Untersuchung zur Expression, Spezifität und Regulation der Guaninnukleotid-Austauschfaktoren RhoGEF10 und RhoGEF17

Untersuchung zur Expression, Spezifität und Regulation der Guaninnukleotid-Austauschfaktoren RhoGEF10 und RhoGEF17
Untersuchung zur Expression, Spezifität und
Regulation der Guaninnukleotid-Austauschfaktoren
RhoGEF10 und RhoGEF17
Inaugural-Dissertation
zur
Erlangung der Doktorwürde
der
Naturwissenschaftlich-Mathematischen Gesamtfakultät
der
Ruprecht-Karls-Universität
Heidelberg
vorgelegt von
Marion Mohl
aus Reutlingen
September 2007
Die vorliegende Arbeit wurde am Institut für Experimentelle und Klinische Pharmakologie und
Toxikologie der Medizinischen Fakultät Mannheim der Universität Heidelberg durchgeführt.
1. Gutachter: Prof. Dr. rer. nat. Thomas Wieland
2. Gutachter: Prof. Dr. rer. nat. Ulrich Hilgenfeldt
Tag der mündlichen Prüfung:
Für meine Familie und Freunde
Inhaltsverzeichnis
I
I. Inhaltsverzeichnis
I. Inhaltsverzeichnis ___________________________________________________________ I
II. Abbildungsverzeichnis _____________________________________________________ VI
III. Tabellenverzeichnis ______________________________________________________ VIII
IV. Abkürzungsverzeichnis ____________________________________________________ IX
1. Zusammenfassung _________________________________________________________ 1
2. Summary__________________________________________________________________ 2
3. Einleitung _________________________________________________________________ 3
3.1 Monomere GTP-bindende Proteine _________________________________________ 3
3.1.1 Die Ras-Superfamilie __________________________________________________ 3
3.1.2 GTPase-Domäne der monomeren GTPasen ________________________________ 3
3.1.3 Lipidmodifikation der monomeren GTPasen ________________________________ 4
3.2 Rho-GTPasen ___________________________________________________________ 4
3.2.1 Funktion von RhoA, Rac1 und Cdc42 _____________________________________ 6
3.3 Akzessorische Proteine der Regulation der Rho-GTPasen______________________ 7
3.3.1 RhoGAPs ___________________________________________________________ 8
3.3.2 RhoGDIs ____________________________________________________________ 8
3.3.3 RhoGEFs ___________________________________________________________ 9
3.4 Regulation von RhoGEFs ________________________________________________ 10
3.4.1 Aktivierung durch Entfernen intramolekularer, inhibitorischer Sequenzen sowie durch
Phosphorylierung und Phospholipidbindung ____________________________________ 10
3.4.2 Aktivierung durch direkte Protein-Protein-Interaktion _________________________ 11
3.4.3 Regulation der RhoGEFs durch subzelluläre Lokalisation _____________________ 12
3.4.4 Inhibition der RhoGEFs _______________________________________________ 13
3.5 Stickstoffmonoxid/zyklisches 3'-5'-Guanosinmonophosphat/cGMP-abhängige
Protein-kinase-Signalkaskade _______________________________________________ 13
3.5.1 Regulation der cGMP-Synthese _________________________________________ 13
3.5.2 Regulation der NO-sensitiven Guanylylzyklasen ____________________________ 13
3.5.3 Effektoren von cGMP _________________________________________________ 14
3.5.4 cGMP-abhängige Proteinkinasen ________________________________________ 15
Inhaltsverzeichnis
II
3.6 Regulation des Gefäßtonus des glatten Muskels _____________________________ 17
3.6.1 Regulation der Ca2+-abhängigen und Ca2+-unabhängigen Kontraktion des glatten
Muskels ________________________________________________________________ 17
3.6.2 Regulation der cGMP/cGKI-abhängigen Relaxation des glatten Muskels _________ 19
3.6.3 Einfluss der cGKI auf RhoA ____________________________________________ 21
3.7 Zielsetzungen der Arbeit _________________________________________________ 23
4. Material und Methoden _____________________________________________________ 24
4.1 Material _______________________________________________________________ 24
4.1.1 Tiere ______________________________________________________________ 24
4.1.2 Chemikalien ________________________________________________________ 24
4.1.3 Feinchemikalien _____________________________________________________ 24
4.1.4 Radiochemikalien ____________________________________________________ 24
4.1.5 Antikörper __________________________________________________________ 25
4.1.6 Enzyme ____________________________________________________________ 26
4.1.7 Genspezifische Primer ________________________________________________ 26
4.1.8 siRNA-Sequenzen und DNA-Oligonukleotid-Matrizen für Haarnadelschleifen-shRNA28
4.1.9 Plasmide ___________________________________________________________ 29
4.1.10 Klonierungen_______________________________________________________ 30
4.1.10.1 Tabellarische Übersicht der Klonierungen_____________________________ 30
4.1.10.2 Schematische Darstellung der Klonierungen___________________________ 31
4.1.11 Bakterien__________________________________________________________ 37
4.1.12 Zellkultur __________________________________________________________ 37
4.1.13 Transfektionsreagenzien _____________________________________________ 37
4.1.14 Verbrauchsmaterialien _______________________________________________ 38
4.1.15 Sonstige Materialien _________________________________________________ 38
4.1.16 Geräte ____________________________________________________________ 38
4.2 Puffer und Nährmedien __________________________________________________ 39
4.2.1 Puffer für molekularbiologische Methoden _________________________________ 39
4.2.2 Puffer für proteinbiochemische Methoden _________________________________ 39
4.2.3 Medien für die Zellkultur und Bakterienzucht _______________________________ 44
4.3 Molekularbiologische Methoden __________________________________________ 45
4.3.1 Plasmid-DNA Präparation aus E. coli _____________________________________ 45
4.3.2 DNA-Fällung ________________________________________________________ 45
4.3.3 Konzentrationsbestimmung von Nukleinsäurelösungen_______________________ 46
4.3.4 DNA-Gelelektrophorese _______________________________________________ 46
4.3.5 DNA-Sequenzierung __________________________________________________ 46
4.3.6 Restriktion von DNA mit Endonukleasen __________________________________ 47
Inhaltsverzeichnis
III
4.3.7 Dephosphorylierung von DNA-Enden_____________________________________ 47
4.3.8 Enzymatische Verlängerung von DNA-Enden ______________________________ 47
4.3.9 Verknüpfung von DNA-Molekülen mit der T4-DNA-Ligase_____________________ 47
4.3.10 Transformation von Bakterien__________________________________________ 48
4.3.11 Kryokonservierung von Bakterien_______________________________________ 48
4.3.12 RNA-Isolierung _____________________________________________________ 49
4.3.13 Reverse Transkription von RNA ________________________________________ 49
4.3.14 PCR _____________________________________________________________ 49
4.3.15 Mutagenese _______________________________________________________ 50
4.3.16 Herstellung rekombinanter Adenoviren __________________________________ 50
4.3.17 Klonierung von Haarnadelschleifen-shRNA-Inserts in einen Expressionsvektor
(pAdTrack-CMV-shRNA) ___________________________________________________ 53
4.4 Proteinbiochemische Methoden___________________________________________ 54
4.4.1 Proteingewinnung für die SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE) ____ 54
4.4.2 SDS-PAGE _________________________________________________________ 54
4.4.3 Western Blot ________________________________________________________ 55
4.4.4 ROCK-Assay________________________________________________________ 55
4.4.5 Coomassie-Färbung __________________________________________________ 56
4.4.6 Protein-Konzentrationsbestimmung ______________________________________ 56
4.4.7 Kopplung des RhoGEF17-spezifischen Peptids an CNBr-aktivierte Sepharose 4B _ 56
4.4.8 Aufreinigung des polyklonalen Antikörpers RhoGEF17 _______________________ 57
4.4.9 Isoelektrische Fokussierung (IEF) _______________________________________ 57
4.4.10 Zellfraktionierung ___________________________________________________ 58
4.4.11 Ko- bzw. Immunopräzipitation (IP) ______________________________________ 58
4.4.12 Pulldown-Assay ____________________________________________________ 59
4.4.13 Expression und Aufreinigung von GST-Fusionsproteinen für den GDP/GTPAustausch-Assay _________________________________________________________ 60
4.4.14 GDP/GTP-Austausch-Assay___________________________________________ 60
4.4.15 Immunhistologie ____________________________________________________ 61
4.5 Zellbiologische Methoden________________________________________________ 62
4.5.1 Verwendete permanente Zelllinien bzw. Primärzellen ________________________ 62
4.5.2 Trypsinieren und Passagieren von Zellkulturen _____________________________ 63
4.5.3 Auftauen und Einfrieren von Zellen ______________________________________ 63
4.5.4 Transiente Transfektion _______________________________________________ 63
4.5.5 Adenovirale Infektion von Zellen_________________________________________ 65
4.5.6 SRE/SRF-Luciferase-Assay ____________________________________________ 65
4.5.7 Färbung des Aktin-Zytoskeletts _________________________________________ 66
Inhaltsverzeichnis
IV
4.5.8 Isolation von thorakalen Aorten und Kultivierung der isolierten, glattmuskulären Zellen
_______________________________________________________________________ 67
5. Ergebnisse _______________________________________________________________ 68
1. Teil ______________________________________________________________________ 69
5.1 Grundcharakterisierung von RhoGEF10 ____________________________________ 69
5.1.1 Klonierung und Expression von zwei humanen RhoGEF10-Varianten ___________ 69
5.1.2 Theoretische Analyse der Proteinsequenz von RhoGEF10, Expression und
subzelluläre Lokalisation ___________________________________________________ 71
5.1.3 RhoGEF10 aktiviert RhoA in vitro________________________________________ 72
5.1.4 RhoGEF10 aktiviert RhoA-C in intakten Zellen _____________________________ 73
5.1.5 Expression von RhoGEF10 in Endothelzellen ______________________________ 76
2. Teil ______________________________________________________________________ 78
5.2 Regulation von RhoGEF17 _______________________________________________ 78
5.2.1 Klonierung von RhoGEF17 _____________________________________________ 78
5.2.2 RhoGEF17 aktiviert spezifisch RhoA-C ___________________________________ 79
5.2.3 Einfluss verschiedener Signalmediatoren auf die Regulation von RhoGEF17______ 80
5.2.4 Aktivierung von RhoGEF17 durch cGMP/cGKI-α____________________________ 81
5.2.5 RhoGEF17 wird durch cGKI-α phosphoryliert und interagiert mit cGKI-α _________ 85
5.2.6 Putative cGK- bzw. PKA-Konsensusmotive des Proteins RhoGEF17 ____________ 87
5.2.7 Bedeutung des N-Terminus von RhoGEF17 für dessen Aktivierbarkeit durch
cGMP/cGKI-α____________________________________________________________ 87
5.2.8 Untersuchung der inhibitorisch wirkenden cGKI-α-Phosphorylierungsstelle im
RhoGEF17-ΔN___________________________________________________________ 90
5.2.9 Einfluss der cGKI-α-Phosphorylierungsstelle SS1330/1331 auf die Aktivierung des
Volllängenproteins RhoGEF17 ______________________________________________ 93
5.2.10 Einfluss von RhoGEF17 auf die cGMP/cGKI-α vermittelte Hemmung der Seruminduzierten RhoA-Aktivierung _______________________________________________ 95
5.2.11 Einfluss der Phosphorylierung von RhoA auf dessen Aktivierung durch RhoGEF17
und cGMP/cGKI-α ________________________________________________________ 96
5.2.12 Regulation von RhoGEF17 durch einen positiven Rückkopplungsmechanismus über
ROCK__________________________________________________________________ 99
5.3 Vaskuläre RhoA-Aktivierung durch RhoGEF17 _____________________________ 103
5.3.1 Expression von RhoGEF17 in glattmuskulären Zellen der Aorta von Ratte und Maus
______________________________________________________________________ 103
5.3.2 Einfluss der Überexpression von RhoGEF17-ΔN und der cGMP-Stimulation auf die
RhoA-Aktivierung in RASMC _______________________________________________ 106
Inhaltsverzeichnis
V
5.3.3 RhoGEF17-ΔN induzierte Stressfaserbildung in RASMC und HUVEC __________ 107
5.3.4 Einfluss der RhoGEF17-Depletion auf die cGMP-abhängige RhoA-Aktivierung in
RASMC _______________________________________________________________ 109
5.3.5 Einfluss von SNP auf die cGMP-abhängige RhoA-Aktivierung in RASMC _______ 112
6. Diskussion ______________________________________________________________ 114
6.1 RhoGEF10____________________________________________________________ 114
6.1.1. Proteinsequenzanalyse ______________________________________________ 114
6.1.2. Expression von RhoGEF10 und alternatives Spleißen des Gens ______________ 115
6.1.3. RhoB Spezifität von RhoGEF10 _______________________________________ 115
6.1.4 Physiologische Relevanz von RhoGEF10 ________________________________ 116
6.2. RhoGEF17 ___________________________________________________________ 116
6.2.1 Spezifität von RhoGEF17 für RhoGTPasen _______________________________ 116
6.2.2 RhoGEF17 wird spezifisch durch cGKI-α phosphoryliert und aktiviert___________ 116
6.2.3 Der Einfluss von cGMP/cGKI-α auf die Aktivität von RhoA in An- und Abwesenheit von
RhoGEF17 _____________________________________________________________ 118
6.2.4 Die ROCK-abhängige Verstärkung der cGMP/cGKI-α-induzierten RhoGEF17Aktivierung _____________________________________________________________ 119
6.2.5 Physiologische Relevanz von RhoGEF17 ________________________________ 121
6.3 Ausblick _____________________________________________________________ 124
7. Literaturverzeichnis _______________________________________________________ 125
8. Danksagung _____________________________________________________________ 146
Abbildungsverzeichnis
VI
II. Abbildungsverzeichnis
Abb. 1: Der molekulare Schaltermechanismus monomerer Rho-GTPasen ________________ 10
Abb. 2: Die cGMP-Signalkaskade in der glatten Muskulatur ____________________________ 15
Abb. 3: Ca2+-abhängige und Ca2+-unabhängige Kontraktion der glatten Muskulatur _________ 19
Abb. 4: Schematische Darstellung der NO/cGMP/cGKI-vermittelten Relaxation der glatten
Muskulatur __________________________________________________________________ 21
Abb. 5: DNA-Oligonukleotid-Matrixe für Haarnadelschleifen-shRNA _____________________ 29
Abb. 6: Schematische Darstellung der Klonierungen _________________________________ 36
Abb. 7: Herstellung rekombinanter Adenoviren mittels des pAdEasy1-Systems_____________ 51
Abb. 8: Schematische Darstellung des Virusrings ____________________________________ 53
Abb. 9: Phylogenetischer Baum der Dbl-Subfamilie p164-RhoGEF, RhoGEF10 und GrinchGEF
erstellt mit dem ClustalW-Computerprogramm ______________________________________ 68
Abb. 10: Primärsequenz und alternative Spleißvariante von RhoGEF10 __________________ 70
Abb. 11: Abgeleitete Proteindomänenstruktur und subzelluläre Lokalisation von RhoGEF10 __ 72
Abb. 12: Guaninnukleotid-Austauschaktivität von RhoGEF10 in vitro _____________________ 73
Abb. 13: RhoA-C spezifische Guaninnukleotid-Austauschaktivität von RhoGEF10-Varianten in
intakten Zellen _______________________________________________________________ 74
Abb. 14: Stimulation der RhoA-C vermittelten Gentranskription durch verschiedene RhoGEF10Varianten ___________________________________________________________________ 76
Abb. 15: Endogene Expression von RhoGEF10 in Endothelzellen _______________________ 77
Abb. 16: Schematische Darstellung der Proteindomänenstruktur und Expression von RhoGEF17
und RhoGEF17 -554 __________________________________________________________ 79
Abb. 17: RhoGEF17 aktiviert spezifisch RhoA-C_____________________________________ 80
Abb. 18: Regulation von RhoGEF17 durch cGMP/cGKI-α _____________________________ 81
Abb. 19: Regulation der RhoA-Aktivierung durch RhoGEF17 und cGMP/cGKI-α____________ 83
Abb. 20: Zeit- und Konzentrationsabhängigkeit der Aktivierung von RhoGEF17 durch
cGMP/cGKI-α________________________________________________________________ 84
Abb. 21: cGKI-α spezifische Phosphorylierung von RhoGEF17 und Interaktion von cGKI-α mit
RhoGEF17 __________________________________________________________________ 86
Abb. 22: Schematische Darstellung der putativen cGMP- bzw. cAMP-abhängigen ProteinkinasePhosphorylierungsstellen im RhoGEF17 (ScanProsite) _______________________________ 87
Abb. 23: Einfluss der sukzessiven, N-terminalen Verkürzung von RhoGEF17 auf seine
Aktivierbarkeit durch cGMP/cGKI-α _______________________________________________ 90
Abb. 24: Untersuchung zur Aktivierbarkeit verschiedener phosphoresistenter RhoGEF17-ΔNMutanten ___________________________________________________________________ 92
Abbildungsverzeichnis
VII
Abb. 25: Untersuchungen zur Aktivierbarkeit der phosphomimetischen bzw. phosphoresistenten
RhoGEF17-SS1330/1331-Varianten ______________________________________________ 94
Abb. 26: Einfluss von RhoGEF17 auf die cGMP/cGKI-α vermittelte Hemmung der Seruminduzierten RhoA-Aktivierung____________________________________________________ 95
Abb. 27: Einfluss der RhoA-Phosphorylierung auf dessen Aktivierbarkeit durch RhoGEF17 und
cGMP/cGKI-α________________________________________________________________ 98
Abb. 28: Nachweis der cGKI-α/RhoGEF17-abhängigen ROCK-Aktivierung ________________ 99
Abb. 29: Einfluss der ROCK-Inhibitoren Y-27632 und H-1152P auf die cGKI-α/RhoGEF17vermittelte RhoA-Aktivierung ___________________________________________________ 100
Abb. 30: Untersuchungen zur Beteiligung von Serin/Threonin-spezifischen Proteinphosphatasen
an der ROCK-vermittelten Rückkopplung des RhoGEF17-Signalwegs __________________ 102
Abb. 31: Detektion von endogenem RhoGEF17 in isolierten, glattmuskulären thorakalen Zellen
der Aorta von Ratte und Maus __________________________________________________ 105
Abb. 32: Immunhistologische Färbungen von thorakalen Aorten-Paraffinschnitten der Ratte _ 106
Abb. 33: cGMP- bzw. RhoGEF17-ΔN-induzierte RhoA-Aktivierung in RASMC ____________ 107
Abb. 34: Aktin-Zytoskelettfärbung in RASMC und HUVEC ____________________________ 108
Abb. 35: Suppression der Expression von rekombinantem RhoGEF17-ΔN Ratte-Protein mittels
RhoGEF17-spezifischer siRNA bzw. shRNA _______________________________________ 110
Abb. 36: Suppression der Expression von endogenem RhoGEF17-Protein in RASMC mittels
eines shRNA-RhoGEF17-spezifischen Adenovirus __________________________________ 111
Abb. 37: Inhibition der cGMP-vermittelten RhoA-Aktivierung in RASMC durch Ad-shRNARhoGEF17 _________________________________________________________________ 112
Abb. 38: Inhibition der SNP-vermittelten RhoA-Aktivierung in RASMC durch Ad-shRNARhoGEF17 _________________________________________________________________ 113
Abb. 39: Schematische Darstellung des RhoGEF17-Signalwegs _______________________ 121
Abb. 40: Putativer Einfluss von cGKI und ROCK auf die MYPT1 Untereinheit der MLCP bzw. auf
den Gefäßtonus der glatten Muskulatur in Gegenwart von RhoGEF17 __________________ 123
Tabellenverzeichnis
VIII
III. Tabellenverzeichnis
Tab. 1: Primärantikörper _______________________________________________________ 25
Tab. 2: Sekundärantikörper _____________________________________________________ 26
Tab. 3: Mutagenese ___________________________________________________________ 28
Tab. 4: Klonierungen __________________________________________________________ 31
Tab. 5: Reaktionsansatz für die cDNA-Synthese_____________________________________ 49
Tab. 6: Reaktionsansatz für die gerichtete Mutagenese _______________________________ 50
Tab. 7: Laufbedingungen der IEF ________________________________________________ 57
Tab. 8: Verwendete permanente Zelllinien bzw. Primärzellen___________________________ 62
Tab. 9: Parameter für die transiente Plasmid-DNA Transfektion von HEK-Zellen mit dem
PolyFect-Transfektionsreagenz __________________________________________________ 64
Tab. 10: Parameter für die transiente Plasmid-DNA und siRNA Kotransfektion von HEK-Zellen
mit dem Transfektionsreagenz Lipofectamin 2000 ___________________________________ 65
Abkürzungsverzeichnis
IV. Abkürzungsverzeichnis
%
Prozent
°C
Grad Celcius
Abb.
Abbildung
ACK
engl.: activated cdc42-associated kinase
dt.: aktivierte Cdc42-assoziierte Kinase
Ad
Adenovirus
ADP
Adenosindiphosphat
AMP
Adenosinmonophosphat
AMP-PNP
Adenylylimidodiphosphat
AMV
engl.: avian myeloblastosis virus
dt.: Vogel Myeloblastose Virus
ANP
engl.: atrial natriuretic peptide
dt.: atriales natriuretisches Peptid
Arf
engl.: ADP-ribosylation factor
dt.: ADP-ribosylierender Faktor
AS
Aminosäure
ATP
Adenosintriphosphat
bFGF
engl.: fibroblast growth factor
dt.: Fibroblasten Wachstumsfaktor
BKCa-Kanal
Calcium (Ca2+)-abhängiger Kaliumkanal
bp
Basenpaar
Bq
Bequerel
BNP
engl.: brain natriuretic peptide
dt.: Hirn natriuretisches Peptid
Br
Bromo
BSA
engl.: bovine serum albumin
dt.: Rinder-Serum-Albumin
bzw.
beziehungsweise
C
konserviert
C3T
C3-ADP-Ribosyltransferase
ca.
circa
Ca2+
Calciumion
Calyculin A
Serin/Threonin-Proteinphosphatase-Inhibitor
CaM
Calmodulin
cAMP
zyklisches 3'-5'-Adenosinmonophosphat
IX
Abkürzungsverzeichnis
cDNA
komplementäre Desoxyribonukleinsäure
cGK
cGMP-abhängige Proteinkinase
cGMP
zyklisches 3'-5'-Guanosinmonophosphat
CHO-Zellen
engl.: chinese hamster ovary-cells
dt.: chinesische Hamsterovarien Zellen
Ci
Curie
CIAP
engl.: calf intestinal alkaline Phosphatase
dt.: Kalbsdarm alkalische Phosphatase
Cl
-
cm
Chloridion
engl.: centimeter
dt.: Zentimeter
CMV
engl.: Cytomegalovirus
dt.: Zytomegalovirus
CNBr
Cyanbromid
CNG
engl.: cyclic nucleotide-gated cation channels
dt.: zyklische Nukleotid-gesteuerte Kationen-Kanäle
CNP
engl.: C-type natriuretic peptide
dt.: C-Typ natriuretisches Peptid
CO2
Kohlenstoffdioxid
CPI-17
Proteinkinase C (PKC)-stimuliertes Myosin-Phosphatase
Inhibitorprotein
CsCl
Cäsiumchlorid
C-terminal
Carboxy-terminal
D
Dimension
Da
Dalton
DAG
Diazylglyzerol
Dbl
diffuses menschliches B-Zell Lymphom
DEPC
Diethylpyrocarbonat
dest.
destilliert
DH
Dbl-homologe
DNA
Desoxyribonukleinsäure
DMEM
Dulbeccos modifiziertes Eagle Medium
DMSO
Dimethylsulfoxid
dNTP
Desoxyribonukleotidtriphosphat
DRF
engl.: diaphanous related formin
dt.: Diaphanous-verwandtes Formin
dt.
deutsch
DTT
Dithiothreitol
X
Abkürzungsverzeichnis
E
Extinktion
ECGS/H
Wachstumssupplement für humane Endothelzellen
E. coli
Escherichia coli
EDRF
engl.: endothelium-derived relaxing factor
dt.: Endothel-abstammender relaxierender Faktor
EDTA
Ethylendiamintetraacetat
EF-Tu
engl.: elongation factor-Tu
dt.: Verlängerungs-Faktor-Tu
EGF
engl.: endothelial growth factor
dt.: endothelialer Wachstumsfaktor
EGFP
engl.: enhanced green fluorescent protein
dt.: verstärktes grün fluoreszierendes Protein
engl.
englisch
eNOS
endotheliale NO-Synthase
F
Farnesylisoprenoid
FCS
engl.: foetal calf serum
dt.: fötales Kälberserum
for
engl.: forward
dt.: vorwärts
G
Giga (109)
GG
Geranylgeranylisoprenoid
g
Gramm
g
Erdbeschleunigung
G-Domäne
GTPase-Domäne
G-Protein
Guaninnukleotid-bindendes Protein
GAP
engl.: gtpase activating protein
dt.: GTPase-aktivierendes Protein
GAPDH
Glycerinaldehyd-3-Phosphat-Dehydrogenase
GBD
GTPase-bindende Domäne
GC
Guanylylzyklase
GDI
engl.: guanine nucleotide dissociation inhibitor
dt.: Guaninnukleotid-Dissoziations-Inhibitor
GEF
engl.: guanine nucleotide exchange factor
dt.: Guaninnukleotid-Austauschfaktor
GDP
Guanosindiphosphat
GPCR
engl.: G protein coupled receptor
dt.: G-Protein gekoppelter Rezeptor
GST
Glutathion-S-Transferase
XI
Abkürzungsverzeichnis
GTP
Guanosintriphosphat
H
Wasserstoff
3
Tritium
h
engl.: hour
H
dt.: Stunde
H-1152P
ROCK-Inhibitor
H89
spezifischer Inhibitor der PKA
HCl
Salzsäure
HEK
engl.: human embryonal kidney
dt.: humane embryonale Niere
H2O
Wasser
HUVEC
engl.: human umbilical vein endothelial cell
dt.: humane Endothelzellen der Umbilikalvene
Hz
Herz
ICAM
engl.: intercellular adhesion molecule
dt.: interzelluläres Adhäsionsmolekül
IEF
Isoelektrische Fokussierung
iNOS
induzierbare NO-Synthase
IP3
Inositol-1,4,5-triphosphat
IPTG
Isopropylthiogalactosid
IRAG
IP3-Rezeptor-assoziertes cGKI-Substrat
K
+
Kaliumion
kb
Kilobase
KCl
Kaliumchlorid
KH2PO4
Kaliumhydrogenphosphat
H2SO4
Schwefelsäure
L
Liter
LAR
engl.: luciferase assay reagent
dt.: Luciferase-Assay Reagenz
LARG
Leukämie-assoziiertes RhoGEF
LimK
Lim Kinase
LPA
engl.: lysophosphatic acid
dt.: Lysophosphatsäure
M
Molar (mol/L)
m
milli (10-3)
m
Meter
µ
mikro (10-6)
XII
Abkürzungsverzeichnis
mDia
engl.: diaphanous related formin
dt.: Diaphanous-verwandtes Formin 1
MASMC
engl.: mouse aortic smooth muscle cell
dt.: glattmuskuläre Zellen der Mausaorta
MBS
engl.: myosin binding substrate
dt.: Myosin Bindungs-Substrat
MCS
engl.: multiple cloning site
dt.: multiple Klonierungsstelle
2+
Mg
Magnesiumion
MgCl2
Magnesiumchlorid
MgSO4
Magnesiumsulfat
min
Minute
MLCK
Calmodulin-abhängige leichte Myosinketten-Kinase
MLCP
engl.: myosin light chain phosphatase
dt.: leichte Myosinketten-Phosphatase
MOI
engl.: multiplicity of infection
dt.: Multiplizität der Infektion
mol
Stoffmenge
MRCK
engl.: myotonic dystrophy kinase-related Cdc42-binding
kinase
MWCO
engl.: molecular weight cut off
dt.: Molekulargewicht-Ausschlussgrenze
MYPT1
engl.: myosin-targeting subunit of myosin light-chain
phosphatase
dt.: Myosin-bindende Untereinheit der leichten
Myosinketten-Phosphatase
N2
Stickstoff
n
nano (10-9)
Na+
Natrium
NaAc
Natriumacetat
NaCl
Natriumchlorid
NaF
Natriumfluorid
NaHCO3
Natriumhydrogencarbonat
NaHPO4
Natriumhydrogenphosphat
NaN3
Natriumazid
Na3VO4
Natriumorthovanadat
NFκB
engl.: nuclear factor kappa B
dt.: Kern-Faktor kappa B
XIII
Abkürzungsverzeichnis
nNOS
neuronale Stickstoffmonoxid (NO)-Synthase
NO
Stickstoffmonoxid
NOS
Stickstoffmonoxid (NO)-Synthase
NO-sensitive GC
Stickstoffmonoxid (NO)-sensitive Guanylylzyklase
N-terminal
Amino-terminal
O2
Sauerstoff
OD
optische Dichte
Okadainsäure
Serin/Threonin-Proteinphosphatase-Inhibitor
ORF
engl.: open reading frame
dt.: offener Leserahmen
PP
Proteinphosphatase
p
engl.: plasmid
dt.: Plasmid
p
pico
Pak
p21-aktivierte Kinase
PBGD
Porphobilinogendesaminase
PBS
engl.: phosphate buffered saline
dt.: Phosphat-gepufferte Salzlösung
pCPT
p-chlorophenylthio
PCR
engl.: polymerase chain reaction
dt.: Polymerase-Kettenreaktion
PDE
Phosphodiesterase
PFA
Paraformaldehyd
pGC
partikuläre Guanylylzyklase
PH
Pleckstrin-homologe
PI-4,5-P2
Phosphatidyl-Inositol-4,5-biphosphat
PI-3,4,5-P3
Phosphatidyl-Inositol-3,4,5-triphosphat
Pi
anorganisches Phosphat
PI3K
Phosphatidyl-Inositol-3-Kinase
pI
isoelektrischer Punkt
PKA
Proteinkinase A
PKC
Proteinkinase C
PKN
Proteinkinase N
PLC
Phospholipase C
PMSF
Phenylmethylsulfonylfluorid
pol
Polymerase
PRK
engl.: proliferation-related kinase
dt.: Proliferations-verwandte Kinase
XIV
Abkürzungsverzeichnis
pRL-TK
engl.: plasmid renilla luciferase-thymidine kinase
pSRE.L
engl.: plasmid serum response element luciferase
Rab
engl.: Ras-like proteins in brain
dt.: Ras-ähnliche Proteine im Gehirn
Ran
engl.: Ras-like nuclear
dt.: Ras-ähnliches nukleäres Protein
Ras
engl.: Rat sarcoma oncogene
dt.: Ratten-Sarkoma Onkogen
RASMC
engl.: rat aortic smooth muscle cell
dt.: glattmuskuläre Zellen der Rattenaorta
RBD
Rho-Bindedomäne
rev
engl.: revers
dt.: rückwärts
RGS
engl.: regulator of G protein signalling
dt.: Regulator des G-Protein-Signalwegs
Rho
engl.: Ras-homologous
dt.: Ras-homolog
RLC
engl.: regulatory light chain
dt.: regulatorische leichte Myosinkette
RNA
Ribonukleinsäure
ROCK
Rho-Kinase
Rp-8-pCPT-cGMP
8-(4-Chlorophenylthio)-Guanosin-3'-5'-zyklisches
Monophosphorothioat, Rp-Isomer
rpm
engl.: rounds per minute
dt.: Umdrehungen pro Minute
RT
Raumtemperatur
S
Schwefel
SD
engl.: standard deviation
dt.: Standardabweichung
SDS
engl.: sodium dodecyl sulfate
dt.: Natrium-Dodecylsulfat
SDS-PAGE
SDS-Polyacrylamidgelelektrophorese
sec
engl.: second
dt.: Sekunde
SEM
engl.: standard error of the mean
dt.: Standardabweichung des Mittelwertes
sh
engl.: short hairpin
dt.: kleine Haarnadel
XV
Abkürzungsverzeichnis
si
engl.: small interfering
dt.: geringfügig interferierend
SM
engl.: smooth muscle
dt.: glatter Muskel
SMC
engl.: smooth muscle cell
dt.: glattmuskuläre Zellen
SM-MHC
engl.: SM-Myosin-heavy-chain
dt.: glatmuskuläre schwere Myosinkette
SNP
engl.: Sodium nitroprusside
dt.: Natrium-Nitroprussid
SOC
Salz-optimiertes Medium mit Glukose
(„salt-optimized + carbon“)
SR
sarkoplasmatisches Retikulum
SRE
engl.: serum response element
SRF
engl.: serum response factor
SV 40
engl.: simian virus 40
Tab.
Tabelle
TAE
Tris-Acetat-EDTA
Tap
Thermo aquaticus
TBS
engl.: Tris-buffered-saline
dt.: Tris-gepufferte Salzlösung
TCF
ternärer Komplexfaktor
TE
Tris-EDTA
TEMED
Tetramethylendiamin
TMB
Tetra-Methylbenzidin
TMBH2
Leukoform von Tetra-Methylbenzidin
TNF
Tumor-Nekrose-Faktor
TRITC
Tetramethyl Rhodamin Iso-Thiocyanat
U
engl.: unit
dt.: Einheit
ü. N.
über Nacht
UV
Ultraviolett
V
Volt
v
engl.: volume
dt.: Volumen
VASP
engl.: vasodilatator-stimulated Phosphoprotein
dt.: Vasodilation-stimuliertes Phosphoprotein
XVI
Abkürzungsverzeichnis
VCAM
XVII
engl.: vascular adhesion molecule
dt.: vaskuläres Adhäsionsmolekül
VEGF
engl.: vascular endothelial growth factor
dt.: vaskulärer endothelialer Wachstumsfaktor
Vhrs
Voltstunden
VSMC
engl.: vascular smooth muscle cell
dt.: vaskuläre glatte Muskelzellen
W
Watt
WASP
engl.: Wiskott-Aldrich-syndrome-protein
dt.: Wiskott-Aldrich Syndrom Protein
WAVE
engl.: Wiskott-Aldrich syndrome protein family verprolinhomologous protein
dt.: Wiskott-Aldrich Syndrom Protein-Familie Verprolinhomologes Protein
w
engl.: weight
dt.: Gewicht
wt
Wildtyp
X-gal
5-Bromo-4-Chloro-3-Indolyl-β-D-Galaktopyranosid
Y-27632
ROCK-Inhibitor
z. B.
zum Beispiel
Abkürzungsverzeichnis
Aminosäuren
L-Alanin, Ala (A)
L-Leucin, Leu (L)
L-Arginin, Arg (R)
L-Lysin, Lys (K)
L-Asparagin, Asn (N)
L-Methionin, Met (M)
L-Asparaginsäure, Asp (D)
L-Phenylalanin, Phe (F)
L-Cystein, Cys (C)
L-Prolin, Pro (P)
L-Glutamin, Gln (Q)
L-Serin, Ser (S)
L-Glutaminsäure, Glu (E)
L-Threonin, Thr (T)
Glycin, Gly (G)
L-Tyrosin, Tyr (Y)
L-Histidin, His (H)
L-Tryptophan, Trp (W)
L-Isoleucin, Ile (I)
L-Valin, Val (V)
XVIII
Zusammenfassung
1
1. Zusammenfassung
Die koordinierte Regulation von Rho-GTPasen ist entscheidend für die Funktion von vaskulärem
Gewebe. Rho-GTPasen kontrollieren hierbei als zentrale Mediatoren Prozesse wie Proliferation,
Migration und Kontraktion sowohl glattmuskulärer als auch endothelialer Zellen. Bis heute ist
jedoch
nur
wenig
über
die
unmittelbar
beteiligten
akzessorischen
Proteine
und
Signalübertragungswege bekannt. Das Ziel dieser Arbeit war es, in diesem Kontext die Rolle der
Guaninnukleotid-Austauschfaktoren RhoGEF10 und RhoGEF17 zu charakterisieren sowie deren
übergeordnete Regulation näher zu untersuchen. Dazu wurden unterschiedliche zelluläre
Systeme (permanente Zelllinien (HEK-293 und TSA), isolierte glattmuskuläre Zellen der
Rattenaorta (RASMC) und humane Endothelzellen der Umbilikalvene) als Modell verwendet und
die Signalübertragung mittels diverser molekularer Werkzeuge (Toxine, bioaktive Substanzen,
eukaryote Expressionsvektoren, rekombinante Adenoviren, shRNA-kodierende Adenoviren)
beeinflusst. Im ersten Teil dieser Arbeit wird gezeigt, dass RhoGEF10 spezifisch RhoA-C mit
einer Präferenz für RhoB aktiviert. Des Weiteren haben immunhistologische Untersuchungen
eine vorwiegende Expression von RhoGEF10 im Gefäßendothel ergeben. Der zweite Teil dieser
Arbeit zeigt, dass das im Gefäßendothel, vor allem aber in der glatten Muskulatur der Gefäße,
exprimierte, RhoA-C spezifische RhoGEF17 durch die cGMP-abhängige Proteinkinase I-α (cGKIα) spezifisch aktiviert wird. Diese Aktivierung setzt eine direkte Interaktion beider Proteine voraus
und beinhaltet eine koordinierte Phosphorylierung von RhoGEF17 sowie möglicherweise von
RhoA. Mittels der gezielten Mutagenese und der Generierung von trunkierten Mutanten von
RhoGEF17 konnte nachgewiesen werden, dass zwei cGK-spezifische Phosphorylierungsstellen
(Serine 43 und 1331) für die Regulation der RhoGEF17-Aktivität entscheidend sind. Darüber
hinaus wurde ein positiver Rückkopplungsmechanismus innerhalb des cGKI-α/RhoGEF17/RhoASignalwegs identifiziert, welcher in Abhängigkeit der RhoA-regulierten Kinase ROCK und von
Phospho-Serin/Threonin-spezifischen
Phosphatasen
erfolgt.
Zusätzlich
zu
diesen
mechanistischen Untersuchungen ist es gelungen in RASMC durch shRNA-mediierte Depletion
von endogenem RhoGEF17 zu zeigen, dass die cGMP-abhängige RhoA-Aktivierung in diesen
Zellen tatsächlich von der RhoGEF17-Expression abhängig ist. Da die Fehlregulation der
Proliferation, Migration und Kontraktion von vaskulären Zellen z. B. bei der Arteriosklerose und
der Hypertonie eine wichtige Rolle spielt, könnten RhoGEF17 und RhoGEF10 somit bei diesen
Erkrankungen von pathophysiologischer Bedeutung sein.
Summary
2
2. Summary
The coordinated regulation of Rho GTPases is crucial for the function of vascular tissue. Rho
GTPases control as central mediators processes like proliferation, migration and contraction both
in smooth muscle and endothelial cells. However until now only little is known about the involved
accessory proteins and signal transduction pathways. Therefore, the aim of this work was to
characterise the role of the guanine nucleotide exchange factors RhoGEF10 and RhoGEF17 and
to identify upstream regulatory mechanisms. For this purpose different cellular systems
(permanent cell lines (HEK-293 und TSA), isolated rat aortic smooth muscle cells (RASMC) and
human umbilical cord endothelial cells) were used as models and the cellular signal transduction
was studied using different molecular tools (toxins, bioactive substances, eukaryotic expression
vectors, recombinant adenovirus, shRNA-coding adenovirus). In the first part of this work it is
shown
that
RhoGEF10
activates
specifically
RhoA-C
with
a
preference
for
RhoB.
Immunohistological analyses showed that RhoGEF10 exhibits a predominant expression in the
aortic vascular endothelium. In the second part of this work it is demonstrated that the RhoA-C
specific RhoGEF17, which is endogenously expressed in the aortic vascular endothelium and
more prominent in aortic smooth muscle cells, is activated specifically through the cGMPdependent protein kinase I-α (cGKI-α). This activation requires a direct interaction of both
proteins and comprises a coordinated phosphorylation of RhoGEF17 and possibly of RhoA. By
site-directed mutagenesis and truncation of RhoGEF17 two cGK-specific phosphorylation sites
(serine 43 and 1331) were found to be crucial for the regulation of RhoGEF17 activity.
Furthermore
a
positive
feedback
mechanism
could
be
identified
within
the
cGKI-
α/RhoGEF17/RhoA pathway which is dependent on the RhoA-regulated kinase ROCK and on
phosho-serine/threonine-specific phosphatases. Moreover, shRNA mediated depletion of
endogenous RhoGEF17 in RASMC, revealed that the cGMP-dependent RhoA activation in these
cells is dependent on RhoGEF17 expression. As the dysregulation of proliferation, migration and
contraction of vascular cells plays a role for the pathogenesis of arteriosclerosis and hypertension
RhoGEF17 and RhoGEF10 could be of pathophysiological relevance in these diseases.
Einleitung
3
3. Einleitung
3.1 Monomere GTP-bindende Proteine
Guaninnukleotid-bindende
Proteine
(G-Proteine)
agieren
als
molekulare
Schalter
und
kontrollieren viele Aspekte des Zellverhaltens durch die Regulation von unterschiedlichen
Signaltransduktionswegen (Jaffe & Hall, 2005). Zu den G-Proteinen zählen unter anderem
heterotrimere G-Proteine, Faktoren welche in der Proteinsynthese eine Rolle spielen, wie z. B.
der Elongationsfaktor Tu („elongation factor-Tu“, EF-Tu) und die monomeren GTPasen der Ras
(„Rat sarcoma oncogene“)-Superfamilie (Newmark, 1977; Yokosawa et al., 1975; Chardin, 1988;
Bourne et al., 1991).
3.1.1 Die Ras-Superfamilie
Die Ras-Superfamilie repräsentiert eine Gruppe von mehr als 150 bekannten Proteinen, welche
evolutionär konservierte Orthologe in Pflanzen, Mikroorganismen sowie in Vertebraten und
Invertebraten haben (Chardin, 1988; Colicelli, 2004; Wennerberg et al., 2005). Basierend auf
Sequenzhomologien und ihrer jeweiligen physiologischen Funktion kann die Ras-Superfamilie in
die folgenden fünf Familien eingeteilt werden: Ras, Rho, Rab, Ran und Arf (Colicelli, 2004). Die
Ras-Familie besteht aus 39 beschriebenen Isoformen und ist an der Regulation verschiedener
physiologischer Prozesse beteiligt, wie Genexpression, Differenzierung, Zellproliferation und
Apoptose (Gardner et al., 1993; Reymond et al., 1984; Feramisco et al., 1984; FernandezSarabia & Bischoff, 1993). Einige Mitglieder der Ras-Subfamilie wirken in der Zelle als
Tumorsuppressoren, andere besitzen ein onkogenes Potential (Eckert et al., 2004; Colicelli,
2004). Das Ran-Protein („Ras-like nuclear“) ist für den nukleozytoplasmatischen Export und
Import von Proteinen bzw. RNA verantwortlich (Kadowaki et al., 1993; Moore & Blobel, 1993). Die
größte Familie stellen mit 61 Mitgliedern die Rab-GTPasen dar („Ras-like proteins in brain“), die
als Regulatoren des intrazellulären Vesikeltransports agieren (Ayala et al., 1989; Grosshans et
al., 2006). Bislang sind 30 Isoformen der Arf-GTPasen („ADP-ribosylation factor“) bekannt, die
die Formierung von Vesikelhüllen bei verschiedenen Schritten der Exo- und Endozytose
regulieren (Serafini et al., 1991; Nie & Randazzo, 2006). Die Proteine der Rho-Familie („Rashomologous“) agieren ähnlich wie die GTPasen der Ras-Familie als zentrale Regulatoren in
verschiedenen Signaltransduktionswegen (Jaffe & Hall, 2005).
3.1.2 GTPase-Domäne der monomeren GTPasen
Die monomeren GTPasen haben ein Molekulargewicht von 20 - 40 kDa und besitzen wie alle GProteine eine konservierte 20 kDa große N-terminale GTPase-Domäne, auch G-Domäne
genannt (Bourne et al., 1991). Die G-Domäne besteht aus fünf konservierten Bereichen G-1 bis
Einleitung
4
G-5 und ist für die Nukleotid- und Mg2+-Bindung, für die intrinsische GTPase-Aktivität und für den
Nukleotidaustausch-induzierten Konformationswechsel notwendig (Bourne et al., 1991; Vetter &
Wittinghofer, 2001). Die Bindung von GDP und GTP erfolgt mit einer hohen Affinität und
abhängig vom gebundenen Nukleotid, verändert die G2-Region („switch I“) und die G3-Region
(„switch II) ihre Konformation. Durch die GTP-Bindung-induzierte Konformationsänderung der
GTPase wird über die „switch I“-Region eine Interaktion mit Effektormolekülen ermöglicht (Bishop
& Hall, 2000; Vetter & Wittinghofer, 2001) (siehe Abb. 1, Seite 10).
3.1.3 Lipidmodifikation der monomeren GTPasen
Die Mehrheit der Ras- und Rho-Proteine besitzt ein C-terminales CAAX-Motiv (C=Cystein,
A=aliphatische Aminosäure, X=beliebige Aminosäure), welches ein Erkennungsmotiv für die
Farnesyltransferase und Geranylgeranyltransferase I darstellt (Ghomashchi et al., 1995; Silvius &
L'heureux, 1994; Hancock et al., 1989). Diese Enzyme katalysieren eine kovalente Bindung von
Farnesyl- (C-15 F) oder Geranylgeranylisoprenoiden (C-20 GG) an dem Cysteinrest des CAAXMotivs. Die enzymatische Modifikation des C-terminalen Isoprenoidrests scheint in einigen Fällen
variabel zu sein, da z. B. RhoB (siehe 3.2, Seite 4) entweder durch das C-15 F- oder durch das
hydrophobere C-20 GG-Isoprenoid acetyliert werden kann (Armstrong et al., 1995). Nach der
Isoprenylierung der GTPasen erfolgt eine enzymatische Proteolyse des C-terminalen AAXTripeptids sowie eine Isoprenyl-Cystein-Carboxyl-Methylierung (Lane & Beese, 2006). Zusätzlich
werden einige GTPasen, wie z. B. RhoB noch an einem weiteren Cysteinrest durch Verknüpfung
einer Palmitinsäure (C-16) posttranslational modifiziert (Adamson et al., 1992). Die Prenylierung
sowie die Carboxyl-Methylierung dienen beide der Regulation der subzellulären Lokalisation der
GTPasen in der Zelle (Lane & Beese, 2006; Wright & Philips, 2006). Die Rab-Subfamilie wird
durch die Geranylgeranyltransferase II an distinkten C-terminalen Cystein-Motiven (CC, CXC,
CCX, CCXX oder CCXXX) modifiziert (Khosravi-Far et al., 1991). Dahingegen besitzen Mitglieder
der Arf-Familie und das Ran-Protein kein C-terminales CAAX-Motiv (Kahn et al., 1988; Rush et
al., 1996). Alternativ findet bei einigen Mitgliedern der Arf-Familie eine posttranslationale
Modifikation in Form einer kovalenten Bindung einer Myristinsäure (C-14) an ein N-terminales
Glycin statt (Kahn et al., 1988).
3.2 Rho-GTPasen
Die Rho-GTPasen bilden eine wichtige Unterfamilie der Ras-Superfamilie. Zurzeit sind 22
humane Gene bekannt, welche für 25 verschiedene Proteine kodieren (Wennerberg et al., 2005).
Strukturell unterscheiden sie sich von anderen monomeren GTPasen durch eine Rho-InsertDomäne, die zwischen dem fünften β-Faltblatt und der vierten α-Helix der G-Domäne lokalisiert
ist (Zong et al., 2001). Rho-GTPasen weisen innerhalb der G-Domäne eine ungefähr 30 %ige
Aminosäure-Homologie zu den Ras-Proteinen und eine 40-95 %ige Homologie innerhalb der
Einleitung
5
Rho-Familie auf (Wennerberg et al., 2005). Aufgrund von strukturellen Motiven und biologischen
Funktionen sowie Homologie in der Aminosäuresequenz, kann die Familie der Rho-GTPasen
wiederum in 6 Subfamilien unterteilt werden: Die RhoA- (RhoA, B, C), die Rac1- (Rac1, 1b, 2, 3,
RhoG), die Cdc42- (Cdc42, Cdc42-G25K, TC10, TCL, Chp/Wrch-2, Wrch-1), die Rnd- (Rnd1,
Rnd2, RhoE/Rnd3), die RhoBTB- (RhoBTB1, 2, 3) und die Miro- (Miro-1, 2) Subfamilie. Einige
Rho-GTPasen wie RhoD, Rif und TTF/RhoH, lassen sich keiner der Subfamilien zuordnen
(Wennerberg et al., 2005). Typische Vertreter der Rho-GTPasen, wie z. B. RhoA, Rac1 und
Cdc42 haben ein Molekulargewicht von 20 - 25 kDa und bestehen nur aus der G-Domäne sowie
kurzen N- und C-terminalen Enden (Wennerberg et al., 2005). Die Mitglieder der RhoBTB- und
Miro-Subfamilie weichen von der gewöhnlichen Struktur der Rho-GTPasen ab und können
aufgrund zusätzlicher Domänen aus bis zu 700 Aminosäuren bestehen (Fransson et al., 2003;
Rivero et al., 2001). Die Miro-Proteine stellen aufgrund der Sequenz-Divergenz zu den anderen
Rho-GTPasen und dem Fehlen der Rho-spezifischen Insert-Domäne die ungewöhnlichsten
Mitglieder dieser Familie dar.
Während ursprünglich angenommen wurde, dass die Mitglieder der Rho-Familie ausschließlich
Regulatoren des Aktin-Zytoskeletts sind und damit wichtige physiologische Prozesse, wie die
Zellmigration, Chemotaxis, Phago- und Pinozytose, Zell-Zell- und Zell-Matrix-Adhäsion steuern
(Chrzanowska-Wodnicka & Burridge, 1992; Takaishi et al., 1993; Jones et al., 1998; Hackam et
al., 1997; Cox et al., 1997; Ellis & Mellor, 2000; Nobes & Hall, 1995), konnte mittlerweile gezeigt
werden, dass sie darüber hinaus wichtige Mediatoren vieler anderer zellulärer Prozesse sind.
Dazu gehören z. B. die Regulation der Genexpression, der Apoptose und des Zellzykluses
(Mackay & Hall, 1998; Jimenez et al., 1995; Coleman & Olson, 2002; Olson et al., 1995). Eine
weitere wichtige Rolle spielen Rho-GTPasen für die Pathogenese von Erkrankungen, die durch
bestimmte Bakterienstämme ausgelöst werden. Diese Bakterienstämme exprimieren Enzyme
und Toxine, welche die Aktivität verschiedener Rho-GTPasen beeinflussen (Aktories et al., 2000).
Die Cytotoxine A und B des Diarrhoe- und in schweren Fällen Kolitis-verursachenden Bakteriums
Clostridium difficile bzw. das lethale Toxin des entzündungsauslösenden Bakteriums Clostridium
sordellii inaktivieren durch Glukosylierung verschiedene Isoformen der Rho-, Rac- und Cdc42Proteine (Just et al., 1994; Just et al., 1995; Dillon et al., 1995; Popoff et al., 1996). Neben ihrer
Bedeutung für die Pathogenese von Bakterien haben die unterschiedlichen Toxine auch als
molekulare Werkzeuge zum Verständnis der Beteiligung von Rho-GTPasen an zellulären
Vorgängen beigetragen. So ADP-ribosyliert z. B. das Exoenzym C3-ADP-Ribosyltransferase des
Botulismus auslösenden Bakteriums Clostridium botulinum spezifisch RhoA-C und inaktiviert
diese Rho-GTPasen (Aktories et al., 1989; Sekine et al., 1989; Aktories et al., 1992). Diese
Inaktivierung kann deshalb zum Nachweis der Beteiligung von RhoA-C an zellulären Funktionen
herangezogen werden.
Einleitung
6
3.2.1 Funktion von RhoA, Rac1 und Cdc42
Die ersten direkten Hinweise auf die biologische Funktion von Rho-Proteinen ergaben sich durch
Mikroinjektion von rekombinanten Rho-Proteinen bzw. Rho-cDNAs in Swiss 3T3 Fibroblasten
(Paterson et al., 1990). Dadurch konnte gezeigt werden, dass die monomeren GTPasen RhoA,
Rac1 und Cdc42 Einfluss auf das Aktin-Zytoskelett haben. Weitere Untersuchungen ergaben,
dass diese Rho-GTPasen als Antwort auf extrazelluläre Stimuli abgrenzende Effekte auf die
Zellmorphologie, Zellpolarität sowie Zellmigration haben (Nobes & Hall, 1995; Hall, 1998; Schmitz
et al., 2000; Aspenstrom et al., 2004). Des Weiteren belegen Studien, dass für die gerichtete
Zellmigration eine koordinierte Aktivierung von RhoA, Rac1 und Cdc42 notwendig ist (Disanza et
al., 2005). Überexpressionsstudien zeigen, dass RhoA-C gleichermaßen Stressfasern und fokale
Adhäsionen induzieren (Ridley & Hall, 1992). Stressfasern sind kontraktile Bündel, die
hauptsächlich aus Aktinfilamenten, Myosin II und α-Actinin bestehen und im gesamten Zellkörper
lokalisiert sind (Byers & Fujiwara, 1982). Diese Filamente werden an den „Fokal-Adhäsionen“
durch verschiedene Adapterproteine und Transmembran-Verbindungsproteine, die zur IntegrinFamilie gehören, mit der extrazellulären Matrix verknüpft (Ridley & Hall, 1992; Akiyama, 1996).
Die Entstehung der Stressfasern basiert auf einem koordinierten Zusammenspiel des
Diaphanous-verwandten Formins 1 („mammalian homolog of Drosophila diaphanous“, mDia1
oder „diaphanous related formin“, DRF), der Lim Kinase (LimK) und der Rho-Kinase (ROCK)
(Watanabe et al., 1999; Ohashi et al., 2000). Die ROCK-abhängige Aktivierung der LimK und die
Stimulation von DRF führen zur Stimulation der Aktin-Polymerisation sowie zur Stabilisierung der
Aktinfilamente (Geneste et al., 2002). Außerdem reguliert ROCK durch Phosphorylierung der
regulatorischen leichten Myosinkette („regulatory light chain“, RLC) und gleichzeitiger Inhibition
der leichten Myosinketten-Phosphatase („myosin light chain phosphatase“, MLCP) die
Kontraktilität der Aktin-Myosin-Fasern (Kimura et al., 1996; Charest & Firtel, 2007). Die
Aktivierung der „Rac-ähnlichen“-GTPasen induziert am Leitsaum der Zelle die Bildung von
Lamellipodien bzw. „Membrankräuselungen“ sowie fokale Adhäsionen (Ridley et al., 1992; Nobes
& Hall, 1995). Die planaren Zellausläufer wie Lamellipodien werden kurz nach der Zelladhäsion
ausgebildet und bestimmen die Polarität bzw. die Richtung bei der Zellmigration (Nobes & Hall,
1999; Pollard et al., 2001; Ridley et al., 2003). Außerdem spielen sie eine Rolle bei pino- und
phagozytotischen Prozessen (Bar-Sagi & Feramisco, 1986; Ridley et al., 1992; Cox et al., 1997).
Die Bildung der Membranvorsprünge bzw. der Lamellipodien ist begleitet von einer AktinPolymerisation, welche hauptsächlich durch die Aktivierung von WAVE („Wiskott-Aldrich
syndrome protein family verprolin-homologous protein“) (Miki et al., 1998) und der p21aktivierten-Kinase („p21 activated kinase“, Pak) gesteuert wird (Sells et al., 1997). Die Aktivierung
von Pak führt gleichzeitig auch zu einer Aufhebung von RhoA-induzierten Stressfasern und
fokalen Adhäsionen an der Hinterseite der Zelle (Manser et al., 1997). Die Aktivierung der
„Cdc42-ähnlichen“-GTPasen
induziert
eine
Bildung
von
fingerförmigen
Zellausläufern
(Filopodien), die als Chemosensoren gelten und deren Form durch parallele Bündel von
Einleitung
7
Aktinfilamenten bestimmt ist (Jacinto & Wolpert, 2001; Mallavarapu & Mitchison, 1999). Die
Formierung der Filopodien wird unter anderem durch die Aktivierung von WASP („Wiskott-Aldrich
syndrome protein“) oder N-WASP initiiert (Machesky & Insall, 1998). Cdc42 aktiviert zudem die
Tyrosinkinasen ACK1 und ACK2 („activated Cdc42-associated kinase“) (Manser et al., 1994;
Yang & Cerione, 1997; Yokoyama & Miller, 2003; Ahmed et al., 2004; Elliot-Smith et al., 2005;
Galisteo et al., 2006; Shen et al., 2007), wobei letztere die Bildung der fokalen Adhäsionen am
Leitsaum und die Organisation des Aktin-Zytoskeletts reguliert (Yang et al., 2001). Außerdem
reguliert Cdc42 die Zellpolarität durch Bindung an Par6, welche eine Komponente eines
Komplexes bestehend aus Par3 und der atypischen Proteinkinase C ζ (PKC ζ) oder PKC η
darstellt (Joberty et al., 2000). Dieser Komplex reguliert die Position des Mikrotubuliorganisierenden Zentrums während der Zellmigration (Tzima et al., 2003). Letztlich katalysiert
Cdc42 durch die Aktivierung der Serin/Threonin-Kinase MRCK („myotonic dystrophy kinaserelated Cdc42 binding kinase“) die Myosin-Phosphorylierung und dadurch die Position des
Zellkerns während der Zellmigration (Gomes et al., 2005).
Neben der Regulation des Aktin-Zytoskeletts sind die Rho-GTPasen auch bei der Kontrolle der
Genregulation beteiligt. Die Rho-, Rac-, und Cdc42-Subfamilien-Proteine aktivieren den SerumResponse-Faktor (SRF), der anschließend mit dem ternären Komplexfaktor („ternary complex
factor“, TCF) und der Promotor-Regulatorsequenz Serum-Response-Element (SRE) einen
Komplex bildet und dadurch die Transkription spezifischer Gene stimuliert (Hill et al., 1995). Das
SRE findet sich z. B. in den Promotoren von Genen, die für Bestandteile des Zytoskeletts, für
natriuretische Proteine, wie z. B. ANP („atrial natriuretic peptide“) oder für kontraktile Proteine der
quergestreiften oder glattmuskulären Zellen („smooth muscle cells“, SMC), wie z. B. „SM-Myosinheavy-chain“ (SM-MHC) oder „α-SM Actin“ kodieren (Chai & Tarnawski, 2002). Eine veränderte
Aktivierung des SRFs durch Rho, Rac oder Cdc42 kann Auswirkungen auf den Phänotyp einer
Zelle haben und z. B. die Differenzierung von kontraktilen glatten Muskelzellen zum
synthetischen, proliferativen Phänotyp zur Folge haben (Walsh & Takahashi, 2001; Worth et al.,
2001). Die „Rho-ähnlichen“-Proteine regulieren unter anderem auch die Aktivierung des
Transkriptionsfaktors NF-κB („nuclear factor-κB“), welcher proatherogene, proproliferierende
sowie proapoptotische Zellantworten induzieren kann (Perona et al., 1997). Unter anderem führt
die Aktivierung von NF-κB zu einer Expression von inflammatorischen Zytokinen, wie z. B. dem
Tumor-Nekrose-Faktor-α (TNF-α) und zu einer Erhöhung der Expression von interzellulären
(„intercellular adhesion molecule“, ICAM-1) sowie vaskulären Adhäsionsmolekülen („vascular
adhesion molecule”, VCAM-1) (Shimizu et al., 1990; Marui et al., 1993; Brasier, 2006).
3.3 Akzessorische Proteine der Regulation der Rho-GTPasen
Der Zyklus zwischen dem aktiven GTP-gebundenen und dem inaktiven GDP-gebundenen
Zustand der Rho-GTPasen wird hauptsächlich von drei Proteinklassen reguliert: (1) Den
GTPase-aktivierenden Proteinen („Rho GTPase activating protein“, RhoGAPs) (Lancaster et al.,
Einleitung
8
1994), (2) den Guaninnukleotid-Dissoziations-Inhibitoren („Rho guanine nucleotide dissociation
inhibitor”, RhoGDIs) (Fukumoto et al., 1990) und (3) den Guaninnukleotid-Austauschfaktoren
(„Rho guanine nucleotide exchange factor”, RhoGEFs) (Isomura et al., 1990) (siehe Abb. 1, Seite
10).
3.3.1 RhoGAPs
RhoGAPs beschleunigen die intrinsische Hydrolyserate der monomeren aktivierten RhoGTPasen um ein Vielfaches (bis zu 105-fach) und ermöglichen dadurch eine schnelle
Abschaltung von Rho-GTPasen in Signaltransduktionswegen (Bourne et al., 1991). Derzeit sind
über 80 humane RhoGAPs bekannt, denen allen neben unterschiedlichen strukturellen Proteinund Lipidbindungsmotiven eine konservierte RhoGAP-Domäne zueigen ist. Diese aus 150
Aminosäuren bestehende Domäne interagiert mit spezifischen Aminosäuren in den „switch“Regionen von aktiven GTP-gebundenen Rho-GTPasen und fördert dadurch die Hydrolyse des γPhosphats des gebundenen GTPs. Die Rho-GTPasen werden durch dieses Ereignis in den
inaktiven GDP-gebundenen Zustand zurückgeführt (Moon & Zheng, 2003; Bernards & Settleman,
2004; Scheffzek & Ahmadian, 2005).
3.3.2 RhoGDIs
Die RhoGDI-Proteine stellen eine Familie aus drei Mitgliedern dar (RhoGDI-α, RhoGDI-β und
RhoGDI-γ), welche eine distinkte Bindungsselektivität für zumindest einige der Rho-GTPasen
Proteine aufweisen (Ohga et al., 1989; Olofsson, 1999). RhoGDIs extrahieren Rho-GTPasen
sowohl in ihrer GDP- als auch in ihrer GTP-gebundenen Form aus der Membran und bilden im
Zytosol einen stabilen RhoGDI/Rho-GTPasen-Komplex (Olofsson, 1999). Ebenso extrahiert
RhoGDI bevorzugt durch die cAMP-abhängige Proteinkinase A („cAMP dependent proteinkinase
A“, PKA) oder cGMP-abhängige Proteinkinase („cGMP dependent protein kinase“, cGK)
phosphoryliertes RhoA aus der Plasmamembran und beendet somit frühzeitig den Signalweg der
GTPase (Lang et al., 1996; Forget et al., 2002; Sauzeau et al., 2000; Sawada et al., 2001). Des
Weiteren können RhoGDIs die Rho-GTPasen nach der Extraktion aus der Plasmamembran an
ein anderes Membrankompartiment innerhalb der Zelle transportieren (Dovas & Couchman,
2005; Dransart et al., 2005). RhoGDIs interagieren nur mit prenylierten Rho-Proteinen und
inhibieren den Nukleotidaustausch sowie GTP-hydrolysierende Aktivitäten (Hori et al., 1991).
Strukturanalysen von RhoGDI/Rho-GTPasen-Komplexen zeigen, dass diese RhoGDI-Proteine
aus einer N-terminalen Domäne, welche den GDP/GTP-Zyklus des monomeren Proteins durch
Bindung an spezifische Reste der „switch“-Regionen beeinflusst, sowie aus einer C-terminalen
Domäne bestehen, die den Isoprenylrest der Rho-GTPase in einer hydrophoben „Tasche“ bindet
(Li et al., 1997; Scheffzek et al., 2000).
Einleitung
9
3.3.3 RhoGEFs
RhoGEFs beschleunigen die geringe, intrinsische Austauschaktivität der Rho-GTPasen von GDP
zu GTP und sind somit direkt verantwortlich für deren Aktivierung und die damit einhergehende
Wechselwirkung mit Effektorproteinen (Schmidt & Hall, 2002; Hakoshima et al., 2003). 1985
wurde das Onkogen Dbl als erster Säugetier-GEF aus einem diffusen menschlichen B-Zell
Lymphom isoliert (Eva & Aaronson, 1985). Dbl besitzt eine etwa 200 Aminosäuren große
Proteindomäne, welche für die katalytische Aktivität des Proteins verantwortlich ist (Ron et al.,
1988; Ron et al., 1991). Bis heute wurden anhand dieser Sequenz, die als Dbl-homologe
Domäne (DH-Domäne) bezeichnet wird, 69 distinkte, putative RhoGEFs im menschlichen Genom
identifiziert (Rossman et al., 2005). Die DH-Domänen der Dbl-homologen RhoGEFs weisen, bis
auf drei konservierte Regionen (C1-C3), eine niedrige Homologie in ihrer Primärsequenz auf.
Selbst RhoGEFs, welche die gleiche Substratspezifität besitzen, haben oftmals eine
Sequenzidentität innerhalb der DH-Domäne von weniger als 20 %. Mutationen in den
konservierten Regionen können zu einer konstitutiv aktiven oder dominant negativen
Veränderung des RhoGEFs führen (Aghazadeh et al., 1998). Für die spezifische Bindung an die
jeweilige GTPase sind die nicht-konservierten Aminosäuren der DH-Domäne von Bedeutung. Die
Mutation einer Aminosäure im nicht-konservierten Bereich der DH-Domäne kann zu einer
Veränderung der Substratspezifität des jeweiligen RhoGEFs führen (Worthylake et al., 2000;
Karnoub et al., 2001; Cheng et al., 2002; Snyder et al., 2002; Rossman & Sondek, 2005). Bei
nahezu allen RhoGEFs grenzt invariant 10-20 Aminosäuren C-terminal der DH-Domäne eine
etwa 100 Aminosäuren lange Pleckstrin-homologe Domäne (PH-Domäne) an (Haslam et al.,
1993). Verschiedene Studien zeigen, dass die Gegenwart der PH-Domäne bei vielen RhoGEFs
die Nukleotid-Austauschfähigkeit deutlich verstärkt (Liu et al., 1998; Rossman & Sondek, 2005).
Des Weiteren wird einem kleinen Teil der bisher identifizierten PH-Domänen (33 %), aufgrund
ihrer Fähigkeit Phospholipide der Plasmamembran zu binden, eine potenzielle Rolle bei der
Membranbindung bzw. der allosterischen Regulation der RhoGEF-Aktivität über Lipide
zugeschrieben (Harlan et al., 1994; Ferguson et al., 1995; Lemmon, 2004).
Einleitung
10
Aktivierung
RhoGEF
GTP
RhoA-GDP
GDP
RhoA-GTP Effektor
RhoA-GDP
Zytoskelett- und
Zellregulation
RhoGDI
Sequestrierung
RhoGAP
Pi
Inaktivierung
Abb. 1: Der molekulare Schaltermechanismus monomerer Rho-GTPasen. Abkürzungen: GEF
(„guanine nucleotide exchange factor“), GAP („GTPase activating protein“), GDI („guanine nucleotide
dissociation inhibitor“), GTP (Guanosintriphosphat), GDP (Guanosindiphsophat), Pi (anorganisches
Phosphat), Rho („Ras-homologous“).
3.4 Regulation von RhoGEFs
Als Regulator zahlreicher zellulärer Signalwege unterliegt auch die Aktivität der RhoGEFs selbst
einer
strikten
Kontrolle.
Trotz
zahlreicher,
für
einzelne
RhoGEFs
spezifische
Aktivierungsmechanismen, die sich wahrscheinlich aus der hochvariablen Sequenz- und
Domänenstruktur der RhoGEFs erklären, zeichnen sich einige allgemeine Prinzipien der
RhoGEF-Regulation ab. Zu diesen zählen die Aktivierung der RhoGEFs durch Entfernen von
intramolekularen,
inhibitorischen
Sequenzen,
durch
Phosphorylierung,
durch
Phospholipidbindung, durch direkte Protein-Protein-Interaktionen sowie durch die Regulation der
RhoGEF-Aktivität durch ihre subzelluläre Lokalisation. Die Abschaltung der RhoGEF-Aktivität
kann wiederum durch Dephosphorylierung, Degradation oder durch spezifische Inhibitoren
reguliert werden (Schmidt & Hall, 2002; Rossman et al., 2005; Garcia-Mata & Burridge, 2007).
3.4.1 Aktivierung durch Entfernen intramolekularer, inhibitorischer Sequenzen sowie
durch Phosphorylierung und Phospholipidbindung
Viele RhoGEFs besitzen eine regulatorische Domäne, die die Aktivität der Proteine durch eine
intramolekulare Inhibition unterdrückt. Für einige Proteine, wie z. B. Dbl und p164-RhoGEF,
konnte gezeigt werden, dass ein Entfernen von N- oder C-terminalen Sequenzen zu einer
konstitutiven Aktivität der Proteine führt (Ron et al., 1989; Rumenapp et al., 2002). Andere
Studien zeigen, dass bei einigen RhoGEFs die PH-Domäne die katalytische Aktivität reguliert
(Das et al., 2000; Russo et al., 2001; Welch et al., 2002). In allen diesen Fällen wird
angenommen, dass die Aktivierung der RhoGEFs wahrscheinlich durch Phosphorylierung oder
durch Interaktion mit anderen Proteinen reguliert wird. Das am besten untersuchte Beispiel stellt
Einleitung
11
in diesem Zusammenhang Vav dar, das durch eine Tyrosinphosphorylierung einer N-terminalen
mit der DH-Domäne interagierenden Sequenz sowie durch eine Phosphorylierung des PHDomänen-gebundenen inhibitorisch wirkenden Phospholipids PI-4,5-P2 (Phosphatidyl-Inositol4,5-bi-phosphat) durch die PI3K (Phosphatidyl-Inositol-3-Kinase) zu PI-3,4,5-P3 (PhosphatidylInositol-3,4,5-tri-phosphat) aktiviert wird (Crespo et al., 1997; Salojin et al., 1999; Bustelo, 2000;
Han et al., 1998).
3.4.2 Aktivierung durch direkte Protein-Protein-Interaktion
Einen weiteren Regulationsmechanismus stellt die Aktivierung von RhoGEFs durch heterotrimere
G-Proteine dar. Eine Stimulation von G12/13-Protein-gekoppelten Rezeptoren („G12/13-protein
coupled receptor“, G12/13PCR) induziert eine Aktivierung der Gα12/13-Untereinheiten, die an die
RGS-ähnliche („regulator of G-protein signaling“) Domäne von p115RhoGEF binden. Die RGSDomäne agiert als GAP und stimuliert die GTPase-Aktivität von Gα12/13. Gleichzeitig erhöht die
Bindung von Gα12/13-GTP die Austauschaktivität von p115RhoGEF für RhoA-C (Hart et al., 1998;
Kozasa et al., 1998; Kozasa, 2001). Die Rho-spezifischen GEFs LARG (Leukämie-assoziiertes
RhoGEF) und PDZ-RhoGEF binden ebenfalls wie p115RhoGEF aktiviertes Gα12/13, werden
dadurch aktiviert und führen zu einer Aktivierung von Rho-Proteinen (Tanabe et al., 2004;
Fukuhara et al., 1999; Fukuhara et al., 2000; Wells et al., 2002). LARG kann außerdem durch
aktivierte Gαq- bzw. Gα11-Untereinheiten stimuliert werden (Booden et al., 2002; Vogt et al.,
2003). Ebenso wurde für den kürzlich identifizierten p63RhoGEF eine spezifische Aktivierung
durch Gαq/11-Untereinheiten nachgewiesen (Lutz et al., 2005). Zudem können bestimmte andere
RhoGEFs, wie z. B. P-Rex oder Tiam1, durch Gβγ- und PI3K-abhängige Signalwege aktiviert
werden (Welch et al., 2002; Vogt et al., 2007). Ein weiterer wichtiger Regulationsmechanismus ist
die Oligomerisierung von RhoGEFs (Zhu et al., 2001; Anborgh et al., 1999). Ein gut untersuchtes
Beispiel stellt Dbl dar, das in einem N-terminal deletierten konstitutiv aktiven Zustand, der z. B. in
Karzinomzellen vorkommt (Dbl-Onkogen), Homo- sowie Hetero-Oligomere mit dem nah
verwandten RhoGEF Dbs/Ost bildet. Die Oligomerisierung wird durch die CR2-Region der DHDomäne vermittelt und ist wahrscheinlich wichtig für die Generierung größerer Signalkomplexe,
die die Anzahl aktivierter GTPasen lokal stark erhöht, was die Möglichkeit, mehrere Signalwege
koordiniert zu aktivieren, erlauben könnte. Ob das Volllängenprotein von Dbl (Dbl-Protoonkogen),
in dem der N-Terminus die DH-Domäne maskiert, in der Lage ist Oligomere zu bilden, ist nicht
bekannt. Allerdings ist es denkbar, dass die Oligomerisierung erst nach Aufhebung der Nterminalen Autoinhibition möglich ist und einen zweiten Schritt in der Aktivierung von Dbl darstellt
(Schmidt & Hall, 2002).
Einleitung
12
3.4.3 Regulation der RhoGEFs durch subzelluläre Lokalisation
Viele zelluläre Funktionen der Rho-GTPasen, wie z. B. Zellpolarität und Migration sind abhängig
von ihrer lokalen, intrazellulären Aktivierung. Deshalb ist die subzelluläre Lokalisation der
RhoGEFs für die koordinierte Aktivierung der Rho-GTPasen von Bedeutung. In vielen Fällen (z.
B. Sos1 oder Tiam1) konnte nach einer Aktivierung der Rho-spezifischen GEFs eine veränderte
Lokalisation in der Zelle beobachtet werden (Schmidt & Hall, 2002). Wie bereits erwähnt wurde,
vermittelt die PH-Domäne in einigen Fällen durch die Bindung von Phospholipiden die
Translokation an die Plasmamembran. Darüberhinaus haben Fraktionierungs-Experimente
gezeigt, dass einige RhoGEFs konstitutiv an die Plasmamembran gebunden zu sein scheinen
(Whitehead et al., 1999) und andere wie z. B. Sos1 oder Tiam1 durch bestimmte Signale, wie
z.
B. Rezeptor-Tyrosinkinase-Aktivierung oder als Antwort auf eine zelluläre Aktivierung, an die
Plasmamembran translozieren (Buday & Downward, 1993; Gale et al., 1993; Skolnik et al., 1993;
Chen et al., 1997). Des Weiteren haben Immunofluoreszenz- und subzelluläre FraktionierungsExperimente gezeigt, dass die RhoGEFs Dbl und Lbc in einer PH-Domänen-abhängigen Art nicht
an die Plasmamembran, sondern an Aktin-Stressfasern translozieren (Zheng et al., 1996; Bi et
al., 2001; Olson et al., 1997). Möglicherweise induzieren RhoGEFs abhängig von ihrer
subzellulären Lokalisation verschiedene Prozesse in der Zelle (Schmidt & Hall, 2002). Die
subzelluläre Kompartimentierung der RhoGEFs kann auch durch Translokalisation an aktivierte
Zelloberflächen-Rezeptoren reguliert werden. Das am besten untersuchte Beispiel ist in diesem
Zusammenhang Vav, das z. B. durch eine SH2/SH3-abhängige Interaktion mit Adapterproteinen
an aktivierte B- und T-Zell-Rezeptoren transloziert (Bustelo, 2000). Außerdem wurde berichtet,
dass die Bindung von Gα13 an p115RhoGEF nicht nur zu einer Aktivierung des Proteins führt,
sondern auch eine Relokalisation vom Zytoplasma zur Plasmamembran zur Folge hat
(Bhattacharyya & Wedegaertner, 2000). Ein distinkter Mechanismus der Regulation der RhoGEFAktivität durch deren Lokalisation wurde für die zwei Proteine Ect1 und Net1 beschrieben. Diese
werden durch zwei N-terminal gelegene nukleäre Lokalisationssignale in den Zellkern
transportiert und dadurch von ihren Substraten getrennt (Prokopenko et al., 1999; Tatsumoto et
al., 1999; Schmidt & Hall, 2002). Neuere Arbeiten zeigen jedoch, dass Ect1 über die Interaktion
mit einem Adapterprotein an der Aktivierung von RhoA durch Tyrosinkinase-Rezeptoren in der
Membran beteiligt sein könnte (Nacak et al., 2007).
Einleitung
13
3.4.4 Inhibition der RhoGEFs
Normalerweise
erfolgt
die
Abschaltung
der
RhoGEF-Aktivität
durch
Umkehrung
des
Aktivierungsmechanismus, z. B. durch Dephosphorylierung, Aufhebung der Protein-Protein- oder
Lipid-Protein-Interaktion. Jedoch ist die Deaktivierung der RhoGEFs komplexer, da einige
Proteine identifiziert wurden, die als Inhibitoren der RhoGEFs agieren können. Die Aktivität von
Vav, Tiam1 und p115RhoGEF wird z. B. durch Bindung von spezifischen Inhibitoren unterdrückt
(Bustelo et al., 1997; Germani et al., 1999; Otsuki et al., 2001; Zhang et al., 1999). Auf welche Art
und Weise diese Moleküle die RhoGEF-Funktion inhibieren ist nicht bekannt. Möglicherweise
spielt z. B. die Interaktion des Inhibitors mit Vav eine Rolle bei der Ubiquitinierung und
Degradierung des Proteins (De Sepulveda et al., 2000). Außerdem besitzen einige RhoGEFs,
wie z. B. Ras-GRF2 zusätzlich eine PEST-Domäne, die für die Degradation des Proteins
zuständig ist (De Hoog et al., 2001; Rechsteiner & Rogers, 1996).
3.5 Stickstoffmonoxid/zyklisches 3'-5'-Guanosinmonophosphat/cGMP-abhängige Proteinkinase-Signalkaskade
3.5.1 Regulation der cGMP-Synthese
cGMP (zyklisches 3'-5'-Guanosinmonophosphat) besitzt ähnlich wie cAMP (zyklisches 3'-5'Adenosinmonophosphat) wichtige Funktionen als intrazelluläres Signalmolekül bei der Regulation
von verschiedenen zellulären Ereignissen (Ashcroft, 1997). Obwohl viele der biologischen
Funktionen von cGMP noch geklärt werden müssen, ist es ein etabliertes, ubiquitäres second
messenger Molekül, das unter anderem an der glattmuskulären Relaxation, an der Inhibition der
Blutplättchenaggregation und an der Regulation der Proliferation bzw. Migration der SMC sowie
der Endothelzellen involviert ist (Hofmann et al., 2006). Zwei Hauptgruppen der cGMP-bildenden
Enzyme wurden identifiziert (Chrisman et al., 1975). Dies sind zum einen die Peptid („atrial
natriuretic peptide“, ANP; „brain natriuretic peptide“, BNP; „C-type natriuretic peptide“, CNP und
Guanylin)-regulierten partikulären Guanylylzyklasen (pGC) (Kobialka & Gorczyca, 2000) und zum
anderen die Stickstoffmonoxid (NO)-sensitiven GC, die hauptsächlich im Zytosol lokalisiert sind
(Poulos, 2006).
3.5.2 Regulation der NO-sensitiven Guanylylzyklasen
Die NO-sensitiven GC sind die am besten charakterisierten Rezeptoren für NO, das von den NOSynthasen (NOS) produziert wird. Die Enzymfamilie der NOS umfasst die neuronale NOS
(nNOS, NOS-1), die induzierbare NOS (iNOS, NOS-2) und die endotheliale NOS (eNOS, NOS-3)
(Bredt et al., 1990; Gross et al., 1990). Die eNOS und die nNOS sind konstitutiv exprimierte
Enzyme und werden Calcium (Ca2+)-abhängig reguliert. Im Gegensatz dazu wird die iNOS Ca2+unabhängig aktiviert (Hecker et al., 1991). Die Expression der iNOS ist induzierbar und wird auf
Einleitung
14
transkriptioneller Ebene reguliert (Geller et al., 1993; Hanafy et al., 2001). Alle drei NOSIsoenzyme bilden Homodimere und katalysieren aus der Aminosäure L-Arginin durch Oxidation
des terminalen Stickstoffs der Guanidinogruppe die Entstehung von L-Citrullin und NO (Palmer et
al., 1988). NO steuert zahlreiche physiologische Funktionen, wie z. B. den Gefäßtonus, die
Regulation der Darmmotilität, die Aktivierung von Thrombozyten und besitzt Eigenschaften als
Neurotransmitter (Bruckdorfer, 2005). Die physiologische Bedeutung von NO als Signalmolekül
ist im Jahr 1987 entdeckt worden (Ignarro et al., 1987; Palmer et al., 1987). In diesen Studien
wurde biologisch freigesetztes NO als die wirksame Entität des Faktors aus der Endothelschicht
von Blutgefäßen, dem „endothelium-derived relaxing factor“ (EDRF) (Furchgott & Zawadzki,
1980) identifiziert.
3.5.3 Effektoren von cGMP
Analysen des cGMP-Systems identifizierten eine Vielzahl von intrazellulären Effektoren von
cGMP. Zu diesen zählen die cGMP-abhängigen Proteinkinasen („cGMP-dependent protein
kinase“, cGK) (Christensen et al., 1975), die cAMP-abhängigen Proteinkinasen („cAMPdependent protein kinase A“, PKA) (Cornwell et al., 1994), cGMP- bzw. cAMP-regulierte
Phosphodiesterasen („phosphodiesterase“, PDE) (Sonnenburg & Beavo, 1994), durch zyklische
Nukleotid-aktivierbare Kationenkanäle („cyclic nucleotide-gated cation channels“, CNG Kanäle)
(Biel et al., 1999) und möglicherweise die monomere GTPase Ras (Munzel et al., 2003; Pham et
al., 2000). In vielen Zelltypen, wie z. B. auch in der glatten Muskulatur stellt die cGK einen der
wichtigsten Effektoren für cGMP dar (Vaandrager & De Jonge, 1996) (Abb. 2).
Einleitung
L-Arginin
NOS
15
L-Citrullin
+
ANP, BNP,
CNP, Guanylin
NO
GTP
pGC
NO-sensitive
GC
NO
Ras
cGMP
PKA
PDEs
cGK
CNG-Kanäle
Ca2+
Na+
Abb. 2: Die cGMP-Signalkaskade in der glatten Muskulatur. Das second messenger Molekül
cGMP wird aus GTP nach Stimulation der löslichen NO-sensitiven oder membrangebundenen
Guanylylzyklase gebildet. cGMP aktiviert die cGK, CNG-Kanäle und reguliert cGMP- und cAMPabhängige PDEs. Abkürzungen: cGK (cGMP-abhängige Proteinkinase), PKA (cAMP-abhängige
Proteinkinase), PDE (Phosphodiesterase), CNG-Kanäle („cyclic nucleotide-gated cation channels“),
Ras („rat sarcoma virus“), GC (Guanylylzyklase), pGC (partikuläre GC), NO (Stickstoffmonoxid), GTP
(Guanosintriphosphat), cGMP (Guanosin-3',5'-zyklisches Monophosphat), ANP („atrial natriuretic
peptide“), BNP („brain natriuretic peptide“), CNP („C-type natriuretic peptide“).
3.5.4 cGMP-abhängige Proteinkinasen
Die cGKs gehören zur Familie der Serin/Threonin-Kinasen und phosphorylieren spezifisch
Substratproteine an den Aminosäuren Serin bzw. Threonin. Der phosphorylierte Aminosäurerest
ist gewöhnlich in eine der typischen Konsensussequenzen RKXS/T bzw. RRXS/T eingebettet, die
aus einem N-terminalen Arginin- und Lysinrest bzw. zwei Argininresten, gefolgt von einer
beliebigen Aminosäure und dem Serin- bzw. Threoninrest, bestehen. Die meisten der bislang
identifizierten Substrate der cGKs enthalten diese so genannte PKA- bzw. cGK-spezifische
Phosphorylierungskonsensussequenz (Glass & Krebs, 1979; Tegge et al., 1995; Pfeifer et al.,
1999). Im Genom von Vertebraten konnten bisher zwei verschiedene cGK-Gene nachgewiesen
werden: die cGMP-abhängige Proteinkinase Typ I (cGKI) und Typ II (cGKII) (Gill et al., 1976;
Jarchau et al., 1994). cGKI und cGKII sind sich zwar strukturell ähnlich, unterscheiden sich aber
in ihrer Gewebsverteilung, subzellulären Lokalisation und Funktion (Schlossmann et al., 2005).
Generell sind die Kinasen aus drei funktionellen Domänen aufgebaut: Der regulatorischen
Domäne, der katalytischen Domäne und dem Amino-Terminus (Pfeifer et al., 1999; Francis &
Corbin, 1999; Hofmann, 2005). Der Amino-Terminus steuert die Dimerisierung der homologen
Einleitung
Untereinheiten,
die
Inhibition
Autophosphorylierungs-abhängige
und
die
Aktivierung
Stimulation
der
16
des
katalytischen
Isoenzyme
bei
Zentrums,
niedrigen
die
cGMP-
Konzentrationen sowie die subzelluläre Lokalisation des Enzyms bzw. die Interaktion mit anderen
Proteinen (Feil et al., 2003; Hofmann, 2005; Schlossmann et al., 2005). Die regulatorische
Domäne besitzt zwei aufeinander folgende cGMP-Bindungsstellen, die cGMP sowohl mit
geringer als auch mit hoher Affinität binden (Hofmann et al., 1985). Nach Bindung von 2 mol
cGMP/mol Enzym an der regulatorischen Domäne kommt es zur Autophosphorylierung des
Amino-Terminus an Threonin 59 der cGKI-α bzw. an Serin 64 und Serin 80 der cGKI-β unter
Ausbildung einer Konformationsänderung der Isoenzyme (Landgraf et al., 1990). Dadurch steigt
der α-helikale Anteil an, wobei das Molekül expandiert (Zhao et al., 1997) und die Hemmung der
katalytischen Domäne durch die N-terminale Pseudo-Substratbindungsstelle aufgehoben wird.
Die katalytische Domäne enthält eine große Bindungstasche für das Peptidsubstrat und eine
kleine Mg+-ATP-Bindungstasche. Bei einer Interaktion des Substrats mit der Bindungsstelle in der
katalytischen Domäne wird das γ-Phosphat des ATPs auf den Serin- bzw. Threoninrest des
Zielproteins übertragen (Pfeifer et al., 1999).
Die ungefähr 75 kDa große cGKI ist ein Homodimer und liegt löslich im Zytosol vor (Gill et al.,
1976). Durch alternatives Spleißen zweier für den Amino-Terminus kodierender Exone entstehen
zwei unterschiedliche Isoformen der cGKI, die cGKI-α bzw. cGKI-β (Francis et al., 1988; Wolfe et
al., 1989), welche sich in den ersten etwa 100 Aminosäuren unterscheiden. Die aktive cGKI
wurde 1972 zum ersten Mal im Rattenkleinhirn nachgewiesen (Hofmann & Sold, 1972) und
wurde seitdem in vielen Geweben von Säugetieren identifiziert. Die höchste Expression der cGKI
wurde unter anderem in vaskulären glatten Muskelzellen („vascular smooth muscle cell“, VSMC)
(Keilbach et al., 1992) sowie in Thrombozyten (Waldmann et al., 1986) nachgewiesen und zu
einem geringeren Anteil z. B. auch in Endothelzellen von Blutgefäßen (Draijer et al., 1995) sowie
in Kardiomyozyten (Kumar et al., 1999). Etablierte Substrate der cGKI-Isoformen sind z. B. das
Myosin-Bindungs-Substrat („myosin binding substrate”, MBS auch „myosin-targeting subunit of
myosin light-chain phosphatase“, MYPT1) der Myosin-Leichtketten-Phosphatase („myosin light
chain phosphatase“, MLCP) (Surks et al., 1999), das IP3 (Inositol-1,4,5-triphosphat)-Rezeptorassozierte cGKI-Substrat (IRAG) (Schlossmann et al., 2000) sowie RGS2 (Tang et al., 2003). Ein
weiteres Substrat der cGKI stellt unter anderem RhoA dar (Ellerbroek et al., 2003). Die cGKII,
deren molekulare Masse etwa 85 kDa beträgt, tritt ebenfalls als Homodimer auf (Jarchau et al.,
1994). Sie ist aufgrund einer Myristoylierung des Amino-Terminus membrangebunden und
kommt im Gehirn, in Knochen, den Nieren und der intestinalen Mukosa vor (Pfeifer et al., 1999;
Hofmann et al., 2000). Die cGKII stimuliert im Darm cGMP-regulierte Cl--Kanäle bzw. die
Sekretion von Cl--Ionen und Wasser (Pfeifer et al., 1996; Vaandrager et al., 1997). In der Niere
wirkt die cGKII vermutlich hemmend auf die Renin- und Aldosteronfreisetzung (Wagner et al.,
1998). Außerdem spielt die cGKII beim Knochenwachstum und bei der Steuerung des TagNacht-Rhythmus eine Rolle (Pfeifer et al., 1996; Golombek et al., 2004).
Einleitung
17
3.6 Regulation des Gefäßtonus des glatten Muskels
3.6.1 Regulation der Ca2+-abhängigen und Ca2+-unabhängigen Kontraktion des glatten
Muskels
Der kontraktile Zustand des glatten Muskels wird hauptsächlich durch Rezeptor- bzw.
mechanisch-vermittelte Aktivierung von Myosin gesteuert. Dies ermöglicht die Interaktion von
Aktin und Myosin und führt über einen ATP-abhängigen Zyklus des Myosinmoleküls an den
Aktinfilamenten zur Verkürzung des Sarkomers und damit zur Kontraktion des glatten Muskels
(Webb, 2003). Die Ca2+-abhängige Kontraktion der glatten Muskulatur wird durch einen Anstieg
der intrazellulären Ca2+-Konzentration ausgelöst, welches sowohl aus dem Extrazellulärraum als
auch aus dem sarkoplasmatischen Retikulum (SR) in das Zytosol der glatten Muskulatur
gelangen kann (Berridge et al., 1998; Berridge et al., 2003; Mcdaniel et al., 2001). Agonisten, wie
z. B. Noradrenalin oder Angiotensin II, die an Gq/11PCRs binden, lösen eine Ca2+-abhängige
Kontraktion der glatten Muskulatur aus. Die Ligandenbindung an den GPCR hat eine Aktivierung
der heterotrimeren Gq/11-Proteine zur Folge, die ihrerseits die Phospholipase C-β (PLC-β)
aktivieren (Ushio-Fukai et al., 1998; Wang et al., 2004; Xia et al., 2001). PLC-β katalysiert die
Entstehung der Botenstoffe Diazylglyzerol (DAG) und IP3 (Filtz & Niibori, 2004). IP3 induziert
durch Bindung an den IP3-Rezeptor, einem Ionenkanal des SR, die Freisetzung von Ca2+ aus
den intrazellulären Speichern in das Zytosol (Bootman et al., 2002; Hisatsune et al., 2005). Die
Agonisten-induzierte Ca2+-Freisetzung aus dem SR löst in der Plasmamembran die Öffnung von
speichergesteuerten Kanälen aus, was als ein kapazitativer Ca2+-Einstrom bezeichnet wird.
Dieser Ca2+-Einstrom dient zur Wiederbeladung des leeren SR mit Ca2+ und zur
Aufrechterhaltung einer erhöhten zytosolischen Ca2+-Konzentration (Mcdaniel et al., 2001). Der
Anstieg der intrazellulären Ca2+-Konzentration führt zur Aktivierung der Ca2+/Calmodulin- (CaM)
abhängigen leichten Myosinketten-Kinase („myosin light chain kinase“, MLCK) und zur
Phosphorylierung der RLC am Serin-19, welches den Schlüsselmechanismus zur Kontraktion der
glatten Muskulatur darstellt (Schlossmann et al., 2003) (siehe Abb. 3, Seite 19). Zudem wird der
Phosphorylierungsgrad der RLC Ca2+-unabhängig von der MLCP gesteuert. Die MLCP reguliert
die Relaxation des glatten Muskels durch Abspaltung der Phosphatgruppe von der RLC (Lee et
al., 1997). Die MLCP ist ein Holoenzym, das aus drei Untereinheiten zusammengesetzt ist: Einer
etwa 37 kDa großen katalytischen Untereinheit (PP1c), einer 110-130 kDa großen
regulatorischen Untereinheit (MYPT1) sowie einer 20 kDa großen Untereinheit, deren Funktion
noch unbekannt ist (Hartshorne, 1998; Kitazawa et al., 2003). Die Ca2+-unabhängige Kontraktion
der glatten Muskulatur wird durch eine Stimulation von G12/13PCRs über die Aktivierung des
RhoA/ROCK-Signalwegs vermittelt (Gohla et al., 2000). Die Aktivierung der ROCK katalysiert
eine Phosphorylierung der MYPT1-Untereinheit der MLCP und vermindert dadurch deren
Enzymaktivität. Die Hemmung der MLCP erhöht den Phosphorylierungsgrad der RLC und führt
dadurch bei konstantem Ca2+-Spiegel zur Verstärkung der Kontraktion der glatten Muskulatur
Einleitung
18
(Bonnevier et al., 2004; Somlyo & Somlyo, 1998). Dieser Vorgang wird auch Ca2+-Sensitisierung
genannt. Die RLC-Phosphorylierung wird also durch eine Agonisten-induzierte duale Regulation
über die Aktivierung von Gq/11- und G12/13-Proteinen vermittelt. Weitere Möglichkeiten zur
Hemmung der MLCP-Aktivität stellt die Phosphorylierung des PKC-stimulierten MyosinPhosphatase Inhibitorproteins (CPI-17) (Eto et al., 1995; Kitazawa et al., 2000; Kitazawa et al.,
2004; Bonnevier & Arner, 2004) und die Arachidonsäure-induzierte Dissoziation der MLCP dar
(Xiao et al., 2005). Die Phosphorylierung von CPI-17 wird unter anderem auch von der ROCK
(Koyama et al., 2000), der Proteinkinase N (PKN), der „MYPT1-assoziierten“-Kinase (Macdonald
et al., 2001) und der „integrin-linked“-Kinase (Deng et al., 2001) vermittelt. Das Gleichgewicht des
RLC Phosphorylierungsgrads wird folglich zum einen durch den RhoA/ROCK-Signalweg und zum
anderen durch eine Phosphorylierung des CPI-17 Proteins in Richtung phosphorylierter RLC
verschoben, wodurch eine Ca2+-unabhängige Kontraktion des glatten Muskels induziert wird
(Hofmann, 2005; Somlyo & Somlyo, 2000) (Abb. 3).
Einleitung
19
Agonisten
Gq/11
G12/13
PLC-β
RhoGEF
RhoA-GDP
IP3
RhoA-GTP
RLC
Ca2+
IP3 R
IRAG
MLCK
ROCK
P
RLC
MYPT1
(MBS)
SR
Calcium
Aktin/Myosin
Abb. 3: Ca2+-abhängige und Ca2+-unabhängige Kontraktion der glatten Muskulatur. Die
Aktivierung der Gq/11-Proteine führt zur Ca2+-Freisetzung aus dem SR und Aktivierung der Ca2+/CaMabhängigen MLCK. G12/13-Proteine aktivieren den RhoA/ROCK-Signalweg und hemmen die MLCPAktivität. Beide Signalwege erhöhen den Phosphorylierungsgrad der RLC und führen zur Kontraktion
des glatten Muskels. Weitere Erklärungen im Text. Abkürzungen: Gq/11 (heterotrimeres Gq/11-Protein),
G12/13 (heterotrimeres G12/13-Protein), Rho („Ras-homologous“), GEF („guanine nucleotide exchange
factor“), GTP (Guanosintriphosphat), GDP (Guanosindiphosphat), ROCK (Rho-Kinase), MYPT1
(„myosin-targeting subunit of myosin light-chain phosphatase”), MBS („myosin binding substrate“),
RLC („regulatory light chain“), MLCK (Calmodulin-abhängige leichte Myosinketten-Kinase), Ca2+
(Calciumion), IP3 (Inositol-1,4,5-triphosphat), IRAG (IP3-Rezeptor-assoziertes cGKI-Substrat), SR
(sarkoplasmatisches Retikulum), PLC (Phospholipase C), CaM (Calmodulin), R (Rezeptor), P
(Phosphat).
3.6.2 Regulation der cGMP/cGKI-abhängigen Relaxation des glatten Muskels
Die Relaxation des glatten Muskels durch den cGMP/cGKI-Signalweg wird sowohl über Ca2+abhängige als auch Ca2+-unabhängige Mechanismen vermittelt (Schlossmann et al., 2005). In
Abbildung 4 (Seite 21) sind die wichtigsten Angriffsziele der cGKI im glatten Muskel dargestellt.
Das im glatten Muskel überwiegend exprimierte Isoenzym der cGKI ist die cGKI-β (Keilbach et
al., 1992). Das IP3-Rezeptor-assoziierte cGKI-Substrat (IRAG) wurde als ein Substratprotein der
cGKI-β identifiziert (Schlossmann et al., 2000), das mit dem IP3-Rezeptor und der cGKI-β
assoziiert ist. Eine cGKI-β-abhängige Phosphorylierung von IRAG vermittelt vermutlich die
Relaxation des glatten Muskels, welche möglicherweise die Hormon-induzierte Ca2+-Freisetzung
aus dem SR inhibiert (Geiselhoringer et al., 2004). Eine weitere Möglichkeit die intrazelluläre
Einleitung
20
Ca2+-Konzentration zu reduzieren, ist die cGKI-abhängige Phosphorylierung des Ca2+abhängigen
Kaliumkanals
(BKCa-Kanal)
(Alioua
et
al.,
1998).
Dadurch
wird
die
2+
Öffnungswahrscheinlichkeit des BKCa-Kanals bei konstanter Ca -Konzentration erhöht. Bei
geöffnetem BKCa-Kanal kommt es durch den K+-Ausstrom zur Hyperpolarisation der Zelle, was
schließlich zu einer Inaktivierung von spannungsaktivierten Ionenkanälen führt. Die Inaktivierung
des L-Typ-Ca2+-Kanals reduziert den Ca2+-Einstrom in die Zelle und verringert die zytosolische
Ca2+-Konzentration (Fukao et al., 1999; Taniguchi et al., 1993). Die Phosphorylierung der PLC-β3
durch die cGKI-α führt vielleicht direkt zur Hemmung der IP3-Synthese (Ruth et al., 1993; Xia et
al., 2001). Jedoch ist noch nicht geklärt, ob diese Phosphorylierung eine Bedeutung für die
Relaxation der glatten Muskeln hat. Dagegen trägt die Phosphorylierung des RGS2 durch die
cGKI-α zur Translokation an die Plasmamembran bzw. zur Relaxation des glatten Muskels bei
(Tang et al., 2003). Die direkte Interaktion von RGS-Domänen an GTP-gebundene GαUntereinheiten bewirkt eine Inaktivierung der aktiven Gα-Untereinheit durch Beschleunigung der
GTPase-Aktivität (Hepler, 1999), deshalb nimmt die Agonisten-induzierte IP3-Bildung in RGS2
deletierten Zellen zu (Wang et al., 2004). Ein weiteres Target der cGKI-vermittelten Relaxation
stellt die MLCP dar, deren Aktivierung zur Desensitisierung gegenüber Ca2+ („Ca2+Desensitisierung“) und somit zur Relaxation des glatten Muskels führt (Bonnevier et al., 2004;
Lee et al., 1997). Kürzlich wurde gezeigt, dass die cGKI-α über den Amino-Terminus mit der
MYPT1-Untereinheit der MLCP interagiert und diese Interaktion zur Regulation des Gefäßtonus
der glatten Muskulatur essentiell ist (Surks & Mendelsohn, 2003; Surks et al., 1999). Eine weitere
Arbeit zeigt, dass die cGKI-α die beiden regulatorischen Untereinheiten MYPT1 und M20 der
MLCP phosphoryliert, jedoch ohne die Phosphataseaktivität gegenüber der RLC zu ändern
(Nakamura et al., 1999). Eine cGKI- und PKA-abhängige Phosphorylierung des 17 kDa großen,
glattmuskulär-spezifischen Proteins Telokin, welches mit der C-terminalen Domäne der
glattmuskulären MLCK identisch ist (Ito et al., 1989; Wu et al., 1998), induziert vermutlich eine
Ca2+-Desensitisierung durch die Aktivierung der MLCP (Choudhury et al., 2004; Wu et al., 1998).
Des Weiteren belegt eine Studie, dass der cGMP/cGKI-abhängige Signalweg der PKCvermittelten Phosphorylierung von CPI-17 und damit der Ca2+-Sensitisierung entgegenwirken
kann. Auf diese Weise erhöht die cGKI vermutlich die MLCP-Aktivität und induziert die Ca2+Desensitisierung über einen RhoA/ROCK-unabhängigen Signalweg (Bonnevier & Arner, 2004).
Einen weiteren Mechanismus zur Ca2+-Desensitisierung stellt die Inhibition der RhoA-vermittelten
Ca2+-Sensitisierung durch eine cGKI-abhängige Phosphorylierung von RhoA am Serin 188 dar
(Sauzeau et al., 2000; Sawada et al., 2001). Dies bewirkt eine Reduktion der ROCK-vermittelten
Hemmung der MLCP (Ito et al., 2004). Der Einfluss der cGKI-abhängigen Phosphorylierung von
RhoA wird in dem folgenden Abschnitt genauer erläutert.
Einleitung
21
Agonisten
G12/13
Gq/11
PLC-β3
RhoGEF
RhoA-GDP
RGS2
Ca2+
Calcium
K+
Hyperpolarisation
BKCa
α
cGKI
IP3
L-Typ Ca2+Kanal
IP3 R
IRAG
β
RhoA-GTP
α
ROCK
MYPT1
(MBS)
cGMP
SR
Calcium
NO-sensitive
GC
NO
Aktin/Myosin
pGC
ANP, BNP,
CNP, Guanylin
Abb. 4: Schematische Darstellung der NO/cGMP/cGKI-vermittelten Relaxation der glatten
Muskulatur. Mögliche Angriffsziele der cGKI sind RhoA, der BKCa-Kanal, RGS2, IRAG und die
MYPT1 (MBS)-Untereinheit der MLCP. Weitere Erklärungen im Text. Abkürzungen: Gq/11
(heterotrimeres Gq/11-Protein), G12/13 (heterotrimeres G12/13-Protein), Rho („Ras-homologous“), GEF
(„guanine nucleotide exchange factor“), GTP (Guanosintriphosphat), GDP (Guanosindiphosphat),
ROCK (Rho-Kinase), MYPT1 („myosin-targeting subunit of myosin light-chain phosphatase”), MBS
(„myosin binding substrate“), Ca2+ (Calciumion), IP3 (Inositol-1,4,5-triphosphat), IRAG (IP3 Rezeptorassoziertes cGKI Substrat), SR (sarkoplasmatisches Retikulum), PLC (Phospholipase C), R
(Rezeptor),
IRAG
(IP3-Rezeptor-assozierte
cGKI-Substrat),
cGMP
(zyklisches
3'-5'Guanosinmonophosphat), cGK (cGMP-abhängige Proteinkinase ), K+ (Kaliumion), BKCa (Ca2+abhängiger Kaliumkanal), NO (Stickstoffmonoxid), GC (Guanylylzyklase), pGC (partikuläre GC), ANP
(„atrial natriuretic peptide“), BNP („brain natriuretic peptide“), CNP („C-type natriuretic peptide“).
3.6.3 Einfluss der cGKI auf RhoA
Erste Hinweise auf eine phosphorylierungsabhängige Regulation der Rho-Aktivität ergaben sich
durch eine Behandlung von humanen Lymphozyten mit einem Aktivator der Adenylylzyklase. Die
Akkumulation des cAMPs induzierte ähnliche morphologische Veränderungen wie der Rhospezifische Inhibitor C3T (Lang et al., 1996). Ausgehend von dieser anfänglichen Beobachtung
konnte gezeigt werden, dass RhoA sowohl von der PKA als auch von der cGKI C-terminal am
Serin 188 phosphoryliert werden kann (Lang et al., 1996; Sawada et al., 2001; Ellerbroek et al.,
2003). Diese PKA- bzw. cGKI-abhängige Phosphorylierung von RhoA inhibiert die RhoA-Funktion
(Lang et al., 1996; Forget et al., 2002; Sawada et al., 2001), da PKA- bzw. cGKI-abhängig
phosphoryliertes RhoA durch RhoGDI, ungeachtet des Aktivierungszustands (GDP oder GTP
Einleitung
22
gebunden) leichter aus der Plasmamembran extrahiert werden kann (Lang et al., 1996; Forget et
al., 2002; Rolli-Derkinderen et al., 2005; Kwak & Uhlinger, 2000). Dies verringert die
Interaktionsfähigkeit von RhoA mit RhoGEFs oder Effektoren (Lang et al., 1996; Laudanna et al.,
1997; Dong et al., 1998). Mutationsstudien haben gezeigt, dass die inhibitorisch wirkende
Phosphorylierung von RhoA am Serin 188 durch eine phosphorylierungsresistente RhoA-Mutante
S188A aufgehoben werden kann (Sawada et al., 2001; Ellerbroek et al., 2003; Nusser et al.,
2006). Neben der direkten Interaktion mit RhoA scheint die cGKI den Rho-Signalweg jedoch auch
ober- und unterhalb von RhoA zu beeinflussen. Dabei hemmt die cGKI sowohl die Aktivierung
von endogenem RhoA nach Stimulation mit Serum oder durch aktiviertes Gα12/13 bzw. Gαq/11, als
auch die SRF-abhängige Genexpresssion unterhalb von aktiviertem RhoA. Bei der Hemmung der
SRF-abhängigen Genexpression scheint der Angriffspunkt der cGKI distal der Rho-Effektoren
ROCK, PKN und PRK-2 („proliferation-related kinase“) zu liegen (Gudi et al., 2002). Im Rahmen
dieser
cGKI-vermittelten
Hemmung
der
SRF-abhängigen
Genexpression
wird
VASP
(„vasodilatator-stimulated phosphoprotein“) als mögliches Zielprotein beschrieben (Zhuang et al.,
2004). Zhuang und Mitarbeiter haben nachgewiesen, dass VASP die SRF-abhängige
Genexpression distal von Rho stimuliert. Diese Stimulation der SRF-abhängigen Genexpression
kann
durch
eine
cGKI-vermittelte
Phosphorylierung
von
VASP
an
mehreren
Phosphorylierungsmotiven inhibiert werden. Bei VASP-Mutanten ohne Phosphorylierungsmotive
für die cGKI wird die SRF-abhängige Genexpression durch die cGKI nicht gehemmt (Zhuang et
al., 2004). Neben einer Inhibition RhoA-vermittelter Signalwege scheint der NO/cGMP/cGKIabhängige Signalweg auch die Expression von RhoA zu regulieren. Dieser Mechanismus
beinhaltet die cGKI-abhängige Phosphorylierung des Transkriptionsfaktors ATF-1, welcher als
Homodimer an das „cAMP-response-element“ (CRE) des RhoA-Promotors bindet und die
Aktivierung des Promotors induziert (Sauzeau et al., 2003). Außerdem erhöht die Aktivierung des
NO/cGMP/cGKI-Signalwegs möglicherweise die Stabilität des RhoA-Proteins. Studien zeigen,
dass die cGKI-abhängige Phosphorylierung RhoA vor einer Ubiquitin-vermittelten Degradation an
der Plasmamembran durch Forcierung der Rho-GDI vermittelten zytosolischen Lokalisation
schützt. Der Mechanismus der cGKI-abhängigen Phosphorylierung stellt folglich einen
physiologischen Prozess dar, der das Niveau des stabilen Zustands sowie die Expression von
RhoA zu regulieren und RhoGDI/RhoA-GTP nach Stimulation der cGKI-Aktivität im Zytosol zu
akkumulieren vermag (Sauzeau et al., 2003; Rolli-Derkinderen et al., 2005). In vivo Experimente
zeigen, dass dieser Prozess aktiv ist und dass eine Stimulation oder Inhibition des
NO/cGMP/cGKI-Signalwegs die RhoA-Phosphorylierung und die Lokalisation in VSMC reguliert
(Rolli-Derkinderen et al., 2005). Der inhibitorische Einfluss von cGMP/cGKI auf RhoA stellt also
einen Mechanismus dar, durch welchen endotheliales NO die Relaxation der VSMCs regulieren
kann. Eine gesteigerte RhoA-Aktivierung ist zusätzlich zur Modulation der Kontraktion der glatten
Muskulatur in die Kontrolle von zahlreichen anderen zellulären Funktionen involviert, wie z. B. die
Proliferation und die Migration von VSMCs und Endothelzellen (Seasholtz et al., 1999). Folglich
Einleitung
23
vermittelt eine cGMP/cGKI-abhängige Phosphorylierung und Inhibition von RhoA durch NO z. B.
blutdrucksenkende, antiproliferative und antimigratorische Effekte (Garg & Hassid, 1989; Rudic et
al., 1998). Aktuelle Studien zeigen jedoch, dass unter bestimmten physiologischen Bedingungen,
bei denen eine gesteigerte RhoA-Aktivierung induziert wird sowie in VEGF („vascular endothelial
growth factor“)-stimulierten Endothelzellen der cGMP/cGKI-abhängige Signalweg keinen Einfluss
auf die RhoA-Aktivierung hat bzw. sogar zu einer RhoA-Aktivierung führt (Gratacap et al., 2001;
Chen et al., 2006; Worner et al., 2007; Gao et al., 2007; Oka et al., 2007; Zeng et al., 2002b).
3.7 Zielsetzungen der Arbeit
p164-RhoGEF, GrinchGEF sowie das bisher funktionell noch nicht charakterisierte RhoGEF10
bilden eine Subfamilie der Dbl-Proteinfamilie. Diese drei Proteine weichen von dem üblichen
Modell eines DH-PH-Tandem Motivs ab. Sie bestehen aus einer N-terminal lokalisierten
katalytischen DH-Domäne, einer ungewöhnlichen, falls überhaupt existierenden PH-Domäne und
einer putativen C-terminalen WD-40-ähnlichen Domäne mit einer β-Propeller-ähnlichen Struktur
(Winkler et al., 2005; Yu et al., 2000). Für GrinchGEF und RhoGEF10 wurden zusätzlich putative
Transmembransegmente beschrieben (Schmidt & Hall, 2002), welche bei GrinchGEF nicht
funktionell sind. Trotz der hohen strukturellen Homologie weisen die drei RhoGEFs ein distinktes
Expressionsmuster auf. Während p164-RhoGEF hauptsächlich in gefäßreichen Geweben, wie z.
B. Herz, Niere oder Lunge und GrinchGEF vorwiegend im Skelettmuskel und Pankreas exprimiert
wird, zeigt RhoGEF10 ein ubiquitäres Vorkommen mit dem höchsten Anteil in gefäßreichen
Geweben. Inhärent für p164-RhoGEF ist vermutlich eine Autoinhibition durch eine Interaktion des
N- und C-Terminus und eine Spezifität für Rho. GrinchGEF aktiviert die Rho-Isoformen RhoA-C
mit einer ähnlichen Präferenz (Yoshizawa et al., 2003; Rumenapp et al., 2002; Winkler et al.,
2005). Über eine mögliche physiologische Relevanz von GrinchGEF und p164-RhoGEF sowie
über mögliche Regulationsmechanismen dieser drei Proteine ist bisher in der Literatur noch
nichts beschrieben worden. Für RhoGEF10 wurde eine physiologische Bedeutung bei der
Nerven-Weiterleitungsgeschwindigkeit angenommen (Verhoeven et al., 2003).
Das Ziel der Untersuchungen, die dieser Arbeit zu Grunde liegen, war die Charakterisierung der
bisher
nicht
näher
untersuchten
Guaninnukleotid-Austauschfaktoren
p164-RhoGEF
und
RhoGEF10. Im Besonderen sollten die Aktivierungsmechanismen aufgeklärt und zelluläre
Systeme bzw. Gewebe identifiziert werden, in welchen p164-RhoGEF und RhoGEF10 von
funktioneller Bedeutung für die physiologische und pathophysiologische Aktivierung von RhoProteinen sind.
Material und Methoden
24
4. Material und Methoden
4.1 Material
4.1.1 Tiere
Wistar-Kyoto-Ratten
4.1.2 Chemikalien
Die verwendeten Chemikalien wurden analysenrein, wenn nicht anders vermerkt, von den Firmen
Calbiochem, Fluka, Roth, Serva, Sigma-Aldrich und Merck bestellt. Weitere Materialien wurden
bezogen von:
4.1.3 Feinchemikalien
Ampholyte
IPG-Puffer, nicht-linear, pH 3-10
GE Healthcare
AMP-PNP
Sigma-Aldrich
8-Bromo-cAMP
Sigma-Aldrich
8-Bromo-cGMP
Sigma-Aldrich/Biolog
Calyculin A
Santa Cruz
GTP
Roche
H-1152P
Calbiochem
H-89
Calbiochem
KT-5823
Sigma-Aldrich
Okadainsäure
Sigma-Aldrich
Protease-Inhibitor
Complete (mini) Tablette, Roche
8-pCPT-cGMP
Biolog
Rp-8-pCPT-cGMP
Biolog
SNP
Sigma-Aldrich
TRITC-Phalloidin
Sigma-Aldrich
Y-27632
Calbiochem
4.1.4 Radiochemikalien
[8,5'-3H]-GDP, 14.5 Ci/mmol, 536 G Bq/mmol PerkinElmer
Material und Methoden
25
4.1.5 Antikörper
Die Primär- bzw. Sekundärantikörper wurden in TBST-Puffer verdünnt.
Primärantikörper
anti-RhoA
monoklonal, sc-418,
Santa Cruz
Anti-RhoA/B/C (H-70)
polyklonal, sc-28565,
Santa Cruz
anti-Rac1
monoklonal, 610650,
Transduction
anti-Cdc42
monoklonal, 17-299,
Upstate
anti-c-myc
monoklonal, Klon 9E10,
Roche
anti-HA
polyklonal, K03100R,
Biodesign
anti-GAPDH
monoklonal, H86504M,
Biodesign
anti-Histon-H1
polyklonal, sc-10806,
Santa Cruz
anti-Gβ
monoklonal, sc-378,
Santa Cruz
anti-Phospho-(Ser/Thr)PKA
polyklonal, 9621,
Cell Signaling
anti-RhoGEF10
polyklonal, PAB-11686,
Orbigen
anti-RhoGEF17
polyklonal,
(Kaninchen-Serum;
affinitätsaufgereinigt)
anti-cGKI
polyklonal,
(von H. Schlossmann
zur Verfügung gestellt)
Tab. 1: Primärantikörper.
Verdünnung
Inkubationsbedingung
Sekundärantikörper
1:200
ü. N., 4°C
anti-Maus
1:500
ü. N., 4°C
anti-Kaninchen
1:1'000
1 h, RT
anti-Maus
1:250
ü. N., 4°C
anti-Maus
1:200
1 h, RT
anti-Maus
1:500
ü. N., 4°C
anti-Kaninchen
1:4'000
ü. N., 4°C
anti-Maus
1:200
ü. N., 4°C
anti-Kaninchen
1:400
ü. N., 4°C
anti-Kaninchen
1:1'000
ü. N., 4°C
anti-Kaninchen
1:1'000
ü. N., 4°C
anti-Kaninchen
1:1'000
ü. N., 4°C
anti-Kaninchen
1:1'000
ü. N., 4°C
anti-Kaninchen
Material und Methoden
Sekundärantikörper
26
Inkubations-
Verdünnung
bedingung
anti-Kaninchen-IgG-PeroxidaseKonjugat (Ziege) A-9169,
1:80'000
45 min, RT
1:10'000
45 min, RT
Sigma-Aldrich
anti-Maus-IgG-PeroxidaseKonjugat (Ziege) A-9044,
Sigma-Aldrich
Tab. 2: Sekundärantikörper.
4.1.6 Enzyme
Alkalische Phosphatase (CIAP)
Fermentas
FideliTaq-Polymerase
USB
Klenow (Großes Fragment der DNA Polymerase I)
Fermentas
PfuTurboHotstart-Polymerase
Stratagene
Restriktionsenzyme
Fermentas, Invitrogen,
New England BioLabs
Reverse Transkriptase (AMV)
Roche
Taq-Polymerase
Qiagen
T4-DNA-Ligase
Fermentas
4.1.7 Genspezifische Primer
Die Primer wurden von der Firma Sigma-Ark synthetisiert und sind in 5’→3’-Orientierung
aufgelistet. „For“ steht für einen Primer in sense- und „rev“ für einen Primer in antisenseRichtung. Die gelieferten Lyophilisate wurden in einer adäquaten Menge dest. Wasser
aufgenommen, um eine 100 µM Primerlösung zu erhalten.
RhoGEF17-19-for (EcoRI)
aaaggtaccgaattctggcggacggggcaccc
RhoGEF17-2007-rev (KpnI)
cctgtggtacccaggccgcaa
RhoGEF17-5302-for
aggaacagcatgaagctccag
RhoGEF17-6108-rev
cccacccacagataccatctt
RhoGEF17-Ratte-3636-for
tgacctcatgatcaagcccg
RhoGEF17-Ratte-6200-rev
tcagagcaggtggtttgtgctgt
RhoGEF17-Maus-3151-for
tgctgtagcaagccacaagt
RhoGEF17-Maus-3436-rev
tgttcaccaagacgtctttgg
Material und Methoden
RhoGEF10-735-for
atcaagtcggtcgagaggaca
RhoGEF10-1271-rev
aagatctgtgatcctgtgcga
PBGD-for
cctgaaactctgcttcgctg
PBGD-rev
ctggaccatcttcttgctgaa
27
Mutagenese-Primer:
Die Mutagenese-Primer wurden mit einer „stillen“ Restriktionsschnittstelle konzipiert, um die
erfolgreiche Mutagenese zu überprüfen. In Tabelle 3 sind die durchgeführten Mutagenesen
aufgelistet.
RhoGEF17-ΔN-S1324A-for (BamHI)
ctgaagcgaaaggcaggatccctgcggcgc
RhoGEF17-ΔN-S1324A-rev (BamHI)
gcgccgcagggatcctgcctttcgcttcag
RhoGEF17-ΔN-SS1330/31AA-for (NruI)
tccctgcggcgcatccgcgatgagcctgtac
RhoGEF17-ΔN-SS1330/31AA-rev (NruI)
gtacaggctcatcgcgatgcgccgcaggga
RhoGEF17-ΔN-S1331E-for
tccctgcggcgcagcgagatgagcctgtac
RhoGEF17-ΔN-S1331E-rev
gtacaggctcatctcgctgcgccgcaggga
RhoGEF17-ΔN-SS1716/17AA-for (NcoI)
gcccttcgccgcgccatccatggctcctccacc
RhoGEF17-ΔN-SS1716/17AA-rev (NcoI)
ggtggaggagccatggatggcgcggcgaagggc
RhoGEF17-ΔN-S1765A-for (HindIII)
gaccgcaggaacatcatgaagcttcagcatgcg
RhoGEF17-ΔN-S1765A-rev (HindIII)
cgcatgctgaagcttcatgatgttcctgcggtc
RhoA-S188A-for (BsrFI)
cgtgggaagaaaaaagccggttgccttgtcttg
RhoA-S188A-rev (BsrFI)
caagacaaggcaaccggcttttttcttcccacg
RhoA-S188E-for
cgtgggaagaaaaaagagggttgccttgtcttg
RhoA-S188E-rev
caagacaaggcaaccctcttttttcttcccacg
Material und Methoden
Name des Klons
RhoGEF17-ΔN-S1324A
RhoGEF17-ΔNSS1330/31AA
RhoGEF17-ΔN-S1331E
RhoGEF17-ΔNSS1716/17AA
28
„template“ bzw.
Primer
Matrize
RhoGEF17-ΔN*
RhoGEF17-ΔN*
RhoGEF17-ΔN-S1324A-for (BamHI)
RhoGEF17-ΔN-S1324A-rev (BamHI)
RhoGEF17-ΔN-SS1330/31AA-for (NruI)
RhoGEF17-ΔN-SS1330/31AA-rev (NruI)
RhoGEF17-ΔN-
RhoGEF17-ΔN-S1331E-for
SS1330/31AA
RhoGEF17-ΔN-S1331E-rev
RhoGEF17-ΔN*
RhoGEF17-ΔN-S1765
RhoGEF17-ΔN*
RhoA-S188A
RhoA-wt
RhoA-S188E
RhoA-S188A
RhoGEF17-ΔN-SS1716/17AA-for (NcoI)
RhoGEF17-ΔN-SS1716/17AA-rev (NcoI)
RhoGEF17-ΔN-S1765-for (HindIII)
RhoGEF17-ΔN-S1765-rev (HindIII)
RhoA-S188A-for (BsrFI)
RhoA-S188A-rev (BsrFI)
RhoA-S188E-for
RhoA-S188E-rev
* wurde von Rümenapp und Mitarbeitern kloniert (Rumenapp et al., 2002)
Tab. 3: Mutagenese.
4.1.8 siRNA-Sequenzen und DNA-Oligonukleotid-Matrizen für Haarnadelschleifen-shRNA
Die siRNA-Sequenzen wurde von Invitrogen bezogen und in 1 mL DEPC-behandeltem H2O
aufgenommen, um eine 20 µM Lösung zu erhalten.
Für die Herstellung der Haarnadelschleifen-shRNAs mussten die siRNA Sequenzen, die bei
transienten Transfektions-Experimenten getestet wurden, modifiziert werden. Ein spezielles
Software-Programm (www.ambion.com/techlib/misc/psilencer_converter.html) konvertierte die
vorhandene Sequenzen in DNA-Oligonukleotid-Matrizen, die eine BamHI-Enzym-Schnittstelle,
einen sense-Strang, eine Schleifen-Sequenz, einen antisense-Strang, einen RNA pol III
Terminator und eine Hind III-Schnittstelle beinhalteten (Abb. 5). Die DNA-Oligonukleotid-Matrizen
für Haarnadelschleifen-shRNA wurden bei der Firma Sigma-Ark bestellt und in einer adäquaten
Menge dest. H2O aufgenommen um eine 200 µM Lösung zu erhalten.
siRNA-Sequenzen:
sense-siRNA-RhoGEF17-Ratte-4041
cagugucauugauacagccagcaaa
antisense-siRNA-RhoGEF17-Ratte-4041
uuugcuggcuguaucaaugacacug
Material und Methoden
29
DNA-Oligonukleotid-Matrizen für Haarnadelschleifen-shRNA:
sense-Haarnadelschleifen-shRNA-Insert-RhoGEF17-Ratte-4041
gatccccagtgtcattgatacagccagcaaattcaagagatttgctggctgtatcaatgacactgtttttggaaa
antisense-Haarnadelschleifen-shRNA-Insert-RhoGEF17-Ratte-4041
agcttttccaaaaacagtgtcattgatacagccagcaaatctcttgaatttgctggctgtatcaatgacactggg
DNA-Sequenz
5'
3'
CAGTGTCATTGATACAGCCAGCAAA
Haarnadelschleifen-shRNA-Insert
BamHI
5'
SchleifenSequenz
sense-Strang
antisense-Strang
RNA pol III
Terminator
HindIII
GATCC C CAGTGTCATTGATACAGCCAGCAAA TTCAAGAGA TTTGCTGGCTGTATCAATGACACTG TTTTT GGAA A
3'
3'
G G GTCACAGTAACTATGTCGGTCGTTT AAGTTCTCT AAACGACCGACATAGTTACTGTGAC AAAAA CCTT TTCGA
Haarnadelschleifen-shRNA
sense-Sequenz
U
UC
UUUUGUCACAGUAACUAUGUCGGUCGUUU
A
GA
5'
3'
CAGUGUCAUUGAUACAGCCAGCAAA
antisense-Sequenz
A
A
G
Abb. 5: DNA-Oligonukleotid-Matrixe für Haarnadelschleifen-shRNA.
4.1.9 Plasmide
pCMV-Tag3/2 A, B, C
Stratagene
pcDNA 3.1
Invitrogen
pDrive Cloning Vector
Qiagen
pGEX-2T
Amersham
pSRE.L
Dian Wu, Rochester,USA
pRL-TK
Promega
pAdEasy-1
Bert Vogelstein, Baltomore, USA
pAdTrack-CMV
Bert Vogelstein, Baltimore, USA
pAdTrack-CMV-shRNA
Susanne Lutz, Mannheim
5'
Material und Methoden
30
4.1.10 Klonierungen
4.1.10.1 Tabellarische Übersicht der Klonierungen
A
Name des Klons
RhoGEF17
Vektor
pCMV-Tag 3C
B
RhoGEF17-ΔDH
pCMV-Tag 3C
C
RhoGEF17SS1330/31AA
pCMV-Tag 3C
D
RhoGEF17S1331E
pCMV-Tag 3C
E
RhoGEF17 -55
pCMV-Tag 3A
F
RhoGEF17 -109
pCMV-Tag 3B
G
pAdTrackRhoGEF17
pAdTrack-CMV
H
RhoGEF17-ΔNRatte
pCMV-Tag 3C
I
RhoGEF10
pCMV-Tag 3B
Klonierung
2007 bp großes PCR-Amplifikat mit den
entsprechenden in 4.1.7 aufgeführten Primern
RhoGEF17-19-for (EcoRI) und RhoGEF17-2007rev (KpnI) (19 - 2007 bp) in EcoRI (737 bp in MCS
vorne/4917 bp in RhoGEF17 -554*) und KpnI (328
bp) geschnittenen RhoGEF17 -554* (Abb. 5 A)
RhoGEF17 -554-ΔDH* XhoI (1344 in RhoGEF17 554-ΔDH*/771 bp in MCS hinten) geschnitten
→ 3606 bp großes Fragment in XhoI (3022 in
RhoGEF17/771 bp in MCS hinten von pCMV-Tag
3C) geschnittenen RhoGEF17 (Abb. 5 B)
RhoGEF17-ΔN*SS1330/31AA
AgeI
(3929
bp)/Bsp119I (3038 in pCMV-Tag 3B) geschnitten
→ 4951 bp großes Fragment in AgeI (3929
bp)/Bsp119I (3038 bp in pCMV-Tag 3C)
geschnittenen RhoGEF17 (Abb. 5 C)
RhoGEF17-ΔN*S1331E AgeI (3929 bp)/Bsp119I
(3038 in pCMV-Tag 3B) geschnitten
→ 4951 bp großes Fragment in AgeI (3929
bp)/Bsp119I (3038 bp in pCMV-Tag 3C)
geschnittenen RhoGEF17 (Abb. 5 D)
RhoGEF17 SmaI (166 bp)/HindIII (750 bp in MCS
hinten) geschnitten
→ 6422 bp großes Fragment in SmaI/ HindII
(712/740 bp in MCS) geschnittenen pCMV-Tag 3A
(Abb. 5 E)
RhoGEF17 NotI (341bp blunt)/HindIII (750 bp in
MCS hinten) geschnitten
→ 6247 bp großes Fragment in SmaI/HindIII
(712/740 bp in MCS) geschnittenen pCMV-Tag 3B
(Abb. 5 F)
RhoGEF17 NotI (667 bp in pCMV-Tag 3C)/HindIII
(750 bp in MCS hinten) geschnitten
→ 6658 bp großes Fragment in NotI/HindIII
(2376/2368 bp in MCS) geschnittenen pAd-TrackCMV (Abb. 5 G)
I. 2590 bp großes PCR-Amplifikat mit den
entsprechenden in 4.1.7 aufgeführten Primern
RhoGEF17-Ratte-3636-for und RhoGEF17-Ratte6200-rev (3636 - 6220 bp) in EcoRV (713 bp in
MCS) linearisierten pCMV-Script
II. pCMV-Script-RhoGEF17-ΔN-Ratte BclI (3645
bp)/XhoI (739 bp in MCS hinten) geschnitten
→ 2601 bp großes Fragment in BamHI/ XhoI
(719/770 bp in MCS) geschnittenen pCMV-Tag 3C
(Abb. 5 H)
KIAA0294 Eco47III (515 bp)/HpaI (4713 bp)
geschnitten
→ 4198 bp großes Fragment in EcoRV (744 bp in
MCS) linearisierten pCMV-Tag 3B (Abb. 5 I)
Material und Methoden
J
RhoGEF10-kurz
pCMV-Tag 3B
K
RhoGEF10-ΔC
pCMV-Tag 3B
L
RhoGEF10-ΔN
pCMV-Tag 3B
M
RhoGEF10-DH
pCMV-Tag 3B
N
RhoGEF10-DH
pGEX-2T
31
I. 3364 bp großes PCR-Amplifikat mit den
entsprechenden in 4.1.7. aufgeführten Primern
RhoGEF10-735-for und RhoGEF10-4215-rev in
pDrive (Δ 1028 - 1144 bp)
II. pDrive RhoGEF10-kurz SapI (956/4166 bp)
geschnitten
→ 3210 bp großes Fragment in SapI (956/4166 bp)
linearisierten RhoGEF10 (Abb. 5 J)
RhoGEF10 EcoRI (736 bp in MCS vorne/2538 bp)
geschnitten
→ 2032 bp großes Fragment in EcoRI (736 bp in
MCS) linearisierten pCMV-Tag 3B (Abb. 5 K)
RhoGEF10 SalI (1397 bp/764 bp in MCS hinten)
geschnitten
→ 3335 bp großes Fragment in SalI (764 bp in
MCS) linearisierten pCMV-Tag 3B (Abb. 5 L)
RhoGEF10 BglII (1265 bp)/EcoRI (2538 bp)
geschnitten
→ 1273 bp großes Fragment in BamHI/EcoRI (719
in MCS/737 bp in MCS) geschnittenen pCMV-Tag
3B (Abb. 5 M)
RhoGEF10 BglII (1265 bp)/EcoRI (2538 bp)
geschnitten
→ 1273 bp großes Fragment in BamHI/EcoRI (930
bp in MCS/940 bp in MCS) geschnittenen pGEX-2T
(Abb. 5 N)
* wurde von Rümenapp und Mitarbeitern kloniert (RhoGEF17 -554 entspricht p164-FL;
RhoGEF17 -554-ΔDH entspricht p164-ΔDH) (Rumenapp et al., 2002)
Tab. 4: Klonierungen.
4.1.10.2 Schematische Darstellung der Klonierungen
A. RhoGEF17
RhoGEF17
MCS
MCS
19 bp
1678 bp 2007 bp
PCR-Amplifikat
737 bp (MCS)
EcoRI
6579 bp
RhoGEF17 -554
pCMV-Tag 3C
4917 bp
EcoRI
1 bp 328 bp
KpnI
RhoGEF17 -554
Material und Methoden
32
B. RhoGEF17-ΔDH
RhoGEF17-ΔDH
ΔDH
3198 bp
MCS
3762 bp
MCS
6612 bp
3022 bp
19 bp
RhoGEF17
RhoGEF17 -554-ΔDH
-554-ΔDH
RhoGEF17
1344 bp
XhoI
pCMV-Tag 3C
771 bp (MCS)
XhoI
RhoGEF17 -554-ΔDH
C. RhoGEF17-SS1330/31AA
RhoGEF17-SS1330/31AA
MCS
MCS
6579 bp
19 bp
RhoGEF17
RhoGEF17-ΔN-SS1331/31 AA
pCMV-Tag 3B pCMV-Tag 3C
3929 bp
AgeI
3038 bp
Bsp119I
RhoGEF17-ΔN-S1330/31AA
D. RhoGEF17-S1331E
RhoGEF17-S1331E
MCS
MCS
6579 bp
19 bp
RhoGEF17
RhoGEF17-ΔN-S1331E
pCMV-Tag 3B
pCMV-Tag 3C
3038 bp
Bsp119I
3929 bp
AgeI
RhoGEF17-ΔN-S1331E
Material und Methoden
33
E. RhoGEF17 -55
RhoGEF17 -55A
MCS
SmaI
712 bp (MCS)
HindIII
740 bp (MCS)
pCMV-Tag 3A
RhoGEF17 -55A
166 bp
SmaI
MCS
750 bp (MCS)
HindIII
RhoGEF17
F. RhoGEF17 -109
RhoGEF17 -109A
MCS
SmaI
712 bp (MCS)
HindIII
740 bp (MCS)
RhoGEF17 -109A
MCS
pCMV-Tag 3B
750 bp (MCS)
HindIII
341 bp
NotI
RhoGEF17
G. pAdTrack-RhoGEF17
pAdTrack-RhoGEF17
MCS
NotI
2376 bp (MCS)
HindIII
2368 bp (MCS)
pAdTrack-RhoGEF17
667 bp
NotI
MCS
pAdTrack-CMV
750 bp (MCS)
HindIII
RhoGEF17
Material und Methoden
34
H. RhoGEF17-ΔN-Ratte
I.
MCS
PCR-Amplifikat (RhoGEF17-ΔN-Ratte)
EcoRV
6220 bp
EcoRV
3636 bp
PCR-Amplifikat (RhoGEF17- ΔN-Ratte)
713 bp (MCS)
EcoRV
pCMV-Script
714 bp (MCS)
EcoRV
RhoGEF17-ΔN-Ratte
II.
MCS
MCS
BclI
3645 bp
XhoI
739 bp
RhoGEF17- ΔN-Ratte
719 bp (MCS)
BamHI
MCS
pCMV-Tag 3C
770 bp (MCS)
XhoI
I. RhoGEF10
RhoGEF10
MCS
Eco47III
515 bp
HpaI
4713 bp
RhoGEF10
MCS
pCMV-Tag 3B
745 bp (MCS)
EcoRV
744 bp (MCS)
EcoRV
KIAA0294
Material und Methoden
35
J. RhoGEF10-kurz
PCR-Amplifikat RhoGEF10-kurz
I.
Δ
1028 bp
1144 bp
MCS
MCS
735 bp
4215 bp
pDrive
PCR-Amplifikat (RhoGEF10-kurz)
316 bp (MCS)
EcoRV
315 bp (MCS)
EcoRV
II.
RhoGEF10-kurz
Δ
1028 bp
1144 bp
MCS
735 bp
4215 bp
pCMV-Tag 3B
PCR-Amplifikat
956 bp
SapI
MCS
4166 bp
SapI
RhoGEF10
RhoGEF10
K. RhoGEF10-ΔC
RhoGEF10-ΔC
MCS
EcoRI
736 bp (MCS)
EcoRI
737 bp (MCS)
RhoGEF10-ΔC
736 bp (MCS)
EcoRI
pCMV-Tag 3B
2538 bp
EcoRI
RhoGEF10
MCS
Material und Methoden
36
L. RhoGEF10-ΔN
RhoGEF10-ΔN
MCS
SalI
763 bp (MCS)
SalI
764 bp (MCS)
RhoGEF10-ΔN
MCS
pCMV-Tag 3B
763 bp (MCS)
SalI
1397 bp
SalI
RhoGEF10
M. RhoGEF10-DH
RhoGEF10-DH
MCS
BamHI
719 bp (MCS)
EcoRI
737 bp (MCS)
RhoGEF10-DH
1265 bp
BglII
MCS
pCMV-Tag 3B
2538 bp
EcoRI
RhoGEF10
N. RhoGEF10-DH
RhoGEF10-DH
MCS
BamHI
930 bp (MCS)
MCS
EcoRI
940 bp (MCS)
RhoGEF10-DH
pGEX-2T
2538 bp
EcoRI
1265 bp
BglII
RhoGEF10
Abb. 6: Schematische Darstellung der Klonierungen.
Material und Methoden
4.1.11 Bakterien
E. coli BL21 (DE3) pLysS {F- ompT hsdSB (rB- mB-) gal dcm met (DE3) pLysS (CamR)}
Novagen
E. coli BJ5183 {endA sbcBC recBC galK met thi-1 bioT bsdR (Strr)}
Stratagene
E. coli dam-/dcm- {ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 gal K2 galT22 mcrA
dcm-6 hisG4 rfbD1 R(zgb210::Tn10) Tets endA1 rspL136 (Strr) dam13:: Tn9
(CamR) xylA-5 mtl-1 thi-1 mcrB1 hsdR2}
New England BioLabs
E. coli XL10 Gold {Tetr D(mcrA)183 D(mcrCB-hsdSMR-mrr)173 endA1
supE44 thi-1 recA1 gyrA96 relA1 lac Hte [F’ proAB lacIqZDM15 Tn10
(Tetr) Tn5 (Kanr) Amy]}
Stratagene
E. coli RosettaTM {F- ompT hsdSB (rB- mB-) gal dcm pRARE2 (CamR)}
Novagen
4.1.12 Zellkultur
DMEM
Sigma-Aldrich
Endothelzellen-Wachstumsmedium
PromoCell
Fötales Kälberserum
Biozol
Gelatine
Sigma-Aldrich
Kollagen I
Upstate
Kolagenase Type II-S
Sigma-Aldrich
L-Glutamin
Sigma-Aldrich
PBS
Sigma-Aldrich
Penicillin/Streptomycin
Sigma-Aldrich
Trypsin-EDTA
Sigma-Aldrich
4.1.13 Transfektionsreagenzien
PolyFect
Qiagen
Lipofectamine2000
Invitrogen
37
Material und Methoden
4.1.14 Verbrauchsmaterialien
Pipettenspitzen
Sarstedt
Zellkulturmaterial
Sarstedt, Nalge Nunc Int.
4.1.15 Sonstige Materialien
anti-c-myc-Agarose konjugiert
Sigma-Aldrich
Cyanogenbromid-Agarose
Sigma-Aldrich
DNA-Größenmarker
1 kb DNA-Leiter, Peqlab
Glutathion-Sepharose Beads
Glutathion-Sepharose 4 Fast-Flow,
GE Healthcare
Nitrozellulose-Membran
Protran, Schleicher&Schuell
Photofilm
Hyperfilm MP, GE Healthcare
Protein-Marker
Roti-Mark Standard, Roth
Protein A-Sepharose CL-4B
GE Healthcare
Streifen für IEF
Immoboline Dry Strip, linear,
pH 3-10, 7cm, GE Healthcare
4.1.16 Geräte
Bakterienbrutschrank
Memmert
Elektroporator
GenePulser, Biorad
Ettan IPGphor IEF System
GE Healthcare
Feinwaage
Sartorius
Gelelektrophoresekammer/Blot Modul
Protean II/ Biorad
Gel-Imager
Multi Image Light Cabinet,
AlphaImagerTM 2200, Alpha-Innotech
Heizblock
Thermomixer comfort, Eppendorf
Homogenisator
Braun-Sonic 300, Quigley-Rochester, Inc
Polytron PT1200E, Kinematica
Mikroskop
Axiovert 25, Zeiss
DMRBE, Leica
Mikroskop-Kamera
DC500, Leica
Mikroskop-Software
IM50, Leica
Multilabel Reader
EnVision, Perkin Elmer
PCR-Gerät
Techne
pH-Meter
Microprocessor pH-Meter, WTW
Photometer
Ultrospec 2000, Pharmacia Biotech
Titertek Multiskan MCC/340
38
Material und Methoden
Rotor für Ultrazentrifuge
SW 27, Beckmann
Schüttler
Neolab
REAX2, Heidolph
Sterile Werkbank
HeraSafe, Heraeus
Ultrazentrifuge
L5,65, Beckmann
Vakuum-Konzentrator
Speed Vac Concentrator, Backofer
Waage
PC440, Mettler
Zellkulturbrutschrank
HeraCell, Heraeus
Zentrifugen
Biofuge fresco, Heraeus
Centrifuge 54125C, Eppendorf
Hettich Rotixa/K
J2-21, Beckmann
4.2 Puffer und Nährmedien
4.2.1 Puffer für molekularbiologische Methoden
DNA-Gelelektrophorese:
50x TAE-Puffer:
2 M Tris-HCl, pH 8
5,7 % Essigsäure (v/v)
0,05 M EDTA
Klonieren von Haarnadelschleifen-shRNA-Insert in einen Expressionsvektor:
10x Annealing-Puffer:
100 mM Tris-HCl, pH 8,0
10 mM EDTA
1 M NaCl
4.2.2 Puffer für proteinbiochemische Methoden
Probenvorbereitung für die SDS-PAGE:
TE-Puffer:
10 mM Tris-HCl, pH 8
1 mM EDTA
39
Material und Methoden
40
SDS-PAGE:
Elektrophorese-Puffer:
0,2 M Tris-HCl, pH 6,8
1,25 M Glycin
0,5 % SDS (w/v)
Western Blot-Puffer:
25 mM Tris-HCl
190 mM Glycin
20 % Methanol (v/v)
10x TBS-Puffer:
100 mM Tris-HCl, pH 7,4
1,5 M NaCl
TBST-Puffer:
10 mM Tris-HCl, pH 7,4
0,15 M NaCl
0,1 % Tween-20 (v/v)
Ponceau-S-Färbelösung:
0,2 % Ponceau-S (w/v)
3 % Essigsäure (v/v)
4x SDS-PAGE Probenpuffer:
0,2 M Tris-HCl, pH 6,8
(Laemmli-Puffer)
8 % SDS (w/v)
0,4 % Bromphenolblau (w/v)
40 % Glycerin (v/v)
10 % β-Mercaptoethanol (v/v)
Coomassie-Färbelösung:
0,14 % Coomassie-Brilliant-Blue R250 (w/v)
50 % Methanol
20 % Essigsäure
Coomassie-Entfärbelösung:
10 % Methanol
10 % Essigsäure
Strip-Puffer:
2 % SDS (w/v)
0,1 M β-Mercaptoethanol
62,5 mM Tris-HCl, pH 6,8
Material und Methoden
41
GDP/GTP-Austausch-Assay:
10x Beladungspuffer-Stammlösung:
200 mM Tris-HCl, pH 7,5
1 M NaCl
20 mM EDTA
1x Beladungspuffer:
100 µL 10x Beladungspuffer-Stammlösung
1 µL 100 mM AMP-PNP
10 µL 10 mM DTT
3 µL [8,5'-3H]-GDP (kurz vor
Versuchsbeginn)
→ ad 1000 µL dest. H2O
10x Versuchspuffer-Stammlösung:
200 mM Tris-HCl, pH 7,5
800 mM NaCl
50 mM MgCl2
0,4 % BSA
1x Versuchspuffer:
100 µL 10x Versuchspuffer-Stammlösung
10 µL 10 mM DTT
10 µL 100 mM GTP
10 µL 100mM AMP-PNP
→ ad 1000 µL dest. H2O
10x Waschpuffer-Stammlösung:
200 mM Tris-HCl, pH 7,5
80 mM NaCl
100 mM MgCl2
1x Waschpuffer:
10 mL 10x Waschpuffer-Stammlösung
90 mM H2O
50 µL β-Mercaptoethanol
Material und Methoden
Adenovirus-Aufreinigung:
Cäsiumchlorid-light:
11,02 g CsCl ad 50 mL 1x VSB-Puffer
{1 mL ≈ 1,2 g; 22,4 % (w/w)}
Cäsiumchlorid-heavy:
21,1 g CsCl ad 1x VSB-Puffer
{1 mL ≈ 1,45g; 42,2 % (w/w)}
10x VSB-Puffer:
100 mM Tris-HCl, pH 7,4
1,37 M NaCl
50 mM KCl
10 mM MgCl2
Ko- bzw. Immunopräzipitation (IP):
IP-Puffer:
0,1 % Triton X-100
1 % PMSF-Lösung
2 mM NaF
2mM Na3VO4
→ 1 x TBS
PMSF-Lösung:
100 mM PMSF (in Isopropanol)
Isoelektrische Fokussierung:
Lysepuffer:
8 M Urea
1 M Thiourea
2 % Chaps
1 % Triton X-100
80 mM DTT
20 mM Tris-HCl
2 % Ampholyte (nicht-linear; pH 3-10)
0,5 x Complete (mini) 1 Tablette
0,004 % Bromphenolblau
42
Material und Methoden
2-D-Äquilibrierungspuffer:
Stammlösung:
6 M Urea
34,5 % Glycerin (v/v)
70 mM SDS
1 M Tris-HCl, pH 8,8
2-D-Äquilibrierungspuffer I:
20 mg/mL DTT (in 2-DÄquilibrierungspuffer-Stammlösung)
2-D-Äquilibrierungspuffer II:
20 mg/mL Iodadcetamid (in 2-DÄquilibrierungspuffer-Stammlösung)
Pulldown-Assay:
GST-Fish-Puffer:
50 mM Tris-HCl, pH 7,4
150 mM NaCl
2 mM MgCl2
10 % Glycerol (v/v)
1 % Igepal CA630 (v/v)
ROCK-Assay:
Lysepuffer:
50 mM Tris-HCl, pH 8,0
0,1 % Trition X-100
1 mM EDTA
0,2 mM PMSF
2 mM NaF
2 mM Na3VO4
10 mM β-Mercaptoethanol
0,5 x Complete (mini) 1 Tablette
Immunhistologie:
Citratpuffer
0,1 M Citrat
0,1 M Tri-Natriumcitrat
→ pH 6,0
43
Material und Methoden
44
4.2.3 Medien für die Zellkultur und Bakterienzucht
SOC-Medium:
2 % Trypton
0,5 % Hefeextrakt
10 mM NaCl
2,5 mM KCl
10 mM MgCl2
10 mM MgSO4
20 mM Glukose
→ mit 0,45 µm Filter steril filtrieren
2x YT-Medium:
16 g Trypton
10 g Hefeextrakt
5 g NaCl
→ ad 1 L mit dest. H2O; autoklavieren
LB-Medium:
10 g Trypton
5 g Hefeextrakt
5 g NaCl
→ ad 1 L mit dest. H2O; autoklavieren
LB-Platten:
2,8 g Agar-Agar
200 mL autoklaviertes LB-Medium
→ Zusätze entweder 100 µg/mL Ampicillin
oder 50 µg/mL Kanamycin
PBS-Puffer:
148 mM NaCl
2,7 mM KCl
6,5 mM NaHPO4
1,5 mM KH2PO4
→ pH 7,4; autoklavieren
Material und Methoden
Zellkulturwachstumsmedien:
45
DMEM + Zusätze:
0,5 bzw. 10 % FCS
2 mM L-Glutamin
100 U/mL Penicillin
0,1 mg/mL Streptomycin
Endothelzellen-Wachstumsmedium +
Zusätze:
0,4 % ECGS/ H
2 % FCS
0,1 ng/mL EGF
1 µg/mL Hydrocortison
1 ng/mL bFGF
Einfriermedium für eukaryotische Zellen:
DMEM mit 10 % DMSO und 10 % FCS
Einfriermedium für prokaryotische Zellen (E. coli):
50 % Glycerin in dest. H2O
4.3 Molekularbiologische Methoden
4.3.1 Plasmid-DNA Präparation aus E. coli
Einzelne Bakterienkolonien wurden in 5 mL bzw. 150 mL LB-Medium (50 µg/mL Kanamycin oder
100 mg/mL Ampicillin) ü. N. mit 250 rpm bei 37°C schüttelnd inkubiert. Die Plasmidpräparationen
erfolgten mit dem „Plasmid Mini Kit“ bzw. dem „Plasmid Midi Kit“ der Firma Sigma-Aldrich. Das
Prinzip der Aufreinigung beruht auf der modifizierten alkalischen Lyse der Bakterien und der
Bindung der Plasmid-DNA an eine Silikamatrix. Zur Verifizierung der aufgereinigten Plasmide
wurde ein Restriktionsverdau mit anschließender Agarosegelelektrophorese durchgeführt.
4.3.2 DNA-Fällung
Zur Aufreinigung und Fällung von DNA wurden 0,1 Volumenanteile Natriumacetat (3 M, pH 5)
und 0,7 Volumenanteile Isopropanol zugegeben. Dadurch wurde die Hydrathülle der DNA von
den Kationen verdrängt und die Ionenbindung zwischen den Kationen und den Phosphatgruppen
der DNA ermöglicht. Die dadurch als Salz ausgefällte DNA wurde mittels Zentrifugation pelletiert,
mit 70 % Ethanol gewaschen und in einer geeigneten Menge TE-Puffer aufgenommen. Die
Fällung erfolgte bei niedrigen Temperaturen, da die Löslichkeit der DNA hier geringer ist.
Material und Methoden
46
4.3.3 Konzentrationsbestimmung von Nukleinsäurelösungen
Zur Konzentrationsbestimmung von Nukleinsäurelösungen (nach Clark und Swika, 1977) wurde
in einem Spektralphotometer eine geeignete Menge der Nukleinsäurelösung mit dest. H2O
verdünnt und in einer Quartzküvette gemessen. Für die Konzentrationsberechnung von
Nukleinsäurelösungen gelten folgende Zusammenhänge (Cryer et al., 1975):
Doppelsträngige (ds) DNA: 1 OD260nm entspricht E 50 µg/mL
Einzelsträngige (ss) RNA: 1 OD260nm entspricht E 37 µg/mL
Einzelsträngige (ss) DNA: 1 OD260nm entspricht E 20 µg/mL
Durch Bestimmen der Extinktion bei 230, 260 und 280 nm können Verunreinigungen der
Nukleinsäurelösungen bestimmt werden. Für eine ausreichende Reinheit der isolierten
Nukleinsäuren gelten folgende Richtwerte (Marmur & Doty, 1961):
E260/E280 ≈ 1,8
E260/E230 ≈ 2,2
4.3.4 DNA-Gelelektrophorese
Zur
qualitativen
Analyse
von
Nukleinsäurepräparationen
wurde
eine
horizontale
Agarosegelelektrophorese durchgeführt. Die Nukleinsäuren wurden in einem elektrischen Feld in
einer Agarosematrix (üblicherweise 1 %iges Agarosegel in 1x TAE-Puffer) aufgetrennt (Mcdonell
et al., 1977). Die Agarose wurde unter Erwärmung in der Mikrowelle gelöst und nach Abkühlen
auf 50°C mit 0,5 µg/mL Ethidiumbromid versetzt. Um den Fortschritt der Elektrophorese
abschätzen zu können, wurde in die Proben Bromphenolblau (6x DNA Ladepuffer, peqLab)
gegeben und als Größenmarker wurde die „1 kb DNA-Leiter “ der Firma Peqlab verwendet. Die
Elektrophorese wurde in 1x TAE-Puffer mit einer elektrischen Spannung von 120 V durchgeführt.
Unter UV Durchstrahlung (302 nm) können DNA-Stränge durch Einlagerung von Ethidiumbromid
sichtbar gemacht werden. Zur Isolierung eines DNA-Fragmentes wurde dieses unter UVBestrahlung aus dem Agarosegel ausgeschnitten und mit dem „High Pure PCR Product
Purification Kit“ (Roche) aufgereinigt.
4.3.5 DNA-Sequenzierung
Die Sequenzierung von DNA wurde von der Firma GATC durchgeführt.
Material und Methoden
47
4.3.6 Restriktion von DNA mit Endonukleasen
Spezifische
palindromische
Tetra-
bis
Oktanukleotidsequenzen
werden
von
Restriktionsendonuklasen vom Typ II erkannt. Sie hydrolisieren die DNA innerhalb der
Erkennungssequenzen (Arber, 1978). Dabei entstehen entweder 5’- bzw. 3’- überstehende
(„sticky-ends“) oder glatte („blunt-ends“) Enden. Zu analytischen Zwecken wurden 1 bis 3 µg
DNA (20 µL Ansatz) und zu präparativen Zwecken 15 bis 20 µg DNA (100 µL Ansatz) mit den
entsprechenden Restriktionsendonukleasen geschnitten. 1 bis 10 U Restriktionsenzym pro 1 µg
DNA wurden für 1 bis 3 h in dem vom Hersteller angegebenen Reaktionspuffer bei geeigneter
Reaktionstemperatur inkubiert. Mittels einer horizontalen Agarosegelelektrophorese wurde der
Restriktionsverdau überprüft.
4.3.7 Dephosphorylierung von DNA-Enden
DNA-Enden wurden durch direkte Zugabe von alkalischer Phosphatase in den Restriktionsansatz
(CIAP) (0,05 U/pmol DNA-Enden) dephosphoryliert. Bei glatten Enden oder 3’-überhängenden
Enden wurde der Ansatz für 30 min bei 37°C und für 30 min bei 56°C inkubiert. Anschließend
wurde erneut CIAP zugegeben und die Inkubationsschritte wiederholt. Bei 5’-überhängenden
Enden wurde der Ansatz für 30 min bei 37°C inkubiert. Die CIAP wurde durch Erhitzen auf 85°C
für 15 min inaktiviert.
4.3.8 Enzymatische Verlängerung von DNA-Enden
Das Auffüllen von 3’-überhängenden Enden erfolgte mit dem großen Fragment der Polymerase I
(Klenow, Fermentas). Der Reaktionsansatz wurde gemäß Herstellerangaben hergestellt und für
15 min bei 37°C inkubiert. Zur Beendigung der Reaktion wurde der Ansatz für 10 min auf 70°C
erhitzt.
4.3.9 Verknüpfung von DNA-Molekülen mit der T4-DNA-Ligase
Die T4-DNA-Ligase katalysiert die ATP-abhängige Bildung von Phosphodiesterbindungen
zwischen 3’-Hydroxy- und 5’-Phosphat-Enden von doppelsträngigen DNA-Molekülen (Weiss et
al., 1968). Die Ligationsreaktion wurde nach Angaben des Herstellers mit dem mitgelieferten
Puffersystem durchgeführt. Für den Ligationsansatz wurden 0,3 pmol Insert-DNA und 0,1 pmol
Vektor-DNA verwendet und ü. N. bei RT inkubiert. Als Kontrolle diente ein Ansatz ohne Insert.
Zur Inaktivierung der Ligase wurde der Ligationsansatz für 10 min auf 65°C erhitzt und einer
Chloroformextraktion unterzogen. Nach Zugabe von 50 µL Chloroform wurde der Ligationsansatz
gemischt, für 3 min bei 16'000 g zentrifugiert und auf ein Urglas gegeben. Die wässrige Phase,
welche die DNA enthält, wurde vorsichtig abgenommen.
Für die Verknüpfung von PCR-Fragmenten, die mit der Taq-Polymerase amplifiziert wurden und
an jedem Ende einzelne Adenosinüberhänge aufwiesen, wurde der „Qiagen PCR Cloning Kit“
Material und Methoden
48
verwendet. Der im Kit in linearer Form vorhandene „pDrive Cloning Vektor“ weist an den Enden
einzelne Uracilüberhänge auf, wodurch eine Ligation der PCR-Fragmente in diesen Vektor
möglich wird. Zusätzlich zur Antibiotika-Selektion ist bei diesem Vektor eine Blau/Weiß-Selektion
möglich. Die „multiple cloning site“ (MCS) des Vektors verläuft durch den für β-Galaktosidase
kodierenden Bereich im Vektor. Bei zusätzlicher Behandlung von LB-Platten mit 50 µM Isopropylβ-D-Thiogalactopyranosid
(IPTG)
und
80
µg/mL
5-Bromo-4-Chloro-3-Indolyl-β-D-
Galaktopyranosid (X-gal) führte dies bei Bakterienkolonien, die das Plasmid ohne Insert
aufgenommen haben, zu einer β-Galaktosidase-Expression und damit zu einer Blaufärbung.
Hingegen blieben Bakterienkolonien, die das Plasmid mit Insert aufgenommen haben weiß. PCRFragmente, die mit einer Pfu-Polymerase amplifiziert wurden, wurden mittels des „pCMV-Script
PCR Cloning Kit“ (Stratagene) gemäß den Angaben des Herstellers mit dem Vektor verknüpft. Da
die Pfu-Polymerase im Gegensatz zur Taq-Polymerase nicht über eine terminale TransferaseAktivität verfügt, besitzen die amplifizierten PCR-Produkte glatte Enden, welche in den „blund
end“ SrfI linearisierten pCMV-Script-Vektor ligiert werden können.
4.3.10 Transformation von Bakterien
Für die Transformation von Bakterien wurden zunächst kompetente Bakterienzellen nach
Hanahan (Hanahan, 1983) hergestellt. Bei der Elektrotransformation wurden 2 - 4 µL des
gereinigten Ligationsansatzes oder 100 ng Plasmid-DNA und 50 µL elektrokompetente Bakterien
in eine kalte Küvette mit einem Elektrodenabstand von 2 mm gegeben. Die DNA wurde mit Hilfe
eines „Gene Pulsers“ (25 µF, 200 Ω, 2,5 kV) in die Bakterien gebracht. Anschließend wurde zu
den Bakterien 200 µL 37°C warmes SOC-Medium gegeben und für 20 min bei 37°C schüttelnd
inkubiert. Die Bakterien wurden auf LB-Selektionsplatten ausgestrichen (Kanamycin oder
Ampicilin) und ü. N. bei 37°C inkubiert.
Für die chemische Transformation wurden die Bakterien zusammen mit 5 µL des
Ligationsansatzes bzw. 100 ng Plasmid-DNA für 30 min auf Eis inkubiert und anschließend für 30
sec auf 42°C erwärmt. Danach wurden die Bakterien für 5 min auf Eis gekühlt, anschließend 250
µL SOC-Medium zugegeben und für 1 h schüttelnd bei 37°C inkubiert. Unter Verwendung von
Antibiotika wurden die Bakterien auf Agarplatten selektiert und ü. N. bei 37°C inkubiert.
4.3.11 Kryokonservierung von Bakterien
Bakterien aus einer Übernachtkultur wurden 1:1 mit 50 % Glycerin versetzt, gut gemischt und bei
-80°C eingefroren.
Material und Methoden
49
4.3.12 RNA-Isolierung
Die RNA-Isolierung aus Zellen erfolgte gemäß den Angaben des Herstellers mit dem „RNeasy
Mini Elute cleanup Kit“ der Firma Qiagen. Zu den Zellen wurde ein Lysepuffer zugegeben, der
Guanidiniumthiocyanat und Ethanol enthielt. Diese Reagenzien fördern die selektive Bindung von
RNA an eine Silikamatrix. Die RNA wurde durch RNase-freies, hochreines H2O von der Matrix
eluiert. Da alle RNA-Moleküle, die größer als 200 Nukleotide sind, durch diese Isolation
aufgereinigt werden, führte dies zu einer Anreicherung von mRNA und rRNA.
4.3.13 Reverse Transkription von RNA
Die Herstellung von cDNA aus Gesamt-RNA erfolgte mit dem „I st Strand cDNA Synthesis Kit for
RT-PCR“ (Roche) entsprechend den Angaben des Herstellers. Die RNA wurde mit Hilfe des
Enzyms AMV („avian myeloblastosis virus“)-Reverse-Transkriptase in cDNA umgeschrieben. Der
Reaktionsansatz (Tab. 5) wurde auf Eis pipettiert und in einem PCR-Gerät für 10 min bei 25°C,
für 60 min bei 42°C und für 5 min bei 99°C inkubiert.
Reagenz
Volumen
Endkonzentration
10 x Reaktionspuffer
2,0 µL
1x
25 mM MgCl2
4,0 µL
5 mM
Desoxynukleotid-Mix
2,0 µL
1 mM
Random-Hexamere
2,0 µL
0,2 µg/µL
RNase-Inhibitor
1,0 µL
50 U
Gelatine
0,4 µL
0,01 µg/µL
AMV-Reverse-Transkriptase
1,0 µL
≥ 20 U
Gesamt-RNA
x µL
2 µg
H2O
x µL
Gesamt
20 µL
Tab. 5: Reaktionsansatz für die cDNA-Synthese.
4.3.14 PCR
Die Amplifikation von DNA-Abschnitten mittels der Polymerase-Kettenreaktion (PCR) erfolgte
entweder mit der Taq-Polymerase oder mit der PfuTurbo- bzw. der Fideli-Taq-Polymerase, um
längere und fehlerärmere PCR-Produkte zu erhalten. Die jeweiligen Reaktionsansätze wurden
gemäß den Angaben des Herstellers pipettiert. Um unspezifische Reaktionen zu minimieren,
wurde das PCR-Gerät auf die Denaturierungstemperatur vorgeheizt und anschließend der
Reaktionsansatz hineingestellt.
Material und Methoden
50
4.3.15 Mutagenese
Der Austausch einzelner Basen erfolgte mit dem „Quik Change Site Directed Mutagenesis Kit“
(Stratagene) gemäß den Angaben des Herstellers. Das PCR-Programm ist in Tabelle 6
dargestellt.
Zyklus
Zeit
Temperatur
Anzahl der Zyklen
30sec
95°C
1
Denaturierung
30 sec
95°C
Anlagerung
1 min
55°C
Extension
2 min/kb
68°C
Kühlung
∞
4°C
Initiale
Denaturierung
16
Tab. 6: Reaktionsansatz für die gerichtete Mutagenese.
4.3.16 Herstellung rekombinanter Adenoviren
Die Herstellung rekombinanter Adenoviren erfolgte mit dem pAdEasy1-System, welches
genomische Abschnitte des Adenovirus Serotyp-5 (Ad5) enthält. Die dadurch generierten
Adenoviren sind durch eine Deletion des E1 und E3 Gens, des linearen doppelsträngigen 36 kb
großen Ad5-Genoms zwar infektiös, aber replikationsdefizient. In Abbildung 7 ist das Schema der
Adenovirus-Generierung dargestellt, dessen Vorgehensweise im Anschluss genauer erläutert
wird (He et al., 1998).
Material und Methoden
51
CMV
Abb. 7: Herstellung rekombinanter Adenoviren mittels des pAdEasy1-Systems. Nach Insertion
des entsprechenden Fremdgens in den Transfervektor pAdTrack-CMV erfolgt eine homologe
Rekombination mit dem Vektor pAdEasy-1 in E. coli BJ 5183-Bakterien. Für die anschließende
Produktion rekombinanter Adenoviren wurden HEK-Zellen mit dem rekombinierten und Pac1
linearisierten Vektorkonstrukt transfiziert.
Zunächst wurde die spezifische cDNA bzw. das Haarnadelschleifen-shRNA-Insert in den
Transfervektor bzw. Shuttel-Vektor pAdTrack-CMV oder entsprechend in den Shuttel-Vektor
pAdTrack-CMV-shRNA kloniert, der zusätzlich für das grün fluoreszierende Protein EGFP
(„enhanced green fluorescent protein“) kodiert. Dies erlaubte in den folgenden Schritten die
direkte Visualisierung und Abschätzung der Transfektionseffizienz sowie die Verfolgung der
Infektion des Adenovirus. Der zweite Schritt beinhaltete eine homologe Rekombination. Hierfür
wurde zunächst der pAdTrack-CMV-Vektor, der das spezifische Gen enthält, mit dem
Restriktionsenzym
PmeI
linearisiert
und
anschließend
mittels
einer
horizontalen
Agarosegelelektrophorese aufgereinigt. Zur homologen Rekombination wurden 100 ng des
linearisierten Transfervektors mit 1 µg des supercoiled vorliegenden Vektors pAdEasy1 mittels
Elektroporation in E. coli BJ 5183 Bakterienzellen kotransformiert. Durch die homologe
Rekombination in den Bakterien kam es zur Übertragung der cDNA des Zielgens auf das
Virusgenom und zusätzlich zu einem Austausch des Gens für die Ampicillin-Resistenz des
Material und Methoden
52
pAdEasy1-Vektors gegen das Kanamycin-Resistenzgen des pAdTrack-CMV-Vektors. Positive
Klone konnten deshalb auf Kanamycin-haltigen LB-Agarplatten selektiert werden. Mit dem
Restriktionsenzym Pac I wurde die homologe Rekombination überprüft, wobei bei erfolgreicher
homologer Rekombination zwei DNA-Fragmente mit 33 kb bzw. 4,1 kb im Agarosegel erkennbar
waren. Das so gewonnene adenovirale Plasmid wurde mit dem Restriktionsenzym Pac I
linearisiert. Der produktive Zyklus dieser rekombinanten Adenoviren, der zur Lyse der infizierten
Wirtszellen führt, findet nur in permissiven Zellen, wie z. B. HEK („human embryonal kidney“)Zellen statt, die zu einer Komplementierung der fehlenden E1-Region in der Lage sind (Graham
et al., 1977). Bei Zellen, wie z. B. glatten Muskelzellen, die den Replikationsdefekt der E1-Region
nicht komplementieren können, erfolgt nach einer Infektion mit der replikationsdefizienten Ad5Deletionsmutante keine Produktion infektiöser Viren. Die Amplifikation wurde durch die
Transfektion von HEK-Zellen in einer 6 cm Schale mit dem Pac I linearisierten adenoviralen
Plasmid durchgeführt. Die Zellen wurden für die Dauer von mindestens 10 Tagen kultiviert.
Während der Inkubation konnte der Erfolg der Transfektion und die Virusproduktion anhand der
Expression des Reportergens EGFP mit Hilfe eines inversen Mikroskops kontrolliert werden. Zu
diesem Zweck verfügte das Mikroskop über eine Epifluoreszenzeinrichtung mit einem Filtersatz
für EGFP (Anregung 470 nm, Emission 515 nm). Die Isolierung der rekombinanten Adenoviren
erfolgte durch mechanisches Ablösen der infizierten HEK-Zellen von der Schalenoberfläche. Die
erhaltene Zellsuspension wurde dreimal in flüssigem N2 eingefroren, um eine vollständige Lyse
der Zellen zu erreichen. Anschließend wurden die Zelltrümmer durch Zentrifugation für 5 min bei
600 g entfernt. Mit den im Überstand befindlichen rekombinanten Adenoviren wurden nach und
nach bis zu 5 x 108 Zellen infiziert. Anschließend wurden die adenoviral infizierten HEK-Zellen bei
beginnender Zelllyse geerntet, indem etwa 20 x 106 Zellen mit 5 mL serumreduzierten DMEMMedium von der Schalenoberfläche abgespült wurden. Die Zellen zeichnen sich bei Beginn der
Zelllyse dadurch aus, dass sie abgerundet sind, aber noch an der Schalenoberfläche haften. Die
Zellsuspension wurde bei 150 g für 5 min zentrifugiert und das Zellpellet in 50 mL PBS vorsichtig
resuspendiert. Anschließend folgte nochmals ein Zentrifugationsschritt bei 150 g für 5 min. Der
Überstand wurde verworfen und das Zellpellet in 10 mL PBS resuspendiert. Anschließend
erfolgte die Lyse der Zellen durch dreimaliges schockgefrieren in flüssigem N2 und ein Entfernen
der Zelltrümmer durch Zentrifugation der virenhaltigen Suspension bei 600 g für 5 min. Die
Aufreinigung
und
Konzentrierung
der
rekombinanten
Adenoviren
erfolgte
durch
eine
Cäsiumchlorid-Dichtegradzentrifugation. Der CsCl-Dichtegradient wurde hergestellt, indem zuerst
5 mL der CsCl-Lösung mit der höheren Dichte („Cäsiumchlorid-heavy“; 42,2 % {w/w}) in das
Zentrifugationsröhrchen (Herolab, PA dünnwandig, 17 mL) gegeben wurden, die anschließend
vorsichtig mit 5 mL CsCl-Lösung mit der niedrigeren Dichte („Cäsiumchlorid-light“; 22,4 % {w/w})
überschichtet wurden. Anschließend wurde die virushaltige Suspension vorsichtig auf den CsClGradienten pipettiert. Die Zentrifugation erfolgte in einer J2-21 Beckmann-Ultrazentrifuge mit
Material und Methoden
53
einem SW-27 Schwenkbecher-Rotor bei 87'000 g für etwa 20 h bei 4°C. Die rekombinanten
Adenoviren befanden sich aufgrund der höheren Dichte unterhalb der leeren Kapside (Abb. 8).
leere Kapside
Interphase
rekombinante Adenoviren
(Kapside und DNA)
Abb. 8: Schematische Darstellung des Virusrings. Nach der Ultrazentrifugation war an der
Interphase zwischen der leichten und schweren Phase des CsCl-Gradienten eine dünne, weiße
Bande (rekombinante Adenoviren) und eine dickere weiße Bande (leere Kapside) im oberen Drittel
des Ultrazentrifugationsröhrchens zu sehen.
Der Virusring wurde mit einer Spritze abgenommen und zunächst für 8 h und danach ü. N. gegen
PBS dialysiert (Float-A-Lyzer, 15 kDa MWCO, 3 mL; Spectrum). Anschließend erfolgte eine 6stündige Dialyse gegen 1x VSB-Puffer. Die Lagerung des rekombinanten Adenovirus erfolgte bei
-20°C durch Zugabe des gleichen Volumens einer 90 %igen Glycerinlösung in 1x VSB-Puffer.
4.3.17 Klonierung von Haarnadelschleifen-shRNA-Inserts in einen Expressionsvektor
(pAdTrack-CMV-shRNA)
Die Haarnadelschleifen-shRNA Oligonukleotid-Matrizen wurden „aufgeschmolzen“ (annealing)
und in den liniearisierten Vektor ligiert. Dies erfolgte zunächst durch Verdünnen der beiden
komplementären einzelsträngigen 75 bp großen DNA-Oligonukleotid-Matrizen für shRNA in
einem Reaktionsansatz mit Annealing-Puffer, so dass die Oligonukleotidkonzentration jeweils 50
µM betrug. Die Zusammenlagerung der beiden einzelsträngigen Oligonukleotide erfolgte durch 4minütiges Aufkochen des Reaktionsansatzes bei 94°C und anschließendem Abkühlen bei RT für
10 min. Danach wurde das doppelsträngige Oligonukleotid auf eine Konzentration von 5 nM
verdünnt. Da die DNA-Oligonukleotid-Matrizen für shRNA über eine zusätzliche 5’-lokalisierte
BamHI bzw. 3’-lokalisierte HindIII Schnittstelle verfügen, war eine gerichtete Klonierung in den
Vektor pAdTrack-CMV-shRNA möglich. Dazu wurde 1 µL der 5 nM doppelsträngigen
Oligonukleotidlösung mit 100 ng HindIII/BamHI-linearisiertem pAdTrack-CMV-shRNA ligiert. Der
pAdTrack-CMV-shRNA Vektor verfügt über einen Polymerase III Promotor, den H1 Promotor,
wodurch die Expression der shRNA steuert wird.
Im Anschluss wurden E. coli Zellen (XL10-Gold, Stratagene) mit dem Ligations-Produkt
transformiert. Als negative Kontrolle wurde ein Aliquot von E. coli Zellen mit Minus-Insert (Vektor
Material und Methoden
54
ohne Insert) Ligation transformiert. Die transformierten Zellen wurden auf LB-Agar-Platten mit
Kanamycin (50 µg/mL) ausplatiert und über Nacht bei 37°C inkubiert. Nach der Inkubation
wurden die Klone gepickt, in 5 mL LB-Medium mit Kanamycin überführt und über Nacht bei 37°C
und 250 rpm geschüttelt. Die Plasmid-DNA wurde mit Hilfe des „Plasmid Mini Kit“ (Sigma-Aldrich)
isoliert und die DNA Konzentrationen spektrometrisch bestimmt. Um zu kontrollieren, ob das
shRNA-Insert in den Vektor aufgenommen wurde, wurde ein Restriktionsverdau angesetzt. Die
Restriktionsprodukte wurden dann mittels eines 2 %igen Agarosegels aufgetrennt, um das
Vorhandensein der Insert-Bande zu überprüfen. Mit den Klonen, die das shRNA Insert enthielten,
wurden größere Kulturen angesetzt (200 ml LB-Medium mit Kanamycin) und über Nacht
schüttelnd bei 37°C und 250 rpm inkubiert. Die Plasmid-DNA wurde mit dem „Plasmid Midi Kit“
(Sigma-Aldrich) isoliert und die DNA Konzentrationen spektrometrisch bestimmt.
4.4 Proteinbiochemische Methoden
4.4.1 Proteingewinnung für die SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE)
Zur Proteingewinnung wurden die Zellen mit PBS gespült und mit einer adäquaten Menge kaltem
TE-Puffer abgeschabt. Die Proben wurden mit einem Polytron auf Eis dreimal für 15 sec mit
jeweils 15 sec Pause lysiert. Danach wurden die Zelltrümmer für 10 min mit 16'000 g bei 4°C
abzentrifugiert. Ein Teil der Proben wurde in 4x SDS-Probenpuffer für 5 min bei 95°C aufgekocht
und der andere Teil wurde bis zur weiteren Verarbeitung in flüssigem N2 schockgefroren und bei
-80°C gelagert.
4.4.2 SDS-PAGE
In der SDS-PAGE wurden Proteinlysate (30 - 100 µg) für die immunologische Detektion und
Coomassie-Färbung aufgetrennt. Die Proteinlysate wurden hierfür mit einer adäquaten Menge
Laemmli-Puffer versetzt und mittels diskontinuierlicher SDS-PAGE unter denaturierenden
Bedingungen in einer „Mini Protean II“-Apparatur (Biorad) bei 200 V aufgetrennt (Laemmli, 1970).
Anhand eines Molekulargewichtsstandards „Roti-Mark Standard“ (Roth) wurden die Größen der
aufgetrennten Proteine ermittelt. Der prozentuale Anteil der Acrylamid-Bisacrylamidlösung der
verwendeten Trenngele variierte je nach Größe des nachzuweisenden Proteins von 6-15 %. Die
Sammelgele besaßen eine Acrylamid-Bisacrylamidkonzentration von 5 %. Die aufgetrennten
Proteine wurden durch eine anschließende Coomassie-Färbung oder eine immunologische
Detektion mittels Western Blot sichtbar gemacht.
Material und Methoden
55
4.4.3 Western Blot
In einer Blotkammer der Firma Biorad wurden die durch SDS-PAGE aufgetrennten Proteine im
Nassblotverfahren bei 100 V auf eine Nitrozellulosemembran transferiert. Die Transferzeit betrug
durchschnittlich 1 h bzw. bei Proteinen mit einem Molekulargewicht größer als 200 kDa 2 h. Mit
einer 0,2 %igen Ponceau-S-Lösung wurden die Proteine nach dem Transfer auf der Membran
reversibel angefärbt und mit einem Imager (AlphaInnotech) dokumentiert. Anschließend wurde
das Ponceau-S mit TBST abgewaschen und die Membran zur Blockierung freier Bindungsstellen
mit einem Blockpuffer (5 % BSA oder RotiBlock, Roth) für 1 h inkubiert. Danach wurde die
Membran dreimal für 5 min mit TBST gewaschen um ungebundenen Blockpuffer zu entfernen.
Die Inkubation mit dem ersten Antikörper erfolgte wie in Tabelle 1 (siehe 4.1.5, Seite 25)
beschrieben. Daraufhin wurde die Membran dreimal für 10 min mit TBST gewaschen und für 45
min bei RT mit dem entsprechenden Sekundärantikörper inkubiert (anti-Maus 1:10'000, antiKaninchen 1:80'000 in TBST). Die Membran wurde abschließend dreimal für 5 min mit TBST
gewaschen. Danach erfolgte mittels eines Chemolumineszenz-Substrats der Firma Roche (LumiLight-Plus)
die
Detektion
der
Primär-Sekundär-Antikörperkomplexe
über
die
an
die
Sekundärantikörper gekoppelte Meerrettichperoxidase. Die Signale wurden ebenfalls mit einem
Imager (AlphaInnotech) dokumentiert.
4.4.4 ROCK-Assay
Die Aktivitätsmessung der ROCK erfolgte mit dem „Rho-kinase Assay Kit“ der Firma CycLex im
96-well ELISA-Format. Transient transfizierte HEK-Zellen einer 6-well Platte wurden nach einer
48-stündigen Inkubation mit PBS gewaschen und mit 300 µL Lysepuffer abgeschabt. Die Zellen
wurden auf Eis dreimal für 15 sec mit einem Handpolytron lysiert und die Zelltrümmer bei 4°C für
5 min mit 16'000 g abzentrifugiert. Anschließend erfolgte die Proteinbestimmung nach der
Methode von Bradford. Die Bestimmung der ROCK-Aktivität erfolgte zunächst durch eine 30minütige Inkubation von 300 ng Proteinlysat bei 30°C mit dem auf der Oberfläche der
Mikrotitervertiefungen immobilisierten Peptid des rekombinanten C-Terminus von MBS („myosin
binding substrate“). Nach fünf-maligem Waschen wurde für 1 h bei RT ein Meerrettichperoxidasegekoppelter anti-Phospho-MBS-Threonine 696-spezifischer monoklonaler Antikörper zugesetzt.
Nach einem weiteren Waschschritt erfolgte eine 10-minütige Inkubation mit TMBH2 (eine
Leukoform von Tetra-Methylbenzidin (TMB)) und die abschließende Zugabe eines H2SO4haltigen Stopreagenzes. Die Meerrettichperoxidase des gebundenen Antikörpers katalysierte die
äquivalente Umwandlung der Leukoform des chromogenen Substrats TMBH2 zu TMB bzw. die
Umwandlung einer farblosen zu einer blauen Lösung. Der Zusatz von H2SO4 stoppte die
katalytische Umwandlung von TMBH2 zu TMB und bewirkte einen Farbumschlag nach Gelb. Die
Extinktionen der Proben wurden in einem Mikrotiterplatten-Photometer bei 450 nm gemessen.
Material und Methoden
56
4.4.5 Coomassie-Färbung
Um Proteine nach einer erfolgten Trennung mittels SDS-Gelelektrophorese im Gel zu fixieren und
sichtbar zu machen, wurde das Gel mit Coomassie-Brilliant-Blue-R250 angefärbt. Dafür wurde
das Gel dreimal mit der Färbelösung in der Mikrowelle aufgekocht und anschließend bis zur
gewünschten Verringerung des Hintergrundes mit der Entfärberlösung gewaschen. Die Fixierung
erfolgte durch eine Ethanol/Essigsäure/Wasser-Mischung, in der die Coomassie-Farbe enthalten
ist. Daraufhin erfolgte die Dokumentation mit einem Imager (AlphaInnotech). Die Nachweisgrenze
dieser Methode liegt bei 1 - 0,1 µg.
4.4.6 Protein-Konzentrationsbestimmung
Die Proteinbestimmung wurde mittels der Methode nach Bradford durchgeführt (Bradford, 1976).
Die Proben sowie die Proteinstandardreihe (0; 0,4; 0,8; 1,2; 1,6; 2,0 µg BSA) wurden in
Triplikaten in einer Mikrotiterplatte in einem Volumen von 50 µL vorbereitet. Das BradfordReagenz (Biorad) wurde vor der Messung 1 : 4 in dest. H2O verdünnt und jeweils 200 µL zu den
Proben gegeben. Die entstandene Farbveränderung wurde in einem Spektralphotometer bei 595
nm gemessen und die Proteinkonzentration anhand einer Standardreihe mathematisch ermittelt.
4.4.7 Kopplung des RhoGEF17-spezifischen Peptids an CNBr-aktivierte Sepharose 4B
Um das RhoGEF17-spezifische Peptid (DSDSDDESSPSPSGT, Aminosäuren 1640 - 1655 von
RhoGEF17) kovalent an eine Sepharosematrix zu binden, wurde zunächst 0,6 g CNBrSepharose 4B (Pharmacia Biotech) zweimal in 50 mL kalter 1 mM HCl für 30 min rehydriert.
Danach wurde die gequollene Sepharose mit 50 mL H2O gewaschen, anschließend
abzentrifugiert und in einem Volumen von 5 mL H2O in eine geeignete Säule überführt. Zur
Aktivierung der Sepharose wurde die Säule mit 3 mL 0,1 M NaHCO3/0,5 M NaCl-Lösung (pH 8,4)
gewaschen. Anschließend wurden 2 mg des zu koppelnden RhoGEF17-spezifischen Peptids,
welches in 1 mL 0,1 M NaHCO3/0,5 M NaCl (pH 8,4) gelöst wurde, auf die Säule gegeben und ü.
N. bei 4°C auf einem „Über-Kopf-Schüttler“ mit der aktivierten Sepharose inkubiert. Um
ungebundenes Peptid zu entfernen wurde die Säule am nächsten Tag fünfmal mit 5 mL 0,1 M
NaHCO3/0,5 M NaCl-Lösung (pH 8,4) gewaschen. Um die noch vorhandenen freien reaktiven
Bindungsstellen zu blockieren, wurde die Säule mit 0,2 M Glycinlösung (pH 8,0) ü. N. bei 4°C
rotierend inkubiert. Am nächsten Tag wurde die Säule abwechselnd je viermal mit 5 mL 0,1 M
NaHCO3/0,5 M NaCl-Lösung (pH 8,4) und 5 mL 0,1 M NaAc/0,5 M NaCl (pH 4,0) gewaschen.
Abschließend wurde die Säule in 5 mL 1 M NaCl mit 0,1 % NaN3 bei 4°C gelagert.
Material und Methoden
57
4.4.8 Aufreinigung des polyklonalen Antikörpers RhoGEF17
Das RhoGEF17-spezifische Antiserum wurde von der Firma Biogenesis hergestellt. Das
erhaltene Antiserum der immunisierten Kaninchen wurde mittels einer Affinitätschromatographie
über eine CNBr-Sepharose 4B-Säule mit kovalent gekoppeltem RhoGEF17-spezifischem Peptid
aufgereinigt. Hierfür wurde die Säule fünfmal mit jeweils 5 mL kaltem PBS gewaschen,
anschließend 5 mL des RhoGEF17-spezifischen Antikörperserums zugegeben und ü. N. bei 4°C
rotierend inkubiert. Anschließend wurde die Säule viermal mit 5 mL kaltem PBS gewaschen. Die
Elution des RhoGEF17-spezifischen Antikörpers erfolgte fraktionsweise mit je 2 mL 100 mM
Glycinlösung (pH 2,5). Die Fraktion, welche den eluierten, aufgereinigten Antikörper enthielt,
wurde mit einer Proteinbestimmung detektiert. Abschließend wurde der Antikörper mit einer
Vivaspinsäule (10 kDa MWCO; VivaScience) konzentriert und in einer adäquaten Menge PBS
aufgenommen, so dass der Antikörper eine Endkonzentration von 1 µg/µL aufwies.
4.4.9 Isoelektrische Fokussierung (IEF)
Transfizierte HEK-Zellen einer 10 cm Schale wurden mit 500 µL Lysepuffer abgeschabt und bei
-20°C ü. N. eingefroren. Für die IEF wurde ein 7 cm IEF-Streifen (Immobiline DryStrip, pH 3-10,
linear, Fa. GE Healthcare) mit 100 µL Proteinlysat beladen und in einer Nasskammer ü. N.
aufgequollen. Die Fokussierung erfolgte in einem Ettan IPGphor (GE Healthcare) nach dem in
Tabelle 7 aufgeführten Programm. Die Proteine wandern in einem pH-Gradienten unter dem
Einfluss eines elektrischen Feldes bis sie den Punkt erreichen, an dem ihre Nettoladung null
beträgt. Diesen pH-Wert bezeichnet man als „isoelektrischen Punkt“ (pI) des Proteins. Da das
Molekül an seinem pI keine Nettoladung mehr trägt, hat das angelegte elektrische Feld keinen
Einfluss mehr auf das Protein. Damit ist die IEF eine Endpunktmethode. Nach erfolgter IEF
wurden die Streifen jeweils nacheinander für 15 min mit dem Äquilibrierungspuffer I und II
behandelt. Abschließend erfolgte eine Auftrennung der Proteine mittels der diskontinuierlichen
SDS-Gelelektrophorese und eine immunologische Detektion mittels des Western Blot Verfahrens.
Schritt
Spannung (V)
Zeit (Vhrs)
1
300
200
2
1000
300
3
5000
4000
4
5000
2000
Tab. 7: Laufbedingungen der IEF.
Material und Methoden
58
4.4.10 Zellfraktionierung
Die Zellfraktionierung diente als Methode zur Untersuchung der intrazellulären Lokalisation von
Proteinen in Zellen. Dazu wurden HEK-Zellen lysiert und anschließend mittels unterschiedlicher
Zentrifugationsschritte in eine partikuläre Fraktion und eine zytosolische Fraktion aufgetrennt. Die
Effektivität der Auftrennung wurde im anschließenden Western Blot anhand von Markerproteinen
kontrolliert. Als Marker für die partikuläre Fraktion wurde die β-Untereinheit der heterotrimeren GProteine (Gβ) und für die zytosolische Fraktion die Glycerinaldehyd-3-Phosphat-Dehydrogenase
(GAPDH) verwendet. Für die Zellfraktionierung wurden drei 10 cm Schalen mit HEK-Zellen 48 h
nach Transfektion mit jeweils 10 mL PBS gespült und dann mit je 2 mL PBS abgeschabt. Die
Proben wurden vereinigt, danach mit einem Glas-Glas-Homogenisator mit 20 Stößen
homogenisiert und anschließend für 5 min mit 200 g bei 4°C abzentrifugiert. Das Pellet wurde
verworfen und der Überstand wurde für 20 min mit 16'000 g bei 4°C zentrifugiert. Der erhaltene
Überstand (zytosolische Fraktion) wurde abgenommen und in flüssigem Stickstoff eingefroren.
Das Pellet wurde in 10 mL PBS resuspendiert, mit einem Polytron fünfmal für 15 sec bei 30 Hz
homogenisiert, für 20 min bei 16'000 g zentrifugiert und der Überstand verworfen. Dieser
Waschschritt wurde dreimal durchgeführt, das so gewonnene Pellet (partikuläre Fraktion) zuletzt
in 200 µL PBS aufgenommen und in flüssigem Stickstoff eingefroren. Alle Proben wurden bis
zum anschließenden Western Blot bei -80°C gelagert.
4.4.11 Ko- bzw. Immunopräzipitation (IP)
Für die Ko- bzw. Immunopräzipitation wurden transient transfizierte HEK-Zellen einer 10 cm
Kulturschale nach 48-stündiger Inkubation mit PBS gewaschen und mit 1 mL IP-Puffer
abgeschabt. Die Zellen wurden dreimal für 15 sec mit einem Polytron auf Eis lysiert und die
Zelltrümmer bei 4°C für 10 min bei 16'000 g abzentrifugiert. Die Bestimmung der
Proteinkonzentration erfolgte nach der Methode von Bradford. Von der Proteinlösung wurden 2
mg, sowie 8 µg anti-c-myc-Antikörper und 50 µL Protein A-Sepharose, welche in IP-Puffer
äquilibriert wurden, für die Ko- bzw. Immunopräzipitation verwendet und 4 h bei 4°C über Kopf
schüttelnd inkubiert. Alternativ wurde eine entsprechende Menge anti-c-myc-Antikörper
eingesetzt, welcher kovalent an die Protein A-Sepharose gekoppelt war. Abschließend wurde die
Protein A-Sepharose viermal mit 1 mL IP-Puffer gewaschen. Beim letzten Waschschritt wurden
etwa 20 µL Überstand über der Protein A-Sepharose stehen gelassen und mit 5 µL LaemmliProbenpuffer versetzt. Die Proben wurden gut gemischt, anschließend für 2 min bei 16'000 g
abzentrifugiert und für 5 min bei 95°C aufgekocht. Der Überstand mit den denaturierten
immunopräzipitierten Proteinen wurde mittels einer diskontinuierlichen SDS-Gelelektrophorese
aufgetrennt und immunologisch im Western Blot Verfahren nachgewiesen.
Material und Methoden
59
4.4.12 Pulldown-Assay
Aktivierte, GTP-gebundene monomere GTPasen binden mit einer sehr hohen Affinität an die
GTPase-bindende Domäne (GBD) von Effektormolekülen. Diese Eigenschaft wird im PulldownAssay genutzt, um die Aktivierung von RhoA, Rac1 und Cdc42 in Zelllysaten zu bestimmen
(Benard & Bokoch, 2002; Ren & Schwartz, 2000). Die jeweilige Bindedomäne des
Effektormoleküls der kleinen GTPasen wurde als GST-Fusionsprotein in E. coli RosettaTM
Bakterien exprimiert und an Glutathion-Sepharose gebunden. Für Rac1-GTP und Cdc42-GTP
wurde GST-PBD (p21 Bindedomäne von Pak1) verwendet, sowie GST-Rhotekin-RBD (RhoBindedomäne von Rhotekin) um RhoA-GTP nachzuweisen. Zur Herstellung der verwendeten
GST-Fusionsproteine wurde die entsprechende GTPase-bindende Domäne in den pGEX2TVektor kloniert, die für das entsprechende Protein zusammen mit einem Glutathion-STransferase-Fusionsanteil kodiert. Ausgehend von einer ü. N. Kultur wurden 100 mL 2x YT
Medium (100 µg/mL Ampicillin) angeimpft und bis zu einer OD (600 nm) von 0,6 bis 0,8 bei 37°C
und 250 rpm im Schüttler inkubiert. Dann wurde die Proteinsynthese mit 100 µL 1 M IPTG bei
25°C und 250 rpm für 1 h induziert. Anschließend wurden die Bakterien für 10 min mit 3'000 g bei
4°C abzentrifugiert, mit 10 mL kaltem PBS resuspendiert und fünfmal für 30 sec mit Ultraschall
lysiert. Nach Zugabe von 1 mL 10 %igem Triton X-100 wurde der Ansatz für 30 min auf Eis
schüttelnd inkubiert. Danach wurde der Ansatz für 10 min mit 20'000 g bei 4°C abzentrifugiert
und der Überstand zu 300 µL Glutathion-Sepharose (Fastflow, Amersham Biosciences) gegeben,
die zuvor zweimal mit 10 mL kaltem PBS gewaschen wurde. Das Lysat mit der vereinigten
Glutathion-Sepharose wurde für 45 min schüttelnd auf Eis inkubiert. Dann wurde die GlutathionSepharose für 2 min mit 1'000 g bei 4°C abzentrifugiert, mit 50 mL PBS gewaschen und erneut
abzentrifugiert, bevor die Proteinkonzentration der Probe bestimmt wurde. Der Pulldown-Assay
wurde bei 4°C im Kühlraum durchgeführt. Dazu wurde das Medium der 48 h zuvor transfizierten
Zellen abgenommen und die 6-well Platte senkrecht auf Eis gestellt um restliches Medium
absaugen zu können. Dann wurden die Zellen mit 500 µL GST-Fish-Puffer pro well abgeschabt
und für 5 min bei 16'000 g und 4°C abzentrifugiert. Nach diesem Zentrifugationsschritt wurden je
400 µL vom Überstand mit 40 µg GST-Fusionsprotein, welches an Glutathion-Sepharose
gebundenen ist, für 60 min auf Eis über Kopf schüttelnd inkubiert. Dann wurden die Proben
zweimal mit 1 mL GST-Fish-Puffer gewaschen, mit 5 µL 4x SDS-Probenpuffer versetzt, bei 95°C
für 5 min aufgekocht und mittels Immunoblot analysiert.
Material und Methoden
60
4.4.13 Expression und Aufreinigung von GST-Fusionsproteinen für den GDP/GTPAustausch-Assay
Für die Expression von GST-Fusionsproteinen wurden die entsprechenden cDNAs in den
pGEX2T-Vektor kloniert und anschließend in den Bakterienstamm E. coli BL21(DE3)pLysS
transformiert, der eine Proteinexpression ermöglicht. Unter Verwendung von Ampicillin wurden
die Bakterien auf Agarplatten selektiert und ü. N. bei 37°C inkubiert. Am nächsten Tag wurde
eine Einzelkolonie in 5 mL LB-Ampicillin ü. N. bei 37°C und 250 rpm inkubiert. Anschließend
wurden 500 µL der ü. N. Kultur in 200 mL LB-Ampicillin überführt und bis zu einer OD600 von 0,5 0,6 bei 37°C und 250 rpm inkubiert. Daraufhin erfolgte eine Induktion der Proteinexpression für 1
h mit 200 µL 1M IPTG bei 25°C und 250 rpm. Nach Pelletierung der Bakterienkultur für 10 min
bei 3'000 g wurde das Pellet in 10 mL PBS resuspendiert und mit Ultraschall fünfmal für 30 sec
(60 Hz) lysiert. Die Zelltrümmer wurden bei 16'000 g für 10 min abzentrifugiert. Der Überstand
wurde anschließend mit 300 µL Glutathion-Sepharose versetzt, die zuvor zweimal mit 10 mL
kaltem PBS gewaschen wurde. Die Bindung der GST-Fusionsproteine an die Sepharose erfolgte
durch 45-minütiges schütteln auf Eis. Anschließend wurde die Glutathion-Sepharose für 2 min mit
3’000 g abzentrifugiert und zweimal mit 50 mL kaltem PBS gewaschen. Die Elution des GSTFusionproteins von der Glutathion-Sepharose erfolgte durch Zugabe von Elutionspuffer (GSTFish-Puffer mit 20 mM Glutathion). Der Ansatz wurde zweimal mit je 1 mL Elutionspuffer für 15
min bei 4°C über Kopf schüttelnd inkubiert, abzentrifugiert und die Überstände vereinigt.
Abschließend wurden die eluierten Proteine mit einer Vivaspinsäule (10 kDa MWCO,
VivaScience) konzentriert und in den Versuchspuffer des GDP/GTP-Austausch-Assays
umgepuffert. Die Proteinbestimmung erfolgte nach der Bradfordmethode.
4.4.14 GDP/GTP-Austausch-Assay
Der GDP/GTP-Austausch-Assay diente der in vitro Substratspezifitätsbestimmung des
Guaninnukleotid-Austauschfaktors
RhoGEF10s. Dazu wurde
bakteriell exprimiertes und
aufgereinigtes GST-RhoA, GST-Rac1 oder GST-Cdc42 mit 3 µM [3H]-GDP beladen und
anschließend der durch den RhoGEF katalysierten Austausch gegen nicht markiertes GTP
bestimmt (Zheng et al., 1995). Um die Konzentrationsabhängigkeit der RhoGEF-Aktivität zu
bestimmen, wurden die aus E. coli BL21 aufgereinigten GST-GTPasen (0,6 µM) in 100 µL
Beladungspuffer für 5 min bei RT mit [3H]-GDP inkubiert. Die Beladung wurde durch Zugabe von
1 µL 500 mM MgCl2 gestoppt und der Ansatz für weitere 20 min bei RT inkubiert. Während
dessen wurden ansteigende Konzentrationen des aufgereinigten GST-RhoGEF-DHs (0; 0,25;
0,5; 0,75; 1 µM) in 20 µL Versuchspuffer für 5 min bei RT äquilibriert. Die Reaktion wurde durch
Zugabe der [3H]-GDP beladenen GST-GTPasen gestartet und für 20 min bei RT inkubiert. Die
Proben wurden dann mittels Vakuumpumpe durch eine Nitrozellulosemembran filtriert und der
Filter mit 3 mL Waschpuffer gespült. Während ungebundenes [3H]-GDP die Membran passieren
konnte, blieb das gebundene [3H]-GDP auf der Membran zurück. Die Nitrozellulosemembran
Material und Methoden
61
wurde in Szintillationsröhrchen gegeben und mit 10 mL Szintillationsflüssigkeit (Ultima Gold,
Firma Packard) versetzt. Die Aktivität wurde in einem Flüssigkeitsszintillationszähler „Tri-Carb
2100 TR“ der Firma Packard gemessen.
4.4.15 Immunhistologie
Die Perfusion von Wistar-Kyoto-Ratten erfolgte für 10 min mit kaltem PBS und 0,1 % Heparin
(200 IU/Tier), indem mit einer Nadel in die linke Herzkammer eingestochen und in die rechte
Herzkammer ein kleiner Schnitt gemacht wurde. Dadurch wurde das Blut gegen PBS
ausgetauscht, wobei Heparin die Blutgerinnung verhinderte. Anschließend erfolgte für 20 min
eine Perfusion mit 4 % Paraformaldehyd (PFA) in PBS. Die thorakale Aorta wurde aus dem Tier
entnommen und in eine Einbettkassette (Turboflow, Micron International) gelegt. Daraufhin folgte
eine Postfixierung der thorakalen Aorta für 12 h bei 4°C in 4 % PFA in PBS. Danach wurden etwa
0,5 mm große Aortenringe geschnitten, in die Einbettkassette gelegt und eine Paraffinierung
vorgenommen. Hierfür wurden die Aortenringe einmal für 5 min und dreimal für 15 min bei RT in
PBS gewaschen, anschließend für jeweils 30 min in 70 %igem, 90 %igem und dreimal in 100
%igem Ethanol sowie dreimal für 60 min in jeweils frischer Rotihistollösung (Roth) entwässert.
Die Präparate wurden für 6 - 12 h in einem absteigendem Rotihistol/Paraffingemisch (2:1, 1:1,
1:2) bei 58°C inkubiert, danach dreimal für 4 h in jeweils frischem, reinem Paraffin bei 58°C
inkubiert und anschließend mit frischem Paraffin in einer Standardkassette eingebettet. Daraufhin
wurden an einem Rotationsmikrotom (Mikrom, HM 340E) 7 µm dünne Paraffinschnitte
angefertigt, diese auf Objektträger aufgelegt und bei 37°C ü. N. im Wärmeschrank getrocknet. Im
nächsten Schritt wurden die Präparate entparaffiniert, indem diese zweimal für 10 min mit
Rotihistol und jeweils für 5 min in 100 %igem, 96 %igem, 90 %igem und 70 %igem Ethanol
behandelt wurden. Anschließend erfolgte ein Waschschritt für 5 min in dest. H2O und für 5 min in
Citratpuffer. In einer Färbeküvette wurden die Präparate dreimal für 5 min in 200 mL Citratpuffer
in der Mikrowelle bei etwa 600 W erhitzt. Zusätzlich wurden 2 Bechergläser mit je 200 mL dest.
H20 zur Energieaufnahme in die Mikrowelle gestellt. Nach 30-minütigem Abkühlen der Präparate
bei RT wurden diese für 5 min in etwa 22°C warmem PBS gewaschen. Im nächsten Schritt
erfolgte die Blockierung der Aldehyde für 15 min in 0,1 M Ammoniumchloridlösung in PBS. Nach
einem 5-minütigem Waschschritt in PBS wurden die Aortenringe auf dem Objektträger mit einem
Fettstift umkreist, um das Volumen der nachfolgenden Lösungen zu reduzieren. Die Blockierung
der Avidine und Biotine erfolgte für jeweils 15 min bei RT mit entsprechender Avidin- bzw. BiotinBlockierlösung (Blocking Kit, Linaris SP 2001, Wertheim-Bettingen). Die endogenen Peroxidasen
wurden für 15 min bei RT mit einer 0,3 %igen H2O2-Lösung blockiert. Die Präparate wurden
jeweils nach jedem Blockierungsschritt für 5 min bei RT mit PBS gewaschen. Die Präinkubation
der Aorten erfolgte für 30 min in 3 %igem n-goat-Serum sowie 1 % BSA in PBS. Letzlich folgte
eine Immunfärbung mit den entsprechenden Antikörpern und eine Behandlung der Präparate
entsprechend den Angaben des Herstellers mit ABC-Lösung (Vector Laboratories, Inc.,
Material und Methoden
62
Burlingame, USA) sowie Histo-Green (Kat. Nr. E109, Linaris, Wertheim-Bettingen, Deutschland).
Die Dehydratisierung nach der Histo-Green Färbung erfolgte jeweils für 30 sec in 70 %igem, 90
%igem, 96 %igem und 100 %igem Ethanol sowie dreimal für 30 sec in Rotihistollösung.
Abschließend wurden die Präparate mit Entellan (Merck, Darmstadt) eingedeckelt und bei 4°C
gelagert. Die Auswertung und Dokumentation wurde an einem DMRBE-Mikroskop der Firma
Leica durchgeführt.
4.5 Zellbiologische Methoden
4.5.1 Verwendete permanente Zelllinien bzw. Primärzellen
Für die Kultivierung der HEK-293-, TSA- und der thorakalen glattmuskulären Rattenaorta
(RASMC)-Zellen wurde DMEM mit den entsprechenden Zusätzen (10 % FCS + 100 U/mL
Penicillin und 0,1 mg/mL Streptomicin + 2 mM Glutamin) von der Firma Sigma verwendet.
Humane Endothelzellen aus der Umbilikalvene (HUVEC) wurden mit speziellem EndothelWachstumsmedium und den entsprechenden Zusätzen von PromoCell kultiviert (siehe 4.2.3,
Seite 45).
Zelltyp
HEK-293
(humane
embryonale
Nierenzellen:
adenoviral
transformiert)*
TSA
(humane
embryonale
Nierenzellen:
SV40
transformiert)*
RASMC
(glattmuskuläre
Zellen der
thorakalen
Rattenaorta)
HUVEC
(humane
Endothelzellen
aus der
Umbilikalvene)
Wachstumsbedingungen
Plattenbeschichtung
Anwendung
Transfektionsreagenz/Adenovirus
37°C, 5 % CO2
Kollagen
(45 µg/mL in
PBS)
LuciferaseAssay,
Pulldown-Assay
PolyFect,
Lipofectamin 2000
37°C, 5 % CO2
Kollagen
(45 µg/mL in
PBS)
LuciferaseAssay,
Pulldown-Assay
37°C, 5 % CO2
keine
AktinZytoskelettfärbung,
Pulldown-Assay
adenoviral
37°C, 5 % CO2
1 % Gelatine
AktinZytoskelettfärbung
adenoviral
* HEK-293- und TSA-Zellen werden im Folgenden als HEK-Zellen bezeichnet.
Tab. 8: Verwendete permanente Zelllinien bzw. Primärzellen.
PolyFect
Material und Methoden
63
4.5.2 Trypsinieren und Passagieren von Zellkulturen
Die
permanenten
Zelllinien
bzw.
Primärzellen
wurden
in
dem
entsprechenden
Wachstumsmedium kultiviert und in einem Inkubationsschrank in einer wasserdampfgesättigten
Atmosphäre bei 37°C und 5 % CO2 inkubiert. Alle 2 bis 3 Tage wurden die Zellen passagiert.
Zum Passagieren der Zelllkulturen wurde das Wachstumsmedium von den Zellen abgesaugt.
Anschließend wurden die Zellen einmal mit PBS gespült und mit einer adäquaten Menge TrypsinEDTA-Lösung für 3 min bei RT behandelt. Unter dem Mikroskop wurde das Ablösen der Zellen
von der Zellkulturschale kontrolliert und die Zellen durch Auf- und Abziehen in einer 10 mL
Pipette vereinzelt. Nach vollständigem Ablösen der Zellen wurde das Trypsin mit einem
äquivalenten Volumen des entsprechenden Wachstumsmediums aufgenommen und die Zellen
bei RT für 2 min mit 150 g abzentrifugiert. Das Zellpellet wurde in der entsprechenden Menge an
frischem Wachstumsmedium aufgenommen und nach Bedarf auf neue Zellkulturschalen verteilt.
Mussten die Zellkulturschalen mit Kollagen beschichtet werden, so wurden sie vor dem
Ausplattieren der Zellen mit 45 µg/mL Kollagen in PBS gespült. Die verwendeten Medien wurden
vor Gebrauch in einem Wasserbad auf 37°C erwärmt.
4.5.3 Auftauen und Einfrieren von Zellen
Zur dauerhaften Aufbewahrung wurden Zellen in einem Gemisch aus DMEM, 10 % FCS und 10
% DMSO bei -80°C tiefgefroren. Dazu wurden die Zellen trypsinisiert, durch Auf- und Abziehen in
einer 10 mL Pipette vereinzelt und die Zellen bei RT für 2 min mit 150 g abzentrifugiert. Das
Zellpellet einer konfluenten 10 cm Zellkulturschale wurde mit 1 mL Einfriermedium resuspendiert
und in ein Kryoröhrchen gegeben. Anschließend wurden die Zellen bei -80°C schonend
heruntergekühlt.
Beim Auftauen wurden die Zellen so kurz wie nur möglich mit dem toxischen Einfriermedium in
Kontakt belassen. Die Kryoröhrchen, welche die eingefrorenen Zellen enthielten wurden dazu im
37°C warmen Wasserbad aufgetaut und die Zellen sofort in eine vorbereitete, mit
Wachstumsmedium gefüllte Zellkulturflasche überführt. Nach erfolgter Adhärenz der Zellen wurde
das Wachstumsmedium gewechselt.
4.5.4 Transiente Transfektion
Für die transiente Transfektion der HEK-Zellen mit Plasmid-DNA bzw. Kotransfektion mit siRNA
wurden die Transfektionsreagenzien „PolyFect Transfection Reagent“ von Qiagen bzw.
„Lipofectamin 2000“ von Invitrogen benutzt (Tab. 9 und 10). Das PolyFect-Transfektionsreagenz
besteht aus Dendrimer-Molekülen, die stark verzweigt sind. Die Dendrimer-Moleküle interagieren
mit ihren positiv geladenen Aminogruppen mit den negativ geladenen Phosphatgruppen der
Nukleinsäure und erzeugen so eine kompakte und zellgängige Struktur der DNA. „Lipofectamin
2000“ verwendet die lipidbasierte Transfektion als Mechanismus, dabei werden Moleküle mit
Material und Methoden
64
einem unpolaren, lipophilen Schwanz und einem polaren, positiv geladenen Kopf verwendet, die
zusammen mit der DNA in wässriger Lösung Lipoplexe bilden. Mittels eines endozytotischen
Aufnahmemechanismus oder der Fusion der Lipoplexe mit der Zytoplasmamembran gelang die
DNA in die Zelle. Die Zellen wurden mit einer Konfluenz von 80 % bei Verwendung von „PolyFect
Transfection
Reagent“
bzw.
50%
bei
Verwendung
von
„Lipofectamin
2000“
und
serumreduziertem Medium („PolyFect Transfection Reagent“: 0,5 % FCS, 100 U/mL Penicillin
und 0,1 mg/mL Streptomicin, 2 mM Glutamin; „Lipofectamin 2000“: 0,5 % FCS, 2 mM Glutamin)
ausgesät. Nach Adhärenz der Zellen, üblicherweise nach 6 h, wurde die transiente Transfektion
gemäß den Angaben des Herstellers durchgeführt. Bei der reversen transienten Transfektion
wurde die Transfektion direkt nach dem Aussäen der Zellen durchgeführt.
Größe der
Zellkulturschale
24-well Platte
6-well Platte
6 cm Schale
10 cm Schale
Zellzahl
1,6 x 105
9,6 x 105
2,5 x 106
7,0 x 106
Gesamtvolumen
an
Medium
auf
Zellen*
(mL)
20
3,0
5,0
8,0
Plas
midDNA
#
(µg)
0,5
2,0
4,0
8,0
Endvolumen
der
gelösten
DNA**
(µL)
Volumen
des
PolyFect
Reagenz
(µL)
Zugegebenes
Medium
zu den
Zellen*
(mL)
25
100
150
300
5
20
40
80
300
1,5
3,0
7,0
Zugegebenes
Medium
zu
PolyFect/
DNA
Komplex*
(mL)
200
0,6
1,0
1,0
* 0,5 % FCS in DMEM (100 U/mL Penicillin und 0,1 mg/mL Streptomicin + 2 mM Glutamin)
# in TE-Puffer
** DMEM ohne FCS und Penicillin, Streptomicin, Glutamin
Tab. 9: Parameter für die transiente Plasmid-DNA Transfektion von HEK-Zellen mit dem PolyFectTransfektionsreagenz.
Material und Methoden
Größe der
Zellkulturschale
Zellzahl
96-well Platte
48-well Platte
24-well Platte
6-well Platte
2,8 x 104
5,6 x 104
11,2 x 104
6,7 x 105
GesamtVolumen
an
Medium
auf
Zellen*
(mL)
0,1
0,2
0,5
2
PlasmidDNA
#
(ng)
100
100
200
1000
65
siRNA
(pmoL)
DNA/RNA
Gesamtvolumen**
(µL)
Lipofectamin
2000 in
Gesamtvolumen**
(µL)
1
5
10
50
25
25
50
250
0,2-0,5 in 25
0,3-0,8 in 25
0,5-1,5 in 50
2,5-6 in 250
* 0,5 % FCS in DMEM + 2 mM Glutamin ohne Penicillin bzw. Streptomicin
# in TE-Puffer
** DMEM ohne FCS, Penicillin, Streptomicin und Glutamin
Tab. 10: Parameter für die transiente Plasmid-DNA und siRNA Kotransfektion von HEK-Zellen mit
dem Transfektionsreagenz Lipofectamin 2000.
4.5.5 Adenovirale Infektion von Zellen
Bei
der
adenoviralen
Infektion
der
RASMC-
und
HUVEC-Primärzellen
wurde
das
Wachstumsmedium von den Zellen abgesaugt und die Zellen einmal mit PBS gespült.
Anschließend wurde eine adäquate Menge an serumreduziertem Medium (0,5 % FCS) mit dem
jeweiligen rekombinanten Adenovirus gemischt und auf die Zellen gegeben. Daraufhin wurden
die Zellen für 48 h mit dem rekombinanten Adenovirus inkubiert. Die HUVEC-Zellen wurden mit
einer MOI (Multiplizität der Infektion) von 10 und die RASMC-Zellen mit einer MOI von 150
infiziert. Die Infektionseffizienz der Zellen betrug etwa 80 % - 100 %.
4.5.6 SRE/SRF-Luciferase-Assay
Zur luminometrischen Quantifizierung der Luciferase-Aktivität wurde der „Dual-Luciferase
Reporter Assay“ von Promega verwendet (Hill, 1995). Dabei wurde die Aktivierung des
Transkriptionsfaktors „serum response factor“ (SRF) gemessen, der an die PromotorRegulatorsequenz „serum response element“ (SRE) bindet und damit die Transkription von
Genen stimuliert. Ein Reportergenvektor, welcher für die Photinus pyralis-Luciferase kodiert
wurde als Richtmaß der SRF-abhängigen Gentranskription verwendet (pSRE.L Plasmid, Dr. J.
Mao, Dr.D. Wu, University of Rochester, Rochester, NewYork, USA). Ein Kontrollvektor, der ein
Renilla reniformis-Luciferase (pRL-TK-Plasmid von Promega) exprimierendes Reportergen
enthält, wurde als Kontrolle verwendet, und gegen die Messung des experimentellen
Reportergenvektors abgeglichen. Um eine Kontrolle für die transkriptionelle Aktivierung zu
gewährleisten, besitzt der Kontrollvektor ein von experimentellen Bedingungen unabhängigen
Herpes Simplex Thymidin Kinase (HSV-TK)-Promotor, der für eine schwache, aber konstitutive
Expression der Renilla reniformis-Luciferase sorgt. Die Renilla reniformis- sowie die Photinus
Material und Methoden
66
pyralis-Luciferase erzeugen ein Biolumineszenzsignal. Die Photonenemission der Photinus
pyralis-Luciferase erfolgt über Oxidation von Käferluciferin, für dessen Emission das
Vorhandensein von ATP, Mg2+ und O2 notwendig ist. Da die Zwischenstufe Luciferyl-AMP sehr
schnell umgewandelt wird, würde die Lichtemission schnell wieder abnehmen. Durch Zugabe von
Coenzym A, das im Assay bereits enthalten ist, erfolgt eine längerdauernde Lumineszenz. Bei
der Renilla reniformis-Luciferase ist zur Photonenemission O2 und Coelenterazin notwendig.
Die Bestimmung der SRF-Aktivierung erfolgte in denselben Lysaten durch sukzessive Messung
zunächst der Photinus pyralis- und danach der Renilla reniformis-Luciferase-Expression
(Photinus
pyralis-Luciferase:
LARII;
Renilla
reniformis-Luciferase:
Stop&Glow
Buffer).
Abschließend wurde der Quotient aus den beiden Werten gebildet, der unabhängig von der
Transfektionseffizienz als Grundlage für die Bestimmung der Promotoraktivierung dient. Die
experimentelle Vorgehensweise war die reverse transiente Transfektion von HEK-Zellen in einer
48-well Platte. Die Zellen wurden mit einer 80 %igen Konfluenz ausgesät und mit insgesamt 250
ng DNA pro well transfiziert. Pro well wurden 43 ng pSRE.L und 7 ng pRL-TK verwendet, sowie
200 ng von den jeweils zu untersuchenden Plasmiden. Nach 48-stündiger Inkubation wurden die
Zellen mit PBS gespült und mit 50 µL „Passiv Lysis Buffer“ lysiert. Von den Lysaten wurde 1 µL
gemäß den Angaben des Herstellers in einem Multilabel Reader EnVision (Perkin Elmer)
gemessen. Der Vorteil der Methode liegt darin, dass die Renilla reniformis- und Photinus pyralisLuciferase-Expression in einer einzigen Probe gemessen werden kann.
4.5.7 Färbung des Aktin-Zytoskeletts
Für die Färbung des Aktin-Zytoskeletts wurden RASMC oder HUVEC auf speziellen
Objektträgern (4-well Culture-Slides, Falcon), entsprechend mit 45 µg/mL Kollagen in PBS bzw.
mit 1 %iger Gelatine beschichtet und mit einer etwa 50 %igen Konfluenz ausgesät. Nach 48 h
wurden die Zellen mit PBS gewaschen und für 10 min in 3 %igem PFA in PBS fixiert. Nach
zweimaligem Waschen mit PBS wurden RASMC mit 0,5 %igem bzw. HUVEC mit 0,05 %igem
Triton X-100 für 10 bzw. 3 min permeabilisiert, anschließend wieder mit PBS gewaschen und
dann für 1 h mit 0,5 % BSA in PBS blockiert. Die Färbung des Aktin-Zytoskeletts erfolgte durch
Inkubation mit 1 µg/mL TRITC-Phalloidin in 0,5 % BSA in PBS ü. N. im Dunkeln. Nach
dreimaligem Waschen mit PBS wurden die Zellen in einer Mowiollösung eingebettet und ü. N. bei
4°C getrocknet. Die Auswertung und Dokumentation der Aktin-Zytoskelett Färbung wurde an
einem DMRBE-Mikroskop der Firma Leica durchgeführt.
Material und Methoden
67
4.5.8 Isolation von thorakalen Aorten und Kultivierung der isolierten, glattmuskulären
Zellen
Die thorakalen Aorten wurden aus 1 - 3 Monate alten Wistar-Kyoto-Ratten präpariert und in kaltes
PBS gegeben. Die Aorten wurden mit einer Pinzette in PBS-Lösung von Binde- und Fettgewebe
befreit und anschließend mit einem Skalpell in einer 0,4 %igen Kollagenaselösung in
serumfreiem DMEM-Medium in 2 - 3 mm Ringe geschnitten. Anschließend folgte eine 20 - 30
minütige Inkubation im Brutschrank bei 37°C und 5 % CO2. Der Kollagenaseverdau der Aorten
wurde unter dem Mikroskop kontrolliert. Nach erfolgreichem Verdau der Aorten wurde die
Kollagenase mit einer äquivalenten Menge Wachstumsmedium inaktiviert und die Aortenringe
dreimal mit Wachstumsmedium gewaschen. Dies erfolgte durch Zentrifugation bei 150 g für 5 min
bei RT. Abschließend wurden die Aortenringe von 2 - 3 Aorten in eine 25 cm2 Zellkulturflasche
mit 4 mL Wachstumsmedium überführt. Nach 24 h wurde überprüft, ob sich Zellen an der
Zellkulturflasche angeheftet haben und nach weiteren 48 h wurde 3 - 5 mL frisches
Wachstumsmedium zugegeben. Nach weiteren 3-4 Tagen erreichten die Zellen eine Konfluenz
von 80 - 90 %. Die isolierten, glattmuskulären Zellen aus der Rattenaorta (RASMC) wurden bis
zur Passage 5 für Anwendungen, wie den Pulldown-Assay oder eine Aktin-Zytoskelett Färbung
verwendet.
Ergebnisse
68
5. Ergebnisse
Die Guaninnukleotid-Austauschfaktoren RhoGEF10, GrinchGEF (Winkler et al., 2005) und p164RhoGEF (Rumenapp et al., 2002) lassen sich anhand ihrer beschriebenen cDNA- und der daraus
abgeleiteten Aminosäuresequenzen in einer Subfamilie der Dbl-Proteine zusammenfassen. Der
direkte Sequenzvergleich zeigt jedoch, dass der Verwandtschaftsgrad zwischen RhoGEF10 und
GrinchGEF höher ist, als der von p164-RhoGEF zu den jeweiligen anderen Austauschfaktoren
(Abb.
9).
So
weisen
z.
B.
nur
RhoGEF10
und
GrinchGEF
C-terminal
putative
Transmembransegmente auf, deren Funktionalität allerdings für GrinchGEF bereits widerlegt
worden ist (Winkler et al., 2005).
Abgesehen von der Primärsequenz ist jedoch bislang wenig über die Spezifität, die Regulation
und die physiologische Funktion dieser Subfamilie der Dbl-Proteine bekannt. Daher stand die
Charakterisierung der biologischen Bedeutung dieser Proteine, insbesondere von RhoGEF10
und p164-RhoGEF im Fokus dieser Arbeit.
p164-RhoGEF
GrinchGEF
RhoGEF10
Abb. 9: Phylogenetischer Baum der Dbl-Subfamilie p164-RhoGEF, RhoGEF10 und GrinchGEF
erstellt mit dem ClustalW-Computerprogramm. p164-RhoGEF weist bezogen auf die DH-Sequenz
eine ~ 44 %ige Homologie zu GrinchGEF und RhoGEF10 auf. Die DH-Sequenz von GrinchGEF ist ~
60 % homolog zu RhoGEF10.
Ergebnisse
69
1. Teil
5.1 Grundcharakterisierung von RhoGEF10
5.1.1 Klonierung und Expression von zwei humanen RhoGEF10-Varianten
Der KIAA0294 Klon, welcher vom Kazusa DNA Research Institute (Chiba, Japan) zur Verfügung
gestellt wurde, wies einen offenen Leserahmen von Position +2 bis zu einem in-frame-Stopkodon
bei Position 4219 auf. Mit dem Bioinformatik-Programm GeneMark (Borodovsky & Mcininch,
1993) konnten an den Positionen 185, 230, 443 und 800 vier putative Startkodons ermittelt
werden (Abb. 10 A), wobei jedoch das ATG an Position 443 als das wahrscheinlichste Startkodon
errechnet wurde. Deshalb wurde mittels Restriktionsklonierung zunächst der Sequenzabschnitt
von Base 517 bis 4715 in den eukaryoten Expressionsvektor pCMV-Tag3 B kloniert, welcher die
Überexpression einer N-terminal c-myc-getaggten, humanen RhoGEF10-Variante erlaubte.
Da in einer genetischen Studie von Verhoeven und Mitarbeitern beschrieben wurde (Verhoeven
et al., 2003), dass das murine RhoGEF10-Ortholog einem Gewebe-unabhängigen, alternativen
Spleißen des Exons 4 unterliegt, sollte zunächst untersucht werden, ob das korrespondierende
humane Exon 8 (Nukleotide 1028 bis 1144) ebenfalls Gegenstand alternativen Spleißens ist.
Dazu wurden zunächst mit Exon 8-umspannenden Oligonukleotiden und isolierter Gesamt-RNA
aus verschiedenen humanen Geweben eine RT-PCR durchgeführt, die Fragmente anschließend
kloniert und sequenziert. Wie aus Abbildung 10 B ersichtlich wird, konnten in allen untersuchten
Geweben 2 Amplifikate mit einer Länge von 420 und 537 bp detektiert werden. Die
Sequenzierung ergab, dass die Differenz beider Fragmente tatsächlich auf alternativem Spleißen
des Exons 8 beruhte und es durch Verlust dieses Exons zu keiner Verschiebung im offenen
Leserahmen kam. Darüber hinaus bestätigte diese RT-PCR die von Yoshizawa und Mitarbeitern
(Yoshizawa et al., 2003) mittels Northern Blot-Analysen bereits nachgewiesene ubiquitäre
Transkription des humanen RhoGEF10-Gens.
Basierend auf der Annahme, dass sich an Position 443 das Startkodon befindet, besteht
RhoGEF10 aus 1258 Aminosäuren bzw. RhoGEF10-ΔE8 aus 1219 Aminosäuren. Die
berechneten theoretischen Molekulargewichte (Expasy Peptide Mass) betragen ca. 140 bzw. 135
kDa. Weitere bioinformatische Untersuchungen ergaben, dass das RhoGEF10-Gen sich aus 28
Exonen zusammensetzt und auf dem Chromosom 8 an der Position 8p23 lokalisiert ist.
Ergebnisse
70
A
KIAA0294
4219
DH
1
ORF
1827
1383
5589 bp
1405aa
185
230
443
800
agcatgg
0,34
gaaatga
0,40
ccgatga
0,62
ccgatga
0,32
Sequenz
Wahrscheinlichkeit
Im Leserahmen
ATG
B
RhoGEF10
735
1271
RhoGEF10-ΔE8
DH
DH
Δ 1028-1144
Exon 8
le
ol
r
t
on
r
K
.
ke
z
ar
eg
er
N
H
M
s
te
n
ie
z
ffi
u
rn
s
Hi
in
z
er
H
l
ke
s
u
tm
t
e
re
el
ie
k
N
S
r
be
e
L
bp
537 bp
500
400
300
420 bp
Abb. 10: Primärsequenz und alternative Spleißvariante von RhoGEF10. (A) Die
Wahrscheinlichkeit mit der verschiedene ATGs als Startkodons innerhalb der RhoGEF10-Sequenz
dienen könnten, wurde mit dem Bioinformatik-Programm GeneMark ermittelt. (B) RT-PCR von
verschiedenen humanen Geweben mit Oligonukleotiden, die das Exon 8 umfassen. Für die RT-PCR
wurden die in 4.1.7 aufgeführten Primer RhoGEF10-735-for und RhoGEF10-1271-rev verwendet.
Ergebnisse
71
5.1.2 Theoretische Analyse der Proteinsequenz von RhoGEF10, Expression und
subzelluläre Lokalisation
Sequenzanalysen mit mehreren Bioinformatikprogrammen (InterProScan, TMHMM, Sosui)
ergaben, dass RhoGEF10 eine ähnliche Proteindomänenstruktur wie das kürzlich publizierte
GrinchGEF (Winkler et al., 2005) aufweist: Neben der Dbl-Homologie-Domäne (Aminosäuren 310
bis 497) konnte eine putative WD40-ähnliche, Protein-Protein-Interaktionsdomäne mit einer βPropeller-ähnlichen Struktur berechnet werden (Abb. 11 A). Unter Verwendung des
dreidimensionalen Homologie-Modelling-Programms Fugue konnte diese etwa 250 Aminosäuren
C-terminal der DH-Domäne zwischen den Aminosäuren 765 und 1110 lokalisiert werden. Eine
solche Domäne von ähnlicher Größe und Position lies sich auch in p164-RhoGEF nachweisen.
Darüber hinaus scheiterten, wie bereits für p164-RhoGEF und GrinchGEF beschrieben,
verschiedene Bioinformatikprogramme an der Berechnung der für die Dbl-Familie so typischen
PH-Domäne. Nur das hochstringente dreidimensionale Homologie-Modelling-Programm Fugue
ermittelte bei RhoGEF10 eine putative PH-ähnliche Domäne zwischen den Aminosäuren 511 und
649. Zusätzlich ließen sich, wie bereits erwähnt, 2 C-terminal lokalisierte Membrandurchspannende Segmente zwischen den Aminosäuren 998 und 1020 sowie 1111 und 1133
berechnen (Abb. 11 A), die theoretisch eine extrazellulär-intrazellulär-extrazelluläre Orientierung
bedingen
würden.
Obwohl
dies
in
Anbetracht
der
Funktion
eines
Guaninnukleotid-
Austauschfaktors äußerst unwahrscheinlich erschien, konnte die tatsächliche Lokalisation von
RhoGEF10 nur in einem experimentellen Ansatz ermittelt werden. Dazu wurden HEK-Zellen mit
einem eukaryoten c-myc-getaggten Expressionsvektor, der für RhoGEF10 kodiert, transfiziert
und anschließend die partikulären Kompartimente und Membranfragmente mittels Zentrifugation
vom Zytosol abgetrennt. Wie in Abbildung 11 B zu sehen ist, konnte das überexprimierte
RhoGEF10 ausschließlich in der zytosolischen, nicht aber in der partikulären Fraktion detektiert
werden. Somit wurde eine theoretische Membranintegration widerlegt.
Ergebnisse
72
A
1110
497
1
DH
310
649
PH?
511
1258 AS
WD40
765
TM
B
r
Pa
ti
re
lä
u
k
n
io
t
ak
Fr
Z
he
c
is
ol
s
o
yt
n
tio
k
a
Fr
RhoGEF10
anti-c-myc
anti-GAPDH
anti-Gβ
Abb. 11: Abgeleitete Proteindomänenstruktur und subzelluläre Lokalisation von RhoGEF10. (A)
Schematische Darstellung der Proteindomänenstruktur von RhoGEF10. (B) HEK-Zellen wurden mit 6
µg pCMV-Tag RhoGEF10 transfiziert. Nach 48 h wurde die zytosolische und die partikuläre Fraktion
präpariert (siehe 4.4.10, Seite 58) und gleiche Mengen an Protein im Immunoblot mit einem anti-cmyc-Antikörper untersucht. Der Nachweis der Reinheit der Fraktionen wurde mit einem anti-GAPDHund einem anti-Gβ-Antikörper im Immunoblot nachgewiesen.
5.1.3 RhoGEF10 aktiviert RhoA in vitro
Um die Spezifität der katalytischen Aktivität von RhoGEF10 zunächst in vitro zu untersuchen,
wurde der Austausch von [3H]-GDP gegen nicht radioaktives GTP in aufgereinigten
rekombinanten GST-RhoA, GST-Rac1 und GST-Cdc42 Fusionsproteinen untersucht. Dazu
wurde die DH-Domäne von RhoGEF10 in den bakteriellen Expressionsvektor pGEX2T kloniert,
die Expression des daraus resultierenden GST-RhoGEF10-DH-Fusionsproteins in E. coli
induziert
und
dies
mittels
Glutathion-Sepharose
aufgereinigt.
Im
nachfolgenden
Austauschexperiment vermochte GST-RhoGEF10-DH, vergleichbar der GST-DH-Domäne des
RhoA-aktivierenden Dbs (Whitehead et al., 1999), konzentrationsabhängig GST-RhoA, nicht aber
GST-Rac1 und GST-Cdc42 zu aktivieren (Abb. 12).
Ergebnisse
73
DH
01
EF
oG
Rh ker
ST Mar kDa
G
GST + Rac1
119
GST + Cdc42
66
GST + RhoA
RhoGEF10-DH + Rac1
43
RhoGEF10-DH + Cdc42
RhoGEF10-DH + RhoA
Gebundenes [3H]-GDP
(% der Kontrolle)
125
29
Dbs-DH + RhoA
100
75
50
25
0
0,00
0,25
0,50
0,75
1,00
GST-GEF (µM)
Abb. 12: Guaninnukleotid-Austauschaktivität von RhoGEF10 in vitro. RhoGEF10-DH wurde in
den Vektor pGEX2T (Amersham) subkloniert und anschließend als GST-Fusionsprotein in E. coli
BL21 Bakterien exprimiert, aufgereinigt und in einer 8 %igen SDS-PAGE und anschließender
Coomassie-Färbung kontrolliert (Abb. rechts oben). 0,6 µM der gereinigten Rho-GTPasen (GSTRhoA, GST-Rac1 und GST-Cdc42) wurden für 5 min bei RT mit 3 µM [3H]-GDP beladen und
anschließend mit 0; 0,25; 0,5; 0,75 und 1 µM GST-RhoGEF10-DH bzw. GST-Dbs-DH für 20 min bei
RT inkubiert. Gebundenes [3H]GDP ist in Prozent bezogen auf die Negativkontrolle angegeben. Die
gezeigten Werte sind Mittelwerte (n=4) ± SD.
5.1.4 RhoGEF10 aktiviert RhoA-C in intakten Zellen
Um
die
Spezifität
der
Guaninnukleotid-Austauschaktivität
von
RhoGEF10
und
deren
Spleißvariante RhoGEF10-ΔE8 (Abb. 13 A) in intakten Zellen zu untersuchen, wurde ein
semiquantitativer Effektor-Pulldown-Assay durchgeführt (siehe 4.4.12, Seite 59). Dazu wurden
HEK-Zellen mit RhoGEF10 bzw. RhoGEF10-ΔE8 transfiziert und die Aktivierung von endogenem
RhoA bzw. überexprimiertem, N-terminal HA-getaggtem RhoB und RhoC untersucht. Als
Positivkontrolle der RhoA-Aktivierung diente das engverwandte GrinchGEF. Wie aus Abbildung
13 B und C ersichtlich wird, waren sowohl RhoGEF10, als auch RhoGEF10-ΔE8 gleichermaßen
in der Lage die Homologen RhoA-C zu aktivieren. In guter Übereinstimmung mit den in vitro
Untersuchungen konnte RhoGEF10 auch in intakten Zellen keine Aktivierung von endogenem
Rac1 bzw. Cdc42 bewirken (Abb. 13 D). Die Funktionalität dieser Pulldown-Assays wurde parallel
durch Überexpression des Rac1-spezifischen RhoGEFs TIAM1, sowie der Cdc42-aktivierenden
DH-Domäne von Dbl überprüft.
Ergebnisse
74
A
RhoGEF10 517
DH
WD40
4715 bp
RhoGEF10-ΔE8 517
DH
WD40
4715 bp
Δ 1028-1144
K
on
tr
ol
le
R
ho
G
EF
10
G
rin
ch
G
EF
K
on
tr
ol
le
R
ho
G
EF
10
-Δ
E8
B
RhoA-GTP
RhoA/Gesamt
R
ho
B
R
ho
C
R
ho
B
+R
R
ho ho
G
C
+R EF
ho 10
G
EF
10
C
R
ho
B
R
ho
C
R
ho
B
+R
R
ho hoG
C
+R EF1
0ho
Δ
G
EF E8
10
-Δ
E8
anti-c-myc
HA-Rho-GTP
HA-Rho/Gesamt
anti-c-myc-GEF10
Rac1-GTP
Rac1/Gesamt
K
on
tr
ol
le
R
ho
G
EF
10
D
bl
-D
H
K
on
tr
ol
le
R
ho
G
EF
10
Ti
am
1
D
Cdc42-GTP
Cdc42/Gesamt
Abb. 13: RhoA-C spezifische Guaninnukleotid-Austauschaktivität von RhoGEF10-Varianten in
intakten Zellen. (A) Schematische Darstellung der klonierten cDNA-Sequenz von RhoGEF10 und
RhoGEF10-ΔE8. (B), (C), (D) HEK-Zellen wurden mit 1,5 µg Plasmid-DNA des entsprechenden
RhoGEFs bzw. 750 ng Plasmid-DNA des entsprechenden RhoGEFs plus 750 ng Plasmid-DNA für
RhoB bzw. RhoC und bis zu 1,5 µg Kontrollvektor kotransfiziert. Zur Bestimmung der Gesamtmenge
der jeweiligen Rho-GTPase wurde parallel 40 µg der jeweiligen Zelllysate analysiert. Die Expression
der RhoGEF10-Varianten und von GrinchGEF wurde mit dem anti-c-myc-Antikörper überprüft.
Ergebnisse
75
Da der Pulldown-Assay keine quantitative Aussage über die RhoGEF10-abhängige Aktivierung
von RhoA-C erlaubt, wurde anschließend ein SRE/SRF-abhängiger Luciferase-ReportergenAssay durchgeführt. Hierbei zeigte sich, dass im Vergleich zu Zellen, welche mit einem
Kontrollplasmid (basale Kontrolle) transfiziert wurden, die Überexpression von RhoA-C, sowie die
alleinige Überexpression von RhoGEF10 zu einem moderaten Anstieg der SRF-Aktivierung
führte (Abb. 14 C). Zu einer deutlich über-additiven Zunahme der SRF-Aktivierung kam es durch
Koexpression der jeweiligen Rho-GTPase mit RhoGEF10. Dabei zeigte RhoGEF10 eine leichte
Präferenz gegenüber RhoB, dessen Aktivierung um etwa das 4-fache gesteigert wurde im
Gegensatz zur 3-fachen Zunahme der RhoA und RhoC induzierten SRF-Aktivierung. Als
Positivkontrolle wurde eine konstitutiv aktive p164-RhoGEF-ΔN-Mutante verwendet (Rumenapp
et al., 2002). Diese wies keine Präferenz für eine der drei Rho-Isoformen auf. Ein weiterer
Unterschied zwischen p164-RhoGEF und RhoGEF10 wurde anhand der Überexpression
verschiedener N- und C-terminal trunkierter Mutanten von RhoGEF10 deutlich (Abb. 14 A, B).
Während für p164-RhoGEF eine autoinhibitorische Regulation beschrieben wurde, die durch die
Verkürzung des Proteins aufgehoben werden konnte (Rumenapp et al., 2002), erwies sich die
Verkürzung von RhoGEF10 nicht als stimulierend, sondern vielmehr als Aktivitäts-inhibierend.
A
RhoGEF10
RhoGEF10-ΔN
RhoGEF10-ΔC
RhoGEF10-DH
B
kDa
200
119
66
43
1
294
1
250
DH
WD40
1258 AS
DH
WD40
1258 AS
DH
674 AS
DH
674 AS
ΔN -ΔC -DH
0
00
0
1
1
ll e
F1 EF1
F EF
o
E
E
r
nt
oG hoG hoG hoG
Ko
R
R
Rh R
Ergebnisse
76
C
35
30
25
Basal
RhoA
RhoB
RhoC
20
15
10
5
R
ho
G
EF
17
-Δ
N
K
on
tr
ol
le
R
ho
G
EF
R
10
ho
G
EF
10
-Δ
R
ho
N
G
EF
10
-Δ
R
ho
C
G
EF
10
-D
H
0
Abb. 14: Stimulation der RhoA-C vermittelten Gentranskription durch verschiedene RhoGEF10Varianten. (A) Schematische Darstellung der Proteindomänenstruktur der entsprechenden trunkierten
RhoGEF10-Mutanten. (B) Nachweis von überexprimierten trunkierten RhoGEF10-Mutanten in HEKZellen mittels eines anti-c-myc-Antikörpers im Immunoblot. (C) HEK-Zellen wurden mit 43 ng
Reporterplasmid pSRE.L und mit 7 ng Kontroll-Plasmid pRL-TK sowie mit 150 ng Plasmid-DNA der
entsprechenden RhoGEF-Varianten und entsprechend mit 25 ng Plasmid-DNA für RhoA sowie mit 50
ng Plasmid-DNA für RhoB und RhoC sowie bis zu 200 ng Leervektor kotransfiziert. Die Aktivität der
Photinus pyralis-Luciferase (zur Vereinfachung im Folgenden als Photinus-Luciferase abgekürzt)
wurde gegen die Aktivität der Renilla reniformis-Luciferase (zur Vereinfachung im Folgenden als
Renilla-Luciferase abgekürzt) normalisiert. Die Werte sind Mittelwerte (n=8) ± SEM, ausgedrückt als
Vielfaches der Luciferase-Bildung von Kontroll-transfizierten Zellen.
5.1.5 Expression von RhoGEF10 in Endothelzellen
Die von Yoshizawa und Mitarbeitern (Yoshizawa et al., 2003) veröffentliche Northern BlotAnalyse zur Transkription des RhoGEF10-Gens zeigte, wie bereits erwähnt, ein relativ weit
verbreitetes Vorkommen des RhoGEF10-Transkripts in unterschiedlichsten Geweben. Besonders
deutliche Signale waren jedoch in gefäßreichem Gewebe, wie Herz, Lunge, Gehirn, Plazenta und
Niere aufgetreten. Aufgrund dessen sollte die Expression von RhoGEF10 zunächst in vaskulärem
Gewebe untersucht werden. Dazu wurde eine immunhistologische Färbung thorakaler
Aortenschnitte der Ratte (wurden freundlicherweise von Dr. Martin Thomas am Institut für
Pharmakologie und Toxikologie der Fakultät für Klinische Medizin Mannheim der Universität
Heidelberg durchgeführt) mit einem spezifischen anti-RhoGEF10-Antikörper durchgeführt. Diese
wies eine deutliche Expression von RhoGEF10 in den Endothelzellen und eine wesentlich
geringere in den glatten Muskelzellen der Aorta auf (Abb. 15 A). Als Negativkontrolle diente eine
Färbung mit dem Zweitantikörper. Die vorwiegend endotheliale Expression von RhoGEF10
konnte in einem anschließenden Immunoblot mit Lysaten von isolierten humanen Endothelzellen
Ergebnisse
77
der Umbilikalvene (HUVEC) bestätigt werden (Abb. 15 B). Dahingegen konnte in einem
Immunoblot mit RASMC-Lysaten auf dieser Höhe keine spezifische Bande detektiert werden.
A
RhoGEF10
Kontrolle
200 kDa
überexprimiertes
RhoGEF10
119 kDa
üb
er
B
ex
pr
i
(H mie
EK r t
H
U
-L es
VE
ys Rh
at o
C
-L
) GE
ys
F1
at
0
üb
er
ex
pr
i
(H mie
EK rt
H
-L es
U
VE
ys Rh
at o
C
-L
) GE
ys
F1
at
0
10 µM
200 kDa
endogenes
RhoGEF10
119 kDa
Ponceau-Färbung
Abb. 15: Endogene Expression von RhoGEF10 in Endothelzellen. (A) Immunhistologische
Färbung eines Paraffinschnittes der thorakalen Aorta der Ratte. 1. Antikörper: anti-RhoGEF10
(1:1000; 1h Inkubation). 2. Antikörper: anti-Kaninchen (1:200; 30 min Inkubation). Schwarzer Pfeil:
glattmuskuläres Gewebe; roter Pfeil: Endothel. Inset: Kontrollfärbung des Zweitantikörpers.
Maßstab:10 µM (B) Nachweis von endogenem RhoGEF10 in 80 µg HUVEC-Lysat im Immunoblot mit
einem anti-RhoGEF10-Antikörper. Als Expressionskontrolle diente das in HEK-Zellen rekombinant
überexprimierte RhoGEF10. Die entsprechende Ponceau-Färbung ist im rechten Bild dargestellt.
Zusammenfassend zeigt dieser Teil der Arbeit, dass es sich bei RhoGEF10 um einen unter
anderem endothelial exprimierten Guaninnukleotid-Austauschfaktor handelt, der spezifisch RhoAC zu aktivieren vermag. RhoGEF10 unterliegt nicht, wie das verwandte Protein p164-RhoGEF
einer autoinhibitorischen Kontrolle (Rumenapp et al., 2002) und kommt im Menschen,
vergleichbar wie in der Maus, zumindest in zwei verschiedenen Spleißvarianten vor.
Ergebnisse
78
2. Teil
5.2 Regulation von RhoGEF17
5.2.1 Klonierung von RhoGEF17
Bei einem Computer-gestützten Vergleich der cDNA-Sequenzen für p164-RhoGEF von Mensch
(Rumenapp et al., 2002) und Maus stellte sich heraus, dass die murine Sequenz ein etwa 1,5 kb
längeres 5’-Ende aufwies. Diese Sequenz enthielt ein putatives Startkodon und wies einen
durchgängigen offenen Leserahmen auf, welcher in einer zu p164-RhoGEF homologen
Aminosäuresequenz mündete. Dies legte die Vermutung nahe, dass diese zusätzliche Sequenz
kodierend ist und aufgrund der hohen Homologie (~ 87 %) von Mensch und Maus auch im
Mensch vorhanden sein sollte. Der direkte Vergleich dieser murinen Sequenz mit dem
menschlichen Genom erbrachte eine entsprechende, hoch homologe Sequenz von 1662 Basen
die im Folgenden mittels RT-PCR (entsprechende Primer RhoGEF17-19-for (EcoRI) und
RhoGEF17-2007-rev (KpnI) sind in 4.1.7 aufgelistet) aus Gesamt-RNA von HEK-Zellen
amplifiziert wurde. Das PCR-Produkt wurde per Restriktionsklonierung in die bereits vorhandene
p164-RhoGEF-cDNA eingefügt. Die nun zur Verfügung stehende 7540 bp lange cDNA wies
einen offenen Leserahmen von 6189 bp Länge auf, der für ein putatives, 2063 Aminosäuren
langes Protein kodiert (Abb. 16 A). Dieses Protein, welches im Folgenden korrespondierend zu
neueren Genbankeinträgen als RhoGEF17 bezeichnet wird, besitzt ein theoretisches
Molekulargewicht (Expasy Peptide Mass) von ca. 221 kDa, das experimentell bestätigt werden
konnte (Abb. 16 B). Somit stellt das von Rümenapp und Mitarbeitern beschriebene p164RhoGEF eine N-terminal trunkierte Mutante von RhoGEF17 dar und wird deshalb im Folgenden
entsprechend der fehlenden 554 Aminosäuren als RhoGEF17 -554 bezeichnet (Abb. 16 A).
Die DH-Domäne von RhoGEF17 konnte mit mehreren Bioinformatikprogrammen (BlastP,
ScanProsite oder InterPro) zwischen den Aminosäuren 1066 bis 1254 lokalisiert werden.
Außerdem konnte, ähnlich wie für RhoGEF10, eine putative WD40-ähnliche Protein-ProteinInteraktionsdomäne mit einer β-Propeller-ähnlichen Struktur im Bereich der Aminosäuren 1737
bis 1954 nachgewiesen werden (Touhara et al., 1994). Im Gegensatz zur Mehrheit der bekannten
RhoGEFs verfügt RhoGEF17, vergleichbar mit RhoGEF10 und GrinchGEF, nicht über eine
typische PH-Domäne. Mittels des hochstringenten dreidimensionalen Homologie-ModellingProgramms Fugue (Shi et al., 2001) konnte allerdings eine putative PH-ähnliche Domäne
errechnet werden, die zwischen den Aminosäuren 1269 und 1386 lokalisiert ist. Die zusätzlichen
554 Aminosäuren am N-Terminus weisen keine distinkten Proteindomänen auf (Abb. 16 A).
Ergebnisse
79
A
RhoGEF17
1254 1386
PH?
DH
1066
1269
1
1954
WD40
1737
2063 AS
WD40
2063AS
RhoGEF17 -554 (p164-FL)
554 AS
DH
F1
7
Rh
oG
E
Rh
oG
E
F1
7-
55
4
B
221 kDa
164 kDa
Abb. 16: Schematische Darstellung der Proteindomänenstruktur und Expression von
RhoGEF17 und RhoGEF17 -554. (A) Schematische Darstellung der Proteindomänenstruktur von
RhoGEF17 und RhoGEF17 -554. Abkürzungen: DH (Dbl-homologe Domäne), PH (Pleckstrinhomologe Domäne), WD40 (kurzes ~ 40 Aminosäuren langes „repeat“ Motiv, welches oft mit einem
Tryptophan-Asparaginsäure-Dipeptid endet). (B) Expressionsnachweis von überexprimiertem
RhoGEF17 und RhoGEF17 -554 in HEK-Zellen mittels eines anti-c-myc-Antikörpers im Immunoblot.
5.2.2 RhoGEF17 aktiviert spezifisch RhoA-C
Um zu überprüfen, ob das vollständige RhoGEF17-Protein, analog zu RhoGEF17 -554 eine Rhospezifische GEF-Aktivität aufweist (Rumenapp et al., 2002), wurde ein quantitativer SRE/SRFLuciferase-Assay durchgeführt. Wie in Abbildung 17 dargestellt, führte die Überexpression von
RhoGEF17 in HEK-Zellen zu einer verstärkten Luciferaseproduktion im Vergleich zur Kontrolle.
Diese lies sich durch Koexpression der RhoA-C-inhibierenden C3-ADP-Ribosyltransferase (C3T)
aus Clostridium botulinum komplett hemmen. Bei Überexpression von Wildtyp RhoA-C kam es
ebenfalls zu einer SRF-Aktivierung. Die Koexpression von RhoA-C mit RhoGEF17 führte zu einer
synergistischen SRF-Aktivierung im Vergleich zu der jeweiligen GTPase alleine, wobei im
Unterschied zu RhoGEF10 kein Spezifitätsunterschied zwischen der Aktivierung von RhoA-C
erkennbar war. Diese synergistische Aktivierung von RhoA-C mit RhoGEF17 ließ sich ebenfalls
durch C3T unterdrücken. In Übereinstimmung mit den Daten, die für RhoGEF17 -554 von
Rümenapp und Mitarbeitern beschrieben worden waren (Rumenapp et al., 2002), konnte auch für
das vollständige RhoGEF17-Protein keine Aktivierung von Rac1 und Cdc42 nachgewiesen
werden.
80
Basal
RhoGEF17
RhoGEF17 und C3T
30
20
10
1
42
Cd
c
Ra
c
Rh
oC
Rh
oB
Rh
o
Ko
ntr
o
A
0
ll e
relative Luciferaseprouktion
Ergebnisse
Abb. 17: RhoGEF17 aktiviert spezifisch RhoA-C. HEK-Zellen wurden mit 43 ng Reporterplasmid
pSRE.L und 7 ng Kontroll-Plasmid pRL-TK zusammen mit jeweils 100 ng Plasmid-DNA für RhoGEF17
sowie entsprechend 25 ng Plasmid-DNA für RhoA und mit 50 ng Plasmid-DNA für RhoB, RhoC, Rac1
und Cdc42 sowie 50 ng Plasmid-DNA für C3T bzw. bis zu 200 ng Leervektor kotransfiziert. Die
Aktivität der Photinus-Luciferase wurde gegen die Aktivität der Renilla-Luciferase normalisiert. Die
Werte sind Mittelwerte (n=5) ± SEM, ausgedrückt als Vielfaches der Luciferase-Bildung von Kontrolltransfizierten Zellen.
5.2.3 Einfluss verschiedener Signalmediatoren auf die Regulation von RhoGEF17
Um die Signalkaskade, in die RhoGEF17 involviert ist, zu ermitteln, wurden in einem SRE/SRFLuciferase-Assay charakteristische Signalmediatoren verschiedener Signalwege mit RhoGEF17
in HEK-Zellen koexprimiert bzw. die Zellen mit verschiedenen Wachstumsfaktoren bzw.
membrangängigen second-messenger-Analoga stimuliert. Stellvertretend für den MAPK
(Mitogen-aktivierte Proteinkinase)-Signalweg wurden Raf sowie MEKK-1 und für den JNK (c-JunNH2-terminale Proteinkinase)-Signalweg das Gerüstprotein JSAP-1 (JNK/SAPK-assoziiertes
Protein) verwendet. Außerdem wurden verschiedene Untereinheiten der heterotrimeren GProteine, wie Gα12 und Gαq sowie Gβγ ausgewählt. Weiterhin wurden RhoGEF17überexprimierende Zellen mit verschiedenen Wachstumsfaktoren (IGF, PDGF und EGF) bzw. 10
% FCS behandelt, sowie die mögliche Beteiligung der cGKI-α bzw. PKA untersucht. Zum
Nachweis einer potentiellen Beteiligung der PKA, wurde der Einfluss des membrangängigen
cAMP-Analogon 8-Bromo-cAMP bzw. des Adenylylzyklase-Aktivators Forskolin in Kombination
mit dem Phosphodiesterase Inhibitor IBMX auf die RhoGEF17 induzierte SRF-Aktivierung
ermittelt. Eine mögliche regulatorische Funktion der cGKI-α wurde mittels Koexpression von
RhoGEF17 und der Kinase und anschließender Stimulation mit dem membrangängigen cGMPAnalogon 8-Bromo-cGMP untersucht. Hierbei zeigte sich, dass ausschließlich die Kotransfektion
von RhoGEF17 mit cGKI-α bei gleichzeitiger Stimulation mit dem membrangängigen cGMP-
Ergebnisse
81
Analogon 8-Bromo-cGMP eine synergistische Verstärkung der SRF-Aktivierung um ca. das 7-
10.0
Basal
RhoGEF17
RhoGEF17 + 24h 10 %FCS
RhoGEF17 + Forskolin + IBMX
7.5
5.0
2.5
MP
cG
K/
cG
cA
MP
γ
Gβ
q
Gα
12
EG
F
Ra
f
ME
KK
-1
JS
AP
-1
Gα
PD
GF
IG
F
0.0
Ko
ntr
oll
e
relative Luciferaseproduktion
fache zu induzieren vermochte (Abb. 18).
Abb. 18: Regulation von RhoGEF17 durch cGMP/cGKI-α. HEK-Zellen wurden mit 43 ng
Reporterplasmid pSRE.L und 7 ng Kontroll-Plasmid pRL-TK sowie 100 ng Plasmid-DNA für
RhoGEF17 bzw. 100 ng Plasmid-DNA für Raf, MEKK-1, JSAP-1 sowie 50 ng Plasmid-DNA für Gα12,
Gαq, Gβγ und cGKI-α bzw. bis zu 200 ng Leervektor kotransfiziert. Die Zellen wurden entsprechend
nach 24 h für 24 h mit 10 ng/mL PDGF, 5 ng/mL EGF, 5 ng/mL IGF bzw. für 24 h mit 10 % FCS, 1 mM
8-Bromo-cGMP, 1 mM 8-Bromo-cAMP sowie 24 h mit 20 µM Forskolin plus 30 Minuten mit 1 µM
IBMX behandelt. Die Werte sind Mittelwerte (n=6) ± SEM, ausgedrückt als Vielfaches der LuciferaseBildung von Kontrollvektor-transfizierten, unstimulierten Zellen.
5.2.4 Aktivierung von RhoGEF17 durch cGMP/cGKI-α
Um auszuschließen, dass die beobachtete Aktivierung des SRFs durch RhoGEF17 und cGKI-α
auf einem unspezifischen Effekt des 8-Bromo-cGMPs beruht, wurde ein zweites cGMP-Analogon
(8-pCPT-cGMP) parallel verwendet. Im Gegensatz zu 8-Bromo-cGMP stellt 8-pCPT-cGMP einen
spezifischeren cGK-Agonisten dar und weist gegenüber Phosphodiesterasen eine größere
Stabilität auf. Daher konnte es im Vergleich zu 8-Bromo-cGMP in einer geringeren Konzentration
verwendet werden. Wie in Abbildung 19 A zu erkennen ist, führte die Stimulation der mit
RhoGEF17 und cGKI-α transfizierten Zellen mit 8-pCPT-cGMP zu einer vergleichbaren
Aktivierung des SRFs wie 8-Bromo-cGMP. Da es sich bei dem SRE/SRF-Luciferase-Assay
jedoch um eine Methode handelt, die nur indirekt Rho-Aktivierung nachweist, wurde im
Folgenden die RhoA-Aktivierung direkt mittels Pulldown-Experimenten untersucht. Hier zeigte
sich, dass die Überexpression von RhoGEF17 in Verbindung mit der cGKI-α nach Stimulation mit
8-pCPT-cGMP (zur Vereinfachung im Folgenden als cGMP abgekürzt) zu einer deutlichen
Zunahme des Anteils GTP-gebundenen RhoAs führte. Wohingegen die Überexpression der
katalytisch inaktiven RhoGEF17-ΔDH-Mutante weder allein noch in Anwesenheit von cGKI-α und
Ergebnisse
82
cGMP eine RhoA-Aktivierung zu induzieren vermochte (Abb. 19 B). Vergleichbar wie im
SRE/SRF-Luciferase-Assay zeigte auch im Pulldown-Experiment die Behandlung der Zellen mit
dem membrangängigen cAMP-Analogon 8-Bromo-cAMP keinen Einfluss auf die RhoAAktivierung durch RhoGEF17 (Abb. 19 A, C).
A
relative
Luciferaseproduktion
15
Basal
8-Bromo-cGMP+cGK
8-pCPT-cGMP+cGK
8-Bromo-cAMP
10
5
ho
G
EF
17
B
Ko
nt
ro
lle
cG
MP
/c
GK
Rh
oG
EF
17
Rh
oG
EF
17
Rh
+c
oG
GM
EF
P/
cG
17
Rh
-Δ
K
DH
oG
EF
17
-Δ
DH
+c
GM
P
/c G
K
R
K
on
t
ro
lle
0
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
Rh
oG
E
Rh
oG
EF
17
cA
MP
Ko
nt
ro
lle
C
83
F1
7+
cA
MP
Ergebnisse
RhoA-GTP
RhoA/Gesamt
anti-c-myc
Abb. 19: Regulation der RhoA-Aktivierung durch RhoGEF17 und cGMP/cGKI-α. (A) HEK-Zellen
wurden mit 43 ng Reporterplasmid pSRE.L und 7 ng Kontroll-Plasmid pRL-TK sowie 150 ng PlasmidDNA für RhoGEF17 und 50 ng Plasmid-DNA für cGKI-α bzw. bis zu 200 ng Kontrollvektor
kotransfiziert und nach 24 h mit 1 mM 8-Bromo-cAMP bzw. 1 mM 8-Bromo-cGMP und 100 µM 8pCPT-cGMP für 24 h stimuliert. Die Werte sind Mittelwerte (n=6) ± SEM, ausgedrückt als Vielfaches
der Luciferase-Bildung von Kontrollvektor-transfizierten, unstimulierten Zellen. (B), (C) HEK-Zellen
wurden entsprechend mit 750 ng Plasmid-DNA für RhoGEF17-ΔDH bzw. RhoGEF17 und 750 ng
cGKI-α bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 46 h für 2 h mit 1 mM 8-Bromo-cGMP
bzw. 1 mM 8-Bromo-cAMP stimuliert. Zur Bestimmung der Gesamt-RhoA-Menge in den Lysaten
wurden parallel 40 µg der Zelllysate analysiert. Die Expression von RhoGEF17 bzw. RhoGEF17-ΔDH
und der cGKI-α wurde mit den entsprechenden Antikörpern überprüft.
Um die durch RhoGEF17 und cGKI-α induzierte RhoA-Aktivierung näher zu charakterisieren,
wurden transfizierte HEK-Zellen unterschiedlich lange mit 8-Bromo-cGMP behandelt und
anschließend ein Pulldown-Assay durchgeführt. Wie aus Abbildung 20 A ersichtlich, wurde zum
einen die maximale Aktivierung von RhoA durch RhoGEF17 und 8-Bromo-cGMP/cGKI-α bei
Stimulationszeiten von größer als einer Stunde erreicht. Zum anderen wurde im SRE/SRFLuciferase-Assay
eine
konzentrationsabhängige
Steigerung
der
8-Bromo-cGMP/cGKI-α-
abhängigen SRF-Aktivierung in Gegenwart von RhoGEF17 nachgewiesen (Abb. 20 B). Die
relative Zunahme der SRF-Aktivierung betrug bei Stimulation der Zellen mit 1 mM 8-BromocGMP 700 % im Vergleich zur unstimulierten Kontrolle.
84
Rh
Ko
n
tr o
lle
A
oG
EF
17
cG
MP
/cG
K
Rh
3h
oG
EF
17
cG
+c
MP
GM
/cG
P/
cG
K
Rh
1h
K
oG
3h
EF
17
cG
+c
MP
GM
/c G
P/
cG
K
Rh
3
K
oG
0m
1h
EF
in
17
+c
GM
P/
cG
K
30
m
in
Ergebnisse
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
B
RhoGEF17
RhoGEF17+cGK
relative Luciferaseproduktion
8
6
4
2
0
0
0.01
0.03
0.10
1.0
[mM] 8-Bromo-cGMP
Abb. 20: Zeit- und Konzentrationsabhängigkeit der Aktivierung von RhoGEF17 durch
cGMP/cGKI-α. (A) HEK-Zellen wurden mit 750 ng Plasmid-DNA für RhoGEF17 sowie 750 ng
Plasmid-DNA für cGKI-α bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 45 h für 30 min, 1h, 2 h
bzw. 3 h mit 1 mM 8-Bromo-cGMP stimuliert. Zur Bestimmung der Gesamt-RhoA-Menge in den
Lysaten wurden parallel 40 µg des Zelllysats analysiert. Die Expression von RhoGEF17 und der cGKIα wurde mit den entsprechenden Antikörpern überprüft. (B) HEK-Zellen wurden mit 43 ng
Reporterplasmid pSRE.L und 7 ng Kontroll-Plasmid pRL-TK sowie mit 150 ng Plasmid-DNA für
RhoGEF17, 50 ng Plasmid-DNA für cGKI-α und bis zu 50 ng Leervektor kotransfiziert und nach 24 h
für 24 h mit 0,01 mM; 0,03 mM; 0,1 mM bzw. 1 mM 8-Bromo-cGMP stimuliert. Die Werte sind
Mittelwerte (n=4) ± SEM, ausgedrückt als Vielfaches der Luciferase-Bildung von Kontrollvektortransfizierten, unstimulierten Zellen.
Ergebnisse
85
5.2.5 RhoGEF17 wird durch cGKI-α phosphoryliert und interagiert mit cGKI-α
Im Folgenden sollte untersucht werden, ob die cGMP/cGKI-α-abhängige Aktivierung von
RhoGEF17 auf einer direkten Interaktion beider Proteine beruht und RhoGEF17 ein Substrat für
die cGKI-α darstellt. Hierfür wurde eine Koimmunopräzipitation von wie folgt transfizierten Zellen
durchgeführt: Kontrollvektor; cGKI-α in Anwesenheit von cGMP; RhoGEF17; RhoGEF17 und
cGKI-α in Anwesenheit von cGMP; RhoGEF17 in Anwesenheit von 8-Bromo-cAMP und
Kontrollvektor-transfizierte Zellen stimuliert mit 8-Bromo-cAMP (Abb. 21 A). Mittels einer anti-cmyc-Agarose wurde das überexprimierte RhoGEF17 präzipitiert und auf eine mögliche
Assoziation mit der cGKI-α untersucht. Weiterhin wurde mit Hilfe eines anti-PhosphoSerin/Threonin-spezifischen Antikörpers, der das folgende Konsensusmotiv RXXT* oder RRXS*
(X steht für eine beliebige Aminosäure, * steht für die phosphorylierte Aminosäure) erkennt, der
Phosphorylierungszustand von RhoGEF17 untersucht. Dieses Experiment zeigte eindeutig, dass
RhoGEF17 in Gegenwart von cGKI-α nach Stimulation mit cGMP im phosphorylierten Zustand
vorliegt und mit der Kinase eine direkte Interaktion eingeht. Die cAMP-abhängige Aktivierung der
PKA blieb auch hier ohne Effekt. Als zusätzliche Kontrolle diente der cGKI-α Kinase-Inhibitor KT5823 (Abb. 21 B). Dieser kompetitive Inhibitor unterdrückte vollständig die cGKI-α bedingte
A
cA
MP
Rh
oG
EF
17
Rh
+c
oG
AM
EF
P
Rh
17
+c
oG
GM
EF
P/
17
cG
cG
MP
K
/cG
K
Ko
nt
ro
lle
Phosphorylierung von RhoGEF17 sowie auch die Assoziation beider Proteine.
anti-RhoGEF17
IP
anti-c-mycAgarose
anti-Phospho RXXS*/T*
anti-cGKI-α
anti-c-myc
Lysate
anti-cGKI-α
Rh
oG
E
F1
7
B
86
Rh
oG
EF
17
+c
GM
Rh
oG
P/
cG
EF
K+
17
KT
+
c
Rh
GM
oG
P/
EF
cG
17
K
cG
+
MP
cG
K
/cG
K
Ergebnisse
anti-RhoGEF17
IP
anti-Phospho RXXS*/T*
anti-c-mycAgarose
anti-cGKI-α
anti-c-myc
Lysate
anti-cGKI-α
Abb. 21: cGKI-α spezifische Phosphorylierung von RhoGEF17 und Interaktion von cGKI-α mit
RhoGEF17. (A), (B) HEK-Zellen wurden entsprechend mit 3 µg RhoGEF17-Plasmid sowie 3 µg
Plasmid-DNA für cGKI-α bzw. bis zu 5 µg Leervektor kotransfiziert und nach 46 h für 2 h
entsprechend mit 100 µM 8-pCPT-cGMP, 1 mM 8-Bromo-cAMP bzw. 100 µM 8-pCPT-cGMP plus 1
µM KT-5823 für 24 h behandelt. Die Zellen wurden anschließend mit 1 mL IP-Puffer abgeschabt und
lysiert. 2 mg der Zelllysate wurden mit 8 µg anti-c-myc-Antikörper und 50 µL Protein A-Sepharose bei
4°C über Kopf schüttelnd für 4 h inkubiert, anschließend präzipitiert und im Immunoblot untersucht.
Die Expression von RhoGEF17 und der cGKI-α wurde mit den entsprechenden Antikörpern in den
Lysaten überprüft.
Die
Ergebnisse
der
bisher
durchgeführten
Experimente
zum
übergeordneten
Aktivierungsmechanismus von RhoGEF17 lassen den Schluss zu, dass RhoGEF17 spezifisch
durch einen cGMP/cGKI-α- und nicht durch einen cAMP/PKA-abhängigen Signalweg aktivierbar
ist und dies zu einer kooperativen RhoA-Aktivierung führt. Des Weiteren konnte durch Ko- bzw.
Immunopräzipitation von RhoGEF17 eindeutig nachgewiesen werden, dass RhoGEF17
cGMP/cGKI-α-abhängig phosphoryliert wird und mit der cGKI-α eine direkte Interaktion eingeht.
Um
diese
Ergebnisse
weiter
zu
untermauern
sollte
im
Folgenden
der
detaillierte
Phosphorylierungsmechanismus inklusive der entsprechenden Phosphorylierungsstellen von
RhoGEF17 näher untersucht werden.
Ergebnisse
87
5.2.6 Putative cGK- bzw. PKA-Konsensusmotive des Proteins RhoGEF17
Die bioinformatische Analyse der humanen RhoGEF17-Aminosäuresequenz mit dem Programm
ScanProsite ergab, dass der Guaninnukleotid-Austauschfaktor 9 putative PKA- bzw. cGKspezifische Phosphorylierungsstellen (Abb. 22) besitzt, welche ebenfalls in der Maus und in der
Ratte vorhanden sind und somit evolutionär konserviert zu sein scheinen.
Das etwas stringentere Analyseprogramm „Motif Scanner“ berechnete 4 der 9 Serine an den
Positionen 43, 142, 1331 und 1765 als hochwahrscheinliche Phosphorylierungsstellen.
RhoGEF17
1
DH
142
43
59
WD40
2063 AS
827 922
1324 1330/31 1716/17 1765
Abb. 22: Schematische Darstellung der putativen cGMP- bzw. cAMP-abhängigen ProteinkinasePhosphorylierungsstellen im RhoGEF17 (ScanProsite).
5.2.7 Bedeutung des N-Terminus von RhoGEF17 für dessen Aktivierbarkeit durch
cGMP/cGKI-α
Um die Bedeutung der N-terminal gelegenen, putativen Phosphorylierungsstellen für die
Aktivierbarkeit von RhoGEF17 zu untersuchen, wurden zunächst die in Abbildung 23 A
schematisch dargestellten, trunkierten Mutanten generiert, in HEK-Zellen mit der cGKI-α
koexprimiert und die RhoA- bzw. SRF-Aktivierung untersucht. Wie in Abbildung 23 B, C und D
eindeutig zu erkennen ist, führte bereits die Deletion der ersten 55 Aminosäuren und somit des
ersten Serins an Position 43 zum Verlust der cGMP/cGKI-α/RhoGEF17-abhängigen RhoAAktivierung und der korrespondierenden SRF-Aktivierung. Die weitere sukzessive Verkürzung
hatte keinen zusätzlichen Einfluss auf die cGMP/cGKI-α-mediierte RhoGEF17-Aktivität. Erst die
Deletion von 1003 Aminosäuren und somit nahezu der gesamten N-terminalen Sequenz vor der
DH-Domäne wirkte sich wieder auf die Stimulierbarkeit durch cGMP/cGKI-α aus. Allerdings
zeigte diese Mutante eine gegenläufige Regulation im Vergleich zum Gesamtprotein: Zum einen
war, in Übereinstimmung mit der von Rümenapp und Mitarbeitern publizierten autoinhibitorischen
Regulation von p164-RhoGEF (Rumenapp et al., 2002), die basale Aktivität dieser Mutante
deutlich höher als die des Volllängenproteins, zum anderen bewirkte die Koexpression von cGKIα nach Stimulation mit cGMP keine Aktivierung, sondern eine Inhibition der RhoA- und der SRFAktivierung um ca. 30% (Abb. 23 E, F). Dieser Befund deutete auf einen komplexen
Aktivierungsmechanismus hin, welcher nicht ausschließlich auf der Phosphorylierung des Serins
43 beruhen konnte. Aus diesem Grund wurden im nächsten Schritt die einzelnen in Frage
Ergebnisse
88
kommenden Serine der Deletionsmutante RhoGEF17-ΔN mittels gezielter Punktmutagenese
durch Phosphorylierungs-resistente Alanine ausgetauscht und die entsprechenden Auswirkungen
auf die RhoA-Aktivierung untersucht.
A
RhoGEF17
1
DH
2063 AS
827 922
142
1324 1330/31 1716/17 1765
59
43
WD40
RhoGEF17 -55
55 AS
DH
WD40
2063 AS
DH
WD40
2063 AS
DH
WD40
2063 AS
WD40
2063 AS
RhoGEF17 -109
109 AS
RhoGEF17 -554
554 AS
RhoGEF17-ΔN
1003 AS
B
Basal
cGMP+cGK
3
2
1
EF
17
R
ho
G
EF
17
-5
R
5
ho
G
EF
17
-1
09
R
ho
G
EF
17
-5
54
0
R
ho
G
relative Änderung
4
DH
lle
D
cG
MP
/cG
K
Rh
oG
EF
17
Rh
-5
oG
54
EF
17
Rh
-5
54
oG
+c
EF
GM
17
Rh
P/
oG
cG
EF
K
17
+c
GM
P/
cG
K
Ko
nt
ro
MP
/c G
K
lle
C
Rh
oG
EF
17
-5
Rh
5
oG
EF
17
-5
5+
Rh
cG
oG
MP
EF
/cG
17
-1
K
Rh
09
oG
EF
17
-1
09
Rh
+c
oG
GM
EF
P/
17
cG
K
Rh
oG
EF
17
+c
GM
P/
cG
K
cG
Ko
nt
ro
Ergebnisse
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
89
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
90
F
2.5
0
Ko
ntr
oll
anti-cGKI-α
5.0
N
anti-c-myc
7.5
Rh
oG
EF1
7-Δ
RhoA/Gesamt
10.0
Rh
oG
EF1
7
RhoA-GTP
Basal
cGMP+cGK
e
relative Luciferaseproduktion
E
Ko
n
cG trol
M le
Rh P/c
oG GK
Rh EF
oG 17EF ΔN
17
-Δ
N+
cG
MP
/
cG
K
Ergebnisse
Abb. 23: Einfluss der sukzessiven, N-terminalen Verkürzung von RhoGEF17 auf seine
Aktivierbarkeit durch cGMP/cGKI-α. (A) Schematische Darstellung der trunkierten RhoGEF17Mutanten. (B), (F) HEK-Zellen wurden mit 43 ng Reporterplasmid pSRE.L und 7 ng Kontroll-Plasmid
pRL-TK sowie 150 ng Plasmid-DNA für das entsprechende RhoGEF und 50 ng Plasmid-DNA für
cGKI-α bzw. bis zu 200 ng Leervektor kotransfiziert und nach 24 h für 24 h mit 1 mM 8-Bromo-cGMP
behandelt. Die Werte sind Mittelwerte (n=8) ± SEM, ausgedrückt als Vielfaches der Luciferase-Bildung
von Kontrollvektor-transfizierten, unstimulierten Zellen. (C), (D), (E) HEK-Zellen wurden mit 750 ng
Plasmid-DNA des entsprechenden RhoGEFs sowie 750 ng Plasmid-DNA für cGKI-α bzw. bis zu 1,5
µg Leervektor kotransfiziert und nach 46 h für 2 h mit 1 mM 8-Bromo-cGMP stimuliert. Zur
Bestimmung der Gesamt-RhoA-Menge in den Lysaten wurden parallel 40 µg des Zelllysats analysiert.
Die Expression der jeweiligen RhoGEFs und der cGKI-α wurde mit den entsprechenden Antikörpern
überprüft.
5.2.8 Untersuchung der inhibitorisch wirkenden cGKI-α-Phosphorylierungsstelle im
RhoGEF17-ΔN
RhoGEF17-ΔN weist noch 4 potentielle, cGK/PKA-spezifische Phosphorylierungsstellen auf,
welche im Folgenden durch Punktmutation einzeln entfernt wurden. Wider Erwarten führte dies
bei der RhoGEF17-ΔN-SS1330/1331AA-Mutante bei gleicher Expressionsstärke zu einem
Anstieg der basalen Aktivität im Vergleich zu RhoGEF17-ΔN (Abb. 24 A). Dies legte die
Vermutung nahe, dass diese Phosphorylierungsstelle im Wildtyp-Protein zumindest teilweise
phosphoryliert vorliegt und dies zur cGKI-α vermittelten Inhibition der RhoGEF17-ΔN Aktivität
beiträgt.
Da
bei
diesem
Experiment
keine
cGKI-α
koexprimiert
wurde,
wäre
eine
Ergebnisse
91
Grundvoraussetzung für diese Annahme die endogene Expression der cGKI-α in HEK-Zellen.
Um dies zu verifizieren, wurde ein Immunoblot von HEK-Zelllysaten mit einem anti-cGKIspezifischen Antikörper durchgeführt, welcher einen eindeutig positiven Nachweis der endogenen
Expression der Kinase erbrachte. Als Negativkontrolle dienten Lysate von chinesischen
Hamsterovarien (CHO)-Zellen, die nachweislich cGKI nicht exprimieren (Ruth et al., 1993) (Abb.
24 B). Eine weitere Bestätigung der aufgestellten Hypothese lieferten Experimente mit den
gänzlich unterschiedlich wirkenden cGK-Inhibitoren KT-5823 und Rp-8-pCPT-cGMP: Sowohl der
ATP-Kompetitor KT-5823, als auch das allosterisch inhibierende Rp-8-pCPT-cGMP vermochten
die basale Aktivität von RhoGEF17-ΔN zu stimulieren, hatten aber auf die Aktivität der
RhoGEF17-ΔN-SS1330/1331AA-Mutante keinen Einfluss mehr (Abb. 24 C-E). Weiterhin zeigte
die Koexpression der cGKI-α und deren Stimulation mit cGMP keine Wirkung mehr auf die
Aktivität dieser Mutante. In einem Parallelansatz wurde der PKA-Inhibitor H89 verwendet, um wie
auch in vorhergehenden Untersuchungen eine Beteiligung der cAMP-regulierten Kinase
auszuschließen (Abb. 24 C, D). Aus diesen Untersuchungen lässt sich also ableiten, dass die
basale Phosphorylierung des Kinasemotivs an Position 1330/1331 einen inhibierenden Einfluss
auf die Grundaktivität, zumindest der N-terminal trunkierten RhoGEF17-ΔN-Mutante, ausübt. Um
nun zu eruieren, ob diese Phosphorylierung für die Regulierbarkeit des Volllängenproteins
ebenfalls benötigt wird, wurde ein entsprechendes RhoGEF17-SS1330/1331AA-Konstrukt
generiert.
5
4
3
2
1
0
CH
O
HE
K
6
-2
93
B
R Rh
R Ko
ho
ho
nt
G oG
R EF EF GE rol
ho 1
le
F
1
G 7-Δ 7-Δ 17EF N N
Δ
N
17 S
S
1
S
R ΔN 13 32
ho
4
3
G SS 0/3 A
EF 17 1
17 16 AA
-Δ /17
N
A
S1 A
76
5A
relative
Luciferaseproduktion
A
anti-cGKI-α
Ergebnisse
92
D
2.0
1.5
1.0
0.5
0
1.00
0.75
0.50
0.25
0.00
-5
82
3
+
1.25
R
ho
G
EF
17
-Δ
N
+
S
8pC S1
PT 330
- c /31
G
M AA
P+
+
R
+ cG
p
-8
K
K
T-p
58
C
PT
2
-c 3
G
M
P
+
H
89
relative Änderung
2.5
R
8- ho
pC G
PT EF1
-c
7G
Δ
N
M
P+
+
c
R
p- + K GK
8T
pC - 58
PT 23
-c
G
M
P
+
H
89
relative Änderung
C
Ko
nt
Rh rol
o le
Rh G E F
oG 17
EF -ΔN
17
-Δ
N
+K
T
E
RhoA-GTP
RhoA/Gesamt
anti-c-myc
Abb. 24: Untersuchung zur Aktivierbarkeit verschiedener phosphoresistenter RhoGEF17-ΔNMutanten. (A) HEK-Zellen wurden mit 43 ng Reporterplasmid pSRE.L, 7 ng Kontroll-Plasmid pRL-TK
sowie 150 ng Plasmid-DNA für das entsprechende RhoGEF (die entsprechenden Mutagenese-Primer
sind in 4.1.7 aufgelistet) und bis zu 200 ng Leervektor kotransfiziert. Der Nachweis der
entsprechenden überexprimierten RhoGEFs erfolgte mittels eines anti-c-myc-Antikörpers im
Immunoblot. Die Werte sind Mittelwerte (n=8) ± SEM, ausgedrückt als Vielfaches der LuciferaseBildung von Kontrollvektor-transfizierten, unstimulierten Zellen. (B) Nachweis von cGKI in
untransfizierten HEK-Zelllysaten mittels eines spezifischen anti-cGKI-Antikörpers im Immunoblot.
CHO-Zelllysate dienten als Negativkontrolle. (C), (D) HEK-Zellen wurden entsprechend mit 43 ng
Reporterplasmid pSRE.L, 7 ng Kontroll-Plasmid pRL-TK, 150 ng der RhoGEF-kodierenden Plasmide,
50 ng cGKI-α-Plasmid und bis zu 200 ng Leervektor transfiziert. Die Behandlung mit 1 µM KT-5823,
100 µM Rp-8-pCPT-cGMP bzw. 1 µM H-89 erfolgte für 48 h bzw. mit 100 µM 8-pCPT-cGMP für 24 h.
(E) HEK-Zellen wurden mit 1,5 µg RhoGEF17-ΔN-Plasmid bzw. Leervektor transfiziert und
entsprechend mit 1 µM KT-5823 für 24 h behandelt. Zur Bestimmung der Gesamt-RhoA-Menge in den
Lysaten wurden parallel 40 µg des Zelllysats analysiert. Die Expression des RhoGEFs wurde mit dem
entsprechenden Antikörper überprüft.
Ergebnisse
93
5.2.9 Einfluss der cGKI-α-Phosphorylierungsstelle SS1330/1331 auf die Aktivierung des
Volllängenproteins RhoGEF17
Nach Rückklonierung des entsprechenden Mutations-tragenden Abschnitts in die VolllängencDNA-Sequenz,
wurde
zunächst
der
Einfluss
dieser
neu
generierten
RhoGEF17-
SS1330/1331AA-Mutante auf die SRF-Aktivierung untersucht (Abb. 25 A). Im direkten Vergleich
mit Wildtyp-RhoGEF17 zeigte sich, dass auch hier die Mutation, vergleichbar wie bei der Nterminal
trunkierten
Variante,
zu
einer
Zunahme
von
dessen
Basalaktivität
führte.
Interessanterweise war auch bei dieser Mutante kein Ansprechen auf cGMP/cGKI-α mehr
detektierbar, trotz des noch vorhandenen, zur Stimulation benötigten Serins 43. Im Gegensatz
dazu erwies sich eine äquivalente phosphomimetische RhoGEF17-S1331E-Mutante nach wie vor
als vollkommen sensitiv gegenüber der cGKI-α. Dieser Befund konnte auch im PulldownExperiment bestätigt werden (Abb. 25 B).
Basal
cGMP/cGK
10
7,5
5
2,5
31
13
-S
0 /3
Rh
oG
EF
17
33
S1
-S
17
EF
oG
E
A
1A
17
EF
oG
Rh
Rh
ntr
oll
e
0
Ko
relative Luciferaseprouktion
A
Ko
nt
B
94
ro
lle
cG
MP
/c G
Rh
K
oG
EF
Rh
1
oG 7
EF
1
Rh
oG 7+c
GM
R h E F1
P/
cG
oG 7 -S
S1
K
EF
33
Rh
17
0
-S
oG
S1 /31A
EF
33
A
17
Rh
S1 0/31
oG
AA
33
EF
1E
+c
17
GM
-S
13
P/
cG
31
E+
K
cG
MP
/ cG
K
Ergebnisse
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
Abb.
25:
Untersuchungen
zur
Aktivierbarkeit
der
phosphomimetischen
bzw.
phosphoresistenten RhoGEF17-SS1330/1331-Varianten. (A) HEK-Zellen wurden mit 43 ng
Reporterplasmid pSRE.L, 7 ng Kontroll-Plasmid pRL-TK, 150 ng des entsprechenden RhoGEFkodierenden Plasmids, 50 ng cGKI-α-Plasmid und bis zu 200 ng Kontrollvektor kotransfiziert und nach
24 h für 24 h mit 100 µM 8-pCPT-cGMP stimuliert. Die Werte sind Mittelwerte (n=6) ± SEM,
ausgedrückt als Vielfaches der Luciferase-Bildung von Kontrollvektor-transfizierten, unstimulierten
Zellen. (B) HEK-Zellen wurden mit 750 ng Plasmid-DNA für das entsprechende RhoGEF und 750 ng
cGKI-α-Vektor bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 46 h für 2 h mit 100 µM 8-pCPTcGMP behandelt. Zur Bestimmung der Gesamt-RhoA-Menge in den Lysaten wurden parallel 40 µg
des Zelllysats analysiert. Die Expression der jeweiligen RhoGEFs und der cGKI-α wurde mit den
entsprechenden Antikörpern überprüft.
Zusammenfassend weisen die mittels Mutationsstudien erzielten Ergebnisse darauf hin, dass es
für die cGMP/cGKI-α induzierte RhoGEF17-Aktivierung zumindest der Phosphorylierung der
Serine 43 und 1331 bedarf, wobei die Phosphorylierung an Position 1331 obligate Voraussetzung
für die Phosphorylierung des Serins 43 und somit der Aktivierung von RhoGEF17 zu sein scheint.
Ergebnisse
95
5.2.10 Einfluss von RhoGEF17 auf die cGMP/cGKI-α vermittelte Hemmung der Seruminduzierten RhoA-Aktivierung
Die Mehrzahl der bis dato publizierten Erkenntnisse bezüglich der cGMP-abhängigen Regulation
der
RhoA-Aktivierung,
sowie
RhoA-mediierter
Signaltransduktionsprozesse
stehen
im
Widerspruch zu den bislang hier beschriebenen Ergebnissen. So wurde z. B. gezeigt, dass
cGMP die Serum-induzierte RhoA-Aktivierung in bovinen, glattmuskulären Zellen der Aorta
(BoASMC) zu inhibieren vermochte (Gudi et al., 2002). Um nun auszuschließen, dass die in
dieser Arbeit erhobenen Daten, beruhend auf Untersuchungen in HEK-Zellen, auf einer
grundsätzlich gegenläufigen und somit möglicherweise artifiziellen Regulation von RhoA durch
cGMP beruht, wurden diese Zellen zunächst entweder mit einem Kontrollplasmid oder dem cGKIα-Plasmid transfiziert und anschließend mit 10 % Serum stimuliert (Abb. 26). Wie schon bereits
von einer anderen Gruppe (Diviani et al., 2004) für HEK-Zellen gezeigt werden konnte, führte
auch in dieser Arbeit die Stimulation mit Serum zu einer RhoA-Aktivierung. Diese konnte
vergleichbar wie in BoASMCs durch Koapplikation von cGMP in cGKI-α überexprimierenden
Zellen inhibiert werden, während in Anwesenheit von RhoGEF17 auch in Serum-stimulierten
R
ho
G
EF
17
R
ho
G
EF
17
+S
er
R
ho
G
EF
17
R
ho
G
EF
1
K 7+S
on
tr eru
o
m
Se lle
ru
m
um
Se
r
K
on
tr
ol
le
um
Zellen nach wie vor eine cGMP/cGKI-α-vermittelte RhoA-Aktivierung zu beobachten war.
+cGK/cGMP
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
Abb. 26: Einfluss von RhoGEF17 auf die cGMP/cGKI-α vermittelte Hemmung der Seruminduzierten RhoA-Aktivierung. HEK-Zellen wurden entsprechend mit 750 ng Plasmid-DNA für
RhoGEF17 bzw. 750 ng Plasmid-DNA für cGKI-α bzw. bis zu 1,5 µg Leervektor kotransfiziert und für
48 h mit 0,5 %igem fötalem Kälberserum bzw. nach 24 h für 24 h mit 10 %igem nicht
hitzeinaktiviertem fötalem Kälberserum sowie nach 46 h für 2 h mit 100 µM 8-pCPT-cGMP stimuliert.
Zur Bestimmung der Gesamt-RhoA-Menge in den Lysaten wurden parallel 40 µg des Zelllysats
analysiert. Die Expression des RhoGEFs und der cGKI-α wurde mit den entsprechenden Antikörpern
überprüft.
Ergebnisse
96
5.2.11 Einfluss der Phosphorylierung von RhoA auf dessen Aktivierung durch RhoGEF17
und cGMP/cGKI-α
Auch die in dieser Arbeit beschriebene kooperative, durch cGKI-α/RhoGEF17-induzierte SRFAktivierung wirft im Hinblick auf die aktuelle Literatur kritische Fragen auf. So wurde mehrfach
beschrieben, dass RhoA selbst ein Zielmolekül der cGMP-abhängigen Phosphorylierung darstellt
und dies zu einer vermehrten Sequestrierung des RhoAs durch RhoGDI-Proteine führt (Lang et
al., 1996; Kwak & Uhlinger, 2000; Sawada et al., 2001; Forget et al., 2002; Ellerbroek et al., 2003;
Rolli-Derkinderen et al., 2005). Durch diesen Vorgang wird die RhoA-abhängige Aktivierung von
Effektoren, wie z. B. den Rho-Kinasen (ROCK) unterdrückt und somit entsprechende zelluläre
und physiologische Vorgänge inhibiert. Um nun herauszufinden, ob RhoGEF17 in der Lage ist
phosphoryliertes RhoA zu aktivieren und unabhängig vom Phosphorylierungsgrad RhoAEffektoren zu stimulieren, wurde die Aktivierbarkeit verschiedener RhoA-Mutanten untersucht.
Neben dem N-terminal 2 x c-myc-getaggten Wildtyp-RhoA, wurde die phosphomimetische RhoAS188E-, sowie die Phosphorylierungs-resistente RhoA-S188A-Mutante verwendet (Ellerbroek et
al., 2003). Wie aus Abbildung 27 A ersichtlich wird, konnte kein Unterschied in der RhoGEF17vermittelten Aktivierung der drei verschiedenen RhoA-Varianten nachgewiesen werden.
Endogenes RhoA wurde in diesen Zellen ebenfalls aktiviert. Überraschenderweise hatte die
zusätzliche Expression der cGKI-α plus Stimulation mit cGMP keinen Effekt mehr auf die
RhoGEF17-vermittelte Aktivierung des überexprimierten Wildtyp-RhoAs, aber noch immer auf die
Aktivierung von endogenem RhoA. Im Gegensatz dazu konnte eine deutliche Auswirkung des
Zusammenspiels von Kinase und RhoGEF auf das überexprimierte phosphomimetische RhoAS188E nachgewiesen werden. Die Analyse von endogenem RhoA und dem 2 x c-myc-getaggten
Wildtyp-RhoA in der zweidimensionalen Gelelektrophorese lieferte eine mögliche Erklärung für
diesen Befund (Abb. 27 B). So zeigte sich, dass endogenes RhoA (pI=5,83; mit Expasy
berechnet) wie bereits beschrieben (Cicha et al., 2004) in Gegenwart von cGKI-α und 8-pCPTcGMP phosphoryliert (pI=5,56 1x phosphoryliert; mit Expasy berechnet) und posttranslational
modifiziert (pI=5,3 bzw. 5,1) vorlag, wohingegen der 2 x c-myc-getaggte Wildtyp-RhoA (pI=5,11)
anscheinend weder phosphoryliert noch posttranslational modifiziert wurde. Dies würde
bedeuten, dass, zumindest in Anwesenheit der aktiven cGKI-α, RhoGEF17 bevorzugt
phosphoryliertes RhoA aktiviert. Es ist hingegen jedoch unklar, warum sich die Koexpression der
cGKI-α negativ auf die RhoGEF17-induzierte Stimulation der Phosphorylierungs-resistenten
RhoA-S188A-Mutante auswirkt.
Mit diesem experimentellen Ansatz konnte zwar gezeigt werden, dass RhoGEF17 in der Lage ist
RhoA unabhängig von seinem Phosphorylierungsstatus zu aktivieren, jedoch wurde damit nicht
geklärt, ob die beobachtete SRF-Aktivierung tatsächlich auf der Übertragung des Signals durch
das phosphorylierte RhoA beruht oder vielmehr von verbleibendem, nicht-phosphoryliertem RhoA
bewerkstelligt wird. Zur Klärung dieser Frage wurden HEK-Zellen sowohl mit den verschiedenen
RhoA-Varianten als auch mit RhoGEF17 transfiziert und deren Einfluss auf die transkriptionelle
Ergebnisse
97
Aktivierung des SRFs untersucht. Hierbei zeigte sich eindeutig, dass alle drei RhoA-Varianten in
der Lage sind SRF zu aktivieren und in Verbindung mit RhoGEF17 diese Aktivierung
Ko
ntr
cG olle
MP
Rh /cGK
oG
Rh EF1
7
oG
EF
17
+c
Ko
GM
ntr
P /c
o
lle
cG
GK
MP
/
Rh cGK
oG
Rh EF1
oG
7
EF
17
+c
GM
cG
P/c
MP
GK
/
Rh cGK
oG
EF
17
Rh
oG
EF
17
+c
GM
P/ c
GK
synergistisch gesteigert wurde (Abb. 27 C).
A
RhoA-S188A
RhoA-wt
RhoA-S188E
RhoA-GTP
2 x c-myc-RhoA-GTP
RhoA/Gesamt
2 x c-myc-RhoA/Gesamt
B
7
29 kDa
6
5
4
3
pI
2 x c-myc-RhoA
RhoA
Ergebnisse
98
C
relative Luciferaseproduktion
30
20
10
K
on
t
R
R h rol
ho oA le
R A- -w
ho S t
A- 188
S1 E
88
50 A
n
75 g
10 ng
0n
50 g
n
75 g
10 ng
0n
50 g
n
75 g
10 ng
0n
50 g
n
75 g
10 ng
0n
g
0
RhoA
wt
RhoA
S188A
RhoGEF17
RhoA
S188E
Abb. 27: Einfluss der RhoA-Phosphorylierung auf dessen Aktivierbarkeit durch RhoGEF17 und
cGMP/cGKI-α. (A) HEK-Zellen wurden mit 600 ng Plasmid-DNA für RhoGEF17, 600 ng cGKI-αVektor und mit 300 ng Plasmid-DNA der entsprechenden RhoA-Variante (die entsprechenden
Mutagenese-Primer sind in 4.1.7 aufgelistet) bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 46
h für 2 h mit 100 µM 8-pCPT-cGMP stimuliert. Zur Bestimmung der Gesamt-RhoA-Menge von
endogenem und der entsprechenden 2 x c-myc-getaggten RhoA-Mutanten in den Lysaten wurden
parallel 40 µg des Zelllysats analysiert. (B) HEK-Zellen wurden mit 10 µg Plasmid-DNA für cGKI-α und
mit 10 µg Plasmid-DNA für Wildtyp-RhoA kotransfiziert und nach 46 h für 2 h mit 100 µM 8-pCPTcGMP stimuliert, anschließend wurden die Zellen mit 500 µL Lysepuffer abgeschabt und die Zelllysate
bei -20°C ü. N. eingefroren. Für die IEF wurde ein 7 cm IEF-Streifen (Immobiline DryStrip, pH 3-10,
linear, Fa. GE Healthcare) mit 100 µL Proteinlysat beladen und in einer Nasskammer ü. N.
aufgequollen. Die Fokussierung erfolgte in einem Ettan IPGphor (GE Healthcare) nach dem in Tabelle
7 (siehe 4.4.9, Seite 57) aufgeführten Programm. Nachweis von endogenem und 2 x c-mycgetaggtem Wildtyp-RhoA nach einer 15 %igen SDS-PAGE im Immunoblot mittels eines anti-RhoAAntikörpers. (C) HEK-Zellen wurden mit 43 ng Reporterplasmid pSRE.L und 7 ng Kontroll-Plasmid
pRL-TK sowie entsprechend mit 25 ng Plasmid-DNA für Wildtyp-RhoA, 50 ng Plasmid-DNA für RhoAS188A und 50 ng Plasmid-DNA für RhoA-S188E sowie entsprechend mit ansteigenden
Konzentrationen 50 ng, 75 ng und 100 ng RhoGEF17-Plasmid bzw. bis zu 200 ng Leervektor
kotransfiziert und für 48 h inkubiert. Die Werte sind Mittelwerte (n=8) ± SEM, ausgedrückt als
Vielfaches der Luciferase-Bildung von Kontrollvektor-transfizierten Zellen.
Ergebnisse
99
5.2.12 Regulation von RhoGEF17 durch einen positiven Rückkopplungsmechanismus über
ROCK
Die Serin/Threonin-spezifischen Rho-Kinasen I und II (ROCKI und ROCKII) sind wichtige
Effektoren von RhoA-C (Ishizaki et al., 1996; Sahai & Marshall, 2002) und im Gegensatz zum
SRF werden sie direkt durch die Rho-Proteine aktiviert. Um auszuschließen, dass die hier
beschriebene cGKI-α/RhoGEF17-vermittelte Stimulation des SRFs auf einer unbekannten
Interferenz des cGMPs mit Mediatoren des RhoA-SRF-Signalwegs beruht, wurde zusätzlich die
Aktivierung der ROCK untersucht. Dabei zeigte sich, dass sowohl cGMP/cGKI-α sowie
RhoGEF17 eine minimale Steigerung der ROCK-Aktivität induzieren konnten, welche jedoch
durch die Kombination von RhoGEF17 mit cGMP/cGKI-α überadditiv gesteigert wurde. Die
Behandlung der Zelllysate mit Y-27632, einem ROCK-Inhibitor (Ishizaki et al., 2000), führte zu
einer nahezu vollständigen Unterdrückung der durch RhoGEF17 und cGMP/cGKI-α gesteigerten
ROCK-Aktivität (Abb. 28).
0,5
GK
MP
/c
cG
o ll
Ko
ntr
Rh
Rh
oG
oG
EF
EF
17
17
+c
GM
P/c
GK
0,0
1,5
1,0
0,5
0,0
cG
MP
/c G
K
Rh
Rh
oG
oG
EF
EF
17
17
+c
GM
P/
cG
K
1,0
2,0
lle
1,5
2,5
Ko
ntr
o
relative Aktivierung
2,0
e
relative Aktivierung
+ Y-27632
2,5
Abb. 28: Nachweis der cGKI-α/RhoGEF17-abhängigen ROCK-Aktivierung. HEK-Zellen wurden
entsprechend mit 750 ng Plasmid-DNA für RhoGEF17 und 750 ng Plasmid-DNA für cGKI-α bzw. bis
zu 1,5 µg Leervektor kotransfiziert und nach 46 h für 2 h mit 100 µM 8-pCPT-cGMP stimuliert. Für die
ROCK-Aktivitäts-Messung wurden jeweils 300 ng Proteinlysat eingesetzt und entsprechend für 30 min
mit 10 µM Y-27632 behandelt.
Im Folgenden sollte untersucht werden, ob die RhoA-abhängige ROCK-Aktivierung Einfluss auf
die Aktivität von RhoGEF17 nimmt. Dazu wurde ein Pulldown-Assay unter Verwendung der
ROCK-Inhibitoren Y-27632 und H-1152P durchgeführt. Wie aus Abbildung 29 A und B ersichtlich,
wurde die basale RhoGEF17-abhängige RhoA-Aktivierung weder durch Y-27632 noch durch H1152P beeinflusst. Jedoch zeigte sich, dass die synergistische cGKI-α/RhoGEF17-abhängige
RhoA-Aktivierung durch die Inhibition der ROCK vollständig aufgehoben wurde. Dies konnte
Ergebnisse
100
sowohl mit dem weniger potenten und selektiven Inhibitor Y-27632 (Ki 0,15 µM), als auch mit
dem wirksameren und spezifischeren Inhibitor H-1152P (Ki 0,006 µM) (Sasaki et al., 2002)
beobachtet werden (Abb. 29 A, B). H-1152P hemmte die cGKI-α/RhoGEF17 induzierte RhoA-
Ko
nt
ro
lle
A
cG
M
P/
cG
K
Rh
oG
EF
17
Rh
oG
EF
17
Ko +c
G
nt
ro MP
/c
lle
GK
cG
M
P/
cG
K
Rh
oG
EF
17
Rh
oG
EF
17
+c
G
M
P/
c
GK
Aktivierung bereits in einer Konzentration von 1 nM nahezu vollständig (Abb. 29 B).
Y-27632
RhoA-GTP
RhoA/Gesamt
anti-c-myc
Ko
nt
ro
lle
H11
52
P
10
Rh
0n
oG
M
EF
17
B
H11
52
P
0.
H3n
11
M
52
P
1n
HM
11
52
P
10
H11
nM
52
P
33
H11
nM
52
P
10
0n
M
anti-cGKI-α
RhoGEF17+cGMP/cGK
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
Abb. 29: Einfluss der ROCK-Inhibitoren Y-27632 und H-1152P auf die cGKI-α/RhoGEF17vermittelte RhoA-Aktivierung. (A) HEK-Zellen wurden mit 750 ng Plasmid-DNA für RhoGEF17
sowie 750 ng Plasmid-DNA für cGKI-α bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 46 h für 2
h mit 100 µM 8-pCPT-cGMP und nach 47 h für 1 h mit 10 µM Y-27632 behandelt. (B) Alternativ
wurden die transfizierten Zellen nach 46 h für 2 h mit 100 µM 8-pCPT-cGMP und nach 47 h mit 0,3
nM, 1 nM, 10 nM, 33 nM bzw. 100 nM H-1152P für 1 h behandelt. Zur Bestimmung der Gesamt-RhoAMenge in den Lysaten wurden parallel je 40 µg der Zelllysate analysiert. Die Expression von
RhoGEF17 und der cGKI-α wurde mit den entsprechenden Antikörpern überprüft.
Ergebnisse
101
Die Beteiligung der ROCK an der cGKI-α/RhoGEF17-vermittelten RhoA-Aktivierung war
zunächst überraschend. Mögliche Gründe dafür könnten sein, dass die ROCK direkt ihren
stimulatorischen Einfluss auf den Aktivierungsmechanismus nimmt oder dies indirekt über die
Aktivierung anderer Kinasen, bzw. über die Inhibition von Phosphatasen, bewerkstelligt. Da
bekanntermaßen eine zentrale Rolle der ROCK darin besteht, die Myosin-bindende Untereinheit
der leichten Myosinketten-Serin/Threonin-Phosphatase (MYPT1) zu inhibieren (Hartshorne,
1998;
Kawano
et
al.,
1999),
wurde
zunächst
Proteinphosphatase-Inhibitoren Okadainsäure
unterdrückte
RhoGEF17-
und
und
untersucht,
ob
die
Serin/Threonin-
Calyculin A einen Einfluss auf die
cGMP/cGKI-α-abhängige
RhoA-Aktivierung
nehmen.
Die
Anwesenheit von Calyculin A alleine führte zu einer gesteigerten RhoGEF17-abhängigen RhoAAktivierung, welche durch cGMP/cGKI-α noch weiter erhöht werden konnte. Diese Zunahme war
aber zum Teil noch sensitiv gegenüber H-1152P (Abb. 30 A). In Gegenwart beider PhosphataseInhibitoren, hatte H-1152P keinen Einfluss mehr auf die RhoGEF17 und cGMP/cGKI-α-
A
Ko
nt
ro
lle
Rh
oG
EF
17
Rh
oG
EF
17
Rh
+c
oG
GM
EF
P/
17
cG
Rh +c
K
oG GM
EF
P/
cG
Rh
1
K
oG 7+c
GM +H
EF
P/ 115
17
Rh
cG 2P
+c
oG
K
GM
EF
P/
Ko
17
cG
nt
K+
ro
lle
H1
15
2P
abhängige RhoA-Aktivierung (Abb. 30 B).
Calyculin A
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
102
cG
B
K/
cG
M
cG P
K/
cG
Rh
M
P
oG
EF
Rh
1
oG 7
EF
1
Rh 7+
oG RO
Rh EF CKoG 17 I
EF
Rh
17
oG
+R
EF
OC
Rh
17
KoG
+c
I
GK
EF
/ cG
1
Rh 7+
M
oG cG
P
K
Rh EF1 / cG
oG 7+ MP
EF cG +R
K
O
17
+c / cG CK
GK MP -I
/ cG
M
P+
RO
CK
-I
Ergebnisse
PP-I
PP-I
PP-I
RhoA-GTP
RhoA/Gesamt
anti-c-myc
anti-cGKI-α
Abb.
30:
Untersuchungen
zur
Beteiligung
von
Serin/Threonin-spezifischen
Proteinphosphatasen an der ROCK-vermittelten Rückkopplung des RhoGEF17-Signalwegs. (A)
HEK-Zellen wurden mit 750 ng Plasmid-DNA für RhoGEF17 sowie 750 ng Plasmid-DNA für cGKI-α
bzw. bis zu 1,5 µg Leervektor kotransfiziert und nach 46 h für 2 h mit 100 µM 8-pCPT-cGMP sowie
nach 47 h für 1 h entsprechend mit 10 nm H-1152P bzw. nach 47,5 h für 30 min mit 50 nM Calyculin A
behandelt. (B) HEK-Zellen wurden äquivalent zu (A) kotransfiziert und nach 46 h für 2 h mit 100 µM 8pCPT-cGMP stimuliert sowie nach 47 h entsprechend mit 10 nm H-1152P für 1 h bzw. nach 47,5 h mit
50 nM Calyculin A plus 100 nM Okadainsäure für 30 min behandelt. Zur Bestimmung der GesamtRhoA-Menge in den Lysaten wurden parallel 40 µg des Zelllysats analysiert. Die Expression von
RhoGEF17 und der cGKI-α wurde mit den entsprechenden Antikörpern überprüft. Abkürzung: PP-I
(Proteinphosphatase-Inhibitoren: Calyculin A und Okadainsäure)
Die in diesem sowie im vorherigen Abschnitt beschriebenen Ergebnisse lassen den Schluss zu,
dass RhoGEF17 für einen „Schaltermechanismus“ verantwortlich ist, der die Inhibition der RhoAAktivierung durch den cGMP/cGKI-α-abhängigen Signalweg in eine Aktivierung von RhoA bzw.
SRF umkehrt. Des Weiteren legen die Ergebnisse nahe, dass phosphoryliertes RhoA in
Gegenwart von RhoGEF17 funktionell aktiv ist und für die RhoGEF17- und cGMP/cGKI-αabhängige RhoA-Aktivierung erforderlich ist. Zusätzlich legen die hier gezeigten Daten nahe,
dass
die
cGKI-α/RhoGEF17-abhängige
RhoA-Aktivierung
einem
positiven
Rückkopplungsmechanismus unterliegt, welcher von einer ROCK-vermittelten Inhibition einer
Serin/Threonin-Proteinphosphatase getragen wird.
Ergebnisse
103
5.3 Vaskuläre RhoA-Aktivierung durch RhoGEF17
Die von Rümenapp und Mitarbeitern (Rumenapp et al., 2002) durchgeführte Northern BlotAnalyse zur Transkription des RhoGEF17-Gens wies darauf hin, dass dieses RhoGEF
anscheinend vorwiegend in gefäßreichen Geweben exprimiert wird. Deshalb sollte im Folgenden
die Expression von RhoGEF17 mittels RT-PCR, Immunoblot und immunhistologischen Methoden
speziell in Gefäßen und Primärzellen des Gefäßsystems untersucht werden.
5.3.1 Expression von RhoGEF17 in glattmuskulären Zellen der Aorta von Ratte und Maus
Mit Hilfe der RT-PCR konnte das Vorkommen der mRNA für RhoGEF17 in isolierten,
glattmuskulären Zellen der thorakalen Aorten der Maus (MASMC), der Ratte (RASMC) sowie in
humanen Endothelzellen der Umbilikalvene (HUVEC) nachgewiesen werden (Abb. 31 A). Um die
Expression der Translation und damit die Expression des Proteins zu verifizieren wurde ein
Immunoblot mit einem anti-RhoGEF17-spezifischen Antikörper durchgeführt. Wie in Abbildung 31
B zu erkennen ist, detektierte der anti-RhoGEF17-Antikörper sowohl in MASMC als auch in
RASMC ein Protein dessen Molekulargewicht ca. 220 kDa betrug und das etwas kleiner war als
das rekombinant-exprimierte, c-myc-getaggte menschliche RhoGEF17. Die cDNA, die für das
RhoGEF17-Protein der Ratte kodiert, weist einen offenen Leserahmen von 6159 bp auf, welcher
für ein putatives 2053 Aminosäure-großes Protein kodiert. Der offene Leserahmen der
entsprechenden cDNA-Sequenz der Maus besteht aus 6171 bp und kodiert für ein putatives 2057
Aminosäure-großes Protein. Aus den beiden Sequenzen lässt sich jeweils ein theoretisches
Molekulargewicht von ca. 221 kDa berechnen. Wahrscheinlich aufgrund der geringen Expression
war das Protein im Gesamtlysat der Mausaorta nicht mehr nachweisbar.
lle
)
tr o
RA
SM
C
ne
g.
Ko
n
MA
SM
C
ta
(
Ao
r
ne
g.
Ko
nt
A
104
Ma
us
ro
lle
Ergebnisse
8000 bp
8000 bp
3000 bp
2000 bp
1031 bp
3000 bp
2000 bp
500 bp
300 bp
1031 bp
ne
g.
Ko
nt
HU
ro
lle
VE
C
500 bp
8000 bp
3000 bp
2000 bp
1031 bp
800 bp
500 bp
ü
Rh bere
oG xp
E F ri m
17 i e
Ao
(hu rtes
rta
ma
(M
n)
au
MA
s)
SM
C
B
überexprimiertes
RhoGEF17
200 kDa
119 kDa
endogenes
RhoGEF17
2600 bp
endogenes
RhoGEF17
200 kDa
Ly
sa
t
üb
Rh ere
oG xp
EF r i m
17
i
(hu erte
ma s
n)
105
HE
K-
RA
SM
C
Ergebnisse
überexprimiertes
RhoGEF17
119 kDa
Abb. 31: Detektion von endogenem RhoGEF17 in isolierten, glattmuskulären thorakalen Zellen
der Aorta von Ratte und Maus. (A) RT-PCR mit RNA aus isolierten, glattmuskulären thorakalen
Zellen der murinen Aorta (MASMC), der Rattenaorta (RASMC) bzw. HUVEC. Für die RT-PCR wurden
die in 4.1.7 aufgeführten Primer RhoGEF17-Maus-3151-for, RhoGEF17-Maus-3436-rev, RhoGEF17Ratte-3636-for, RhoGEF17-Ratte-6200-rev, RhoGEF17-5302-for und RhoGEF17-6108-rev verwendet.
(B) Nachweis von RhoGEF17 in MASMC bzw. RASMC mittels des anti-RhoGEF17-spezifischen
Antikörpers im Immunoblot. Als Kontrolle diente in beiden Fällen das in HEK-Zellen überexprimierte,
rekombinante, c-myc getaggte humane RhoGEF17.
Um die Expression von RhoGEF17 in Gewebe nachzuweisen, wurden histologische Schnitte der
thorakalen Rattenaorta durchgeführt (Dr. Martin Thomas, persönliche Mitteilung) und das
RhoGEF17-Protein mit Hilfe des spezifischen Antikörpers detektiert. Wie in Abbildung 32 zu
erkennen ist, wird RhoGEF17 sowohl im glattmuskulären Gewebe als auch im Endothel
exprimiert. Um eine eventuelle Kolokalisation mit der cGKI zu überprüfen, wurden entsprechende
Schnitte mit einem anti-cGKI-Antikörper gefärbt. In Übereinstimmung mit der Literatur, konnte die
cGKI überwiegend im glattmuskulären Gewebe und nur zu einem sehr geringen Teil im Endothel
nachgewiesen werden (Abb. 32). Als Kontrolle diente in beiden Fällen eine Färbung mit dem
Zweitantikörper alleine.
Ergebnisse
cGKI
RhoGEF17
Kontrolle
Kontrolle
10 µM
106
Kontrolle
10 µM
Abb. 32: Immunhistologische Färbungen von thorakalen Aorten-Paraffinschnitten der Ratte.
Linkes Bild: 1. Antikörper: anti-RhoGEF17 (1:1000; 1 h Inkubation). Rechtes Bild: 1. Antikörper: anticGKI (1:50, 1 h Inkubation). Als Zweitantikörper wurde jeweils anti-Kaninchen verwendet (1:200; 30
min Inkubation). Schwarzer Pfeil: glattmuskuläres Gewebe; roter Pfeil: Endothel.
Inset: Kontrollfärbungen nur mit dem Zweitantikörper. Maßstab: 10 µM
5.3.2 Einfluss der Überexpression von RhoGEF17-ΔN und der cGMP-Stimulation auf die
RhoA-Aktivierung in RASMC
Im Folgenden sollte untersucht werden, wie sich die Behandlung der primären RASMC mit 8pCPT-cGMP bzw. 8-Bromo-cGMP auf die RhoA-Aktivierung auswirkt und ob eine mögliche
Beteiligung von RhoGEF17 an einer cGMP-induzierten RhoA-Aktivierung nachweisbar ist.
Zunächst wurden RASMC für unterschiedliche Zeiten mit beiden cGMP-Analoga inkubiert und die
RhoA-Aktivierung mittels des Pulldown-Assays bestimmt. Wie in Abbildung 33 A dargestellt ist,
induzierten beide cGMP-Analoga eine transiente RhoA-Aktivierung, die nach 30 min bereits ihr
Maximum erreicht hatte und nach 3 h wieder deutlich abnahm.
Um zu überprüfen, ob RhoGEF17 auch in RASMC eine RhoA-Aktivierung induzieren kann, wurde
die bereits beschriebene, konstitutiv aktive RhoGEF17-Mutante RhoGEF17-ΔN mit Hilfe eines
rekombinaten Adenovirus überexprimiert (Abb. 33 B). In Übereinstimmung mit den in HEK-Zellen
erhobenen Daten führte die Überexpression dieser Mutante zu einer deutlichen Aktivierung von
RhoA, welche, ebenfalls in Übereinstimmung mit den Daten in HEK-Zellen (siehe Abb. 23 E und
F, Seite 90 ), durch Inkubation mit 8-Bromo-cGMP beinahe vollständig aufgehoben wurde.
Ergebnisse
107
8-pCPT-cGMP
h
3
h
2
1h
in
30
m
lle
Ko
nt
ro
h
3
h
2
1h
in
30
m
Ko
nt
ro
lle
A
8-Bromo-cGMP
RhoA-GTP
RhoA/Gesamt
B
-
+
Ad-EGFP
-
+
8-Bromo-cGMP
Ad-RhoGEF17-ΔN
RhoA-GTP
RhoA/Gesamt
Abb. 33: cGMP- bzw. RhoGEF17-ΔN-induzierte RhoA-Aktivierung in RASMC. (A) RASMC wurden
nach 45 h in serumreduziertem Medium (0,5 % FCS) für 0,5 h, 1 h, 2 h und 3 h mit 100 µM 8-pCPTcGMP bzw. mit 1 mM 8-Bromo-cGMP stimuliert. (B) RASMC wurden mit Adenoviren, die für EGFP
bzw. RhoGEF17-ΔN kodieren, mit einer MOI von 150 infiziert (Infektionseffizienz etwa 80 %) und nach
46 h für 2 h mit 1 mM 8-Bromo-cGMP stimuliert. Zur Bestimmung der Gesamt-RhoA-Menge in den
Lysaten wurden parallel 40 µg des Zelllysats analysiert.
5.3.3 RhoGEF17-ΔN induzierte Stressfaserbildung in RASMC und HUVEC
Da aktiviertes RhoA bekanntermaßen Stressfaserbildung in vaskulären Zellen induziert (Mack et
al., 2001; Fukata et al., 2001), wurde der Einfluss von cGMP-Analoga und RhoGEF17-ΔN auf die
Morphologie des Aktin-Zytoskeletts untersucht. Wie in Abbildung 34 A gezeigt, konnte in Kontroll
(AdEGFP)-infizierten
RASMC
nach
Stimulation
mit
8-Bromo-cGMP
eine
deutliche
Stressfaserbildung beobachtet werden. Ebenso führte die Expression von RhoGEF17-ΔN zu
einer deutlichen Stressfaserbildung, die in Übereinstimmung mit den Daten zur RhoA-Aktivierung
(siehe Abb. 23 E und F, Seite 90) bei Behandlung mit 8-Bromo-cGMP wieder abnahm (Abb. 34
A). Wie in Abbildung 34 B ersichtlich, führte die Infektion von HUVEC mit Ad-RhoGEF17-ΔN
ebenfalls zu einer deutlichen Stressfaserbildung im Vergleich zu Ad-EGFP infizierten Zellen. Eine
Behandlung mit 8-Bromo-cGMP in Ad-EGFP infizierten HUVEC hatte keinen Einfluss,
wohingegen die Stressfaserbildung der mit Ad-RhoGEF17-ΔN infizierten HUVEC bei Applikation
mit 8-Bromo-cGMP vergleichbar zu RASMC deutlich abnahm.
Ergebnisse
108
A
-
+
8-Bromo-cGMP
Ad-EGFP
TRITC-Phalloidin
EGFP
-
TRITC-Phalloidin
EGFP
+
8-Bromo-cGMP
Ad-RhoGEF17-ΔN
TRITC-Phalloidin
EGFP
TRITC-Phalloidin
EGFP
B
-
+
8-Bromo-cGMP
Ad-EGFP
TRITC-Phalloidin
EGFP
TRITC-Phalloidin
+
-
8-Bromo-cGMP
Ad-RhoGEF17-ΔN
TRITC-Phalloidin
EGFP
TRITC-Phalloidin
Abb. 34: Aktin-Zytoskelettfärbung in RASMC und HUVEC. (A) RASMC wurden mit Adenoviren, die
für EGFP bzw. RhoGEF17-ΔN kodieren, mit einer MOI von 150 infiziert. Nach 46 h wurden die Zellen
mit 1 mM 8-Bromo-cGMP für 2 h inkubiert. Die Färbung des Aktin-Zytoskeletts erfolgte mit TRITCPhalloidin (1 µg/µL). (B) HUVEC wurden mit Adenoviren, die für EGFP bzw. RhoGEF17-ΔN kodieren,
mit einer MOI von 10 infiziert. Nach 46 h wurden die Zellen für 2 h mit 1 mM 8-Bromo-cGMP inkubiert.
Das Aktin-Zytoskelett wurde mit TRITC-Phalloidin (1 µg/µL) gefärbt.
Ergebnisse
109
5.3.4 Einfluss der RhoGEF17-Depletion auf die cGMP-abhängige RhoA-Aktivierung in
RASMC
Um zu untersuchen, ob die cGMP-induzierte RhoA-Aktivierung in RASMC durch endogenes
RhoGEF17 hervorgerufen wird, wurde mittels eines siRNA-Design-Programms eine RhoGEF17spezifische siRNA ermittelt (Abb. 35 A). Mit ihrer Hilfe sollte die endogene Expression von
RhoGEF17 in RASMC supprimiert werden. Die Funktionalität der RhoGEF17-spezifischen siRNA
wurde durch Kotransfektion von HEK-Zellen mit Plasmid-DNA für RhoGEF17-ΔN-Ratte bei
steigenden Konzentrationen der siRNA im Immunoblot überprüft. Wie in Abbildung 35 B
erkennbar, wurde die Expression des RhoGEF17-ΔN-Proteins der Ratte bereits bei einer siRNAMenge von 40 pmol wirksam unterdrückt. Anschließend wurde basierend auf der siRNA-Sequenz
ein Adenovirus hergestellt, der über die Produktion einer short-hairpin-RNA (shRNA) zur
Generierung der entsprechenden siRNA in infizierten Zellen führte (Xia et al., 2002; Shen et al.,
2003). Zur Kontrolle der Wirksamkeit der shRNA wurde vor der eigentlichen Generierung des
Adenovirus der Einfluss des als Shuttle-Vektor dienenden Konstrukts pAdTrack-shRNARhoGEF17 auf die Expression von rekombinantem RhoGEF17-ΔN-Protein der Ratte in HEKZellen im Immunoblot überprüft. 72 h nach Transfektion war eine deutlich geringere Expression
des RhoGEF17-ΔN-Proteins der Ratte in den Zellen zu beobachten, die mit pAdTrack-shRNARhoGEF17 kotransfiziert waren. Dieser Effekt war nach 96 h noch deutlich ausgeprägter (Abb. 35
C).
A
RhoGEF17-ΔN-Ratte
RhoGEF17-Ratte
1
WD40
DH
387
3180
3732 4170
PH?
3819
siRNA
+4
0
Ko
nt
ro
lle
B
pm
ol
+6
si
0
pm
ol
si
+1
00
pm
ol
si
+1
50
pm
ol
si
4041 4065
RhoGEF17-ΔN-Ratte
anti-c-myc
5946
6159 bp
Ko
nt
ro
C
110
lle
Rh
oG
EF
17
Rh
-Δ
oG
NRa
EF
tte
17
Ko
-Δ
Nnt
Ra
ro
lle
tte
+p
Rh
Ad
oG
Tr
EF
ac
17
kRh
-Δ
sh
NoG
RN
R
EF
at
Ate
17
Rh
-Δ
oG
NEF
Ra
17
tte
+p
Ad
Tr
ac
ksh
RN
ARh
oG
EF
17
Ergebnisse
72 h
96 h
anti-c-myc
Abb. 35: Suppression der Expression von rekombinantem RhoGEF17-ΔN Ratte-Protein mittels
RhoGEF17-spezifischer siRNA bzw. shRNA. (A) Schematische Darstellung der cDNA-Sequenz
(offener Leserahmen), die für das RhoGEF17-Protein der Ratte kodiert und Lokalisation der
RhoGEF17-spezifischen siRNA-Sequenz (siRNA-Oligonukleotide sind in 4.1.8 aufgelistet). (B)
Kotransfektion von HEK-Zellen mit 1 µg Plasmid-DNA für RhoGEF17-ΔN-Ratte sowie ansteigenden
Mengen RhoGEF17-spezifischer siRNA (40 pmol, 60 pmol, 100 pmol und 150 pmol/750 µL).
Nachweis von RhoGEF17-ΔN-Protein der Ratte nach 48 h im Immunoblot mit einem anti-c-mycAntikörper. (C) Kotransfektion von HEK-Zellen entsprechend mit 0,4 µg Plasmid-DNA für RhoGEF17ΔN-Ratte und 1,2 µg Plasmid-DNA für pAdTrackCMV-shRNA-RhoGEF17 bzw. mit 1,6 µg
Kontrollvektor (shRNA-Oligonukleotide sind in 4.1.8 aufgelistet). Nach 72 h bzw. nach 96 h wurde im
Immunoblot das RhoGEF17-ΔN-Protein der Ratte mit einem anti-c-myc-Antikörper nachgewiesen.
Im Folgenden wurde die Funktionalität des RhoGEF17-spezifischen shRNA-Adenovirus in
RASMC mittels RT-PCR und Immunoblot überprüft. Wie in Abbildung 36 A und B erkennbar ist,
war nach 96-stündiger Infektion die mRNA für RhoGEF17 nicht mehr nachweisbar und die
Expression des Proteins stark vermindert. Im Gegensatz zum Gehalt an RhoGEF17-mRNA war
der Gehalt an mRNA für Porphobilinogen-Deaminase (PBGD) in Ad-shRNA-RhoGEF17
infizierten RASMC nicht verändert.
EG
Ad
-
Ne
g.
K
on
tro
lle
A
111
FP
Ad
-s
hR
NA
-R
ho
GE
Ne
F1
g.
7
Ko
nt
ro
Ad
lle
-E
GF
P
Ad
-s
hR
NA
-R
ho
GE
F1
7
Ergebnisse
RhoGEF17
PBGD
8000 bp
3000 bp
2600 bp
2000 bp
1031 bp
500 bp
120 µg 90 µg 120 µg
Ad
-s
hR
NA
-R
ho
FP
Ad
-E
G
Ad
-
Ad
-
EG
FP
sh
RN
ARh
o
B
GE
F1
7
GE
F1
7
200 bp
120 µg 90 µg 120 µg
90 µg
90 µg
endogenes
RhoGEF17
200 kDa
200 kDa
Ponceau-Färbung
Abb. 36: Suppression der Expression von endogenem RhoGEF17-Protein in RASMC mittels
eines shRNA-RhoGEF17-spezifischen Adenovirus. (A) RT-PCR mit RNA aus isolierten,
glattmuskulären thorakalen Aortenzellen der Ratte (RASMC), die mit Adenoviren, die für EGFP bzw.
shRNA-RhoGEF17 kodieren, mit einer MOI von 150 infiziert und für 96 h inkubiert wurden. Für die RTPCR wurden die in 4.1.7 aufgeführten Primer PBGD-for, PBGD rev, RhoGEF17-Ratte-3636-for und
RhoGEF17-Ratte-6200-rev verwendet. (B) RASMC wurden mit Adenoviren, die für EGFP und shRNARhoGEF17 kodieren, mit einer MOI von 150 infiziert und für 96 h inkubiert. Nachweis von endogenem
RhoGEF17 in 120 µg bzw. 90 µg RASMC-Lysat mittels des anti-RhoGEF17-spezifischen Antikörpers
im Immunoblot. Als Beladungskontrolle ist die entsprechende Ponceau-Färbung des Blots im rechten
Bild gezeigt.
Ergebnisse
112
Als nächstes wurde der Einfluss des RhoGEF17-spezifischen shRNA-Adenovirus auf die cGMPabhängige RhoA-Aktivierung in RASMC untersucht. Bei Infektion von RASMC mit Ad-EGFP und
Stimulation mit cGMP war wiederum die bereits gezeigte RhoA-Aktivierung nachweisbar. Die
Depletion des endogenen RhoGEF17s führte zwar zu einer gesteigerten basalen RhoAAktivierung im Vergleich zu Ad-EGFP infizierten Zellen, jedoch im Gegensatz zu Ad-EGFP
infizierten RASMC konnte durch cGMP keine gesteigerte RhoA-Aktivierung mehr induziert
werden (Abb. 37). Interessanterweise führte die cGMP-Behandlung von Ad-shRNA-RhoGEF17infizierten RASMC-Zellen zu der in einer Vielzahl von Publikationen beschriebenen Inhibition der
RhoA-Aktivierung durch die cGKI. Dieses Resultat legt nahe, dass RhoGEF17 für eine cGMPvermittelte Aktivierung von RhoA in RASMC notwendig ist.
Ad-EGFP
+
-
+
8-pCPT-cGMP
Ad-shRhoGEF17
RhoA-GTP
RhoA/Gesamt
Abb. 37: Inhibition der cGMP-vermittelten RhoA-Aktivierung in RASMC durch Ad-shRNARhoGEF17. RASMC wurden mit Adenoviren, die für EGFP und shRNA-RhoGEF17 kodieren, mit einer
MOI von 150 infiziert. Nach 94 h wurden die Zellen mit 100 µM 8-pCPT-cGMP für 2 h stimuliert. Zur
Bestimmung der Gesamt-RhoA-Menge in den Lysaten wurden parallel 40 µg des Zelllysats analysiert.
5.3.5 Einfluss von SNP auf die cGMP-abhängige RhoA-Aktivierung in RASMC
Die Effekte von cGMP auf die RhoA-Aktivierung in RASMC ließen sich durch Inkubation mit
Natrium-Nitroprussid (SNP), einem Aktivator der löslichen Guanylylzyklase (Katsuki et al., 1977)
imitieren. Wie in Abbildung 38 zu erkennen ist, induzierte SNP eine gesteigerte Aktivierung von
RhoA in Kontroll (EGFP)-infizierten RASMC, während die gesteigerte RhoA-Aktivierung, die in
RhoGEF17-depletierten RASMC beobachtet wurde, durch SNP, analog zur Behandlung mit
cGMP, gehemmt wurde. Diese Daten legen nahe, dass die Stimulation der löslichen
Guanylylzyklase zu einer cGMP-abhängigen Aktivierung von RhoGEF17 und damit auch zur
Stimulation von RhoA-abhängigen Signalwegen in RASMC führen kann.
Ergebnisse
-
+
Ad-EGFP
-
+
113
SNP
Ad-shRhoGEF17
RhoA-GTP
RhoA/Gesamt
Abb. 38: Inhibition der SNP-vermittelten RhoA-Aktivierung in RASMC durch Ad-shRNARhoGEF17. RASMC wurden mit Adenoviren, die für EGFP und shRNA-RhoGEF17 kodieren, mit einer
MOI von 150 infiziert. Nach 95 h wurden die Zellen mit 1 µM SNP für 1 h inkubiert. Zur Bestimmung
der Gesamt-RhoA-Menge in den Lysaten wurden parallel 40 µg des Zelllysats analysiert.
Diskussion
114
6. Diskussion
Monomere GTPasen der Rho-Familie spielen eine entscheidende Rolle bei der Regulation einer
Vielzahl von verschiedenen zellulären Prozessen. Neben der Reorganisation des AktinZytoskeletts sind diese unter anderem an der Koordination von vaskulären physiologischen und
pathophysiologischen Vorgängen beteiligt. Rho-GTPasen kontrollieren hierbei als zentrale
Mediatoren Prozesse wie Proliferation, Migration und Kontraktion von glattmuskulären als auch
von endothelialen Zellen (Rolfe et al., 2005; Pacaud et al., 2005). Bis heute ist jedoch nur relativ
wenig über die unmittelbar beteiligten akzessorischen Proteine und Signalübertragungswege
bekannt. Das Ziel dieser Arbeit war es, in diesem Kontext die Rolle der GuaninnukleotidAustauschfaktoren der mit GrinchGEF (Winkler et al., 2005) verwandten GEFs, RhoGEF10 und
RhoGEF17 sowie deren übergeordnete Regulation näher zu untersuchen.
6.1 RhoGEF10
6.1.1. Proteinsequenzanalyse
Bioinformatische Proteinsequenzanalysen von RhoGEF10 ergaben, ähnlich wie bei GrinchGEF,
neben der Detektion einer typischen DH- und einer putativen WD40-änlichen Domäne, zwei Cterminale putative Transmembransegmente (Hirokawa et al., 1998). Dagegen konnten die
Programme TMHMM und PSORT aber weder eine Sequenz für eine transmembranäre
Lokalisation, noch eine N-terminale Signalsequenz für einen Transport in das endoplasmatische
Retikulum detektieren (Sonnhammer et al., 1998; Nakai & Horton, 1999). Die experimentelle
Analyse der subzellulären Lokalisation mittels Zellfraktionierung zeigte, dass das rekombinante
RhoGEF10 kein integrales Membranprotein ist, sondern vorwiegend zytosolisch vorliegt. Ähnlich
wie bei GrinchGEF (Winkler et al., 2005), sind damit die putativen Transmembrandomänen von
RhoGEF10 offensichtlich nicht funktionell. Es ist anzunehmen, dass RhoGEF10 analog zur
Mehrheit der Mitglieder der Dbl-Familie, ein zytosolisches Protein ist, das nach bzw. durch eine
spezifische Aktivierung mit der Plasmamembran assoziiert und dort zur Aktivierung von
RhoGTPasen führt (Schmidt & Hall, 2002; Rossman et al., 2005). Ob, wie für andere RhoGEFs
gezeigt, eine direkt auf die DH-Domäne folgende PH-Domäne an der Translokation von
RhoGEF10 an die Membran beteiligt ist, scheint zweifelhaft. Die Existenz einer solchen PHDomäne ist, wie bei GrinchGEF und RhoGEF17, aus der Primärsequenz nicht ableitbar. Nur
hoch stringente Modelling-Programme, wie z. B. Fugue, die die dreidimensionale Struktur
bekannter PH-Domänen dem Modelling zu Grunde legen, können mit einer niedrigen
Wahrscheinlichkeit die Existenz einer solchen PH-Domäne in der Struktur von RhoGEF10
Diskussion
115
berechnen. Wenn RhoGEF10, RhoGEF17 und GrinchGEF überhaupt PH-Domäne besitzen,
dann sind diese strukturell mit bekannten RhoGEF-PH-Domänen nur wenig vergleichbar.
6.1.2. Expression von RhoGEF10 und alternatives Spleißen des Gens
Die Durchführung einer RT-PCR mit Oligonukleotiden, die das Exon 8 umfassen, ergab in allen
überprüften Geweben zwei PCR-Amplifikate bei 420 und 537 bp. Eine anschließende Klonierung
des kürzeren PCR-Fragments und Sequenzierung deckte ein alternatives Spleißen des Exons 8
auf. Diese alternative Spleißvariante stimmt überein mit einem von Verhoeven und Mitarbeitern
beschriebenen alternativen Spleißen des Exons 4 des murinen RhoGEF10 Orthologs, welches
dem Exon 8 der humanen genomischen RhoGEF10-Sequenz entspricht. In den genomischen
Studien von Verhoeven und Mitarbeitern wurden darüber hinaus für das murine RhoGEF10-Gen
zwei weitere Spleißvarianten beschrieben, welche möglicherweise gewebespezifisch exprimiert
werden (Verhoeven et al., 2003 ). Im Gegensatz dazu bestätigt die in dieser Arbeit durchgeführte
Analyse mittels RT-PCR die bereits von Yoshizawa und Mitarbeitern mittels Northern BlotAnalysen nachgewiesene Transkription des humanen RhoGEF10-Gens in allen untersuchten
Geweben (Yoshizawa et al., 2003). Die Spleißvariante RhoGEF10-ΔE8 wurde ebenfalls in allen
untersuchten Geweben detektiert, so dass von einer verbreiteten Expression von RhoGEF10 im
menschlichen
Organismus
ausgegangen
werden
kann.
Mittels
immunhistochemischer
Untersuchungen konnte die Expression des RhoGEF10-Proteins im Endothel von Blutgefäßen
sowie im ZNS nachgewiesen werden (Yoshizawa et al., 2003). Dieses Expressionsmuster erklärt
zum einen das Vorhandensein von RhoGEF10-mRNA in allen untersuchten Geweben, da diese
alle Gefäßendothelzellen enthalten und zum anderen könnte dieses Expressionsmuster auch auf
eine spezifische Aufgabe, z. B. in Gefäßendothelzellen hindeuten.
6.1.3. RhoB Spezifität von RhoGEF10
Eine Analyse zur Spezifität von RhoGEF10 für verschiedene Rho-GTPasen ergab, dass alle
Varianten von RhoGEF10 in der Lage sind RhoA-C, nicht aber Rac1 und Cdc42 zu aktivieren. Im
Gegensatz zu den beiden anderen Subfamilienmitgliedern RhoGEF17 und GrinchGEF (Winkler
et al., 2005) zeigte RhoGEF10 eine Präferenz für RhoB. RhoGEF10 stellt somit das erste
RhoGEF der Dbl-Familie dar, welches bevorzugt RhoB aktiviert. Andere RhoGEFs jedoch wie z.
B. XPLN und Scambio unterscheiden zwar ebenfalls zwischen den hoch homologen RhoProteinen, bevorzugen jedoch RhoA und RhoB bzw. RhoA und RhoC (Arthur et al., 2002; Curtis
et al., 2004).
Diskussion
116
6.1.4 Physiologische Relevanz von RhoGEF10
Die deutliche Expression im Gefäßendothel, z. B. der Aorta und die Präferenz für die RhoBAktivierung könnte auf eine mögliche Bedeutung von RhoGEF10 beim Überleben endothelialer
Zellen (Liu et al., 2001; Jiang et al., 2004) und auf eine Beteiligung am zellulären Transport von
EGF-Rezeptoren (Gampel et al., 1999) hindeuten.
Des Weiteren wurde für RhoGEF10 eine putative Rolle bei der Myelinisierung von peripheren
Nervenfasern beschrieben. In einer genetischen Studie wurde aufgrund einer Mutation im
ARHGEF10-Gen eine geringere Isolationsschicht der Nervenfasern sowie eine verzögerte
Nerven-Reizweiterleitungsgeschwindigkeit beobachtet (Verhoeven et al., 2003). Insgesamt
jedoch können beim gegenwärtigen Stand der Forschung noch keine definitiven Aussagen über
die physiologische bzw. pathophysiologische Bedeutung gemacht werden, da bis dato weder der
Aktivierungsmechanismus bekannt ist noch Signalwege und zelluläre Funktionen identifiziert
sind, bei denen die Beteiligung von RhoGEF10 nachgewiesen ist.
6.2. RhoGEF17
6.2.1 Spezifität von RhoGEF17 für RhoGTPasen
Das in dieser Arbeit hergestellte Konstrukt, das für das 2063 Aminosäuren umfassende
menschliche RhoGEF17-Protein kodiert, zeigte nach Expression in HEK-Zellen dieselbe
Substratspezifität wie die vor einigen Jahren bereits charakterisierte, trunkierte Variante p164RhoGEF (Rumenapp et al., 2002). RhoGEF17 ist in der Lage die Rho-Proteine RhoA-C, nicht
aber Rac1 oder Cdc42 zu aktivieren. Ebenso wie in RhoGEF10 und GrinchGEF (Winkler et al.,
2005) ist die Existenz der klassischen PH-Domäne des DH/PH-Motivs der Dbl-Familenmitglieder
in RhoGEF17 fraglich, deshalb bildet es mit den strukturverwandten Proteinen RhoGEF10 und
GrinchGEF eine neue Rho-spezifische Subfamilie von GEFs.
6.2.2 RhoGEF17 wird spezifisch durch cGKI-α phosphoryliert und aktiviert
Ähnlich wie eine Vielzahl anderer RhoGEFs (Schmidt & Hall, 2002; Rossman et al., 2005) sind in
RhoGEF17 autoinhibitorische Domänen vorhanden, die die GEF-Aktivität regulieren (Rumenapp
et al., 2002). Die Phosphorylierung der RhoGEFs durch spezifische Proteinkinasen ist des
Öfteren als Mechanismus beschrieben worden, durch den die Autoinhibition aufgehoben und
damit die Aktivität eines RhoGEFs stimuliert werden kann. So konnte z. B. gezeigt werden, dass
der N-Terminus von Vav eine α-Helix bildet, die die Bindungstasche für RhoGTPasen in der DHDomäne von Vav verschließt und damit die GEF-Aktivität blockiert (Aghazadeh et al., 2000). Die
Phosphorylierung des Tyrosins 174 durch Src-ähnliche, lösliche Tyrosinproteinkinasen induziert
eine Umstrukturierung des N-terminalen, inhibitorischen Peptids, das daraufhin den Kontakt zur
DH-Domäne verliert. Dies führt dann zur ungehemmten Aktivierung von RhoGTPasen durch Vav.
Diskussion
117
In der vorliegenden Arbeit konnten eine Vielzahl von Befunden erhoben werden, die belegen,
dass die Autoinhibition in RhoGEF17 unter Kontrolle des cGMP/cGKI-α-Signalwegs steht.
Erstens, wie durch Koimmunopräzipitations-Experimente belegt, interagierte RhoGEF17 mit
cGMP-aktivierter cGKI-α. Zweitens, die cGMP-abhängige Phosphorylierung von RhoGEF17
konnte mit Hilfe eines für das phosphorylierte Konsensusmotiv spezifischen Antikörpers
nachgewiesen werden. Drittens, die Aktivierung von rekombinant exprimierter cGKI-α durch
stabile cGMP-Analoga induzierte eine zeit- und konzentrationsabhängige Aktivierung von RhoA
in Anwesenheit von RhoGEF17, aber nicht bei Anwesenheit der katalytisch inaktiven RhoGEF17ΔDH-Mutante. Viertens, die Hemmung von Serin/Threonin-Proteinphosphatasen verstärkte die
cGMP/cGKI-α/RhoGEF17-induzierte
RhoA-Aktivierung.
Fünftens,
die
durch
cGMP/cGKI-
α/RhoGEF17-induzierte RhoA-Aktivierung stimulierte Rho-abhängige Effektorproteine, wie z. B.
ROCK und aktivierte Rho-abhängige Signalwege, wie z. B. die SRF-vermittelte Gentranskription.
Sechstens, in RASMC, die RhoGEF17 endogen exprimieren, konnte eine cGMP-abhängige
Aktivierung von RhoA nachgewiesen werden, die nach Depletion von RhoGEF17 mittels siRNA
verschwand. Diese Daten zeigen eindeutig, dass RhoGEF17 das erste bisher identifizierte
RhoGEF ist, das unter direkter Kontrolle des cGMP/cGKI-α-Signalweges steht.
Die Primärsequenz von RhoGEF17 enthält neun putative Phosphorylierungsstellen, die dem
Konsensusmotiv der cGK entsprechen. Durch Verwendung von phosphomimetischen bzw.
Phosphorylierungsresistenten, sowie N-terminal trunkierten Varianten von RhoGEF17, konnten
Hinweise erarbeitet werden, dass eine koordinierte Phosphorylierung der Serine 43 und 1331 zur
Aktivierung von RhoGEF17 durch cGKI-α benötigt wird. Obwohl die alleinige Phosphorylierung
des Serins 1331 sowohl im Volllängenprotein als auch in der um 1003 AA trunkierten, konstitutiv
aktiven RhoGEF17-Mutante RhoGEF17-ΔN eine Inhibition der cGMP/cGKI-α abhängigen RhoAAktivierung bewirkte, war eine Aktivierung der phosphomimetischen Mutante S1331E durch
cGKI-α weiterhin möglich. Die phosphorylierungsresistente Mutante SS1330/1331AA zeigte
dagegen, wie durch den Wegfall der inhibitorischen Phosphorylierung zu erwarten, eine erhöhte
Basalaktivität, die durch cGMP/cGKI-α aber nicht weiter stimuliert werden konnte. Weitere
Untersuchungen unter Verwendung von Inhibitoren der cGK deuten daraufhin, dass sowohl
RhoGEF17 als auch RhoGEF17-ΔN bereits im nicht stimulierten Zustand am Serin 1331
konstitutiv phosphoryliert sein könnte. Am wahrscheinlichsten erscheint deshalb folgendes
Szenario der cGKI-α-abhängigen Aktivierung von RhoGEF17: Obwohl die Phosphorylierung von
Serin 1331 per se inhibitorisch auf die RhoGEF17-Aktivität wirkt, ist die Phosphorylierung von
Serin 1331 durch die cGKI-α zur Aktivierung notwendig. Aufgrund der Hinweise auf eine
konstitutive Phosphorylierung, ist es vorstellbar, dass das Serin 1331 für die cGKI-α gut
zugänglich
ist.
Erst
die
durch
die
Phosphorylierung
von
Serin
1331
induzierte
Konformationsänderung ermöglicht dann der cGKI-α den Zugang zur zweiten, N-terminalen
Phosphorylierungsstelle Serin 43. Die Phosphorylierung von Serin 43 löst anschließend die
inhibitorische Interaktion des N-Terminus mit einer anderen Domäne von RhoGEF17, z. B. der
Diskussion
DH-Domäne,
so
dass
das
Protein
letztendlich
118
aktiviert
wird.
Dieser
komplexe
Reaktionsmechanismus steht erstens in Übereinstimmung mit der Mehrzahl der hier erhobenen
Befunde
und
deutet
zweitens
auf
eine
zentrale
Bedeutung
der
cGKI-α-abhängigen
Phosphorylierung für die Aktivierung von RhoGEF17 hin. Dieser Eindruck wird durch einen
weiteren Befund noch verstärkt.
Trotz der Tatsache, dass die PKA und die cGK dasselbe Konsensusmotiv (RK-X-S/T bzw. RR-XS/T) (Tegge et al., 1995) erkennen und viele Proteine an derselben Stelle sowohl durch die PKA
als auch durch die cGK phosphoryliert werden (Glass & Krebs, 1980), ist RhoGEF17 aufgrund
der hier erhobenen Befunde kein Substrat für die PKA. Obwohl 8-Bromo-cAMP die endogene
PKA in HEK-Zellen aktiviert und die Phosphorylierung von PKA-Substraten induziert (Beebe,
1994), konnte keine cAMP-abhängige Phosphorylierung von RhoGEF17 nachgewiesen werden.
In Übereinstimmung damit, konnte 8-Bromo-cAMP auch keine Aktivierung von RhoA und auch
keine Aktivierung von nachgeschalteten Signalwegen in RhoGEF17-exprimierenden Zellen
induzieren. RhoGEF17 gehört deshalb zusammen mit IRAG (Schlossmann et al., 2000) und
RGS2 (Tang et al., 2003) zu den spezifischen Substraten der cGKI und stellt deswegen ein
neues Signalmolekül dar, das entweder durch lösliche, NO-abhängige (Palacios et al., 1989;
Koesling et al., 2004) oder membranständige, durch natriuretische Peptide regulierte (Potter &
Hunter, 2001; Garbers et al., 2006) Guanylylzyklasen aktiviert werden kann.
6.2.3 Der Einfluss von cGMP/cGKI-α auf die Aktivität von RhoA in An- und Abwesenheit
von RhoGEF17
In der Literatur wird von verschiedenen Arbeitsgruppen beschrieben, dass RhoA sowohl von der
PKA als auch von der cGKI C-terminal am Serin 188 phosphoryliert werden kann (Lang et al.,
1996; Sawada et al., 2001; Ellerbroek et al., 2003). Die Phosphorylierung geht mit einer
Hemmung der Aktivität von RhoA einher, wie z. B. durch die Hemmung der SRF-abhängigen
Genexpression nachgewiesen wurde (Lang et al., 1996; Forget et al., 2002; Sawada et al., 2001).
Anscheinend weist das phosphorylierte RhoA eine erhöhte Affinität zu dem zytosolischen
Inhibitor RhoGDI auf und wird deshalb vermehrt aus der Plasmamembran ins Zytosol transloziert
(Lang et al., 1996; Forget et al., 2002; Rolli-Derkinderen et al., 2005; Kwak & Uhlinger, 2000).
Dies verringert die Interaktionsfähigkeit von RhoA mit RhoGEFs oder Effektoren (Lang et al.,
1996)
In Übereinstimmung mit diesen Daten konnte in der vorliegenden Arbeit die beschriebene
Hemmung der Serum-induzierten Aktivierung von RhoA durch cGMP/cGKI-α (Gudi et al., 2002)
in HEK-Zellen, in denen kein RhoGEF17 exprimiert wurde, ebenfalls beobachtet werden (siehe
Abb. 26, Seite 95). Interessanterweise wurde aber allein durch die Expression von RhoGEF17
der Effekt von cGMP/cGKI-α auf die Aktivität von RhoA von einer Hemmung in eine Stimulation
umgekehrt. Da die Sequestrierung von phosphoryliertem RhoA durch RhoGDI als wesentlicher
Mechanismus der cGMP/cGKI-induzierten Hemmung der RhoA-Aktivität gilt, legen diese Daten
Diskussion
119
nahe, dass erstens RhoGEF17 in der Lage ist mit RhoGDI um das phosphorylierte RhoA zu
konkurrieren und zweitens phosphoryliertes RhoA zu aktivieren. In der Tat konnte in der
vorliegenden Arbeit durch Verwendung der phosphorylierungsresistenten Mutante RhoA-S188A
bzw. der phosphomimetischen Mutante RhoA-S188E (Ellerbroek et al., 2003) gezeigt werden,
dass RhoGEF17 RhoA sowohl in unphosphorylierter als auch in phosphorylierter Form aktivieren
kann.
Da
die
phosphomometische
Mutante
zudem
in
gleicher
Weise
wie
die
phosphorylierungsrestistente Mutante und Wildtyp-RhoA in der Lage war RhoA-abhängige
Signalwege, wie z. B. die SRF-abhängige Gentranskription (siehe Abb. 27 C, Seite 98) zu
aktivieren, legen diese Daten nahe, dass die cGMP/cGKI-α induzierte Aktivierung von
RhoGEF17 tatsächlich in der Lage ist dem inhibitorischen Effekt von cGMP/cGKI auf die zelluläre
Aktivität von RhoA entgegen zu wirken und bei einem Überwiegen der RhoGEF17-vermittelten
RhoA-Aktivierung sogar in der Lage ist den Effekt von cGMP auf die zelluläre RhoA-Aktivität in
eine Stimulation umzuwandeln (siehe Abb. 26, Seite 95).
Die in dieser Arbeit nachgewiesene cGMP/cGKI-α/RhoGEF17-abhängige Aktivierung von RhoA
steht im Einklang mit einer Reihe von publizierten Studien, welche demonstrieren, dass die cGKI
zellspezifisch und unter bestimmten physiologischen Bedingungen nicht zu einer Inhibition der
RhoA-Aktivität führt. Beispielweise könnte dieser Mechanismus erklären, warum in einer Studie
von Gratacap und Mitarbeitern die durch das Thromboxan-Analogon U 46619 gesteigerte RhoAAktivierung in humanen Thrombozyten nicht durch cGMP gehemmt wird, obwohl in
Thrombozyten eine relativ große Menge an cGKI enthalten und deren Aktivität für die
antithrombotischen Effekte des NO/cGMP-Systems von zentraler Bedeutung ist (Gratacap et al.,
2001).
6.2.4
Die
ROCK-abhängige
Verstärkung
der
cGMP/cGKI-α-induzierten
RhoGEF17-
Aktivierung
Die Serin/Threonin-Kinasen ROCKI und ROCKII sind die am besten charakterisierten Effektoren
der monomeren GTPasen RhoA, RhoB und RhoC (Ishizaki et al., 1996; Sahai & Marshall, 2002).
ROCKs regulieren eine Vielzahl von fundamental wichtigen Zellfunktionen wie Kontraktion,
Motilität, Proliferation und Apoptose (Etienne-Manneville & Hall, 2002; Loirand et al., 2006).
Ebenso spielt eine gesteigerte Aktivierung des RhoA/ROCK-Signalwegs bei der Pathogenese
von bedeutenden kardiovaskulären Krankheiten, wie z. B. Arteriosklerose, kardialer Hypertrophie
und Bluthochdruck eine große Rolle (Noma et al., 2006; Loirand et al., 2006).
Erstaunlicherweise führte die akute Hemmung der ROCK-Aktivität mit dem ROCK-Inhibitor Y27632, welcher in vitro sowohl die ROCKI als auch die ROCKII mit einer ähnlichen
Inhibitionskonstante inhibiert (Ki=220 nM für ROCKI und 300 nM für ROCKII) (Ishizaki et al.,
2000), zu einer vollständigen Inhibition der cGMP/cGKI-α/RhoGEF17-abhängigen RhoAAktivierung. Da Y-27632 im mikromolaren Bereich andere Rho-Effektor-Kinasen wie die
Citronkinase (Ki=5,3 µM) und die Proteinkinase N (PKN) (Ki=3,1 µM) und bei Konzentrationen im
Diskussion
120
hohen mikromolaren Bereich auch andere ATP-abhängige Proteinkinasen, wie die PKC α, PKA
und MLCK inhibiert (Davies et al., 2000), wurde zur Verifizierung der ROCK-abhängigen
Inhibition der RhoGEF17- und cGMP/cGKI-α-abhängigen RhoA-Aktivierung der selektivere und
potentere ROCK-Inhibitor H1152-P eingesetzt (Ki-Wert=1,6 nM für ROCK) (Sasaki et al., 2002).
Die Verwendung von H1152-P führte ebenso wie die Behandlung der Zellen mit dem
unselektiveren ROCK-Inhibitor Y-27632 zum Verlust der RhoGEF17- und cGMP/cGKI-αabhängigen RhoA-Aktivierung.
In VSMC z. B. führte die Aktivierung von ROCK zu einer Hemmung der Aktivität der
Serin/Threonin-Proteinphosphatase MLCP (Hartshorne et al., 1998; Riddick et al., 2007).
Deshalb wurde untersucht, ob Serin/Threonin-Proteinphosphatase-Inhibitoren Einfluss auf die
RhoGEF17- und cGMP/cGKI-α-abhängige Aktivierung von RhoA nehmen. Tatsächlich führte
eine gleichzeitige Behandlung der Zellen mit dem ROCK-Inhibitor H-1152P sowie mit den
Serin/Threonin-Proteinphosphatase-Inhibitoren Okadainsäure und Calyculin A (Swingle et al.,
2007) zu einer kompletten Wiederherstellung der RhoGEF17- und cGMP/cGKI-α-abhängigen
RhoA-Aktivierung. Untersuchungen anderer Arbeitsgruppen belegen, dass die MLCP neben der
spezifischen Dephosphorylierung von Myosin (Hirano et al., 2004) noch andere zelluläre
Prozesse beeinflusst, wie z. B. die Regulation der Aktivität des N-Methyl-D-Aspartat-Rezeptors
(NMDAR) (Norenberg et al., 1999; Lei et al., 2001). Ebenso ist die MLCP möglicherweise an der
Anordnung des kortikalen Zytoskeletts an der Plasmamembran (Hirano et al., 2004) und an der
Regulation von Transportprozessen beteiligt (Wenthold et al., 2003a; Wenthold et al., 2003b).
Eine Beteiligung der MLCP an der Regulation von RhoGEF17 erscheint deshalb durchaus
möglich. Da jedoch die verwendeten Phosphatase-Inhibitoren nicht spezifisch für die MLCP
(PP1c) sind, sondern auch die Aktivität anderer Phosphatasen der Gruppe 1 sowie die
Proteinphosphatase 2A hemmen, ist mit dem hier gewählten Ansatz die Identifikation der
Phosphatase(n), die letztendlich für die Dephosphorylierung von RhoGEF17 unter ROCKKontrolle verantwortlich sind, nicht möglich. Die hier gezeigten Ergebnisse belegen jedoch, dass
sich die Aktivierung von RhoGEF17 durch cGMP/cGKI-α über eine RhoA/ROCK-vermittelte
Hemmung einer oder mehrerer Serin/Threonin-Phosphatase(n) selbst verstärkt. Dieser positive
Rückkopplungsmechanismus trägt sicher ebenfalls dazu bei, dass die cGMP/cGKI-α-abhängige
Inhibition der RhoA-Aktivierung in Abwesenheit von RhoGEF17 in eine cGMP/cGKI-α-abhängige
Aktivierung von RhoA in Anwesenheit ausreichender Mengen von RhoGEF17 umgelenkt werden
kann (siehe Abb. 26, Seite 95).
In Abbildung 39 ist der in dieser Arbeit vorgeschlagene RhoGEF17-Signalweg schematisch
dargestellt.
Diskussion
121
NO
ANP, BNP,
CNP, Guanylin
RhoA-GDP
NO-sensitive
GC
pGC
GTP
RhoA-GTP
RhoA-GDI
cGMP
5'-GMP
P
RhoA-GDP
PDE
ROCK
GTP
cGKI-α
GDP
P
Phosphatase
RhoGEF17
RhoGEF17
Phosphatase
Pi
Dephosphorylierung
bzw. Inaktivierung
Abb. 39: Schematische Darstellung des RhoGEF17-Signalwegs. Das RhoA-C spezifische
RhoGEF17 wird durch die cGKI-α spezifisch aktiviert. Diese Aktivierung setzt eine direkte Interaktion
beider Proteine voraus und beinhaltet eine koordinierte Phosphorylierung von RhoGEF17 sowie
möglicherweise von RhoA. Die cGKI-α/RhoGEF17-abhängige RhoA-Aktivierung unterliegt einem
positiven Rückkopplungsmechanismus, welcher von einer ROCK-vermittelten Inhibition einer oder
mehrerer Serin/Threonin-Proteinphosphatase(n) getragen wird. RhoGEF17 kann entweder durch
lösliche, NO-abhängige oder membranständige, durch natriuretische Peptide regulierte
Guanylylzyklasen aktiviert werden. Weitere Erläuterungen im Text. Abkürzungen: ANP („atrial
natriuretic peptide“), BNP („brain natriuretic peptide“), CNP („C-type natriuretic peptide“), NO
(Stickstoffmonoxid), GC (Guanylylzyklase), pGC (partikuläre GC), GTP (Guanosintriphosphat), GDP
(Guanosindiphosphat), cGMP (Guanosin-3',5'-zyklisches Monophosphat), PDE (Phosphodiesterase),
cGK (cGMP-abhängige Proteinkinase), GEF („guanine nucleotide exchange factor“), ROCK (RhoKinase), Pi (anorganisches Phosphat), P (Phosphat), Rho („Ras-homologous“).
6.2.5 Physiologische Relevanz von RhoGEF17
Im Rahmen dieser Arbeit konnte eine endogene Expression von RhoGEF17 in isolierten
glattmuskulären
Aortenzellen
der
Maus
bzw.
der
Ratte
nachgewiesen
werden.
In
immunhistologischen Färbungen der Rattenaorta konnte die Expression von RhoGEF17 in allen
Schichten der glatten Gefäßmuskulatur sowie zu einem geringeren Anteil im Endothel gezeigt
werden. Übereinstimmend mit der Literatur wurde ein kongruentes Expressionsmuster der cGKI
detektiert, wobei die Expression im Endothel deutlich schwächer war als in der glatten Muskulatur
(Keilbach et al., 1992; Draijer et al., 1995). Interessanterweise führte eine Stimulation von
kultivierten RASMC mit verschiedenen cGMP-Analoga bzw. eines NO-Donors zu einer
Diskussion
122
gesteigerten RhoA-Aktivierung, welche durch Inhibition der endogenen RhoGEF17-Expression
mit Hilfe des RhoGEF17-spezifischen shRNA-Adenovirus vollständig unterdrückt werden konnte.
Diese Daten deuten auf eine physiologische Bedeutung von RhoGEF17 in VSMC unter
bestimmten Bedingungen hin. Eine Reihe von RhoA/ROCK-abhängigen Prozessen in VSMC, wie
z. B. Migration, Proliferation und Kontraktion sind in der Literatur beschrieben worden (Rolfe et
al., 2005). Der RhoA/ROCK-Signalweg ist zudem als ein entscheidender Mechanismus
beschrieben worden, der in die Differenzierung der SMC durch die Regulation der SRFabhängigen Transkription eingreift (Owens, 1995; Mack et al., 2001; Miano, 2003; Liu et al.,
2003; Owens et al., 2004). Die cGMP/cGKI-α und RhoGEF17-abhängige RhoA-Aktivierung in
VSMC, könnte deshalb beim Wechsel vom kontraktilen zum proliferativen Phänotyp der VSMC
von zentraler Bedeutung sein.
Aktuelle Studien zeigen, dass die Aktivierung der cGKI, im Gegensatz zur generellen Situation,
unter bestimmten Bedingungen nur zu einer geringfügigen Relaxation der Gefäße führt. So zeigt
die cGKI nur einen kleinen inhibitorischen Effekt auf die Ca2+-Sensitisierung in permeabilisierten
murinen Aorten (Worner et al., 2007). Auch in pulmonalen, hypoxischen Gefäßen spielt die
cGMP/cGKI-abhängige Relaxation nur eine geringe Rolle (Gao et al., 2007; Oka et al., 2007).
Diese verminderte cGMP/cGKI-abhängige Relaxation geht mit einer erhöhten RhoA- bzw. ROCKAktivität einher (Gao et al., 2007; Nagaoka et al., 2006; Guilluy et al., 2005). Es ist davon
auszugehen, dass die gesteigerte ROCK-Aktivität zu eine verstärkten Phosphorylierung
spezifischer Threonine (T 696, T 853) von MYPT1 und damit verbunden, durch Aktivierung des
MLCP inhibitorischen Proteins CIP-17, zu einer deutlichen Hemmung der MLCP-Aktivität führt
(Abb. 40) (Feng et al., 1999; Somlyo & Somlyo, 2003; Wooldridge et al., 2004, Muranyi et al.,
2005; Dimopoulos et al., 2007). Wooldridge und Mitarbeiter konnten zeigen, dass eine ROCKabhängige Phosphorylierung von MYPT1 an den Threoninen 696 und 853 eine cGKI-abhängige
Phosphorylierung an den benachbarten Serinen 695 und 852 unterdrückt und dies mit einer
Hemmung der MLCP-Enzymaktivität bzw. einer Abschwächung der relaxierenden Wirkung der
cGKI einhergeht (Wooldridge et al., 2004) (Abb. 40). Eine mögliche Erklärung für die
abgeschwächte Relaxation, wie z. B. unter Hypoxie, wäre deshalb, dass eine verstärkte
Expression von RhoGEF17 über eine gesteigerte cGMP/cGKI-abhängige RhoA/ROCKAktivierung die MLCP-Aktivität hemmt und damit der cGMP/cGKI-induzierten Relaxation
entgegenwirkt (siehe Abb. 26, Seite 95). Der cGMP/cGKI/RhoGEF17-Signalweg könnte deshalb
zudem eine wichtige Rolle im Ausbalancieren der NO/cGMP-induzierten Relaxation der Gefäße
spielen und deshalb an der Pathogenese einer primären Hypertonie beteiligt sein.
Diskussion
123
NO
ANP, BNP,
CNP, Guanylin
NO-sensitive
GC
pGC
GTP
RhoA-GDP
RhoA-GTP
cGMP
P
P
RhoGEF17
cGKI
ROCK
P
P
S695 T696
MLCP
P
P
S852 T853
PP1c
MYPT1
M20
Vasorelaxation
CPI-17
Vasokontraktion
Abb. 40: Putativer Einfluss von cGKI und ROCK auf die MYPT1 Untereinheit der MLCP bzw. auf
den Gefäßtonus der glatten Muskulatur in Gegenwart von RhoGEF17. Eine gesteigerte ROCKAktivität führt zu einer verstärkten Phosphorylierung spezifischer Threonine (T 696, T 853) der
MYPT1-Untereinheit der MLCP und unterdrückt dadurch eine cGKI-abhängige Phosphorylierung an
den benachbarten Serinen 695 und 852. Die relaxierende Wirkung der cGKI wird damit
abgeschwächt. Weitere Erläuterungen im Text. Abkürzungen: ANP („atrial natriuretic peptide“), BNP
(„brain natriuretic peptide“), CNP („C-type natriuretic peptide“), NO (Stickstoffmonoxid), GC
(Guanylylzyklase), pGC (partikuläre GC), GTP (Guanosintriphosphat), GDP (Guanosindiphosphat),
cGMP (Guanosin-3',5'-zyklisches Monophosphat), cGK (cGMP-abhängige Proteinkinase), GEF
(„guanine nucleotide exchange factor“), ROCK (Rho-Kinase), MLCP (leichte MyosinkettenPhosphatase), MYPT1 (Myosin-bindende Untereinheit der leichten Myosinketten-Phosphatase), PP1C
(Proteinphosphatase 1C), M20 (Untereinheit von MLCP die an MYPT1 bindet, ohne bekannte
Funktion), CPI-17 (Proteinkinase C stimuliertes Myosin-Phosphatase Inhibitorprotein), P (Phosphat), S
(Serin), T (Threonin).
Diskussion
124
In isolierten Gefäßendothelzellen haben verschiedene Arbeiten eine VEGF-vermittelte cGMPErhöhung nachgewiesen (Kroll & Waltenberger, 1998), die mit einer Aktivierung von RhoA
einhergeht (Zeng et al., 2002b) und zudem wurde RhoGEF17 als ein Tumor-EndothelialMarkerprotein (TEM-4) beschrieben (Carson-Walter et al., 2001). Eine Beteiligung des
endothelialen RhoGEF17 bei der Migration (Zeng et al., 2002b), Proliferation (Zeng et al., 2002a)
bzw. Kontraktion (Bogatcheva et al., 2002) von Endothelzellen erscheint deshalb möglich. Daraus
ergeben sich putative Bedeutungen von RhoGEF17 für die Wundheilung (Aepfelbacher et al.,
1997), die Regulation der endothelialen Permeabilität oder die Angiogenese (Carbajal &
Schaeffer, 1999; Wojciak-Stothard & Ridley, 2002; Van Nieuw Amerongen et al., 2003).
Demnach könnte RhoGEF17 ein wichtiger Mediator in VSMC und Gefäßendothelzellen sein.
6.3 Ausblick
In der vorliegenden Arbeit wurden die Guaninnukleotid-Austauschfaktoren RhoGEF10 und
RhoGEF17 charakterisiert, sowie deren übergeordnete Regulation untersucht. Besonders die hier
identifizierte Aktivierung von RhoGEF17 über den cGMP/cGKI-Signalweg in VSMC und
Endothelzellen könnte von physiologischer bzw. pathophysiologischer Bedeutung sein. Um dies
zu klären sind zum einen Expressions- und zum anderen Funktionsstudien an Gefäßen von
Tiermodellen für eine endotheliale Dysfunktion bzw. primäre Hypertonie angezeigt. Eine weitere
jedoch aufwendigere Möglichkeit die physiologische Relevanz dieser GuaninnukleotidAustauschfaktoren näher zu untersuchen ist die Generierung von konventionellen und
konditionellen RhoGEF17 bzw. RhoGEF10 Knockout-Mäusen. Ein konditioneller Knockout z. B.
in VSMC bzw. Endothelzellen würde beispielsweise im Bezug auf den Gefäßtonus sowie auf die
Aufrechterhaltung des kontraktilen Phänotyps der glatten Muskulatur, der Hypertrophie, der
Angiogenese oder der Arteriosklerose Aufschluss über die Bedeutung dieser beiden
Guaninnukleotid-Austauschfaktoren geben können. Da solche Untersuchungen aber weit über
das Ziel der vorliegenden Arbeit hinausgehen, müssen sie zukünftigen Studien vorbehalten
bleiben.
Literaturverzeichnis
125
7. Literaturverzeichnis
Adamson, P., Marshall, C.J., Hall, A. und Tilbrook, P.A. (1992) Post-translational modifications of
p21rho proteins. J Biol Chem, 267: 20033-20038.
Aepfelbacher, M., Essler, M., Huber, E., Sugai, M. und Weber, P.C. (1997) Bacterial toxins block
endothelial wound repair. Evidence that Rho GTPases control cytoskeletal rearrangements in
migrating endothelial cells. Arterioscler Thromb Vasc Biol, 17: 1623-1629.
Aghazadeh, B., Lowry, W.E., Huang, X.Y. und Rosen, M.K. (2000) Structural basis for relief of
autoinhibition of the Dbl homology domain of proto-oncogene Vav by tyrosine phosphorylation.
Cell, 102: 625-633.
Aghazadeh, B., Zhu, K., Kubiseski, T.J., Liu, G.A., Pawson, T., Zheng, Y. und Rosen, M.K. (1998)
Structure and mutagenesis of the Dbl homology domain. Nat Struct Biol, 5: 1098-1107.
Ahmed, I., Calle, Y., Sayed, M.A., Kamal, J.M., Rengaswamy, P., Manser, E., Meiners, S. und Nur,
E.K.A. (2004) Cdc42-dependent nuclear translocation of non-receptor tyrosine kinase, ACK.
Biochem Biophys Res Commun, 314: 571-579.
Akiyama, S.K. (1996) Integrins in cell adhesion and signaling. Hum Cell, 9: 181-186.
Aktories, K., Braun, U., Rosener, S., Just, I. und Hall, A. (1989) The rho gene product expressed in E.
coli is a substrate of botulinum ADP-ribosyltransferase C3. Biochem Biophys Res Commun,
158: 209-213.
Aktories, K., Mohr, C. und Koch, G. (1992) Clostridium botulinum C3 ADP-ribosyltransferase. Curr Top
Microbiol Immunol, 175: 115-131.
Aktories, K., Schmidt, G. und Just, I. (2000) Rho GTPases as targets of bacterial protein toxins. Biol
Chem, 381: 421-426.
Alioua, A., Tanaka, Y., Wallner, M., Hofmann, F., Ruth, P., Meera, P. und Toro, L. (1998) The large
conductance, voltage-dependent, and calcium-sensitive K+ channel, Hslo, is a target of
cGMP-dependent protein kinase phosphorylation in vivo. J Biol Chem, 273: 32950-32956.
Anborgh, P.H., Qian, X., Papageorge, A.G., Vass, W.C., Declue, J.E. und Lowy, D.R. (1999) Rasspecific exchange factor GRF: oligomerization through its Dbl homology domain and calciumdependent activation of Raf. Mol Cell Biol, 19: 4611-4622.
Arber, W. (1978) Restriction endonucleases. Angew Chem Int Ed Engl, 17: 73-79.
Armstrong, S.A., Hannah, V.C., Goldstein, J.L. und Brown, M.S. (1995) CAAX geranylgeranyl
transferase transfers farnesyl as efficiently as geranylgeranyl to RhoB. J Biol Chem, 270:
7864-7868.
Arthur, W.T., Ellerbroek, S.M., Der, C.J., Burridge, K. und Wennerberg, K. (2002) XPLN, a guanine
nucleotide exchange factor for RhoA and RhoB, but not RhoC. J Biol Chem, 277: 4296442972.
Ashcroft, S.J. (1997) Intracellular second messengers. Adv Exp Med Biol, 426: 73-80.
Aspenstrom, P., Fransson, A. und Saras, J. (2004) Rho GTPases have diverse effects on the
organization of the actin filament system. Biochem J, 377: 327-337.
Literaturverzeichnis
126
Ayala, J., Olofsson, B., Touchot, N., Zahraoui, A., Tavitian, A. und Prochiantz, A. (1989)
Developmental and regional expression of three new members of the ras-gene family in the
mouse brain. J Neurosci Res, 22: 384-389.
Bar-Sagi, D. und Feramisco, J.R. (1986) Induction of membrane ruffling and fluid-phase pinocytosis in
quiescent fibroblasts by ras proteins. Science, 233: 1061-1068.
Beebe, S.J. (1994) The cAMP-dependent protein kinases and cAMP signal transduction. Semin
Cancer Biol, 5: 285-294.
Benard, V. und Bokoch, G.M. (2002) Assay of Cdc42, Rac, and Rho GTPase activation by affinity
methods. Methods Enzymol, 345: 349-359.
Bernards, A. und Settleman, J. (2004) GAP control: regulating the regulators of small GTPases.
Trends Cell Biol, 14: 377-385.
Berridge, M.J., Bootman, M.D. und Lipp, P. (1998) Calcium--a life and death signal. Nature, 395: 645648.
Berridge, M.J., Bootman, M.D. und Roderick, H.L. (2003) Calcium signalling: dynamics, homeostasis
and remodelling. Nat Rev Mol Cell Biol, 4: 517-529.
Bhattacharyya, R. und Wedegaertner, P.B. (2000) Galpha 13 requires palmitoylation for plasma
membrane localization, Rho-dependent signaling, and promotion of p115-RhoGEF membrane
binding. J Biol Chem, 275: 14992-14999.
Bi, F., Debreceni, B., Zhu, K., Salani, B., Eva, A. und Zheng, Y. (2001) Autoinhibition mechanism of
proto-Dbl. Mol Cell Biol, 21: 1463-1474.
Biel, M., Zong, X., Ludwig, A., Sautter, A. und Hofmann, F. (1999) Structure and function of cyclic
nucleotide-gated channels. Rev Physiol Biochem Pharmacol, 135: 151-171.
Bishop, A.L. und Hall, A. (2000) Rho GTPases and their effector proteins. Biochem J, 348 Pt 2: 241255.
Bogatcheva, N.V., Garcia, J.G. und Verin, A.D. (2002) Molecular mechanisms of thrombin-induced
endothelial cell permeability. Biochemistry (Mosc), 67: 75-84.
Bonnevier, J. und Arner, A. (2004) Actions downstream of cyclic GMP/protein kinase G can reverse
protein kinase C-mediated phosphorylation of CPI-17 and Ca(2+) sensitization in smooth
muscle. J Biol Chem, 279: 28998-29003.
Bonnevier, J., Fassler, R., Somlyo, A.P., Somlyo, A.V. und Arner, A. (2004) Modulation of Ca2+
sensitivity by cyclic nucleotides in smooth muscle from protein kinase G-deficient mice. J Biol
Chem, 279: 5146-5151.
Booden, M.A., Siderovski, D.P. und Der, C.J. (2002) Leukemia-associated Rho guanine nucleotide
exchange factor promotes G alpha q-coupled activation of RhoA. Mol Cell Biol, 22: 40534061.
Bootman, M.D., Berridge, M.J. und Roderick, H.L. (2002) Activating calcium release through inositol
1,4,5-trisphosphate receptors without inositol 1,4,5-trisphosphate. Proc Natl Acad Sci U S A,
99: 7320-7322.
Borodovsky, M. und Mcininch, J. (1993) Recognition of genes in DNA sequence with ambiguities.
Biosystems, 30: 161-171.
Bourne, H.R., Sanders, D.A. und Mccormick, F. (1991) The GTPase superfamily: conserved structure
and molecular mechanism. Nature, 349: 117-127.
Literaturverzeichnis
127
Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal Biochem, 72: 248-254.
Brasier, A.R. (2006) The NF-kappaB regulatory network. Cardiovasc Toxicol, 6: 111-130.
Bredt, D.S., Hwang, P.M. und Snyder, S.H. (1990) Localization of nitric oxide synthase indicating a
neural role for nitric oxide. Nature, 347: 768-770.
Bruckdorfer, R. (2005) The basics about nitric oxide. Mol Aspects Med, 26: 3-31.
Buday, L. und Downward, J. (1993) Epidermal growth factor regulates p21ras through the formation of
a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell, 73:
611-620.
Bustelo, X.R. (2000) Regulatory and signaling properties of the Vav family. Mol Cell Biol, 20: 14611477.
Bustelo, X.R., Crespo, P., Lopez-Barahona, M., Gutkind, J.S. und Barbacid, M. (1997) Cbl-b, a
member of the Sli-1/c-Cbl protein family, inhibits Vav-mediated c-Jun N-terminal kinase
activation. Oncogene, 15: 2511-2520.
Byers, H.R. und Fujiwara, K. (1982) Stress fibers in cells in situ: immunofluorescence visualization
with antiactin, antimyosin, and anti-alpha-actinin. J Cell Biol, 93: 804-811.
Carbajal, J.M. und Schaeffer, R.C., Jr. (1999) RhoA inactivation enhances endothelial barrier function.
Am J Physiol, 277: C955-964.
Carson-Walter, E.B., Watkins, D.N., Nanda, A., Vogelstein, B., Kinzler, K.W. und St Croix, B. (2001)
Cell surface tumor endothelial markers are conserved in mice and humans. Cancer Res, 61:
6649-6655.
Chai, J. und Tarnawski, A.S. (2002) Serum response factor: discovery, biochemistry, biological roles
and implications for tissue injury healing. J Physiol Pharmacol, 53: 147-157.
Chardin, P. (1988) The ras superfamily proteins. Biochimie, 70: 865-868.
Charest, P.G. und Firtel, R.A. (2007) Big roles for small GTPases in the control of directed cell
movement. Biochem J, 401: 377-390.
Chen, F.C., Ogut, O., Rhee, A.Y., Hoit, B.D. und Brozovich, F.V. (2006) Captopril prevents myosin
light chain phosphatase isoform switching to preserve normal cGMP-mediated vasodilatation.
J Mol Cell Cardiol, 41: 488-495.
Chen, R.H., Corbalan-Garcia, S. und Bar-Sagi, D. (1997) The role of the PH domain in the signaldependent membrane targeting of Sos. Embo J, 16: 1351-1359.
Cheng, L., Rossman, K.L., Mahon, G.M., Worthylake, D.K., Korus, M., Sondek, J. und Whitehead, I.P.
(2002) RhoGEF specificity mutants implicate RhoA as a target for Dbs transforming activity.
Mol Cell Biol, 22: 6895-6905.
Choudhury, N., Khromov, A.S., Somlyo, A.P. und Somlyo, A.V. (2004) Telokin mediates Ca2+desensitization through activation of myosin phosphatase in phasic and tonic smooth muscle.
J Muscle Res Cell Motil, 25: 657-665.
Chrisman, T.D., Garbers, D.L., Parks, M.A. und Hardman, J.G. (1975) Characterization of particulate
and soluble guanylate cyclases from rat lung. J Biol Chem, 250: 374-381.
Christensen, L.F., Meyer, R.B., Jr., Miller, J.P., Simon, L.N. und Robins, R.K. (1975) Synthesis and
enzymic activity of 8-acyl and 8-alkyl derivatives of guanosine 3, 5-cyclic phosphate.
Biochemistry, 14: 1490-1496.
Literaturverzeichnis
128
Chrzanowska-Wodnicka, M. und Burridge, K. (1992) Rho, rac and the actin cytoskeleton. Bioessays,
14: 777-778.
Cicha, I., Schneiderhan-Marra, N., Yilmaz, A., Garlichs, C.D. und Goppelt-Struebe, M. (2004)
Monitoring the cellular effects of HMG-CoA reductase inhibitors in vitro and ex vivo.
Arterioscler Thromb Vasc Biol, 24: 2046-2050.
Coleman, M.L. und Olson, M.F. (2002) Rho GTPase signalling pathways in the morphological
changes associated with apoptosis. Cell Death Differ, 9: 493-504.
Colicelli, J. (2004) Human RAS superfamily proteins and related GTPases. Sci STKE, 2004: RE13.
Cornwell, T.L., Arnold, E., Boerth, N.J. und Lincoln, T.M. (1994) Inhibition of smooth muscle cell
growth by nitric oxide and activation of cAMP-dependent protein kinase by cGMP. Am J
Physiol, 267: C1405-1413.
Cox, D., Chang, P., Zhang, Q., Reddy, P.G., Bokoch, G.M. und Greenberg, S. (1997) Requirements
for both Rac1 and Cdc42 in membrane ruffling and phagocytosis in leukocytes. J Exp Med,
186: 1487-1494.
Crespo, P., Schuebel, K.E., Ostrom, A.A., Gutkind, J.S. und Bustelo, X.R. (1997) Phosphotyrosinedependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product.
Nature, 385: 169-172.
Cryer, D.R., Eccleshall, R. und Marmur, J. (1975) Isolation of yeast DNA. Methods Cell Biol, 12: 39-44.
Curtis, C., Hemmeryckx, B., Haataja, L., Senadheera, D., Groffen, J. und Heisterkamp, N. (2004)
Scambio, a novel guanine nucleotide exchange factor for Rho. Mol Cancer, 3: 10.
Das, B., Shu, X., Day, G.J., Han, J., Krishna, U.M., Falck, J.R. und Broek, D. (2000) Control of
intramolecular interactions between the pleckstrin homology and Dbl homology domains of
Vav and Sos1 regulates Rac binding. J Biol Chem, 275: 15074-15081.
Davies, S.P., Reddy, H., Caivano, M. und Cohen, P. (2000) Specificity and mechanism of action of
some commonly used protein kinase inhibitors. Biochem J, 351: 95-105.
De Hoog, C.L., Koehler, J.A., Goldstein, M.D., Taylor, P., Figeys, D. und Moran, M.F. (2001) Ras
binding triggers ubiquitination of the Ras exchange factor Ras-GRF2. Mol Cell Biol, 21: 21072117.
De Sepulveda, P., Ilangumaran, S. und Rottapel, R. (2000) Suppressor of cytokine signaling-1 inhibits
VAV function through protein degradation. J Biol Chem, 275: 14005-14008.
Deng, J.T., Van Lierop, J.E., Sutherland, C. und Walsh, M.P. (2001) Ca2+-independent smooth muscle
contraction. a novel function for integrin-linked kinase. J Biol Chem, 276: 16365-16373.
Dillon, S.T., Rubin, E.J., Yakubovich, M., Pothoulakis, C., Lamont, J.T., Feig, L.A. und Gilbert, R.J.
(1995) Involvement of Ras-related Rho proteins in the mechanisms of action of Clostridium
difficile toxin A and toxin B. Infect Immun, 63: 1421-1426.
Dimopoulos, G.J., Semba, S., Kitazawa, K., Eto, M. und Kitazawa, T. (2007) Ca2+-dependent rapid
Ca2+ sensitization of contraction in arterial smooth muscle. Circ Res, 100: 121-129.
Disanza, A., Steffen, A., Hertzog, M., Frittoli, E., Rottner, K. und Scita, G. (2005) Actin polymerization
machinery: the finish line of signaling networks, the starting point of cellular movement. Cell
Mol Life Sci, 62: 955-970.
Diviani, D., Abuin, L., Cotecchia, S. und Pansier, L. (2004) Anchoring of both PKA and 14-3-3 inhibits
the Rho-GEF activity of the AKAP-Lbc signaling complex. Embo J, 23: 2811-2820.
Literaturverzeichnis
129
Dong, J.M., Leung, T., Manser, E. und Lim, L. (1998) cAMP-induced morphological changes are
counteracted by the activated RhoA small GTPase and the Rho kinase ROKalpha. J Biol
Chem, 273: 22554-22562.
Dovas, A. und Couchman, J.R. (2005) RhoGDI: multiple functions in the regulation of Rho family
GTPase activities. Biochem J, 390: 1-9.
Draijer, R., Vaandrager, A.B., Nolte, C., De Jonge, H.R., Walter, U. und Van Hinsbergh, V.W. (1995)
Expression of cGMP-dependent protein kinase I and phosphorylation of its substrate,
vasodilator-stimulated phosphoprotein, in human endothelial cells of different origin. Circ Res,
77: 897-905.
Dransart, E., Olofsson, B. und Cherfils, J. (2005) RhoGDIs revisited: novel roles in Rho regulation.
Traffic, 6: 957-966.
Eckert, L.B., Repasky, G.A., Ulku, A.S., Mcfall, A., Zhou, H., Sartor, C.I. und Der, C.J. (2004)
Involvement of Ras activation in human breast cancer cell signaling, invasion, and anoikis.
Cancer Res, 64: 4585-4592.
Ellerbroek, S.M., Wennerberg, K. und Burridge, K. (2003) Serine phosphorylation negatively regulates
RhoA in vivo. J Biol Chem, 278: 19023-19031.
Elliot-Smith, A.E., Mott, H.R., Lowe, P.N., Laue, E.D. und Owen, D. (2005) Specificity determinants on
Cdc42 for binding its effector protein ACK. Biochemistry, 44: 12373-12383.
Ellis, S. und Mellor, H. (2000) Regulation of endocytic traffic by rho family GTPases. Trends Cell Biol,
10: 85-88.
Etienne-Manneville, S. und Hall, A. (2002) Rho GTPases in cell biology. Nature, 420: 629-635.
Eto, M., Ohmori, T., Suzuki, M., Furuya, K. und Morita, F. (1995) A novel protein phosphatase-1
inhibitory protein potentiated by protein kinase C. Isolation from porcine aorta media and
characterization. J Biochem (Tokyo), 118: 1104-1107.
Eva, A. und Aaronson, S.A. (1985) Isolation of a new human oncogene from a diffuse B-cell
lymphoma. Nature, 316: 273-275.
Feil, R., Lohmann, S.M., De Jonge, H., Walter, U. und Hofmann, F. (2003) Cyclic GMP-dependent
protein kinases and the cardiovascular system: insights from genetically modified mice. Circ
Res, 93: 907-916.
Feng, J., Ito, M., Ichikawa, K., Isaka, N., Nishikawa, M., Hartshorne, D.J. und Nakano, T. (1999)
Inhibitory phosphorylation site for Rho-associated kinase on smooth muscle myosin
phosphatase. J Biol Chem, 274: 37385-37390.
Feramisco, J.R., Gross, M., Kamata, T., Rosenberg, M. und Sweet, R.W. (1984) Microinjection of the
oncogene form of the human H-ras (T-24) protein results in rapid proliferation of quiescent
cells. Cell, 38: 109-117.
Ferguson, K.M., Lemmon, M.A., Sigler, P.B. und Schlessinger, J. (1995) Scratching the surface with
the PH domain. Nat Struct Biol, 2: 715-718.
Fernandez-Sarabia, M.J. und Bischoff, J.R. (1993) Bcl-2 associates with the ras-related protein R-ras
p23. Nature, 366: 274-275.
Filtz, T.M. und Niibori, Y. (2004) Desensitization of angiotensin-stimulated inositol phosphate
accumulation in human vascular smooth muscle cells. Eur J Pharmacol, 502: 11-19.
Literaturverzeichnis
130
Forget, M.A., Desrosiers, R.R., Gingras, D. und Beliveau, R. (2002) Phosphorylation states of Cdc42
and RhoA regulate their interactions with Rho GDP dissociation inhibitor and their extraction
from biological membranes. Biochem J, 361: 243-254.
Francis, S.H. und Corbin, J.D. (1999) Cyclic nucleotide-dependent protein kinases: intracellular
receptors for cAMP and cGMP action. Crit Rev Clin Lab Sci, 36: 275-328.
Francis, S.H., Woodford, T.A., Wolfe, L. und Corbin, J.D. (1988) Types I alpha and I beta isozymes of
cGMP-dependent protein kinase: alternative mRNA splicing may produce different inhibitory
domains. Second Messengers Phosphoproteins, 12: 301-310.
Fransson, A., Ruusala, A. und Aspenstrom, P. (2003) Atypical Rho GTPases have roles in
mitochondrial homeostasis and apoptosis. J Biol Chem, 278: 6495-6502.
Fukao, M., Mason, H.S., Britton, F.C., Kenyon, J.L., Horowitz, B. und Keef, K.D. (1999) Cyclic GMPdependent protein kinase activates cloned BKCa channels expressed in mammalian cells by
direct phosphorylation at serine 1072. J Biol Chem, 274: 10927-10935.
Fukata, Y., Amano, M. und Kaibuchi, K. (2001) Rho-Rho-kinase pathway in smooth muscle
contraction and cytoskeletal reorganization of non-muscle cells. Trends Pharmacol Sci, 22:
32-39.
Fukuhara, S., Chikumi, H. und Gutkind, J.S. (2000) Leukemia-associated Rho guanine nucleotide
exchange factor (LARG) links heterotrimeric G proteins of the G(12) family to Rho. FEBS Lett,
485: 183-188.
Fukuhara, S., Murga, C., Zohar, M., Igishi, T. und Gutkind, J.S. (1999) A novel PDZ domain containing
guanine nucleotide exchange factor links heterotrimeric G proteins to Rho. J Biol Chem, 274:
5868-5879.
Fukumoto, Y., Kaibuchi, K., Hori, Y., Fujioka, H., Araki, S., Ueda, T., Kikuchi, A. und Takai, Y. (1990)
Molecular cloning and characterization of a novel type of regulatory protein (GDI) for the rho
proteins, ras p21-like small GTP-binding proteins. Oncogene, 5: 1321-1328.
Furchgott, R.F. und Zawadzki, J.V. (1980) The obligatory role of endothelial cells in the relaxation of
arterial smooth muscle by acetylcholine. Nature, 288: 373-376.
Gale, N.W., Kaplan, S., Lowenstein, E.J., Schlessinger, J. und Bar-Sagi, D. (1993) Grb2 mediates the
EGF-dependent activation of guanine nucleotide exchange on Ras. Nature, 363: 88-92.
Galisteo, M.L., Yang, Y., Urena, J. und Schlessinger, J. (2006) Activation of the nonreceptor protein
tyrosine kinase Ack by multiple extracellular stimuli. Proc Natl Acad Sci U S A, 103: 97969801.
Gampel, A., Parker, P.J. und Mellor, H. (1999) Regulation of epidermal growth factor receptor traffic by
the small GTPase rhoB. Curr Biol, 9: 955-958.
Gao, Y., Portugal, A.D., Negash, S., Zhou, W., Longo, L.D. und Usha Raj, J. (2007) Role of Rho
kinases in PKG-mediated relaxation of pulmonary arteries of fetal lambs exposed to chronic
high altitude hypoxia. Am J Physiol Lung Cell Mol Physiol, 292: L678-684.
Garbers, D.L., Chrisman, T.D., Wiegn, P., Katafuchi, T., Albanesi, J.P., Bielinski, V., Barylko, B.,
Redfield, M.M. und Burnett, J.C., Jr. (2006) Membrane guanylyl cyclase receptors: an update.
Trends Endocrinol Metab, 17: 251-258.
Garcia-Mata, R. und Burridge, K. (2007) Catching a GEF by its tail. Trends Cell Biol, 17: 36-43.
Gardner, A.M., Vaillancourt, R.R. und Johnson, G.L. (1993) Activation of mitogen-activated protein
kinase/extracellular signal-regulated kinase kinase by G protein and tyrosine kinase
oncoproteins. J Biol Chem, 268: 17896-17901.
Literaturverzeichnis
131
Garg, U.C. und Hassid, A. (1989) Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine
monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle
cells. J Clin Invest, 83: 1774-1777.
Geiselhoringer, A., Werner, M., Sigl, K., Smital, P., Worner, R., Acheo, L., Stieber, J., Weinmeister, P.,
Feil, R., Feil, S., Wegener, J., Hofmann, F. und Schlossmann, J. (2004) IRAG is essential for
relaxation of receptor-triggered smooth muscle contraction by cGMP kinase. Embo J, 23:
4222-4231.
Geller, D.A., Lowenstein, C.J., Shapiro, R.A., Nussler, A.K., Di Silvio, M., Wang, S.C., Nakayama,
D.K., Simmons, R.L., Snyder, S.H. und Billiar, T.R. (1993) Molecular cloning and expression
of inducible nitric oxide synthase from human hepatocytes. Proc Natl Acad Sci U S A, 90:
3491-3495.
Geneste, O., Copeland, J.W. und Treisman, R. (2002) LIM kinase and Diaphanous cooperate to
regulate serum response factor and actin dynamics. J Cell Biol, 157: 831- 838.
Germani, A., Romero, F., Houlard, M., Camonis, J., Gisselbrecht, S., Fischer, S. und Varin-Blank, N.
(1999) hSiah2 is a new Vav binding protein which inhibits Vav-mediated signaling pathways.
Mol Cell Biol, 19: 3798-3807.
Ghomashchi, F., Zhang, X., Liu, L. und Gelb, M.H. (1995) Binding of prenylated and polybasic
peptides to membranes: affinities and intervesicle exchange. Biochemistry, 34: 11910-11918.
Gill, G.N., Holdy, K.E., Walton, G.M. und Kanstein, C.B. (1976) Purification and characterization of
3':5'-cyclic GMP-dependent protein kinase. Proc Natl Acad Sci U S A, 73: 3918-3922.
Glass, D.B. und Krebs, E.G. (1979) Comparison of the substrate specificity of adenosine 3':5'monophosphate- and guanosine 3':5'-monophosphate-dependent protein kinases. Kinetic
studies using synthetic peptides corresponding to phosphorylation sites in histone H2B. J Biol
Chem, 254: 9728-9738.
Glass, D.B. und Krebs, E.G. (1980) Protein phosphorylation catalyzed by cyclic AMP-dependent and
cyclic GMP-dependent protein kinases. Annu Rev Pharmacol Toxicol, 20: 363-388.
Gohla, A., Schultz, G. und Offermanns, S. (2000) Role for G(12)/G(13) in agonist-induced vascular
smooth muscle cell contraction. Circ Res, 87: 221-227.
Golombek, D.A., Agostino, P.V., Plano, S.A. und Ferreyra, G.A. (2004) Signaling in the mammalian
circadian clock: the NO/cGMP pathway. Neurochem Int, 45: 929-936.
Gomes, E.R., Jani, S. und Gundersen, G.G. (2005) Nuclear movement regulated by Cdc42, MRCK,
myosin, and actin flow establishes MTOC polarization in migrating cells. Cell, 121: 451-463.
Graham, F.L., Smiley, J., Russell, W.C. und Nairn, R. (1977) Characteristics of a human cell line
transformed by DNA from human adenovirus type 5. J Gen Virol, 36: 59-74.
Gratacap, M.P., Payrastre, B., Nieswandt, B. und Offermanns, S. (2001) Differential regulation of Rho
and Rac through heterotrimeric G-proteins and cyclic nucleotides. J Biol Chem, 276: 4790647913.
Gross, S.S., Stuehr, D.J., Aisaka, K., Jaffe, E.A., Levi, R. und Griffith, O.W. (1990) Macrophage and
endothelial cell nitric oxide synthesis: cell-type selective inhibition by NG-aminoarginine, NGnitroarginine and NG-methylarginine. Biochem Biophys Res Commun, 170: 96-103.
Grosshans, B.L., Ortiz, D. und Novick, P. (2006) Rabs and their effectors: achieving specificity in
membrane traffic. Proc Natl Acad Sci U S A, 103: 11821-11827.
Literaturverzeichnis
132
Gudi, T., Chen, J.C., Casteel, D.E., Seasholtz, T.M., Boss, G.R. und Pilz, R.B. (2002) cGMPdependent protein kinase inhibits serum-response element-dependent transcription by
inhibiting rho activation and functions. J Biol Chem, 277: 37382-37393.
Guilluy, C., Sauzeau, V., Rolli-Derkinderen, M., Guerin, P., Sagan, C., Pacaud, P. und Loirand, G.
(2005) Inhibition of RhoA/Rho kinase pathway is involved in the beneficial effect of sildenafil
on pulmonary hypertension. Br J Pharmacol, 146: 1010-1018.
Hackam, D.J., Rotstein, O.D., Schreiber, A., Zhang, W. und Grinstein, S. (1997) Rho is required for
the initiation of calcium signaling and phagocytosis by Fcgamma receptors in macrophages. J
Exp Med, 186: 955-966.
Hakoshima, T., Shimizu, T. und Maesaki, R. (2003) Structural basis of the Rho GTPase signaling. J
Biochem (Tokyo), 134: 327-331.
Hall, A. (1998) Rho GTPases and the actin cytoskeleton. Science, 279: 509-514.
Han, J., Luby-Phelps, K., Das, B., Shu, X., Xia, Y., Mosteller, R.D., Krishna, U.M., Falck, J.R., White,
M.A. und Broek, D. (1998) Role of substrates and products of PI 3-kinase in regulating
activation of Rac-related guanosine triphosphatases by Vav. Science, 279: 558-560.
Hanafy, K.A., Krumenacker, J.S. und Murad, F. (2001) NO, nitrotyrosine, and cyclic GMP in signal
transduction. Med Sci Monit, 7: 801-819.
Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol, 166: 557580.
Hancock, J.F., Magee, A.I., Childs, J.E. und Marshall, C.J. (1989) All ras proteins are
polyisoprenylated but only some are palmitoylated. Cell, 57: 1167-1177.
Harlan, J.E., Hajduk, P.J., Yoon, H.S. und Fesik, S.W. (1994) Pleckstrin homology domains bind to
phosphatidylinositol-4,5-bisphosphate. Nature, 371: 168-170.
Hart, M.J., Jiang, X., Kozasa, T., Roscoe, W., Singer, W.D., Gilman, A.G., Sternweis, P.C. und Bollag,
G. (1998) Direct stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by
Galpha13. Science, 280: 2112-2114.
Hartshorne, D.J. (1998) Myosin phosphatase: subunits and interactions. Acta Physiol Scand, 164:
483-493.
Hartshorne, D.J., Ito, M. und Erdodi, F. (1998) Myosin light chain phosphatase: subunit composition,
interactions and regulation. J Muscle Res Cell Motil, 19: 325-341.
Haslam, R.J., Koide, H.B. und Hemmings, B.A. (1993) Pleckstrin domain homology. Nature, 363: 309310.
He, T.C., Zhou, S., Da Costa, L.T., Yu, J., Kinzler, K.W. und Vogelstein, B. (1998) A simplified system
for generating recombinant adenoviruses. Proc Natl Acad Sci U S A, 95: 2509-2514.
Hecker, M., Walsh, D.T. und Vane, J.R. (1991) On the substrate specificity of nitric oxide synthase.
FEBS Lett, 294: 221-224.
Hepler, J.R. (1999) Emerging roles for RGS proteins in cell signalling. Trends Pharmacol Sci, 20: 376382.
Hill, C.S., Wynne, J. und Treisman, R. (1995) The Rho family GTPases RhoA, Rac1, and CDC42Hs
regulate transcriptional activation by SRF. Cell, 81: 1159-1170.
Hirano, K., Hirano, M. und Kanaide, H. (2004) Regulation of myosin phosphorylation and myofilament
Ca2+ sensitivity in vascular smooth muscle. J Smooth Muscle Res, 40: 219-236.
Literaturverzeichnis
133
Hirokawa, T., Boon-Chieng, S. und Mitaku, S. (1998) SOSUI: classification and secondary structure
prediction system for membrane proteins. Bioinformatics, 14: 378-379.
Hisatsune, C., Nakamura, K., Kuroda, Y., Nakamura, T. und Mikoshiba, K. (2005) Amplification of Ca2+
signaling by diacylglycerol-mediated inositol 1,4,5-trisphosphate production. J Biol Chem, 280:
11723-11730.
Hofmann, F. (2005) The biology of cyclic GMP-dependent protein kinases. J Biol Chem, 280: 1-4.
Hofmann, F., Ammendola, A. und Schlossmann, J. (2000) Rising behind NO: cGMP-dependent
protein kinases. J Cell Sci, 113 ( Pt 10): 1671-1676.
Hofmann, F., Feil, R., Kleppisch, T. und Schlossmann, J. (2006) Function of cGMP-dependent protein
kinases as revealed by gene deletion. Physiol Rev, 86: 1-23.
Hofmann, F., Gensheimer, H.P. und Gobel, C. (1985) cGMP-dependent protein kinase.
Autophosphorylation changes the characteristics of binding site 1. Eur J Biochem, 147: 361365.
Hofmann, F. und Sold, G. (1972) A protein kinase activity from rat cerebellum stimulated by
guanosine-3':5'-monophosphate. Biochem Biophys Res Commun, 49: 1100-1107.
Hori, Y., Kikuchi, A., Isomura, M., Katayama, M., Miura, Y., Fujioka, H., Kaibuchi, K. und Takai, Y.
(1991) Post-translational modifications of the C-terminal region of the rho protein are important
for its interaction with membranes and the stimulatory and inhibitory GDP/GTP exchange
proteins. Oncogene, 6: 515-522.
Ignarro, L.J., Buga, G.M., Wood, K.S., Byrns, R.E. und Chaudhuri, G. (1987) Endothelium-derived
relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci
U S A, 84: 9265- 9269.
Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A., Fujita, A., Watanabe, N., Saito, Y.,
Kakizuka, A., Morii, N. und Narumiya, S. (1996) The small GTP-binding protein Rho binds to
and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase.
Embo J, 15: 1885-1893.
Ishizaki, T., Uehata, M., Tamechika, I., Keel, J., Nonomura, K., Maekawa, M. und Narumiya, S. (2000)
Pharmacological properties of Y-27632, a specific inhibitor of rho-associated kinases. Mol
Pharmacol, 57: 976-983.
Isomura, M., Kaibuchi, K., Yamamoto, T., Kawamura, S., Katayama, M. und Takai, Y. (1990) Partial
purification and characterization of GDP dissociation stimulator (GDS) for the rho proteins
from bovine brain cytosol. Biochem Biophys Res Commun, 169: 652-659.
Ito, M., Dabrowska, R., Guerriero, V., Jr. und Hartshorne, D.J. (1989) Identification in turkey gizzard of
an acidic protein related to the C-terminal portion of smooth muscle myosin light chain kinase.
J Biol Chem, 264: 13971- 13974.
Ito, M., Nakano, T., Erdodi, F. und Hartshorne, D.J. (2004) Myosin phosphatase: structure, regulation
and function. Mol Cell Biochem, 259: 197-209.
Jacinto, A. und Wolpert, L. (2001) Filopodia. Curr Biol, 11: R634.
Jaffe, A.B. und Hall, A. (2005) Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol, 21:
247-269.
Jarchau, T., Hausler, C., Markert, T., Pohler, D., Vanderkerckhove, J., De Jonge, H.R., Lohmann, S.M.
und Walter, U. (1994) Cloning, expression, and in situ localization of rat intestinal cGMPdependent protein kinase II. Proc Natl Acad Sci U S A, 91: 9426-9430.
Literaturverzeichnis
134
Jiang, K., Delarue, F.L. und Sebti, S.M. (2004) EGFR, ErbB2 and Ras but not Src suppress RhoB
expression while ectopic expression of RhoB antagonizes oncogene-mediated transformation.
Oncogene, 23: 1136-1145.
Jimenez, B., Arends, M., Esteve, P., Perona, R., Sanchez, R., Ramon Y Cajal, S., Wyllie, A. und
Lacal, J.C. (1995) Induction of apoptosis in NIH3T3 cells after serum deprivation by
overexpression of rho-p21, a GTPase protein of the ras superfamily. Oncogene, 10: 811-816.
Joberty, G., Petersen, C., Gao, L. und Macara, I.G. (2000) The cell-polarity protein Par6 links Par3
and atypical protein kinase C to Cdc42. Nat Cell Biol, 2: 531-539.
Jones, G.E., Allen, W.E. und Ridley, A.J. (1998) The Rho GTPases in macrophage motility and
chemotaxis. Cell Adhes Commun, 6: 237-245.
Just, I., Fritz, G., Aktories, K., Giry, M., Popoff, M.R., Boquet, P., Hegenbarth, S. und Von EichelStreiber, C. (1994) Clostridium difficile toxin B acts on the GTP-binding protein Rho. J Biol
Chem, 269: 10706-10712.
Just, I., Wilm, M., Selzer, J., Rex, G., Von Eichel-Streiber, C., Mann, M. und Aktories, K. (1995) The
enterotoxin from Clostridium difficile (ToxA) monoglucosylates the Rho proteins. J Biol Chem,
270: 13932-13936.
Kadowaki, T., Goldfarb, D., Spitz, L.M., Tartakoff, A.M. und Ohno, M. (1993) Regulation of RNA
processing and transport by a nuclear guanine nucleotide release protein and members of the
Ras superfamily. Embo J, 12: 2929-2937.
Kahn, R.A., Goddard, C. und Newkirk, M. (1988) Chemical and immunological characterization of the
21-kDa ADP-ribosylation factor of adenylate cyclase. J Biol Chem, 263: 8282- 8287.
Karnoub, A.E., Worthylake, D.K., Rossman, K.L., Pruitt, W.M., Campbell, S.L., Sondek, J. und Der,
C.J. (2001) Molecular basis for Rac1 recognition by guanine nucleotide exchange factors. Nat
Struct Biol, 8: 1037-1041.
Katsuki, S., Arnold, W., Mittal, C. und Murad, F. (1977) Stimulation of guanylate cyclase by sodium
nitroprusside, nitroglycerin and nitric oxide in various tissue preparations and comparison to
the effects of sodium azide and hydroxylamine. J Cyclic Nucleotide Res, 3: 23-35.
Kawano, Y., Fukata, Y., Oshiro, N., Amano, M., Nakamura, T., Ito, M., Matsumura, F., Inagaki, M. und
Kaibuchi, K. (1999) Phosphorylation of myosin-binding subunit (MBS) of myosin phosphatase
by Rho-kinase in vivo. J Cell Biol, 147: 1023-1038.
Keilbach, A., Ruth, P. und Hofmann, F. (1992) Detection of cGMP dependent protein kinase isozymes
by specific antibodies. Eur J Biochem, 208: 467-473.
Khosravi-Far, R., Lutz, R.J., Cox, A.D., Conroy, L., Bourne, J.R., Sinensky, M., Balch, W.E., Buss, J.E.
und Der, C.J. (1991) Isoprenoid modification of rab proteins terminating in CC or CXC motifs.
Proc Natl Acad Sci U S A, 88: 6264-6268.
Kimura, K., Ito, M., Amano, M., Chihara, K., Fukata, Y., Nakafuku, M., Yamamori, B., Feng, J.,
Nakano, T., Okawa, K., Iwamatsu, A. und Kaibuchi, K. (1996) Regulation of myosin
phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science, 273: 245-248.
Kitazawa, T., Eto, M., Woodsome, T.P. und Brautigan, D.L. (2000) Agonists trigger G protein-mediated
activation of the CPI-17 inhibitor phosphoprotein of myosin light chain phosphatase to
enhance vascular smooth muscle contractility. J Biol Chem, 275: 9897-9900.
Kitazawa, T., Eto, M., Woodsome, T.P. und Khalequzzaman, M. (2003) Phosphorylation of the myosin
phosphatase targeting subunit and CPI-17 during Ca2+ sensitization in rabbit smooth muscle.
J Physiol, 546: 879-889.
Literaturverzeichnis
135
Kitazawa, T., Polzin, A.N. und Eto, M. (2004) CPI-17-deficient smooth muscle of chicken. J Physiol,
557: 515-528.
Kobialka, M. und Gorczyca, W.A. (2000) Particulate guanylyl cyclases: multiple mechanisms of
activation. Acta Biochim Pol, 47: 517-528.
Koesling, D., Russwurm, M., Mergia, E., Mullershausen, F. und Friebe, A. (2004) Nitric oxide-sensitive
guanylyl cyclase: structure and regulation. Neurochem Int, 45: 813-819.
Koyama, M., Ito, M., Feng, J., Seko, T., Shiraki, K., Takase, K., Hartshorne, D.J. und Nakano, T.
(2000) Phosphorylation of CPI-17, an inhibitory phosphoprotein of smooth muscle myosin
phosphatase, by Rho-kinase. FEBS Lett, 475: 197-200.
Kozasa, T. (2001) Regulation of G protein-mediated signal transduction by RGS proteins. Life Sci, 68:
2309-2317.
Kozasa, T., Jiang, X., Hart, M.J., Sternweis, P.M., Singer, W.D., Gilman, A.G., Bollag, G. und
Sternweis, P.C. (1998) p115 RhoGEF, a GTPase activating protein for Galpha12 and
Galpha13. Science, 280: 2109-2111.
Kroll, J. und Waltenberger, J. (1998) VEGF-A induces expression of eNOS and iNOS in endothelial
cells via VEGF receptor-2 (KDR). Biochem Biophys Res Commun, 252: 743-746.
Kumar, R., Joyner, R.W., Komalavilas, P. und Lincoln, T.M. (1999) Analysis of expression of cGMPdependent protein kinase in rabbit heart cells. J Pharmacol Exp Ther, 291: 967-975.
Kwak, J.Y. und Uhlinger, D.J. (2000) Downregulation of phospholipase D by protein kinase A in a cellfree system of human neutrophils. Biochem Biophys Res Commun, 267: 305-310.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature, 227: 680-685.
Lancaster, C.A., Taylor-Harris, P.M., Self, A.J., Brill, S., Van Erp, H.E. und Hall, A. (1994)
Characterization of rhoGAP. A GTPase-activating protein for rho-related small GTPases. J
Biol Chem, 269: 1137-1142.
Landgraf, W., Hofmann, F., Pelton, J.T. und Huggins, J.P. (1990) Effects of cyclic GMP on the
secondary structure of cyclic GMP dependent protein kinase and analysis of the enzyme's
amino-terminal domain by far-ultraviolet circular dichroism. Biochemistry, 29: 9921-9928.
Lane, K.T. und Beese, L.S. (2006) Thematic review series: lipid posttranslational modifications.
Structural biology of protein farnesyltransferase and geranylgeranyltransferase type I. J Lipid
Res, 47: 681-699.
Lang, P., Gesbert, F., Delespine-Carmagnat, M., Stancou, R., Pouchelet, M. und Bertoglio, J. (1996)
Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects
of cyclic AMP in cytotoxic lymphocytes. Embo J, 15: 510-519.
Laudanna, C., Campbell, J.J. und Butcher, E.C. (1997) Elevation of intracellular cAMP inhibits RhoA
activation and integrin-dependent leukocyte adhesion induced by chemoattractants. J Biol
Chem, 272: 24141-24144.
Lee, M.R., Li, L. und Kitazawa, T. (1997) Cyclic GMP causes Ca2+ desensitization in vascular smooth
muscle by activating the myosin light chain phosphatase. J Biol Chem, 272: 5063-5068.
Lei, S., Czerwinska, E., Czerwinski, W., Walsh, M.P. und Macdonald, J.F. (2001) Regulation of NMDA
receptor activity by F-actin and myosin light chain kinase. J Neurosci, 21: 8464- 8472.
Lemmon, M.A. (2004) Pleckstrin homology domains: not just for phosphoinositides. Biochem Soc
Trans, 32: 707-711.
Literaturverzeichnis
136
Li, R., Zhang, B. und Zheng, Y. (1997) Structural determinants required for the interaction between
Rho GTPase and the GTPase-activating domain of p190. J Biol Chem, 272: 32830-32835.
Liu, A.X., Rane, N., Liu, J.P. und Prendergast, G.C. (2001) RhoB is dispensable for mouse
development, but it modifies susceptibility to tumor formation as well as cell adhesion and
growth factor signaling in transformed cells. Mol Cell Biol, 21: 6906-6912.
Liu, H.W., Halayko, A.J., Fernandes, D.J., Harmon, G.S., Mccauley, J.A., Kocieniewski, P., Mcconville,
J., Fu, Y., Forsythe, S.M., Kogut, P., Bellam, S., Dowell, M., Churchill, J., Lesso, H., Kassiri,
K., Mitchell, R.W., Hershenson, M.B., Camoretti-Mercado, B. und Solway, J. (2003) The
RhoA/Rho kinase pathway regulates nuclear localization of serum response factor. Am J
Respir Cell Mol Biol, 29: 39-47.
Liu, X., Wang, H., Eberstadt, M., Schnuchel, A., Olejniczak, E.T., Meadows, R.P., Schkeryantz, J.M.,
Janowick, D.A., Harlan, J.E., Harris, E.A., Staunton, D.E. und Fesik, S.W. (1998) NMR
structure and mutagenesis of the N-terminal Dbl homology domain of the nucleotide exchange
factor Trio. Cell, 95: 269-277.
Loirand, G., Guerin, P. und Pacaud, P. (2006) Rho kinases in cardiovascular physiology and
pathophysiology. Circ Res, 98: 322-334.
Lutz, S., Freichel-Blomquist, A., Yang, Y., Rumenapp, U., Jakobs, K.H., Schmidt, M. und Wieland, T.
(2005) The guanine nucleotide exchange factor p63RhoGEF, a specific link between Gq/11coupled receptor signaling and RhoA. J Biol Chem, 280: 11134-11139.
Macdonald, J.A., Eto, M., Borman, M.A., Brautigan, D.L. und Haystead, T.A. (2001) Dual Ser and Thr
phosphorylation of CPI-17, an inhibitor of myosin phosphatase, by MYPT-associated kinase.
FEBS Lett, 493: 91-94.
Machesky, L.M. und Insall, R.H. (1998) Scar1 and the related Wiskott-Aldrich syndrome protein,
WASP, regulate the actin cytoskeleton through the Arp2/3 complex. Curr Biol, 8: 1347-1356.
Mack, C.P., Somlyo, A.V., Hautmann, M., Somlyo, A.P. und Owens, G.K. (2001) Smooth muscle
differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J
Biol Chem, 276: 341-347.
Mackay, D.J. und Hall, A. (1998) Rho GTPases. J Biol Chem, 273: 20685-20688.
Mallavarapu, A. und Mitchison, T. (1999) Regulated actin cytoskeleton assembly at filopodium tips
controls their extension and retraction. J Cell Biol, 146: 1097-1106.
Manser, E., Huang, H.Y., Loo, T.H., Chen, X.Q., Dong, J.M., Leung, T. und Lim, L. (1997) Expression
of constitutively active alpha-PAK reveals effects of the kinase on actin and focal complexes.
Mol Cell Biol, 17: 1129-1143.
Manser, E., Leung, T., Salihuddin, H., Zhao, Z.S. und Lim, L. (1994) A brain serine/threonine protein
kinase activated by Cdc42 and Rac1. Nature, 367: 40-46.
Marmur, J. und Doty, P. (1961) Thermal renaturation of deoxyribonucleic acids. J Mol Biol, 3: 585-594.
Marui, N., Offermann, M.K., Swerlick, R., Kunsch, C., Rosen, C.A., Ahmad, M., Alexander, R.W. und
Medford, R.M. (1993) Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and
expression are regulated through an antioxidant-sensitive mechanism in human vascular
endothelial cells. J Clin Invest, 92: 1866-1874.
Mcdaniel, S.S., Platoshyn, O., Wang, J., Yu, Y., Sweeney, M., Krick, S., Rubin, L.J. und Yuan, J.X.
(2001) Capacitative Ca(2+) entry in agonist-induced pulmonary vasoconstriction. Am J Physiol
Lung Cell Mol Physiol, 280: L870-880.
Literaturverzeichnis
137
Mcdonell, M.W., Simon, M.N. und Studier, F.W. (1977) Analysis of restriction fragments of T7 DNA
and determination of molecular weights by electrophoresis in neutral and alkaline gels. J Mol
Biol, 110: 119-146.
Miano, J.M. (2003) Serum response factor: toggling between disparate programs of gene expression.
J Mol Cell Cardiol, 35: 577-593.
Miki, H., Suetsugu, S. und Takenawa, T. (1998) WAVE, a novel WASP-family protein involved in actin
reorganization induced by Rac. Embo J, 17: 6932-6941.
Moon, S.Y. und Zheng, Y. (2003) Rho GTPase-activating proteins in cell regulation. Trends Cell Biol,
13: 13-22.
Moore, M.S. und Blobel, G. (1993) The GTP-binding protein Ran/TC4 is required for protein import
into the nucleus. Nature, 365: 661-663.
Munzel, T., Feil, R., Mulsch, A., Lohmann, S.M., Hofmann, F. und Walter, U. (2003) Physiology and
pathophysiology of vascular signaling controlled by guanosine 3',5'-cyclic monophosphatedependent protein kinase [corrected]. Circulation, 108: 2172-2183.
Muranyi, A., Derkach, D., Erdodi, F., Kiss, A., Ito, M. und Hartshorne, D.J. (2005) Phosphorylation of
Thr695 and Thr850 on the myosin phosphatase target subunit: inhibitory effects and
occurrence in A7r5 cells. FEBS Lett, 579: 6611-6615.
Nacak, T.G., Alajati, A., Leptien, K., Fulda, C., Weber, H., Miki, T., Czepluch, F.S., Waltenberger, J.,
Wieland, T., Augustin, H.G. und Kroll, J. (2007) The BTB-Kelch protein KLEIP controls
endothelial migration and sprouting angiogenesis. Circ Res, 100: 1155-1163.
Nagaoka, T., Gebb, S.A., Karoor, V., Homma, N., Morris, K.G., Mcmurtry, I.F. und Oka, M. (2006)
Involvement of RhoA/Rho kinase signaling in pulmonary hypertension of the fawn-hooded rat.
J Appl Physiol, 100: 996-1002.
Nakai, K. und Horton, P. (1999) PSORT: a program for detecting sorting signals in proteins and
predicting their subcellular localization. Trends Biochem Sci, 24: 34-36.
Nakamura, M., Ichikawa, K., Ito, M., Yamamori, B., Okinaka, T., Isaka, N., Yoshida, Y., Fujita, S. und
Nakano, T. (1999) Effects of the phosphorylation of myosin phosphatase by cyclic GMPdependent protein kinase. Cell Signal, 11: 671-676.
Newmark, P. (1977) Membranes and receptors. Nature, 267: 107-109.
Nie, Z. und Randazzo, P.A. (2006) Arf GAPs and membrane traffic. J Cell Sci, 119: 1203-1211.
Nobes, C.D. und Hall, A. (1995) Rho, rac, and cdc42 GTPases regulate the assembly of
multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia.
Cell, 81: 53-62.
Nobes, C.D. und Hall, A. (1999) Rho GTPases control polarity, protrusion, and adhesion during cell
movement. J Cell Biol, 144: 1235-1244.
Noma, K., Oyama, N. und Liao, J.K. (2006) Physiological role of ROCKs in the cardiovascular system.
Am J Physiol Cell Physiol, 290: C661-668.
Norenberg, W., Hofmann, F., Illes, P., Aktories, K. und Meyer, D.K. (1999) Rundown of
somatodendritic N-methyl-D-aspartate (NMDA) receptor channels in rat hippocampal
neurones: evidence for a role of the small GTPase RhoA. Br J Pharmacol, 127: 1060-1063.
Nusser, N., Gosmanova, E., Makarova, N., Fujiwara, Y., Yang, L., Guo, F., Luo, Y., Zheng, Y. und
Tigyi, G. (2006) Serine phosphorylation differentially affects RhoA binding to effectors:
implications to NGF-induced neurite outgrowth. Cell Signal, 18: 704-714.
Literaturverzeichnis
138
Ohashi, K., Hosoya, T., Takahashi, K., Hing, H. und Mizuno, K. (2000) A Drosophila homolog of LIMkinase phosphorylates cofilin and induces actin cytoskeletal reorganization. Biochem Biophys
Res Commun, 276: 1178-1185.
Ohga, N., Kikuchi, A., Ueda, T., Yamamoto, J. und Takai, Y. (1989) Rabbit intestine contains a protein
that inhibits the dissociation of GDP from and the subsequent binding of GTP to rhoB p20, a
ras p21-like GTP-binding protein. Biochem Biophys Res Commun, 163: 1523-1533.
Oka, M., Homma, N., Taraseviciene-Stewart, L., Morris, K.G., Kraskauskas, D., Burns, N., Voelkel,
N.F. und Mcmurtry, I.F. (2007) Rho kinase-mediated vasoconstriction is important in severe
occlusive pulmonary arterial hypertension in rats. Circ Res, 100: 923-929.
Olofsson, B. (1999) Rho guanine dissociation inhibitors: pivotal molecules in cellular signalling. Cell
Signal, 11: 545-554.
Olson, M.F., Ashworth, A. und Hall, A. (1995) An essential role for Rho, Rac, and Cdc42 GTPases in
cell cycle progression through G1. Science, 269: 1270-1272.
Olson, M.F., Sterpetti, P., Nagata, K., Toksoz, D. und Hall, A. (1997) Distinct roles for DH and PH
domains in the Lbc oncogene. Oncogene, 15: 2827-2831.
Otsuki, Y., Tanaka, M., Yoshii, S., Kawazoe, N., Nakaya, K. und Sugimura, H. (2001) Tumor
metastasis suppressor nm23H1 regulates Rac1 GTPase by interaction with Tiam1. Proc Natl
Acad Sci U S A, 98: 4385-4390.
Owens, G.K. (1995) Regulation of differentiation of vascular smooth muscle cells. Physiol Rev, 75:
487-517.
Owens, G.K., Kumar, M.S. und Wamhoff, B.R. (2004) Molecular regulation of vascular smooth muscle
cell differentiation in development and disease. Physiol Rev, 84: 767-801.
Pacaud, P., Sauzeau, V. und Loirand, G. (2005) Rho proteins and vascular diseases. Arch Mal Coeur
Vaiss, 98: 249-254.
Palacios, M., Knowles, R.G., Palmer, R.M. und Moncada, S. (1989) Nitric oxide from L-arginine
stimulates the soluble guanylate cyclase in adrenal glands. Biochem Biophys Res Commun,
165: 802-809.
Palmer, R.M., Ferrige, A.G. und Moncada, S. (1987) Nitric oxide release accounts for the biological
activity of endothelium-derived relaxing factor. Nature, 327: 524-526.
Palmer, R.M., Rees, D.D., Ashton, D.S. und Moncada, S. (1988) L-arginine is the physiological
precursor for the formation of nitric oxide in endothelium-dependent relaxation. Biochem
Biophys Res Commun, 153: 1251-1256.
Paterson, H.F., Self, A.J., Garrett, M.D., Just, I., Aktories, K. und Hall, A. (1990) Microinjection of
recombinant p21rho induces rapid changes in cell morphology. J Cell Biol, 111: 1001-1007.
Perona, R., Montaner, S., Saniger, L., Sanchez-Perez, I., Bravo, R. und Lacal, J.C. (1997) Activation
of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins. Genes Dev, 11: 463-475.
Pfeifer, A., Aszodi, A., Seidler, U., Ruth, P., Hofmann, F. und Fassler, R. (1996) Intestinal secretory
defects and dwarfism in mice lacking cGMP-dependent protein kinase II. Science, 274: 20822086.
Pfeifer, A., Ruth, P., Dostmann, W., Sausbier, M., Klatt, P. und Hofmann, F. (1999) Structure and
function of cGMP-dependent protein kinases. Rev Physiol Biochem Pharmacol, 135: 105-149.
Literaturverzeichnis
139
Pham, N., Cheglakov, I., Koch, C.A., De Hoog, C.L., Moran, M.F. und Rotin, D. (2000) The guanine
nucleotide exchange factor CNrasGEF activates ras in response to cAMP and cGMP. Curr
Biol, 10: 555-558.
Pollard, T.D., Blanchoin, L. und Mullins, R.D. (2001) Actin dynamics. J Cell Sci, 114: 3-4.
Popoff, M.R., Chaves-Olarte, E., Lemichez, E., Von Eichel-Streiber, C., Thelestam, M., Chardin, P.,
Cussac, D., Antonny, B., Chavrier, P., Flatau, G., Giry, M., De Gunzburg, J. und Boquet, P.
(1996) Ras, Rap, and Rac small GTP-binding proteins are targets for Clostridium sordellii
lethal toxin glucosylation. J Biol Chem, 271: 10217-10224.
Potter, L.R. und Hunter, T. (2001) Guanylyl cyclase-linked natriuretic peptide receptors: structure and
regulation. J Biol Chem, 276: 6057-6060.
Poulos, T.L. (2006) Soluble guanylate cyclase. Curr Opin Struct Biol, 16: 736-743.
Prokopenko, S.N., Brumby, A., O'keefe, L., Prior, L., He, Y., Saint, R. und Bellen, H.J. (1999) A
putative exchange factor for Rho1 GTPase is required for initiation of cytokinesis in
Drosophila. Genes Dev, 13: 2301-2314.
Rechsteiner, M. und Rogers, S.W. (1996) PEST sequences and regulation by proteolysis. Trends
Biochem Sci, 21: 267-271.
Ren, X.D. und Schwartz, M.A. (2000) Determination of GTP loading on Rho. Methods Enzymol, 325:
264-272.
Reymond, C.D., Gomer, R.H., Mehdy, M.C. und Firtel, R.A. (1984) Developmental regulation of a
Dictyostelium gene encoding a protein homologous to mammalian ras protein. Cell, 39: 141148.
Riddick, N., Ohtani, K.I. und Surks, H.K. (2007) Targeting by myosin phosphatase-RhoA interacting
protein mediates RhoA/ROCK regulation of myosin phosphatase. J Cell Biochem,
Ridley, A.J. und Hall, A. (1992) The small GTP-binding protein rho regulates the assembly of focal
adhesions and actin stress fibers in response to growth factors. Cell, 70: 389-399.
Ridley, A.J., Paterson, H.F., Johnston, C.L., Diekmann, D. und Hall, A. (1992) The small GTP-binding
protein rac regulates growth factor-induced membrane ruffling. Cell, 70: 401-410.
Ridley, A.J., Schwartz, M.A., Burridge, K., Firtel, R.A., Ginsberg, M.H., Borisy, G., Parsons, J.T. und
Horwitz, A.R. (2003) Cell migration: integrating signals from front to back. Science, 302: 17041709.
Rivero, F., Dislich, H., Glockner, G. und Noegel, A.A. (2001) The Dictyostelium discoideum family of
Rho-related proteins. Nucleic Acids Res, 29: 1068-1079.
Rolfe, B.E., Worth, N.F., World, C.J., Campbell, J.H. und Campbell, G.R. (2005) Rho and vascular
disease. Atherosclerosis, 183: 1-16.
Rolli-Derkinderen, M., Sauzeau, V., Boyer, L., Lemichez, E., Baron, C., Henrion, D., Loirand, G. und
Pacaud, P. (2005) Phosphorylation of serine 188 protects RhoA from ubiquitin/proteasomemediated degradation in vascular smooth muscle cells. Circ Res, 96: 1152-1160.
Ron, D., Graziani, G., Aaronson, S.A. und Eva, A. (1989) The N-terminal region of proto-dbl down
regulates its transforming activity. Oncogene, 4: 1067-1072.
Ron, D., Tronick, S.R., Aaronson, S.A. und Eva, A. (1988) Molecular cloning and characterization of
the human dbl proto-oncogene: evidence that its overexpression is sufficient to transform
NIH/3T3 cells. Embo J, 7: 2465-2473.
Literaturverzeichnis
140
Ron, D., Zannini, M., Lewis, M., Wickner, R.B., Hunt, L.T., Graziani, G., Tronick, S.R., Aaronson, S.A.
und Eva, A. (1991) A region of proto-dbl essential for its transforming activity shows sequence
similarity to a yeast cell cycle gene, CDC24, and the human breakpoint cluster gene, bcr. New
Biol, 3: 372-379.
Rossman, K.L., Der, C.J. und Sondek, J. (2005) GEF means go: turning on RHO GTPases with
guanine nucleotide-exchange factors. Nat Rev Mol Cell Biol, 6: 167-180.
Rossman, K.L. und Sondek, J. (2005) Larger than Dbl: new structural insights into RhoA activation.
Trends Biochem Sci, 30: 163-165.
Rudic, R.D., Shesely, E.G., Maeda, N., Smithies, O., Segal, S.S. und Sessa, W.C. (1998) Direct
evidence for the importance of endothelium-derived nitric oxide in vascular remodeling. J Clin
Invest, 101: 731-736.
Rumenapp, U., Freichel-Blomquist, A., Wittinghofer, B., Jakobs, K.H. und Wieland, T. (2002) A
mammalian Rho-specific guanine-nucleotide exchange factor (p164-RhoGEF) without a
pleckstrin homology domain. Biochem J, 366: 721-728.
Rush, M.G., Drivas, G. und D'eustachio, P. (1996) The small nuclear GTPase Ran: how much does it
run? Bioessays, 18: 103-112.
Russo, C., Gao, Y., Mancini, P., Vanni, C., Porotto, M., Falasca, M., Torrisi, M.R., Zheng, Y. und Eva,
A. (2001) Modulation of oncogenic DBL activity by phosphoinositol phosphate binding to
pleckstrin homology domain. J Biol Chem, 276: 19524-19531.
Ruth, P., Wang, G.X., Boekhoff, I., May, B., Pfeifer, A., Penner, R., Korth, M., Breer, H. und Hofmann,
F. (1993) Transfected cGMP-dependent protein kinase suppresses calcium transients by
inhibition of inositol 1,4,5-trisphosphate production. Proc Natl Acad Sci U S A, 90: 2623-2627.
Sahai, E. und Marshall, C.J. (2002) ROCK and Dia have opposing effects on adherens junctions
downstream of Rho. Nat Cell Biol, 4: 408-415.
Salojin, K.V., Zhang, J. und Delovitch, T.L. (1999) TCR and CD28 are coupled via ZAP-70 to the
activation of the Vav/Rac-1-/PAK-1/p38 MAPK signaling pathway. J Immunol, 163: 844-853.
Sasaki, Y., Suzuki, M. und Hidaka, H. (2002) The novel and specific Rho-kinase inhibitor (S)-(+)-2methyl-1-[(4-methyl-5-isoquinoline)sulfonyl]-homopiperazine as a probing molecule for Rhokinase-involved pathway. Pharmacol Ther, 93: 225-232.
Sauzeau, V., Le Jeune, H., Cario-Toumaniantz, C., Smolenski, A., Lohmann, S.M., Bertoglio, J.,
Chardin, P., Pacaud, P. und Loirand, G. (2000) Cyclic GMP-dependent protein kinase
signaling pathway inhibits RhoA-induced Ca2+ sensitization of contraction in vascular smooth
muscle. J Biol Chem, 275: 21722-21729.
Sauzeau, V., Rolli-Derkinderen, M., Marionneau, C., Loirand, G. und Pacaud, P. (2003) RhoA
expression is controlled by nitric oxide through cGMP-dependent protein kinase activation. J
Biol Chem, 278: 9472-9480.
Sawada, N., Itoh, H., Yamashita, J., Doi, K., Inoue, M., Masatsugu, K., Fukunaga, Y., Sakaguchi, S.,
Sone, M., Yamahara, K., Yurugi, T. und Nakao, K. (2001) cGMP-dependent protein kinase
phosphorylates and inactivates RhoA. Biochem Biophys Res Commun, 280: 798-805.
Scheffzek, K. und Ahmadian, M.R. (2005) GTPase activating proteins: structural and functional
insights 18 years after discovery. Cell Mol Life Sci, 62: 3014-3038.
Scheffzek, K., Stephan, I., Jensen, O.N., Illenberger, D. und Gierschik, P. (2000) The Rac-RhoGDI
complex and the structural basis for the regulation of Rho proteins by RhoGDI. Nat Struct Biol,
7: 122-126.
Literaturverzeichnis
141
Schlossmann, J., Ammendola, A., Ashman, K., Zong, X., Huber, A., Neubauer, G., Wang, G.X.,
Allescher, H.D., Korth, M., Wilm, M., Hofmann, F. und Ruth, P. (2000) Regulation of
intracellular calcium by a signalling complex of IRAG, IP3 receptor and cGMP kinase Ibeta.
Nature, 404: 197-201.
Schlossmann, J., Feil, R. und Hofmann, F. (2003) Signaling through NO and cGMP-dependent protein
kinases. Ann Med, 35: 21-27.
Schlossmann, J., Feil, R. und Hofmann, F. (2005) Insights into cGMP signalling derived from cGMP
kinase knockout mice. Front Biosci, 10: 1279-1289.
Schmidt, A. und Hall, A. (2002) Guanine nucleotide exchange factors for Rho GTPases: turning on the
switch. Genes Dev, 16: 1587-1609.
Schmitz, A.A., Govek, E.E., Bottner, B. und Van Aelst, L. (2000) Rho GTPases: signaling, migration,
and invasion. Exp Cell Res, 261: 1-12.
Seasholtz, T.M., Majumdar, M., Kaplan, D.D. und Brown, J.H. (1999) Rho and Rho kinase mediate
thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration. Circ Res, 84:
1186-1193.
Sekine, A., Fujiwara, M. und Narumiya, S. (1989) Asparagine residue in the rho gene product is the
modification site for botulinum ADP-ribosyltransferase. J Biol Chem, 264: 8602-8605.
Sells, M.A., Knaus, U.G., Bagrodia, S., Ambrose, D.M., Bokoch, G.M. und Chernoff, J. (1997) Human
p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr Biol, 7:
202-210.
Serafini, T., Orci, L., Amherdt, M., Brunner, M., Kahn, R.A. und Rothman, J.E. (1991) ADP-ribosylation
factor is a subunit of the coat of Golgi-derived COP-coated vesicles: a novel role for a GTPbinding protein. Cell, 67: 239-253.
Shen, C., Buck, A.K., Liu, X., Winkler, M. und Reske, S.N. (2003) Gene silencing by adenovirusdelivered siRNA. FEBS Lett, 539: 111-114.
Shen, F., Lin, Q., Gu, Y., Childress, C. und Yang, W. (2007) Activated Cdc42-associated kinase 1 is a
component of EGF receptor signaling complex and regulates EGF receptor degradation. Mol
Biol Cell, 18: 732-742.
Shi, J., Blundell, T.L. und Mizuguchi, K. (2001) FUGUE: sequence-structure homology recognition
using environment-specific substitution tables and structure-dependent gap penalties. J Mol
Biol, 310: 243-257.
Shimizu, H., Mitomo, K., Watanabe, T., Okamoto, S. und Yamamoto, K. (1990) Involvement of a NFkappa B-like transcription factor in the activation of the interleukin-6 gene by inflammatory
lymphokines. Mol Cell Biol, 10: 561-568.
Silvius, J.R. und L'heureux, F. (1994) Fluorimetric evaluation of the affinities of isoprenylated peptides
for lipid bilayers. Biochemistry, 33: 3014-3022.
Skolnik, E.Y., Batzer, A., Li, N., Lee, C.H., Lowenstein, E., Mohammadi, M., Margolis, B. und
Schlessinger, J. (1993) The function of GRB2 in linking the insulin receptor to Ras signaling
pathways. Science, 260: 1953-1955.
Snyder, J.T., Worthylake, D.K., Rossman, K.L., Betts, L., Pruitt, W.M., Siderovski, D.P., Der, C.J. und
Sondek, J. (2002) Structural basis for the selective activation of Rho GTPases by Dbl
exchange factors. Nat Struct Biol, 9: 468-475.
Somlyo, A.P. und Somlyo, A.V. (1998) From pharmacomechanical coupling to G-proteins and myosin
phosphatase. Acta Physiol Scand, 164: 437-448.
Literaturverzeichnis
142
Somlyo, A.P. und Somlyo, A.V. (2000) Signal transduction by G-proteins, rho-kinase and protein
phosphatase to smooth muscle and non-muscle myosin II. J Physiol, 522 Pt 2: 177-185.
Somlyo, A.P. und Somlyo, A.V. (2003) Ca2+ sensitivity of smooth muscle and nonmuscle myosin II:
modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev, 83: 1325-1358.
Sonnenburg, W.K. und Beavo, J.A. (1994) Cyclic GMP and regulation of cyclic nucleotide hydrolysis.
Adv Pharmacol, 26: 87-114.
Sonnhammer, E.L., Von Heijne, G. und Krogh, A. (1998) A hidden Markov model for predicting
transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol, 6: 175-182.
Surks, H.K. und Mendelsohn, M.E. (2003) Dimerization of cGMP-dependent protein kinase 1alpha and
the myosin-binding subunit of myosin phosphatase: role of leucine zipper domains. Cell
Signal, 15: 937-944.
Surks, H.K., Mochizuki, N., Kasai, Y., Georgescu, S.P., Tang, K.M., Ito, M., Lincoln, T.M. und
Mendelsohn, M.E. (1999) Regulation of myosin phosphatase by a specific interaction with
cGMP- dependent protein kinase Ialpha. Science, 286: 1583-1587.
Swingle, M., Ni, L. und Honkanen, R.E. (2007) Small-molecule inhibitors of ser/thr protein
phosphatases: specificity, use and common forms of abuse. Methods Mol Biol, 365: 23-38.
Takaishi, K., Kikuchi, A., Kuroda, S., Kotani, K., Sasaki, T. und Takai, Y. (1993) Involvement of rho
p21 and its inhibitory GDP/GTP exchange protein (rho GDI) in cell motility. Mol Cell Biol, 13:
72-79.
Tanabe, S., Kreutz, B., Suzuki, N. und Kozasa, T. (2004) Regulation of RGS-RhoGEFs by Galpha12
and Galpha13 proteins. Methods Enzymol, 390: 285-294.
Tang, K.M., Wang, G.R., Lu, P., Karas, R.H., Aronovitz, M., Heximer, S.P., Kaltenbronn, K.M., Blumer,
K.J., Siderovski, D.P., Zhu, Y. und Mendelsohn, M.E. (2003) Regulator of G-protein signaling2 mediates vascular smooth muscle relaxation and blood pressure. Nat Med, 9: 1506-1512.
Taniguchi, J., Furukawa, K.I. und Shigekawa, M. (1993) Maxi K+ channels are stimulated by cyclic
guanosine monophosphate-dependent protein kinase in canine coronary artery smooth
muscle cells. Pflugers Arch, 423: 167-172.
Tatsumoto, T., Xie, X., Blumenthal, R., Okamoto, I. und Miki, T. (1999) Human ECT2 is an exchange
factor for Rho GTPases, phosphorylated in G2/M phases, and involved in cytokinesis. J Cell
Biol, 147: 921-928.
Tegge, W., Frank, R., Hofmann, F. und Dostmann, W.R. (1995) Determination of cyclic nucleotidedependent protein kinase substrate specificity by the use of peptide libraries on cellulose
paper. Biochemistry, 34: 10569-10577.
Touhara, K., Inglese, J., Pitcher, J.A., Shaw, G. und Lefkowitz, R.J. (1994) Binding of G protein beta
gamma-subunits to pleckstrin homology domains. J Biol Chem, 269: 10217-10220.
Tzima, E., Kiosses, W.B., Del Pozo, M.A. und Schwartz, M.A. (2003) Localized cdc42 activation,
detected using a novel assay, mediates microtubule organizing center positioning in
endothelial cells in response to fluid shear stress. J Biol Chem, 278: 31020-31023.
Ushio-Fukai, M., Griendling, K.K., Akers, M., Lyons, P.R. und Alexander, R.W. (1998) Temporal
dispersion of activation of phospholipase C-beta1 and -gamma isoforms by angiotensin II in
vascular smooth muscle cells. Role of alphaq/11, alpha12, and beta gamma G protein
subunits. J Biol Chem, 273: 19772-19777.
Vaandrager, A.B. und De Jonge, H.R. (1996) Signalling by cGMP-dependent protein kinases. Mol Cell
Biochem, 157: 23-30.
Literaturverzeichnis
143
Vaandrager, A.B., Tilly, B.C., Smolenski, A., Schneider-Rasp, S., Bot, A.G., Edixhoven, M., Scholte,
B.J., Jarchau, T., Walter, U., Lohmann, S.M., Poller, W.C. und De Jonge, H.R. (1997) cGMP
stimulation of cystic fibrosis transmembrane conductance regulator Cl- channels co-expressed
with cGMP-dependent protein kinase type II but not type Ibeta. J Biol Chem, 272: 4195-4200.
Van Nieuw Amerongen, G.P., Koolwijk, P., Versteilen, A. und Van Hinsbergh, V.W. (2003)
Involvement of RhoA/Rho kinase signaling in VEGF-induced endothelial cell migration and
angiogenesis in vitro. Arterioscler Thromb Vasc Biol, 23: 211-217.
Verhoeven, K., De Jonghe, P., Van De Putte, T., Nelis, E., Zwijsen, A., Verpoorten, N., De Vriendt, E.,
Jacobs, A., Van Gerwen, V., Francis, A., Ceuterick, C., Huylebroeck, D. und Timmerman, V.
(2003) Slowed conduction and thin myelination of peripheral nerves associated with mutant
rho Guanine-nucleotide exchange factor 10. Am J Hum Genet, 73: 926-932.
Vetter, I.R. und Wittinghofer, A. (2001) The guanine nucleotide-binding switch in three dimensions.
Science, 294: 1299-1304.
Vogt, A., Lutz, S., Rumenapp, U., Han, L., Jakobs, K.H., Schmidt, M. und Wieland, T. (2007)
Regulator of G-protein signalling 3 redirects prototypical G(i)-coupled receptors from Rac1 to
RhoA activation. Cell Signal, 19: 1229-1237
Vogt, S., Grosse, R., Schultz, G. und Offermanns, S. (2003) Receptor-dependent RhoA activation in
G12/G13-deficient cells: genetic evidence for an involvement of Gq/G11. J Biol Chem, 278:
28743-28749.
Wagner, C., Pfeifer, A., Ruth, P., Hofmann, F. und Kurtz, A. (1998) Role of cGMP-kinase II in the
control of renin secretion and renin expression. J Clin Invest, 102: 1576-1582.
Waldmann, R., Bauer, S., Gobel, C., Hofmann, F., Jakobs, K.H. und Walter, U. (1986) Demonstration
of cGMP-dependent protein kinase and cGMP-dependent phosphorylation in cell-free extracts
of platelets. Eur J Biochem, 158: 203-210.
Walsh, K. und Takahashi, A. (2001) Transcriptional regulation of vascular smooth muscle cell
phenotype. Z Kardiol, 90 Suppl 3: 12-16.
Wang, X., Huang, G., Luo, X., Penninger, J.M. und Muallem, S. (2004) Role of regulator of G protein
signaling 2 (RGS2) in Ca(2+) oscillations and adaptation of Ca(2+) signaling to reduce
excitability of RGS2-/- cells. J Biol Chem, 279: 41642-41649.
Watanabe, N., Kato, T., Fujita, A., Ishizaki, T. und Narumiya, S. (1999) Cooperation between mDia1
and ROCK in Rho-induced actin reorganization. Nat Cell Biol, 1: 136-143.
Webb, R.C. (2003) Smooth muscle contraction and relaxation. Adv Physiol Educ, 27: 201-206.
Weiss, B., Thompson, A. und Richardson, C.C. (1968) Ezymatic breakage and joining of
deoxyribonucleic acid. VII. Properties of the enzyme-adenylate intermediate in the
polynucleotide ligase reaction. J Biol Chem, 243: 4556-4563.
Welch, H.C., Coadwell, W.J., Ellson, C.D., Ferguson, G.J., Andrews, S.R., Erdjument-Bromage, H.,
Tempst, P., Hawkins, P.T. und Stephens, L.R. (2002) P-Rex1, a PtdIns(3,4,5)P3- and
Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Cell, 108: 809-821.
Wells, C.D., Liu, M.Y., Jackson, M., Gutowski, S., Sternweis, P.M., Rothstein, J.D., Kozasa, T. und
Sternweis, P.C. (2002) Mechanisms for reversible regulation between G13 and Rho exchange
factors. J Biol Chem, 277: 1174-1181.
Wennerberg, K., Rossman, K.L. und Der, C.J. (2005) The Ras superfamily at a glance. J Cell Sci, 118:
843-846.
Literaturverzeichnis
144
Wenthold, R.J., Prybylowski, K., Standley, S., Sans, N. und Petralia, R.S. (2003a) Trafficking of NMDA
receptors. Annu Rev Pharmacol Toxicol, 43: 335-358.
Wenthold, R.J., Sans, N., Standley, S., Prybylowski, K. und Petralia, R.S. (2003b) Early events in the
trafficking of N-methyl-D-aspartate (NMDA) receptors. Biochem Soc Trans, 31: 885-888.
Whitehead, I.P., Lambert, Q.T., Glaven, J.A., Abe, K., Rossman, K.L., Mahon, G.M., Trzaskos, J.M.,
Kay, R., Campbell, S.L. und Der, C.J. (1999) Dependence of Dbl and Dbs transformation on
MEK and NF-kappaB activation. Mol Cell Biol, 19: 7759-7770.
Winkler, S., Mohl, M., Wieland, T. und Lutz, S. (2005) GrinchGEF--a novel Rho-specific guanine
nucleotide exchange factor. Biochem Biophys Res Commun, 335: 1280-1286.
Wojciak-Stothard, B. und Ridley, A.J. (2002) Rho GTPases and the regulation of endothelial
permeability. Vascul Pharmacol, 39: 187-199.
Wolfe, L., Francis, S.H. und Corbin, J.D. (1989) Properties of a cGMP-dependent monomeric protein
kinase from bovine aorta. J Biol Chem, 264: 4157-4162.
Wooldridge, A.A., Macdonald, J.A., Erdodi, F., Ma, C., Borman, M.A., Hartshorne, D.J. und Haystead,
T.A. (2004) Smooth muscle phosphatase is regulated in vivo by exclusion of phosphorylation
of threonine 696 of MYPT1 by phosphorylation of Serine 695 in response to cyclic nucleotides.
J Biol Chem, 279: 34496-34504.
Worner, R., Lukowski, R., Hofmann, F. und Wegener, J.W. (2007) cGMP signals mainly through cAMP
kinase in permeabilized murine aorta. Am J Physiol Heart Circ Physiol, 292: H237-244.
Worth, N.F., Campbell, G.R. und Rolfe, B.E. (2001) A role for rho in smooth muscle phenotypic
regulation. Ann N Y Acad Sci, 947: 316-322.
Worthylake, D.K., Rossman, K.L. und Sondek, J. (2000) Crystal structure of Rac1 in complex with the
guanine nucleotide exchange region of Tiam1. Nature, 408: 682-688.
Wright, L.P. und Philips, M.R. (2006) Thematic review series: lipid posttranslational modifications.
CAAX modification and membrane targeting of Ras. J Lipid Res, 47: 883-891.
Wu, X., Haystead, T.A., Nakamoto, R.K., Somlyo, A.V. und Somlyo, A.P. (1998) Acceleration of
myosin light chain dephosphorylation and relaxation of smooth muscle by telokin. Synergism
with cyclic nucleotide-activated kinase. J Biol Chem, 273: 11362-11369.
Xia, C., Bao, Z., Yue, C., Sanborn, B.M. und Liu, M. (2001) Phosphorylation and regulation of Gprotein-activated phospholipase C-beta 3 by cGMP-dependent protein kinases. J Biol Chem,
276: 19770-19777.
Xia, H., Mao, Q., Paulson, H.L. und Davidson, B.L. (2002) siRNA-mediated gene silencing in vitro and
in vivo. Nat Biotechnol, 20: 1006-1010.
Xiao, D., Longo, L.D. und Zhang, L. (2005) Alpha1-adrenoceptor-mediated phosphorylation of MYPT1 and CPI-17 in the uterine artery: role of ERK/PKC. Am J Physiol Heart Circ Physiol, 288:
H2828-2835.
Yang, W. und Cerione, R.A. (1997) Cloning and characterization of a novel Cdc42-associated tyrosine
kinase, ACK-2, from bovine brain. J Biol Chem, 272: 24819-24824.
Yang, W., Lin, Q., Zhao, J., Guan, J.L. und Cerione, R.A. (2001) The nonreceptor tyrosine kinase
ACK2, a specific target for Cdc42 and a negative regulator of cell growth and focal adhesion
complexes. J Biol Chem, 276: 43987-43993.
Literaturverzeichnis
145
Yokosawa, H., Kawakita, M., Arai, K., Inoue-Yokosawa, N. und Kaziro, Y. (1975) Binding of
aminoacyl-tRNA to ribosomes promoted by elongation factor Tu. Studies on the role of GTP
hydrolysis. J Biochem (Tokyo), 77: 719-728.
Yokoyama, N. und Miller, W.T. (2003) Biochemical properties of the Cdc42-associated tyrosine kinase
ACK1. Substrate specificity, authphosphorylation, and interaction with Hck. J Biol Chem, 278:
47713-47723.
Yoshizawa, M., Sone, M., Matsuo, N., Nagase, T., Ohara, O., Nabeshima, Y. und Hoshino, M. (2003)
Dynamic and coordinated expression profile of dbl-family guanine nucleotide exchange factors
in the developing mouse brain. Gene Expr Patterns, 3: 375-381.
Yu, L., Gaitatzes, C., Neer, E. und Smith, T.F. (2000) Thirty-plus functional families from a single motif.
Protein Sci, 9: 2470-2476.
Zeng, H., Zhao, D. und Mukhopadhyay, D. (2002a) Flt-1-mediated down-regulation of endothelial cell
proliferation through pertussis toxin-sensitive G proteins, beta gamma subunits, small GTPase
CDC42, and partly by Rac-1. J Biol Chem, 277: 4003-4009.
Zeng, H., Zhao, D. und Mukhopadhyay, D. (2002b) KDR stimulates endothelial cell migration through
heterotrimeric G protein Gq/11-mediated activation of a small GTPase RhoA. J Biol Chem,
277: 46791-46798.
Zhang, H., Wang, L., Kao, S., Whitehead, I.P., Hart, M.J., Liu, B., Duus, K., Burridge, K., Der, C.J. und
Su, L. (1999) Functional interaction between the cytoplasmic leucine-zipper domain of HIV-1
gp41 and p115-RhoGEF. Curr Biol, 9: 1271-1274.
Zhao, J., Trewhella, J., Corbin, J., Francis, S., Mitchell, R., Brushia, R. und Walsh, D. (1997)
Progressive cyclic nucleotide-induced conformational changes in the cGMP-dependent protein
kinase studied by small angle X-ray scattering in solution. J Biol Chem, 272: 31929-31936.
Zheng, Y., Hart, M.J. und Cerione, R.A. (1995) Guanine nucleotide exchange catalyzed by dbl
oncogene product. Methods Enzymol, 256: 77-84.
Zheng, Y., Zangrilli, D., Cerione, R.A. und Eva, A. (1996) The pleckstrin homology domain mediates
transformation by oncogenic dbl through specific intracellular targeting. J Biol Chem, 271:
19017-19020.
Zhu, K., Debreceni, B., Bi, F. und Zheng, Y. (2001) Oligomerization of DH domain is essential for Dblinduced transformation. Mol Cell Biol, 21: 425-437.
Zhuang, S., Nguyen, G.T., Chen, Y., Gudi, T., Eigenthaler, M., Jarchau, T., Walter, U., Boss, G.R. und
Pilz, R.B. (2004) Vasodilator-stimulated phosphoprotein activation of serum-response
element-dependent transcription occurs downstream of RhoA and is inhibited by cGMPdependent protein kinase phosphorylation. J Biol Chem, 279: 10397-10407.
Zong, H., Kaibuchi, K. und Quilliam, L.A. (2001) The insert region of RhoA is essential for Rho kinase
activation and cellular transformation. Mol Cell Biol, 21: 5287- 5298.
Danksagung
146
8. Danksagung
An dieser Stelle möchte ich herzlichst all denen danken, die zum Gelingen dieser Arbeit
beigetragen haben:
Herrn Prof. Dr. rer. nat. Thomas Wieland für die Vergabe des Themas und die Aufnahme in
seinen Arbeitskreis und für sein stetes Interesse an meiner Arbeit.
Herrn Prof. Dr. rer. nat. Ulrich Hilgenfeldt für seine Bereitschaft, diese Arbeit zu begutachten und
vor der Mathematisch-Naturwissenschaftlichen Fakultät der Universität Heidelberg zu vertreten.
Frau Dr. rer. nat. Susanne Lutz für die kompetente Betreuung dieser Arbeit, ihrer fachlichen
Unterstützung, für die stete Diskussionsbereitschaft und die vielen neuen Ideen, die zum
Gelingen dieser Arbeit beigetragen haben.
Dr. rer. nat. Andreas Vogt, Christiane Vettel und Javier Carbajo für die kollegiale
Zusammenarbeit und die gegenseitige moralische Unterstützung.
Weiterhin möchte ich mich bei den folgenden Arbeitskollegen für ihre Hilfe, Unterstützung und
das angenehme Arbeitsklima während meiner Dissertation herzlich danken: Stefania Alexa, Anna
Hahn, Doris Baltus, Zenon Baraniak, Heinz Scheffel, Rita Weber und Irene Ruprecht.
Ein Extra-Dankeschön an Tina Schummer für die Korrektur der Arbeit.
Herrn Dr. phil. nat. Martin Thomas danke ich für die Durchführung der immunhistologischen
Färbungen.
Herrn Prof. Dr. Jens Schlossmann danke ich für das großzügige Abtreten des cGKI Antikörpers.
Ein ganz besonderer Dank geht an meine Familie, auf deren Unterstützung ich während Studium
und Promotion immer zählen konnte und an meinen Freund Roger Kilchenmann, der mich
jederzeit mental unterstütze und sein seelischer Beistand wesentlich zum Gelingen dieser Arbeit
beitrug.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement