Local Run Manager Amplicon Analysis Module Workflow Guide (1000000002708 v00)

Local Run Manager Amplicon Analysis Module Workflow Guide (1000000002708 v00)
Local Run Manager
Amplicon Analysis Module
Workflow Guide
For Research Use Only. Not for use in diagnostic procedures.
Overview
Set Parameters
Analysis Methods
View Analysis Results
Analysis Report
Analysis Output Files
Custom Analysis Settings
Technical Assistance
ILLUMINA PROPRIETARY
Document # 1000000002708 v00
January 2016
3
4
6
9
10
12
18
21
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the
contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This
document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed,
or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license
under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order
to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read
and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN
MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND
DAMAGE TO OTHER PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2016 Illumina, Inc. All rights reserved.
Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio,
Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect,
MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome,
TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the
streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the U.S. and/or other countries. All other
names, logos, and other trademarks are the property of their respective owners.
The Local Run Manager Amplicon analysis module aligns reads against the reference
specified in the manifest file using the banded Smith-Waterman algorithm, and then
performs variant analysis.
Compatible Library Types
The Amplicon analysis module is compatible with specific library types represented by
library kit categories on the Create Run screen. For a current list of compatible library
kits, see the Local Run Manager support page on the Illumina website.
Input Requirements
In addition to sequencing data files generated during the sequencing run, such as base
call files, the Amplicon analysis module requires the following files.
} Manifest file—The Amplicon analysis module requires at least 1 manifest file. The
manifest file is provided with either your custom assay (CAT) or from the Illumina
website depending on the library kit used for the run.
} Reference genome—The Amplicon analysis module requires the reference genome
specified in the manifest file. The reference genome provides variant annotations and
sets the chromosome sizes in the BAM output files.
Uploading Manifests
To import a manifest for all runs using the Amplicon analysis module, use the Module
Settings command from the Local Run Manager navigation bar. For more information,
see the Local Run Manager Software Guide (document # 1000000002702). Alternatively, you
can import a manifest for the current run only using the Import Manifests command on
the Create Run screen.
About This Guide
This guide provides instructions for setting up run parameters for sequencing and
analysis parameters for the Amplicon analysis module. For information about the Local
Run Manager dashboard and system settings, see the Local Run Manager Software Guide
(document # 1000000002702).
Local Run Manager Amplicon Analysis Module Workflow Guide
3
Overview
Overview
Set Parameters
1
Click Create Run, and select Amplicon.
2
Enter a run name that identifies the run from sequencing through analysis.
Use alphanumeric characters, spaces, underscores, or dashes.
3
[Optional] Enter a run description to help identify the run.
Use alphanumeric characters.
Specify Run Settings
1
From the Library Kit drop-down list, select from the following library kit categories.
} TruSight Amplicon Panels
} TruSeq Amplicon
2
Specify the number of cycles for the run.
3
[Optional] Specify any custom primers to be used for the run.
NOTE
By default, the Amplicon analysis module is set to 2 index reads of 8 cycles each and the
read type Paired End.
Specify Module-Specific Settings
1
Expand the Variant Caller drop-down list and select a variant calling method.
} Starling—(Default) Calls SNPs and small indels, and summarizes depth and
probabilities for every site in the genome.
} Somatic—Identifies variants at low frequency and minimizes false positives.
Recommended for analysis of tumor samples.
} GATK—Calls raw variants for each sample, analyzes variants against known
variants, and then calculates a false discovery rate for each variant.
2
If using the Somatic Variant Caller, specify the following settings.
} Variant Frequency—Set to a threshold of 0.05 by default. Variants with a
frequency below the specified threshold are not reported in VCF files.
} Indel Repeat Filter Cutoff—On by default. When enabled, indels are filtered when
the reference has a 1-base or 2-base motif over 8 times next to the variant.
3
Click Show advanced module settings and click the On/Off toggle to specify the
following analysis settings.
} Read Stitching—On by default. When enabled, reads that overlap ≥ 10 bases
between Read 1 and Read 2 are stitched together to form a single read.
} Variant Quality Filter—Set to 30 by default. Variants with a variant quality score
below the specified threshold are flagged as filtered in VCF files. Possible values
are 2–1000.
NOTE
By default, the Amplicon analysis module uses the Smith-Waterman algorithm for
alignment.
Import Manifest Files for the Run
1
4
Make sure that the manifests you want to import are available in an accessible
network location or on a USB drive.
Document # 1000000002708 v00
Click Import Manifests.
3
Navigate to the manifest file and select the manifest that you want to add.
NOTE
To import manifests for any run using the Amplicon analysis module, use the Module
Settings feature from the navigation bar.
Specify Samples for the Run
Specify samples for the run using the following options:
} Enter samples manually—Use the blank table on the Create Run screen.
} Import samples—Navigate to an external file in a comma-separated values (*.csv)
format. A template is available for download on the Create Run screen.
After you have populated the samples table, you can export the sample information to
an external file, and use the file as a reference when preparing libraries or import the file
for another run.
Enter Samples Manually
1
Adjust the samples table to an appropriate number of rows.
} Click the + icon to add a row.
} Use the up/down arrows to add multiple rows. Click the + icon.
} Click the x icon to delete a row.
} Right-click on a row in the table and use the commands in the drop-down menu.
2
Enter a unique sample ID in the Sample ID field.
Use alphanumeric characters, dashes, or underscores.
3
[Optional] Enter a sample description in the Sample Description field.
Use alphanumeric characters, dashes, underscores, or spaces.
4
Expand the Index 1 (i7) drop-down list and select an Index 1 adapter.
5
Expand the Index 2 (i5) drop-down list and select an Index 2 adapter.
6
Expand the Manifest drop-down list and select a manifest file.
7
Expand the Genome Folder drop-down list and select a reference genome.
8
[Optional] Click the Export
9
When finished, click Save Run.
icon to export sample information in *.csv format.
Import Samples
1
Click Template. The template file contains the correct column headings for import.
2
Enter the sample information in each column for the samples in the run, and then
save the file.
3
Click Import Samples and browse to the location of the sample information file.
4
When finished, click Save Run.
Local Run Manager Amplicon Analysis Module Workflow Guide
5
Set Parameters
2
Analysis Methods
The Amplicon analysis module performs the following analysis steps and then writes
analysis output files to the Alignment folder.
} Demultiplexes index reads
} Generates FASTQ files
} Aligns to a reference
} Identifies variants
Demultiplexing
Demultiplexing compares each Index Read sequence to the index sequences specified for
the run. No quality values are considered in this step.
Index reads are identified using the following steps:
} Samples are numbered starting from 1 based on the order they are listed for the run.
} Sample number 0 is reserved for clusters that were not assigned to a sample.
} Clusters are assigned to a sample when the index sequence matches exactly or when
there is up to a single mismatch per Index Read.
FASTQ File Generation
After demultiplexing, the software generates intermediate analysis files in the FASTQ
format, which is a text format used to represent sequences. FASTQ files contain reads for
each sample and the associated quality scores. Any controls used for the run and
clusters that did not pass filter are excluded.
Each FASTQ file contains reads for only 1 sample, and the name of that sample is
included in the FASTQ file name. FASTQ files are the primary input for alignment.
Read Stitching
The Amplicon analysis module performs read stitching by default.
When enabled, paired-end reads that overlap are stitched to form a single read in the
FASTQ file. At each overlap position, the consensus stitched read has the base call and
quality score of the read with higher Q-score.
For each paired read, a minimum of 10 bases must overlap between Read 1 and Read 2
to be a candidate for read stitching. The minimum threshold of 10 bases minimizes the
number of reads that are stitched incorrectly due to a chance match. Candidates for read
stitching are scored as follows:
} For each possible overlap of 10 base pairs or more, a mismatch score is calculated.
Perfectly matched overlaps have a MismatchRate of 0, resulting in a score of 1.
} If the best overlap has a score of ≥ 0.9 and the score is ≥ 0.1 higher than any other
candidate, then the reads are stitched together at this overlap.
} Paired-end reads that cannot be stitched are converted to 2 single reads in the
FASTQ file.
Although the stitched reads are aligned as a single sequence, the stitched read is split
into individual alignments in the BAM file.
Alignment
During the alignment step, the banded Smith-Waterman algorithm aligns clusters from
each sample against amplicon sequences specified in the manifest file.
6
Document # 1000000002708 v00
Each paired-end read is evaluated in terms of its alignment to the relevant probe
sequences for that read.
} Read 1 is evaluated against the reverse complement of the Downstream LocusSpecific Oligos (DLSO).
} Read 2 is evaluated against the Upstream Locus-Specific Oligos (ULSO).
} If the start of a read matches a probe sequence with no more than 1 mismatch, the
full length of the read is aligned against the amplicon target for that sequence.
Alignments that include more than 3 indels are filtered from alignment results. Filtered
alignments are written in alignment files as unaligned and are not used in variant
calling.
Variant Calling
Variant calling records single nucleotide polymorphisms (SNPs), insertions/deletions
(indels), and other structural variants in a standardized variant call format (VCF).
For each SNP or indel called, the probability of an error is provided as a variant quality
score. Reads are realigned around candidate indels to improve the quality of the calls
and site coverage summaries.
The Amplicon analysis module provides the option of using Starling, Somatic, or GATK
for variant calling.
Starling
Starling calls both SNPs and small indels, and summarizes depth and probabilities for
every site in the genome. Starling produces a VCF file for each sample that contains
variants.
Starling treats each insertion or deletion as a single mismatch. Base calls with more than
2 mismatches to the reference sequence within 20 bases of the call are ignored. If the call
occurs within the first or last 20 bases of a read, the mismatch limit is increased to 41
bases.
Somatic Variant Caller
Developed by Illumina, the somatic variant caller identifies variants present at low
frequency in the DNA sample and minimizes false positives.
The somatic variant caller identifies SNPs in 3 steps:
} Considers each position in the reference genome separately
} Counts bases at the given position for aligned reads that overlap the position
} Computes a variant score that measures the quality of the call using a Poisson
model. Variants with a quality score below Q20 are excluded.
The somatic variant caller analyzes how many alignments covering a given position
include a particular indel compared to the overall coverage at that position.
Local Run Manager Amplicon Analysis Module Workflow Guide
7
Analysis Methods
The banded Smith-Waterman algorithm performs local sequence alignments to
determine similar regions between 2 sequences. Instead of comparing the total sequence,
the Smith-Waterman algorithm compares segments of all possible lengths. Local
alignments are useful for dissimilar sequences that are suspected to contain regions of
similarity within the larger sequence. This process allows alignment across small
amplicon targets, often less than 10 bp.
GATK
The Genome Analysis Toolkit (GATK) calls raw variants for each sample, analyzes
variants against known variants, and then calculates a false discovery rate for each
variant. Variants are flagged as homozygous (1/1) or heterozygous (0/1) in the VCF file
sample column. For more information, see www.broadinstitute.org/gatk.
8
Document # 1000000002708 v00
1
From the Local Run Manager dashboard, click the run name.
2
From the Run Overview tab, review the sequencing run metrics.
3
[Optional] Click the Copy to Clipboard
4
Click the Sequencing Information tab to review run parameters and consumables
information.
5
Click the Samples and Results tab to view the analysis report.
} If analysis was repeated, expand the Select Analysis drop-down and select the
appropriate analysis.
} From the left navigation bar, select a sample name to view the report for another
sample.
6
[Optional] Click the Copy to Clipboard
Local Run Manager Amplicon Analysis Module Workflow Guide
icon for access to the output run folder.
icon for access to the Analysis folder.
9
View Analysis Results
View Analysis Results
Analysis Report
Analysis results are summarized on the Samples and Results tab. The report is also
available in a PDF file format for each sample and as an aggregate report in the Analysis
folder.
Sample Information
Table 1 Sample Information Table
Column Heading
Description
Sample ID
The sample ID provided when the run was created.
Total PF Reads
The total number of reads passing filter.
Percent Q30 Bases
The percentage of bases called with a quality score ≥ Q30.
Amplicon Summary
Table 2 Amplicon Summary Table
Column Heading
Description
Manifest
The name of the file that specifies the reference and targeted
reference regions.
Number of Amplicon
The number of amplicon regions sequenced.
Regions
Total Length of Amplicon The total length in base pairs of sequenced amplicons in the
Regions
target regions.
Read Level Statistics
Table 3 Read Level Statistics Table
Column Heading
Description
Total Aligned Reads
The total number of reads that aligned to the reference for each
read (Read 1 and Read 2).
Percent Aligned Reads
The percentage of reads that aligned to the reference for each
read (Read 1 and Read 2).
Base Level Statistics
Table 4 Base Level Statistics Table
Column Heading
Description
Total Aligned Bases
The total number of bases that aligned to the reference for each
read (Read 1 and Read 2).
Percent Aligned Bases
The percentage of aligned bases averaged over cycles per read
(Read 1 and Read 2).
Mismatch Rate
The percentage of bases that did not align to the reference
averaged over cycles per read (Read 1 and Read 2).
10
Document # 1000000002708 v00
Analysis Report
Small Variants Summary
Table 5 Small Variants Summary Table
Row Heading
Description
Total Passing
The total number of variants passing filter for single nucleotide
variations (SNVs), insertions, and deletions.
Het/Hom Ratio
The ratio of the number of heterozygous SNPs and number of
homozygous SNPs detected for the sample.
Ts/Tv Ratio
The ratio of transitions and transversions in SNPs.
• Transitions are variants of the same nucleotide type
(pyrimidine to pyrimidine, C and T; or purine to purine, A
and G).
• Transversions are variants of a different nucleotide type
(pyrimidine to purine, or purine to pyrimidine).
Coverage Summary
Table 6 Coverage Summary Table
Column Heading
Description
Amplicon Mean
The total number of aligned bases divided by the targeted region
Coverage
size.
Uniformity of Coverage The percentage of amplicon regions with coverage values greater
than the low coverage threshold of 0.2 * amplicon mean
coverage.
Coverage by Amplicon Region Plot
The Coverage by Amplicon Region plot show the coverage across amplicon regions.
Regions with coverage values lower than the coverage threshold are highlighted in red.
The average of all values is indicated by an orange line.
Figure 1 Coverage by Amplicon Region Plot (Example)
Local Run Manager Amplicon Analysis Module Workflow Guide
11
Analysis Output Files
The following analysis output files are generated for the Amplicon analysis module and
provide analysis results for alignment and variant calling. Analysis output files are
located in the Alignment folder.
File Name
Description
Demultiplexing (*.demux)
Intermediate files containing demultiplexing results.
FASTQ (*.fastq.gz)
Intermediate files containing quality scored base calls.
FASTQ files are the primary input for the alignment step.
Alignment files in the
BAM format (*.bam)
Contains aligned reads for a given sample.
Per-Pool variant call files
in the VCF format (*.vcf)
Contains variants called at each position from either the
forward pool or the reverse pool.
Variant call files in the
genome VCF format
(*.genome.vcf)
Contains the genotype for each position, whether called
as a variant or called as a reference.
Consensus variant call files
in the VCF format (*.vcf)
Contains variants called at each position from both pools.
AmpliconCoverage_M1.tsv
Contains information about coverage per amplicon per
sample for each manifest provided. M# represents the
manifest number.
Demultiplexing File Format
The process of demultiplexing reads the index sequence attached to each cluster to
determine from which sample the cluster originated. The mapping between clusters and
sample number are written to 1 demultiplexing (*.demux) file for each tile of the flow
cell.
The demultiplexing file naming format is s_1_X.demux, where X is the tile number.
Demultiplexing files start with a header:
} Version (4 byte integer), currently 1
} Cluster count (4 byte integer)
The remainder of the file consists of sample numbers for each cluster from the tile.
When the demultiplexing step is complete, the software generates a demultiplexing file
named DemultiplexSummaryF1L1.txt.
} In the file name, F1 represents the flow cell number.
} In the file name, L1 represents the lane number.
} Demultiplexing results in a table with 1 row per tile and 1 column per sample,
including sample 0.
} The most commonly occurring sequences in index reads.
FASTQ File Format
FASTQ file is a text-based file format that contains base calls and quality values per read.
Each record contains 4 lines:
12
Document # 1000000002708 v00
The identifier
The sequence
A plus sign (+)
The quality scores in an ASCII encoded format
The identifier is formatted as:
@Instrument:RunID:FlowCellID:Lane:Tile:X:Y ReadNum:FilterFlag:0:SampleNumber
Example:
@SIM:1:FCX:1:15:6329:1045 1:N:0:2
TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
+
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=
BAM File Format
A BAM file (*.bam) is the compressed binary version of a SAM file that is used to
represent aligned sequences up to 128 Mb. SAM and BAM formats are described in
detail at https://samtools.github.io/hts-specs/SAMv1.pdf.
BAM files use the file naming format of SampleName_S#.bam, where # is the sample
number determined by the order that samples are listed for the run.
BAM files contain a header section and an alignments section:
} Header—Contains information about the entire file, such as sample name, sample
length, and alignment method. Alignments in the alignments section are associated
with specific information in the header section.
} Alignments—Contains read name, read sequence, read quality, alignment
information, and custom tags. The read name includes the chromosome, start
coordinate, alignment quality, and the match descriptor string.
The alignments section includes the following information for each or read pair:
} RG: Read group, which indicates the number of reads for a specific sample.
} BC: Barcode tag, which indicates the demultiplexed sample ID associated with the
read.
} SM: Single-end alignment quality.
} AS: Paired-end alignment quality.
} NM: Edit distance tag, which records the Levenshtein distance between the read and
the reference.
} XN: Amplicon name tag, which records the amplicon tile ID associated with the
read.
BAM files are suitable for viewing with an external viewer such as IGV or the UCSC
Genome Browser.
BAM index files (*.bam.bai) provide an index of the corresponding BAM file.
VCF File Format
VCF is a widely used file format developed by the genomics scientific community that
contains information about variants found at specific positions in a reference genome.
VCF files use the file naming format SampleName_S#.vcf, where # is the sample number
determined by the order that samples are listed for the run.
VCF File Header—Includes the VCF file format version and the variant caller version.
The header lists the annotations used in the remainder of the file. If MARS is listed, the
Illumina internal annotation algorithm annotated the VCF file. The VCF header includes
Local Run Manager Amplicon Analysis Module Workflow Guide
13
Analysis Output Files
}
}
}
}
the reference genome file and BAM file. The last line in the header contains the column
headings for the data lines.
VCF File Data Lines—Each data line contains information about a single variant.
VCF File Headings
Heading
Description
CHROM
The chromosome of the reference genome. Chromosomes appear in
the same order as the reference FASTA file.
POS
The single-base position of the variant in the reference chromosome.
For SNPs, this position is the reference base with the variant; for indels
or deletions, this position is the reference base immediately before the
variant.
ID
The rs number for the SNP obtained from dbSNP.txt, if applicable.
If there are multiple rs numbers at this location, the list is semicolon
delimited. If no dbSNP entry exists at this position, a missing value
marker ('.') is used.
REF
The reference genotype. For example, a deletion of a single T is
represented as reference TT and alternate T. An A to T single nucleotide
variant is represented as reference A and alternate T.
ALT
The alleles that differ from the reference read.
For example, an insertion of a single T is represented as reference A and
alternate AT. An A to T single nucleotide variant is represented as
reference A and alternate T.
QUAL
A Phred-scaled quality score assigned by the variant caller.
Higher scores indicate higher confidence in the variant and lower
probability of errors. For a quality score of Q, the estimated probability
of an error is 10-(Q/10). For example, the set of Q30 calls has a 0.1% error
rate. Many variant callers assign quality scores based on their statistical
models, which are high in relation to the error rate observed.
VCF File Annotations
14
Heading
Description
FILTER
If all filters are passed, PASS is written in the filter column.
• LowDP—Applied to sites with depth of coverage below a cutoff.
• LowGQ—The genotyping quality (GQ) is below a cutoff.
• LowQual—The variant quality (QUAL) is below a cutoff.
• LowVariantFreq—The variant frequency is less than the given
threshold.
• R8—For an indel, the number of adjacent repeats (1-base or 2-base)
in the reference is greater than 8.
• SB—The strand bias is more than the given threshold. Used with the
Somatic Variant Caller and GATK.
Document # 1000000002708 v00
Description
INFO
Possible entries in the INFO column include:
• AC—Allele count in genotypes for each ALT allele, in the same order
as listed.
• AF—Allele Frequency for each ALT allele, in the same order as listed.
• AN—The total number of alleles in called genotypes.
• CD—A flag indicating that the SNP occurs within the coding region
of at least 1 RefGene entry.
• DP—The depth (number of base calls aligned to a position and used
in variant calling).
• Exon—A comma-separated list of exon regions read from RefGene.
• FC—Functional Consequence.
• GI—A comma-separated list of gene IDs read from RefGene.
• QD—Variant Confidence/Quality by Depth.
• TI—A comma-separated list of transcript IDs read from RefGene.
FORMAT
The format column lists fields separated by colons. For example,
GT:GQ. The list of fields provided depends on the variant caller used.
Available fields include:
• AD—Entry of the form X,Y, where X is the number of reference calls,
and Y is the number of alternate calls.
• DP—Approximate read depth; reads with MQ=255 or with bad mates
are filtered.
• GQ—Genotype quality.
• GQX—Genotype quality. GQX is the minimum of the GQ value and
the QUAL column. In general, these values are similar; taking the
minimum makes GQX the more conservative measure of genotype
quality.
• GT—Genotype. 0 corresponds to the reference base, 1 corresponds
to the first entry in the ALT column, and so on. The forward slash (/)
indicates that no phasing information is available.
• NL—Noise level; an estimate of base calling noise at this position.
• PL—Normalized, Phred-scaled likelihoods for genotypes.
• SB—Strand bias at this position. Larger negative values indicate less
bias; values near 0 indicate more bias. Used with the Somatic Variant
Caller and GATK.
• VF—Variant frequency; the percentage of reads supporting the
alternate allele.
SAMPLE
The sample column gives the values specified in the FORMAT column.
Analysis Output Files
Heading
Genome VCF Files
Genome VCF (gVCF) files are VCF v4.1 files that follow a set of conventions for
representing all sites within the genome in a reasonably compact format. The gVCF files
include all sites within the region of interest in a single file for each sample.
The gVCF file shows no-calls at positions with low coverage, or where a low-frequency
variant (< 3%) occurs often enough (> 1%) that the position cannot be called to the
reference. A genotype (GT) tag of ./. indicates a no-call.
For more information, see sites.google.com/site/gvcftools/home/about-gvcf.
Local Run Manager Amplicon Analysis Module Workflow Guide
15
Amplicon Coverage File
An amplicon coverage file is generated for each manifest file. The M# in the file name
represents the manifest number as it is listed in the samples table for the run.
Each file includes a header row that contains the sample IDs associated with the
manifest. Under the header row are 3 columns that list the following information:
} The Target ID as it is listed in the manifest.
} The coverage depth of reads passing filter.
} The total coverage depth.
Supplementary Output Files
The following output files provide supplementary information, or summarize run results
and analysis errors. Although, these files are not required for assessing analysis results,
they can be used for troubleshooting purposes. All files are located in the Alignment
folder unless otherwise specified.
File Name
Description
AnalysisLog.txt
Processing log that describes every step that occurred
during analysis of the current run folder. This file does
not contain error messages.
Located in the root level of the run folder.
AnalysisError.txt
Processing log that lists any errors that occurred
during analysis. This file is present only if errors
occurred.
Located in the root level of the run folder.
CompletedJobInfo.xml
Written after analysis is complete, contains information
about the run, such as date, flow cell ID, software
version, and other parameters.
Located in the root level of the run folder.
DemultiplexSummaryF1L1.txt
Reports demultiplexing results in a table with 1 row
per tile and 1 column per sample.
ErrorsAndNoCallsByLaneTile
ReadCycle.csv
A comma-separated values file that contains the
percentage of errors and no-calls for each tile, read,
and cycle.
Mismatch.htm
Contains histograms of mismatches per cycle and nocalls per cycle for each tile.
AmpliconRunStatistics.xml
Contains summary statistics specific to the run.
Located in the root level of the run folder.
Summary.xml
Contains a summary of mismatch rates and other base
calling results.
Summary.htm
Contains a summary web page generated from
Summary.xml.
Analysis Folder
The analysis folder holds the files generated by the Local Run Manager software.
The relationship between the output folder and analysis folder is summarized as follows:
16
Document # 1000000002708 v00
}
}
}
During sequencing, Real-Time Analysis (RTA) populates the output folder with files
generated during image analysis, base calling, and quality scoring.
RTA copies files to the analysis folder in real time. After RTA assigns a quality score
to each base for each cycle, the software writes the file RTAComplete.xml to both
folders.
When the file RTAComplete.xml is present, analysis begins.
As analysis continues, Local Run Manager writes output files to the analysis folder,
and then copies the files back to the output folder.
Folder Structure
Data
Intensities
BaseCalls
Alignment—Contains *.bam and *.vcf files, and files specific to the
analysis module.
L001—Contains one subfolder per cycle, each containing *.bcl files.
Sample1_S1_L001_R1_001.fastq.gz
Sample2_S2_L001_R1_001.fastq.gz
Undetermined_S0_L001_R1_001.fastq.gz
L001—Contains *.locs files, 1 for each tile.
RTA Logs—Contains log files from RTA software analysis.
InterOp—Contains binary files used by Sequencing Analysis Viewer (SAV).
Logs—Contains log files describing steps performed during sequencing.
Queued—A working folder for software; also called the copy folder.
AnalysisError.txt
AnalysisLog.txt
CompletedJobInfo.xml
QueuedForAnalysis.txt
[WorkflowName]RunStatistics
RTAComplete.xml
RunInfo.xml
runParameters.xml
Alignment Folders
Each time that analysis is requeued, the Local Run Manager creates an Alignment folder
named AlignmentN, where N is a sequential number.
Local Run Manager Amplicon Analysis Module Workflow Guide
17
Analysis Output Files
}
Custom Analysis Settings
Custom analysis settings are intended for technically advanced users. If settings are
applied incorrectly, serious problems can occur.
Add a Custom Analysis Setting
1
From the Module-Specific Settings section of the Create Run screen, click Show
advanced module settings.
2
Click Add custom setting.
3
In the custom setting field, enter the setting name as listed in the Available Analysis
Settings section.
4
In the setting value field, enter the setting value.
5
To remove a setting, click the x icon.
Available Analysis Settings
}
}
}
}
18
Variant Frequency—Filters variants with a frequency less than the specified
threshold. If using the Somatic Variant Caller, adjust the value for this setting on the
Create Run screen.
Setting Name
Setting Value
VariantFrequencyFilterCutoff
Enter a threshold value.
With the Somatic Variant Caller, the default value
is 0.05.
With GATK or Starling, the default value is 0.20.
Indel Repeat Cutoff—Filters insertions and deletions when the reference has a 1base or 2-base motif over 8 times (by default) next to the variant. If using the Somatic
Variant Caller, enable or disable this setting on the Create Run screen.
Setting Name
Setting Value
IndelRepeatFilterCutoff
Enter a threshold value.
The default value is 8.
Variant Genotyping Quality—Filters variants with a genotype quality (GQ) less than
the specified threshold.
Setting Name
Setting Value
VariantMinimumGQCutoff
Enter a value less than 99.
With GATK or Somatic Variant Caller, the default
value is 30.
With Starling, the default value is 20.
Variant Quality Cutoff—Filters variants with a quality (QUAL) less than the
specified threshold. QUAL indicates the confidence of the variant call.
Document # 1000000002708 v00
Setting Value
VariantMiniumQualCutoff
Enter a threshold value.
With GATK or Somatic Variant Caller, the default
value is 30.
With Starling, the default value is 20.
Local Run Manager Amplicon Analysis Module Workflow Guide
Custom Analysis Settings
Setting Name
19
Notes
For technical assistance, contact Illumina Technical Support.
Table 7 Illumina General Contact Information
Website
Email
www.illumina.com
[email protected]
Table 8 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
North America
1.800.809.4566
Japan
Australia
1.800.775.688
Netherlands
Austria
0800.296575
New Zealand
Belgium
0800.81102
Norway
China
400.635.9898
Singapore
Denmark
80882346
Spain
Finland
0800.918363
Sweden
France
0800.911850
Switzerland
Germany
0800.180.8994
Taiwan
Hong Kong
800960230
United Kingdom
Ireland
1.800.812949
Other countries
Italy
800.874909
Contact Number
0800.111.5011
0800.0223859
0800.451.650
800.16836
1.800.579.2745
900.812168
020790181
0800.563118
00806651752
0800.917.0041
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at
support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go
to support.illumina.com, select a product, then select Documentation & Literature.
Local Run Manager Amplicon Analysis Module Workflow Guide
Technical Assistance
Technical Assistance
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement