Dissertation2

Dissertation2
INAUGURAL-DISSERTATION
zur
Erlangung der Doktorwürde
der
Naturwissenschaftlich-Mathematischen Gesamtfakultät
der
Ruprecht-Karls-Universität
Heidelberg
vorgelegt von
Diplom-Biologin Heidrun Guthöhrlein
aus: Marburg an der Lahn
Tag der mündlichen Prüfung:
HPV 16 Strukturproteine als Vehikel zur Immunisierung
Gutachter: Prof. Dr. Lutz Gissmann
Prof. Dr. Ingrid Haas
meinen Eltern
Danksagung
Danksagung
Prof. Dr. Lutz Gissmann danke ich für die Übernahme des Gutachtens, die Überlassung des
Themas, die wertvolle Betreuung bei der Planung, Durchführung und Abfassung dieser
Arbeit, die jederzeit gewährte Unterstützung und stete Diskussionsbereitschaft.
Prof. Dr. Ingrid Haas danke ich für ihr Interesse und ihre Bereitschaft, das Gutachten zu
erstellen.
Dr. Michael Pawlita und Dr. Martin Müller danke ich für hilfreiche Diskussionen und
Lösungsvorschläge im Rahmen meines Doktorandenkomitees.
Dr. Martin Müller danke ich außerdem für die Bereitstellung der Baculovirusvorräte.
Birgit Aengeneyndt danke ich ganz herzlich für die Produktion und Analyse virus-ähnlicher
Partikel.
Thomas Holz danke ich für die prompte Hilfe bei allen die Arbeit am Computer betreffenden
Fragen und Problemen.
Prof. Dr. Hanswalter Zentgraf danke ich für die Erstellung der elektronenmikroskopischen
Aufnahmen.
Ganz herzlich bedanke ich mich bei meinen Kollegen und Freunden aus der ATV, die durch
ihre Hilfsbereitschaft und Zusammenarbeit viel zum Gelingen dieser Arbeit beigetragen
haben.
Meiner Familie und meinen Freunden möchte ich an dieser Stelle meinen besonderen Dank
für die vielfältige Unterstützung aussprechen.
Inhaltsverzeichnis
i
Inhaltsverzeichnis
A. Einleitung
1 HPV allgemein
2 Struktur des Kapsids
3 Genomstruktur
3.1 Die frühen Gene E1-E5
3.2 Die frühen Gene E6 und E7
3.3 Die späten Gene L1 und L2
4 Lebenszyklus
5 HPV und Immunantwort
6 Vakzinierungsstrategien
6.1 Prophylaktische Vakzine
6.2 Therapeutische Vakzine
7 DNA-Immunisierung
8 Zielsetzung der Arbeit
8.1 Pseudovirionen
8.1.1 Rekombinante Vacciniaviren
8.1.2 in vitro Konstruktion von Pseudovirionen
8.1.3 Pseudovirionen aus Hefe
8.2 Kopplung von DNA an Partikel
8.3 Kopplung von DNA an ein HPV 16 L2-Peptid
8.4 Spezifische Fragestellung
B Material
1 Chemikalien
2 Radiochemikalien
3 Kits
4 Enzyme
5 Größen- und Konzentrationsstandards
6 Antikörper
6.1 Primärantikörper
6.2 Sekundärantikörper
7 DNA und Peptide
7.1 Plasmide
7.2 Oligonukleotidprimer
7.3 Peptide
8 Biologische Materialien
8.1 Bakterienstämme
8.2 Hefestämme
8.3 Eukaryontische Zellinien
8.3.1 Insektenzellen
8.3.2 Säugerzellen
8.4 Mauslinien
8.5 Bakulovirusstocks
9 Medien
9.1 Medien für die Bakterienkultur
9.2 Medien für die Hefekultur
9.3 Medien für die Zellkultur
1
1
2
2
3
3
4
5
6
7
7
7
8
11
11
11
12
12
13
13
14
15
15
15
15
15
15
15
15
16
16
16
17
17
17
17
17
18
18
18
18
18
18
18
18
19
Inhaltsverzeichnis
ii
10 Puffer und Lösungen
20
C Methoden
1. Mikrobiologische Methoden
21
21
21
21
22
22
22
22
23
24
24
25
25
25
26
27
28
29
30
30
31
31
32
32
33
33
34
34
34
34
35
36
36
36
37
37
37
38
38
38
39
39
40
41
42
42
43
43
44
1.1 Aufbewahrung und Kultur von Bakterien
1.2 Herstellung elektrokompetenter Bakterien
1.3 Elektrotransformation kompetenter Bakterien
2 Arbeiten mit DNA
2.1 Fällen von DNA
2.2 Schnellpräparatione von Plasmid-DNA
2.3 Großpräparation von Plasmid-DNA
2.4 Konzentrationsbestimmung von Nukleinsäuren in wäßrigen Lösungen
2.5 Restriktionsverdau von DNA
2.6 Dephosphorylierung von Vektor-DNA
2.7 Ligation von DNA
2.8 DNA-Elektrophorese in Agarosegelen
2.9 Elution von DNA aus Agarosegelen
2.10 Polymerasekettenreaktion (PCR)
2.11 3’-Endmarkierung von DNA
2.12 Herstellung einer 32P-markierten DNA-Sonde
2.13 DNA-DNA-Hybridisierung
2.14 Nichtdenaturierende Polyacrylamid-Gelelektrophorese
3 Arbeiten mit Zellkultur
3.1
3.2
3.3
3.4
3.5
Kultivierung eukaryontischer Zellen
T-Zell Kultivierung
Bestimmung der Zellzahl
Einfrieren und Auftauen eukaryontischer Zellen
Transfektion eukaryontischer Zellen
4 Arbeiten mit Hefen
4.1
4.2
4.3
4.4
4.5
Aufbewahrung und Kultur von Hefen
Herstellung kompetenter Hefezellen
Transformation der Hefezellen
Nachweis der Proteinexpression in Hefe-Transformanden
Isolation von Plasmid-DNA aus Hefe
5 Arbeiten mit Proteinen
5.1 SDS-Polyacrylamidgelelektrophorese (SDS-PAGE)
5.2 Bestimmung der Proteinkonzentration
5.3 Herstellung virus-ähnlicher HPV 16 L1-Partikel (VLPs)
5.3.1
5.3.2
5.3.3
5.3.4
5.4
5.5
5.6
5.7
Vermehrung rekombinanter Bekulovirusstocks
Infektion von TN high five Insektenzellen
Aufschluß der Zellen
Aufreinigung durch Gradientenzentrifugation
Transmissionselektronenmikroskopie
Zerfall und Zusammenlagerung von VLPs (Dis- und Reassembly)
Kopplung von DNA an Protein oder Peptid
Isolation von pseudovirionen aus Hefe
6 Immunologische Experimente
6.1
6.2
6.3
6.4
Affinitätschromatographie zur Aufreinigung von Antikörpern aus Serum
Immunpräzipitation
Enhanced Chemiluminescence (ECL) Western Blot
ELISA (enzyme-linked immunosorbent assay)
Inhaltsverzeichnis
6.5
6.6
6.7
6.8
ELISPOT (enzyme-linked immunospot assay)
Intrazelluläre IFNγ-Färbung
Durchflußzytometrie
Zytotoxizitätstest
7 Tierexperimentelle Methoden
7.1 Anästhesie der Versuchstiere
7.2 Immunisierung
D Ergebnisse
1 Klonierungen der für die Vehikelpräparationen notwendigen Plasmide
1.1 Klonierung des Ovalbumingens (OVA) in pcDNA3.1+
1.2 Klonierung des Ovalbumingens (OVA) in pYes2*-VP22-E7(1-66)
1.3 Polymerasekettenreaktion (PCR) zur Herstellung eines exprimierbaren DNA-Fragments (PCRB/N)
2 Expressionskontrolle der verschiedenen DNA-Konstrukte
3 Herstellung der Vehikel zur immunisierung
3.1 Pseudovirionen
3.1.1 Pseudovirionen im Hefesystem
3.1.1.1 Transformation des Hefestammes #1699 mit dem Targetplasmid
3.1.1.2 Überprüfung der Expression der Strukturproteine in den Hefezellen
3.1.1.3 Überprüfung des Vorhandenseins des Targetplasmids in den Hefezellen
3.1.1.4 Aufreinigung von ψ-VLPs im Cäsiumchlorid-Dichtegradienten
3.1.2 Herstellung von Pseudovirionen duch in vitro Dis- und Reassembly
3.1.2.1 Verifikation des Dis- und Reassembly
3.1.2.2 Analyse der ψ-VLPs im Cäsiumchlorid-Dichtegradienten
3.2 Kopplung von DNA
3.2.1 Kopplung von DNA an VLPs
3.2.1.1 Überprüfung der Kopplung
3.2.2 Kopplung von DNA an HPV 16 L2108-126
3.2.2.1 Überprüfung der Kopplung
4 Vergleichbarkeit der verschiedenen Methoden
4.1 DNA-Immunisierung
4.2 Adjuvante Wirkung von VLPs
5 Immunisierung mit Vehikelpräparationen
iii
45
46
47
48
48
48
49
50
50
50
51
52
53
54
54
54
55
55
56
57
59
60
60
63
63
63
65
65
70
70
72
74
E Diskussion
1 Klonierung und Expression des Reportergens
2 Pseudovirionen in Hefe
3 Dis- und Reassembly von HPV 16 VLPs zur Herstellung von Pseudovirionen
4 Kopplung von DNA an HPV 16 VLPs
5 HPV 16 L2 als Shuttlevektor
6 DNA-Immunisierung
76
76
77
79
80
81
85
F Zusammenfassung
88
G Abkürzungen
89
H Literatur
92
A Einleitung
1
A Einleitung
A.1 HPV allgemein
Schätzungsweise 15-20 % aller humanen Krebserkrankungen sind ursächlich mit Virusinfektionen verbunden. Zu den Vertretern dieser Tumorviren gehören die Papillomviren, die
neben gutartigen Warzenerkrankungen auch Karzinome, vor allem in der Genitalschleimhaut,
und verschiedene maligne Hauttumoren verursachen. Die Gruppe der Papillomviren zählt
etwa 130 Mitglieder (De Villiers, 1997), davon 85 humanpathogene, die alle streng speziesund gewebespezifisch sind.
Man teilt die humanpathogenen Papillomviren (HPV) aufgrund ihres Tropismus in haut- und
schleimhautinfizierende Typen ein (Zusammenstellung in Tabelle A.1).
Tabelle A.1: Die häufigsten HPV-Typen in gutartigen und malignen
Erkrankungen
Krankheitsbild
Hautwarzen
plantare Warzen
gemeine Warzen
flache Warzen
Epidermodysplasia Verruciformis (EV)
Genitalwarzen
subklinisch
flache Warzen
Zervixkarzinom
starke Assoziation
moderate Assoziation
respiratorische Papillome
assoziierter HPV-Typ
1
2, 4
3, 10, 28, 41
5, 8, 9, 12, 14, 15, 17, 19-25, 36-38, 47, 49
alle den Genitaltrakt infizierenden HPVs
6, 11, 16, 18
16, 18, 31, 45
33, 35, 39, 51, 52, 56, 58, 59, 68
6, 11
nach Fields, 1996
In beiden Gruppen finden sich sogenannte „low risk“ und „high risk“ HPV-Typen, die
entweder mit gutartigen Wucherungen, z.B. Warzen und Kondylomen, bzw. mit prämalignen
und malignen Läsionen wie dem Zervixkarzinom, das die zweithäufigste krebsbedingte
Todesursache bei Frauen darstellt (Boyle, 1997), assoziiert sind. So konnte in über 94 % aller
untersuchten Zervixkarzinome HPV-DNA gefunden werden, wobei die Typen 16 und 18 am
häufigsten detektiert wurden (Bosch et al., 1993; zur Hausen, 1996; Walboomers et al.,1999).
Die Entwicklung zum Zervixkarzinom erfolgt über mehrere Stufen zellulärer Veränderungen,
die je nach Proliferationsgrad in CIN (zervikale intraepitheliale Neoplasie) I, II und III
eingeteilt werden. In den wenigsten Fällen führt eine Infektion mit HPV jedoch zu einem
A Einleitung
2
Karzinom. So bilden sich bei etwa 60-80 % der Frauen mit CIN I die Läsionen spontan
zurück (Ostor, 1993; Riethmuller et al., 2002), und bei weiteren 20–30 % verbleibt der
Zustand unverändert (Ostor, 1993). Eine andauernde Infektion mit „high risk“ HPV-Typen
scheint der wichtigste Faktor zu sein, ob sich eine Infektion in Richtung eines invasiven
Karzinoms entwickelt.
A.2 Struktur des Kapsids
Papillomviren sind kleine, hüllenlose DNA-Viren, deren Kapsiddurchmesser 52-55 nm
beträgt. Ein Virus setzt sich aus 72 pentameren Kapsomeren zusammen, die in einem T=7
Gitter (Baker et al., 1991) auf der Virusoberfläche arrangiert sind. Es besteht aus zwei
Strukturproteinen: Dem Haupstrukturprotein L1
(~ 55 kDa), und dem Nebenstrukturprotein L2 (~
70 kDa), wobei das Verhältnis etwa 30:1 beträgt
(Hagensee et al., 1993; Kirnbauer et al., 1993).
Abbildung A.1: Kapsidmodell von HPV 16
www.uchsc.edu./sm/molbiol/rgarcea.html
A.3 Genomstruktur
Die Struktur des Genoms verschiedener Papillomviren ist sehr einheitlich. Alle besitzen ein
etwa 8 kbp großes, zirkuläres, doppelsträngiges DNA-Genom, das sich in drei Regionen einteilen läßt: Die regulatorische Region (upstream regulatory region, URR oder long control
region, LCR), die frühe Region (early Region, E) und die späte Region (late, L). Die URR
enthält alle cis-regulatorischen Elemente, die für die Transkription benötigt werden, inklusive
des frühen Promotors und des Replikationsursprungs.
Die frühe Region kodiert die Proteine E1 bis E7, die für die virale Replikation und Transkription und die Zellzykluskontrolle verantwortlich sind. Die späte Region kodiert die
Strukturproteine L1 und L2, die für die Kapsidproduktion benötigt werden, welche im späten
viralen Lebenszyklus stattfindet. Ein linearisiertes Genom ist in Abbildung A.2 dargestellt.
A Einleitung
3
Abbildung A.2: Genomaufbau von HPV 16
www.cinvestax.mx/genetica/MyFiles/Papillomavirus/PAPexp.html
A.3.1 Die frühen Gene E1 – E5
Das frühe Protein E1 ist mit der DNA-Replikation assoziiert und besitzt ATPase- und
Helikaseaktivität (Liu et al., 1995; Conger et al., 1999; Swindle et al., 1999). Es interagiert
mit dem E2-Protein und hat hohe Bindungsaffinität an den Replikationsursprung in der URR
(Chiang et al., 1992; Kuo et al., 1994).
E2 besitzt eine C-terminale DNA-bindende und eine N-terminale transaktivierende Domäne.
Es bildet zusammen mit E1 einen Initiationskomplex und bindet als Dimer an pallindromische
Sequenzen in der URR, was eine Aktivierung oder Repression der viralen Aktivierung zur
Folge haben kann (McBride et al., 1991).
E4 kann zu den späten Genen gerechnet werden. Das Protein destabilisiert die Keratinfilamente, was zur Auflösung des Keratinnetzwerks führt und die Freisetzung der Viren
erleichtert (Doorbar et al., 1991; Roberts et al., 1993).
Bei bovinen Papillomviren ist das membranassoziierte E5 Protein hauptverantwortlich für die
zelluläre Transformation (Burkhardt et al., 1987), wohingegen diese Eigenschaft bei HPV E5
von untergeordneter Bedeutung ist. Hier aktiviert E5 Wachstumsfaktoren und blockiert die
Regulation des Rezeptorabbaus (Straight et al., 1993; Hwang et al., 1995).
A.3.2 Die frühen Gene E6 und E7
Die frühen Proteine E6 und E7 spielen bei der Krebsentstehung eine entscheidender Rolle, da
sie für die Transformation der Zellen verantwortlich sind. So haben sogenannte „low risk“Typen eine weit geringere Fähigkeit, maligne Transformation einzuleiten, als „high risk“-
A Einleitung
4
Typen, was an den funktionellen Unterschieden zwischen den jeweiligen E6 und E7 Proteinen
liegt.
Das E6 Protein der „high risk“ HPV-Typen 16 und 18 interagiert mit dem antionkogenen
Regulator p53 und dem Protein E6AP des Ubiquitin-Abbaus, was zur Degradation von p53
führt (Werness et al., 1990; Huibregtse et al., 1991; Hubbert et al., 1992). Im Gegensatz dazu
wird bei den „low risk“ HPV-Typen 6 und 11 keine p53 Degradation ausgelöst (Gage et al.,
1990; Barbosa et al., 1991; Halbert et al., 1992). Das Fehlen eines fuktionellen p53 Proteins
macht die Zellen anfällig für Schäden der DNA und verhindert die Aktivierung der p53vermittelten Apoptose (Crook et al., 1991; Crook et al., 1992). HPV 16 E6 hat zwei Spleißprodukte, von denen aber nur das Vollänge E6 zur Interaktion mit p53 in der Lage und somit
klinisch relevant ist. Des weiteren besitzt es vier Zinkfingerstrukturen (Cys-X-X-Cys) wie
verschiedene Transkriptionsfaktoren (Grossman & Laimins, 1989; Barbosa et al., 1989),
wobei eine Rolle in der Transkription noch nicht klar nachgewiesen wurde.
E7 enthält zwei Zinkfingermotive und besitzt transformierende und transkriptionelle
regulatorische Funktionen (Phelps et al., 1988; Barbosa et al., 1989; Phelps et al., 1991). Auch
wenn E7 in vitro allein in der Lage ist, Zellen zu transformieren, benötigt es E6, um durch
HPV die volle Transformation und Immortalisierung der Zellen zu erreichen (Barbosa &
Schlegel, 1989; Sedman et al., 1991). E7 kontrolliert den Zellzyklus durch Interaktion mit
pRB (Dyson et al., 1989; Munger et al., 1989) und anderen RB-assoziierten Proteinen wie
P107 und P130, indem es den Transkriptionsfaktor E2F ersetzt (Chellappan et al., 1992), was
zu unregulierter Aktivierung des Zellzyklus in der infizierten Zelle führt (Morozov et al.,
1997; Ruesch & Laimins, 1997).
A.3.3 Die späten Gene L1 und L2
Das L1-Gen ist das stärkste Antigen der Papillomvirusproteine: Während der natürlichen
Infektion, vor allem aber nach Immunisierung mit HPV-Kapsiden werden hohe Titer von
Antikörpern gemessen. Es ist schwach phosphoryliert und besitzt keine DNA-bindenden
Eigenschaften (Kirnbauer et al., 1992; Kirnbauer et al., 1993). L1 ist bei allen Papillomviren
ein stark konserviertes Protein, das sich selbständig zu virus-ähnlichen Partikeln (virus-like
particles, VLPs) zusammenlagern kann (Kirnbauer et al., 1993; Christensen et al., 1994). Das
L2-Protein ist stark phosphoryliert und bindet an DNA. Im Gegensatz zu L1 ist L2 nicht in
der Lage, sich zu Partikeln zusammen zu lagern.
A Einleitung
5
A.4 Lebenszyklus
Der Lebenszyklus aller Papillomviren ist vom Differenzierungsgrad der Zelle abhängig
(Laimins, 1993) (Abbildung A.3). Die initiale Infektion mit HPV erfolgt in undifferenzierten
Epithelzellen im Stratum basale, in das die Viren durch kleinste Verletzungen der Haut
gelangen. Im Nukleus der infizierten Zelle wird die Zahl der HPV-Genome, welche
extrachromosomal vorliegen (Terhune et al., 1999), auf 50-100 erhöht (Stubenrauch &
Laimins, 1999). Bei der Zellteilung wird die virale DNA auf beide Tochterzellen verteilt, von
denen die eine aus der Basalschicht wandert und den Differenzierungsprozess durchläuft
(Watt, 1998), während die andere weitere Zellteilungen in der Basalschicht durchläuft und so
ein Reservoir für virale DNA darstellt. Im Stratum spinosum werden die virale DNA
amplifiziert und die frühen Gene transkribiert. Die Synthese der Kapside findet schließlich in
ausdifferenzierten Keratinozyten im Stratum granulosum statt (Baker & Howley, 1987;
Hummel et al., 1995) und das reife Virus wird von den distalen Zellen nach außen abgegeben
(Tindle, 1996).
Abbildung A.3: Differenzierungsabhängige Funktionen in normalen
und HPV-infizierten Epithelzellen;
aus Stubenrauch et al., 1999
A Einleitung
6
A.5 HPV und Immunantwort
Eine Infektion mit HPV wird in fast allen Fällen durch die Aktivierung des Immunsystems
erfolgreich bekämpft (Laga et al., 1992; Petry et al., 1994; Garzetti et al., 1995). Im Falle
einer nicht hinreichenden Immunantwort kann es jedoch als Folge einer persistierenden
viralen Infektion zur Entstehung einer Neoplasie kommen (Remmink et al., 1995; Stern et al.,
2001; O’Brien & Campo, 2002). PV persistieren für eine längere Zeitspanne, bevor das
Immunsystem aktiviert wird, wobei die Antwort auf die viralen Antigene erstaunlich niedrig
ist. So findet man nur geringe oder keine humoralen oder zellulären Antworten bei der
Virusproduktion, die in CIN I und II-Läsionen stattfindet (Laimins, 1993). Antikörper
hauptsächlich gegen frühe HPV-Proteine werden in Patienten mit CIN III und Tumoren
gefunden (Di Leonardo et al., 1994; Carter & Galloway, 1997) und CD4 und CD8 TLymphozyten werden in sich rückbildenden Warzen (Coleman et al., 1994; Knowles et al.,
1996) und in Tumoren der Zervix beobachtet (Evans et al., 1997; Hohn et al., 1999). Das
Scheitern des Immunsystems bei der Beseitigung der Virusinfektion kann eventuell durch den
Lebenszyklus der Viren erklärt werden. So sind die Kapsidproteine, obwohl bei systemischer
Applikation immunogen (Kirnbauer et al., 1996), aufgrund der Expression im Stratum
granulosum für die Immunzellen fast unzugänglich (de Gruijl et al., 1999). Helfer-T-ZellAntworten werden zwar bei CIN-Patientinnen, jedoch nur selten bei Patientinnen mit
Zervixkarzinom beobachtet. Das könnte einen Defekt bei der korrekten E7-Präsentation zur
Aufrechterhaltung der E7-spezifischen T-Zellen widerspiegeln (Nakagawa et al., 1996;
Tsukui et al., 1996; Kadish et al., 1997; Luxton et al., 1997; de Gruijl et al., 1998). Des
weiteren ist die Häufigkeit von Langerhans Zellen, den epithelialen Dendritischen Zellen,
umgekehrt proportional zur Schwere der Erkrankung (Viac et al., 1990; Morelli et al., 1992;
Lehtinen et al., 1993); in Kondylomen und CIN wurde eine signifikante Abnahme von
Langerhans Zellen im Vergleich zu „normalen“ Gewebeproben der selben Patienten beobachtet, was nahe legt, daß dadurch die immunologische Überwachung nachläßt (Viac et al.,
1990; Lehtinen et al., 1993). HPVs sind also in der Lage, das Immunsystem zu umgehen und
einen Status der Immuntoleranz her zu stellen (Tindle & Frazer, 1994; O’Brien & Campo,
2002).
Einige Vakzinierungsstrategien sind entwickelt worden, um eine verstärkte Immunantwort
gegen HPV auszulösen.
A Einleitung
7
A.6 Vakzinierungsstrategien
A.6.1 Prophylaktische Vakzine
Prophylaktische Vakzine dienen dazu, eine Infektion zu verhindern, wobei die ausgelöste
Immunantwort gegen die späten Strukturproteine wie L1 gerichtet ist, aus denen das
Viruskapsid besteht. Die häufigste prophylaktische Vakzine besteht aus virus-ähnlichen
Partikeln (VLPs), die einen idealen Untereinheiten-Impfstoff darstellen, der weder DNA noch
onkogene Proteine enthält (Berry & Palefsky, 2003).
A.6.2 Therapeutische Vakzine
Diese Vakzine sind in der Regel gegen die E6 und E7 Proteine gerichtet, da sie in den meisten
hochgradigen Läsionen und im Karzinom vermehrt exprimiert werden (Stern, 2001).
Idealerweise wird dadurch eine zelluläre Immunantwort erzeugt, die HPV-spezifische
zytotoxische T-Zellen induziert (Stern, 2001; Berry & Palefsky, 2003).
Beide Arten von Impfstoffen sind erfolgreich in präklinischen Studien an Tiermodellen
getestet worden, wo sie vor Neuinfektionen schützten oder bestehende Tumore beseitigen
konnten (Tabelle A.3) und werden inzwischen in klinischen Studien getestet (Tabelle A.2).
Tabelle A.2: Klinische Studien von HPV Vakzinen
Pharmakonzern
Merck
NCI
Merck
Merck
Stressgen
Xenova
Zycos
Xenova
GlaxoSmithKline
NCI
Not Available
prophylaktisch /
therapeutisch
P
P
P
P
T
T
T
P, T
T
P, T
T
aus Berry and Palefsky, 2003
Antigen
Art der Vakzine
HPV-Typ
L1
L1
L1
L1
E7
E6, E7
E7
L2, E6, E7
E7
L1, L2, mutated E2, mutated E7
E7
VLP
VLP
VLP
VLP
Fusionsprotein (HspE7)
Vacciniavirus (TA-HPV)
verkapselte Plasmid-DNA
Fusionsprotein (TA-CIN)
Fusionsprotein (D16E7)
CVLP
Peptide
6, 11, 16, 18
16
16
11
16
16, 18
16
16
16
16
A Einleitung
8
Tabelle A.3: Verschiedene Modelle einer HPV-Vakzine
Impfstoff
Struktur
prophylaktisch /
therapeutisch
Art der relevanten
Immunantwort
Referenzen
VLPs
PV-Kapside aus den
Strukturproteinen L1 oder
L1/L2
P
humoral: neutralisierende Antikörper
gegen L1 /L2
Kirnbauer et al., 1992
Brown et al., 2001
Evans et al., 2001
Emeny et al., 2002
Kapsomere
L1-Pentamere
P, T
humoral: neutralisierende Antikörper
gegen L1
zellulär: zytotoxische T-Lymphozyten
gegen L1
Rose et al., 1998
Ohlschlager et al., 2001
CVLPs (chimäre VLPs)
VLPs aus Fusion von
Strukturproteinen und
Peptiden früher Proteine
T (P)
zellulär: zytotoxische T-Lymphozyten
gegen E7
(humoral: neutralisierende Antikörper
gegen L1 /L2)
Greenstone et al., 1998
Peng et al., 1998
Schäfer et al., 1999
Wakabayashi et al., 2002
(Fusions-) Proteine
E7
hsp65+E7
Fusion aus L2, E6 + E7 (TACIN)
Haemophilus influenzae
Protein D + E7 (D16E7)
synthetisch hergestellt Peptide
von L2 / E6 /E7
P, T
humoral: neutralisierende Antikörper
gegen L2
zellulär: zytotoxische T-Lymphozyten
gegen E6 / E7
Hariharan et al., 1998
Chu et al., 2000
van der Burg et al., 2001
Gerard et al., 2001
Kim et al., 2002
P, T
humoral: neutralisierende Antikörper
gegen L2
zellulär: zytotoxische T-Lymphozyten
gegen E7
Kawana et al., 2001
Castellanos et al., 2001
Kadish et al., 2002
Zwaveling et al., 2002
P, T
humoral: neutralisierende Antikörper
gegen L1
zellulär: zytotoxische T-Lymphozyten
gegen E7
Osen et al., 2001
Rocha-Zavaleta et al., 2002
Cheng et al., 2002
Sheets et al., 2003
De Marco et al., 2003
Peptide
DNA-Vakzine
Plasmid-DNA, die für L1 / E7
codiert
A.7 DNA-Immunisierung
DNA-Vakzine stellen einen neuen Ansatz der Immunisierung dar, bei dem statt eines
abgetöteten oder attenuierten Krankheitserregers oder einer Untereinheit davon, ein oder
mehrere Gene, die für Proteine des Pathogens kodieren, verimpft werden. Ziel dieses
Ansatzes ist es, sowohl zelluläre als auch humorale Immunität gegen z.B. Krebserkrankungen,
Allergien oder Autoimmunkrankheiten zu erzeugen (Tabelle A.4).
A Einleitung
9
Tabelle A.4: Möglich Ziele für eine DNA-Vakzine
Erkrankung
Krebserkrankungen
Prostatakrebs
Referenzen
Zervixkarzinom
Osen et al., 2001
Rocha-Zavaleta et al., 2002
Cheng et al., 2002
Sheets et al., 2003
De Marco et al., 2003
Allergien
Hausstaubmilbe
Birkenpollen
Autoimmunkrankheiten
Typ 1 Diabetes
Multiple Sklerose (Tiermodell: experimentelle
Autoimmunencephalomyelitis, EAE)
Bhattachary et al., 2002
Steiner et al., 2002
Kuratsukuri et al., 2002
Hsu et al., 1996a
Hsu et al., 1996b
Jaquet et al., 2003
Hartl et al., 1993
Li & Escher, 2003
Baker & Hankey, 2003
Bei der DNA-Vakzinierung werden meist Plasmide verwendet, die für ein spezifisches
Antigen unter der Kontrolle eines eukaryontischen Promotors kodieren. Das dann endogen
synthetisierte Immunogen besitzt eine natürliche Konformation und durchläuft posttranslationale Modifikationen und Signalwege der Immunerkennung, die sich nicht von denen
natürlicher Antigene unterscheiden. Plasmid-DNA kann eine große Anzahl verschiedener
Zellen transfizieren und scheint bereitwillig von verschiedenen Zellen des reticuloendothelialen Systems aufgenommen zu werden, darunter auch Makrophagen und Dendritische
Zellen (Condon et al., 1996; Parker et al., 1999; Lunsford et al., 2000).
DNA-Vakzine vereinen die optimalen Charakteristika der konventionellen Impfstoffe: Sie
sind nicht infektiös, produzieren aber die Antigene in vivo und können sowohl eine zelluläre
als auch humorale Immunantwort auslösen (Abbildung A.4, Tabelle A.5). Außerdem
erleichtern sie die Verwendung kombinatorischer Impfstoffe und sind auch ohne Kühlung
stabil.
A Einleitung 10
Tabelle A.5: Immunogenität und Effizienz von DNA-Vakzinen, die erfolgreich in Tiermodellen getestet wurden
Pathogen
VIREN
Cytomegalovirus
Encephalitis Virus
Hepatitis B Virus
Antikörper
CTL
Schutz
pp89
prM/E
HbsAg
HbcAG
+
+
+
+
ND
+
+
+
+
Herpes Virus, bovin
Herpes simplex virus 1,2
gD
gB, gD
+
+
ND
fragwürdig
+
+
Affen Immundefizienz Viren und Affen /
Human Immundefizienz Virus-Chimeren
Gag, Pol, Env, Vif, Vpr Vpu, Rev,
Tat, Nef
+
+
+
Influenza
HA, NP
+
+
+
lymphocytäres Choriomeningitisvirus
Masern
Tollwut
Rotaviren
BAKTERIEN
Mycoplasma pulmonis
Mycobacterium tuberculosis
NP
HA, F, NP
G
VP6
+
+
+
+
+
+
+
ND
+
ND
+
+
library
Ag85, hsp65
+
+
ND
+
+
+
Barry et al., 1995
Tascon et al., 1996
Huygen et al., 1996
CSP, HEP17
+
+
+
Sedegah et al., 1994
Doolan et al., 1996
PARASITEN
Malaria
Protein(e)
ND: nicht durchgeführt
http://www.asm.org/ASM/files/CCPAGECONTENT/docfilename/0000003769/dnareprt[1].pdf
Referenzen
Armas et al., 1996
Philpotts et al.,1996
Davis et al., 1993
Michel et al., 1995
Kuhöber et al., 1996
Davis et al., 1996
Cox et al., 1993
McClemens et al., 1996
Kriesel et al., 1996
Bourne et al., 19996
Wang et al., 1993
Lu et al., 1996
Boyer et al., 1996
Letvin et al., 1998
Fynan et al., 1993
Donnelly et al., 1995
Robinson et al., 1997
Yokoyama et al., 1995
Cardoso et al, 1996
Xiang et al., 1994
Herrmann et al., 1996
A Einleitung 11
Abbildung A.4: Immunmechanismen, die durch Impfung mit nackter DNA induziert werden.
Aus Scientific American, Juli 1999
A.8 Zielsetzung der Arbeit
Es sollte untersucht werden, ob sich die Strukturproteine L1 und L2 von HPV 16 als Vehikel
zur Immunisierung eignen. HPV-Partikel und auch VLPs werden von Zellen verschiedener
Spezies sehr gut aufgenommen (Müller et al., 1995). Diese Eigenschaft sollte genutzt werden,
um DNA in Zellen einzuschleusen, die eine Immunantwort auf das kodierte Antigen
hervorrufen soll.
In den letzten Jahren wurden verschiedene Ansätze entwickelt, um DNA mit Papillomvirusproteinen zu assoziieren, von denen einige hier kurz vorgestellt werden.
A.8.1 Pseudovirionen
A.8.1.1 Rekombinante Vacciniaviren
Beim Vacciniavirus-System wurden die Strukturproteine L1 und L2 von BPV (Zhao et al.,
1998), HPV 33 (Unckell et al., 1997) oder HPV 18 (Stauffer et al., 1998) in Cos-Zellen
A Einleitung 12
(Unckell et al., 1997; Zhao et al., 1998) oder 293T-Zellen (Stauffer et al., 1998) mittels rekombinanter Viren exprimiert. Die Zellen wurden vorher mit einem für ß-Gal kodierenden
Plasmid (3,5 bis 10,2 kb) transfiziert, das verpackt werden sollte. Episomale Kopien des
Plasmids konnten erfolgreich in Abwesenheit eines HPV-Verpackungssignals eingepackt und
dann in Zellen transduziert werden.
A.8.1.2 in vitro Konstruktion von Pseudovirionen
Hierfür werden VLPs bestehend aus HPV 16 L1 (Touze & Coursaget, 1998) oder L1 und L2
(Kawana et al., 1998) im Bakulovirussystem hergestellt. Das Disassemblieren der Partikel
erfolgt durch Zugabe von Calzium-Chelatbildnern wie EGTA zusammen mit DTT (Touze &
Coursaget, 1998) oder durch Reduktion der Disulfidbrücken mit 2-Mercaptoethanol (Kawana
et al., 1998). Das Zusammensetzen der Partikel durch Zugabe von 25 mM CaCl2 oder Dialyse
gegen PBS mit physiologischer NaCl-Konzentration findet in Gegenwart von Plasmid-DNA
statt, die für verschiedene Reportergene kodiert (ß-Gal oder GFP). Die so entstandenen
Pseudovirionen wurden mit DNaseI behandelt, um nicht verpackte DNA zu entfernen, und für
Transduktionsexperimente eingesetzt, in denen das Reporterplasmid erfolgreich in die
Zielzellen eingeschleust wurde (Kawana et al., 1998; Touze & Coursaget, 1998). Die Rolle
von L2 wurde von den Gruppen unterschiedlich bewertet: Im Gegensatz zu Kawana et al. sind
Touze & Coursaget der Auffassung, daß L2 für die Verpackung und die Infektion nicht nötig
ist.
A.8.1.3 Pseudovirionen aus Hefe
Bei dieser Methode wurde ein saccharomyces cerevisiae-Stamm mit zwei Plasmiden
transfiziert: Eines kodiert für die Strukturproteine L1 und L2 von HPV 16, das andere enthält
das Reportergen (GFP), HPV 16 E2 und die URR, wobei das E2-Protein durch Interaktion mit
der URR bei der Verpackung des Plasmids in die Partikel eine Rolle spielt. Aufgrund von
ebenfalls kodierten Selektionsmarkern auf beiden Plasmiden kann auf doppelt positive
Hefeklone selektiert werden. Etwa 30 % der produzierten Partikel enthalten DNA. Nach
Behandlung mit DNaseI wurden ID13-Zellen erfolgreich mit den Pseudovirionen transduziert,
wie die Expression des Reportergens zeigte (Rossi et al., 2000).
A Einleitung 13
A.8.2 Kopplung von DNA an Partikel
Diesem Ansatz liegt die Überlegung zu Grunde, daß DNA nicht in Partikel verpackt sein
muß, um in Zellen zu gelangen, sondern daß externe Bindung an VLPs dafür ausreichend ist.
An VLPs aus sowohl L1 als auch L1 und L2 von HPV 6, -11, -16 und –18 (Müller et al.,
1995, Yeager et al., 2000), die entweder im Bakulovirussystem (Müller et al., 1995) oder in
Hefe (Yeager et al., 2000) hergestellt wurden, wurde DNA mit dem ß-Gal-Reportergen
chemisch gekoppelt. Bei einem Reporterplasmid von knapp 9 kb lag die Infektion bei weniger
als einem Prozent (Müller et al., 1995). Wurde jedoch ein lineares DNA-Stück von 1,8 kb, das
den CVM Promotor, das Reportergen und ein Polyadenylierungssignal umfaßte, an die
Partikel gebunden, wurden 15-40 % der Zellen infiziert. Vermutlich verhindert ein komplettes
Plasmid aufgrund seiner Größe die Aufnahme der VLPs in Zellen (Yeager et al., 2000). Die
Aussagen über die Notwendigkeit von L2 bei der Infektion sind auch hier unterschiedlich.
A.8.3 Kopplung von DNA an ein HPV 16 L2-Peptid
Bei Infektionsversuchen mit HPV 6 und –16 Pseudovirionen fanden Kawana et al. 1999
heraus, daß monoklonale Antikörper gegen ein synthetisches Peptid der HPV 16 L2-Sequenz,
das die Aminosäuren 108 bis 120 umfaßt, die Pseudoinfektion blockieren. Da die Antikörper
an intakte HPV16 L1/L2 VLPs binden, wird davon ausgegangen, daß sich diese L2-Region an
der Oberfläche der Virionen befindet. Auch ist die Aminosäuresequenz verschiedener HPVTypen in diesem Bereich stark konserviert, so daß es sich eventuell um ein kreuzneutralisierendes Epitop von genitalen HPV-Typen handelt. In einem Kompetitionsassay mit
dem L2180-126-Peptid von HPV 16 konnte die Infektion von COS-1-Zellen mit HPV 16
Pseudovirionen behindert werden (Kawana et al., 2001). Mit einem Fusionsprotein aus
diesem L2-Peptid und GFP konnte gezeigt werden, daß das Peptid die Bindung und den
Eintritt in Zellen vermittelt. Wurden die ersten vier Aminosäuren des Peptids, die bei
verschiedenen HPV-Typen stark konserviert sind, ausgetauscht, so konnte keine Bindung des
Fusionsproteins mehr beobachtet werden. In Pseudovirionen mit der selben Mutation sank die
Infektiosität, was nahe legt, daß L2 in einen frühen Schritt bei der Infektion verwickelt ist.
A Einleitung 14
A.8.4. Spezifische Fragestellung
Im Rahmen dieser Arbeit sollten drei verschiedene Vehikelpräparationen im Vergleich zu
nackter DNA getestet werden: (i) Pseudovirionen, bei denen das Zielplasmid in HPV 16VLPs verpackt ist, (ii) VLPs, an die das Reportergen von außen gebunden ist und (iii) ein
Peptid von HPV 16 L2, an das das Reportergen gebunden vorliegt. Als Reportergen wurde
Ovalbumin ausgewählt.
Dabei waren folgende experimentelle Schritte vorgesehen:
•
Klonierung der zu verpackenden / koppelnden DNA-Konstrukte und Test auf
Expression des Reportergens Ovalbumin
•
Herstellung von Pseudovirionen im Hefesystem und durch Dis- und Reassembly,
Kopplung des Reporters an HPV 16 VLPs und L2108-126 und Überprüfung der
Verschiedenen Vehikel auf den korrekten Zusammenbau
•
Immunisierung von Versuchstieren und Analyse der Immunantwort
B Material 15
B Material
B.1 Chemikalien
Chemikalien und Lösungen wurden, wenn nicht anders vermerkt, von Merck (Darmstadt),
Roth (Karlsruhe), Serva (Heidelberg) und Sigma (Deisenhofen) bezogen.
B.2 Radiochemikalien
[α32P]-dCTP (25 µCi / µl)
[α32P]-dGTP (100 µCi / µl)
Na251CrO4 (gesamt 5 mCi)
Amersham Biosciences, Braunschweig
Perkin Elmer, Weiterstadt
B.3 Kits
PCR Kits
Taq DNA Polymerase
Herkulase Hotstart DNA Polymerase
Promega, Mannheim
Stratagene, Heidelberg
QIAGEN Plasmid Maxi Kit
QIAEX II Gel Extraction Kit
Effectene Transfection Reagent
Qiagen, Düsseldorf
Cytofix / Cytoperm Kit
BD PharMingen San
Diego, CA, USA
B.4 Enzyme (DNA-Modifikation)
Alle Restriktionsenzyme und andere DNA-modifizierenden Enzyme mit dazugehörigen
Puffern wurden von NEBiolabs (Schwalbach) und MBI Fermentas (St. Leon-Rot) bezogen.
B.5 Größen- und Konzentrationsstandards
SmartLadder Größen-/Konzentrationsstandard für DNA
Protein-Größenstandard
BSA-Proteinkonzentrationsstandard
Eurogentech, Darmstadt
Biorad, München
Sigma, Deisenhofen
B.6 Antikörper
B.6.1 Primärantikörper
Bezeichnung, Spezifität
α-OVA; 8,1 mg/ml
α-HPV16 L1; 0,5 mg/ml
Typ
Maus monoklonal
Klon: OVA-14
Maus monoklonal
Anwendung
Western Blot
1:10.000
Western Blot
Bezugsquelle
Sigma, Deisenhofen
BD Pharmingen, San
B Material 16
4543 α-HPV16 L1
Klon: CAMVIR-1
Kaninchen polyklonal
25/C α-HPV16 L1
Maus monoklonal
#65-Kanda αHPV16 L2
Kaninchen polyklonal
α-Maus CD4; 0,2 mg/ml
Ratte monoklonal
Cy-chrom konjugiert
Klon: H129.19
Ratte monoklonal
PE konjugiert
Klon: 53-6.7
Ratte monoklonal
FITC konjugiert
Klon: XMG1.2
Ratte monoklonal
Biotin konjugiert
Klon: XMG1.2
Ratte monoklonal
Klon: R4-6A2
α-Maus CD8a; 0,2 mg/ml
α-Maus IFNγ; 0,1 mg/ml
α-Maus IFNγ; 0,5 mg/ml
α-Maus IFNγ; 1 mg/ml
1:2000
Western Blot
1:5000
ELISA
1:300
Western Blot
1:50
FACS
1:100
Diego, CA, USA
Dr. M. Müller, DKFZ
Heidelberg
Dr. M. Müller, DKFZ
Heidelberg
Dr. M. Müller, DKFZ
Heidelberg
BD Pharmingen, San
Diego, CA, USA
FACS
1:100
BD Pharmingen, San
Diego, CA, USA
FACS
1:50
Caltag, Burlingame,
CA, USA
ELISPOT
1:500
BD Pharmingen, San
Diego, CA, USA
ELISPOT
1:500
BD Pharmingen, San
Diego, CA, USA
Anwendung
Western, ELISA
1:5000
Western, ELISA
1:7500
Bezugsquelle
Dianova, Hamburg
B.6.2 Sekundärantikörper
Bezeichnung
Ziege-α-Maus IgG / IgM, HRP konjugiert
Ziege-α-Kaninchen IgG, HRP konjugiert
Dianova, Hamburg
B.7 DNA und Peptide
B.7.1 Plasmide
pAc-Neo-OVA
12 kb, enthält komplette OVA cDNA unter Kontrolle des humanen ß-Actin
Promotors;
Moore et al, 1988, Cell 54:777-785;
von H.G. Rammensee, Tübingen, erhalten; verwendet, um OVA über PCR zu
amplifizeren und zu subklonieren;
pcDNA3.1+
5428 bp, MCS zwischen pCMV-Promotor und BGH Polyadenylierungssequenz, Ampicillin-Resistenzgen;
Insertion cDNA OVA über BamHI und EcoRI
Invitrogen
pYes2*-VP22-E7(1-60)
7906 bp nach Entfernung der bakteriellen Sequenzen, 2 µ ori, HPV 16 E2 und
URR, VP22-E7(1-60) unter Kontrolle des pCMV-Promotors, URA3 Marker;
Austausch VP22-E7 gegen OVA über BamHI und AflII
Targetplasmid für Pseudovirionen; von T. ElHindi DKFZ Heidelberg erhalten
pD125
15 kb, HPV 16 L1 und L2 unter Kontrolle den Gal1/10 Promotors, 2 µ ori,
LEU2-d Marker; Hofmann et al., 1995;
Verpackungsplasmid; von Dr. M. Müller, DKFZ Heidelberg erhalten
B Material 17
B.7.2 Oligonukleotidprimer
für Klonierung von OVA in pcDNA3.1 mit Restriktionsstellen
sense
OVA 5‘ BamHI
5‘ AGCAGTGGATCCATGGGCTCCATCGGCGCAGCA 3‘
antisense
OVA 3‘ EcoRI
5‘ AGCAGTGAATTCTTAAGGGGAAACACAATCTGCC 3‘
für den Austausch von VP22-E7(1-60) gegen OVA in pYES2*-VP22-E7(1-60) mit
Restriktionsstellen
sense
OVA 5‘ BamHI
siehe oben
antisense
OVA 3‘ AflII
5‘ AGCAGTCTTAAGTTAAGGGGAAACACAATCTGCC 3‘
für PCR B/N mit und ohne Modifikation
sense
pCMV 5‘ (Biotin)
5‘ GTTGACATTGATTATTGACTA 3‘
5‘ CCATAGAGCCCACCGCATCCC 3‘
antisense
BGHpA 3‘ (NH2)
für OVA-Nachweis
sense
yes I
antisense
yes II
5‘ TCAACCAAATCACCAAACCAAATGA 3‘
5‘ TGCTTGTGTGTCTTCATCCTTAAAT 3‘
B.7.3 Peptide
Folgende Peptide wurden in der Peptidsyntheseeinheit des DKFZ hergestellt und mittels
HPLC gereinigt:
Ovalbumin 258-265
SIINFEKL
HPV 16 L2 108-126
LVEETSFIDAGAPTSVPSI
HPV 16 L1 165-173
AGVDENRECI
H2-Kb restringiertes CTL Epitop (Turner et
al.,1997), zur Beladung von Zielzellen im
intrazellulären IFNγ-Assay und ELISPOT
verwendet
zur Herstellung eines Antiserums und als
Carrierpeptid zum Zelleintritt für DNA
verwendet (Kawana et al., 2001)
H2-Db restringiertes CTL Epitop (Öhlschläger
et al., 2003), zur Beladung von Zielzellen im
Zytotoxizitätstest und ELISPOT verwendet
B.8 Biologische Materialien
B.8.1 Bakterienstämme
E. coli SURE
Präparation von Plasmid DNA
e14-(McrA-)D (mcrCB-hsdSMR-mrr)171 endA1 supE44 thi-1
gyrA96 relA1 lac recB recJ sbcC umuC ::TN 5 (Kanr) uvrC [F‘
proAB lacIq Z∆M15Tn 10 (Tetr)]c
B.8.2 Hefestämme
saccharomyces cerevisiae 1699/pD125 Herstellung eines DNA-verpackenden Stammes; enthält das
Strukturplasmid pD125
MATα leu2-04 ade1 ura3 pep4::ura3 cir0
B Material 18
B.8.3 Eukaryontische Zellinien
B.8.3.1 Insektenzellen
SF9
TN high five
Ovarialgewebe der Larve der Spodoptera frugiperda;
Replikation rekombinanter Bakulovirus Expressionsvektoren
Ovarialgewebe der Larve der Trichoplusia ni;
Expression von VLPs
B.8.3.2 Säugerzellen
EL4
EG7
RMA-S
293T
T-Lymphom Linie, Stimulator-Zellen; in C57BL/6 Maus durch 9,10-dimethyl-1,2benzanthracen induziert; Shevach et al., 1972
T-Lymphom Linie, Stimulator-Zellen; mit pAc-neo-OVA transfizierte EL4 Zellen;
Moore et al., 1988
TAP-defiziente Lymphomzellen aus einer C57BL/6 Maus, Stimulator-Zellen; Powis
et al., 1991
humane Nierenepithelzellen, sehr gut transfizierbarer Abkömmling der Linie 293, in
die das Gen für das SV40 T-Antigen inseriert wurde
B.8.4 Mauslinien
C57BL/6
Charles River WIGA, Sulzfeld
im Zentralen Tierlabor des DKFZ unter spezifisch pathogenfreien Bedingungen
gehalten
B.8.5 Bakulovirusstocks
A 245
A 194
Expression von HPV 16 L1∆C, erhalten von Dr. M. Müller, DKFZ Heidelberg
Expression von HPV 16 L1∆C E71-55, erhalten von Dr. M. Müller, DKFZ Heidelberg
B.9 Medien
B.9.1 Medien für die Bakterienkultur
LB-Medium
LB Agar
10 g Bacto-Trypton
5 g Hefe Extrakt
5 g NaCl
15 g Bacto-Agar
1 l LB-Medium
B.9.2 Medien für die Hefekultur
20 % Glucose (sterilfiltrieren)
20 % Galactose (sterilfiltrieren)
YPD-Medium
20 g Difco Pepton
ad 1 l H2O bidest
B Material 19
10 g Hefe Extrakt
ad 1 l H2O, auf pH 5,8 einstellen, autoklavieren
2 % Glucose zugeben
URA-/LEU- Medium
6,7 g Stickstoffbasis ohne Aminosäuren
20 g Dextrose
182 g Sorbitol
0,02 g L-Arginin
0,01 g L-Histidin
0,06 g L-Isoleucin
0,04 g L-Methionin
0,06 g L-Phenylalanin
0,06 g L-Threonin
0,04 g L-Tryptophan
0,05 g L-Tyrosin
ad 1 l H2O, autoklavieren
Agarplatten
98 % Medium
2 % Bacto-Agar, autoklavieren
100 x LEU
10 g L-Leucin
ad 1 l H2O, sterilfiltrieren
100 x URA
0,2 g L-Uracil
ad 1 l H2O, sterilfiltrieren
B.9.3 Medien für die Zellkultur
TNM-FH und Trypanblau von Sigma (Deisenhofen), alle anderen Medien und Zusätze von
GibcoBRL (Eggenstein) bezogen.
Medium
Dublecco’s MEM / 2 mM L-Glutamin
Zusatz von
10 % FCS
1 % Penicillin / Streptomycin
RPMI 1640 / 2 mM L-Glutamin
10 % FCS
1 % Penicillin / Streptomycin
Minimum Essential Medium Eagle αModification
10 % FCS
2 mM L-Glutamin
1 % Penicillin / Streptomycin
0,01 mM 2-Mercaptoethanol
25 mM Methyl-α-Mannopyranosid
3,3 % ConA-induzierter Überstand einer
Rattenmilzzellkultur als IL2 Quelle)
(Restimulierung: „komplett“
TMN-FH
10 % FCS
1 % Antibiotikum / Antimykotikum Mix
Excell-8
10 % FCS
B Material 20
2 mM L-Glutamin
1 % Antibiotikum / Antimykotikum Mix
Fötales Kälberserum (FCS)
vor Gebrauch 30 min bei 56 °C inaktivieren
Penicillin (10000 U / ml) / Streptomycin (10000 µg / ml)
Antibiotikum / Antimykotikum-Mix
L-Glutamin (200 mM)
Geneticin (G418)
Trypsin / EDTA
0,4 % Trypanblau
B.10 Puffer und Lösungen
1 x PBS
140 mM NaCl
2,7 mM KCl
8,1 mM Na2HPO4
1,5 mM KH2PO4
Phenol /CIA
Phenol / Chloroform / Isoamylalkohl
25:24:1 (Roth)
TE-Puffer
10 mM Tris-HCl pH 8
0,1 mM EDTA
C Methoden 21
C Methoden
C.1 Mikrobiologische Methoden
C.1.1 Aufbewahrung und Kultur von Bakterien
Bakterien können in einer Flüssigkultur bei 4 °C etwa drei Wochen aufbewahrt werden, auf
LB-Agarplatten (B.9.1) etwa vier Wochen. Für eine längere Lagerung wurden
Glycerinkulturen angelegt. Dazu wurden 1 ml einer Übernachtkultur mit 0,5 ml 86%igem
(v/v) Glycerin (sterilfiltriert) vermischt und bei −70 °C eingefroren.
Bakterienklone wurden durch Ausplattieren von Bakterien auf Agarplatten mit einem
Drigalski-Spatel hergestellt. Für eine Flüssigkultur wurde eine geeignete Menge Nährmedium
mit einer Einzelkolonie von einer Platte oder aus einer Glycerinkultur angeimpft. Die
Kultivierung erfolgte bei 37 °C.
C.1.2 Herstellung elektrokompetenter Bakterien
Für die Herstellung kompetenter Bakterien für die Transformation durch Elektroporation
wurden 500 ml LB-Medium (B.9.1) mit 5 ml einer Übernachtkultur angeimpft und bei 37 °C
mit 220 rpm geschüttelt, bis die Zellen eine OD600 von 0,5 erreicht hatten. Die Bakterien
wurden 20 min auf Eis gekühlt und dann bei 4 °C mit 4000 rpm 5 min zentrifugiert (Sorvall
RC-5B Refrigiated Superspeed Centrifuge, Du Pond, Bad Nauheim, Rotor SLA-3000).
Anschließend wurde das Bakterienpellet in 500 ml kaltem 10%igem (v/v) Glycerin
aufgenommen und 20 min auf Eis inkubiert. Darauf folgte erneute Zentrifugation (4 °C /
4000 rpm / 10 min (Sorvall RC-5B)), Resuspendierung in 50 ml kaltem 10%igem (v/v)
Glycerin und 20 min Inkubation auf Eis. Die Bakterien wurden erneut zentrifugiert, (4 °C /
4000 rpm / 10 min (Sorvall RC-5B)), in 2 ml kaltem 10%igem (v/v) Glycerin aufgenommen
und in 50-µl-Aliquots bei −70 °C eingefroren.
C Methoden 22
C.1.3 Elektrotransformation kompetenter Bakterien
Kompetente Bakterien wurden auf Eis aufgetaut, vorsichtig mit 1−2 µl DNA-Lösung
vermischt und in eine vorgekühlte Elektroporationsküvette (Invitrogen, Groningen,
Niederlande) überführt. Die Transformation erfolgte in der Elektroporationskammer (Gene
Pulser, Biorad, München) bei 2,1 kV, 25 µFD und 200 Ω. Sofort danach wurden die
Bakterien in 1 ml LB-Medium / 20 mM Glukose aufgenommen und 30−120 min bei 37 °C
inkubiert. Anschließend wurden die Bakterien auf Agarplatten ausplattiert und über Nacht bei
37 °C wachsen gelassen.
C.2 Arbeiten mit DNA
C.2.1 Fällen von DNA
Puffer und Lösungen:
3 M NaOAc pH 5,0
Um DNA in wäßrigen Lösungen zu fällen, wurde die Lösung mit 1/10 Volumen 3 M
Natriumacetat pH 5,0 und 2 Volumen 100%igem (v/v) Ethanol versetzt und 10 min bei
–20 °C inkubiert. Dann wurde die DNA bei 4 °C und 15000 rpm für 15 min zentrifugiert
(Eppendorf Centrifuge, 5417R) und das Pellet mit kaltem 70%igem (v/v) Ethanol gewaschen.
Nach dem Trocknen wurde die DNA in einem adäquaten Volumen eines geeigneten Puffers
gelöst , um eine Konzentration von 0,1 bis 2 µg zu erreichen, und bis zur Verwendung bei
–20 °C aufbewahrt.
C.2.2 Schnellpräparation von Plasmid-DNA
Puffer und Lösungen:
Lösung I
50 mM Glucose / 25 mM Tris-HCl pH 8,0 / 10 mM EDTA
Lösung II
0,2 N NaOH / 1 % (w/v) SDS
Lösung III
49,1 g Kaliumacetat / 20 ml Eisessig / ad 100 ml H2O
Phenol / CIA
C Methoden 23
Mit einer einzelnen Bakterienkolonie wurden 3 ml LB-Medium / Ampicillin (100 µg/ml)
angeimpft und über Nacht bei 37 °C geschüttelt. Von dieser Kultur wurden 1,5 ml in ein
1,5-ml-Eppendorf-Reaktionsgefäß überführt und für 5 min bei 13000 rpm (Eppendorf
Centrifuge, 5417R) pelletiert. Das Bakterienpellet wurde in 100 µl Puffer I resuspendiert,
vorsichtig mit 200 µl Puffer II gemischt und auf Eis gestellt. Nach Zugabe von 150 µl Puffer
III wurde vorsichtig gevortext (Reax Top, Heidolph, Kelkheim) und 5 min auf Eis inkubiert.
Anschließend wurde erneut 5 min bei 13000 rpm zentrifugiert (Eppendorf Centrifuge,
5417R), und der Überstand wurde in ein neues Reaktionsgefäß überführt. Die Lösung wurde
mit dem gleichen Volumen Phenol/CIA versetzt und 2 min bei 13000 rpm zentrifugiert
(Eppendorf Centrifuge, 5417R), um die DNA zu extrahieren. Die wäßrige Phase wurde
abgenommen und die darin enthaltene DNA wie beschrieben gefällt (C.2.1) Nach dem
Trocknen wurde die DNA in 50 µl TE-Puffer (B.10) gelöst und bis zur Verwendung bei
–20 °C aufbewahrt.
C.2.3 Großpräparation von Plasmid-DNA
Puffer und Lösungen:
QIAGEN Plasmid Maxi Kit
P1
50 mM Tris-HCl pH 8,0 / 10 mM EDTA / 100 µg/ml RNase A
P2
200 mM NaOH / 10 % (w/v) SDS
P3
3 M Kaliumacetat pH 5,5
QBT
750 mM NaCl / 50 mM MOPS pH 7 / 15 % (v/v) Ethanol / 0,15 % (v/v) Triton X-100
QC
1 M NaCl / 50 mM MOPS pH 7 / 15 % (v/v) Ethanol
QF
1,25 M NaCl / 50 mM Tris-HCl pH 8,5 / 15 % (v/v) Ethanol
Bakterien einer 200-ml-Übernachtkultur wurden durch 10 min Zentrifugation bei 4 °C und
5500 rpm pelletiert (Sorvall RC-5B, Rotor SLA-3000). Das Pellet wurde in 10 ml Puffer P1
resuspendiert, mit 10 ml Puffer P2 vermischt und für 5 min bei Raumtemperatur inkubiert.
Nach Zugabe von 10 ml kaltem Puffer P3 wurde vorsichtig gemischt und 20 min auf Eis
inkubiert. Die Entfernung von Zelltrümmern, Proteinen und chromosomaler DNA von der
Plasmid-DNA erfolgte durch Zentrifugation (30 min / 15000 rpm / 4 °C (Sorvall RC-5B,
Rotor F-28/50)). Der Überstand wurde durch einen Filter auf eine mit 10 ml Puffer QBT
äquilibrierte Anionenaustauscher-Säule aufgetragen. Nach dem Durchlauf wurde zweimal mit
30 ml Puffer QC gewaschen und schließlich die DNA mit 15 ml Puffer QF eluiert. Das Eluat
C Methoden 24
wurde zur Fällung der DNA mit 10,5 ml Isopropanol versetzt und zentrifugiert (45 min /
4300 rpm / 4 °C (Heraeus Kühlzentrifuge Megafuge 1,0 R)). Das Sediment wurde mit 5 ml
kaltem 70%igem (v/v) Ethanol gewaschen, bei 37 °C getrocknet und in 300 µl eines
geeigneten Puffers aufgenommen.
C.2.4
Konzentrationsbestimmung von Nukleinsäuren in wäßrigen
Lösungen
Die Nukleinsäurekonzentrationen wurden durch Messung der optischen Dichte bei einer
Wellenlänge von 260 nm bestimmt (Photometer U-1100, Hitachi, Tokyo, Japan). Für die
Messung wurden die Lösungen 1:100 verdünnt.
•
für einzelsträngige DNA und RNA:
OD260, 1 cm = 1 c ~ 40 µg / µl
•
für doppelsträngige DNA:
OD260, 1 cm = 1 c ~ 50 µg / µl
C.2.5 Restriktionsverdau von DNA
Die Restriktionsenzyme werden in 50%igem (v/v) Glycerin aufbewahrt, haben aber eine
optimale Aktivität bei Glycerinkonzentrationen unter 10 %. Aufgrund dessen ist das
Endvolumen des Restriktionsansatzes abhängig von der eingesetzten Enzymmenge.
Analytische Spaltung
10-µl-Ansatz
1 µg Plasmid-DNA
5 U Restriktionsenzym
1 µl 10 x Reaktionspuffer
ad 10 µl TE-Puffer
Präparative Spaltung
100-µl-Ansatz
10−20 µg Plasmid-DNA
50−10 U Restriktionsenzym
10 µl 10 x Reaktionspuffer
ad 100 µl TE-Puffer
Die Reaktionsansätze wurden für mindestens 2 h bei 37 °C inkubiert und anschließend durch
Fällung, Phenolextraktion oder Zugabe von 6 x Agarosegel-Beladungspuffer gestoppt.
C Methoden 25
C.2.6 Dephosphorylierung von Vektor-DNA
Die Entfernung der 5`-Phosphatgruppen von Nukleinsäuren wird von der „calf intestinal
phosphatase“ (CIP) katalysiert. Da die T4-DNA-Ligase 5`phosphorylierte DNA-Enden für die
Ligation benötigt, wird auf diese Weise eine Ligation des Vektors mit sich selber verhindert
und die Einführung des Inserts erleichtert.
Dazu wurde die DNA in 1 x CIP-Puffer aufgenommen (0,5 µg/10 µl) und nach Zugabe von
0,1 U CIP/pmol DNA für 60 min bei 37 °C inkubiert. Die DNA wurde dann durch
Phenol/CIA-Behandlung extrahiert (C.2.2) und nach Ethanolfällung und Trocknen in TEPuffer oder H2O aufgenommen.
C.2.7 Ligation von DNA
Die zu klonierende DNA und der mit entsprechenden Enzymen behandelte Vektor wurden im
absoluten Mengenverhältnis 1:1 bis 10:1 eingesetzt, wobei die Menge an Vektor 0,1−0,5 µg
betrug.
Ligationsansatz:
1 µl Vektor-DNA
x µl Insert-DNA
1 µl 10 x Ligationspuffer
0,5−1 µl T4-DNA-Ligase (400 U/µl)
1 µl 5 mM ATP
ad 10 µl H2O
Der Ligationsansatz wurde für 4−16 h bei 16 °C inkubiert.
C 2.8 DNA-Elektrophorese in Agarosegelen
Puffer und Lösungen:
6 x Agarosegel-Beladungspuffer
40 % (w/v) Saccharose / 0,125 % (w/v) Bromphenolblau / 0,1 % (v/v) SDS
50 x Agarosegel-Elektrophoresepuffer
2 mM Tris-HCl pH 7,5 / 250 mM Natriumacetat / 50 mM EDTA pH 8,0, auf pH 7,8 einstellen
1 % (w/v) Ethidiumbromid
C Methoden 26
Die
Agarosegelelektrophorese
wurde
durchgeführt,
um
die
Vollständigkeit
von
Restriktionsspaltungen zu überprüfen, Restriktionsfragmente präparativ zu isolieren und
DNA-Konzentrationen im Vergleich zu Standards abzuschätzen.
Die Agarosekonzentration der Gele richtete sich nach der Größe der aufzutrennenden DNA
Fragmente und reichte von 0,7 % (Fragmente von 0,8–12 kb) bis 2 % (Fragmente von
0,05–2 kb).
Die Agarose wurde entsprechend der Gelgröße und -konzentration abgewogen (Satorius,
Göttingen), mit dem adäquaten Volumen 1 x Agarosegel-Elektrophoresepuffer gemischt und
in der Mikrowelle gekocht, bis die Lösung schlierenfrei war. Nach dem Abkühlen auf etwa 60
°C wurde die Lösung mit Ethidiumbromid (Endkonzentration 1 µg / ml) versetzt und in die
Gelapparatur (Renner, Heidelberg) gegossen. Die DNA-Proben wurden mit 6 x AgarosegelBeladungspuffer gemischt (Endkonzentration 1 x) und auf das polymerisierte Gel
aufgetragen. Die Auftrennung der DNA Fragmente erfolgte in 1 x AgarosegelElektrophoresepuffer bei 80–130 Volt (Spannungsgerät Powersupply EPS 3500, Pharmacia
Biotech, Freiburg).
Anschließend konnten die DNA-Banden durch das interkalierte Ethidiumbromid im UV-Licht
(UV- Leuchttisch 254nm, K.Benda, Wiesloch) sichtbar gemacht und fotografiert werden.
C.2.9 Elution von DNA aus Agarosegelen
QIAEX II Gel Extraktion Kit
Puffer QX1, Puffer PE
QIAEX II
die Zusammensetzung der Puffer ist nicht bekannt
Silicagel-Partikel
Nach der elektrophoretischen Auftrennung wurde das gewünschte DNA-Fragment mit einem
Skalpell aus dem Gel ausgeschnitten, und das Gelstück wurde gewogen. Je nach Größe des
DNA-Fragments wurde eine dem Gewicht des Gelstücks entsprechende Menge an Puffer
QX1 zugegeben. So wurden zum Beispiel bei einer Fragmentgröße von 0,1−4 kb 300 µl
Puffer QX1 je 100 mg Gel verwendet.
Fragmentgröße [kb]
Volumen Puffer QX1/ 100 mg Gel [µl]
< 0,1
0,1−4
>4
600
300
300 + 200 H2O
C Methoden 27
Je nach der Menge der zu eluierenden DNA wurde ein bestimmtes Volumen an QIAEX-IISilicagel-Partikeln zugegeben.
DNA-Menge [µg]
≤2
2—10
je zusätzliche 10
Volumen QIAEX II [µl]
10
30
je 30
Das Gemisch wurde für 10 min bei 50 °C inkubiert (Thermomixer, Eppendorf, Hamburg) und
alle 2 min gevortext, (Vortex „Reax Top“, Heidolph, Kelheim) um QIAEX II in Lösung zu
halten. Dann wurde zentrifugiert (13000 rpm / 30 sec, (Eppendorf Centrifuge, 5417R)), und
der Überstand wurde verworfen. Das Pellet wurde mit 500 µl Puffer QX1 und zweimal mit
500 µl Puffer PE gewaschen (13000 rpm / 30 sec), um alle Verunreinigungen wie Agarose,
Proteine, Salz und Ethidiumbromid zu entfernen, und anschließend an der Luft getrocknet.
Für die Elution der DNA wurden 20 µl H2O oder 10 mM Tris-HCl pH 8,5 zugegeben und
gevortext. Dabei richtete sich die Inkubationszeit und -temperatur nach der Größe der DNAFragmente.
Fragmentgröße [kb]
≤4
4—10
> 10
Zeit [min]
5
5
10
Temperatur [°C]
Raumtemperatur
50
50
Danach wurde zentrifugiert (13000 rpm / 30 sec), und der Überstand, der die DNA enthielt,
wurde in ein frisches Reaktionsgefäß überführt. Die Konzentration des Eluats wurde in einem
Agarosegel durch Vergleich mit einem Standard (Größenmarker) (B.10) abgeschätzt. Die so
gereinigte DNA war für Restriktionsspaltungen (C.2.5), Ligationen (C.2.7), PCR (C.2.10) und
Sequenzierungen verwendbar.
C.2.10 Polymerasekettenreaktion (PCR)
PCR-Kits von Promega (Taq-Polymerase) und Stratagene (Herkulase) (B3)
Die Polymerasekettenreaktion (PCR) dient der Vermehrung ausgewählter Stücke von DNA.
Diese erfolgt mit Hilfe hitzestabiler DNA-Polymerasen.
C Methoden 28
Zur Anreicherung wurden 20 ng der zu amplifizierenden DNA mit
1 x PCR-Puffer
2,5 mM MgCl2
je 2,5 mM dATP, dCTP, dGTP, dTTP
2,5 U Polymerase
150 ng Sense-Primer
150 ng Antisense-Primer
H2O ad 50 µl
gemischt und mit einigen Tropfen Mineralöl überschichtet. Als Negativkontrolle diente ein
Ansatz ohne DNA. Die Ansätze wurden im Thermocycler (Landgraf, Langenhagen)
folgendermaßen inkubiert:
Herkulase:
1 Zyklus
10 Zyklen
20 Zyklen
1 Zyklus
danach
120 sec 94 °C
30 sec 94 °C
60 sec 50 °C
180 sec 72 °C
30 sec 94 °C
60 sec 60 °C
180 sec 72 °C
420 sec 72 °C
∞ 4 °C
Taq-Polamerase:
1 Zyklus
30 Zyklen
1 Zyklus
danach
180 sec 94 °C
30 sec 94 °C
30 sec 53 °C
30 sec 72 °C
420 sec 72 °C
∞ 4 °C
Die Analyse der PCR-Produkte erfolgte durch Agarosegelelektrophorese (C.2.8).
C.2.11 3‘-Endmarkierung von DNA
Puffer und Lösungen:
3 M NaOAc pH 5
Radioaktive Markierung ist bei der Visualisierung kleiner DNA-Fragmente nach der
Gelelektrophorese sehr nützlich. Im Gegensatz zum Anfärben mit Ethidiumbromid, wo die
C Methoden 29
Bandenintensität proportional zur Fragmentlänge ist, besitzen alle endmarkierten Fragmente
die gleiche Intensität. DNA mit 5‘-Überhängen kann mit Hilfe des Klenow-Fragments der
E. coli-DNA-Polymerase I an den 3‘-Enden radioaktiv markiert werden. Man benötigt dazu
die [α-32P]Desoxynucleosidtriphosphate, die zur jeweils ersten Base der 5‘-Einzelstrangenden
komplementär sind.
In einem 1,5 ml Reaktionsgefäß wurden 2 pmol DNA, 4 µl 10 x Klenow-Puffer, 2 µl
[α-32P]dNTP, 1 µl (2 U) Klenow-Fragment ad 40 µl H2O zusammenpipettiert. Der Ansatz
wurde für 45 min bei 25 °C inkubiert und anschließend gefällt (C.2.1). Das Sediment wurde
getrocknet und in einem für die weitere Verwendung geeigneten Puffer aufgenommen.
C.2.12 Herstellung einer 32P-markierten DNA-Sonde
Puffer und Lösungen:
Oligo-labelling-buffer (OLB)
250 mM Tris-HCl pH 8,0 / 25 mM MgCl2 /2 mM je dATP, dGTP, dTTP / 5 mM ß-Mercaptoethanol /
1 mM HEPES pH 6,6 / 27 U/ml Hexadeonucleotide
2 x TNE-Puffer
1 ml 100 x TE / 2 ml 0,5 M EDTA / 10 ml 1 M NaCl / 25 ml H2O /50 mg Bromphenolblau / 250 mg
Dextranblau
2 % (w/v) BSA
TE / 0,1 % (w/v) SDS
Zur Herstellung der radioaktiv markierten Sonde wurden 40 ng DNA in 9 µl H2O
aufgenommen und 5 min bei 95 °C denaturiert. Dann wurden 4 µl OLB, 2 µl 2%iges (w/v)
BSA, 2 µl Klenow-Polymerase (= 16 U) und 2,5 µl 32P-dCTP (= 25 µCi) zugefügt. Nach 4 h
Inkubation bei RT wurde die Reaktion durch Zugabe von 40 µl 2 x TNE und 20 µl H2O
abgestoppt. Die nicht eingebauten Nukleotide wurden über Säulenchromatographie von der
markierten DNA abgetrennt. Dazu wurde eine Pasteurpipette mit in TE gequollenem
Sephadex G-50 befüllt, wobei eine kleine Glaskugel das Auslaufen verhinderte, und 4 x mit
1 ml TE / 0,1 % (w/v) SDS gewaschen. Der Markierungsansatz wurde aufpipettiert, die
Strahlung mit einem Zählrohr (LB1200, Berthold, Wildbad) detektiert und die markierte DNA
so separat aufgefangen. Die Radioaktivität der markierten DNA wurde in einem β-Counter
(Tricarb Liquid Scintillation Analyzer, Packard) vermessen.
C Methoden 30
C.2.13 DNA-DNA-Hybridisierung
Puffer und Lösungen:
20 x SSC
3 M NaCl / 0,3 M Na-Citrat pH 7,0
5 % Denhardt
25 g BSA / 25 g Ficoll 400 / 25 g Polyvinylpyrrolidon 25 ad 500 ml H2O
NaPP (Natriumphosphatpuffer)
1 M Na2HPO4•2 H2O / 1 M NaH2PO4•2 H2O, beide Lösungen mischen bis pH 6,5 erreicht ist
Vorhybridisierungslösung
50 % (v/v) Formamid und 0,1 mg/ml tRNA zusammen 10 min bei RT denaturieren / 5 x SSC / 0,1 %
(v/v) Denhardt / 20 mM NaPP / 10 % (v/v) H2O / 1 % (w/v) SDS
Zur Vorhybridisierung, die der Absättigung unspezifischer Bindungsstellen dient, wurde die
Membran mindestens 2 h bei 42 °C in Vorhybridisierungslösung (0,1 ml/cm2 Blotmembran)
in einem Hybridisierungsofen (Bachofer, Reutlingen) inkubiert. Die Sonde wurde durch
Erhitzen auf 95 °C für 3 min denaturiert. Die Hybridisierung erfolgte mit 3 x 106 cpm der
denaturierten Sonde pro ml Vorhybridisierungslösung über Nacht bei 42 °C.
Die Membran wurde dreimal bei 60 °C in 2 x SSC / 0,1 % (w/v) SDS gewaschen, und dann
wurde ein Röntgenfilm für 1 bis 2 Tage bei –70 °C der Membran exponiert.
C.2.14 Nichtdenaturierende Polyacrylamid-Gelelektrophorese
Puffer und Lösungen:
10 x TBE
108 g Tris / 55 g Borsäure / 5,3 g EDTA ad 1 l H2O
30 % (w/v) Acrylamid
10 % (w/v) APS
TEMED
Polyacrylamid-Gelelektrophorese bietet eine hohe Auflösung von niedermolekularen
Nukleinsäuren. Besonders DNA-Fragmente <500 bp werden in normalen Agarosegelen
schlecht aufgetrennt. Je nach Porengröße des Gels kann eine Auftrennung von 10 bis 1000 bp
erreicht werden.
C Methoden 31
Acrylamidkonzentrationen für die größtmögliche Auftrennung von DNA-Fragmenten:
Acrylamid (%)
Größe der getrennten
Migration von
Migration von Xylencyanol
Fragmente (bp)
Bromphenolblau (bp)
(bp)
3,5
100 bis 1000
100
460
5,0
100 bis 500
65
260
8,0
60 bis 400
45
160
12,0
50 bis 200
20
70
20,00
5 bis 100
12
45
Daten zusammengestellt aus Maniatis & Ptashne, 1973 a und b; Maniatis et al., 1975
Eine der Glasplatten wurde mit Repelsilan behandelt, um die Trennung der Platte vom Gel
nach der Elektrophorese zu erleichtern. Für ein 20 x 20 cm großes Gel mit einer
Endkonzentration von 8 % Acrylamid wurden 3 ml 10 x TBE, 8 ml 30 % Acrylamid und
19 ml H2O gemischt. Dann wurden 17 µl TEMED und 125 µl 10 % (w/v) APS beigegeben,
gemischt, zügig zwischen die gut abgeklebten Glasplatten gegossen und der Kamm
eingeschoben. Nach dem Polymerisieren wurde das Gel für mindestens 30 min bei 5 V/cm
zum warm werden laufen gelassen (Sequenzgel Elektrophoresekammer ADJ-2, Owl
Scientific, Portsmouth, NH, USA). Nach dem Beladen lief das Gel bei 2 bis 10 V/cm, wobei
Überhitzung zu vermeiden war, da die Proben in der Mitte des Gels schneller laufen und
sogar denaturieren könnten.
C.3 Arbeiten mit Zellkultur
C.3.1 Kultivierung eukaryontischer Zellen
Alle Zellen wurden in beschichteten Zellkulturflaschen aus Kunststoff (Greiner,
Frickenhausen) in 10 – 30 ml Medium mit 10 % FCS, 100 U/ml Penicillin und 100 µg/ml
Streptavidin bei 37 °C, 95 % Luftfeuchtigkeit und 6 % CO2 kultiviert (Brutschrank Sterikult
200, Labotect, Göttingen). Suspensionszellen wurden in RPMI 1640 Medium in einer Dichte
von 1 – 10x105 Zellen / ml gehalten. Adhärente Zellen wuchsen in DMEM bis zur Konfluenz
und wurden dann weiter passagiert. Dafür wurden die Zellen mit 5 ml Trypsin/EDTA-Lösung
für 1 – 5 min bei 37 °C inkubiert und anschließend durch festes Klopfen an die Kulturflasche
abgelöst. Die Zellen wurden je nach Linie in einer Verdünnung von 1:5 bis 1:20 ausgesät.
C Methoden 32
C.3.2 T-Zell Kultivierung
Puffer und Lösungen:
ACT-Lysepuffer
17 mM Tris / 160 mM NH4Cl pH 7,2
Vierzehn Tage nach Immunisierung wurden die Mäuse getötet und die Milzen steril
entnommen. Von jeder Milz wurde eine Kultur angelegt, indem durch Passieren der Milzen
durch engmaschige Drahtnetze mit einem Spritzenstempel die Zellen vereinzelt wurden. Die
Zellen wurden gesammelt (5 min, 1200 rpm (Heraeus Kühlzentrifuge Megafuge 1,0 R)), pro
Milz in 5 ml ACT-Lysepuffer aufgenommen und 5 min bei 37 °C inkubiert, so daß die
Erythrozyten lysiert und aus der Kultur entfernt wurden. Die so behandelten Zellen wurden
mit 2x106 bestrahlten (200 Gy (Gammacell 1000, Canada Limited)) Stimulator-Zellen
(B.8.3.2) in insgesamt 10 ml αMEM (B.9.3) in 25 cm2 Zellkulturflaschen stimuliert. Alle
sieben Tage erfolgte eine Restimulierung. Dazu wurden die Zellen aus den Kulturflaschen in
jeweils eine Reihe einer 24-well-Zellkulturplatte verteilt und mit 1x106 bestrahlten
Stimulator-Zellen (200 Gy) und 5x106 syngenen Milzzellen, Fütterzellen, (33 Gy) je
Vertiefung versorgt. Als Kulturmedium für die Restimulierung wurde αMEM komplett
(B.9.3) verwendet.
C.3.3 Bestimmung der Zellzahl
Die Anzahl der lebenden Zellen wurde durch Färbung mit Trypanblau bestimmt (nur tote
Zellen sind durch ihre defekte Plasmamembran anfärbbar). Ein Aliquot einer Zellsuspension
wurde 1:10 mit 0,04 % Trypanblau gemischt und in einer Neubauer Zählkammer ausgezählt.
Die Summe aller nicht gefärbten Zellen in den vier großen äußeren Quadraten multipliziert
mit 2,5 x 104 ergab die Zellzahl pro ml.
C Methoden 33
C.3.4 Einfrieren und Auftauen eukaryontischer Zellen
Puffer und Lösungen:
Einfriermedium
50 % Kulturmedium / 40 % FCS / 10 % DMSO
Zur längeren Lagerung von Zellen wurden diese geerntet und sedimentiert (5 min, 1200 rpm
(Heraeus Kühlzentrifuge Megafuge 1,0 R)). 5x106 – 1x107 Zellen wurden in 1,5 ml
Einfriermedium aufgenommen und in einem Kryokonservierungsröhrchen zuerst für
mindestens einen Tag bei -70 °C eingefroren und dann zur langfristigen Lagerung in
flüssigem Stickstoff aufbewahrt.
Zum Auftauen wurden die Zellen schnell bei 37 °C im Wasserbad (Thermomix U, Braun,
Melsungen) erwärmt, in 10 ml Kulturmedium aufgenommen und zentrifugiert (1200 rpm,
5 min (Heraeus Kühlzentrifuge Megafuge 1,0 R)), um DMSO zu entfernen. Das Zellsediment
wurde in 10 ml Medium aufgenommen und in eine Kulturflasche überführt.
C.3.5 Transfektion eukaryontischer Zellen mit DNA
Effectene Transfection Reagent, QIAGEN
Die Transfektion eukaryontischer Expressionsvektoren in Zellkultur ermöglicht die
Expression der klonierten DNA-Sequenzen. Hierzu wurde der Effectene Transfection Kit
(B.3) verwendet, wobei sich die Vorgehensweise an den Empfehlungen des Herstellers
orientiert.
Am Tag vor der Transfektion wurden 2 – 8x105 Zellen in 60 mm ∅ Kulturschalen (Greiner,
Frickenhausen) in 5 ml Medium ausgesät. Für die Transfektion wurden 4 µg DNA mit 150 µl
Puffer EC vermischt, 8 µl Enhancer zugegeben und 1 sec gevortext. Nach 2–5 min Inkubation
bei RT wurden 25 µl Effectene zugefügt und für 10 sec gevortext und für weitere 5–10 min
bei RT inkubiert. Nach Zugabe von 1 ml Medium zum Transfektionsmix wurde dieser
vorsichtig auf die vorher einmal mit PBS gewaschenen und mit 4 ml Medium versorgten
Zellen getropft. Im Anschluß wurden die Zellen für mindestens 24 h kultiviert. Die
Genexpression konnte nach Aufschluß der Zellen mittels ECL-Westernblot (C.6.2) überprüft
werden.
C Methoden 34
C.4 Arbeiten mit Hefen
C.4.1 Aufbewahrung und Kultur von Hefen
Die Hefen wurden bei 30 °C in flüssigem YPD-Medium (B.9.2) geschüttelt, bis eine Dichte
von 5x107 Zellen pro ml erreicht war. Dann wurde 1 ml einer Zellsuspension mit 0,5 ml
86%igem (v/v) Glycerin (sterilfiltriert) vermischt und bei −70 °C eingefroren.
Die Hefen wurden aus der Glycerinkultur auf Platten des passenden Voll- oder
Selektionsmediums (B.9.2) ausgestrichen und bei 30 °C für 2 bis 5 Tage kultiviert. Die so
gezogenen Kolonien konnten bei 4 °C mehrere Wochen gelagert werden und wurden zum
Animpfen von Flüssigmedium verwendet.
C.4.2 Herstellung kompetenter Hefezellen
Puffer und Lösungen:
10 x Lithium-Acetat
1 M LiAc pH 7,5
10 x TE
100 mM Tris-HCl pH 8,0 / 10 mM EDTA pH 8,0
Mehrere Kolonien von 2-3 mm Durchmesser wurden in 1 ml Selektionsmedium inokuliert,
gevortext, bis alle Klumpen gelöst waren, in 50 ml Selektionsmedium überführt und bei 30 °C
unter Schütteln über Nacht inkubiert. 300 ml YPD-Medium wurden so mit der ÜbernachtKultur angeimpft, daß eine Zelldichte von 5x106 / ml entstand und 3-5 h bei 30 °C und 200
rpm geschüttelt, bis eine Dichte von 1x107 Zellen / ml erreicht war. Dann wurden die Zellen
geerntet ( 5 min, 5000 rpm (Sorvall RC-5B, Rotor SLA-3000)) und in 10 ml sterilem H2O
dest. resuspendiert. Nach einer weiteren Zentrifugation wurden die Zellen in 1,5 ml 1x TE /
LiAc aufgenommen.
C.4.3 Transformation der Hefezellen
Puffer und Lösungen:
PEG-Lösung
8 vol 50 % (w/v) Polyethylenglycol MW4000 / 1 vol 10 x TE / 1 vol 10 x LiAc
C Methoden 35
Die Lithium-Acetat Methode beruht auf der Tatsache, daß Alkali-Kationen die Hefe für die
Aufnahme von DNA kompetent machen. Nachdem die Hefe kurz in gepuffertem LitiumAcetat inkubiert wurde, wird die zu transformierende DNA mittels Träger-DNA eingeführt.
Die Zugabe von Polyethylenglycol (PEG) und Hitzeschock lösen die Aufnahme der DNA aus.
Für jede Transformation wurden 200 µg Heringsperma-DNA als Träger und 0,1 µg PlasmidDNA in einem 1,5 ml Reaktionsgefäß gemischt. Dann wurden 200 µl kompetente Hefezellen
und 600 µl PEG-Lösung zugefügt, gut gemischt und 45 min bei 30 °C geschüttelt. Der
Hitzeschock wurde für genau 15 min bei 42 °C durchgeführt. Die Hefen wurden sedimentiert
(5 sec, 13.000 rpm (Eppendorf Centrifuge, 5417R)) und in 1 ml 1 x TE aufgenommen und je
bis zu 200 µl auf Selektionsnährböden ausplattiert.
C.4.4 Nachweis der Proteinexpression in Hefe-Transformanden
Puffer und Lösungen:
Lysepuffer
1 % (w/v) SDS / 0,5 mM EDTA in PBS
Um zu überprüfen, ob Hefeklone, die mit einem induzierbaren Expressionsplamid transfiziert
wurden, dieses auch enthalten und das entsprechende Protein produzieren, wurde 1 ml
Selektionsmedium in einer 24-well-Platte (Costar, Bodenheim) mit einem Klon angeimpft
und für 2 Tage bei 30 °C auf einem Schüttler inkubiert, bis eine Dichte von OD600 1-5 erreicht
war. 50 µl dieser Kultur wurden dann in 1 ml YP-Medium mit 2 % Galactose zur Induktion
der Proteinexpression überführt und weitere 3 Tage unter Schütteln bei 30 °C wachsen
gelassen. Dabei wurde alle 24 h Galactose zugegeben (Endkonzentration 2 %), um anhaltende
Induktion zu gewährleisten. Die Hefen wurden sedimentiert (10 min, 5000 rpm (Eppendorf
Centrifuge, 5417R)) und das Pellet in 100 µl Lysepuffer aufgenommen. Anschließend wurden
die Hefen 10 min gekocht und erneut sedimentiert. 100 µl des Überstandes wurde in 1 ml
PBS verdünnt und auf eine Protein-Blot-Membran (Protran, Schleicher & Schuell, Dassel)
mittels einer Dot-Blot Apparatur (Schleicher & Schuell, Dassel) aufgebracht und ein ECLWestern Blot (C.6.3) durchgeführt.
C Methoden 36
C.4.5 Isolation von Plasmid-DNA aus Hefe
Puffer und Lösungen:
Aufbrechpuffer
Phenol / CIA
2 % (v/v) Triton-X-100 / 1 % (v/v) SDS / 100 mM NaCl / 10 mM Tris-HCl pH 8,0 / 1 mM EDTA pH 8,0
Die Hefen wurden in 10 ml Selektionsmedium angeimpft und bei 30 °C 24–48 h bis zur
stationären Phase auf einem Schüttler wachsen gelassen. Die Kultur wurde 5 min bei
5000 rpm sedimentiert (Heraeus Kühlzentrifuge Megafuge 1,0 R) und der Überstand
verworfen. Das Pellet wurde im Rücklauf resuspendiert, in ein 2 ml Reaktionsgefäß überführt
und mit 200 µl Aufbrechpuffer, 200 µl Phenol/Chloroform und 0,3 g Glaskügelchen (425-600
µm, Sigma, Deisenhofen) (~200 µl Volumen) aufgefüllt. Dann wurde 5 min gevortext, der
Überstand in ein frisches Reaktionsgefäß überführt, die DNA mit Ethanol gefällt und
schließlich in 20-30 µl TE-Puffer mit 0,2 µg RNase aufgenommen.
C.5 Arbeiten mit Proteinen
C.5.1 SDS-Polyacrylamidgelelektrophorese (SDS-PAGE)
Puffer und Lösungen:
Trenngel
10-15 % Acrylamid / 125 mM Tris-HCl pH 8,8 / 0,1 % SDS / 0,1 % APS / 0,05 % TEMED
Sammelgel
3 % Acrylamid / 125 mM Tris-HCl pH 6,8 / 0,1 % SDS / 0,1 % APS/ 0,05 % TEMED
10 x PAGE-Puffer
50 mM Tris-HCl pH 8,0 / 1,45 % (w/v) Glycin / 0,1 % (w/v) SDS
2 x Proteingel-Ladepuffer
2 mM EDTA pH 8,0 / 0,1 M Tris-HCl pH 8,0 / 4 % (w/v) SDS / 20% (v/v) Glycerin / 10 % (v/v)
ß-Mercaptoethanol / 0,02 % (w/v) Bromphenolblau
Die SDS-PAGE dient dazu, Proteine ihrer Größe entsprechend aufzutrennen. Das
Polyacrylamid hat den Effekt eines Molekülsiebs, SDS denaturiert die Proteine und verleiht
ihnen eine einheitliche negative Ladung, so daß sie entsprechend ihrer Größe aufgetrennt
werden können. Die Gele sind aus einem großporigen Sammelgel und einem kleinporigen
Trenngel zusammengesetzt.
Die Trenngellösung wurde in die Gelapparatur gegossen und bis zur Polymerisation mit
Isopropanol überschichtet. Das Isopropanol wurde abgegossen, die Sammelgellösung
eingefüllt und mit eingestecktem Kamm polymerisiert. Die Proteinproben wurden vor dem
Gelauftrag mit einem Volumen 2 x Proteingelladepuffer versetzt und durch Kochen
C Methoden 37
denaturiert. Die Elektrophorese erfolgte in 1 x PAGE-Puffer bis zum Eintritt ins Trenngel bei
60 V, dann bei 90 V (Elektrophporesekammer vertikal MBT70EL, über Neolab Migge,
Heidelberg).
C.5.2 Bestimmung der Proteinkonzentration
Die Konzentration von Proteinen wurde mittels der Bradford Methode bestimmt (Bradford,
1976). 20 µl einer Proteinlösung wurden mit 200 µl Bradford-Reagenz und 780 µl H2O
vermischt und bei Raumtemperatur inkubiert. Als Proteinstandart wurden 5, 10, 15 und 20 µg
BSA verwendet. Die Absorption wurde bei einer Wellenlänge von 595 nm gemessen.
C.5.3 Herstellung virus-ähnlicher HPV-16-L1 Partikel (VLPs)
Puffer und Lösungen:
Extraktionspuffer
10 mM MgCl2 / 50 mM CaCl2 / 150 mM NaCl / 20 mM HEPES pH 7.4 / 1 mM PMSF ( / 0.01 % (v/v) Triton X-100)
100 mM PMSF
40%ige (w/v) Sucroselösung
C.5.3.1 Vermehrung rekombinanter Bakulovirusstocks
Zur Vermehrung rekombinanter Bakulovirusstocks wurden in einer 175 cm2-Zellkulturflasche
4 x 106 Sf9 Zellen in 20 ml TMN-FH-Medium (B.9.3) ausgesät. Nach dem Absetzten der
Zellen wurde das Medium entfernt, 2 ml des zu amplifizierenden Bakulovirusstocks (B.8.5)
mit 10 ml frischem Medium zugegeben und zur Infektion für sechs Tage im 27 °CBrutschrank inkubiert. Dann wurde der Überstand 10 min bei 5000 rpm zentrifugiert (Heraeus
Kühlzentrifuge Megafuge 1,0 R), um Zellbestandteile zu entfernen und in ein frisches
Röhrchen überführt, das bis zur weiteren Verwendung bei 4 °C aufbewahrt wurde.
C Methoden 38
C.5.3.2 Infektion von TN high five Insektenzellen
Zur Infektion wurden TN high five Zellen in einem 1 l Kolben mit Schikane in 250 ml Ex-cell
450-Medium (B.9.3) bis zu einer Zelldichte von 2 x 106 / ml unter Schütteln bei 27 °C
wachsen gelassen. Sie wurden für 30 min bei 1500 rpm sedimentiert (Sorvall RC-5B, Rotor
SLA-3000), in 30 ml Ex-cell 450-Medium aufgenommen und zusammen mit 8 ml Virusstock
(MOI 2-5) in den Kolben überführt. Nach einer Stunde Schwenken bei RT wurde mit Medium
auf 250 ml aufgefüllt und für drei Tage bei 27 °C geschüttelt. Dann wurden die Zellen 10 min
bei 2000 rpm zentrifugiert, (Heraeus Kühlzentrifuge Megafuge 1,0 R) mit PBS gewaschen
und bis zur weiteren Verwendung bei –70 °C aufbewahrt.
C.5.3.3 Aufschluß der Zellen
Die Zellen wurden aufgetaut, in 9 ml Extraktionspuffer resuspendiert und mit 200 µl PMSF
versetzt. Dieser und die folgenden Schritte wurden auf Eis durchgeführt. Der Aufschluß der
Zellen erfolgte mittels French Press (Avestin, Ottawa, Kanada). Vor dem Durchlauf der
Zellsuspension wurde die Presse mit Ethanol, H2O und 7 ml Extraktionspuffer gespült, nach
dem Zelldurchlauf erneut mit 7 ml Extraktionspuffer. Der Druck während des Aufschlusses
sollte 15.000 – 20.000 kPa betragen. Zum Schluß wurde mit Ethanol gespült, das auch im
Gerät belassen wurde.
C.5.3.4 Aufreinigung durch Gradientenzentrifugation
Die Insektenzellfragmente
wurden durch zweimaliges Zentrifugieren für 10 min bei
10.000 rpm und 4 °C sedimentiert (Sorvall RC-5B, Rotor F-28/50). Der Überstand wurde auf
einen Zwei-Phasen-Gradienten aufgetragen. Dazu wurden 4.7 g CsCl in 8 ml
Extraktionspuffer ohne Triton gelöst, in ein 25 x 89-mm-Zentrifugenröhrchen (Beckman,
München) gefüllt und vorsichtig mit 10 ml einer 40%igen Sucroselösung überschichtet. Der
Überstand wurde auf das Sucrosekissen aufgetragen und in einer Ultrazentrifuge zentrifugiert
(2 h / 24000 rpm / 10 °C (Beckman XL 70 Ultrazentrifuge, Ausschwingrotor SW 28). Die nun
in der Interphase zwischen CsCl und Sucrose befindlichen Partikel wurden zusammen mit der
CsCl-Phase abgezogen, mit Extraktionspuffer ohne Triton auf eine Dichte von 1.37 g/ml
eingestellt, in ein Quickseal-Zentrifugenröhrchen (13,4 ml, Beckman, München) überführt
und auf 13 ml mit Extraktionspuffer ohne Trition aufgefüllt. Die Lösung wurde erneut
C Methoden 39
zentrifugiert (16 h / 48000 rpm / 20 °C, (Beckman XL 70 Ultrazentrifuge, Festwinkelrotor Ti
70)), und der entstandene Dichtegradient wurde in 1 ml Fraktionen ausgetropft und die Dichte
im Refraktometer bestimmt. Die Fraktionen wurden anschließend im ELISA (C.6.4), im ECLWestern-Blot (C.6.3) und auch im Elektronenmikroskop (C.5.4) auf die Gegenwart von VLPs
bzw. des rekombinanten Proteins getestet.
C.5.4 Transmissionselektronenmikroskopie
Die Fraktionen, in denen durch ECL-Western-Blot rekombinantes Protein nachgewiesen
werden konnte, wurden unter dem Elektronenmikroskop auf Kapside hin untersucht. Dazu
wurden 10 µl einer positiven Fraktion auf ein mit Kohle beschichtetes Kupfernetz gegeben.
Nach 2 min wurde das Netz abgetupft und für 2 min mit 10 µl 2%igem Uranylacatat als
Negativ-Kontrastmittel behandelt. Die so präparierten Proben wurden mit einem
Elektronenmikroskop (EM10, Zeiss, Oberkochen) untersucht.
C.5.5 Zerfall und Zusammenlagerung von VLPs (Dis- und Reassembly)
Puffer und Lösungen:
Dialysepuffer
PBS / 0,5 M NaCl / 2 mM CaCl2
Das Dis- und Reassembly diente dazu, in vitro Pseudovirionen herzustellen.
Die dazu benötigte Menge an VLPs wurde für 45 min auf einem Nitrocellulosefilter (0,025
µm Typ VS, Millipore, Eschborn) gegen PBS dialysiert und anschließend in 5 % (v/v)
2-Mercaptoethanol (2-ME) für 16 h ohne Schütteln bei 4 °C inkubiert, um die
Disulfidbrücken zu reduzieren, so daß die Partikel in Kapsomere zerfallen. Nach der Zugaben
von Plasmid-DNA in 10-molarem Überschuß folgte Dialyse gegen 4 l Dialysepuffer für 24 h
bei 4 °C, wobei sich die Kapsomere wieder zu Partikeln zusammen lagern und das Plasmid
inkapsidiert wird. Die entstandenen Pseudovirionen wurden bis zur Verwendung maximal
zwei bis drei Tage bei 4 °C aufbewahrt.
C Methoden 40
C.5.6 Kopplung von DNA an Protein oder Peptid
Puffer und Lösungen:
Aktivierungspuffer
0,1 M MES / 0,5 M NaCl pH 6,0
100 x EDC
0,2 M 1-Ethyl-3-(3-Dimethylaminopropyl)carbodiimid Hydrochlorid (Pierce)
100 x NHS
0,5 M N-Hydroxysuccinimid (Pierce)
Mit Hilfe von EDC und NHS kann zwischen einer Carboxylgruppe einerseits und einer
Aminogruppe andererseits eine Peptidbindung gebildet werden. Dies gilt sowohl für zwei
Proteine als auch für ein Protein oder Peptid und
DNA, welche über PCR hergestellt und dabei
über einen modifizierten Primer mit einer
endständigen NH2-Gruppe versehen wurde. EDC
reagiert zuerst mit der Carboxylgruppe unter
Ausbildung
eines
aminreaktiven
Zwischen-
produkts, O-Acylisoharnstoff. Dieses Produkt ist
Abbildung C.1: von EDC katalysierte Reaktion
EDC reagiert zuerst mit der Carboxylgruppe des Proteins oder
Peptids (gelb) und dann mit der Aminogruppe (blau), die durch
den 3’-Primer der DNA-Komponente gestellt wird.
in wäßrigen Lösungen instabil und muß deshalb
im Konjugationsprozess durch NHS stabilisiert
werden.
Um DNA an VLPs oder ein HPV-L2-Peptid zu binden, wurde die Proteinkomponente 45 min
gegen Aktivierungspuffer dialysiert. In einem 1,5 ml Reaktionsgefäß wurden dann EDC und
NHS zugegeben und mit Aktivierungspuffer aufgefüllt, so daß die Chemikalien in einfacher
Endkonzentration in einem insgesamt möglichst kleinen Volumen vorlagen. Nach 15 min bei
Raumtemperatur wurde die Reaktion von EDC durch Zugabe von 2-Mercaptoethanol
(Endkonzentration 20 mM) abgestoppt. Dann wurde eine zum Protein äquimolare Menge an
DNA zugegeben und für 2 h bei Raumtemperatur stehen gelassen. Diese Reaktion wurde
durch Zugabe von Tris/HCl pH 6,8 (Endkonzentration 20-50 mM) abgestoppt.
C Methoden 41
C.5.7 Isolation von Pseudovirionen aus Hefe
Puffer und Lösungen:
20 mM HEPES pH 7,0
100 mM PMSF
25 ml Selektionsmedium wurden mit 150 µl Glycerinkultur des Pseudovirionen
produzierenden Hefestammes angeimpft und 48 h bei 30 °C und 130 rpm inkubiert. 20 ml
Kultur wurden in 360 ml YP-Medium überführt, mit 20 % Galactose auf eine
Endkonzentration von 2 % eingestellt und für 72 h bei 30 °C und 130 rpm inkubiert. Alle 24 h
wurden weitere 40 ml 20 % Galactose zugegeben, um die Proteinexpression aufrecht zu
erhalten. Nach den drei Tagen wurden die Hefen zentrifugiert (10 min, 5000 rpm, 4 °C
(Sorvall RC-5B, Rotor SLA-3000)) und das Sediment bei –70 °C bis zur weiteren
Aufarbeitung aufbewahrt.
Der Aufschluß der Hefen wurde bei 4 °C durchgeführt. Dazu wurde das Hefesediment in
10 ml HEPES und 250 µl PMSF resuspendiert und zusammen mit 10 ml Glaskügelchen
(425-600 µm) in den Mixer (Bead-Beater, Hamilton Beach, Washington, NC, USA) gefüllt
und wie folgt behandelt:
1 min Aufschluß im Mixer
2 min Inkubation auf Eis
1 min Aufschluß im Mixer
2 min Inkubation auf Eis
Der Überstand wurde nach 10 min Zentrifugation (10000 rpm, 4°C (Sorvall RC-5B, Rotor F28/50)) gesammelt und das Sediment in 10 ml HEPES und 250 µl PMSF aufgenommen und
weiter aufgeschlossen:
1,5 min Aufschluß im Mixer
2 min Inkubation auf Eis
1 min Aufschluß im Mixer
2 min Inkubation auf Eis
Nach erneuter Zentrifugation (Sorvall RC-5B, Rotor F-28/50) wurden beide Überstände
vereinigt und auf Eis maximal 14 Tage aufbewahrt.
C Methoden 42
C.6 Immunologische Experimente
C.6.1 Affinitätschromatographie zur Aufreinigung von Antikörpern aus
Serum
Puffer und Lösungen:
1 mM HCl
1 M Tris-HCl pH 8,0
Kopplungspuffer
0,2 M NaHCO3 / 0,5 M NaCl pH 8,3
Blockpuffer
0,5 M Ethanolamin / 0,5 M NaCl pH 8,3
Waschpuffer
0,1 M Na-Azetat / 0,5 M NaCl pH 4,0
Elutionspuffer
0,1 M Glycin / 0,15 M NaCl pH 2,5
Die Aufreinigung spezifischer Antikörper aus Serum erfolgte über eine 1 ml HiTrap NHSaktivierte Säule (Pharmacia Biotech, Freiburg), die zur kovalenten Bindung von Liganden mit
primären Aminogruppen verwendet wird. Die Gelmatrix besteht aus Agarose. Im ersten
Schritt wurde das Peptid (1 mg/ml), gegen welches die zu reinigenden Serumantikörper
gerichtet sind, über den N-Terminus an die Säule gebunden. Das Serum wurde mit Hilfe einer
Pumpe (Econo Pump, Biorad, München) über die Säule geleitet (0,5 ml / min), so daß
spezifische Antikörper an das Peptid binden konnten, die in einem letzten Schritt von der
Säule eluiert wurden.
Die Säule wurde mit sechs Säulenvolumina (SV) 1 mM HCl und einer Durchflussgeschwindigkeit von 0,5 ml / min gewaschen und dann das in Kopplungspuffer gelöste
Peptid mittels einer Spritze auf die Säule aufgebracht. Zur Bindung des Peptids an die Säule
folgte eine Inkubation von 15-30 min bei RT, bzw. 1 h bei 4 °C. Ungebundenes Peptid wurde
mit drei SV Kopplungspuffer ausgewaschen (0,5 ml / min). Die Säule wurde mit sechs SV
Blockpuffer, sechs SV Waschpuffer und sechs SV Blockpuffer gespült und dann für
30-60 min bei RT inkubiert, um verbleibende reaktive Gruppen zu blocken. Es folgten drei
weitere Waschschritte mit jeweils sechs SV Wasch-, Block- und Waschpuffer. Dann wurde
die Säule mit fünf SV PBS gespült und das zu reinigende Serum mit einer
Laufgeschwindigkeit von 0,2-1 ml / min aufgetragen und der Durchlauf aufgefangen. Vor der
Elution wurde die Säule mit 5-10 SV PBS gespült um anschließend die Antikörper mit 1-3
SV Elutionspuffer von der Säule zu lösen. Die Elution erfolgte in Fraktionen von je 1 ml,
inklusive einer Vorlage von 250 µl Tris/HCl pH 8,0 pro Fraktion zur Neutralisation.
C Methoden 43
Schließlich wurde der Proteingehalt der einzelnen Fraktionen mittels Bradford bestimmt
(C.5.2).
C.6.2 Immunpräzipitation
Lösungen und Puffer:
Bindungspuffer
50 mM Tris-HCl pH 7,0
Aktivierungspuffer
0,1 M MES / 0,5 M NaCl pH 6,0
10 x PCR-Puffer
100 mM Tris-HCL pH 9,0 / 15 mM MgCl2 / 500 mM KCl
Für etwa 1 ml Säulenmaterial wurden 250 mg Protein A Sepharose CL-4B (Pharmacia
Biotech, Freiburg) in PBS gequellt und dreimal mit PBS gewaschen (1500 rpm, 2 min
(Heraeus Kühlzentrifuge Megafuge 1,0 R)). Pro Ansatz wurden 100 µl gequellte Protein A
Sepharose mit Bindungspuffer gewaschen und über Nacht bei 4 °C mit und ohne 10 µl des αHPV 16 L2-Serums (B.6.1) inkubiert. Die Ansätze wurden dreimal mit je 800 µl
Aktivierungspuffer gewaschen (2000 rpm, 2 min (Eppendorf Centrifuge, 5417R) und dann
zusammen mit dem zu testenden Antigen bei 4 °C über Nacht geschüttelt. Es folgten fünf
Waschschritte mit je 1 ml Aktivierungspuffer / 1 % Trition-X-100 und zwei Waschschritte
mit je 500 µl 1 x PCR-Puffer. Dann wurden die Proben in einer PCR auf Kopräzipitation der
an das Antigen gebundenen DNA gestestet.
C.6.3 Enhanced Chemoluminescence (ECL) Western Blot
Lösungen und Puffer:
Western Blot Puffer I
0,3 M Tris-HCl pH 8,0 / 20 % (v/v) Methanol
Western Blot Puffer II
0,025 M Tris-HCl pH 8,0 / 20 % (v/v) Methanol
Western Blot Puffer III
0,025 M Tris-HCl pH 8,0 / 20 % (v/v) Methanol / 0,04 M DL-Norleucin
Blockierlösung
PBS / 5 % (w/v) Magermilchpulver / 0,1 % (v/v) Tween 20
ECL-Lösung
200 ml 0,1 M Tris-HCl pH 8,6 / 1,25 mM Sodium-Luminol / 2,7 mM H2O2
Enhancer
11 mg p-Hydroxy-Cumarinsäure in 10 ml DMSO
C Methoden 44
Nach der elektrophoretischen Auftrennung wurde das Polyacrylamidgel für 5 min in WesternBlot-Puffer (WBP) III äquilibriert. Die Western-Blot-Membran (Immobilon® P, Millipore,
Bedford, MA, USA) wurde für 2 min in Methanol gelegt, mit H2O gewaschen und für 5 min
in WBP II inkubiert. In der Blotkammer (Semidry-Transfer Cell, Biorad, München) wurden
2 Lagen 3MM-Papier (Schleicher & Schuell, Dassel), getränkt in WBP I, 3 Lagen 3MMPapier, getränkt in WBP II, die Blot-Membran, das Gel und 4 Lagen 3MM-Papier, getränkt in
WBP III, übereinander geschichtet. Der Transfer der Proteine auf die Membran erfolgte bei
175 mA für 45 min. Die Membran wurde anschließend 30 min in Blockierlösung inkubiert,
um unspezifische Bindungsstellen abzusättigen. Der Erstantikörper, entsprechend (B.6.1) in
Blockierlösung verdünnt, wurde mit der Membran 1 Stunde bei RT oder über Nacht bei 4 °C
inkubiert. Dann wurde die Membran viermal 5 min mit Blockierlösung gewaschen, mit dem
Zweitantikörper, ebenfalls in Blockierlösung verdünnt, (B.6.2) 45 min bei RT inkubiert und
noch viermal 5 min mit Blockierlösung gewaschen. Die Membran wurde 1 min in 8 ml ECLLösung / 2 ml H2O / 20 µl Enhancer geschwenkt, nachdem die Reste der Blockierlösung
durch Spülen in PBS entfernt worden waren. Danach wurde die Membran mit einer Folie
umwickelt, und für die Dauer von 10 sec bis 10 min wurde ein Röntgenfilm (Kodak/NEN
Life Science Prod., Köln) der Membran exponiert.
C.6.4 ELISA (enzyme-linked immunosorbent assay)
Puffer und Lösungen:
Waschpuffer
0,05 % (v/v) Tween 20 in PBS
Blockpuffer
5 % (w/v) Milchpulver / 0,05 % (v/v) Tween 20 in PBS
Substratlösung
100 mM Na-Acetat pH 6 / 1 mM Zitronensäure / 2 % (v/v) Tetramethylbenzidin (TMB, 10 mg/ml DMSO) / 0,03 %
H2O2
Stopplösung
2 M H2SO4
Eine 96-Loch Platte (Falcon, über Becton Dickinson, Heidelberg) wurde mit 50 µl / well einer
1:300 Verdünnung eines HPV-16 L1 – spezifischen monoklonalen Antikörpers (25/C) (B.6.1)
beladen und für 1 h bei 37 °C oder ÜN bei 4 °C inkubiert. Ungebundene Antikörper wurden
durch dreimaliges Waschen mit Waschpuffer entfernt und anschließend unspezifische
Bindungsstellen durch Inkubation mit 200 µl Blockpuffer pro well für 1 h bei 37 °C
abgesättigt. Die Platte wurde dreimal gewaschen und mit 50 µl (entweder in konzentrierter
Form oder in einer Verdünnung von bis zu 1:25 in Blockpuffer) der einzelnen vom
C Methoden 45
Gradienten getropften Fraktion (C.5.3.4) beladen. Nach einstündiger Inkubation bei 37 °C
wurde erneut dreimal gewaschen und gebundene Partikel durch ein HPV-16 L1 – spezifisches
Kaninchenserum (B.6.1) (4543), 50 µl/well, 1:5000 in Blockpuffer verdünnt, detektiert (1h,
37 °C). Nach dreimaligem Waschen erfolgte die Bindung eines HRP-gekoppelten
Sekundärantikörpers (B.6.2), 50 µl/well, 1:7500 in Blockpuffer verdünnt, für 1 h bei 37 °C.
Nach drei weiteren Waschschritten durch Zugabe von 50 µl Substratpuffer pro well erfolgte
der Nachweis der gebundenen Partikel. Dazu wurde nach 1-5 min die Farbreaktion durch
Zugabe von 50 µl Stopplösung pro Loch beendet und die Platte bei einer Wellenlänge von
450 nm im ELISA-Lesegerät (Titertek Multiskan MKII, Labsystems, Turku, Finnland)
gemessen.
C.6.5 ELISPOT (enzyme-linked immunospot assay)
Puffer und Lösungen:
PBS / 0,5 % Tween 20
Pokeweed Mitogen (Sigma)
Streptavidin Alkaline Phosohatase (Pharmingen)
BCIP/NBT (5-Bromo-4-chloro-3-indyl Phosphat / Nitro blue; Sigma)
Dieser Filter-Immunoplaque-Assay dient dazu, die Cytokin-Sekretion von Zellen zu messen.
Er nutzt den Vorteil einer relativ hohen Konzentration eines Proteins in der unmittelbaren
Umgebung einer dieses Protein sezernierenden Zelle. Diese Zellprodukte werden von
hochaffinen Antikörpern abgefangen und detektiert, die gegen verschieden Epitope des selben
Zytokins gerichtet sind. Die im ELISPOT durch eine Farbreaktion erzeugten Tupfen (spots)
repräsentieren den „Fußabdruck“ einer einzelnen Zytokin-produzierenden Zelle.
Tag 1: 96-Loch Nitrocellulose Microtiterplatten (MultiScreen-HA, Millipore, Eschborn)
wurden mit 200 µl PBS pro Loch äquilibriert, dann mit einem Ratte-anti-Maus-IFNγAntikörper (B.6.1) in einer 1:500 Verdünnung in PBS beladen (100 µl pro well) und über
Nacht bei 4 °C inkubiert.
Tag 2: Die Platte wurde einmal mit 200 µl PBS pro well gewaschen und dann mit 200 µl
RPMI-Medium pro well für 1-2 h bei 37 °C und 5 % CO2 im Inkubator geblockt, um
verbleibende Bindestellen abzusättigen. Von jeder Zellinie wurden Triplikate serieller
1:2-Verdünnungen angelegt, so daß insgesamt vier verschiedene Konzentrationen der
C Methoden 46
Milzzellsuspension (100 µl / well) vorlagen. Als Positivkontrolle wurde Pokeweed Mitogen in
einer Konzentration von 200 ng / well zugegeben. Um die spezifischen zytotoxischen
T-Zellen zu aktivieren wurden 0,2 µmol Peptidlösung (B.7.3) pro Vertiefung zugegeben. Als
Negativkontrolle, um die Hintergrundproduktion von Zytokin zu messen, wurden Zellen ohne
zusätzliche Stimuli in Medium belassen. Die Zellen wurden 16 bis 20 h bei 37 °C und 5 %
CO2 im Inkubator gehalten.
Tag 3: Die Platte wurde fünfmal mit 200 µl PBS / 0,5 % Tween 20 pro Vertiefung gewaschen
und anschließend mit 200 µl PBS. Ein zweiter, Biotin markierter Ratte–anti-Maus-IFNγ
Antikörper (B.6.1) wurde in einer 1:500-Verdünnung in PBS dazu pipettiert (100 µl / well)
und die Platte bei 4 °C über Nacht inkubiert.
Tag 4: Die Platte wurde vier Mal mit 200 µl PBS / Vertiefung gewaschen, bevor je 100 µl
Streptavidin-Alkaline Phosphatase in einer Verdünnung von 1:500 in PBS in die wells
gegeben wurden. Die Platte wurde für 1-2 h bei Raumtemperatur stehen gelassen. Vor der
Substratzugabe (50 µl / well) wurde die Platte erneut viermal mit 200 µl PBS pro Vertiefung
gewaschen. Nach der Entwicklung blauer Tupfen (5–30 min bei Raumtemperatur) wurde die
Platte unter fließendem VE-Wasser gründlich gespült, getrocknet und mit einem ELISPOTLesegerät (AID, Autoimmundiagnostika, Strassberg) ausgezählt.
C.6.6 Intrazelluläre IFNγ-Färbung
Puffer und Lösungen:
Monensinlösung
3 mM Monensin in 100 % Ethanol (Sigma)
PBS / 0,5 % (w/v) BSA
Cytofix/Cytoperm Kit (PharMingen)
Die Messung der Zytokin-produzierenden Zellen dient dazu, die Spezifität zytotoxischer TZellen zu messen. Das intrazelluläre Zytokin und die Korezeptoren CD4 und CD8 werden
hier durch fluoreszenzmarkierte Antikörper (B.6.1) nachgewiesen.
In einer 96-Loch Rundboden-Platte (Nunc, Roskilde, Dänemark) wurden jeweils 50 µl der
Zielzellen (5x105 / ml) in Duplikaten ausgesät: Als Negativkontrolle die Parentalzellen EL4,
als Zielzellen mit Peptid (10 µM / well) beladene EL4 Zellen und EG.7 Zellen. Sie wurden
über Nacht bei 37 °C und 6 % CO2 belassen. Am nächsten Tag wurden die auf ihre
Aktivierung zu untersuchenden T-Zellen geerntet (~1x105 / ml), in 50 µl Medium pro well
C Methoden 47
aufgenommen und zu den Zielzellen gegeben. Die Platte wurde kurz zentrifugiert (1 min,
1200 rpm (Heraeus Kühlzentrifuge Megafuge 1,0 R)), um die Zellen am Boden zu sammeln
und dann für 1 h bei 37 °C und 6 % CO2 inkubiert. Zur Inhibition der Zytokinsekretion wurde
pro well 3 µM Monensinlösung zupipettiert und die Zellen für 5 h bei 37 °C und 6 % CO2
belassen. Die Platte wurde zentrifugiert (2 min, 1200 rpm), der Überstand verworfen und die
Zellen durch kurzes Vortexen resuspendiert. Die Fixierung der Zellen erfolgte durch Zugabe
von 100 µl Cytofix/Cytoperm pro well für 20 min bei 4 °C. Vor dem Färben wurden die
Zellen zweimal mit 1 x Perm/Wash-Lösung gewaschen. Die Antikörper gegen CD4 (Cychrom-markiert) und CD8 (PE-markiert) wurden 1:100, der anti-IFNγ-Antikörper (FITCmarkiert) 1:50 in 1 x Perm/Wash-Lösung verdünnt und jeweils insgesamt 20 µl pro well
eingesetzt. Die Bindung erfolgte für 30 min auf Eis. Anschließend wurden die Zellen wieder
zweimal mit 1 x Perm/Wash-Lösung gewaschen und dann in 130 µl BSA-Lösung
aufgenommen, so daß sie im Durchflußzytometer (FACSsort, Becton Dickinson,
Heidelberg) vermessen werden konnten (C.6.7).
C.6.7 Durchflußzytometrie (FACS-Analyse)
Die Durchflußzytometrie (fluorescense activated cell sorting, FACS) erlaubt die Analyse
einzelner Zellen nach Größe und Granularität. Des weiteren können Zellen, die mit
fluoreszenzmarkierten Antikörpern angefärbt wurden, voneinander unterschieden werden.
Bei der Messung werden die Zellen in einer konischen Kanüle eingesaugt, deren
Enddurchmesser 20–40 µm beträgt, so daß die Zellen einzeln ein Argon-Laserstrahl (488 nm)
passieren. Durch die Lichtbeugung und –streuung können Aussagen über die Größe
(forwardscatter, FSC) und Granularität (sidescatter, SSC) getroffen werden, und die an die
Antikörper gekoppelten Fluoreszenzfarbstoffe werden angeregt. Sie emittieren ihrerseits
Licht, welches von Fotodioden erfaßt und amplifiziert wird. Die Überlappung der
Emissionsspektren verschiedener Farbstoffe (FITC: λmax = 525 nm; PE: λmax = 575 nm;
Cy-5: λmax = 670 nm) muß bei einer Mehrfarbenmessung durch Kompensation der
verschiedenen Kanäle korrigiert werden. Mit dem Softwareprogramm Cellquest werden
dies Vorgänge grafisch dargestellt, so daß Zellpopulationen und auch einzelne Zellen sichtbar
werden.
C Methoden 48
C.6.8 Zytotoxizitätstest
Die Effektorzellen der Milzzellkultur wurden ausgezählt, wobei nur solche Zellen gerechnet
wurden, die Blastenmorphologie aufwiesen (Vergrößerung gegenüber primären Milzzellen
oder T-förmige Gestalt, Abb. C.2), und in 96-Loch Rundbodenplatten in 1:2 Verdünnungen
ausgesät. Für jede Zellinie wurden Kontrollen für die Spontanlyse (nur Medium) und die
Totallyse (5 % Triton X-100) pipettiert. Die Zielzellen (1 x 106 / Platte) wurden mit 100 µCi
Na251CrO4 für eine Stunde bei 37 °C markiert. Die Zellen wurden dreimal gewaschen (1200
rpm, 5 min), in 10 ml RPMI Medium aufgenommen und zu den Effektorzellen und
Kontrollen gegeben (5x103/Vertiefung). Nach vierstündiger Inkubation bei 37 °C und 5 %
CO2 wurde aus jeder Vertiefung 50 µl zellfreier Überstand auf LumaPlates-96 (Packard
Bioscience, Meriden, USA) überführt. Nach dem Trocknen wurden die Platten in einem
Mikroplatten Scintilationszähler (Microbeta Trilux 1450, Wallac, Turku, Finnland)
vermessen. Die spezifische Lyse wurde wie folgt berechnet:
(experimentelle 51Cr-Freisetzung — Spontanlyse) / (Totallyse — Spontanlyse) x 100 %
Abbildung C.2: T-Zelle in einer Milzzellkultur von C57BL/6 Mäusen
in 40x Vergrößerung
von P. Öhlschläger
C.7 Tierexperimentelle Methoden
C.7.1 Anästhesie der Versuchstiere
Zur intramuskulären (i.m.) Immunisierung wurden die Mäuse mit Methoxyfluran
(Metofane, Janssen, Neuss) ruhiggestellt.
C Methoden 49
C.7.2 Immunisierung
Für die i.m. DNA-Immunisierung wurde den Tieren 5 Tage vor der DNA-Injektion je 50 µl
10 µM Cardiotoxin in den Musculus Tibialis Anterior gespritzt. Für die Vakzinierung wurde
den Mäusen die gewünschte DNA-Menge in je 50 µl PBS in die vorbehandelten Muskeln
injiziert.
Bei der subkutanen (s.c.) Immunisierung wurde die Vakzine in Volumina zwischen 100 und
300 µl unter die Nackenhaut appliziert.
Nach 14 Tagen wurden die Mäuse getötet, um aus den entnommenen Milzen Zellkulturen
anzulegen.
D Ergebnisse 50
D Ergebnisse
Es sollte untersucht werden, ob sich die Strukturproteine L1 und L2 des humanpathogenen
Papillomvirus Typ 16 als Vehikel zur Immunisierung eignen. HPV-Partikel und auch viruslike particles (VLPs) werden von Zellen verschiedener Spezies und Gewebe sehr gut
aufgenommen (Müller et al., 1995). Diese Eigenschaft sollte genutzt werden, um DNA in
Zellen einzuschleusen, die eine Immunantwort auf das codierte Antigen hervorrufen soll.
Es sollten drei verschiedene Vehikelpräparationen im Vergleich zu nackter DNA getestet
werden: (i) Pseudovirionen, bei denen das Reportergen in HPV 16-VLPs verpackt ist, (ii)
VLPs, an die das Reporter(anti)gen von außen gebunden ist und (iii) ein Peptid von HPV 16
L2, an das das Reportergen gebunden vorliegt. Als Reportergen wurde Ovalbumin
ausgewählt, da die Immunogenität des Proteins gut definiert ist, und verschiedene Methoden
zur Messung der Immunantwort zur Verfügung stehen.
D.1
Klonierungen der für die Vehikelpräparationen notwendigen
Plasmide
D.1.1 Klonierung des Ovalbumingens (OVA) in pcDNA3.1+
Der Vektor pcDNA3.1/OVA sollte im Dis- und Reassembly (C.5.5, D.3.1.2) in HPV 16 VLPs
verpackt werden, um so in vitro Pseudovirionen herzustellen. Des weiteren diente er als
Matrize, um ein exprimierbares DNA-Fragment über PCR zu amplifizieren (D.1.3).
Ovalbumin wurde mittels PCR aus dem Vektor pAc-Neo-OVA mit den Primern OVA 5‘
BamHI und OVA 3‘ EcoRI amplifiziert. Das PCR-Produkt und der Vektor pcDNA3.1+
wurden mit den Restriktionsenzymen BamHI und EcoRI gespalten und miteinander ligiert.
Anschließend wurde das Plasmid pcDNA3.1/OVA sequenziert, um die PCR zu überprüfen.
D Ergebnisse 51
Abbildung D.1: Klonierungsschema für pcDNA3.1 /OVA
1 Aus dem Vektor pAc-Neo-OVA wurde die Ovalbumin-cDNA durch PCR amplifiziert und im gleichen Schritt mit den Schnittstellen
BamHI und EcoRI versehen. 2 Der Zielvektor wurde mit den entsprechenden Restriktionsenzymen geöffnet (BamHI, EcoRI), so daß
Ovalbumin einligiert werden konnte (3).
D.1.2 Klonierung des Ovalbumingens (OVA) in pYes2*-VP22-E7(1-66)
Dieser Vektor sollte bei der Herstellung von Pseudovirionen im Hefesystem Verwendung
finden. Auf ihm sind Elemente zur Verpackung und Replikation in Hefe vorhanden: die HPV
16 URR als mögliches cis-Element für die Verpackung, das offene Leseraster für HPV 16 E2
unter der Kontrolle des induzierbaren Hefepromotors Gal 10 als mögliches trans-Element und
das Ovalbumingen unter Kontrolle des CMV-Promotors als Reportergen. Vor der
Tansformation in Hefe mußte noch ein 1875 bp großes Fragment entfernt werden, das
Sequenzen zur Amplifikation in Bakterien enthielt, so daß der Vektor anschließend fast die
Größe des HPV-Genoms aufwies (7968 bp). Zusätzlich enthielt das Plasmid den 2 µ
Hefereplikationsursprung und den auxotrophen Marker URA3, der Wachstum in Medium
ohne Uracil ermöglicht.
D Ergebnisse 52
Der VP22-E7(1-66)-Teil wurde durch Spaltung des Vektors mit den Enzymen BamHI und
AflII aus dem Plasmid pYes2*-VP22-E7(1-66) entfernt, so daß das mit den Primern OVA 5‘
BamHI und OVA 3‘ AflII aus pAc-Neo-OVA amplifizierte Ovalbumingen eingesetzt werden
konnte.
Abbildung D.2: Klonierungsschema des Targetplasmids
1 Aus dem Vektor pAc-Neo-OVA wurde die Ovalbumin-cDNA durch PCR amplifiziert und im gleichen Schritt mit den Schnittstellen
BamHI und AflII versehen. 2 Aus dem Vektor pYes2*-VP22-E7(1-66) wurde der VP22-E7-Teil über die Schnittstellen BamHI und AflII
entfernt, so daß Ovalbumin eingesetzt werden konnte (3).
D.1.3 Polymerasekettenreaktion (PCR) zur Herstellung eines exprimierbaren DNA-Fragments (PCRB/N)
Es sollte ein exprimierbarer, jedoch gleichzeitig möglichst kleiner Reporter hergestellt
werden, der in den Kopplungen an HPV 16 Strukturproteine eingesetzt werden sollte (D.3.2).
Er beschränkte sich deshalb auf drei notwendige Elemente: einen Promotor, das Reportergen
und eine Polyadenylierungsstelle.
D Ergebnisse 53
Die PCR wurde mit modifizierten Primern durchgeführt: Der 5‘-Primer war biotinyliert, um
einerseits das später freie Ende der DNA zu schützen und um andererseits eine Möglichkeit
zur Detektion zu bieten. Das 3‘-Ende trug einen Aminolink, um darüber eine Bindung an
Protein oder Peptid zu ermöglichen (C.5.6, Abb. C.1). Die Amplifikation erfolgte aus dem
Plasmid pcDNA3.1/OVA und umfaßte den pCMV-Promotor, das Ovalbumingen und die
Polyadenylierungsstelle des Bovinen Wachstumshormons (bovine growth hormone, BGHpA),
was einer Gesamtlänge von 2165 bp entspricht.
Abbildung D.3: Herstellung PCRB/N
Das lineare DNA Fragment setzt sich aus dem pCMV-Promotor, Ovalbumin und der BGH-Polyadenylierungsstelle zusammen. Beide
Primer tragen Modifikationen: 5‘ eine Biotinylierung, 3‘ eine Aminogruppe.
D.2 Expressionskontrolle der verschiedenen DNA-Konstrukte
Um die verschiedenen in D.1 beschriebenen Konstrukte auf die Produktion des gewünschten
Proteins, Ovalbumin, zu testen, wurden 293T-Zellen mit pcDNA3.1/OVA, pYes2*/OVA und
PCRB/N transfiziert. Als Negativkontrollen dienten die mit Leervektor pcDNA3.1 und nichttransfizierte Zellen. Die nach 48 h gewonnenen Zellextrakte wurden im Westernblot auf die
Expression von Ovalbumin hin untersucht. Als Positivkontrolle für das Laufverhalten in der
SDS-PAGE und die Antikörperdetektion wurde gereinigtes Ovalbumin (Sigma, Deisenhofen)
eingesetzt.
D Ergebnisse 54
Abbildung
D.4:
Überprüfung
der
Expression von Ovalbumin durch die
verschiedenen DNA-Konstrukte
Im Western Blot wurden Zellextrakte von
transfizierten 293T-Zellen auf Ovalbumin getestet.
Die Plasmide pcDNA3.1/OVA und pYes2*/OVA
zeigten eine hohe Expressionsrate, PCRB/N eine
eher niedrige. Als Positivkontrolle dienten 7,5 ng
Ovalbumin, als Negativkontrolle nicht transfizierte,
bzw. mit Leervektor pcDNA3.1 transfizierte Zellen.
Durch alle drei Konstrukte konnte Ovalbumin exprimiert werden, wobei das lineare PCRProdukt die geringste Expression zeigte. Eine mögliche Erklärung dafür ist, daß in dieser
DNA kein weiterer Replikationsursprung enthalten ist. Plasmide wie pcDNA3.1, die
außerdem noch einen SV40 Ori enthalten, haben dem gegenüber einen Vorteil, da in 293TZellen das SV40 large T-Antigen konstitutiv exprimiert wird, was zur ori-abhängigen
Replikation des Plasmids führt (Wobbe et al., 1986; Tsurimoto et al., 1989; Castellino et al.,
1997). Die auf diese Art erhöhte Plasmidzahl trägt so zu einer höheren Proteinausbeute bei
gleicher Ausgangsmenge an DNA für die Transfektion bei. Auch ist die bei PCRB/N
auftretende Doppelbande ungewöhnlich, da Ovalbumin unter reduzierenden Bedingungen in
der SDS-PAGE nur eine sichtbare Bande von 45 kDa hat (Kahlert et al., 1992; siehe
Diskussion E.1).
Aufgrund der positiven Transfektionsergebnisse konnten alle DNAs für die weitere
Herstellung von Vehikeln eingesetzt werden.
D.3 Herstellung der Vehikel zur Immunisierung
D.3.1 Pseudovirionen (ψVLPs)
D.3.1.1 Pseudovirionen im Hefesystem
Zur Herstellung von Pseudovirionen in Hefe wurde der Saccharomyces cerevisiae-Stamm
#1699 mit einem Plasmid transformiert, das die Produktion von HPV 16 VLPs ermöglicht
(Abb. D.5). Durch eine zweite Transformation wurde das Targetplasmid (D.1.2), das etwa die
D Ergebnisse 55
Größe des HPV-Genoms hat (7965 bp), ebenfalls in den Hefestamm eingeführt und dort in die
HPV-Kapside verpackt.
D.3.1.1.1
Transformation des Hefestammes #1699 mit dem Target-
plasmid
Der Hefestamm #1699, der schon das sogenannte Strukturplasmid pD125 mit den Genen für
HPV16 L1 und L2 enthielt (Abb. D.5), wurde mit dem Targetplasmid pYes2*/OVA
transfiziert, um infektiöse Pseudovirionen herzustellen. Zu
diesem Zweck wurde aus dem Plasmid pYes2*/OVA über einen
Verdau mit SmaI ein 1875 bp großes Stück entfernt, das die für
die Vermehrung in Bakterien notwendigen Sequenzen umfaßt.
Vor der Transformation in den das Strukturplasmid enthaltenden
Hefestamm wurde pYes2*/OVA religiert, so daß es etwa die
Abbildung D.5:
Expressionsplasmid
pD125
für die Strukturproteine L1
und L2 von HPV 16 in Hefe
Größe des HPV 16 Genoms vorwies (7965 bp, Abb. D.2). Das
Strukturplasmid pD125 trägt den auxotrophen Marker Leucin
(LEU2) und das Targetplasmid pYes2*/OVA den Marker Uracil
(URA3), so daß eine Doppelselektion auf Struktur- und
Targetplasmid-positive Klone auf Minimalmediumplatten ohne Leucin und Uracil stattfinden
konnte. Nach viertägigem Wachstum bei 30 °C konnten elf Klone zur weiteren Untersuchung
isoliert werden. Um Revertanten, das heißt Klone, die durch Rekombination mit den
transfizierten Plasmiden die zur Selektion benötigten Aminosäuren wieder selbst
synthetisieren können, auszuschließen, wurden diese Klone noch auf die Expression der
Strukturproteine und das Vorhandensein des Targetplasmids hin getestet.
D.3.1.1.2
Überprüfung der Expression der Strukturproteine in den
Hefezellen
Die Expression des HPV 16 L1 Proteins wurde im Dotblot (C.4.4) getestet. Als
Positivkontrolle für die L1-Expression diente der Extrakt aus einem GFP-Pseudovirionen
produzierenden Hefeklon (erhalten von Dr. M. Müller, DKFZ, Heidelberg), als Negativkontrolle der Ausgangshefestamm #1699. Im Dotblot wurden zusätzlich als Positivkontrolle
D Ergebnisse 56
im Bakulovirussystem produzierte HPV16 L1/L2 VLPs verwendet (Abb. D.6). Mit dem
Antikörper α-HPV16 L1 konnte die Expression der Strukturproteine in 10 von 11 Klonen Klon # 8 war negativ - nachgewiesen werden.
Abbildung D.6: Nachweis der Expression
von HPV 16 L1
Pro Klon wurden 200 µl Hefeextrakt auf die
Membran aufgebracht und mit dem
monoklonalen α-HPV 16 L1-Antikörper CAMVIR1 auf Expression des L1-Proteins getestet. Als
Positivkontrollen dienten im Bakulovirussystem
hergestellt HPV 16 L1/L2 VLPs und ein GFPψVLPs produzierender Hefestamm, als
Negativkontrolle der Ausgangshefestamm
#1699.
D.3.1.1.3 Überprüfung des Vorhandenseins des Targetplasmids in den
Hefezellen
Die Gegenwart des Targetplasmids wurde über PCR mit für Ovalbumin spezifischen Primern
getestet. Dazu wurden Plasmidpräparationen aller elf Hefeklone durchgeführt (Abb. D.7,
Spuren 1-11) und zusätzlich noch als Negativkontrollen GFP-Pseudovirionen, der
Ausgangshefestamm #1699 und der nur das Strukturplasmid pD125 (D.3.1.1.1, Abb. D.5)
enthaltende Stamm #1699 benutzt. Als Positivkontrolle in der PCR diente der Vektor
pYes2*/OVA (Abb. D.7). Auf diese Weise konnten zwei Hefeklone, #2 und #9, identifiziert
werden, in denen das Targetplasmid enthalten war.
D Ergebnisse 57
Abbildung D.7: PCR zum Nachweis des Targetplasmids
Die Detektion des Targetplasmids wurde mit OVA-spezifischen Primern durchgeführt. Ein 300 bp großes Fragment wurde amplifiziert,
auf einem 1%igen Agarosegel aufgetragen und mit Ethidiumbromid angefärbt. Als Negativkontrollen dienten der Ausgangshefestamm
#1699, #1699 mit Strukturplasmid pD125, GFP-ψVLP und ein Ansatz ohne DNA („ohne Template“), als Positivkontrollen das
Targetplasmid pYes2*/OVA und pYes2*/OVA gemischt mit #1699.
Die weiteren Versuche zur Produktion von Pseudovirionen wurden mit den für Struktur- und
Targetplasmid positiven Hefeklonen #2 und #9 durchgeführt.
D.3.1.1.4 Aufreinigung von ψVLPs im Cäsiumchlorid-Dichtegradienten
Die Auftrennung im CsCl-Gradienten ermöglicht die Aufreinigung von vollen, d.h. DNAenthaltenden, und leeren Partikeln aufgrund ihrer unterschiedlichen Dichte. Volle Partikel
sind bei ca. 1,34 g / ml CsCl zu finden, leere bei etwa 1,29 g / ml (Crawford & Crawford,
1963).
Die Extrakte der Hefeklone #2 und #9 wurden einer Zentrifugation im CsCl-Dichtegradienten
unterzogen (C.5.3.4). Nach der Zentrifugation wurden Fraktionen von 100 - 200 µl abgetropft
und in einem Capture-ELISA auf VLPs getestet. Da ein monoklonaler Antikörper, der ein
Konformationsepitop erkennt (25/C, B.6.1), zum Abfangen der HPV 16-Partikel benutzt
wurde, konnte auch sicher gestellt werden, daß komplette VLPs erkannt wurden, nicht nur das
Vorhandensein von L1-Protein (Christensen et al., 1996).
D Ergebnisse 58
Abbildung D.8: Korrelation von Dichte und ELISA der Hefeextrakte
Verteilung von HPV 16 VLPs aus Hefeextrakt #2 (A) und #9 (B) im CsCl-Dichtegradienten bestimmt durch ELISA. Die Korrelation von
Dichte (g/ml) und ELISA-Titer (Abs. 450 nm) für jede der gezapften Fraktionen ist dargestellt.
D Ergebnisse 59
Der mittlere in ELISA-Profil auftretenden Peak (Stern) war wiederholt zu beobachten, der
Grund hierfür ist nicht klar (siehe Diskussion E.2). In den Dichtebereichen um 1,34 und 1,29
g/ml CsCl traten jedoch Peaks im ELISA auf (Pfeile), die die Gegenwart von vollen bzw.
leeren VLPs indizieren. Diese sollten auf verpacktes Targetplasmid getestet werden. Um
sicher zu gehen, daß das Targetplasmid in den VLPs enthalten war und nicht nur außen an den
Partikeln haftet, wurden die einzelnen Fraktionen vor und nach DNaseI-Verdau mittels PCR
auf das Vorhandensein des Plasmids hin überprüft. Im Anschluß wurden die Fraktionen nach
einem Proteinase K-Verdau auf verpackte DNA untersucht, die vor dem vorangegangenen
DNaseI-Verdau durch das Kapsid geschützt war. Als Kontrollen wurde das Targetplasmid vor
und nach DNaseI-Verdau ebenfalls in der PCR getestet.
Leider war es nicht möglich, in auch nur einer Fraktion DNA nach zu weisen, was nicht am
Versuchsaufbau lag, wie durch die mitlaufenden Kontrollen bestätigt wurde: so konnte von
der Kontroll-DNA pcDNA3.1/OVA vor dem DNaseI-Verdau mittels PCR ein 300 bpFragment amplifiziert werden, nach dem DNaseI- und Proteinase K-Verdau jedoch nicht
mehr (Daten nicht gezeigt). Dieses Ergebnis gilt für beide Hefeklone, #2 und #9.
Aufgrund dieser Tatsache wurde eine weitere Methode zur Herstellung von Pseudovirionen
herangezogen, das sogenannte in vitro Dis- und Reassembly.
D.3.1.2
Herstellung von Pseudovirionen durch in vitro Dis- und
Reassembly
Hierbei
werden
im
Bakulovirussystem
hergestellte
VLPs
durch
Reduktion
der
Disulfidbrücken zwischen den Cysteinen im C-terminalen Bereich von L1 in Kapsomere
zerlegt. Bei SV40 bilden sich interpentamere Disulfidbrücken aus (Stehle et al., 1996), was
durch eine Röntgenstruktuanalyse durch Chen et al. auch für HPV 16 L1 VLPs nahe gelegt
wurde. Der Verbindungsarm, der von einer aus den Aminosäuren TLEDTYRFVTSQAIACQ
bestehenden Helix (Helix 4) gebildet wird, und an Position 428 ein Cystein enthält, dient
durch interpentamere Bindungen zwischen den Kapsomeren der Ausbildung von Kapsiden
(Li et al., 1998; McCarthy et al, 1998, Chen et al., 2000). In Gegenwart des Targetplasmids
lagern sich die Kapside durch Dialyse in calciumhaltigem Puffer mit erhöhter NaClKonzentration (0,5 M) zur Stabilisierung (McCarthy et al., 1998) wieder zu VLPs zusammen
und verpacken dabei das Plasmid (Kawana et al., 1998).
D Ergebnisse 60
D.3.1.2.1 Verifikation des Dis- und Reassembly
Der erfolgreiche Zerfall und Neuzusammenschluß der VLPs wurde elektronenmikroskopisch
bestätigt. Aus TN high five Zellen aufgereinigte Partikel (Abb. D.9 A) wurden durch
Reduktion der Disulfidbrücken in Kapsomere zerlegt (Abb. D.9 B) aus denen sich durch
Dialyse wieder Partikel zusammen lagerten (Abb. D.9 C). Diese glichen morphologisch den
in TN high five Zellen produzierten VLPs in Abb. D.9 A.
Abbildung D.9: Elektronenmikroskopische Bestätigung des Dis- und Reassembly
(A) gereinigte HPV16 VLPs, (B) in Kapsomere zerfallene Partikel, (C) neu zusammengelagerte Kapside
Balken 100 nm (A, C), 50 nm (B)
D.3.1.2.2 Analyse der ψVLPs im Cäsiumchlorid-Dichtegradienten
Um die Verpackung von DNA zu bestätigen wurde wie bei den Hefe-ψVLPs eine Dichtegradienten-Zentrifugation durchgeführt. So konnte festgestellt werden, ob volle und leere
Partikel in der Präparation vorhanden waren. Auch hier wurden Fraktionen von etwa 150 µl
abgetropft und im ELISA auf das Vorhandensein von VLPs untersucht. Zur Kontrolle wurden
und behandelte VLPs aus dem Bakulovirussystem ebenfalls in einer DichtegradientenZentrifugation aufgereinigt und auf den VLP-Gehalt in den im Anschluß ausgetropften
Fraktionen untersucht (Abb. D.10).
D Ergebnisse 61
Abbildung D.10: Korrelation von ELISA und Dichte bei unbehandelten VLPs und nach dem Dis- und Reassembly
Verteilung von HPV 16 VLPs im CsCl-Dichtegradienten von unbehandelten VLPs (A) und nach Reassembly (B) bestimmt durch ELISA. Die
Korrelation von Dichte (g/ml) und ELISA Titer (Abs. 450 nm) für jede der getropften Fraktionen ist dargestellt.
Ein Vergleich der ELISA-Profile zeigte, daß die Verteilung von unbehandelten Partikeln aus
dem Bakulovirussystem (Abb. D.9 A) im Vergleich zu Partikeln, wie sie nach Dis- und
Reassembly entstanden sind (Abb. D.9 C) homogener war. Die Analyse der getropften
Fraktionen zeigte, daß der Peak der unbehandelten VLPs bei 1,300 g/ml CsCl lag, also etwas
über dem von Crawford und Crawford bestimmten Wert von 1,29 (Abb. D.10 A). Der erste
D Ergebnisse 62
Peak im VLP-ELISA der Pseudovirionen in den Fraktionen 19 - 21 entspricht einer Dichte
von 1,329 bis 1,327 g/ml im Gradienten, was das Vorhandensein voller Partikel demonstriert
(Abb. D.10 B). Diese bandieren laut Crawford und Crawford zwar bei 1,34 g/ ml CsCl, aber
auch bei Kawana et al. fanden sich die DNA-enthaltenden Partikel bei einer niedrigeren
Dichte, nämlich 1,31 g/ml CsCl. Die anderen Peaks könnten durch Reassembly entstandene
VLPs sein, die keine DNA enthalten (siehe Diskussion E.3).
Die Verpackung von DNA bzw. das Vorhandensein freier DNA wurde wieder über DNaseIund Proteinase K-Verdaus und PCR mit für Ovalbumin spezifischen Primern nachgewiesen.
Die möglicherweise in den Fraktionen 19-35 (Abb. D.10 B), die ein hohes Signal im L1ELISA aufwiesen, enthaltene DNA wurde als Matrize verwendet.
Abbildung D.11: Verteilung der DNA in den vom CsCl-Gradienten nach Dis- und Reassembly gezapften Fraktionen
Von den Fraktionen 19-35 (Dichte 1,33-1,30g/ml, siehe Abb. D.10 B) wurde eine PCR mit OVA-spezifischen Primern vor DNaseI-Verdau
und nach DNaseI- und Proteinase K-Verdau durchgeführt. Die amplifizierten Fragmente (300 bp) wurden auf einem 1%igen Agarosegel
aufgetrennt und mit Ethidiumbromid angefärbt.
In den mit DNaseI und Proteinase K behandelten Fraktionen konnte ein DNA-Fragment von
300 bp nur in Fraktion 20 amplifiziert werden, wohingegen aus allen unverdauten Fraktionen
ein DNA-Fragment vermehrt werden konnte. Die DNA-Daten (Abb. D.11) und die
Proteindaten (Abb. D.10 B) legen nahe, daß Fraktion 20 (und möglicherweise noch
umliegende Fraktionen) zusammengelagerte HPV 16 Pseudovirionen enthalten, die in einer
Immunisierung als Shuttle eingesetzt werden können.
D Ergebnisse 63
D.3.2 Kopplung von DNA
Ein weiterer Ansatz war, DNA chemisch an die HPV 16 Strukturproteine (L1-VLPs bzw. L2)
zu binden. Die DNA (=PCRB/N, siehe D.1.3) bestand aus einem 2,165 kbp großen Stück, das
den pCMV-Promotor, das Ovalbumingen und die Polyadenylierungsstelle des bovinen
Wachstumshormons umfaßte. Die Herstellung erfolgte über PCR mit modifizierten Primern,
die zum einen für die Bindung an die VLPs (3’ -NH2) und zum anderen zur Detektion und
zum Schutz des nach der Kopplung freien Endes der DNA benötigt wurden (5’ -Biotin). Die
Kopplung wurde mit Hilfe von 1-Ethyl-3-(3-Dimethylaminopropyl)carbodiimid Hydrochlorid
(EDC) durchgeführt, welches für die Ausbildung von Peptidbindungen zwischen den
Bindungspartnern sorgt. In einem ersten Schritt reagiert EDC mit einer Carboxylgruppe des
Proteins unter Ausbildung von O-Acylisoharnstoff, einem aminreaktiven Zwischenprodukt.
Nach Zugabe der DNA, die durch den 3‘-Primer mit einer terminalen NH2-Gruppe
ausgestattet ist, findet die Bildung der Peptidbindung statt (Abbildung siehe C.5.6).
D.3.2.1 Kopplung von DNA an VLPs
Für die Bindung von Reporter-DNA, PCRB/N, an die Kapsid-Oberfläche konnten wie beim
Dis- und Reassembly (D.3.1.2) im Bakulovirussystem hergestellte VLPs verwendet werden.
D.3.2.1.1 Überprüfung der Kopplung
Um die Kopplung der DNA an die Partikel zu verifizieren, wurden zwei Präparationen von
HPV 16 VLPs plus PCRB/N im CsCl-Dichtegradienten aufgetrennt und anschließend die
einzelnen getropften Fraktionen mittels ELISA auf VLPs und mittels PCR auf DNA getestet.
Der einzige Unterschied zwischen den Ansätzen bestand darin, daß in einem das
Kopplungsagens EDC fehlte, um sicher zu stellen, daß die Reporter-DNA PCRB/N nicht von
sich aus mit VLPs assoziiert.
Freie DNA ist in einem CsCl-Gradienten bei einer Dichte von etwa 1,6 g / ml zu finden, VLPs
bei ca. 1,29 g / ml. Dies erlaubt eine Unterscheidung zwischen frei vorliegender und an
Partikel gebundener DNA. In den Versuchen konnte gezeigt werden, daß PCRB/N auch nach
der Kopplung nicht komplett an VLPs gebunden vorliegt (sieh Signal in Fraktion 1-3, Abb.
D.12 C). Die anderen nach PCR auftretenden Banden sind jedoch in den Fraktionen zu finden,
D Ergebnisse 64
in denen VLPs im ELISA detektiert wurden (Fraktionen 10-17, Abb. D.12 A und C). Im
Gegensatz dazu sind im Ansatz ohne Kopplungsagenz nach der PCR nur Signale bei hoher
Dichte zu finden, bei der die freie DNA vorliegt. Es gibt keine Fraktionen, in denen sowohl
DNA als auch Partikel zu finden sind (Abb. D.12 B, D). Aus diesen Daten folgt, daß durch
den Kopplungsprozeß DNA an Partikel gebunden werden kann und dieser Vorgang
notwendig ist, um ein zusammenhängendes Vehikel zu erhalten.
D Ergebnisse 65
Abbildung D.12: Kopplung von DNA an VLPs
Verteilung von HPV16 L1 nach der Kopplung (A) und im Ansatz ohne Kopplungsagenz (B) im CsCl-Dichtegradienten bestimmt durch
ELISA. Die Korrelation von Dichte (g/ml) und ELISA Titer (Abs. 450 nm) für jede der Fraktionen ist dargestellt. Verteilung der DNA im
Gradienten nach der Kopplung (C) und im Ansatz ohne Kopplungsagenz (D). Die PCR zur Detektion wurde mit OVA-spezifischen Primern
durchgeführt. Ein 300 bp großes DNA-Fragment wurde amplifiziert, auf einem 1%igen Agarosegel aufgetrennt und mit Ethidiumbromid
gefärbt. Als Positivkontrolle in der PCR wurde pcDNA3.1/OVA verwendet, als Negativkontrolle ein Ansatz ohne DNA.
D.3.2.2 Kopplung von DNA an HPV16 L2108-126
In einem weiteren Kopplungsansatz sollte versucht werden, PCRB/N an ein HPV16 L2spezifisches Peptid (LVEETSFIDAGAPTSVPSI) zu binden. Dieses die Aminosäuren 108 bis
126 von HPV 16 L2 umfassende Peptid stellt ein kreuzneutralisierendes Epitop bei genitalen
HPV-Typen dar (Kawana K et al., 1999). Die Autoren folgerten, daß es sich an der
Oberfläche von Virionen befindet. Diese Annahme wurde durch Beobachtungen unterstützt,
daß das Peptid L2108-126 die Infektion mit HPV16-Pseudovirionen inhibiert und daß ein
HPV16 L2108-126 GFP Fusionsprotein nach spezifischer Bindung in Zellen eintritt (Kawana Y
et al., 2001). Diese Eigenschaften sollten dazu benutzt werden, an das Peptid gebundene DNA
in Zellen einzuschleusen.
D.3.2.2.1 Überprüfung der Kopplung
In einem ersten Ansatz wurde versucht, die Bindung zwischen PCRB/N und L2108-126 durch
Immunpäzipitation
des
L2-Teils
und
anschließende
Ovalbumin-spezifische
PCR
D Ergebnisse 66
nachzuweisen (Abb. D.13, Ansatz A). Die durchgeführten Kontrollen zeigten jedoch, daß
auch ein Signal in der PCR detektierbar war, wenn kein Antikörper zum Abfangen des
Komplexes (Ansatz B) oder kein Peptid, über das die Bindung an die Antikörper stattfinden
sollte, verwendet wurde (Ansatz C). Eine weitere Kontrolle zeigte schließlich, daß die DNA
auch ohne Antikörper und gekoppeltem Peptid an der Protein-A-Sepharose haftet (Ansatz D),
was an der Größe von PCRB/N liegen kann (persönliche Mitteilung Dr. Herbert Tschochner,
BZH Heidelberg).
Protein-A-Sepharose
α-L2-Serum
L2108-126
PCRB/N
A B C D
+ + + +
+
+
+ +
+ + + +
Abbildung D.13: PCR zur Detektion des Komplexes aus PCRB/N und L2108-126 nach Immunpräzipitation des
Kopplungsansatzes
Die Zusammensetzung der einzelnen Ansätze ist in der Tabelle zusammengestellt. Als Positivkontrolle in der PCR diente pcDNA3.1/OVA
mit unbehandelter Sepharose, als Negativkontrolle ein Ansatz nur mit unbehandelter Sepharose.
Ein weiterer Ansatz bestand darin, in einem Band-Shift-Assay unterschiedliches
Laufverhalten der gekoppelten, bzw. ungekoppelten Reporter DNA im Polyacrylamidgel
nachzuweisen. Hierzu wurde die DNA mit und ohne L2108-126-Peptid inkubiert und mit BanI
geschnitten. Im Fall einer erfolgreichen Kopplung sollte am kleinsten resultierenden DNAFragment von 159 bp (Abb. D.14) das Peptid über den modifizierten Primer gebunden sein, so
daß sich eine Verschiebung der Bande um eine etwa 3,2 bp entsprechende Strecke einstellen
sollte, wenn man davon ausgeht, daß eine Aminosäure ein durchschnittliches Gewicht von
110 Da hat und ein Basenpaar von 660 Da (Abb. D.14 A). Um diese sehr kleine Verschiebung
einer unter Umständen auch sehr geringen Menge an DNA sichtbar zu machen, wurden die
Fragmente 3‘ mit [α32P]-dGTP endmarkiert und in einem 12 %igen nicht denaturierenden
Polyacrylamidgel aufgetrennt (Abb. D.14 B). Die Tatsache, daß die jeweils größte und
kleinste Bande das stärkste Signal zeigten, war wiederholt zu beobachten, konnte jedoch nicht
erklärt werden (siehe Diskussion E.4). Bei einer radioaktiven Markierung sollten alle Banden
die gleiche Intensität aufweisen, da das Signal nicht wie bei einer Färbung mit
Ethidiumbromid größenabhängig ist.
Trotz der hohen Sensitivität ist es wiederholt mißlungen, den vorhergesagten Effekt sichtbar
zu machen, da die Auftrennung auch bei einer Gellänge von 35 cm möglicherweise nicht
D Ergebnisse 67
ausreichend war, obwohl ein Gel mit einer Acrylamidkonzentration von 12 % die maximal
Auflösung von Fragmenten mit einer Länge zwischen 50 und 200 bp ermöglicht (C.2.14).
Auch diese Methode konnte nicht zur Bestätigung der Kopplung von PCRB/N und L2108-126
nicht herangezogen werden.
Abbildung D.14: Detektion der Kopplung via
Band-shift—Assay
(A) Vorhersage des Bandenmusters durch CloneManager bei erfolgreicher Kopplung von L2108-126 an
den Reporter PCRB/N und anschließendem Verdau mit
BanI. (B) Auftrennung des Reporters in einem 12%igen
nicht denatuirerenden Polyacrylamidgel nach
Kopplung an L2108-126, Verdau mit BanI und Markierung
mit 32P-dGTP.
Eine dritte Möglichkeit war, die Reporter DNA über den biotinylierten Primer mit Hilfe von
magnetischen Streptavidin-Dynabeads zu immobilisieren, dann auf eine Membran
aufzubringen und mit einem L2-spezifischen Serum den Peptidanteil zu detektieren. Zuerst
mußte gezeigt werden, daß Biotin notwendig ist, um die Bindung an die Kügelchen zu
vollziehen (Abb. D.15). Dazu wurde Reporter-DNA ohne (PCR−/N) und mit (PCRB/N)
biotinyliertem Primer hergestellt und in getrennten Ansätzen mit den magnetischen
Streptavidin-Dynabeads inkubiert. Ungebundene und an die Kügelchen gebundene DNA
wurden mit Hilfe eines Magneten voneinander getrennt und auf eine Membran gedottet (Abb.
D.15). Der Nachweis erfolgte nach DNA-DNA-Hybridisierung mit einer
32
P-dCTP-
markierten Sonde durch Autoradiographie und zusätzlicher Messung der Membran im
Scintilationszähler. Wie in Abbildung D.15 gezeigt, ist im Überstand des biotinylierten PCR-
D Ergebnisse 68
Produkts (B) etwa 7mal weniger Radioaktivität nachweisbar, als bei der unbiotinylieren DNA
(A). Bei der an die Kügelchen gebundenen Radioaktivität wäre ein umgekehrtes Verhältnis zu
erwarten gewesen. Das schwache Signal, bzw. die geringe gezählte Radioaktivitätsmenge in
Abbildung D.15 D erklärt sich wahrscheinlich dadurch, daß die Kügelchen beim Waschen
teilweise von der Membran abgespült wurden.
Abbildung D.15: Bindung Biotin-Primer an Streptavidin-Dynabeads
Reporter DNA ohne (links, A, C) und mit (rechts B, D) biotinyliertem Primer wurde an Streptavidin-Dynabeads gebunden, ungebundene
DNA weggewaschen und alle Ansätze wurden auf eine Membran gedottet. Der Nachweis erfolgte nach DNA-DNA-Hybridisierung mit einer
32
P-dCTP-markierten Sonde durch Autoradiographie und zusätzlicher Messung im Scintilationszähler (Werte neben den Spots
angegeben). A ungebundene DNA ohne Biotin-Primer, B ungebundene DNA mit Biotin-Primer, C gebundene DNA ohne Biotin-Primer, D
gebundene DNA mit Biotin-Primer.
Nachdem gezeigt wurde, daß Biotin für die Bindung an die Kügelchen notwendig ist (Abb.
D.15), wurden für den eigentlichen Nachweis der Kopplung von L2108-126 und PCRB/N (Abb.
D.16) folgende Kontrollen durchgeführt: Inkubation der DNA und des Peptids ohne
Verwendung von EDC (Ansatz B), Weglassen des Peptids in der Reaktion (Ansatz C) und das
Fehlen der Beads (Ansatz D) bei der magnetischen Abtrennung von an die Kügelchen
gebundenem und freiem L2108-126-PCRB/N-Komplex.
D Ergebnisse 69
L2108-126
EDC
PCRB/N
Beads
A B C D
+ +
+
+
+ +
+ + + +
+ + +
Abbildung D.16: Detektion der Kopplung über den Peptid-Anteil
Die Zusammensetzung der einzelnen Ansätze ist in der Tabelle zusammengefaßt. Präparationen mit und ohne EDC und mit und ohne L2
wurden an Streptavidin-Dynabeads gebunden, gewaschen und alle Ansätze aufgedottet. HPV 16 L1/L2 VLPs dienten als Positivkontrolle.
Der L2-Anteil wurde mit dem affinitätsgereinigten α-HPV 16 L2108-126-Serum (C.6.1) detektiert. Links ist das erwartete Dot-Muster
gezeigt, rechts der dazugehörige Blot.
Erwartet wurde, daß in allen Ansätzen außer (D), in dem keine Dynabeads enthalten waren,
die DNA über den biotinylierten Primer an die Kügelchen binden sollte. Nach dem Nachweis
des L2-Anteils mit dem affinitätsgereinigten α-HPV 16 L2108-126-Serum sollte das Peptid nur
im kompletten Ansatz (A) an die Beads gebunden vorliegen, bei Weglassen des
Kopplungsreagenz EDC (B) bzw. der Beads (D) sollte das Peptid ungebunden sein. Ansatz C,
der kein Peptid enthält, diente als Negativkontrolle, HPV 16 L1/L2 VLPs als Positivkontrolle.
Diese Methode brachte ebenfalls kein Ergebnis bezüglich der Kopplung von PCRB/N und
L2108-126, da in keinem der Ansätze ein Signal detektiert werden konnte, so daß keine
Rückschlüsse über die Zusammensetzung dieses Vehikels gemacht werden konnten (siehe
Diskussion). Trotzdem sollte auch dieser Ansatz in den Immunisierungsexperimenten getestet
werden, da möglicherweise trotz der Schwierigkeiten im Nachweis das Vehikel in der
korrekten Zusammensetzung vorlag und eine gegenüber nackter DNA verbesserte
Immunantwort hervorzurufen vermag.
D Ergebnisse 70
D.4 Vergleichbarkeit der verschiedenen Methoden
D.4.1 DNA-Immunisierung
Um die Effizienz der verschiedenen Vehikelpräparationen im Vergleich mit nackter DNA im
Auslösen einer Immunantwort vergleichen zu können, wurde die pro Maus eingesetzte DNAMenge als Standard gesetzt.
Um heraus zu finden, welches die minimale Menge an DNA ist, die noch eine Immunantwort
hervorruft,
wurde
eine
DNA-Titration
durchgeführt.
Da
DNA-Immunisierungen
üblicherweise intramuskulär vorgenommen werden und diese Art der Vakzinierung als
Ausgangspunkt für den Vergleich galt, wurden Mengen von 100 µg bis 3 µg DNA i.m.
appliziert (Abb. D.17). So konnte mit Hilfe der intrazellulären IFNγ-Analyse festgestellt
werden, daß bei C57BL/6 Mäusen eine Menge von mindestens 10 µg pcDNA3.1/OVA
benötigt wurde, um eine meßbare Antwort zu erhalten.
Abbildung D.17: Immunogenität verschiedener Mengen des Expressionsplasmids pcDNA3.1/OVA nach
intramuskulärer Applikation
Intrazelluläre IFNγ-Färbung ovalbuminspezifischer zytotoxische T-Zellen.
Je drei C57BL/6 Mäuse wurden mit 100 µg, 30 µg, 10 µg oder 3 µg pcDNA3.1/OVA i.m. injiziert. Als Negativkontrolle
erhielten drei Tiere PBS. Nach 14 Tagen wurden die OVA-spezifischen zytotoxischen T-Zellen durch intrazelluläre IFNγFärbung quantifiziert, wobei die Aktivierung der Milzzellen durch EL4-Zellen, mit OVA258-265 beladenen EL4-Zellen und EG7Zellen (B.8.3.2) getestet wurde. Doppelt positive T-Zellen (CD8+ und IFNγ+) sind als Prozent aller CD8-positiven Zellen
dargestellt. Der mit EL4-Zellen erhaltene Hintergrundwert wurde von den EL4-OVA und EG7-Daten abgezogen.
D Ergebnisse 71
Da sich gezeigt hatte, daß die Volumina der verschiedenen Vehikelpräparationen (D.3.1.2,
D.3.2.1, D.3.2.2) selten geringer waren als 150 µl, wurde auch eine subkutane Titration
durchgeführt. Das maximale Volumen, das für eine i.m. Injektion bei einer Maus eingesetzt
werden sollte, beträgt 50 µl pro Muskel, so daß eine andere Applikationsart für die Vehikel
gewählt und getestet werden mußte. Bei der subkutanen Immunisierung können Volumina bis
zu 3 ml pro Maus (Tuffery, 1987) verabreicht werden, so daß diese Applikationsroute
geeigneter erschien.
Abbildung D.18: Immunogenität verschiedener Mengen des Expressionsplasmids pcDNA3.1/OVA nach
sukutaner Applikation
IFNγ-ELISPOT (C.6.5) zum Nachweis von ovalbuminspezifischen T-Zellen. Je drei C57BL/6 Mäuse wurden mit 100, 30, 10 oder
3 µg pcDNA3.1/OVA s.c. injiziert. Als Positivkontrolle wurden drei Tiere mit 100 µg Ovalbumin (Protein) plus Titermax
behandelt. Nach 14 Tagen wurden die Milzen in Kultur genommen, einmal mit EG7 Zellen stimuliert und dann im IFNγELISPOT quantifiziert. Als Positivkontrolle für den Assay diente die Ova-spezifische ZTL-Linie 13.1D12. Alle Singale einer
seriellen Verdünnung wurden addiert und die Tupfen der OVA-spezifischen T-Zellen (durch OVA258-265-Peptid aktiviert) wurden
als Prozent der unspezifisch IFNγ-produzierenden Zellen (aktiviert durch Pokeweed Mitogen) dargestellt. Der
Hintergrundwert der Mediumkontrolle wurde von beiden Werten subtrahiert.
Die s.c. Titration ergab, daß die Immunantwort in allen mit DNA behandelten Gruppen nur
bei einem Teil der Mäuse meßbar war. Nur in der Positivkontrolle mit Protein und Adjuvans
konnte eine starke Reaktion bei allen Tieren beobachtet werden. Möglicherweise werden
DNA-Mengen von mehr als 100 µg benötigt, um eine homogene Immunantwort auf nackte
DNA bei der subkutanen Applikation auszulösen. Wenn die Hypothese sich jedoch als richtig
D Ergebnisse 72
erweisen sollte, daß über ein Vehikel eingeschleuste DNA immunogener ist als nackte DNA,
so ließe sich auch mit einer geringeren Menge eine Immunantwort auslösen. Um dies zu
testen, wurde die in der i.m.-Titration als gerade nicht mehr immunogen getestete Menge von
3 µg DNA als die pro Maus für die Vehikelpräparation einzusetzende Menge festgelegt.
D.4.2 Adjuvante Wirkung von VLPs
Da die verschiedenen Vehikelpräparationen unterschiedliche Mengen an VLPs enthielten,
mußte ausgeschlossen werden können, daß diese eine adjuvante Wirkung bei der
Immunisierung haben könnten. Bei Immunisierungen mit chimären VLPs (CVLPs) bestehend
aus entweder bovinen L1-VLPs (Liu et al., 1998) oder HPV 16 L1-VLPs (Schäfer et al, 1999)
und einem T-Zellepitop des E7 Proteins von HPV 16 konnte gezeigt werden, daß sowohl eine
humorale als auch zelluläre Immunantwort ausgelöst wurde, was zeigt, daß VLPs in cis eine
Rolle als Adjuvans spielen. Protein alleine ohne Adjuvans kann allenfalls eine schlechte ZTLAntwort auslösen. Ob die adjuvante Wirkung von VLPs auch in trans vorhanden ist, wurde
am Beispiel von Ovalbumin (Protein) untersucht.
Abbildung D.19: VLPs als Adjuvans
Zytotoxizitätstest von je einer Maus, die mit PBS (A), 30 µg OVA (B, F), 30 µg OVA und 10 µg VLPs (C, G), 30 µg (D) bzw. 100 µg (E) OVA
und Titermax geimpft wurde. Nach 14 Tagen wurden die Milzen in Kultur genommen und mit EG7 Zellen (A-E) oder mit L1165-173 Peptid
beladenen RMA-Zellen (RMA-L1) (F, G) 19 Tage stimuliert. Dann wurden die Zellen im Zytotoxizitätstest gegen EG7 Zellen (A-E) oder
RMA-L1 Zellen (F, G) als Zielzellen getestet.
D Ergebnisse 73
Abbildung D.20: VLPs als Adjuvans
IFNγ-ELISPOT (C.6.5) zum Nachweis von ovalbuminspezifischen T-Zellen.
Vier C57BL/6 Mäuse wurden mit 30 µg Ovalbumin zusammen mit 10 µg VLPs injiziert. Je vier Tiere erhielten als Negativkontrollen
entweder PBS oder 30 µg unbehandeltes Ovalbumin (3 mg / ml, Speidel et al., 1997) und als Positivkontrollen 30 bzw. 100 µg
Ovalbumin mit Titermax als Adjuvans. Nach 14 Tagen wurden die Milzen in Kultur genommen, einmal mit EG7 Zellen stimuliert und
dann im IFNγ-ELISPOT quantifiziert. Die Milzzellen der mit 30 µg OVA und mit OVA und VLPs behandelten Tiere wurden zur Kontrolle in
zwei Kulturen geteilt: Die eine Hälfte wurde mit EG7-Zellen, die andere mit L1165-173 Peptid beladenen RMA-Zellen stimuliert. Alle Signale
einer seriellen Verdünnung wurden addiert und die Tupfen der OVA- /L1-spezifischen T-Zellen (durch OVA258-265-Peptid / L1165-173-Peptid
aktiviert) wurden als Prozent der unspezifisch IFNγ-produzierenden Zellen (aktiviert durch Pokeweed Mitogen) angegeben. Der
Hintergrundwert der Mediumkontrolle wurde von beiden Werten abgezogen.
C57BL/6 Mäusen wurde 30 µg Ovalbumin alleine oder zusammen mit 10 µg VLPs und 30
und 100 µg OVA mit dem Adjuvans TiterMax Gold verabreicht und die ZTL-Antwort
anschließend im ELISPOT (Abb. E.20) und im Zytotoxizitätstest (Abb. E.19) analysiert. Bei
den auf Ovalbumin getesteten spezifischen T-Zellen konnte eine Aktivierung nur bei den mit
Titermax behandelten Tieren festgestellt werden (Abb. E.19 D + E, E.20). Um ausschließen
zu können, daß ein Fehlen der adjuvanten Wirkung in Zusammenhang mit den VLPs steht,
wurden die Zellen der mit Ovalbumin und mit Ovalbumin und VLPs behandelten Mäuse
aufgeteilt und auch auf L1-spezifische T-Zellen getestet. Die Zellen der nur mit OVA
behandelten Tiere zeigten keine Aktivierung, die der mit OVA und VLPs behandelten jedoch
eine hohe IFNγ-Sekretion (Abb. E.20) und eine moderate Lyse der Zielzellen (Abb. E.19 G).
D Ergebnisse 74
Offensichtlich besitzen VLPs in trans bei einer Vakzinierung mit Ovalbumin keine adjuvante
Wirkung. Man sollte also davon ausgehen können, daß eine Immunantwort allein durch DNA
ohne verstärkende Wirkung des Vehikels hervorgerufen wurde.
D.5 Immunisierung mit Vehikelpräparationen
Auf der Basis der hier definierten Parameter wurden C57BL/6 Mäuse s.c. mit den
verschiedenen Präparationen - ψVLPs erhalten durch Dis- und Reassembly und Kopplung des
Reporters an VLPs bzw. L2108-126 - immunisiert und die zelluläre Immunantwort anschließend
im ELISPOT überprüft (Abb. E.21). Jeder Maus wurde dabei über das Vehikel eine DNAMenge von 3 µg zugeführt.
Abbildung D.21: HPV als Shuttle
IFNγ-ELISPOT (C.6.5) zum Nachweis von ovalbuminspezifischen T-Zellen. Je vier C57BL/6 Mäuse wurden mit ψVLPs, DNA an VLPs und
an L2108-126 gekoppelt s.c. injiziert. Als Kontrollen wurden je vier Tiere mit 10 µg VLPs, 3 µg DNA mit bzw. ohne 10 µg VLPs, 100 µg DNA
und 30 µg OVA plus Titermax behandelt. Nach 14 Tagen wurden die Milzen entnommen und im IFNγ-ELISPOT quantifiziert. Alle Singale
einer seriellen Verdünnung wurden addiert und die Anzahl der OVA-spezifischen T-Zellen (durch OVA258-265-Peptid aktiviert) wurden als
Prozent der unspezifisch IFNγ-produzierenden Zellen (aktiviert durch Pokeweed Mitogen) dargestellt. Der Hintergrundwert der
Mediumkontrolle wurde von beiden Werten abgezogen. Der Mittelwert der Positiven ist nur angegeben, wenn nicht bei allen Mäusen
eine Immunantwort meßbar war.
D Ergebnisse 75
In keiner der fraglichen Gruppen konnte eine Zunahme der Immunantwort im Vergleich zur
nackten DNA festgestellt werden. Eindeutig positiv war nur die Kontrolle mit Ovalbumin und
TiterMax.
Die Hypothese, daß Vehikelpräparationen bestehend aus HPV 16 Strukturproteinen und für
Ovalbumin kodierender DNA immunogener sind als nackte DNA, ließ sich in der
vorliegenden Arbeit nicht bestätigen.
E Diskussion 76
E Diskussion
Papillomviren sind zwar streng spezies- und gewebespezifisch, jedoch ist bekannt, daß virusähnliche Partikel (virus-like particles, VLPs) aus L1 allein oder aus L1 und L2 bestehend von
einer großen Zahl unterschiedlicher Zellen aufgenommen werden (Roden et al., 1994; Müller
et al., 1995, Volpers et al., 1995). Diese Eigenschaft sollte für eine DNA-Immunisierung
genutzt werden, in der Annahme daß eine Induktion der Immunantwort effizienter sei, wenn
ein Shuttle zum Eintritt der Nukleinsäure in Zellen eingesetzt wird. In der vorliegenden Arbeit
sollte überprüft werden, ob die Strukturproteine L1 und L2 des humanpathogenen
Papillomvirus (HPV) Typ 16 diese Aufgabe erfüllen können.
Dazu sollten drei verschiedene Vehikelpräparationen hergestellt und getestet werden: (i)
Pseudovirionen, bei denen das Reporter(anti)gen in HPV 16-VLPs verpackt ist, (ii) VLPs, an
die das Reportergen von außen gebunden ist und (iii) ein Peptid von HPV 16 L2, an das das
Reportergen gebunden vorliegt. Als Reportergen wurde Ovalbumin ausgewählt, da die
Immunogenität des Proteins gut definiert ist, und verschiedene Methoden zur Messung der
Immunantwort zur Verfügung stehen.
E.1 Klonierung und Expression des Reportergens
Zunächst wurden die benötigten Vektoren kloniert (D.1) und auf die Expression von
Ovalbumin getestet (D.2). Die unterschiedlichen Ansätze benötigten verschiedene DNAs: Für
die Produktion von Pseudovirionen in Hefe wurde ein Plasmid verwendet (pYes2*/OVA,
D.1.2), das Elemente für die Replikation und Selektion in Hefe, sowie zur Verpackung des
Plasmids in VLPs enthielt. Das andere Plasmid (pcDNA3.1/OVA, D.1.1) sollte im Dis- und
Reassembly in HPV 16 VLPs verpackt werden, diente als Matrize für die Herstellung des
linearen Reporters PCRB/N (D.1.3) für die Kopplung an L1 VLPs und ein die Aminosäuren
108 - 126 umfassendes L2 Peptid und wurde für Immunisierungen mit nackter DNA
verwendet.
Die Expressionskontrolle der drei Konstrukte wurde durchgeführt, um zu testen, ob überhaupt
Antigen produziert wird, so daß eine Antwort nach einer Immunisierung mit diesen Reportern
hervorgerufen werden kann. Nach Transfektion in 293T-Zellen wurde von allen DNAs
Ovalbumin exprimiert, wobei bei der gleichen Menge an eingesetzter DNA die Expression
E Diskussion 77
vom linearen Reporter PCRB/N am geringsten ausfiel (Abb. D.4). Ein Grund dafür könnte
sein, daß in diesem Stück kein Replikationsursprung enthalten ist, der die Kopienzahl nach
der Transfektion erhöht. So erfolgt z.B. über den in pcDNA3.1/OVA enthaltenen SV40-ori
die Replikation des Plasmids durch das konstitutiv in 293T-Zellen exprimierte SV40 large TAntigen (Wobbe et al., 1986; Tsurimoto et al., 1989; Castellino et al., 1997). Die bei PCRB/N
auftretende Doppelbande ließe sich eventuell durch Degradation des Proteins erklären.
Möglicherweise ist aber die Reduktion von Ovalbumin durch die Vorbehandlung mit
Proteingel-Ladepuffer, der 5 % 2-Mercaptoethanol enthält, nicht vollständig, so daß es in der
SDS-PAGE ein scheinbares Molekulargewicht von 40, 45, 63 und 72 kD hat (Kahlert et al.,
1992) und die prominenten Banden die von 40 und 45 kD sind. Unter reduzierten
Bedingungen wäre nur eine Bande von 45 kD zu beobachten.
Da durch jedes der drei Konstrukte Ovalbumin exprimiert wurde, konnten die DNAs zur
Herstellung von Vehikeln zum Zweck der Immunisierung verwendet werden.
E.2 Pseudovirionen in Hefe
Rossi et al. zeigten 2000, daß sich HPV 16 Pseudovirionen in Saccharomyces cerevisiae
herstellen lassen. Ein Targetplasmid ließ sich erfolgreich in VLPs verpacken, die in Hefe
exprimiert wurden, und dann in verschiedene Primärzellen und etablierte Zellinien
transduzieren.
Der Hefestamm, der das Plasmid pD125 enthielt, das für die Expression der Strukturproteine
L1 und L2 von HPV 16 zuständig ist, wurde mit einem für Ovalbumin kodierenden
Targetplasmid transfiziert. Alle erhaltenen Klone wurden sodann untersucht, ob sowohl
Struktur, als auch Targetplasmid in ihnen enthalten waren. Zwei doppelt positive Klone
konnten gefunden werden, die zur Herstellung von Pseudovirionen verwendet werden sollten
(D.3.1.1.2 und D.3.1.1.3). Die Analyse der über einen CsCl-Dichtegradienten aufgereinigten
Hefeextrakte zeigte, daß zwar VLPs produziert wurden, diese aber kein Targetplasmid
enthielten (D.3.1.1.4). Vor der Transfektion des Targetplasmids pYes2*/OVA in Hefezellen
mußten Sequenzen zur Vermehrung der DNA in Bakterien entfernt werden, damit es in etwa
die Größe des HPV 16-Genoms hat. Anschließend wurde das Plasmid religiert und durch
Hitzeschock in die Hefezellen eingebracht. Durch die Selbstligation nach Entfernen dieser
Sequenzen könnten sich Konkatemere bilden, die zwar in einer Plasmidpräparation
nachweisbar wären, aber zu groß sind, um in VLPs verpackt zu werden. Zhao et al. zeigten
E Diskussion 78
1998, daß die absolute Obergrenze für zu verpackende DNA bei 10,2 kb liegt, die schon
durch Zusammenschluß von nur zwei Targetplasmiden mit knapp 16 kb überschritten wäre.
Außerdem beobachteten sie, daß die Unterschiede in der Dichte schwerer und leichter VLPs
möglicherweise die Größe der verpackten DNA widerspiegeln. Die aus den leichten VLPs
gewonnene DNA war heterogen in der Größe, aber die meisten Plasmide waren verstümmelt
und hatte eine Länge von etwa 3,5 kb. Weiterhin wollten die Autoren nicht ausschließen, daß
diese leichten Partikel unsachgemäß geformte Partikel sind, die DNA eingeschlossen haben.
Eventuell läßt sich darüber das Profil des CsCl-Dichtegradienten der in Hefe gewonnenen
Pseudovirionen erklären (Abb. D.8). So könnte der mittlere Peak (Stern in Abb. D.8) bei 1,31
g/ml CsCl Partikel widerspiegeln, die gestutzte DNA enthalten, der bei 1,34 g/ml CsCl
auftretende Peak VLPs mit dem Vollänge-Plasmid und der Peak bei 1,29 g/ml CsCl Partikel
ohne DNA.
Eine andere Möglichkeit weshalb keine Pseudovirionen produziert wurden, besteht darin, daß
der verwendete Hefestamm zum Wildtyp (wt) revertiert und die für das Wachstum in
Selektionsmedium benötigten Plasmide nicht mehr gebraucht werden. Die genomischen
Allele vieler häufig verwendeter auxotropher Marker enthalten Punktmutationen, kleine
Deletionen oder Ty1-Insertionen und können deshalb noch große homologe Regionen zu dem
entsprechenden wt-Gen auf einem eingeführten Plasmid beherbergen, was zu unerwünschten
Rekombinationen führen kann (Brachmann et al., 1998). Der Genotyp des verwendeten
Hefestammes #1699 ist nur ungenügend definiert, so daß sich z.B. keine genaue Aussage über
das ura3-Allel machen läßt. Eine Unterscheidung zwischen ura3-52 und ura3-1 wäre aber
sinnvoll, denn das ura3-1-Allel kann revertieren (Brachmann et al., 1998). In diesem Fall
würde das Targetplasmid, welches diesen Marker beinhaltet, nicht mehr fürs das Wachstum
auf Selektionsmedium benötigt und deshalb der Bestand nicht mehr aufrecht erhalten.
Beide für die Produktion von Pseudovirionen benötigten Plasmide besitzen 2µReplikationsursprünge, wodurch für hohe Kopienzahlen in einer Hefezelle gesorgt wird.
Jedoch übersteigt die Kopienzahl aller in einer Zelle befindlichen Plasmide, die einen 2µ-ori
besitzen, nicht 60 bis 100 (Rose & Broach, 1990). Dies kann sich ungünstig auf den Anteil
des Targetplasmids auswirken, da sich das Gleichgewicht zwischen den Plasmiden aufgrund
der verwendeten Selektionsmarker zugunsten des Strukturplasmids verschieben kann. Die
eingesetzten Marker sind URA3 auf dem Targetplasmid und LEU2 auf dem Strukturplasmid.
Plasmide, die leu2-d enthalten, fallen durch eine hohe Kopienzahl auf. Die Expression des
LEU2-Gens ist sehr niedrig, weshalb eine hohe Anzahl an Kopien benötigt wird, damit ein
Hefestamm unter Selektion auf Leucin wachsen kann (Erhart & Hollenberg, 1983). Es könnte
E Diskussion 79
sich demnach als günstig erweisen, diesen starken Selektionsmarker im Target- statt im
Strukturplasmid einzusetzen, um dessen Kopienzahl und damit die Chance auf Verpackung zu
erhöhen.
Wollte man das Hefesystem für die Produktion von Pseudovirionen beibehalten, da es
prinzipiell auch für die Herstellung größerer Mengen geeignet ist, so müßte zuerst ein
Hefestamm mit genau definiertem Genotyp ausgewählt werden, um alle Möglichkeiten für
eine Reversion ausschließen zu können. Außerdem wäre es von Vorteil, wenn das Targetstatt das Strukturplasmid den stärkeren Selektionsmarker besäße (siehe oben), um dessen
Kopienzahl zu erhöhen.
Statt diese Modifikationen vorzunehmen wurde hier eine weitere Methode zur Produktion von
Pseudovirionen herangezogen, das sogenannte in vitro Dis- und Reassembly.
E.3
Dis- und Reassembly von HPV 16 VLPs zur Herstellung von
Pseudovirionen
Kawana et al. und Touze & Coursaget konnten zeigen, daß in vitro hergestellt Pseudovirionen
in der Lage waren, Zellen unterschiedlicher Gewebe und Spezies zu infizieren und sich somit
zur Verwendung als Shuttle-Vektor für beliebige Plasmide eignen. Diese Fähigkeit zum
Gentransfer sollte genutzt werden, um in vivo eine Immunantwort auf ein auf der verpackten
DNA kodiertes Antigen zu induzieren.
Durch
Verwendung
eines
reduzierenden
Agens,
2-Mercaptoethanol,
konnten
im
Bakulovirussystem produzierte HPV 16 VLPs in Kapsomere zerlegt werden und sich in
Gegenwart von pcDNA3.1/OVA durch Dialyse wieder zu Partikeln zusammen lagern und das
Plasmid einschließen (D.3.1.2.1). Die Analyse der getropften Fraktionen des anschließend
durchgeführten CsCl-Dichtegradienten im ELISA zeigte, daß in den Fraktionen 19 bis 35
VLPs vorhanden waren. Der erste Peak in Fraktion 20 entspricht einer Dichte von 1,327 g/ml
CsCl im Gradienten, was das Vorhandensein voller Partikel nahe legt, da diese Dichte fast der
von DNA-enthaltenden Partikeln entspricht (Abb. D.10). Diese bandieren laut Crawford und
Crawford zwar bei 1,34 g/ml CsCl, aber auch bei Kawana et al. fanden sich die DNAenthaltenden Partikel bei einer niedrigeren Dichte, nämlich 1,31 g/ml CsCl. Ein Grund für
diesen Unterschied könnte sein, daß Crawford und Crawford native Partikel aus Warzen
untersuchten, die sich in der Verpackung der DNA und im Aufbau von den in vitro
generierten Pseudovirionen unterscheiden. Die von Zhao et al., 1998 in vivo in Cos-1-Zellen
E Diskussion 80
oder auch von Unckell et al. 1997 in Cos-7-Zellen hergestellten Pseudovirionen weisen sicher
eine größere Homologie zu nativen Partikeln auf, jedoch ist auch hier keine volle
Übereinstimmung in der Dichte zu finden, bei denen volle und leere Partikel im CsClGradienten laut Crawford und Crawford zu finden sind: 1,34 g/ml und 1,30 g/ml CsCl bei
Zhao et al. bzw. 1,31 g/ml und 1,29 g/ml CsCl bei Unckell et al..
Die in diesem ELISA (Abb. D.10 B) auftretenden weiteren Peaks bei einer Dichte von 1,31
und 1,32 g/ml CsCl könnten möglicherweise, wie schon bei den in Hefen produzierten
Pseudovirionen angenommen, VLPs darstellen, die trunkierte Plasmid-DNA enthalten oder
aber auch falsch geformte, DNA enthaltende Partikel darstellen (Zhao et al., 1998).
Die Verpackung von DNA in VLPs (52-55 nm Durchmesser) im in vitro-System könnte
problematisch sein, da sich die DNA durch ihre eigene Ladung abstößt und hier keine
Faktoren zur Kondensation der DNA verwendet werden. Möglicherweise ließe sich durch
Verwendung von Zellkernextrakt beim Dis- und Reassembly die Ausdehnung des Plasmids
für die Verpackung reduzieren, da Kernextrakte aus Xenopus Oozyten oder auch ein
sogenannter Kondensin-Komplex aus einem solchen Oozyten-Extrakt die Kondensation von
Chromatin bewirken (Ohsumi et al, 1998; Kimura et al., 2001).
Über DNaseI- und Proteinase K-Verdaus konnte gezeigt werden, daß in den in Fraktion 20
vorhandenen VLPs, die bei einer Dichte 1,327 g/ml CsCl auftraten, bei der sich volle Partikel
erwarten lassen, geschützte DNA enthalten war (Abb. D.11). Hier handelte es sich um
Pseudovirionen, die, wie in der Literatur beschrieben, während des Reassemblys das
Targetplasmid verpacken, welches dann vor DNase-Verdau geschützt ist. Die so generierten
Pseudovirionen konnten dazu verwendet werden, pcDNA3.1/OVA als DNA-Vakzine in
Zellen einzuschleusen.
E.4 Kopplung von DNA an HPV 16 VLPs
Die durch Kopplung hergestellten Pseudovirionen wurden für unterschiedliche Zwecke
entwickelt: Müller et al. (1995) wollten damit die Interaktionen von Papillomvirus Kapsiden
mit der Zelle untersuchen, Yeager et al. (2000) testeten Patientenseren auf das Vorhandensein
neutralisierender Antikörper. Möglicherweise lassen sich diese Pseudovirionen aber auch für
eine in vivo-Infektion von Zellen und somit zur Induktion einer Immunantwort einsetzen.
Offensichtlich scheint die Länge der an die Partikeloberfläche gekoppelten DNA für die
Interaktion mit der Zelle kritisch zu sein: Müller et al. verwendeten ein 8,9 kb großes Plasmid,
E Diskussion 81
wodurch weniger als 1 % der Zellen infiziert wurden. Erst nach Koinfektion mit einem
replikationsdefizienten Adenovirus, gelang es, eine Infektion von 10 – 20 % zu erreichen.
Adenoviren vereinfachen die Lyse der Lysosomenmembran, wodurch der Komplex ins
Zytoplasma gelangen und exprimiert werden kann. Im Gegensatz dazu wurden in der
Untersuchung von Yeager et al., die ein lineares Reporterkonstrukt von 1,8 kb einsetzten, bis
zu 40 % der Zielzellen infiziert, ohne daß eine Koinfektion vonnöten gewesen wäre.
Möglicherweise wirkt die Größe des von Müller et al. verwendeten Plasmids inhibierend auf
die Aufnahme in Zellen. Aus diesem Grund wurde eine etwa 2,1 kb großer Reportergen-DNA
(PCRB/N) für die Kopplung über PCR hergestellt, die den pCMV-Promotor, das Gen für
Ovalbumin und die BGH-Polyadenylierungsstelle umfaßte (D.1.3). Die dafür verwendeten
Primer trugen 5’ eine Biotinylierung mit Detektions- und Schutzfunktion und 3’ einen
Aminolink, über den die Bindung an die Partikel stattfand. Durch Protein- und DNAAnalysen (ELISA und PCR) konnte festgestellt werden, daß der Reporter nach der
chemischen Kopplung mittels 1-Ethyl-3-(-3-Dimethylaminopropyl)carbodiimide Hydrochlorid (EDC) an die Partikel gebunden vorlag (D.3.2.1.1). Jedoch ist nicht die gesamte
eingesetzte DNA an die Partikel gebunden, sondern ein Teil, etwas 30 %, lag frei vor (Abb.
D.12 C). Für eine Immunisierung dürfte das aber nicht hinderlich sein, da die Gesamtmenge
an DNA (als DNA-VLP-Komplex und freie DNA zusammen genommen) geringer ist, als die
minimale Menge nackter DNA, die zur Induktion einer Immunantwort benötigt wird (< 10
µg, D.4.1). Falls durch das gekoppelte Shuttle eine Immunantwort hervorgerufen wird, so ist
dies der Assoziation von DNA und VLPs zuzuschreiben, nicht dem Anteil nackt vorliegender
DNA, da auch VLPs in trans keinen adjuvanten Effekt haben (D.4.2).
E.5 HPV 16 L2 als Shuttlevektor
In einer Studie von Kawana et al. zur Lokalisation der Epitope monoklonaler Mausantikörper
gegen HPV 16 L2 konnten zwei Antikörper gefunden werden, die das die Aminosäuren (AS)
108-126
umfassende
L2-Peptid
(LVEETSFIDAGAPTSVPSI)
binden.
In
einem
Sequenzvergleich wurde festgestellt, daß dies eine konservierte Sequenz innerhalb der
genitalen HPV-Typen darstellt. Durch die Antikörper gegen dieses Peptid konnte eine
Pseudoinfektion mit HPV 16 und 6 blockiert werden, was nahe legt, daß diese beiden Typen
ein gemeinsames L2-Neutralisationsepitop besitzen, das an der Virusoberfläche lokalisiert ist.
E Diskussion 82
Es erscheint als wahrscheinlich, daß die Aminosäuren 108-126 innerhalb des L2-Proteins eine
wichtige Funktion bei der Infektion mit HPV spielen (Kawana et al., 1999).
In einem Kompetitionsassay interferierte HPV 16 L2108-126 mit der Infektiosität von HPV16
Pseudovirionen in COS-Zellen und das L2108-126-Peptid fusioniert an GFP vermittelte dessen
Bindung an und Eintritt in Zellen verschiedener Herkunft. Wurden Pseudovirionen mit
Mutationen in den AS 108-111 von L2 verwendet, so resultierte daraus eine geringere
Infektiosität. Auch diese Daten weisen auf eine Rolle von L2 bei der Infektion mit HPV durch
Interaktion der N-terminalen Region mit einem zellulären Oberflächenprotein hin (Kawana et
al., 2001).
Die Experimente mit der Fusion aus L2108-126 und GFP regten an, daß dieses Peptid eine
Funktion als Shuttle nicht nur für Protein, sondern möglicherweise auch für DNA haben
könnte. Deshalb wurde versucht, L2108-126 und PCRB/N chemisch mittels eines Katalysators
(EDC) über eine Peptidbindung zu koppeln, um so dem DNA-Teil zum Eintritt in Zellen zu
verhelfen, wo schließlich Expression und Prozessierung den Antigens, Ovalbumin, stattfinden
sollten.
Um die Bindung von Peptid an PCRB/N nachzuweisen, wurden verschiedene Versuche
durchgeführt (D.3.2.2.1). In einer Immunpräzipitation des L2-Teils und anschließender
Ovalbumin-spezifischer PCR sollte die Kopplung überprüft werden. In den Kontrollen zeigte
sich, daß die DNA auch in Abwesenheit des Peptids an der Protein-A-Sepharose haftet (Abb.
D.13, Ansatz D), was an der Größe der Reporter-DNA (2165 bp) liegen kann (persönliche
Mitteilung Dr. Herbert Tschochner, BZH Heidelberg). Immunpräzipitationen werden zwar
auch durchgeführt, um DNA-bindende Protein zu analysieren, jedoch liegt die optimale Länge
der verwendete DNA zwischen 80 und 600 bp (Pollock & Treisman, 1990; Orlando et al.,
1997). Somit konnte diese Methode nicht zur Verifikation der Kopplung zwischen PCRB/N
und L2108-126 herangezogen werden.
In einem anderen Ansatz sollte untersucht werden, ob die Bindung von L2108-126 an PCRB/N
eine Verschiebung im Laufverhalten in einem nicht denaturierenden Polyacrylamidgel, das
der Auftrennung doppelsträngiger DNA dient, verursachen kann. Wenn man davon ausgeht,
daß eine Aminosäure ein durchschnittliches Gewicht von 110 Da hat und ein Basenpaar von
660 Da, würde L2108-126 eine Verschiebung von etwa 3,2 bp bewirken. Um eine Veränderung
dieser Größenordnung sichtbar zu machen, wurde die Reporter DNA nach der chemischen
Kopplung mit einem Restriktionsenzym (BanI) verdaut, so daß das L2-Peptid am kleinsten
resultierenden Fragment gebunden sein sollte. Zum besseren Nachweis wurden die Fragmente
am 3’-Ende radioaktiv markiert, was für eine gleichmäßige, größenunabhängige Signalstärke
E Diskussion 83
wichtig ist, und die Polyacrylamidkonzentration so gewählt, daß DNA-Fragmente mit einer
Größe von 50 bis 200 bp gut aufgetrennt werden können. Trotzdem konnte keine
Verschiebung des Bandenmusters beobachtet werden. Dies könnte daran liegen, daß die
Gellänge für eine Trennung nicht ausreichend war und der Anteil ungekoppelter DNA ein
Signal zeigte, das das der verschobenen DNA überlagerte. Eine Möglichkeit, um eine
Verschiebung sichtbar zu machen, könnte ein sogenannter Antibody-Supershift-Assay sein
(Kristie & Roizman, 1986). Die Bindung von Antikörper und Protein, oder in diesem Fall
Peptid, kann zu einer weiteren Reduktion der Mobilität des DNA-Peptid-Komplexes im Gel
führen, so daß die Verschiebung deutlicher wird.
Auch zeigten die größte und kleinste Bande (1320 bzw. 159 bp) das stärkste Signal, obwohl
bei einer radioaktiven Markierung alle Banden die gleiche Intensität aufweisen sollten, nicht
wie bei einer Färbung mit Ethidiumbromid, wo das Signal von der Fragmentgröße abhängig
ist. Für dieses Phänomen konnte auch in der Literatur kein Hinweis auf eine Erklärung
gefunden werden. Wenn man versuchen wollte, als Erklärung einen nur partiellen Verdau mit
BanI anzuführen, müßten die Banden mittlerer Länge von 202 und 484 bp intensiver sein und
noch zusätzliche Banden sichtbar werden. Auch eine mögliche Bevorzugung der terminalen
DNA-Fragmente durch das Klenow-Fragment kann man ausschließen, denn das größte
Fragment von 1320 bp befindet sich wie das 202 bp große Stück zentral in PCRB/N. Auch die
Termini zeigen eine unterschiedliche Signalintensität in der Radiographie: Das biotinylierte
5’-Ende von 484 bp zeigt ein schwaches Signal, das mit dem Aminolink versehene 3’-Ende
von 159 bp hingegen ein starkes, unabhängig davon, ob L2108-126 daran gebunden vorliegt
oder nicht. Eventuell wurde das Peptid auch während des Versuchs degradiert. Peptide sind
zwar bei Raumtemperatur für einige Stunden stabil, aber möglicherweise führten die
einzelnen Schritte des Versuchs wie Kopplung, Verdau und radioaktive Markierung der DNA
mit jeweils anschließender Fällung der DNA zur Degradation des Peptids.
Eine dritte Möglichkeit zum Nachweis der Bindung von Peptid an PCRB/N bestand darin, die
Reporter-DNA über den biotinylierten Primer an Streptavidin-Dynabeads zu binden und so
von nicht-gebundener DNA abzutrennen, dann auf eine Membran aufzubringen und mit
einem L2-spezifischen Serum zu detektieren (D.3.2.2.1). Nur die Positivkontrolle aus HPV 16
L1/L2 VLPs rief ein Signal hervor, jedoch keiner der Kopplungsansätze. Je Kopplungsansatz
wurden 40 ng Peptid eingesetzt, in der Positivkontrolle 400 ng L1/L2 VLPs, was bei einem
Verhältnis von 30:1 zwischen L1 und L2 etwa 13 ng L2-Protein entspricht, also ca. einem
Drittel der eingesetzen Peptidmenge. Das entspricht in etwa einem molaren Verhältnis von
L2108-126-Peptid zu L2-Protein von 88:1. Da das Antiserum gegen das synthetisch hergestellte
E Diskussion 84
L2-Peptid gerichtet ist, nicht gegen das komplette Protein oder L1/L2 VLPs, läßt sich das
fehlende Signal im Dotblot nicht durch unkompatible Epitope (synthetisches Peptid bzw.
natives Protein) erklären. Möglicherweise wurde auch hier der Peptidanteil während des
Versuchsverlaufs degradiert, so daß keine Detektion erfolgen konnte. Die Immunisierung
sollte von diesem Problem nicht betroffen sein, da die Kopplungsprozedur in zwei Stunden
abgeschlossen ist und das Vehikel direkt im Anschluß den Mäusen injiziert wurde.
Da es in dieser Arbeit nicht gelang, ein Bindung von Peptid an PCRB/N nachzuweisen, kann
auch nicht klar gesagt werden, ob die fehlende Immunantwort nach Applikation an Mäusen
auf möglicherweise nicht zusammengebaute Komponenten zurückzuführen ist, oder ob auch
ein korrekt zusammengesetztes Shuttle keine Resultate in einer Immunisierung gezeigt hätte
(D.5, Abb. D.21).
Ein Grund für einen Fehlschlag der Verbesserung einer Immunantwort könnte eventuell in der
Wahl des Peptids liegen, da eine andere Studie (Yang et al., 2003) besagt, daß die AS 91-129
von L2 zwar für die Infektion, nicht aber für die Bindung des Partikels an die Zelloberfläche
benötigt werden. Statt dessen sind die Aminosäuren 13-31 für die Kompetition zur Bindung
an Zellen vonnöten und auch nur ein Fusionsprotein aus AS 13-31 und GFP, nicht aber AS
25-45 oder 299-333, zeigt Bindung an und sogar Aufnahme in Zellen. Mutationen in den
Positionen 18 und 19 oder 21 und 22 von L2 reduzierten die Bindung des Fusionspeptids an
Zellen und die Infektiosität von HPV 16 Pseudovirionen. Auch wurde für BPV 1 gezeigt, daß
das Fehlen der AS 91-129 von L2 zwar eine Infektion verhindert, nicht aber das Assembly,
die Struktur oder die Bindung der Virionen an die Zelloberfläche stört (Yang et al.,2003).
Diese gegenteiligen Aussagen bezüglich der Fähigkeit zur Bindung der verschiedenen HPV
16 L2-Peptide (Kawana: AS 108-126 bzw. Yang: AS 13-31) an Zellen könnten bedeuten, daß
HPV 16 L213-31 statt L2108-126 als der geeignetere Kandidat für ein Shuttle angesehen werden
kann.
Eine andere Möglichkeit zur Komplexierung eines L2-Peptids und DNA durch direkte
Interaktion wie von Bousarghin et al. 2003 beschrieben, ist für das L2108-126 Peptid jedoch
nicht geeignet. In dieser Arbeit wurde gezeigt, daß positiv geladene Sequenzen (AS 1-13 und
AS 454-462) am N- und C-Terminus von HPV 16 L2 an DNA und Heparansulfat binden
können und Gentransfer in Cos-7 Zellen vermitteln. Die DNA war durch Komplexierung mit
diesen Peptiden vor Benzonaseverdau geschützt. Allerdings sind diese Sequenzen reich an
Arginin und Lysin, wohingegen L2108-126 nur ein N-terminales Lysin vorweisen kann
(LVEETSFIDAGAPTSVPSI), was es für die auf den Ladungsverhältnissen der
E Diskussion 85
Bindungspartner beruhende Methode zur Komplexbildung wahrscheinlich unbrauchbar
macht.
Auch besitzt L2108-126 keine Zugehörigkeit zur Gruppe der sogenannten Penetratine, die
translozierende Eigenschaften besitzen, da auch diese Peptide viele basische und apolare
Aminosäuren beinhalten. Aber auch dann wäre das Einschleusen von PCRB/N problematisch,
da durch die Bindung doppelsträngiger DNA die Penetratin-vermittelte Translokation
aufgehoben wird (Prochiantz, 1996; Derossi et al., 1998; Schwarze et al., 2000).
Es läßt sich also aufgrund der hier gewonnenen Ergebnisse keine Aussage bezüglich des
Status der Kopplung treffen, und auch die Wahl des Peptids in Hinsicht auf Zellbindung und
–Eintritt war eventuell nicht optimal. Trotzdem wurde der Ansatz in den Immunisierungen
verwendet, um feststellen zu können, ob trotz der Schwierigkeiten im Nachweis des
Komplexes ein ihm zu zuschreibender Effekt nach der Immunisierung zu beobachten war.
E.6 DNA-Immunisierung
Die ersten humanen Studien zur DNA-Immunisierung wurden 1998 publiziert (Calarota et al.,
1998; MacGregor et al., 1998; Ugen et al., 1998; Wang et al., 1998). Inzwischen hat sich
herausgestellt, daß die Effizienz von DNA-Vakzinen in Primaten wesentlich geringer zu sein
scheint, insbesondere die Induktion der humoralen Immunantwort, als Studien mit Mäusen
vermuten ließen (Gregersen, 2001; Johnston et al., 2002). So waren Rhesusaffen, an denen ein
SIV-Impfstoff getestet wurde, vor einer Infektion mit dem SI-Virus nur nach viermaliger
Injektion von 5 mg DNA geschützt (Couillin et al., 2001). In einer Studie für eine MalariaVakzine mußte den Probanden große Mengen an DNA (2,5 mg / Injektion) verabreicht
werden, um eine Immunantwort, gemessen durch
51
Cr-Freisetzung im Zytotoxizitätstest, zu
erhalten (Wang et al., 1998). In beiden Studien konnten keine Antikörper induziert werden.
Durch Modifikation oder Targeting der DNA-Vakzine ist es möglich, die Immunantwort zu
verbessern. So kann z.B. durch Immunisierung mit DNA-Vektoren, die für ein UbiquitinFusionsprotein kodieren, das Antigen innerhalb der Zelle durch Anhängen weiterer
Ubiquitinmoleküle zum Proteasom geleitet werden, was die MHC Klasse I-Präsentation
verstärkt (Fu et al., 1998). Für extrazelluläres Targeting können Signalpeptide verwendet
werden, die der DNA zur Aufnahme in Antigen-präsentierende Zellen (APCs) verhelfen und
die Immunantwort verstärken (Barry et al., 1996). Eine weitere Möglicherweise für
extrazelluläres Targeting können HPV-Strukturproteine sein, da diese von einer Vielzahl von
E Diskussion 86
Zellen, darunter auch Dendritische Zellen, aufgenommen werden (Roden et al., 1994; Müller
et al., 1995, Volpers et al., 1995). Auf diese Weise könnten sie einem DNA-Impfstoff den
Eintritt in Zellen erleichtern und so die Wirkung einer DNA-Immunisierung verbessern.
Bei DNA-Immunisierungen im Mausmodell wird am häufigsten die intramuskuläre (i.m.)
Applikation gewählt, gefolgt von intradermaler (i.d.) und subkutaner (s.c.) Administration
(Gregoriadis et al., 2002). Bei der i.m. Injektion verwenden einige Autoren Cardiotoxin
(Davis et al., 1993) oder Bupivacain (Wang et al., 1993) zur Vorbehandlung des Muskels, um
durch auf die Schädigung folgende Regeneration die Infiltration von Lymphozyten zu
erhöhen oder den Blutfluß zu steigern. Die verwendete DNA-Dosis hängt vom Antigen und
vom Modellsystem ab, wobei typischerweise für i.m. und s.c. Immunisierungen Mengen von
10 – 100 µg und bei i.d. Applikation mit einer Gene Gun, die mit DNA beschichtete mikroGoldpartikel in die Haut schießt, 0,1 – 1 µg eingesetzt werden (Gurunathan et al., 2000;
Rodriguez & Whitton, 2000).
Die hier durchgeführte i.m. Immunisierung mit pcDNA3.1/OVA zeigte, daß durch DNAMengen von 10 – 100 µg eine zelluläre Immunantwort hervorgerufen wird (D.4.1), wie auch
von Gurunathan et al. beschrieben. Aufgrund der großen Volumina der Vehikelpräparationen
mußte jedoch eine andere Applikationsroute gewählt werden, da pro Muskel maximal 0,05 ml
injiziert werden sollen (Tuffery, 1987). Da subkutan (s.c.) Volumina von bis zu 3 ml pro
Maus appliziert werden können (Tuffery, 1987), bot sich diese Immunisierungsroute an. Die
s.c. Injektion kann entweder in den Fußballen, an der Schwanzwurzel oder unter die Haut
zwischen den Schulterblättern erfolgen, wobei letztere Möglichkeit am einfachsten
durchzuführen ist und auch in einer Untersuchung der DNA-Immunisierung gegen VaricellaZoster-Virus genauso effektiv war, wie eine i.m. Applikation (Hasan et al., 2000). In einer
Studie zum Schutz vor kutaner Leishmaniose (Mendez et al., 2002) war die s.c. Applikation,
allerdings in den Fuß, der i.m. Administration sogar überlegen. In dieser Arbeit wurden die
Mäuse mit Dosen von 3 – 100 µg pcDNA3.1/OVA zwischen den Schulterblättern vakziniert,
wobei in keiner der Gruppen eine Immunantwort detektiert werden konnte (D.4.1). Dies ist
möglicherweise auf das Immunisierungsprotokoll zurück zu führen, da die Tiere nur eine
Einfachdosis ohne Booster-Injektion erhielten. Bei Hasan et al. (2000) wurden die besten
Ergebnisse mit 200 µg DNA, also einer höheren Dosis, und einer Booster-Injektion erhalten,
und bei einer Untersuchung der Immunantwort gegen das kleine Hepatitis B
Oberflächenantigen (HbsAg) konnten zwar bei Mengen von 10 und 100 µg DNA
zytotoxische T-Zellen induziert werden, aber die Administration wurde an der
Schwanzwurzel durchgeführt (Böhm et al., 1998). Eventuell ist auch die s.c. Immunisierung
E Diskussion 87
für Ovalbumin kodierende DNA ungeeignet, da nicht jede Applikationsroute für verschiedene
Antigene gleichermaßen geeignet ist (Böhm et al., 1998; McCluskie et al., 1999; Hasan et al.,
2000; Mendez et al., 2002).
Auch die negativen Ergebnisse bei der vergleichenden Immunisierung der verschiedenen
HPV-Shuttles (D.5) lassen sich möglicherweise mit dem Immunisierungsprotokoll erklären.
Da die s.c. Injektion offensichtlich für Ovalbumin-DNA nicht geeignet ist (D.4.1), ist es
möglich, daß auch durch die Verwendung eines Vehikels, das per se die Immunantwort
verbessern könnte, keine nachweisbare Antwort erzielt wird. Falls es gelänge, die
Konzentration der VLP-Präparationen zu erhöhen (auf etwa 1mg/ml), reduzierte sich das
Volumen der Vehikelansätze, so daß auf eine i.m. Immunisierung zurück gegriffen werden
könnte oder sogar auf intradermale (i.d.) Applikation, die in der Untersuchung von Mendez
der Administration in die Fußsohle noch überlegen war. Diese Steigerung ist dadurch zu
erklären, daß sich in der Haut spezialisierte Antigen-präsentierende Zellen (APCs) wie
Langerhanszellen und dermale Dendritische Zellen (Casares et al., 1997) befinden, die bei der
Immunisierung direkt getroffen („infiziert“) werden könnten.
Von den verwendeten Vehikeln zur Immunisierung konnte bei zweien der korrekte
Zusammenbau gezeigt werden: Im Dis- und Reassembly ließen sich HPV 16 Pseudovirionen
herstellen, in die das Reporterplasmid verpackt wurde und auch die Kopplung der linearen
Reporter-DNA an HPV 16 VLPs konnte nachgewiesen werden. Der dritte Ansatz jedoch, die
Kopplung von Reporter-DNA an ein HPV 16 L2-Peptid, konnte nicht bestätigt werden.
In der vergleichenden Immunisierung der drei Vehikel mit nackter DNA, die subkutan bei
C57BL/6Mäusen durchgeführt wurde, konnte keine Verbesserung der Immunogenität der
Shuttle gegenüber nackter DNA festgestellt werden.
Die Hypothese, daß HPV-Strukturproteine als Shuttle für DNA die Immunisierung im
Vergleich zu nackter DNA verbessern, konnte mit dem hier verwendeten Versuchsaufbau also
nicht bestätigt werden.
F Zusammenfassung 88
F Zusammenfassung
Bestimmte Typen der humanpathogenen Papillomviren (HPV), z.B. HPV 16, sind ursächlich
an der Entstehung von Gebärmutterhalskrebs und seinen Vorläuferläsionen beteiligt. Unter
natürlichen Bedingungen erfolgt die Infektion mit HPV in undifferenzierten Epithelzellen des
Stratum basale. Jedoch können infektiöse Papillomviren und durch Expression des
Hauptstrukturproteins L1 hergestellte virus-ähnliche Partikel (virus-like particles, VLPs), aber
auch das „minor“ Strukturprotein L2, an eine Vielzahl von Zellen binden und von diesen
aufgenommen werden. Diese Eigenschaft sollte für eine DNA-Immunisierung genutzt werden
in der Annahme, daß eine Induktion der Immunantwort effizienter sei, wenn ein Shuttle zum
Eintritt der Nukleinsäure in Zellen eingesetzt wird. So könnte eine erhöhte
Proteinexpresession in den getroffenen Zellen stattfinden. Die Freisetzung größerer
Antigenmengen aus infizierten Zellen wie Muskel- oder Epithelzellen könnte vermehrt zu
„cross-priming“ professioneller Antigen-präsentierender Zellen führen und dadurch oder
durch direkte Infektion von Zellen des Immunsystems wie Dendritischen Zellen (DCs) die
Präsentation des Antigens erhöhen. In dieser Arbeit sollte untersucht werden, ob die
Strukturproteine L1 und L2 des HPV Typs 16 diese Aufgabe erfüllen können.
Zu diesem Zweck sollten drei verschiedene Vehikelpräparationen mit Ovalbumin als
Reportergen hergestellt und getestet werden: (i) Pseudovirionen, bei denen die für das
Antigen kodierende Reporter-DNA in HPV 16-VLPs verpackt ist, (ii) VLPs, an die das
Reportergen von außen chemisch gebunden ist und (iii) ein Peptid von HPV 16 L2, an das das
Reportergen gebunden vorliegt.
Durch Dis- und Reassembly, bei dem in vitro DNA in VLPs verpackt wird, konnten
Pseudovirionen hergestellt werden. Auch die Kopplung des Reportergens an VLPs war
erfolgreich. Allein die Bindung zwischen dem HPV 16 L2-Peptid und dem Reportergen
konnte nicht nachgewiesen werden. Trotzdem wurden alle Präparationen im Mausmodell auf
ihre Immunogenität getestet.
Die eingesetzte DNA-Menge pro Maus wurde als Standard gesetzt, um die Effizienz der
verschiedenen Vehikelpräparationen vergleichen zu können. In einer intramuskulär (i.m.)
durchgeführten DNA-Titration konnte festgestellt werden, daß eine Menge von mindestens
10 µg DNA benötigt wird, um eine meßbare zelluläre Immunantwort zu induzieren. Da die
Vehikelpräparationen jedoch das maximale Volumen von 0,05 ml überschritten, das in einer
i.m.-Injektion pro Maus eingesetzt werden kann, wurde außerdem die subkutane (s.c.) Route
getestet. Bei dieser Applikationsart reichte sogar eine Menge von 100 µg DNA nicht aus, um
eine meßbare Immunantwort hervor zu rufen.
In der vergleichenden Immunisierung der Shuttle-Vektoren mit nackter DNA erhielt jede
Maus über das Vehikel 3 µg DNA, eine Menge, die sich in der i.m. Titration als gerade nicht
mehr immunogen erwies. Ein möglicher adjuvanter Effekt der VLPs bei einer Immunisierung
mit Ovalbumin war vorher experimentell ausgeschlossen worden. So sollte getestet werden,
ob durch Vehikel eingeschleuste DNA immunogener ist als nackte DNA. Eine Zunahme der
Immunantwort im Vergleich zu nackter DNA konnte jedoch nicht festgestellt werden.
Somit konnte die Hypothese, daß Vehikelpräparationen bestehend aus HPV 16Strukturproteinen und für Ovalbumin kodierender DNA immunogener sind als nackte DNA,
in dieser Arbeit nicht bestätigt werden.
G Abkürzungen 89
G Abkürzungen
A
Abb.
APC
APS
AS
ATP
Alanin
Abbildung
Antigen-präsentierende Zelle (antigen presenting cell)
Ammoniumpersulfat
Aminosäure
Adenosintriphosphat
β-Gal
bp
BPV
BSA
β-Galaktosidase
Basenpaar
bovines Papillomvirus
bovines Serumalbumin
C
°C
CD
Ci
CIA
CIN
CIP
cm
cpm
CTL
CVLPs
Cys
Cystein
Grad Celsius
humane Leukozyten Differenzierungsantigenen (cluster of differentiation)
Curie
Chloroform / Isoamylalkohol
zervikale intraepitheliale Neoplasie
calf intestine phosphatase
Zentimeter
radioaktiver Zerfälle pro Minute (counts per minute)
zytotoxische T-Lymphozyten (cytotoxic T-lymphocytes)
chimäre virus-ähnliche Partikel (chimeric virus-like particles)
Cystein
D
Da
dCTP
dGTP
DMSO
DNA
DTT
Asparaginsäure
Dalton
Desoxycytidintriphosphat
Desoxyguanidintriphosphat
Dimethylsulfoxid
Desoxyribonucleinsäure
Dithiothreitol
E
E
ECL
E. coli
EDC
EDTA
EGTA
ELISA
ELISPOT
Glutaminsäure
Effektorzelle im Zytotoxizitätstest
enhanced chemoluminescense
Escherichia coli
1-Ethyl-3-(3-Dimethylaminoporpyl)carbodiimide Hydrochlorid
Ethylendiaminotetraessigsäure
Ethylenglykoltetraessigsäure
enzyme linked immunosorbent assay
enzyme linked immunospot
F
FACS
FCS
FITC
Phenylalanin
Fluoreszenz-aktivierte Zellsortierung (flourescence activated cell sorting)
fötales Kälberserum
Fluorescinthiocynat
G Abkürzungen 90
g
G
GFP
Gramm
Glycin
grünes fluoreszierendes Protein
h
HEPES
HPV
H2O
Stunde
4-(2-Hyxdroxyethyl)-1-piperazin-ethansulfonsäure
humanpathogenes Papillomvirus
bidestilliertes Wasser
I
IFNγ
Ig
i.d.
i.m.
Isoleucin
Interferon γ
Immunglobulin
intradermal
intramuskulär
K
kb
kDa
kV
Lysin
Kilobasen
Kilodalton
Kilovolt
l
L
LEU
Liter
Leucin
Leucin
M
µ
µFD
µg
µl
mA
MES
mg
min
ml
mM
mm
molar
Mikro
Mikrofarad
Mikrogramm
Mikroliter
Milliampère
2-Morpholinethansulfonsäure
Milligramm
Minute
Milliliter
millimolar
Millimeter
n
N
ng
NHS
nm
nt
Nano
Asparagin
Nanogramm
N-Hydroxysuccinimid
Nanometer
Nukleotid
Ω
OD
ori
OVA
Ohm
optische Dichte
Replikationsursprung (origin of replication)
Ovalbumin
p
P
Pico
Prolin
G Abkürzungen 91
PAGE
PBS
PCR
PE
PEG
pH
pmol
PMSF
PV
ψVLPs
Polyacrylamidgelelektrophorese
phosphatgepufferte Salzlösung
Polymerasekettenreaktion (polymerase chain reaction)
R-Phycoerythrin
Polyethylenglykol
pondus hydrogenii (negativ dekadischer Logarithmus der
Wasserstoffionenkonzentration)
Picomol
Phenylmethylsulfonylfluorid
Papillomviren
Pseudovirionen
Q
Glutamin
R
RNA
rpm
RT
Arginin
Ribonukleinsäure
Umdrehungen pro Minute (runs per minute)
Raumtemperatur
S
SAP
s.c.
SDS
sec
Serin
Streptavidin-alkaline Phosphatase
subkutan
Natriumdodecylsulfat (sodiumdodecylsulfat)
Sekunde
T
T
TBE
TE
TEMED
TMB
Tris
tRNA
Threonin
Zielzelle (target cell) im Zytotoxizitätstest
Tris-Borsäure-EDTA-Puffer
Tris-EDTA-Puffer
N, N, N’, N’-Tetramethylethylendiamin
Tetramethylbenzidin
Tris(hydroxymethyl)aminomethan
Transfer-RNA
U
ÜN
URA
URR
UV
Einheiten (units)
über Nacht
Uracil
upstream regulatory region
ultraviolett
V
V
VLPs
v/v
Valin
Volt
virus-ähnliche Partikel (virus-like particles)
Volumen pro Volumen
wt
w/v
Wildtyp
Gewicht pro Volumen (weight per volume)
Y
Tyrosin
ZTLs
zytotoxische T-Lymphozyten
H Literatur 92
H Literatur
BAKER, C. C., and HOWLEY, P. M. (1987). Differential promoter utilization by the bovine papillomavirus in
transformed cells and productively infected wart tissues. Embo J 6(4), 1027-35.
BAKER, D., and HANKEY, D. J. (2003). Gene therapy in autoimmune, demyelinating disease of the central
nervous system. Gene Ther 10(10), 844-53.
BAKER, T. S., NEWCOMB, W. W., OLSON, N. H., COWSERT, L. M., OLSON, C., and BROWN, J. C. (1991).
Structures of bovine and human papillomaviruses. Analysis by cryoelectron microscopy and threedimensional image reconstruction. Biophys J 60(6), 1445-56.
BARBOSA, M. S., LOWY, D. R., and SCHILLER, J. T. (1989). Papillomavirus polypeptides E6 and E7 are zincbinding proteins. J Virol 63(3), 1404-7.
BARBOSA, M. S., and SCHLEGEL, R. (1989). The E6 and E7 genes of HPV-18 are sufficient for inducing twostage in vitro transformation of human keratinocytes. Oncogene 4(12), 1529-32.
BARRY, M. A., DOWER, W. J., and JOHNSTON, S. A. (1996). Toward cell-targeting gene therapy vectors: selection
of cell-binding peptides from random peptide-presenting phage libraries. Nat Med 2(3), 299-305.
BERRY, J. M., and PALEFSKY, J. M. (2003). A review of human papillomavirus vaccines: from basic science to
clinical trials. Front Biosci 8, s333-45.
BHATTACHARY, R., BUKKAPATNAM, R., PRAWOKO, I., SOTO, J., MORGAN, M., and SALUP, R. R. (2002). Efficacy
of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against
prostate cancer in rats. Int Immunopharmacol 2(6), 783-96.
BOHM, W., MERTENS, T., SCHIRMBECK, R., and REIMANN, J. (1998). Routes of plasmid DNA vaccination that
prime murine humoral and cellular immune responses. Vaccine 16(9-10), 949-54.
BOSCH, F. X., MUNOZ, N., DE SANJOSE, S., NAVARRO, C., MOREO, P., ASCUNCE, N., GONZALEZ, L. C., TAFUR,
L., GILI, M., LARRANAGA, I., and ET AL. (1993). Human papillomavirus and cervical intraepithelial
neoplasia grade III/carcinoma in situ: a case-control study in Spain and Colombia. Cancer Epidemiol
Biomarkers Prev 2(5), 415-22.
BOUSARGHIN, L., TOUZE, A., COMBITA-ROJAS, A. L., and COURSAGET, P. (2003). Positively charged sequences
of human papillomavirus type 16 capsid proteins are sufficient to mediate gene transfer into target cells
via the heparan sulfate receptor. J Gen Virol 84(Pt 1), 157-64.
BOYLE, P. (1997). Global burden of cancer. Lancet 349(Suppl 2), SII23-6.
BRACHMANN, C. B., DAVIES, A., COST, G. J., CAPUTO, E., LI, J., HIETER, P., and BOEKE, J. D. (1998). Designer
deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for
PCR-mediated gene disruption and other applications. Yeast 14(2), 115-32.
BROWN, D. R., BRYAN, J. T., SCHROEDER, J. M., ROBINSON, T. S., FIFE, K. H., WHEELER, C. M., BARR, E.,
SMITH, P. R., CHIACCHIERINI, L., DICELLO, A., and JANSEN, K. U. (2001). Neutralization of human
papillomavirus type 11 (HPV-11) by serum from women vaccinated with yeast-derived HPV-11 L1
virus-like particles: correlation with competitive radioimmunoassay titer. J Infect Dis 184(9), 1183-6.
BURKHARDT, A., DIMAIO, D., and SCHLEGEL, R. (1987). Genetic and biochemical definition of the bovine
papillomavirus E5 transforming protein. Embo J 6(8), 2381-5.
CALAROTA, S., BRATT, G., NORDLUND, S., HINKULA, J., LEANDERSSON, A. C., SANDSTROM, E., and WAHREN, B.
(1998). Cellular cytotoxic response induced by DNA vaccination in HIV-1-infected patients. Lancet
351(9112), 1320-5.
CARTER, J. J., and GALLOWAY, D. A. (1997). Humoral immune response to human papillomavirus infection. Clin
Dermatol 15(2), 249-59.
H Literatur 93
CASARES, S., INABA, K., BRUMEANU, T. D., STEINMAN, R. M., and BONA, C. A. (1997). Antigen presentation by
dendritic cells after immunization with DNA encoding a major histocompatibility complex class IIrestricted viral epitope. J Exp Med 186(9), 1481-6.
CASTELLANOS, M. R., HAYES, R. L., and MAIMAN, M. A. (2001). Synthetic peptides induce a cytotoxic response
against human papillomavirus type-18. Gynecol Oncol 82(1), 77-83.
CASTELLINO, A. M., CANTALUPO, P., MARKS, I. M., VARTIKAR, J. V., PEDEN, K. W., and PIPAS, J. M. (1997).
trans-Dominant and non-trans-dominant mutant simian virus 40 large T antigens show distinct
responses to ATP. J Virol 71(10), 7549-59.
CHELLAPPAN, S., KRAUS, V. B., KROGER, B., MUNGER, K., HOWLEY, P. M., PHELPS, W. C., and NEVINS, J. R.
(1992). Adenovirus E1A, simian virus 40 tumor antigen, and human papillomavirus E7 protein share
the capacity to disrupt the interaction between transcription factor E2F and the retinoblastoma gene
product. Proc Natl Acad Sci U S A 89(10), 4549-53.
CHEN, X. S., GARCEA, R. L., GOLDBERG, I., CASINI, G., and HARRISON, S. C. (2000). Structure of small virus-like
particles assembled from the L1 protein of human papillomavirus 16. Mol Cell 5(3), 557-67.
CHENG, W. F., HUNG, C. F., PAI, S. I., HSU, K. F., HE, L., LING, M., and WU, T. C. (2002). Repeated DNA
vaccinations elicited qualitatively different cytotoxic T lymphocytes and improved protective antitumor
effects. J Biomed Sci 9(6), 675-87.
CHIANG, C. M., DONG, G., BROKER, T. R., and CHOW, L. T. (1992). Control of human papillomavirus type 11
origin of replication by the E2 family of transcription regulatory proteins. J Virol 66(9), 5224-31.
CHRISTENSEN, N. D., CLADEL, N. M., REED, C. A., BUDGEON, L. R., EMBERS, M. E., SKULSKY, D. M.,
MCCLEMENTS, W. L., LUDMERER, S. W., and JANSEN, K. U. (2001). Hybrid papillomavirus L1
molecules assemble into virus-like particles that reconstitute conformational epitopes and induce
neutralizing antibodies to distinct HPV types. Virology 291(2), 324-34.
CHRISTENSEN, N. D., DILLNER, J., EKLUND, C., CARTER, J. J., WIPF, G. C., REED, C. A., CLADEL, N. M., and
GALLOWAY, D. A. (1996). Surface conformational and linear epitopes on HPV-16 and HPV-18 L1
virus-like particles as defined by monoclonal antibodies. Virology 223(1), 174-84.
CHRISTENSEN, N. D., HOPFL, R., DIANGELO, S. L., CLADEL, N. M., PATRICK, S. D., WELSH, P. A., BUDGEON, L.
R., REED, C. A., and KREIDER, J. W. (1994). Assembled baculovirus-expressed human papillomavirus
type 11 L1 capsid protein virus-like particles are recognized by neutralizing monoclonal antibodies and
induce high titres of neutralizing antibodies. J Gen Virol 75(Pt 9), 2271-6.
CHU, N. R., WU, H. B., WU, T., BOUX, L. J., SIEGEL, M. I., and MIZZEN, L. A. (2000). Immunotherapy of a
human papillomavirus (HPV) type 16 E7-expressing tumour by administration of fusion protein
comprising Mycobacterium bovis bacille Calmette-Guerin (BCG) hsp65 and HPV16 E7. Clin Exp
Immunol 121(2), 216-25.
COLEMAN, N., BIRLEY, H. D., RENTON, A. M., HANNA, N. F., RYAIT, B. K., BYRNE, M., TAYLOR-ROBINSON, D.,
and STANLEY, M. A. (1994). Immunological events in regressing genital warts. Am J Clin Pathol
102(6), 768-74.
CONDON, C., WATKINS, S. C., CELLUZZI, C. M., THOMPSON, K., and FALO, L. D., JR. (1996). DNA-based
immunization by in vivo transfection of dendritic cells. Nat Med 2(10), 1122-8.
CONGER, K. L., LIU, J. S., KUO, S. R., CHOW, L. T., and WANG, T. S. (1999). Human papillomavirus DNA
replication. Interactions between the viral E1 protein and two subunits of human dna polymerase
alpha/primase. J Biol Chem 274(5), 2696-705.
COUILLIN, I., LETOURNEUR, F., LEFEBVRE, P., GUILLET, J. G., and MARTINON, F. (2001). DNA vaccination of
macaques with several different Nef sequences induces multispecific T cell responses. Virology 279(1),
136-45.
CRAWFORD, L. V., and CRAWFORD, E. M. (1963). A comparative study of polyoma and papillomaviruses.
Virology 217:285-92
H Literatur 94
CROOK, T., WREDE, D., TIDY, J. A., MASON, W. P., EVANS, D. J., and VOUSDEN, K. H. (1992). Clonal p53
mutation in primary cervical cancer: association with human-papillomavirus-negative tumours. Lancet
339(8801), 1070-3.
CROOK, T., WREDE, D., and VOUSDEN, K. H. (1991). p53 point mutation in HPV negative human cervical
carcinoma cell lines. Oncogene 6(5), 873-5.
DAVIS, H. L., WHALEN, R. G., and DEMENEIX, B. A. (1993). Direct gene transfer into skeletal muscle in vivo:
factors affecting efficiency of transfer and stability of expression. Hum Gene Ther 4(2), 151-9.
DE GRUIJL, T. D., BONTKES, H. J., WALBOOMERS, J. M., COURSAGET, P., STUKART, M. J., DUPUY, C., KUETER,
E., VERHEIJEN, R. H., HELMERHORST, T. J., DUGGAN-KEEN, M. F., STERN, P. L., MEIJER, C. J., and
SCHEPER, R. J. (1999). Immune responses against human papillomavirus (HPV) type 16 virus-like
particles in a cohort study of women with cervical intraepithelial neoplasia. I. Differential T-helper and
IgG responses in relation to HPV infection and disease outcome. J Gen Virol 80(Pt 2), 399-408.
DE GRUIJL, T. D., BONTKES, H. J., WALBOOMERS, J. M., STUKART, M. J., DOEKHIE, F. S., REMMINK, A. J.,
HELMERHORST, T. J., VERHEIJEN, R. H., DUGGAN-KEEN, M. F., STERN, P. L., MEIJER, C. J., and
SCHEPER, R. J. (1998). Differential T helper cell responses to human papillomavirus type 16 E7 related
to viral clearance or persistence in patients with cervical neoplasia: a longitudinal study. Cancer Res
58(8), 1700-6.
DE MARCO, F., HALLEZ, S., BRULET, J. M., GESCHE, F., MARZANO, P., FLAMINI, S., MARCANTE, M. L., and
VENUTI, A. (2003). DNA vaccines against HPV-16 E7-expressing tumour cells. Anticancer Res 23(2B),
1449-54.
DE VILLIERS, E. M.
(1997). Papillomavirus and HPV typing. Clin Dermatol 15(2), 199-206.
DEROSSI, D., CHASSAING, G., and PROCHIANTZ, A. (1998). Trojan peptides: the penetratin system for
intracellular delivery. Trends Cell Biol 8(2), 84-7.
DI LEONARDO, G., TORCHIO, P., PASQUALONI, E., CORRAO, G., and QUAGLINO, D. (1998). Incidence of
malignant lymphoproliferative diseases by stage and histological variants in central Italy: a population
based study 1982-1994. Eur Rev Med Pharmacol Sci 2(2), 65-74.
DOORBAR, J., ELY, S., STERLING, J., MCLEAN, C., and CRAWFORD, L. (1991). Specific interaction between HPV16 E1-E4 and cytokeratins results in collapse of the epithelial cell intermediate filament network.
Nature 352(6338), 824-7.
DYSON, N., HOWLEY, P. M., MUNGER, K., and HARLOW, E. (1989). The human papilloma virus-16 E7
oncoprotein is able to bind to the retinoblastoma gene product. Science 243(4893), 934-7.
EMENY, R. T., WHEELER, C. M., JANSEN, K. U., HUNT, W. C., FU, T. M., SMITH, J. F., MACMULLEN, S., ESSER,
M. T., and PALIARD, X. (2002). Priming of human papillomavirus type 11-specific humoral and cellular
immune responses in college-aged women with a virus-like particle vaccine. J Virol 76(15), 7832-42.
EVANS, E. M., MAN, S., EVANS, A. S., and BORYSIEWICZ, L. K. (1997). Infiltration of cervical cancer tissue with
human papillomavirus-specific cytotoxic T-lymphocytes. Cancer Res 57(14), 2943-50.
EVANS, T. G., BONNEZ, W., ROSE, R. C., KOENIG, S., DEMETER, L., SUZICH, J. A., O'BRIEN, D., CAMPBELL, M.,
WHITE, W. I., BALSLEY, J., and REICHMAN, R. C. (2001). A Phase 1 study of a recombinant viruslike
particle vaccine against human papillomavirus type 11 in healthy adult volunteers. J Infect Dis 183(10),
1485-93.
FU, T. M., GUAN, L., FRIEDMAN, A., ULMER, J. B., LIU, M. A., and DONNELLY, J. J. (1998). Induction of MHC
class I-restricted CTL response by DNA immunization with ubiquitin-influenza virus nucleoprotein
fusion antigens. Vaccine 16(18), 1711-7.
GAGE, J. R., MEYERS, C., and WETTSTEIN, F. O. (1990). The E7 proteins of the nononcogenic human
papillomavirus type 6b (HPV-6b) and of the oncogenic HPV-16 differ in retinoblastoma protein binding
and other properties. J Virol 64(2), 723-30.
H Literatur 95
GARZETTI, G. G., CIAVATTINI, A., BUTINI, L., VECCHI, A., and MONTRONI, M. (1995). Cervical dysplasia in
HIV-seropositive women: role of human papillomavirus infection and immune status. Gynecol Obstet
Invest 40(1), 52-6.
GERARD, C. M., BAUDSON, N., KRAEMER, K., BRUCK, C., GARCON, N., PATERSON, Y., PAN, Z. K., and PARDOLL,
D. (2001). Therapeutic potential of protein and adjuvant vaccinations on tumour growth. Vaccine
19(17-19), 2583-9.
GREENSTONE, H. L., NIELAND, J. D., DE VISSER, K. E., DE BRUIJN, M. L., KIRNBAUER, R., RODEN, R. B., LOWY,
D. R., KAST, W. M., and SCHILLER, J. T. (1998). Chimeric papillomavirus virus-like particles elicit
antitumor immunity against the E7 oncoprotein in an HPV16 tumor model. Proc Natl Acad Sci U S A
95(4), 1800-5.
GREGORIADIS, G., BACON, A., CAPARROS-WANDERLEY, W., and MCCORMACK, B. (2002). A role for liposomes
in genetic vaccination. Vaccine 20(Suppl 5), B1-9.
GROSSMAN, S. R., and LAIMINS, L. A. (1989). E6 protein of human papillomavirus type 18 binds zinc. Oncogene
4(9), 1089-93.
GURUNATHAN, S., KLINMAN, D. M., and SEDER, R. A. (2000). DNA vaccines: immunology, application, and
optimization*. Annu Rev Immunol 18, 927-74.
HAGENSEE, M. E., YAEGASHI, N., and GALLOWAY, D. A. (1993). Self-assembly of human papillomavirus type 1
capsids by expression of the L1 protein alone or by coexpression of the L1 and L2 capsid proteins. J
Virol 67(1), 315-22.
HALBERT, C. L., DEMERS, G. W., and GALLOWAY, D. A. (1992). The E6 and E7 genes of human papillomavirus
type 6 have weak immortalizing activity in human epithelial cells. J Virol 66(4), 2125-34.
HARIHARAN, K., BRASLAWSKY, G., BARNETT, R. S., BERQUIST, L. G., HUYNH, T., HANNA, N., and BLACK, A.
(1998). Tumor regression in mice following vaccination with human papillomavirus E7 recombinant
protein in PROVAX. Int J Oncol 12(6), 1229-35.
HARTL, A., KIESSLICH, J., WEISS, R., BERNHAUPT, A., MOSTBOCK, S., SCHEIBLHOFER, S., EBNER, C., FERREIRA,
F., and THALHAMER, J. (1999). Immune responses after immunization with plasmid DNA encoding Bet
v 1, the major allergen of birch pollen. J Allergy Clin Immunol 103(1 Pt 1), 107-13.
HASAN, U. A., HARPER, D. R., ARGENT, S., LAYTON, G., WREN, B. W., and MORROW, W. J. (2000).
Immunization with a DNA expression vector encoding the varicella zoster virus glycoprotein E (gE)
gene via intramuscular and subcutaneous routes. Vaccine 18(15), 1506-14.
HOFFMAN, S. L., DOOLAN, D. L., SEDEGAH, M., AGUIAR, J. C., WANG, R., MALIK, A., GRAMZINSKI, R. A.,
WEISS, W. R., HOBART, P., NORMAN, J. A., MARGALITH, M., and HEDSTROM, R. C. (1997). Strategy for
development of a pre-erythrocytic Plasmodium falciparum DNA vaccine for human use. Vaccine 15(8),
842-5.
HOHN, H., PILCH, H., GUNZEL, S., NEUKIRCH, C., HILMES, C., KAUFMANN, A., SELIGER, B., and MAEURER, M. J.
(1999). CD4+ tumor-infiltrating lymphocytes in cervical cancer recognize HLA-DR-restricted peptides
provided by human papillomavirus-E7. J Immunol 163(10), 5715-22.
HSU, C. H., CHUA, K. Y., TAO, M. H., HUANG, S. K., and HSIEH, K. H. (1996a). Inhibition of specific IgE
response in vivo by allergen-gene transfer. Int Immunol 8(9), 1405-11.
HSU, C. H., CHUA, K. Y., TAO, M. H., LAI, Y. L., WU, H. D., HUANG, S. K., and HSIEH, K. H. (1996b).
Immunoprophylaxis of allergen-induced immunoglobulin E synthesis and airway hyperresponsiveness
in vivo by genetic immunization. Nat Med 2(5), 540-4.
HUBBERT, N. L., SEDMAN, S. A., and SCHILLER, J. T. (1992). Human papillomavirus type 16 E6 increases the
degradation rate of p53 in human keratinocytes. J Virol 66(10), 6237-41.
H Literatur 96
HUIBREGTSE, J. M., SCHEFFNER, M., and HOWLEY, P. M. (1991). A cellular protein mediates association of p53
with the E6 oncoprotein of human papillomavirus types 16 or 18. Embo J 10(13), 4129-35.
HUMMEL, M., LIM, H. B., and LAIMINS, L. A. (1995). Human papillomavirus type 31b late gene expression is
regulated through protein kinase C-mediated changes in RNA processing. J Virol 69(6), 3381-8.
HWANG, E. S., NOTTOLI, T., and DIMAIO, D. (1995). The HPV16 E5 protein: expression, detection, and stable
complex formation with transmembrane proteins in COS cells. Virology 211(1), 227-33.
JACQUET, A., MAGI, M., HAUMONT, M., JURADO, M., GARCIA, L., and BOLLEN, A. (2003). Absence of
immunoglobulin E synthesis and airway eosinophilia by vaccination with plasmid DNA encoding
ProDer p 1. Clin Exp Allergy 33(2), 218-25.
KADISH, A. S., HO, G. Y., BURK, R. D., WANG, Y., ROMNEY, S. L., LEDWIDGE, R., and ANGELETTI, R. H. (1997).
Lymphoproliferative responses to human papillomavirus (HPV) type 16 proteins E6 and E7: outcome of
HPV infection and associated neoplasia. J Natl Cancer Inst 89(17), 1285-93.
KADISH, A. S., TIMMINS, P., WANG, Y., HO, G. Y., BURK, R. D., KETZ, J., HE, W., ROMNEY, S. L., JOHNSON, A.,
ANGELETTI, R., and ABADI, M. (2002). Regression of cervical intraepithelial neoplasia and loss of
human papillomavirus (HPV) infection is associated with cell-mediated immune responses to an HPV
type 16 E7 peptide. Cancer Epidemiol Biomarkers Prev 11(5), 483-8.
KAHLERT, H., PETERSEN, A., BECKER, W. M., and SCHLAAK, M. (1992). Epitope analysis of the allergen
ovalbumin (Gal d II) with monoclonal antibodies and patients' IgE. Mol Immunol 29(10), 1191-201.
KAWANA, K., KAWANA, Y., YOSHIKAWA, H., TAKETANI, Y., YOSHIIKE, K., and KANDA, T. (2001a). Nasal
immunization of mice with peptide having a cross-neutralization epitope on minor capsid protein L2 of
human papillomavirus type 16 elicit systemic and mucosal antibodies. Vaccine 19(11-12), 1496-502.
KAWANA, K., YOSHIKAWA, H., TAKETANI, Y., YOSHIIKE, K., and KANDA, T. (1998). In vitro construction of
pseudovirions of human papillomavirus type 16: incorporation of plasmid DNA into reassembled L1/L2
capsids. J Virol 72(12), 10298-300.
KAWANA, K., YOSHIKAWA, H., TAKETANI, Y., YOSHIIKE, K., and KANDA, T. (1999). Common neutralization
epitope in minor capsid protein L2 of human papillomavirus types 16 and 6. J Virol 73(7), 6188-90.
KAWANA, Y., KAWANA, K., YOSHIKAWA, H., TAKETANI, Y., YOSHIIKE, K., and KANDA, T. (2001b). Human
papillomavirus type 16 minor capsid protein l2 N-terminal region containing a common neutralization
epitope binds to the cell surface and enters the cytoplasm. J Virol 75(5), 2331-6.
KIM, T. Y., MYOUNG, H. J., KIM, J. H., MOON, I. S., KIM, T. G., AHN, W. S., and SIN, J. I. (2002). Both E7 and
CpG-oligodeoxynucleotide are required for protective immunity against challenge with human
papillomavirus 16 (E6/E7) immortalized tumor cells: involvement of CD4+ and CD8+ T cells in
protection. Cancer Res 62(24), 7234-40.
KIMURA, K., CUVIER, O., and HIRANO, T. (2001). Chromosome condensation by a human condensin complex in
Xenopus egg extracts. J Biol Chem 276(8), 5417-20.
KIRNBAUER, R. (1996). Papillomavirus-like particles for serology and vaccine development. Intervirology 39(12), 54-61.
KIRNBAUER, R., BOOY, F., CHENG, N., LOWY, D. R., and SCHILLER, J. T. (1992). Papillomavirus L1 major capsid
protein self-assembles into virus-like particles that are highly immunogenic. Proc Natl Acad Sci U S A
89(24), 12180-4.
KIRNBAUER, R., TAUB, J., GREENSTONE, H., RODEN, R., DURST, M., GISSMANN, L., LOWY, D. R., and SCHILLER,
J. T. (1993). Efficient self-assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like
particles. J Virol 67(12), 6929-36.
KNOWLES, G., O'NEIL, B. W., and CAMPO, M. S. (1996). Phenotypical characterization of lymphocytes
infiltrating regressing papillomas. J Virol 70(12), 8451-8.
H Literatur 97
KRISTIE, T. M., and ROIZMAN, B. (1986). Alpha 4, the major regulatory protein of herpes simplex virus type 1, is
stably and specifically associated with promoter-regulatory domains of alpha genes and of selected
other viral genes. Proc Natl Acad Sci U S A 83(10), 3218-22.
KULSKI, J. K., SADLEIR, J. W., KELSALL, S. R., CICCHINI, M. S., SHELLAM, G., PENG, S. W., QI, Y. M.,
GALLOWAY, D. A., ZHOU, J., and FRAZER, I. H. (1998). Type specific and genotype cross reactive B
epitopes of the L1 protein of HPV16 defined by a panel of monoclonal antibodies. Virology 243(2),
275-82.
KUO, S. R., LIU, J. S., BROKER, T. R., and CHOW, L. T. (1994). Cell-free replication of the human papillomavirus
DNA with homologous viral E1 and E2 proteins and human cell extracts. J Biol Chem 269(39), 2405865.
KURATSUKURI, K., SONE, T., WANG, C. Y., NISHISAKA, N., JONES, R. F., and HAAS, G. P. (2002). Inhibition of
prostate-specific membrane antigen (PSMA)-positive tumor growth by vaccination with either fulllength or the C-terminal end of PSMA. Int J Cancer 102(3), 244-9.
LAGA, M., ICENOGLE, J. P., MARSELLA, R., MANOKA, A. T., NZILA, N., RYDER, R. W., VERMUND, S. H.,
HEYWARD, W. L., NELSON, A., and REEVES, W. C. (1992). Genital papillomavirus infection and cervical
dysplasia--opportunistic complications of HIV infection. Int J Cancer 50(1), 45-8.
LAIMINS, L. A. (1993). The biology of human papillomaviruses: from warts to cancer. Infect Agents Dis 2(2), 7486.
LEHTINEN, M., RANTALA, I., TOIVONEN, A., LUOTO, H., AINE, R., LAUSLAHTI, K., YLA-OUTINEN, A.,
ROMPPANEN, U., and PAAVONEN, J. (1993). Depletion of Langerhans cells in cervical HPV infection is
associated with replication of the virus. Apmis 101(11), 833-7.
LI, A. F., and ESCHER, A. (2003). Intradermal or oral delivery of GAD-encoding genetic vaccines suppresses
type 1 diabetes. DNA Cell Biol 22(4), 227-32.
LI, M., BEARD, P., ESTES, P. A., LYON, M. K., and GARCEA, R. L. (1998). Intercapsomeric disulfide bonds in
papillomavirus assembly and disassembly. J Virol 72(3), 2160-7.
LIU, J. S., KUO, S. R., BROKER, T. R., and CHOW, L. T. (1995). The functions of human papillomavirus type 11
E1, E2, and E2C proteins in cell-free DNA replication. J Biol Chem 270(45), 27283-91.
LIU, X. S., ABDUL-JABBAR, I., QI, Y. M., FRAZER, I. H., and ZHOU, J. (1998). Mucosal immunisation with
papillomavirus virus-like particles elicits systemic and mucosal immunity in mice. Virology 252(1), 3945.
LUNSFORD, L., MCKEEVER, U., ECKSTEIN, V., and HEDLEY, M. L. (2000). Tissue distribution and persistence in
mice of plasmid DNA encapsulated in a PLGA-based microsphere delivery vehicle. J Drug Target 8(1),
39-50.
LUXTON, J. C., ROSE, R. C., COLETART, T., WILSON, P., and SHEPHERD, P. S. (1997). Serological and T-helper
cell responses to human papillomavirus type 16 L1 in women with cervical dysplasia or cervical
carcinoma and in healthy controls. J Gen Virol 78(Pt 4), 917-23.
MACGREGOR, R. R., BOYER, J. D., UGEN, K. E., LACY, K. E., GLUCKMAN, S. J., BAGARAZZI, M. L.,
CHATTERGOON, M. A., BAINE, Y., HIGGINS, T. J., CICCARELLI, R. B., CONEY, L. R., GINSBERG, R. S.,
and WEINER, D. B. (1998). First human trial of a DNA-based vaccine for treatment of human
immunodeficiency virus type 1 infection: safety and host response. J Infect Dis 178(1), 92-100.
MANIATIS, T., JEFFREY, A., and VAN DESANDE, H. (1975). Chain length determination of small double- and
single-stranded DNA molecules by polyacrylamide gel electrophoresis. Biochemistry 14(17), 3787-94.
MANIATIS, T., and PTASHNE, M. (1973a). Multiple repressor binding at the operators in bacteriophage lambda.
Proc Natl Acad Sci U S A 70(5), 1531-5.
MANIATIS, T., and PTASHNE, M. (1973b). Structure of the lambda operators. Nature 246(5429), 133-6.
H Literatur 98
MCBRIDE, A. A., ROMANCZUK, H., and HOWLEY, P. M. (1991). The papillomavirus E2 regulatory proteins. J
Biol Chem 266(28), 18411-4.
MCCARTHY, M. P., WHITE, W. I., PALMER-HILL, F., KOENIG, S., and SUZICH, J. A. (1998). Quantitative
disassembly and reassembly of human papillomavirus type 11 viruslike particles in vitro. J Virol 72(1),
32-41.
MCCLUSKIE, M. J., BRAZOLOT MILLAN, C. L., GRAMZINSKI, R. A., ROBINSON, H. L., SANTORO, J. C., FULLER, J.
T., WIDERA, G., HAYNES, J. R., PURCELL, R. H., and DAVIS, H. L. (1999). Route and method of delivery
of DNA vaccine influence immune responses in mice and non-human primates. Mol Med 5(5), 287-300.
MENDEZ, S., BELKAID, Y., SEDER, R. A., and SACKS, D. (2002). Optimization of DNA vaccination against
cutaneous leishmaniasis. Vaccine 20(31-32), 3702-8.
MORELLI, A. E., SANANES, C., DI PAOLA, G., PAREDES, A., and FAINBOIM, L. (1993). Relationship between types
of human papillomavirus and Langerhans' cells in cervical condyloma and intraepithelial neoplasia. Am
J Clin Pathol 99(2), 200-6.
MOROZOV, A., SHIYANOV, P., BARR, E., LEIDEN, J. M., and RAYCHAUDHURI, P. (1997). Accumulation of human
papillomavirus type 16 E7 protein bypasses G1 arrest induced by serum deprivation and by the cell
cycle inhibitor p21. J Virol 71(5), 3451-7.
MORRISSEY, J. H. (1981). Silver stain for proteins in polyacrylamide gels: a modified procedure with enhanced
uniform sensitivity. Anal Biochem 117(2), 307-10.
MULLER, M., GISSMANN, L., CRISTIANO, R. J., SUN, X. Y., FRAZER, I. H., JENSON, A. B., ALONSO, A.,
ZENTGRAF, H., and ZHOU, J. (1995). Papillomavirus capsid binding and uptake by cells from different
tissues and species. J Virol 69(2), 948-54.
MUNGER, K., PHELPS, W. C., BUBB, V., HOWLEY, P. M., and SCHLEGEL, R. (1989). The E6 and E7 genes of the
human papillomavirus type 16 together are necessary and sufficient for transformation of primary
human keratinocytes. J Virol 63(10), 4417-21.
NAKAGAWA, M., STITES, D. P., FARHAT, S., JUDD, A., MOSCICKI, A. B., CANCHOLA, A. J., HILTON, J. F., and
PALEFSKY, J. M. (1996). T-cell proliferative response to human papillomavirus type 16 peptides:
relationship to cervical intraepithelial neoplasia. Clin Diagn Lab Immunol 3(2), 205-10.
O'BRIEN, P. M., and SAVERIA CAMPO, M. (2002). Evasion of host immunity directed by papillomavirus-encoded
proteins. Virus Res 88(1-2), 103-17.
OHLSCHLAGER, P., OSEN, W., DELL, K., FAATH, S., GARCEA, R. L., JOCHMUS, I., MULLER, M., PAWLITA, M.,
SCHAFER, K., SEHR, P., STAIB, C., SUTTER, G., and GISSMANN, L. (2003). Human papillomavirus type
16 L1 capsomeres induce L1-specific cytotoxic T lymphocytes and tumor regression in C57BL/6 mice.
J Virol 77(8), 4635-45.
OHSUMI, K., KATAGIRI, C., and YANAGIMACHI, R. (1988). Human sperm nuclei can transform into condensed
chromosomes in Xenopus egg extracts. Gamete Res 20(1), 1-9.
ORLANDO, V., STRUTT, H., and PARO, R. (1997). Analysis of chromatin structure by in vivo formaldehyde crosslinking. Methods 11(2), 205-14.
OSEN, W., PEILER, T., OHLSCHLAGER, P., CALDEIRA, S., FAATH, S., MICHEL, N., MULLER, M., TOMMASINO, M.,
JOCHMUS, I., and GISSMANN, L. (2001). A DNA vaccine based on a shuffled E7 oncogene of the human
papillomavirus type 16 (HPV 16) induces E7-specific cytotoxic T cells but lacks transforming activity.
Vaccine 19(30), 4276-86.
OSTOR, A. G. (1993). Natural history of cervical intraepithelial neoplasia: a critical review. Int J Gynecol Pathol
12(2), 186-92.
PARKER, S. E., BORELLINI, F., WENK, M. L., HOBART, P., HOFFMAN, S. L., HEDSTROM, R., LE, T., and NORMAN,
J. A. (1999). Plasmid DNA malaria vaccine: tissue distribution and safety studies in mice and rabbits.
Hum Gene Ther 10(5), 741-58.
H Literatur 99
PENG, S., FRAZER, I. H., FERNANDO, G. J., and ZHOU, J. (1998). Papillomavirus virus-like particles can deliver
defined CTL epitopes to the MHC class I pathway. Virology 240(1), 147-57.
PETRY, K. U., SCHEFFEL, D., BODE, U., GABRYSIAK, T., KOCHEL, H., KUPSCH, E., GLAUBITZ, M., NIESERT, S.,
KUHNLE, H., and SCHEDEL, I. (1994). Cellular immunodeficiency enhances the progression of human
papillomavirus-associated cervical lesions. Int J Cancer 57(6), 836-40.
PHELPS, W. C., BAGCHI, S., BARNES, J. A., RAYCHAUDHURI, P., KRAUS, V., MUNGER, K., HOWLEY, P. M., and
NEVINS, J. R. (1991). Analysis of trans activation by human papillomavirus type 16 E7 and adenovirus
12S E1A suggests a common mechanism. J Virol 65(12), 6922-30.
PHELPS, W. C., YEE, C. L., MUNGER, K., and HOWLEY, P. M. (1988). The human papillomavirus type 16 E7 gene
encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53(4),
539-47.
POLLOCK, R., and TREISMAN, R. (1990). A sensitive method for the determination of protein-DNA binding
specificities. Nucleic Acids Res 18(21), 6197-204.
PROCHIANTZ, A. (1996). Getting hydrophilic compounds into cells: lessons from homeopeptides. Curr Opin
Neurobiol 6(5), 629-34.
REMMINK, A. J., WALBOOMERS, J. M., HELMERHORST, T. J., VOORHORST, F. J., ROZENDAAL, L., RISSE, E. K.,
MEIJER, C. J., and KENEMANS, P. (1995). The presence of persistent high-risk HPV genotypes in
dysplastic cervical lesions is associated with progressive disease: natural history up to 36 months. Int J
Cancer 61(3), 306-11.
RIETHMULLER, D., SCHAAL, J. P., and MOUGIN, C. (2002). [Epidemiology and natural history of genital infection
by human papillomavirus]. Gynecol Obstet Fertil 30(2), 139-46.
ROBERTS, S., ASHMOLE, I., JOHNSON, G. D., KREIDER, J. W., and GALLIMORE, P. H. (1993). Cutaneous and
mucosal human papillomavirus E4 proteins form intermediate filament-like structures in epithelial cells.
Virology 197(1), 176-87.
ROCHA-ZAVALETA, L., ALEJANDRE, J. E., and GARCIA-CARRANCA, A. (2002). Parenteral and oral immunization
with a plasmid DNA expressing the human papillomavirus 16-L1 gene induces systemic and mucosal
antibodies and cytotoxic T lymphocyte responses. J Med Virol 66(1), 86-95.
RODEN, R. B., KIRNBAUER, R., JENSON, A. B., LOWY, D. R., and SCHILLER, J. T. (1994). Interaction of
papillomaviruses with the cell surface. J Virol 68(11), 7260-6.
RODRIGUEZ, F., and WHITTON, J. L. (2000). Enhancing DNA immunization. Virology 268(2), 233-8.
ROSE, A. B., and BROACH, J. R. (1990). Propagation and expression of cloned genes in yeast: 2-microns circlebased vectors. Methods Enzymol 185, 234-79.
ROSE, R. C., WHITE, W. I., LI, M., SUZICH, J. A., LANE, C., and GARCEA, R. L. (1998). Human papillomavirus
type 11 recombinant L1 capsomeres induce virus-neutralizing antibodies. J Virol 72(7), 6151-4.
ROSSI, J. L., GISSMANN, L., JANSEN, K., and MULLER, M. (2000). Assembly of human papillomavirus type 16
pseudovirions in Saccharomyces cerevisiae. Hum Gene Ther 11(8), 1165-76.
RUESCH, M. N., and LAIMINS, L. A. (1997). Initiation of DNA synthesis by human papillomavirus E7
oncoproteins is resistant to p21-mediated inhibition of cyclin E-cdk2 activity. J Virol 71(7), 5570-8.
SCHAFER, K., MULLER, M., FAATH, S., HENN, A., OSEN, W., ZENTGRAF, H., BENNER, A., GISSMANN, L., and
JOCHMUS, I. (1999). Immune response to human papillomavirus 16 L1E7 chimeric virus-like particles:
induction of cytotoxic T cells and specific tumor protection. Int J Cancer 81(6), 881-8.
SCHWARZE, S. R., HRUSKA, K. A., and DOWDY, S. F. (2000). Protein transduction: unrestricted delivery into all
cells? Trends Cell Biol 10(7), 290-5.
H Literatur 100
SEDMAN, S. A., BARBOSA, M. S., VASS, W. C., HUBBERT, N. L., HAAS, J. A., LOWY, D. R., and SCHILLER, J. T.
(1991). The full-length E6 protein of human papillomavirus type 16 has transforming and transactivating activities and cooperates with E7 to immortalize keratinocytes in culture. J Virol 65(9), 48606.
SHEETS, E. E., URBAN, R. G., CRUM, C. P., HEDLEY, M. L., POLITCH, J. A., GOLD, M. A., MUDERSPACH, L. I.,
COLE, G. A., and CROWLEY-NOWICK, P. A. (2003). Immunotherapy of human cervical high-grade
cervical intraepithelial neoplasia with microparticle-delivered human papillomavirus 16 E7 plasmid
DNA. Am J Obstet Gynecol 188(4), 916-26.
SPEIDEL, K., OSEN, W., FAATH, S., HILGERT, I., OBST, R., BRASPENNING, J., MOMBURG, F., HAMMERLING, G. J.,
and RAMMENSEE, H. G. (1997). Priming of cytotoxic T lymphocytes by five heat-aggregated antigens in
vivo: conditions, efficiency, and relation to antibody responses. Eur J Immunol 27(9), 2391-9.
STAUFFER, Y., RAJ, K., MASTERNAK, K., and BEARD, P. (1998). Infectious human papillomavirus type 18
pseudovirions. J Mol Biol 283(3), 529-36.
STEHLE, T., GAMBLIN, S. J., YAN, Y., and HARRISON, S. C. (1996). The structure of simian virus 40 refined at 3.1
A resolution. Structure 4(2), 165-82.
STEINER, M. S., GINGRICH, J. R., and CHAUHAN, R. D. (2002). Prostate cancer gene therapy. Surg Oncol Clin N
Am 11(3), 607-20.
STERN, P. L., FAULKNER, R., VERANES, E. C., and DAVIDSON, E. J. (2001). The role of human papillomavirus
vaccines in cervical neoplasia. Best Pract Res Clin Obstet Gynaecol 15(5), 783-99.
STRAIGHT, S. W., HINKLE, P. M., JEWERS, R. J., and MCCANCE, D. J. (1993). The E5 oncoprotein of human
papillomavirus type 16 transforms fibroblasts and effects the downregulation of the epidermal growth
factor receptor in keratinocytes. J Virol 67(8), 4521-32.
STUBENRAUCH, F., and LAIMINS, L. A. (1999). Human papillomavirus life cycle: active and latent phases. Semin
Cancer Biol 9(6), 379-86.
SWINDLE, C. S., ZOU, N., VAN TINE, B. A., SHAW, G. M., ENGLER, J. A., and CHOW, L. T. (1999). Human
papillomavirus DNA replication compartments in a transient DNA replication system. J Virol 73(2),
1001-9.
TERHUNE, S. S., MILCAREK, C., and LAIMINS, L. A. (1999). Regulation of human papillomavirus type 31
polyadenylation during the differentiation-dependent life cycle. J Virol 73(9), 7185-92.
TINDLE, R. W. (1996). Human papillomavirus vaccines for cervical cancer. Curr Opin Immunol 8(5), 643-50.
TINDLE, R. W., and FRAZER, I. H. (1994). Immune response to human papillomaviruses and the prospects for
human papillomavirus-specific immunisation. Curr Top Microbiol Immunol 186, 217-53.
TOUZE, A., and COURSAGET, P. (1998). In vitro gene transfer using human papillomavirus-like particles. Nucleic
Acids Res 26(5), 1317-23.
TSUKUI, T., HILDESHEIM, A., SCHIFFMAN, M. H., LUCCI, J., 3RD, CONTOIS, D., LAWLER, P., RUSH, B. B.,
LORINCZ, A. T., CORRIGAN, A., BURK, R. D., QU, W., MARSHALL, M. A., MANN, D., CARRINGTON, M.,
CLERICI, M., SHEARER, G. M., CARBONE, D. P., SCOTT, D. R., HOUGHTEN, R. A., and BERZOFSKY, J. A.
(1996). Interleukin 2 production in vitro by peripheral lymphocytes in response to human
papillomavirus-derived peptides: correlation with cervical pathology. Cancer Res 56(17), 3967-74.
TSURIMOTO, T., FAIRMAN, M. P., and STILLMAN, B. (1989). Simian virus 40 DNA replication in vitro:
identification of multiple stages of initiation. Mol Cell Biol 9(9), 3839-49.
TUFFERY A. A. (1987). Laboratory Animals: An introduction for new experimentators. pp. 225-6. John Wiley &
Sons, Chichester, England.
UGEN, K. E., NYLAND, S. B., BOYER, J. D., VIDAL, C., LERA, L., RASHEID, S., CHATTERGOON, M., BAGARAZZI,
M. L., CICCARELLI, R., HIGGINS, T., BAINE, Y., GINSBERG, R., MACGREGOR, R. R., and WEINER, D. B.
H Literatur 101
(1998). DNA vaccination with HIV-1 expressing constructs elicits immune responses in humans.
Vaccine 16(19), 1818-21.
UNCKELL, F., STREECK, R. E., and SAPP, M. (1997). Generation and neutralization of pseudovirions of human
papillomavirus type 33. J Virol 71(4), 2934-9.
VAN DER BURG, S. H., KWAPPENBERG, K. M., O'NEILL, T., BRANDT, R. M., MELIEF, C. J., HICKLING, J. K., and
OFFRINGA, R. (2001). Pre-clinical safety and efficacy of TA-CIN, a recombinant HPV16 L2E6E7
fusion protein vaccine, in homologous and heterologous prime-boost regimens. Vaccine 19(27), 365260.
VIAC, J., GUERIN-REVERCHON, I., CHARDONNET, Y., and BREMOND, A. (1990). Langerhans cells and epithelial
cell modifications in cervical intraepithelial neoplasia: correlation with human papillomavirus infection.
Immunobiology 180(4-5), 328-38.
VOLPERS, C., UNCKELL, F., SCHIRMACHER, P., STREECK, R. E., and SAPP, M. (1995). Binding and internalization
of human papillomavirus type 33 virus-like particles by eukaryotic cells. J Virol 69(6), 3258-64.
WAKABAYASHI, M. T., DA SILVA, D. M., POTKUL, R. K., and KAST, W. M. (2002). Comparison of human
papillomavirus type 16 L1 chimeric virus-like particles versus L1/L2 chimeric virus-like particles in
tumor prevention. Intervirology 45(4-6), 300-7.
WALBOOMERS, J. M., JACOBS, M. V., MANOS, M. M., BOSCH, F. X., KUMMER, J. A., SHAH, K. V., SNIJDERS, P. J.,
PETO, J., MEIJER, C. J., and MUNOZ, N. (1999). Human papillomavirus is a necessary cause of invasive
cervical cancer worldwide. J Pathol 189(1), 12-9.
WANG, B., UGEN, K. E., SRIKANTAN, V., AGADJANYAN, M. G., DANG, K., REFAELI, Y., SATO, A. I., BOYER, J.,
WILLIAMS, W. V., and WEINER, D. B. (1993). Gene inoculation generates immune responses against
human immunodeficiency virus type 1. Proc Natl Acad Sci U S A 90(9), 4156-60.
WANG, P., PENG, Z., and WANG, H. (1997). [Relationship between human papillomavirus E7 protein and Rb
gene product in fresh tissues of squamous cervical carcinoma]. Zhonghua Fu Chan Ke Za Zhi 32(12),
722-4.
WANG, R., DOOLAN, D. L., LE, T. P., HEDSTROM, R. C., COONAN, K. M., CHAROENVIT, Y., JONES, T. R.,
HOBART, P., MARGALITH, M., NG, J., WEISS, W. R., SEDEGAH, M., DE TAISNE, C., NORMAN, J. A., and
HOFFMAN, S. L. (1998). Induction of antigen-specific cytotoxic T lymphocytes in humans by a malaria
DNA vaccine. Science 282(5388), 476-80.
WATT, F. M. (1998). Epidermal stem cells: markers, patterning and the control of stem cell fate. Philos Trans R
Soc Lond B Biol Sci 353(1370), 831-7.
WERNESS, B. A., LEVINE, A. J., and HOWLEY, P. M. (1990). Association of human papillomavirus types 16 and
18 E6 proteins with p53. Science 248(4951), 76-9.
WOBBE, C. R., DEAN, F. B., MURAKAMI, Y., WEISSBACH, L., and HURWITZ, J. (1986). Simian virus 40 DNA
replication in vitro: study of events preceding elongation of chains. Proc Natl Acad Sci U S A 83(13),
4612-6.
YANG, R., DAY, P. M., YUTZY, W. H. T., LIN, K. Y., HUNG, C. F., and RODEN, R. B. (2003). Cell surface-binding
motifs of L2 that facilitate papillomavirus infection. J Virol 77(6), 3531-41.
YEAGER, M. D., ASTE-AMEZAGA, M., BROWN, D. R., MARTIN, M. M., SHAH, M. J., COOK, J. C., CHRISTENSEN,
N. D., ACKERSON, C., LOWE, R. S., SMITH, J. F., KELLER, P., and JANSEN, K. U. (2000). Neutralization
of human papillomavirus (HPV) pseudovirions: a novel and efficient approach to detect and
characterize HPV neutralizing antibodies. Virology 278(2), 570-7.
ZHAO, K. N., SUN, X. Y., FRAZER, I. H., and ZHOU, J. (1998). DNA packaging by L1 and L2 capsid proteins of
bovine papillomavirus type 1. Virology 243(2), 482-91.
ZUR HAUSEN, H.
(1996). Papillomavirus infections--a major cause of human cancers. Biochim Biophys Acta
1288(2), F55-78.
H Literatur 102
ZWAVELING, S., FERREIRA MOTA, S. C., NOUTA, J., JOHNSON, M., LIPFORD, G. B., OFFRINGA, R., VAN DER
BURG, S. H., and MELIEF, C. J. (2002). Established human papillomavirus type 16-expressing tumors
are effectively eradicated following vaccination with long peptides. J Immunol 169(1), 350-8.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement