ADAPTIVE RADIATION OF GALL-INDUCING INSECTS WITHIN A SINGLE HOST-PLANT SPECIES ORIGINAL ARTICLE

ADAPTIVE RADIATION OF GALL-INDUCING INSECTS WITHIN A SINGLE HOST-PLANT SPECIES ORIGINAL ARTICLE
ORIGINAL ARTICLE
doi:10.1111/j.1558-5646.2007.00069.x
ADAPTIVE RADIATION OF GALL-INDUCING
INSECTS WITHIN A SINGLE HOST-PLANT
SPECIES
Jeffrey B. Joy1,2 and Bernard J. Crespi1,3
1 Behavioural
Ecology Research Group, Department of Biological Sciences, Simon Fraser University, Burnaby, British
Columbia Canada, V5A 1S6
2 E-mail:
[email protected]
3 E-mail:
[email protected]
Received April 27, 2006
Accepted December 1, 2006
Speciation of plant-feeding insects is typically associated with host-plant shifts, with subsequent divergent selection and adaptation to the ecological conditions associated with the new plant. However, a few insect groups have apparently undergone
speciation while remaining on the same host-plant species, and such radiations may provide novel insights into the causes of
adaptive radiation. We used mitochondrial and nuclear DNA to infer a phylogeny for 14 species of gall-inducing Asphondylia flies
(Diptera: Cecidomyiidae) found on Larrea tridentata (creosote bush), which have been considered to be monophyletic based on
morphological evidence. Our phylogenetic analyses provide strong support for extensive within-host plant speciation in this group,
and it demonstrates that diversification has involved numerous shifts between different plant organs (leaves, buds, flowers, and
stems) of the same host-plant species. Within-plant speciation of Asphondylia is thus apparently facilitated by the opportunity
to partition the plant ecologically. One clade exhibits temporal isolation among species, which may have facilitated divergence
via allochronic shifts. Using a novel method based on Bayesian reconstruction, we show that the rate of change in an ecomorphological trait, ovipositor length, was significantly higher along branches with inferred shifts between host-plant organs than
along branches without such shifts. This finding suggests that Larrea gall midges exhibit close morphological adaptation to specific
host-plant parts, which may mediate ecological transitions via disruptive selection.
KEY WORDS:
Adaptive radiation, Asphondylia, ecological shifts, galling, insect–plant interactions, plant-part specific specializa-
tion, speciation.
Plant-feeding insects have several characteristics that make them
useful models for the study of speciation. First, the high diversity
of phytophagous insects and the continuum of populations exhibiting various stages of reproductive isolation facilitate comparative
analyses of speciation mechanisms (Drès and Mallet 2002). Second, most phytophagous insects are ecologically specialized on
particular host-plant resources, and such specialization may facilitate the evolution of reproductive isolation (Jaenike 1989; Caillaud
and Via 2000). Third, the developmental timing of phytophagous
insect populations can be determined by host-plant resources with
784
different phenologies, such that adults from populations specialized on different host-plant resources may mature and mate at
different times, leading to temporal isolation (Feder and Filchak
1999; Groman and Pellmyr 2000).
Shifts to new host-plant species have played a crucial role in
the diversification of phytophagous insects (Ehrlich and Raven
1964; Jermy 1984; Farrell and Mitter 1994; Thompson 1994;
Mardulyn et al. 1997; Becerra and Venable 1999; Funk et al. 2002).
Speciation via host shifting often proceeds via the development
of prezygotic isolation, associated with fidelity of mating on the
C 2007 The Society for the Study of Evolution.
2007 The Author(s). Journal compilation !
Evolution 61-4: 784–795
!
C
WITHIN HOST-PLANT RADIATION
host plant (Berlocher 2000; Feder et al. 2003). Such prezygotic
isolation can lead to the formation of host-plant races exhibiting
moderate levels of reproductive isolation, and in time these host
races may differentiate into species (Drès and Mallet 2002). Such
host-plant shifts and the evolution of host races have been proposed as a common scenario for nonallopatric speciation (Craig
et al. 1993; Feder et al. 1994; Futuyma et al. 1995; Berlocher 2000;
Groman and Pellmyr 2000; Abrahamson et al. 2001; Craig et al.
2001; Emelianov et al. 2001; Drès and Mallet 2002), although
strong support for these mechanisms has remained elusive.
Recent phylogenetic and ecological studies of several clades
of phytophagous insects have demonstrated that speciation can
also occur in the absence of host-plant shifts (Condon and Steck
1997; Cook et al. 2002; Després et al. 2002). In these cases, speciation is often associated with shifting to different parts of the same
host-plant species, such as from leaf to stem, and the evolution of
reproductive isolation may often involve phenological separation
(Condon and Steck 1997; Després et al. 2002; Ferdy et al. 2002).
These patterns of within-host speciation are also not limited to
phytophagous insects: for example, Simkova et al. (2004) showed
that in a group of monogean parasites of fishes, diversification is
explained in part by within-host speciation. Cases of within-host
speciation may provide useful insights into speciation, because in
these cases the effects of ecology on divergence are likely easier to partition from alternative processes, and divergence may be
more likely to involve nonallopatric processes in the evolution of
reproductive isolation.
Gall midges (Diptera: Cecidomyiidae) are unusual among
phytophagous insects in that taxonomic classifications show that
many genera exhibit large groups of putatively closely related
species found on a single host-plant species (Jones et al. 1983;
Hawkins et al. 1986; Gagné 1989; Gagné and Waring 1990). Gall
midges comprise the largest radiation of galling insects (Ronquist
and Liljeblad 2001). They form galls on virtually all plant parts
(leaves, stems, twigs, buds, flowers, and roots). Cecidomyiids are
widely distributed among host plants, occurring on gymnosperms,
angiosperms, monocotyledons, and dicotyledons (Gagné 1989).
Most cecidomyiids, like other gall-inducing insects (Crespi et al.
1997), are highly host-plant specific, most often feeding only on
one part of a single host-plant species (Jones et al. 1983; Hawkins
et al. 1986; Gagné 1989). For example, within the large genus
Asphondylia (247 described species world wide), members of
morphologically based species groups, defined by similarities
in larval, pupal, and adult characters, are often associated with
the same host-plant species (Hawkins et al. 1986; Gagné and
Waring 1990).
Current understanding of phylogenetic relationships among
the Cecidomyiidae is highly incomplete, such that patterns of
host-associated radiations in this group remain largely unexplored
(Dorchin et al. 2004). Based on larval, pupal, and adult morphological characters, gall-inducing flies of the Asphondylia auripila
group are believed to form a monophyletic group in which all of
the species feed upon creosote bush (Larrea tridentata) (Waring
and Price 1989). Members of this group differ in several ecologically important characteristics such as gall morphology, gall
position, and ovipositor characteristics. The life histories of these
midges are linked to winter rains followed by increasing temperature and rains in the spring and to late summer monsoonal rains.
Thus, adults of different species are active (for their very short
adult lives of 1–2 days) in spring, summer, or both (Waring and
Price 1989). The different species in this group are sympatric over
a broad area and widely distributed across the Mojave, Sonoran,
and Chihuahuan deserts of North America, and up to 10 species
having been collected from a single creosote bush (Waring and
Price 1989).
In this study, we investigated the phylogenetic relationships
of the “Asphondylia auripila group” (Gagné and Waring 1990) of
cecidomyiid flies to evaluate hypotheses regarding the role of
host-plant use in their diversification. First, we used DNA sequence data from one mitochondrial and three nuclear genes to
address the hypothesis that the auripila group has evolved wholly
or in part via in situ radiation on L. tridentata. Second, we analyzed the potential roles of ecology (gall position) and phenology
(adult emergence time) in the diversification of this group. Thus,
if new species arise in association with changes in gall position,
then we expect sister species to exhibit contrasting gall positions.
By contrast, if new species arise through phenological separation,
then sympatric sister taxa are predicted to be temporally isolated.
Alternatively, if neither temporal isolation nor tissue shifts are observed, then new species are more likely to have arisen through
divergence resulting from geographic isolation. Finally, we employed independent contrast analysis to test whether evolutionary
shifts in gall position (the host-plant part that is galled) are associated with increased rates of change in two ecologically important
traits, ovipositor length, and wing length.
Methods
COLLECTION SITES AND METHODS
We collected Asphondylia species associated with L. tridentata
(creosote bush) from sites across southern California, Nevada,
Arizona, New Mexico, and Texas between March and September
2001–2005. We also collected six Asphondylia species associated
with the sympatric host plants A. atriplicis, A. caudicis, and A.
neomexicana from saltbush (Atriplex spp.), A. bigeloviabrassicoides from rabbitbrush (Chrysothamnus spp.), A. websteri from
alfalfa (Medicago spp.), and Asphondylia spp. from snake weed
(Gutierrezia spp.) as putative outgroups. Outgroups were chosen
EVOLUTION APRIL 2007
785
J. B. JOY AND B. J. CRESPI
based on previous taxonomic work which identified the saltbush
inhabiting Asphondylia species as a potential sister group complex
to those found on creosote bush, based upon shared morphological character states between these two groups (Gagné and Waring
1990). One additional outgroup, A. conglomerata from a species
of saltbush (Atriplex hamalis), was obtained from Genbank.
Field-collected galls were transported to the laboratory in
an ice-filled cooler where they were kept room temperature until adults emerged. Following emergence, adults were preserved
whole in 20% dimethyl sulphoxide in a saturated solution of NaCl.
Voucher specimens were deposited with the Smithsonian Institution National Museum of Natural History in Washington, DC.
(ITS-2) of nuclear ribosomal DNA (Harris and Crandall 2000) was
amplified using primers 5.8sFC and 28s BLD (Simon et al. 1994).
A 574 base pair fragment of the Wingless gene (Wg) was amplified using primers 5" wg1 and 3" wg2 (Ober 2003). A 568 base pair
fragment of the elongation factor 1 alpha (EF-1∝) gene was amplified using primers EF1aF (AAAATGCCATGGTTCAAAGG)
and EF1aR (CGAAATTTGACCTGGATGGT) developed based
on an EF-1∝ sequence from Mayetiola destructor obtained from
Genbank (accession number AF085227). Resulting PCR products were purified using shrimp alkaline phosphatase (SAP) and
exonuclease (EXO), and purified PCR products were used in sequencing reactions with an ABI Prism Dye Terminator Cycle (Applied Biosystems, Foster City, CA, USA) sequencing kit.
COLLECTION OF DNA DATA
Genomic DNA was isolated using standard phenol chloroform
methods (Hillis et al. 1996) from single adult midges of either sex.
DNA was extracted from as many individuals for each species as
possible (Table 1). We used polymerase chain reactions (PCR)
to amplify three nuclear and one mitochondrial gene. A 452
base pair fragment of cytochrome oxidase I (COI) was amplified
using primers C1-J-1718 and C1-N-2191 (Simon et al. 1994). A
419 base pair fragment of the internal transcribed spacer region 2
Number of sequences obtained per species per gene (see
also Appendix).
Table 1.
Species
Host plant
COI ITS-2 Wg EF-1
Asphondylia
apicata
A. rosetta
A. florea
A. auripila
A. foliosa
A. resinosa
A. barbata
A. clavata
A. fabalis
A. pilosa
A. silicula
A. villosa
A. digitata
A. bullata
A. caudicis
A. atriplicis
A. neomexicana
A. bigeloviabrassicoides
A. spp.
A. websteri
A. conglomerata
Larrea
tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
L. tridentata
Atriplex spp.
Atriplex spp.
Atriplex spp.
Chysothamnus
spp.
Gutierrezia spp.
Medicago spp.
Atriplex spp.
2
1
0
0
2
2
2
2
2
2
2
2
2
2
2
1
2
1
1
1
1
2
2
2
2
2
2
2
1
2
1
2
0
0
1
1
0
0
2
2
2
2
2
2
2
1
2
0
2
0
0
1
1
0
1
2
2
2
2
2
2
2
1
2
1
1
0
1
0
1
0
1
1
1
1
0
0
0
0
0
0
1
0
0
786
EVOLUTION APRIL 2007
PHYLOGENETIC ANALYSES
Sequences were aligned using Clustal (Thompson et al. 1994)
and adjusted by eye using Se-Al (Rambaut 1996). Protein coding
genes were also checked to ensure that they coded and for stop
codons in Se-Al (Rambaut 1996). The best-fitting model of sequence evolution was determined for each gene using ModelTest
(Posada and Crandall 1998). We also employed MrModeltest 2.2
(Nylander 2004) to identify best models of sequence evolution for
each partition for use in Bayesian phylogeny estimation. We first
used maximum likelihood (ML) and maximum parsimony (MP)
analyses to infer phylogenies for Asphondylia species for each
gene separately. We employed the heuristic (ML) and branch and
bound (MP) searching features of PAUP 4.0b10 (Swofford 2002).
ML trees were also reconstructed using Mr Bayes 3.1.2 (Ronquist
and Huelsenbeck 2003). To assess support for recovered nodes,
we employed bootstrap replicates (500 for ML, 1000 for MP).
We employed the incongruence length test (ILD test), as implemented in PAUP∗ (TBR, 1000 replicates) (Huelsenbeck and Bull
1996; Swofford 2002), to help evaluate the congruence of the trees
inferred from the four different genes. To analyze the combined
data, we employed a four-partition analysis applying the best-fit
model of sequence evolution for each partition using Mr. Bayes
3.1.2 (Ronquist and Huelsenbeck 2003).
Evaluation of the monophyly of Asphondylia taxa found on
L. tridentata is complicated by the large number of ingroup taxa
(14) relative to putative outgroup taxa (7) in our dataset, and size
of the genus as a whole (67 Nearctic species, 247 world wide). We
used several lines of evidence to test the hypothesis of monophyly.
First, we considered MP, ML bootstrap values, and Bayesian posterior probability values from the combined tree, for the nodes
that corresponded to monophyly of the Larrea taxa (Hillis and
Bull 1993). Second, we used Shimodaira–Hasegawa (SH) tests
and Templeton tests, as implemented in PAUP∗ (Swofford 2002),
to compare the best trees with constraint trees that forced the invasion of the ingroup by one or more outgroup taxa. For example,
WITHIN HOST-PLANT RADIATION
the best tree was compared to the best constraint tree that did not
contain the grouping (ingroup1, ingroup2, ingroup3, ingroup4)
because one or more outgroup species had invaded the combined ingroup.
COMPARATIVE ANALYSES
We predicted that changes in gall position should be associated
with accelerated change in an ecomorphological trait (ovipositor
length) related to gall induction, but not in change in wing length,
a trait closely indicative of body size (Sokoloff 1966; Norry and
Vilardi 1996). To best infer changes in gall position, we used
Bayesian methods to reconstruct ancestral states for the categorical four-state character gall position (leaf, stem, flower, bud) for
each node, using Bayes MultiState (Pagel et al. 2004). This program uses a Markov Chain Monte Carlo approach to sampling
phylogenies, and for investigating the parameters of trait evolution, and it calculates a fifth state for the probability that the node
does not exist. To calculate the strength of evidence for a shift in
gall position at each node, we first calculated the probability of no
shift across an internode by summing the product of the probability of each state in each node (e.g., p(leaf) node A∗ p(leaf) node
B + p(flower)node A∗ p(flower) node B) + . . ., where A and B
are the ends of an internode). One minus this probability is a continuous measure of the probability of change for each node that
accounts for phylogenetic uncertainty. To quantify the evolution of
our ecomorphological trait (ovipositor length), we optimized this
trait, and wing length (a measure of body size), on the combined
data Bayesian consensus tree (data from Gagnè and Waring 1990)
using McPeek’s (1995) contrast method. We then used McPeek’s
(1995) independent contrast test to determine whether higher rates
of change in ovipositor length and wing length occurred along
branches associated with ecological shifts (changes in gall position) relative to branches lacking ecological shifts. We tested this
hypothesis by regressing a measure of the probability of change
at each node with independent contrast values. For this analysis,
we used the “speciational” model of character evolution, because
we assumed that changes in ovipositor morphology take place in
association with speciation events rather than continuously over
time.
Table 2.
Results
DATASET
The complete dataset of COI, internal transcribed spacer region
2 (ITS-2), wingless (Wg), and elongation factor 1 alpha (EF-1∝)
nucleotide sequences for 21 Asphondylia species, consisted of
2013 positions (452 COI, 574 Wg, 419 ITS-2, 568 EF-1∝, Table
2). All gene sequences have been deposited in GenBank (Appendix.). Of the 2013 sites, 243 were parsimony informative (118
COI, 47 Wg, 30 ITS-2, 88 EF-1∝). Interspecific pairwise differences within the ingroup ranged from 0.2% to 15.0% for COI,
0.4% to 5.5% for Wg, 0.0% to 2.5% for ITS-2, and 0.5% to 7.8%
for EF-1∝. Differences between the ingroup and outgroups were
9.3% COI, 10.5% Wg, 4.8% ITS-2, and 6.6% EF-1∝. Incongruence length difference (ILD) tests showed that all-possible
combinations of the different gene regions were compatible
(P = 0.51).
PHYLOGENIES
Figure 1 shows the ML trees for each of the four gene regions. For
each of the four, MP and ML and Bayesian analyses yielded trees
of very similar topology. The grouping of the ingroup taxa into five
main clades relative to the outgroup taxa was consistent across all
genes except EF-1∝ in which one clade (A. auripila/A. foliosa/A.
resinosa) is moved to the base of the tree with the outgroup taxa
(Fig. 1). The topologies of the best trees for COI and Wg exhibited
only minor differences. ITS-2 differed in the placement of one leaf
galling taxon (A. villosa) and in the placement of A. florea and
A. rosetta at the base of the tree. EF1-1∝ differed in the invasion
of the ingroup by the putative outgroup taxon A. atriplicis and in
the placement of the stem galling clade (A. auripila, A. foliosa,
and A. resinosa) at the base of the tree with the outgroup taxon.
MP, ML, and Bayesian analyses of the combined dataset yielded
similar topologies (Fig. 2).
EVOLUTION OF HOST-PLANT USE
All Asphondylia species that induce galls on L. tridentata formed
a monophyletic group for both the combined dataset and three
of the four datasets separately. Support for the node indicating
Summary of support for monophyly of clades within the Asphondylia auripila group. L, leaf; S, stem; B, bud; and F, flower.
Support for each of the five clades is provided: ML, maximum likelihood bootstrap support; MP, maximum parsimony bootstrap support;
MCMCMC, Bayesian posterior probability; SH, significance for the SH test; Templeton test, significance level for Templeton test.
A. auripila supported clade
Plant part
MP
ML
MCMCMC
SH test
Templeton test
A. clavata, A. pilosa
A. silicula, A. fabalis
A. barbata, A. villosa
A. rosetta, A. florea, A. apicata
A. resinosa, A. auripila, A. foliosa, A. digitata
L,L
L,L
L,L
S,F,B
S,S,S,L
100
100
100
100
88
100
100
100
100
88
99
100
99
96
88
P < 0.05
P < 0.05
P < 0.05
P < 0.05
P < 0.05
P < 0.001
P < 0.001
P = 0.29
P < 0.05
P < 0.05
EVOLUTION APRIL 2007
787
J. B. JOY AND B. J. CRESPI
Maximum likelihood (ML) phylogenies for (A) COI, (B) wingless (C) ITS-2, and (D) EF-1. Maximum parsimony, ML, and Bayesian
support values are shown for each node. Branch lengths are proportional to the inferred number of substitutions per site.
Figure 1.
Figure 2. Phylogeny of Asphondylia auripila group and outgroups according to a four-partition Bayesian phylogenetic analysis using a
separate substitution model for each gene. Numbers above branches are MP bootstrap, ML bootstrap, and Bayesian posterior probabilities.
Host genera are delineated at the tips.
788
EVOLUTION APRIL 2007
WITHIN HOST-PLANT RADIATION
monophyly of this entire group varied among genes, being
strongest in ITS-2, the most highly conserved gene (100, 100,
100; MP bootstrap, ML bootstrap, and Bayesian a posteriori probabilities, respectively), moderate in Wg (61, 73, 95), weakest in
COI (−, 65, 99), nonexistent in EF-1∝, and intermediate but weak
in the combined analyses (60, 56, 62). Monophyly of the Asphondylia species on L. tridentata was strongly statistically supported
for the ITS2 data under MP using Templeton test (difference in
length = 15, P < 0.001) and under ML using SH test (difference
in –ln L = 48.67, P < 0.001). The ML and MP scores for best trees
were better than negative constraint trees, but not significantly so
as judged by Templeton and SH tests for the rest of the datasets
and for the combined dataset.
Within the A. auripila group, five clades consistently formed
strongly supported groups as judged by ML and MP bootstrap
support, Bayesian posterior probabilities, SH test, and Templeton
tests. These five clades consisted of three pairs of leaf-galling sister
taxa, the clade containing three species that form galls on different
plant parts (Asphondylia rosetta, A. florea, and A. apicata), and
a fifth clade containing four species, three of which form galls
on the same plant part but display widely divergent emergence
timing (Table 2). These results demonstrate that although support
for monophyly of the entire A. auripila group of gall midges on L.
tridentata is not definitive, there is strong evidence for within-host
plant speciation within particular clades.
Figure 3.
HOST-PLANT COLONIZATION SEQUENCE
Bayesian ancestral state reconstruction of colonization of different
host-plant parts yielded several notable inferences (Fig. 3). Leaf
galling has apparently evolved twice, A. digitata derived within the
clade of stem gallers (A. resinosa, A. auripila, and A. foliosa), and
A. barbata, A. villosa, A. silicula, and A. fabalis from stem galling
ancestors (Fig. 3). Flower (A. florea) and bud galling (A. apicata)
each evolved once, but the order under which these transitions
occurred is not clear (Fig. 3). In the well-supported clades within
this radiation on a single host plant, speciation has apparently
occurred in association with shifts to new plant parts three times,
and in association with retention of the same host-plant part five
times (Fig. 3).
ECOLOGICAL ADAPTATION TO SPECIFIC PLANT PARTS
Evolution of phenology
Most Asphondylia species (10 of 14 sampled) found on L. tridentata are bivoltine, with adults found in both spring and summer. The remaining four species are univoltine, being found as
adults in only the spring, winter, or summer as follows: March–
May (A. foliosa), August–September (A. rosetta, A. auripila), and
December–February (A. resinosa) (Fig. 3). If new species arise
through phenological separation, then sympatric sister taxa are expected to be temporally isolated. Among well-supported clades,
sister-taxa comparisons for phenology (Fig. 3) show two main
Phylogeny of Asphondylia auripila group based on combined dataset with ancestral gall position reconstruction by Bayesian
methods. Drawings of galls for each species, gall position, and the phenology of adult emergence are provided for each species. Speciation
events associated with shifts to new plant parts are denoted with an “s” and speciation events associated with retention of the same
plant parts are denoted with an “r.”
EVOLUTION APRIL 2007
789
J. B. JOY AND B. J. CRESPI
Phylogenetically independent contrast values for Asphondylia ovipositor lengths calculated for each node plotted versus an index of the probability of change in host-plant part usage
from one node to the next.
Figure 4.
patterns: (1) bivoltine sister taxa emerge at the same times (A.
barbata and A. villosa; A. silicula and A. fabalis; A. clavata and
A. pilosa; A. apicata and A. florea) and (2) three of the four univoltine taxa that are phenologically isolated are members of the
same clade (A. resinosa, A. auripila, and A. foliosa) and within
this clade there is a reversal to bivoltinism (A. digitata).
Evolution of ecomorphology
Our Bayesian extension of McPeek’s (1995) contrast analysis indicates that ovipositor length underwent higher rates of change
along branches where shifts to new plant parts were inferred to be
more probable than where shifts were not inferred (R2 = 0.26, F =
5.054, df = 11, P < 0.05). By contrast, there was no difference
in rates of change in wing length in relation to shifts in plant part
versus retention of the same plant part (R2 = 0.13, F = 2.802,
df = 11, P = 0.13, Fig. 4).
Discussion
Four of five phylogenies (each gene and combined), and SH and
Templeton tests for ITS2, support the hypothesis derived from
morphological data (Gagné and Waring 1990) that the A. auripila group has radiated in situ on L. tridentata. The tree from the
EF-1∝ data did not support the hypothesis of monophyly for the
A. auripila group as a whole. However, SH and Templeton tests
show this tree is not significantly better than a tree constraining
the ingroup (A. auripila group) to be monophyletic. The contrasting results from different genes, and the nonsignificant SH and
790
EVOLUTION APRIL 2007
Templeton tests, suggest that based on the currently available evidence, support for monophyly of the A. auripila group as a whole
remains equivocal.
Despite this uncertainty regarding monophyly of the A. auripila group as a whole, two lines of evidence strongly support the monophyly of multiple clades within this group. First,
Bayesian posterior probabilities, ML, and MP bootstap values indicate strong support for five clades, and some of the sister species
in these clades are very closely related (e.g., A. villosa and A. barbata differ by only 1.3% at COI). Second, SH and Templeton tests
significantly support the hypotheses of monophyly of these clades
(Fig. 3). Thus, even if the entire A. auripila group is not monophyletic, it comprises multiple lineages that show strong evidence
for monophyly, which indicates that this group is characterized by
a notable degree of within host-plant speciation. Hypotheses regarding monophyly of this clade, and the lineages within it, could
be tested further via sequencing of additional Asphondylia species
from the North American deserts.
POTENTIAL MECHANISMS OF WITHIN HOST-PLANT
SPECIATION
Shifts to a new host plant are usually accompanied by adaptations to markedly different plant characteristics, such as plant
morphology, chemistry, and phenology (Jaenike 1989; Jaenike
1990; Becerra and Venable 1999; Cook et al. 2002). By contrast,
shifts within a host plant may not require such substantial evolutionary change. Other barriers, such as high rates of gene flow,
likely inhibit speciation via ecological shifts within a host plant
(Ferdy et al. 2002). In Asphondylia midges, there are several possible geographic modes and mechanisms of speciation within a
single host plant, each of which could result in the partitioning of
the plant into a number of finely divided niches.
Divergence under sympatry
Changes in diapause timing could result in sympatric populations
shifting in time to exploit the same or a new part of a host plant at
a different point in time, effectively generating reproductive isolation. Thus, three species of stem galling Asphondylia midges on L.
tridentata (A. auripila, A. foliosa, A. resinosa) in a well-supported
clade are phenologically separated from one another (Fig. 3). The
emergence timing of these species corresponds to the timing of
plant growth associated with rains in winter (A. resinosa), spring
(A. foliosa), and summer (A. auripila). The emergence timing of
other members of the A. auripila group show no seasonal isolation between sister taxa, although they may be phenologically
isolated on a finer scale (within a season), given the short life
spans and weak flight abilities of adult flies (Jones et al. 1983;
Gagné 1989). This hypothesis could be tested by monitoring the
emergence timing of bivoltine sister taxa such as A. barbata and
A. villosa.
WITHIN HOST-PLANT RADIATION
Phenology has been shown to be important in mediating reductions in gene flow leading to speciation or host race formation
in many other insect taxa, including Rhagoletis flies (Feder and
Filchak 1999), Eurosta flies (Craig et al. 1993), Enchenopa treehoppers (Wood et al. 1990), Magicicada cicadas (Cooley et al.
2003), and Blepharoneura flies (Condon and Steck 1997). These
parallel patterns suggest that temporal isolation may be an important process favoring speciation in phytophagous insects.
Phenological divergence may be facilitated by shifts to
competition-free space, in that the insects that have shifted to
a new plant part are expected to be released from the strong competition that typifies many gall-inducing species (Denno et al.
1995; Craig et al. 2000; Inbar et al. 2004). The prolonged diapause of the gall midge Dasineura rachiphaga is thought to be
a mechanism that evolved in the context of selection for reduced
intraspecific competition for limiting oviposition sites (Prévost
1990). Similarly, Cook et al. (2002) showed that speciation of
Andricus gall wasps is more commonly associated with shifts to a
novel part of the same host plant than with shifts between different
host-plant species, and they suggested that intraspecific competition for oviposition sites has facilitated within-host divergence.
In Chiastocheta flies inhabiting Trollius species, Després et al.
(2002) demonstrated that diversification has involved both host
shifts and radiation within a host, and the within-host diversification may be a result of competition for oviposition or feeding
sites, favoring temporal shifts in oviposition timing and shifts to
different larval food resources (Ferdy et al. 2002).
The proximate mechanism of sympatric shifts in host-plant
parts may involve a combination of mistakes in oviposition site
and variation in the developmental schedules of different plant
parts. Insects sometimes lay eggs on unfamiliar host plants or host
plant parts; such ovipositional mistakes have been documented for
Lepidoptera (Feldman and Haber 1998), Coleoptera (Fox et al.,
in press), and Diptera (Gratton and Welter 1998), including many
Cecidomyiidae (Larsson and Strong 1992; Larsson and Ekbom
1995). When a female oviposits on a plant tissue type other than
her natal type (i.e., flower instead of leaf), the eggs in the new
tissue type may break diapause later or earlier as a result of differences in the developmental schedule of the different plant tissue
types (Linkosalo 2000; Mahoro 2002), and this may translate to
the temporal isolation of adults. This hypothesis could be tested
with the Asphondylia midges on L. tridentata by enforcing oviposition on nonnatal host-plant parts (i.e., leaf–stem) and recording
changes in emergence timing.
Divergence under allopatry
Colonization of a new plant part could also occur in an allopatric
population, resulting in a single species inducing galls on multiple
parts of a single host plant. The ability to gall the original part of
the host plant may, in theory, be subsequently lost, or the colo-
nizing species may go locally extinct, and differentiation could
then occur due to drift and selection in allopatry. Upon secondary
contact, we would be left with two sympatric species using different niches on the same host plant. Speciation on the same plant
part could also result from allopatric isolation. In this scenario reproductive isolation and ecological divergence might develop as a
product of isolation through both selection resulting from different
ecological conditions (climate, plant genotype, parasitoids, and
composition of the galling community) and differentiation due to
genetic drift. Upon secondary contact we would have two ecologically diverged species (e.g., phenologically isolated) on the same
plant part. In a third scenario, reproductive isolation could develop
in allopatry purely due to genetic drift, and ecological divergence
of the resulting species could occur as a result of subsequent interspecific competition.
The host plant of the A. auripila group is the dominant shrub
throughout an immense area, the southwestern deserts of North
America (Hunter et al. 2001). Larrea tridentata was isolated in
refugia during the major North American glaciations (Hunter et al.
2001), and speciation may have occurred in this manner in refugia
during glacial periods. However, under any of the above allopatry
hypotheses it is not clear why the ability to gall the original plant
part would be lost, or why such progenitor populations would go
extinct; moreover, most of the radiation on L. tridentata appears
to be considerably older than the glaciation cycles starting in the
Pleistocene. These allopatry hypotheses could be addressed further through comparative phylogeographic analyses of sister-taxa
inducing galls on different plant parts.
ECOLOGICAL ADAPTATION TO SPECIFIC PLANT PARTS
Adaptive changes in insect morphological characters following
host shifts have been documented only rarely, despite the central
importance of morphological adaptations in insect diversification
(Moran 1986; Carroll et al. 1997; Groman and Pellmyr 2000). In
this study, we have documented adaptive changes in an ecologically important morphological character, ovipositor length, within
the context of radiation on a single host-plant species. Our independent contrast analyses, which account for both uncertainty in
the phylogeny and uncertainty in the reconstructions of ancestral
galling position states, demonstrate that Asphondylia species inhabiting L. tridentata show substantially larger changes in ovipositor length following ecological shifts (shifts to new parts of a host
plant) relative to the amount of change when no ecological shift
has taken place. By contrast, wing length, a trait not predicted to
be adaptive in the context of exploitation of different plant parts,
shows no significant relation with ecological shifts. The finding
that ovipositor length changed more than wing length in response
to ecological shifts is consistent with the hypothesis that selection
for host-plant part associated morphological differences is driving
changes in Asphondylia ovipositor lengths.
EVOLUTION APRIL 2007
791
J. B. JOY AND B. J. CRESPI
The morphological basis of adaptation to different host-plant
parts in these species is simple: Asphondylia species inhabiting
different parts of L. tridentata deposit their eggs into strikingly
different tissue types (stems, leaves, buds, and flowers) that differ
markedly in hardness, thickness, and depth to plant vasculature.
Thus, the shorter ovipositor of leaf galling species may facilitate the placement of eggs in thinner softer leaf tissue, whereas
longer ovipositors of stem, bud, and flower galling species allow egg placement deeper into host-plant tissues. These findings
suggest that strong divergent selection on ovipositor length accompanies evolutionary shifts in host-plant part, which would be
expected to drive postzygotic isolation; this hypothesis could be
tested further via measuring oviposition depths in different plant
tissues, and through experimental manipulation of oviposition
sites.
Conclusions
Our study provides strong evidence that some clades of Asphondylia gall midges have radiated in situ on their host plant L. tridentata. This diversification was apparently driven by the ability
of these insects to partition the plant ecologically, via two mechanisms that facilitate the evolution of reproductive isolation: shifts
to new plant parts and changes in phenology. Evidence from other
host-specific phytophagous insects that can use different parts of
the same plant species (e.g., Condon and Steck 1997; Cook et al.
2002; Després et al. 2002), and from host-specific parasites (e.g.,
Simková et al. 2004), suggests that within-host ecological divergence may be a common mechanism of speciation that promotes
the extraordinarily high species diversity found in many groups
of parasites and plant-feeding insects.
ACKNOWLEDGMENTS
We are especially grateful to A. Mooers, N. Moran, C. E. Parent, P. Nosil
and four anonymous reviewers for advice and comments that greatly improved this manuscript, and to the Simon Fraser University FAB∗ laboratory for discussion. We are also very grateful to N. Moran for laboratory
space and support in Arizona. H. Kucera, G. Waring, and F. Joy assisted
with field data collection. We thank R. Gagné and the Smithsonian Institution National Museum of Natural History for providing samples of
museum preserved cecidomyiid species. This research was funded by the
Natural Sciences and Engineering Research Council of Canada and by
the Society for Systematic Biology.
LITERATURE CITED
Abrahamson, W. G., M. D. Eubanks, C. P. Blair, and A. V. Whipple. 2001.
Gall flies, inquilines, and goldenrods: a model for host-race formation
and sympatric speciation. Am. Zool. 41:928–938.
Becerra, J. X., and D. L. Venable. 1999. Macroevolution of insect-plant associations: the relevance of host biogeography to host affiliation. Proc.
Natl. Acad. Sci. U.S.A. 96:12626–12631.
Berlocher, S. H. 2000. Radiation and divergence in the Rhagoletis
pomonella species group: inferences from allozymes. Evolution 54:543–
557.
792
EVOLUTION APRIL 2007
Caillaud, M. C., and S. Via. 2000. Specialized feeding behavior influences
both ecological specialization and assortative mating in sympatric host
races of pea aphids. Am. Nat. 156:606–621.
Carroll, S. P., H. Dingle, and S. P. Klassen. 1997. Genetic differentiation
of fitness-associated traits among rapidly evolving populations of the
soapberry bug. Evolution 51:1182–1188
Condon, M. A., and G. J. Steck. 1997. Evolution of host use in fruit flies of the
genus Blepharoneura (Diptera: Tephritidae): cryptic species on sexually
dimorphic host plants. Biol. J. Linn. Soc. 60:443–466.
Cook, R. J., A. Rokas, M. Pagel, and G. N. Stone. 2002. Evolutionary shifts
between host oak sections and host-plant organs in Andricus gallwasps.
Evolution 56:1821–1830.
Cooley, J. R., C. Simon, and D. C. Marshall. 2003. Temporal separation and
speciation in periodical cicadas. Bioscience 53:151–157.
Craig, T. P., J. K. Itami, W. G. Abrahamson, and J. D. Horner. 1993. Behavioral evidence for host-race formation in Eurosta solidaginis. Evolution
47:1696–1710.
Craig, T. P., J. K. Itami, C. Shantz, W. G. Abrahamson, J. D. Horner, and J.
V. Craig. 2000. The influence of host plant variation and intraspecific
competition on oviposition preference and offspring performance in the
host races of Eurosta solidaginis. Ecol. Entomol. 25:7–18.
Craig, T. P., J. D. Horner, and J. K. Itami. 2001. Genetics, experience, and
host-plant preference in Eurosta solidaginis: implications for host shifts
and speciation. Evolution 55:773–782.
Crespi, B. J., D. A. Carmean, and T. W. Chapman. 1997. Ecology and evolution of galling thrips and their allies. Annu. Rev. Entomol. 42:51–
71.
Denno, R. F., M. S. McClure, and J. R. Ott. 1995. Interspecific interactions in
phytophagous insects—competition reexamined and resurrected. Annu.
Rev. Entomol. 40:297–331.
Després, L., E. Pettex, V. Plaisance, and F. Pompanon. 2002. Speciation in the
globeflower fly Chiastocheta spp. (Diptera: Anthomyiidae) in relation
to host plant species, biogeography, and morphology. Mol. Phylogenet.
Evol. 22:258–268.
Dorchin, N., A. Freidberg, and O. Mokady. 2004. Phylogeny of the Baldratiina (Diptera: Cecidomyiidae) inferred from morphological, ecological
and molecular data sources, and evolutionary patterns in plant-galler
relationships. Mol. Phylogenet. Evol. 30:503–515
Drès, M., and J. Mallet. 2002. Host races in plant-feeding insects and their
importance in sympatric speciation. Philos. Trans. R. Soc. Lond. B
357:471–492.
Ehrlich, P. R., and P. H. Raven. 1964. Butterflies and plants: a study in coevolution. Evolution 18:586–608.
Emelianov, I., M. Drès, W. Baltensweiler, and J. Mallet. 2001. Host-induced
assortative mating in host races of the larch budmoth. Evolution 55:
2002–2010.
Farrell, B. D., and C. Mitter. 1994. Adaptive radiation in insects and plants time and opportunity. Am. Zool. 34:57–69.
Feder, J. L., S. B. Opp, B. Wlazlo, K. Reynolds, W. Go, and S. Spisak.
1994. Host fidelity is an effective premating barrier between sympatric
races of the apple maggot fly. Proc. Natl. Acad. Sci. U.S.A 91:7990–
7994.
Feder, J. L., and K. E. Filchak. 1999. It’s about time: the evidence for host plantmediated selection in the apple maggot fly, Rhagoletis pomonella, and
its implications for fitness trade-offs in phytophagous insects. Entomol.
Exp. Appl. 91:211–225.
Feder, J. L., S. H. Berlocher, J. B. Roethele, H. Dambroski, J. J. Smith,
W. L. Perry, V. Gavrilovic, K. E. Filchak, J. Rull, and M. Aluja.
2003. Allopatric genetic origins for sympatric host-plant shifts and
race formation in Rhagoletis. Proc. Natl. Acad. Sci. U.S.A. 100:10314–
10319.
WITHIN HOST-PLANT RADIATION
Feldman, T. S., and W. A. Haber. 1998. Oviposition behavior, host plant use,
and diet breadth of Anthanassa butterflies (Lepidoptera: Nymphalidae)
using plants in the Acanthaceae in a Costa Rican community. Fla. Entomol. 81:396–406.
Ferdy, J. B., L. Després, and B. Godelle. 2002. Evolution of mutualism between globeflowers and their pollinating flies. J. Theor. Biol. 217:219–
234.
Fox, C. W., R. C. Stillwell, A.R. Amarillo-s, M. E. Czesak, and F. J. Messina.
2004. Genetic architecture of population differences in oviposition behaviour of the seed beetle Callosobruchus maculatus. J. Evol. Biol.
17:1141–1151.
Funk, D. J., K. E. Filchak, and J. L. Feder. 2002. Herbivorous insects:
model systems for the comparative study of speciation ecology. Genetica
116:251–267.
Futuyma, D. J., M. C. Keese, and D. J. Funk. 1995. Genetic constraints on
macroevolution—the evolution of host affiliation in the leaf beetle genus
Ophraella. Evolution 49:797–809.
Gagné, R. J. 1989. The Plant-feeding Gall Midges of North America. Cornell
Univ. Press, Ithaca.
Gagné, R. J., and G. L. Waring. 1990. The Asphondylia (Cecidomyiidae:
Diptera) of creosote bush (Larrea tridentata) in North America. Proc.
Entomol. Soc. Wash. 92:649–671.
Gratton, C., and S. C. Welter. 1998. Oviposition preference and larval performance of Liriomyza helianthi (Diptera: Agromyzidae) on normal and
novel host plants. Environ. Entomol. 27:926–935.
Groman, J. D., and O. Pellmyr. 2000. Rapid evolution and specialization
following host colonization in a yucca moth. J. Evol. Biol. 13:223–
236.
Harris, D. J., and K. A. Crandall. 2000. Intragenomic variation within ITS1 and
ITS2 of freshwater crayfishes (Decapoda: Cambaridae): implications
for phylogenetic and microsatellite studies. Mol. Biol. Evol. 17:284–
291.
Hawkins, B. A., R. D. Goeden, and R. J. Gagné. 1986. Ecology and taxonomy of the Asphondylia spp. (Diptera: Cecidomyiidae) forming galls on
Atriplex spp. (Chenopodiaceae) in Southern California. Entomography
4:55–107.
Hillis, D. M., and J. J. Bull. 1993. An empirical test of bootstrapping as a
method for assessing confidence in phylogenetic analysis. Syst. Biol.
42:182–192.
Hillis, D. M., C. Moritz, and B. K. Mable. 1996. Molecular Systematics. 2nd
ed. Sinauer and Associates, Sunderland, MA.
Huelsenbeck, J. P., and J. J. Bull. 1996. A likelihood ratio test to detect conflicting phylogenetic signal. Syst. Biol. 45:92–98.
Hunter, K. L., J. L. Betancourt, B. R. Riddle, T. R. Van Devender, K. L. Cole,
and W. G. Spaulding. 2001. Ploidy race distributions since the last glacial
maximum in the North American desert shrub, Larrea tridentata. Glob.
Ecol. Biogeogr. 10:521–533.
Inbar, M., M. Wink, and D. Wool. 2004. The evolution of host plant
manipulation by insects: molecular and ecological evidence from
gall-forming aphids on Pistacia. Mol. Phylogenet. Evol. 32:504–
511.
Jaenike, J. 1989. Genetics of butterfly hostplant associations. Trends Ecol.
Evol. 4:34–35.
———. 1990. Host specialization in phytophagous insects. Annu. Rev. Ecol.
Syst. 21:243–273.
Jermy, T. 1984. Evolution of insect/host plant relationships. Am. Nat. 124:609–
630.
Jones, R. G., R. J. Gagné, and W. F. Barr. 1983. Biology and taxonomy of
the Rhopalomyia gall midges (Diptera: Cecidomyiidae) of Artemesia
tridentata Nutall (Compositae) in Idaho. Contrib. Am. Entomol. Instit.
21:1–76.
Larsson, S., and D. R. Strong. 1992. Oviposition choice and larval survival of Dasineura marginemtorquens (Diptera, Cecidomyiidae) on
resistant and susceptible Salix viminalis. Ecol. Entomol. 17:227–
232.
Larsson, S., and B. Ekbom. 1995. Oviposition mistakes in herbivorous
insects—confusion or a step towards a new host? Oikos 72:155–
160.
Linkosalo, T. 2000. Mutual regularity of spring phenology of some boreal tree
species: predicting with other species and phenological models. Can. J.
For. Res. 30:667–673.
Mahoro, S. 2002. Individual flowering schedule, fruit set, and flower and
seed predation in Vaccinium hirtum Thunb (Ericaceae). Can. J. Bot. 80:
82–92.
Mardulyn, P., M. C. Milinkovitch, and J. M. Pasteels. 1997. Phylogenetic
analyses of DNA and allozyme data suggest that Gonioctena leaf
beetles (Coleoptera; Chrysomelidae) experienced convergent evolution in their history of host-plant family shifts. Syst. Biol. 46:722–
747.
McPeek, M. A. 1995. Testing hypotheses about evolutionary change on single
branches of a phylogeny using evolutionary contrasts. Am. Nat. 145:686–
703.
Moran, N. A. 1986. Morphological adaptation to host plants in Uroleucon
(Homoptera, Aphididae). Evolution 40:1044–1050.
Norry, F. M., and J. C. Vilardi. 1996. Size-related sexual selection and yeast
diet in Drosophila buzzatii (Diptera: Drosophilidae). J. Insect Behav.
9:329–338.
Nylander, J. A. A. 2004. MrModeltest v2. Program distributed by the author.
Evolutionary Biology Centre, Uppsala Univ, Sweden.
Ober, K. 2003. Phylogenetic relationships of the carabid subfamily Harpalinae
(Coleoptera) based on molecular sequence data. Mol. Phylogenet. Evol.
26:334–336.
Pagel, M., A. Meade, and D. Barker. 2004. Bayesian estimation of ancestral
states on phylogenies. Syst. Biol. 53:673–684.
Posada, D., and K. A. Crandall. 1998. MODELTEST: testing the model of
DNA substitution. Bioinformatics 14:817–818.
Prevost, Y. H. 1990. Spruce cone axis midge, Dasineura rachiphaga Tripp
(Diptera, Cecidomyiidae), in cones of black spruce, Picea mariana (Mill)
Bsp. Can. Entomol. 122:441–447.
Rambaut, A. 1996. Se-Al: sequence alignment editor. Available at
http://evolve.zoo.ox.ac.uk/.
Ronquist, F., and J. Liljeblad. 2001. Evolution of the gall wasp-host plant
association. Evolution 55:2503–2522.
Ronquist, F., and J. P. Huelsenbeck. 2003. MRBAYES: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–
1574.
Simkova, A., S. Morand, E. Jobet, M. Gelnar, and O. Verneau. 2004. Molecular
phylogeny of congeneric monogenean parasites (Dactylogyrus): a case
of intrahost speciation. Evolution 58:1001–1018.
Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu, and P. Flook. 1994.
Evolution, weighting, and phylogenetic utility of mitochondrial gene
sequences and a compilation of conserved polymerase chain reaction
primers. Annu. Rev. Entomol. 87: 651–701.
Sokoloff, A. 1966. Morphological variation in natural and experimental populations of Drosophila pseudoobscura and D. persimilis. Evolution 20:49–
71.
Swofford, D. L. 2002. PAUP∗ . Phylogenetic Analysis Using Parsimony (∗ and
other methods). Ver. 4. Sinauer Associates, Sunderland, MA.
Thompson, J. N. 1994. The coevolutionary process. Univ. of Chicago Press,
Chicago, IL.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through
EVOLUTION APRIL 2007
793
J. B. JOY AND B. J. CRESPI
sequence weighting, position-specific gap penalties and weight matrix
choice. Nucl. Acids Res. 22: 4673–4680.
Waring, G. L., and P. W. Price. 1989. Parasitoid pressure and the radiation of a
gallforming group (Cecidomyiidae: Asphondylia spp.) on creosote bush
(Larrea tridentata). Oecologia 79:293–299.
Wood, T. K., K. L. Olmstead, and S. I. Guttman. 1990. Insect phenology
mediated by host-plant water relations. Evolution 44:629–636.
Associate Editor: M. Peterson
Appendix
Table A1. Genbank accession numbers for Asphondylia samples used in this study. COI refers to cytochrome oxidase subunit I, ITS-2 refers
to internal transcribed spacer region 2, Wg refers to wingless, and EF-1 refers to elongation factor 1 alpha.
Genbank accession number(s)
Species
Asphondylia Apicata
A. apicata
A. rosetta
A. rosetta
A. florae
A. florae
A. auripila
A. auripila
A. foliosa
A. foliosa
A. resinosa
A. resinosa
A. barbata
A. barbata
A. clavata
A. clavata
A. fabalis
A. fabalis
A. pilosa
A. pilosa
A. silicula
A. silicula
A. villosa
A. villosa
A. digitata
A. bullata
A. bullata
A. caudices
A. atriplicis
A. neomexicana
A. bigeloviabrassicoides
A. spp.
A. websteri
A. conglomerata
794
COI
ITS-2
Wg
EF-1
EF189965
EF189966
EF189967
EF189968
EF189969
EF189970
EF189973
EF189974
EF189971
EF189972
EF189975
EF189976
EF189977
EF189978
EF189979
EF189980
EF189985
EF189986
EF189981
EF189982
EF189987
EF189988
EF189983
EF189984
EF189989
EF189990
EF189991
EF189992
EF189993
EF189994
EF189995
EF189996
EF189997
AB115566
–
–
EF189921
EF189922
EF189923
EF189924
EF189927
EF189928
EF189925
EF189926
EF189929
EF189930
EF189931
EF189932
EF189933
EF189934
EF189939
–
EF189935
EF189936
EF189940
–
EF189937
EF189938
–
–
–
EF189941
EF189942
–
–
–
–
–
–
–
EF189943
EF189944
EF189945
EF189946
EF189949
EF189950
EF189947
EF189948
EF189951
EF189952
EF189953
EF189954
EF189955
EF189956
EF189961
–
EF189957
EF189958
–
–
EF189959
EF189960
–
–
–
EF189962
EF189963
–
EF189964
–
–
–
–
–
EF189998
EF189999
EF190000
EF190001
EF190004
EF190005
EF190002
EF190003
EF190006
EF190007
EF190008
EF190009
EF190010
EF190011
–
–
EF190012
EF190013
EF190015
–
EF190014
–
–
EF190016
–
–
EF190017
–
EF190018
EF190019
–
–
EVOLUTION APRIL 2007
WITHIN HOST-PLANT RADIATION
Table A2.
Collection locations for Asphondylia samples used in this study. NA refers to coordinates not available.
Species
Asphondylia apicata
A. apicata
A. rosetta
A. rosetta
A. florae
A. florae
A. auripila
A. auripila
A. foliosa
A. foliosa
A. resinosa
A. resinosa
A. barbata
A. barbata
A. clavata
A. clavata
A. fabalis
A. fabalis
A. pilosa
A. pilosa
A. silicula
A. silicula
A. villosa
A. villosa
A. digitata
A. bullata
A. bullata
A. caudices
A. atriplicis
A. neomexicana
A. bigeloviabrassicoides
A. spp.
A. websteri
A. conglomerata
Location
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
New Mexico
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Arizona
Texas
Arizona
Arizona
Arizona
Arizona
Texas
Texas
California
Arizona
Arizona
British Columbia
California
Arizona
Israel
Collection location
Latitude
Longitude
32.85419
32.85419
33.66552
35.62776
32.10646
32.04849
32.22744
32.19672
33.43421
32.19672
33.79714
34.05390
32.17640
34.61367
32.04849
32.08436
33.40855
33.40855
33.79716
32.46565
31.06663
32.27415
31.96300
31.96300
32.06105
31.06663
31.06663
34.92229
32.75440
32.75440
49.23960
32.63629
NA
NA
−112.76898
−112.76898
−114.00259
−114.42500
−110.02626
−111.39339
−108.95309
−112.46421
−112.58794
−112.46421
−112.13309
−112.14478
−112.26275
−111.86295
−111.39339
−110.81089
−112.39408
−112.39408
−112.13789
−112.87441
−104.21716
−110.95036
−110.80246
−110.80246
−110.77532
−104.21716
−104.21716
−117.27702
−110.64789
−110.64789
−119.40010
−116.11862
NA
NA
EVOLUTION APRIL 2007
795
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement