (A) Analisi di Western blot di fosfo-p53 (Ser-20) in HepG2 trasfettate
col miR-122, con G1/832 siRNA o con controlli negativi (NC, Scramble). La
β-actina è stata utilizzata come gene housekeeping. I valori riportatoi indicano
il rapporto tra il valore di densitometria di fosfo-p53 e quello di β-actina. (B)
Le cellule HepG2 sono state co-trasfettate con vettore responsivo a p53
(pp53TA-luc) o vettore vuoto (pTA-luc) in presenza di miR-122, G1/832
siRNA o controlli negativi. L’attività di luciferasi è stata valutata 24h dopo la
trasfezione. I risulati sono riportati come rapporto dell’attività luciferasica
delle cellule trasfettate con pp53TA-luc rispetto a quelle trasfettate con pTAluc. Colonne: valore medio di due esperimenti indipendenti; Barre: deviazione
standard. (C) Analisi di RT-PCR di Bax e Puma in seguito a sovraespressione del miR-122 o silenziamento con G1/238 siRNA in cellule
HepG2. La β-actina è stata utilizzata come gene housekeeping.
96
Da notare che l’aumento di p53 in seguito alla trasfezione col miR-122 è più
elevato rispetto a quello indotto dal silenziamento della ciclina G1. Questo dato
suggerisce che il miR-122 possa regolare l’espressione di più di un gene bersaglio
appartenente al pathway di p53. Abbiamo quindi eseguito un’analisi bioinformatica (attraverso l’algoritmo miRanda), la quale ha consentito di
individuare la subunità regolatoria β’, isoforma-β (PPP2R5B), della fosfatasi 2a
(PP2A) come ipotetico gene bersaglio del miR-122. Dati di letteratura riportano
che l’associazione della ciclina G1 con la subunità β’ della PP2A promuove la defosforilazione del repressore di p53, Mdm-2 (91, 92); perciò, una diretta
regolazione della subunità regolatoria di PP2A da parte del miR-122 potrebbe
aumentare l’effetto mediato dalla ciclina G1. La figura 18 mostra l’aumento dei
livelli di p53 sia dopo il silenziamento della subunità PPP2R5B che in seguito alla
trasfezione col miR-122 (2.4 e 1.9 volte, rispettivamente). Questi dati
suggeriscono che l’inibizione di ciclina G1 e di PPP2R5B da parte del miR-122
contribuiscono entrambe alla modulazione dell’espressione di p53. Ulteriori studi
saranno necessari per elucidare i meccanismi molecolari attraverso cui il miR-122
regola l’espressione di PPP2R5B.
Figura 18. La subunità PPP2R5B regola l’espressione di p53 nella linea
HepG2. Analisi di Western blot per 53 e PPP2R5B in seguito a trasfezione
con miR-122, PPP2R5B siRNA o controlli negativi (NC, Scramble) in cellule
HepG2. La β-actina è stata utilizzata come gene housekeeping. I valori
riportati indicano il rapporto tra il valore di densitometria di fosfo-p53, di
PPP2R5B e quello della β-actina.
97
3.2.2 Il microRNA-122 e la ciclina G1 regolano il ciclo cellulare e l’invasione
della linea cellulare HepG2
Un’attenta osservazione al microscopio delle cellule HepG2 in seguito a
trasfezione col miR-122 o al silenziamento della ciclina G1 ha evidenziato una
diminuita crescita cellulare ed una variazione della morfologia, con cellule più
allungate e con protrusioni citoplasmatiche. Queste osservazioni hanno suggerito
che il silenziamento della ciclina G1 mediata dai siRNA o dal miR-122 modifica
il fenotipo cellulare della linea HepG2 (Figura 19A). Abbiamo perciò analizzato
la distribuzione delle cellule nelle differenti fasi del ciclo celulare attraverso
analisi di citofluorimetria (FACS). Un aumento del 20% della popolazione
cellulare nella fase G1 ed una diminuzione delle cellule nella fase G2/M è stato
osservato in seguito a trasfezione con miR-122 o silenziamento di ciclina G1
(Figura 19B). La diminuzione delle cellule nella fase G2/M è in accordo con
precedenti dati di letteratura che descrivono la regolazione del check-point G2/M
da parte della ciclina G1(85).
98
Figura 19. Il miR-122 e la ciclina G1 influenzano la morfologia ed il ciclo
cellulare della linea HepG2. (A) Analisi al microscopio confocale di cellule
HepG2 trasfettate con miR-122, ciclina G1 siRNA e controlli negativi (NC,
Scramble); ingradimento 10X. (B) Analisi del ciclo cellulare di cellule HepG2
trasfettate con miR-122, ciclina G1 siRNA e controlli negativi. Colonne:
valore medio di due esperimenti indipendenti; barre: deviazione standard.
Per caratterizzare ulteriormente l’effetto del miR-122 e del suo gene target,
ciclina G1, nella modulazione del fenotipo delle cellule HepG2 abbiamo
analizzato la capacità invasiva delle cellule trasfettate con miR-122 o G1/832
siRNA tramite Matrigel assay. Il saggio di invasione ha mostrato una diminuzione
del numero di cellule in grado di attraversare lo strato di Matrigel, sia nelle cellule
trasfettate col miR-122 (1.6 volte, p=0.006, t-test) che in quelle silenziate per la
ciclina G1 (1.3 volte, p=0.04, t-test) (Figura 20A). Allo scopo di investigare i
pathway molecolari coinvolti nella modulazione della capacità invasiva delle
cellule trasfettate con miR-122 o G1/832 siRNA, abbiamo analizzato
l’espressione della proteina E-caderina, una molecola nota per il suo ruolo nei
processi adesione tra cellule e nell’invasione cellulare (93). L’analisi di Western
99
blot ha mostrato un aumento dei livelli di espressione della E-caderina nelle
cellule sovra-esprimenti il miR-122 (1.5 volte), come pure nelle cellule silenziate
per la ciclina G1 (1.3 volte) (Figura 20B). Poiché non è stata osservata nessuna
regolazione a livello dell’mRNA di E-caderina, abbiamo ipotizzato un
meccanismo di regolazione post-trascrizionale. Inoltre, un’analisi bio-informatica
(algoritmo miRanda) ha evidenziato che PDGF1A e c-Met sono bersagli ipotetici
del miR-122, suggerendo che tale microRNA potrebbe regolare l’invasione
attraverso la modulazione di multipli pathway molecolari. Presi insieme, tali dati
suggeriscono un ruolo attivo del miR-122 sia nella modulazione del ciclo
cellulare che dell’invasione in linee cellulari derivate da epatocarcinoma.
Figura 20. Il miR-122 e la ciclina G1 regolano l’invasione della linea
cellulare HepG2. (A) Matrigel assay di cellule HepG2 trasfettate con miR122 o G1/832 siRNA. Quattro campi indipendenti sono stati considerati per la
conta delle cellule invasive ad un ingrandimento di 25X. Colonne: valore
medio; barre: deviazione standard. (B) Analisi di Western blot ed RT-PCR per
la E-caderina in cellule HepG2 trasfettate con miR-122, G1/832 siRNA o
controlli negativi. La β-actina è stata utilizzata come gene housekeeping sia
nell’analisi di Western blot che di RT-PCR. I valori riportati indicano il
rapporto tra il valore di densitometria di E-caderina e β-actina.
100
3.2.3 Il microRNA-122 e la ciclina G1 sensibilizzano la linea cellulare HepG2
al trattamento con Doxorubicina
In seguito alla trasfezione con miR-122 o ciclina G1 siRNA nelle cellule
HepG2 non è stata osservata alcuna variazione nel processo di morte cellulare
(conta con Trypan Blue). Nonostante questo, poiché la ciclina G1 è attivata in
risposta al danno al DNA (86), abbiamo investigato la modulazione della
sensibilità al trattamento con il chemioterpico Doxorubicina delle cellule HepG2
in seguito a sovra-espressione del miR-122 o silenziamento della ciclina G1.
Abbiamo scelto la Doxorubicina poiché al momento è il farmaco anti-neoplastico
più utilizzato nel trattamento dell’HCC in stadio intermedio-avanzato. Inoltre la
Doxorubicina induce morte cellulare per apoptosi in maniera sia p53 dipendente
che indipendente (94), abbiamo quindi testato entrambe le linee cellulari HepG2 e
Huh-7 che differiscono per lo status di p53 e l’espressione del miR-122. Le
cellule HepG2 sono state trasfettate sia con il miR-122 che con il siRNA contro
ciclina G1 e sottoposte per 24h a trattamento con Doxorubicina. L’analisi al
FACS per l’Anexina V ha rivelato un aumento del numero di cellule apoptotiche
sia nelle cellule trasfettate con il miR-122 (1.3 volte, p=0.001, t-test) che con
G1/832 siRNA (1.2 volte, p=0.002, t-test) (Figura 21A). Come ulteriore prova,
abbiamo saggiato tramite Western blot i livelli di espressione della caspasi-3
attivata ed abbiamo osservato un incremento della sua attivazione sia nelle cellule
trasfettate col miR-122 che nelle cellule silenziate per la ciclina G1 (1.3 e 3.2
volte, rispettivamente). Inoltre, l’analisi del target trascrizionale di p53 ad attività
pro-apoptotica, Puma, ha mostrato un aumento dell’espressione sia nelle cellule
sovra-esprimenti il miR-122 che in quelle trasfettate con G1/832 siRNA (1.7 e 1.4
101
volte, rispettivamente) (Figura 21B). Poichè la linea cellulare Huh-7 esprime
costitutivamente il miR-122, questa linea è stata utilizzata per investigare l’effetto
del silenziamento del miR-122 in seguito a trattamento con Doxorubicina. Nelle
cellule Huh-7 trattate con anti-miR-122 è stata osservata una diminuzione di 1.2
volte del numero di cellule apoptotiche (p=0.001, t-test), mentre, in maniera
simile a quanto osservato nella linea HepG2, il silenziamento della ciclina G1 ha
portato ad un aumento della suscettibilità delle cellule Huh-7 al trattamento con
Doxorubicina (1.3 volte, p=0.05, t-test). (Figura 21C). Presi insieme, questi dati
dimostrano che il miR-122 aumenta la suscettibilità delle cellule di
epatocarcinoma al trattamento con Doxorubicina attraverso vie molecolari sia p53
dipendenti che indipendenti.
Figura 21. Il miR-122 e la ciclina G1 influenzano la sensibilità alla
Doxorubicina in linee cellulari di HCC. (A) FACS Anexina V assay in
cellule HepG2 trasfettate con miR-122 o G1/832 siRNA e trattate con
Doxorubicina (5.0 µg/ml). (B) Analisi di Western blot per lacaspasi-3 attivata
e Puma in cellule HepG2 trasfettate con miR-122 o G1/832 siRNA. La βactina è stata utilizzata come gene housekeeping. I valori riportati indicano il
rapporto tra il valore di densitometria dei 2 geni e quello della β-actina. (C)
FACS Anexina V assay in cellule Huh-7 trasfettate con anti-miR-122 o
G1/832 siRNA e trattate con doxorubicina (5 µg/ml). Colonne: valore medio
di 3 esperimenti indipendenti; barre: deviazione standard.
102
3.2.4 Il microRNA-122 e la ciclina G1 correlano con variabili clinicopatologiche di pazienti con epatocarcinoma
Per verificare se i dati ottenuti in vitro potessero avere un significato
funzionale anche in vivo, abbiamo analizzato l’espressione del miR-122 tramite
Real time PCR in 57 campioni provenienti da tessuto di HCC e circostante fegato
cirrotico (Tabella 19). A causa della limitata disponibilità dei pezzi chirurgici,
l’espressione della ciclina G1 è stata analizzata attraverso analisi di Western blot
solo in 35 dei 57 campioni di HCC. L’analisi Kaplan-Meier ha rivelato che bassi
livelli di miR-122 correlano con un ridotto tempo di insorgenza della recidiva
epatica (TTR) (Figura 22A), viceversa non è stat osservata alcuna correlazione
statisticamente significativa con i dati di sopravvivenza (Figura 22B). Al
contrario, bassi livelli di ciclina G1 sono risultati significativamente associati ad
un aumento della sopravvivenza dei pazienti sottoposti a resezione epatica per
HCC, ma non con il TTR (Figura 22C, D). Nessuna correlazione è stata osservata
tra l’espressione del miR-122 o della ciclina G1 ed i livelli di alfa-fetoproteina
(AFP), le dimensioni del tumore, il grado di focalità, l’eziologia ed il grado istopatologico degli epatocarcinomi analizzati.
103
Figura 22. Probabilità di insorgenza della recidiva epatica e
sopravvivenza in pazienti con HCC. (A, B) Associazione tra i livelli di miR-122
ed il TTR o la sopravvivenza. Alti e bassi livelli di miR-122 sono stati
categorizzati in base al valore medio. (C, D) Associazione tra i livelli di ciclina
G1 ed il TTR o la sopravvivenza. Alti e bassi livelli di ciclina G1 sono stati
categorizzati in base al valore medio. I log-rank p-value provengono dall’analisi
di Kaplan-Meier.
104
Tabella 19. Caratteristiche dei pazienti analizzati nello studio del microRNA122.
N.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
Età
Genere
Eziologia (1)
Focalità
(2)
Dimensioni
(3)
AFP
(4)
Grado (5)
65
52
70
65
62
67
77
70
65
80
59
66
68
59
82
60
78
54
69
74
73
77
71
68
81
74
74
82
51
79
70
72
70
75
59
67
65
76
49
53
62
79
68
65
64
60
60
58
M
M
M
F
F
M
M
F
M
F
F
F
F
M
F
M
M
M
M
M
M
M
F
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
F
F
M
M
F
M
M
M
M
HBV+Ethanol
None
HCV
HCV
HCV
HCV
HBV-Ab
Ethanol
HCV+Ethanol
HCV
HCV
HCV
None
HCV
HCV
Ethanol
HCV
HBV
HCV
None
HCV
HCV
HCV
HCV
HCV
HCV
HCV+HBV
None
HBV+HCV
HCV
HCV
HCV
None
HCV
HCV
None
HCV
HBV-Ab
HBV
HCV
HCV
HBV
HCV
HCV
HCV+Ethanol
HCV
HCV
HCV
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
multi
uni
uni
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
3.0
5.0
4.0
3.0
3.0
6.0
5.0
5.0
3.0
5.0
6.0
8.0
5.5
5.0
7.5
1.8
3.0
4.0
10
11
4.5
2.2
2.0
2.5
3.0
3.5
3.0
5.2
7.0
10
2.3
3.4
10
7.0
3.0
6.0
6.5
5.0
4.0
4.0
3.0
7.0
8.0
7.0
6.5
3.2
1.3
3.0
5.0
5.0
35
3.0
76
3352
4.0
537
20
76
7.0
9572
2.0
86
964
156
9.0
162
390
78
2
48
276
5.0
8.0
2198
75
4.0
1924
7.0
46
18
11
9.0
76
18766
167
10000
2708
60
468
540
86
139313
8
15
257
132
G2
G2
G3
G3
G3
G2
G3
G3
G3
G3
G4
G3
G3
G3
G3
G2
G2
G2
G3
G3
G3
G2
G3
G2
G3
G2
G4
G3
G3
G3
G3
G3
G2
G3
G3
G3
G3
G4
G4
G3
G2
G4
G3
G4
G3
G2
G4
G3
105
49
50
51
52
53
54
55
56
57
66
75
68
66
70
74
69
74
70
M
M
M
M
F
F
F
M
M
HCV
HCV
HCV
None
HCV
HBV+HCV
HCV
HCV+HBV-Ab
HCV+HBV
uni
multi
uni
uni
multi
uni
uni
uni
uni
3.0
3.0
6.5
15
2.5
3.0
3.0
3.0
7.0
58
63
131
6
3
186
453
134
500
1) Cause della sottostante patologia epatica: HBV: Virus Epatite B; HCV: Virus Epatite B; BAb:
anticorpi contro HBV; Etanolo: storia di abuso di alcol; Criptogenici sono quei casi in cui sono
stati esclusi: infezioni virali, abuso di alcol, emocromatosi, patologia di Wilson, deficienza di α1anti-tripsina, cirrosi biliare primaria, epatite autoimmune e colangite sclerosante primaria.
2) Uni-o multifocalità è stata assegnata sulla base di tecniche di imaging precedenti l’intervento
chirurgico.
3) Dimensioni del nodulo di HCC (cm)
4) Livelli di alfa-feto-proteina sono stati misurati prima dell’intervento.
5) Grado di HCC è stato assegnato attraverso i criteri di Edmonson e Steiner’s (74).
106
G2
G3
G3
G3
G3
G2
G2
G3
G4
3.3 Studio del ruolo biologico del microRNA-221: regolazione di
CDKN1C/p57 e CDKN1B/p27 in linee cellulari di epatocarcinoma
Tra i 35 microRNA deregolati nei tessuti di HCC abbiamo successivamente
studiato il microRNA-221. Il miR-221 è infatti uno dei pochi microRNA della
signature ad essere sovra-espresso nel tessuto tumorale rispetto al circostante
fegato cirrotico, dato che ha fatto ipotizzare ad un ruolo attivo di questo
microRNA
nel
processo
di
epatocarcinogenesi.
Inoltre,
un
aumento
dell’espressione del miR-221 era stata osservata anche in altri tipi di tumore
umano quali glioblastoma (95), cancro della vescica (96), tumore papillare della
tiroide (97) e cancro del pancreas (98), supportando ulteriormente il ruolo prooncogenico di questo microRNA nel processo di tumorigenesi. In aggiunta, la
sovra-espressione del miR-221 era stata precedentemente associata all’aumentata
proliferazione di cellule cancerose, probabilmente attraverso la sua capacità di
regolare la proteina oncogenica c-kit (76) e l’inibitore delle cinasi-ciclina
dipendenti CDKN1B/p27 (99-102), un importante controllore del ciclo cellulare.
Allo scopo di studiare il ruolo del miR-221 nel processo di epatocarcinogenesi
ed al fine di individuare ipotetici geni bersaglio, abbiamo eseguito un’analisi bioinformatica utilizzando gli algoritmi miRanda, TargetScan e PicTar. Da tale
analisi, entrambi gli mRNA di CDKN1B/p27 e CDKN1C/p57 sono stati predetti
da almeno due degli algoritmi utilizzati come ipotetici geni bersaglio del miR221; infatti, entrambi presentano uno o più siti complementari alla sequenza del
miR-221 nelle loro regioni 3’UTR.
Dati di letteratura riportano la sotto-espressione di CDKN1B/p27 nei tessuti di
HCC quando confrontati con il circostante tessuto cirrotico. Inoltre, la diminuita
107
espressione di CDKN1B/p27 mostra un rilevante significato prognostico
nell’epatocarcinoma umano, essendo associata ad uno stadio tumorale avanzato, a
diminuita sopravvivenza ed insorgenza di recidiva epatica (103). La sottoespressione di CDKN1C/p57 nell’HCC è stata anch’essa correlata ad un fenotipo
tumorale a più elevata aggressività biologica, a stadi tumorali più avanzati, ad uno
scarso differenziamento, a presenza di invasione portale ed elevata attività
proliferativa. Inoltre, un basso indice di espressione di CDKN1C/p57 è stato
associato ad una prognosi peggiore e ad un diminuito tempo di sopravvivenza in
pazienti curativamente trattati per HCC; suggerendo che la sotto-espressione di
CDKN1C/p57 potrebbe contribuire alla progressione dell’epatocarcinoma
attraverso la modulazione della crescita cellulare (104, 105). Il nostro ed altri
gruppi di ricerca hanno recentemente riportato che circa il 26% degli HCC
mostrano una perdita della metilazione dell’allele materno nel locus soggetto ad
imprinting, KvDMR1, situato nel cromosoma 11p15.5 dove si trova il gene
CDKN1C/p57 (106, 107), e che tale meccanismo è coinvolto nella riduzione
dell’espressione di CDKN1C/p57 (108). Nonostante questo, in una casistica non
selezionata di HCC, abbiamo osservato una riduzione dei livelli di CDKN1C/p57
nell’80% dei casi di HCC, dato che fa ipotizzare all’esistenza di altri meccanismi
molecolari implicati nella regolazione di CDKN1C/p57 nell’epatocarcinoma
umano, oltre all’aberrante metilazione genica. Dal momento che la predizione
bioinformatica ha indicato CDKN1C/p57 come possibile bersaglio del miR-221,
in questo lavoro di tesi abbiamo investigato la regolazione dei due inibitori del
ciclo cellulare CDKN1C/p57 e CDKN1B/p27 da parte del miR-221.
Alla luce di questi dati, per caratterizzare la regolazione dei due inibitori del
ciclo cellulare da parte del miR-221 abbiamo analizzato tramite Northern blot
108
l’espressione del miR-221 in tre linee cellulari derivate da HCC (Hep3B, SNU398
e SNU449). Nelle stesse linee cellulari abbiamo successivamente investigato,
tramite Western blot ed RT-PCR, i livelli di espressione dei due target molecolari,
CDKN1B/p27 e CDKN1C/p57 (Figura 23). Questa analisi ha mostrato una
correlazione inversa tra i livelli di espressione del miR-221 ed i livelli proteici di
entrambi i geni target, mentre non è stata rivelata alcuna correlazione tra il miR221 e l’espressione dell’mRNA dei due bersagli molecolari. Tali osservazioni
fanno ipotizzare ad una regolazione di tipo post-trascrizionale, ed in particolare al
blocco della traduzione, da parte del miR-221 sui due geni bersaglio.
Figura 23. Correlazione inversa tra miR-221 e ipotetici geni target,
CDKN1C/p57 e CDKN1B/p27. Analisi di Northern blot del miR-221 in tre
linee cellulari di HCC. Il gene U6RNA è stato utilizzato come housekeeping.
Analisi di Western blot ed RT-PCR di CDKN1C/p57 e CDKN1B/p27 nelle
stesse tre linee di HCC. La β-actina è stata utilizzata come gene housekeeping
per la normalizzazione sia dei livelli proteici che di mRNA.
109
Per quel che riguarda la successiva analisi funzionale in vitro, abbiamo
selezionato la linea cellulare Hep3B sia per l’over-espressione che per il
silenziamento del miR-221, in quanto tale linea esprime livelli intermedi di miR221 rispetto alle altre linee analizzate insieme a livelli piuttosto elevati dei due
ipotetici geni bersaglio. La trasfezione del miR-221 nelle cellule Hep3B ha
determinato una diminuzione di 1.8 e 2.6 volte delle bande corrispondenti a
CDKN1C/p57 e CDKN1B/p27, rispettivamente, quando confrontate con le cellule
trasfettate con il solo controllo negativo (Negative Control #1 precursor miRNAs)
(Figura 24A). Al contrario, le cellule Hep3B trasfettate con l’anti-miR-221 hanno
mostrato un incremento di 1.9 e 1.4 volte nei livelli di espressione di
CDKN1C/p57 e CDKN1B/p27, rispettivamente, se paragonate alle cellule trattate
con il controllo negativo (Negative Control #1 miRNA inhibitors) (Figura 24B).
Inoltre, l’over-espressione del miR-221 è stata effettuata anche sulla linea
cellulare SNU398, la quale esprime livelli basali molto bassi di miR-221 ed alti
livelli proteici di CDNK1C /p57e CDKN1B/p27. La trasfezione del miR-221
nelle cellule SNU398 ha portato ad una diminuzione di 3.4 e 1.9 volte dei livelli
di espressione di CDKN1C/p57 e CDKN1B/p27, rispettivamente, quando
confrontatae con le cellule trattate con il controllo negativo (Figura 24C). Il
silenziamento del miR-221 non è stato eseguito sulla linea SNU398 in quanto essa
esprime livelli costitutivi di miR-221 molto bassi. Abbiamo invece eseguito il
silenziamento del miR-221 nella terza linea cellulare testata, SNU449, la quale
esprime livelli costitutivi di miR-221 molto elevati insieme a bassi livelli dei due
inibitori delle cicline-cinasi dipendenti (CDKI). Le cellule SNU449 trasfettate con
l’anti-miR-221 hanno mostrato un incremento di 1.3 e 2.0 volte nei livelli proteici
di CDKN1C/p57 e CDKN1B/p27, rispettivamente (Figura 24D).
110
Figura 24. Il miR-221 regola CDKN1C/p57 e CDKN1B/p27 in linee
cellulari di HCC. (A) Analisi di Western blot di CDKN1C/p57 e
CDKN1B/p27 nelle cellule Hep3B trasfettate col miR-221. NC: Negative
Control #1 precursor miRNAs; miR: miR-221. (B) Analisi di Western blot di
CDKN1C/p57 e CDKN1B/p27 nelle cellule Hep3B trasfettate con anti-miR221. NCi: Negative Control #1 inhibitor miRNAs; AM: anti-miR-221. (C)
Analisi di Western blot di CDKN1C/p57 e CDKN1B/p27 nelle cellule
SNU398 trasfettate col miR-221. (D) Analisi di Western blot di CDKN1C/p57
e CDKN1B/p27 nelle cellule SNU449 trasfettate con anti-miR-221. La βactina è stata utilizzata come gene housekeeping.
Poichè la regolazione di CDKN1B/p27 da parte del miR-221 era già stata
dimostrata in altri tipi di tumore umano (99-102), abbiamo focalizzato la nostra
attenzione nello studio dell’interazione tra miR-221 e CDKN1C/p57. Per
dimostrare il legame diretto del miR-221 al sito complementare presente nella
regione 3’UTR dell’RNA messaggero di CDKN1C/p57 (Figura 25A), abbiamo
clonato una porzione (295 bp) del 3’UTR di CDKN1C/p57 a valle del gene
reporter contenuto nel vettore pGL3. Il vettore così costruito è stato nominato
pGL3-p57 ed è stato utilizzato in esperimenti di co-trasfezione con miR-221, antimiR-221 o controlli negativi nelle linee cellulari Hep3B e SNU449. Il vettore
pRL-TK, contenente il gene di luciferasi di Renilla è stato utilizzato per
normalizzare le differenze nell’efficienza di trasfezione. L’attività luciferasica
nelle cellule Hep3B co-trasfettate con il vettore pGL3-p57 ed il miR-221 è
risultata diminuita del 29% quando paragonata con il Negative Control#1 miRNA
111
precursors (NC) (p=0.001, t-test) (Figura 25B). Al contrario, l’attività
luciferasica del vettore pGL3-p57 nella linea SNU449 in seguito a co-trasfezione
con anti-miR-221 è risultata aumentata del 27%, quando paragonata con Negative
Control #1 miRNA inhibitors (NCi) (p=0.0008 at t-test) (Figura 25B). Presi
insieme, i dati di immunoblot e di saggio di luciferasi dimostrano che i due
inbitori del ciclo cellulare, CDKN1C/p57 e CDKN1B/p27, sono direttamente
regolati dal miR-221 in linee cellulari di epatocarcinoma.
Figura 25. Regolazione diretta di CDKN1C/p57 mRNA da parte del miR221. (A) Sito complementare al miR-221 in CDKN1C/p57 3’UTR, come
predetto dall’algoritmo TargetScan. (B) Saggio di luciferasi in cellule Hep3B
e SNU449 trasfettate con miR-221, anti-miR-221 e controlli negativi. NCi:
Negative Control #1 inhibitor miRNAs; AM: anti-miR-221; NC: Negative
Control #1 precursor miRNAs; miR: miR-221. Ogni campione è stato
analizzato in triplicato in due esperimenti differenti. Colonne: valore medio;
Barre: deviazione standard.
112
3.3.1 Il microRNA-221 regola il ciclo cellulare e la crescita in linee cellulari di
epatocarcinoma
Poichè i due bersagli molecolari del miR-221 sono proteine coinvolte nella
regolazione del ciclo cellulare, ed in particolare nella transizione G1/S, abbiamo
analizzato il ruolo del miR-221 nella regolazione della crescita e del ciclo
cellulare in linee cellulari derivate da HCC. Dopo 24, 48 e 72h dalla trasfezione
con miR-221 o anti-miR-221, le cellule Hep3B sono state raccolte e contate con
camera di Burker. A 72h dalla trasfezione, l’over-espressione del miR-221 ha
determinato un incremento della crescita cellulare di 1.3 volte rispetto alle cellule
trasfettate con il controllo negativo (p=0.011, t-test), mentre il silenziamento del
miR-221 ha causato una diminuzione di 1.5 volte nel numero di cellule quando
confrontato con il controllo negativo (p=0.003, t-test) (Figura 26A). Per
confermare tale dato, abbiamo eseguito lo stesso esperimento su di una seconda
linea di HCC, le SNU398, la quale è stata utilizzata per l’over-espressione del
miR-221, dal momento che esprime livelli basali molto bassi di tale microRNA.
Dopo 24 e 48h dalla trasfezione del miR-221 è stato registrato un incremento nel
numero di cellule di 1.5 (p=0.002, t-test) e 1.4 volte (p=0.0006, t-test),
rispettivamente, in confronto alle cellule trattate con un oligonucleotide di
controllo (Figura 26B). A 72h dalla trasfezione, l’incremento della crescita
cellulare delle cellule SNU398 trasfettate con il miR-221 risulta meno evidente,
probabilmente a causa del raggiungimento della confluenza cellulare all’interno
del pozzetto.
In seguito abbiamo eseguito un’analisi citofluorimetrica per investigare la
distribuzione delle cellule Hep3B nelle diverse fasi del ciclo cellulare in seguito a
113
trasfezione con il miR-221. Tale analisi ha rivelato un incremento significativo
delle popolazione cellulare nella fase S (1.8 volte; p=0.005, t-test) nelle cellule
trasfettate col miR-221 rispetto a quello trasfettate con un controllo negativo. Una
concomitante diminuzione delle cellule in fase G1 è stata osservata nelle cellule
over-esprimenti il miR-221 (Figura 26C).
Figura 26. Il miR-221 regola la crescita cellulare di linee cellulari di HCC.
(A) Curva di crescita delle cellule Hep3B dopo trasfezione con miR-221 e
antimiR-221. NCi: Negative Control #1 inhibitor miRNAs; AM: anti-miR221; NC: Negative Control #1 precursor miRNAs; miR: miR-221. (B) Curva
di crescita delle cellule SNU398 dopo trasfezione con miR-221. Ogni dato è
stato ottenuto in triplicato. In grafico sono mostrati i valori medi più le
deviazioni standard di ogni punto della curva. (C) Analisi del ciclo cellulare
nella linea Hep3B dopo 72h dalla trasfezione con miR-221. Ogni dato è stato
ottenuto in duplicato. Colonne: valore medio; Barre: deviazione standard.
114
3.3.2 Correlazione inversa tra il microRNA-221 e i due target molecolari in
pazienti con epatocarcinoma
I pazienti appartenenti alla casistica analizzata in questo studio sono stati
selezionati sulla base dei livelli mRNA della proteina CDKN1C/p57. Ovvero,
sono stati selezionati solo quei pazienti che mostravano livelli di mRNA simili tra
il tessuto proveniente da HCC e quello proveniente dal fegato cirrotico circostante
il nodulo. Questo per evitare quel 25-30% di casi di HCC che mostrano
un’aberrante mutilazione del promotore del gene CDKN1C/p57. Tra i 39 casi
selezionati inizialmente, solo 35 casi sono stati selezionati per l’analisi di
correlazione tra miR-221 ed i suoi geni target, in quanto esprimevano livelli molto
simili di mRNA di CDKN1C/p57 tra HCC e fegato cirrotico. Ventisette dei 35
casi (77%) hanno mostrato una sotto-espressione della proteina CDKN1C/p57;
una selezione dei casi è riportato in Figura 27A. Per dimostrare l’esistenza di una
correlazione inversa tra l’espressione del miR-221 ed i livelli delle proteine
CDKN1B/p27 e CDKN1C/p57 nei campioni di HCC, abbiamo eseguito un’analisi
di Real time PCR per la quantificazione del miR-221 ed un’analisi di Western
blot per la quantificazione dei due CDKI nei 35 tessuti accoppiati di HCC e fegato
cirrotico (CE). Come mostrato in Figura 27B e C, quando i livelli proteici di
CDKN1C/p57 and CDKN1B/p27 sono stati graficati contro i livelli di miR-221, è
stata osservata una correlazione inversa tra i due parametri. Nessuna associazione
è stata individuata tra i livelli di miR-221 e le cause della cirrosi sottostante il
nodulo tumorale, in particolare con le infezioni virali, né con il sesso, il grado
istopatologico ed i livelli di AFP.
115
Figura 27. Correlazione inversa tra il miR-221 e i due CDKI in campioni
d HCC. (A) Livelli di mRNA e proteina di CDKN1C/p57 in tessuti di HCC e
circostante fegato cirrotico (CE). Casi rappresentativi analizzati tramite RTPCR e Western blot. La ß-actina è stata utilizzata come gene housekeeping sia
a livello di mRNA che di proteina. I casi sono numerati in accordo alla
Tabella 20. (B) Correlazione inversa tra miR-221 e CDKN1C/p57 e (C) miR221 e CDKN1B/p27 in tessuti di HCC. Ogni dato derivante da campioni di
HCC è stato normalizzato con il valore della rispettiva cirrosi ed espresso in
forma logaritmica (log2). Una correlazione statisticamente significativa tra il
miR-221 ed i livelli proteici di CDKN1B/p27 e CDKN1C/p57 è stata
osservata (p<0.001 per entrambi i CDKI) usando il two-tailed Pearson test.
116
Tabella 20. Caratteristiche dei pazienti con HCC analizzati nello studio del
miR-221 e dei due inibitori del ciclo cellulare, CDKN1B/p27 e CDKN1C/p57.
N.
Età
Genere
Etiology (1)
Focalità
(2)
Dimensioni
(cm) (3)
AFP
(ng/mL)
(4)
Grado (5)
1
80
F
HCV
uni
5
76
G3
2
70
M
HCV
multi
2.3
46
G3
3
70
M
HCV
uni
4.8
95
G3
4
82
F
HCV
uni
7.5
67
G2
5
65
M
HCV+Ethanol
uni
3
19.6
G3
6
75
M
HCV
multi
5.4
9
G2
7
59
M
HCV+BAb
multi
3.8
10
G3
8
68
M
HCV
multi
2.5
5
G2
9
68
F
HCV
uni
3
9
G3
10
77
M
BAb
uni
5
4
G3
11
81
M
HCV
uni
3
210
G3
12
65
M
HBV+Ethanol
uni
3
5
G2
13
82
M
None
multi
5.2
4
G2
14
74
M
HCV+HBV
multi
3.4
75
G4
15
74
M
HCV
uni
3.5
2198
G3
16
60
M
Ethanol
uni
1.8
121
G2
17
76
M
HBV
multi
5
10000
G3
18
75
M
None
multi
15
6
G3
19
78
M
HCV
uni
3
9
G2
20
60
M
HCV
multi
1.3
257
G4
21
74
M
None
uni
11
78
G3
22
69
M
HCV
multi
10
7
G3
23
65
M
HCV
multi
6.5
167
G3
24
68
F
None
uni
5.5
2
G3
25
70
M
None
multi
10
11
G2
26
64
F
HCV
multi
3
148
G3
27
59
M
HCV
uni
5
86
G3
28
75
M
HCV
multi
3
63
G3
29
73
M
HCV
uni
4.5
2
G3
30
82
M
None
multi
5
4
G3
31
59
F
HCV
uni
6
7
G4
32
51
M
HBV+HCV
multi
7
1924
G3
33
78
M
HCV
multi
4
7
G2
34
66
F
HCV
uni
8
9572
G3
35
67
M
None
multi
6
18766
G3
36
68
F
HCV
uni
4
436
G3
37
67
M
HCV
multi
3.5
9
G3
38
78
M
None
multi
5.5
7
G4
39
71
M
HCV
uni
2.5
69
G2
1) Cause della sottostante patologia epatica: HBV: Virus Epatite B; HCV: Virus Epatite B; BAb:
anticorpi contro HBV; Etanolo: storia di abuso di alcol; Criptogenici sono quei casi in cui sono
stati esclusi: infezioni virali, abuso di alcol, emocromatosi, patologia di Wilson, deficienza di α1anti-tripsina, cirrosi biliare primaria, epatite autoimmune e colangite sclerosante primaria.
2) Uni-o multifocalità è stata assegnata sulla base di tecniche di imaging precedenti l’intervento
chirurgico.
3) Dimensioni del nodulo di HCC (cm)
4) Livelli di alfa-feto-proteina sono stati misurati prima dell’intervento.
5) Grado di HCC è stato assegnato attraverso i criteri di Edmonson e Steiner’s (74).
117
3.3.3 Il microRNA-221 regola l’espressione di Bmf in linee cellulari di
epatocarcinoma
Allo scopo di caratterizzare ulteriormente il ruolo del miR-221 nel processo di
epatocarcinogenesi, abbiamo focalizzato la nostra attenzione sullo studio di
molecole coinvolte nel processo di apoptosi. Infatti, l’equilibrio tra segnali
proliferativi e segnali pro-apoptotici è stato ampiamente studiato in patologie
epatiche, dove il programma di morte programmata può essere attivato sia
attraverso il coinvolgimento del recettore Fas(CD95) che dei membri della
famiglia di Bcl-2 (109-111). A questo riguardo, l’analisi bioinformatica ha
consentito di individuare tra i target del miR-221 la proteina Bmf (BCcl-2
modifying factor), un membro pro-apoptotico appartenente alla famiglia di Bcl-2.
Tale famiglia proteica è composta sia da membri anti-apoptotici (Bcl-2, Bcl-xL,
Bcl-w, Mcl-1 e A1) che da membri pro-apoptotici comprendenti il gruppo di
Bax/Bak ed il gruppo delle proteine contenti il dominio BH3 (Bmf, Bim, Bad,
Bik, Puma, Noxa e Hrk). Quest’ultimo gruppo di proteine monitora il benessere
cellulare e, quando attivato da segnali extra-cellulari, sequestra i membri antiapoptotici della famiglia di Bcl-2 inattivandone la loro funzione e promuovendo
l’attivazione della morte cellulare per apoptosi. Inoltre, i membri con dominio
BH3 giocano un ruolo chiave nello sviluppo, nell’omeostasi tissutale,
nell’immunità e nella soppressione tumorale; composti che mimano le funzioni di
questo gruppo di proteine risultano perciò promettenti agenti anti-tumorali (112).
La proteina Bmf è normalmente sequestrata dal complesso della miosina V e della
catena leggera della dineina 2; tale localizzazione citoscheletrica potrebbe essere
fondamentale per la risposta a stimoli extra-cellulari e la successiva induzione
118
dell’apoptosi. In seguito ad eventi stressanti come il distacco delle cellule dalla
matrice extra-cellulare e l’esposizione ad irradiazioni UV, Bmf è rilasciata dal
complesso citoscheletrico nel citoplasma, dove può legarsi a membri antiapoptotici della famiglia di Bcl-2 ed attivare la cascata delle caspasi e
conseguente morte cellulare (113). La proteina Bmf è stata individuata in molti
organi, con livelli abbondanti nel pancreas, rene, fegato e tessuto ematopoietico.
Al momento nessun dato di letteratura è disponibile a riguardo dell’espressione di
Bmf nell’epatocarcinoma umano. In questo lavoro di tesi abbiamo quindi
investigato la regolazione di Bmf da parte del miR-221 ed il ruolo del miR nella
regolazione di pathway pro-apoptotici.
Il sito del miR-221 nel 3’UTR di Bmf risulta molto conservato tra le varie
specie animali ed è riconosciuto da tutti e tre gli algoritmi utilizzati (miRanda,
TargetScan e Pictar) (Figura 28A). Un’ulteriore prova a favore del potenziale
ruolo del miR-221 nella regolazione di Bmf è data dall’analisi di linee cellulari di
HCC (HepG2, Hep3B, SNU398 and SNU449), le quali mostrano una correlazione
inversa tra i livelli di miR-221 ed i livelli della proteina Bmf. Il fatto che non vi
sia una correlazione tra miR-221 e Bmf mRNA fa ipotizzare ad una regolazione
di tipo post-trascrizionale, blocco della traduzione, da parte del miR-221 (Figura
28B-E).
119
Figura 28. Sito del miR-221 nel 3’UTR di Bmf ed analisi di linee cellulari
di HCC. (A) Sito di legame del miR-221 nel 3’UTR dell’mRNA di Bmf,
come predetto dall’algoritmo TargetScan. (B) Analisi di Real time PCR del
miR-221 in linee di HCC. Il gene U6RNA è stato utilizzato come
housekeeping. (C, D) Analisi di Western blot ed RT-PCR di Bmf in linee
cellulari di HCC. La β-actina è stata utilizzata come gene housekeeping. I
valori rappresentano il rapporto tra Bmf e la β-actina. (E) Correlazione inversa
tra miR-221 e Bmf proteina e tra miR-221 e Bmf RNA nelle linee di HCC. I
valori di miR-221 e Bmf sono stati espressi in forma logaritmica (log2).
Per verificare che il miR-221 regolasse i livelli di espressione di Bmf,
abbiamo eseguito un’analisi funzionale in vitro su linee di HCC. In particolare,
abbiamo selezionato la linea Hep3B sia per l’over-espressione che per il
silenziamento del miR-221, in quanto esprime, tra linee analizzate in questo
studio, livelli intermedi di miR-221 e bassi livelli della proteina Bmf. Dopo la
trasfezione con il miR-221 abbiamo osservato una diminuzione di 1.5 volte dei
livelli di Bmf, mentre in seguito al sileziamento del miR-221 è stato osservato un
incremento di 1.8 volte dell’espressione di tale proteina (Figura 29A). Per
confermare tale dato, abbiamo selezionato la linea SNU398 la quale esprime
120
livelli costitutivi molto bassi di tale microRNA insieme ad alti livelli della
proteina Bmf, per eseguire l’over-espressione del miR-221. La trasfezione del
miR-221 in tale linea ha portato ad una diminuzione di 1.9 volte nei livelli di
espressione della proteina Bmf (Figura 29A). Al contrario la linea SNU449 è
stata selezionata per il silenziamento del miR-221 in quanto esprime i più alti
livelli di miR-221 ed i più bassi livelli di Bmf. La trasfezione con l’anti-miR-221
ha determinato un aumento di 2.5 volte dei livelli di espressione della proteina
Bmf, quando paragonata con la trasfezione di un controllo negativo (Figura
29A).
Successivamente, per dimostrare la presenza di interazione diretta tra miR-221
e Bmf mRNA, abbiamo clonato una porzione del 3’UTR di Bmf a valle di un
gene reporter nel vettore pGL3 (pGL3-BMF). Tale vettore è stato co-trasfettato
nella linea Hep3B insieme al miR-221, all’antimiR-221 o a controlli negativi.
L’attività di luciferasi del vettore pGL3-Bmf è risultata significativamente
diminuita in presenza di miR-221 (p=0.0001, t-test) e significativamente
aumentata in presenza di anti-miR-221 (p=0.00001 at t-test), quando paragonata
con cellule co-trasfettate con il controllo negativo (Figura 29B). Presi insieme,
questi dati dimostrano che Bmf è un bersaglio diretto del miR-221 in linee
cellulari di HCC.
121
Figura 29. Bmf è un bersaglio diretto del miR-221. (A) Esperimenti di
trasfezione ed analisi di Western blot nelle linee Hep3B, SNU3398 e
SNU449. Control: miRNA Negative Controls; Test: miR-221 o anti-miR-221
come indicato. β-actina è stata utilizzata come gene housekeeping. I valori
rappresentano il rapporto tra Bmf e la β-actina. (B) Saggio di luciferasi nelle
cellule Hep3B trasfettate con miR-221, anti-miR-221 e controllo negativo.
Ogni campione è stato analizzato in triplicato in due esperimenti differenti.
Colonne: valore medio; Barre: deviazione standard.
3.3.4 Il microRNA-221 è sovra-espresso in condizioni di non-adesione alla
matrice extra-cellulare e induce apoptosi tramite l’inibizione di Bmf
Dati di letteratura dimostrano che la proteina Bmf è coinvolta in uno specifico
tipo di morte cellulare indotta in seguito a distacco delle cellule dalla matrice
extra-cellulare (ECM), tale processo è noto come ‘anoikis’(114). Per saggiare il
ruolo del miR-221 in condizioni di sospensione cellulare, le piastre colturali sono
state trattate con il polimero Polyhema per 24h a 37°C, tale polimero impedisce
122
l’adesione delle cellule alla piastra. La linea cellulare SNU449 è stata trasfettata
per 24h con l’anti-miR-221 o con un controllo negativo e successivamente le
cellule sono state coltivate in condizioni di sospensione per altre 24h. La conta
delle cellule apoptotiche è stata effettuata con Trypan Blue in camera di Burker.
Dopo 24 e 48h di crescita in condizioni di sospensione cellulare, è stato osservato
un incremento di 1.4 e 2.0 volte nel numero di cellule morte nelle cellule
trasfettate con l’anti-miR-221 rispetto a quelle trattate con il controllo negativo
(p<0.001, t-test per entrambi i tempi) (Figura 30A). Per caratterizzare più nel
dettaglio tale processo apoptotico, abbiamo eseguito un’analisi di Western blot di
alcuni marcatori apoptotici sulle cellule SNU449 trattate con anti-miR-221 e
cresciute in sospensione per 24h. Le cellule silenziate per il miR-221 hanno
mostrato un incremento di 1.7 volte sia nei livelli di espressione di Bmf che di
Caspasi 3 attivata, quando confrontate con le cellule trattate con un controllo
negativo (Figura 30B). Per dimostrare che il miR-221 induce morte cellulare in
condizioni di non-adesione specificatamente attraverso l’azione di Bmf, abbiamo
eseguito il silenziamento di Bmf utilizzando un pool di siRNA nelle cellule
SNU449. Ventiquattro ore dopo la trasfezione dell’anti-miR-221, abbiamo
eseguito il silenziamento di Bmf per altre 24h e successivamente trasferito le
cellule in una piastra trattata con polyhema. Il silenziamento di Bmf in seguito a
trattamento con anti-miR-221 ha causato una diminuzione significativa dei livelli
di Caspasi 3 attivata (isoforma di 17 kDa) rispetto alle cellule trattate con solo
l’anti-miR-221 (Figura 30C). Presi insieme, questi dati dimostrano chiaramente
che il miR-221 regola il processo di morte cellulare in condizioni di non-adesione
attraverso l’inibizione di Bmf.
123
Figura 30. L’anti-miR-221 aumenta la suscettibilità all’apoptosi della
linea SNU449 in condizioni di non-adesione. (A,B) Conta cellulare con
Trypan Blue ed analisi di Western blot in cellule SNU449 trasfettate con antimiR-221 e controllo negativo (NC) e cresciute in condizioni di non-adesione.
(C) In condizioni di sospensione cellulare il silenziamento del miR-221
seguito dal silenziamento di Bmf determina una diminuzione dell’attivazione
della Caspasi 3. La β-actina è stata utilizzata come gene housekeeping. I valori
rappresentano il rapporto tra Bmf o Caspasi 3 e la β-actina.
Successivamente, abbiamo investigato l’espressione del miR-221 e del suo
gene target Bmf in condizioni di non-adesione cellulare nella linea SNU449.
L’analisi di Real time PCR ha mostrato un progressivo aumento dei livelli di
miR-221 con un picco massimo a 24h dalla sospensione cellulare (Figura 31A).
Tale aumento è risultato direttamente proporzionali ai livelli di Bmf mRNA
124
(Figura 31B), ma inversamente proporzionale ai livelli di Bmf proteina (Figura
31C). Inoltre, l’attivazione della Caspasi 3 è avvenuta solo a 48h dalla
sospensione cellulare quando i livelli di miR-221 cominciavano a diminuire
consentendo la traduzione dell’mRNA di Bmf. Tali dati dimostrano che, anche in
condizioni di non-adesione alla matrice extra-cellulare, il miR-221 è in grado di
regolare l’espressione della proteina Bmf e che quest’ultima è determinante
nell’attivazione della Caspasi 3 e quindi nell’induzione del processo di morte
cellulare per apoptosi.
Figura 31. L’espressione del miR-221 aumenta in condizioni di nonadesione e regola Bmf. (A) Analisi di Real time PCR del miR-221 in condizioni
di non-adesione. (B) Analisi di RT-PCR di Bmf in condizioni di non-adesione.
(C) Analisi di Western blot di Bmf e Caspasi 3 attivata in condizioni di nonadesione. La β-actina è stata utilizzata come gene housekeeping per la
normalizzazione sia dei livelli di mRNA che di proteina. I valori rappresentano il
rapporto tra Bmf o Caspasi 3 e la β-actina.
125
3.3.5 Ruolo prognostico del microRNA-221: correlazione con la focalità del
tumore ed il tempo di insorgenza di recidiva epatica in pazienti
chirurgicamente trattati per epatocarcinoma
Per valutare il significato della correlazione tra miR-221 e Bmf in tumori
primari di HCC, l’espressione del miR-221 è stata analizzata tramite Real time
PCR in 51 campioni di HCC e circostante fegato cirrotico ed è risultata aumentata
nel 70% dei campioni di HCC. L’espressione della proteina Bmf è stata valutata
tramite analisi di Western blot in 27 dei 51 campioni di HCC, selezionati sulla
base della disponibilità del tessuto. In linea con i dati ottenuti in vitro, nei
campioni di HCC è stata osservata una correlazione inversa tra i valori di miR221 e quelli del suo gene target Bmf (Pearson’s test: p=0.003) (Figura 32A).
Inoltre, allo scopo di investigare la funzione biologica di Bmf nei campioni di
HCC, gli stessi campioni biologici sono stati analizzati tramite Western blot per
testare l’attivazione della Caspasi 3, utilizzata come marcatore di apoptosi. Una
correlazione inversa statisticamente significativa è stata individuata tra Bmf e
Caspasi 3 attivata (Pearson’s correlation, p<0.0001) (Figura 32B); tale dato fa
supporre ad un possibile coinvolgimento della proteina Bmf nel processo proapoptotico in vivo. Al contrario non è stata trovata alcuna correlazione tra miR221 e Caspasi 3 attivata. Quest’ultimo dato potrebbe essere spiegato dal fatto che
il miR-221 non è l’unico fattore in grado di regolare l’espressione di Bmf e che
quest’ultimo non è l’unico fattore pro-apoptotico in grado di scatenare
l’attivazione della cascata delle caspasi. Perciò, in vivo risulta molto difficile
trovare una correlazione diretta tra miR-221 e attivazione della Caspasi-3,
essendo probabilmente il network molecolare molto più complesso; ulteriori studi
126
saranno quindi necessari per caratterizzare più a fondo il ruolo del miR-221 nel
processo di morte cellulare per apoptosi nei campioni di HCC.
Figura 32. Analisi dell’espressione del miR-221, Bmf e Caspasi 3 attivata
in campioni di HCC. (A) Il miR-221, analizzato tramite Real-Time PCR,
correla in maniera inversamente proporzionale con l’espressione di Bmf,
analizzata tramite Western blot, in campioni di HCC. Ogni dato derivante da
campioni di HCC è stato normalizzato con il valore della rispettiva cirrosi ed
espresso in forma logaritmica (log2). (B) L’espressione della proteina Bmf
correla direttamente con i livelli di Caspasi 3 attivata in campioni di HCC.
Entrambe le molecole sono state saggiate tramite Western blot. La β-actina è
stata utilizzata come gene housekeeping.
In aggiunta, poichè la deregolazione dell’apoptosi gioca un ruolo cruciale
nello sviluppo e nella progressione tumorale dell’epatocarcinoma, abbiamo
investigato la presenza di possibili correlazioni tra i livelli di miR-221 o di Bmf
con le caratteristiche clinico-patologiche dei pazienti sottoposti a resezione
chirurgica per HCC. Da tale analisi statistica è emersa una correlazione tra alti
livelli di miR-221 e HCC di natura multi-focale rispetto a quelli uni-focali
(p=0.009, t-test). In linea con questo dato, l’espressione di Bmf è risultata più
127
bassa in tumori multi-focali rispetto a quelli uni-focali (p=0.01, t-test). Gli alti
livelli di Bmf osservati negli HCC uni-focali e la correlazione con l’attivazione
della Caspasi 3 possono far supporre ad un coinvolgimento di Bmf nel processo
apoptotico e ad un suo ruolo attivo nel processo di mestatizzaione neoplastica.
Potremmo quindi speculare che, attraverso l’inibizione di Bmf, alti livelli di miR221 possano contribuire ad una diminuita velocità di apoptosi, favorendo la
selezione di cellule tumorali di natura più aggressiva, con aumentate capacità
invasive ed in grado di generare tumori multi-focali.
Dall’analisi di Kaplan-Meier è stata inoltre osservata una correlazione tra
pazienti che presentavano una recidiva di HCC entro i due anni dalla resezione
epatica con alti livelli di espressione del miR-221 (log-rank test, p = 0.0009)
(Figura 33A), ma non con bassi livelli di Bmf (Figura 33B), anche se bassi
livelli di Bmf sono associati ad un tendenza verso un minor tempo di insorgenza
della recidiva (TTR). Per quel che riguarda la recidiva epatica, il valore soglia di
due anni dal giorno dell’intervento è stato scelto in accordo con il lavoro di
Imamura et al, in quanto tumori epatici che insorgono ad una distanza di tempo
superiore ai due anni dalla resezione sono da considerare dei nuovi HCC insorti
su fegato cirrotico (115). Il fatto che i livelli di Bmf non correlano in maniera
significativa con il TTR potrebbe essere dovuto al basso numero di campioni
analizzati per Bmf rispetto a quelli analizzati per il miR-221 (26 contro 46 HCC).
Inoltre, non possiamo dimostrare se il diverso comportamento di pazienti con
differenti livelli di miR-221 sia da imputare alla sola regolazione di Bmf o ad altri
bersagli molecolari non ancora individuati o, ancora più probabilmente, all’intero
set di geni regolati dal miR-221.
128
Nessuna associazione significativa è stata invece trovata tra i livelli di miR221 o Bmf e la mortalità dopo intervento chirurgico associata al tumore. Questo
potrebbe essere spiegato dal fatto che una percentuale di pazienti curativamente
trattati per HCC muoiono per complicazioni dovute alla cirrosi o per insorgenza
di un nuovo epatocarcinoma. Inoltre non è stata trovata alcuna correlazione tra i
livelli di miR-221 o del suo gene target con il grado istopatologico, la dimensione
del tumore, le infezioni virali ed i livelli di AFP. I pazienti arruolati in questo
studio sono descritti in Tabella 21.
Figura 33. Probabilità di recidiva epatica in pazienti con HCC. (A, B)
Associazione tra i livelli di miR-221 o Bmf ed il TTR. Alti e bassi livelli di
miR-221 o Bmf sono stati categorizzati in base al valore medio. I log-rank pvalue provengono dall’analisi di Kaplan-Meier.
129
Tabella 21. Caratteristiche dei pazienti con HCC analizzati nello studio del
miR-221 e di Bmf.
N.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
Genere
M
M
M
F
F
M
M
M
M
F
F
F
F
M
F
M
M
M
M
M
M
M
F
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
F
F
M
M
M
M
M
M
M
M
Età
65
52
70
65
62
67
77
70
65
80
59
66
68
59
82
60
78
54
69
74
73
77
71
68
81
74
74
82
51
79
70
72
70
75
59
67
65
76
49
53
62
79
68
65
64
60
60
58
66
Eziologia (1)
Focalità (2)
HBV+Ethanol
None
HCV
HCV
HCV
HCV
HBV-Ab
Ethanol
HCV+Ethanol
HCV
HCV
HCV
None
HCV
HCV
Ethanol
HCV
HBV
HCV
None
HCV
HCV
HCV
HCV
HCV
HCV
HCV+HBV
None
HBV+HCV
HCV
HCV
HCV
None
HCV
HCV
None
HCV
HBV-Ab
HBV
HCV
HCV
HBV
HCV
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
uni
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
multi
Dimensioni
(3)
3
5
4
3
3
6
5
5
3
5
6
8
5.5
5
7.5
2
3
4
10
11
4.5
2.2
2
2.5
3
3.5
3
5
7
10
2.3
3.4
10
7
3
6
6.5
5
4
4
3
7
8
HCV
HCV+Ethanol
HCV
HCV
HCV
HCV
multi
multi
multi
multi
multi
multi
7
6.5
3.2
1.3
3
3
130
AFP (4)
5
5
35
3
76
3352
4
537
20
76
7
9572
2
86
964
156
9
162
390
78
2
48
276
5
8
2198
75
4
1924
7
46
18
11
9
76
18766
167
10.000
2708
60
468
540
86
139.313
8
15
257
132
58
Grado
(5)
G2
G2
G3
G3
G3
G3
G3
G3
G3
G3
G4
G3
G3
G3
G3
G2
G2
G2
G3
G3
G3
G2
G3
G2
G3
G3
G4
G3
G3
G3
G3
G3
G2
G3
G3
G3
G3
G4
G4
G3
G2
G4
G3
G4
G3
G2
G4
G3
G2
50
51
M
M
75
68
HCV
HCV
multi
multi
3
6.5
63
131
G3
G3
1) Cause della sottostante patologia epatica: HBV: Virus Epatite B; HCV: Virus Epatite B; BAb:
anticorpi contro HBV; Etanolo: storia di abuso di alcol; Criptogenici sono quei casi in cui sono
stati esclusi: infezioni virali, abuso di alcol, emocromatosi, patologia di Wilson, deficienza di α1anti-tripsina, cirrosi biliare primaria, epatite autoimmune e colangite sclerosante primaria.
2) Uni-o multifocalità è stata assegnata sulla base di tecniche di imaging precedenti l’intervento
chirurgico.
3) Dimensioni del nodulo di HCC (cm)
4) Livelli di alfa-feto-proteina sono stati misurati prima dell’intervento.
5) Grado di HCC è stato assegnato attraverso i criteri di Edmonson e Steiner’s (74).
131
3.4 Studio del ruolo biologico del microRNA-199a-3p: regolazione dei
pathway molecolari di mTOR e c-Met in linee cellulari di epatocarcinoma
Tra i 35 microRNA deregolati nei campioni di HCC, individuati tramite
analisi di microarray, abbiamo investigato il ruolo del miR-199a-3p poiché tale
miRNA risultava sotto-espresso nella maggior parte degli epatocarcinomi (70%),
così come in altri tumori umani (116, 117), in linee cellulari derivate da neoplasia
(118, 119) ed in modelli animali di steatoepatite (120). Inoltre, dati di letteratura
riportano la regolazione di differenti geni target da parte del miR-199a-3p quali cMet (56), Smad1 (121), LIF (122) e dimostrano che l’espressione esogena di tale
miR riduce la motilità e la sopravvivenza di linee cellulari derivate da melanoma,
cancro gastrico e cancro del polmone (119).
Allo scopo di caratterizzare il ruolo del miR-199a-3p nel processo di
epatocarcinogenesi, abbiamo eseguito un’analisi bioinformatica al fine di
individuare ipotetici geni bersaglio di questo miR. Tale analisi ha consentito di
individuare l’oncogene mTOR (Mammalian Target Of Rapamycin) come
possibile bersaglio molecolare del miR-199a-3p. Tutti gli algoritmi utilizzati,
MiRanda, Pictar and TargetScan (Figura 34A) hanno infatti individuato un sito
bersaglio del miR-199a-3p nella regione 3’UTR dell’RNA messaggero di mTOR.
L’oncogene mTOR è una serina/treonina cinasi che gioca un ruolo chiave
nella crescita cellulare, nella traduzione proteica, nell’invasione e nell’apoptosi
(123). Il pathway di mTOR viene attivato da multipli segnali extra-cellulari come
fattori di crescita, aminoacidi, ormoni e fitogeni, portando alla fosforilazione del
regolatore della traduzione, la cinasi RPS6-p-70, la quale a sua volta regola la
proliferazione cellulare, la sintesi proteica e consente la progressione dalla fase
132
G1 alla fase S del ciclo cellulare. Inoltre, il pathway di mTOR risulta implicato
nell’iniziazione e nella progressione di numerosi tipi di tumore, incluso
l’epatocarcinoma, risultando perciò un promettente bersaglio terapeutico per il
trattamento dell’HCC (124, 125). In particolare, nell’epatocarcinoma l’attivazione
del pathway di mTOR è associata ad una prognosi peggiore e all’aumentato
rischio di metatstatizzazione (126).
Allo scopo di studiare la regolazione di mTOR da parte del miR-199a-3p,
abbiamo analizzato tre linee cellulari derivate da HCC (Huh-7, HepG2 e
SNU475) per i liveli di espressione del miR-199a-3p e di mTOR tramite analisi di
Real time PCR, di Western blot e di RT-PCR (Figura 34B, C). Da tale analisi si
può osservare la presenza di una correlazione inversa tra i livelli di miR-199a-3p
ed i livelli proteici di mTOR, mentre non vi è alcuna correlazione tra l’espressione
del miR ed il livelli di mRNA di mTOR (Figura 34D).
133
Figura 34. Sito di appaiamento tra il miR-199a-3p ed il 3’UTR di mTOR.
Analisi di linee di HCC. (A) Sito di legame del miR-199a-3p nel 3’UTR di
mTOR, come predetto dall’algoritmo TargetScan. (B) Analisi di Real time
PCR del miR-199a-3p in linee cellulari di HCC. Il gene U6RNA è stato
utilizzato come gene housekeeping. Nell’asse delle ordinate è riportato il
valore di 2(-δδCt) in scala logaritmica.Ogni campione è stato analizzato in
triplicato. Colonne: valore medio; Barre: deviazione standard. (C,D) Analisi
di Western blot e di RT-PCR di mTOR in linee di HCC. La β-actina è stata
utilizzata come gene housekeeping per la normalizzazione sia dei livelli di
mRNA che di proteina. I valori rappresentano il rapporto tra mTOR e la βactina.
Allo scopo di dimostrare che il miR-199a-3p partecipa alla regolazione
dell’espressione di mTOR, abbiamo eseguito un’analisi funzionale in vitro sovraesprimendo o silenziando il miR-199a-3p in linee cellulari derivate da HCC. Le
linee HepG2 e Huh-7 sono state selezionate per la sovra-espressione del miR199a-3p, in quanto esprimono livelli costitutivi molto bassi di tale miR in
presenza di alti livelli della proteina mTOR. In seguito alla trasfezione,
l’espressione del miR-199a-3p nelle due linee di HCC è risultata simile a quella
134
osservata nei campioni provenienti da fegato sano (Figura 35); tale dato mostra
quindi che nei nostri saggi in vitro abbiamo quindi ripristinato il miR-199a-3p a
livelli simili a quelli fisiologici.
Figura 35. Espressione del miR-199a-3p in linee cellulari e campioni
biologici. (A) Analisi di Real-time PCR del miR-199a-3p nel fegato sano
(pool di 6 casi), in campioni di HCC (pool di 5 casi), campioni di CE (pool di
5 CE circostanti i noduli di HCC) e linee cellulari trasfettate con miR-199a-3p
(miR), anti-miR-199a-3p (AM) e controlli negativi (NC). Il gene U6RNA è
stato utilizzato come gene housekeeping. Il valore di 2(-∆∆Ct) è stato riportato
nell’asse delle ordinate in scala logaritmica. Ogni campione è stato corso in
triplicato. Colonne: valore medio; Barre: deviazione standard.
L’analisi di Western blot ha rivelato una diminuzione di 1.9 e 1.4 volte nei
livelli di espressione di mTOR nelle linee HepG2 e Huh-7, rispettivamente. Al
fine di dimostrare che anche il pathway a valle di mTOR era modulato dal miR199a-3p, abbiamo analizzato il grado di fosforilazione della proteina ribosomale
S6, un bersaglio della cinasi RPS6-p70. La trasfezione del miR-199a-3p ha
determinato una sotto-espressione della isoforma fosforilata della proteina S6 (PS6) sia nelle cellule HepG2 che Huh-7 (9.1 e 1.3 volte, rispettivamente) Non è
stata invece individuata alcuna diminuzione dei livelli di mRNA di mTOR
(Figura 36A, B). Al contrario, la linea SNU475 è stata scelta per il silenziamento
del miR-199a-3p poiché essa esprime alti livelli basali di miR-199a-3p associati a
135
bassi livelli proteici di mTOR. L’inibizione del miR-199a-3p nelle cellule
SNU475 ha determinato un aumento sia di mTOR che di P-S6, ma nessuna
variazione a livello di mTOR mRNA (Figura 36C). Questi dati suggeriscono una
regolazione post-trascrizionale, blocco della traduzione, di mTOR da parte del
miR-199a-3p in linee di HCC.
Successivamente, per dimostrare l’interazione diretta tra miR-199a-3p ed il
sito complementare presente nella regione 3’UTR di mTOR, un’ampia regione
del 3’UTR è stata clonata a valle del gene reporter nel vettore pGL3. Il vettore
così ottenuto, chiamato pGL3-mTOR è stato co-trasfettato nelle linee Huh-7 e
SNU475 insieme a miR-199a-3p, anti-miR-199a-3p o controlli negativi e la
variazione di attività luciferasica è stata saggiata tramite il Dual Luciferase Assay.
Le cellule Huh-7 trasfettate con il vettore pGL3-mTOR hanno mostrato una
diminuzione di 1.3 volte dell’attività luciferasica quando co-trasfettate con il miR199a-3p (t-test, p=0.03). Al contrario, le cellule SNU475 trasfettate con il vettore
pGL3-mTOR hanno mostrato una diminuzione di 3.0 volte dell’attività
luciferasica quando co-trasfettate con l’anti-miR-miR-199a-3p (t-test, p=0.006)
(Figura 36D). Inoltre la sequenza complementare al miR-199a-3p è stata
mutagenizzata nella regione 3’UTR di mTOR, per generare il vettore mutato
pGL3-mTOR-m1. Nessuna variazione significativa dell’attività luciferasica è
stata osservata in seguito a co-trasfezione del vettore mutagenizzato con il miR199a-3p o l’anti-miR-199a-3p (Figura 36D). Presi insieme, questi dati
dimostrano la presenza di interazione diretta tra miR-199a-3p ed mTOR mRNA
in linee cellulari derivate da HCC.
136
Figura 36. mTOR è un bersaglio del miR-199a-3p. (A-C) Trasfezione di
miR-199a-3p (miR), anti-miR-199a-3p (AM) e controlli negativi (NC) nelle
linee cellulari HepG2, Huh-7 e SNU475. Analisi di Real time PCR del miR199a-3p. Il gene U6RNA è stato utilizzato come gene housekeeping. Il valore
di 2(-∆∆Ct) è stato riportato nell’asse delle ordinate in scala logaritmica. Ogni
campione è stato corso in triplicato. Colonne: valore medio; Barre: deviazione
standard. Analisi di RT-PCR e Western blot per determinare l’espressione di
mTOR e P-S6. La β-actina è stata utilizzata come gene housekeeping per la
normalizzazione sia dei livelli di mRNA che di proteina. I valori
rappresentano il rapporto tra mTOR o P-S e la β-actina. (D) Saggio di
luciferasi nelle celule Huh-7 e SNU475. Il vettore pGL3-mTOR ed il vettore
mutagenizzato pGL3-mTOR-m1 sono stati co-trasfettati con miR-199a-3p,
anti-miR-199a-3p o controlli negativi. Ogni campione è stato corso in
triplicato. Colonne: valore medio; Barre: deviazione standard.
3.4.1 Il microRNA-199a-3p ed i suoi bersagli molecolari regolano il ciclo
cellulare in linee cellulari di epatocarcinoma
Al fine di analizzare il ruolo biologico del miR-199a-3p nella regolazione del
ciclo cellulare, abbiamo trasfettato il miR-199a-3p nelle cellule HepG2 e saggiato
la distribuzione attraverso le diverse fasi del ciclo cellulare. Inoltre, per valutare
137
l’inibizione dell’espressione dei due geni target, mTOR e c-Met, abbiamo
eseguito un’analisi di Western blot sulle cellule HepG2 trasfettaete con il miR199a-3p, la quale ha mostrato una diminuzione dell’espressione (1.8 volte) sia di
mTOR che di c-Met. Un aumento della popolazione cellulare nella fase G1 (11%)
ed una diminuzione del numero di cellule nella fase S (22%) è stata osservata in
seguito a sovra-espressione del miR-199a-3p, rispetto alle cellule trasfettate con il
controllo negativo (t-test, p<0.01). In accordo con l’analisi citofluorimetrica
(FACS), abbiamo osservato tramite Western blot ed RT-PCR un aumento di
espressione di due importanti inibitori del ciclo cellulare, CDKN1A/p21 e
CDKN1B/p27, in seguito al ripristino dei livelli fisiologici di miR-199a-3p nelle
cellule HepG2 (Figura 37A).
Inoltre, essendo noto il ruolo del miR-199a-3p nella regolazione del protooncogene c-Met in diverse linee cellulari (56) ed il suo coinvolgimento nella
modulazione della proliferazione cellulare, per discriminare quale bersaglio del
miR-199a-3p, mTOR o c-Met, contribuisse maggiormente alla regolazione del
ciclo cellulare, abbiamo silenziato entrambi i geni target tramite specifici siRNA
(Figura 37B, C). La trasfezione delle cellule HepG2 con entrambi i siRNA contro
mTOR o c-Met ha determinato un arresto nella fase G1 (25%) del ciclo cellulare
(t-test, p<0.01). In aggiunta, in maniera simile a quanto osservato con il miR199a-3p, il silenziamento di mTOR e c-Met (diminuzione di 2.9 volte) ha causato
un aumento dell’espressione di CDKN1B/p27 sia a livello di mRNA che di
proteina. Per quel che riguarda la regolazione di CDKN1A/p21, il silenziamento
di c-Met ha portato ad un aumento della sua espressione, mentre il silenziamento
di mTOR ha determinato una diminuzione dei livelli proteici di CDKN1A/p21
(Figura 37B, C).
138
Figura 37. Il miR-199a-3p regola il ciclo cellulare della linea HepG2. (A)
Analisi di Western blot di mTOR e c-Met nelle cellule HepG2 trasfettate con
il miR-199a-3p o con un controllo negativo (NC). Analisi FACS di cellule
HepG2 trasfettate con il miR-199a-3p. Analisi di WB ed RT-PCR per i due
inibitori CDKN1A/p21 e CDKN1B/p27. (B, C) Analisi di Western blot di
mTOR e c-Met nelle cellule HepG2 trasfettate con siRNA contro mTOR o cMet o con un controllo negativo (Scramble). Analisi FACS di cellule HepG2
silenziate per mTOR o c-Met. Analisi di Western blot ed RT-PCR per i due
inibitori CDKN1A/p21 e CDKN1B/p27. La β-actina è stata utilizzata come
gene housekeeping per la normalizzazione sia dei livelli di mRNA che di
proteina. I valori rappresentano il rapporto tra l’espressione genica e la βactina. Analisi FACS: ogni campione è stato analizzato in duplicato. Colonne:
valore medio; Barre: deviazione standard.
In aggiunta, per confrontare i nostri dati con quelli riportati dalla letteratura
(127), abbiamo bloccato il pathway di mTOR trattando la linea HepG2 con la
Rapamicina, un noto inibitore del pathway di mTOR. Questo trattamento ha
provocato un arresto del ciclo cellulare in fase G1 (11%) (p=0.04, t-test) ed un
blocco della fosforilazione della proteina S6, simili a quelli osservati in seguito
alla trasfezione del miR-199a-3p (Figura 38). Inoltre, in seguito al trattamento
con Rapamicina, è stata osservata una diminuzione dell’espressione di
CDKN1A/p21.
139
Figura 38. Il trattamento con Rapamicina regola il ciclo cellulare della
linea HepG2.Analisi di Western blot di mTOR e P-S nelle cellule HepG2 trattate
con la Rapamicina o con il veicolo (DMSO). Analisi FACS di cellule HepG2
trattate con Rapamicina. Analisi di WB per i due inibitori CDKN1A/p21 e
CDKN1B/p27. La β-actina è stata utilizzata come gene housekeeping. I valori
rappresentano il rapporto tra p21 e p27 e la β-actina.
Per caratterizzare ulteriormente il contributo del miR-199a-3p nella
regolazione del ciclo cellulare, abbiamo silenziato il miR-199a-3p nelle cellule
SNU475 e trasfettato le stesse con i siRNA contro mTOR o c-Met. In linea con i
dati precedenti, il trattamento con l’anti-miR-199a-3p ha rivelato una riduzione
(20%) (p<0.01, t-test) del numero di cellule in fase G1, rispetto alle cellule
tasfettate con il controllo negativo (Figura 39A). In particolare, il silenziamento
di mTOR o c-Met successivo alla trasfezione con l’anti-miR-199a-3p ha portato
ad un parziale ripristino del fenotipo indotto dall’anti-miR-199a-3p, con un
aumento della fase G1 (8% con mTOR siRNA e 12% con c-Met siRNA; t-test,
p=0.028 e p=0.014, rispettivamente) (Figura 39B). Presi insieme, questi dati
140
dimostrano che il miR-199a-3p contribuisce alla modulazione del ciclo cellulare
di cellule derivate da HCC, almeno in parte, attraverso il silenziamento di mTOR
e di c-Met.
Figura 39. Il miR-199a-3p regola il ciclo cellulare attraverso l’inibizione
di mTOR e c-Met. (A) Analisi FACS di cellule SNU475 trasfettate con
l’anti-miR-199a-3p (AM-199a-3p) o con il controllo negativo (NCi). (B)
Analisi FACS di cellule SNU475 trasfettate con l’anti-miR-199a-3p (AM199a-3p) e successivamente silenziate con siRNA contro mTOR o c-Met.
Analisi FACS: ogni campione è stato analizzato in duplicato. Colonne: valore
medio; Barre: deviazione standard.
3.4.2 Il microRNA-199a-3p regola la sensibilità alla Doxorubicina, l’apoptosi
in condizioni ipossiche e le capacità invasive in linee cellulari di
epatocarcinoma
Dati di letteratura riportano che l’inibizione del pathway di mTOR da parte
della Rapamicina, o di farmaci analoghi, ha un effetto anti-tumorale sinergico
quando co-somministrata con il chemioterapico Doxorubicina in modelli animali
di HCC (128). Per tale motivo, in questo lavoro di tesi abbiamo investigato se,
oltre al trattamento con analoghi della Rapamicina, anche il ripristino del miR199a-3p od il silenziamento dei suoi geni target potesse modulare il processo di
141
apoptosi indotto dalla Doxorubicina. Poiche la Rapamicina induce apoptosi in
maniera p53-dipendente (129), abbiamo utilizzato la linea cellulare HepG2, la
quale esprime un’isoforma wild-type della proteina p53. In seguito al trattamento
con Doxorubicina, l’analisi FACS con l’anticorpo anti-Annexina V ha rivelato un
aumento dell’apoptosi di 2.5 volte (p=0.005, t-test) in seguito al ripristino dei
livelli fisiologici di miR-199a-3p. In maniera del tutto simile, un aumento del
numero di cellule apoptotiche è stato osservato in seguito al silenziamento sia di
mTOR che di c-Met (3.0 e 1.6 volte) (p=0.005 e p=0.03, t-test), con il più alto
incremento nelle cellule trattate con i siRNA anti-mTOR (Figura 40A). Come
ulteriore prova a favore dell’incrementata apoptosi cellulare, un aumento dei
livelli di Caspasi-3 attivata è stato osservato sia nelle cellule trasfettate con il
miR-199a-3p che nelle cellule silenziate per mTOR. Inoltre, una sovraespressione dell’mRNA di Puma, un target trascrizionale di p53, è stata osservata
in seguito al ripristino dei livelli di miR-199a-3p come pure in seguito al
silenziamento sia di mTOR che c-Met (Figura 40B). Questi dati dimostrano che
il miR-199a-3p incrementa la sensibiltà delle cellule HepG2 alla Doxorubicina a
livelli simili a quelli del silenziamento di mTOR e che il processo apoptotico è
scatenato, almeno in parte, dall’attivazione della cascata delle caspasi.
Poichè è noto che il pathway di mTOR incrementa la stabilità della proteina
HIF-1α (Hypoxia Inducile Factor 1A) in condizioni di ipossia (130) e che il miR199a-5p regola direttamente l’espressione del gene HIF-1α (131), abbiamo
analizzato il ruolo dei miR-199a-3p e miR-199a-5p nella suscettibilità
all’apoptosi in condizioni ipossiche nelle cellule HepG2. L’analisi FACSAnnexin V ha mostrato un aumento del numero di cellule apoptotiche nella linea
142
HepG2 trattata sia con il miR-199a-3p che con il miR-199a-5p e coltivata in
condizioni ipossiche (Figura 40C).
Successivamente abbiamo investigato tramite Matrigel assay il ruolo del miR199a-3p e dei suoi geni target nella modulazione della capacità invasiva di linee
cellulari di epatocarcinoma. Dati di letteratura dimostrano che il proto-oncogene
c-Met è coinvolto in un complesso programma biologico note come ‘crescita
invasiva’ il quale consiste nella stimolazione della motilità ed invasione cellulare
e nella protezione dall’apoptosi (132). Il saggio di invasione ha evidenziato una
ridotta capacità invasiva sia delle cellule HepG2 trasfettate con il miR-199a-3p
(2.5 volte; t-test, p=0.009), che delle cellule trasfettate con i siRNA contro c-Met
(1.7 volte; t-test, p=0.017), rispetto alle cellule trasfettate con i controlli negativi.
Al contrario, le cellule silenziate per mTOR non hanno mostrato una riduzione
significativa nel numero di cellule capaci di attraversare lo strato di Matrigel (ttest, p=0.15). In accordo con questi dati, le cellule SNU475 trasfettate con l’antimiR-199a-3p hanno mostrato un’aumentata capacità invasiva (2.2 volte; t-test,
p=0.0005), rispetto alle cellule trasfettate con un oligonucleotide di controllo
(Figura 40D). Questi dati dimostrano che il miR-199a-3p è in grado di diminuire
il potenziale invasivo delle cellule di HCC attraverso l’inibizione di c-Met.
Inoltre, la maggiore diminuzione della capacità invasiva da parte del miR-199a-3p
rispetto al silenziamento di c-Met lascia ipotizzare che il miR possa agire sul
potenziale invasivo delle cellule di HCC attraverso la regolazione di multipli geni
bersaglio.
143
Figura 40. Il miR-199a-3p regola la sensibilità alla Doxorubicina, la
crescita in condizioni ipossiche e l’invasione cellulare. (A) Analisi FACSAnnexina V in cellule HepG2 trasfettate e sottoposte a trattamento con
Doxorubicina. (B) Analisi di Western blot della Caspasi 3 attivata e di RT-PCR di
Puma mRNA in cellule HepG2 trasfettate e sottoposte a trattamento con
Doxorubicina. La β-actina è stata utilizzata come gene housekeeping. I valori
rappresentano il rapporto tra Puma e la β-actina. (C) Analisi FACS-Annexina V
in cellule HepG2 trasfettate e sottoposte a trattamento con Deferoxamina. (D)
Matrigel assay in cellule HepG2 e SNU475 trasfettate. Sono stati contati 20 campi
indipendenti ad un ingrandimento di 25X. Analisi FACS el saggio di invasione:
ogni campione è stato analizzato in duplicato. Colonne: valore medio; Barre:
deviazione standard.
3.4.3 Ruolo prognostico del microRNA-199a-3p: correlazione con il tempo di
insorgenza di recidiva epatica in pazienti chirurgicamente trattati per
epatocarcinoma
Al fine di confermare i dati di microarray, per saggiare l’espressione del miR199a abbiamo eseguito un’analisi di Real time PCR su 39 tessuti di HCC e
circostante fegato cirrotico. Una significativa diminuzione dell’espressione sia del
miR-199a-3p che del miR-199a-5p è stata osservata in campioni di HCC quando
paragonati ai campioni provenienti dal tessuto cirrotico circostante (Figura 41A,
B) (ANOVA: p=0.0009). L’espressione proteica di mTOR è stata determinata
tramite analisi di Western blot ed è risutata aumentata in 23 dei 39 pazienti con
144
HCC inclusi in questo studio (Tabella 22). Una correlazione inversa tra
l’espressione del miR-199a-3p e quella di mTOR è stata individuata nei campioni
di HCC (Pearson’s correlation: p<0.0001) (Figura 41C). Inoltre, bassi livelli di
miR-199a-3p sono risultati associati ad un diminuito tempo di ricorrenza della
recidiva epatica (TTR) nei pazienti trattati chirurgicamente per epatocarcinoma
(log-rank test, p=0.04, Figura 41D). Al contrario, nessuna associazione è stata
identificata con la sopravvivenza dei pazienti analizzati. In aggiunta, nessuna
correlazione è stata individuata tra il miR-199a-3p ed i livelli di AFP, dimensioni
del tumore, focalità, grado istologico ed eziologia della sottostante cirrosi.
Figura 41. Espressione di miR-199a-3p e miR-199a-5p in campioni di
HCC e correlazione con mTOR e TTR. (A, B) Grafici box-plot di 39 campioni
di HCC e circostante fegato cirrotico (CE) raggruppati sulla base dei livelli di
espressione dei miR-199a-3p e miR-199a-5p. Le tre barre orizzontali dall’alto al
basso rappresentano il 75esimo, il 50esimo (mediana) ed il 25esimo percentile,
ripettivamente. I valori esterni sono rappresentati dai circoli. (C) Correlazione
inversa tra il miR-199a-3p ed mTOR nei tessuti di HCC (two-tailed Pearson’s
test, p<0.0001). Ogni dato derivante da campioni di HCC è stato normalizzato con
il valore della rispettiva cirrosi ed espresso in forma logaritmica (log2). (D)
Analisi di Kaplan-Meier della probabilità di recidiva epatica di pazienti con HCC.
145
I pazienti sono stati categorizzati sulla base del valore medio di espressione del
miR-199a-3p.
Tabella 22. Caratteristiche dei pazienti con HCC analizzati nello studio del
miR-199a.
N.
Genere Età
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
M
M
M
M
M
M
M
M
M
M
F
M
F
M
M
F
M
M
F
M
M
M
F
M
M
M
M
M
M
M
M
M
M
F
M
M
M
M
M
60
82
70
65
65
77
59
74
65
60
71
74
80
59
75
73
76
75
78
51
52
70
82
54
69
81
66
65
78
67
68
72
70
65
73
79
77
74
79
Eziologia (1)
Ethanol
None
HCV
HCV+Ethanol
HBV+Ethanol
HBV-Ab
HCV
HCV
HCV
HCV
HCV
None
HCV
HCV
HCV
None
HBV-Ab
HCV
HCV
HBV+HCV
None
HCV
HCV
HBV
HCV
HCV
HCV
HCV
HCV
None
HCV
HCV
Ethanol
HCV
HCV
HBV
HCV
HCV+HBV
HCV
Focalità (2)
uni
multi
uni
uni
uni
uni
uni
multi
multi
multi
uni
uni
uni
multi
multi
uni
multi
multi
uni
multi
uni
multi
uni
uni
uni
multi
multi
multi
uni
multi
multi
multi
uni
uni
uni
multi
uni
multi
multi
Dimensioni
(3)
AFP (4)
Grado
(5)
1.8
5.2
4.0
3.0
3.0
5.0
5
3.5
6.5
1.3
2.0
11
5.0
3.0
3
5.5
5
7.0
8.0
7.0
5.0
2.3
7.5
4
10
3
3.0
7.0
3
6.0
8.0
3.4
5.0
3.0
4.5
7.0
2.2
5.0
10
156
4
35
20
5
4
86
2198
167
252577
276
78
76
76
63
2
10000
9
9572
1924
5
46
67
162
390
210
58
139313
9
18766
86
18
537
3
2
540
48
75
7
G4
G3
G3
G3
G2
G3
G3
G3
G3
G4
G3
G3
G3
G2
G3
G3
G4
G3
G3
G3
G2
G3
G3
G2
G3
G3
G2
G4
G2
G3
G3
G3
G3
G3
G3
G4
G2
G4
G3
1) Cause della sottostante patologia epatica: HBV: Virus Epatite B; HCV: Virus Epatite B; BAb:
anticorpi contro HBV; Etanolo: storia di abuso di alcol; Criptogenici sono quei casi in cui sono
stati esclusi: infezioni virali, abuso di alcol, emocromatosi, patologia di Wilson, deficienza di α1anti-tripsina, cirrosi biliare primaria, epatite autoimmune e colangite sclerosante primaria.
2) Uni-o multifocalità è stata assegnata sulla base di tecniche di imaging precedenti l’intervento
chirurgico.
146
3) Dimensioni del nodulo di HCC (cm)
4) Livelli di alfa-feto-proteina sono stati misurati prima dell’intervento.
5) Grado di HCC è stato assegnato attraverso i criteri di Edmonson e Steiner’s (74).
147
CAPITOLO 4
DISCUSSIONE
148
4.1 L’identificazione di un pannello di microRNA rappresenta un passaggio
fondamentale per l’individuazione di nuovi bersagli terapeutici per il
trattamento non-convenzionale di pazienti con epatocarcinoma in stadio
intermedio-avanzato
Negli ultimi anni, lo sviluppo di piattaforme di microarray per l’analisi
dell’espressione
dei
microRNA
ha
rivelato
che
molti
miRNA
sono
aberrantemente espressi nei tumori umani, suggerendo che essi potrebbero
rappresentare una nuova classe di oncogeni o geni oncosoppressori (36, 57, 60,
75, 133, 134). Numerosi studi riportano la deregolazione dell’espressione dei
microRNA nelle neoplasie umane (95, 97, 135), sottolineando il loro contributo
fondamentale nei processi di iniziazione e progressione tumorale. A tale riguardo,
l’identificazione di miRNA cancro-specifici e dei loro bersagli molecolari
rappresenta un passaggio chiave per caratterizzare il ruolo dei miRNA nella
tumorigenesi umana e potrebbe essere importante per l’identificazione di nuovi
bersagli terapeutici.
In questo lavoro di tesi, abbiamo eseguito un’analisi dei profili di espressione
dei microRNA in campioni di epatocarcinoma insorto su di un fegato con
pregressa cirrosi epatica. L’indagine dell’espressione dei miRNA nell’HCC, ha
consentito di individuare una signature di 35 miRNA differenzilamente regolati
nel tessuto tumorale rispetto al circostante tessuto cirrotico. I nostri dati
suggeriscono che l’espressione aberrante di un ristretto pannello di miRNA è in
grado di predire con una buona accuratezza la natura del campione analizzato e
che tali miRNA potrebbero partecipare agli eventi molecolari che portano allo
sviluppo di epatocarcinoma (136). A conferma della validità scientifica della
149
nostra analisi, alcuni dei miRNA differenzialmente espressi nell’HCC erano stati
precedentemente individuati in altri tumori umani, suggerendo il loro
coinvolgimento in comuni processi di cancerogenesi. Tra questi la famiglia di let7 risultava deregolata in numerose neoplasie umane (61, 62), il miR-221 era
sovra-espresso nel carcinoma della tiroide e nel glioblastoma (97, 135), mentre il
miR-145 risultava sotto-espresso nel cancro del colon e della mammella (133,
137). Di notevole interesse il miR-122, un microRNA epato-specifico, è risultato
sotto-espresso nella maggior parte degli HCC ed in tutte le linee esaminate.
Altri studi hanno riportato il ruolo dei miRNA nell’epatocarcinogenesi umana,
ed abbiamo individuato sia differenze che buone sovrapposizioni con i dati del
nostro gruppo di ricerca. Ad esempio, nello studio di Murakami et al (43),
probabilmente a causa del differente approccio analitico utilizzato, nessuno degli
appena menzionati miRNA cancro-specifici è emerso ed inoltre vi era una scarsa
sovrapposizione tra i 35 miRNA individuati dal nostro gruppo e quelli presenti
nella loro lista, tra cui risultavano comuni solo il miR-195 ed il miR-199a. Al
contrario, l’articolo di Kutay et al (45), nonostante fosse basato su di un esiguo
numero di casi, ha mostrato che il miR-122 era significativamente sotto-espresso
nell’epatocarcinoma umano e di topo, confermando che down-regolazione di
questo
miRNA
potesse
avere
un
ruolo
importante
nel
processo
di
epatocarcinogenesi.
Il nostro studio è perciò utile nel definire una signature di miRNA cancroassociati coinvolti nella tumorigenesi epatica e che potrebbe risultare utile
nell’identificazione di potenziali bersagli terapeutici. L’individuazione di miRNA
deregolati nell’epatocarcinoma umano rappresenta quindi il primo step per lo
150
sviluppo di terapie sperimentali per il trattamento non-convenzionale di HCC in
stadio intermedio-avanzato.
4.2 La regolazione del pathway ciclina G1/p53 da parte del microRNA-122
rappresenta un possibile meccanismo molecolare implicato nel processo di
epatocarcinogenesi, in grado di sensibilizzare le cellule di epatocarcinoma al
trattamento con Doxorubicina
La comprensione dei meccanismi molecolari associati alla deregolazione dei
miRNA nei tumori umani rimane a tutt’oggi un compito difficile da investigare.
Infatti, sebbene programmi bioinformatici possano aiutare nella predizione di
ipotetici geni bersaglio, procedure sperimentali in vitro sono necessarie per la
validazione dei target molecolari. Attualmente sono stati individuati numerosi
geni bersaglio di microRNA deregolati nelle neoplasie umane, ma nonostante le
incoraggianti evidenze sperimentali in grado di legare i miRNA alla biologia del
cancro, si conosce ancora poco riguardo ai circuiti cellulari e molecolari nei quali
sono coinvolti i microRNA. Infatti, lo scenario è enormemente complicato dalla
capacità dei miRNA di bersagliare multipli pathway molecolari, a volte correlati
tra loro ed a volte con funzioni opposte, ed allo stesso tempo dalla ridondanza dei
miRNA stessi. Questo dà origine ad un complesso network di regolazione nel
quale gli effetti biologici e le proprietà di un singolo miRNA non consentono
sempre una spiegazione lineare.
In questo lavoro di tesi, abbiamo investigato il ruolo biologico del microRNA
epato-specifico, miR-122, nel processo di epatocarcinogenesi attraverso
l’individuazione di geni bersaglio. L’analisi di microarray riportava infatti una
151
sotto-espressione del miR-122 nella maggior parte dei campioni di HCC,
lasciando ipotizzare un possibile coinvolgimento di questo miRNA nella epatotumorigenesi. Nel nostro studio abbiamo individuato la ciclina G1 come bersaglio
molecolare del miR-122 (136) ed abbiamo dimostrato che, attraverso la
modulazione della ciclina G1, il miR-122 regola l’espressione e la stabilità
dell’oncosoppressore p53 e sensibilizza le linee cellulari di HCC al trattamento
con Doxorubicina. Inoltre, abbiamo dimostrato che il miR-122 ed il suo gene
bersaglio modulano la capacità invasiva delle linee cellulari esaminate e che la
diminuzione dei livelli di miR-122 è associata ad un ridotto tempo di insorgenza
della recidiva epatica in pazienti chirurgicamente trattati per epatocarcinoma
(138).
L’importanza del miR-122 nella fisiologia epatica è supportata dal fatto che
tale miR è specificamente espresso nel fegato sano, rappresentando il 70% della
popolazione di miRNA epatici sia nell’uomo che nel topo. Inoltre, è possibile che
la sua deregolazione possa avere un ruolo significativo su numerose funzioni
epatiche (53). Per esempio, è stato riportato che alcuni dei bersagli molecolari del
miR-122 includono geni coinvolti nel fenotipo epatico e nella biosintesi del
colesterolo, suggerendo che una perdita del miR-122 possa essere relazionata alla
perdita del differenziamento epatico (54). In aggiunta, il miR-122 possiede un sito
di legame nel genoma del virus dell’epatite C (HCV), sottolineando il suo ruolo
fondamentale
nella
regolazione
della
replicazione/adattamento
dell’HCV
all’interno degli epatociti (55).
La riduzione dei livelli di espressione del miR-122 rappresenta una
caratteristica comune nell’epatocarcinoma di natura umana e murina. A tale
riguardo la ricostituzione di livelli fisiologici del miR-122 offre la possibilità
152
teorica di modulare il fenotipo maligno, attraverso la regolazione di numerosi geni
bersaglio (139). Infatti, le multiple funzioni cancro-associate esercitate dal miR122 in linee cellulari di HCC suggeriscono un potenziale uso di questo miR nella
terapia dell’HCC, attraverso l’utilizzo di molecole miRNA-mimetiche. Inoltre,
l’aumentata sensibilità alla Doxorubicina osservata in seguito al ripristino di
livelli fisiologici di miR-122 in linee cellulari di HCC, fa ipotizzare all’impiego di
una terapia combinata con chemioterapici e miRNA-mimetici per il trattamento
non-convenzionale dell’epatocarcinoma. Per quel che riguarda l’utilizzo di miR122-mimetici in pazienti con HCV, deve essere posta particolare attenzione
all’effetto di tale miR nella replicazione virale; sebbene un recente articolo riporti
la mancanza di correlazione tra livelli di miR-122 e carico virale e l’associazione
tra bassi livelli di miR-122 e l’assenza di una risposta virologica in seguito a
trattamento con interferone (140). In aggiunta, il fegato rappresenta un organo
ideale per la terapia basata su piccoli oligonucleotidi poiché è un organo
estremamente ricettivo nell’assorbimento di oligonucleotidi somministrati
periferalmente, risultando perciò un buon modello per lo sviluppo di approcci
anti-tumorali basati sui microRNA (54), come precedentemente riportato in altri
tipi di patologie epatiche (141). Inoltre, l’impiego nella pratica clinica di metodi
di somministrazione selettiva di farmaci attraverso l’arteria che alimenta
direttamente il nodulo di HCC (TACE) rappresenta un ulteriore approccio
terapeutico in grado di diminuire la tossicità sistemica ed incrementare la selettivà
del trattamento farmacologico.
153
4.3 La regolazione di importanti processi cellulari da parte del microRNA221 pone le basi per lo sviluppo di un possibile approccio terapeutico con
molecole antagoniste dei microRNA per il trattamento non-convenzionale di
pazienti con epatocarcinoma in stadio intermedio-avanzato
Studi di profiling hanno consentito di individuare la sovra-espressione del
microRNA-221 in numerosi tipi di tumore umano, compreso l’epatocarcinoma
(97, 135, 136). In questo lavoro di tesi, abbiamo inizialmente dimostrato il
coinvolgimento del miR-221 nella regolazione del ciclo cellulare attraverso la
modulazione di due inibitori delle cinasi-ciclina dipendenti (CDKI), CKN1B/p27
e CDKN1C/p57, implicati nella transizione G1/S del ciclo cellulare. Per valutare
la rilevanza di questi studi nella patogenesi dell’epatocarcinoma, abbiamo
successivamente eseguito un’analisi ex vivo, la quale ha consentito di individuare
una correlazione inversa tra i livelli di miR-221 e l’espressione dei due CDKI nei
tessuti di HCC. Questi dati suggeriscono un ruolo pro-oncogenico del miR-221
nel processo di epatocarcinogenesi, attraverso la promozione della proliferazione
delle cellule tumorali.
Successivamente, per meglio caratterizzare il ruolo bio-patologico del miR221 nel processo di epatocarcinogenesi, abbiamo focalizzato la nostra attenzione
nella regolazione di pathway apoptotici da parte del miR-221. A tale riguardo,
abbiamo dimostrato che il miR-221 è in grado di inibire l’espressione della
proteina pro-apoptotica Bmf in linee cellulari di HCC, e che tale inibizione
determina una ridotta attivazione della cascata delle caspasi sia in vitro che in
154
vivo. Inoltre, abbiamo dimostrato che il miR-221 regola l’espressione di Bmf
anche in condizioni di non-adesione alla matrice cellulare, impedendo il processo
di morte cellulare noto come ‘anoikis’, suggerendo un ruolo del miR-221 nel
processo di metastatizzazione tumorale. Ipotesi confermata dall’associazione
dialti livelli di miR-221 con HCC di natura multi-focale e con un ridotto tempo di
insorgenza di recidiva epatica in pazienti chirurgicamente trattati per
epatocarcinoma.
I recenti avanzamenti nella conoscenza delle potenzialità di microRNA nel
trattamento dei tumori umani hanno portato allo sviluppo di oligonucleotidi
chimicamente stabilizzati, con elevata specificità e ridotta tossicità, in grado di
inibire le funzioni dei miRNA quando somministrati periferalmente in differenti
modelli animali (54, 142, 143). La regolazione di numerosi pathway molecolari
da parte del miR-221 pone quindi le basi per il trattamento non-convenzionale
dell’HCC con molecole antagoniste del miR-221.
4.4 La regolazione dei pathway molecolari di mTOR e c-Met da parte del
microRNA-199a-3p rappresenta un possibile meccanismo molecolare
implicato nel processo di epatocarcinogenesi, in grado di sensibilizzare le
cellule di epatocarcinoma al trattamento con Doxorubicina
Lo sviluppo di piattaforme di microarray di miRNA ha mostrato la sottoespressione del miR-199a-3p in numerosi tipi di tumore umano, incluso l’HCC
(50, 116, 117, 136), suggerendo un coinvolgimento di questo miRNA in comuni
processi di cancerogenesi. Inoltre, dati di letteratura riportano la regolazione di
importanti geni bersaglio, tra cui c-Met (56), Smad1 (121), LIF (122) da parte del
155
miR-199a-3p e si è osservato che espressione esogena di questo miRNA era in
grado di ridurre la motilità e la vitalità di cellule di melanoma, cancro gastrico e
del polmone (119). Di notevole interesse, tramite analisi bioinformatica, abbiamo
individuato un fattore chiave nella proliferazione cellulare, mTOR, tra gli ipotetici
geni bersaglio del miR-199a-3p. La rilevanza del pathway di mTOR nel processo
di iniziazione e progressione tumorale è una caratteristica comune a numerosi tipi
di tumore umano, incluso l’HCC (124), dove la sua sovra-espressione è associata
ad una prognosi peggiore, invasione e metastasi (126). In questo lavoro di tesi
abbiamo focalizzato la nostra attenzione nell’individuazione di nuovi geni
bersaglio del miR-199a-3p, al fine di meglio caratterizzare il suo ruolo funzionale
nell’iniziazione e nella progressione tumorale. Tra i numerosi geni target del miR199a-3p abbiamo analizzato la regolazione di due importanti oncogeni spesso
deregolati nell’HCC, mTOR e c-Met. Abbiamo quindi caratterizzato il ruolo
biologico del miR-199a-3p e dei suoi geni target in importanti processi cellulari
ed abbiamo osservato che il ripristino di livelli fisiologici di questo miRNA
determinava un arresto del ciclo cellulare nella fase G1, una diminuzione delle
capacità invasive, un’aumentata suscettibilità a condizioni ipossiche ed
un’aumentata morte cellulare in seguito al trattamento con Doxorubicina. Inoltre,
la rilevanza di queste analisi in vitro è stata confermata dallo studio di campioni di
HCC, nei quali è stata individuata una correlazione inversa tra il miR-199a-3p ed
il suo gene target mTOR, così come un’associazione tra bassi livelli di miR-199a3p con un diminuito tempo di insorgenza della recidiva epatica in seguito a
resezione per HCC.
La regolazione di pathway chiave cancro-associati, come quelli di mTOR e cMet, e la modulazione di fondamentali processi fisiologici spesso deregolati
156
nell’HCC, sottolineano l’importanza del ripristino di livelli fisiologici di miR199a-3p come possibile strategia terapeutica, combinata alla tradizionale
chemioterapia, per il trattamento di tumori ad elevata mortalità come
l’epatocarcinoma. A questo proposito, molecole endogene e non tossiche come i
microRNA, possono rappresentare un promettente strumento per terapia genica
dei tumori (139), in particolare se associati alla Doxorubicina.
4.5 Prospettive future
In questo lavoro di tesi abbiamo dimostrato il chiaro coinvolgimento dei
microRNA in processi cellulari alla base della trasformazione maligna
dell’epatocarcinoma umano, ipotizzando l’utilizzo di questa nuova classe di
molecole come possibili marcatori diagnostici, prognostici ed, eventualmente,
come nuovi bersagli o strumenti per una specifica ed innovativa terapia dell’HCC
in stadio intermedio-avanzato.
Le prospettive future del nostro gruppo di ricerca sono le seguenti:
1) Ulteriore caratterizzazione in vitro dei microRNA analizzati in questo lavoro
di tesi e di altri miRNA della signature di HCC. Al fine di meglio
comprendere il ruolo bio-patologico e delucidare i meccanismi molecolari
coinvolti nel processo di trasformazione maligna miRNA-associata, verranno
analizzati nuovi bersagli e pathway molecolari ed investigata la suscettibilità a
differenti trattamenti farmacolgici.
2) Caratterizzazione di meccanismi genetici, epigenetici e trascrizionali alla base
della deregolazione dei microRNA nell’epatocarcinoma umano. Verranno
157
impiegate tecniche quali l’immuno-precipitazione della cromatina con
anticorpi contro specifici fattori di trascrizione (in collaborazione con il
gruppo del Prof. Giovanni Capranico, Università di Bologna) e verrà utilizzata
la piattaforma Sequenom per l’indagine dei profili di metilazione di promotori
di microRNA deregolati nell’HCC (in collaborazione con il gruppo della
Dr.ssa Vilma Mantovani, Policlinico Sant’Orsola-Malpighi di Bologna).
3) Sviluppo di modelli animali al fine di valutare i meccanimi molecolari di
epatocarcinogenesi miRNA-indotti e di testare l’efficacia e la ridotta tossicità
di molecole oligonucleotidiche chimicamente modificate.
•
Utilizzo di topi immuno-compromessi per la somministrazione di linee
cellulari infettate stabilmente con i microRNA di interesse, al fine di valutarne
le capacità tumorigeniche in vivo.
•
Sviluppo di un modello animale di topo transgenico per il microRNA-221 al
fine di analizzare in vivo i meccanismi molecolari coinvolti nel processo di
tumorigenesi indotti dal miR-221, da solo o in combinazione con potenti
epatocarcinogeni. In seguito allo sviluppo di tumori verranno effettuati
trattamenti con molecole antagoniste del miR-221 al fine di testarne l’efficacia
anti-tumorale in vivo (progetto in collaborazione con il gruppo del Dr.
Massimo Negrini dell’Università di Ferrara).
•
Sviluppo di un modello animale di epatocarcinoma al fine di individuare
microRNA comuni nell’HCC umano e murino ed al fine di testare in vivo
l’efficacia e la tossicità di molecole ad attività di miRNA-mimetici o miRNAantagonisti.
158
4) Individuazione di una signature di miRNA circolanti in grado di distinguere
pazienti con HCC da pazienti con cirrosi epatica, al fine di identificare
marcatori diagnostici in grado di identificare HCC in stadi molto precoci,
altrimenti non rivelabili con le comuni tecniche di imaging.
159
BIBLIOGRAFIA
160
1.
Parkin, D.M., Bray, F., Ferlay, J., and Pisani, P. Global cancer statistics,
2002. CA Cancer J Clin, 55: 74-108, 2005.
2.
Bosh, F.X., Ribes, J., Diaz, M., Cleries, R. Primary liver cancer:
worldwild incidence and trends. Gastroenterology, 127: S5–16, 2004.
3.
Edmondson, H.A., Henderson, B., and Benton, B. Liver-cell adenomas
associated with use of oral contraceptives. N Engl J Med, 294: 470-472,
1976.
4.
Montalto, G., Cervello, M., Giannitrapani, L., Dantona, F., Terranova, A.,
and Castagnetta, L. A. Epidemiology, risk factors, and natural history of
hepatocellular carcinoma. Ann N Y Acad Sci, 963: 13-20, 2002.
5.
Furuya, K., Nakamura, M., Yamamoto, Y., Togei, K., and Otsuka, H.
Macroregenerative nodule of the liver. A clinicopathologic study of 345
autopsy cases of chronic liver disease. Cancer, 61: 99-105, 1988.
6.
Teoh, N.C. Proliferative drive and liver carcinogenesis: too much of a
good thing? J Gastroenterol Hepatol, 24: 1817-1825, 2009.
7.
Farinati, F., Marino, D., De Giorgio, M., Baldan, A., Cantarini, M.,
Cursaro, C., Rapaccini, G., Del Poggio, P., Di Nolfo, M.A., Benvegnu, L.,
Zoli, M., Borzio, F., Bernardi, M., and Trevisani, F. Diagnostic and
prognostic role of alpha-fetoprotein in hepatocellular carcinoma: both or
neither? Am J Gastroenterol, 101: 524-532, 2006.
8.
Befeler, A.S. and Di Bisceglie, A.M. Hepatocellular carcinoma: diagnosis
and treatment. Gastroenterology, 122: 1609-1619, 2002.
9.
Bruix, J., and Sherman, M. Diagnosis of small HCC. Gastroenterology,
129: 1364, 2005.
10.
Lencioni, R., Cioni, D., Della Pina, C., Crocetti, L., and Bartolozzi, C.
Imaging diagnosis. Semin Liver Dis, 25: 162-170, 2005.
11.
Llovet, J.M. and Bruix, J. Systematic review of randomized trials for
unresectable hepatocellular carcinoma: Chemoembolization improves
survival. Hepatology, 37: 429-442, 2003.
12.
Llovet, J.M., Ricci, S., Mazzaferro, V., Hilgard, P., Raoul, J., Zeuzem, S.,
Poulin-Costello, M., Moscovici, M., Voliotis, D., and Bruix J. Sorafenib
improves survival in advanced Hepatocellular Carcinoma (HCC): Results
of a Phase III randomized placebo-controlled trial. J Clin Oncol, 25:
LBA1, 2007.
13.
Laurent-Puig, P. and Zucman-Rossi, J. Genetics of hepatocellular tumors.
Oncogene, 25: 3778-3786, 2006.
161
14.
Chiang, D.Y., Villanueva, A., Hoshida, Y., Peix, J., Newell, P., Minguez,
B., LeBlanc, A.C., Donovan, D.J., Thung, S.N., Sole, M., Tovar, V.,
Alsinet, C., Ramos, A. H., Barretina, J., Roayaie, S., Schwartz, M.,
Waxman, S., Bruix, J., Mazzaferro, V., Ligon, A. H., Najfeld, V.,
Friedman, S.L., Sellers, W.R., Meyerson, M., and Llovet, J.M. Focal gains
of VEGFA and molecular classification of hepatocellular carcinoma.
Cancer Res, 68: 6779-6788, 2008.
15.
Ladeiro, Y., Couchy, G., Balabaud, C., Bioulac-Sage, P., Pelletier, L.,
Rebouissou, S., and Zucman-Rossi, J. MicroRNA profiling in
hepatocellular tumors is associated with clinical features and
oncogene/tumor suppressor gene mutations. Hepatology, 47: 1955-1963,
2008.
16.
Lee, R.C., Feinbaum, R.L., and Ambros, V. The C. elegans heterochronic
gene lin-4 encodes small RNAs with antisense complementarity to lin-14.
Cell, 75: 843-854, 1993.
17.
Bartel, D.P. MicroRNAs: genomics, biogenesis, mechanism, and function.
Cell, 116: 281-297, 2004.
18.
Zhang, B., Pan, X., Cobb, G. P., and Anderson, T. A. Plant microRNA: a
small regulatory molecule with big impact. Dev Biol, 289: 3-16, 2006.
19.
Lee, R. C. and Ambros, V. An extensive class of small RNAs in
Caenorhabditis elegans. Science, 294: 862-864, 2001.
20.
Brown, J. R. and Sanseau, P. A computational view of microRNAs and
their targets. Drug Discov Today, 10: 595-601, 2005.
21.
Zhang, B.H., Pan, X.P., Wang, Q.L., Cobb, G P., and Anderson, T.A.
Identification and characterization of new plant microRNAs using EST
analysis. Cell Res, 15: 336-360, 2005.
22.
Zhang, B., Pan, X., and Anderson, T.A. Identification of 188 conserved
maize microRNAs and their targets. FEBS Lett, 580: 3753-3762, 2006.
23.
Ventura, A., Young, A.G., Winslow, M.M., Lintault, L., Meissner, A.,
Erkeland, S.J., Newman, J., Bronson, R.T., Crowley, D., Stone, J.R.,
Jaenisch, R., Sharp, P.A., and Jacks, T. Targeted deletion reveals essential
and overlapping functions of the miR-17 through 92 family of miRNA
clusters. Cell, 132: 875-886, 2008.
24.
Lee, Y., Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. MicroRNA
maturation: stepwise processing and subcellular localization. Embo J, 21:
4663-4670, 2002.
25.
Kim, V.N., Han, J., and Siomi, M.C. Biogenesis of small RNAs in
animals. Nat Rev Mol Cell Biol, 10: 126-139, 2009.
162
26.
Cai, X., Hagedorn, C.H., and Cullen, B.R. Human microRNAs are
processed from capped, polyadenylated transcripts that can also function
as mRNAs. RNA, 10: 1957-1966, 2004.
27.
Borchert, G.M., Lanier, W., and Davidson, B.L. RNA polymerase III
transcribes human microRNAs. Nat Struct Mol Biol, 13: 1097-1101,
2006.
28.
Lee, Y.S. and Dutta, A. MicroRNAs in cancer. Annu Rev Pathol, 4: 199227, 2009.
29.
Schwarz, D.S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore,
P.D. Asymmetry in the assembly of the RNAi enzyme complex. Cell, 115:
199-208, 2003.
30.
Khvorova, A., Reynolds, A., and Jayasena, S.D. Functional siRNAs and
miRNAs exhibit strand bias. Cell, 115: 209-216, 2003.
31.
Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S.,
Rhoades, M.W., Burge, C.B., and Bartel, D.P. The microRNAs of
Caenorhabditis elegans. Genes Dev, 17: 991-1008, 2003.
32.
Ambros, V. The functions of animal microRNAs. Nature, 431: 350-355,
2004.
33.
Sempere, L.F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E.,
and Ambros, V. Expression profiling of mammalian microRNAs uncovers
a subset of brain-expressed microRNAs with possible roles in murine and
human neuronal differentiation. Genome Biol, 5: R13, 2004.
34.
Wienholds, E. and Plasterk, R.H. MicroRNA function in animal
development. FEBS Lett, 579: 5911-5922, 2005.
35.
Calin, G.A., Dumitru, C.D., Shimizu, M., Bichi, R., Zupo, S., Noch, E.,
Aldler, H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T.,
Negrini, M., Bullrich, F., and Croce, C.M. Frequent deletions and downregulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic
lymphocytic leukemia. Proc Natl Acad Sci U S A, 99: 15524-15529,
2002.
36.
Calin, G.A., Sevignani, C., Dumitru, C.D., Hyslop, T., Noch, E.,
Yendamuri, S., Shimizu, M., Rattan, S., Bullrich, F., Negrini, M., and
Croce, C.M. Human microRNA genes are frequently located at fragile
sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A,
101: 2999-3004, 2004.
37.
Weber, B., Stresemann, C., Brueckner, B., and Lyko, F. Methylation of
human microRNA genes in normal and neoplastic cells. Cell Cycle, 6:
1001-1005, 2007.
163
38.
Fazi, F., Racanicchi, S., Zardo, G., Starnes, L.M., Mancini, M., Travaglini,
L., Diverio, D., Ammatuna, E., Cimino, G., Lo-Coco, F., Grignani, F., and
Nervi, C. Epigenetic silencing of the myelopoiesis regulator microRNA223 by the AML1/ETO oncoprotein. Cancer Cell, 12: 457-466, 2007.
39.
McManus, M.T. MicroRNAs and cancer. Semin Cancer Biol, 13: 253258, 2003.
40.
Volinia, S., Calin, G.A., Liu, C.G., Ambs, S., Cimmino, A., Petrocca, F.,
Visone, R., Iorio, M., Roldo, C., Ferracin, M., Prueitt, R.L., Yanaihara, N.,
Lanza, G., Scarpa, A., Vecchione, A., Negrini, M., Harris, C.C., and
Croce, C.M. A microRNA expression signature of human solid tumors
defines cancer gene targets. Proc Natl Acad Sci U S A, 103: 2257-2261,
2006.
41.
Ma, L., Teruya-Feldstein, J., and Weinberg, R.A. Tumour invasion and
metastasis initiated by microRNA-10b in breast cancer. Nature, 449: 682688, 2007.
42.
Li, N., Fu, H., Tie, Y., Hu, Z., Kong, W., Wu, Y., and Zheng, X. miR-34a
inhibits migration and invasion by down-regulation of c-Met expression in
human hepatocellular carcinoma cells. Cancer Lett, 275: 44-53, 2009.
43.
Murakami, Y., Yasuda, T., Saigo, K., Urashima, T., Toyoda, H., Okanoue,
T., Shimotohno, K. Comprehensive analysis of microRNA expression
patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene,
25: 2537-2545, 2006.
44.
Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S.T., Patel,
T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene
in human hepatocellular cancer. Gastroenterology, 133: 647-658, 2007.
45.
Kutay, H., Bai, S., Datta, J., Motiwala, T., Pogribny, I., Frankel, W.,
Jacob, S.T., Ghoshal, K. Downregulation of miR-122 in the rodent and
human hepatocellular carcinomas. J Cell Biochem, 99: 371-678, 2006.
46.
Pogribny, I.P., Tryndyak, V.P., Boyko, A., Rodriguez-Juarez, R., Beland,
F.A., and Kovalchuk, O. Induction of microRNAome deregulation in rat
liver by long-term tamoxifen exposure. Mutat Res, 619: 30-37, 2007.
47.
Budhu, A., Jia, H.., Forgues, M., Liu, C.G., Goldstein, D., Lam, A.,
Zanetti, K.A., Ye, Q.H., Qin, L.X., Croce, C.M., Tang, Z.Y., and Wang,
X.W. Identification of metastasis-related microRNAs in hepatocellular
carcinoma. Hepatology, 47: 897-907, 2008.
48.
Varnholt, H., Drebber, U., Schulze, F., Wedemeyer, I., Schirmacher, P.,
Dienes, H.P., and Odenthal, M. MicroRNA gene expression profile of
hepatitis C virus-associated hepatocellular carcinoma. Hepatology, 47:
1223-1232, 2008.
164
49.
Huang, Y.S., Dai, Y., Yu, X.F., Bao, S.Y., Yin, Y.B., Tang, M., and Hu,
C.X. Microarray analysis of microRNA expression in hepatocellular
carcinoma and non-tumorous tissues without viral hepatitis. J
Gastroenterol Hepatol, 23: 87-94, 2008.
50.
Jiang, J., Gusev, Y., Aderca, I., Mettler, T.A., Nagorney, D.M., Brackett,
D.J., Roberts, L.R., and Schmittgen, T.D. Association of MicroRNA
expression in hepatocellular carcinomas with hepatitis infection, cirrhosis,
and patient survival. Clin Cancer Res, 14: 419-427, 2008.
51.
Ura, S., Honda, M., Yamashita, T., Ueda, T., Takatori, H., Nishino, R.,
Sunakozaka, H., Sakai, Y., Horimoto, K., and Kaneko, S. Differential
microRNA expression between hepatitis B and hepatitis C leading disease
progression to hepatocellular carcinoma. Hepatology, 49: 1098-1112,
2009.
52.
Braconi, C. and Patel, T. MicroRNA expression profiling: a molecular tool
for defining the phenotype of hepatocellular tumors. Hepatology, 47:
1807-1809, 2008.
53.
Esau, C., Davis, S., Murray, S.F., Yu, X.X., Pandey, S.K., Pear, M., Watts,
L., Booten, S.L., Graham, M., McKay, R., Subramaniam, A., Propp, S.,
Lollo, B.A., Freier, S., Bennett, C.F., Bhanot, S., and Monia, B.P. miR122 regulation of lipid metabolism revealed by in vivo antisense targeting.
Cell Metab, 3: 87-98, 2006.
54.
Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K.G., Tuschl, T.,
Manoharan, M., and Stoffel, M. Silencing of microRNAs in vivo with
'antagomirs'. Nature, 438: 685-689, 2005.
55.
Jopling, C.L., Yi, M., Lancaster, A.M., Lemon, S.M., and Sarnow, P.
Modulation of hepatitis C virus RNA abundance by a liver-specific
MicroRNA. Science, 309: 1577-1581, 2005.
56.
Kim, S., Lee, U.J., Kim, M.N., Lee, E.J., Kim, J.Y., Lee, M.Y., Choung,
S., Kim, Y.J., and Choi, Y.C. MicroRNA miR-199a* regulates the MET
proto-oncogene and the downstream extracellular signal-regulated kinase
2 (ERK2). J Biol Chem, 283: 18158-18166, 2008.
57.
Lu, J., Getz, G., Miska, E.A., Alvarez-Saavedra, E., Lamb, J., Peck, D.,
Sweet-Cordero, A., Ebert, B.L., Mak, R.H., Ferrando, A.A., Downing, J.
R., Jacks, T., Horvitz, H.R., and Golub, T.R. MicroRNA expression
profiles classify human cancers. Nature, 435: 834-838, 2005.
58.
Fulci, V., Chiaretti, S., Goldoni, M., Azzalin, G., Carucci, N., Tavolaro,
S., Castellano, L., Magrelli, A., Citarella, F., Messina, M., Maggio, R.,
Peragine, N., Santangelo, S., Mauro, F.R., Landgraf, P., Tuschl, T., Weir,
D.B., Chien, M., Russo, J.J., Ju, J., Sheridan, R., Sander, C., Zavolan, M.,
Guarini, A., Foa, R., and Macino, G. Quantitative technologies establish a
165
novel microRNA profile of chronic lymphocytic leukemia. Blood, 109:
4944-4951, 2007.
59.
Yanaihara, N., Caplen, N., Bowman, E., Seike, M., Kumamoto, K., Yi,
M., Stephens, R.M., Okamoto, A., Yokota, J., Tanaka, T., Calin, G.A.,
Liu, C.G., Croce, C.M., and Harris, C.C. Unique microRNA molecular
profiles in lung cancer diagnosis and prognosis. Cancer Cell, 9: 189-198,
2006.
60.
Calin, G.A., Ferracin, M., Cimmino, A., Di Leva, G., Shimizu, M.,
Wojcik, S. E., Iorio, M.V., Visone, R., Sever, N.I., Fabbri, M., Iuliano, R.,
Palumbo, T., Pichiorri, F., Roldo, C., Garzon, R., Sevignani, C., Rassenti,
L., Alder, H., Volinia, S., Liu, C.G., Kipps, T.J., Negrini, M., and Croce,
C.M. A MicroRNA signature associated with prognosis and progression in
chronic lymphocytic leukemia. N Engl J Med, 353: 1793-1801, 2005.
61.
Takamizawa, J., Konishi, H., Yanagisawa, K., Tomida, S., Osada, H.,
Endoh, H., Harano, T., Yatabe, Y., Nagino, M., Nimura, Y., Mitsudomi,
T., and Takahashi, T. Reduced expression of the let-7 microRNAs in
human lung cancers in association with shortened postoperative survival.
Cancer Res, 64: 3753-3756, 2004.
62.
Johnson, S.M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng,
A., Labourier, E., Reinert, K.L., Brown, D., and Slack, F.J. RAS is
regulated by the let-7 microRNA family. Cell, 120: 635-647, 2005.
63.
Johnson, C.D., Esquela-Kerscher, A., Stefani, G., Byrom, M., Kelnar, K.,
Ovcharenko, D., Wilson, M., Wang, X., Shelton, J., Shingara, J., Chin, L.,
Brown, D., and Slack, F.J. The let-7 microRNA represses cell proliferation
pathways in human cells. Cancer Res, 67: 7713-7722, 2007.
64.
Garofalo, M., Di Leva, G., Romano, G., Nuovo, G., Suh, S.S., Ngankeu,
A., Taccioli, C., Pichiorri, F., Alder, H., Secchiero, P., Gasparini, P.,
Gonelli, A., Costinean, S., Acunzo, M., Condorelli, G., and Croce, C.M.
miR-221&222 regulate TRAIL resistance and enhance tumorigenicity
through PTEN and TIMP3 downregulation. Cancer Cell, 16: 498-509,
2009.
65.
Meng, F., Henson, R., Lang, M., Wehbe, H., Maheshwari, S., Mendell, J.
T., Jiang, J., Schmittgen, T.D., and Patel, T. Involvement of human microRNA in growth and response to chemotherapy in human
cholangiocarcinoma cell lines. Gastroenterology, 130: 2113-2129, 2006.
66.
Weidhaas, J.B., Babar, I., Nallur, S.M., Trang, P., Roush, S., Boehm, M.,
Gillespie, E., and Slack, F.J. MicroRNAs as potential agents to alter
resistance to cytotoxic anticancer therapy. Cancer Res, 67: 11111-11116,
2007.
166
67.
Orom, U.A., Kauppinen, S., and Lund, A.H. LNA-modified
oligonucleotides mediate specific inhibition of microRNA function. Gene,
372: 137-141, 2006.
68.
Weiler, J., Hunziker, J., and Hall, J. Anti-miRNA oligonucleotides
(AMOs): ammunition to target miRNAs implicated in human disease?
Gene Ther, 13: 496-502, 2006.
69.
Dykxhoorn, D.M., Palliser, D., and Lieberman, J. The silent treatment:
siRNAs as small molecule drugs. Gene Ther, 13: 541-552, 2006.
70.
Tibshirani, R., Hastie, T., Narasimhan, B., and Chu, G. Diagnosis of
multiple cancer types by shrunken centroids of gene expression. Proc Natl
Acad Sci U S A, 99: 6567-6572, 2002.
71.
Furey, T.S., Cristianini, N., Duffy, N., Bednarski, D.W., Schummer, M.,
and Haussler, D. Support vector machine classification and validation of
cancer tissue samples using microarray expression data. Bioinformatics,
16: 906-914, 2000.
72.
Negrini, M., Ferracin, M., Sabbioni, S., and Croce, C.M. MicroRNAs in
human cancer: from research to therapy. J Cell Sci, 120: 1833-1840, 2007.
73.
Llovet, J.M., Burroughs, A., and Bruix, J. Hepatocellular carcinoma.
Lancet, 362: 1907-1917, 2003.
74.
Edmondson, H.A. and Steiner, P.E. Primary carcinoma of the liver: a
study of 100 cases among 48,900 necropsies. Cancer, 7: 462-503, 1954.
75.
Liu, C.G., Calin, G.A., Meloon, B., Gamliel, N., Sevignani, C., Ferracin,
M., Dumitru, C.D., Shimizu, M., Zupo, S., Dono, M., Alder, H., Bullrich,
F., Negrini, M., and Croce, C.M. An oligonucleotide microchip for
genome-wide microRNA profiling in human and mouse tissues. Proc Natl
Acad Sci U S A, 101: 9740-9744, 2004.
76.
Felli, N., Fontana, L., Pelosi, E., Botta, R., Bonci, D., Facchiano, F.,
Liuzzi, F., Lulli, V., Morsilli, O., Santoro, S., Valtieri, M., Calin, G.A.,
Liu, C.G., Sorrentino, A., Croce, C.M., and Peschle, C. MicroRNAs 221
and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via
kit receptor down-modulation. Proc Natl Acad Sci U S A, 102: 1808118086, 2005.
77.
Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W.,
and Tuschl, T. Identification of tissue-specific microRNAs from mouse.
Curr Biol, 12: 735-739, 2002.
78.
Okamoto, K. and Beach, D. Cyclin G is a transcriptional target of the p53
tumor suppressor protein. Embo J, 13: 4816-4822, 1994.
167
79.
Zauberman, A., Lupo, A., Oren M. Identification of p53 target genes
through immune selection of genomic DNA: the cyclin G gene contains
two distinct p53 binding sites. Oncogene, 10: 2361-2366, 1995.
80.
Okamoto, K., Li, H., Jensen, M.R., Zhang, T., Taya, Y., Thorgeirsson,
S.S., and Prives, C. Cyclin G Recruits PP2A to Dephosphorylate Mdm2.
Mol Cell, 9: 761-777, 2002.
81.
Smith, M.L., Kontny, H., Bortnick, R., and Fornace A.J. Jr. The p53regulated cyclin G gene promotes cell growth: p53 downstream effectors
cyclin G and Gadd45 exert different effects on cisplatin chemosensitivity.
Exp Cell Res, 230: 61-68, 1997.
82.
Skotzko M, W. L., Anderson WF, Gordon EM, Hall FL Retroviral vectormediated gene transfer of antisense cyclin G1 (CYCG1) inhibits
proliferation of human osteogenic sarcoma cells. Cancer research, 55:
5493-5498, 1995.
83.
Reimer, C.L., Borras, A.M., Kurdistani, S.K., Garreau, J.R., Chung, M.,
Stuart, A.A., and Lee, S.W. Altered Regulation of Cyclin G in Human
Breast Cancer and Its Specific Localization at Replication Foci in
Response to DNA Damage in p531/1 Cells. J Biol Chem, 274: 1102211029, 1999.
84.
Baek, W.K., Kim, D., Jung, N., Yi Y.W., Kim, J.M., Cha, S.D., Bae, I.,
and Cho, C.H. Increased expression of cyclin G1 in leiomyoma compared
with normal myometrium. Gynecology, 188: 634-639, 2003.
85.
Jensen, M.R., Factor, V.M., and Thorgeirsson, S.S. Regulation of cyclin
G1 during murine hepatic regeneration following Dipin-induced DNA
damage. Hepatology, 28: 537-546, 1998.
86.
Kimura, S.H., Ikawa, M., Ito, A., Okabe, M., and Nojima, H. Cyclin G1 is
involved in G2/M arrest in response to DNA damage and in growth
control after damage recovery. Oncogene, 20: 3290-3300, 2001.
87.
Zhao, L., Samuels, T., Winckler, S., Korgaonkar, C., Tompkins, V.,
Horne, M.C., and Quelle, D.E. Cyclin G1 has growth inhibitory activity
linked to theARF-Mdm2–53 and pRb tumor suppressor pathways. Mol
Cancer Res, 1: 195-206, 2003.
88.
Jensen, M.R. Factor, V.M., Fantozzi, A., Helin, K., Huh, C.G, and
Thorgeirsson, S.S. Reduced Hepatic Tumor Incidence in Cyclin G1–
Deficient Mice. Hepatology, 37: 862-870, 2003.
89.
Laurent-Puig, P., Legoix, P., Bluteau, O., Belghiti, J., Franco, D., Binot,
F., Monges, G., Thomas, G., Bioulac-Sage, P., and Zucman-Rossi, J.
Genetic alterations associated with hepatocellular carcinomas define
168
distinct pathways of hepatocarcinogenesis. Gastroenterology, 120: 17631773, 2001.
90.
Thompson, T., Tovar, C., Yang, H., Carvajal, D., Vu, B.T., Xu, Q., Wahl,
G. M., Heimbrook, D.C., and Vassilev, L.T. Phosphorylation of p53 on
key serines is dispensable for transcriptional activation and apoptosis. J
Biol Chem, 279: 53015-53022, 2004.
91.
Okamoto, K., Kamibayashi, C., Serrano, M., Prives, C., Mumby, M. C.,
and Beach, D. p53-dependent association between cyclin G and the B'
subunit of protein phosphatase 2A. Mol Cell Biol, 16: 6593-6602, 1996.
92.
Chen, X. Cyclin G: a regulator of the p53-Mdm2 network. Dev Cell, 2:
518-519, 2002.
93.
Theard, D., Raspe, M. A., Kalicharan, D., Hoekstra, D., and van
IJzendoorn, S.C. Formation of E-cadherin/beta-catenin-based adherens
junctions in hepatocytes requires serine-10 in p27(Kip1). Mol Biol Cell,
19: 1605-1613, 2008.
94.
Lee, T.K., Lau, T.C., and Ng, I.O. Doxorubicin-induced apoptosis and
chemosensitivity in hepatoma cell lines. Cancer Chemother Pharmacol,
49: 78-86, 2002.
95.
Ciafre, S.A., Galardi, S., Mangiola, A., Ferracin, M., Liu, C.G., Sabatino,
G., Negrini, M., Maira, G., Croce, C.M., and Farace, M.G. Extensive
modulation of a set of microRNAs in primary glioblastoma. Biochem
Biophys Res Commun, 334: 1351-1358, 2005.
96.
Gottardo, F., Liu, C.G., Ferracin, M., Calin, G. A., Fassan, M., Bassi, P.,
Sevignani, C., Byrne, D., Negrini, M., Pagano, F., Gomella, L.G., Croce,
C.M., and Baffa, R. Micro-RNA profiling in kidney and bladder cancers.
Urol Oncol, 25: 387-392, 2007.
97.
He, H., Jazdzewski, K., Li, W., Liyanarachchi, S., Nagy, R., Volinia, S.,
Calin, G.A., Liu, C.G., Franssila, K., Suster, S., Kloos, R.T., Croce, C.M.,
and de la Chapelle, A. The role of microRNA genes in papillary thyroid
carcinoma. Proc Natl Acad Sci U S A, 102: 19075-19080, 2005.
98.
Lee, E.J., Gusev, Y., Jiang, J., Nuovo, G.J., Lerner, M.R., Frankel, W.L.,
Morgan, D.L., Postier, R.G., Brackett, D.J., and Schmittgen, T.D.
Expression profiling identifies microRNA signature in pancreatic cancer.
Int J Cancer, 120: 1046-1054, 2007.
99.
Galardi, S., Mercatelli, N., Giorda, E., Massalini, S., Frajese, G.V., Ciafre,
S.A., and Farace, M.G. miR-221 and miR-222 expression affects the
proliferation potential of human prostate carcinoma cell lines by targeting
p27Kip1. J Biol Chem, 282: 23716-23724, 2007.
169
100.
Le Sage, C., Nagel, R., Egan, D. A., Schrier, M., Mesman, E., Mangiola,
A., Anile, C., Maira, G., Mercatelli, N., Ciafre, S.A., Farace, M.G., and
Agami, R. Regulation of the p27(Kip1) tumor suppressor by miR-221 and
miR-222 promotes cancer cell proliferation. Embo J, 26: 3699-3708,
2007.
101.
Gillies, J.K. and Lorimer, I.A. Regulation of p27Kip1 by miRNA 221/222
in glioblastoma. Cell Cycle, 6: 2005-2009, 2007.
102.
Visone, R., Russo, L., Pallante, P., De Martino, I., Ferraro, A., Leone, V.,
Borbone, E., Petrocca, F., Alder, H., Croce, C.M., and Fusco, A.
MicroRNAs (miR)-221 and miR-222, both overexpressed in human
thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell
cycle. Endocr Relat Cancer, 14: 791-798, 2007.
103.
Tannapfel, A., Grund, D., Katalinic, A., Uhlmann, D., Kockerling, F.,
Haugwitz, U., Wasner, M., Hauss, J., Engeland, K., and Wittekind, C.
Decreased expression of p27 protein is associated with advanced tumor
stage in hepatocellular carcinoma. Int J Cancer, 89: 350-355, 2000.
104.
Ito, Y., Takeda, T., Sakon, M., Tsujimoto, M., Monden, M., and Matsuura,
N. Expression of p57/Kip2 protein in hepatocellular carcinoma. Oncology,
61: 221-225, 2001.
105.
Nakai, S., Masaki, T., Shiratori, Y., Ohgi, T., Morishita, A., Kurokohchi,
K., Watanabe, S., and Kuriyama, S. Expression of p57(KIP2) in
hepatocellular carcinoma: relationship between tumor differentiation and
patient survival. Int J Oncol, 20: 769-775, 2002.
106.
Schwienbacher, C., Gramantieri, L., Scelfo, R., Veronese, A., Calin, G.A.,
Bolondi, L., Croce, C.M., Barbanti-Brodano, G., and Negrini, M. Gain of
imprinting at chromosome 11p15: a pathogenetic mechanism identified in
human hepatocarcinomas. Proc Natl Acad Sci U S A, 97: 5445-5449,
2000.
107.
Diaz-Meyer, N., Day, C.D., Khatod, K., Maher, E.R., Cooper, W., Reik,
W., Junien, C., Graham, G., Algar, E., Der Kaloustian, V.M., and Higgins,
M.J. Silencing of CDKN1C (p57KIP2) is associated with hypomethylation
at KvDMR1 in Beckwith-Wiedemann syndrome. J Med Genet, 40: 797801, 2003.
108.
Soejima, H., Nakagawachi, T., Zhao, W., Higashimoto, K., Urano, T.,
Matsukura, S., Kitajima, Y., Takeuchi, M., Nakayama, M., Oshimura, M.,
Miyazaki, K., Joh, K., and Mukai, T. Silencing of imprinted CDKN1C
gene expression is associated with loss of CpG and histone H3 lysine 9
methylation at DMR-LIT1 in esophageal cancer. Oncogene, 23: 43804388, 2004.
170
109.
Fabregat, I., Roncero, C., and Fernandez, M. Survival and apoptosis: a
dysregulated balance in liver cancer. Liver Int, 27: 155-162, 2007.
110.
Guo, X.Z., Shao, X.D., Liu, M.P., Xu, J.H., Ren, L.N., Zhao, J.J., Li, H.
Y., and Wang, D. Effect of bax, bcl-2 and bcl-xL on regulating apoptosis
in tissues of normal liver and hepatocellular carcinoma. World J
Gastroenterol, 8: 1059-1062, 2002.
111.
Schattenberg, J.M., Galle, P.R., and Schuchmann, M. Apoptosis in liver
disease. Liver Int, 26: 904-911, 2006.
112.
Willis, S.N. and Adams, J.M. Life in the balance: how BH3-only proteins
induce apoptosis. Curr Opin Cell Biol, 17: 617-625, 2005.
113.
Puthalakath, H., Villunger, A., O'Reilly, L.A., Beaumont, J.., Coultas, L.,
Cheney, R.E., Huang, D.C., and Strasser, A. Bmf: a proapoptotic BH3only protein regulated by interaction with the myosin V actin motor
complex, activated by anoikis. Science, 293: 1829-1832, 2001.
114.
Schmelzle, T., Mailleux, A.A., Overholtzer, M., Carroll, J.S., Solimini,
N.L., Lightcap, E.S., Veiby, O.P., Brugge, J.S. Functional role and
oncogene-regulated expression of the BH3-only factor Bmf in mammary
epithelial anoikis and morphogenesis. Proc Natl Acad Sci U S A, 104:
3787-3792, 2007.
115.
Imamura, H., Matsuyama, Y., Tanaka, E., Ohkubo, T., Hasegawa, K.,
Miyagawa, S., Sugawara, Y., Minagawa, M., Takayama, T., Kawasaki, S.,
and Makuuchi, M. Risk factors contributing to early and late phase
intrahepatic recurrence of hepatocellular carcinoma after hepatectomy. J
Hepatol, 38: 200-207, 2003.
116.
Iorio, M.V., Visone, R., Di Leva, G., Donati, V., Petrocca, F., Casalini, P.,
Taccioli, C., Volinia, S., Liu, C.G., Alder, H., Calin, G. A., Menard, S.,
and Croce, C.M. MicroRNA signatures in human ovarian cancer. Cancer
Res, 67: 8699-8707, 2007.
117.
Ichimi, T., Enokida, H., Okuno, Y., Kunimoto, R., Chiyomaru, T.,
Kawamoto, K., Kawahara, K., Toki, K., Kawakami, K., Nishiyama, K.,
Tsujimoto, G., Nakagawa, M., and Seki, N. Identification of novel
microRNA targets based on microRNA signatures in bladder cancer. Int J
Cancer, 125: 345-352, 2009.
118.
Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A.,
Pfeffer, S., Rice, A., Kamphorst, A. O., Landthaler, M., Lin, C., Socci, N.
D., Hermida, L., Fulci, V., Chiaretti, S., Foa, R., Schliwka, J., Fuchs, U.,
Novosel, A., Muller, R.U., Schermer, B., Bissels, U., Inman, J., Phan, Q.,
Chien, M., Weir, D.B., Choksi, R., De Vita, G., Frezzetti, D., Trompeter,
H. I., Hornung, V., Teng, G., Hartmann, G., Palkovits, M., Di Lauro, R.,
Wernet, P., Macino, G., Rogler, C.E., Nagle, J.W., Ju, J., Papavasiliou, F.
171
N., Benzing, T., Lichter, P., Tam, W., Brownstein, M.J., Bosio, A.,
Borkhardt, A., Russo, J.J., Sander, C., Zavolan, M., and Tuschl, T. A
mammalian microRNA expression atlas based on small RNA library
sequencing. Cell, 129: 1401-1414, 2007.
119.
Migliore, C., Petrelli, A., Ghiso, E., Corso, S., Capparuccia, L., Eramo, A.,
Comoglio, P. M., and Giordano, S. MicroRNAs impair MET-mediated
invasive growth. Cancer Res, 68: 10128-10136, 2008.
120.
Dolganiuc, A., Petrasek, J., Kodys, K., Catalano, D., Mandrekar, P.,
Velayudham, A., and Szabo, G. MicroRNA Expression Profile in LieberDeCarli Diet-Induced Alcoholic and Methionine Choline Deficient DietInduced Nonalcoholic Steatohepatitis Models in Mice. Alcohol Clin Exp
Res, 2009.
121.
Lin, E.A., Kong, L., Bai, X.H., Luan, Y., and Liu, C.J. miR-199a, a bone
morphogenic protein 2-responsive MicroRNA, regulates chondrogenesis
via direct targeting to Smad1. J Biol Chem, 284: 11326-11335, 2009.
122.
Oskowitz, A.Z., Lu, J., Penfornis, P., Ylostalo, J., McBride, J.,
Flemington, E.K., Prockop, D.J., and Pochampally, R. Human multipotent
stromal cells from bone marrow and microRNA: regulation of
differentiation and leukemia inhibitory factor expression. Proc Natl Acad
Sci U S A, 105: 18372-18377, 2008.
123.
Vignot, S., Faivre, S., Aguirre, D., and Raymond, E. mTOR-targeted
therapy of cancer with rapamycin derivatives. Ann Oncol, 16: 525-537,
2005.
124.
Villanueva, A., Chiang, D.Y., Newell, P., Peix, J., Thung, S., Alsinet, C.,
Tovar, V., Roayaie, S., Minguez, B., Sole, M., Battiston, C., Van
Laarhoven, S., Fiel, M.I., Di Feo, A., Hoshida, Y., Yea, S., Toffanin, S.,
Ramos, A., Martignetti, J. A., Mazzaferro, V., Bruix, J., Waxman, S.,
Schwartz, M., Meyerson, M., Friedman, S.L., and Llovet, J.M. Pivotal role
of mTOR signaling in hepatocellular carcinoma. Gastroenterology, 135:
1972-1983, 1983 e1971-1911, 2008.
125.
Meric-Bernstam, F. and Gonzalez-Angulo, A.M. Targeting the mTOR
signaling network for cancer therapy. J Clin Oncol, 27: 2278-2287, 2009.
126.
Zhou, L., Huang, Y., Li, J., and Wang, Z. The mTOR pathway is
associated with the poor prognosis of human hepatocellular carcinoma.
Med Oncol, 2009.
127.
Huynh, H., Chow, K. H., Soo, K. C., Toh, H.C., Choo, S.P., Foo, K.F.,
Poon, D., Ngo, V.C., and Tran, E. RAD001 (everolimus) inhibits tumour
growth in xenograft models of human hepatocellular carcinoma. J Cell
Mol Med, 13: 1371-1380, 2009.
172
128.
Piguet, A.C., Semela, D., Keogh, A., Wilkens, L., Stroka, D., Stoupis, C.,
St-Pierre, M.V., and Dufour, J.F. Inhibition of mTOR in combination with
doxorubicin in an experimental model of hepatocellular carcinoma. J
Hepatol, 49: 78-87, 2008.
129.
Buitrago-Molina, L.E., Pothiraju, D., Lamle, J., Marhenke, S., Kossatz,
U., Breuhahn, K., Manns, M. P., Malek, N., and Vogel, A. Rapamycin
delays tumor development in murine livers by inhibiting proliferation of
hepatocytes with DNA damage. Hepatology, 50: 500-509, 2009.
130.
Land, S.C. and Tee, A.R. Hypoxia-inducible factor 1alpha is regulated by
the mammalian target of rapamycin (mTOR) via an mTOR signaling
motif. J Biol Chem, 282: 20534-20543, 2007.
131.
Rane, S., He, M., Sayed, D., Vashistha, H., Malhotra, A., Sadoshima, J.,
Vatner, D.E., Vatner, S.F., and Abdellatif, M. Downregulation of miR199a derepresses hypoxia-inducible factor-1alpha and Sirtuin 1 and
recapitulates hypoxia preconditioning in cardiac myocytes. Circ Res, 104:
879-886, 2009.
132.
Comoglio, P.M. and Trusolino, L. Invasive growth: from development to
metastasis. J Clin Invest, 109: 857-862, 2002.
133.
Iorio, M.V., Ferracin, M., Liu, C.G., Veronese, A., Spizzo, R., Sabbioni,
S., Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., Menard, S.,
Palazzo, J.P., Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G.
A., Querzoli, P., Negrini, M., and Croce, C. M. MicroRNA gene
expression deregulation in human breast cancer. Cancer Res, 65: 70657070, 2005.
134.
Pineau, P., Volinia, S., McJunkin, K., Marchio, A., Battiston, C., Terris,
B., Mazzaferro, V., Lowe, S.W., Croce, C.M., and Dejean, A. miR-221
overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S
A, 107: 264-269.
135.
Pallante, P., Visone, R., Ferracin, M., Ferraro, A., Berlingieri, M. T.,
Troncone, G., Chiappetta, G., Liu, C. G., Santoro, M., Negrini, M., Croce,
C.M., and Fusco, A. MicroRNA deregulation in human thyroid papillary
carcinomas. Endocr Relat Cancer, 13: 497-508, 2006.
136.
Gramantieri, L., Ferracin, M., Fornari, F., Veronese, A., Sabbioni, S., Liu,
C.G., Calin, G.A., Giovannini, C., Ferrazzi, E., Grazi, G.L., Croce, C.M.,
Bolondi, L., and Negrini, M. Cyclin G1 is a target of miR-122a, a
microRNA frequently down-regulated in human hepatocellular carcinoma.
Cancer Res, 67: 6092-6099, 2007.
137.
Cummins, J.M., He, Y., Leary, R.J., Pagliarini, R., Diaz, L.A. Jr.,
Sjoblom, T., Barad, O., Bentwich, Z., Szafranska, A.E., Labourier, E.,
Raymond, C.K., Roberts, B.S., Juhl, H., Kinzler, K.W., Vogelstein, B.,
173
and Velculescu, V.E. The colorectal microRNAome. Proc Natl Acad Sci
U S A, 103: 3687-3692, 2006.
138.
Fornari, F., Gramantieri, L., Giovannini, C., Veronese, A., Ferracin, M.,
Sabbioni, S., Calin, G. A., Grazi, G.L., Croce, C.M., Tavolari, S., Chieco,
P., Negrini, M., and Bolondi, L. MiR-122/cyclin G1 interaction modulates
p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma
cells. Cancer Res, 69: 5761-5767, 2009.
139.
Tong, A.W. and Nemunaitis, J. Modulation of miRNA activity in human
cancer: a new paradigm for cancer gene therapy? Cancer Gene Ther, 15:
341-355, 2008.
140.
Sarasin-Filipowicz, M., Krol, J., Markiewicz, I., Heim, M.H., and
Filipowicz, W. Decreased levels of microRNA miR-122 in individuals
with hepatitis C responding poorly to interferon therapy. Nat Med, 15: 3133, 2009.
141.
Song, E., Lee, S.K., Wang, J., Ince, N., Ouyang, N., Min, J., Chen, J.,
Shankar, P., and Lieberman, J. RNA interference targeting Fas protects
mice from fulminant hepatitis. Nat Med, 9: 347-351, 2003.
142.
Elmen, J., Lindow, M., Schutz, S., Lawrence, M., Petri, A., Obad, S.,
Lindholm, M., Hedtjarn, M., Hansen, H.F., Berger, U., Gullans, S.,
Kearney, P., Sarnow, P., Straarup, E. M., and Kauppinen, S. LNAmediated microRNA silencing in non-human primates. Nature, 452: 896899, 2008.
143.
Elmen, J., Lindow, M., Silahtaroglu, A., Bak, M., Christensen,M., LindThomsen, A., Hedtjarn, M., Hansen, J.B., Hansen, Straarup, E.M.,
McCullagh, K., Kearney, P., and Kauppinen, S. Antagonism of
microRNA-122 in mice by systemically administered LNA-antimiR leads
to up-regulation of a large set of predicted target mRNAs in the liver.
Nucleic Acids Res, 36: 1153-1162, 2008.
174
RINGRAZIAMENTI
175
Ringrazio il Prof. Giovanni Capranico per avermi ‘adottato’ nel suo gruppo di
ricerca e consentito di portare a termire questo percorso di Dottorato, che si è
rivelato molto istruttivo e che mi ha consentito di crescere sia scientificamente
che umanamente.
Ringrazio il Prof. Luigi Bolondi per aver avuto fiducia in me sin dall’inizio e per
avermi dato l’opportunità di fare ricerca ad altissimi livelli e soprattutto la ricerca
che avevo sempre sognato dal primo giorno di Università.
Ringrazio in particolar modo la Dr.ssa Laura Gramantieri che più di tutti ha
creduto in me e mi ha sostenuto anche quando gli esperimenti non ne volevano
sapere di andare per il verso giusto ed il laboratorio sembrava un buco nero. Poi
però ci siamo prese le nostre rivincite e adesso non ci ferma più nessuno! Grazie
di cuore per tutto quello che hai fatto per me!
Ringrazio il Dr. Massimo Negrini, il mio mentore, per avermi dato fiducia in quel
lontano colloquio del 2005 e per avermi aperto le porte dell’affascinante ‘mondo
dei microRNA’.
Ringrazio il Dr. Chieco per avermi offerto l’opportunità di lavorare in un
laboratorio (CRBA) così all’avanguardia, che quasi non sembra neanche di essere
in Italia!
Ringrazio i miei genitori e mia sorella Chiara che pur considerandomi una
‘scienziata pazza’ hanno gioito insieme a me delle soddisfazioni che questo
lavoro mi ha offerto.
Ringrazio Matteo che mi è stato vicino e mi ha sempre incoraggiata,
infondendomi autostima e desiderio di farcela a tutti i costi e, anche se a volte le
gambe mi tremavano un poco, sono contenta della mie conquiste e di condividerle
con chi mi vuole bene.
176
Ringrazio i due pilastri che quotidianamente mi sostengono, Maddalena e
Manuela, a cui spero di aver insegnato qualcosa e soprattutto trasmesso l’amore
per la ricerca che è spesso avara di soddisfazioni, ma che è così affascinante
anche per questo suo metterti costantemente alla prova. Ed alla fine sono convinta
che le risposte sono proprio lì, dove non te le saresti mai aspettate, a predersi
gioco del tuo tanto cercare…il segreto consiste proprio nel non mollare mai!
Forza ragazze!
Ringrazio tutte le mie amiche per avermi strappato un sorriso anche quando c’era
solo il buio e per aver condiviso con me gioie e dolori e soprattutto perché so che
ci siete sempre, anche quando siete lontane…
Ringrazio tutti i miei nonni, vicini e ‘lontani’, che ancora si commuovono quando
dico loro che ho vinto un premio ad un congresso, e che sono un esempio
quotidiano di resistenza e di ingegno!
Grazie a tutti per avermi consentito di raccontare questa storia!
177
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising