contaldo clara tesi

contaldo clara tesi
Alma Mater Studiorum – Universita’ di Bologna
Dottorato di Ricerca in Scienze dello Sviluppo
e del Movimento Umano
Ciclo XXV
Settore Concorsuale di afferenza: 06/D3
Settore Scientifico disciplinare: MED/06
Valutazione del ruolo dell’espressione di IRS-1
nel differenziamento osteoblastico di cellule di
osteosarcoma ed MSCs
Presentata da Clara Contaldo
Coordinatore del Dottorato
Relatore
Chiar.ma Prof.ssa Elisabetta Caramelli
Chiar.ma Prof.ssa Cinzia Zucchini
Correlatore
Chiar.ma Prof.ssa Katia Scotlandi
Esame finale anno 2013
Abstract
L’osteosarcoma (OS) è il tumore primitivo dell’osso più comune in età pediatrica e
adolescenziale. L’OS è stato recentemente riconsiderato come una patologia da dedifferenziamento, legata all’interruzione del processo cui vanno incontro i precursori
osteoblastici, quali le cellule staminali mesenchimali (MSCs), per trasformarsi in osteoblasti
maturi.
Il sistema IGF è coinvolto nella regolazione della proliferazione e del differenziamento di
cellule di OS. IRS-1 è un mediatore critico di tale via di segnalazione e il suo livello di
espressione modula il differenziamento di cellule ematopoietiche. Lo scopo di questa tesi è stato
quello di definire il ruolo di IRS-1 nel differenziamento osteoblastico di MSCs e cellule di OS. Il
potenziale differenziativo di cellule di OS umano e murino e di MSCs derivate da midollo osseo è
stato valutato tramite Alizarin Red staining e Real Time-PCR. Dai dati ottenuti è emerso come i
livelli di espressione di IRS-1 diminuiscano durante il differenziamento osteoblastico.
Conseguentemente, i livelli di espressione di IRS-1 sono stati manipolati utilizzando shRNA per
down-regolare l’espressione della proteina o un plasmide per sovra-esprimerla. Sia la downregolazione sia la sovra-espressione di IRS-1 hanno inibito il differenziamento osteoblastico delle
linee cellulari considerate. Allo scopo di valutare il contributo di IRS-1 nella via di segnalazione
di IGF-1R è stato utilizzato l’inibitore di tale recettore, αIR-3. Anche in questo caso è stata
osservata una riduzione della capacità differenziativa. L’inibitore del proteasoma MG-132 ha
portato ad un aumento dei livelli di IRS-1, portando nuovamente all’inibizione del
differenziamento osteoblastico e suggerendo che l’ubiquitinazione di questa proteina potrebbe
avere un ruolo importante nel mantenimento di appropriati livelli di espressione di IRS-1. I
risultati ottenuti indicano la criticità dei livelli di espressione di IRS-1 nella determinazione della
capacità differenziativa sia di cellule di OS umano e murino, sia delle MSCs.
Abstract
Osteosarcoma (OS) is the most common primary malignant bone tumor affecting children
and adolescents. OS has recently been re-considered as a differentiation disease, caused by
genetic and epigenetic alterations which may impair normal bone development by blocking
multipotent mesenchymal stem cell (MSCs) differentiation into osteoblasts. The IGF-system is
involved in regulating OS cell proliferation and differentiation. IRS-1 is a critical mediator of
IGF-1R signaling and its expression level modulates hematopoietic cell differentiation. The aim
of this study is to define the role of IRS-1 in the osteoblastic differentiation of MSCs and OS
cells. Differentiating potential of human and murine OS cell lines and bone marrow-derived
mouse MSCs was evaluated by Alizarin Red staining and real-time PCR. We found that IRS-1
expression level decreased during differentiation. Consequently, IRS-1 expression levels were
manipulated using shRNAs to knock-down, or a plasmid to over-express the protein. Both downregulation and over-expression of IRS-1 inhibited osteoblastic differentiation. To understand the
contribution of IRS-1 in the IGF-1R pathway we used the αIR-3 IGF-1R blocking antibody,
which inhibited the differentiation process. The proteasome inhibitor MG-132 led to an increase
in IRS-1 protein level that again inhibited osteoblastic differentiation, suggesting ubiquitination
may play a role in maintaining the appropriate expression level of IRS-1. Taken together, these
results indicate that IRS-1 expression level is critical for determining the differentiating capacity
of MSCs as well as human and mouse OS cells and that precise regulation of IRS-1 expression by
cells
is
required
for
this
commitment
to
osteoblastic
differentiation.
Indice
INTRODUZIONE.................................................................................3
Osteosarcoma..............................................................................................3
Aspetti generali ed epidemiologia.............................................................3
Osteosarcoma classico o convenzionale..................................................5
Eziopatogenesi............................................................................................7
Terapia.......................................................................................................11
Osteogenesi e differenziamento osteoblastico..................................14
Aspetti generali......................................................................................14
Componente cellulare e matrice...........................................................15
Processi di ossificazione intramembranosa ed endocondrale..........17
Cellule del lineage osteoblastico: sviluppo osseo e differenziamento.19
Controllo trascrizionale e segnali per il differenziamento................20
Controllo dei fattori trascrizionali osteoblasto-specifici..................26
Osteosarcoma e differenziamento osteoblastico................................27
Il sistema IGF................................................................................30
I ligandi...................................................................................................31
Le IGFBPs..............................................................................................32
Il recettore per IGF-1 (IGF-1R)..............................................................33
Il sistema IGF e lo sviluppo tumorale...................................................35
Strategie terapeutiche per colpire il sistema IGF................................40
IRS-1 (Insulin Receptor Substrate-1).........................................44
La famiglia di proteine IRS.....................................................................44
1
Indice
IRS-1.......................................................................................................45
IRS-1: degradazione................................................................................48
IRS-1 e lo sviluppo tumorale..................................................................50
IRS-1 e il differenziamento.....................................................................52
SCOPO DELLA TESI.........................................................................55
MATERIALI E METODI....................................................................57
RISULTATI..........................................................................................64
Risultati preliminari………………………………………………..64
La sovra-espressione di IRS-1 riduce la capacità delle cellule di
differenziare in senso osteoblastico e ne aumenta la
tumorigenicità........................................................................................67
Importanza
di
IRS-1
durnate
il
differenziamento
osteoblastico……………………………………………………….....76
L’accumulo di IRS-1 inibisce il differenziamento osteoblastico……82
PROSPETTIVE FUTURE………………………………………….85
DISCUSSIONE...................................................................................87
BIBLIOGRAFIA…………………………………………………....92
2
Introduzione
Introduzione
OSTEOSARCOMA
Aspetti generali ed epidemiologia
L’osteosarcoma (OS), conosciuto anche come sarcoma osteogenico, è un tumore ad
elevata malignità costituito da cellule mesenchimali maligne che producono matrice di tipo
osteoide ed ossea. Rappresenta il tumore maligno primitivo più frequente dell'apparato
scheletrico. In Italia, l'incidenza dei tumori primitivi dell'osso si attesta intorno a 0,8-1 caso per
100.000 abitanti, quindi si calcola vi siano circa 500 nuovi casi di tumori maligni primitivi
dell'osso per anno. Tra questi, la percentuale degli osteosarcomi si attesta intorno al 20-25%,
perciò si possono supporre circa 100 nuovi casi l'anno. Sulla base dei dati epidemiologici relativi
all'osteosarcoma per la popolazione bianca canadese, che mostrano un'incidenza di 4,6 nuovi casi
l'anno per milione di abitanti nella fascia di età fino ai 19 anni e supponendo nel nostro paese la
medesima incidenza, si possono attendere 57 nuovi casi l'anno di osteosarcoma in soggetti nella
stessa fascia d'età. Considerando che tale valore di incidenza si riduce significativamente con l'età,
una stima globale, nel nostro Paese, è di circa 100 nuovi casi l'anno [Campanacci M. 1999]. Molti
dei pazienti con sarcoma osteogenico delle estremità presentano dolore seguito da gonfiore dei
tessuti molli, ma questo è vero per tutti i tumori primari dell’osso poichè l’allungamento del
periostio causa dolore prima che il tumore si possa distinguere. Il dolore può anche derivare
dall’indebolimento dell’osso con sviluppo di micro fratture. L’insorgenza di dolore severo e
improvviso denuncia la presenza di fratture patologiche più gravi, che sono inusuali nei pazienti
adulti, mentre piu’ del 15% dei pazienti pediatrici presenta fratture patologiche. Molto rari sono i
sintomi di malessere generico, come perdita di peso, pallore, febbre, anoressia [Picci P. 2007].
3
Introduzione
Il registro dei Tumori Maligni Primitivi dell’Osso dell’Istituto Ortopedico Rizzoli mostra
come l’osteosarcoma colpisca maggiormente i giovani, con un’età mediana di 19 anni, periodo in
cui si ha il maggior accrescimento. L’osteosarcoma ha una distribuzione bimodale, con un picco
di incidenza nella seconda decade e uno in età più avanzata, intorno ai 50 anni [Dorfman, H.
1995][Jaffe N., 1979] [Dahlin DC, 1986]; il picco adolescenziale sembra correlare con l’ intensa
crescita tipica della pubertà, infatti le zone in cui più spesso insorge il tumore sono quelle in cui si
ha un massiccio rimaneggiamento osseo, suggerendo anche una correlazione tra l’attività
osteoblastica e la tumorigenesi [Kansara M. 2007]. Alcuni studi mettono in evidenza una
maggiore incidenza di questa patologia nei maschi piuttosto che nelle femmine [Mascarenhas L,.
2000], con un rapporto di 1,5-2 : 1.; raramente l’osteosarcoma insorge in bambini di età inferiore
ai 5 anni (in questa fascia d’età è più diffuso il sarcoma di Ewing), così come in pazienti anziani
esso è solitamente un tumore secondario, post-irradiazione o su Malattia di Paget [Jaffe N.,1979]
[Deyrup AT., 2007] [Hansen MF, 2006 63].
L’osteosarcoma può colpire tutti i distretti ossei, ma nel 90% dei casi si riscontra nelle
ossa lunghe e nel 50% dei casi colpisce le ossa del ginocchio. Nell’ordine di insorgenza troviamo
prima la parte distale del femore e la parte prossimale della tibia, seguite dalla parte prossimale
dell’omero; si hanno riscontri anche nelle ossa cranio-facciali, nell’estremità prossimale del
femore, nella diafisi del femore e nel bacino. Molto più raramente compare in sedi come il
perone, la diafisi e l’estremità distale della tibia; ancora più atipiche sono le masse localizzate a
livello della colonna vertebrale, della scapola, della clavicola, delle coste, dello sterno, dell’omero
distale, dell’avambraccio, della mano e del piede [Campanacci M. 1999]. Nelle ossa lunghe
l’osteosarcoma predilige le metafisi e le meta diafisi, mentre la cartilagine di accrescimento
costituisce un ostacolo che ritarda l’invasione dell’epifisi: nell’adulto, infatti, il tumore si estende
rapidamente all’epifisi. Raramente il tumore origina in una zona diafisiaria o epifisiaria (Figura
4).
4
Introduzione
Figura 4. Sesso, età e localizzazione in 1469 casi di osteosarcoma (Campanacci M, 1999).
Osteosarcoma classico o convenzionale
L’osteosarcoma classico è una neoplasia ad alto grado di malignità che si localizza
principalmente nelle metafisi delle ossa lunghe di adolescenti e giovani adulti; sedi preferenziali
sono la regione metafisaria del femore distale e della tibia prossimale. L’ osteosarcoma interessa
la diafisi delle ossa lunghe in circa il 10% dei casi, anche se in questa sede insorgono
generalmente varianti non convenzionali. Clinicamente, il paziente presenta dolore localizzato
all’arto interessato e più raramente manifesta una frattura patologica. All’esame radiografico la
lesione appare come un’area mista litica-addensante dell’osso, con estensione ai tessuti molli
limitrofi; la presenza di una reazione periostea, al confine tra l’osso corticale normale e quello
infiltrato dalla neoplasia, rappresenta un parametro radiografico diagnostico utile, chiamato
triangolo di Codman. A seconda dell’istotipo la lesione può mostrare differenti livelli di
mineralizzazione o essere puramente litica. Macroscopicamente l’osteosarcoma si presenta come
una grande massa che sostituisce quasi totalmente la midollare metafisaria, risparmiando in
genere la regione epifisaria, dove la cartilagine epifisaria funge da barriera protettiva. La
consistenza della lesione può variare dal soffice al duro-ligneo, a seconda della quantità di
5
Introduzione
osteoide e di osso prodotta. Nel 25% dei casi è presente una componente tumorale cartilaginea
talmente ricca da simulare un condrosarcoma.
Istologicamente, e per definizione, l’osteosarcoma convenzionale è un sarcoma a cellule
fusate ad alto grado di malignità, che produce matrice osteoide, tuttavia ne sono state descritte tre
varianti istologiche, che tengono conto dell’aspetto predominante della matrice: osteoblastico,
fibroblastico e condroblastico. La variante osteoblastica è sicuramente la più frequente e
rappresenta il 50% degli osteosarcoma convenzionali. Le cellule mostrano aspetto fusato o
epitelioide e presentano un significativo grado di atipia citologica. La produzione di matrice
osteoide variamente mineralizzata è abbondante e tende ad intrappolare le cellule neoplastiche
con deposizione a livello pericellulare oppure può mostrare un’organizzazione trabecolare. Il
restante 50% si divide tra l’istotipo fibroblastico (25%), con produzione di matrice molto ridotta e
con una prevalenza della componente fusata simil-fibrosarcomatosa, e l’istotipo condroblastico
(25%), in cui si ritrova un’importante componente condroide di tipo maligno, simile a quella
osservata nei condrosarcomi; intorno ai lobuli cartilaginei è possibile riscontrare la presenza di
cellule fusate con produzione di matrice osteoide. Anche in assenza di matrice osteoide, la
presenza di una neoplasia condroide ad alto grado di malignità, associata ad una componente
fuso-cellulare in un paziente giovane, porta alla diagnosi di osteosarcoma di tipo condroblastico.
Può accadere che la presenza di cellule giganti simil-osteoclasti mascheri un osteosarcoma
convenzionale, inducendo il patologo a pensare ad un tumore a cellule giganti, ma nel caso di un
paziente giovane una lesione a cellule giganti dell’osso nella regione metafisaria deve far
sospettare un osteosarcoma. La presenza di metastasi a distanza è molto frequente in questo tipo d
patologia e la sede preferenziale è il polmone; la presenza di metastasi ha un significato altamente
prognostico.
6
Introduzione
Figura 1. Osteosarcoma intramidollare alto grado con coinvolgimento del midollo (Murphey M.,
1997).
Eziopatogenesi
Nel corso degli anni sono stati effettuati numerosi studi sugli aspetti citogenetici e
molecolari dell’osteosarcoma con risultati spesso discordi. Pertanto il loro valore diagnostico e
prognostico appare tuttora limitato e la rarità della patologia non contribuisce a chiarirne il
significato eziologico. L’osteosarcoma è annoverato tra i sarcomi a cariotipo complesso [Hayden
JB, 2006], e a differenza di quanto accaduto per il rabdomiosarcoma alveolare, per il sarcoma di
Ewing e per il sarcoma sinoviale, non è mai stata descritta alcuna traslocazione caratteristica di
questa patologia [Cormier et al., 2004]. Sono state individuate diverse alterazioni geniche che
correlano con l’insorgenza dell’osteosarcoma. Il 70% dei casi di osteosarcoma mostra alterazioni
numeriche e strutturali e amplificazioni genomiche. Tra queste alterazioni le piu’ comuni sono la
duplicazione del cromosoma 1, la perdita dei cromosomi 9, 10, 13 e/o 17, la perdita parziale o
completa del braccio lungo del cromosoma 6 e riarrangiamenti dei cromosomi 11, 19 e 20
[Sandberg et al., 2003]. L’amplificazione del tratto 8q, è presente in circa il 50% degli
7
Introduzione
osteosarcomi e rappresenta un fattore prognostico sfavorevole in termini di sopravvivenza. [Lopez
M., 2009]. Le analisi citogenetiche hanno rivelato numerosi punti di rottura e traslocazioni,
sottolineando la complessità e l’instabilità del background genetico in questa patologia. Diverse
evidenze mettono in relazione l’aumento dell’instabilità e della complessità genomica con il
processo di accorciamento dei telomeri [Artandi SE, 2000]. Le cellule tumorali, essendo dotate di
proliferazione incontrollata, non sono soggette al normale processo di senescenza e utilizzano
meccanismi che consentono il mantenimento della lunghezza dei telomeri; l’85% dei tumori
attiva enzimi chiamati telomerasi, responsabili appunto dell’allungamento dei telomeri, il restante
15% utilizza un meccanismo alternativo basato sulla ricombinazione, detto ALT (alternative
lenthening of telomeres) [Bryan TM, 1997]. Tale meccanismo viene utilizzato nel 50% degli
osteosarcomi [Scheel C, 2001] e l’alta instabilità genomica dovuta a questo meccanismo potrebbe
spiegare, almeno in parte, l’estrema variabilità di difetti genomici riscontrabili nell’osteosarcoma.
E’ stato ipotizzato che osteosarcomi dipendenti da ALT abbiano un comportamento clinico
differente rispetto a quelli telomerasi-dipendenti, ma tale correlazione resta ancora da verificare.
Recentemente è stato proposto un possibile meccanismo per spiegare l’estrema instabilità
genetica dell’osteosarcoma: la cromotripsi, un evento cataclismico in cui i cromosomi vengono
frammentati e conseguentemente riassemblati in modo aberrante [Campbell PJ, 2011]. Dalla
comparazione dei risultati di esami CGH (Comparative Genomic Hybridization) si notano
mutazioni gain function dei cromosomi 6p, 8q e 17p. [Szuhai K, 2012]. L’eziologia
dell’osteosarcoma è quindi tutt’oggi oggetto di studio. La marcata attività osteoblastica e
osteogenica appaiono fattori predisponenti all’insorgenza della neoplasia, come suggeriscono
l’aumentata incidenza durante lo sviluppo adolescenziale e la tipica localizzazione a livello delle
metafisi. L’esposizione a radiazioni ionizzanti è l’unico fattore di rischio esogeno individuato
come causa comprovata dell’insorgenza del 4% degli osteosarcomi [Fuchs B, 2002], con un lungo
lasso di tempo, 10-20 anni, intercorrente tra l’esposizione alle radiazioni e l’insorgenza della
patologia [Longhi A, 2003], pertanto l’osteosarcoma radio-indotto risulta essere tipico dell’età
adulta e molto raro. Alcuni studi comprovano l’origine virale dei sarcomi dell’osso ed anche nel
caso dell’osteosarcoma è stata ipotizzata un’origine virale [Finkel MP,1966]. Il DNA del virus
SV40, accidentale contaminante dei vaccini per il poliovirus largamente utilizzati tra il 1955 ed il
1962, è stato ritrovato in cellule di osteosarcoma, ma il follow-up a lungo termine di pazienti che
avevano ricevuto questo tipo di vaccinazione non ha mostrato alcun incremento del rischio di
8
Introduzione
sviluppare tale neoplasia [Mendoza SM, 1998][Engels EA,]. Sono state descritte famiglie in cui
diversi membri hanno sviluppato osteosarcoma, suggerendo una predisposizione genetica
all’insorgenza di questa patologia [Swaney JJ, 1973].Altre alterazioni riscontrate frequentemente
nell’osteosarcoma sono mutazioni o delezioni a carico di oncogeni e geni oncosoppressori.
Screening effettuati su bambini con sarcoma dell’osso hanno rivelato che dal 3 al 4% di essi
presentano una mutazione germinale di p53 [McIntyre JF, 1994]. Il gene P53, localizzato nella
regione 17p13, codifica per un fattore di trascrizione implicato nella regolazione del ciclo
cellulare, nella risposta al danno al DNA e nel processo apoptotico. La gran parte dei casi con
mutazioni di p53 nella linea germinale rappresentano pazienti con una storia familiare di
sindrome di Li-Fraumeni, infatti come riportato da Wang et al. [Wang LL, 2005] la sindrome di
Li-Fraumeni (LFS) porta ad una predisposizione ai tumori ed è associata ai sarcomi delle parti
molli, al tumore al seno, alla leucemia, all’osteosarcoma e al melanoma, oltre che ai tumori del
colon, del pancreas, della corteccia surrenale e del cervello; i soggetti LFS mostrano un aumentato
rischio di sviluppare tumori multipli primitivi. Questi pazienti presentano mutazioni dei geni p53
ed Rb. Anche pazienti affetti dalla sindrome di Rothmund-Thomson e dalla sindrome di Bloom
possiedono una maggiore predisposizione allo sviluppo di osteosarcoma; queste due sindromi
sono caratterizzate dalla perdita di due geni, RECQL4 nella prima e BLM nella seconda,
codificanti per due DNA elicasi, quindi coinvolti nel processo di duplicazione che aiutano lo
svolgimento dell’elica di DNA. Anche i pazienti con sindrome di Paget mostrano una
predisposizione allo sviluppo dell’osteosarcoma, infatti l’1% di questi pazienti sviluppa la
neoplasia ossea presa in considerazione. La sindrome di Paget dell’osso è dovuta ad una
disconnessione tra l’attività degli osteoclasti e quella degli osteoblasti, risultando nella
formazione di ossa largamente deformate [Wagner ER., 2011]. L’amplificazione e l’overespressione dei geni di MDM2 e CDK4 sono state riscontrate in casi di osteosarcoma, suggerendo
il loro coinvolgimento nella patogenesi tumorale [Ragazzini P, 1999]. Il gene MDM2 codifica per
una proteina responsabile del legame e della inattivazione di p53; la sua iper-espressione e’ stata
dimostrata nel 5-10% degli osteosarcomi [Lonardo F, 1997] CDK4 e’ una chinasi ciclinadipendente che puo’ fosforilare ed inattivare pRb, la proteina prodotta dal gene RB [Benassi MS,
1999]. Anche la Ciclina D1 viene altamente espressa nell’osteosarcoma [Maelandsmo GM, 1995].
La più forte predisposizione genetica è stata rilevata in pazienti con retinoblastoma
ereditario. Il gene oncosoppressore del retinoblastoma (RB), localizzato sul cromosoma 13q14, e’
9
Introduzione
un importante regolatore del ciclo cellulare, durante il quale inibisce l’ingresso delle cellule nella
fase S di replicazione del DNA. Nella transizione dalla fase G1 alla fase S, Rb viene fosforilato ed
inibito, consentendo cosi’ l’attivazione di fattori trascrizionali E2F e promuovomendo quindi il
processo di sintesi del DNA. Il gene RB e’ coinvolto nell’insorgenza di un raro tumore infantile
della retina, il retinoblastoma, nel quale e’ sempre presente una mutazione del gene RB. I pazienti
affetti da retinoblastoma mostrano un aumentato rischio di incidenza di tumori extraoculari
secondari e l’osteosarcoma è tra questi il più frequente. In questi pazienti, infatti, l’osteosarcoma
insorge 500 volte più frequentemente che nella popolazione generale [Huvos AG, 1991] [Thomas
DM, 2001].
Un altro gene oncosoppressore implicate nella predisposizione all’osteosarcoma e’
p16INK4a, codificato dal gene INK4A, che rientra nell’ampia famiglia dei regolatori del ciclo
cellulare. Esso e’ in grado di indurre un arresto del ciclo in fase G1 attraverso l’inibizione della
chinasi di regolazione delle cicline, la Cdk4. Deleto in circa il 10% degli osteosarcomi, la sua
mancata espressione correla con una diminuita sopravvivenza nei pazienti pediatrici [Kansara et
al., 2007].
C-myc e C-fos sono due proto-oncogeni che giocano un ruolo importante nella
regolazione del ciclo cellulare. Entrambi i geni codificano infatti per fattori trascrizionali che
controllano la progressione del ciclo cellulare e il differenziamento di osteoblasti e condrociti.
Questi geni risultano essere amplificati o over-espressi nelle cellule di osteosarcoma [Barrios H,
1994] [Van den Berg S, 1993]. Sebbene sia chiaro che le alterazioni a carico di oncogeni e geni
onco-soppressori siano coinvolte nella genesi dell’osteosarcoma, non e’ ancora chiaro quale
evento avvenga per primo nella cascata delle alterazioni [Bacci G, 2006].
Nell’osteosarcoma risultano de-regolate molte delle principali vie di segnalazione
cellulare. Le proteine Wnt appartengono ad una famiglia di molecole secrete altamente conservata
che ricoprono un ruolo fondamentale nell’embriogenesi e nella modulazione della proliferazione
cellulare [Logan et al., 2004]. Molte di esse, insieme ad i loro recettori, sono espresse in
precursori dell’osso e l’attivazione della pathway di Wnt è associata allo sviluppo di numerosi tipi
di tumori. La gran parte degli osteosarcomi mostra un’alta espressione citoplasmatica e/o nucleare
di β-catenina [Haydon et al., 2002] e questo sembra correlare con la capacità metastatica. Il 50%
10
Introduzione
dei campioni di osteosarcoma analizzati mostra anche alti livelli del co-recettore LRP5 e la sua
espressione correla significativamente con la comparsa di eventi metastatici [Hoang et al., 2004].
Membri della famiglia TGFβ/BMP giocano un ruolo importante nella regolazione della
crescita cellulare e nello sviluppo [Massague et al., 1998] [Gobbi et al., 2002]. Negli
osteosarcomi, in particolare l’espressione del fattore β3 è maggiore di quella degli altri membri
della famiglia e risulta fortemente correlata alla progressione della malattia [Kloen et al., 1997].
Anche il recettore del fattore di crescita dei fibroblasti, FGF2R, assolve funzioni importanti nello
sviluppo osseo e la mutazione in eterozigosi di questo gene è stata osservata in osteosarcomi di
alto grado [Mendoza et al., 2005]. I fattori di crescita insulino-simili o IGF sono importanti
regolatori della crescita e dello sviluppo osseo che agiscono su specifici recettori di superficie per
attivare proliferazione e differenziamento. L’espressione dei fattori, IGF1 e 2, e del recettore,
IGF1R, è stata identificata in numerose linee cellulari di osteosarcoma ed è funzionalmente
correlata a crescita maligna e invasività. Polimorfismi del gene IGF2R sono stati
significativamente associati a un aumentato rischio di sviluppare osteosarcomi [Savage et al.,
2007] e l’incidenza più alta osservata nelle razze canine è associata a più alti livelli sierici di IGF1
[MacEwen et al., 2004].
Terapia
Fino agli anni ’70 il trattamento dell’osteosarcoma prevedeva solo l’intervento chirurgico
(per lo piu’ risultante in amputazione) o la radioterapia. Sebbene si ottenesse un buon controllo
locale della malattia, la gran parte dei pazienti decedeva in poco tempo a causa delle metastasi,
localizzate in prima istanza a livello polmonare. Con l’impiego della sola chirurgia la
sopravvivenza libera da malattia a 5 anni era del 12% circa. Per questa ragione fu introdotta la
chemioterapia adiuvante e i primi farmaci impiegati con successo furono la Doxorubicina e il
Metotrexate [Campanacci M, 1981] [Enneking WF, 1979] [Rosemburg SA, 1979]. Altri farmaci
utilizzati furono la Vincristina, la Bleomicina e la Dactinomicina, ma il loro impiego fu sospeso a
causa degli scarsi risultati [Meyers PA, 1992]. Attualmente il trattamento dell’osteosarcoma e’
costituito da protocolli che prevedono l’accostamento dell’approccio chirurgico, con interventi
11
Introduzione
conservativi volti all’asportazione della parte lesa e della chemioterapia neoadiuvante, che
contempla l’impiego di terapie farmacologiche pre- e post- operatorie. La chemioterapia preoperatoria si propone di ridurre il volume del tumore primario, diminuendone quindi i margini, e
di valutare la risposta istologica ai chemioterapici. Con la chirurgia viene rimossa la massa
neoplastica e l’ampiezza dei margini di tessuto sano esportato varia a seconda del sottotipo
istologico del tumore primario. La chemioterapia post-operatoria ha l’obiettivo di eradicare invece
le micrometastasi [Campanacci M, 1999]. I farmaci piu’ utilizzati sono l’Adriamicina, il
Metotrexate, il cis-Platino e l’Ifosfamide. Il tasso di mortalita’ associato all’osteosarcoma
risultava molto elevato prima dell’avvento della chemioterapia, ma attualmente la combinazione
dei trattamenti chemioterapici e chirurgici ha consentito di migliorare notevolmente le percentuali di
sopravvivenza, che oggi si aggirano attorno al 65%. Cio’ non toglie che l’individuazione di nuovi bersagli
terapeutici sia necessaria per garantire ulteriori miglioramenti, soprattutto nei pazienti che mostrano
chemioresistenza o che manifestano ricadute locali (35% dei pazienti) o metastai polmonari ( 60% dei
pazienti) [Marina N, 2009]. Uno studio del 2010 mette in evidenza come un recupero precoce dei linfociti
dopo chemioterapia sia indice di un migliore outcome dei pazienti con osteosarcoma [Moore C, 2010].
Inoltre la ricostituzione del sistema immunitario successiva al trasferimento di cellule T naive in modelli
murini di osteosarcoma riduce significativamente le ricorrenze metastatiche [Merchant MS, 2007]. Queste
scoperte hanno messo in evidenza un ruolo importante del sistema immunitario nel controllo
dell’osteosarcoma; pertanto l’immunoterapia, basata sull’up-regolazione della risposta immune dei
pazienti, e’ un’attraente opportunita’ terapeutica per questa patologia.
L’approccio immunoterapico viene utilizzato in due forme: l’immunoterapia attiva con
l’impiego delle citochine e l’immunoterapia passiva o adottiva con l’amministrazione di anticorpi
e terapie cellulari adottive (ACT) [Marina N, 2009]. Nonostante le citochine vengano
ampiamente utilizzate e studiate, il loro impiego in clinica e’ molto limitato a causa dei gravi
effetti collaterali. Una delle molecole impiegate in combinazione ai tradizionali chemioterapici
nella terapia sia contro l’osteosarcoma metastatico sia contro l’osteosarcoma non metastatico e’ il
mifamurtide, un immunomodulatore che agisce attivando macrofagi e monociti [Frampton JE,
2010]. Il suo impiego ha portato ad un aumento della sopravvivenza del 8 e del 13%,
rispettivamente a 5 e 6 anni [Anderson PM, 2010]. Attualmente sono stati sviluppati diversi
anticorpi terapeutici, ma solo pochi di essi sono stati testati sull’osteosarcoma a causa della
complessita’ genetica che contraddistingue questa neoplasia e del fatto che l’osteosarcoma
12
Introduzione
esprime molti recettori di superficie ma solo una minima parte sono caratteristici del tessuto
tumorale e quindi distinguibili da quelli del tessuto normale [Gorlick R, 2003]. Una molecola i cui
effetti sull’osteosarcoma sono stati recentemente dimostrati e’ la baicaleina, un flavonoide
bioattivo largamente utilizzato nella medicina orientale. Zhang e i suoi collaboratori hanno
dimostrato l’effetto antiproliferativo e pro-apoptotico esercitato da questa molecola in cellule di
osteosarcoma, la quale e’ anche in grado di ridurre la capacita’ di adesione, di migrazione e di
invasione delle stesse cellule, indicandone un possibile effetto anti-metastatico e di conseguenza
una nuova prospettiva terapica nel trattamento dell’osteosarcoma [Zhang Y, 2012].
E’ quindi chiara la necessita’ di individuare nuvi bersagli terapeutici e nuove molecole in
grado di superare queste problematiche e la terapia contro IGF-1R potrebbe rappresentare una
valida alternativa da esplorare.
13
Introduzione
OSTEOGENESI
E
DIFFERENZIAMENTO
OSTEOBLASTICO
Aspetti generali
L’osso è un tessuto connettivo specializzato che si caratterizza per la durezza e la
resistenza meccanica [Monesi V, 2008]. Nella sua conformazione si distinguono una parte esterna
più compatta e una interna costituita da tessuto spugnoso, dalla caratteristica struttura trabecolare,
leggera ma in grado di resistere a tensioni elevate. Non si tratta pero’ di una struttura
complessivamente rigida e statica poiché è soggetta ad un continuo rimodellamento e
rinnovamento. Il tessuto osseo assolve diversi compiti: svolge una funzione di sostegno, offre
supporto strutturale ai muscoli scheletrici permettendone il movimento e garantisce protezione
fisica a organi vitali; esso rappresenta un’indubbia riserva di minerali quali calcio e fosfato;
costituisce una continua fonte di cellule staminali emopoietiche per la rigenerazione delle cellule
ematiche e del sistema immunitario.
Morfologicamente si distinguono tre principali tipi di ossa: lunghe, corte e piatte. Le ossa
lunghe sono costituite da un corpo allungato, detto diafisi, e due estremità, chiamate epifisi.
All’interno della cavità diafisaria è presente il midollo osseo. Le pareti della cavità sono formate
da osso compatto. Le epifisi presentano tessuto osseo spugnoso, reso più resistente dalle trabecole
ossee. Le ossa corte hanno invece una forma più o meno cuboide e sono costituite da tessuto
osseo spugnoso ricoperto da un sottile strato di osso compatto. Le ossa piatte si caratterizzano per
la presenza di uno strato di tessuto spugnoso allocato tra due lamine di tessuto compatto. Il
periostio rappresenta il rivestimento superficiale esterno, di natura fibrosa e ampiamente
vascolarizzato.
14
Introduzione
Componente cellulare e matrice
L’osso è costituito da cellule specializzate disperse in un'abbondante matrice
extracellulare. La componente cellulare, parte fondamentale del tessuto osseo, è diretta
responsabile della sintesi dei componenti della matrice ed è rappresentata dagli osteoblasti. Gli
osteoblasti hanno forma tondeggiante e derivano dal differenziamento di cellule osteoprogenitrici,
ossia di cellule staminali mesenchimali già committed verso il lineage differenziativo. In quanto
cellule secernenti, gli osteoblasti sono caratterizzati dalla presenza di un reticolo endoplasmatico
rugoso e di un apparato di Golgi molto estesi e responsabili, dal punto di vista istologico, della
loro basofilia citoplasmatica. Come i fibroblasti (le cellule fondamentali del tessuto connettivo
propriamente detto), gli osteoblasti sono responsabili delle fasi di formazione dell'osso, ossia della
sintesi dei componenti molecolari che andranno poi a costituire sia le fibre che le glicoproteine
della matrice. Questi composti vengono espulsi dalle cellule per esocitosi e successivamente
vengono assemblati nella loro forma definitiva all'esterno della cellula. Completata la sintesi della
matrice e avvenuta la sua calcificazione, gli osteoblasti si allocano in cavità ellissoidali non
mineralizzate scavate nella matrice stessa, dette lacune ossee. In questa fase prendono il nome di
osteociti e, pur restando cellule vitali, entrano in uno stato di quiescenza. Pertanto, gli osteociti
rappresentano come i fibrociti un momento funzionale successivo di una stessa cellula,
caratterizzati da Golgi e reticolo endoplasmatico granulare poco sviluppati. Queste cellule sono
caratterizzate da lunghi prolungamenti citoplasmatici con cui attingono alle sostanze nutritizie
presenti all'interno di microgallerie definite canalicoli ossei: al microscopio elettronico si può
osservare che tra la matrice calcificata e la membrana plasmatica è presente uno spazio occupato
da glicoproteine e liquido interstiziale. I canalicoli possono intersecarsi tra loro consentendo a più
osteociti di entrare in contatto e al liquido interstiziale di giungere a cellule poste lontano dalla
sorgente nutritiva. Gli osteociti posso anche essere controllati dagli osteoblasti, mediante
opportuni segnali, qualora vi sia bisogno di deporre matrice ossea. Avendo recettori di membrana
per l'ormone paratiroideo (PTH), gli osteociti controllano anche l'azione degli osteoclasti. Un’
ulteriore componente cellulare del tessuto osseo e’ rappresentata dagli osteoclasti. Contrariamente
a osteoblasti e osteociti, gli osteoclasti derivano da precursori emopoietici del lineage
monocitario-macrofagico; essi hanno notevoli dimensioni, sono multinucleati, presentano molte
15
Introduzione
estroflessioni e increspature nella membrana plasmatica chiamate orletto a spazzola. Gli
osteoclasti si occupano della produzione e della secrezione di enzimi che agiscono degradando la
matrice calcificata, permettendo cosi’ il riassorbimento dell'osso e collaborando al mantenimento
dell'omeostasi di questo tessuto.
Oltre che dalla componente cellulare, l’osso e’ costituito anche da un’abbondante matrice
di natura proteica prodotta dalle stesse cellule del tessuto e nella quale esse sono intersperse. Tale
matrice proteica presenta una porzione di natura organica, simile a quella degli altri connettivi, e
una componente minerale calcificata. La frazione organica è formata da una componente fibrillare
costituita principalmente da collagene di tipo I. Le fibre di collagene I nell’osso adulto sono
disposte secondo un’organizzazione precisa e ordinata, formando fasci che a loro volta danno
origine a strutture a elica che aumentano la compattezza e la resistenza del tessuto.
L'organizzazione tridimensionale dei fasci di fibre e delle cellule forma strutture lamellari.
Glicoproteine di vario tipo costituiscono il resto della matrice ed hanno per lo più il ruolo di
proteine di adesione; tra esse troviamo la fibronectina, la trombospondina e l'osteopontina,
proteine che hanno il compito di ancorare le cellule alla matrice. Una proteina particolare è
l'osteocalcina, coinvolta nella sintesi del tessuto osseo. L'osteonectina ha invece il compito di
promuovere la mineralizzazione della matrice stessa. A differenza degli altri tipi di connettivo, il
tessuto osseo possiede elementi minerali nella componente matriciale che costituiscono
un’impalcatura dura e compatta, essenziale per le funzioni di sostegno e locomozione proprie
dell'osso. Nei vertebrati il processo di mineralizzazione inizia già durante lo sviluppo embrionale,
ma giunge al completamento solo durate lo sviluppo postnatale; il 65% del peso secco del tessuto
osseo in un individuo adulto e’ rappresentato dalla componente minerale. Essa è costituita
principalmente da calcio, combinato con ossigeno, fosforo e idrogeno a formare la molecola
cristallina detta idrossiapatite (Ca10(PO4)6(OH)2), composto che forma sottili cristalli a forma di
prisma. Le diverse componenti della matrice, organica e minerale, conferiscono proprietà diverse
ed interconnesse al tessuto: la frazione calcificata è responsabile della durezza dell'osso, la
frazione fibrillare è responsabile della flessibilità e dunque della sua resistenza del alla trazione.
16
Introduzione
Processi di ossificazione intramembranosa ed endocondrale
La formazione dell’osso avviene durante lo sviluppo embrionale mediante due distinti
processi. Un piccolo numero di elementi scheletrici, principalmente le ossa cranio-facciali, si
forma grazie all’ossificazione intramembranosa (Fig. 5A). Gli osteoblasti differenziano
dall’interno di un foglietto di tessuto connettivo di cellule mesenchimali condensate e cominciano
a produrre matrice fibrillare, l’osteoide, priva di minerali. Si formano poi le prime trabecole nelle
quali una parte del connettivo derivato dal mesenchima rimane bloccato e differenzia in midollo.
Successivamente la matrice diventa mineralizzata e si organizza a formare l’osso compatto. Gran
parte delle ossa (arti, bacino e colonna vertebrale) viene pero’ generata tramite ossificazione
endocondrale (Fig. 5B). In questo processo i condrociti si differenziano dal mesenchima
condensato e formano uno stampo cartilagineo che prefigura il futuro elemento scheletrico. I
condrociti al centro dello scaffold cessano di proliferare, diventano pre-ipertrofici e maturano in
cellule ipertrofiche caratterizzate dall’aumento di dimensioni, vacuolizzazione e secrezione di
matrice extracellulare. Le cellule mesenchimali che circondano lo stampo di cartilagine si
compattano fino a formare un tessuto condensato multistrato, il pericondrio. Qui le cellule che si
trovano nel versante cartilagineo ricevono dai condrociti pre-ipertrofici un segnale che induce il
programma osteogenico. Nello strato più interno del pericondrio, vicino all’area dei condrociti
ipertrofici, il periostio, comincia cosi’ ad essere depositata matrice ossea. La morte dei condrociti
ipertrofici e l’invasione vascolare portano alla formazione di una nuova area di mineralizzazione,
la spongiosa primaria, all’interno delle diafisi delle ossa lunghe. Il manicotto osseo forma tessuto
compatto lamellare che produce più matrice e si estende a scapito della cartilagine. Mentre la
cartilagine si ritira e il tessuto osseo compatto aumenta, si ha l'allungamento di diafisi ed epifisi.
L'equilibrio finale si raggiunge quando rimane in quantità costante la cartilagine che, dopo l'età di
sviluppo, scompare del tutto. Lo stesso processo si ha anche nelle ossa brevi, ma la cartilagine si
irradia in tutte le direzioni e non solo verso le epifisi.
17
Introduzione
Figura 5. Processi di ossificazione (Hartmann, 2006). A. L’ossificazione intramembranosa
comincia con il differenziamento osteoblastico all’interno della condensazione mesenchimale. Gli
osteoblasti in prima battuta producono una matrice fibrillare non mineralizzata (osteoide) che
comincia a organizzarsi in osso compatto. Gli osteoblasti intrappolati nella matrice ossea
differenziano in osteociti. Gli osteoclasti, cellule del riassorbimento osseo, sono di origine
ematopoietica. B. L’ossificazione endocondrale ha inizio con la formazione di mesenchima
condensato in cui si sviluppano condrociti a costituire un abbozzo cartilagineo in sostituzione
temporanea della struttura ossea. Le cellule mesenchimali che circondano questo abbozzo
formano il pericondrio che consiste in cellule mesenchimali densamente impaccate. Nella zona
del pericondrio adiacente ai condrociti ipertrofici (HTC), i primi precursori degli osteoblasti
differenziano dopo aver ricevuto un segnale dai condrociti pre-ipertrofici e ipertrofici. Questa
regione è nota anche come periostio. Gli osteoblasti secernono una matrice non mineralizzata
fibrillare che infine si organizza in osso compatto mineralizzato. Il manicotto osseo e l’osso
trabecolare sono di natura compatta. Durante il deposito dell’osso, gli osteoblasti rimangono
intrappolati nella matrice ossea e differenziano in osteociti; la matrice viene, poi, riassorbita dagli
osteoclasti. Questi sono necessari per la produzione dell’architettura cava delle ossa dei vertebrati
e la loro attività è importante per il rilascio di minerali come calcio e fosfato.
18
Introduzione
Cellule del lineage osteoblastico: sviluppo osseo e
differenziamento
Il processo di ossificazione intramembranosa viene finemente regolato ed è innescato
dall’espressione coordinata di un ampio numero di fattori che dettano l’organizzazione spaziale e
temporale delle cellule osteogeniche [Thomas et al., 2006] [Lian et al., 2004].
Il processo differenziativo ha inizio a partire da cellule staminali mesenchimali localizzate
nello stroma del midollo osseo che, dopo un iniziale commitment, vanno incontro a una fase di
espansione. La divisione iniziale è asimmetrica, da’ origine a un’altra cellula staminale (selfrenewal) e ad un osteoprogenitore committed. In seguito al commitment, la cellula staminale attiva
un compartimento di amplificazione associato a un’intensa attività proliferativa.
Inizia poi la maturazione della matrice; in questa fase si ha la multistratificazione cellulare
degli osteoblasti e il deposito della matrice di collagene che contribuisce al blocco della
proliferazione attivando cascate di segnalazione tramite interazioni cellula-cellula e cellulamatrice. Viene cosi’ indotta l’espressione di geni specifici. Gli osteoblasti maturi esprimono
fosfatasi alcalina (ALP), collagene e sialoproteine, si localizzano in posizione adiacente
all’osteoide di nuova produzione e sono caratterizzati da un limitato potenziale proliferativo [Stein
G, 1996]. L’ultima fase dell’osteoblastogenesi porta all’inizio del differenziamento terminale e la
permanente uscita dal ciclo cellulare delle cellule interessate. Nella matrice inizia il deposito di
minerali e la mineralizzazione è segnata dall’up-regolazione di geni indicatori, quali
l’osteopontina e l’osteocalcina. In questo contesto, l’osteocita si sviluppa durante l’impaccamento
degli osteoblasti nell’osso mineralizzato. I meccanismi che portano ai cambiamenti morfologici
dall’osteoblasto cuboide all’osteocita stellato restano ancora oggi poco noti. Le cellule che non
differenziano in osteociti possono trasformarsi in lining cells che rimangono sulla superficie ossea
inattive, proteggendo la matrice dagli osteoclasti e possono essere riattivate dagli stessi osteociti,
grazie ai processi dendritici intracanalicolari, in caso della necessita’ di riparazione dei
microdanni che si verificano nello scheletro. L’apoptosi rappresenta un’alternativa al processo di
differenziamento [Jilka RL, 1998]. Il 70% circa degli osteoblasti segue questo percorso
alternativo il cui ruolo consiste molto probabilmente nell’eliminare l’eccesso di cellule che non
19
Introduzione
sono necessarie né come osteociti né in qualità di lining cells, intervenendo nel regolare
l’omeostasi del tessuto.
L’analisi del processo differenziativo mette in luce la proporzionalità inversa esistente tra
proliferazione e differenziamento.
Controllo trascrizionale e segnali per il differenziamento
Le fasi dell’osteoblastogenesi, il commitment, la maturazione e la mineralizzazione, sono
interamente regolate da una interconnessione finemente controllata di segnali di sviluppo,
proteine, fattori di trascrizione e loro co-regolatori per indurre l’espressione di geni specifici e
l’acquisizione del fenotipo osteoblastico [Komori T, 2006]. I regolatori trascrizionali piu’
importanti sono stati identificati (Fig. 6).
Figura 6. Controllo del differenziamento osteoblastico mediato dai fattori di trascrizione (Marie,
2008).
20
Introduzione
Runx2 e’ stato identificato come il principale elemento di controllo del commitment e del
differenziamento osteoblastico [Komori T, 1997] [Otto F, 1997]. Membro della famiglia dei
fattori di trascrizione Runt, presenta questo tipo di dominio richiesto per il legame con il DNA e
per la dimerizzazione con la subunità β; Runx2 costituisce infatti la subunità α di un fattore
trascrizionale eterodimerico che forma insieme a CBFβ. Nei mammiferi esistono tre differenti
geni codificanti per la subunità α: Runx1, Runx2 e Runx3, che svolgono un ruolo fondamentale
rispettivamente nell’ematopoiesi, nell’osteoblastogenesi e nello sviluppo neuronale oltre che nella
regolazione della crescita delle cellule epiteliali gastriche; un solo un gene, CBFβ, codifica per la
subunità β [Blyth K, 2005]. In quanto membro della famiglia di fattori trascrizionali Runx, Runx2
si lega ad una specifica sequenza consenso (PuACCPCA), denominata elemento specifico
osteoblastico (OSE), che si trova nei promotori di gran parte dei geni osteoblastici, tra cui
osteopontina, collagene di tipo I e osteocalcina, controllandone l’espressione e quindi l’instaurarsi
del fenotipo osteoblastico. Runx2 è infatti presente negli osteoblasti durante tutto il processo
differenziativo. Esso viene espresso nelle cellule mesenchimali all’inizio dello sviluppo
scheletrico, tanto che cellule Runx2 -/- possono potenzialmente differenziare in adipociti e
condrociti [Kobayashi H, 2000], confermando l’estrema importanza di Runx2 nelle cellule
mesenchimali ai fini del programma osteogenico. Questo fattore possiede tutte le proprietà per
essere definito un fondamentale fattore nell’osteogenesi. La sua espressione in cellule non
osteoblastiche è sufficiente per indurre l’espressione di numerosi geni osteoblasto-specifici, quali
l’osteocalcina [Ducy P, 1997]. Inoltre topi knock out per Runx2 mostrano una completa assenza
di ossificazione intramembranosa ed endocondrale per la mancanza di differenziamento delle
cellule mesenchimali in osteoblasti [Komori T, 1997].
Il funzionamento di Runx2 e’ complicato tanto quanto i meccanismi che contribuiscono
alla sua regolazione. La sua localizzazione subnucleare contribuisce certamente al controllo
dell’osteogenesi. Topi con una delezione in omozigosi nella sua porzione C-terminale non
generano osso a causa di un arresto nella maturazione degli osteoblasti [Choi JY, 2001]; a causa
della mutazione presente viene a mancare un segnale di indirizzamento alla matrice nucleare. La
forma tronca di Runx2 penetra nel nucleo, conserva una normale capacità di legame al DNA, ma
ha completamente perso il suo homing intranucleare che risulta quindi essere fondamentale per la
sua completa attività trascrizionale. Runx2 interagisce con numerose proteine regolatorie a livello
del nucleo, portando all’attivazione o repressione di geni che controllano il programma di
21
Introduzione
proliferazione e differenziamento osteoblastico. Nonostante questo suo importante ruolo nel
commitment osteoblastico, Runx2 non sembra essere essenziale per il mantenimento
dell’espressione dei geni responsabili della produzione delle principali proteine di matrice negli
osteoblasti maturi [Maruyama Z, 2007]. Topi iper-esprimenti Runx2 esibiscono un fenotipo
osteopenico, a causa di un ridotto numero di osteoblasti maturi [Liu W, 2001], indicando come
Runx2 possa agire anche come repressore, regolando negativamente le fasi terminali del
differenziamento osteoblastico.
L’attività di Runx2 e’ a sua volta regolata da numerosi fattori trascrizionali che agiscono
nelle interazioni proteina-DNA e proteina-proteina. Trascrizionalmente, Runx2 è controllato da
Hoax2, membro dei fattori di trascrizione Hox contenenti un omeodominio, che regola la
segmentazione scheletrica. Hoxa2 inibendo l’espressione di Runx2, inibisce anche la formazione
d’osso, mentre l’inibitore di Hoxa2, SATB2, ne attiva l’espressione [Dobreva G, 2006]. Sox8,
regolatore della crescita ossea appartenente alla famiglia Sox, è un altro inibitore trascrizionale di
Runx2, come dimostrato dall’osteoporosi che presentano topi transgenici in seguito
all’espressione forzata di Sox8 negli osteoblasti [Schmidt K, 2005]. Anche Sox9, principale
coordinatore del differenziamento condrogenico, interagendo con Runx2, ne blocca l’attività
trascrizionale [Zhou G, 2006]. TLE2, un omologo nei mammiferi della proteina Groucho di
Drosophila, viene espresso negli osteoblasti e inibisce l’attività trascrizionale di Runx2
interagendo con la sua regione C-terminale [Thirunavukkarasu K, 1998].
Molto interessante è l’opposta attività regolatoria che esercitano su Runx2 p53 ed Rb. p53
regola negativamente Runx2 [Lengner CJ, 2006] mentre Rb funziona da coattivatore
trascrizionale, promuovendo il processo di differenziamento osteoblastico [Thomas DM, 2001].
Anche meccanismi post-trascrizionali possono contribuire alla regolazione della funzione di
Runx2, che può essere fosforilato e attivato da MAP chinasi [Xiao G,2000] dopo il legame del
collagene di tipo I all’integrina α2β1 sulla superficie degli osteoblasti, mentre la pathway
dell’AMP ciclico porta a una riduzione dei livelli di Runx2 nella popolazione osteoblastica,
attraverso una sua degradazione ubiquitina-dipendente [Tintut Y, 1999]. La degradazione da parte
del proteasoma è un altro meccanismo di controllo della funzione di Runx2. L’ubiquitina ligasi
Smurf1 interagisce con il motivo PY nel C-terminale di Runx2 promuovendone la degradazione
proteosomale [Zhao M, 2004]. La proteina Schnurri-3 controlla i livelli proteici di Runx2,
22
Introduzione
promuovendone la degradazione attraverso l’ubiquitina ligasi WWP1; la delezione di Schnurri-3,
in modelli murini, risulta in un incremento della massa ossea [Jones RA, 2006]. In ultima analisi,
Runx2 prende contatti anche con proteine ad attività istone acetiltransferasi, come p300,
consentendo un preciso controllo del differenziamento anche dal punto di vista epigenetico,
mantenendo un idoneo bilanciamento tra cromatina acetilata e deacetilata; Runx2 interagisce
inoltre con le istone deacetilasi (HDACs) che costituiscono un’importante classe di regolatori
negativi dell’osteoblastogenesi [Westendorf JJ, 2006].
Oltre a Runx2, un ulteriore regolatore del differenziamento osteoblastico che merita
attenzione è Osterix (Osx). E’ un fattore di trascrizione a dita di zinco, specificatamente espresso
negli osteoblasti di tutti i segmenti scheletrici [Nakashima K., 2002]. A differenza dei topi KO per
Runx2, il cui scheletro è interamente non mineralizzato, i topi Osx-deficienti mancano di una
matrice mineralizzata solamente nelle ossa derivate da processi di ossificazione intramembranosa,
mostrando una matrice mineralizzata che ricorda la cartilagine calcificata, ma non la matrice
ossea. Questi risultati mostrano come Osterix, a differenza di Runx2, non sia richiesto per
l’induzione dell’ipertrofia dei condrociti rivelando il suo esclusivo coinvolgimento nel
differenziamento osteoblastico e nella formazione di osso in vivo. Studi di ibridazione in situ
hanno consentito di individuare una relazione gerarchica tra i due fattori. Mentre Osx non è
espresso in embrioni Runx2-deficienti, Runx2 è presente in embrioni privi di Osx. Ciò dimostra
che Osx agisce a valle di Runx2 nella cascata trascrizionale del differenziamento osteoblastico e
che la sua espressione può essere direttamente regolata dal legame di Runx2 a un elemento di
risposta presente nel promotore di Osx [Nishio Y., 2006]. A differenza di Runx2, non è stata
identificata nell’uomo alcuna mutazione del gene Osx associata a una diminuzione della
formazione di osso. L’azione molecolare del funzionamento di Osx negli osteoblasti è
decisamente molto meno conosciuta. Osx è stato recentemente identificato in un complesso con il
fattore nucleare NFAT (Nuclear Factor of Activated T cells) con la funzione di attivatore del
promotore del collagene di tipo I [Koga T, 2005] nella regolazione di una delle vie non canoniche
di Wnt. p53 è stato identificato come un repressore trascrizionale di Osx, confermando il suo
ruolo di antagonista nel processo di differenziamento osteoblastico [Wang J, 2006]. Studi genetici
hanno evidenziato l’importanza della via di Wnt nel controllo della formazione ossea [Hartmann
C, 2006]. L’interazione delle proteine Wnt con i recettori Frizzled e i co-recettori LRP 5/6
portano all’inibizione della fosforilazione della β-catenina mediata dalla GSK-3, risultando in un
23
Introduzione
accumulo della stessa e in una sua traslocazione nucleare. In questa sede si lega ai fattori di
trascrizione LEF/TCF attivando i geni sotto il suo controllo. L’inattivazione della β-catenina
arresta il differenziamento degli osteoblasti a partire dai progenitori mesenchimali, sostenendo un
suo ruolo nel differenziamento osteoblastico. Uno dei bersagli del signalling di Wnt è proprio
Runx2 dato che la β-Catenina complessata a TCF1 promuove l’espressione di Runx2 e la sua
attività [Gaur T, 2005]. Una delle proteine Wnt, Wnt10b, è stata descritta come coinvolta
nell’induzione di espressione di Runx2, Osx e Dlx5, e capace di ridurre, per contro, fattori di
trascrizione adipogenici come C/EBPα e PPAR γ nei topi, indicando, ancora una volta che il
controllo dell’osteoblastogenesi si estrinseca su più bersagli e a più livelli.
Un altro fattore che sembra intervenire nelle fasi tardive del processo differenziativo è
ATF4. Topi ATF4-deficienti mostrano uno sviluppo scheletrico ritardato associato ad una
diminuzione della massa ossea. A livello molecolare, ATF4 è stato identificato come il fattore che
si lega a un elemento specifico degli osteoblasti nel promotore dell’osteocalcina [Ducy P, 1995].
ATF4 sembra regolare la formazione dell’osso regolando la produzione del collagene di tipo I.
ATF4 può poi essere fosforilato dalla chinasi Rsk2, controllando l’importazione amminoacidica
negli osteoblasti; l’inattivazione di Rsk2 porta allo sviluppo della sindrome di Coffin-Lowry,
evidenziando che il diminuito livello di fosforilazione di ATF4, in assenza di Rsk2, potrebbe
essere responsabile delle anomalie scheletriche associate a questa sindrome [Yang X, 2004].
AP1 è un fattore trascrizionale composto da proteine eterodimeriche delle famiglie Jun (cJun, JunB e JunD) e Fos (c-Fos, FosB, Fra-1, Fra2). c-Fos è stato il primo membro di questa
famiglia riconosciuto come regolatore del differenziamento osteoblastico: la sua delezione nei
topi porta alla nascita di animali con grave osteopetrosi, mentre la sua iperespressione e’ coinvolta
nello sviluppo dell’osteosarcoma [Grigoriadis AE, 1995]. Altre proteine della famiglia AP1 sono
coinvolte nel controllo del programma osteogenico: la sovraespressione di Fra1 promuove il
differenziamento, con un conseguente incremento della massa scheletrica dovuta all’aumentato
numero di osteoblasti; la delezione di JunB si traduce fenotipicamente in una ridotta crescita
ossea [Jochum W, 2000] [Kenner L, 2004]. Numerosi fattori trascrizionali appartenenti alla
famiglia delle proteine con omeodominio, Msx1, Msx2, Dlx5, Dlx6, intervengono nel processo di
differenziamento osteoblastico. Una mutazione attivante di Msx2 è responsabile della
craniosinostosi di tipo Boston, caratterizzata da un incremento della formazione d’osso attorno
24
Introduzione
alla sutura craniale [Ma L, 1996], mentre l’inattivazione di Msx2 porta, nel topo, a un ritardo
dell’ossificazione, associata ad un decremento dell’espressione di Runx2 [Satokata I, 2000].
Msx2 viene espresso prevalentemente in cellule osteoprogenitrici, dove promuove la
proliferazione e il differenziamento delle cellule mesenchimali ma, poiché inibisce l’attività di
Runx2 e di altri geni osteoblasto-specifici in osteoblasti maturi [Shirakabe K, 2001], potrebbe
avere un ruolo specifico anche nella fase precoce del differenziamento. Proteine espresse in tutti
gli stadi del differenziamento osteoblastico sono Dlx3 e Dlx5, che risultano però maggiormente
espresse negli osteoblasti maturi; Dlx3 svolge un ruolo complesso, agendo sia come regolatore
negativo che positivo della trascrizione dell’osteocalcina [Hassan MQ, 2004]. Dlx5 è, invece, in
grado di attivare l’espressione di Runx2 e di alcuni marcatori del differenziamento, quali le
sialoproteine e l’osteocalcina [Holleville N, 2007]. Il ruolo delle altre proteine Dlx è ancora
sconosciuto.
L’induzione del fenotipo osteoblastico richiede che i fattori trascrizionali che agiscono
come repressori della fase di maturazione vengano down-regolati. Due esempi sono le proteine Id
e Twist, appartenenti alla famiglia elica-giro-elica, che risultano essere altamente espresse durante
la fase proliferativa nei pre-osteoblasti, per poi essere represse durante il differenziamento.
L’espressione di Runx2 è associata alla repressione di Twist [Bialek P, 2004], mentre
l’aploinsufficienza di Twist induce una fusione precoce della sutura craniale dovuta ad un
prematuro differenziamento osteoblastico [Yousfi M, 2001].
Alcuni fattori trascrizionali rivestono un duplice ruolo nel differenziamento, agendo non
solo in quello osteoblastico, ma anche in quello adipocitico. PPAR γ2 (Peroxisome ProliferationActivated Receptor γ2) è coinvolto in entrambi i processi, agendo sulle cellule mesenchimali
come repressore dell’osteogenesi e come induttore dell’adipogenesi. La sua delezione nei topi
promuove il differenziamento osteoblastico e incrementa la massa ossea [Akune T, 2004]; PPAR
γ2 potrebbe agire legandosi a Runx2 e inibendone l’attività trascrizionale [Jeon MJ, 2003]. La
famiglia dei fattori trascrizionali C/EBPs (CCAAT/Enhancer-Binding Proteins) è anch’essa
implicata nella regolazione dello sviluppo osteoblastico e adipocitico. C/EBPδ modula
l’espressione e l’attività di fattori di crescita coinvolti nell’osteogenesi; C/EBPδ e C/EBPβ
attivano la trascrizione dell’osteocalcina, agendo in sinergia con Runx2 [Gutierrez S, 2002].
25
Introduzione
Controllo dei fattori trascrizionali osteoblasto-specifici
I fattori trascrizionali che intervengono nella regolazione dell’osteoblastogenesi sono
numerosi, di conseguenza il controllo della loro funzione ha un’importanza fondamentale ai fini
della corretta progressione del processo di differenziamento osteoblastico. Nei processi di
generazione ossea sono coinvolti molti fattori ormonali.
Gli estrogeni e i glucocorticoidi sono stati recentemente identificati come stimolatori
dell’osteoblastogenesi agendo sull’attivazione di Runx2 e sui geni più a valle. Anche l’ormone
della crescita è in grado di modulare l’attività trascrizionale di Runx2 nella popolazione
osteoblastica promuovendone un’interazione inibitoria con la proteina STAT3β. L’ormone
paratiroideo (PTH) promuove la formazione d’osso in parte attraverso l’attivazione di Runx2,
regolandone la fosforilazione o contribuendo ad inibirne la degradazione proteosomale. Il PTH
aumenta l’espressione di Osx e riduce quella di PPAR γ2 in cellule osteoprogenitrici
indirizzandole verso il lineage osteoblastico. La vitamina D mostra un meccanismo d’azione
simile a quello appena descritto, agendo su Runx2 e PPAR γ2.
L’osteoblastogenesi è trascrizionalmente regolata da molti fattori di crescita [Hughes et
al., 2006]. Questi sono proteine solubili, quindi la loro modalità d’azione prevede l’interazione
con recettori localizzati sulla superficie cellulare, influenzando funzioni critiche quali divisione,
sintesi di matrice e differenziamento. Il fattore di crescita trasformante β (TGF-β) appartiene a
una superfamiglia di proteine che regolano sia la proliferazione che il differenziamento. La
maggior parte delle cellule risponde in modalità autocrina al TGF-β, ma alti livelli sono stati
individuati nell'osso, nelle piastrine e nella cartilagine [Janssens et al., 2005]. In seguito ad
attivazione, il TGF-β interagisce con recettori serin-treonin chinasici, attivando le proteine Smad.
Nelle fasi iniziali del differenziamento il TGF-β agisce nel reclutamento e nella stimolazione delle
cellule osteoprogenitrici che induce a proliferare per formare la popolazione osteoblastica. Nelle
fasi terminali il TGF-β ricopre, invece, un ruolo inibitorio, bloccando la mineralizzazione della
matrice. Appartengono alla famiglia del TGF- β anche le proteine morfogeniche dell’osso, le
BMPs. Queste proteine sono importanti regolatori della crescita, del differenziamento, della
migrazione e dell’apoptosi, così come dello sviluppo e della funzionalità di molti organi e tessuti
quali osso, cartilagine, cuore, cervello, pelle e reni [Chen et al., 2004]. E’ stato valutato l’utilizzo
26
Introduzione
terapeutico di queste proteine nel trattamento delle patologie ossee. Esistono più di 20 BMPs, con
diversa attività biologica, ma il loro meccansismo d’azione è simile: si basa sull’interazione con
due tipologie di recettori serin-treonin chinasici a diversa affinità. I recettori attivati trasmettono
un segnale intracellulare che converge nella cascata degli Smad. L’effetto principale delle BMP
viene esercitato sulle cellule mesenchimali indirizzandole verso l’osteoblastogenesi mediante
l’attivazione di fattori trascrizionali quali Runx2, Osx e Dlx5 [Nakashima et al., 2002]. I fattori di
crescita fibroblastici (FGF) sono una famiglia di polipeptidi che svolgono un ruolo fondamentale
nell’angiogenesi e nella mitogenesi delle cellule mesenchimali. Il fattore di crescita fibroblastico
si lega a recettori tirosin chinasici (FGFR) attivando la via di segnalazione mediata dalle MAP
chinasi. Le mutazioni di questi recettori sono associate ad anomalie nei processi di ossificazione e
mutazioni attivanti FGFR2 sono state identificate in numerose sindromi di craniosinostosi [Ornitz
et al., 2002]. Sebbene gli FGFs siano coinvolti nello sviluppo osseo, non ne e’ ancora stato
chiarito il ruolo a livello molecolare.
Anche il sistema IGF sembra avere un ruolo fondamentale ai fini dell’osteoblastogenesi
cosi’ come dell’omeostasi dell’osso. Tuttavia non sono ancora stati individuati tutti i bersagli
cellulari e i meccanismi molecolari responsabili del suo funzionamento [Clemens et al., 2004].
IGF-1 e IGF-2 sono tra i fattori di crescita maggiormente prodotti dalle cellule dello scheletro e
dagli osteoblasti in vitro. Essi sono coinvolti sia nelle fasi di proliferazione dei precursori degli
osteoblasti negli stadi differenziativi precoci che nelle fasi più avanzate, durante il deposito di
matrice. In particolare, IGF-1 interviene nelle fasi precoci del differenziamento osteoblastico,
aumentando la trascrizione del collagene di tipo I e successivamente contribuendo al
mantenimento di adeguati livelli di matrice ossea [Canals E, 2009].
Osteosarcoma e differenziamento osteoblastico
Sebbene gli osteosarcomi mostrino varie alterazioni genetiche e molecolari, buona parte di
esse non viene rilevata nella maggioranza di queste neoplasie. Data la precoce età di insorgenza, è
poco probabile che la trasformazione tumorale sia associata all’accumulo sequenziale di eventi
mutazionali come avviene invece nei carcinomi. Alcuni studi ridefiniscono l’osteosarcoma come
una patologia legata al differenziamento, nella quale i cambiamenti di natura genetica ed
27
Introduzione
epigenetica interrompono il normale andamento del processo differenziativo a partire dalle cellule
staminali mesenchimali (Fig. 7).
Figura 7. La de-regolazione del differenziamento osteoblastico, dovuta a cambiamenti genetici o
epigenetici, potrebbe portare all’insorgenza di osteosarcomi. Difetti negli stadi precoci possono
portare allo sviluppo di osteosarcomi meno differenziati e più aggressivi e viceversa. Le cellule in
nero rappresentano le cellule iniziatrici del tumore [Tang et al., 2008].
E’ plausibile che per un sottogruppo degli osteosarcomi le cellule che danno inizio allo sviluppo
tumorale presentino aspetti comuni agli osteoprogenitori committed dato che molti dei marcatori
precoci, come la fosfatasi alcalina, e la capacità di produrre matrice ossea vengono conservati
[Campanacci M, 1999]. A supporto di questa ipotesi si pone l’elevata frequenza di questi tumori
durante l’adolescenza in cui la rapida crescita e l’attivo rimodellamento dello scheletro sono
indice dell’intensa attività osteoblastica. La tumorigenesi può coinvolgere una de-regolazione
della capacità proliferativa da parte delle cellule tumorali staminali che danno origine a una
progenie osteoblastica differenziata in modo aberrante [Gibbs et al., 2005]. Le somiglianze tra le
28
Introduzione
cellule staminali e quelle trasformate sono rilevanti dato che entrambe mostrano capacità di autorinnovamento, esprimono la telomerasi e si trovano a uno stadio indifferenziato. Una piccola
popolazione di cellule tumorali di osteosarcoma si è mostrata in grado di formare colonie sferiche
in sospensione e le stesse cellule esprimono marcatori di cellule staminali embrionali come Nanog
e Oct 3/4. Dato il ruolo di Runx2 come mediatore trascrizionale cardine dell’osteoblastogenesi
indispensabile per l’espressione dei geni associati al differenziamento osteoblastico, e’ plausibile
che anomalie nella sua regolazione possano giocare un ruolo importante nello sviluppo
dell’osteosarcoma. Negli ultimi anni il legame tra differenziamento osteoblastico ed osteosarcoma
è diventato più chiaro ma resta ancora da chiarire, tuttavia ne restano da chiarire i mediatori
molecolari ed i meccanismi.
29
Introduzione
IL SISTEMA IGF
Il ruolo dei fattori di crescita nella patogenesi delle neoplasie umane è ben documentato.
Diversi studi suggeriscono la dipendenza delle neoplasie dai fattori di crescita e dai loro recettori
[Baserga R, 1994]. Tra questi, il sistema dei fattori di crescita insulino-simili (IGF) e la via di
segnalazione mitogenica da essi regolata sembrano avere particolare importanza. Il sistema IGF,
infatti, risulta essere coinvolto nella crescita e nella proliferazione cellulare, poichè ha un ruolo
fondamentale nella progressione dala fase G1 alla fase S del ciclo cellulare.
Il sistema IGF è composto dai due ligandi IGF-1 e IGF-2 e da tre recettori di membrana: il
recettore di IGF-1 (IGF-1R), il recettore di IGF-2 (IGF-2R) e il recettore insulinico (IR). Esistono
poi 6 proteine che legano IGF con alta affinità, le IGF-Binding Proteins (IGFBP-1, -2, -3, -4, -5, 6).
Figura 8. Componenti chiave della via di segnalazione di IGF-1R (Zha J, 2010).
30
Introduzione
I ligandi
I fattori di crescita insulino-simili 1 e 2 (IGF-1 e 2) sono piccoli polipeptidi appartenenti
ad una famiglia di proteine strettamente correlate che comprendono anche l’insulina. L’insulina
viene prodotta principalmente dalle cellule β-pancreatiche e tramite il sistema circolatorio
raggiunge i vari tessuti dove esplica il proprio effetto. L’IGF-1 circolante è prodotto
principalmente nel fegato in risposta alle stimolazioni ormonali; IGF-2 viene prodotto in età fetale
da una grande varietà di tessuti, mentre nell’individuo adulto si trova prevalentemente come
molecola circolante e può essere over-espresso da cellule neoplastiche [Furstenberger G, 2002].
Oltre che dal fegato IGF-1 e IGF-2 vengono prodotti anche da altri tessuti, quali il muscoloscheletrico, l’osso e la cartilagine. Il cambiamento della concentrazione sanguigna di tali fattori
dipende comunque dalla sintesi e secrezione epatica, responsabile di circa l’80% dell’IGF-1
presente nel siero.
La regolazione della produzione di IGF-1 a livello epatico è complessa e l’ormone della
crescita (GH) riveste un ruolo importante in questo processo, dirigendo l’aumento
dell’espressione del gene IGF-1 nel fegato. A sua volta, la regolazione della produzione di GH
avviene ad opera dell’ipofisi sotto lo stimolo dei fattori ipotalamici somatostatina e ormone di
rilascio della somatotropina (GHRH), che rispettivamente ne reprimono e inducono il rilascio.
All’interno di osso, tessuto muscolo-scheletrico e cartilagine, IGF-1 può avere sia funzione
autocrina, legando e stimolando la crescita delle stesse cellule che l’hanno prodotto, oppure
funzione paracrina, legandosi ai recettori delle cellule vicine quali le cellule epiteliali che
normalmente non lo producono. L’espressione di IGF-1 varia in relazione all’età dell’individuo,
aumentando dalla nascita alla pubertà e mostrando un progressivo decremento a partire dall’età
adolescenziale; IGF-1 svolge quindi un ruolo importante nella regolazione della crescita dei
tessuti mesenchimali, compresi il tessuto osseo e la cartilagine.
A differenza di quanto avviene per IGF-1, IGF-2 viene prodotto anch’esso dal fegato ma
non subisce una regolazione di tipo ormonale; la sua produzione viene regolata dall’imprinting
genomico ed è dettata dall’espressione del solo allele paterno. Inoltre, il livello di espressione di
IGF-2 è pressocchè costante durante la vita e risulta essere superiore di circa 7 volte rispetto ai
livelli di IGF-1 [Krassas et al.,2003].
31
Introduzione
Le IGFBPs
La biodisponibilità di entrambi i ligandi IGF-1 e IGF-2 viene modulata anche dal loro
legame alle IGFBPs, che ne prevengono così la degradazione e ne aumentano l’emivita. Il legame
tra I fattori IGF e le IGFBP può essere scisso da una famiglia di proteine dette IGFBP-proteasi
[Zha J, 2010]. La famiglia di proteine cui appartengono le IGFBPs mostra due caratteristiche
chiave: sono ricche in cisteine e possiedono una struttura terizaria che ne consente il legame con
IGF ad alta affinità. Tra le IGFBPs IGFB-3 è quella predominante nel siero e IGF-1 ed IGF-2
sono prevalentemente legate ad essa in un complesso ternario con la subunità ALS (acid-label
subunit), una glicoproteina di 85kDa sintetizzata dal fegato, in un rapporto molare di 1:1:1. La
concentrazione di IGF-1 libero nel sangue è meno dell’1% della concentrazione totale, pertanto la
formazione di questo complesso ternario fa si che la maggior parte dell’IGF-1 e IGF-2 secreti
siano presenti come riserva stabile [Frystyk et al., 2004]. Anche IGFBP-5 forma lo stesso tipo di
struttura con ALS e i ligandi del sistema IGF. Mentre le IGFBPs da 1 a 4 mostrano la stessa
affinita’ per IGF-1 e IGF-2, IGFBP-5 e IGFBP-6 hanno una affinità rispettivamente 10 e 100
volte superiore per IGF-2 rispetto ad IGF-1. Le proteine IGFBPs non legano l’insulina. Queste
proteine controllano l’azione dei fattori IGF aumentandone l’emivita e controllandone la
disponibilità per il legame con i recettori. Ognuna delle IGFBPs è soggetta e potenzialmente
regolata dalla proteolisi effettuata da diverse proteasi. Pertanto le interazioni ligando-recettore nel
sistema IGF sono soggette a complessi meccanismi di regolazione come risultato dei livelli di
IGFBPs, del loro profilo di espressione, del grado di associazione alla superficie cellulare e
certamente della regolazione proteolitica [Clemmons D.R., 2001]. Una serie di studi ha stabilito
che alcune azioni delle IGFBPs sono IGF-indipendenti. In particolare, IGFBP-3 e IGFBP-5 hanno
mostrato avere effetti sulla proliferazione, la migrazione e la sensibilità all’apoptosi
indipendentemente dai loro effetti sul signaling di IGF. Alcuni di questi effetti IGF-indipendenti
vengono comunque indirettamente modulati dal legame dei fattori IGF alle IGFBPs; le molecole
della superficie cellulare e/o intracellulari che partecipano all’esplicarsi di questi effetti non sono
ancora state ben caratterizzate, ma l’esposizione a IGFBP-3 e 5 ricombinanti esogeni ha indotto la
localizzazione nucleare di tali proteine. Una migliore caratterizzazione delle azioni IGFindipendenti delle IGFBPs metterebbe in luce una nuova dimensione nella comprensione del
signaling di IGF in generale.
32
Introduzione
Il Recettore per IGF-1 (IGF-1R)
Il recettore IGF-1R è un recettore tirosin-chinasico (RTK) eterodimerico composto da due
subunità α e due subunità β. Sia IGF-2 che IGF-2 sono in grado di indurre la clusterizzazione e
l’autofosforilazione del recettore, portando all’attivazione della via di segnalazione sottostante. Al
contrario, il recettore IGF-2R, conosciuto anche come recettore del mannoso-6-fosfato, non
sembra in grado di regolare questo signaling, assolvendo solo alla funzione di sequestrare l’IGF-2
circolante, regolandone i livelli attraverso un’endocitosi recettore-mediata che porta alla
degradazione di IGF-2 mediata dai lisosomi [Braulke T, 1999]. IGF-1R mostra un’omologia
dell’84% con il dominio chinasico del recettore insulinico IR. Inoltre l’isoforma A di questo
recettore (IR-A) è in grado di legare IGF-2 con alta affinità e di mediare il signaling mitogenico e
di sopravvivenza cellulare [Sciacca L, 2002]. IGF-1R è in grado di formare anche eterodimeri con
il recettore insulinico, mostrando attività molto simile a quella del recettore omodimerico
[Pandini G, 1999].
Una volta attivato dal legame con IGF-1, IGF-1R recluta ed attiva proteine adattatrici che
portano alla regolazione di diversi processi cellulari, sia fisiologici, sia patologici. IGF-1R è
infatti in grado di stimolare la proliferazione, la crescita cellulare, il differenziamento e di inibire
il processo apoptotico, nonchè di indurre la trasformazione neoplastica.
Andando più in dettaglio, dopo il legame con IGF-1, IGF-1R subisce la fosforilazione
delle 3 tirosine del dominio tirosina chinasico, cui segue la fosforilazione di una tirosina della
regione juxtamembrana, la tirosina 950. Tale tirosina viene utilizzata come punto di ancoraggio
per numerosi substrati, tra cui i più importanti sono le proteine IRSs (Insulin receptor substrates) e
Shc, che legano la tirosina fosforilata attraverso il dominio PTB (Phosphotyrosine Binding).
Alcuni studi suggeriscono come l’attivazione di IRS-1 sia principalmente richiesta per un segnale
di tipo mitogenico, mentre IRS-2 giochi un ruolo chiave nella motilità cellulare [Byron SA, 2006].
La via di segnalazione mediata da IRS-1 e quella mediata da Shc sono le principali vie di
trasmissione del segnale regolate da IGF-1R.
Il reclutamento delle proteine IRS1-4 presso il recettore porta alla fosforilazione di uno o
più residui specifici che fungono poi da punti ti attacco per le proteine contenenti i domini SH2
33
Introduzione
(Src-homology 2), come PI3-K (phosphoinositide-3-kinase); in particolare legano la subunità
regolatoria di PI3-K, p85. Il legame con p85 favorisce la traslocazione della subunità catalitica
p110 sulla membrana cellulare, dove andrà a fosforilare il fosfatidilinositolo-(4,5)-bisfosfato
(PIP2) in fosfatidilinositolo-(3,4,5)-trifosfato (PIP3). Questo evento consente il reclutamento della
proteina chinasi B (AKT) e della proteina ribosomiale p70 S6 chinasi. AKT viene reclutata presso
la membrana grazie all’interazione tra PIP3 e il suo dominio PH (plekstrin homology domain);
l’interazione genera un cambiamento conformazionale di AKT cui segue la sua fosforilazione sui
residui Ser473 e Thr308 da parte del complesso formato da PDK1 e da mTOR (mammalian target
of Rapamycin) che ne porta all’attivazione [Guertin DA, 2005]. L’attivazione di AKT porta alla
fosforilazione ed attivazione di diverse proteine i cui effetti principali sono l’aumento della sintesi
proteica tramite l’attivazione di mTOR e l’inibizione dell’apoptosi generata dalla fosforilazione
inibitoria di fattori pro-apoptotici come Bad e membri della famiglia di fattori trascrizionali Foxo,
così come dall’aumento dell’espressione e dell’attivazione di proteine anti-apoptotiche quali Bcl2, BCL-XL e il fattore nucleare kappa-B (NF-kB). Il singaling di AKT influenza anche il
metabolismo del glucosio attraverso la regolazione dell’attività di GSK-3β (glycogen synthase
kinase-3) e assume un ruolo chiave nella sintesi proteica e nella crescita cellulare, regolando
l’attività del complesso CRTC-1 (CREB-regulated transcription coactivator-1) attraverso una
serie di eventi intermedi [Efeyan A, 2009].
Al contrario, l’attivazione di Shc stimola l’attivazione della pathway di Ras/MAP chinasi e
la trasduzione di segnali mitogenici attraverso l’attivazione nucleare di ELK1 [Pollak M, 2008].
Ras è una proteina ad attività GTPasica associate alla membrana plasmatic ache si trova in forma
inattiva legata al GDP e viene attivata dal legame con il GTP, processo catalizzato dal fattore Sos
(Son-of-sevenless). L’associazione tra Sos e il suo substrato viene mediate dalla proteina
adattatrice Grb2, che lega specifiche fosfotirosine del recettore e viene attivata dall’interazione
con Shc [Ravichandran KS, 2001]. Ras recluta in membrana e attiva la serina/treonina chinasi
Raf, che è in grado di attivarea sua volta una cascata di proteine tirosin-chinasiche appartenenti
alla famiglia delle MAP chinasi (Mitogen Activate Protein Kinase), tra cui MEK. Questi eventi
portano all’attivazione di Erk1/2 (Extracellular signal-regulated kinase), tramite la doppia
fosforilazione sui residui di tirosine e treonine. ERK è in grado di fosforilare diversi bersagli, sia
in membrane che a livello citoplasmatico. La stessa proteina può anche traslocare nel nucleo e
34
Introduzione
attivare fattori trascrizionali specifici, tra cui Fos ed ELK1, implicati nella promozione della
proliferazione cellulare.
IGF-1R può anche attivare SAPK (stress activated protein kinase) e JAK (Janus kinase).
Le proteine SAPK, di cui fanno parte p38 e JNK (Jun N-terminal kinase), sono associate alla
regolazione della risposta al danno al DNA e alla sopravvivenza cellulare. JAK-1 e JAK-2 sono
invece coinvolte nella trasmissione del segnale mediate da citochine. La fosforilazione delle
proteine JAK porta alla fosforilazione e dimerizzazione delle proteine STAT (Signal Transducers
and Activator of Transcription), che andranno poi ad agire a livello nucleare come fattori
trascrizionali.
Il controllo negativo della via di segnalazione di IGF-1R può avvenire sia attraverso la
repression dei componenti della cascata, sia interferendo con l’assemblaggio del complesso
formato dal recettore e dal suo ligando. Un esempio è la repressione della via di segnalazione
mediate da PI3-K attraverso l’aumentata espressione della fosfatasi PTEN, che agisce sul PIP3
defosforilandolo e impedendo un corretto reclutamento di Akt sulla membrane. La repressione
della formazione del complesso ligando-recettore può invece avvenire ad opera della stimolazione
di specifiche fosfatasi di membrane, tra cui SHP-2 (Src-homology 2 domain tyrosine
phosphatase) e PTP-1B (protein tyrosine phosphatase 1B), che legano IGF-1R e ne modulano
l’attività defosforilando specifici residui. In molti casi tale defosforilazione è legata
all’internalizzazione del recettore stesso tramite endocitosi. Una volta all’interno del
compartimento endosomico, il recettore può andare incontro a dissociazione dal ligando e taglio
proteolitico. L’azione di due ligasi E3: Nedd4 e MDM2 (mouse double minute 2) presiede,
invece, la degradazione tramite ubiquitazione del recettore internalizzato.
Il sistema IGF e lo sviluppo tumorale
Il crescente consenso che la fisiologia del sistema IGF sia rilevante nelle neoplasie origina
da risultati convergenti ottenuti in modo indipendente da diverse linee di ricerca. Studi di
popolazione hanno fornito evidenze della relazione esistente tra i livelli circolanti dei ligandi di
questo sistema, così come variazioni polimorfiche di geni importanti, ed il rischio di insorgenza
35
Introduzione
del cancro e la prognosi dei pazienti. Tale correlazione risulta evidente sia da studi di laboratorio
che dalla validazione di diverse terapie target [Pollak M, 2008]. Alterazioni del sistema IGF sono
state riportate in diversi tipi di tumori, compresi l’osteosarcoma, il cancro ai polmoni, alla prostata
e tumori gastrointestinali. Studi in vivo hanno dimostrato che un IGF-1R funzionante è necessario
alla trasformazione cellulare operata da diversi oncogeni virali e cellulari e sembra essere
importante anche nell’espressione di geni che regolano il ciclo cellulare, la sopravvivenza, la
motilità, l’ancoraggio e il potere metastatico di queste cellule [Gallagher EJ, 2011]. Sebbene
mutazioni di IGF-1R non siano state descritte in nessun tumore, numerosi polimorfismi genetici
sono stati identificati nei geni codificanti IGF-1 o IGFBP3 e potrebbero svolgere un ruolo
importante come fattore di rischio nel tumore al seno, al polmone e alla prostata [Habuchi T,
2006]. Un polimorfismo rilevato nella regione del promotore di IGF-1, caratterizzato da
ripetizioni di citosine e adenine potrebbe essere associato a cambiamenti nei livelli di IGF-1
circolanti; l’allele contenente tali ripetizioni è presente con una maggiore frequenza in pazienti
con cancro alla prostata e può essere utilizzato come fattore prognostico in pazienti affetti da
cancro alla prostata con metastasi ossee [Tsuchiya N, 2006]. Modificazioni a carico di IGF-2 sono
state associate allo sviluppo dell’osteosarcoma: l’ipometilazione del promotore P3 di IGF-2
correla con l’espressione del trascritto di P3 nell’osteosarcoma; l’elevata espressione di IGF-2-P3
nei campioni di osteosarcoma è dovuta all’ipometilazione di P3, che può rappresentare un evento
precoce nella progressione della patologia [Li Y, 2009]. L’alterata metilazione delle isole CpG
porta ad una disregolazione della trascrizione e dell’espressione di IGF-2 anche nel cancro alla
mammella, dove si ipotizza l’utilizzo dell’analisi del profilo di metilazione a fini prognostici.
[Shetty PJ, 2011]. Jones et al. hanno mostrato come l’espressione di IGF-1R induca la crescita
tumorale e la metastatizzazione e come la diminuzione della sua espressione porti ad un
decremento della crescita tumorale nella maggior parte dei tumori [Jones RA, 2009]. IGF-1R
risulta essere fortemente over-espresso nelle cellule tumorali rispetto alle cellule normali ed è
ubiquitariamente espresso nei tessuti cancerosi [Ouban A, 2003].
Da diversi anni è noto come l’azione trasformante di numerosi geni sia facilitata dal
sistema IGF, mentre altre evidenze suggeriscono che le variazioni dei livelli di IGF circolante
siano in grado di influenzare la crescita tumorale: in topi transgenici TRAMP, utilizzati per lo
studio del tumore alla prostata, l’over-espressione del DNA dell’IGF-1 umano nelle cellule
36
Introduzione
epiteliali della prostata comporta un aumento dei livelli di IGF-1R e l’insorgenza spontanea del
cancro [DiGiovanni J, 2000].
Dal punto di vista biologico, nelle prime fasi del processo di cancerogenesi, l’accumularsi
di diverse mutazioni somatiche porta ad un aumento del danno al DNA nelle cellule a rischio, che
normalmente verrebbero indirizzate alla morte cellulare dipendente da p53. L’aumentata attività
del sistema IGF nel microambiente cellulare potrebbe svolgere un ruolo cruciale nell’influenzare
il destino di queste cellule, sostenendone la proliferazione, inibendone l’apoptosi e
promuovendone
l’evoluzione
in
cellule
maligne.
L’incremento
anche
minimo
della
concentrazione locale di IGF così come l’over-espressione del recettore potrebbe portare
all’inibizione dei processi apoptotici. Questi sono solo alcuni esempi poichè i fattori che
influenzano il processo di cancerogenesi sono numerosi, ma se si considera la complessità del
corpo umano e dei processi biologici, anche variazioni piccole in questa via di segnalazione
potrebbero contribuire ad aumentare la sopravvivenza cellulare e a spiegare l’associazione
esistente tra IGF e rischio di insorgenza del cancro. Sebbene l’over-espressione delle proteine
IGFs e di IGF-1R siano state riconosciute tra i maggiori fattori promuoventi la crescita tumorale,
negli anni è divenuto chiaro che questo sistema può essere alterato a diversi livelli. Queste
modificazioni posso esplicarsi a livello genetico, epigenetico, di sintesi proteica o di
modoficazioni proteiche port-traduzionali di diverse proteine che influenzano la funzione di IGF1R [Samani A.A., 2007]. L’over-espressione di IGF-2 in seguito a perdita dell’imprinting materno
è stata rivelata in numerosi tumori, tra cui i carcinomi colorettali e il tumore di Wilms. Le cellule
che invece esprimono entrambi gli alleli di IGF-2 possiedono un’aumentata produzione della
proteina e questo potrebbe costituire uno dei meccanismi principali della tumorigenesi. Molti dei
geni appartenenti al sistema IGF ed in grado di regolare la biodisponibilità di IGF-1 presentano
polimorfismi che sembrano essere associate ad un maggior rischio di sviluppare il cancro [Le
Marchand L, 2002]. Anche le variazioni di espressione delle proteine IGFBP correlano con la
possiile deregolazione della disponibilità dei ligandi di IGF-1R ed anche questi fenomeni possono
portare alla crescita neoplastica.
Un altro fenomeno legato all’over-espressione dei proto-oncogeni associate alla
trasformazione cellulare e alla progressione tumorale è l’amplificazione genica; anche
l’amplificazione del gene IGF-1R, per quanto rara, sembra essere identificata in melanomi
37
Introduzione
maligni, seppur con una frequenza molto bassa [Hartog H, 2007]. Anche le pro-proteine
convertasi (PC) sono implicate nell’over-espressione di IGF-1 e del suo recettore; nei mammiferi
sono state identificate 7 pro-proteine, esse hanno il compito di mediare il processamento dei
precursori polipeptidici. La furina è implicata specificatamente nel processamento di IGF-1R, IR
e dei legandi del sistema IGF, mentre numerose convertasi sono responsabili del processamento
tessuto-specifico di alter proteine del sistema [Duguay SJ, 1997]. L’aumento dell’espressione
delle convertasi può costituire un mezzo alternative per l’aumento dell’attività del sistema IGF.
Nelle cellule tumorali si ritrovano spesso processi di glicosilazione aberranti che portano
alla produzione di proteine non funzionali. L’alterata glicosilazione di IGF-1R è stata dimostrata
in numerosi tumori, tra cui il glioma, in cui questa modificazione potrebbe svolgere un ruolo
importante nella tumorigenesi [Gammeltoft S, 1988].
L’attivazione costitutiva insieme all’over-espressione di intermedi della via di
segnalazione di IGF-1R, quali IRS-1 ed ERK1/2, rappresenta un altro meccanismo mediante cui
un tumore può ridurre la propria dipendenza da fonti esogene di IGFs e dai livelli di espressione
di IGF-1R. L’espressione di IGF-1R viene determinata principalmente a livello trascrizionale; il
suo promotore è ricco di sequenze CG e contiene numerosi siti di attacco per i membri della
famiglia di fattori trascrizionali Sp1. Oltre ad essi sono stati identificati nel promotore di IGF-1R
e IGF i potenziali siti di legame per AP2, famiglia di fattori trascrizionali implicata nel normale
processo di crescita e di sviluppo nei mammiferi, di conseguenza l’over-espressione di tali fattori
potrebbe contribuire ad una migliore attività del sistema. A sostegno di questa ipotesi è stata
riscontrata una forte associazione tra l’aumento dell’espressione di AP-2 e l’incremento di IGF1R nei carcinoma mammari [Turner BC, 1998].
I geni onco-soppressori contribuiscono alla regolazione dell’espressione di IGF-1R. La
perdita di tali geni, come p53, BRCA1 o WT1, risulta nell’aumento dell’espressione di IGF-1R,
conseguenza della perdita del controllo trascrizionale. Al contrario, diversi oncogeni quali c-myb
e la proteina X del virus dell’epatite B ne stimolano la trascrizione. p53 viene attivato in seguito a
stress genotossico e ipossia ed agisce modulando negativamente il sistema IGF, tramite la
repressione dell’espressione di IGF-1R, IGF-2 e IRS-1 [Werner H, 1996] e l’aumento della sintesi
di IGFBP-3, riducenso così la disponibilità di IGF-1 [Buckbinder L, 1995]. L’elevata frequenza di
mutazioni di p53, presente in più del 50% dei tumori, e la sua consequenziale perdita di attività
38
Introduzione
repressiva, porta alla mancata repressione del sistema IGF, con il conseguente aumento di
espressione delle componenti di questa via di segnalazione che porta alla progressione
neoplastica. La forte relazione esistente tra p53 e IGF-1R viene confermata anche dall’attività di
MDM2, coinvolta nell’ubiquitinazone di entrambe le molecole. L’attivazione di IGF-1R induce la
modulazione positiva dell’espressione di MDM2, favorendo la degradazione di p53 [HeronMilhavet L, 2002].
Tra le proteine spesso mutate nei tumori coinvolte nella trasduzione del segnale troviamo
la fosfatasi PTEN, che regola negativamente la risposta d IGF-1. La sua perdita di funzionalità
può provocare l’aumento dell’attività del sistema IGF attraverso diversi meccanismi: essa può
aumentare il segnale derivante da PI3-K, può aumentare l’espressione di IGF-1R e dei suoi
ligandi o, ancora, può ridurre l’espressione di IGFBP-3 [Yi HK, 2005].
Nelle cellule tumorali risulta essere frequentemente mutato anche IGF-2R. Questo
recettore mostra un’ affinità per IGF-2 di circa 10 volte maggiore rispetto a quella per IGF-1, ma
non esssendo provvisto di un dominio catalitico non può trasdurre il segnale. La sua funzione
principale sembra essere quindi la regolazione della disponibilità di IGF-2. Nonostante questa sua
funzione possa sembrare secondaria, mutazioni, perdita di eterozigosi e instabilità dei
microsatellite riguardanti IGF-2R, sono spesso identificati nei tumori primary e l’espressione
forzata di questo recettore si è mostrata responsabile della riduzione della capacità proliferativa in
cellule di tumore della prostata [Schaffer BS, 2003].
Di particolare interesse è l’attenzione posta recentemente sul ruolo di IGF-1 nella
patogenesi dell’osteosarcoma, derivata dalla descrizione di IGF-1 come un fattore che media gli
effetti dell’ormone della crescita sull’accrescimento scheletrico. IGF-1 è infatti un potente agente
mitogenico per le cellule di osteosarcoma umano [Pollak M, 1990 ] mentre la crescita di cellule di
osteosarcoma murino è inibita in animali ipofisectomizzati, poichè la produzione di IGF-1 è
stimolata dalla produzione dell’ormone della crescita ad opera della ghiandola pituitaria [Pollak
M, 1992].
39
Introduzione
Strategie terapeutiche per colpire il sistema IGF
Alla fine degli anni ’80 Arteaga e i suoi collaboratori comprovarono che la repressione di
IGF-1R potesse consentire il controllo della crescita tumorale [Arteaga CL, 1989]. Tuttavia negli
anni successivi tutti i tentativi di colpire questo sistema si limitarono a studi di laboratorio, poichè
questo tipo di terapie venne surclassato dalla strategie per il controllo del recettore EGF
(epidermal growth factor).
In tempi più recenti sono state proposte terapie basate sull’utilizzo degli inibitori tirosinchinasici, gli RTKI (Receptor Tyrosin Kinase Inhibitor), che si sono dimostrati efficaci in diversi
studi clinici e alcuni di essi sono stati approvati, ad esempio, nella terapia del cancro ai polmoni,
al fegato e ai reni. Gli RTKI sono piccole molecole che competono per il legame dell’ATP
all’apposito sito di legame sul recettore per IGF-1. Essi inibiscono il cambiamento
conformazionale del dominio tirosin-chinasico e pur essendosi dimostrati efficaci, mostrano una
scarsa specificità, poichè non sono in grado di discriminare tra IGF-1R e IR, a causa dell’alta
omolgia strutturale esistente tra i due recettori e della loro capacità di formare recettori ibridi.
Tuttavia questo potrebbe rappresentare un vantaggio nella terapia delle tipologie di cancro in cui
l’attività del sistema IGF risulta essere fondamentale per lo sviluppo tumorale. Studi clinici di
fase I e fase II vengono attualmente condotti su AVE1642, BMS754807, OSI-906 e AXL1717. I
risultati preliminari sono incoraggianti in diverse tipi di tumori solidi [Heidegger I, 2011]. Da
non sottovalutare poi la possibilità che questi farmaci attraversino la barriera emato-encefalica,
con possibili effetti neurotossici. D’altro canto, però, questi composti presentano anche il
vantaggio di poter essere somministrati oralmente e di essere maggiormente bio-disponibili
[D’Ercole AJ, 2008]. I primi tentativi utilizzati invece per ridurre la disponibilità del ligando
utilizzavano analoghi della somatostatina, ma i trial clinici furono fallimentari, poichè non si
ottenne l’abbassamento dei livelli circolanti di IGF-1. Sono in fase di studio pre-clinico strategie
che utilizzano le IGFBPs per sequestrare IGF-1 e anticorpi che agiscono più a monte, inibendo il
GH, ma i risultati sono ancora da valutare.
Lo sviluppo di anticorpi umanizzati, i progressi in materia di topi geneticamente
ingenierizzati a la disponibilita’ di librerie fagiche di anticorpi umani, ha portato alla creazione di
40
Introduzione
una classe di prodotti innovativa: gli anticorpi monoclonali umanizzati e completamente umani, in
grado di ovviare ai problemi di immunogenicita’ provocati dagli anticorpi murini [Corvaia N,
2009]. Le terapie che prevedono l’impiego degli anticorpi monoclonali sono diverse, ma il
meccanismo di funzionamento è ricorrente: devono inibire il legame di entrambi i ligandi IGF-1 e
IGF-2 al recettore, devono indurre la down-regolazione dello stesso recettore, ma devono anche
essere in grado di non interferire con il funzionamento del recettore insulinico. Ad oggi sono però
pochi i composti che soddisfano questi criteri. L’esperienza migliore si è ottenuta con l’anticorpo
CP-751871 prodotto dalla Pfizer, che sembra aumentare anche l’effetto dei farmaci
chemioterapici normalmente utilizzati nella terapia dei tumori squamosi. Si apre quindi una nuova
prospettiva nel trattamento combinato delle neoplasie [Gualberto A, 2008]. Molti altri anticorpi
sono ancora in fase di studio clinico, ma sembra abbiano effetto solo in pochi pazienti. La sfida
piu’ importante è legata all’espressione del recettore per IGF-1, presente in molti tessuti: sarebbe
importante riuscire a definire le tipologie di tumori che potrebbero risentire maggiormente di
questo tipo di trattamento, anche tenendo conto dell’attuale mancanza di marcatori molecolari che
possano essere in grado di predire la resistenza o la sensibilità a queste terapie. Un primo tentativo
potrebbe essere fatto nei pazienti affetti da tipologie neoplastiche in cui è nota la correlazione tra
l’aumento dell’espressione di IGF-1R e la prognosi, come nel caso del tumore ovarico [Spentzos
D, 2007].
Attualmente sono in corso moltissimi trials clinici con anticorpi contro IGF-1R, anche in
combinazione con farmaci tradizionali. Essi si pongono anche l’obiettivo di identificare e validare
nuovi marcatori che possano predire la risposta alle terapie contro il recettore di IGF-1; un’ altra
necessità è certamente quella di chiarire il ruolo delle varie componenti del signaling di IGF-1R
nell’insorgenza dei tumori resistenti alla terapia. A questo proposito è possibile che la perdita di
funzionalità di PTEN porti all’attivazione della cascata del segnale a valle del recettore, rendendo
inefficace il trattamento contro IGF-1R; in questo caso le mutazioni inattivanti di PTEN
potrebbero essere considerate marcatori di resistenza. Un esempio di anticorpo contro il recettore
di IGF-1 è l’IMC-A12 (cixutumumab) somministrato sia da solo che in combinazione con altri
farmaci come erlotinib o gemcitabina in diversi tipi di tumori neuroendocrini, nel tumore alla
prostata, nel cancro alla mammella, al colon, al pancreas e al fegato e nel sarcoma di Ewing. Tra
gli altri ricordiamo AMG-479 (ganitumab) e MK 0646 (dalotuzumab) [Scartozzi M, 2011].
Quest’ultimo inibisce l’attivazione del recettore provocata sia da IGF-1 che da IGF-2, esercitando
41
Introduzione
un significativo effetto sulla fosforilazione di IRS-1/2 e Shc. Sono attualmente in corso dei trials
clinici per valutarne l’efficia in combinazione ad altri farmaci, poiche’ i risultati ottenuti in
monoterapia non hanno dato esiti soddisfacienti [Corvaia N, 2009] [Reidy-Lagunes DL, 2012].
Anche nel trattamento dell’osteosarcoma sono stati ottenuti risultati incoraggianti con le
terapie anti-IGF-1R che includono l’utilizzo di anticorpi e inibitori dell’attività chinasica del
recettore, interferendo sia con l’attività del recettore che con la biodisponibilità dei suoi ligandi
[Picci P, 2008]. Uno dei più promettenti anticorpi monoclonali contro IGF-1R è l’R1507 (Roche).
Gli studi inerenti questo anticorpo sono stati condotti su diverse linee di osteosarcoma,
utilizzandolo sia da solo che in combinazione con l’inibitore di mTOR rapamicina. I risultati
ottenuti hanno dimostrato che l’anticorpo R1507 è in grado di reprimere l’attivazione di Akt IGF1R-dipendente in tutte le linee di osteosarcoma analizzate [Kolb EA, 2010], interferendo con
l’attività anti-apoptotica esercitata da Akt. Sono attualmente in atto studi clinici di fase I e II
[Seccareccia E, 2012]. Anche il targeting di IGF-1R con AG1024 in concimitanza all’utilizzo
della doxorubicina ha mostrato effetti benefici su alcune linee di osteosarcoma, riducendo la
proliferazione cellulare ed aumentandone l’apoptosi [Luk F, 2011].
Tuttavia gran parte degli anticorpi monoclonali aventi come target IGF-1R non inibiscono
la trasduzione del segnale mediata dal recettore ibrido; le uniche eccezioni sono il figitumumab e
SCH717454 (Schering-Plough). Quest’ultimo inibisce la fosforilazione di IGF-1R mediata sia da
IGF-1 che da IGF-2, ma non l’attività di IR stimolata da IGF-2 [Feng Y, 2012] Le stesse
osservazioni sono state effettuate nel sarcoma di Ewing utilizzando gli anticorpi AVE1642 e
NVP-AEW541 [Garofalo C, 2011].
E’ chiaro quindi che gli anticorpi contro IGF-1R non sono in grado di reprimere
completamente il segnale trasmesso da questo recettore, poiché non influenzano il legame di IGF2 al recettore insulinico o al recettore ormonale HR. Pertanto una terapia combinata con anticorpi
specifici per IGF-1R e per IGF-2 potrebbe avere maggiore effetto, portando ad una più
consistente inibizione della tumorigenesi dovuta al sistema IGF. E’ altresì importante sottolineare
come l’effetto degli anticorpi utilizzati in monoterapia abbia come effetto principale la
stabilizzazione della malattia, mentre quando associati ad altre terapie danno effetti di maggior
rilievo [Scartozzi M, 2011].
42
Introduzione
Un’altra strategia terapeutica in sperimentazione è quella che utilizza oligonucleotidi
antisenso (ASO) contro IGF-1R. Gli ASO sono corte molecole di DNA o RNA a singolo
filamento complementari al target prescelto; vengono introdotti nella cellula e si legano alla
sequenza complementare nel trascritto target, questo risulta nel blocco, nella degradazione e nella
riduzione della traduzione del gene target [Di Cresce C, 2010]. Modelli preclinici hanno mostrato
come il targeting dell’mRNA per IGF-1R tramite gli ASO porti ad una riduzione dei livelli del
recettore con conseguente riduzione della crescita cellulare, induzione dell’apoptosi e inibizione
della trasduzione del segnale di IGF-1R in diversi modelli di cancro, quali il cancro al polmone,
alla mammella e al pancreas [Shen YM, 2008]. A livello clinico la loro efficiacia è stata
dimostrata, ad oggi, solo nell’astrocitoma [Heidegger I, 2011].
Le molecole che inibiscono IGF-1R e gli altri elementi di superfice del sistema IGF
costituiscono una promettente classe di farmaci nel trattamento del cancro. Tuttavia, visto il forte
cross-talk esistente tra IGF-1R ed IR, una terapia basata su target più specifici potrebbe dare
migliori risultati e ridurre gli effetti indesiderati. In particolare, nel caso dell’osteosarcoma, visto
il legame esistente tra il grado di differenziamento delle cellule e la severità della patologia, il
circuito del recettore di IGF-1, coinvolto nei processi differenziativi di varie tipologie cellulari,
potrebbe essere utilizzato per promuovere il differenziamento osteoblastico e migliorare la
prognosi.
43
Introduzione
IRS-1 (Insulin receptor substrate-1)
La famiglia di proteine IRS
I membri appartenenti alla famiglia di proteine adattatrici IRS sono 6 (IRS-1-6). IRS-1 e
IRS-2 sono largamente espresse in diversi tessuti, inclusi cervello, muscoli, cuore, tessuto
adiposo, reni, ovaio e ghiandola mammaria [Wu X, 2000], mentre l’espressione di IRS-4 è limitata
solo al timo e al cervello. IRS-3 è espresso nei roditori e non ne è ancora stato trovato un omologo
nell’uomo [Lavan BE, 1997]. Gli altri due membri della famiglia IRS-5 e IRS-6 sono considerati
parenti lontani e sono più simili tra loro che non agli altri membri della famiglia [Cai D, 2003]. A
causa della loro vasta espressione tissutale nei roditori e nell’uomo, IRS-1 e IRS-2 sono le
componenti di questo gruppo di proteine più studiate; la loro struttura proteica è molto simile:
entrambe contengono un dominio N-terminale altamente conservato, con i domini PH (plextrin
homology) e PTB (phosphotyrosine binding) che mediano il legame al recettore insulinico IR e al
recettore per IGF-1 [White MF, 2002] [He W, 1996]. Pur essendo strutturalmente molto simili,
IRS-1 e IRS-2 non hanno una funzione ridondante, infatti topi privi di IRS-1 si presentano di
piccole dimensioni alla nascita e restano nani durante tutta la vita, dimostrando il convolgimento
di IRS-1 nella regolazione della crescita somatica. Topi deficienti per IRS-1 sviluppano resistenza
all’insulina ma non progrediscono ad uno stadio di diabete conclamato, poiché mantengono il
normale numero di cellule β-pancreatiche. I topi totalmente privi di IRS-2 sono invece di
dimensioni normali ma mostrano difetti cerebrali, risultato di una riduzione della proliferazione
neuronale pari al 50%, e sviluppano il diabete [Araki E, 1994] [Schubert M, 2003]. Nella porzione
C-terminale le proteine IRSs contengono numerosi residui di tirosina e serina che fungono da siti
di attracco per le proteine contenenti domini SH2, come PI3-K, Grb2, SHP2 ed altre. In seguito
alla fosforilazione dei residui di tirosina e serina le proteine adattarici a valle vengono reclutate ed
attivate. Gli effettori meglio caratterizzati sono PI3-K ed ERK1/2. I recettori IR e IGF-1R e le
loro vie di segnalazione, che prevedono il binding delle proteine IRS, sono conosciute come
pathway canoniche di queste proteine, ma ciò non toglie che esse siano coinvolte anche in altre
pathway non canoniche indipendenti dal legame con i recettori del sistema IGF, incluse le
44
Introduzione
pathway stimolate dalle citochine (come IL-4) o dagli ormoni (prolattina e GH). Ad esempio, i
recettori citochinici posso attivare la tirosin chinasi citoplasmatica JAK che fosforila e attiva le
proteine IRSs [Burfoot MS, 1997]. Il contenuto cellulare delle proteine IRSs viene regolato a
diversi livelli. Tra questi troviamo la modulazione della sua trascrizione genica e la regolazione
della sua degradazione.
IRS-1
Il gene per IRS-1 è localizzato sul cromosoma 2q36. IRS-1 è stato a lungo considerato un
tipico esempio di molecola citosolica coinvolta nella trasduzione del segnale a partire da due
tirosin-chinasi di membrana, IR ed IGF-1R. Questa fosfoproteina idrofilica è il principale
substrato di risposta all’insulina, ma può essere attivato da molti altri sistemi, incluso, appunto, il
recettore per IGF-1, molte interleuchine (IL-2, IL-4, IL-9, IL-13 ed IL-15), l’ormone della
crescita, la leptina, il VEGF (Vascular Endothelial Growth Factor), membri della famiglia delle
integrine e l’interferone (INF-α-β e INF-γ). A causa della sua sensibilità allo stimolo insulinico è
implicato anche nel controllo del glucosio, della deposizione dei lipidi e della sintesi del
glicogeno.
Sun et all. nel 1991 la descrissero come una proteina citosolica con peso molecolare
predetto di 131 kDa, ma che sull’SDS-PAGE migrava ad un’altezza compresa tra 170 e 185 kDa,
da qui il nome con cui fu indicata, pp185. La differenza di peso riscontrata è dovuta alle
molteplici fosforilazioni che la proteina subisce sui residui di serina e tirosina a seguito
dell’attivazione del recettore insulinico [Sun XJ, 1991]. IRS-1 contiene infatti 21 potenziali siti di
fosforilazione in tirosina, con 6 di essi nel motivo YMXM e 3 nel dominio YXXM, così come 30
potenziali siti di fosforilazione in serina/treonina riconosciuti da varie chinasi e attraverso i quali
viene modulato il segnale insulinico [Whitehead JP, 1998]. La fosforilazione di IRS-1 in tirosina
è funzionale al ruolo di ancoraggio multi-sito svolto da questa proteina con i motivi della
sequenza amminoacidica attorno ai residui di fosfotirosina che fungono da siti di legame specifi
per le proteine contenenti i domini SH2 [Krook A, 1996]. Tra queste troviamo le proteine
adattatrici Grb2, Nck e Crk II, la tirosin-fosfatasi SHP2, la tirosin chinasi Fyn e PI3-K. Oltre ad
esse anche 14-3-3 e gli antigeni del poliomavirus possono legarsi ad IRS-1, contribuendo alla
45
Introduzione
trasformazione maligna e associandosi alla proteina in maniera indipendente dalla fosforilazione
in tirosina.
Il ruolo di IRS-1 è proprio quello di fungere da supporto per il legame e l’attivazione di
altre proteine ed enzimi: non è nota per IRS-1 un’attività di tipo enzimatico [Reiss K, 2012].
I due principali domini di IRS-1, PH e PTB, mostrano funzioni distinte: il dominio PH
contiene una tasca di legame carica positivamente che media l’interazione con fosfolipidi e
proteine contenenti un motivo acidico [Myers MG, 1995]; il dominio PTB ha invece la capacità di
riconoscere reidui tirosinici fosforilati attraverso il dominio NPXY, fornendo un meccanismo di
accoppiamento tra IRS-1 e le tyrosine 950 e 960 della regione juxtamembrana di IGF-1R e IR
rispettivamente [Craparo A, 1995] [Eck MJ, 1996].
IRS-1 partecipa anche alla regolazione dei processi di riparo del danno al DNA, infatti il
legame e la ritenzione citoplasmatica della proteina legata alla riparazione del danno al DNA,
Rad51, da parte di IRS-1 in forma ipofosforilata viene inibito in cellule stimolate con IGF-1,
indicando fortemente un’implicazione dell’asse IGF-1R/IRS-1 nel riparo al danno al DNA tramite
ricombinazione omologa (HRR) [Trojanek J, 2003].
Una delle vie di segnalazione mediata da IRS-1 e più studiate è certamente la via della
PI3-K. Come precedentemente ricordato, l’associazione della subunità regolatoria p85 del PI3-K
con IRS-1 fosforilato in tirosina, porta alla localizzazione in membrana e attivazione della
subunità catalitica p110 di PI3-K, generando il fosfatidilinositolo 3,4,5-trifosfato e 3,4-bifosfato.
Questi prodotti lipidici inducono l’attivazione di una serie di segnali chinasici, inclusa quella della
serin-treonina chinasi Akt [Lawlor MA, 2001]. L’attivazione di Akt e delle molecole downstream
mediano diverse azioni metaboliche dell’insulina, quali la traslocazione del GLUT-4 e il trasporto
di glucosio, la fosforilazione di GSK-3 e la sintesi di glicogeno, l’attivazione di mTOR e
l’attivazione della sintesi proteica [Mendez R, 2001]. Altri effetti dell’insulina, come ad esempio
il suo segnale mitogenico, sono mediati dall’associazione di Grb2 con Shc e IRS-1/2 fosforilati in
tirosina, che portano all’attivazione di MAPK [Ogawa W, 1998]. Possono però partecipare
all’esplicarsi di questi effetti anche altre cascate di segnale. Sia nella pathway di IR che in quella
di IGF-1R, esistono molti meccanismi a feedback, ad esempio l’attivazione di MAPK può anche
provocare un aumento nella fosforilazione di IRS-1 in serina 616 [De Fea K, 1997], mentre
46
Introduzione
l’attivazione di JNK porta alla stimolazione della fosforilazione di IRS-1 in serina 322. Un altro
aspetto importante della regolazione di IRS-1 è infatti la sua fosforilazione sui residui di serina
che, al contrario di quanto avviene con le fosforilazioni in tirosina, sembrano inattivare alcune
delle più importanti funzioni di questa proteina di ancoraggio e potrebbero essere responsabili
dello sviluppo dell’insulino-resistenza mediata da TNF-α [Hotamisligil GS, 1996]. I residui di
serina meglio caratterizzati sono il 307 (nel topo)/312 (uomo), fosforilati in seguito all’attivazione
di PI3-K, PKC, JNK e TNF-α; la serina 612 viene invece fosforilata dalle MAPK; la
fosforilazione del cluster di serine 632, 662 e 731, fosforilate da parte di Akt/mTOR, può portare
alla degradazione di IRS-1. L’attivazione della serina 789 che segue la fosforilazione mediata da
AMPK, può avere come conseguenza un’aumento dell’associazione di IRS-1 al recettore
insulinico [Schmitz-Peiffer C, 2003]. Curiosamente, elevati livelli di fosforilazione dei residui
serinici di IRS-1 facilitano l’interazione con le integrine, anche se sono le stesse fosforilazioni in
serina ad inibire il binding tra IRS-1 e l’antigene-T di JCV [Lassak A, 2002].
Esistono molti potenziali meccanismi tramite cui l’iperfosforilazione delle proteine IRS in
serina/treonina può bloccare il segnale generato dall’insulina. Tra questi il disaccoppiamento delle
proteine IRS dal citoscheletro e/o dalle componenti di membrana, che provoca la traslocazione di
IRS-1 nel citosol [Clark SF, 2000], l’inibizione dell’interazione IR/IRS, l’inibizione
dell’associazione delle proteine contenenti domini SH2/IRS, quali PI3-K e l’inibizione
dell’attività fosfotrasferasica di IR [Li J, 1999].
Diversi studi hanno dimostrato il ruolo di IRS-1 nella regolazione delle dimensioni
cellulari, nella promozione della proliferazione e del differenziamento, soprattutto quando attivato
dal segnale proveniente da IGF-1R [Valentinis B, 1999] [Valentinis B, 2000] [Chang Q, 2002]
[Cristofanelli B, 2000].
IRS-1 trasloca nel nucleo e nei nucleoli dopo stimolazione con IGF-1 o tramite interazione
con l’antigene T del virus SV40 o il suo equivalente umano. Nel nucleo IRS-1 lega il fattore
UBF1 (Upstream Binding Factor), una proteina coinvolta nella regolazione della sintesi dell’RNA
ribosomale e quindi nella regolazione delle dimensioni cellulari. Questa scoperta costituisce una
spiegazione molecolare al fatto che sia nel topo che nella Drosophila IRS-1 e il suo omologo
controllano il 50% delle dimensioni del corpo [Pete G, 1999]. La localizzazione nucleare di IRS1 è stata riscontrata in sezioni di cancro alla mammella umano, di medulloblastoma umano e nel
47
Introduzione
fegato di ratti adulti. Insieme ad IRS-1 sono state ritrovate nel nucleo anche altre proteine della
pathway di IGF-1R, come PI3-K e Akt, PTEN ed ERK. La localizzazione nucleare di PTEN non
sopprime la crescita e questo spiega perchè IRS-1 nucleare stimola c-myc e i promotori dell’DNA
ribosomiale non richiedono l’attività di PI3-K. La traslocazione di IRS-1 richiede il dominio PTB
dopo la stimolazione di IGF-1 o il dominio PH per la traslocazione dell’antigene T, una proteina
nucleare. Il dominio PTB è anche il dominio richiesto per l’interazione con IGF-1R e IR, come
precedentemente detto. Anche quando IRS-1 è traslocato nel nucleo, la stimolazione da parte di
IGF-1 è ancora richiesta per l’occupazione del promotore. IRS-1 non viene ritrovato sul promote
di cellule in fase G0. L’occupazione del promotore è accompagnata da un aumento dell’attività
trascrizionale. Quindi IRS-1 può anche agire come co-fattore trascrizionale. Una possibilità è che
IRS-1 nel nucleo agisca come facilitatore trascrizionale, attraverso il legame all’istone H1
[Baserga R, 2009].
IRS-1: degradazione
La degradazione di IRS-1 avviene tramite l’azione del proteasoma, che degrada gran parte
delle proteine cellulari con breve emivita e per questo gli sono state attribuite molte funzioni
biologiche, incluso il controllo del ciclo cellulare, la regolazione della morte programmata e la
presentazione dell’antigene [Ciechanover A, 1994].
Il meccanismo di degradazione di questa proteina è stato oggetto di molti studi. In diversi
sistemi gli inibitori selettivi di PI3-K ed mTOR inibiscono la degradazione di IRS-1 stimolata
dall’insulina, confermando l’ipotesi che la degradazione di IRS-1 sia iniziata dall’asse PI3K/Akt/mTOR [Berg CE, 2002]. Ad ogni modo, siccome questi inibitori potrebbero avere effetti
addizionali sconosciuti, sarebbe importante confermare ulteriormente questi risultati. A questo
proposito, una scoperta importante è stata quella di Takano et all., che afferma che l’espressione
di PI3-K costitutivamente attiva legata alla membrana, p110CAAX, induce la degradazione di IRS1 e la sua iperfosforilazione in serina-treonina. Questi risultati suggeriscono come l’overespressione della cascata di PI3-K guidi la degradazione di IRS-1 [Takano A, 2001]. Ad oggi non
ci sono studi che confermino la capacità dell’insulina di indurre la degradazione di IRS-1 in
modelli in cui PI3-K venga persa, o anche altre componenti a valle della stessa pathway. Prove a
48
Introduzione
sostegno di questo modello includono la scoperta che specifici inibitori della subunità 26S del
proteasoma blocchino la degradazione di IRS-1 ma non la sua fosforilazione in serina-treonina.
Più recentemente, un mutante temperatura-sensibile dell’attività ubiquitina-attivante dell’enzima
E1 è stato in grado di bloccare completamente la degradazione di IRS-1 stimolata dall’insulina.
Oltre a questo, numerosi studi riportano come l’insulina stimoli l’ubiquitinazione di IRS-1
[Zhande R, 2002]. La fosforilazione in serina-treonina correla con la degradazione di IRS-1,
suggerendo che essa porti poi alla sua degradazione. L’identificazione di siti di fosforilazione
regolatori richiesti per la degradazione di IRS-1 e della chinasi che fosforila questi siti è un
presupposto necessario per comprendere meglio questo meccanismo. Nel 2003 Greene et al.,
mostrarono come l’inibizione della degradazione di IRS-1 tramite l’utilizzo di inibitori della
cascata di segnalazione PI3-K/Akt/mTOR correli con l’inibizione della fosforilazione in Ser312
di IRS-1. Inoltre, la degradazione stimolata dall’insulina della proteina mutata in Ser312 risultava
diminuita rispetto all’inibizione della degradazione della proteina wild-type (wt); al contrario, un
mutante di IRS-1 in cui Ser616 venne sostituita con un residuo di Alanina, mostrava lo stesso
livello di degradazione della proteina wt. Lo stimolo alla degradazione risulta essere parzialmente
bloccato con molecole inibitorie di JNK. Tuttavia, la fosforilazione in Ser312 stimolata
dall’insulina potrebbe non essere dovuta a JNK, poiché altri inibitori, come LY294002, sono in
grado di bloccare questo processo senza perturbare l’attività di JNK. Questo studio indica quindi
che la fosforilazione in Ser312 è necessaria affinchè IRS-1 venga degradato e suggerisce che la
fosforilazione in Ser312 possiede un doppio meccanismo di regolazione del segnale proveniente
dalla stimolazione esercitata dall’insulina: inibisce l’interazione del recettore con IRS-1 e
indirizza IRS-1 verso la degradazione [Greene MW, 2003].
Studi successivi affermano, invece, un ruolo preponderante di mTOR nella regolazione
della degradazione di IRS-1, affidandogli la direzione di tale processo insieme a JNK, ma in
maniera indipendente da quest’ultima. I residui fosforilati in questo caso sono Ser307 e
Ser636/639.
Un altro regolatore comprovato della degradazione di IRS-1 è la caveolina 1 (cav1).
Entrambe queste molecole interagiscono con una moltitudine di proteine e non è quindi
sorprendente che interagiscano anche tra loro, ma lo è invece il fatto che si stabilizzino a vicenda.
L’espressione della caveolina 1 stabilizza quella sia di IRS-1 che di IRS-2, ma Akt, S6K ed ERK
49
Introduzione
risultano espressi a livelli normali in cellule KO (Knokc-out) per questi due effettori di IGF-1R.
La loro fosforilazione risulta però inibita [Salani B, 2008]. La stabilizzazione di cav1 e IRS-1 è
reciproca e tale correlazione è valida in diverse linee cellulari e in selezionati modelli murini. La
down-regolazione di una delle due porta alla down-regolazione dell’altra e la down-regolazione di
entrambe porta alla loro degradazione. Non è noto quale dei due processi avvenga prima, è noto
solo che le sequenze richieste per l’interazione IRS-1/cav1, e la conseguente stabilizzazione, sono
la Tyr14 per cav1 e il dominio PTB per IRS-1. Questo conferma l’intuizione di Lee et al. che la
Tyr14 di cav1 sia un sito di ancoraggio per molecole con siti di legame fosforilati in tirosina.
L’interazione protegge entrambe le proteine dalla degradazione proteasomica. La capacità che
l’espressione di IRS-1 e/o IRS-2 aumenti la capacità di adesione delle cellula potrebbe essere un
effetto dell’espressione di cav1, poichè questa proteina è noto essere coinvolta nell’adesione
cellulare [Parton RG, 2007] [Lee H, 2000]. Questa spiegazione potrebbe anche dar conto della
paradossale situazione di alcune cellule neolpastiche metastatiche che mostrano livelli di
espressione molto bassi di IRS-1, come le LnCaP e le BT-20 [DeAngelis T, 2006] [Reiss K,
2001]. Fisiologicamente, alcuni degli effetti di IRS-1 sulla proliferazione, l’adesione e la motilità
cellulare potrebbero essere spiegati dal suo effetto sui livelli di cav-1 [Chen J, 2008].
IRS-1 e lo sviluppo tumorale
Come precedentemente riportato, il recettore IGF-1R agisce tramite diverse vie di
segnalazione ma le sue pathway mitogeniche sono essenzialmente due: PI3-K ed ERK [O'Connor
R, 2003]. L’attivazione della pathway di PI3-K da parte di IGF-1 è mediata proprio da IRS-1 ed
IRS-2. IRS-1, soprattutto quando attivato da IGF-1R, trasmette un forte segnale mitogenico, antiapoptotico e proliferativo [Baserga R, 2000]. L’espressione di IRS-1 risulta essere spesso
aumentata nei tumori umani quali cancro alla mammella, alla prostata, al pancreas e al fegato e
per questo ne è stato postulato un ruolo cruciale nello sviluppo delle neoplasie [Chang Q, 2002].
L’over-espressione di questa proteina causa infatti la trasformazione cellulare, incluse le capacità
di formare colonie in soft agar e dare tumori in modelli murini [Valentinis B, 1999]. Esistono
comunque linee cellulari di cancro che non esprimono IRS-1, come nel caso delle BT-20, cellule
di carcinoma mammario che esprimono IRS21 ma non IRS-1 e non sono in grado di formare
50
Introduzione
colonie in soft agar, senon quando esprimono IRS-1 in maniera ectopica. Tuttavia possono
formare tumori nei topi anche quando non esprimono IRS-1 e questo non è sorprendente, infatti
ogni gain nelle funzioni a valle di IRS-1 può provocare la trasformazione cellulare anche in
assenza di IRS-1 o di IGF-1R. In cellule che non esprimono o esprimono IRS-1 a livelli molto
bassi, come nel caso delle cellule mieloidi e delle cellule neuronali, l’attivazione di IGF-1R porta
al differenziamento. Infatti IRS-1 è solitamente assente o espresso a bassi livelli nelle cellule che
sono in grado di differenziare; ad esempio la linea precursore mieloide 32D non esprime IRS-1 e
quando sottoposta allo stimolo di IGF-1 è indotta a differenziare. L’espressione ectopica di IRS-1
in queste cellule provoca una riduzione della capacità differenziativa e stimola la formazione di
tumori nei topi [Valentinis B, 1999]. Allo stesso modo la regolazione negativa di IRS-1 tramite,
ad esempio, l’utilizzo di siRNA o molecole antisenso provoca la reversione del fenotipo maligno.
La capacità di IRS-1 di provocare la trasformazione cellulare e la tendenza di perdere il fenotipo
trasformato da parte di cellule che lo esprimono a bassi livelli o che ne subiscono la downregolazione suggerisce che l’importanza di IGF-1R nello sviluppo tumorale possa dipendere da
IRS-1 oltre che del recettore stesso [Baserga R, 2009]. Infatti l’utilizzo di un anticorpo contro
IGF-1R si è rivelato inutile sulla linea di cancro alla mammella T47D-YA quando le proteine IRS
non risultavano espresse [Byron S.A, 2006].
Per quanto sin ora detto IRS-1 è una proteina multifunzionale coinvolta nella
trasformazione del fenotipo. E’ plausibile che esso assuma un ruolo fondamentale in tutte le
tipologie di cancro in cui risulta essere coinvolto il recettore IGF-1R e potrebbe essere quindi
considerato un biomarcatore per quei tumori che possono essere obiettivo di anticorpi contro IGF1R. Molto probabilmente la trasformazione tumorale mediata da IRS-1 è dovuta alla sua
traslocazione a livello del nucleo e dei nucleoli, dove IRS-1 può agire come co-fattore
trascrizionale e facilitare la trascrizione, come la nucleolina e alcune proteine istoniche [Angelov
D, 2006].
IRS-1 è importante nella trasformazione cellulare attraverso la regolazione degli oncogeni
come l’antigene T del virus SV40 e v-src e può essere attivato da altri recettori per fattori di
crescita, come EGFR. Negli embrioni di topo l’espressione di IRS-1 inibisce il differenziamento
[Rubin R, 2007]. Naturlamente quanto detto sin ora riguardo l’importanza di IGF-1R e di IRS-1
nello sviluppo del cancro può essere vero per alcuni casi ma non per altri. Quando IGF-1R è una
51
Introduzione
componente significativa nella crescita della popolazione cellulare, come nel caso delle cellule di
cancro al colon metastatizzante, allora IRS-1 potrebbe essere un fattore cruciale. In altre
situazioni dove il ruolo del recettore per IGF-1 è ridotto o interamente assente, allora l’importanza
di IRS-1 può essere minore. Non dovrebbe essere difficile poter validare IRS-1 come marcatore
biologico del cancro, poichè la sua localizzazione sub-nucleare è facilmente dimostrabile in
sezioni tissutali. Koda et al., hanno dimsotrato su campioni cancro alla mammella come i livelli di
IRS-1 possono predire la gravità della patologia [Koda M, 2005]. Più problematico è invece avere
delle prove inerenti la fosforilazione di IRS-1, poichè gli anticorpi esistenti sono notoriamente
poco specifici nelle sezioni tissutali.
IRS-1 e il differenziamento
Il ruolo di IRS-1 nel differenziamento è quanto mai controverso, anche a causa del fatto
che questo tipo di studi non sono numerosi. La letteratura si divide, infatti, tra studi che riportano
un’attività di IRS-1 come promotore del differenziamento ed altri che ne descrivono la funzione
inibitoria nell’ambito differenziativo in diversi contesti neoplastici.
I fattori IGF e l’attivazone dei loro recettori sono importanti per la miogenesi. In
particolare, l’attivazione sostenuta del segnale di IGF, tramite espressione costitutiva di IRS-1,
provoca una riduzione della miogenesi, mentre l’inibizione di IRS-1 e la successiva mancata
attivazione di Akt promuovono il differenziamento e l’ipertrofia delle cellule muscolari [Lee CS,
2010]. Hakuno et al. propongono un duplice ruolo di IRS-1 nel differenziamento mioblastico, in
relazione alle fasi di realizzazione di tale processo: nelle fasi precoci si ha l’inibizione della
cascata IRS-1/PI3-K/Akt, mentre nelle fasi successive questa via di segnalazione è attiva e
promuove il differenziamento mioblastico. Questo tipo di differenziamento risulta quindi legato
ad una fine regolazione dell’attivazione della cascata del segnale di IGF-1R [Hakuno F, 2011].
IRS-1 è implicato anche nel differenziamento di altre tipologie cellulari, quali quelle del
tessuto adiposo. Pre-adipociti in cui IRS-1 è stato artificialmente inattivato non riescono a
52
Introduzione
differenziare in adipociti maturi, indicando che IRS-1 ha un ruolo critico nella trasduzione del
segnale generato da IR e IGF-1R nella maturazione di queste cellule [Cypess AM, 2011].
Il gruppo di Baserga diversi anni fa dimostrò come cellule ematopoietiche 32D del lineage
mieloide stabilmente trasfettate con cDNA per IRS-1 perdano la capacità di differenziare e
proliferino indefinitamente, formando tumori negli animali [Valentinis B, 2001]. Studi successivi
consentirono di collocare IRS-1 in un quadro più complesso riguardante la regolazione del
differenziamento di tali cellule, poichè fu dimostrato che se la sovra-espressione di IRS-1 provoca
un arresto del differenziamento, la sovra-espressione dell’altro maggiore substrato di IGF-1R,
Shc, promuove il differenziamento delle cellule 32D, così come l’utilizzo di una forma dominante
negativa della stessa proteina lo inibisce parzialmente, facendo pensare ad un modello in cui il
processo differenziativo viene regolato attraverso la modulazione dei livelli di entrambe le
proteine considerate e facendo intendere la complessità del ruolo che IRS-1 riveste in questo
contesto.
IRS-1 è implicato anche nella carcinogenesi intestinale, sotto il diretto controllo del
complesso TCF/LEF-β-catenina ed in particolare regola il differenziamento delle cellule epiteliali
intestinali. I risultati ottenuti da Esposito et all. hanno mostrato come i livelli di IRS-1 vengano
modulati, insieme a quelli di IR-β, IGF-1R e β-catenina, durante il differenziamento delle linee
cellulari Caco-2 e HT29. La sua presenza è associata al cancro del colon-retto e l’aumento di IRS1 nelle metastasi epatiche lascia pensare ad un suo possibile ruolo anche nella metastatizzazione
epatica [Esposito DL, 2012].
Alcune linee di ricerca suggeriscono che l’insulina e i fattori IGF siano implicati nello
sviluppo e nella fisiologia dell’osso regolando la funzione osteoblastica. Un recettore insulinico
funzionale è espresso dagli osteoblasti e l’esposizione di osteoblasti primari o cellule osteoblastosimili a livelli fisiologici di insulina aumenta l’espressione dei marcatori anabolici dell’osso,
inclusa la sintesi del collagene [Pun KK, 1989], la produzione di fosfatasi alcalina e l’up-take di
glucosio [Kream BE, 1985]. Pazienti con diabete di tipo 1 sviluppano osteopenia o osteoporosi e
mostrano un aumentato rischio di fratture [Janghorbani M, 2006], così come una scarsa capacità
dell’osso di rigenerarsi in seguito a danno. Il trasporto locale di insulina accelera il processo di
riparazione in questi modelli aumentando l’osteogenesi [Gandhi A, 2005]. In relazione al recettore
di IGF-1 non è nota una sua relazione diretta con il differenziamento di cellule stromali in cellule
53
Introduzione
del lineage osteoblastico, ma sappiamo che esso aumenta la funzionalità degli osteoblasti maturi
[Walsh S, 2003]. IGF-1 è anche un fattore importante nella regolazione del differenziamento
condrocitario e promuove la crescita longitudinale dell’osso aumentando l’ipertrofia condrocitica
[Wang J, 1999]. La down-regolazione di IRS-1 in cellule HPDL (human periodontal ligamentderived cells) provoca una riduzione dei livelli di mRNA dei geni relativi ai marcatori di
differenziamento [Ochiai H, 2012]. sottolineando ancora una volta l’importanza di IRS-1 nei
processi differenziamentivi.
Come emerge dalla letteratura, la funzione di IRS-1 di regolatore del processo
differenziativo può dipendere anche dalla sua localizzazione subcellulare. Alcuni studi, infatti,
attribuiscono ad IRS-1 il ruolo di promotore del differenziamento condrocitario solo quando
localizzato a livello citoplasmatico, mentre quando si trova nel nucleo la proliferazione cellulare
prevale sul differenziamento [Longobardi L, 2009]. La stessa osservazione era stata fatta da
Baserga e i suoi collaboratori alcuni anni prima su cellule ematopoietiche ed in quel caso fu
ipotizzata per IRS-1 anche una funzione di shuttle per la traslocazione nucleare di β-catenina
[Chen J, 2005].
Per quanto sin ora riportato possiamo concludere che IGF-1R invia segnali sia di
differenziamento che proliferazione cellulare, accentuando in quest’ultimo caso le caratteristiche
tumorali delle cellule, a seconda delle situazioni e della disponibilità dei substrati. In questo
contesto IRS-1 assume un ruolo centrale e contrastante e data la sua importanza sia nel processo
tumorigenico sia in quello differenziativo sarebbe opportuno riuscire a delucidarne la funzione,
soprattutto in un campo nel quale il grado di differenziamento risulta essere fondamentale ai fini
prognostici, quale è quello dell’osteosarcoma.
54
Scopo della tesi
Scopo della tesi
L’osteosarcoma è il più comune tumore osseo riscontrato in età pediatrica ed
adolescenziale. E’ caratterizzato da una forte instabilità genetica, ma gran parte delle anomalie
genetiche ad esso correlate non sono spesso rilevate nei pazienti affetti da questa neoplasia.
Dati recenti e meno recenti suggeriscono che questa forma tumorale possa essere
identificata come una patologia del differenziamento, legata all’interruzione del processo cui
vanno incontro i precursori osteoblastici per trasformarsi in osteoblasti maturi.
Nello sviluppo tumorale il sistema IGF riveste un ruolo fondamentale nella promozione
della proliferazione cellulare e per questa ragione numerose terapie mirate contro di esso sono
oggetto di studio. Nell’ambito dell’osteosarcoma il sistema IGF ricopre funzioni anti-apoptotiche
e proliferative, rafforzando l’ipotesi della possibiltà di impiego di terapie anti-IGF-1R nel
trattamento di questa patologia.
Non si può non considerare la relazione esistente tra lo sviluppo dell’osteosarcoma e il
mancato completamento del processo di differenziamento osteoblastico, così come non è
possibile tralasciare le evidenze che legano il sistema IGF allo stesso processo. In particolare una
delle proteine responsabili della propagazione del segnale di IGF-1R, IRS-1, è oggetto di studio,
ormai da alcuni anni, nell’ambito delle ricerche effettuate sui processi tumorali e differenziativi.
I risultati sin ora ottenuti da diversi gruppi di ricerca mettono in evidenza il ruolo
contrastante di questa proteina nello sviluppo tumorale e nel processo di metastatizzazione ad
esso correlato. Infatti, IRS-1 è stato identificato come un fattore promuovente la crescita e la
proliferazione e inibente i processi apoptotici e differenziativi in diverse linee cellulari [Baserga
R, 2000]. Altri studi mettono in relazione IRS-1 con la promozione del differenziamento delle
MSCs e delle cellule del tessuto adiposo [Cypess AM, 2011]. IRS-1 è il presunto responsabile
55
Scopo della tesi
anche del differenziamento dei precursori osteoblastici, come appunto le MSCs, in osteoblasti
maturi [Ochiai H, 2012].
In questo quadro, lo scopo dello studio è stato quello di verificare e delucidare il
coinvolgimento ed il ruolo svolto da IRS-1 nel differenziamento osteoblastico di cellule di
osteosarcoma ed MSCs, con l’intento di comprendere se e come la sua presenza possa influenzare
il completamento del processo differenziativo, la cui interruzione è fortemente correlata allo
sviluppo della neoplasia.
A tale fine è stato indotto il differenziamento osteoblastico in modelli cellulari di
osteosarcoma e in MSCs derivate da midollo osseo. La via di segnalazione di IGF-1R è stata
inibita attraverso l’utilizzo di un anticorpo neutralizzante diretto contro il recettore con lo scopo di
confermare il coinvolgimento di questa pathway nel processo di differenziamento osteoblastico.
Una volta verificata la capacità delle linee cellulari prese in esame di differenziare in senso
osteoblastico in risposta a stimoli specifici presenti nel terreno ed il coinvolgimento di IRS-1 nella
realizzazione del processo differenziativo, tramite la valutazione della formazione di matrice
mineralizzata e analisi di RT-PCR e Western blot, le linee cellulari sono state trasfettate o
infettate con plasmidi in grado di modificare i livelli di espressione della proteina, overesprimendola o down-regolandola. Sono poi state valutate le caratterisctiche di malignità
sviluppate dalle cellule in seguito alla sovra-espressione della proteina, sia in vitro che in vivo.
L’indagine dello stato di fosforilazione di IRS-1 e l’utilizzo dell’inibitore del proteasoma
MG-132 sono stati effettuati al fine di valutare come la quantita’ di IRS-1 presente nelle cellule
possa essere in grado di determinare e modificare la loro capacita’ differenziativa.
56
Materiali e Metodi
Materiali e Metodi
Linee cellulari
Le linee cellulari SaOS-2 ed MG-63 sono state ottenute dall’American Type Colture
Collection (Rockville, MD, USA), mentre OS-7, OS-9 e SARG sono state stabilizzate e
precedentemente caratterizzate presso il CRS Sviluppo di Terapie Molecolari, Laboratorio di
Oncologia Sperimentale dell’ Istituto Ortopedico Rizzoli.
Le cellule sono state coltivate in Iscove's modified Dulbecco's medium (IMDM)
(Invitrogen, Carlsbad, CA) contenente 10% di siero fetale bovino inattivato (FBS CambrexBiowhittaker), 20 unita/mL di penicillina e 100 µg/mL di streptomicina (Invitrogen), mentre le
cellule staminali mesenchimali murine (MSCs) sono state ottenute dal midollo osseo di topi wild
type C57BL/6, utilizzando la procedura di Peister et al. e sono state mantenute in terreno di
crescita
αMEM
al
10%
FBS
(Atlanta
Biologicals,
Lawrenceville,
GA)
e
1%
penicillina/streptomicina [Peister A, 2004]. La linea di osteosarcoma murino 8086 è stata ottenuta
da un tumore primario di topi eterozigoti per p53, precedentemente irradiati, in cui il midollo
osseo è stato ricostituito come precedentemente descritto [Sangaletti S,2003]. Anche in questo
caso il terreno di coltura utilizzato è stato IMDM 10%FBS.
Le cellule di osteosarcoma umano SaOS-2 e OS-7 sono state precedentemente trasfettate
in modo stabile con pCMV IRS-1 per over-esprimere la proteina [D'Ambrosio C, 1995], mediante
la metodica del calcio-fosfato. I pool di cellule trasfettate sono stati selezionati in IMDM 10%
FBS contenente 500 μg/mL di neomicina (Sigma-Aldricht) e mantenuti in terreno selettivo.
57
Materiali e Metodi
Crescita in monostrato
I tempi di raddoppiamento delle linee analizzate sono stati determinati tramite la raccolta
giornaliera delle cellule dopo la semina di 5x105 delle stesse in fiasca da 25cm2, in IMDM 10%
FBS. La vitalità cellulare è stata determinata tramite conta in trypan blu.
Crescita in condizioni di ancoraggio-indipendenza
La crescita ancoraggio-indipendente è stata determinata mediante coltura in petri 60-mm
su agar 0.5% (Sigma, Rockville, MD), su uno starto inferiore di agar allo 0.33%. La sospensione
cellulare (1x104–3.3x104 cellule per petri) è stata seminata in mezzo semisolido (IMDM 10%
FBS + agar 0.33%) e incubate a 37°C in atmosfera umida al 5% CO2. Le colonie sono state
contate a distanza di almeno 10 giorni.
58
Materiali e Metodi
Test di migrazione in trans-well chambers (Motility Assay)
Il test è stato effettuato utilizzando le Transwell chambers (Corning, NY) con inserti di 6.5
mm di diametro e membrana di policarbonato con pori di 8 µm. Le cellule (1x10 5) in terreno
IMDM 10% FBS sono state seminate nel compartimento superiore della chamber, mentre nel
compartimento inferiore della chamber è stato posto normale terreno di coltura (IMDM 10%
FBS). Circa 18 ore dopo è stato rimosso il compartimento superiore. Le cellule sono state fissate
4 ore dopo in metanolo assoluto per 15 minuti; successivamente sono state colorate per 20 minuti
con Giemsa 1:10 in acqua e contate al microscopio invertito.
Stimolazione con IGF-1
Le linee cellulari OS-7 e OS-7/pool IRS-1 sono state seminate in IMDM 10% FBS. Il
giorno successivo sono state sottoposte a starvation overnight e successivamente sono state
stimolate con IGF-1 (UpState) 50ng/ml per 5,15 e 45 minuti in terreno privo di FBS.
Western blotting
I lisati cellulari sono stati preparati con buffer contenente Tris-HCl 50 mM (pH 7.4), NaCl
150 mM, NP-40 1%, NaF 1 mM, EGTA 1 mM, Na deossicolato 0.25%, inibitori delle proteasi e
delle fosfatasi (aprotinina 10µg/ml, Na ortovanadato 0.2 mM, PMSF 1 mM, Pepstatina 1µg/mL e
Leupeptina 100 µM). La concentrazione delle proteine è stata determinata tramite Bio-Rad
protein assay (Bio-Rad Laboratories, Hercules, CA.) e lettura allo spettrofotometro. Uguali
quantità di lisati cellulari (40 µg) sono stati separati tramite SDS-PAGE 7.5% in condizioni
denaturanti e trasferite su membrane di nitrocellulosa. Mediante colorazione con Ponceau (Sigma)
si è valutato il corretto trasferimento delle proteine su filtro che è stato poi incubato per 1 h con
una soluzione TBST 1x (Tris-HCl 10 mM pH 7.4, NaCl 150 mM e Tween20 0.1%) al 5% di nonfat dry milk per saturare i siti di legame aspecifici. Le membrane sono state poi incubate overnight
a 4ºC con i seguenti anticorpi: anti–phosphorylated IRS-1 Tyr612 (1:1000; Invitrogen), anti-IRS-1
polyclonal antibody (1:1000; Millipore), anti-phospho-p44/42 Thr202/Tyr204 (diluito 1:1000,
59
Materiali e Metodi
Covance). anti-p44/42 (diluito 1:3000), anti-phospho-Akt Ser473 (1:1000), anti-Akt (1:800), antiphospho-GSK-3β Ser9 (1:1000), anti- GSK-3β (1:1000), anti-phospho-mTOR Ser2448 (1:1000),
anti-mTOR (1:1000) tutti Cell Signaling. anti-Shc (1:1000), IGF-1R (1:1000), Lamin-B (1:2000)
a Actina (1:50000) tutti prodotti dalla Santa Cruz Biotechnology. Dopo una serie di lavaggi con
buffer salino TBST 1x, le membrane sono state incubate con l’anticorpo secondario anti-mouse,
anti-goat o anti-rabbit (GE Healthcare), per poi rilevare l’attività delle perossidasi coniugate allo
stesso secondario con reazione chemiluminescente mediante Western Blotting Detection Reagents
(ECL - Euroclone).
Induzione del differenziamento osteoblastico
Le cellule sono state seminate in normale terreno di coltura (IMDM 10% FBS o αMEM
10% FBS) e dopo 4 giorni è stato indotto il differenziamento osteoblasticio mediante specifico
terreno osteogenico (addizionato con acido ascorbico 50 µg/mL, β-glicerofosfato 5 mM e 1% di
penicillina/streptomicina) contenente tra il 2 e il 5% FBS. Dove indicato, l’anticorpo monoclonale
αIR-3, gentilmente donato dal Dr. J. D’Ercole (University of North Carolina at Chapel Hill,
USA), è stato aggiunto a concentrazione 150 ng/mL in terreno differenziativo privo di siero,
dopo aver lavato le cellule con PBS 1X in agitazione per 30 minuti, cosi’ da evitare il legame al
recettore da parte dei fattori contenuti nel siero. Due ore dopo aver incubato le cellule con
l’anticorpo, l’ FBS è stato aggiunto alle concentrazioni precedentemente specificate. Il terreno
osteogenico è stato sostituito ogni 3 giorni per 3 settimane. Negli esperimenti in cui è stato
utilizzato l’inibitore del proteasoma MG-132 (Selleck Chemicals) è stato seguito lo stesso
protocollo di differenziamento ed è stato aggiunto nello stesso mezzo di coltura MG-132 a
concentrazione 10 µM per 1 ora. Successivamente il terreno è stato sostituito con mezzo di
coltura fresco.
Alizarin red staining
Il saggio del rosso di Alizarina (AR) è stato effettuato a 0, 7, 14 e 21 giorni, a seconda
delle linee cellulari considerate, dopo l’induzione del differenziamento osteoblastico. Il terreno è
60
Materiali e Metodi
stato rimosso dalle piastre e le cellule state lavate con PBS 1X, fissate in etanolo 70% per 1 ora a
temperatura ambiente e colorate per 10 minuti in agitazione lenta con la soluzione di Alizarin Red
40 mM a pH 4.2. Successivamente, l’eccesso di colorante è stato rimosso con PBS 1X. Il
colorante è stato poi estratto incubando le piastre per 15 minuti con cloruro di cetilpiridinio 10%
disciolto in sodio fosfato 10mM a pH 7.0. La quantificazione del colorante e stata effettuata
tramite lettura spettrofotometrica a 550 nm.
Studi in vivo per la valutazione della capacita’ tumorigenica e metastatica
−/−
I topi BALB- Rag2 ;γc
−/−
sono stati gentilmente forniti dal Central Institute for
Experimental Animals (CIEA), Kawasaki, Giappone. I topi sono stati accoppiati presso il
Dipartiemnto di Medicina Diangostica e Specialistica, Università di Bologna, in condizioni sterili.
In seguito all’inoculo sottocute di 107 SaOS-2, Sa/pool IRS-1, OS-7 e OS-7/pool IRS-1 è stato
valutato il potenziale tumorigenico delle cellule, mentre la formazione di metastasi sperimentali è
stata valutata utilizzando l’inoculo endovena di 2x106 SaOS-2 e Sa/pool IRS-1. La crescita
tumorale è stata valutata una volta a settimana misurando i volumi tumorali [Scotlandi K, 2005].
Le metastasi polmonari ed epatiche sono state valutate a due mesi dall’inoculo, (dopo staining con
black India ink per le metastasi polmonari), tramite stereomicroscopio o mediante la valutazione
del peso degli organi freschi quando le metastasi non potevano essere contate. Gli esperimenti
sono stati autorizzati dal comitato etico di Bologna, seguendo le norme di utilizzo degli animali
italiane ed europee.
Infezioni retrovirali con shRNA
Le cellule di packaging 293 Phoenix Amphotrophic (ATCC) sono state trasfettate con
vettori pRFP-C-RS contenenti short-hairpin RNA contro l’mRNA di IRS-1, il vettore pRFP-C-RS
contenente shRNA scramble non-effettivo di 29-mer o il vettore vuoto pMSCV (OriGene
Technologies, Rockville, MD) utilizzando Lipofectamine LTX (Invitrogen), seguendo il
protocollo fornito dal kit, per produrre i retrovirus. A 16 ore dalla trasfezione è stato cambiato il
mezzo di coltura e il surnatante contenente i virus è stato raccolto a 24 e 48 ore dalla trasfezione.
61
Materiali e Metodi
Lo stesso surnatante è stato poi aggiunto alle cellule SaOS-2, MSCs e 8086 ad 1 giorno dalla
semina, utilizzando polibrene 4 µg/mL preparato fresco (Sigma, Rockville, MD). L’infezione
retrovirale è stata ripetuta 24 ore dopo e a distanza di altre 24 ore le cellule infettate sono state
poste in selezione con puromicina 2.5 µg/mL per le 8086 e 2 µg/mL nel caso di SaOS-2 ed MSCs.
La puromicina è stata mantenuta nel terreno di coltura durante la propagazione delle cellule e
rimossa durante gli esperimenti di differenziamento osteoblastico.
Estrazione dell’RNA e analisi di espressione dell’ mRNA
A 14 e 21 giorni dall’induzione del differenziamento osteoblastico, l’RNA messaggero è
stato isolato utilizzando il kit µMacs mRNA Isolation (Milteny Biotec, Auburn CA), le tracce di
DNA sono state rimosse utilizzando la DNAsi I (New England Bio Labs, Ipswich, MA) e
l’mRNA estratto è stato convertito in cDNA tramite il kit µMacs One-step cDNA (Milteny
Biotec). Per determinare i livelli di espressione di IRS-1, osterix ed osteocalcina, il primo
filamento di DNA è stato sottoposto a Real Time PCR utilizzando i primers riportati in tabella. I
risultati sono stati normalizzati utilizzando i valori relativi alla gliceraldeide-3-fosfato deidrogenai
(GAPDH) umana per le SaOS-2 e di β-actina murina per 8086 ed MSCs. Il livello di espressione
dei geni analizzati ai diversi tempi è stato poi rapportato a quello degli stessi geni nei campioni
indifferenziati o non trattati. L’analisi dei risultati è stata eseguita secondo il metodo comparativo
con valutazione del ciclo soglia (Ct), cioè il numero di cicli in cui il prodotto specifico di PCR in
fluorescenza inizia ad essere rilevato. Il Ct della GAPDH o della β-actina, geni di riferimento per
la normalizzazione, è stato sottratto al Ct dei geni d’interesse in tutti i campioni, ottenendo così il
ΔCt:
Ct GENE X – Ct GAPDH = ΔCt
Ogni ΔCt (ΔCt CAMPIONE) ricavato per ciascuno dei campioni viene a sommarsi
algebricamente a quello del calibratore (ΔCt CALIBRATORE), cioè quello ricavato dal campione
indifferenziato o non trattato usato come controllo:
ΔCt CAMPIONE - ΔCt CALIBRATORE = ΔΔCt
L’espressione relativa di ogni gene viene espressa come:
62
Materiali e Metodi
RQ = 2-ΔΔCT
che indica quante volte, in più o in meno, il gene d’interesse è espresso nel campione analizzato
rispetto al calibratore.
Proteina
Sequenza Forward
Sequenze Reverse
GAPDH umana
5’ gagtcaacggatttggtcgt 3’
5’ gctctagggaggttttagtt 3’
β-actina murina
5’ acccacactgtgcccatctacg 3’
5’gccacgctcggtcaggactcttc 3’
IRS-1 umano
5’ acagaaggaaagcgtggaga 3’
5’ aactttcgtaaaacagtcgc 3’
IRS-1 murino
5’ ccagcctggctatttagctg 3’
5’ tcaccacctcaactcaaccc 3’
Osterix umano
5’ gccagaagctgtgaaacctc 3’
5’ ccaatacctctcgaacgtcg 3’
Osterix murino
5’ actcatccctatggctcgtg 3’
5’ ggtagggagctgggttaagg 3’
Osteocalcina umana
5’ gactgtgacgagttggctga 3’
5’ gtcttctccttagacacccg 3’
Osteocalcina murina
5’ caagtcccacacagcagctt 3’
5’ aaagccgagctgccagagtt 3’
Analisi statistiche
I dati sono espressi come media ± SD. Le analisi statistiche sono state effettuate
utilizzando il test di Student, tramite il software Prism 5.0 (GraphPad Software, La Jolla, CA). La
significatività statistica è stata settata a p≤0.05.
63
Risultati
Risultati
L’osteosarcoma è stato definito come una patologia da de-differenziamento nella quale il
differenziamento degli osteoblasti a partire da cellule staminali mesenchimali viene interrotto,
portando alla formazione di cellule indifferenziate che possono diventare tumori. Nei pazienti
affetti da questa patologia, tanto più il tumore è indifferenziato, tanto peggiore sarà la prognosi
[Tang N., 2008].
Risultati preliminari
Dati preliminarmente ottenuti hanno mostrato come 5 di 12 linee di osteosarcoma umano
fossero in grado di differenziare in senso osteoblastico in risposta a stimoli specifici presenti nel
terreno di coltura. Le cellule sono quindi state tenute in coltura per 21 giorni con acido ascorbico
50µg/ml e β-glicerofosfato 5mM in basso siero, allo scopo di valutarne la capacità di formare
matrice ossea mineralizzata utilizzando la colorazione del rosso di Alizarina (AR). Il colorante
utilizzato è in grado di legare gli ioni Ca2+, uno dei maggiori componenti della matrice ossea,
formando precipitati di colore rosso. E’ stato così possibile discriminare tra linee cellulari a
fenotipo differenziante (Figura 9A) e linee cellulari a fenotipo non differenziante (Figura 9B).
64
Risultati
Figura 9. Induzione del differenziamento osteoblastico in linee cellulari di osteosarcoma umano.
La mineralizzazione della matrice ossea è stata valutata tramite il saggio del rosso di Alizarina a
vari time points. A. Linee cellulari a fenotipo differenziante (OS-7, SaOS-2 e SARG). B. Linee
cellulari a fenotipo non differenziante (OS-9 e MG-63).
In Tabella 1 sono riassunti i risultati dell’AR sulle 12 linee di osteosarcoma analizzate.
Tabella 1. Risultati dell’AR sulle linee cellulari analizzate.
65
Risultati
L’analisi del sistema IGF, messo in relazione con lo sviluppo del cancro e con l’aumento
della crescita e della sopravvivenza delle cellule tumorali da numerosi studi [Yu H, 1999], ha
messo in evidenza come non ci fossero differenze nei livelli di espressione di IGF-1 ed IGF-2 tra
cellule a fenotipo differenziante (linee riportate in rosso) e cellule a fenotipo non differenziante
(linee riportate in nero). Successivamente sono stati analizzati tramite Western blot i livelli
proteici del recettore IGF-1R e dei due principali mediatori della sua via di segnalazione, IRS-1 e
Shc. Da tale analisi è emerso come l’espressione di IRS-1 correlasse con la capacità
differenziativa delle linee cellulari prese in considerazione: 4 linee cellulari su 5 del gruppo a
fenotipo differenziante esprimevano bassi livelli di IRS-1, mentre 4 delle 5 linee che non
differenziano esprimevano alti livelli di IRS-1. Non è emersa invece alcuna correlazione tra i
livelli di espressione di IGF-1R e Shc e la capacità differenziativa delle cellule (Figura 10).
Figura 10. Analisi densitometrica dell’espressione di IRS-1 effettuata sul pannello di 10 linee di
osteosarcoma. In rosso le linee a fenotipo differenziante. Coefficiente di correlazione di Sperman:
-0.900; p=0.0833.
66
Risultati
Allo scopo di identificare eventuali variazioni nel sistema IGF durante il processo di
differenziamento osteoblastico sono state analizzate varie componenti di questa via di
segnalazione. L’andamento dell’espressione delle molecole a monte del recettore IGF-1R, IGF-1
e IGF-2 e IGFBP3 durante il differenziamento, è stato analizzato mediante Real Time PCR (RTPCR). Non è stata rilevata alcuna differenza in relazione ai trascritti dei tre geni analizzati tra i
due fenotipi.
IGF-1R trasduce il segnale mediante il reclutamento in membrana e l’attivazione di due
mediatori, IRS-1 e Shc. I livelli di espressione di queste due proteine e di IGF-1R, durante il
differenziamento osteoblastico, sono stati valutati mediante Western blot. E’ stata osservata una
drastica diminuzione dei livelli di espressione di IRS-1 a partire dal settimo giorno di
differenziamento nelle linee a fenotipo differenziante OS-7, SaOS-2 and SARG. Tale
diminuzione non è stata identificata nelle linee cellulari a fenotipo non differenziante OS-9 ed
MG-63. Sono stati valutati anche i livelli di espressione di IGF-1R che risultano variare tra le
linee durante i 21 giorni di differenziamento. Allo stesso modo sono stati analizzati anche i livelli
di Shc, i quali mostrano un andamento variabile, ma restano tuttavia elevati se rapportati ad IRS-1
nelle linee a fenotipo differenziante. Nelle linee OS-9 ed MG-63, appartenenti al fenotipo non
differenziante, la quantità totale di Shc diminuisce. I cambiamenti inconsistenti riscontrati
nell’espressione di IGF-1R e Shc comparati a quelli relativi ad IRS-1 suggeriscono l’importanza
di IRS-1 durante il differenziamento osteoblastico delle linee di osteosarcoma analizzate.
La sovra-espressione di IRS-1 riduce la capacità delle cellule di differenziare in
senso osteoblastico e ne aumenta la tumorigenicità.
I dati preliminari sin qui illustrati hanno consentito di focalizzare l’attenzione su IRS-1.
Allo scopo di studiare in modo più approfondito il ruolo della proteina IRS-1 nel contesto del
differenziamento osteoblastico, le linee cellulari SaOS-2 e OS-7, che mostrano un basso livello di
espressione della proteina di interesse, sono state scelte come rappresentative delle linee a
fenotipo differenziante, per valutare gli effetti dell’overespessione di IRS-1 sul differenziamento
osteoblastico. La sovra-espressione della proteina è stata ottenuta trasfettando stabilmente le due
linee cellulari, mediante il metodo del calcio-fosfato, con il plasmide pCMV/IRS-1 [D’Ambrosio
67
Risultati
et all. 1995], contenente la sequenza codificante per IRS-1 posta sotto il controllo del promotore
virale CMV, così da ottenere una forte espressione della proteina. La selezione dei trasfettanti è
stata effettuata in terreno contenente neomicina, sfruttando la resistenza all’antibiotico presente
nel plasmide. Due settimane dopo, le linee cellulari ottenute Sa/pool IRS-1 ed OS-7/pool IRS-1
sono state testate in Western blot, confermando l’over-espressione di IRS-1. Sono stati verificati
anche i livelli di Shc, mostrando come i livelli di questa proteina non subiscano alcuna variazione
in seguito alla trasfezione (Figura 11).
Figura 11. A. Analisi al Western blot dell’over-espressione di IRS-1 nelle linee cellulari SaOS-2 e
OS-7. B. e C. Analisi densitometrica del rapporto IRS-1/Shc.
68
Risultati
La stimolazione della linea OS-7 e del suo pool over-esprimente IRS-1 con IGF-1 ha consentito di
verificare l’attività della pathway di IGF-1R e quindi di convalidare la funzionalità dei modelli
creati (Figura 12).
Figura 12. Stimolazione di OS-7 e OS-7/pool IRS-1 con IGF-1.
Successivamente le linee cellulari Sa/pool IRS-1 e OS-7/pool IRS-1 sono state
caratterizzate per il potenziale tumorigenico, poichè solitamente cellule meno differenziate
risultano essere più maligne di cellule meglio differenziate. Come controllo sono state utilizzate le
linee parentali da cui derivano, SaOS-2 e OS-7. Le linee Sa/pool IRS-1 e OS-7/pool IRS-1 hanno
mostrato un aumento statisticamente significativo della capacità proliferativa rispetto alle linee
wild-type (Figura 13A), così come una maggiore capacità di formare colonie in condizioni di
69
Risultati
ancoraggio indipendenza e una maggiore capacità migratoria rispetto alle linee parentali SaOS-2 e
OS-7 (Figura 13B e 13C).
Formazione di colonie in soft-agar
# colonie
1500
*
1000
500
0
OS-7
OS-7/pool IRS-1
Figura 13. A. Valutazione della proliferazione cellulare mediante conta in trypan blu. Le conte
sono state effettuate ogni 24 ore per 96 ore (***, p≤0.001). B. Valutazione della capacità di
70
Risultati
formare colonie in condizioni di ancoraggio-indipendenza effettuata a due diverse densità di
semina (**, p≤0.005). C. Valutazione della capacità migratoria di SaOS-2, Sa/pool IRS-1, OS-7 e
OS-7/pool IRS-1(***, p≤0.001).
Tramite gli esperimenti in vivo è stato possibile confermare i dati ottenuti dagli esperimenti in
vitro. SaOS-2, OS-7 e i loro pool over-esprimenti IRS-1 sono state inoculate sottocute in topi
BALB-Rag2-/-;γc-/- (topi privati dei linfociti B, T e delle cellule Natural Killer). Le linee cellulari
Sa/pool IRS-1 e OS-7/pool IRS-1 hanno generato tumori di dimensioni significativamente
maggiori rispetto a quelli dati dalle linee parentali (Figura 14A). Il potenziale metastatico è stato
valutato tramite l’inoculo endovena. La linea Sa/pool IRS-1 ha mostrato una capacità di formare
colonie significativamente maggiore rispetto alla linea parentale, sia a livello dei polmoni
(principale sito di metastatizzazione nell’osteosarcoma) sia a livello epatico. Non essendo stato
possibile contare le metastasi sviluppatesi nei polmoni, ne sono stati valutati i pesi (Figura 14B e
14C). Questi risultati mostrano un aumento della malignità della linea cellulare over-esprimente
IRS-1, la quale aveva mostrato anche una minore capacità di differenziare in senso osteoblastico.
71
Risultati
Figura 14. A. Volumi tumorali rilevati dopo l’inoculo sottocute di 107 SaOS-2, Sa/pool IRS-1,
OS-7 e OS-7/pool IRS-1 (*, p≤0.05, ***, p≤0.001, n=5). Metastasi sperimentalmente indotte
tramite inoculo endovena di 2x106 SaOS-2 e Sa/pool IRS-1 misurate come peso dei polmoni (B;
*, p≤0.05, n=10) e noduli al fegato (C; *, p≤0.05, n=9) dopo 2 mesi.
Analizzando tramite il saggio AR la capacità della linea cellulare Sa/pool IRS-1 di
differenziare in senso osteoblastico in relazione alla linea parentale SaOS-2, quantificando il
colorante e valutando in RT-PCR l’espressione di alcuni marcatori di differenziamento dopo
l’induzione del differenziamento tramite terreno osteogenico, è stato possibile osservare una
riduzione dei noduli di matrice mineralizzata, così come la diminuzione dell’espressione di
osterix al giorno 14 e dell’osteocalcina al giorno 21 (Figura 15). In questo modo è stato
dimostrato che la sovra-espressione di IRS-1 porta ad una riduzione della capacità delle linee
analizzate di differenziare in senso osteoblastico.
72
Risultati
Figura 15. Effetti dell’over-espressione di IRS-1 sul differenziamento osteoblastico. A.
Colorazione AR in SaOS-2 e Sa/pool IRS-1 dopo 21 giorni di differenziamento e quantificazione
del colorante (*, p≤0.05). B. Espressione dei marcatori di differenziamento osteoblastico osterix
al giorno 14 (**,≤0.005) e osteocalcina al giorno 21 (*, p≤0.05), misurati mediante RT-PCR e
comparati con i campioni indifferenziati.
Una volta analizzati gli effetti dell’over-espressione di IRS-1 nella linea cellulare di
osteosarcoma SaOS-2, è stata valutata la modulazione della stessa proteina in un contesto
“normale”, utilizzando cellule staminali mesenchimali murine derivate da midollo osseo (MSCs).
La Figura 16 dimostra che i livelli di IRS-1 diminuiscono in MSCs differenzianti, similmente a
quanto avviene nella linea cellulare di osteosarcoma SaOS-2 e nelle altre linee in grado di
differenziare in senso osteoblastico.
73
Risultati
Figura 16. A.Valutazione tramite AR della capacità di differenziare in senso osteoblastico di
cellule staminali mesenchimali murine derivate da midollo osseo. B. Riduzione dei livelli di
mRNA di IRS-1 al giorno 21 in MSCs (**, p≤0.005).
Allo scopo di confermare l’importanza della via di segnalazione di IGF-1R durante il
differenziamento osteoblastico, è stata inibita l’interazione tra IGF-1 ed il suo recettore
utilizzando l’anticorpo monoclonale αIR-3, che ha consentito di reprimere l’attività tirosinchinasica IGF-1 ed IGF-2-dipendente del recettore [Steele-Perkins G, 1990]. L’effetto
dell’anticorpo è stato testato nella linea di osteosarcoma umano SaOS-2 e nelle MSCs murine. In
presenza dell’anticorpo neutralizzante utilizzato durante i 21 giorni di differenziamento
osteoblastico, è stata osservata una riduzione della formazione di matrice mineralizzata in
entrambe le linee cellulari. Tale dato è stato confermato dai risultati ottenuti in RT-PCR, che
mostrano la riduzione a 14 giorni di osterix (62% per SaOS-2 e 48% per MSC) e a 21 giorni
74
Risultati
dell’osteocalcina (68% per SaOS-2 e 96% per MSC) nelle linee parentali SaOS-2 ed MSCs (Fig
17).
Figura 17. Effetti dell’inibizione della pathway di IGF-1R ottenuta tramite l’utilizzo
dell’anticorpo αIR-3. La colorazione AR e l’estrazione del colorante insieme alle analisi di RTPCR, a 14 giorni per osterix e a 21 giorni per osteocalcina, sono state utilizzate per misurare il
75
Risultati
differenziamento osteoblastico di SaOS-2 (A) ed MSCs (B) dopo l’utilizzo dell’anticorpo
(*,p≤0.05; ***, p≤0.001).
Importanza di IRS-1 durante il differenziamento osteoblastico.
La modulazione dell’espressione di IRS-1 riscontrata durante il processo di
differenziamento osteoblastico nella linea cellulare SaOS-2 e nella linea di MSCs, ha suggerito
che la down-regolazione della stessa proteina potesse promuovere il programma differenziativo.
A questo scopo è stata utilizzata un’infezione retrovirale per trasportare 4 diversi shRNAs (shorthairpin RNA) contro IRS-1 nelle cellule di osteosarcoma umano SaOS-2, nella linea murina di
MSCs e nella linea di osteosarcoma murino 8086. La linea 8086 deriva da un tumore murino
primario; la sua caratterizzazione ha mostrato una maggiore capacità proliferativa di queste
cellule rispetto alle due linee di osteosarcoma umano utilizzate (Figura 18A) ma anche una
minore capacità clonogenica e migratoria (Figura 18B e C).
76
Risultati
Figura 18. A.Valutazione della proliferazione cellulare mediante conta in trypan blu. Le conte
sono state effettuate ogni 24 ore per 96 ore (***, p≤0.001). B. Valutazione della capacità di
formare colonie in condizioni di ancoraggio-indipendenza effettuata a diverse densità di semina.
C. Valutazione della capacità migratoria di SaOS-2, OS-7 e 8086 (***, p≤0.001).
Le 8086 esprimono alti livelli di IRS-1 sia basalmente che in differenziamento, pur essendo in
grado di formare matrice ossea mineralizzata e di esprimere i marcatori di differenziamento
osteoblastico (Figura 19).
Figura 19. Differenziamento osteoblastico della linea di osteosarcoma murino 8086. A.
Formazione di matrice ossea mineralizzata determinata tramite AR dopo 14 giorni di
differenziamento e visualizzata con obiettivo 10X o ingrandita a 40X. Quantificazione del
colorante estratto *, p≤0.05. B. Espressione dei marcatori di differenziamento osteoblastico
osterix a 7 giorni (ns) e osteocalcina a 14 giorni (*, p≤0.05) misurati in RT-PCR. C. Immunoblot
rappresentativo dei livelli di IRS-1 in cellule controllo e differenzianti a 14 giorni.
77
Risultati
La diminuzione dei livelli di espressione di IRS-1 in seguito all’infezione retrovirale è stata
verificata tramite analisi di Western blot (Figura 20). Valutando al densitometro le differenze
rilevate tra le linee infettate con i vettori controllo e quelle infettate con gli shRNAs funzionali si
rileva una riduzione dell’espressione della proteina pari al 95% nella linea cellulare SaOS-2, al
66% nelle MSCs e al 51% nelle 8086.
Figura 20. Riduzione dell’espressione di IRS-1 mediante infezione retrovirale. La diminuzione
dell’espressione della proteina è stata verificata mediante Western blot e successiva analisi
densitometrica. La percentuale di riduzione è pari al 94.6±2.4% nelle SaOS-2, al 65.9% ±10.8%
nelle MSCs ed al 51.2±10.7% nelle 8086.Gli shRNAs cerchiati in rosso sono quelli utilizzati per i
successivi esperimenti.
Le linee cellulari derivate da SaOS-2, MSCs ed 8086 e contenenti i vettori di controllo o gli
shRNAs funzionali sono state testate per la capacità di differenziare in senso osteoblastico,
78
Risultati
utilizzando lo stesso terreno osteogenico impiegato in precedenza. Anche in questo caso il
differenziamento osteoblastico è stato verificato tramite la fromazione di matrice ossea
mineralizzata con l’AR e le successive analisi di RT-PCR hanno consentito di determinare
l’espressione dei marcatori di differenziamento osterix ed osteocalcina. In figura 21 viene
riportata la significativa inibizione della deposizione di calcio osservata in tutte le linee cellulari;
in particolare si ha una riduzione del 33% nelle SaOS-2, del 50% nelle MSCs e del 66% nelle
8086.
Figura 21. Riduzione della desposizione di calcio a 21 giorni di differenziamento osteoblastico
nella linea SaOS-2 e nelle MSCs ed a 14 giorni nella linea 8086, con o senza l’utilizzo degli
shRNA (*, p≤0.05 e ***, p≤0.001 confrontati con le cellule controllo).
79
Risultati
L’analisi dei marcatori di differenziamento in RT-PCR mostra un trend nella riduzione
dell’espressione di osterix al giorno14 ed una significativa diminuzione dei livelli di osteocalcina
al giorno 21 nella linea di osteosarcoma umano SaOS-2 infettata con l’shRNA funzionale e
comparata con la stessa linea infettata con il vettore di controllo. Allo stesso modo le MSCs
infettate con l’shRNA funzionale mostrano una significativa riduzione sia nell’espressione di
osterix al giorno 14, sia in quella dell’osteocalcina a 21 giorni. Le analisi di RT-PCR mostrano
anche la diminuzione statisticamente significativa dell’espressione di osterix al giorno 7 e
dell’osteocalcina al giorno 14 nella linea di osteosarcoma murino 8086 infettata con l’shRNA
funzionale (Figura 22). Di conseguenza, la perdita di IRS-1 genera una riduzione nel potenziale
differenziativo delle linee cellulari analizzate.
80
Risultati
Figura 22. Analisi dell’espressione dei marcatori di differenziamento osteoblastico osterix (al
giorno 14 per SaOS-2 ed MSCs e al giorno 7 per 8086) e osteocalcina (al giorno 21 per SaOS-2
ed MSCs e al giorno 14 per 8086) nelle cellule infettate con gli shRNA e normalizzata sul giorno
0 (*, p≤0.05; **, p≤0.005; ***, p≤0.001).
81
Risultati
L’accumulo di IRS-1 inibisce il differenziamento osteoblastico.
I risultati ottenuti suggeriscono che le cellule sono in grado di differenziare in senso
osteoblastico solo se IRS-1 è espresso a livello basale in un certo range. Modulando la sua
espressione, sia sovra-esprimendone che down-regolandone i livelli proteici, si ottiene
l’inibizione della capacità di differenziare in senso osteoblastico in tutte le linee cellulari
analizzate (Figura 23).
Figura 23. Analisi densitometrica dei livelli di espressione basale di IRS-1 nelle linee parentali e
nei loro trasfettanti.
Per confermare questa osservazione è stata valutata in prima analisi l’attivazione di IRS-1,
misurandone i livelli di fosforilazione in Tyr 612 durante il processo differenziativo, tramite
Western blot, nelle linee SaOS-2 ed MSCs. Non è stata riscontrata alcuna differenza nei livelli di
fosforilazione di IRS-1 tra campioni differenzianti e non differenzianti, suggerendo che i
cambiamenti nello stato di attivazione di IRS-1 non sono coinvolti nella regolazione del
differenziamento osteoblastico (Figura 24).
82
Risultati
Figura 24. Analisi al Western blot e densitometria di IRS-1 fosforilato in Tyr612 o del suo
equivalente murino Tyr608 dopo 21 giorni di differenziamento nelle linee cellulari SaOS-2 ed
MSCs.
Di conseguenza è stato indotto un accumulo di IRS-1, inibendone la degradazione. E’ noto come
la degradazione di IRS-1 venga effettuata mediante il proteasoma [Sun XJ, 1999], pertanto è stato
utilizzato un potente inibitore del proteasoma, MG-132, allo scopo di bloccarne l’attività.
L’inibitore è stato aggiunto al mezzo di coltura nei 21 giorni di differenziamento a concentrazione
10 μM ed è stato riscontrato un aumento nell’espressione di IRS-1 in entrambe le linee cellulari.
Insieme all’accumulo della proteina è stata rilevata la diminuzione della formazione di matrice
ossea mineralizzata mediante AR (Figura 25A). Tale dato è supportato dalla riduzione evidenziata
in RT-PCR della produzione di osterix a 14 giorni di differenziamento e dell’osteocalcina a 21
giorni (Figura 25B). Pertanto la mancata regolazione dei livelli di IRS-1 tramite l’inibizione dei
normali processi di degradazione proteica può inibire il differenziamento osteoblastico.
83
Risultati
Figura 25. Effetti dell’inibitore del proteasoma MG-132 sul differenziamento osteoblastico. A.
Formazione di matrice ossea mineralizzata valutata tramite AR a 21 giorni di differenziamento
con e senza l’utilizzo di MG-132 e sua quantificazione. Western blots relativi all’espressione di
IRS-1 in SaOS-2 ed MSCs in seguito all’impiego di MG-132 durante il differenziamento
osteoblastico. B. Valutazione della produzione dei marcatori di differenziamento osteoblastico
mediante RT-PCR in campioni differenzianti trattati e non trattati con MG-132. (*, p≤0.05; **,
p≤0.005; ***, p≤0.001).
84
Prospettive Future
L’inibizione di IRS-1 tramite NT_157 provoca una riduzione della capacità proliferativa.
Allo scopo di verificare gli effetti della diminuzione dei livelli di espressione di
IRS-1, è stato utilizzato l’inibitore di IRS-1/2 su una delle linee di osteosarcoma
umano a fenotipo non differenziante, le OS-19. In prima istanza è stata verificata
l’efficacia dell’inibitore, misurando i livelli proteici di IRS-1 tramite Western
Blotting. Sono state utilizzate 3 diverse concentrazioni della molecola: 300, 1000 e
3000 nM. In figura 26 è possibile osservare una drastica riduzione della proteina
d’interesse alla dose 3000 nM di NT_157.
Figura 26. Analisi al Western Blot dei livelli di IRS-1 dopo trattamento con l’inibitore NT_157.
85
Prospettive Future
Successivamente è stato valutato l’effetto dello stesso inibitore sulla capacità proliferativa della
stessa linea cellulare, mediante conta in trypan blu (Figura 27).
Figura 27. Inibizione della proliferazione esercitata da NT_157 sulla linea di osteosarcoma umano
OS-19 (*, p≤0.05; **, p≤0.005; ***, p≤0.001).
86
Discussione
Discussione
L’osteosarcoma è un tumore primitivo maligno dell’osso. Nonostante la sua incidenza sia
relativamente bassa, viene annoverato tra i tumori pediatrici più frequenti, rimanendo preminente
anche tra adolescenti e giovani adulti [Longhi A, 2006]. La sua origine resta pressocchè
sconosciuta. Il quadro istologico riscontrato nei pazienti con osteosarcoma lo rende una neoplasia
correlata al grado di differenziamento delle cellule, in cui anomalie genetiche ed epigenetiche
interrompono il normale programma osteogenico cui vanno incontro le cellule staminali
osteoprogenitrici. Alcuni aspetti del fenotipo differenziato vengono effettivamente conservati in
queste cellule patologiche, quali l’espressione di marcatori precoci del differenziamento e la
capacità delle cellule neoplastiche di produrre matrice ossea, seppure in maniera aberrante
[Campanacci M, 1999].
Questo studio identifica IRS-1 come un fattore chiave nel passaggio da cellule immature a
osteoblasti differenziati. IRS-1 è infatti il solo componente della pathway di IGF-1R i cui livelli di
espressione diminuiscono durante la progressione del processo di differenziamento osteoblastico.
I dati illustrati mostrano come il livello basale di IRS-1 sia un importante presupposto per l’avvio
del differenziamento di cellule di osteosarcoma e di MSCs murine. In queste linee cellulari sia la
down-regolazione sia la sovra-espressione di IRS-1 inibiscono il differenziamento osteoblastico.
Bloccando la degradazione di IRS-1 ad opera del proteasoma è possibile inibire il processo
differenziativo; questo suggerisce un importante ruolo della degradazione proteasomica nella
regolazione
del
differenziamento
osteoblastico
IRS-1-dipendente.
La
regolazione
del
differenziamento osteoblastico attraverso l’espressione di IRS-1 potrebbe avere un profondo
effetto sulla severità e sul potenziale metastatico degli osteosarcomi.
IRS-1 è una proteina di ancoraggio per IGF-1R e un regolatore chiave responsabile di
diversi effetti dovuti all’attivazione di questo recettore, quali la proliferazione, il differenziamento
e la trasformazione neoplastica [Valentinis B, 2001]. Nelle linee cellulari analizzate la via di
segnalazione di IGF-1R è essenziale per il differenziamento osteoblastico. Infatti, utilizzando un
anticorpo neutralizzante per bloccare il recettore, il differenziamento viene inibito: nelle SaOS-2 e
87
Discussione
nelle MSCs si assiste ad una riduzione della produzione dei marcatori di differenziamento osterix
ed osteocalcina pari almeno al 50%. Confrontando questi risultati con quelli ottenuti in seguito
alla down-regolazione di IRS-1 si nota come il differenziamento osteoblastico venga inibito ad un
livello pari a quello raggiunto con l’utilizzo dell’anticorpo. In questo modo è stato dimostrato
come pressochè l’intero segnale di differenziamento IGF-1R-dipendente sia dovuto alla
regolazione di IRS-1, la cui funzione non può essere compensata o sostituita da altre proteine. Di
conseguenza, IRS-1 è una proteina critica di questa via di segnalazione durante la transizione da
cellule indifferenziate ad osteoblasti maturi.
I risultati riportati in letteratura riguardo al ruolo di IRS-1 nel differenziamento sono
contrastanti. Questa proteina è stata indicata come un fattore che promuove la crescita e la
proliferazione mentre inibisce l’apoptosi e il differenziamento in colture cellulari emopoietiche
umane 32D, NIH3T3 murine e fibroblasti e cellule epiteliali umane [Valentinis B, 1999] [Baserga
R., 2000]. Altri studi correlano IRS-1 alla promozione del differenziamento delle MSCs. Il
signaling di IRS-1 attraverso PI3K-Akt regola il commitment IGF-1-indotto dei preadipociti in
adipociti maturi nel tessuto adiposo bruno [Cypess AM, 2011], mentre studi in vivo attribuiscono
il differenziamento dei precursori osteoblastici, come le MSCs, in osteoblasti maturi al signaling
di IGF-1 ed Akt, presumibilmente in maniera IRS-1-dipendente. Tali evidenze sono supportate da
uno studio che mostra come il TGF- β1 regoli negativamente il differenziamento osteoblastico di
MSCs umane, pre-osteoblasti MC3T3-E1 umani e cellule dei legamenti periodontali umane
tramite la down-regolazione del signaling di IGF1. In seguito alla perdita di IRS-1, IGF-1 non è in
grado di ristabilire il fenotipo differenziato in queste cellule [Ochiai H, 2012]. Noi stessi abbiamo
verificato la contraddittorietà del ruolo di IRS-1 nell’ambito del differenziamento, infatti una linea
cellulare (OS-9) esprimente bassi livelli della proteina non si è mostrata in grado di differenziare
in senso osteoblastico e due linee che esprimono alti livelli di IRS-1 (OS-14 e 8086) si sono
invece dimostrate capaci di differenziare. Come dimostrato da uno studio del 2009, anche la
localizzazione di IRS-1 è una condizione importante per il differenziamento delle BM-MSCs
(bone-marrow MSCs) in condrociti: la localizzazione nucleare di IRS-1 totale e fosforilato
sembra favorire la proliferazione, mentre il differenziamento condrogenico è favorito da una
localizzazione citoplasmatica della proteina [Longobardi L, 2009]. Il coinvolgimento diretto di
IRS-1 nel differenziamento è stato dimostrato anche tramite l’utilizzo di shRNAs contro IRS-1
nelle MSCs, in seguito al quale le cellule non riescono a differenziare in osteoblasti in assenza
88
Discussione
della proteina o quando trattate con inibitori di PI3K [Granero-Molto F, 2011]. I livelli di IRS-1
nei nostri modelli risultano essere direttamente correlati al differenziamento osteoblastico di
cellule cancerose così come di cellule normali. Nella linea di osteosarcoma umano SaOS-2 la
quantità di IRS-1 diminuisce durante il differenziamento osteoblastico a partire dal giorno 7. La
ragione di questa diminuzione dei livelli proteici resta da determinare ma suggerisce che IRS-1
sia richiesto solo durante le fasi iniziali di questo tipo di differenziamento e che il commitment al
differenziamento terminale porti alla down-regolazione di IRS-1. Ancora più importante della
diminuzione di IRS-1 durante il processo differenziativo risulta essere il livello di IRS-1 all’inizio
del differenziamento. Quando IRS-1 è over-espresso nella stessa linea cellulare SaOS-2, il
differenziamento osteoblastico viene inibito rispetto a quanto avviene nelle stesse cellule wildtype. La stessa osservazione è stata effettuata nei precursori mieloidi 32D, che normalmente non
esprimono IRS-1, dove la sua sovra-espressione inibisce il differenziamento e provoca anche
l’aumento della tumorigenicità delle cellule [Valentinis B, 1999]. Anche nel nostro modello di
osteosarcoma umano l’aumentata espressione di IRS-1 ha portato all’accentuazione delle
proprietà neoplastiche di queste cellule: le linee Sa/pool IRS-1 e OS-7/pool IRS-1 hanno mostrato
una capacità proliferativa, una capacità migratoria e una capacità di formare colonie in condizioni
di ancoraggio indipendenza superiore a quella delle linee parentali. I successivi esperimenti in
vivo, effettuati mediante inoculi sottocute ed endovena, hanno confermato i risultati ottenuti in
vitro: le cellule trasfettate per over-esprimere la proteina hanno dato tumori di dimensioni
maggiori rispetto a quelli generati dalle linee parentali, così come hanno formato un maggior
numero di metastasi sperimentalmente indotte, sia a livello polmonare che a livello epatico.
L’over-espressione di IRS-1 ha influenzato le caratteristiche di malignità di queste cellule anche
diminuendone la capacità differenziativa.
Sorprendentemente, si assiste alla stessa inibizione del differenziamento quando
l’espressione di IRS-1 viene manipolata tramite shRNAs in MSCs e SaOS-2 riducendola. La
diminuzione dei livelli di IRS-1 in queste cellule inibisce infatti il differenziamento quando si
paragonano le cellule manipolate alle cellule controllo. Come precedentemente riportato, il
knockdown di IRS-1 riduce il differenziamento osteoblastico delle MSCs [Granero-Molto F,
2011] [Ochiai H, 2012] [Cypess AM, 2011]. Allo scopo di avere un modello di osteosarcoma più
vicino e quindi più paragonabile anche alla linea mesenchimale murina, è stata impiegata la linea
89
Discussione
di osteosarcoma murino 8086, che mostra una quantità di IRS-1 largamente superiore a quella
riscontrata nelle SaOS-2 e nelle MSCs. Nonostante questa peculiarità, le cellule 8086 sono in
grado di differenziare in senso osteoblastico. L’shRNA impiegato è stato in grado di ridurre i
livelli di espressione della proteina del 51%, ma i livelli di espressione di IRS-1 mostrati dalle
8086 risultano comunque essere 5 volte superiori rispetto alle altre linee cellulari impiegate e pari
alla linea Sa/pool IRS-1, la quale mostra una capacità differenziativa ridotta.
L’importanza dei livelli proteici di IRS-1 è stata confermata dalla valutazione dell’attività
di IRS-1 in questo contesto. Un vasto numero di proteine inclusa PI3K può legare IRS-1 una volta
fosforilata sui residui tirosinici, consentendo la propagazione del segnale di IGF-1R. Nei modelli
considerati non si riscontra alcuna differenza nello stato di fosforilazione in Tyr612 (uomo)/Tyr
608 (topo) di IRS-1, fosforilazione necessaria per l’interazione PI3K-IRS-1, durante il
differenziamento osteoblastico. Questo suggerisce che IRS-1 sia ancora in grado di interagire con
PI3K ed altre proteine di legame. Di conseguenza, la funzione di IRS-1 di proteina di ancoraggio
potrebbe dipendere dalla regolazione stechiometrica dei target di legame a valle [Good MC,
2011]. Nel caso dell’over-espressione, sopra una certa soglia IRS-1 può attivare chinasi e substrati
partner, come PI3K e Akt, in complessi separati, inibendo il signaling. Nella situazione opposta,
cioè in assenza di IRS-1, tali complessi non sono presenti in quantità sufficiente a propagare il
segnale. Un esempio è la via canonica di Wnt/β-catenina, che regola positivamente la formazione
dell’osso e il differenziamento osteoblastico. Tale funzione è dipendente dalla localizzazione
nucleare e dalla attività trascrizionale di β-catenina, conseguenza della prevenzione della
degradazione proteasomica di β-catenina indotta da Wnt che ne aumenta quindi la concentrazione
citoplasmatica [Milat F, 2009]. IRS-1 può legare β-catenina e mediare la sua traslocazione nel
nucleo, ma in assenza di livelli di IRS-1 sufficienti nel citoplasma, la traslocazione nucleare di βcatenina non può essere ostacolata [Chen J, 2005]. Si rende necessario uno studio più attento
dello stato di fosforilazione dei residui target, degli effetti del legame di IRS-1 alle proteine
partners e della localizzazione di questi complessi al fine comprendere meglio la funzione di
sequestro svolta da IRS-1.
Uno dei modi attraverso cui la cellula può regolare i livelli di IRS-1 è la sua degradazione
attraverso il proteasoma. L’inibitore del proteasoma MG-132 è stato quindi utilizzato per indurre
90
Discussione
un accumulo di IRS-1 nelle linee cellulari SaOS-2 ed MSCs. L’aumento della quantità della
proteina ha portato alla diminuzione della capacità differenziativa delle cellule, al pari di quanto
avvenuto over-esprimendo IRS-1 tramite trasfezione nelle SaOS-2. Tale accumulo ha avuto delle
forti ripercussioni, come dimostrato in diverse linee tumorali umane nelle quali IRS-1 è spesso
sovra-espresso. L’espressione ectopica o aumentata di IRS-1 può portare alla trasformazione
cellulare e in questo scenario è noto il coinvolgimento del proteasoma nella regolazione dei livelli
di IRS-1. L’associazione di IRS-1 alla caveolina-1 in fibroblasti derivati da embrioni di topo è in
grado di proteggere IRS-1 da questo tipo di degradazione, portando ad un aumento dei livelli di
IRS-1 e ad una maggiore capacità clonogenica in vitro [Chen J, 2008]. Pertanto, la regolazione
dei livelli di IRS-1 potrebbe migliorare le terapie utilizzate nella cura del cancro, consentendo alle
cellule di raggiungere il differenziamento terminale.
L’osteosarcoma rappresenta un esempio di come la regolazione della pathway di IGF-1R e
in particolare di IRS-1 potrebbe essere importante nella progressione della malattia, poichè lo
stato di differenziamento delle cellule tumorali influenza l’aggressività del tumore stesso
[Scotlandi K, 2008]. In questa patologia il normale processo di differenziamento osteoblastico a
partire da cellule staminali mesenchimali è interrotto, portando allo sviluppo di cellule
indifferenziate maligne e ad una prognosi peggiore. I risultati ottenuti dimostrano che l’alterata
espressione di IRS-1 inibisce il differenziamento osteoblastico ed aumenta le caratteristiche
tumorali delle cellule, pertanto IRS-1 potrebbe essere un target da sfruttare allo scopo di modulare
il differenziamento cellulare in pazienti affetti da osteosarcoma o da altre forme di cancro nelle
quali IRS-1 svolga un ruolo simile e il grado di differenziamento cellulare rappresenti un
parametro importante ai fini prognistici.
91
Bibliografia
Bibliografia
Akune T, Ohba S, Kamekura S, Yamaguchi M, Chung UI, Kubota N et al (2004). PPARgamma
insufficiency enhances osteogenesis through osteoblast formation from bone marrow progenitors.
The Journal of clinical investigation 113: 846-855.
Anderson PM, Tomaras M, McConnell K (2010). Mifamurtide in osteosarcoma--a practical
review. Drugs Today (Barc) 46: 327-337.
Angelov D, (2006). Nucleolin is a histone chaperon with FACT-like activity and assists
remodeling of nucleosomes, EMBO J. 25 1669–1679.
Araki E, Lipes MA, Patti ME, Bruning JC, Haag B, 3rd, Johnson RS et al (1994). Alternative
pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 372:
186-190.
Artandi SE, Chang S, Lee SL, Alson S, Gottlieb GJ, Chin L et al (2000). Telomere dysfunction
promotes non-reciprocal translocations and epithelial cancers in mice. Nature 406: 641-645.
Arteaga CL, Kitten LJ, Coronado EB, Jacobs S, Kull FC, Jr., Allred DC et al (1989). Blockade of
the type I somatomedin receptor inhibits growth of human breast cancer cells in athymic mice.
The Journal of clinical investigation 84: 1418-1423.
Barrios H, Castresana JS, Ruiz J, et al. (1994). Amplification of the cmyc proto-oncogene in soft
tissue sarcomas. Oncology 51:13–7.
Baserga R (1994). Oncogenes and the strategy of growth factors. Cell 79: 927-930.
Baserga R (2000). The contradictions of the insulin-like growth factor 1 receptor. Oncogene 19:
5574-5581.
Baserga R (2009). The insulin receptor substrate-1: a biomarker for cancer? Experimental cell
research 315: 727-732.
90
Bibliografia
Benassi MS, Molendini L, Gamberi G, Ragazzini P, Sollazzo MR, Merli M et al (1999).
Alteration of pRb/p16/cdk4 regulation in human osteosarcoma. International journal of cancer
Journal international du cancer 84: 489-493.
Berg CE, Lavan BE, Rondinone CM (2002). Rapamycin partially prevents insulin resistance
induced by chronic insulin treatment. Biochemical and biophysical research communications
293: 1021-1027.
Bialek P, Kern B, Yang X, Schrock M, Sosic D, Hong N et al (2004). A twist code determines the
onset of osteoblast differentiation. Developmental cell 6: 423-435.
Blyth K, Cameron ER, Neil JC (2005). The RUNX genes: gain or loss of function in cancer.
Nature reviews Cancer 5: 376-387.
Braulke T (1999). Type-2 IGF receptor: a multi-ligand binding protein. Hormone and metabolic
research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 31: 242-246.
Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, Reddel RR (1997). Evidence for an
alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell
lines. Nature medicine 3: 1271-1274.
Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR et al (1995).
Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature 377: 646-649.
Burfoot MS, Rogers NC, Watling D, Smith JM, Pons S, Paonessaw G et al (1997). Janus kinasedependent activation of insulin receptor substrate 1 in response to interleukin-4, oncostatin M, and
the interferons. The Journal of biological chemistry 272: 24183-24190.
Byron SA, Horwitz KB, Richer JK, Lange CA, Zhang X, Yee D (2006). Insulin receptor
substrates mediate distinct biological responses to insulin-like growth factor receptor activation in
breast cancer cells. British journal of cancer 95: 1220-1228.
Cai D, Dhe-Paganon S, Melendez PA, Lee J, Shoelson SE (2003). Two new substrates in insulin
signaling, IRS5/DOK4 and IRS6/DOK5. The Journal of biological chemistry 278: 25323-25330.
Campanacci M. “Bone and soft tissue tumors”. 2nd Edition, Wien: Springer-Verlag, 1999
91
Bibliografia
Campanacci M, Bacci G, Bertoni F, Picci P, Minutillo A, Franceschi C (1981). The treatment of
osteosarcoma of the extremities: twenty year's experience at the Istituto Ortopedico Rizzoli.
Cancer 48: 1569-1581.
Canalis E (2009). Growth factor control of bone mass. Journal of cellular biochemistry 108: 769777.
Chang Q, Li Y, White MF, Fletcher JA, Xiao S (2002). Constitutive activation of insulin receptor
substrate 1 is a frequent event in human tumors: therapeutic implications. Cancer research 62:
6035-6038.
Chen D, Zhao M, Mundy GR (2004). Bone morphogenetic proteins. Growth Factors 22: 233241.
Chen J, Wu A, Sun H, Drakas R, Garofalo C, Cascio S et al (2005). Functional significance of
type 1 insulin-like growth factor-mediated nuclear translocation of the insulin receptor substrate-1
and beta-catenin. The Journal of biological chemistry 280: 29912-29920.
Chen J, Capozza F, Wu A, Deangelis T, Sun H, Lisanti M et al (2008). Regulation of insulin
receptor substrate-1 expression levels by caveolin-1. Journal of cellular physiology 217: 281-289.
Choi JY, Pratap J, Javed A, Zaidi SK, Xing L, Balint E et al (2001). Subnuclear targeting of
Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic
development. Proceedings of the National Academy of Sciences of the United States of America
98: 8650-8655.
Clark SF, Molero JC, James DE (2000). Release of insulin receptor substrate proteins from an
intracellular complex coincides with the development of insulin resistance. The Journal of
biological chemistry 275: 3819-3826.
Clemens TL, Chernausek SD (2004). Genetic strategies for elucidating insulin-like growth factor
action in bone. Growth hormone & IGF research : official journal of the Growth Hormone
Research Society and the International IGF Research Society 14: 195-199.
Clemmons DR (2001). Use of mutagenesis to probe IGF-binding protein structure/function
relationships, Endocr. Rev. 22:800–817.
Cormier JN, Pollock RE (2004). Soft tissue sarcomas. CA: a cancer journal for clinicians 54: 94109.
92
Bibliografia
Craparo A, O'Neill TJ, Gustafson TA (1995). Non-SH2 domains within insulin receptor substrate1 and SHC mediate their phosphotyrosine-dependent interaction with the NPEY motif of the
insulin-like growth factor I receptor. The Journal of biological chemistry 270: 15639-15643.
Cristofanelli B, Valentinis B, Soddu S, Rizzo MG, Marchetti A, Bossi G et al (2000). Cooperative
transformation of 32D cells by the combined expression of IRS-1 and V-Ha-Ras. Oncogene 19:
3245-3255.
Cypess AM, Zhang H, Schulz TJ, Huang TL, Espinoza DO, Kristiansen K et al (2011).
Insulin/IGF-I regulation of necdin and brown adipocyte differentiation via CREB- and FoxO1associated pathways. Endocrinology 152: 3680-3689.
D'Ambrosio C, Keller SR, Morrione A, Lienhard GE, Baserga R, Surmacz E (1995).
Transforming potential of the insulin receptor substrate 1. Cell growth & differentiation : the
molecular biology journal of the American Association for Cancer Research 6: 557-562.
D’Ercole AJ (2008). Expanding the mind: IGF-I and brain development. Endocrinology.
Dec;149(12):5958-62.
De Fea K, Roth RA (1997). Modulation of insulin receptor substrate-1 tyrosine phosphorylation
and function by mitogen-activated protein kinase. The Journal of biological chemistry 272:
31400-31406.
DeAngelis T, Chen J, Wu A, Prisco M, Baserga R (2006). Transformation by the simian virus 40
T antigen is regulated by IGF-I receptor and IRS-1 signaling. Oncogene 25: 32-42.
Deyrup AT, Montag AG, Inwards CY, Xu Z, Swee RG, Krishnan Unni K (2007). Sarcomas
arising in Paget disease of bone: a clinicopathologic analysis of 70 cases. Archives of pathology &
laboratory medicine 131: 942-946.
Di Cresce C, Koropatnick J (2010). Antisense treatment in human prostate cancer and melanoma.
Current cancer drug targets 10: 555-565.
DiGiovanni J, Kiguchi K, Frijhoff A, Wilker E, Bol DK, Beltran L et al (2000). Deregulated
expression of insulin-like growth factor 1 in prostate epithelium leads to neoplasia in transgenic
mice. Proceedings of the National Academy of Sciences of the United States of America 97: 34553460.
Dobreva G, Chahrour M, Dautzenberg M, Chirivella L, Kanzler B, Farinas I et al (2006). SATB2
is a multifunctional determinant of craniofacial patterning and osteoblast differentiation. Cell 125:
971-986.
93
Bibliografia
Dorfman HD, Czerniak B (1995). Bone cancers. Cancer 75: 203-210.
Ducy P, Karsenty G (1995). Two distinct osteoblast-specific cis-acting elements control
expression of a mouse osteocalcin gene. Molecular and cellular biology 15: 1858-1869.
Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G (1997). Osf2/Cbfa1: a transcriptional
activator of osteoblast differentiation. Cell 89: 747-754.
Duguay SJ, Milewski WM, Young BD, Nakayama K, Steiner DF (1997). Processing of wild-type
and mutant proinsulin-like growth factor-IA by subtilisin-related proprotein convertases. The
Journal of biological chemistry 272: 6663-6670.
Eck MJ, Dhe-Paganon S, Trub T, Nolte RT, Shoelson SE (1996). Structure of the IRS-1 PTB
domain bound to the juxtamembrane region of the insulin receptor. Cell 85: 695-705.
Efeyan A, Sabatini DM (2010). mTOR and cancer: many loops in one pathway. Current opinion
in cell biology 22: 169-176.
Engels EA (2005). Cancer risk associated with receipt of vaccines contaminated with simian virus
40: epidemiologic research. Expert review of vaccines 4: 197-206.
Enneking WF (1979). Advances and treatment of primary bone tumors. The Journal of the
Florida Medical Association 66: 28-30.
Esposito DL, Aru F, Lattanzio R, Morgano A, Abbondanza M, Malekzadeh R et al (2012). The
insulin receptor substrate 1 (IRS1) in intestinal epithelial differentiation and in colorectal cancer.
PloS one 7: e36190.
Feng Y, Dimitrov DS (2012). Antibody-based therapeutics against components of the IGF
system. Oncoimmunology 1: 1390-1391.
Finkel MP, Biskis BO, Jinkins PB (1966). Virus induction of osteosarcomas in mice. Science
151: 698-701.
Frampton JE (2010). Mifamurtide: a review of its use in the treatment of osteosarcoma.
Paediatric drugs 12: 141-153.
94
Bibliografia
Frystyk J (2004). Free insulin-like growth factors -- measurements and relationships to growth
hormone secretion and glucose homeostasis. Growth hormone & IGF research : official journal
of the Growth Hormone Research Society and the International IGF Research Society 14: 337375.
Fuchs B, Pritchard DJ (2002). Etiology of osteosarcoma. Clinical orthopaedics and related
research: 40-52.
Furstenberger G, Senn HJ (2002). Insulin-like growth factors and cancer. The lancet oncology 3:
298-302.
Gallagher EJ, LeRoith D (2011). Minireview: IGF, Insulin, and Cancer. Endocrinology 152:
2546-2551.
Gammeltoft S, Ballotti R, Kowalski A, Westermark B, Van Obberghen E (1988). Expression of
two types of receptor for insulin-like growth factors in human malignant glioma. Cancer research
48: 1233-1237.
Gandhi A, Beam HA, O'Connor JP, Parsons JR, Lin SS (2005). The effects of local insulin
delivery on diabetic fracture healing. Bone 37: 482-490.
Garofalo C, Manara MC, Nicoletti G, Marino MT, Lollini PL, Astolfi A et al (2011). Efficacy of
and resistance to anti-IGF-1R therapies in Ewing's sarcoma is dependent on insulin receptor
signaling. Oncogene 30: 2730-2740.
Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS et al (2005). Canonical
WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. The
Journal of biological chemistry 280: 33132-33140.
Gibbs CP, Kukekov VG, Reith JD, Tchigrinova O, Suslov ON, Scott EW et al (2005). Stem-like
cells in bone sarcomas: implications for tumorigenesis. Neoplasia 7: 967-976.
Gobbi G, Sangiorgi L, Lenzi L, Casadei R, Canaider S, Strippoli P et al (2002). Seven BMPs and
all their receptors are simultaneously expressed in osteosarcoma cells. International journal of
oncology 20: 143-147.
Goetsch L, Corvaia N (2009). Insulin-like growth factor receptor type I as a target for cancer
therapy. Immunotherapy 1: 265-279.
95
Bibliografia
Good MC, Zalatan JG, Lim WA (2011). Scaffold proteins: hubs for controlling the flow of
cellular information. Science 332: 680-686.
Gorlick R, Anderson P, Andrulis I, Arndt C, Beardsley GP, Bernstein M et al (2003). Biology of
childhood osteogenic sarcoma and potential targets for therapeutic development: meeting
summary. Clinical cancer research : an official journal of the American Association for Cancer
Research 9: 5442-5453.
Granero-Molto F, Myers TJ, Weis JA, Longobardi L, Li T, Yan Y et al (2011). Mesenchymal
stem cells expressing insulin-like growth factor-I (MSCIGF) promote fracture healing and restore
new bone formation in Irs1 knockout mice: analyses of MSCIGF autocrine and paracrine
regenerative effects. Stem Cells 29: 1537-1548.
Greene MW, Sakaue H, Wang L, Alessi DR, Roth RA (2003). Modulation of insulin-stimulated
degradation of human insulin receptor substrate-1 by Serine 312 phosphorylation. The Journal of
biological chemistry 278: 8199-8211.
Grigoriadis AE, Wang ZQ, Wagner EF (1995). Fos and bone cell development: lessons from a
nuclear oncogene. Trends in genetics : TIG 11: 436-441.
Gualberto, A. et al. (2008). Characterization of NSCLC patients responding to anti-IGF-IR
therapy. J. Clin. Oncol. 26 (May 20 Suppl.), 8000.
Guertin DA, Sabatini DM (2005). An expanding role for mTOR in cancer. Trends in molecular
medicine 11: 353-361.
Gutierrez S, Javed A, Tennant DK, van Rees M, Montecino M, Stein GS et al (2002).
CCAAT/enhancer-binding proteins (C/EBP) beta and delta activate osteocalcin gene transcription
and synergize with Runx2 at the C/EBP element to regulate bone-specific expression. The
Journal of biological chemistry 277: 1316-1323.
Habuchi T (2006). Common genetic polymorphisms and prognosis of sporadic cancers: prostate
cancer as a model. Future Oncol 2: 233-245.
Hakuno F, Yamauchi Y, Kaneko G, Yoneyama Y, Nakae J, Chida K et al (2011). Constitutive
expression of insulin receptor substrate (IRS)-1 inhibits myogenic differentiation through nuclear
exclusion of Foxo1 in L6 myoblasts. PloS one 6: e25655.
96
Bibliografia
Hansen MF, Seton M, Merchant A (2006). Osteosarcoma in Paget's disease of bone. Journal of
bone and mineral research : the official journal of the American Society for Bone and Mineral
Research 21 Suppl 2: P58-63.
Hartmann C (2006). A Wnt canon orchestrating osteoblastogenesis. Trends in cell biology 16:
151-158.
Hartog H, Wesseling J, Boezen HM, van der Graaf WT (2007). The insulin-like growth factor 1
receptor in cancer: old focus, new future. Eur J Cancer 43: 1895-1904.
Hassan MQ, Javed A, Morasso MI, Karlin J, Montecino M, van Wijnen AJ et al (2004). Dlx3
transcriptional regulation of osteoblast differentiation: temporal recruitment of Msx2, Dlx3, and
Dlx5 homeodomain proteins to chromatin of the osteocalcin gene. Molecular and cellular biology
24: 9248-9261.
Hayden JB, Hoang BH (2006). Osteosarcoma: basic science and clinical implications. The
Orthopedic clinics of North America 37: 1-7.
Haydon RC, Deyrup A, Ishikawa A, Heck R, Jiang W, Zhou L et al (2002). Cytoplasmic and/or
nuclear accumulation of the beta-catenin protein is a frequent event in human osteosarcoma.
International journal of cancer Journal international du cancer 102: 338-342.
He W, Craparo A, Zhu Y, O'Neill TJ, Wang LM, Pierce JH et al (1996). Interaction of insulin
receptor substrate-2 (IRS-2) with the insulin and insulin-like growth factor I receptors. Evidence
for two distinct phosphotyrosine-dependent interaction domains within IRS-2. The Journal of
biological chemistry 271: 11641-11645.
Heidegger I, Pircher A, Klocker H, Massoner P (2011). Targeting the insulin-like growth factor
network in cancer therapy. Cancer biology & therapy 11: 701-707.
Heron-Milhavet L, LeRoith D (2002). Insulin-like growth factor I induces MDM2-dependent
degradation of p53 via the p38 MAPK pathway in response to DNA damage. The Journal of
biological chemistry 277: 15600-15606.
Hoang BH, Kubo T, Healey JH, Sowers R, Mazza B, Yang R et al (2004). Expression of LDL
receptor-related protein 5 (LRP5) as a novel marker for disease progression in high-grade
osteosarcoma. International journal of cancer Journal international du cancer 109: 106-111.
97
Bibliografia
Holleville N, Mateos S, Bontoux M, Bollerot K, Monsoro-Burq AH (2007). Dlx5 drives Runx2
expression and osteogenic differentiation in developing cranial suture mesenchyme.
Developmental biology 304: 860-874.
Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM (1996). IRS-1mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesity-induced
insulin resistance. Science 271: 665-668.
Hughes FJ, Turner W, Belibasakis G, Martuscelli G (2006). Effects of growth factors and
cytokines on osteoblast differentiation. Periodontology 2000 41: 48-72.
Huvos AG. (1991). Bone Tumors: Diagnosis. Treatment and Prognosis 2nd edition. Philadelphia,
W.B. Saunders. Co.
Jaffe N. Malignant bone tumors in children: incidence and etiologic considerations. In: Jaffe N,
ed. Solid Tumors in Childhood. Littleton, MA: PSG Publishing Co; 1979:1-10.
Janghorbani M, Feskanich D, Willett WC, Hu F (2006). Prospective study of diabetes and risk of
hip fracture: the Nurses' Health Study. Diabetes care 29: 1573-1578.
Janssens K, ten Dijke P, Janssens S, Van Hul W (2005). Transforming growth factor-beta1 to the
bone. Endocrine reviews 26: 743-774.
Jeon MJ, Kim JA, Kwon SH, Kim SW, Park KS, Park SW et al (2003). Activation of peroxisome
proliferator-activated receptor-gamma inhibits the Runx2-mediated transcription of osteocalcin in
osteoblasts. The Journal of biological chemistry 278: 23270-23277.
Jilka RL, Weinstein RS, Bellido T, Parfitt AM, Manolagas SC (1998). Osteoblast programmed
cell death (apoptosis): modulation by growth factors and cytokines. Journal of bone and mineral
research : the official journal of the American Society for Bone and Mineral Research 13: 793802.
Jochum W, David JP, Elliott C, Wutz A, Plenk H, Jr., Matsuo K et al (2000). Increased bone
formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nature
medicine 6: 980-984.
Jones DC, Wein MN, Oukka M, Hofstaetter JG, Glimcher MJ, Glimcher LH (2006). Regulation
of adult bone mass by the zinc finger adapter protein Schnurri-3. Science 312: 1223-1227.
98
Bibliografia
Jones RA, Campbell CI, Wood GA, Petrik JJ, Moorehead RA (2009). Reversibility and
recurrence of IGF-IR-induced mammary tumors. Oncogene 28: 2152-2162.
Kansara M, Thomas DM (2007). Molecular pathogenesis of osteosarcoma. DNA and cell biology
26: 1-18.
Kenner L, Hoebertz A, Beil FT, Keon N, Karreth F, Eferl R et al (2004). Mice lacking JunB are
osteopenic due to cell-autonomous osteoblast and osteoclast defects. The Journal of cell biology
164: 613-623.
Kloen P, Gebhardt MC, Perez-Atayde A, Rosenberg AE, Springfield DS, Gold LI et al (1997).
Expression of transforming growth factor-beta (TGF-beta) isoforms in osteosarcomas: TGF-beta3
is related to disease progression. Cancer 80: 2230-2239.
Kobayashi H, Gao Y, Ueta C, Yamaguchi A, Komori T (2000). Multilineage differentiation of
Cbfa1-deficient calvarial cells in vitro. Biochemical and biophysical research communications
273: 630-636.
Koda M, Sulkowska M, Kanczuga-Koda L, Sulkowski S (2005). Expression of insulin receptor
substrate 1 in primary breast cancer and lymph node metastases. Journal of clinical pathology 58:
645-649.
Koga T, Matsui Y, Asagiri M, Kodama T, de Crombrugghe B, Nakashima K et al (2005). NFAT
and Osterix cooperatively regulate bone formation. Nature medicine 11: 880-885.
Kolb EA, Kamara D, Zhang W, Lin J, Hingorani P, Baker L et al (2010). R1507, a fully human
monoclonal antibody targeting IGF-1R, is effective alone and in combination with rapamycin in
inhibiting growth of osteosarcoma xenografts. Pediatric blood & cancer 55: 67-75.
Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K et al (1997). Targeted
disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of
osteoblasts. Cell 89: 755-764.
Komori T (2006). [Mechanism of transcriptional regulation by Runx2 in osteoblasts]. Clinical
calcium 16: 801-807.
Krassas GE, Papadopoulou P, Koliakos G, Konstantinidis T, Kalothetou K (2003). Growth
hormone, insulin growth factor-1, and igf binding protein-3 axis relationship with bone mineral
density among healthy men. Archives of andrology 49: 191-199.
99
Bibliografia
Kream BE, Smith MD, Canalis E, Raisz LG (1985). Characterization of the effect of insulin on
collagen synthesis in fetal rat bone. Endocrinology 116: 296-302.
Krook A, O'Rahilly S (1996). Mutant insulin receptors in syndromes of insulin resistance.
Bailliere's clinical endocrinology and metabolism 10: 97-122.
Lassak A, Del Valle L, Peruzzi F, Wang JY, Enam S, Croul S et al (2002). Insulin receptor
substrate 1 translocation to the nucleus by the human JC virus T-antigen. The Journal of
biological chemistry 277: 17231-17238.
Lavan BE, Fantin VR, Chang ET, Lane WS, Keller SR, Lienhard GE (1997). A novel 160-kDa
phosphotyrosine protein in insulin-treated embryonic kidney cells is a new member of the insulin
receptor substrate family. The Journal of biological chemistry 272: 21403-21407.
Lawlor MA, Alessi DR (2001). PKB/Akt: a key mediator of cell proliferation, survival and
insulin responses? Journal of cell science 114: 2903-2910.
Le Marchand L, Donlon T, Seifried A, Kaaks R, Rinaldi S, Wilkens LR (2002). Association of a
common polymorphism in the human GH1 gene with colorectal neoplasia. Journal of the
National Cancer Institute 94: 454-460.
Lee CS, Yi JS, Jung SY, Kim BW, Lee NR, Choo HJ et al (2010). TRIM72 negatively regulates
myogenesis via targeting insulin receptor substrate-1. Cell death and differentiation 17: 12541265.
Lee H, Volonte D, Galbiati F, Iyengar P, Lublin DM, Bregman DB et al (2000). Constitutive and
growth factor-regulated phosphorylation of caveolin-1 occurs at the same site (Tyr-14) in vivo:
identification of a c-Src/Cav-1/Grb7 signaling cassette. Mol Endocrinol 14: 1750-1775.
Lengner CJ, Steinman HA, Gagnon J, Smith TW, Henderson JE, Kream BE et al (2006).
Osteoblast differentiation and skeletal development are regulated by Mdm2-p53 signaling. The
Journal of cell biology 172: 909-921.
Li J, DeFea K, Roth RA (1999). Modulation of insulin receptor substrate-1 tyrosine
phosphorylation by an Akt/phosphatidylinositol 3-kinase pathway. The Journal of biological
chemistry 274: 9351-9356.
Li Y, Meng G, Huang L, Guo QN (2009). Hypomethylation of the P3 promoter is associated with
up-regulation of IGF2 expression in human osteosarcoma. Human pathology 40: 1441-1447.
100
Bibliografia
Lian JB, Javed A, Zaidi SK, Lengner C, Montecino M, van Wijnen AJ et al (2004). Regulatory
controls for osteoblast growth and differentiation: role of Runx/Cbfa/AML factors. Critical
reviews in eukaryotic gene expression 14: 1-41.
Liu W, Toyosawa S, Furuichi T, Kanatani N, Yoshida C, Liu Y et al (2001). Overexpression of
Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures.
The Journal of cell biology 155: 157-166.
Logan CY, Nusse R (2004). The Wnt signaling pathway in development and disease. Annual
review of cell and developmental biology 20: 781-810.
Lonardo F, Ueda T, Huvos AG, Healey J, Ladanyi M (1997). p53 and MDM2 alterations in
osteosarcomas: correlation with clinicopathologic features and proliferative rate. Cancer 79:
1541-1547.
Longhi A, Barbieri E, Fabbri N, Macchiagodena M, Favale L, Lippo C et al (2003). Radiationinduced osteosarcoma arising 20 years after the treatment of Ewing's sarcoma. Tumori 89: 569572.
Longhi A, Errani C, De Paolis M, Mercuri M, Bacci G (2006). Primary bone osteosarcoma in the
pediatric age: state of the art. Cancer treatment reviews 32: 423-436.
Longobardi L, Granero-Molto F, O'Rear L, Myers TJ, Li T, Kregor PJ et al (2009). Subcellular
localization of IRS-1 in IGF-I-mediated chondrogenic proliferation, differentiation and
hypertrophy of bone marrow mesenchymal stem cells. Growth Factors 27: 309-320.
Luk F, Yu Y, Walsh WR, Yang JL (2011). IGF1R-targeted therapy and its enhancement of
doxorubicin chemosensitivity in human osteosarcoma cell lines. Cancer investigation 29: 521532.
Ma L, Golden S, Wu L, Maxson R (1996). The molecular basis of Boston-type craniosynostosis:
the Pro148-->His mutation in the N-terminal arm of the MSX2 homeodomain stabilizes DNA
binding without altering nucleotide sequence preferences. Human molecular genetics 5: 19151920.
MacEwen EG, Pastor J, Kutzke J, Tsan R, Kurzman ID, Thamm DH et al (2004). IGF-1 receptor
contributes to the malignant phenotype in human and canine osteosarcoma. Journal of cellular
biochemistry 92: 77-91.
101
Bibliografia
Maelandsmo GM, Berner JM, Florenes VA, Forus A, Hovig E, Fodstad O et al (1995).
Homozygous deletion frequency and expression levels of the CDKN2 gene in human sarcomas-relationship to amplification and mRNA levels of CDK4 and CCND1. British journal of cancer
72: 393-398.
Marie PJ (2008). Transcription factors controlling osteoblastogenesis. Archives of biochemistry
and biophysics 473: 98-105.
Marina N, Gorlick R (2009). Immune approaches to treating osteosarcoma. Cancer biology &
therapy 8: 981-983.
Maruyama Z, Yoshida CA, Furuichi T, Amizuka N, Ito M, Fukuyama R et al (2007). Runx2
determines bone maturity and turnover rate in postnatal bone development and is involved in
bone loss in estrogen deficiency. Developmental dynamics : an official publication of the
American Association of Anatomists 236: 1876-1890.
Mascarenhas L, Siegel S, Spector L, et al. Malignant bone tumors. In: Bleyer A, O’Leary M, Barr
R, et al., eds. Cancer Epidemiology in Older Adolescents and Young Adults 15 to 29 Years of
Age, Including SEER Incidence and Survival: 1975–2000.
Massague J (1998). TGF-beta signal transduction. Annual review of biochemistry 67: 753-791.
McIntyre JF, Smith-Sorensen B, Friend SH, Kassell J, Borresen AL, Yan YX et al (1994).
Germline mutations of the p53 tumor suppressor gene in children with osteosarcoma. Journal of
clinical oncology : official journal of the American Society of Clinical Oncology 12: 925-930.
Mendez R, Welsh G, Kleijn M, Myers MG, White MF, Proud CG et al (2001). Regulation of
protein synthesis by insulin through IRS-1. Progress in molecular and subcellular biology 26: 4993.
Mendoza S, David H, Gaylord GM, Miller CW (2005). Allelic loss at 10q26 in osteosarcoma in
the region of the BUB3 and FGFR2 genes. Cancer genetics and cytogenetics 158: 142-147.
Mendoza SM, Konishi T, Miller CW (1998). Integration of SV40 in human osteosarcoma DNA.
Oncogene 17: 2457-2462.
102
Bibliografia
Merchant MS, Melchionda F, Sinha M, Khanna C, Helman L, Mackall CL (2007). Immune
reconstitution prevents metastatic recurrence of murine osteosarcoma. Cancer immunology,
immunotherapy : CII 56: 1037-1046.
Meyers PA, Heller G, Healey J, Huvos A, Lane J, Marcove R et al (1992). Chemotherapy for
nonmetastatic osteogenic sarcoma: the Memorial Sloan-Kettering experience. Journal of clinical
oncology : official journal of the American Society of Clinical Oncology 10: 5-15.
Milat F, Ng KW (2009). Is Wnt signalling the final common pathway leading to bone formation?
Molecular and cellular endocrinology 310:52-62.
Monesi V, Adamo S, Carinci P, Molinaro M, Siracusa G, Stefanini M, Ziparo E (2008). Istologia
di V. Monesi. Piccin Editore, 5° edizione.
Moore C, Eslin D, Levy A, Roberson J, Giusti V, Sutphin R (2010). Prognostic significance of
early lymphocyte recovery in pediatric osteosarcoma. Pediatric blood & cancer 55: 1096-1102.
Murphey MD, Robbin MR, McRae GA, Flemming DJ, Temple HT, Kransdorf MJ (1997). The
many faces of osteosarcoma. Radiographics : a review publication of the Radiological Society of
North America, Inc 17: 1205-1231.
Myers MG, Jr., Grammer TC, Brooks J, Glasheen EM, Wang LM, Sun XJ et al (1995). The
pleckstrin homology domain in insulin receptor substrate-1 sensitizes insulin signaling. The
Journal of biological chemistry 270: 11715-11718.
Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR et al (2002). The novel zinc
finger-containing transcription factor osterix is required for osteoblast differentiation and bone
formation. Cell 108: 17-29.
Nishio Y, Dong Y, Paris M, O'Keefe RJ, Schwarz EM, Drissi H (2006). Runx2-mediated
regulation of the zinc finger Osterix/Sp7 gene. Gene 372: 62-70.
O'Connor R (2003). Regulation of IGF-I receptor signaling in tumor cells. Hormone and
metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 35: 771777.
Ochiai H, Okada S, Saito A, Hoshi K, Yamashita H, Takato T et al (2012). Inhibition of insulinlike growth factor-1 (IGF-1) expression by prolonged transforming growth factor-beta1 (TGF103
Bibliografia
beta1) administration suppresses osteoblast differentiation. The Journal of biological chemistry
287: 22654-22661.
Ogawa W, Matozaki T, Kasuga M (1998). Role of binding proteins to IRS-1 in insulin signalling.
Molecular and cellular biochemistry 182: 13-22.
Ornitz DM, Marie PJ (2002). FGF signaling pathways in endochondral and intramembranous
bone development and human genetic disease. Genes & development 16: 1446-1465.
Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR et al (1997). Cbfa1, a
candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and
bone development. Cell 89: 765-771.
Ouban A, Muraca P, Yeatman T, Coppola D (2003). Expression and distribution of insulin-like
growth factor-1 receptor in human carcinomas. Human pathology 34: 803-808.
Pandini G, Vigneri R, Costantino A, Frasca F, Ippolito A, Fujita-Yamaguchi Y et al (1999).
Insulin and insulin-like growth factor-I (IGF-I) receptor overexpression in breast cancers leads to
insulin/IGF-I hybrid receptor overexpression: evidence for a second mechanism of IGF-I
signaling. Clinical cancer research : an official journal of the American Association for Cancer
Research 5: 1935-1944.
Parton RG, Simons K (2007). The multiple faces of caveolae. Nature reviews Molecular cell
biology 8: 185-194.
Peister A, Mellad JA, Larson BL, Hall BM, Gibson LF, Prockop DJ (2004). Adult stem cells from
bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates
of proliferation, and differentiation potential. Blood 103: 1662-1668.
Pete G, Fuller CR, Oldham JM, Smith DR, D'Ercole AJ, Kahn CR et al (1999). Postnatal growth
responses to insulin-like growth factor I in insulin receptor substrate-1-deficient mice.
Endocrinology 140: 5478-5487.
Picci P (2007). Osteosarcoma (osteogenic sarcoma). Orphanet journal of rare diseases 2: 6.
Pollak M, Richard M (1990). Suramin blockade of insulinlike growth factor I-stimulated
proliferation of human osteosarcoma cells. Journal of the National Cancer Institute 82: 13491352.
104
Bibliografia
Pollak M, Sem AW, Richard M, Tetenes E, Bell R (1992). Inhibition of metastatic behavior of
murine osteosarcoma by hypophysectomy. Journal of the National Cancer Institute 84: 966-971.
Pollak M (2008). Insulin and insulin-like growth factor signalling in neoplasia. Nature reviews
Cancer 8: 915-928.
Pun KK, Lau P, Ho PW (1989). The characterization, regulation, and function of insulin receptors
on osteoblast-like clonal osteosarcoma cell line. Journal of bone and mineral research : the
official journal of the American Society for Bone and Mineral Research 4: 853-862.
Ragazzini P, Gamberi G, Benassi MS, Orlando C, Sestini R, Ferrari C et al (1999). Analysis of
SAS gene and CDK4 and MDM2 proteins in low-grade osteosarcoma. Cancer detection and
prevention 23: 129-136.
Ravichandran KS (2001). Signaling via Shc family adapter proteins. Oncogene 20: 6322-6330.
Reidy-Lagunes DL, Vakiani E, Segal MF, Hollywood EM, Tang LH, Solit DB et al (2012). A
phase 2 study of the insulin-like growth factor-1 receptor inhibitor MK-0646 in patients with
metastatic, well-differentiated neuroendocrine tumors. Cancer 118: 4795-4800.
Reiss K (2001). Mechanism of regulation of cell adhesion and motility by insulin receptor
substrate-1 in prostate cancer cells. Oncogene 20:490–500.
Reiss K, Del Valle L, Lassak A, Trojanek J (2012). Nuclear IRS-1 and cancer. Journal of cellular
physiology 227: 2992-3000.
Rosemburg SA (1979). Treatment of osteogenic sarcoma. Effect of adjuvant high-dose
Methotrexate after amputation. Cancer Treat Rep. 63:739–51.
Rubin R, Arzumanyan A, Soliera AR, Ross B, Peruzzi F, Prisco M (2007). Insulin receptor
substrate (IRS)-1 regulates murine embryonic stem (mES) cells self-renewal. Journal of cellular
physiology 213: 445-453.
Salani B, Briatore L, Garibaldi S, Cordera R, Maggi D (2008). Caveolin-1 down-regulation
inhibits insulin-like growth factor-I receptor signal transduction in H9C2 rat cardiomyoblasts.
Endocrinology 149: 461-465.
105
Bibliografia
Samani AA, Yakar S, LeRoith D, Brodt P (2007). The role of the IGF system in cancer growth
and metastasis: overview and recent insights. Endocrine reviews 28: 20-47.
Sandberg AA, Bridge JA. (2003). Updates on the cytogenetics and molecular genetics of bone
and soft tissue tumors: osteosarcoma and related tumors. Cancer Genet Cytogenet, Aug;145(1):130.
Sangaletti S, Stoppacciaro A, Guiducci C, Torrisi MR, Colombo MP (2003). Leukocyte, rather
than tumor-produced SPARC, determines stroma and collagen type IV deposition in mammary
carcinoma. The Journal of experimental medicine 198: 1475-1485.
Satokata I, Ma L, Ohshima H, Bei M, Woo I, Nishizawa K et al (2000). Msx2 deficiency in mice
causes pleiotropic defects in bone growth and ectodermal organ formation. Nature genetics 24:
391-395.
Savage SA, Woodson K, Walk E, Modi W, Liao J, Douglass C et al (2007). Analysis of genes
critical for growth regulation identifies Insulin-like Growth Factor 2 Receptor variations with
possible functional significance as risk factors for osteosarcoma. Cancer epidemiology,
biomarkers & prevention : a publication of the American Association for Cancer Research,
cosponsored by the American Society of Preventive Oncology 16: 1667-1674.
Scartozzi M, Bianconi M, Maccaroni E, Giampieri R, Del Prete M, Berardi R et al (2011). State
of the art and future perspectives for the use of insulin-like growth factor receptor 1 (IGF-1R)
targeted treatment strategies in solid tumors. Discovery medicine 11: 144-153.
Schaffer BS, Lin MF, Byrd JC, Park JH, MacDonald RG (2003). Opposing roles for the insulinlike growth factor (IGF)-II and mannose 6-phosphate (Man-6-P) binding activities of the IGFII/Man-6-P receptor in the growth of prostate cancer cells. Endocrinology 144: 955-966.
Scheel C, Schaefer KL, Jauch A, Keller M, Wai D, Brinkschmidt C, van Valen F, Boecker W,
Dockhorn-Dworniczak B, Poremba C. (2001). Alternative lengthening of telomeres is associated
with chromosomal instability in osteosarcomas. Oncogene 20(29):3835-44.
Schmidt K, Schinke T, Haberland M, Priemel M, Schilling AF, Mueldner C et al (2005). The
high mobility group transcription factor Sox8 is a negative regulator of osteoblast differentiation.
The Journal of cell biology 168: 899-910.
106
Bibliografia
Schmitz-Peiffer C, Whitehead JP (2003). IRS-1 regulation in health and disease. IUBMB life 55:
367-374.
Schubert M, Brazil DP, Burks DJ, Kushner JA, Ye J, Flint CL et al (2003). Insulin receptor
substrate-2 deficiency impairs brain growth and promotes tau phosphorylation. The Journal of
neuroscience : the official journal of the Society for Neuroscience 23: 7084-7092.
Schwartz AL, Ciechanover A (1999). The ubiquitin-proteasome pathway and pathogenesis of
human diseases. Annual review of medicine 50: 57-74.
Sciacca L, Mineo R, Pandini G, Murabito A, Vigneri R, Belfiore A (2002). In IGF-I receptordeficient leiomyosarcoma cells autocrine IGF-II induces cell invasion and protection from
apoptosis via the insulin receptor isoform A. Oncogene 21: 8240-8250.
Scotlandi K, Manara MC, Nicoletti G, Lollini PL, Lukas S, Benini S et al (2005). Antitumor
activity of the insulin-like growth factor-I receptor kinase inhibitor NVP-AEW541 in
musculoskeletal tumors. Cancer research 65: 3868-3876.
Scotlandi K, Picci P (2008). Targeting insulin-like growth factor 1 receptor in sarcomas. Current
opinion in oncology 20: 419-427.
Seccareccia E, Brodt P (2012). The role of the insulin-like growth factor-I receptor in malignancy:
an update. Growth hormone & IGF research : official journal of the Growth Hormone Research
Society and the International IGF Research Society 22: 193-199.
Shen YM, Yang XC, Yang C, Shen JK (2008). Enhanced therapeutic effects for human pancreatic
cancer by application K-ras and IGF-IR antisense oligodeoxynucleotides. World journal of
gastroenterology : WJG 14: 5176-5185.
Shetty PJ, Movva S, Pasupuleti N, Vedicherlla B, Vattam KK, Venkatasubramanian S et al
(2011). Regulation of IGF2 transcript and protein expression by altered methylation in breast
cancer. Journal of cancer research and clinical oncology 137: 339-345.
Shirakabe K, Terasawa K, Miyama K, Shibuya H, Nishida E (2001). Regulation of the activity of
the transcription factor Runx2 by two homeobox proteins, Msx2 and Dlx5. Genes to cells :
devoted to molecular & cellular mechanisms 6: 851-856.
Spentzos D, Cannistra SA, Grall F, Levine DA, Pillay K, Libermann TA et al (2007). IGF axis
gene expression patterns are prognostic of survival in epithelial ovarian cancer. Endocrine-related
cancer 14: 781-790.
107
Bibliografia
Steele-Perkins G, Roth RA (1990). Monoclonal antibody alpha IR-3 inhibits the ability of insulinlike growth factor II to stimulate a signal from the type I receptor without inhibiting its binding.
Biochemical and biophysical research communications 171: 1244-1251.
Stein GS, Lian JB, Stein JL, Van Wijnen AJ, Montecino M (1996). Transcriptional control of
osteoblast growth and differentiation. Physiological reviews 76: 593-629.
Stephens PJ, Greenman CD, Fu B, Yang F, Bignell GR, Mudie LJ et al (2011). Massive genomic
rearrangement acquired in a single catastrophic event during cancer development. Cell 144: 2740.
Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA et al (1991). Structure of the
insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352: 73-77.
Sun XJ, Goldberg JL, Qiao LY, Mitchell JJ (1999). Insulin-induced insulin receptor substrate-1
degradation is mediated by the proteasome degradation pathway. Diabetes 48: 1359-1364.
Swaney JJ (1973). Familial osteogenic sarcoma. Clinical orthopaedics and related research: 6468.
Szuhai K, Cleton-Jansen AM, Hogendoorn PC, Bovée JV (2012). Molecular pathology and its
diagnostic use in bone tumors. Cancer Genet. 205(5):193-204.
Takano A, Usui I, Haruta T, Kawahara J, Uno T, Iwata M et al (2001). Mammalian target of
rapamycin pathway regulates insulin signaling via subcellular redistribution of insulin receptor
substrate 1 and integrates nutritional signals and metabolic signals of insulin. Molecular and
cellular biology 21: 5050-5062.
Tang N, Song WX, Luo J, Haydon RC, He TC (2008). Osteosarcoma development and stem cell
differentiation. Clinical orthopaedics and related research 466: 2114-2130.
Thirunavukkarasu K, Mahajan M, McLarren KW, Stifani S, Karsenty G (1998). Two domains
unique to osteoblast-specific transcription factor Osf2/Cbfa1 contribute to its transactivation
function and its inability to heterodimerize with Cbfbeta. Molecular and cellular biology 18:
4197-4208.
Thomas D, Kansara M (2006). Epigenetic modifications in osteogenic differentiation and
transformation. Journal of cellular biochemistry 98: 757-769.
108
Bibliografia
Thomas DM, Carty SA, Piscopo DM, Lee JS, Wang WF, Forrester WC et al (2001). The
retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation.
Molecular cell 8: 303-316.
Tintut Y, Parhami F, Le V, Karsenty G, Demer LL (1999). Inhibition of osteoblast-specific
transcription factor Cbfa1 by the cAMP pathway in osteoblastic cells. Ubiquitin/proteasomedependent regulation. The Journal of biological chemistry 274: 28875-28879.
Trojanek J, Ho T, Del Valle L, Nowicki M, Wang JY, Lassak A et al (2003). Role of the insulinlike growth factor I/insulin receptor substrate 1 axis in Rad51 trafficking and DNA repair by
homologous recombination. Molecular and cellular biology 23: 7510-7524.
Tsuchiya N, Wang L, Suzuki H, Segawa T, Fukuda H, Narita S et al (2006). Impact of IGF-I and
CYP19 gene polymorphisms on the survival of patients with metastatic prostate cancer. Journal
of clinical oncology : official journal of the American Society of Clinical Oncology 24: 19821989.
Turner BC, Zhang J, Gumbs AA, Maher MG, Kaplan L, Carter D et al (1998). Expression of AP2 transcription factors in human breast cancer correlates with the regulation of multiple growth
factor signalling pathways. Cancer research 58: 5466-5472.
Valentinis B, Romano G, Peruzzi F, Morrione A, Prisco M, Soddu S et al (1999). Growth and
differentiation signals by the insulin-like growth factor 1 receptor in hemopoietic cells are
mediated through different pathways. The Journal of biological chemistry 274: 12423-12430.
Valentinis B, Navarro M, Zanocco-Marani T, Edmonds P, McCormick J, Morrione A et al
(2000). Insulin receptor substrate-1, p70S6K, and cell size in transformation and differentiation of
hemopoietic cells. The Journal of biological chemistry 275: 25451-25459.
Valentinis B, Baserga R (2001). IGF-I receptor signalling in transformation and differentiation.
Molecular pathology : MP 54: 133-137.
Van den Berg S, Rahmsdorf HJ, Herrlich P, Kaina B (1993). Overexpression of c-fos increases
recombination frequency in human osteosarcoma cells. Carcinogenesis 14: 925-928.
Wagner ER, Luther G, Zhu G, Luo Q, Shi Q, Kim SH et al (2011). Defective osteogenic
differentiation in the development of osteosarcoma. Sarcoma 2011: 325238.
109
Bibliografia
Walsh, S. (2003) IGF-I does not affect the proliferation or early osteogenic differentiation of
human marrow stromal cells. Bone 33, 80-89.
Wang J, Zhou J, Bondy CA (1999). Igf1 promotes longitudinal bone growth by insulin-like
actions augmenting chondrocyte hypertrophy. FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 13: 1985-1990.
Wang LL (2005). Biology of osteogenic sarcoma. Cancer J 11: 294-305.
Wang X, Kua HY, Hu Y, Guo K, Zeng Q, Wu Q et al (2006). p53 functions as a negative
regulator of osteoblastogenesis, osteoblast-dependent osteoclastogenesis, and bone remodeling.
The Journal of cell biology 172: 115-125.
Werner H, Karnieli E, Rauscher FJ, LeRoith D (1996). Wild-type and mutant p53 differentially
regulate transcription of the insulin-like growth factor I receptor gene. Proceedings of the
National Academy of Sciences of the United States of America 93: 8318-8323.
Westendorf JJ (2006). Transcriptional co-repressors of Runx2. Journal of cellular biochemistry
98: 54-64.
White MF (2002). IRS proteins and the common path to diabetes. American journal of physiology
Endocrinology and metabolism 283: E413-422.
Whitehead JP, Humphreys P, Krook A, Jackson R, Hayward A, Lewis H et al (1998). Molecular
scanning of the insulin receptor substrate 1 gene in subjects with severe insulin resistance:
detection and functional analysis of a naturally occurring mutation in a YMXM motif. Diabetes
47: 837-839.
Wu X, Sallinen K, Anttila L, Makinen M, Luo C, Pollanen P et al (2000). Expression of insulinreceptor substrate-1 and -2 in ovaries from women with insulin resistance and from controls.
Fertility and sterility 74: 564-572.
Xiao G, Jiang D, Thomas P, Benson MD, Guan K, Karsenty G et al (2000). MAPK pathways
activate and phosphorylate the osteoblast-specific transcription factor, Cbfa1. The Journal of
biological chemistry 275: 4453-4459.
Yang X, Matsuda K, Bialek P, Jacquot S, Masuoka HC, Schinke T et al (2004). ATF4 is a
substrate of RSK2 and an essential regulator of osteoblast biology; implication for Coffin-Lowry
Syndrome. Cell 117: 387-398.
110
Bibliografia
Yi HK, Kim SY, Hwang PH, Kim CY, Yang DH, Oh Y et al (2005). Impact of PTEN on the
expression of insulin-like growth factors (IGFs) and IGF-binding proteins in human gastric
adenocarcinoma cells. Biochemical and biophysical research communications 330: 760-767.
Yousfi M, Lasmoles F, Lomri A, Delannoy P, Marie PJ (2001). Increased bone formation and
decreased osteocalcin expression induced by reduced Twist dosage in Saethre-Chotzen syndrome.
The Journal of clinical investigation 107: 1153-1161.
Yu H, Berkel H (1999). Insulin-like growth factors and cancer. The Journal of the Louisiana State
Medical Society : official organ of the Louisiana State Medical Society 151: 218-223.
Zha J, Lackner MR (2010). Targeting the insulin-like growth factor receptor-1R pathway for
cancer therapy. Clinical cancer research : an official journal of the American Association for
Cancer Research 16: 2512-2517.
Zhande R, Mitchell JJ, Wu J, Sun XJ (2002). Molecular mechanism of insulin-induced
degradation of insulin receptor substrate 1. Molecular and cellular biology 22: 1016-1026.
Zhang Y, Song L, Cai L, Wei R, Hu H, Jin W (2013). Effects of baicalein on apoptosis, cell cycle
arrest, migration and invasion of osteosarcoma cells. Food and chemical toxicology : an
international journal published for the British Industrial Biological Research Association 53:
325-333.
Zhao M, Qiao M, Harris SE, Oyajobi BO, Mundy GR, Chen D (2004). Smurf1 inhibits osteoblast
differentiation and bone formation in vitro and in vivo. The Journal of biological chemistry 279:
12854-12859.
Zhou G, Zheng Q, Engin F, Munivez E, Chen Y, Sebald E et al (2006). Dominance of SOX9
function over RUNX2 during skeletogenesis. Proceedings of the National Academy of Sciences of
the United States of America 103: 19004-19009.
111
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising