Brighenti Elisa tesi

Brighenti Elisa tesi
Alma Mater Studiorum – Università di Bologna
Dottorato di ricerca in Oncologia e Patologia Sperimentale
Progetto Nr.2 - Patologia Sperimentale
CICLO XXIII
MED/05
Tesi di Dottorato
RELEVANCE OF CELL CYCLE REGULATORS
ON CHEMOTHERAPY RESPONSE
IN BREAST CANCER
Presentata da: Dott.ssa Elisa Brighenti
Coordinatore Dottorato:
Chiar.mo Prof.
Sandro Grilli
Relatore:
Chiar.mo Prof.
Massimo Derenzini
Esame finale anno 2011
Table of contents
TABLE OF CONTENTS
LIST OF ABBREVIATIONS.............................................................................I
INDEX OF FIGURES.........................................................................................V
INDEX OF TABLES.........................................................................................VII
INTRODUCTION
1. BREAST CANCER
1.1 FEATURES……………………………...…………………………….…...…1
1.2 EPIDEMIOLOGY AND RISK FACTORS…………………………………...2
1.3 DISEASE ONSET AND PROGRESSION………………………………….12
1.4 CLASSIFICATION AND CLINICAL PATHOLOGY………………….…..15
1.5 TYPES AND SUBTYPES……..................................……………………….22
1.5.1 TRIPLE-NEGATIVE BREAST CANCER…………………………....26
1.6 THERAPY..................................……....………….…………........................27
2. CHEMOTERAPY
2.1 FEATURES .......................................……………………………………….33
2.2 CHEMOTHERAPEUTIC DRUGS AND MECHANISM OF ACTION……35
3. CELL CYCLE
3.1 CELL CYCLE AND CANCER………………………………………………40
3.2 THE p53, pRb AND p16INK4a PATHWAYS IN CANCER………………..48
EXPERIMENTAL DESIGN
4. AIMS OF THE THESIS…………………………………………………...58
Table of contents
5. MATERIALS AND METHODS
5.1. Patients……………………………………………………………...……….60
5.2. Adjuvant treatments…………………………………………………………61
5.3. Immunohistochemical assessment…………...……….……………………..61
5.4. Cell lines and growth conditions.....................................................................63
5.5. Production of HCT-116-derived cells with stably inactivated p53................64
5.6. Drugs and cell treatment protocols.................................................................64
5.7. Genes silencing by RNAi transfection............................................................65
5.8. RNA extraction, cDNA synthesis and real-time RT–PCR analysi.................66
5.9. Proteins extraction and Western blot analysis................................................67
5.10. Immunocytochemical analysis......................................................................68
5.11. Evaluation of cell population growth............................................................69
5.12. Evaluation of cell death rate.........................................................................70
5.13. Cell cycle progression analysis by dual-parameter flow cytometry............71
5.14. Effect of drug treatment on p53 activation and DNA double-strand breaks
accumulation.................................................................................................72
5.15. Statistical analysis.........................................................................................72
5.16. RNAi sequences............................................................................................73
6. RESULTS
6.1. The p53-mediated sensitivity of cancer cells to chemotherapeutic agents
is conditioned by status of the pRb protein
6.1.1. Assessment of pRb and p53 status........................................................74
Table of contents
6.1.2. Relationship between p53 and pRb in tumor prognosis.......................77
6.1.3. Evaluation of p53-mediate chemosensitivity and pRb pathway
status in cancer cells..............................................................................80
6.2. Loss of pRb protein makes human breast cancer cells more sensitive to
antimetabolites exposure
6.2.1. Immunohistochemical definition of pRb status and determination
of its prognostic value in a large series of primary breast
cancer patients.......................................................................................90
6.2.2. Prognostic value of pRb expression and phosphorylation...................91
6.2.3. The absence of pRb expression is the only predictive factor of
good clinical outcome in patients treated with adjuvant
chemotherapy........................................................................................92
6.2.4. 5-FU and MTX treatment hindered cell population growth of
RB1- silenced MCF-7 and HCT-116 cells............................................95
6.2.5. 5-FU and MTX treatment caused a cell cycle arrest in control but
not in RB1-silenced cells.......................................................................98
6.2.6. The p53/p21 pathway was normally activated in RB1-silenced
cells treated with 5-FU and MTX.......................................................100
6.2.7. RB1-silenced cells accumulated DNA double-strand breaks..............101
6.3. High prevalence of retinoblastoma protein loss in triple-negative breast
cancers and its association with a good prognosis in patients treated
with adjuvant chemotherapy
6.3.1. Valuation of pRb status and its association of the clinical outcome
of chemotherapy-treated patients with triple-negative tumors..........103
Table of contents
6.3.2. pRb status and the clinical outcome of triple negative tumors treated
with chemotherapy..............................................................................106
6.3.3. Relevance of pRb status on sensitivity to doxorubicin in
MDA-MB-231 triple-negative derived cells.......................................108
7. DISCUSSION.................................................................................................111
7.1. In breast cancer with a normally function of pRb pathway, the p53 status
was the only independent factor capable to predicting the patient clinical
outcome after adjuvant chemotherapy treatment..........................................112
7.2. The absence but not inactivation of pRb predicted the clinical outcome of
patients treated with 5-FU and MTX adjuvant therapy...............................113
7.3. Lack of pRb expression was the only independent factor predicting
a good clinical outcome in patients treated with adjuvant
chemotherapy................................................................................................114
7.4. The greater sensitivity of pRb deficient cells to 5-FU plus MTX exposure
was due to the absence of a DNA damage checkpoint and DNA
repair mechanisms........................................................................................116
7.5. High prevalence of retinoblastoma protein loss in triple-negative breast
cancers was responsible for a good prognosis in patients treated
with adjuvant chemotherapy.........................................................................118
8. NOTES..............................................................................................................123
9. REFERENCES..............................................................................................124
List of Abbreviations
LIST OF ABBREVIATIONS
5-FU: 5-Fluorouracile
ADH: Atypical Ductal Hyperplasia
ATCC: American Type Culture Collection
ATM: Ataxia Telangiectasia Mutated
BC: Breast Cancer
BRCA1: Breast Cancer 1
BRCA2: Breast Cancer 2
BrdUrd: Bromodeoxyuridine
BSA: Bovine Serum Albumin
CDK: Cyclin-Dependent Kinase
CDKI: Cyclin-Dependent Kinases Inhibitor
cDNA: copy of DNA
CMF: Cyclophosphamide plus Methotrexate plus 5-Fluorouracil
CSPG2: Chondroitin Sulfate Proteoglycan 2
DAB: Diaminobenzidine
DAPI: 4',6-Diamidino-2-phenylindole dihydrochloride
DCIS: Ductal Carcinoma In Situ
DEPC: Diethylpyrocarbonate treated water
DFS: Disease-Free Survival
DHFR: Dihydrofolate Reductase
DMEM: Dulbecco‟s Modified Eagle‟s Medium
DNA: DesossiriboNucleic Acid
I
List of Abbreviations
EDTA: EthyleneDiamine Tetra-acetic Acid
EGF: Epidermal Growth Factor
EGFR: Epidermal Growth Factor Receptor
ER: Estrogen Receptor
ErbB-2: Human Epidermal growth factor Receptor 2
ERD: Estrogen Receptor Downregulators
FBS: Fetal Bovine Serum
FITC: Fluorescein IsoThioCyanate
HCT-116: Colon cancer cell line
HELU: Hyperplastic Enlarged Lobular Units
HepG2: Human liver carcinoma cell line
HER2/neu: Human Epidermal Growth Factor Receptor 2
IBC: Invasive Breast Cancer
IL-2: Interleukin-2
LCIS: Lobular Carcinoma In Situ
LI: Labeling Index
MCF-7: estrogen receptor positive breast cancer cell line
MDA-MB-231: estrogen receptor negative breast cancer cell line
MDM2: Murine Double Minute 2
MI: Mitotic Index
mAbs: Monoclonal Antibodies
mRNA: messenger RNA
MTX: Methotrexate
PARP: Poly (ADP-ribose) Polymerase
II
List of Abbreviations
PBS: Phosphate Buffered Saline
PDGF: Platelet-Derived Growth Factor
PR: Progesterone Receptor
pRb: Retinoblastoma protein
PTEN: Phosphatase and Tensin Homolog
RB1: Retinoblastoma gene
RNA: ribonucleic acid
RNAi: RNA interference
RPMI: Roswell Park Memorial Institute
RT: Room Temperature
RT-PCR: Reverse Transcriptase-Polymerase Chain Reaction
SD: Standard Deviation
SDS-PAGE: Sodium Dodecyl Sulfate PolyAcrilammide Gel Electrophoresis
SERM: Selective Estrogen Receptors Modulators
TDLU: Terminal Duct Lobular Unit
TGF-β: Transforming Growth Factor-β
TLI: Thymidine Labeling Index
TNBC: Triple-Negative Breast Cancer
TNM: Tumor Nodes Metastasis
TP53: p53 gene
VEGF: Vascular Endothelial Growth Factor
WHO: World Health Organization
WT: Wild Type
µg/ml: micrograms per millilitre
III
List of Abbreviations
µl: microlitre
µm: micrometer
µM: micromolar
IV
Index of figures
INDEX OF FIGURES
FIGURE 1…………………………….......................……………………….……… 1
FIGURE 2………………………………...……………………………….………….3
FIGURE 3………………………………………………………...……….………….4
FIGURE 4………………………………………………………...………….……...13
FIGURE 5………………………………………………………………….…….….23
FIGURE 6…………………………………………………………………....……...40
FIGURE 7………………………………………………………………...….……...42
FIGURE 8…………………………………………………………………....……...44
FIGURE 9……………………………………………………………….……...…...48
FIGURE 10…………………………..………………………………….………......49
FIGURE 11…………………………………………….……………….………...…50
FIGURE 12……………………………………………………………….……...….53
FIGURE 13…………………………………………………………….……...…….54
FIGURE 14…………………………………………………………………...……..57
FIGURE 15…………………………………………………………….…………....75
FIGURE 16…………………………………………………………….……...…….75
FIGURE 17…………………………………….…….......................................…….78
FIGURE 18…………………………………………….……………….…………...78
FIGURE 19……………………………………………………………………….....79
FIGURE 20……………………………………………………………….…………82
FIGURE 21……………………………………………………………….…………83
FIGURE 22…………………………..………………………………….…………..84
FIGURE 23…………………………………………….………………….………...85
V
Index of figures
FIGURE 24……………………………………………………………………….....86
FIGURE 25……………………………………………………………….…………87
FIGURE 26……………………………………………………………….…………88
FIGURE 27…………………………..………………………………….…………..89
FIGURE 28…………………………………………….………………….………...95
FIGURE 29……………………………………………………………….…………96
FIGURE 30…………………………..………………………………….…………..98
FIGURE 31…………………………………………….………………….………...99
FIGURE 32……………………………………………………………….………..101
FIGURE 33…………………………..………………………………….…………102
FIGURE 34…………………………………………….………………….……….105
FIGURE 35...............................................................................................................107
FIGURE 36...............................................................................................................109
FIGURE 37...............................................................................................................110
FIGURE 38...............................................................................................................122
FIGURE 39...............................................................................................................122
VI
Index of tables
INDEX OF TABLES
TABLE 1…………………………………………….………………….…..……….17
TABLE 2…………………………………………….………………….…….……..44
TABLE 3…………………………………………….………………….…….….….76
TABLE 4…………………………………………….………………….…….……..77
TABLE 5…………………………………………….………………….…………...80
TABLE 6…………………………………………….………………….…………...91
TABLE 7…………………………………………….………………….…………...92
TABLE 8…………………………………………….………………….…………...93
TABLE 9…………………………………………….………………….…………...94
TABLE 10…………………………………………….………………….………...103
TABLE 11…………………………………………….………………….………...104
TABLE 12…………………………………………….………………….………...105
TABLE 13…………………………………………….………………….………...106
TABLE 14…………………………………………….………………….………...108
VII
Introduction
INTRODUCTION
1. BREAST CANCER
1.1. FEATURES
Breast cancer (BC) is the most frequent carcinoma in females and the second most
common cause of cancer-related mortality in women, after lung cancer. According to
the American Cancer Society, it is expected that the 3 most commonly diagnosed
types of cancer among women in 2010 will be cancers of the breast, lung and
bronchus, and colorectum, accounting for 52% of estimated cancer cases in women.
Breast cancer alone is expected to account for 28% (207,090) of all new cancer cases
among women, more than 1 in 4 women (Figure 1) (Jemal et al., 2010).
Figure 1: Ten Leading Cancer Types for the Estimated New Cancer Cases and Deaths by Sex,
2010. *Excludes basal and squamous cell skin cancers and in situ carcinoma except urinary bladder.
Estimates are rounded to the nearest 10.
1
Introduction
The decrease in breast cancer incidence, and in particular mortality, has been
attributed to the combination of early detection with screening programmes, breast
cancer prevention interventions, a decrease in the use of post-menopausal hormonereplacement therapy and the advent of more efficacious adjuvant systemic therapy
(Jemal et al., 2007). Continued advances in our understanding of the molecular
biology of breast cancer progression have aided in the discovery of novel pathwayspecific targeted therapeutics, and the emergence of such effective therapeutics is
currently driving the „patient-tailored‟ treatment planning. Knowledge gained from
studying the molecular pathology of human breast cancer progression, integration
and implementation of this knowledge in the clinical setting, promises to further
reduce breast cancer morbidity and mortality.
1.2. EPIDEMIOLOGY AND RISK FACTORS
The cause of breast cancer is still relatively unknown, although researchers have
accumulated a considerable amount of information on the factors, which may
increase one's risk of developing the disease. Today, the disease, like all other forms
of cancer, is considered to be the end result of many factors, both environmental and
hereditary. These factors include gender, age, family history of the disease especially
if there are first degree relatives affected, age at menarche and at menopause, number
of full term pregnancies, the use of both oral contraceptives and hormone therapies
and mutation in specific genes. Also the industrialization accompanied by
environmental pollutants may contribute to breast cancer risk.
2
Introduction
1.2.1. Gender
Breast cancer is predominantly a disease that occurs in women even if, in rare
circumstances, it can develop in men. In fact, approximately one out of every 150
breast cancer cases occurs in male. It seems likely that estrogens have some role in
the development of breast cancer; in fact the difference in incidence may be because
estradiol is able to exert a direct biological effect on breast cells in females, whereas
in males testosterone needs to be converted to estradiol before exerting any biologic
effect (Endogenous Hormones and Breast Cancer Collaborative Group, 2002).
1.2.2. Age
The incidence of breast cancer, in the reproductive years, increases rapidly with age
then increases at a slower rate after about the age of 50, which is average age at
menopause (Figure 2).
Figure 2. Age-incidence curve of breast cancer; log-log plot (from data for England and Wales
1983–87).
3
Introduction
Younger women are not generally considered to be at risk for breast cancer: only 7%
of all breast cancer cases occur in women under 40 years old, even if these women
tend to have more aggressive breast cancers than older women, which may explain
why often survival rates are lower among younger women. The incidence rates
increased up to 10-fold by the age of 40 (Hulka and Moorman, 2001).
1.2.3. Effects of migration and geographical factors
Among populations around the world the incidence and the mortality of breast cancer
vary greatly, also five-fold (Figure 3). In most of more developed countries the rates
are high while in less developed countries and in Japan they are low, probably
because of differences in reproductive factors. Among the migrants, the rates of
those who migrate from countries with low incidence to countries with high
incidence take on the higher rates of the new host country (Buell, 1973).
Figure 3. Worldwide variation in breast cancer rates (data from International Agency for Research
on Cancer 1990).
4
Introduction
1.2.4. Reproductive factors
Menarche and the menstrual cycle
At menarche a woman's body undergoes changes in order to accommodate the
monthly cycling of sex steroid hormones and to prepare the body for childbearing.
The age at menarche is inversely related to the risk for development of breast cancer
(women who begin menstruating before age 13 years, have a two-fold increased risk
of cancer). Some researchers have suggested that certain characteristics of the
menstrual cycle, such as the time it takes for regular menstrual cycles, the length of
menstrual cycles and the age at which these cycles begin, may increase the likelihood
of developing breast cancer (Butler et al., 2000): for example, a short menstrual cycle
of less than 28 days confers a greater risk of breast cancer than longer cycles of 28
days (Whelan et al., 1994). This is because women who have short menstrual cycles,
would have more cycles throughout a year, and have more time spent in the luteal
phase of the menstrual cycle and therefore an increase in time spent on cell
proliferation. Moreover, if fertilization does not occur, there could also be effects on
apoptosis that would occur more frequently determining a major cancer risk.
Pregnancy, breastfeeding and abort
Pregnancy and related factors, such as the age at first full term pregnancy, the
number of full term births, interruptions in pregnancy (such as abortions) and
breastfeeding have opposite influences on the risk of developing breast cancer.
Childbearing seems to have a dual effect on risk of breast cancer: it is increased in
the period immediately after a birth, but this excess risk gradually diminishes and, in
the longer term, the effect of a birth is to protect against the disease (Beral and
Reeves, 1993). Compared with women who never had children (nulliparous women),
5
Introduction
women who have had at least one full-term pregnancy have, on average, around a
25% reduction in breast-cancer risk. (Layde et al., 1989). The age at first full term
pregnancy is related to breast cancer risk. The reason is that the pregnancy induces
changes in the hormonal profile and these changes could result in alterations in the
tissues that are under hormonal control. This renders the breast tissue less susceptible
to carcinogenic stimuli and thus protects from cancer induction (Lambe et al., 1994).
Furthermore, the protection rises with increasing of full-pregnancies number (Layde
et al., 1989).
About the effect of breastfeeding, recent studies in less developed countries, in which
the total duration of breastfeeding can be much longer, have reported substantial
protective effects (women who had breastfed for a total of 25 months had a 33%
lower risk of breast cancer than those who had never breastfed) (Layde et al., 1898).
Regarding the incomplete pregnancies, arising from spontaneous or induced
abortions, the risk of breast cancer may be increased because the birth does not go to
term, and would no longer have a protective effect. During pregnancy there is the
interplay between prolactin, estrogen and progesterone which all act to promote
breast growth and differentiation. If the pregnancy is interrupted, the growth and
differentiation would also be incomplete and the undifferentiated structures of breast
would render the breast susceptible to carcinogenesis (Russo and Russo, 1980).
Menopause
In the breast of postmenopausal women the cellular proliferation tends to be less than
that of premenopausal women and this reduction of proliferation rate may be due to
the decline of plasma estrogen concentrations during the menstrual cycle. The age at
which menopause occurs influences breast cancer risk: women going through
6
Introduction
menopause at a late age have a higher risk of breast cancer than those who cease
menstruating earlier (Collaborative Group on Hormonal Factors in Breast Cancer,
1997).
A combination of early age at menarche and a late age at menopause would therefore
prolong the time of the menstrual cycling of sex hormones, and thus would
substantially increase a woman's risk of breast cancer development (Rosner et al.,
1994).
1.2.5. Hormone therapies
Hormone therapies are used throughout a woman's reproductive life and decline of
reproductive years, to combat a variety of ailments. They include oral contraceptives
and hormones for menopausal women.
Oral contraceptives
The use of combined oral contraceptives increases the risk of breast cancer of around
25%, and the risk falls after cessation of use (10 or more years after use stops, no
significant increase in risk is evident); risk does not vary significantly with duration
of use, with the effect of combined oral contraceptives or with the type of estrogen or
progestagen used. Women with several years of oral contraceptive use before age 25
and/or before the first full-term pregnancy, women who use oral contraceptives at
age 45 or older, women with early menarche and women with a family history of
breast cancer have an increased risk of breast cancer (Vessey et al., 1989).
Hormonal therapy for the menopause
Hormone replacement therapies (HRTs) are routinely prescribed for menopausal
women to alleviate the symptoms of menopause and to slow the bone loss which is
7
Introduction
associated with postmenopausal osteoporosis. Their use determines a higher risk of
breast cancer than that of women who have never used these therapies and this risk
increases with increasing duration of HRT use (Magnusson et al., 1999).
1.2.6. Breast tissue composition
Breast density reflects variations in breast tissue composition and can be strongly
associated with breast cancer risk. Breast density is assessed by mammography and
expressed as the percentage of the breast that is occupied by radiologically dense
tissue. Researchers found that a major extension of mammographic density percent
was associated with an increased risk of breast cancer (McCormack and dos Santos
Silva, 2006). For many women, breast density will change with age or be related to
factors such as relative body mass index, age at first childbirth, postmenopausal
hormone replacement use and/or genetic make-up.
1.2.7. Alcohol and smoking
Observational studies have repeatedly shown that alcohol consumption is associated
with only a moderate increase in the risk of breast cancer, although it depends on the
amount and on the type of alcohol taken (Rohan and Bain, 1987). It has been
suggested that alcohol may induce changes in the liver, which in turn may affect
estrogen metabolism or may affect the level of steroid binding globulins, or for the
increased secretion of pituitary stimulated hormones, such as prolactin and thyroid
stimulating hormone, which would increase mitotic activity in target tissues, and
hence lead to an increased susceptibility to malignancy. Another hypothesis is that
the consumption of alcohol (approximately one to two alcoholic drinks per day)
8
Introduction
increased estrogen levels in premenopausal and postmenopausal women (Ginsburg et
al., 1959).
Carcinogens found in tobacco smoke pass through the alveolar membrane and into
the blood stream, by means of which they may be transported to the breast via
plasma lipoproteins. Due to the fact that they are lipophilic, tobacco-related
carcinogens can be stored in breast adipose tissue and then metabolized and activated
by human mammary epithelial cells (MacNicoll et al., 1980). As is well known,
tobacco smoke contains potential human breast carcinogens (including PAHs,
aromatic amines, and N-nitrosamines); in fact an higher prevalence of smokingspecific DNA adducts and p53 gene mutations were found in the breast tissue of
smokers compared with that in nonsmokers, supporting the biological plausibility of
a positive association between cigarette smoking and breast cancer risk, depending
by dose and duration (Palmer and Rosenberg, 1993).
1.2.8. Diet
Foods may have several effects on the breast cancer risk. It has been demonstrated
that aliments rich in omega-3 fatty acids, such as fish, suppress mammary tumour
growth by blocking the tumour promoting properties of carcinogens or by inhibiting
prostaglandin synthesis. Conversely, foods rich in omega-6 fatty acids, such as oil,
are thought to stimulate mammary tumour growth. Both saturated and unsaturated
fats are thought to act during the promotional stages of carcinogenesis and this
promotion is largely dependent on the amounts and sources of fat in the diet.
A link between red meat consumption and risk for breast cancer have been reported
(Toniolo et al., 1994) while an inverse associations between intakes of fruits, dietary
9
Introduction
fibre, vegetables and breast cancer risk have been reported in several case-control
studies because they are important sources of antioxidants, which may help protect
against the tissue damage linked to increased cancer risk (Fund WCRL, 1997).
Antioxidants include vitamin C, vitamin E, and Vitamin A such as carotenoids.
Regarding to caffeine, in a prospective studies, it has not been seen correlation
between caffeine intake and breast cancer risk (Vatten et al., 1990).
1.2.9. Height, weight and exercise
Adult height shows a positive association with breast cancer risk. Average height is
substantially greater in populations with high rates of breast cancer than in
populations with low rates. Within populations, a 10 cm greater height is typically
associated with an increase in risk of about 10%. (Hunter and Willett, 1993).
Probably because height is positively correlated with energy during growth and with
early menarche, and it might be a marker for the number of susceptible breast cells.
In postmenopausal women, obesity increases the risk of breast cancer; risk is about
50% higher in obese women (body-mass index >30 kg/m2) than in lean women (body
mass index 20 kg/m2) and this association is not observed in premenopausal women
(Hunter and Willett, 1993). Several studies have reported that moderate physical
activity is associated with a lower risk of breast cancer. The size of the effect of high
physical activity has varied widely between studies, but a typical result is a reduction
in risk of around 30% in association with a few hours per week of vigorous activity
versus none (Friedenreich et al., 1998) and more evident in premenopausal women.
10
Introduction
1.2.10. Family history and genetic factors
Environmental and lifestyle factors rather than inherited genetic factors account for
most cases of breast cancer, even if most women with the disease do not have a
family history of it, and most women with affected relatives never develop breast
cancer.
Family history
The evidence for genetic predisposition to breast cancer derives originally from
observations of cancer clustering in families and cancer risk increasing in individuals
with some genetically determined syndromes.
Most studies on familial risk of breast cancer have found about two-fold relative
risks for first-degree relatives (mothers, sisters, daughters) of affected patients
(Pharoah et al., 1997). About 13% of all patients have a first-degree relative with
breast cancer. A significant increased in breast cancer risk has been observed even in
second (grandmothers, aunts, grand-daughters) to fifth degree (Amundadottir et al.,
2004).
High-risk mutations
About 5-10% of all breast cancers are caused by germ-line mutations in wellidentified breast cancer susceptibility genes (inherited from one‟s mother or father).
So far at least five germ line mutations that predispose to breast cancer have been
identified. These include mutations in the genes BRCA1, BRCA2, TP53, PTEN, and
ATM. Mutations in BRCA1 and BRCA2 can cause high risks of breast cancer because
they are tumor suppressor genes and their inactivation causes genetic defects and
genetic instability. Germ line mutations in TP53 predispose to the Li-Fraumeni
cancer syndrome (including childhood sarcomas and brain tumors, as well as early-
11
Introduction
onset breast cancer) and those in PTEN are responsible for Cowden disease (of which
breast cancer is a major feature). High-risk alleles probably account for most of the
families with four or more breast cancer cases, for around 20–25% of the familial
breast cancer risk overall, and for around 5% of all breast cancers (Easton, 1999).
The ATM (ataxia telangiectasia mutate) gene control cell cycle and mutations of this
gene are closely linked to a childhood disorder of the nervous system called Ataxia
Telangiectasia and to breast cancer susceptibility.
1.3. DISEASE ONSET AND PROGRESSION
Breast cancer is a group of related conditions, characterized by differing microscopic
appearance and biologic behavior, in which the cells of the breast escape the normal
replication, growing and dividing rapidly and uncontrollably (Coe and Steadman,
1995). It is believed that this capacity of evade from the replication cycle involves
the accumulation of mutations, usually in genes that regulate cell division and the
accurate replication of DNA (Davis and Bradlow, 1995). Also hormones and other
substances located in close proximity of the cell can stimulate abnormal cell
multiplication. There are many models of human breast cancer evolution.
Cytogenetic and molecular genetics analysis have revealed that the development of a
primary breast carcinoma derives from a multistep process involving initiating or
promoting factors characterized by the accumulation of various genetic alterations
which may invoke a transformation of normal cells into malignant cells (Beckmann
et al., 1997)
One of the most well-established models, published by Wellings and Jensen over 30
years ago, proposed that the cellular origin of most breast cancers occurs in the
12
Introduction
normal terminal duct lobular unit (TDLU), the basic histopathologic and
physiologic unit of breast, and there is an apparently continuous but non-obligatory
progression from TDLUs to cancers through a series of increasingly abnormal stages
over long periods of time also decades in most cases (Figure 4) (Wellings and
Jensen, 1973).
Figure 4. Revised Wellings and Jensen model of human breast cancer evolution. The original
Wellings and Jensen model proposed an apparently continuous but non-obligatory linear progression
from normal TDLU to IBC through a series of increasingly abnormal stages over long periods of time.
The key stages in this progression, in today‟s terminology, are called:
◊ hyperplastic enlarged lobular units (HELU);
◊ atypical ductal hyperplasia (ADH);
◊ ductal carcinoma in situ (DCIS) or lobular carcinoma in situ (LCIS) so called
when the tumor remain confined within the basement membrane of the duct or lobule
(Coe and Steadman, 1995).
13
Introduction
If the breast cancer remains within the basement membrane and does not invade
surrounding tissue or metastasize to distant organs it is said to be in situ (noninvasive)
◊ invasive breast cancer (IBC) when the tumor increases in size and the invade (or
infiltrate) the normal adjacent tissue (Allred et al., 2004). When the cancer cells
break away from the site of origin and penetrate the basement membrane of the
epithelium, they enter the bloodstream or lymphatics located in connective tissue and
may metastasize to distant organs and form secondary tumors. The major route of
metastases via the lymphatic system is through the axillary nodes. Hence, the tumor
extends into the central lymphatic terminus and the cancer cells enter into the venous
stream. These cells can then be carried through the heart to lungs. Tumor fragments
that may break loose from pulmonary vein are then carried off, back to heart and
enter the bloodstream. Organs with a rich blood supply, such as the liver, spleen,
adrenals and bone, are the targets for blood-bone metastases (Lu and Kang, 2007).
.
Several characteristics distinguish the breast cancer types. The transition from TDLU
to HELU is characterized by increased growth due to epithelial hyperplasia.
Alterations of cell adhesion and polarity distinguish ADH from HELU as the
hyperplastic epithelium begins to pile up and distends acini. DCIS is characterized by
further expansion of tumor volume, intraductal spread into other areas of the breast,
and, most importantly, the appearance of increased histologic and biological
diversity compared with earlier precursors. Invasion into surrounding stroma defines
the transition of DCIS to IBC. Evidences support that most high-grade DCIS
gradually evolve from lower-grade DCIS and, thus indirectly from ADH, by the
14
Introduction
random accumulation of genetic defects, which are propagated to IBC in a manner
that is largely independent of progression to invasion. Since the DCIS are the
precursor of nearly all ductal IBCs (which account for 85-90% of all IBCs), then
ADH is probably also a risk factor for the development of DCIS independent of its
histologic and biological characteristics (Allred et al., 2008).
Since the major breast cancers evolve from precursors, identifying of biological
alterations associated with early precursors, before the cancer development, may
reveal strategies for the prevention of the majority of cancers or treated them early.
1.4. CLASSIFICATION AND CLINICAL PATHOLOGY
When cancer is present, a number of tests are performed to assess the behavior of the
cancer, and to determine the most effective treatments.
Prognosis is defined according to several parameters: tumor size and grade, the
presence/ absence of estrogen (ER) and/or progesterone (PR) receptors, HER2/neu
(HER2, c-erbB2) protein, lymph node metastases and vascular or perineural tumor
invasion. Other parameters, such as the proliferating index, the presence of p53,
BRCA1 and 2 or EGFR alterations, may also be useful for prognostic evaluation or
as predicting therapeutic response.
The TNM Classification of Malignant Tumors (TNM) is a cancer staging system for
all solid tumors that describes the extent of cancer in a patient‟s body. It was devised
by Pierre Denoix between 1943 and 1952 using the size and extension of the primary
tumor, its lymphatic involvement, and the presence of metastases to classify the
progression of cancer. The parameters are:
15
Introduction
● T (range from 1 to 4) describes the size of the primary tumour and whether it has
invaded nearby tissue:
o
T1: No evidence of primary tumour
o
T2: Tumor 2 cm or less
o
T3: Tumour more than 5cm
o
T4: Tumour of any size with extension to adjacent tissue
● N (range from 0 to 3) describes regional lymph nodes that are involved and the
degree of spread:
o
N0: tumor cells absent from regional lymph nodes
o
N1: regional lymph node metastasis present; (at some sites: tumor
spread to closest or small number of regional lymph nodes)
o
N2: tumor spread to an extent between N1 and N3 (N2 is not used at
all sites)
o
N3: tumor spread to more distant or numerous regional lymph nodes
(N3 is not used at all sites);
● M (0-1) represents the presence of metastasis (spread of cancer from one body
part to another).
o
M0: no distant metastasis
o
M1: metastasis to distant organs (beyond regional lymph nodes)
1.4.1. Tumour Stage
Once a TNM classification is available for a tumour, the tumour is then classified
into a clinical stage; stage I, II, III, or IV (Table 1) (Sainsbury et al., 1994).
16
Introduction
Table 1. The correlation of the tumour, nodes, metastases (TNM) system and the Unio
Internationale Contra Cancrum (UICC) system of classification for tumours.
Survival from breast cancer is largely dependent on the stage at presentation, and the
prescription of appropriate treatment is based on stage.
1.4.2. Tumour Grade
On microscopic examination, a tumour can be graded according to the degree of
differentiation of the tumour from adjacent "normal" cells. The most common
grading system used by pathologists is the Scarff, Bloom, and Richardson (SBR)
classification and is usually used as a preference to tumour staging.
Tumour Grade Definition:
◊ Tumor grade 1: tumor well-differentiated
◊ Tumor grade 2: tumor moderately-differentiated
◊ Tumor grade 3: tumor poorly-differentiated
Grade 1 tumors are small, round, have regular nuclei and very few mitoses.
Conversely, grade 3 tumors are large, have irregular nuclei and have many mitoses
17
Introduction
Survival studies show that grade 1 tumors have a good prognosis, and thus a good
response to treatment, whilst grade 3 tumors would have a poor prognosis and the
response to treatment would be less successful (Elledge and McGufre, 1993).
1.4.3. Tumour size
The size of the primary tumour and the involvement of axillary nodes (which,
combined, constitute the stage of the disease) in cancer development, are the most
important indicators of prognosis. A good prognosis is associated with a small
tumour (less than 1cm in diameter); whilst a poor prognosis accompanies a large
tumour (a diameter greater than 5cm) (Stockdale, 19889. Results from the SEER
program (Surveillance, Epidemiology and End Results program of the National
Cancer Institute) suggest that if tumors are less than 1cm in diameter and have not
progressed from the initial site of development, then there is a relatively high chance
of survival, after 5 years, from the time of primary diagnosis, in comparison, tumors
of greater than 5 cm in diameter, have an 82% chance of survival after 5 years from
the initial time of diagnosis (Carter. Et al., 1989).
1.4.4. Estrogen and progesterone receptors
Hormone receptor assays are considered to be essential tools for the assessment,
prognosis and treatment of breast cancer. Approximately 50 to 85% of breast cancers
cells contain receptors that specifically bind estrogen and progesterone.
Estrogen receptors (ER) and progesterone receptors (PR) are present in higher
concentrations in breast cancer tissue than in "normal" breast tissue, and are thus
significantly important for planning treatment. In fact, about 75% of breast cancers
18
Introduction
are estrogen receptor-positive (ER-positive, or ER+). About 65% of ER-positive
breast cancers are also progesterone receptor-positive (PR-positive, or PR+). Cells
that have receptors for one of these hormones, or both of them, are considered
hormone receptor-positive. Patients with breast cancers that are shown to be ER
positive, respond favorably to hormone treatments such as tamoxifen, in
approximately 60-65% of cases. On the contrary, patients with negative ER assays
have a less than 10% response rate to hormone therapy (Stockdale, 1988). Therefore
a high concentration of these receptors is highly predictive of the response hormonal
therapy.
1.4.5. Proliferation index
The proliferation index is a measure of the number of cells in a tumor that are
dividing, and thus proliferating. Cell proliferation can reasonably be supposed to be
related to tumor aggressiveness. Proliferative activity can be determined using
various methods based on different rationales:
Ki-67 protein is an indicator strictly associated with cell proliferation. During
interphase, the Ki-67 antigen can be detected only within the nucleus of cells, while
in mitosis the majority of the protein is relocated to the surface of chromosomes. The
Ki-67 protein is present during all active phases of cell cycle (G1, S, G2 and M) but
it is absent from resting cells (G0). Ki-67 is an excellent indicator to determine the
fraction of development given population of cells. The fraction of Ki-67 positive
tumor cells (Ki-67 labeling index) is often correlated with the clinical course of
cancer.
19
Introduction
The mitotic index (MI) is the fraction of cells in mitosis at any given time. It
consists in counting the number of mitotic figure on a constant sample of cells (1000
or 10000) per mm2 of epithelium. Mitotic activity is currently used mainly as part of
the tumor grading system, for women with infiltrating breast carcinoma. Several
studies have indicated that mitotic activity is an important imprint of tumor evolution
as it exerts a determining influence on long-term clinical outcome, regardless of type
of treatment, but also they suggested that mitotic activity does not provide predictive
information on response to systemic therapy (Medri et al, 2003).
The thymidine labeling index (TLI) is a method, which involves the incubation of
fresh tissue with tritium-labeled thymidine, provides an estimate of the fraction of
tumor cells that are in the S (DNA synthesis) phase of the cell cycle. Because DNA
synthesis is an integral part of each cell division cycle, TLI gives an indication of the
amount of proliferation taking place in a tumor and it is a strong independent
predictor of survival and relapse-free survival.
Both Ki-67 and TLI are high in cancers with high nuclear and histologic grade and
are higher in cancers from premenopausal women than in those from postmenopausal
women (Gentili et al., 1981; McGurrin et al, 1987); tumors with high TLI or Ki-67
are frequently estrogen receptor negative (Gerdes et al, 1987).
1.4.6. HER2-neu
HER2/neu (Human Epidermal growth factor Receptor 2, also known as ErbB-2) is a
member of the ErbB protein family, more commonly known as the epidermal growth
factor receptor family, and it is encoded by the ERBB2 gene. It is a cell membrane
surface-bound receptor tyrosine kinase and is normally involved in the signal
20
Introduction
transduction pathway leading to cell growth. In breast cancer approximately 30%
have an amplification of HER2/neu gene or overexpression of its protein product,
giving higher aggressiveness, increased disease recurrence and worse prognosis of
breast cancer patients.
1.4.7. p53
p53 is a tumor suppressor protein that regulates the cell cycle and plays a role in
genetic stability and inhibition of angiogenesis; it exerts its anti-cancer role through
several mechanisms (activates DNA repair proteins, induces growth arrest and
initiates apoptosis). More than 50% of human tumors contain mutations or deletions
of the TP53 gene. While the prognostic and predictive value of p53 is still matter of
debate, there is an increased interest for p53-based therapies.
1.4.8. BRCA1 and BRCA2
BRCA1 and BRCA2 are two tumor suppressor genes with several functions such as
repair DNA double-strand breaks, protein ubiquitylation and cell cycle checkpoint
control. Germ line mutations of these two genes confer strong lifetime risks of breast
cancer and the risks are influenced by the position of mutation within the gene
sequence (Easton, 1997). Researchers have identified hundreds of mutations in the
BRCA1 and BRCA2 genes, many of which are associated with an increased risk of
cancer. Women with a family history of breast cancer are screened for mutations in
their BRCA1 and BRCA2 genes.
21
Introduction
1.4.9. EGFR
The Epidermal Growth Factor Receptor (EGFR) is a cell-surface receptor for
members of epidermal growth factor family (EGF-family) of extracellular protein
ligands. The binding by ligands activates EGFR dimerization and stimulates intrinsic
intracellular protein-tyrosine kinase activity. The downstream signaling proteins
initiate several signal transduction cascades, principally MAPK, Akt and JNK
pathways leading to DNA synthesis and cell proliferation.
The expression of EGFR in models of breast cancer is associated with increased
proliferation and resistance to apoptosis and with poorer prognosis. Mutations that
lead to EGFR overexpression or over-activity have been associated with breast
cancer: it is overespressed in 35-60% of breast cancers.
1.5. TYPES AND SUBTYPES
The normal female adult breast consists of a mixture of epithelial and stromal
elements. The epithelial elements of the breast contain a series of branching ducts,
which extends from the nipple, and terminates into the functional units of the breast,
the lobules (DiSaia, 1993). Each breast is composed of 15-20 lobules, containing a
cluster of alveoli, which are responsible for the secretion of milk during lactation.
The stroma contains variable amounts of interspersed adipose tissue and fibrous
connective tissue, which constitutes most of the breast volume in a non-lactational
state (Carola et al., 1992; DiSaia, 1993).
The two most common types of breast cancer are named after the parts of the breast
in which they start (Figure 5):
22
Introduction
Figure 5. Anatomy of breast
● Ductal Carcinoma in situ (DCIS): it is the most common type of non invasive
breast cancer, in fact between 85% and 90% of all breast cancers are ductal. It starts
inside the milk ducts, beneath the nipple and areola and it is well contained, hasn‟t
spread beyond the milk duct into any normal surrounding breast tissue, and it can be
very successfully treated. The DCIS cancers have a higher risk for recurrence (most
recurrences happen within the 5 to 10 years after initial diagnosis and the chances of
a recurrence are under 30%) and for developing a new breast cancer.
● Lobular Carcinoma: about 8% of breast cancers are lobular. LCIS begins in the
lobes, or glands which produce milk in the breast and the cancer is limited within the
lobe and has not spread to surrounding tissues. Despite the fact that its name includes
the term “carcinoma,” LCIS is not a true breast cancer. Rather, LCIS is an indication
that a person is at higher-than-average risk for getting breast cancer at some point in
the future. LCIS is usually diagnosed often between the ages of 40 and 50.
These two cancer types are usually removed during a lumpectomy if the tumor
margins are clear of cancer, follow-up treatment may include radiation. If ductal
23
Introduction
cancer has broken into nearby breast tissue (invasive cancer) then a mastectomy may
be needed, and also chemotherapy.
Second most common is a group of breast cancers that invade nearby tissue:
● Invasive (Infiltrating) Breast Cancer has the potential to spread out of the
original tumor site and to invade other parts of your breast, the lymph nodes and
other areas of the body. There are several types and subtypes of invasive breast
cancer such as invasive ductal carcinoma and invasive lobular carcinoma. The
treatments fall into two broad categories: local (surgery and radiation) or systemic
(chemotherapy, hormonal and target therapy).
Other breast cancer types are:
● Inflammatory Breast Cancer: is the least common (1-5% of all breast cancer),
but most aggressive of breast cancers, taking the form of sheets or nests, instead of
lumps. It can start in the soft tissues of the breast, just under the skin, or it can appear
in the skin. Unlike ductal and lobular cancers, it is treated first with chemotherapy
and then with surgery. When caught early, inflammatory breast cancer can be a
manageable disease, and survival rates are increasing.
● Paget's disease of the nipple/areola is a rare form of breast cancer, often looks
like a skin rash, or rough. The itching and scabs are signs that cancer may be under
the surface of the skin, and is breaking through. The cancer usually affects the ducts
of the nipple first (small milk-carrying tubes), then spreads to the nipple surface and
the areola. The disease usually develops after age 50 and is usually treated with a
mastectomy, because the cancer has by then invaded the nipple, areola, and the milk
ducts.
24
Introduction
● Rare types of breast cancer include:
- Medullary breast cancer (5%)
- Mucinous (mucoid or colloid) breast cancer (2%)
- Tubular breast cancer (1%)
- Adenoid cystic carcinoma of the breast (1%)
- Metaplastic breast cancer (is a mixture of two cell types; 1%)
Human breast cancer is a heterogeneous disease, encompassing a number of distinct
biological
entities
that
are
associated
with
specific
morphological
and
immunohistochemical features and clinical behavior and, therefore, no golden
standard therapy exists suitable for all tumors of the mammary gland (Lacroix et al.,
2004). For many decades, breast carcinomas were only classified according to
histological type, grade, and expression of hormone receptors as described above.
However, this classification proved to be limiting for it was unable to define
subgroups sharing similar prognostic and therapeutic aspects. A more recent
approach to classify breast cancer subgroups is gene expression profiling, based on
cDNA microarrays (Care et al., 2006; Sorlie et al., 2001), which suggests the
presence of multiple molecular subtypes of breast cancer. Based on transcriptomic
similarity, breast carcinomas can be distinguished into five “intrinsic” main distinct
subtypes:
- Luminal A (ER positive, and/or PR positive, HER2 negative)
- Luminal B (ER positive and/or PR positive, HER2 positive)
- Triple negative (or also basal like) (ER negative, PR negative, HER2 negative)
- HER2 positive (ER negative, PR negative, HER2 positive)
- Normal Breast-like
25
Introduction
Known as the „intrinsic subtypes of breast cancer‟, these groups of tumors have
revealed critical differences in incidence (Millikan et al., 2008), survival (Cheang et
al., 2009; Hu et al., 2006), and response to treatment (Prat et al., 2010; Nielsen et al.,
2010). For example, luminal tumors have been associated with the most favorable
prognoses, while HER2-overespressing and triple-negative have been associated with
the worst prognoses.
1.5.1 TRIPLE-NEGATIVE BREAST CANCER
Triple-negative breast cancers (TNBC) account for 10–17% of all breast carcinomas
(Reis-Filho and Tutt, 2008) are reported to be more commonly seen in younger
women, often in pre-menopausal women (<50 years), of African-American and
Hispanic ethnicity (Morris et al., 2007), with BRCA1 mutations (Dent et al., 2007),
an increased body weight (Trivers et al., 2009). It have been characterized by several
aggressive clinicopathologic features including higher mean tumor size, higher
histologic grade tumors, elevated mitotic count, ductal or mixed histology, and, in
some cases, a higher rate of node positivity (Dent et al., 2007; Irvin and Carey,
2008). TNBC have a worse prognosis than the other breast cancer subtypes, high
recurrence, occurring within three years of diagnosis and mortality rates are
increased for five years after diagnosis, and development of recurrence and distant
metastasis with a specific metastatic pattern (meninges, brain, liver and lung) (Rakha
et al., 2007). Due to the absence of hormone receptors and HER2 expression, these
tumors cannot take advantage from the endocrine therapy or trastuzumab treatment,
chemotherapy remaining the only potential adjuvant therapeutic approach. As far as
sensitivity to chemotherapy is concerned, the TNBCs exhibit higher rates of
26
Introduction
objective response to neoadjuvant chemotherapy than other tumor types (Reis-Filho
and Tutt, 2008), thus suggesting that biological features present more frequently in
this group are responsible for the increased sensitivity to chemotherapy. In general,
adjuvant therapeutic options for TNBC can be divided into two groups: cytotoxic
agents (as anthracycline agents or platinum-containing agent) and targeted therapies
(as PARP1 and EGFR or VEGF inhibitors). Although triple-negative cancers are
report to have excellent response rates to neoadjuvant chemotherapy (Rouzier et al.,
2005), survival of patients with such tumors is still poor and their management may
therefore require a more aggressive alternative intervention and it remains an urgent
need to understand the molecular and biological features of these tumors in order to
develop novel therapeutic strategies to improve their clinical outcome.
1.6. THERAPY
The mainstay of breast cancer is surgery when the tumor is localized, followed by
chemotherapy, radiotherapy and hormonal therapy for ER positive tumor, depending
on clinical criteria. Treatments are given with increasing aggressiveness according to
the prognosis and risk of recurrence.
1.6.1 Surgery
Surgery is usually the first line of attack against breast cancer. Some of the lymph
nodes under the arm are usually taken out and looked at under a microscope to see if
they contain cancer cells. Several types of surgery exist to remove breast cancer.
Breast-conserving surgery, an operation to remove only the cancer but not the breast
itself, includes the following:
27
Introduction

Lumpectomy: Surgery to remove a tumour (lump) and a small amount of normal
tissue around it.

Partial mastectomy: Surgery to remove the part of the breast that has cancer and
some normal tissue around it.
Other types of surgery include the following:

Total mastectomy: Surgery to remove the whole breast that has cancer. Some of
the lymph nodes under the arm may be removed for biopsy.

Modified radical mastectomy: Surgery to remove the whole breast that has
cancer, many of the lymph nodes under the arm, the lining over the chest
muscles, and sometimes, part of the chest wall muscles.

Radical mastectomy: Surgery to remove the breast that has cancer, chest wall
muscles under the breast, and all of the lymph nodes under the arm
Radiation therapy
Radiation therapy is a cancer treatment that uses high-energy x-rays or other types of
radiation (gamma rays). This radiation is very effective in killing cancer cells that
may remain after surgery or recur where the tumor was removed.
There are two types of radiation therapy. External radiation therapy uses a machine
outside the body to send radiation toward the cancer. Internal radiation therapy (or
brachytherapy) uses a radioactive substance sealed in needles, seeds, wires, or
catheters that are placed directly into or near the cancer. The way the radiation
therapy is given depends on the type and stage of the cancer being treated. Although
radiation therapy can reduce the chance of breast cancer recurrence, it is much less
effective in prolonging patient survival. According to a review of six studies by the
28
Introduction
United States' National Cancer Institute, none of them found a survival benefit for
radiation therapy (Porter et al., 1993).
Chemotherapy
Chemotherapy is a cancer treatment that uses drugs to stop the growth of cancer
cells. The mechanism of action of chemotherapy is to destroy fast growing or fast
replicating cancer cells either by causing DNA damage upon replication or other
mechanisms; these drugs also damage fast-growing normal cells where they cause
serious side effects. Chemotherapy is used to treat: early-stage invasive breast cancer
to get rid of any cancer cells that may be left behind after surgery and to reduce the
risk of the cancer coming back; advanced-stage breast cancer to destroy or damage
the cancer cells as much as possible. In some cases, chemotherapy is given before
surgery to shrink the cancer.
When chemotherapy is taken by mouth or injected into a vein or muscle, the drugs
enter the bloodstream and can reach cancer cells throughout the body (systemic
chemotherapy). When chemotherapy is placed directly into the cerebrospinal fluid,
an organ, or a body cavity such as the abdomen, the drugs mainly affect cancer cells
in those areas (regional chemotherapy). The way the chemotherapy is given depends
on the type and stage of the cancer being treated. Some protocols call for a cycle of
treatment every three weeks; others may be more frequent.
It predominately is used for stage 2-4 disease, but may also be used to treat types of
early-stage breast cancer. Many different types of chemotherapy drugs are used to
treat this cancer and often they are administered in combination (regimen).
29
Introduction
One of the most common treatments is cyclophosphamide plus doxorubicin
(Adriamycin), known as AC. Sometimes a taxane drug, such as docetaxel, is added,
and the regime is then known as CAT; taxane attacks the microtubules in cancer
cells. Another common treatment, which produces equivalent results, is
cyclophosphamide, methotrexate, and fluorouracil, known as CMF.
Hormone therapy
Hormones are substances produced by glands in the body and circulated in the
bloodstream. Some hormones can cause certain cancers to grow. Hormonal therapy
medicines treat hormone-receptor-positive breast cancers in two ways: by lowering
the amount of the hormone estrogen in the body or by blocking the action of estrogen
on breast cancer cells, stopping their growth.
If tests show that the cancer cells have places where hormones can attach (receptors),
drugs, surgery, or radiation therapy are used to reduce the production of hormones or
block them from working. The hormone estrogen, which makes some breast cancers
grow, is made mainly by the ovaries. Treatment to stop the ovaries from making
estrogen is called ovarian ablation.
Hormone therapy with tamoxifen is often given to patients with early stages of breast
cancer and those with metastatic breast cancer. Hormone therapy with tamoxifen or
estrogens can act on cells all over the body and may increase the chance of
developing endometrial cancer. Hormone therapy with an aromatase inhibitor is
given to some postmenopausal women who have hormone-dependent breast cancer.
Hormone-dependent breast cancer needs the hormone estrogen to grow. Aromatase
inhibitors decrease the body's estrogen by blocking an enzyme called aromatase from
30
Introduction
turning androgen into estrogen. For the treatment of early stage breast cancer, certain
aromatase inhibitors may be used as adjuvant therapy instead of tamoxifen.
Targeted therapy
Targeted therapy is a type of treatment that uses drugs or other substances to identify
and attack specific cancer cells without harming normal cells. Monoclonal antibodies
and tyrosine kinase inhibitors are two types of targeted therapies used in the
treatment of breast cancer.
Monoclonal antibody therapy is a cancer treatment that uses antibodies made in the
laboratory, from a single type of immune system cell. These antibodies can identify
substances on cancer cells or normal substances that may help cancer cells grow. The
antibodies attach to the substances and kill the cancer cells, block their growth, or
keep them from spreading. Monoclonal antibodies are given by infusion. They may
be used alone or to carry drugs, toxins, or radioactive material directly to cancer cells
ant they may be used in combination with chemotherapy as adjuvant therapy.
Trastuzumab (Herceptin) is a monoclonal antibody that blocks the effects of the
growth factor protein HER2, which sends growth signals to breast cancer cells.
About one-fourth of patients with breast cancer have tumors that may be treated with
trastuzumab combined with chemotherapy.
Another important monoclonal antibody used for the antiangiogenic therapy is
Bevacizumab that blocks the VEGF receptor protein, which is involved in forming
tumor blood vessels.
Tyrosine kinase inhibitors are targeted therapy drugs that block signals needed for
tumors to grow. Also tyrosine kinase inhibitors may be used in combination with
31
Introduction
other anticancer drugs as adjuvant therapy. Lapatinib is a tyrosine kinase inhibitor
that blocks the effects of the HER2 protein and other proteins inside tumor cells. It
may be used to treat patients with HER2-positive breast cancer that has progressed
following treatment with trastuzumab.
PARP inhibitors are a type of targeted therapy that block DNA repair and may cause
cancer cells to die. PARP inhibitor therapy is being studied for the treatment of
triple-negative breast cancer.
Stage 1 cancers (and DCIS) have an excellent prognosis and are generally treated
with lumpectomy and sometimes radiation. HER2+ cancers should be treated with
the trastuzumab (Herceptin) regime (Gonzalez-Angulo et al., 2009) chemotherapy is
uncommon for other types of stage 1 cancers. Stage 2 and 3 cancers with a
progressively poorer prognosis and greater risk of recurrence are generally treated
with surgery (lumpectomy or mastectomy with or without lymph node removal),
chemotherapy (plus trastuzumab for HER2+ cancers) and sometimes radiation
(particularly following large cancers, multiple positive nodes or lumpectomy). Stage
4, metastatic cancer, (i.e. spread to distant sites) has poor prognosis and is managed
by various combination of all treatments from surgery, radiation, chemotherapy and
targeted therapies.
32
Introduction
2. CHEMOTHERAPY
2.1. FEATURES
Chemotherapy for the treatment of cancer was introduced into the clinic more than
fifty years ago. Chemotherapy refers to antineoplastic drugs or chemical used to treat
cancer. Chemotherapeutic drugs acts by killing cells that divide rapidly, one of the
main properties of most cancer cells. Since malignant cells divide without control or
order, these drugs effectively target cancerous growths. Ideally, chemotherapeutic
drugs should specifically target only neoplastic cells and should decrease tumor
burden by inducing cyto-endotoxic and/or cytostatic effects with minimal “collateral
damage” to normal cells. Indeed, chemotherapy inadvertently also harms healthy
cells that divide rapidly under normal circumstances: cells in the bone marrow,
digestive tract and hair follicles; this results in the most common side effects of
chemotherapy: myelosuppression (decreased production of blood cells, hence also
immunosuppression), mucositis (inflammation of the lining of the digestive tract),
and alopecia (hair loss).
There are various types of cancer those need different type of drugs that kill cancer
cell in different ways at various phases in the cell cycle. Depending on the type, size,
and location of the cancer, as well as your overall health, there are different strategies
in the administration of chemotherapeutic drugs:
● Neoadjuvant Chemotherapy: refers to the administration of therapeutic agents
prior to the main treatment, that usually it is the surgery. The aim is to reduce the size
or extent of the cancer before employing radical treatment intervention, thus making
procedures easier and more likely to be successful, and reducing the consequences of
a more extensive treatments technique.
33
Introduction
● Adjuvant chemotherapy: refers to additional treatment, usually given after
primary therapy (surgery or radiotherapy) where all detectable disease has been
removed, but where there remains a statistical risk of relapse due to occult disease.
This treatment strategy permit to kill any remaining cancer cells in the body.
● Palliative chemotherapy: is given to patients who develop metastatic disease
(cancer that spreads throughout the body) which are generally not curable. New
advances in drug therapies, however, can help shrink tumors, prolong survival, and
improve quality of life. Palliative treatments are also used to help relieve cancerrelated symptoms, improving the patient‟s quality of life.
First line chemotherapy is treatment with chemotherapeutic drugs that has, through
research studies and clinical trials, been determined to have the best probability of
treating a given cancer. This may also be called “standard therapy”.
Second line chemotherapy: is chemotherapy that is given if a disease has not
responded or reoccurred after first line chemotherapy. In some cases, this may also
be referred to as “salvage therapy”.
Multiple chemotherapeutic agents may be used in combination to treat patients with
breast cancer. Determining the appropriate regimen to use depends on many factors;
such as, the character of the tumor, lymph node status, and the age and health of the
patient. In general, chemotherapy has increasing side effects as the patient's age
passes.
34
Introduction
2.2. CHEMOTHERAPEUTIC DRUGS ANS MECHANISM OF
ACTION
Currently there are many drugs, about a hundred, which can be used in cancer
treatment. The majority of chemotherapeutic drugs can be divided into:
Alkylating agents: are drugs that act directly on DNA, causing cross-linking of
DNA strands, abnormal base pairing, or DNA strand breaks, thus preventing the cell
from dividing. Alkylating agents are generally considered to be cell cycle phase nonspecific, meaning that the kill the cell in various and multiple phases of the cell
cycle. Although alkylating agents may be used for most types of cancer, they are
generally of greatest value in treating slow-growing cancers. Examples of these
drugs are:
- classical alkylating agents, that are drugs with true alkyl groups, which including
three subgroups: nitrogen mustards such as cyclophosphamide and melphalan,
nitrosoureas such as carmustine, and alkyl sulfonates such as busulfan;
- alkylating-like agents that are platinum-based drugs, don‟t have an alkyl group but
nevertheless damage DNA (Cruet-Hennequart et al., 2008) and including cisplatin,
oxaliplatin and carboplatin.
Antimetabolites: are chemical that interfere with the formation or use of a normal
cellular metabolites, interfering with DNA or RNA production and therefore cell
division and the tumor growth. Antimetabolites are cell cycle specific, in fact they
are most effective during S-phase of cell division because they primarily act upon
cells undergoing synthesis of new DNA for formation of new cells. Indeed
35
Introduction
antimetabolites masquerade as a purine or a pyrimidine chemicals which become the
building blocks of DNA and they prevent these substance becoming incorporated in
to DNA during S phase stopping normal development and division. The toxicities
associated with these drugs are seen in cells that are growing and dividing quickly.
Examples of antimetabolites include:
- purine antagonists (act by mimicking the structure of metabolic purines) such as 6mercaptopurine;
- pyrimidine antagonists (act by mimicking the pyrimidine structures) such as 5fluorouracil, Gemcitabine and Cytarabine;
- folate antagonists (impair the acid folic function) such as Methotrexate.
Methotrexate is one of the most commonly used chemotherapy agents and works on
the S-phase of the cell cycle. It is an analogous of folic acid and acts by inhibiting
dihydrofolate reductase (DHFR) and, therefore, the metabolism of folic acid required
for DNA synthesis and also for RNA and proteins.
5-Fluorouracil (or 5-FU) is a pyrimidine analogous which works through non
competitive inhibition of thymidylate synthase, blocking the synthesis of the
thymidine required for DNA replication, inducing cell cycle arrest.
Anti-tumor antibiotics: have several mechanisms of action to block cell growth, by
interfering with DNA and RNA synthesis, and they work in all phase of the cell
cycle. Example of anti-tumor antibiotics including:
- anthracyclines (act by inhibiting DNA and RNA synthesis by intercalating between
base pairs of DNA/RNA strand preventing the replication of rapidly-growing
cancer cells or by creating iron-mediated free oxygen radicals that damage the DNA
36
Introduction
and cell membranes) that include doxorubicin;
- actinomycins (act by binding DNA at the transcription initiation complex
preventing the elongation by RNA polymerase) including actinomycin-D;
- bleomycins (act by inducing DNA strand breaks).
Doxorubicin (or also Adriamycin) is used to treat wide range of cancer (carcinomas,
sarcomas and hematological malignancies) and acts with DNA by intercalation
(Fornari et al., 1994) and by inhibition of macromolecular biosynthesis (Momparler
et al., 1976). Doxorubicin stabilizes the topoisomerase II complex preventing the
DNA double helix from being released and thereby stopping the process of
replication.
Mitotic inhibitors are drugs derived from plants and other natural products that
block cell division by preventing microtubule functions during mitosis. Microtubules
are polymers made of tubulin protein. They are created during normal cell functions;
they move and separate the chromosomes and other components of the cell for
mitosis. Therefore they are vital for cell division and, without them, cell division
cannot occur, triggering the apoptosis. These drugs interfere with the assembly and
disassembly of tubulin into microtubules and act primarily during M-phase of cell
cycle, but they can also do so in all phases. The main examples are:
- vinca alkaloids derived from periwinkle plant, vinca rosea (act by binding to
specific sites on tubulin inhibiting the assembly of tubulin into microtubules) such
as Vincristine;
- taxanes derived from Pacific yew tree (act by destroying the microtubule function
preventing the separation of chromosomes during anaphase) including paclitaxel;
37
Introduction
- podophyllotoxins extracted from American May Apple tree (prevent the cell from
entering the G1 phase and the replication of DNA and is the pharmacological
precursor for etoposide agent).
Topoisomerase inhibitors: are agents designed to interfere with the action of
topoisomerase enzymes (I and II), which are enzymes that control the changes in
DNA structure, maintaining the topology of DNA and control the integrity of the
genetic material during transcription, replication and recombination processes during
the normal cell cycle. Topoisomerase inhibitors interfere with both transcription and
replication of DNA, by upsetting proper DNA supercoiling, and can be divided
according to which type of enzyme they inhibit:
- topoisomerase I inhibitors such as irinotecan, topotecan and camptothecin;
- topoisomerase II inhibitors including etoposide and mitoxantrone.
Hormone therapy
Drugs in this category are sex hormones, or hormone-like drugs, that alter the action
or production of female or male hormones. The concept of this therapy is that the
cancer cells of an organ sensitive to hormones may be subjected to hormonal control
and an altered hormonal environment, blocking use of hormones or preventing the
body from making them, inhibition produces a remission of tumor.
There are several types of hormonal therapy including:
- aromatase inhibitors (work blocking the enzyme aromatase which turns the
hormone androgen into small amounts of estrogen in the body) such as letrozole;
- selective estrogen receptors modulators (SERMs) (work by sitting in the estrogen
38
Introduction
receptors of cancer cells and so estrogen can‟t attach to the cell and this can‟t grow)
such as tamoxifen;
- estrogen receptor downregulators (ERDs) (enter in the estrogen receptors of cell
and so estrogen cannot attach to the cell and the cell can‟t grow but also it reduce
the number of estrogen receptors) such as fulvestrant.
Some of the abbreviations used for chemotherapy drug combinations (regimens)
refer to drug classes rather than drug names. For example, regimens that contain an
anthracycline drug (such as doxorubicin) use the letter "A," and regimens that
contain a taxane drug (such as docetaxel) use the letter "T." Cyclophosphamide
(Cytoxan), fluorouracil (5-FU), and methotrexate (MTX) are standard cancer drugs
used in many breast cancer chemotherapy regimens.
Chemotherapy regimens usually consist of 4-6 cycles of treatment given over 3-6
months. Common chemotherapy regimens for early-stage breast cancer include:

AC (Doxorubicin and cyclophosphamide)

AC followed by T (Doxorubicin and cylophosphamide followed by
paclitaxel)

CAF (Cyclophosphamide, doxorubicin, and 5-FU)

CMF (Cyclophosphamide, methotrexate, and 5-FU)

TAC (Docetaxel, doxorubicin, and cyclophosphamide
39
Introduction
3. CELL CYCLE
3.1. CELL CYCLE AND CANCER
More than 50 years have passed since Howard and Pele in 1951 first described the
cell cycle and its phases. Nevertheless, there are only more recent studies that have
revealed that the cell cycle is a highly conserved and ordered set of events,
culminating in cell growth and division. Cell cycle is tightly controlled by many
regulatory mechanisms that either permit or restrain its progression (Gali-Muhtasib
and Bakkar, 2002). Therefore, cell cycle is a process in which it grows and divides to
create two genetically identical cells. In mammalian cells, the whole cell cycle takes
around 24 hours from start to finish. Some cells, such as skin cells, are constantly
going through the cell cycle while other cells may divide rarely as the neurons that
don‟t grow and divide. The basic cell cycle consists of four distinct phases (Figure
6):
Figure 6. Phases of cell cycle
- G1 phase (the interval between the M phase and the beginning of S phase) in
40
Introduction
which cells respond to extracellular cues that ultimately determine whether cells
will make the decision to replicate DNA and divide or, alternatively, to exit the cell
cycle into a quiescent state (G0). G1 phase is characterized by metabolic changes
that prepare the cell for division; in fact this phase is marked by synthesis of various
enzymes that are required in S phase, mainly those needed for DNA replication.
Duration of G1 is highly variable, even among different cells of the same species
(Smith and Martin, 1973)
- S phase (S for synthesis) in which the genetic material is duplicated (each
chromosome now consist of two sister chromatids);
- G2 phase (the interval between the end of S phase and the beginning of M phase)
in which metabolic changes assemble the cytoplasmic materials necessary for
mitosis and cytokinesis;
the period between mitotic division, which consists of G1, S, G2 phases, is known
as interphase;
- M phase (M for mitosis) in which phase a nuclear division (mitosis) is followed by
a cell division (cytokinesis) (Gorbsky, 1997).
Mitosis is conventionally divided into five stages (Figure 7):
41
Introduction
Figure 7. Steps in mitosis
- prophase: in which the nuclear membrane breaks and the centrosome duplicate
itself to form two daughter centrosome that migrate to opposite ends of the cell; the
centrosomes organized the production of microtubules that form the spindle fibers
that constitute the mitotic spindle; each replicated chromosome can now be seen to
consist of two identical chromatids, or sister chromatids, held together by the
centromere;
- prometaphase: in which the chromosome migrate to the equatorial plane in the
midline of cell, in the metaphase plate;
- metaphase: in which the chromosome align themselves along the metaphase plate
of the spindle apparatus;
- anaphase: in which the centromeres divide and the sister chromatids are pulled
apart and pulled in opposite sides of the cell;
- telophase: in which the nuclear envelope reassembles around the two new set of
separate chromosome to form two nuclei;
42
Introduction
Cytokinesis is the time in which the other components of the cell (membranes,
cytoskeleton, organelles) are distributed to the two daughter cells.
When cells cease proliferation, either due to specific antimitogenic signals or to the
absence of proper mitogenic signalling, they exit the cycle and enter a non-dividing,
quiescent state known as G0.
Activation of each phase is dependent on the proper progression and completion of
the previous one. In the typical dividing eukaryotic cell, G1 phase lasts
approximately 15 hours, S phase 6 to 8 hours, G2 phase 3 to 6 hours, and mitosis
about 30 minutes, although the exact length of each phase varies with the cell type
and growth conditions (Pardee et al., 19878; Murray and Hunt T, 1993).
In the cell, there are control systems, independent by cell cycle events, that operate
even if those events fail or in response to genetic damage. Both intracellular
(oncogenes and anti-oncogenes) and extracellular (environmental signals, growth
factors) inputs trigger molecular events that regulate normal progress through the
stages of the cell cycle.
The main families of intrinsic regulatory proteins that play key roles in controlling
cell cycle progression are the cyclin-dependent kinases (CDKs), cyclins, CDK
inhibitors (CDKIs) and are actively involved two tumor suppressor protein, p53 and
pRb (Gali-Muhtasib and Bakkar, 2002).
The cyclin-dependent kinase (CDK) is a family of serine/threonine protein kinases
(Morgan, 1997) that regulates cell cycle and mRNA transcription and processing. All
CDKs share the feature that their enzymatic activation requires the binding of a
specific regulatory cyclin subunit (Table 2).
43
Introduction
Phase
Cyclin
CDK
G0
C
CDK3
G1
D,E
CDK4, 2, 6
S
A,E
CDK2
G2
A
CDK2,1
M
B
CDK1
Table 2. Cyclins and CDKs by cell cycle phase
CDK regulators can also control cell-cycle commitment: they include activators,
mainly the cyclins, and inhibitors, generically known as CDKI.
The cyclins are a family of proteins centrally involved in cell cycle regulation and
structurally identified by conserved „cyclin box‟ regions.
Cyclins are regulatory subunits of holoenzyme CDK complexes controlling
progression through cell cycle checkpoints by phosphorylation and inactivating
target substrates and they are so named because their concentration varies in a
cyclical fashion during the cell cycle (Figure 8).
Figure 8. Expression of human cyclins through the cell cycle
44
Introduction
There are several different cyclins that are active in different parts of the cell cycle
and that cause the CDK to phosphorylate different substrates. There are also several
"orphan" cyclins for which no Cdk partner has been identified.
There are two main groups of cyclins:
◊ G1-S cyclins: these ccyclins rise in late G1 and fall in early S phase. The CdkG1/S cyclin complex begins to induce the initial processes of DNA replication,
primarily by arresting systems that prevent S phase Cdk activity in G1; they are
Cyclins D and E involved in the transition from G1 to S phase (bind to CDK4 an
CDK 6) and Cyclins A, active in S-phase (bind to CDK2);
◊ G2/M cyclins: M cyclin concentrations rise as the cell begins to enter mitosis and
the concentrations peak at metaphase. Cell changes in the cell cycle like the
assembly of mitotic spindles and alignment of sister-chromatids along the spindles
are induced by M cyclin-CDK complexes. The destruction of M cyclins during
anaphase causes the exit of mitosis and cytokinesis. They are Cyclins B (bind to
CDK1).
The CDK inhibitors (CDKI) are protein that that serve as negative regulators of the
cell cycle and stop the cell from proceeding to the next phase of the cell cycle,
interacting with the cyclin-CDK complex blocking the kinase activity. There are two
major CDKI families: the INK4 family (named for their ability to inhibit CDK4),
comprising four members (p16
Ink4a
, p18 Ink4c, p15
Ink4b
, p19Ink4d) which inhibit the
activity of cyclin D-dependent kinases to prevent the phosphorylation of pRb family
proteins and Cip/Kip family comprising three members (p21Cip1, p27 Kip1, p57 Kip2).
45
Introduction
In addition to intrinsic controls, many external controls affect cell division. For
example, the hormone estrogen affects the development of a wide variety of cell
types in women and it exerts its effects on a receptive cell by binding to a specific
receptor protein on the cell's nuclear membrane, initiating a cascade of biochemical
reactions that lead to changes in the cell-cycle program. Also growth factors, such as
TGF-β, PDGF, EGF and IL-2, stimulate cell proliferation and cell cycle progression.
The independence from specific growth factors is a common occurrence in
transformed cells, which leads to a growth advantage on normal cells (Baserga et al.,
1993).
To ensure proper progression through the cell cycle, cells have developed a series of
checkpoints that prevent them from entering into a new phase until they have
successfully completed the previous one (Hartwell and Weinert, 1989). It is likely
that newly divided or quiescent cells must also pass certain checkpoints before they
can enter the cycle. For instance, cells must make sure that they have reached their
homeostatic size, otherwise cells will become smaller with each round of division.
The checkpoints are three in the normal cells:
- the G1-S checkpoint (or Start or restriction point) is located between mid and late
G1 phase, just before entry into S phase. This is the point at which the cell ascertains
whether it has received the necessary growth signals so that it can pass out of G1 into
S phase, replicates its DNA and completes one round of cell division (Planas-Silva
and Weinberg, 1997). If the cell has not received the appropriate cues, it will not pass
the restriction point and will instead enter G0.
46
Introduction
The cell may also arrest later in S phase due to incomplete DNA replication or DNA
damage. The main controllers of this restriction point, which are pRb (retinoblastoma
protein), p53, p16INK4a, be discussed in detail in the next section;
- the G2 checkpoint is located at the end of G2 phase, controlling the triggering of
M phase. This point monitors the fidelity of DNA replication and is also an important
sensor of DNA damage;
- the metaphase checkpoint (or spindle checkpoint) is activated during mitosis and
control appropriate formation of spindle microtubule structure, chromosome
alignments, sister-chromatids segregation, and completion of mitosis and cytokinesis.
If these cell cycle checkpoints are not in place then inappropriate proliferation can
occur, which is one of the hallmarks of cancer. Several genes encoding regulatory
activities that govern the cell cycle are targets for genetic and epigenetic alterations
that underlie the development of many human cancers (Sherr, 1996). Molecular
analysis of human tumours has shown that cell-cycle regulators are frequently
mutated in human neoplasias (Figure 9), underscoring the importance of cell-cycle
regulation in the prevention of cancer. These alterations include overexpression of
cyclins (i.e. D1 and E1) and CDKs (i.e. CDK4 and CDK6), as well as loss of CDKI
(i.e. p16, p15 and p27) and pRb expression. Tumour-associated changes in the
expression of these regulators frequently result from chromosome alterations
(amplification of cyclin D1 or CDK4, translocation of CDK6 and deletions of INK4
proteins or pRb) or epigenetic inactivation (methylation of INK4 or RB1 promoters)
(Sherr, 2000; Wölfel et al., 1995).
47
Introduction
Figure 9. Mutations of G1-S regulators in human cancer
3.2. THE p53, pRb AND p16INK4a PATHWAYS IN CANCER
Most, if not all, human cancers contain genetic alterations in the p53, pRb and
p16INK4a tumor suppressor pathway (Hanahan and Weinberg, 2000).
The p53 tumour suppressor (known as “the guardian of genome”) is a transcription
factor responsible for the blockage of the cell cycle at the G1/S and G2/M
checkpoints and/or inducing apoptosis in proliferating cells that are subjected to a
variety of stressful events.
p53 belongs to a small family of related proteins that includes two other members:
p63 and p73. Although structurally and functionally related, p63 and p73 have clear
roles in normal development (Irwin, M. S. & Kaelin, W. G. p53 family update: p73
and p63 develop their own identities. Cell Growth Differ. 12, 337–349 (2001).),
48
Introduction
whereas p53 seems to have evolved in higher organisms to prevent tumour
development. The steady state level of p53 is low in the absence of cellular stress and
its turnover rate is rapid (less than 30 minutes). However, in response to a variety of
stress signals, both intrinsic and extrinsic, the p53 protein is activated and, in turn, it
can induce its downstream pathway. Gamma or UV radiation, alkylation or
depurination of DNA, reaction with oxidative free radicals, ribosomal stress,
oncogene activation, chemotherapeutic agents, altering DNA in different ways, but
also hypoxia, microtubule disruption and loss of normal cell contacts cause damages
and different repair mechanisms are employed by the cell. In each case, the damage
activates and stabilizes p53, which migrates to the nucleus. These effects are
determined by post-translational modifications of p53, such as phosphorylation,
acetylation, methylation, ubiquitination or sumolation (Figure 10) (Appella and
Anderson, 2001).
Figure 10. Diversity of cancer-related signals that activate p53 contributes to the central role the
p53 protein as a tumor suppressor.
49
Introduction
Different types of DNA damage activate different enzyme activities that modify the
p53 protein on different amino-acidic residues. These modifications alter the p53
protein in two ways: first, by increasing the half-life of p53 in the cell (from 6-20
minutes to 1 hours), and this results in a 3-10 fold increase in p53 protein quantity in
the cell; second, by enhancing the ability of p53 to bind to DNA sequences.
In fact, once that p53 is activated, it binds to specific DNA sequences and activates
genes that are part of one of three stress response programs: cell cycle arrest (such as
p21, GADD45 genes) to buy time to repair the DNA damage, cellular apoptosis
(such as Bax, Puma genes), the programmed cell death when DNA damage proves to
be irreparable, senescence (such as CSPG2 gene) promoting irreversible growth
arrest (Figure 11) (Balint and Vousden, 2002; Giaccia and Kastan, 1998).
Figure 11. Downstream targets of the p53 transcription factor mediate its different biological
outcomes.
50
Introduction
One of the genes induced by p53 is p21, which play a pivotal role in G1 arrest by
inhibiting cyclin D-CDK4/6 activity, reducing the pRb phosphorylation and blocking
cell cycle.
Furthermore, p53 is regulated by different regulatory mechanisms. The p53 is a
short-lived protein, its level kept low in most normally proliferating cells by rapid
protein degradation. One of the key components regulating p53 stability is MDM2
(murine double minutes 2), a protein that functions as an ubiquitin ligase for p53,
promoting the rapid degradation of p53 via the ubiquitin-proteasome pathway
(Kubbutat et al., 1997). MDM2 is also a transcriptional target of p53 and therefore it
functions in a negative regulatory feedback loop in which p53 activates the
expression of MDM2, which in turn inactivates p53 by targeting p53 for degradation
(Momand et al., 1992). Therefore, the function of p53 is to prevent the propagation
of abnormal cells at risk of becoming cancer cells, blocking their cell cycle
progression. The loss of p53 function occurs in > 50% of human cancer, thus
representing the most frequent gene alteration in cancers (Harris and Levine, 2005;
Vousden and Lu, 2002), by various mechanisms, including lesions that prevent
activation of p53, missense, deletions and insertions mutations within the TP53 gene
(which encodes p53) itself or mutations of downstream mediators of p53 function.
In human breast tumors p53 gene mutation is the most common genetic alterations
identified: mutations or over-expression of p53 protein in up to 52% of primary
breast cancer specimens were observed indicating p53 as potential marker for
studying the relationship between mutant p53 expression and tumor development,
progression, and response to treatment and disease outcome.
51
Introduction
Of the remainder breast carcinomas in which p53 gene mutation is not observed, half
or more express wild-type p53 protein at high levels. In these cases, events
independent of direct mutation of p53 may interfere with the normal function of the
tumor suppressor during mammary tumorigenesis. Several studies have suggested
that p53 status is an important determinant of tumour responsiveness to antineoplastic agents (Lowe et al., 1994; Clahsen et al., 1998). Specific mutations in p53
have been associated with poor response to primary systemic therapy (Aas et al.,
1996) or overall survival (Borresen et al., 1995). Since many anti-cancer agents
function is to activate cell death/apoptosis (Carson and Ribeiro, 1993), loss of normal
p53 function can potentially result in the relative resistance of breast cancers to
chemotherapeutic agents, due to the loss of the apoptotic properties of p53 (Bates
and Vousden, 1999). This is possibly the reason why alterations of the p53 gene in
breast cancer are associated with an unfavorable prognosis. Therefore, designing
alternative treatment strategies aimed specifically at either restoring p53 function, or
inducing optimal cellular response to damage, is a promising, rapidly-developing
field in cancer research. Among these strategies are the gene therapy transfer of a
„minigene‟ encoding wild-type p53 with a viral vectors, or designing p53reactivating drugs in tumors with an inactived p53, or restoring the p53 function by
alternative approaches which aim to promote p53 transcriptional and tumour
suppressor activities.
The pRb pathway consists of five families of proteins: CDKI, cyclin-D, CDK
(CDK4 and CDK6), pRb-family of pocket protein (pRb, p107, p130), E2F-family of
transcription factors (Figure 12).
52
Introduction
Figure 12. Schematic of pRb pathway in cell cycle control.
The pRb pathway is the major controller of cell cycle progression and of cell
proliferation, and its constituents are activated by growth-promoting and inhibited by
growth-suppressing signals. In quiescent cells, pRb is in its actively growthsuppressing hypophosphorylated state, and inhibits the cell cycle progression through
the interaction with E2F factors, a family of transcriptional regulators that control the
expression of genes whose products are important for entry and progression through
S phase (Sherr and Roberts, 1999; David-Pfeuty, 2006). In response to mitogenic
factors, pRb is inactivated through its phosphorylation on multiple sites. In its hyperphosphorylated form, pRb leaves the E2Fs free to activate the target genes involved
in cell cycle progression (e.g. Cyclins E) and DNA synthesis (i.e. thymidylate
synthase, dihydrofolate reductase, thymidine kinase, ribonucleotide reductase, myc
and DNA polymerase α), thus suggesting that E2F family member may be
responsible for transversing the G/S checkpoint (Harbour et al., 1999; Zhang et al.,
53
Introduction
2000). pRb phosphorylation is triggered in the early G1 phase by the cyclin D–CDK4 and CDK-6 complexes and is completed, at the end of the G1 phase, by cyclin E–
CDK-2 complexes. The activities of the CDKs are in turn constrained by the CDK
inhibitors: CDK-4 and CDK-6 are inhibited mainly by p16(INK4a), whereas CDK-2
is negatively regulated by p21 and p27 (Sherr and McCormick, 2002), p53
negatively affects the cell cycle progression by inducing the p21 expression. The
components of the regulatory machinery that controls G1-S phase transition behave
as tumor suppressors or proto-oncogenes and are frequently altered in cancer cells.
RB1 (the gene encoding pRb) mutation or deletion, p16INK4a mutation and/or
epigenetic silencing, and cyclin D1 or CDK4 overexpression and/or amplification
characterize many human cancers (Figure 13) (Sherr and McCormick, 2002).
Figure 13. Example of alterations in the pRb pathway
These changes, causing either pRb loss or hyperphosphorylation, render the major
control mechanism of the G1-S phase checkpoint out of order. Indeed, inactivation of
the pRb tumor-suppressor pathways is associated with tumorigenesis and
54
Introduction
characterizes a large fraction of many types of cancers (Sherr, 2000; Vogelstein and
Kinzler, 2004).
Loss of normal pRb function is associated with 20% of human breast cancers. In the
80% of breast carcinomas in which pRb gene mutation is not observed, alterations in
components of the signaling pathways that regulate pRb are frequently noted (Varley
et al., 1989). For example, cyclin D1 and cyclin E overexpression, CDK4 gene
amplification, or deletion of p16 have all been associated with primary breast
carcinomas. Nearly 50% of invasive breast cancers examined have elevated cyclin
D1 expression (Buckley et al., 1993).
p16INK4a (also known as CDKN2A) belongs to the INK4 family, which includes
p16 Ink4a, p18 Ink4c, p15 Ink4b, and p19Ink4d. It is an inhibitor of cyclin-CDK4 or cyclinCDK6 complexes, blocking their kinase activity, and so interfering with the pRb
phosphorylation, and inhibiting the progression to the S-phase of cell cycle (Ruas
and Peters, 1998). p16INK4a is a potent tumor suppressor and alterations leading to
its inactivation result in the deregulation of cell proliferation through loss of G1
arrest control, contribute to the formation of cancer and may influence tumour
response to chemotherapy. In fact p16INK4a is commonly mutated, deleted or
hypermethylated, resulting in the reduction or absence of its expression, in human
cancers (Medema et al., 1995).The absence of p16INK4a expression is seen
predominantly in cells that retain wild-type pRb (Otterson et al., 1994). However,
p16INK4a can be up-regulated or overexpressed in cancer cell lines and tumors in
which pRb is dysfunctional (Dublin et al., 1998) providing evidence for a negative
55
Introduction
feedback loop in which the functionally inactive pRb fails to sequester transcription
factors, which, in turn, induce p16INK4a gene expression.
The ability of p16INK4a to arrest the cell cycle in G1 phase depends upon the
presence of a functional pRb, implying that by inhibiting cyclin D-dependent
kinases, pRb remains hypophosphorylated and able to repress transcription of Sphase genes (Medema et al., 1995). The loss of p16 expression is necessary to bypass
the G1 checkpoint in cancer cells during tumor progression (Shapiro et al., 1998). In
mammary carcinomas, the etiological role of p16 is far from understood: although
p16 inactivation is observed in several breast cancer cell lines, mutation or deletion
of the p16INK4a gene are rare events in breast cancer (Quesnel et al., 1995). The
only study available in the literature specifically examining the prognostic
significance of p16INK4a in breast cancer reported that poor outcome was associated
with high expression of p16 protein assessed by immunohistochemical staining
(Dublin et al, 1998).
The hallmark of cancer is deranged growth control (Pardee et al., 1978), because
checkpoints are defective in cancer cells (Hartwell and Kastan, 1994). As previously
stated, control mechanisms are often lost due to mutations in tumor suppressor genes,
e.g. mutated p53 gene, or alterations in one of the pRb pathway components. A
relationship between pRb and p53 exists in cell cycle regulation based on the action
of the two genes regulated by p53: MDM2 and p21.
MDM2 contains a p53-binding site, but also a pRb-binding site: by interacting with
pRb, MDM2 restrains its functions by altering the conformation of the pocket region
(Xiao et al., 1995). It is postulated that overespression of MDM2 inactivates both
56
Introduction
p53 and pRb. p21 is an effector of cell cycle arrest in response to activation of the
p53 G1 phase checkpoint pathway that acts through inactivation of the cyclin-CDK
complexes that are responsible for pRb phosphorylation.
These findings imply a potential link between pRb (p16-pRb-cyclin D1) and p53
(p53-MDM2-p21) pathways in cell cycle regulation and apoptosis and it play a
critical role in tumorigenesis (Figure 14).
Figure 14. Schematic representation of the molecular networking model for p53 and pRb
57
Aims of the thesis
4. AIMS OF THE THESIS
Chemotherapy is used to treat various tumor types, including breast cancers;
chemotherapeutic agents kill cancer cells in different ways, inducing cell cycle arrest
and/or apoptosis. Cells respond to drug-induced damages mainly by activation and
stabilization of p53 protein and its downstream pathway (Johnstone et al., 2002).
Because chemotherapy commonly induces p53 activation, as a matter of principle,
the presence of a normally functioning p53 in cancer cells could be important for
both the response to treatment and the prognosis of patients. However, the
assessment of p53 status has produced contradictory results regarding its
prognostic/predictive value in human breast cancer (Hall and McCluggage, 2006).
We hypothesized that these conflicting results could be a consequence of the fact that
in cancer cells the p53-downstream pathway may be altered, nullifying or changing
the effect of p53 stabilization after chemotherapy treatment. The most important
downstream pathway of p53 is represented by pRb, which is often altered in cancer
cells, influencing the p53-mediated effect of chemotherapy (Knudsen and Knudsen,
2008). Cancers characterized by pRb alteration, from the clinical point of view, are
generally more aggressive than those with a normally functioning pRb pathway
(Cordon-Cardo, 1995) probably because the pRb inactivation causes chromosome
instability, genetic changes facilitating tumor progression and an up-regulation of
proliferation cell rate. Moreover, it is also known that the pRb status influences the
response to DNA-damaging agents in human breast cancer cell lines and in
xenografts models (Bosco et al., 2007). In order to gain information on the influence
58
Aims of the thesis
of the pRb status in p53-mediated response to chemotherapy, we conducted a
prospective study on series of patients with primary breast cancer treated with
chemotherapy, in which we investigated their clinical outcome according to the p53
and pRb status. We also evaluated the role of pRb status on the p53-mediated
response to chemotherapeutic drugs in human cancer cells lines treated either with 5FU plus MTX or doxorubicin where pRb was down-regulated. Since, in this study
we demonstrated that tumors characterized by pRb loss were more sensitive to
chemotherapy independently by p53 status, we then investigated the effects on cell
cycle progression of pRb deficiency in cancer cell lines after chemotherapy
treatments.
There is evidence that a particular subtype of breast carcinomas, the triple-negative
breast cancer (TNBC), is very sensitive to chemotherapy than other tumor subtypes
(Reis-Filho and Tutt, 2008). Since we have shown that breast cancers lacking pRb
expression were more sensitive to adjuvant chemotherapy, we sought to ascertain
whether in TNBCs, the high sensitivity to chemotherapeutic drugs could be due to
the loss of pRb.
Therefore we evaluated the prevalence of pRb loss and the chemosensitivity in a
large series of triple-negative breast cancer patients treated with chemotherapy, in
according to the pRb status. We also studied the relevance of pRb loss on
chemosensitivity in a triple-negative derived cell line.
59
Materials and Methods
5. MATERIALS AND METHODS
5.1. Patients
We studied a total of 518 consecutive patients who underwent surgical resection for
primary invasive breast carcinoma at the Department of Surgery, University of
Bologna, between 1991 and 1995. Patients‟ age ranged from 25 to 89 years, with an
average (±SD) of 60 (±12.9) years (median value, 61 years). Tumors were
histologically classified and staged according to the WHO and the Unio
Internationale Contra Cancrum tumor-node-metastasis systems, respectively.
Histologic grading (G) was done in ductal carcinomas according to Elston and Ellis
(Elston and Ellis, 1991). Due to patient age, axillary dissection was not done in 7
patients (1.3%): in the remaining 511 cases, axillary lymph node metastases were
reported as absent (N0) or present (N+). Estrogen receptor (ER) and progesterone
receptor (PR) status; Ki67 antigen expression; and p53, HER2, and pRb status were
assessed on histologic sections by standard immunohistochemistry, as reported
below. All immunohistochemical analyses were done at the time of diagnosis.
Patients were then regularly followed up every 6 mo for a median observation time
of 109 mo (range 4-142 mo).
The present study was approved by the Senior Staff Committee, the board, which, at
the time of patient enrollment, regulated non interventional studies and was
comparable with an institutional Review Board.
60
Materials and Methods
5.2. Adjuvant treatments
Three hundred and forty-two patients underwent mastectomy and 176 patients
underwent conservative breast surgery. One hundred and forty-five received six
cycles of the cyclophosphamide, methotrexate, and 5-FU (CMF) chemotherapy
regimen that was given on days 1 and 8 of each treatment cycle. The dose of
cyclophosphamide and fluorouracil was 600 mg/m2 of body surface area and the
dose of methotrexate was 40 mg/m2. Each of the three drugs was repeated every 28
d. 231 patients who did not receive systemic chemotherapy received adjuvant
endocrine therapy alone (tamoxifen, 20 mg daily, for at least 2 y). A total of 49
patients received radiotherapy only and 93 patients did not receive any kind of
adjuvant therapy.
5.3. Immunohistochemical assessment
From each case, one block of formalin-fixed, paraffin-embedded tissue was selected,
including a representative tumor area. Four-micrometer-thin serial sections were cut,
collected on 3-ethoxy-aminoethyl-silane-treated slides, and allowed to dry overnight
at 37°C. Tissue sections were then processed for immunohistochemistry and the
immunostaining reaction was then developed according to the SABC (StreptavidinBiotin-Peroxidase Complex) method, combined with antigen retrieval pretreatment
in citrate buffer solution (pH 6), and highlighted using a peroxidase/ 3,3‟diaminobenzidine (DAB) enzymatic reaction.
The following monoclonal antibodies (mAbs) were used: anti-p53 (clone BP5312.1), anti-Ki67 (clone MIB-1), anti-HER2 internal domain (clone CB11), anti-ER
(clone 1D5) and anti-progesterone receptor (anti-PR; clone 1A6), all from BioGenex
61
Materials and Methods
Laboratories. pRb immunostaining was assessed using two different mAbs: clone
G3-245 (BioGenex Laboratories), which specifically recognizes the phosphorylated
pRb form, and clone 1F8/Rb1 (Neomarkers, Lab Vision), which identifies all forms
of pRb (phosphorylated as well as unphosphorylated or underphosphorylated).
The pRb status was assessed by evaluating both the percentage of cells with
phosphorylated pRb and of cells exhibiting total pRb.
The pRb phosphorylation level was evaluated using an anti-pRb monoclonal
antibody (mAb) (clone G3-245) that specifically recognizes ppRb form.
The phosphorylated pRb-LI variable was dichotomized using the cutoff point of
25%, according to Derenzini et al (Derenzini et al., 2004) in which chose the 25%
cutoff because pRb hyperphosphorylation is found mainly in the late G1, S, and G2
phases, whose duration in human cancers is not longer than one quarter of the cell
cycle length. Therefore, the presence of a pRb LI > 25% is strongly indicative of an
alteration of pRb phosphorylation control.
Because in our series 40 cases (7.7%) showed a very low positivity for
phosphorylated pRb (ppRb LI <1%), these cases were assumed to include two kinds
of tumors: (a) tumors in which pRb was present but phosphorylated only in a few
cells and (b) tumors in which both the pRb forms were absent, very likely due to RB1
deletion. To differentiate between these two groups, the 40 cases were investigated
for the presence of total pRb, using a specific mAb (clone 1F8/Rb1) that recognizes
both the phosphorylated and the unphosphorylated or underphosphorylated pRb
forms. Nine cases showed positive immunostaining in some cancer cells, whereas the
remaining 31 cases showed no immunostaining. The latter cases were definitively
62
Materials and Methods
regarded as RB1 deleted and were included in the RB negative (RB-) group. The
remaining 487 cases were included in the RB positive (RB+) group.
The p53 status was evaluated by measuring the percentage of immunostained nuclei
(p53-LI). We considered samples with at least 10% of nuclear staining to be
characterized by an altered p53 status, according to Esrig et al (Esrig et al., 1993).
p21 expression was evaluated using anti-p21 mAb (Dako Cytomation, Glostrup,
Denmark) measuring the percentage of immunostained nuclei (p21-LI). All mAbs
were applied overnight at room temperature at the predetermined optimal
concentrations.
The nuclear immunostaining of ER, PR, Ki67, p53 and pRb was assessed by image
cytometry, using the Cytometrica program (C&V, Bologna, Italy) as detailed by
Faccioli et al. (Faccioli et al., 1996). Staining was expressed as the percentage of
labeled nuclear area over the total neoplastic nuclear area in the section [labelling
index (LI)]. HER2 membrane immunostaining pattern and intensity were assessed by
direct microscope evaluation, following the four class scoring system (0, +1, +2, +3)
according to published protocols (Ellis et al., 2004). For each case, at least 2,000
cells were evaluated. All the immunohistochemical analyses were performed at the
time of diagnosis.
5.4. Cell lines and growth conditions
The human breast cancer cell line MCF-7 was maintained in RPMI 1640 (Euroclone,
Milan, Italy) supplemented with 10% fetal bovine serum (FBS; Euroclone); the
human colon cancer cell line HCT-116 and the human breast cancer cell line MDAMD-231 were maintained in DMEM supplemented with 10% FBS; the human
63
Materials and Methods
hepatocellular carcinoma cell line HepG2 was maintained in RPMI 1640
supplemented with 10% FBS and sodium pyruvate (Euroclone). All cell lines were
from the American Type Culture Collection (ATCC). FBS was inactivated by heat
(56°C for 30 minutes).
All cell lines were cultured in monolayer at 37°C in humidified atmosphere
containing 5% CO2 in medium with L-glutamine (Euroclone) 2mM, penicillin 100
U/ mL and streptomycin 100 mg/ mL (Euroclone).
5.5. Production of HCT-116-derived cells with stably inactivated p53
HCT-116 cells stably expressing p53DD, a truncated, dominant-negative form of
murine p53 (Shaulian et al., 1995) and the related empty vector-transduced control
cells (pBABE), were obtained as described by Morgenstern JP and Land H
(Morgenstern and Land, 1990). These cell lines were maintained in DMEM
supplemented with 10% FBS and selected with puromycin antibiotic (SigmaAldrich, Milan, Italy).
5.6. Drugs and cell treatment protocols
A drug cocktail of 5-Fluorouracil (5-FU; Fluorouracil, Teva Pharma B.V. Milan,
Italy) and methotrexate (MTX; Metotrexato, Mayne-Mayne Pharma, Naples, Italy) at
doses of 20 μg/ml and 0.1 μg/ml, respectively, was used to treat MCF-7, MDA-MB231, HCT-116 wild-type (wt) and HCT-116-derived cell lines. Doxorubicin
(Doxorubicin Hydrochloride Injection, USP, Pfizer Italia, Rome, Italy) was used at a
concentration of 1 μM on MCF-7 and MDA-MB-231, 3 μM on HepG2 and 0.3 μM
on HCT-116-derived cell lines. Both drugs were diluted directly from stock solutions
64
Materials and Methods
and mixed in RPMI or in DMEM with 10% FBS. Cells were exposed to either
doxorubicin or 5-FU plus MTX for 1 or 2 h at 37°C. After the drug treatments, in an
initial set of experiments, the cells were washed extensively with PBS, fed with fresh
medium for 6 h and then harvested. In a second set of experiments the cells were
exposed to the drugs for 2 h daily for 4 consecutive days and fixed in formalin 24 h
after the last treatment.
5.7. Genes silencing by RNAi transfection
The day before transfection, cells were seeded in antibiotic-free growth medium.
Transfections were performed with Lipofectamine RNAiMAX (Invitrogen, Carlsbad,
UK) in Opti-MEM medium (Invitrogen) following the manufacturer‟s protocol.
After 4 hours, the Opti-MEM is been replaced with the appropriate growth medium.
Silencing of RB1, TP53 and p16INK4a was obtained by transient transfection of cells
with specific interferent RNA oligos (RNAi). Transfections were performed with
Lipofectamine RNAiMAX (Invitrogen) in Opti-MEM medium (Invitrogen)
accordingly to manufacturer‟s procedures. RB1 and TP53 genes were silenced using
Stealth RNAi Select kits (Invitrogen), while sequences of RNAi for p16INK4a
silencing (Invitrogen) were from Lau et al (Lau et al., 2007). Controls for RB1- and
TP53-silenced cells were transfected with equivalent amounts of Stealth RNAi
Negative Control (Invitrogen), while controls of p16INK4a silenced cells were
transfected with an RNA oligo sequence (obtained by scrambling the sequence of
p16-specific RNAi) that is not complementary to any known human transcript
(screened on NCBI BLAST). The concentrations of siRNAs used resulted to be
lowest one capable to reduce the mRNA levels to at least the 80% of control for
65
Materials and Methods
duration of 120 h. The RNAi specific for RB1 was used at a final concentration 80
nM, while those for TP53 and p16INK4a genes in 40 nM concentration. The
Lipofectamine is being used with a ratio of 1 μL every 15 picomoles of RNAi.
5.8. RNA extraction, cDNA synthesis and real-time RT–PCR analysis
Cells were harvested and total RNA was extracted from cells 48 and 120 h after
siRNA transfection with TRI reagent (Ambion, Austin, TX, USA) according to
manufacturer instructions. The cells were homogenized in TRI Reagent solution,
collected in eppendorf tubes and incubate for 5 minutes at room temperature (RT).
After that, the homogenate were centrifuged, incubated with 160 μl chloroform for
10 minutes at RT to generate the phase separation, re-centrifuged again and the
aqueous phase containing the RNA was transferred in a fresh tube. The RNA was
precipitated by adding isopropyl alcohol, incubated at RT for 10 minutes, spinned to
allowed RNA to precipitate. After discard the supernatant, the gel-like bottom RNA
was washed in 75% alcohol for washing, centrifuged, air-dried for 10 minutes e
dissolve in DEPC water. Extracted RNAs were quantified with a Nanodrop
spectrophotometer (ND1000). The quality of RNA extracted was evaluated
measuring the A260/A280 ratio. Reverse transcription reactions were performed in a
25 µl volume using 2 µg of total RNA with a High-Capacity cDNA Archive Kit
(Applied Biosystems, Foster City, CA, USA) following the manufacturer‟s protocol.
cDNAs obtained were diluted in DEPC water and were subjected to real-time PCR
analysis in a Gene Amp 7000 Sequence Detection System (Applied Biosystems)
using the TaqMan Universal PCR mastermix (Applied Biosystems) diluted in 20 µl
of total volume for well. For each sample, three replicates were analyzed. Cycling
66
Materials and Methods
conditions were as follows: 50°C for 2 min, 95°C for 10 min, 45 cycles at 95°C for
15 s, and 60°C for 1 min.
Primers and probes for RB1, TP53 and p16INK4a were purchased from Applied
Biosystems (Assay on Demand); human-β-glucuronidase was used as an endogenous
control gene (Applied Biosystems). All primers were used at a final concentration of
5 µM.
The relative amount of the target gene in the cells transfected with the specific
siRNAs compared with that of scrambled sequences of transfected cells was
evaluated by the ΔΔCt method (Schmittgen et al., 2000).
5.9. Proteins extraction and Western blot analysis
For Western blot analysis, cells were lysed in a lysis buffer consisted of 0.1 M
KH2PO4 (pH 7.5), 1% Igepal (NP-40), 0.1 mM β-glycerophosphate and complete
protease inhibitor cocktail (Roche Diagnostics) 1X. Cells were incubated 25 min on
ice and centrifuged at 14,000xg for 25 minutes at 4°C. After the supernatants were
collected for analysis. Protein concentrations in supernatants were evaluated using
Bradford assay (using Bio-Rad Protein Assay). All steps were done at 4°C.
For each sample, 30 µg of lysate proteins (or 50 µg to assess protein expressed little)
were resuspended in Laemmli buffer. Denatured protein samples were separated in
10% or 14% SDS polyacrylamide gels and transferred to cellulose nitrate membranes
(Hybond C Extra, Amersham). Filters were then saturated with 5% non fat dry milk
powered dissolved in TBS-T solution for 1 h at room temperature. TBS is constituted
by 20 mM Tris-HCl, 137 mM NaCl (pH 7.6) and is added 0.1% Tween 20 (Sigma)
for the final TBT-T solution. After the saturation of the membranes are washed with
67
Materials and Methods
TBS-T (2 washes of 5 minutes) at RT and incubated overnight at 4°C with primary
antibodies in 3.5% bovine serum albumin TBS-T. The following antibodies were
used: anti-total pRb (1:200, clone 1F8; Lab Vision Corporation), anti-phospho pRb
(1:250, Ser780, Cell Signalling Technology, Beverly, MA, USA), anti-p16 (1:200,
Santa Cruz Biotechnology), anti-p53 (1:1000, clone BP53-12, Novocastra), anti-p21
(1:100, clone SX118, Dako Cytomation), anti–phospho-H2AX histone (1:1000,
Ser139, clone 20E3, Cell Signaling Technology) and anti-β-actin (1:4000, Sigma
Chemical Co.). The next day, the membranes were washed 1x10 min and 2x5 min in
TBS-T to remove unbound antibody, and were incubated for 1 h in the presence of
horseradish peroxidase–labeled secondary antibody (dilution 1:10.000 in 5% milk
TBS-T) at RT. After 3 washes of 10 minutes, the horseradish peroxidase activity was
detected using an enhanced chemiluminescence kit ECL (GE) and was revealed on
Hyperfilm enhanced chemiluminescence films (Amersham). The intensity of the
bands was evaluated with the densitometric software GelPro analyzer 3.0 (Media
Cybernetics). Normalization was made against β-actin expression.
5.10. Immunocytochemical analysis
HCT-116-derived and MCF-7 cells seeded on glass coverslips were silencing and 48
h after the end of the silencing procedure were fixed and permeabilized in PBS
containing 2% paraformaldehyde and 1% Triton X-100 for 10 minutes at room
temperature; after this process the cells were washed 3 times in PBS. For
immunocytochemical staining, cells were treated with 1.5% H2O2 for 5 min in the
dark in order to suppress endogenous peroxidase activity. After this the slips were
washed in PBS. The slips were incubated for 30 minutes at room temperature in PBS
68
Materials and Methods
containing 1% bovine serum albumin (BSA) to block aspecific staining, then washed
and incubated overnight with primary anti-p53 monoclonal antibody (1:150, clone
BP53-12, Novocastra) and anti-pRb monoclonal antibody (1:150, clone 1F8; Lab
Vision Corporation) diluted in PBS containing 1% BSA at 4°C in a humidified
chamber. After overnight incubation, slips were washed in PBS and incubated first
with a biotinylated secondary antibody (Vector Laboratoires) in PBS 1% BSA for 30
min, washed and then incubated with the streptavidin-peroxidase conjugate (Biospa)
in PBS 1% BSA for 30 min. The streptavidin-peroxidase complex was visualized by
dark incubation with diaminobenzydine DAB (Sigma-Aldrich) for 6 minutes. The
reaction is blocked by immersing slides in H2Od before to proceed with the
dehydration and the assembly through sequential steps in 70% ethanol, 96%, 100%
and xylene. The slides are mounted on the glass with Canada balsam (Sigma). The
number of positive cells (and hence the proportion of cells in active progression in
the S phase) is assessed at the microscope in 10 fields per sample using Image-Pro
Plus software (Media Cybernetics).
5.11. Evaluation of cell population growth
The crystal violet is a substance of violet color able to bind to DNA and allows to
assessment of cellular population growth in vitro.
For the evaluation of cell population growth inhibition after treatment with
doxorubicin or 5FU-MTX cocktail, 40.000-100.000 cells, depending on cell type,
were seeded in 12-well plates and drugs were given for 4 consecutive days, 2 h/day,
starting 48 h after transfection for silenced cells. 24 h after the last drug treatment,
treated and untreated cells were formalin-fixed for their quantitative growth
69
Materials and Methods
evaluation, which was carried out using the crystal violet assay as described in
Carnero et al. (Carnero et al., 2000). Briefly, cells were washed twice with PBS,
formalin-fixed overnight at 4°C, washed with distilled water and stained for 30
minutes with 0.1% Crystal Violet in a 20% methanol solution in agitation. Then they
were washed 4 times in double-distilled water before, photographed, then
resolubilized in 10% acetic acid solution, for 15 min at room temperature and
quantified spectrophotometrically at 595 nm, in triplicate. The absorbance is
proportional to the number of cells because it depends on the quantities of crystal
violet bound to DNA.
5.12. Evaluation of cell death rate
Trypan blue is a vital stain obtained from toluidine that is absorbed by the
macrophages of the reticuloendothelial system and is therefore used for staining cells
to selectively color dead tissues or cells blue.
MCF-7 and HCT-116 cells either silenced for RB1 or transfected with scrambled
sequences were treated with 5-FU and MTX for 1 h. Twenty-four hours after the end
of drug treatment, the floating cells in the medium of each flask were transferred to
centrifuge tubes. After detachment of the adherent cells with trypsin, the cells were
mixed with the corresponding floating cells before centrifugation. The cells were
then stained with 0.4% trypan blue, and the numbers of trypan blue-positive and
trypan blue-negative cells were counted on a hemocytometer by light microscopy.
The experiments were carried out in triplicate.
70
Materials and Methods
5.13. Cell cycle progression analysis by dual-parameter flow cytometry
To define the effect of 5-FU and MTX treatment on cell cycle progression, the MCF7 cell line was used. Dual-parameter flow cytometry for the simultaneous evaluation
of DNA content and Bromodeoxyuridine (BrdUrd) incorporation was done.
Asynchronously growing MCF-7 cells were either silenced for RB1 expression or
transfected with scrambled sequences. Seventy-two hours after the end of silencing
procedure, BrdUrd was added at a final concentration of 20 µmol/L for 1 h, and then
removed and fresh medium was added. Twelve hours later, cells were treated with 5FU and methotrexate at doses of 10 and 0.05 µg/mL for 1 h. Cells were harvested 12
and 24 h later. Untreated cells were used as control. Cells were collected by
centrifugation and fixed in 70% alcohol. Dual-parameter flow cytometry was done
by a direct labeling of incorporated BrdUrd by FITC monoclonal antibody followed
by propidium iodide-DNA counterstaining (Mazzini et al., 1996). Cytofluorimetric
analyses were carried out in triplicate. Measurements were done by means of a
Partec PAS II flow cytometer equipped with dual excitation system (argon ion laser
and HBO100Warc lamp). The 488-nm blue line of the laser has been used to excite
propidium iodide intercalated into the DNA and the FITC bound to BrdUrd. A
preliminary instrument alignment and control has always been set up (with rat
thymocytes stained with propidium iodide) to assure best instrumental analytic
performances. Immediately before measurement, each sample has been filtered by
„„Filcons‟‟ 100 (ConsulTS) to remove cell clusters. For a sample measurement, a
minimum of 20,000 events was acquired. The green (BrdUrd-FITC) and red (DNApropidium iodide) fluorescence emission bands were collected, converted, and stored
as DNA distribution values (histogram) or dual-parameter correlated dot plots by
71
Materials and Methods
means of a dedicated computer integrated into the instrument. Data were elaborated
and plotted thanks to the „„Flow Max‟‟ software installed in the computer. Cell cycle
analyses and the relative statistical data (coefficient of variation of the DNA
distributions) were done by means of a dedicated software.
5.14. Effect of drug treatment on p53 activation and DNA double-strand breaks
accumulation
MCF-7 cells silenced for RB1 and transfected with scrambled sequences were used
48 h after the end of the transfection procedure. Cells were treated for 1 h with the 5FU and MTX and harvested 6, 12, and 24 h after the end of treatment, along with an
untreated control sample for every condition. The experiments were conducted in
triplicate. Proteins were extracted for Western blot analysis as described above.
5.15. Statistical analysis
Differences between groups were evaluated by Student‟s t -test. Comparison of
proportions between groups was assessed using the two-sample Z-test of proportions.
Disease-free survival (DFS) curves were generated using the Kaplan–Meier method
and compared using the log-rank test. Multivariate analyses for DFS were performed
by applying the Cox proportional hazards regression model. All statistics were
obtained using the SPSS statistical software package (Statistical Package for Social
Science, SPSS Inc., Chicago, IL, USA). p<0.05 was regarded as statistically
significant.
72
Materials and Methods
5.16. RNAi sequences
RB1: RB1-HSS109090 Fw UCAAGAUUCUGAGAUGUACUUCUGC
RB1-HSS109090 Rev GCAGAAGUACAUCUCAGAAUCUUGA
RB1-HSS109091 Fw AUAAAGGUGAAUCUGAGAGCCAUGC
RB1-HSS109091 Rev GCAUGGCUCUCAGAUUCACCUUUAU
RB1-HSS109092 Fw UUCAGUCUCUGCAUGAAGACCGAGU
RB1-HSS109092 Rev ACUCGGUCUUCAUGCAGAGACUGAA
TP53: TP53 RNAi-1 Fw CCAUCCACUACAACUACAUGUGUAA
TP53 RNAi-1 Rev UUACACAUGUAGUUGUAGUGGAUGG
TP53 RNAi-2 Fw CCAGUGGUAAUCUACUGGGACGGAA
TP53 RNAi-2 Rev UUCCGUCCCAGUAGAUUACCACUGG
p16INK4a: p16INK4a RNAi Fw 5‟-CGCACCGAAUAGUUACGGUTT-3‟
P16INK4a RNAi Rev 5‟-ACCGUAACUAUUCGGUGCGTT-3‟.
73
Results
6. RESULTS
6.1. The p53-mediated sensitivity of cancer cells to chemotherapeutic
agents is conditioned by status of the pRb protein
6.1.1. Assessment of pRb and p53 status
We analyzed 518 consecutive patients who underwent surgical resection for primary
invasive breast carcinomas.
The pRb status was assessed by immunohistochemistry by evaluating the percentage
either of cells with phosphorylated pRb (using a mAb antibody which specifically
recognizes the phosphorylated pRb form) or of cells exhibiting total pRb (using a
mAb antibody which recognizes all form of pRb) as described in detail in Material
and Methods. We could distinguish three pRb forms: pRb underphosphorylated, pRb
hyperphosphorylated, pRb deleted (Figure 15).
The p53 status was evaluated by measuring the percentage of immunostained nuclei
(p53-LI) as described in Material and Methods and we distinguished two p53 forms:
p53 normal or wild-type (wt) and p53 alterated (Figure 16). Since there is evidence
that a series of local cell injuries may occur in tumour tissues causing wild-type p53
stabilization, in order to identify the cases really characterized by the presence of
mutated p53, we also evaluated the expression of p21, target of activated p53, in the
p53-accumulating tumours. In fact, p53-positive tumours, which also express p21,
might be not characterized by mutated p53 (Nenutil et al, 2005).
74
Results
Figure 15: pRb immunostaining of breast cancers. a-b): pRb immunostaining using pRb
monoclonal antibody which specifically recognizes the phosphorylated pRb form and (a) is indicative
of low positivity for ppRb, these cancers are analyzed also for pRb total form (b) is positive for ppRb
form, these cancers are considered with ppRb. c-d): pRb immunostaining using pRb antibody which
recognized the total pRb protein. (c) is indicative of normal expression of pRb, (d) is indicative of a
presumable RB1 gene deletion. In both cases, stromal cells -considered as positive internal controlsare clearly immunostained. Bar, 25 µm
Figure 16. p53 expression of breast cancers. a-b): Two carcinomas were shown after p53
immunostaining. Note the absence of expression reported in (a), representing a wild-type expression
of p53, and the p53 accumulation in (b), representing a p53 alteration
75
Results
The p21 expression was evaluated in the p53-positive tumours by measuring the
percentage of immunostained nuclei (p21-LI). Fourteen p53-positive tumours were
found to be characterized by a p21-LI>10% and were therefore excluded from the
group of p53 putatively-mutated tumours and not considered for the statistical
analyses. Among the 518 patients, in this study we considered only the 145 patients
treated with CMF chemotherapy. All the features of population enrolled are reported
in Table 3.
Variable
n (%)
Age
< 50%
 50%
Histological diagnosis
ductal carcinomas
lobular carcinomas
medullary carcinomas
mucoid carcinomas
sarcomatoid carcinomas
Tumour size
pT1
pT2
pT3
pT4
Histological grade
G1
G2
G3
N-status (*)
N0
N+
ER-LI
< 10%
 10%
PGR-LI
< 10%
 10%
HER2-status
negative
positive
Ki67-LI
< 20 %
 20 %
pRb status
loss
under- phosphorylated
hyper-phosphorylated
p53-LI
< 10 %
 10 %
63 (43.4)
82 (56.6)
132 (91)
7 (4.8)
1 (0.7)
3 (2.1)
2 (1.4)
78 (53.8)
48 (33.1)
7 (4.8)
12 (8.3)
15 (10.3)
37 (25.5)
93 (64.1)
38 (26.8)
104 (73.2)
58 (40)
87 (60)
93 (64.1)
52 (35.9)
69 (47.6)
76 (52.4)
44 (30.3)
101 (69.7)
16 (11)
85 (58.6)
44 (30.3)
96 (66.2)
49 (33.8)
Table 3. Clinical and histopathological characteristics of the enrolled population, treated with
chemotherapy
76
Results
6.1.2. Relationship between p53 and pRb in tumor prognosis
We assessed the prognostic relevance of p53 in the whole series and in patients
according to the pRb status, treated with chemotherapy (Table 4; Figure 17, 18 and
19).
Treatment
Whole series
p53-LI <10%
p53-LI ≥10% *
Patients with pRb loss
p53-LI <10%
p53-LI ≥10% *
Patients with underphosphorylated pRb
p53-LI <10%
p53-LI ≥10% *
Patients with hyperphosphorylated pRb
p53-LI <10%
p53-LI ≥10% *
Cases
(n)
DFS (%)
χ2
p
96
35
57.29
48.57
0.97
= 0.3259
3
11
100
81.82
0.57
= 0.4492
65
16
61.54
31.25
6.63
= 0.0100
28
8
42.86
37.50
0.75
= 0.6246
Table 4. Prognostic relevance of p53 in the whole series and in patients considered according to
the pRb status, investigated by the log-rank test. * Cases with a p21-LI >10% were excluded from
this group
Univariate analysis of DFS indicated that in the whole patient‟s series, in patients
with pRb loss (Figure 17) and with hyperphosphorylated pRb (Figure 18) the p53
variable was not associated with the clinical outcome; the only association of p53
with prognosis was in patients with normally functioning pRb pathway (Figure 19).
77
Results
Total
Number
Events
Number
Censored
Percent
Censored
p53 wt
3
0
3
100,00
p53 mutated
13
2
11
84,62
Overall
16
2
14
87,50
Significance
0,4881
Figure 17. Disease-free survival curves (Kaplan–Meier estimates) in patients with pRb loss,
according to p53 status, treated with adjuvant chemotherapy
Total
Number
Events
Number
Censored
Percent
Censored
p53 wt
28
16
12
42,86
p53 mutated
16
8
8
50,00
Overall
44
24
20
45,45
Significance
0,8314
Figure 18. Disease-free survival curves (Kaplan–Meier estimates) in patients with
hyperphosphorylated pRb, according to p53 status, treated with adjuvant chemotherapy
78
Results
Total
Number
Events
Number
Censored
Percent
Censored
p53 wt
65
25
40
61,54
p53 mutated
20
13
7
35,00
Overall
85
38
47
55,29
Significance
0,0142
Figure 19. Disease-free survival curves (Kaplan–Meier estimates) in patients with normally
function of pRb, according to p53 status, treated with adjuvant chemotherapy
Then, in this group, a multivariate analysis of DFS, including the histopathological
variables associated with the clinical outcome such as tumor size, histopathological
grade, node status, ER-, PR- and Ki67-LI, and HER2, demonstrated that p53 status
was the only factor significantly associated with the DFS (Table 5). Also, without
correcting the definition of the p53 status by the evaluation of p21 expression, p53LI >10% was associated with a worse clinical outcome in the univariate analysis of
DFS (p=0.0142) and the p53 status was found to be the only factor significantly
associated with patient clinical outcome in the multivariate analysis of DFS
(p=0.0190; data not shown).
79
Results
variable
Patients treated with chemotherapy
hazard ratio
(95% CI)
p53-LI
< 10%
 10%
Tumor size
pT1
pT2
pT3 + pT4
Histological grade
G1
G2
G3
N-status
N0
N+
ER status (LI)
 10%
< 10%
PR status (LI)
 10%
< 10%
HER2-status
negative
positive
Ki67-LI
< 20%
 20%
p-value
1.00
3.02 (1.30–7.01)
= 0.0099
1.00
1.72 (0.74–3.99)
1.93 (0.67–5.55)
= 0.2047
= 0.2194
1.00
1.37 (0.27–6.85)
1.79 (0.32–9.96)
= 0.6975
= 0.5061
1.00
1.92 (0.66–5.51)
= 0.2250
1.00
0.87 (0.33–2.29)
=0.7792
1.00
0. 95 (0.45–2.02)
= 0.9109
1.00
1.70 (0.81–3.55)
=0.1562
1.00
1.51 (0.62–3.66)
=0.3618
Table 5. Prognostic relevance of p53 in patients with cancer with normally functioning pRb
pathway: multivariate DFS analysis
6.1.3. Evaluation of p53-mediate chemosensitivity and pRb pathway status in
cancer cells
In order to demonstrate the relevance of the pRb pathway status in the p53-mediated
sensitivity to chemotherapeutic agents, we studied the response to the drugs used in
breast cancer chemotherapy in human cancer cell lines with either wild-type or
abrogated p53 function, where the function of pRb was down-regulated either
inducing a pRb loss either a pRb hyperphosphorylation. Two methods were used to
inhibit p53 activity:
- interference with siRNAs specific for TP53 mRNA expression in MCF-7 and
HepG2 cells;
80
Results
- inducement of the expression of an inactive truncated, dominant negative form of
murine p53 (p53DD) in HCT-116 cells.
The level of TP53 mRNA was evaluated by Real-Time RT-PCR and it was strongly
reduced in MCF-7 and HepG2 cells at 48 h after the interference procedure and
remained very low up to 120 h (Figure 20 a, b, upper). In order to evaluate the effect
of TP53 mRNA interference on both p53 expression in MCF-7 and HepG2 cells, we
exposed these cells to doxorubicin and p53 expression was measured by Western
blot analysis. TP53-silenced cells did not show any accumulation of p53, unlike
control cells (Figure 20 a, b, lower).
81
Results
Figure 20. p53 inactivation in MCF-7 and HepG2 cells. MCF-7 (a) and HepG2 (b) cells were
silenced for p53 expression by RNA interference. TP53 mRNA level was evaluated in cells
transfected with control scrambled sequences (SCR) and in cells silenced for p53 (TP53i), at 48 and
120 h after the end of the silencing procedure. Note the high reduction of TP53 mRNA in TP53silenced cells at both evaluation times. Histograms show the values (mean ± SD) of three independent
experiments. Representative Western blots of p53 and p21 expression in controls and TP53-silenced
MCF-7 (Figure 20a) and HepG2 (Figure 20 b) cells, 48 h after the end of the silencing procedure,
show the absence of p53 and p21 accumulation after doxorubicin treatment in TP53-silenced cells
(TP53i), as compared to cells transfected with control scrambled sequences (SCR). The expression of
β-actin was used as a control
To check the activity of p53 in the p53DD HCT-116 cells, in which the truncated
form of p53 induced an accumulation of inactive protein, we evaluated the
expression of p53 by p53 immunocytochemical staining (Figure 21, upper) and the
expression of p21, the target of p53, by Western blot analysis after either 5-FU plus
MTX or doxorubicin treatment. p21 was expressed only in pBABE, not in p53DD
82
Results
HCT-116 cells, demonstrating that both methods were effective to abolishing p53
activity (Figure 21, lower).
Figure 21. p53 inactivation in HCT-116 cells. p53 inactivation in HCT-116 cells was induced by
expressing a truncated, dominant-negative form of p53 (p53DD). p53 immunocytochemical staining
exhibits a more intense nuclear positivity in cells expressing p53DD as compared to cells transduced
with appropriate control sequences (pBABE). Bar = 25 μm. Representative Western blots of p53 and
p21 expression in pBABE and p53DD HCT-116 cells treated with either 5-FU plus MTX or
doxorubicin show the absence of p21expression in p53DD HCT-116 cells, as compared to pBABE
HCT-116 cells
To down-regulate the pRb function, we silenced RB1 in MCF-7 and HCT-116 cells,
while we induced pRb hyperphosphorylation by p16INK4a silencing in HepG2 cells,
because in MCF-7 and HCT-116 cells the p16INK4a gene was not expressed
(Musgrove et al., 1995; Myöhänen et al., 1998). The effect of RB1 silencing in MCF7 and HCT-116 pBABE and p53DD cells was evaluated by both Real Time-RT PCR
83
Results
and by Western blot analysis; 48 and 120 h after the RNA interference procedure, a
strong reduction of RB1 mRNA expression occurred in both cell lines (Figure 22 a).
Western blot analysis for pRb expression confirmed that 48 h after the RB1 silencing
procedure, the level of pRb was markedly reduced compared to control samples in
both cell lines (Figure 22 b).
Figure 22. pRb inactivation in MCF-7and HCT-116 cells. a,b) MCF-7 and HCT-116 (pBABE and
p53DD) cells were silenced for RB1 expression by RNA interference. a) RB1 mRNA level was
evaluated in cells transfected with control scrambled sequences (SCR) and in cells silenced for RB1
(RB1i) at 48 and 120 h after the end of the silencing procedure. Note the high reduction of RB1
mRNA in RB1-silenced cells at both evaluation times. Histograms show the values (mean ± SD) of
three independent experiments. b) Representative western blots of pRb expression in MCF-7, pBABE
HCT-116 and p53DD HCT-116 cells, silenced for RB1 expression, 48 h after the end of the silencing
procedure, show the strong reduction of pRb expression in RB1-silenced cells (RB1i) as compared to
cells transfected with control scrambled sequences (SCR). pRb is indicated by the pointer, and the
background staining is indicated by an arrowhead. The expression of β-actin was used as a control.
The histogram shows the densitometric values (mean ± SD) of three independent experiments. Each
value concerns the pRb/β-actin ratio, which was set to 100, in untreated cells transfected with
scrambled sequences. *p < 0.05
84
Results
The silencing of p16INK4a was also confirmed by these two techniques. 48 h after
the interference procedure, the p16INK4a mRNA level was very low and the
expression of p16INK4a protein was strongly reduced, while the amount of
phosphorylated pRb was increased as compared to control, in HepG2 cells (Figure 23
a, b).
Figure 23. pRb inactivation in HepG2 cells. a, b) HepG2 cells were silenced for p16INK4a
expression by RNA interference. a) p16INK4a mRNA level was evaluated in cells transfected with
control scrambled sequences (SCR) and in p16INK4a-silenced cells at 48 and 120 h after the end of
the silencing procedure (p16i). Note the high reduction of p16INK4a mRNA in p16INK4a-silenced
cells at both evaluation times. Histograms show the values (mean ± SD) of three independent
experiments. b) Representative western blots of p16 and phosphorylated pRb expression in controls
(SCR) and p16INK4a-silenced (p16i) HepG2 cells, 48 h after the end of the silencing procedure, show
a high reduction of p16 expression together with the increased level of phosphorylated RB in
p16INK4a-silenced cells as compared to control HepG2 cells. The expression of β-actin was used as a
control. The histogram shows the densitometric values (mean ± SD) of three independent
experiments. In each analysis, values concern the protein:β-actin ratio, which was set to 100, in
untreated cells transfected with scrambled sequences (SCR). *p < 0.05
To assess whether the drug treatment could affect the pRb phosphorylation, after
p16INK4a-silencing, we evaluated, by Western blot analysis, the expression of p53,
85
Results
p21 and phospho-pRb in control (SCR) or p16INK4a-silenced HepG2 cells treated
with doxorubicin for 8 hours (Figure 24). We confirmed that the drug treatment
induced a reduction of phospho-pRb protein level in similarly to not interfered cells.
Figure 24. Effect of p53 stabilization on p21 and phosphorylated pRb expression in p16INK4asilenced HepG2 cells. Cells were treated with Doxorubicin for 8 hours to induce p53 stabilization.
Representative Western blots of p53, p21 and phosphorylated pRb expression in controls and
p16INK4a-silenced HepG2 cells, 48 hours after the end of the silencing procedure, show that the drug
treatment induced an increased level of p53 and p21 expression in controls (SCR) and p16INK4asilenced (p16i) cells, as compared to untreated cells. Both in control and in p16INK4a-silenced cells,
Doxorubicin reduced the level of phosphorylated pRb expression as compared to the respective
untreated cells. Nevertheless, the expression of phosphorylated pRb after drug treatment appeared to
be at the same level in p16INK4a-silenced cells as in control, untreated cells. The expression of β
actin was used as a control. The histogram shows the densitometric values (mean ± S.D.) of three
independent experiments. In each analysis, values concern the ppRb/β-actin ratio, which was set to
100, in untreated cells transfected with scrambled sequences. Statistical significance (p<0.05) is
indicated (*)
We then investigated the long-term effect of 5-FU plus MTX and of doxorubicin
treatment on the cell population growth in controls and p53-deficient MCF-7 and
HCT-116, either silenced or not for RB1 expression, and in controls and p53deficient HepG2 cells, either silenced or not for p16INK4a expression.
86
Results
In MCF-7 cells, the 5-FU plus MTX, but also the doxorubicin treatment,
significantly reduced the cell population growth in control TP53-silenced and RB1silenced cells (p<0.01). In cells silenced for both TP53 and RB1 expression, the drug
treatments induce a growth rate reduction that was significantly greater than caused
in TP53-silenced cells alone (z=3.300; p<0.001) and not significantly differ from that
of control cells (Figure 25).
Figure 25. Effect of TP53- and RB1-silencing on the growth rate of MCF-7 cells exposed to
chemotherapeutic agents. The cells were exposed to either 5-FU plus MTX or doxorubicin for 2 h
daily for 4 consecutive days, and 24 h after the last treatment were formalin-fixed for the crystal violet
assay for growth rate evaluation. Values relative to samples not treated with drugs were normalized to
100. Cells were silenced for either RB1 (RB1i+) or TP53 (TP53i+) expression or for both tumour
suppressors. Cells transfected with scrambled sequences were used as controls (RB1i−, TP53i−). (Left
panel) 5-FU plus MTX treatment strongly hindered the proliferation of controls and RB1-silenced
cells, and to a lesser extent that of TP53-silenced cells. After drug treatment, cells with both tumour
suppressors silenced had a growth rate significantly lower than that of cells silenced for p53
expression alone. Also, doxorubicin treatment (right panel) strongly reduced the proliferation rate of
control and RB1-silenced cells. The drug significantly hindered the proliferation rate of TP53-silenced
cells, although to a lesser extent than in control and RB1-silenced cells. After drug exposure, the
proliferation rate of cells silenced for both tumour suppressors was significantly lower than that of
cells silenced for p53 expression alone
87
Results
The result obtained in HCT-116 cells were similar: 5-FU plus MTX treatments
significantly reduced the growth rate in control and to greater extent of RB1-silenced
cells, but in p53DD cells, the drug treatments did not significantly reduce the growth
rate. In RB1-silenced p53DD cells, after the drug treatment, the cell growth reduction
was significantly greater than that in p53DD cells (z=4.591; p<0.001), being similar
to that induced in control cells. The effect of doxorubicin treatment on the cell
population growth rate of HCT-116 cells was similar to those obtained using 5-FU
plus MTX (Figure 26).
Figure 26. Effect of p53 and pRb inactivation on the growth rate of pBABE and p53DD HCT116 cells exposed to chemotherapeutic agents. The cells were exposed to either 5-FU plus MTX or
doxorubicin for 2 h daily for 4 consecutive days, and 24 h after the last treatment were formalin-fixed
for the crystal violet assay for growth rate evaluation. Values relative to samples not treated with
drugs were normalized to 100. Effect of 5-FU plus MTX (left panel), and doxorubicin (right panel)
treatment on cell population growth of pBABE and p53DD HCT-116 cells, whether or not silenced
for pRb expression. Cells harboring the truncated form of p53 (p53DD) were significantly less
sensitive to the drugs than pBABE cells. RB1 interference (RB1i+) increased the sensitivity to the
drugs in pBABE and p53DD cells. After RB1 interference, both drug treatments reduced the growth
rate of p53DD cells to the same level as that of control pBABE cells
The HepG2 cells were treated only with doxorubicin, as a consequence of their low
sensitivity to 5-FU plus MTX. The drug significantly reduced the growth rate of
88
Results
HepG2 cells independently of TP53 and p16INK4a expression (p<0.001). After
doxorubicin treatment, the difference between the growth rate of cells silenced for
both TP53 and p16INK4a expression and cells silenced for p16INK4a alone was
significantly lower than that observed between control and TP53-silenced HepG2
cells (z=7.720;p<0.001) (Figure 27).
Figure 27. Effect of p53 and pRb inactivation on the growth rate of HepG2 exposed to
doxorubicin. The cells were exposed to doxorubicin for 2 h daily for 4 consecutive days, and 24 h
after the last treatment were formalin-fixed for the crystal violet assay for growth rate evaluation.
Values relative to samples not treated with drugs were normalized to 100. Doxorubicin greatly
reduced the growth rate of control and, to a much lesser extent, of TP53-silenced HepG2 cells
(TP53i+). The drug exposure also reduced the growth rate of p16INK4a-silenced cells alone
(p16INK4ai+) and of cells silenced for both p16INK4a and TP53 expression. On the other hand, the
difference in drug sensitivity between the cells silenced for p16INK4a alone and cells silenced for
both TP53 and p16INK4a expression was significantly lower than that observed between control and
TP53-silenced HepG2 cells. The histograms show the values (mean ± SD) of three independent
experiments
89
Results
6.2. Loss of pRb protein makes human breast cancer cells more sensitive
to antimetabolites exposure
6.2.1. Immunohistochemical definition of pRb status and determination of its
prognostic value in a large series of primary breast cancer patients
We studied 518 consecutive patients who underwent surgical resection for primary
invasive breast carcinomas. The pRb status was assessed by immunohistochemistry
as described in Material and Methods. The cases regarded as RB1 deleted (31 cases)
were included in the RB negative (RB-) group; the remaining 487 cases were
included in the RB positive (RB+) group (Table 6).
90
Results
variable
n (%)
Age
< 50%
 50%
Histological diagnosis
ductal carcinomas
lobular carcinomas
medullary carcinomas
mucoid carcinomas
sarcomatoid carcinomas
Tumor size
pT1
pT2
pT3
pT4
Histological grade
G1
G2
G3
N-status (*)
N0
N+
ER-LI
< 10%
 10%
PGR-LI
< 10%
 10%
HER2-status
negative
positive
Ki67-LI
< 20 %
 20 %
RB status
deleted
under- phosphorylated
hyper-phosphorylated
p53-LI
< 10 %
 10 %
Adjuvant therapy
none
radiotherapy
endocrine therapy alone
chemotherapy
117 (22.6)
401 (77.4)
451 (87.1)
44 (8.5)
16 (3.1)
4 (0.8)
3 (0.6)
323 (62.4)
142 (27.4)
13 (2.5)
40 (7.7)
59 (11.4)
339 (65.4)
120 (23.2)
275 (53.8)
237 (46.2)
123 (23.7)
395 (76.3)
280 (54.1)
238 (45.9)
331 (65.0)
178 (35.0)
277 (53.5)
241 (46.5)
31 (6.0)
406 (78.4)
81 (15.6)
407 (78.6)
111 (21.4)
93 (18.0)
49 (9.5)
231 (44.6)
145 ( 28.0)
Table 6. Clinical and histopathological characteristics of the enrolled population. (*) N-status
was available for 511 cases since, due to patient age, axillary dissection was not performed in 7
patients
6.2.2. Prognostic value of pRb expression and phosphorylation
We evaluated the prognostic effect (univariate DFS analysis) of the pRb protein
expression and phosphorylation in the whole series of patients and in patients who
91
Results
received chemotherapy (145 cases). In the whole series, the pRb protein expression
(RB+ or RB-) did not show an significant correlation with prognosis, whereas it
became a significant predictor of DFS in patients treated with chemotherapy (table
7). In fact the absence of pRb expression was associated with a better clinical
outcome in patients treated with chemotherapy.
factor
pRb expression
RBRB+
ppRb LI
< 25%
≥ 25%
whole series
of patients (n = 518)
No
hazard ratio
p-value
patients
(95% CI)
patients treated with chemotherapy
(n = 145)
No
hazard ratio
p-value
patients
(95% CI)
31
487
1.00
0.79 (0.43 – 1.47)
= 0.469
16
129
1.00
5.10 (1.24 –20.86)
= 0.023
406
81
1.00
1.95 (1.34 – 2.85)
< 0.001
94
35
1.00
1.44 (0.84 – 2.45)
= 0.178
Table 7. Univariate analysis of the pRb and ppRb variables for DFS applied to the whole series
of cases and to patients treated with chemotherapy Abbreviation: 95% CI, 95% confidence interval
To evaluate the relationship between the pRb phosphorylation and the patient clinical
outcome, the ppRb LI variable was analyzed. The ppRb variable was significantly
associated with DFS in the whole series, whereas it did not significantly in patients
receiving chemotherapy (Table 7). These results indicated that the lack of pRb and
not its inactivation by phosphorylation represented a predictive variable of DFS in
patients who received chemotherapy.
6.2.3. The absence of pRb expression is the only predictive factor of good
clinical outcome in patients treated with adjuvant chemotherapy
We have further investigated the relationship between pRb expression and the
clinical outcome in these two groups of patients (RB- and RB+), considering the
possibility that the significant predictive effect of pRb found for chemotherapy-
92
Results
treated patients might be related to other clinical and histopathologic variables
associated with the clinical outcome that can confound the results of the statistical
analysis. We compared the relative predictive value of these variables with that of
pRb status in a multivariate analysis. The multivariate DFS analysis indicated that
the absence of pRb expression resulted to be the only significant variable predicting
the clinical outcome in patients treated with chemotherapy (Table 8).
variable
Patients treated with chemotherapy
hazard ratio
(95% CI)
pRb expression
RBRB+
p53-LI
< 10%
 10%
Tumor size
pT1
pT2
pT3 + pT4
Histological grade
G1
G2
G3
N-status
N0
N+
ER status (LI)
 10%
< 10%
PR status (LI)
 10%
< 10%
HER2-status
negative
positive
Ki67-LI
< 20%
 20%
p-value
1.00
5.56 (1.17-23.71)
= 0.030
1.00
1.49 (0.84 – 1.52)
= 0.169
1.00
0.84 (0.47 – 1.51)
1.11 (0.50 – 2.42)
= 0.574
= 0.792
1.00
1.01 (0.30 – 3.34)
1.47 (0.41 – 5.28)
= 0.980
= 0.549
1.00
2.10 (0.95 – 4.60)
= 0.063
1.00
1.00 (0.51 – 1.95)
= 0.986
1.00
0.84 (0.46 – 1.52)
= 0.569
1.00
1.75 (0.97 – 3.14)
= 0.061
1.00
1.24 (0.97 – 3.14)
= 0.570
Table 8. Multivariate DFS analysis applied to patients treated with chemotherapy
Furthermore because the number of RB- patients treated with chemotherapy was low
(n=16), we did a DFS analysis comparing the population of patients with RB- cancer
with a population of patients with RB+ cancer exhibiting the same characteristics
93
Results
(high histologic grade (G3), high ki67-LI (>30%), absence of ER) (Table 9). The
RB- cancers were then matched with RB+ cancers according to these three variables.
DFS analysis indicated that the pRb expression remained a highly predictive factor
of a better clinical outcome (Figure 28).
variable
Age
< 50%
 50%
Histological diagnosis
ductal carcinomas
lobular carcinomas
medullary carcinomas
mucoid carcinomas
sarcomatoid carcinomas
p53-LI
< 10%
 10%
Tumor size
pT1
pT2
pT3 + pT4
Histological grade
G1
G2
G3
N status
N0
N+
ER status (LI)
 10%
< 10%
PR status (LI)
 10%
< 10%
HER2 status
negative
positive
Ki67-LI
< 20%
 20%
whole series of cases
treated with chemotherapy
(n=145)
n (%)
RB- cases
treated with chemotherapy
(n=16)
n (%)
63 (43.4)
82 (56.6)
11 (68.8)
5 (31.2)
132 (91)
7 (4.8)
3 (2.1)
2 (1.4)
1 (0.7)
16 (100)
-
96 (66.2)
49 (33.8)
3 (18.8)
13 (81.2)
78 (53.8)
48 (33.1)
19 (13.1)
7 (43.8)
6 (37.5)
3 (18.8)
15 (10.3)
37 (25.5)
93 (64.1)
16 (100)
38 (26.2)
104 (73.8)
8 (50)
8 (50)
58 (40.0)
87 (60.0)
16 (100)
-
93 (64.1)
49 (33.8)
15 (96.8)
1 (3.2)
70 (48.3)
75 (51.7)
11 (68.8)
5 (31.2)
44 (30.3)
101 (69.7)
16 (100)
Table 9. Multivariate DFS analysis applied to patients treated with chemotherapy
94
Results
Figure 28. Effect of pRb expression on the clinical outcome of patients treated with
chemotherapy according with the histologic grade, ki67 LI, ER status. DFS curves (Kaplan-Meier
estimates) for patients treated with chemotherapy with reference to the pRb expression. The16 patients
with cancer lacking pRb (RB-) showed a better clinical outcome when treated with chemotherapy in
comparison with 32 patients with RB+ cancer, matched according to histologic grade, Ki67 LI, and
ER status
6.2.4. 5-FU and MTX treatment hindered cell population growth of RB1silenced MCF-7 and HCT-116 cells
To ascertain whether the better prognosis of pRb-deficient tumors treated with
adjuvant chemotherapy might be the consequence of a higher sensitivity of pRbdeficient cells to the drugs used, we studied the response to the 5-FU plus MTX
drugs in MCF-7 and HCT-116 cells, where the function of pRb was down-regulated
by RB1-silencing. We evaluated the effect of RB1 silencing on MCF7 (similar data
were obtained using HCT-116 cells, data not shown) after 48 and 120 hours after the
RNA interference procedure, both by Real Time RT-PCR, by immunocytochemistry
and by Western blot analysis (Figure 29).
95
Results
Figure 29. Effect of RB1 interference on RB1 mRNA and pRb protein expression in MCF-7
cells. A) MCF 7 cells were silenced for RB1 by RNA interference. RB1 mRNA level in cells
transfected with scrambled sequences (SCR) and in cells silenced for RB1at 48 and120 h after the end
of the silencing procedure. Note the high reduction of RB1 mRNA in RB1-silenced cells at both the
times evaluated. B) immunocytochemical pRb staining: Cells transfected with scrambled sequences
(SCR) showed an intense staining reaction, which was absent in cells silenced for RB1 (RB1i) by 48h
after the end of the silencing procedure. Bar, 25 µm. C) Western blot analysis of pRb expression in
control (SCR) and RB1-silenced cells, 48 h after the end of the silencing procedure. Note the strong
reduction of pRb expression in RB1-silenced cells (RB1i), in comparison with cells transfected with
scrambled sequences (SCR).The expression of β-actin was used as a control. Histogram shows the
densitometric values of three independent experiments. Columns, mean; bars, SD. Each value is
relative to the pRb to β-actin ratio in untreated cells transfected with scrambled sequences (SCR),
which was set to 100. *, P < 0.05, statistical significance
48h and 120 h after the RNA interference procedure, a strong reduction in RB1
mRNA expression occurred (Fig. 29 A). Immunocytochemical analysis for pRb
expression revealed that, as early as 48 hours after the RB1 interference procedure,
the intensity of the immunostaining was markedly reduced in comparison with
96
Results
control samples (Fig. 29 B) and Western blot analysis confirmed the reduction of
pRb expression (Fig. 29 C).
We investigate the long-term effect of 5-FU and MTX treatment on the cell
population growth in control (SCR) and RB1-silenced MCF-7 and HCT-116 cells
(Figure 30 A, B). The cell population growth of both MCF-7 and HCT-116 cells
silenced for RB1 was significantly hindered. On the contrary, regarding the control
cells, the 5-FU and MTX treatment induced a not significant reduction in the MCF-7
cell population growth and no reduction at all in the HCT-116 cells. To investigate
the reason for the reduced growth rate of RB1-silenced MCF-7 and HCT-116 cells
after drug treatment, we also evaluated the cell death rate in these cells and in control
cells 24 hours after the end of 5-FU and methotrexate exposure. We found that the
drug treatment was responsible for a significantly greater mortality in RB1-silenced
MCF-7 and HCT-116 cells than in control cells (Figure 30 B, D).
97
Results
Fig. 30. Effect of RB1 interference on the growth and mortality rate of MCF-7 and HCT-116
cells treated with 5-FU and methotrexate. A) and C) the effect of 1-h treatment with 5-FU (20
µg/mL) and MTX (0.10 µg/mL) on cell population growth of MCF-7 (A) and HCT-116 (C) cells
either silenced for RB1expression (RB1-) or transfected with scrambled sequences (RB1+). Cell
number was evaluated 72 h after the end of drug treatment. Drug treatment strongly hindered the
proliferation of RB1-silenced cells. On the contrary, the drugs only slightly reduced the proliferation
of the RB1+MCF-7 cells (P = 0.313) and had no effect on RB1+ HCT-116 cells. B) and D) the effect
of 1-h treatment with 5-FU (20 µg/mL) and methotrexate (0.1 µg/mL) on cell mortality rate. Cell
number was evaluated 24 h after the end of drug treatment. The percentage of dead cells was greater
in the drug-treated RB1i MCF-7 and HCT-116 cells than in untreated cells. Drug-treated and
untreated RB+ cells exhibited the same percentage of dead cells. *, P < 0.05, statistical significance
6.2.5. 5-FU and MTX treatment caused a cell cycle arrest in control but not in
RB1-silenced cells
To obtain information on the cause of the higher sensitivity of RB1-silenced cells to
5-FU and methotrexate treatment, we evaluated the effect of the drug exposure on
the cell cycle progression of control and RB1-silenced asynchronously MCF-7 cells,
by a dual-parameter flow cytometry analysis for DNA content and incorporated
BrdUrd evaluation (Figure 31).
98
Results
Fig. 31. Effect of 5-FU and methotrexate treatment on cell cycle progression of RB-silenced and
control MCF-7 cells. Representative dual-parameter flow cytometry analysis of DNA content
(horizontal) and incorporated BrdUrd (vertical) of asynchronously growing MCF-7 cells either
silenced for RB1 (RB1-) or transfected with scrambled sequences (RB1+).The cells were labeled with
BrdUrd for1h, and12h later were either harvested (C) or treated with 5-FU and MTX for1h; these cells
were processed 12 and 24 h later (T1 and T2, respectively). Each dot plot represents the distribution of
correlated red (propidium iodide) and green (FITC) fluorescence of 20,000 analyzed cells. Top row,
MCF-7 cells silenced for RB1. Twelve hours after the end of BrdUrd labeling, both RB1- and RB1+
BrdUrd-labeled cells (C) are located in the G0-G1region of the cell cycle. After drug treatment, the
BrdUrd-labeled cells silenced for RB1seem to move through the S phase (T1) and finally accumulate
in G2-M (T2), whereas BrdUrd-labeled cells transfected with scrambled sequences seem to be
arrested in the early S-phase region, without entering the G2-M compartment. Columns, mean
percentage of cells in theG1, S, and G2-M compartments relative to three independent experiments;
bars, SD. *, P < 0.05, statistical significance
99
Results
For this purpose, both control and RB1-silenced cells, 72 hours after the end of the
silencing procedure, were labeled with BrdUrd for 1 hour. Twelve hours later, when
most of the labeled cells were passed to the G1 phase, the cells were either
immediately harvested (control cells) or treated with 5-FU and MTX for 1 hour and
harvested 12 and 24 hours later for dual-parameter flow cytometry analysis. The
control cells were mainly located in the G0-G1 region. Twelve hours after the
exposure to 5-FU and MTX, the BrdUrd-labeled RB1-silenced cells seemed to move
to the S phase and, 24 hours after the end of drug treatment, were accumulated in the
G2-M region (Fig. 31 A, T1 and T2). On the other hand, at the same time, the
BrdUrd-labeled, drug treated control cells were prevalently confined to the early Sphase region and only a limited aliquot was able to reach the G2-M compartment,
without any accumulation in the G2-M phase compartment (Fig. 31 B, T1 and T2).
These results indicated that 5-FU and MTX treatment caused an arrest of cell cycle
progression in control cells but not in RB1-silenced cells. The arrest of cell cycle
progression in control cells was removed 36 hours after the end of drug treatment.
6.2.6. The p53/p21 pathway was normally activated in RB1-silenced cells treated
with 5-FU and MTX
After we investigated whether in RB1-silenced cells the p53-p21 pathway, which is
involved in genotoxic-induced arrest of cell cycle, was hindered. We evaluated the
expression of p53 and p21, by Western blot analysis, after 1-hour treatment with 5FU plus MTX in control and RB1-silenced MCF-7 cells. We found that in both
control and RB1-silenced cells, the amount of p53 was greatly increased 6 hours after
100
Results
the drug treatment and progressively decreased thereafter. The expression of p21
reflected the p53 time course (Figure 32).
Figure. 32. Effect of 5-FU and MTX treatment on p53 expression in RB1-silenced MCF-7 cells.
Representative time course Western blot of p53 and p21 in cells transfected with scrambled sequences
(RB+) and in cells silenced for RB1 expression (RB-). Cells were either untreated or treated with 5-FU
and MTX for 1h. An increased amount of p53 was visible 6 h after the treatment and progressively
decreased thereafter. The expression of p21 reflected the p53 time course. No differences were
observed in p53 and p21expression between control and silenced cells. Histograms show the
densitometric values of three independent experiments. Columns, mean; bars, SD. Each value is
relative to the p53 or p21/h-actin ratio in untreated cells transfected with scrambled sequences, which
was set to 100
6.2.7. RB1-silenced cells accumulated DNA double-strand breaks
We also investigated whether the higher sensitivity of RB1-silenced cells to drug
exposure might be the consequence of their reduced capacity for repairing the druginduced DNA changes in comparison with control cells. For this purpose, we carried
out a Western blot analysis with anti-phospho-H2AX antibody to reveal the
accumulation of DNA double-strand breaks in drug-treated and untreated control and
RB1-silenced MCF-7 cells (Figure 33). We observed that RB1 silencing caused
untreated cells markedly to accumulate phosphorylated (γ) H2AX, thus suggesting a
101
Results
failure to repair the endogenously arising double strand breaks promptly enough. The
level of γ-H2AX seemed not to be increased after drug treatment. Control cells
showed a very low level of γ-H2AX, which was not modified by drug exposure.
Figure 33. Effect of 5-FU and MTX treatment on γ-H2AX accumulation in RB1-silenced MCF-7
cells. Time course Western blot analysis of γ-H2AX expression in control (RB+) and RB1-silenced
(RB-) cells. Cells were either untreated or treated with 5-FU and MTX for 1h. Note the high
expression of γ-H2AX in drug-untreated RB1-silenced cells. Drug treatment did not modify the
expression of γ-H2AX either in control or in RB1-silenced cells
102
Results
6.3. High prevalence of retinoblastoma protein loss in triple-negative breast
cancers and its association with a good prognosis in patients treated with
adjuvant chemotherapy
6.3.1. Valuation of pRb status and its association of the clinical outcome of
chemotherapy-treated patients with triple-negative tumors
In our breast cancer series (518 patients), we identified four immunohistochemical
profiles according to the expression of hormone receptors and HER2:
53 tumors as triple-negative cancers, 61 cases pertaining to the ER-, PR- and HER2+
subtypes, 284 cases to luminal A (ER+ and/or PR+ and HER2-) and 120 cases to
luminal B (ER+ and/ or PR+ and HER2+) subtypes (Table 10). The features of
population enrolled are resumed in table 11.
Immunohistochemical
subtypes
Patients
n
Triple negative
53
ER-/PR-/HER2+
61
Luminal A
284
Luminal B
120
Table 10. Immunohistochemical subtypes identified in the population enrolled
103
Results
variables
Age
< 50
 50
Histological grade
G1
G2
G3
N-status (*)
N0
N+
ER-status (LI)
< 10%
 10%
PGR-status (LI)
< 10%
 10%
HER2-status
negative
positive
p53-LI
< 10 %
 10 %
Ki67-LI
< 20 %
 20 %
RB status
RB deleted
RB under- phosphorylated
RB hyper-phosphorylated
Adjuvant therapy
none
radiotherapy
endocrine therapy alone
chemotherapy
whole series
518 pz
triple-negative
53 (10,2%)
non
triple-negative
465 (89,8%)
117 (22.6)
401 (77.4)
19 (35.8)
34 (64.2)
98 (21.1)
367 (78.9)
59 (11.4)
339 (65.4)
120 (23.2)
3 (5.7)
9 (17.0)
41 (77.4)
101 (21.7)
183 (39.4)
181 (38.9)
275 (53.8)
237 (46.2)
30 (57.7)
22 (42.3)
240 (53.2)
211 (46.8)
123 (23.7)
395 (76.3)
53 (100.0)
-
70 (15.1)
395 (84.9)
280 (54.1)
238 (45.9)
53 (100.0)
-
227 (48.8)
238 (51.2)
331 (65.0)
178 (35.0)
53 (100.0)
-
284 (61.1)
181 (38.9)
407 (78.6)
111 (21.4)
22 (41.5)
31 (58.5)
385 (82.8)
80 (17.2)
277 (53.5)
241 (46.5)
9 (17.0)
44 (83.0)
268 (57.6)
197 (42.4)
31 (6.0)
406 (78.4)
81 (15.6)
20 (37.7)
19 (35.8)
14 (26.4)
11 (2.4)
387 (83.2)
67 (14.4)
93 (18.0)
49 (9.5)
231 (44.6)
145 ( 28.0)
7 (13.2)
7 (13.2)
15 (28.3)
24 (45.3)
86 (18.5)
42 (9.0)
216 (46.5)
121 (26.0)
Table 11. Clinical and histopathological characteristics of triple-negative compared with those
with other cancer subtypes gathered together in one group (the non triple-negative group). * N
status was available for 511 cases since, due to patient age, axillary dissection was not carried out in
seven patients
After we evaluated the clinical outcome (univariate DFS analysis) of the four
subtypes of tumors, independently of the adjuvant treatment. After a mean follow-up
time of 109 months, the best prognosis was associated with the luminal A type,
followed by the triple-negative tumors, whereas a poor clinical outcome was
associated with both the luminal B and ER2/PR2/HER2+ subtypes.
104
Results
Moreover, adverse events were concentrated, in the triple-negative tumors, in the
first 40 months after surgery, whereas in other tumor subtypes they were distributed
throughout the entire follow-up period (Figure 34).
Figure 34. Disease-free survival curves (Kaplan-Meier estimates) according to breast cancer
subtypes
After we analyzed the clinical outcome of patients according to chemotherapeutic
treatment. Chemotherapy-treated patients with triple-negative tumors (n=24)
maintained an optimal prognosis in comparison to those affected by other tumor
subtypes (Table 12).
Immunohistochemical
subtypes
Patients treated with chemotherapy
n
DFS rates
(%)
Long-rank
test: χ2 (P)
Triple negative
24
75.0
13.19 (=0,004)
ER-/PR-/HER2+
30
50.0
Luminal A
45
68.89
Luminal B
46
39.96
Table 12. Univariate DFS analysis of different tumor subtypes in patients treated with
chemotherapy
105
Results
6.3.2. pRb status and the clinical outcome of triple negative tumors treated with
chemotherapy
After we evaluated, by immunohistochemical analysis, the pRb status in the different
tumor subtypes and we distinguished three pRb forms: pRb underphosphorylated,
pRb hyperphosphorylated, pRb deleted (Table 13).
Triple
negative
ER-/PRHER2+
Luminal A
Luminal B
pRb loss
(n=31)
20 (64,5%)
7 (22,6%)
2 (6,5%)
2 (6,5%)
pRb underphosphorylated
(n=406)
19 (4,7%)
26 (6,4%)
265(65,3%)
96 (23,6%)
pRb hyperphosphorylated
(n= 81)
14 (17,3%)
28 (34,6%)
17 (21,0%)
22 (27,2%)
Table 13. pRb status in different tumor subtypes
The percentage of tumors without pRb expression was significantly higher in the
triple-negative subtype (64.5%) than in other tumor subtypes. After we evaluated the
clinical outcome of patients with triple-negative tumors treated with chemotherapy
dividing the cancers in two groups: one characterized by presence of pRb expression
including the under- and hyper- phosphorylated pRb form, and one with absence of
pRb expression. All patients with pRb loss were found to be disease free, whereas
those with normal or hyperphosphorylated-pRb had a significantly poorer prognosis
(Figure 35).
106
Results
Total
Number
Events
Number
Censored
Percent
Censored
RB -
11
0
11
100,00
RB +
13
6
7
53,85
Overall
24
6
18
75,00
Figure 35. Disease-free survival curves (Kaplan–Meier estimates) according to pRb status of
triple-negative patients treated with chemotherapy. RB-: tumors with pRb loss; RB+: pRb
expressing tumors
We have considered the possibility that the highly favorable clinical outcome of
chemotherapy-treated patients might be related to other anatomo-clinical parameters
associated with an aggressive phenotype that can confound the results of the
statistical analysis. For this reason, we analyzed the prognostic relevance of the node
status, tumor size, histological grade, Ki67- and p53-LI which are well established
tumor-related factors which might also influence the clinical outcome of the patients
treated with adjuvant therapy. None of these variables, with the exception or pRb
status, resulted to be significantly associated with the clinical outcome (Table 14).
107
Results
Variables
Tumor size
pT1
pT2
pT3 + pT4
Histological grade
G1 + G2
G3
N-status (*)
N0
N+
p53-LI
< 10 %
 10 %
Ki67-LI
< 20 %
 20 %
RB status
RBRB+
n
DFS rate (%)
Long-rank
test: χ2
P
9
11
4
77,78
63,64
100
1,74
= 0,4197
2
22
50
77,27
0,83
= 0,3625
12
11
83,33
64,64
0,90
= 0,3440
10
14
80
71,43
0,05
= 0,8210
2
22
50
77,27
0,83
= 0,3625
11
13
100
53,85
7,03
= 0,0080
Table 14. Prognostic relevance of tumor size, histological grade, N status, p53 status,
proliferation rate and pRb status in triple-negative tumors treated with adjuvant chemotherapy
(n = 24): univariate DFS analysis
6.3.3. Relevance of pRb status on sensitivity to doxorubicin in MDA-MB-231
triple-negative derived cells
In order to demonstrate the relevance of the pRb status in the sensitivity to
chemotherapeutic agents in TNBCs, we also studied the sensitivity to 5-FU and
MTX as well as to doxorubicin exposure, in a human triple-negative derived cancer
cell lines, MDA-MB-231, in which the function of pRb was down-regulated by
silencing RB1. The effect of RB1-silencing in MDA-MB-231 cells was checked by
both Real Time-RT PCR and by Western blot analysis (Figure 36).
48 and 120 h after the RNA interference procedure, a strong reduction of pRb mRNA
expression occurred in MDA-MB-231 cells (Figure 36 a). Western blot analysis for
pRb expression confirmed that 48 h after the RB1 silencing procedure, the level of
pRb was markedly reduced compared to control samples (Figure 36 b).
108
Results
Figure 36. Effect of RB1 interference on RB1mRNA and pRb protein expression on MDA-MB231 cells. a) Asynchronously MDA-MB-231 cells were either silenced for RB1expression or
transfected with control scrambled sequences by RNA interference. The RB1 mRNA level was
evaluated in cells transfected with control scrambled sequences (SCR) and in cells silenced for RB1
(RB1i) at 48 and 120 h after the end of the silencing procedure. Note the high reduction of RB1
mRNA in RB1-silenced cells at both evaluation times. Histograms show the values (mean ± SD) of
three independent experiments. b) Representative Western blots of pRb expression in MDA-MB-231
cells, silenced for RB1 expression, 48 h after the end of the silencing procedure, show the strong
reduction of pRb expression in RB1-silenced cells (RB1i) as compared to cells transfected with
control scrambled sequences (SCR). The expression of β-actin was used as a control. The histogram
shows the densitometric values (mean ± SD) of three independent experiments. Each value concerns
the pRb:β-actin ratio, which was set to 100, in untreated cells transfected with scrambled sequences.
*p < 0.05
We then investigated the long-term effect of 5-FU plus MTX or doxorubicin
treatments on the cell population growth in controls and RB1-silenced MDA-MB231 cells (Figure 37).
109
Results
Figure 37. Effect of RB1 interference on the growth rate of MDA-MB-231 cells exposed to
chemotherapeutic agents. The cells were exposed to either 5-FU plus MTX (a) or doxorubicin (b)
for 2 h daily for 4 consecutive days. The drug treatments started 48 hours after RB1 silencing
procedure was completed and 24 h after the last treatment the cells were formalin-fixed for the crystal
violet assay for growth rate evaluation. Values relative to samples not treated with drugs were
normalized to 100. The histograms show the values (mean ± SD) of three independent experiments.
statistical significance was: *A= 0,0003 *B< 0.0001
The drug treatments significantly reduced cell population growth both in control and
RB1-silenced cells, but when pRb was down-regulated the sensitivity to drugs was
greater.
110
Discussion
7. DISCUSSION
These data show that in breast cancer the response to chemotherapy is conditioned
both by p53 and pRb status. In fact, when pRb pathway is normally functioning, p53
is the only independent factor capable to predict the patient clinical outcome after
adjuvant
chemotherapy
treatment.
pRb
alteration
characterized
by
pRb
hyperphosphorylation reduces the chemosensitivity of cancer cells, independently by
p53 status, while pRb loss increases the chemosensitivity, always independently by
p53 status. These data suggest that the assessment of these two genes is necessary to
have a prognostic indication of response to chemotherapy in breast cancer patients.
Going into detail, clear-cut evidence that the p53 status may influence the response
to chemotherapeutic agents, and therefore the clinical outcome of breast cancer
patients, was still lacking. As far as breast cancer is concerned, no consensus was
established on the predictive role of p53. Several studies, using either
immunohistochemistry or TP53 gene sequencing for p53 status analysis, supported
the role of p53 as prognostic marker (Silvestrini et al., 1993; MacGrogan et al., 1995;
Silvestrini et al., 1996; Thor et al., 1998; Chappuis et al., 1999) and many others
failed to demonstrated this role (Elledge et al., 1995; Sjögren et al., 1998; Clahsen et
al., 1998; Bro¨et et al., 1999; Penault-Llorca et al., 2003). We demonstrated that
these conflicting data were the results of an alteration of the p53-downstream
pathway which is frequently disrupted in human cancer cells for RB1 mutation or
deletion, overexpression of cyclin D1, CDK4, p16INK4a mutation (Knudsen and
Knudsen, 2008). These changes,
by causing either pRb
111
loss or pRb
Discussion
hyperphosphorylation, could either nullify the effect of p53 stabilization after
chemotherapy treatment or change the sensitivity to chemotherapeutic agents.
7.1. In breast cancer with a normally function of pRb pathway, the p53 status
was the only independent factor capable to predicting the patient clinical
outcome after adjuvant chemotherapy treatment
First, we evaluated the prognostic relevance of p53 in a series of patients according
to the pRb status, after chemotherapy treatment (5-FU plus MTX). In this series the
p53 status, considered independently of the pRb status, proved to have a null
prognostic value.
Also, in patients with pRb loss and with hyperphosphorylated pRb, the p53 variable
was not associated with the clinical outcome. As far as the patients with cancer with
normally functioning pRb pathway (underphosphorylated pRb) was concerned,
univariate analysis of DFS indicated a significant association of p53 status with
prognosis, the putatively mutated p53 being associated with a worse clinical
outcome. In this group, a multivariate analysis of DFS, including the other clinical
and histopathological variables associated with the clinical outcome such as tumor
size, histopathological grade, node status, ER-, PR- and Ki67-LI, and HER2, that
could have confounded the results of the statistical analysis, confirmed that the p53
status was the only factor significantly associated with the DFS, when pRb was
normally functioning.
112
Discussion
7.2. The absence but not functional inactivation of pRb predicted the clinical
outcome of patients treated with 5-FU and MTX adjuvant therapy
We evaluated, in a univariate analysis for the DFS, the predictive value of both the
expression of pRb and the degree of its phosphorylation in the whole series of
patients and in the patients who received standard chemotherapy regimen (5-FU plus
MTX). In fact, there is evidence that from the functional point of view,
hyperphosphorylation abolishes the tumor suppressor activity of pRb (Sherr and
McCormick, 2002). Thus, regarding the biological behavior of cancer cells, both the
lack of pRb expression and pRb hyperphosphorylation might have similar effects.
We subdivided the tumors into two groups: one characterized by the presence of pRb
expression, which included the underphosphorylated and hyperphosphorylated pRb
form (RB+), one with a deleted pRb status (RB-).
Regarding the relationship between pRb expression and patient clinical outcome, we
found that this pRb variable (RB- or RB+) was not a significant prognostic parameter
in the whole series of patients. However, among the patients who received
chemotherapy, those whose cancers lacked pRb (RB-) had a better prognosis than
those expressing the tumor suppressor protein.
About the relationship between the level of pRb phosphorylation and prognosis, we
found that the level of pRb phosphorylation not correlated with the clinical outcome
in patients who received chemotherapy. Therefore, only the loss of pRb, but not its
inactivation for hyperphosphorylation, was a predictive factor of the clinical outcome
of breast cancer patients, when treated with chemotherapy.
113
Discussion
7.3. Lack of pRb expression was the only independent factor predicting a good
clinical outcome in patients treated with adjuvant chemotherapy
We further investigated this relationship between pRb expression and the clinical
outcome in patients treated with chemotherapy, considering the possibility that the
significant predictive effect of pRb found might have been related to other clinical
and histopathological variables associated with the clinical outcome, such as node
status, tumor size, histologic grade, ER-, PR-, Ki67-, and p53- LI and HER2 status,
confounding these results. So we carried out a multivariate analysis for DFS and we
found that the pRb expression resulted to be the only significant predictive factor
associated with the prognosis in patients treated with chemotherapy: the group of
patients with RB- cancers having a better clinical outcome than those with RB+
cancer. Furthermore, because the number of breast cancers lacking pRb was small (n
= 16), to validate the significant association between pRb expression and prognosis
the 16 RB- tumors were matched with 32 RB+ tumors according those variables that
characterized all the RB- tumors (high histologic grade, high proliferation rate, and
absence of ER). Also, in this data set, patients with tumors lacking pRb expression
had a significantly better clinical outcome than patients with RB+ tumors. Therefore,
even if the number of breast cancers lacking pRb expression is only a small fraction
of total breast cancers, altogether these data indicated the only independent factor
predicting a good clinical outcome in patients treated with adjuvant chemotherapy
was the loss of pRb.
In order to demonstrate that a normally functioning pRb pathway was necessary to
allow wild-type p53 to induce a cytostatic activity after the exposure to
114
Discussion
chemotherapeutic agents, we analyzed the response to chemotherapeutic drugs, used
in breast cancer therapy, in human cancer cell lines with either wild-type or
abrogated p53 function (to inhibit p53 activity we have both interfered TP53 gene
and used an inactive truncated-dominant negative form of murine p53 (p53DD))
where the function of pRb was down-regulated either by abolishing the expression of
pRb by RB1-silencing, or by inducing pRb hyperphosphorylation by p16INK4asilencing. Therefore, we first evaluated the effects of the loss of pRb on the cell
proliferation rate of a p53-deficient and p53-proficient cell lines treated either with 5FU plus MTX or doxorubicin. As for the effect of the loss of pRb on the sensitivity
of p53-deficient and p53-proficient cells to drug exposure, we found that in cell lines
where p53 was inactivated, the inhibitory effect of drugs on the cell population
growth rate was greatly reduced as compared to cells harboring wild-type p53. RB1
silencing restored the high sensitivity to drugs in cells with inactivated p53 and the
cell population growth rate being the same as that of cells with wild-type p53.
There is evidence that the loss of pRb actually increases cell sensitivity to both
DNA-damaging agents and drugs targeting the thymidylate biosynthesis pathway
(Knudsen and Knudsen, 2008) The present results demonstrated that the high
sensitivity of pRb-deficient breast cancer cells, both to drugs targeting the
thymidylate biosynthesis pathway and to doxorubicin, were not influenced by p53
status and explain why tumours with mutated p53 could strongly benefit from
chemotherapy if they were also characterized by the loss of pRb.
As for the effect of pRb pathway inactivation, our results showed that pRb
hyperphosphorylation, caused by p16INK4a silencing, reduced the sensitivity to
doxorubicin in p53-proficient HepG2 cells. Since drug treatment of p53-proficient
115
Discussion
HepG2 cells caused the disappearance of the phosphorylated form of pRb in controls
but not in p16INK4a-silenced cells, our results demonstrate that p53 stabilization had
a lower cytostatic effect in p16INK4a-silenced cells, which was very likely due to the
persistence of phosphorylated pRb within cancer cells. These results were consistent
with the established mechanism of cell cycle progression blockage induced by the
activation of the p53-p21 pathway leading to the inhibition of pRb phosphorylation:
pRb hyperphosphorylation hinders p53-mediated cell cycle arrest (Knudsen and
Knudsen, 2008). They also explain well the observations that breast cancer patients
with hyperphosphorylated pRb and treated with adjuvant chemotherapy were
characterized by a poor prognosis that was independent of the p53 status. Our results
indicated that in breast cancers, as it has also been previously reported to occur in
non-small cell lung cancer (Burke et al., 2005), the complexity of the cell cycle
protein interaction warrants caution in interpreting survival results when specific
protein abnormalities are taken in isolation.
7.4. The greater sensitivity of pRb deficient cells to 5-FU plus MTX exposure
was due to the absence of a DNA damage checkpoint and DNA repair
mechanisms
To ascertain the mechanism at the basis of the enhanced sensitivity of pRb negative
tumors to antimetabolites action, we analyzed the effect of 5-FU and MTX treatment
on cell cycle progression in MCF-7 cells.
Analysis of the cytofluorimetric results indicated that 1-hour drug treatment caused
an arrest of cell cycle progression in control cells but not in RB1-silenced MCF-7
cell. These data were consistent with the available evidence indicating that several
116
Discussion
DNA damage inducers used in human tumor chemotherapy inhibit G1- and S-phase
progression in pRb-proficient but not in pRb-deficient cells (Knudsen KE et al.,
2000; Angus SP et al., 2002). Specifically, it has been shown that pRb-proficient
cells exposed to 5-FU failed to accumulate in any phase of the cell cycle, indicating
that the drug was responsible for the arrest in all phases of the cell cycle (Mayhew et
al., 2004). We also investigated whether in RB1-silenced cells the p53/p21 pathway,
which is usually involved in the genotoxic-induced arrest of cell cycle progression
(Sherr CJ and McCormick F, 2002) was hindered. We evaluated the expression of
p53 after 1-hour treatment with 5-FU and MTX in control and RB1-silenced MCF-7
cells and we found that in both control and RB1-silenced cells, the amount of p53
was greatly increased after the drug treatment, indicating a functional p53 pathway.
We also investigated whether the higher sensitivity of pRb-deficient cells to drug
exposure could have been the consequence of their reduced capacity for repairing the
drug-induced DNA changes. We demonstrated that RB1-silenced cells exhibited
elevated levels of γ-H2AX, indicative of defects in the DNA repair machinery,
whereas the control cells did not shown accumulation of double strand breaks, thus
indicating a normal DNA repairing activity. In other words, pRb-proficient cells may
be more resistant to anti-metabolite exposure than pRb-deficient cells because they
have the time for repairing the 5-FU-induced damage by possessing functioning cell
cycle checkpoint and DNA repair mechanisms. This repair would be impossible for
cells lacking pRb in which the DNA damaging agents do not induce arrest of cell
cycle progression and DNA repair mechanisms are hindered.
117
Discussion
7.5. High prevalence of retinoblastoma protein loss in triple-negative breast
cancers was responsible for a good prognosis in patients treated with adjuvant
chemotherapy
The triple negative breast cancers (TNBCs) are a particular subtype of breast
carcinomas. They are very aggressive and due to absence of hormone receptors and
HER2, they are treated only with adjuvant chemotherapy.
It is worth noting that they exhibit higher rates of objective response to
chemotherapy then other tumor types. This suggests that the biological features
present more frequently in this subtype are responsible for their increased sensitivity
to chemotherapy.
Since we demonstrated that breast cancers lacking pRb expression were more
sensitive to adjuvant chemotherapy, we investigated whether the high sensitivity to
chemotherapy of TNBCs could be due to the loss of pRb.
We carried out an immunohistochemical analysis on a large consecutive series of
primary breast cancer to identify the breast cancer subtypes. In our breast cancer
series, we identified 53 tumors as triple negative cancers, corresponding to 10.2% of
the 518 cases taken into account. This value was within the range (10%–17%)
reported for the frequency of triple-negative cancers among all breast cancers (ReisFilho and Tutt, 2008). Then we evaluated the clinical outcome of the four subtypes
of tumors independently of the adjuvant treatment received. After a mean follow-up
time of 109 months, the best prognosis was associated with the luminal A type,
followed by the triple-negative tumors. Therefore, in our series, triple negative
tumors did not appear to be characterized by a more aggressive clinical behavior
compared with other types of breast cancer. According to the previous results (Dent
118
Discussion
et al., 2007), we found that in patients with triple-negative tumors, adverse events
were concentrated in the first 40 months after surgery, whereas in other tumor
subtypes they were distributed throughout the entire follow-up period. We also
analyzed the clinical outcome of patients according to their adjuvant therapy
treatment. Chemotherapy-treated patients with triple-negative tumors were
characterized by a very good prognosis in comparison to those affected by other
tumor subtypes.
We evaluated the pRb status on the four breast cancer subtypes and we found that
64.5% of pRb-deficient tumors were triple-negative cases and that 37.7% of triplenegative tumors were pRb deficient compared with 2.3% of other cancer types.
Regarding pRb inactivation by hyperphosphorylation, the percentage of TNBCs with
hyperphosphorylated pRb was not significantly different to that of other cancer
subtypes, thus indicating that pRb loss, but not pRb functional inactivation by
hyperphosphorylation, represented a frequent biological characteristic of triplenegative tumors. We evaluated the clinical outcome of patients with triple-negative
tumors treated with chemotherapy according to the presence or absence of pRb
expression. We subdivided the tumors into two groups: one characterized by the
presence of pRb expression, which included the underphosphorylated and
hyperphosphorylated pRb form (RB+), one with a deleted pRb status (RB-).
We demonstrated that all patients with pRb loss were found to be disease free,
whereas those with normal or hyperphosphorylated-pRb had a significantly poorer
prognosis, indicating that the lack of pRb expression represented a strong predictive
parameter of DFS in TNBC patients who received chemotherapy.
119
Discussion
We considered the possibility that the highly favorable clinical outcome of
chemotherapy-treated patients could be related to other anatomo-clinical parameters
associated with an aggressive phenotype, confusing the results of the statistical
analysis. For this reason, we analyzed the prognostic relevance of the node status,
tumor size, histological grade, Ki67- and p53-LI which were well established tumorrelated factors which could influence the clinical outcome of the patients treated with
adjuvant therapy. We confirmed that none of these variables resulted to be associated
with the clinical outcome, with the exception of pRb status which was the only
predictive factor significantly associated with the clinical outcome.
We also confirmed the effect of loss of pRb on the sensitivity to drug exposure in a
triple-negative derived cell lines, the MDA-MB-231.
In conclusion, triple negative cancers seemed to harbor a biological feature that,
when present, made them highly sensitive to chemotherapy. In the absence of this
specific feature, the highly aggressive phenotype of these cancers would determine
the poor clinical outcome for patients. In the present study we found that the lack of
pRb expression was more frequent in TNBCs than in other cancer subtypes, and
patients with triple-negative tumors lacking pRb had a very favorable clinical
outcome if treated with adjuvant chemotherapy. Therefore, we suggested that the loss
of pRb expression was this biological feature.
In conclusion, taken together, these data indicate that p53 and pRb are key elements
for the determination and prediction of response to chemotherapy, in particular in
breast cancer, just because their function is to control the cell cycle and to respond to
120
Discussion
any damages, including those induced by chemotherapy drugs (Figure 38)
Alterations of p53-pRb pathway may influence the chemosensitivity.
We observed that in breast cancer with a normally functioning pRb pathway, p53
was the only independent factor capable of predicting the patient clinical outcome
after adjuvant chemotherapy treatment. Regarding the pRb alterations, we found that
the
pRb
functional
inactivation
(pRb
hyperphosphorylated)
reduced
the
chemosensitivity, independently by p53 status; whereas the cancers with pRb loss
increased the sensitivity to chemotherapy, always independently by p53 status, and
the patients had a better prognosis (Figure 39). Therefore, the pRb loss was the only
predictive factors of a good clinical outcome for patients treated with adjuvant
chemotherapy, especially in a particular subtype of breast cancers, the triple-negative
tumors, characterized by a large amount of pRb-deleted tissues.
Therefore, the systemic chemotherapy should be considered to represent the first
choice adjuvant treatment for patients with pRb negative cancers.
These studies allow us to suggest the introduction into clinical practice, beyond the
already known assessment of p53, also the concomitant evaluation of the pRb
expression because together they represent two important, related and strong
prognostic and predictive parameters of clinical outcome of patients with breast
cancers and treated with chemotherapy.
121
Discussion
Figure 38. Schematic representation of the p53-pRb pathway activated by chemotherapeutic
treatments
Figure 39. Schematic representation of prognostic relevance of pRb and p53 status to predict
the clinical outcome of breast cancer patients treated with chemotherapy
122
Notes
8. NOTES
During the three years of PhD studies, I coauthored these work:
 M Derenzini, E Brighenti, G Donati, M Vici, C Ceccarelli, D Santini, M
Taffurelli, L Montanaro, D Treré. The p53-mediated sensitivity of cancer
cells to chemotherapeutic agents is conditioned by the status of the
retinoblastoma protein. J Pathol. 2009 Nov; 219(3):373-82.
 D Trerè, E Brighenti, G Donati, C Ceccarelli, D Santini, M Taffurelli, L
Montanaro and M Derenzini. High prevalence of retinoblastoma protein loss
in triple-negative breast cancers and its association with a good prognosis in
patients treated with adjuvant chemotherapy. Ann Oncol. 2009 Nov;
20(11):1818-23. Epub 2009 Jun 25.
I have also been involved in another research project. This work was published at the
beginning of 2011 in Oncogene:
 G Donati*, S Bertoni*, E Brighenti, M Vici, D Treré, S Volarevic, L
Montanaro, M Derenzini. The balance between rRNA and ribosomal protein
synthesis up- and down-regulates the tumour suppressor p53 in mammalian
cells. Oncogene in press.
123
References
9. REFERENCES
Aas T, Borresen AL, Geisler S, Smith-Sorensen B, Johnsen H, Varhaug JE, Akslen
LA, Lonning PE (1996). Specific P53 gene mutations are associated with de novo
resistance to doxorubicin in breast cancer patients. Nat Med; 2:811-814.
Allred DC, Hilsenbeck SG, Mohsin SK (2004). Biologic features of human
premalignant breast disease. In: Harris JR, Lippman ME, Morrow M, et al., editors.
Diseases of the Breast. Philadelphia: Lippincott Williams &Wilkins; p. 512-3.
Allred DC, Mao S, Nagtegaal ID, Lee S, Perou CM, Mohsin SK, O‟Connel P,
Tsimelzon A, Medina D (2008). Ductal carcinoma in situ and the emergence of
diversity during breast cancer evolution. Clin Cancer Res; 14:370-378.
Almasan A,YinY, Kelly RE, Lee EY, Bradley A, Li W, Bertino JR, Wahl GM
(1995). Deficiency of retinoblastoma protein leads to inappropriate S-phase entry,
activation of E2F-responsive genes, and apoptosis. Proc Natl Acad Sci US A;
92:5436-40.
Amundadottir LT, Thorvaldsson S, Gudbjartsson DF, Sulem P, Kristjansson K,
Arnason S, Gulcher JR, Bjornsson J, Kong A, Thorsteinsdottir U, Stefansson K
(2004). Cancer as a complex phenotype: pattern of cancer distribution within and
beyond the nuclear family. PLoS Med; 1:e65.
Angus SP, Wheeler LJ, Ranmali SA, Zhang X, Markey MP, Mathews CK, Knudsen
ES (2002). Retinoblastoma tumor suppressor targets dNTP metabolism to regulate
DNA replication. J Biol Chem; 277:44376-84.
Appella E, Anderson CW (2001). Post-translational modifications and activation of
p53 by genotoxic stresses. Eur. J. Biochem; 268:2764–2772.
Baghurst PA, Rohan TE (1995). Dietary fiber and risk of benign proliferative
epithelial disorders of the breast. Int J Cancer; 63:481-5.
Balint E, Vousden KH (2002). Activation and activities of the p53 tumor suppressor
protein. Br. J. Cancer; 85:1813–1823.
Baserga R, Porcu P, Sell C (1993). Oncogenes, growth factors and control of the cell
cycle. Cancer Surv; 16: 201–13.
Bates S, Vousden KH (1999). Mechanisms of p53-mediated apoptosis. Cell Mol Life
Sci; 55:28-37.
Beckmann MW, Niederacher D, Schnurch HG, Gusterson B, Bender HG (1997).
Multistep carcinogenesis of breast cancer and tumor heterogeneity. J. Mol. Med.;
75:429- 439.
124
References
Beral V, Reeves G (1993). Childbearing, oral contraceptive use, and breast cancer.
Lancet; 341: 1102.
Borresen AL, Andersen TI, Eyfjord JE, Cornelis RS, Thorlacius S, Borg A,
Johansson U, Theillet C, Scherneck S, Hartmen S, Cornelisse CJ, Hovig E, Devilee P
(1995). TP53 mutations and breast cancer prognosis: particularly poor survival rates
for cases with mutations in the zinc-binding domains. Genes Chromosome Cancer;
14:71-75.
Bosco EE, Mayhew CN, Hennigan RF, Sage J, Jacks T, Knudsen ES (2004). RB
signaling prevents replication-dependent DNA double-strand breaks following
genotoxic insult. Nucleic Acids Res; 32:25-34.
Bosco EE, Wang Y, Xu H, Zilfou JT, Knudsen KE, Aronow BJ, Lowe SW, Knudsen
ES (2007). The retinoblastoma tumor suppressor modifies the therapeutic response of
breast cancer. J Clin Invest; 117:218-28.
Broët P, Spyratos F, Romain S, Quillien V, Daver A, Ricolleau G, Rallet A, Toulas
C, Asselain B (1999). Prognostic value of uPA and p53 accumulation measured by
quantitative biochemical assays in 1245 primary breast cancer patients: a multicentre
study. Br J Cancer; 80:536–545.
Buckley MF, Sweeney KJ, Hamilton JA, Sini RL, Manning DL, Nicholson RI,
deFazio A, Watts CK, Musgrove EA, Sutherland RL (1993). Expression and
amplification of cyclin genes in human breast cancer. Oncogene; 8:2127 -2133
Buell P (1973). Changing incidence of breast cancer in Japanese-American women. J
Natl Cancer Inst; 51:1479-1483.
Burke L, Flieder DB, Guinee DG, Brambilla E, Freedman AN, Bennett WP, Jones
RT, Borkowski A, Caporaso NA, Fleming M, Trastek V, Pairolero P, Tazelaar H,
Midthun D, Jett JR, Liotta LA, Travis WD, Harris CC (2005). Prognostic
implications of molecular and immunohistochemical profiles of the Rb and p53 cell
cycle regulatory pathways in primary non-small cell lung carcinoma. Clin Cancer
Res; 11:232–241.
Butler LM, Potischman NA, Newman B, Millikan RC, Brogan D, Gammon MD,
Swanson CA and Brinton LA (2000). Menstrual risk factors and early-onset breast
cancer. Cancer Causes and Control; 11:451-458.
Care LA, Perou CM, Livasy CA, Dressler LG, Cowan D, Convay K, Karaca G,
Troester MA, Tse CK, Edmiston S, Deming SL, Geradts J, Cheang MC, Nielsen TO,
Moorman PG, Earp HS, Millkan RC (2006). Race, breast cancer subtypes and
survival in the Carolina Breast Cancer Study. JAMA; 295: 2492-2502.
Carnero A, Hudson JD, Price CM, Beach DH (2000). p16(INK4a) and p19ARF act
in overlapping pathways in cellular immortalization. Nat Cell Biol; 2:148–155.2000.
125
References
Carola R, Harley JP, Noback C (1992). Human Anatomy and Physiology 2nd ed,
McGraw-Hill Inc., New York.
Carson DA, Ribeiro JM (1993). Apoptosis and disease. Lancet; 341:1251-1254.
Carter CL, Allen C and Henson DE (1989). Relation of tumour size, lymph node
status, and survival in 24,740 breast cancer cases. Cancer; 63:181-187.
Chappuis PO, Estreicher A, Dieterich B, Bonnefoi H, Otter M, Sappino AP, Iggo R
(1999). Prognostic significance of p53 mutation in breast cancer: frequent detection
of non-missense mutations by yeast functional assay. Int J Cancer; 84:587–593.
Cheang MCU, Chia SK, Voduc D, Gao D, Leung S, Snider J, Watson M, Davies S,
Bernard PS, Parker JS, Perou CM, Ellis MJ, Nielsen TO (2009). Ki67 index, HER2
status, and prognosis of patients with luminal B breast cancer. J. Natl. Cancer Inst;
101:736-750.
Clahsen PC, van de Velde CJ, Duval C, Pallud C, Mandard AM, Delobelle-Deroide
A, van den Broek L, Sahmoud TM, van de Vijver MJ (1998). p53 protein
accumulation and response to adjuvant chemotherapy in pre-menopausal women
with node- negative early breast cancer. J Clin Oncol; 16:470-479.
Coe K and Steadman LB (1995). The human breast and the ancestral reproductive
cycle. Human Nature; 6:197-220.
Collaborative Group on Hormonal Factors in Breast Cancer (1996). Breast cancer
and hormonal contraceptives: collaborative reanalysis of individual data on 53 297
with breast cancer and 100 239 women without breast cancer from 54
epidemiological studies. Lancet; 347: 1713–27.
Collaborative Group on Hormonal Factors in Breast Cancer (1997). Breast cancer
and hormone replacement therapy: collaborative reanalysis of data from 51
epidemiological studies of 52 705 women with breast cancer and 108 411 women
without breast cancer. Lancet; 350: 1047–59.
Cordon-Cardo C (1995). Mutations of cell cycle regulators. Biological and clinical
implications for human neoplasia. Am J Pathol; 147:545-60.
Cruet-Hennequart S, Glynn MT, Murillo LS, Coyne S, Carty MP (2008). Enhanced
DNA-PK-mediated RPA2 hyperphosphorylation in DNA polymerase eta-deficient
human cells treated with cisplatin and oxaliplatin. DNA Repair (Amst); 7:582–96.
David-Pfeuty T (2006). The flexible evolutionary anchorage-dependent Pardee‟s
restriction point of mammalian cells. How its deregulation may lead to cancer.
Biochim Biophys Acta; 1765:38–66.
Davis DL and Bradlow HL (1995). Can environmental estrogens cause breast
cancer? Scientific American; 273:144-149.
126
References
Dent R, Trudeau M, Pritchard KI Hanna WM, Kahn HK, Sawka CA, Lickley LA,
Rawlinson E, Sun P, Narod SA (2007). Triple-negative breast cancer: clinical
features and patterns of recurrence. Clin Cancer Res; 13:4429–4434.
Derenzini M, Ceccarelli C, Santini D, Taffurelli M, Trerè D (2004). The prognostic
value of the AgNOR parameter in human breast cancer depends on the RB and p53
status. J Clin Pathol; 57:755–761.
DiSaia PJ (1993). Hormone replacement therapy in patients with breast cancer.
Cancer; 71:1490-1500.
Donegan WL (1992). Prognostic factors: Stage and receptor status in breast cancer.
Cancer; 70:1755-1764.
Dublin EA, Patel NK, Gillett CE, Smith P, Peters G, Barnes DM (1998).
Retinoblastoma and p16 proteins in mammary carcinoma: their relationship to cyclin
D1 and histopathological parameters. Int. J. Cancer; 79:71–75.
Easton D (1997). Breast cancer genes - What are the real risks? Nature Gene;t
16:210-211.
Easton DF (1999). How many more breast cancer predisposition genes are there?
Breast Cancer Res; 1:14-7.
Elledge RM, Gray R, Mansour E, Yu Y, Clark GM, Ravdin P, Osborne CK, Gilchrist
K, Davidson NE, Robert N (1995). Accumulation of p53 protein as a possible
predictor of response to adjuvant combination chemotherapy with
cyclophosphamide, methotrexate, fluorouracil, and prednisone for breast cancer. J
Natl Cancer Inst; 87:1254–1256.
Elledge RM, McGufre WL (1993). Prognostic factors and therapeutic decisions in
axillary node-negative breast cancer. Annual Reviews in Medicine; 44:201-210.
Ellis IO, Bartlett J, Dowsett M, Humphreys S, Jasani B, Miller K, Pinder SE, Rhodes
A, Walker R (2004). Best Practice No. 176: updated recommendations for HER2
testing in the UK. J Clin Pathol; 57:233–237.
Elston CW, Ellis IO (1991). Pathological prognostic factors in breast cancer. I. The
value of histological grade in breast cancer: experience from a large study with longterm follow-up. Histopathology; 19:403-10.
Endogenous Hormones and Breast Cancer Collaborative Group (2002). Endogenous
sex hormones and breast cancer in postmenopausal women: Reanalysis of nine
prospective studies. Journal of the National Cancer Institute; 94:606-616.
127
References
Esrig D, Spruck CH III, Nichols PW, Chaiwun B, Steven K, Groshen S, Chen SC,
Skinner DG, Jones PA, Cote RJ (1993). p53 nuclear protein accumulation correlates
with mutations in the p53 gene, tumor grade, and stage in bladder cancer. Am J
Pathol; 43:1389–1397.
Faccioli S, Chieco P, Gramantieri L, Stecca BA, Bolondi L (1996). Cytometric
measurement of cell proliferation in echo-guided biopsies from focal lesions of the
liver. Mod Pathol; 9:120-5.
Fantl V, Stamp G, Andrews A, Rosewell I, Dickson C (1995). Mice lacking cyclin
D1 are small and show defects in eye and mammary gland development. Genes Dev;
9:2364–2372.
Fornari FA, Randolph JK, Yalowich JC, Ritke MK, Gewirtz DA (1994). Interference
by doxorubicin with DNA unwinding in MCF-7 breast tumor cells. Mol Pharmacol;
45: 649–56.
Friedenreich CM, Thune I, Brinton LA, Albanes D (1998). Epidemiologic issues
related to the association between physical activity and breast cancer. Cancer; 83:
600–10.
Fund WCRL (1997). Food, Nutrition and the Prevention of Cancer: a Global
Perspective. Washington, DC: American Institutue for Cancer Research.
Gali-Muhtasib H, Bakkar N (2002). Modulating cell cycle: current applications and
prospects for future drug development. Curr Cancer Drug Targets; 2:309–36.
Gandini S, Merzenich H, Robertson C, Boyle P (2000). Meta-analysis of studies on
breast cancer risk and diet: the role of fruit and vegetable consumption and the intake
of associated micronutrients. Eur J Cancer; 36: 636–46.
Gentili C, Sanfilippo O, Silvestrini R (1981). Cell proliferation and its relationship to
clinical features and relapse in breast cancers. Cancer; 48:974-979.
Gerdes J, Pickartz H, Brotherton J, Hammerstein J, Weitzel H, Stein H (1987).
Growth fractions and estrogen receptors in human breast cancers as determined in
situ with monoclonal antibodies. Am J Pathol; 129:486-492.
Giaccia AJ, Kastan MB (1998). The complexity of p53 modulation: emerging
patterns from divergent signals. Genes Dev; 12:2973–2983.
Ginsburg ES, Walsh BW, Gao X, Gleason RE, Feltmate C, Barbieri RL (1995). The
effect of acute ethanol ingestion on estrogen levels in postmenopausal women using
transdermal estradiol. J Soc Gynecol Investig; 2:26-29.
128
References
Goodwin PJ, Esplen MJ, Winocur J (1995). Development of a weight management
program in women with newly diagnosed locoregional breast cancer, in Bitzer J SM
(eds): Psychosomatic Obstetrics and Gynecology. Bologna, Italy, Monduzzi Editore,
International Proceedings Division, pp 491-496.
Gorbsky GJ (1997). Cell Cycle Checkpoints: Arresting Progress in Mitosis.
Bioessays; 19:193-7.
Hall PA, McCluggage WG (2006). Assessing p53 in clinical contexts: unlearned
lessons and new perspectives. J Pathol; 208:1–6.
Hanahan D, Weinberg RA (2000). The hallmarks of cancer. Cell; 100:57-70.
Harbour JW, Luo RX, Dei Santi A, Postigo AA, Dean DC (1999). Cdk
phosphorylation triggers sequential intramolecular interactions that progressively
block Rb functions as cells move through G1. Cell; 98:859-69.
Harris SL, Levine AJ (2005). The p53 pathway: positive and negative feedback
loops. Oncogene; 24:2899–2908.
Hartwell L, Weinert T (1989). Checkpoints: controls that ensure the order of cell
cycle events. Science; 246:629–634.
Hartwell LH, Kastan MB (1994). Cell cycle control and cancer. Science; 266:1821–
1828.
Hu Z, Fan C, Oh DS, Marron JS, He X, Qaqish BF, Livasy C, Carey LA, Reynolds
E, Dressler L, Nobel A, Parker J, Ewend MG, Sawyer LR, Wu J, Liu Y, Nanda R,
Tretiakova M, Ruiz Orrico A, Dreher D, Palazzo JP, Perreard L, Nelson E, Mone M,
Hansen H, Mullins M, Quackenbush JF, Ellis MJ, Olopade OI, Bernard PS, Perou
CM (2006). The molecular portraits of breast tumors are conserved across
microarray platforms. BMC Genomics; 7:96.
Hulka BS, Moorman PG (2001). Breast cancer: hormones and other risk factors.
Maturitas; 38:103-113.
Hunter DJ, Willett WC (1993). Diet, body size, and breast cancer. Epidemiol Rev;
15: 110–32.
Irvin WJ Jr, Carey LA (2008). What is triple-negative breast cancer? Eur J Cancer;
44:2799-805.
Irwin MS, Kaelin WG (2001). p53 family update: p73 and p63 develop their own
identities. Cell Growth Differ; 12:337–349.
Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ (2007). Cancer statistics,
2007. CA: A Cancer Journal for Clinicians; 57:43–66.
129
References
Jemal A, Siegel R, Xu J, Ward E (2010). Cancer statistics, 2010. CA Cancer J Clin;
60: 277–300.
Jin S, Levine AJ (2001). The p53 functional circuit. J Cell Sci; 114:4139-40.
Johnstone RW, Ruefli AA, Lowe SW (2002). Apoptosis: a link between cancer
genetics and chemotherapy. Cell; 108:153–164.
Kelsey JL, Gammon MD, John EM (1993). Reproductive factors and breast cancer.
Epidemiol Rev; 15:36–47.
Key TJ, Fraser GE, Thorogood M, Appleby PN, Beral V, Reeves G, Burr ML,
Chang-Claude J, Frentzel-Beyme R, Kuzma JW, Mann J, McPherson K (1998).
Mortality in vegetarians and non-vegetarians: a collaborative analysis of 8300 deaths
among 76,000 men and women in five prospective studies. Public Health Nutr;
1:33–41.
Key TJA, Pike MC, (1988). The role of estrogens and progestagens in the
epidemiology and prevention of breast cancer. European Journal of Cancer and
Clinical Oncology; 24:29-43.
King MM, McCay PB (1983). Modulation of tumor incidence and possible
mechanisms of inhibition of mammary carcinogenesis by dietary antioxidants.
Cancer Res; 43(5 Suppl):2485s-2490s.
Knudsen ES, Knudsen KE (2008). Tailoring to RB tumour suppressor status and
therapeutic response. Nat Rev Cancer; 9:714–724.
Knudsen KE, Booth D, Naderi S, Sever-Chroneos Z, Fribourg AF, Hunton IC,
Feramisco JR, Wang JY, Knudsen ES (2000). RB-dependent S-phase response to
DNA damage. Mol Cell Biol; 20:7751-63.
Kubbutat MH, Jones SN, Vousden KH (1997). Regulation of p53 stability by Mdm2.
Nature; 387:299-303.
Lacroix M, Toillon RA, Leclercq G (2004) Stable 'portrait' of breast tumors during
progression: data from biology, pathology and genetics. Endocr Relat Cancer;
11:497-522.
Lambe M, Hsieh CC, Trichopoulos D, Ekbom A, Pavia M, Adami HO (1994).
Transient increase m the risk of breast cancer after giving birth. New England
Journal of Medicine; 331:5-9.
Lau WM, Ho TH, Hui KM (2007). p16(INK4a)-silencing augments DNA damageinduced apoptosis in cervical cancer cells. Oncogene; 26:6050–6060.
130
References
Layde PM, Webster LA, Baughman AL, Wingo PA, Rubin GL, Ory HW (1989). The
independent associations of parity, age at first full term pregnancy, and duration of
breast feeding with the risk of breast cancer. J Clin Epidemiol; 42:963–73.
Lichtenstein P, Holm NV, Verkasalo PK, Illiadou A, Kaprio J, Koskenvuo M,
Pukkala E, Skytthe A, Hemminki K (2000). Environmental and heritable factors in
the causation of cancer. N Engl J Med; 343:78–85.
Longley DB, Harkin D, Johnston PG (2003). 5-Fluorouracil: mechanisms of action
and clinical strategies. Nat Rev Cancer; 3:330-8.
Lowe SW, Bodis S, McClatchey A, Remington L, Ruley HE, Fisher DE, Housman
DE, Jacks T (1994). p53 status and the efficacy of cancer therapy in vivo. Science;
226:807-810;
Lu X, Kang Y (2007). Organotropism of breast cancer metastasis. J Mammary Gland
Biol Neoplasia; 12:153-62.
MacGrogan G, Bonichon F, de Mascarel I, Trojani M, Durand M, Avril A, Coindre
JM (1995). Prognostic value of p53 in breast invasive ductal carcinoma: an
immunohistochemical study on 942 cases. Breast Cancer Res Treat; 36:71–81.
MacNicoll AD, Easty GC, Neville AM, Grover PL, Sims P (1980). Metabolism and
activation of carcinogenic polycyclic hydrocarbons by human mammary cells.
Bioche Biophys Res Commun; 95: 1599-1606.
Magnusson CM, Baron J, Correia N, Bergström R, Adami HO, Persson I (1999).
Breast-cancer risk following long-term oestrogen- and oestrogen-progestin
replacement therapy. Int J Cancer; 81:339–44.
Mansour EG, Ravdin PM, Dressler L (1994). Prognostic factors in early breast
carcinoma. Cancer; 74:381-400.
Mayhew CN, Perkin LM, Zhang X, Sage J, JacksT, Knudsen ES (2004). Discrete
signaling pathways participate in RB-dependent responses to chemotherapeutic
agents. Oncogene; 23:4107-20.
Mazzini G, Danova M, Ferrari C, Giordano M, Dionigi P, Riccardi A (1996). Cell
proliferation and ploidy of human solid tumours: methodological experience with in
vivo bromodeoxyuridine and DNA flow cytometry. Anal Cell Pathol; 10:101-13.
McCormack VA, dos Santos Silva I (2006). Breast density and parenchymal patterns
as markers of breast cancer risk: a meta-analysis. Cancer Epidemiol Biomarkers
Prev; 15:1159–1169.
McGurrin JF, Doria Ml, Dawson PJ, Karrison T, Stein H, Franklin WA (1987).
Assessment of tumor cell kinetics by immunohistochemistry in carcinoma of breast.
Cancer; 59:1744-1750.
131
References
Medema RH, Herrera RE, Lam F, Weinberg RA (1995). Growth suppression by
p16ink4 requires functional retinoblastoma protein. Proc Natl Acad Sci; 92:6289–
6293.
Medri L, Volpi A, Nanni O, Vecci AM, Mangia A, Schittulli F, Padovani F, Giunchi
DC, Zito A, Amadori D, Paradiso A, Silvestrini R (2003). Prognostic relevance of
mitotic activity in patients with node-negative breast cancer. Mod Pathol; 16:106775.
Millikan R, Newman B, Tse C-K, Moorman P, Conway K, Smith L, Labbok M,
Geradts J, Bensen J, Jackson S, Nyante S, Livasy C, Carey L, Earp H, Perou C
(2008). Epidemiology of basal-like breast cancer. Breast Cancer Res. Treat;
109:123-139.
Mittnacht S (1998). Control of pRB phosphorylation. Curr Opin Genet Dev; 8:21–
27.
Momand J, Zambetti GP, George DL, Levine AJ (1992). The mdm-2 oncogene
product forms a complex with the p53 protein and inhibits p53-mediated
transactivation. Cell; 69:1237–1245.
Momparler RL, Karon M, Siegel SE, Avila F (1976). Effect of adriamycin on DNA,
RNA, and protein synthesis in cell-free systems and intact cells. Cancer Res; 36:
2891–5.
Morgan DO (1997). Cyclin-dependent kinases: Engines, Clocks, and
Microprocessors Annual Review of Cell and Developmental Biology; 13:261-291.
Morgenstern JP, Land H (1990). Advanced mammalian gene transfer: high titre
retroviral vectors with multiple drug selection markers and a complementary helperfree packaging cell line. Nucleic Acids Res; 18:3587–3596.
Morris GJ, Naidu S, Topham AK, Guiles F, Xu Y, McCue P, Schwartz GF, Park PK,
Rosenberg AL, Brill K, Mitchell EP (2007). Differences in breast carcinoma
characteristics in newly diagnosed African-American and Caucasian patients.
Cancer; 110:876–884.
Murray A, Hunt T (1993). The Cell Cycle: An Introduction. W.H. Freeman and Co,
New York.
Musgrove EA, Lilischkis R, Cornish AL, Lee CS, Setlur V, Seshadri R, Sutherland
RL (1995). Expression of the cyclin-dependent kinase inhibitors p16INK4,
p15INK4B and p21WAF1/CIP1 in human breast cancer. Int J Cancer; 63:584–591.
Myöhänen SK, Baylin SB, Herman JG (1998). Hypermethylation can selectively
silence individual p16(INK4a) alleles in neoplasia. Cancer Res; 58:591–593.
132
References
Nenutil R, Smardova J, Pavlova S, Hanzelkova Z, Muller P, Fabian P, Hrstka R,
Janotova P, Radina M, Lane DP, Coates PJ, Vojtesek B (2005). Discriminating
functional and non-functional p53 in human tumours by p53 and MDM2
immunohistochemistry. J Pathol; 207:251–259.
Nielsen TO, Parker JS, Leung S, Voduc D, Ebbert M, Vickery T, Davies SR, Snider
J, Stijleman IJ, Reed J, Cheang MC, Mardis ER, Perou CM, Bernard PS, Ellis MJ
(2010). A comparison of PAM50 intrinsic subtyping with immunohistochemistry and
clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast
cancer. Clin. Cancer Res; 16:5222-5232.
Otterson GA, Kratzke RA, Coxon A, Kim YW, Kaye FJ (1994). Absence of
p16INK4a protein is restricted to the subset of lung cancer lines that retains wild type
RB. Oncogene; 9:3375–3378.
Palmer JR, Rosenberg L (1993). Cigarette smoking and the risk of breast cancer.
Epidemiol Rev; 15:145-156.
Pardee AB, Dubrow R, Hamlin JL, Kletzien RF (1978). Animal cell cycle. Annu Rev
Biochem; 47:715-750.
Pavletich NP (1999). Mechanisms of cyclin-dependent kinase regulation: structures
of Cdks, their cyclin activators, and Cip and INK4 inhibitors. J Mol Biol; 287:821–
828.
Penault-Llorca F, Cayre A, Bouchet Mishellany F, Amat S, Feillel V, Le Bouedec G,
Ferrière JP, De Latour M, Chollet P (2003). Induction chemotherapy for breast
carcinoma: predictive markers and relation with outcome. Int J Oncol; 22:1319–
1325.
Pharoah PD, Day NE, Duffy S, Easton DF, Ponder BA (1997). Family history and
the risk of breast cancer: a systematic review and meta-analysis. Int J Cancer;
71:800–09.
Pickering MT, Kowalik TF (2006). Rb inactivation leads to E2F1-mediated DNA
double-strand break accumulation. Oncogene; 25:746-55.
Planas-Silva MD, Weinberg RA (1997). The restriction point and control of cell
proliferation. Curr Opin Cell Biol; 9:768-72.
Porter AT, McEwan AJ, Powe JE, Reid R, McGowan DG, Lukka H, Sathyanarayana
JR, Yakemchuk VN, Thomas GM, Erlich LE (1993). Results of a randomized phaseIII trial to evaluate the efficacy of strontium-89 adjuvant to local field external beam
irradiation in the management of endocrine resistant metastatic prostate cancer. Int J
Radiat Oncol Biol Phys; 25: 805-13.
133
References
Prat, A., Parker, J., Karginova, O., Fan, C., Livasy, C.,Herschkowitz, J., He, X.,
Perou, C., 2010. Phenotypic and molecular characterization of the claudin-low
intrinsic subtype of breast cancer. Breast Cancer Res; 12:R68.
Quesnel B, Fenaux P, Philippe N, Fournier J, Bonneterre J, Preudhomme C, Peyrat
JP (1995). Analysis of p16 gene deletion and point mutation in breast carcinoma. Br
J Cancer; 72:351–353.
Rakha EA, El-Sayed ME, Green AR, Lee AH, Robertson JF, Ellis IO (2007).
Prognostic markers in triple-negative breast cancer. Cancer; 109:25-32.
Reis-Filho JS, Tutt AN (2008). Triple negative tumours: a critical review.
Histopathology; 52:108–118.
Rohan TE, Bain CJ (1987). Diet in the aetiology of breast cancer. Epidemiologic
Reviews; 9:120-145.
Rosner B, Colditz GA, Willett WC (1994). Reproductive risk factors in a prospective
study of breast cancer: The nurse's health study. American Journal of Epidemiology;
139:819-835.
Rouzier R, Perou CM, Symmans WF, Ibrahim N, Cristofanilli M, Anderson K, Hess
KR, Stec J, Ayers M, Wagner P, Morandi P, Fan C, Rabiul I, Ross JS, Hortobagyi
GN, Pusztai L (2005). Breast cancer molecular subtypes respond differently to
preoperative chemotherapy. Clin Cancer Res; 11:5678-85.
Ruas M, Peters G (1998). The p16INK4a/CDKN2A tumor suppressor and its
relatives. Biochim Biophys Acta; 1378:F115–F177.
Russo J, Russo IH (1980). Susceptibility of the mammary gland to carcinogenesis H.
Pregnancy interraption as a risk factor in tumour incidence. American Journal of
Pathology; 100:497-512.
Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, ReedMW (2000).
Quantitative reverse transcription-polymerase chain reaction to study mRNA decay:
comparison of endpoint and real-time methods. Anal Biochem; 285:194-204.
Shapiro GI, Edwards CD, Ewen ME, Rollins BJ (1998). p16INK4A participates in a
G1 arrest checkpoint in response to DNA damage. Mol Cell Biol; 18:378-87.
Shaulian E, Haviv I, Shaul Y, Oren M (1995). Transcriptional repression by the Cterminal domain of p53. Oncogene; 10:671–680.
Sherr CJ (1996). Cancer cell cycles. Science; 274:1672–77.
Sherr CJ (2000) The Pezcoller lecture: cancer cell cycles revisited. Cancer Res;
60:3689-95.
134
References
Sherr CJ, McCormick F (2002). The RB and p53 pathways in cancer. Cancer Cell;
2:103-12.
Sherr CJ, Roberts JM (1999) CDK inhibitors: positive and negative regulators of G1phase progression. Genes Dev; 13:1501–1512.
Sicinski P, Donaher JL, Parker SB, Li T, Fazeli A, Gardner H, Haslam SZ, Bronson
RT, Elledge SJ, Weinberg RJ (1995). Cyclin D1 provides a link between
development and oncogenesis in the retina and breast. Cell; 82:621–630.
Silvestrini R, Benini E, Daidone MG, Veneroni S, Boracchi P, Cappelletti V, Di
Fronzo G, Veronesi U (1993). p53 as an independent prognostic marker in lymph
node-negative breast cancer patients. J Natl Cancer Ins; 85:965–970.
Silvestrini R, Daidone MG, Benini E, Faranda A, Tomasic G, Boracchi P, Salvadori
B, Veronesi U (1996). Validation of p53 accumulation as a predictor of distant
metastasis at 10 years of follow-up in 1400 node-negative breast cancers. Clin
Cancer Res; 2:2007–2013.
Sjögren S, Inganäs M, Norberg T, Lindgren A, Nordgren H, Holmberg L, Bergh J
(1998). The p53 gene in breast cancer: prognostic value of complementary DNA
sequencing versus immunohistochemistry. J Natl Cancer Inst; 88:173–182.
Smith JA, Martin L (1973). Do cells cycle?. Proc Natl Acad Sci USA; 70: 1263–7
Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, Hastie T, Eisen MB,
Rijn M van de, Jeffrey SS, Thorsen T, Quist H, Matese JC, Brown PO, Botstein D,
Eystein Lonning P, Borresen-Dale AL (2001). Gene expression patterns of breast
carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad
Sci USA; 98:10869-10874.
Spicer DV, Krecker EA, Pike MC (1995). The endocrine prevention of breast cancer.
Cancer Investigation; 13:495-504.
Stockdale FE (1988) Breast cancer. Onco; 12:1-14.
Terry P, Jain M, Miller AB, Howe GR, Rohan TE (2002). No association among
total dietary fiber, fiber fractions, and risk of breast cancer. Cancer Epidemiol
Biomarkers Prev; 11:1507-1508.
Thor AD, Berry DA, Budman DR, Muss HB, Kute T, Henderson IC, Barcos M,
Cirrincione C, Edgerton S, Allred C, Norton L, Liu ET (1998). ErbB-2, p53, and
efficacy of adjuvant therapy in lymph node-positive breast cancer. J Natl Cancer
Inst; 90:1346–1360.
Toniolo P, Riboli E, Shore RE, Pasternack BS (1994). Consumption of meat, animal
products, protein, and fat and risk of breast cancer: a prospective cohort study in
New York. Epidemiology; 5:391-397.
135
References
Trivers KF, Lund MJ, Porter PL, Liff JM, Flagg EW, Coates RJ, Eley JW (2009).
The epidemiology of triple-negative breast cancer, including race. Cancer Causes
Control; 20:1071–1082.
Varley JM, Armour J, Swallow JE, Jeffreys AJ, Ponder BA, T'Ang A, Fung YK,
Brammar WJ, Walker RA (1989). The retinoblastoma gene is frequently altered
leading to loss of expression in primary breast tumors. Oncogene; 4:725-729.
Vatten LJ, Solvoll K, Loken EB (1990). Coffee consumption and the risk of breast
cancer. A prospective study of 14,593 Norwegian women. Br J Cancer; 62:267-270.
Vessey MP, McPherson K, Villard-Mackintosh L, Yeates D (1989). Oral
contraceptives and breast cancer: latest findings in a large cohort study. Br J Cancer;
59:613-7.
Vogelstein B, Kinzler KW (2004). Cancer genes and the pathways they control. Nat
Med; 10:789-99.
Vogelstein B, Lane D, Levine AJ (2000). Surfing the p53 network. Nature; 408:30710.
Vousden KH, Lu X (2002). Live or let die: the cell‟s response to p53. Nat Rev
Cancer; 2:594–604.
Wellings SR, Jensen HM (1973). On the origin and progression of ductal carcinoma
in the human breast. J Natl Cancer Inst; 50:1111-8.
Wellings SR, Jensen HM, Marcum RG (1975). An atlas of subgross pathology of the
human breast with special reference to possible precancerous lesions. J Natl Cancer
Inst; 55:231-73.
Whelan EA, Sandler DP, Root JL, Smitii KR and Weinberg CR (1994). Menstrual
cycle patterns and risk of breast cancer. American Journal of Epidemiology;
140:1081-1090.
Wölfel T, Hauer M, Schneider J, Serrano M, Wölfel C, Klehmann-Hieb E, De Plaen
E, Hankeln T, Meyer zum Büschenfelde KH, Beach D (1995). A p16INK4ainsensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma.
Science; 269:1281-4.
Xiao ZX, Chen J, Levine AJ, Modjtahedi N, Xing J, Sellers WR, Livingston DM
(1995). Interaction between the retinoblastoma protein and the oncoprotein MDM2.
Nature; 375:694-8.
Yu Q, Geng Y, Sicinski P (2001). Specific protection against breast cancers by
cyclin D1 ablation. Nature; 411:1017–1021.
136
References
Zhang HS, Gavin M, Dahiya A, Postigo AA, Ma D, Luo RX, Harbour JW, Dean DC
(2000). Exit from G1and S phase of the cell cycle is regulated by repressor
complexes containing HDAC-Rb-hSWI/SNF and RbhSWI/ SNF. Cell; 101:79-89.
137
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement