Persistence of Human Pathogens in a Crop Grown from

Persistence of Human Pathogens in a Crop Grown from
University of Pretoria etd – Chale-Matsau, J R B (2005)
Persistence of Human Pathogens in a Crop Grown from
Sewage Sludge Treated Soil
by
Jacobeth Raesibe Bettina Chale-Matsau
Submitted in partial fulfillment of the requirement for the degree of
PHILOSOPHIAE DOCTOR
(Water Utilisation)
in the
Faculty of Engineering, the Built Environment and Information Technology
University of Pretoria
Pretoria
June 2005
University of Pretoria etd – Chale-Matsau, J R B (2005)
I, Jacobeth Raesibe Bettina Chale-Matsau hereby declare that the work on which
this thesis is based is original (except where acknowledgements indicate
otherwise) and that neither the whole work or any part of it has been, is being, or
is to be submitted for another degree at this or any other university
Signed:
University of Pretoria etd – Chale-Matsau, J R B (2005)
Acknowledgements
I would like to express my sincere appreciation and gratitude to the following
persons and organizations, without whose involvement this work would not
have been possible.
1. Dr Heidi Snyman, my promotor, who did not only advise and support me,
but shaped my thinking immensely
2. Prof Schoeman for assistance with statistical analysis
3. Boet Weyers for technical assistance and support especially during the
terminal stages of this project
4. Lebo Hanyane, for assistance and support throughout the study
5. Julian Japhta for assistance with molecular techniques. Juanita van der
Heerver, Martella du Preez, Dr Ehlers and Elize Venter who made time to
go through my work especially the risk assessment section
6. Dr John Dewar for proof-reading my thesis
7. WRC and ERWAT for funding the project
8. My employer, Medical University of Southern Africa for the time
9. My son, Moeletsi and my daughter, Lebohang whose time I’ve sacrificed,
yet uncomplainingly accepted. My husband, Tshepo, for love and support.
And the Lord Almighty for life itself.
University of Pretoria etd – Chale-Matsau, J R B (2005)
Summary
Persistence of Human Pathogens in a Crop Grown from
Sewage Sludge Treated Soil
Jacobeth Raesibe Bettina Chale-Matsau
Promoter:
Dr HG Snyman
Department: Department of Chemical Engineering (Water Utilisation)
University:
University of Pretoria
Degree:
Philosophiae Doctor
Key words:
sewage sludge, pathogen, Ascaris, E.coli, Salmonella, risk assessment, high
metal sludge, low metal sludge, management practice, poverty.
Summary:
The advantages associated with the use of sewage sludge in agricultural land
have motivated many countries to use sewage sludge for soil amendment
purposes.
South Africa’s deteriorated agricultural soil could benefit from this
nutritional and cost effective product. However, the major shortcoming of sewage
sludge is the presence of various pathogenic microorganisms. This raised
concern amongst researchers with regard to public safety. The focus of this
study, was to investigate the prevalence of pathogens in a crop grown in soil
enriched with sewage sludge and to determine risk of infection thereof and to
suggest appropriate management practice for sewage sludge use.
Potato (Solanum tuberrosum), which is a high risk crop was used, to simulate a
worst case scenario. Both the low metal sludge (LMS) and high metal sludge
(HMS) were found to have associated diverse numbers of bacteria. Using
culture-based technique, E.coli and Salmonella spp were found to persist in soil
i
University of Pretoria etd – Chale-Matsau, J R B (2005)
throughout the experimental period. One treatment option (LMS 16 tons/ha)
showed a prevalence of these microorganisms in potatoes.
Subsequent molecular studies based on amplification of 16S rRNA gene, yielded
limited contamination of potatoes with enteric pathogens, however diverse types
of opportunistic, pathogens (mostly environmental pathogens) were isolated from
the potatoes. Enteric pathogens were isolated from the sewage treated soil in
which these potatoes were grown.
This study has indicated that growing even high risk crops, may lead to limited
infestation of produce with primary pathogens. However, proper treatment of
sewage sludge prior to use in agriculture is recommendedl to ensure public
safety.
The management requirements indicated in this study serve as recommended
actions that can be implemented to ensure human safety with regard to sludge
application to agricultural land.
ii
University of Pretoria etd – Chale-Matsau, J R B (2005)
CONTENTS
Summary
i
List of Abbreviations
iii
Chapter 1: Introduction
1.1 Background
1
1.2 Motivation for Present Study
2
1.3 Aim and Objectives
3
1.4 Approach
4
Chapter 2: Literature Review
2.1 Introduction
5
2.2 Metals and Toxic Organic Pollutants in Sludge
6
2.3 Socio-economic Issues Regarding Sludge Use
7
2.4 Microorganisms Encountered in Sewage Sludge
8
2.4.1 Bacteria
9
2.4.2 Persistence of Bacteria in Soil
15
2.4.3 Viruses
16
2.4.4 Parasites
18
2.5 Disinfecting Treatment Processes
21
2.6 Treatment and Sewage Sludge Classification in South Africa
23
2.7 Resistance of Microorganisms to Disinfection
28
2.8 Protecting the Public and Environment through Regulatory
Management
28
2.9 Public Perception
30
2.10 Assessing Human Risk Exposure
31
2.10.1 Health Risk Assessment
32
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.11 Factors Affecting Management of Sewage Sludge
Use in South Africa
35
2.12 Conclusion
35
2.13 References
37
Chapter 3: The Microbiological Quality of Sewage Sludge in South Africa
3.1 Introduction
49
3.2 Materials and Methods
50
3.2.1 Sample Collection
50
3.2.2 Microbiological Analysis
51
3.2.3 Microbial Diversity
51
3.3 Results and Discussion
54
3.3.1 Incidence of Organisms in Sludges from WWTPs
in South Africa
54
3.3.2 Microorganisms Identified Using API
and the Biolog technique
57
3.4 Conclusion
61
3.5 References
63
Chapter 4: Survival of Microorganisms in Soil Amended with Sewage Sludge,
and their Subsequent Persistence in Crops
4.1 Introduction
68
4.2 Materials and Methods
69
4.2.1 Green House Experiments
69
4.2.2 Microbiological Determinations
70
4.3 Results and Discussion
72
4.3.1 Microorganisms in Sludge
72
4.3.2 Survival of Microorganisms in Contaminated Soil
73
4.3.3 Microorganisms in Potato
80
4.4 Conclusion
82
4.5 References
84
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 5: Identification of Pathogenic Bacteria from Solanum tuberosum
Grown in Sewage Sludge Amended Soil
5.1 Introduction
90
5.2 Materials and Methods
91
5.2.1 Potato Samples
91
5.2.2 Extraction of Genomic DNA
91
5.2.3 PCR Amplification of the 16S rRNA Gene
92
5.2.4 Agarose Gel Eletrophoresis
93
5.2.5 DNA Purification
93
5.2.6 Cloning
94
5.2.7 Plasmid Extraction
94
5.2.8 Plasmid Purification
94
5.2.9 Restriction Enzyme
95
5.2.10 Sequencing
95
5.2.11 DNA Precipitation
95
5.2.12 Sequence Determination
96
5.3 Results and Discussion
96
5.3.1 DNA Extraction and PCR Amplification
of the 16S Gene
96
5.3.2 Homology Searches Using the BLAST
98
5.3.3 Bacteria Associated with Sewage Sludge Use
102
5.4 Conclusion
105
5.5 References
106
Chapter 6: Microbial Risk Assessment of Using Sewage Sludge for Soil
Enrichment
6.1 Introduction
112
6.2 Health Considerations for Consumption of Contaminated
Vegetables
114
6.3 Assumptions
115
6.4 Methodology
116
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.5 Results and Discussion
118
6.6 Conclusions and Recommendations
127
6.7 References
130
Chapter 7: Management Practices Regarding Sewage Sludge
Use in Agricultural Land
7.1 Introduction
135
7.2 International Trends Regarding Microbiological Sludge Quality 135
7.3 Factors that Influence Sludge Management Practice
in South Africa
137
7.4 Exposure Pathways
139
7.5 Ranking of Exposure Pathways for South African Conditions
141
7.6 Risk Management
145
7.7 Conclusion and Recommendations
148
7.8 References
150
Chapter 8: Concluding Remarks
8.1 Introduction
152
8.2 Research Findings
152
8.3 Sewage Sludge Management Requirements
153
8.4 Future Trends
155
8.5 References
157
Chapter 9: Appendices
158
University of Pretoria etd – Chale-Matsau, J R B (2005)
List of Abbreviations
AMP :
ampicilin
mg
:
milligram
µg
:
microgram
µL
:
microlitre
ton
:
tonne
ha
:
hectare
ml
:
millilitre
IPTG :
isopropyl β-D-galactopyranoside
dNTP :
deoxyribonucleoside triphosphate
bp
base pairs
:
EtoH :
Ethanol
HCl
Hydrochloric acid
:
NaCl :
Sodium chloride
NaoAC
Sodium acetate
LB
Luria Bertani
:
SDS :
Sodium dodecyl sulphate
DNA :
Deoxyribonucleic acid
RNA :
Ribonucleic acid
PCR :
Polymerase Chain Reaction
X-gal :
5-bromo-4-chloro-3-indolyl-β-D-galactoside
iii
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 1
Introduction
1.1 Background
Sewage sludge is an inevitable end product of wastewater treatment, presented
as a concentrate of waste material. As sewage sludge is rich in organic matter
and nutrients, it can successfully be used in agricultural practices especially in
arid countries such as South Africa.
The use of human excreta for soil
fertilization has been widely practised in parts of Asia for centuries and more
recently sewage sludge from modern wastewater treatment plants has been
used as a soil conditioner or has been spread on land as an inexpensive means
of disposal (WHO, 1979). Today, even first world countries such as the United
States and Canada use sewage sludge as soil amendment (NRC, 1996).
One of the problems faced by the agricultural industry in South Africa is the
widespread degradation of the soils by erosion and nutrient depletion through
incorrect agricultural practices. Sewage sludge serves as a suitable inexpensive
alternative to fertilizers. Recycling of organic waste materials to be used for
agriculture is in line
with sustainable agriculture. Apart from nutrient recycling,
organic matter acts as a soil conditioner by improving the soil structure and
permeability, making heavy clay soils more friable and manageable (Easton,
1983). Demand for sludge for agricultural purposes appears to be on the
increase as South African farmers begin to recognize the importance of using
organic substances to improve soil properties (Korentajer, 1991).
Having recognized the benefits of sewage sludge and the widespread use of this
product, it is important to discuss the restrictions on using sewage sludge in
agricultural practice. Sewage sludge may contain toxic organic chemicals such
as pesticides, heavy metals including lead, cadmium and mercury (Purves, 1990)
and disease-causing pathogens (Straub et al., 1995).
1
University of Pretoria etd – Chale-Matsau, J R B (2005)
The subject of this study will be limited to pathogens. These pathogens originate
from humans who use the sewerage systems and who suffer from acute or latent
infections. Pathogens are excreted from infected individuals via faeces, urine,
secretions or excretions of the nose, pharynx and skin depending on the type of
infection, and reach the sewage treatment plants via sewers and sanitary
installations in homes (Strauch, 1991). The spectrum and quantity of pathogens
are extended by other sources connected to the system, including hospitals,
abattoirs, livestock markets and related activities (Strauch, 1991).
Most of the human enteric diseases are caused by bacteria of the family
Enterobacteriaceae, particularly E. coli and Salmonella spp. These organisms
are present in high numbers in sewage.
Biological wastewater treatment processes such as lagoons, trickling filters and
activated sludge treatment may substantially reduce the number of pathogens in
the wastewater. However, these processes do not completely remove or
inactivate pathogenic organisms as some of them are adsorbed to faecal
particles (Strauch, 1991). The resulting sewage sludge still contains sufficient
levels of pathogens to pose a public health and environmental concern (EPA,
1999).
1. 2 Motivation for Present Study
The South African sludge guidelines are presently being revised. The scientific
premises of the current guidelines have been evaluated. This evaluation revealed
that the pathogen limits used in the sludge guidelines were based on
international trends and experiences. It is therefore necessary to investigate the
appropriateness of the current guidelines for South African use.
However, very little information is available on the pathogen load in sludge and
the human health risk associated with sludge used in agricultural practices in
South Africa.
2
University of Pretoria etd – Chale-Matsau, J R B (2005)
1.3 Aim and Objectives
The aim of this research is to understand the behaviour and risks associated with
the agricultural use of sewage sludge in terms of pathogenic infections, so as to
adequately protect humans against sludge borne pathogens associated with the
agricultural application of sewage sludge.
This will be achieved by
•
Evaluating the risk to human health associated with the agricultural
application of inadequately disinfected sewage sludge, and
•
Recommending management practices to ensure that all spheres of the
population associated with the agricultural application/use of sewage
sludge are adequately protected against pathogenic infections.
The aim of the study will be addressed by:
•
Investigating the current microbiological quality of South African sewage
sludge from various wastewater treatment plants in South Africa.
•
Determining the microbial quality of sewage sludge prior to application to
soil.
•
Determining the persistence of microorganisms in soil following sludge
application.
•
Establishing the survival of pathogenic organisms using a high risk crop.
•
Using the research results of the above-mentioned experiments to
quantify the risk to human health associated with the agricultural
application of sewage sludge that has not been adequately disinfected
prior to application.
•
Developing a management framework based on the literature and results
from this research to adequately protect humans against sludge borne
pathogens associated with the agricultural application of sewage sludge.
3
University of Pretoria etd – Chale-Matsau, J R B (2005)
1.4 Approach
A countrywide survey will be performed to establish South African sludge quality
using sludge collected from Wastewater Treatment Plants.
Microbiological assessment in sludge dedicated for soil amendment will be
determined prior to using the sludge for planting. The crop chosen for the
purpose of this study is potato (Solanum tuberosum) (Recke et al., 1997). Potato
was chosen as it is a high risk crop for growing in sewage sludge treated soil
(WRC, 1997; EPA, 1999). Also the season was appropriate for growing potato.
Green house experiments coupled with advanced laboratory techniques will be
employed to establish if any pathogens persist in soil and potato. Knowledge
accrued from these experiments and from the risk assessment will then be used
to recommend management approaches for adequate protection of human
health.
4
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 2
Literature Review
2.1 Introduction
The use of human excreta for fertilizer, ranging from night soil application to
irrigation with sewage has been a world-wide practice for many years, especially
in highly populated countries such as China and India (Rudolfs et al., 1950). It is
especially advantageous because it recycles nutrients back to the land and can
be economically attractive (Zenz et al., 1976).
In South Africa sludge production is increasing rapidly, and at the same time the
soil condition has deteriorated markedly. As sludge contains high levels of
organic matter and nutrients (Hu et al., 1996), use of this product in agricultural
land could provide an alternative means of disposal, and also benefits the poor
soil quality of most of South Africa’s agricultural land. It is believed that when
treated properly, and provided certain industrial contaminants are restricted from
entering the sewage, the resultant sewage sludge can become a relatively
innocuous organic fertilizer and soil conditioner of significant value for growing
trees, grass and certain crops (WRC, 1997).
The beneficial use of sludge for soil amendment in South Africa was also recently
shown by Snyman and colleagues (1998). At present, sewage sludge is used for
crop growing but limited only to fenced areas to restrict access to unauthorized
persons as well as milk-, meat- and egg producing animals (WRC, 1997). Other
recommendations suggest that application may only be done with planting and
during the period subsequent to harvesting and prior to the next growing season.
Snyman and Van der Waals (2003) reported that South African farmers, noting
the increased crop production as a result of enhanced soil properties from
sewage sludge use, are in favour of using sewage sludge and show adherence
to the recommended dosage of 8 ton/ha as stipulated in the guidelines (WRC,
1997).
5
University of Pretoria etd – Chale-Matsau, J R B (2005)
Elsewhere, application of sewage sludge to deteriorated soil, resulted in
increased yields (Tester and Parr, 1983).
Consequently, municipal sewage
sludges are routinely utilized on agricultural lands in various parts of the world. In
Canada, it is becoming a common practice such that as much as 43% of the
produced sewage sludge is applied to land. By comparison, the United States
and Europe apply approximately 60% and 34% respectively of their sewage
sludge to agricultural land (EPA, 1999; Apedaile, 2001).
2.2 Metals and Toxic Organic Pollutants in Sludge
The composition of wastewater sludge may be highly variable depending on the
quantity and quality of contributions from industrial and domestic sources. The
types of constituents include among others, chlorinated hydrocarbons,
polynuclear aromatic hydrocarbons and metals (Brown et al., 1991).
Hyde
(1976) pointed out that heavy metals are retained in soils following sludge
application and can accumulate to the point at which they are toxic to plants.
Thus, due to their uptake by crops, they may also be toxic to humans and
animals. This observation was confirmed by Rost and colleagues (2001) who
recently reported that heavy metals have long lasting adverse effects on
biological functions in soil. The heavy metal of major concern, because of its
possible phytotoxicity and danger to the human food chain, is cadmium (Cd).
Other heavy metals of importance are copper (Cu), nickel (Ni) and zinc (Zn), and
they are also known to be phytotoxic (Hyde, 1976; Purves, 1990).
Organic compounds such as pesticides, polychlorinated biphenyls, halogenated
aliphatics, ethers and aromatic hydrocarbons are the products of industrial
wastewater which could land up in wastewater sludges (Korentajer, 1991;
Vorobieva et al., 1996; Kouloumbis et al., 2000). The concentration of these
compounds needs to be monitored and limited by implementing source
reduction.
6
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.3 Socio-economic Issues Regarding Sludge Use
Farmers and the food industry have expressed their concern that agricultural use
of untreated sludge may affect the safety of food products and the sustainability
of agricultural land, and may carry potential economic and liability risks (NRC,
1996). There is also concern that the use of contaminated sewage sludge for
crop production could negatively affect the export market. For fear of foodborne
illness, some countries may refuse importation of vegetables and foods produced
under such agricultural practices (Sobsey, 1996; Doyle, 2000).
There has been increased public scrutiny of the potential health and
environmental consequences of land spreading of sewage sludge. It appears
that once fear of pathogens, odours, nuisances and possible environmental
deterioration have been generated in a community, people have great difficulty in
accepting the risks, even if there aren’t any, of applying sewage sludge to
agricultural land (Hyde, 1976; Tauxe, 1997). Thus, it is essential that aesthetic
characteristics and matters affecting both long-term quality of the land and the
public health must be thoroughly understood before using sewage sludge on
farmland.
In spite of the increasing concerns, in their recent report to the United States
Environmental Protection Agency, the National Research Council pointed out
that there is no evidence that proper use of wastewater treatment sludge on land
has any detrimental effect on either the people working at the site, on the
population surrounding the land application site, or on people eating the crops
grown in the sludge-amended soil (NRC, 2002). Vesilind (2003) is of the opinion
that the aversion to sludge use emanates from the knowledge of its origin and
not necessarily from diseases linked to sludge use.
Kirby (2001) pointed out that exposure to potentially lethal pathogens is linked to
social factors such as class, education and income. Carneiro and his colleagues
(2002) have observed that less intense Ascaris infection came from affluent
7
University of Pretoria etd – Chale-Matsau, J R B (2005)
households with higher socio-economic profile.
In many African countries
including South Africa, a large percentage of the population live in poverty
(Parliamentary Bulletin, 1996), thus it can be expected that these households
would be intensely affected by contaminated crops.
The high incidence of
HIV/AIDS (Human Immunodeficiency Virus/ Acquired Immune Deficiency
Syndrome) infection in the country could translate into more pathogenic
infections due to their depressed immune systems, if such communities are
exposed to contaminated crops. South Africa is a comparatively large country,
covering 1,221,042 square kilometers and with an estimated population of about
40 million. It has been estimated that 14.2% of people in South Africa have been
infected with HIV/AIDS (Dorrington et al., 2002).
The routine surveillance
conducted by the Department of Health has shown that among pregnant women
attending public health clinics for antenatal care, the prevalence has increased
from less than 1% in 1990 to 26.5% in 2002 (Dorrington et al., 2002). Overall, it
is estimated that 23.3% of men and 23.5% of women are infected whereas the
prevalence amongst the male and female youth is 5.8% and 21.6% respectively
(Dorrington et al., 2002).
2.4 Microorganisms Encountered in Sewage Sludge
Infectious diseases are transmitted primarily through human and animal excreta,
particularly faeces. If there are active cases or carriers in the community, then
faecal contamination of water sources will result in the causative organisms
being present in water. Pathogens in domestic sewage are primarily associated
with insoluble solids. Many of these organisms become bound to solids following
wastewater treatment and are transferred to wastewater sludge (Bitton, 1994).
As the wastewater treatment processes concentrate these solids into sewage
sludge, the sewage sludge has higher quantities of pathogens than incoming
wastewater (EPA, 1999).
However, the transmission of pathogens can be
minimized by reducing the infectivity of sludges through effective treatment
processes (Smith, 1996).
8
University of Pretoria etd – Chale-Matsau, J R B (2005)
The actual species and quantity of pathogens present in sewage sludge from a
particular municipality depend on the health status of the local community and
may vary substantially at different times (EPA, 1999). The four major types of
human pathogenic organisms, namely bacteria, viruses, protozoa and helminths
may all be present in sludge. These organisms can cause infection or disease if
humans or even animals are exposed to sufficient levels. The infective dose,
that is, the number of pathogenic organism to which a human must be exposed
to become infected, varies depending on the organism and on the health status
of the exposed individual (EPA, 1999).
While some pathogens may cause
infections in a susceptible host by a single organism, others may require several
hundreds to be present before an infection can be initiated. Symptoms may vary
in severity from mild gastroenteritis to severe and sometimes fatal diarrhoea,
dysentery, hepatitis or typhoid depending on the type of pathogen and pathogen
load. Thus, when reclaimed water or sludge is used on fields producing food
crops, it is critical to protect public health.
In the sections that follow, the major bacterial, viral and parasitic organisms
found in wastewater sludge are described.
2.4.1 Bacteria
Wastewater normally contains many bacterial species, and strains (Vilanova et
al., 2002) that may end up in the wastewater sludge.
If such sludge is not
adequately treated and used in agricultural land, crop contamination may be
imminent. As Bubert and colleagues (1999) have pointed out, contamination of
food material does not only occur during food processing, but may also begin
with the production of raw food materials in the environment.
Faecal coliforms and enterococci have been used widely as faecal pollution
indicators (Vilanova et al., 2002). Both bacterial groups include several species.
For example, the genus Enterococcus contains 19 recognized species (Manero
and Blanch, 1999). Salmonella spp, Shigella spp, Campylobacter spp, Yersinia
9
University of Pretoria etd – Chale-Matsau, J R B (2005)
spp, Leptosporia spp and Escherichia coli are bacterial pathogens of primary
concern in sludge. Escherichia coli is particularly abundant in human and animal
faeces, where numbers may reach 109 g-1 of faeces (Bitton, 1994). The major
bacterial groups or species are tabulated in Table 2.1 and some of these (*) are
discussed in sections i to viii. Several case studies have been cited in these
sections.
These case studies do not necessarily detail outbreaks due to
wastewater sludge use, but are indicators of what the effects could be if the
pathogens manage to survive and infect a receptor, as a worst-case scenario.
Table 2.1 Bacterial pathogens to be expected in sewage sludge (Source:
EPA, 1999; Strauch, 1991)
Pathogen
Disease
Salmonella spp *
Salmonellosis (gastroenteritis)
Shigella spp *
Bacillary dysentery
Escherichia coli *
Urinary infection; diarrhoea
Yersinia enterocolitica *
Yersniosis (gastroenteritis)
Clostridium spp *
Gas gangrene
Leptospira spp
Leptospirosis
Mycobacterium spp
Tuberculosis and leprosy
Vibrio cholerae spp
Cholera
Staphylococcus spp
Osteomyelitis
Streptococcus spp
Rheumatic fever; glomerulonephritis
Klebsiella spp
Pneumonia; urinary tract infection
Enterobacter spp
Urinary tract infection
Serratia spp
Meningitis; endocarditis
Citrobacter spp
Neonatal meningitis
Proteus spp
Urinary tract infection
Providencia spp *
Urinary tract infection
Listeria monocytogenes *
Listeriosis
10
University of Pretoria etd – Chale-Matsau, J R B (2005)
i Escherichia coli
Escherichia coli is normally found in the gastrointestinal tract of humans and
other warm-blooded animals (Brooks et al., 1991) and is the most common
cause of foodborne illness. Foods that have been implicated with E. coli include
cheese, beef, fish, poultry, apple cider and lettuce (Reis et al., 1980; Kornacki
and Marth, 1982; Ackers et al., 1998).
Escherichia coli, depending on the infective strain, can cause a variety of
illnesses that include infantile diarrhoea, traveler’s diarrhoea, hemorrhagic colitis
(HC), hemolytic uremic syndrome (HUS) and thrombocytopenic purpura (TP)
(Pell, 1997; Penner, 1998).
Hemorrhagic colitis is a severe illness and is
characterized by bloody diarrhoea and severe abdominal cramps while HUS is
characterized by bloody diarrhoea followed by renal failure. Thrombocytopenic
purpura yield symptoms similar to those of HUS but the central nervous system
is also affected. Death often occurs in patients with HUS and TP (Pell, 1997).
Hemolytic uremic syndrome can be a serious complication in children and is a
leading cause of acute kidney failure (Penner, 1998).
ii Salmonella spp
Salmonellosis was normally associated with contamination of food of animal
origin, but in recent years, it has been indicated that Salmonella spp
contamination may also occur in foods of plant origin. For instance Salmonella
spp outbreaks have been associated with consumption of celery, watercress,
watermelon, lettuce, cabbage, tomatoes, potatoes and carrots (Wells and
Butterfield, 1997; Guo et al., 2000). These organisms have also been implicated
in infections due to wastewater spreading (Melloul and Hassani, 1999).
Salmonella spp are capable of surviving and multiplying in fruits and vegetables.
Asplund and Nurmi (1991) have demonstrated that tomatoes can provide a
favourable environment for growth of S. enteitidis, S. infantis and S. typhimurium
in spite of their low pH value, showing that the high acidity is not necessarily
11
University of Pretoria etd – Chale-Matsau, J R B (2005)
effective enough to inhibit Salmonella spp growth. Salmonella spp can grow and
multiply at temperatures of 22oC (Asplund and Nurmi, 1991) suggesting that
once produce has been contaminated, microorganisms may continue to grow on
the shelf in retail stores increasing the risk of infection.
Enteric fever is caused by the microorganism S. typhosa, in which the organism,
ingested along with food finds its way into the bloodstream. Another organism,
S. cholera-suis causes septicemia resulting in blood poisoning.
The S.
typhimurium and S. enteritidis cause gastroenteritis, an infection very commonly
associated with contaminated food. Symptoms of Salmonellosis include nausea,
vomiting, headache, chills, diarrhoea, fever and can even lead to reactive
arthritis. In most cases the disease is short-lived, but salmonellosis can be fatal
(Penner, 1998). Infants, once infected, frequently become long-term carriers and
cause family outbreaks (Burge and Marsh, 1978).
iii Listeria spp
Listeriosis is rare in non-pregnant healthy adults, however, adults with conditions
such as type 1 diabetes, cardiovascular disease, renal transplant, neoplasm,
alcoholism and AIDS are more susceptible (Penner, 1998). Due to its ability to
survive for long periods and its capability to grow at refrigerator temperature
(Penner, 1998) this organism poses a serious threat in regard to foodborne
illness.
Healthy animals can be asymptomatic carriers of L. monocytogenes
(Pell, 1997).
Listeria monocytogenes is a human and animal pathogen capable of causing
nausea, vomiting, headache, fever, and severe infections like septicemia,
encephalitis and meningitis, especially in immunocompromised individuals,
newborns and pregnant women where it can result in stillbirths. About 100 cells
of L. monocytogenes are sufficient to cause illness (Brooks et al., 1991). In the
USA this organism has a fatality rate of 20 – 40% (Penner, 1998).
12
University of Pretoria etd – Chale-Matsau, J R B (2005)
Several outbreaks have been associated with contaminated commercial
foodstuffs, such as vegetables, milk and meat products on which these bacteria
can multiply even at low temperatures (Bubert et al., 1999).
Both L.
monocytogenes and L. innocua have been isolated from various environmental
samples such as soil, vegetation and human and animal faeces (Bubert et al.,
1999).
iv Yersinia enterocolitica
Yersinia enterocolitica causes yersiniosis and is found in a variety of animals,
particularly pigs. It will grow at refrigerator temperatures, but grows best at room
temperature. Infection with this organism yields symptoms that range from a mild
gastroenteritis to sever conditions of polyarthritis and meningitis (Prescott et al.,
2002).
v Shigella spp
Shigellosis is caused by bacteria of the genus Shigella (Brooks et al., 1991).
This disease is characterized by diarrhoea, abdominal pain, vomiting and fever.
As few as 10 to 100 microorganisms are sufficient to cause an illness (Penner,
1998).
Shigella are readily killed by heat and do not survive well in acidic
environments (Prescott et al., 2002).
vi Clostridium spp
Clostridium botulinum produces a neurotoxin that cause botulism. After the toxin
is absorbed, it binds to nerve endings and causes vomiting and diarrhoea,
fatigue, dizziness and headache. Later there may follow constipation, double
vision, difficulty speaking and swallowing, involuntary muscles may become
paralyzed leading to cardiac and respiratory failure and eventually death.
(Penner, 1998). The C. botulinum spores are heat resistant (Brooks et al., 1991).
13
University of Pretoria etd – Chale-Matsau, J R B (2005)
Clostridium perfringens produces toxins that cause diarrhoea and severe
abdominal pain. However, death is uncommon. Although spores of this organism
are common in raw foods and they are heat resistant, large numbers of
vegetative cells of C. perfringes are necessary for an illness to occur (Penner,
1998).
vii Campylobacter jejuni
Campylobacter jejuni causes camphylobacteriosis characterized by cramps,
nausea, diarrhoea, headache and fever.
Onset of the disease following
consumption of contaminated food is within two to five days. Prolonged illness
may lead to complications such as meningitis, urinary tract infection and reactive
arthritis, but death occurs rarely (Penner, 1998). The high incidence of C. jejuni
infections in persons infected with the human immunodeficiency virus points to
the widespread transmission of low levels of this organism (Blaser, 1996).
Campylobacter cells survive for several weeks at temperatures even as low as 4
o
C (Waage et al., 1999). The infective dose of C. jejuni is very small, it has been
estimated that about 500 cells of this organism can cause human illness (Black
et al., 1988). Also, Campylobacter cells may enter a viable but non-culturable
state due to starvation and physical stress, making them even more difficult to
detect (Brooks et al., 1991).
viii Providencia spp
Providencia spp are members of the normal intestinal flora. They cause urinary
tract infection and are often resistant to antimicrobial therapy (Brooks et al.,
1991).
14
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.4.2 Persistence of Bacteria in Soil
The survival of microorganisms added to soil is influenced by a number of factors
that include, water-holding capacity of soil, temperature, rainfall, sunlight, organic
material in soil and the hydrogen ion (Rudolfs et al., 1950; deRopp, 1999).
Faecal coliforms can survive for several years under optimum conditions, and the
Salmonella spp may survive for a year in rich, moist organic soil (deRopp, 1999).
The survival period of Salmonella spp has been reported to be as long as
between 15 – 117 weeks in contaminated soil (Rudolfs et al., 1950; Jones,1980;
Strauch, 1991; Sidhu et al., 1999; Baloda et al., 2001). The L. monocytogenes
grows well in sewage and survives for long periods in soil (Strauch, 1991). Other
bacteria such as Streptococcus jaecelis, Clostridium botulinium, Clostridium
tetani, Clostridium perfringes and butyl-butyric Clostridia spp were found in small
numbers 7 months after sludge application (Hyde, 1976).
Campylobacters spp are not capable of proliferating in the environment, but may
remain dormant and survive in the environment for several weeks at low
temperatures (Waage et al., 1999). However, the infective dose is very small
which increases the risk of infection (Black et al., 1988).
One of the most important factors influencing the survival of pathogenic bacteria
in soil is competition with the existing soil microflora. In soils with low microbial
activity, the newly added microorganisms may persist for much longer (Bitton,
1994). Thus the application of large quantities of sludge to soil with low existing
microbial activity will increase the ability of the pathogens to persist in soil
environment and hence increase the potential risk for transfer of pathogens to
crops grown in the soil.
On the other hand, in biologically active soils,
microorganism numbers are rapidly reduced due to competition (Penner, 1998).
The soils in South Africa are typically biologically active, which could be
advantageous due to the fact that introduced microorganisms are rapidly out
15
University of Pretoria etd – Chale-Matsau, J R B (2005)
competed. However, as a result of high microbial activity, the organic material in
agricultural soil is low (Korentajer, 1991).
Microorganisms may move through the contaminated soil as a result of rainfall or
irrigation (Gerba et al., 1975). Gagliardi and Karns (2000) have indicated that if
soil pores do not become clogged, E. coli can travel below the top layers of soil
for more than two months. They also indicated that E.coli from manure applied
to soil could survive, replicate and move vertically in the soil (Gagliardi and Karns
2000).
While soil contaminated with sewage sludge could lead to crop
contamination, it has been indicated that water bodies such as groundwater,
storm-water and rivers could be contaminated following rainfall or irrigation as a
result of runoff from contaminated agricultural land (Lee and Jones-Lee, 1993;
Bilgrami and Kumar, 1998).
2.4.3 Viruses
Sludge from wastewater treatment may contain demonstrable numbers of viruses
even after anaerobic digestion (Damgaard-Larsen et al., 1977). Some of the
viruses that can be expected in sewage sludge are tabulated in Table 2.2.
Human enteric viruses are excreted in faeces, and can be shed in high numbers
(108 to 1010 particles per gram of faeces) by infected individuals (Abbaszadegan
et al., 1999). The persistence of enteroviruses in sludge and sludge-amended
soil was demonstrated by Damgaard-Larsen et al. (1977) and by Straub et al.
(1994). The virus of greatest potential concern appears to be Hepatitis A, a
disease with potential for long-term liver damage (Pahren et al., 1979).
16
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 2.2 Viruses that can be expected in sewage sludge (Sources: EPA,
1999; Strauch, 1991; Bofill-Mas et al., 2000)
Pathogen
Disease
Enteroviruses
Coxsackievirus A
Acute hemorrhagic conjunctivitis
Coxsackievirus B
Meningoencephalitis
Echovirus
Acute hemorrhagic conjunctivitis
Poliovirus
Poliomyelitis
Adenovirus
Respiratory and systemic infections
Reovirus
Acute respiratory infections
Hepatitis A virus
Infectious hepatitis
Rotavirus
Acute gastroenteritis
Astrovirus
Gastroenteritis
Calicivirus
Acute gastroenteritis
Coronavirus
Gastroenteritis
BK virus
Uretal stenosis and hemorrahgic colitis
JC virus
Multifocal leukoencephalopathy
Norwalk and Norwalk-like viruses
Acute gastroenteritis
Human polyomaviruses JC virus and BK virus were also indicated as being
present in urban sewage obtained from widely divergent geographical areas in
Europe and Africa (Bofill-Mas et al., 2000).
The JC virus is aetiologically
associated with a fatal demyelinating disease known as progressive multifocal
leukoencephalopathy, which has emerged as a frequent complication of AIDS in
HIV infected individuals.
Infection with BK virus has been associated with
diseases of the urinary tract including hemorrhagic cystitis and ureteral stenosis
(Bofill-Mas et al., 2000).
Virus inactivation under natural conditions is a slow process (Damgaard-Larsen
et al., 1977). Viruses may become eluted and travel through the soil (DamgaardLarsen et al., 1977) which includes both vertical and lateral migration (Straub,
17
University of Pretoria etd – Chale-Matsau, J R B (2005)
1995). For instance, other enteroviruses such as the coxsackie B3 virus have
been isolated 18m below the soil surface after wastewater recharge (Straub et
al., 1995). Rainfall and irrigation events may contribute to viral transport (Straub
et al., 1995). Viruses readily adsorp to soil particles, and this has been reported
to prolong their survival (WHO, 1979). However these viruses remain as
infectious to humans as free viruses.
Viruses can survive for up to six months in cold weather and for three months in
warm weather. Enteric viruses can survive up to 170 days in loamy and sandy
soil. Poliomyelitis virus has been detected in soil irrigated with infected sewage
sludge and effluent after 96 days in winter and 11 days in summer in the UK, and
on the surface of mature vegetables 23 days after irrigation had ceased (Tierney
et al., 1977; WHO, 1979). Viral survival on crops may be shorter than in the soil
if viruses on crops surfaces are directly exposed to detrimental environmental
factors such as sunlight and desiccation (Pahren et al., 1979; WHO, 1979). The
warm climate in some regions of South Africa may reduce the survival of these
viruses. However, more prolonged survival can be expected in the moist or more
protected parts of plants, such as within the folds of leafy vegetables, in deep
stem areas and on rough cracked surfaces of edible roots. It is also likely that
viruses can penetrate damaged roots and under certain conditions enter the
stem and leafy parts of edible plants (Pahren et al., 1979).
Once crops are harvested, enteric viruses can survive for prolonged periods
during commercial and household storage at low temperature.
The risk of
human infection associated with virus-contaminated crops is greatest in the case
of fruits and vegetables consumed raw (WHO, 1979).
2.4.4 Parasites
Parasites are a group of foodborne pathogens that have received relatively little
attention. Parasites that are usually encountered in sludge are indicated in Table
2.3, and some of these (*) are briefly discussed.
18
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 2.3 Parasites that can be expected in sewage sludge (EPA, 1999;
Strauch, 1991)
Pathogen
Disease
Entamoeba histolytica
Amebiasis
Giardia lamblia *
Giardiasis
Toxoplasma gondii
Toxoplasmosis
Sarcocystis spp
Intestinal infection
Taenia spp *
Taeniasis
Diphyllobothrium latum
Pernicious anaemia
Echinococcus granulosus
Echinococcosis
Ascaris spp *
Ascariasis
Toxocara spp
Pneumonic symptoms
Trichuris trichiura
Trichuriasis
Toxoplasma gondii
Toxoplasmosis
Cryptosporidium *
Cryptosporidiosis
Some of the common types of parasites that have been detected in fresh fruits
and vegetables include Giardia lamblia, Entamoeba histolytica and Ascaris spp.
(Brackett, 1987). As little as 10 or fewer Giardia cysts are sufficient to cause
illness (Brooks et al., 1991). Ayres and colleagues (1992) recovered viable
Ascaris eggs from lettuce irrigated with raw sewage, while Gaspard and
Scwartzbrod (1993) recovered viable Ascaris from both tomatoes and lettuce
following raw sewage irrigation. It has also been demonstrated that farm workers
may be infected with enteric parasites as a result of occupational exposure (Clark
et al.,1984). It should be noted that these incidents were associated with the
irrigation of raw sewage and not wastewater sludge. However, it does give an
indication of potential risk.
The parasites most often found in sludge are Ascaris species such as A.
lumbricoides (human intestinal roundworm) and A. suum (pig’s roundworm) as
19
University of Pretoria etd – Chale-Matsau, J R B (2005)
well as some Toxocara and Trichuris species (Bitton, 1994; Gaspard et al.,
1995).
Ascaris eggs and certain larval stages of trichostrongylids can survive for over a
year in soil that has been irrigated with sewage sludge (Strauch, 1991), and the
eggs of Cryptosporidium parvum and Taenia saginata are known to survive in
sewage for more than 12 months (NRC, 1996). Cryptosporidium species and
Giardia species pose a serious threat to human health as these organisms are
difficult to inactivate with disinfectants and their infective doses in humans are
very low (Finch and Belosevic, 2001).
Protozoan parasites, such as Giardia spp have been found in sludge in Western
Australia where they remain the most common cause of enteric disease (Hu et
al., 1996). The most noxious are the Ascaris eggs and coccidial oocysts as they
have high resistance (Pahren et al., 1979; Gaspard and Schwartzbrod, 1993).
Helminths larvae are usually killed by composting, but often remain viable in
slurry during storage (Shuval et al., 1984).
Also encountered in sludge are the organisms of the genus Cryptosporidium
(Kuckzynska and Shelton, 1999; EPA, 1999). Of the Cryptosporidium species,
C. parvum is the agent of clinical cryptosporidiosis in humans and livestock. The
C.parvum oocysts are shed by infected mammals and are known to be resistant
to standard disinfectants (Champliaud et al., 1998).
Waterborne C. parvum
oocysts may remain viable for several months (Kuczynska and Shelton, 1999).
Table 2.4 indicates the concentrations of pathogens as indicated by other
countries.
20
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 2.4 Concentrations of pathogens in sludge from other countries
(Jimenez et al., 2002)
Pathogen
Fecal coliforms (MPN/gTS)
E.coli (PFU/gTS)
Ascaris/gTS
Concentration
Country
3.6 X 104 – 1.4 X 106
United Kingdom
2.3 X 107 – 9.3 X 1010
Mexico
2.0 X 107
United States
1.0 X 106 – 1.9 X 106
Mexico
1.3 X 105
United States
2.40 – 8.98
United Kingdom
66 – 136
Mexico
1.4 – 9.7
United States
0.60 – 2.4
France
2.5 Disinfecting Treatment Processes
Previous sections provided detailed discussions on the occurrence of
microorganisms in sludge and their potential presence in crops if inadequately
treated sludge is used for land application. However, the transmission of
pathogens can be minimized by reducing the infectivity of sludges through
effective treatment processes (Smith, 1996). Various techniques are used to
eliminate or reduce the number of microorganisms to levels that do not threaten
human health (EPA, 1999).
Many of these treatment processes are applied either to stabilize the sludge, i.e
reduce its vector attraction potential and odour or render the sludge easier to
handle, store and transport by reducing the volume or drying the wastewater
sludge. Additional treatment technologies need to be employed to reduce the
viable content. Some of these techniques recommended in the US Part 503 rule
are indicated in Table 2.5.
If effective treatment is not available, long term storage could be used to
accelerate inactivation and thus reduce the number of infective species before
21
University of Pretoria etd – Chale-Matsau, J R B (2005)
sludge is spread onto soil (Jenkins et al., 1999). Jenkins and colleagues (1999)
warned that although storing prior to spreading could be an effective
management practice for reducing infective oocyst load, spreading of sludge
during the cold season may have the opposite effect by sustaining the survival of
C. parvum oocysts and positioning them for transport in surface runoff (Jenkins
et al.,1999).
22
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 2.5 Techniques listed in the 40 CFR Part 503 and their effectiveness
in removing pathogens (EPA, 1999)
R = Reduction, E = Elimination, 3 = effective in pathogen reduction/elimination
and 2 = not effective in pathogen reduction /elimination
Effectiveness in Eliminating
Technique
Description
Pathogens
Viruses
R
Aerobic
Sewage sludge is agitated
Digestion
with air or oxygen to maintain
E
Bacteria
R
Parasites
E
R
E
3
2
3
2
2
2
3
2
3
2
2
2
3
2
3
2
2
2
3
2
3
2
3
2
3
2
3
2
2
2
3
2
3
3
3
2
aerobic conditions
Air Drying
Sewage sludge is dried on
sand beds or on paved or
unpaved basins. The sewage
sludge dries for a minimum
duration of 3 months
Anaerobic
Sewage sludge is treated in
digestion
the absence of air at a specific
temperature. The values of
the temperature shall be
o
between 15 days at 35 C and
o
60 days at 20 C
Composting
Using either the within-vessel,
static aerated pile, or widow
composting methods. The
temperature of sewage sludge
o
is raised to 40 C or higher
and remains at 40 oC or higher
for 5 days. Fours in the 5 day
period, the temperature in the
o
compost pile exceeds 55 C
Lime
Sufficient lime is added to the
Stabilization
sewage sludge to raise the pH
of the sewage sludge to 12 for
2 hrs.
Thermal
Sewage sludge is heated to a
Treatment
o
temperature of 180 C or
higher for 30 minutes
22
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.6 Treatment and Sewage Sludge Classification in South Africa
Snyman and colleagues (2003) documented the treatment technologies
employed by South African wastewater treatment plants. According to this study,
57% of the sludge that is produced employs anaerobic digestion of primary and
humus sludge (Snyman et al., 2003). The sludge types generated from these
plants are presented in figure 2.1.
Activated Sludge
20%
Anaerobic Digestion
57%
Blended sludge
12%
Petro sludge
2%
Aerobic digestion
1%
Oxidation Dams
0.3%
Figure 2.1 Sludge types produced by the wastewater treatment plants
surveyed in South Africa on a mass percent basis. The blended sludge
represents primary and activated sludge blended before or after digestion
(Snyman et al., 2003).
Figure 2.2 illustrates the tertiary and additional stabilisation technologies
employed by the wastewater treatment plants surveyed in South Africa. The
majority (74% mass) of the sludge producing treatment plants surveyed do not
treat the sludge further than the traditional anaerobic digestion and activated
sludge treatment. Composting is used by both metropolitan city councils and
plants in smaller town councils while pelletisation is only employed by large
metropolitan councils (Snyman et al., 2003). Aerobic digestion is employed as an
23
University of Pretoria etd – Chale-Matsau, J R B (2005)
additional treatment method after anaerobic digestion in one major site (Snyman
et al., 2003).
Aerobic digestion
2%
Composting
19%
None
74%
Pellets
4%
Figure 2.2 The tertiary and additional stabilisation technologies employed
by the wastewater treatment plants surveyed in South Africa on a mass
percent basis (Snyman et al., 2003).
The sewage sludge produced from treatment plants in South Africa is used for a
number of activities, including application onto golf courses and use by
municipalities for lawn cultivation, while some is collected by farmers for
agricultural use. The disposal and beneficial use of sewage sludge in South
Africa are summarized in figure 2.3.
25
University of Pretoria etd – Chale-Matsau, J R B (2005)
Sludge Dams
0.4%
Contractor
10%
Golf course
3%
Landfill
2%
Compost
2%
Municipal Gardens
21%
Stockpile
11%
Farmers
10%
Instant Lawn
12%
Land Application
12%
Sold
17%
Other
75%
Figure 2.3 the major disposal methods employed by the wastewater
treatment plants surveyed in South Africa on a mass percent basis
(Snyman et al., 2003).
Table 2.6 summarizes the classification of sewage sludge indicated in the South
African sludge guidelines. The South African guidelines classify sludge at three
levels (Types A, B and C) and a fourth category (Type D) that stipulates ceiling
limits for pollutants is added. Although the hygienic quality of Type D is similar to
Type C, the Type D sludge is produced for unrestricted use on land at maximum
application of 8 tonnes per hectare per year, the levels of metals and inorganic
content are limited to acceptable low levels (WRC, 1997).
26
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 2.6 Classification of Sewage Sludge to be used or disposed off on
Land (WRC, 1997)
Sewage Sludge
Treatment
Characteristics-Quality of Sewage sludge
Type A Sludge
Cold digested sludge
Usually unstable and can cause odour nuisances and
Septic tank sludge
fly-breeding
Oxidation tank sludge
Contains pathogenic organisms
Variable metal and inorganic content
Type B Sludge
Anaerobic digested
Fully or partially stabilized – should not cause significant
sludge
odour nuisance or fly-breeding
Surplus activated
Contains pathogenic organisms
sludge
Variable metal inorganic content
Humus tank sludge
Type C Sludge
Pasteurised sludge
Certified to comply with the following quality
Heat treated sludge
requirement:
Lime-stabilised
Stabilized – should not cause odour nuisances or fly-
sludge
breeding
Composted sludge
Contains no viable Ascaris ova per 10 gram of dry
Irradiated sludge
sludge
Maximum 0 Salmonella organisms per 10 gram dry
sludge
Maximum 1000 Faecal coliform per 10 gram dry sludge,
immedialtely after treatment (disinfection/sterilization)
Variable metal and inorganic content
Type D Sludge
Pasteurised sludge
Certified to comply with the following quality
Heat-treated sludge
requirement:
Lime-stabilised
Stabilized – should not cause odour nuisances or fly-
sludge
breeding
Composted sludge
Contains no viable Ascaris ova per 10 gram of dry
Irradiated sludge
sludge
Maximum 0 Salmonella organisms per 10 gram dry
sludge
Maximum 1000 Faecal coliform per 10 gram dry sludge,
immedialtely after treatment (disinfection/sterilization)
Has specific limits for metal and inorganic content
(summarized in WRC, 1997)
Product must be registered in terms of Act 36 of 1947 if
used for agricultural activities
27
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.7 Resistance of Microorganisms to Disinfection
The previous section discussed disinfecting techniques employed by wastewater
treatment plants to reduce or eliminate the numbers of infective species. If the
sewage sludge used is not adequately treated, there is potential for crop
contamination.
Studies have shown that once fruits and vegetables have been contaminated, it
may be difficult to disinfect them (Maxy, 1982; Takeuchi et al., 2000; Wachtel et
al., 2002a; Wachtel et al., 2002b). Some microorganism such as E. coli show
preferential attachment to the interior of damaged fruits and vegetables than on
the surface (Takeuchi et al., 2000) as the juice within the vegetable provides
good growth medium (Maxy, 1982). Itoh and coworkers (1998) found that E. coli
was internalized when radish sprouts were produced from contaminated seeds
and therefore would be protected from surface decontamination treatment. E.
coli is capable of attachment to the interior of stomatal pores (Seo and Frank,
1999; Takeuchi and Frank, 2000; Takeuchi and Frank, 2001) and has a tendency
to form aggregate associations (Wachtel et al., 2002a). These attachment sites
and aggregation tendencies may cause bacterial resistance to physical methods
of surface disinfection as well as chemical treatment such as chlorination
(Wachtel et al., 2002b).
2.8 Protecting the Public and Environment through Regulatory Management
Most countries adopt a similar approach to protect the public from infection due
to pathogens originating from wastewater sludge. The use of wastewater sludge
is regulated and these regulations stipulate how the sludge should be disinfected
and/or how to minimize the chance of infection through prescribed management
practices. In the United States, the use and disposal of treated sewage sludge is
regulated under CFR Part 503 (EPA, 1999).
The regulation protects public health and the environment through requirements
designed to reduce the potential for contact with disease-bearing pathogens in
28
University of Pretoria etd – Chale-Matsau, J R B (2005)
sewage sludge applied to the land or placed. These requirements are divided
into:
•
Requirements designed to control and reduce pathogens in treated
sewage sludge and
•
Requirements designed to reduce the ability of the treated sewage sludge
to attract vectors (insects and other living organisms that can transport
sewage sludge pathogens)
It includes both performance and technology-based requirements. Wastewater
plants have the freedom to modify conditions and combine processes with each
other to meet the requirements.
At present in South Africa humans and the environment are protected under the
National Water Act 36 of 1998 (NWA), National Environmental Management Act
107 of 1998 (NEMA), Water Services Act 108 of 1997(WSA), the Constitution of
the Republic of South Africa (Act 108 of 1996) and the Health Act 63 of 1977.
The Department of Water Affairs and Forestry is the custodian of water
resources in South Africa. The guidelines for sewage sludge classification and
application are summarized in a document on permissible utilization of sewage
sludge (WRC, 1997; WRC, 2002). If the sludge reuse or disposal method does
not comply with the requirements detailed for the applicable classification its
reuse or disposal requires permission, which could be in a form of a licence or
permit (WRC, 2002).
In South Africa, there aren’t any specified restricted techniques for sludge
treatment, but the chosen technologies need to yield the sludge quality as
required in the guidelines (WRC, 1997).
29
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.9 Public Perception
The benefits of sewage sludge are well understood by the scientific community,
and through consultation, most governments around the world recognize the
benefits of using sludge in crop production. It is for this reason that a number of
countries have since engaged in utilizing sewage for land application purposes.
Despite the advancements in sludge use in agriculture, the main recipients of
these services have often been neglected. This often led to fear and rejection of
sewage sludge among some members of the public as a result of misinformation
due to media coverage (Sunday Times, 2003). Due to lack of scientific
knowledge, the public will generally reject any association with a product or
service if it is linked to odour or discolouration (Small Wright, 2002). Tyson
(2002) reported that if sewage sludge did not smell, the public probably would not
complain.
In a small preliminary survey done in South Africa, it has emerged that only a
small percentage (39%) of low income earners were aware of what sewage
sludge was (Snyman and Van der Waals, 2003). Snyman and Van der Waals
(2003) also noted that the respondents did not understand the risks associated
with using sewage sludge for agricultural soil amendment. Of the respondents
from a higher income bracket, 79% were found to have knowledge of sewage
sludge and its potential benefits. The majority of the respondents from this group
also expressed their willingness to purchase vegetables from a sewage sludge
fertilized farm, with 45% prepared to consume vegetables grown on sewage
sludge (Snyman and Van der Waals, 2003). It appears from this survey that if
members of the general public are informed of the benefits of sludge, reception
of the use of sewage sludge might increase in the future. It is thus the
responsibility of the sludge producers together with the governments to introduce
mechanisms of educating the public of sewage sludge and its use in agriculture.
30
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.10 Assessing Human Risk Exposure
The sections preceding indicate that many wastewater plants generate sludges
that still contain pathogens. However, these sludges are still used in agricultural
practices. The question to address therefore is “What is the risk associated with
this practice?”
If the risk of using such sludge is unacceptable, what
management practices should be adapted to reduce this risk to an acceptable
level?
While complete elimination of pathogens from sludge is ideal, it has been
indicated that if the numbers of pathogens in sludge are reduced to an
acceptable level, the use of such sludge in agricultural land does not appear to
result in unacceptable risk to human health (Apedaile, 2001; Tanner et al., 2003).
According to Vesilind (2003), coming into contact with small doses of pathogens
is the “sufficient challenge” our bodies need to stay healthy as our enhanced
health comes not from zero exposure, but from a sufficient exposure to
pathogens. Although this is true for healthy individuals, this could be different for
the South African population, as a large percentage of the population is HIV
positive and therefore immunocompromised (Dorrington et al., 2002).
One of the concerns often raised regarding sludge application is the emission of
pathogenic aerosols during land application (Pillai et al., 1996). The risk of
release rises as the pathogenic content in sludge increases. Raw sludge from
municipal sewage would be more likely to release airborne pathogens than those
that have been treated to reduce the pathogens (Straub et al., 1993). Tanner
and colleagues (2003) evaluated the potential for bio-aerosols from sludge
application, and concluded that the risk of adverse public health effects from bioaerosols following land applied sludge is low.
Forcier (2002) indicated that
although quantities of bio-aerosols could be released during storage, loading and
land application, they are diluted and scattered through atmospheric dispersion in
ambient air. The survival of and the potential for infection from these organisms
are lessened by the natural processes of attenuation such as ultra-violet radiation
31
University of Pretoria etd – Chale-Matsau, J R B (2005)
and desiccation (Forcier, 2002). Bio-aerosol emissions are also lessened when
applied sludge is subsequently incorporated into the soil (Straub et al., 1993). It
appears that the methods used for sludge land application do not result in
airborne release of biological agents to the same extent as in wastewater
treatment facilities (Apedaile, 2001).
Tools exist to measure the risk to human health associated with the use of
sewage sludge that contains pathogens in agricultural practices. The following
section details one of the tools used in this thesis.
2.10 .1 Health Risk Assessment
The health risk assessment provides a means to estimate the probability of
adverse effects associated with measured or estimated levels of the hazardous
agents, and a tool for predicting the extent of potential or probable health effects.
The protocol was originally developed for carcinogen assessments. However,
current trends favour the application of similar procedure to establish the risk of
microbiological hazards. The process as defined by the US EPA, is comprised of
four distinguishable but interacting phases, namely:
-
Hazard identification;
-
Exposure assessment;
-
Dose-response assessment and
-
Risk characterisation (Zwietering and van Gerwen, 2001)
The interrelation of these phases is depicted in Figure 2.4.
32
University of Pretoria etd – Chale-Matsau, J R B (2005)
Hazard Identification
Dose-Response Assessment
Exposure Assessment
Risk Characterisation
Figure 2.4 The interrelation of the risk assessment phases (Genthe 1998).
i Hazard Identification
This involves the identification of biological, chemical and physical agents
capable of causing adverse health effects and that may be present in a particular
food or group of foods (Rocourt et al., 2001). Once the health hazard has been
identified, the remainder of the process encompasses the description of the
properties of the hazardous agent and the identification of both acute and chronic
health effects (Genthe, 1998).
ii Hazard Characterisation
This involves the qualitative and or quantitative evaluation of the nature of the
adverse health effects associated with the hazard present in food. It provides
description of the severity and duration of adverse effects that may result from
ingestion of a microorganism in food. This involves a dose response assessment
by establishment of a relationship between the dose of an agent and the rate of
infection. Dose response assessment is considered a key ingredient of
quantitative risk assessment as it is supposed to provide the link between
exposure to a hazardous agent and the probability of ensuing health effects
(Teunis and Havelaar, 2000).
Some microorganisms when present at sufficient levels are capable of causing
disease, while others may produce toxins that contribute to the development of a
33
University of Pretoria etd – Chale-Matsau, J R B (2005)
disease (Brooks et al., 1991). Toxins produced by bacteria are generally
classified into two groups, exotoxins and endotoxins. Exotoxins are excreted by
living cells, while endotoxins are released on bacterial death (Brooks et al.,
1991).
iii Exposure Assessment
This involves the qualitative and or quantitative evaluation of the likely intake of
biological, chemical and physical agents via food, as well as exposure from other
sources if relevant (Rocourt et al., 2001). It is usually defined as a process of
measuring or estimating the intensity, frequency and duration of human exposure
to a contaminant. The task of exposure assessment is to provide the actual
exposure conditions required to predict risk, and to identify and predict the effects
of the proposed control options (Genthe, 1998).
iv Risk characterisation:
This involves the qualitative and or quantitative estimation, including attendant
uncertainties of the probability of occurrence and severity of known or potential
adverse health effects in a given population based on hazard identification,
hazard characterization and exposure assessment (Rocourt et al., 2001). Risk
characterisation has been defined as the process of calculating the incidence of
the health effect under the conditions of exposure described in exposure
assessment.
A major component of risk assessment is an evaluation of all
assumptions used and all sources of uncertainty (Genthe, 1998).
In risk
characterisation all results of the former steps are integrated, bringing together all
inaccuracies from the former steps (Zwietering and van Gerwen, 2000). Thus
risk characterization is defined as the process of estimating the likelihood or
probability of experiencing the adverse effects of an identified hazard, the impact
or consequences of those effects and describing the attendant uncertainty of the
estimates.
34
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.11 Factors Affecting Management of Sewage Sludge Use in South Africa
South Africa has unique factors that could influence management of land
application of sewage sludge. These factors include population density, high
incidence of HIV/AIDS, unique climatic conditions and soil quality, amongst
others. A detailed description of these factors will be provided in later sections to
indicate how they influence management of sludge use in South Africa.
2.12 Conclusion
Sewage sludge could be used beneficially in agricultural practices, especially in
South Africa’s carbon depleted soils. It appears there are vast agronomic and
economic benefits to sludge use, particularly as the cost of fertilizers are on the
increase.
However, pathogens do occur in a large percentage in what is regarded as
sewage sludge ready for agricultural use. In South Africa, little information is
available on the risks associated with using sewage sludge that has not been
disinfected.
International authors have investigated and quantified these risks. As a result of
the factors that are unique to South Africa, it would not be appropriate to adopt
work from other countries. These factors justify an investigation to assess the
risks associated with the use of pathogen rich sewage sludge in agricultural
practices.
A high risk crop was chosen to illustrate a worst case scenario. It was therefore
decided to investigate the prevalence of microorganisms in a crop grown in
sewage sludge amended soil. A risk assessment will provide a means of
estimating the probability of adverse effects associated with measured or
estimated levels of hazardous agents, and a tool for predicting the extent of
potential health effects.
35
University of Pretoria etd – Chale-Matsau, J R B (2005)
Based on our understanding and findings a functional management plan for
sewage sludge application to agricultural land can be formulated.
36
University of Pretoria etd – Chale-Matsau, J R B (2005)
2.13 References
Abbaszadegan, M., Stewart, P. and Lechevallier, M. 1999. A Strategy for
detection of viruses in groundwater by PCR. Applied and Environmental
Microbiology. 65(2). 444 - 449
Ackers, M-L., Mahon, B.E., Leahy, E., Goode, B., Damrow, T., Hayes, P.S., Bibb,
W.F., Rice, D.H., Barett, T.J., Hutwagner, L., Griffin, P.M. and Slutsker, L. 1998.
An Outbreak of Escherichia coli O157:H7 Infections Associated with Leaf Lettuce
Consumption. The Journal of Infectious Diseases. 177. 1588-1593
Apedaile, E. 2001. A Perspective on Biosolids Management. The Canadian
Journal of Infectious Diseases. 12(4)
http//www.pulsus.com/Infdis/12_04/aped_ed.htm
Asplund, K. and Nurmi, E. 1991. The Growth of Salmonellae in Tomatoes.
International Journal of Food Microbiology. 13. 177-182
Ayres, R.M., Stott, R., Lee, D.L., Mara, D.D. and Silva, S.A. 1992. Contamination
of Lettuce with Nematode Eggs by Spray Irrigation with Treated and Untreated
Wastewater. Water Science and Technology. 26(7-8) 1615-1623
Baloda, S.B., Christensen, L. and Trajcevska, S. 2001. Persistence of a
Salmonella enterica Serovar Typhimurium DT12 Clone in a piggery and in
Agricultural Soil Amended with Salmonella-Contaminated Slurry. Applied and
Environmental Microbiology. 67(6). 2859-2862
Bilgrami, K.S. and Kumar, S. 1998. Bacterial Contamination in Water of the River
Ganga and its Risk to Human Health. International Journal of Environmental
Health Research. 8. 5-13
Bitton, G. 1994. Wastewater Microbiology. Wiley-Liss, New York. 478pp
37
University of Pretoria etd – Chale-Matsau, J R B (2005)
Bofill-Mas, S., Pina, S. and Girones, R. 2000. Documenting the Epidemiologic
Patterns of Polyomaviruses in Human Populations by Studying their Presence in
Urban Sewage. Applied and Environmental Microbiology. 66(1). 238 - 245
Black, R.E., Levine, M.M., Clement, M.L., Hughes, T.P. and Blaser, M.J. 1988.
Experimental Campylobacter jejuni Infection in Humans. Journal of Infectious
Diseases. 157. 472-479
Blaser, M.J. 1996. How Safe is Our Food? The New England Journal of
Medicine. 334(20). 1324-1325
Brackett, R.E. 1987. Microbiological Consequences of Minimally Processed
Fruits and vegetables. Journal of Food Quality. 10. 195-206
Brooks, G.F., Butel, J.S. and Ornston, L.N. 1991. Medical Microbiology. 9th
Edition. New York. 488 pp
Brown, K.W., Thomas, J.C. and Donnelley, K.C. 1991. Bacterial Mutagenicity of
Municipal Sewage Sludge. Journal of Environmental Science and Health A26(3).
395-413
Bubert, A., Hein, I., Rauch, M., Lehner, A., Yoon, B., Goebel, W. and Wagner, M.
1999. Detection and Differentiation of Listeria spp. By a Single Reaction Based
on Multiplex PCR. Applied and Environmental Microbiology. 65(10). 4688 - 4692
Burge, W.D. and Marsh, P.B. 1978. Infectious Disease Hazards on Land
spreading Sewage Wastes. Journal of Environmental Quality. 7(1) 1-9
Carneiro, F.F., Cifuentes, E., Tellez-Rojo, M.M. and Romieu, I. 2002. The Risk of
Ascaris lumbricoides Infection in Children as an Environmental Health Indicator
to Guide Preventive Activities in Caparao and Alto Caparao, Brazil. Bulletin of the
World Health Organization. 80(1). 40-46
38
University of Pretoria etd – Chale-Matsau, J R B (2005)
Champliaud, D., Gobet, P., Naciri, M., Vagner, O., Lopez, J., Buisson, J.C.,
Varga, I., Harly, G., Mancassola, R. and Bonnin, A. 1998. Failure to Differentiate
Cryptosporidium parvum from C. meleangridis Based on PCR Amplification of
Eight DNA Sequences. Applied and Environmental Microbiology. 64(4). 1454 1458
Clark, C.S., Linnemann, C.C., Clark, J.G. and Gartside, P.S. 1984. Enteric
Parasites
in
Workers
Occupationally
Exposed
to
Sewage.
Journal
of
Occupational Medicine. 26(4). 273 - 275
Damgaard-Larsen, S., Jensen, K.O., Lund, E. and Nissen, B. 1977. Survival and
Movement of Enterovirus in Connection with Land Disposal of Sludges. Water
Research. 11. 503 – 508
DeRopp, 1999. Worms and Disease. In: Humanure Handbook. Jenkins, J (Ed.)
Jenkins Publishing, PA. www.weblife.org/humanure/chapter7.html
Dorrington, R., Bradshaw, D. and Budlender, D. 2002. HIV/AIDS Profile in the
Provinces of South Africa. Indicators for 2002. Medical Research Council, South
Africa. 31pp
Doyle, M.P. 2000. Reducing Foodborne Disease: What Are the Priorities?
Nutrition. 16(7/8). 647-649
Easton, J.S. 1983. Utilisation and Effects of Anaerobically Digested Sludge on a
Red Sandy Soil of Natal. Water SA. 9(2). 71 - 78
EPA, 1999. Environmental Regulations and Technology. Control of pathogens
and vector attraction in sewage sludge. U.S. Environmental Protection Agency.
EPA/625/R-92-013. 111pp
39
University of Pretoria etd – Chale-Matsau, J R B (2005)
Finch, G.R. and Belosevic, M. 2001 Controlling Giardia spp. and Cryptosporidium
spp. in drinking water by microbial reduction processes. Canadian Journal of Civil
Engineering. 28(Suppl. 1). 67-80
Forcier, F. 2002. Biosolids and Bioaerosols: The Current Situation. Biosolids and
Bioaerosols Solinov. Quebec Ministry of Environment. 22pp
Gagliardi, J.V. and Karns, J.S. 2000. Leaching of Escherichia coli O157:H7 in
Diverse Soils Under Various Agricultural Management Practices. Applied and
Environmental Microbiology. 66(3). 877-883
Gaspard, P. and Schwartzbrod, J. 1993. Determination of the Parasitic
Contamination of Irrigated Vegetables. Water Science and Technology. 27(7-8).
295-302
Gaspard, P. G., Wiart, J. & Schwartzbrod, J. 1995. Urban sludge reuse in
agriculture:
Waste
treatment
and
parasitological
risk.
Bioresearch
and
Technology. 52: 37-40
Genthe, B. 1998. Specialist Study on the Potential Health Impacts of the
Proposed wastewater treatment facility on the West Bank of East London.
Environmentek, CSIR. 20pp
Gerba, C.P., Wallis, C. and Melnick, J.L. 1975. Fate of Wastewater Bacteria and
Viruses in Soil. Journal of Irrigation and Drainage Engineering. 101. 157-174
Guo, X., Chen, J., Beuchat, L.R. and Brackett, R.E. 2000. PCR Detection of
Salmonella enterica Serotype Montevideo in and on Raw Tomatoes Using
Primers Derived from hilA. Applied and Environmental Microbiology. 66(12).
5248 – 5252
Hyde, H.C. 1976. Utilization of Wastewater Sludge for Agricultural Soil
Enrichment. Journal of Water Pollution Control Federation. 48(1). 77 - 90
40
University of Pretoria etd – Chale-Matsau, J R B (2005)
Hu, C.J., Gibbs, R.A., Mort, N.R., Hofstede, H.T., Ho, G.E. and Unkovich, I.
1996. Giardia and Its Implications for Sludge Disposal. Water Science and
Technology. 34(7-8). 179-186
Itoh, Y., Sugita-Konoshi, Y., Kasuga, F., Lwaki, M., Hara-Kudo, Y., Saito, N.,
Noguchi, Y., Konuma, H. and Kumagai, S. 1998. Enterohemorrhagic Escherichia
coli
O157:H7
Present
in
Radish
Sprouts.
Applied
and
Environmental
Microbiology. 64(4). 1532-1535
Jimenez, B., Maya, C., Sanchez, E., Romero, A., Lira, L. and Barrios J.A. 2002.
Comparison of the Quantity and Quality of the Microbiological Content of Sludge
in Countries with Low and High Content of Pathogens. Water Science and
Technology 46(10) 17-24
Jenkins, M.B., Walker, M.J., Bowman, D.D., Anthony, L.C. and Ghiorse, W.C.
1999. Use of a Sentinel system for field Measurements of Cryptosporadium
parvum oocyst inactivation in soil and animal waste. Applied and Environmental
Microbiology. 65(5). 1998-2005
Jones, P.W. 1980. Health hazards associated with the handling of animal
wastes. Veterinary Record. 106. 4-7
Kirby, J.B. 2001. Exposure, resistance, and recovery: a three-dimensional
framework for the study of mortality from infectious disease. Social Science and
Medicine. 53. 1205-1215
Korentajer, L. 1991. A review of the agricultural use of sewage sludge: Benefits
and potential hazards. Water SA. 17(3). 189-196
Kornacki, J.L. and Marth, E.H. 1982. Foodborne Illness Caused by Escherichia
coli: A Review. Journal of Food Protection. 45(11). 1051-1067
41
University of Pretoria etd – Chale-Matsau, J R B (2005)
Kouloumbis, P., Rigas, F. and Mavridou, A. 2000. Environmental Problems from
the Disposal of Sewage Sludge in Greece. International Journal of Environmental
Health Research. 10. 77-83
Kuckzynska, E. and Shelton, D.R. 1999. Method for Detection and Enumeration
of Cryptosporidium parvum Oocysts in Feces, Manures and Soils. Applied and
Environmental Microbiology. 65(7). 2820 - 2826
Lee, G.F. and Jones-Lee, A. 1993. Public Health Significance of Waterborne
Pathogens in Domestic Water Supplies and Reclaimed Water. Report to state
California Environmental Protection Agency Comparative Risk Project, Berkley,
CA, 27pp
Manero, A. and Blanch, A.R. 1999. Identification of Enterococcus spp. with a
biochemical key. Applied and Environmental Microbiology. 65. 4425-4430
Maxy, R.B. 1982. Fate of Microbial Contaminants in Lettuce Juice. Journal of
Food Protection. 45(4). 335-339
Melloul, A.A and Hassani, L. 1999. Salmonella Infection in Children from the
Wastewater-spreading Zone of Marrakesh City (Morocco). Journal of Applied
Microbiology. 87. 536-539
NRC, 1996. Use of Reclaimed Water and Sludge in Food Crop Production.
Committee on the Use of Treated Wastewater Effluents and Sludge in the
Production of Crops for Human Consumption. Water Science and Technology
Board. Commission on Geosciences, Environment and Resources. National
Research Council. National Academy of Press, Washington, DC
NRC, 2002. Biosolids Applied to land. National Research Council. National
Academy of Press, Washington, DC
42
University of Pretoria etd – Chale-Matsau, J R B (2005)
Pahren, H.R., Lucas, J.B., Ryan, J.A. and Dotson, G.K. 1979. Health risks
associated with land application of municipal sludge. Journal of Water Pollution
Control Federation. 51(11). 2588 - 2601
Pell, A.N. 1997. Manure and Microbes: Public and Animal Health Problem?
Journal of Dairy Science. 80. 2673-2681
Penner, K. 1998. Microorganisms and Foodborne Illness. Food Safety.
http://www.oznet.ksu.edu
Pillai, S.D., Widmer, K.W., Dowd, S.E. and Ricke, S.C. 1996. Occurrence of
Airborne Bacteria and Pathogen Indicators during Land Application of Sewage
Sludge. Applied and Environmental Microbiology. 62(1). 296 - 299
Parliamentary Bulletin, 1996. Poverty in South Africa – Poverty Week Debate. 21
October 1996. Parliamentary Bulletin No. 7. Republic of South Africa
Prescott, L.M., Harley, J.P. and Klein, D.A. 2002. Microbiology 5th ed. McGrawHill. New York. 1026pp
Purves, D. 1990. Toxic Sludge. Nature. 346. 617 - 618
Recke, H., Schnier, H.F., Nabwile, S. and Qureshi, J.N. 1997. Responses of Irish
Potatoes (Solanum Tuberosum L.) to Mineral and Organic Fertilizer in Various
Agro-Ecological Environments in Kenya. Experimental Agriculture. 33(1). 91-102
Reis, M.H., Vasconcelos, J.C. and Trabulsi, L.R. 1980. Prevalence of
Enterotoxigenic Escherichia coli in Some Processed Raw Food from Animal
Origin. Applied and Environmental Microbiology. 39(1). 270-271
43
University of Pretoria etd – Chale-Matsau, J R B (2005)
Rocourt, J., Hogue, A., Toyofuku, H., Jacquet, C. and Schlundt, J. 2001. Listeria
and listeriosis: Risk assessment as a new tool to Unravel a multifaceted problem.
American Journal of Infection Control.29(4). 225-227
Rost, U., Joergensen, R.G. and Chander, K. 2001. Effects of Zn enriched
sewage sludge on microbial activities and biomass in soil. Soil Biology and
Biochemistry. 33. 633-638
Rudolfs, W., Falk, L.L. and Ragotzkie, R.A. 1950. Literature review on the
occurrence and survival of enteric, pathogenic, and relative organisms in soil,
water, sewage, sludges, and on vegetation. Sewage and Industrial Wastes. 22.
1261-1281
Seo, K.H. and Frank, J.F. 1999. Attachment of Escherichia coli O157:H7 to
Lettuce Leaf Surface and Bacterial Viability in Response to Chlorine Treatment
as Demonstrated by Using Confocal Scanning Microscopy. Journal of Food
Protection. 62(1). 3-9
Shuval, H.I., Yekutiel, P. and Fatal, B. 1984. Epidemiological evidence for
Helminth and Cholera transmission by Vegetables Irrigated with Wastewater:
Jerusalem – a case study. Water Science and technology. 17. 442-443
Sidhu, J., Gibbs, R.A., Ho, G.E. and Unkovinch, I. 1999. Selection of Salmonella
Typhimurium as an Indicator for Pathogen Regrowth Potential in Composted
Biosolids. Letters in Applied Microbiology. 29. 303-307
Small Wright, M. 2002. Sewage Sludge/Biosolids. A Health and Environmental
Crisis and Scandal. http://www.pereladra-ltd.com/AB1473/webpage.cfm
Smith S. R. 1996. Agricultural recycling of sewage sludge and the environment.
Biddles Ltd., Guildford. 446pp
44
University of Pretoria etd – Chale-Matsau, J R B (2005)
Snyman, H.G., De Jong, J.M. and Aveling, T.A.S. 1998. The Stabilization of
Sewage Sludge Applied to Agricultural Land and the Effects on Maize Seedlings.
Water Science and Technology. 38(2). 87-95
Snyman, H.G., Terblanche, J.S. and Van der Westhuizen J.L.J. 1999.
Management of Land Disposal and Agricultural Reuse of Sewage Sludge Within
the Framework of the Current South African Guidelines. Procedures of
Specialised Conference on Disposal and Utilization of Sewage Sludge:
Treatment Methods and Application Modalities. Athens, Greece
Snyman, H.G. and Van der Waals, J. 2003. Laboratory and field scale evaluation
of agricultural use of sewage sludge. Final Report of WRC Project Number
K5/1210
Snyman, H.G., Herselman, J.E. and Kasselman, G. 2003. A Metal Content of
South African Sewage Sludge and an Evaluation of Analytical Methods for their
Determination in Sludge. WRC Report
Sobsey, M.D. 1996. Microbial Aspects of Water Quality and Health in the
Developed and Developed World. Stockholm Water Symposium 1996.
Safeguarding Water Resources for Tomorrow: New Solutions to Old Problems.
Stockholm. 195-197
Straub, T.M., Pepper, I.L. and Gerba, G.L. 1993. Hazards from Pathogenic
Microorganisms in Land-disposed Sewage Sludge. Rev of Environmental
Contamination and Toxicology. 132. 55-91
Straub, T.M., Pepper, I.L., Abbaszadegan, M. and Gerba, C.P. 1994. A Method
to Detect Enteroviruses in Sewage Sludge-Amended Soil Using the PCR.
Applied and Environmental Microbiology. 60(3). 1014 - 1017
Straub, T.M., Pepper, I.L. and Gerba, C.P. 1995. Comparison of PCR and Cell
45
University of Pretoria etd – Chale-Matsau, J R B (2005)
Culture for Detection of Enterovirises in Sludge-Amended Field Soils and
Determination of their Transport. Applied and Environmental Microbiology. 61(5).
2066 - 2068
Strauch, D. 1991. Survival of Pathogenic Microorganisms and Parasites in
Excreta, Manure and Sewage Sludge. Revue Scientifique et Technique office
International des Epizooties. 10(3). 813 - 846
Sunday Times, 2003. Putting Our Pooh to Good Use. Location: Sunday 24
August 2003. Gauteng News
Tanner, B., Brooks, J., Josephson, K., Gerba, C. and Pepper I. 2003. Evaluation
of the Potential for Bioaerosols from Land Applied Biosolids. Proceedings of the
IWA Biosolids 2003 Conference, wastewater Sludge as a Resource. 23-25 June
2003. Trondheim. Norway
Takeuchi, K., Matute, C.M., Hassan, A.N. and Frank, J.F. 2000. Comparison of
the Attachment of Escherichia coli O157:H7. Listeria mococytogenes, Salmonella
typhimurium and Pseudomonas fluorescens to Lettuce Leaf. Journal of Food
Protection. 63(10). 1433-1437
Takeuchi, K. and Frank, J.F. 2000. Penetration of Escherichia coli O157:H7 into
Lettuce Tissue as Affected by Inoculum Size and Temperature and the Effect of
Chlorine Treatment on Cell Viability. Journal of Food Protection. 63(4). 434-440
Takeuchi, K. and Frank, J.F. 2001. Quantitative Determination of the Role of
Lettuce Leaf Structures in Protecting Escherichia coli O157:H7 from Chlorine
Disinfection. Journal of Food Protection. 64(2). 147-151
Tauxe, R.V. 1997. Emerging foodborne diseases: an evolving public health
challenge. Emerging Infectious Diseases. 3. 425-434
46
University of Pretoria etd – Chale-Matsau, J R B (2005)
Tester, C.F. and Parr, J.F. 1983. Intensive Vegetable Production Using Compost.
Biocycle. 24(1). 34-36
Teunis, P.F.M. and Havelaar, A.H. 2000. The Beta Poisson Dose-Response
Model is not a Single-Hit Model. Risk Analysis. 20(4). 513- 520
Tierney, J.T., Sullivan, R. and Larkin, E.P. 1977. Persistence of Poliovirus 1 in
Soil and on Vegetables Grown in Soil Previously Flooded with Inoculated
Sewage Sludge or Effluent. Applied and Environmental Microbiology. 33(1). 109113
Tyson, J.M. 2002. Perceptions of Sewage Sludge. Water Science and
Technology. 46:373-380
Vesilind, P.A. 2003. Pathogens in Sludge: A Case of Sufficient Challenge.
Proceedings of the IWA Biosolids 2003 Conference, wastewater Sludge as a
Resource. 23-25 June 2003. Trondheim. Norway
Vilanova, X., Manero, A., Cerdà-Cuéllar, M. and Blanch, A.R. 2002. The effect of
a sewage treatment plant effluent on the faecal coliforms and enterococci
populations of the reception river waters. Journal of Applied Microbiology. 92.
210-214
Vorobieva, L.V., Selyuzhitskii, G.V. and Chernova, G.I. 1996. Ecologic and
Hygienic Evaluation of Lake Ladoga as a Source of Drinking Water.
Hydrobiologia. 322. 137-141
Waage, A.S., Vardund, T., Lund, V. and Kapperud, G. 1999. Detection of Small
Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental
Water, Sewage and Food Samples by a Seminested PCR Assay. Applied and
Environmental Microbiology. 65(4). 1636-1643
47
University of Pretoria etd – Chale-Matsau, J R B (2005)
Wachtel, M.R., Whitehead, L.C. and Mandrell, R.E. 2002a. Association of
Escherichia coli O157:H7 with Preharvest Leaf Lettuce Upon Exposure to
Contaminated Irrigation Water. Journal of Food Protection. 65(1). 18-25
Wachtel, M.R., Whitehand, L.C. and Mandrell, R.E. 2002b. Prevalence of
Escherichia coli Associated with a Cabbage Crop Inadvertently Irrigated with
Partially Treated Sewage Wastewater. Journal of Food Protection. 65(3). 471475
Wells, J.M. and Butterfield, J.E. 1997. Salmonella Contamination Associated with
Bacterial Soft Rot of Fresh Fruits and Vegetables in the Marketplace. Plant
Disease. 81. 867-872
WHO, 1979. Human Viruses in Water, Wastewater and soil. Report of a WHO
Scientific Group. World Health Organization Technical Report Series 639. World
Health organization, Geneva. 19 -20
WRC, 1997. Permissible Utilisation and Disposal of Sewage Sludge. Water
Research Commission. TT 85/97
WRC, 2002. Addendum to the Guideline on Permissible Utilisation and Disposal
of Sewage Sludge. Edition 1 Water Research Commission. TT 154/01
Zenz, D.R., Peterson, J.R., Brooman, D.L. and Lue-Hing, C. 1976. Environmental
Impacts of Land Application of Sludge. Water Pollution Control Federation.
48(10) 2332-2342
Zwietering, M.H and Gerwen, S.J.C. 2000. Sensitivity Analysis in Quantitative
Microbial Risk Assessment. International Journal of Food Microbiology. 58. 213221
48
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 3
The Microbiological Quality of Sewage Sludge in South Africa
3.1. Introduction
The practice of using sewage sludges in agricultural land is attractive to many
farmers and water authorities (Carrington et al., 1982). It provides nutrients for
crop growth as well as organic matter for soil conditioning (Melloul and
Hassani, 1999). In the UK approximately 70% of sludge produced is
deposited on land (Carrington et al., 1982). This is practiced primarily for
economic reasons (Kelley et al., 1984; Bouwer, 1992) and also as an
alternative means of disposal since the ban on sea disposal (EPA, 1999). In
South Africa, agricultural soil is often degraded through erosion and the
nutrient and carbon content are low. Land application therefore appears to be
a beneficial and environmentally sustainable sludge management option
(Sidhu et al., 1999) for South Africa.
However, sludge contains microorganisms that could pose a health hazard to
humans. The types of organisms present in sludge are determined by the
microbiological quality of wastewater from which the sludge is generated.
These organisms include bacteria, viruses, protozoa and helminths (Burge
and Marsh, 1978; Strauch, 1991).
At present, very few South African wastewater treatment plants disinfect their
sewage sludge. Techniques commonly used in South Africa include aerobic
stabilization by increasing the sludge age in the activated sludge process and
anaerobic digestion in either mesophylic or heated digesters. These
techniques are not capable of adequately disinfecting sewage sludge,
resulting in a product that contains a large number of pathogens and can still
have a high potential for vector attraction. Techniques such as lime
stabilisation and composting which yield sewage sludge of improved
microbiological quality
(WRC, 1997), which can be safely applied to
agricultural land are not common practice in South Africa.
49
University of Pretoria etd – Chale-Matsau, J R B (2005)
The South African sewage sludge guidelines classify sewage sludge at four
levels (Type A, B, C and D), rated in the order of improving microbiological
quality. Type A is of low microbiological quality and may not be used for
agricultural use. Type B sludge is typically an anaerobically digested sludge
or waste activated sludge.
This sludge type may be used in agricultural
practice, but with strict control to minimize the exposure of humans to
pathogens. As this sludge type is used extensively, the rest of the thesis
focuses on the agricultural use of a type B sludge. The Types C and D are of
acceptable microbial quality, with Type D being produced for unrestricted use,
provided the levels of metal and inorganic content are kept at the limits set in
the guidelines (WRC, 1997).
Most environmental concerns about land application of sewage sludge have
focused on effects of nutrients especially nitrogenous (N) and phosphoruscontaining (P) compounds and effects of heavy metals (Hyde, 1976).
Microorganisms from sludge are often low on the priority list. To assess the
threat posed by different microorganisms in sludge intended for soil
conditioning, the types of organism present in the sludge must be determined.
This chapter addresses the microbial quality of sewage sludge to be used for
soil amendment purposes. The secondary aim of this chapter is to estimate
the quantity of microorganisms (Faecal coliforms, E.coli, Salmonella spp and
Ascaris) in sewage sludge, as the persistence of these organisms will be
followed during the green house experiments.
3.2. Material and Methods
3.2.1 Sample Collection
Sludge samples (n=78) were collected at selected wastewater treatment
plants. Three rounds of sampling were done to include seasonal variation, i.e
winter,
summer
and
autumn.
These
samples
were
analysed
for
microbiological content.
50
University of Pretoria etd – Chale-Matsau, J R B (2005)
3.2.2 Microbiological Analysis
Two different South African laboratories were selected for the analyses: the
East Rand Water Care Company Laboratory (ERLAB) and the Agricultural
Research Council (ARC) Institute for Soil, Climate and Water (ISCW)
laboratory.
No accredited laboratory for the analysis of sludge could be
found. For this reason, an inter-laboratory extraction and analysis train was
set up. This was done to utilize the expertise of both laboratories to the
optimum. Samples were collected and transported to the laboratories with a
maximum delay of 72 hours. Organisms analysed were Ascaris ova (viability
was not established), faecal coliforms and Salmonella, using methods as
indicated in Table 3.1.
Table 3.1 Methods used in the analysis of microorganisms in sludge
Organism
Method
Ascaris ova
ERLAB Ascaris ova method. 2003
Salmonella spp
Bridson, 1998
Faecal coliforms
Difco Laboratories. 1998
3.2.3 Microbial Diversity
Additional sludge samples were obtained from two of the Waste Water
Treatment Plants (WWTP) in the Gauteng province; namely Rondebult, a high
metal sludge (HMS) and Olifantsfontein, a low metal sludge (LMS) (Table
3.2). These sludges are products of aerobic treatment (using aerator). Three
samples were obtained for each of the sludge types. The sludges from these
two plants were used as soil amendment in experimental trials. The microbial
component in these sludge samples was determined using the Analytical
Profile index and the Biolog technique.
51
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 3.2 Metal content of sludge from Rondebult and Olifantsfontein
(ERWAT, Sludge Analysis Report, 2003)
Metal
Rondebult (HMS) mg/kg
Olifantsfontein (LMS) mg/kg
Cr
308
31
Cu
167
42
Ni
138
21
Pb
155
47
Zn
1334
1036
Cd
11
5
Co
51
7
i Analytical Profile Index
Organisms present in each of the sludge samples (three HMS and three LMS)
were identified using the Analytical Profile Index (API) according to the
manufacture’s instructions (BioMérieux, South Africa). The API system uses
21 miniature reaction compartments (cupules) that produce 23 biochemical
reactions and is standardized for rapid identification of microorganisms. These
tests and related reagents are indicated in Appendix A. The relevant API was
chosen based on the Gram stain (-ve or +ve) reaction and the bacterial
morphology.
The low metal sludge (LMS) and the high metal sludge (HMS) samples were
collected from two wastewater treatment plants situated in the eastern
Gauteng region, South Africa. Two samples comprising 1 g of each sludge
type were emulsified in 9 ml of bacteriological peptone and incubated at 35 oC
overnight. As the samples appeared concentrated, serial dilutions were made
prior to transferring to petri dishes. A pour plate was made using plate count
agar and incubated at 35 oC for 18 - 24 hrs. Following incubation, different
colonies were picked up and transferred by streaking onto plate count agar,
using an inoculating loop, and incubated at 35 oC for 18 - 24 hrs. Well-defined
colonies were picked using an inoculating loop. Gram staining was done by
using crystal violet dye, iodine and acetone (Eikelboom, 2000).
52
University of Pretoria etd – Chale-Matsau, J R B (2005)
(a) Identification of the Enterobacteriaceae
The API 20E is an identification system for Enterobacteriaceae and other
gram-negative bacteria (Juang and Morgan, 2001).
Well-isolated colonies
were picked off from the plate and suspended in 5ml sterile water.
The
suspension was carefully emulsified to achieve a homogeneous bacterial
suspension. Bacterial identification tests were done according to the
manufacturer’s instructions (API 20E, BioMerieux, South Africa).
(b) Identification of the Staphylococci
For
identification
of
the
microorganisms
belonging
to
the
genus
Staphylococcus, the API Staph was used (Ligozzi et al., 2002). Well-isolated
colonies were picked off from the plate and suspended in 5ml API STAPH
medium. The microtubes of the API Staph strip were filled with the bacterial
suspension.
The bacterial identification tests were done according to the
manufacturer’s instructions (API Staph, BioMerieux, South Africa).
ii Microbial Identification Using the Biolog Technique
The Biolog system was used to identity gram positive and gram negative
bacteria isolated from the three LMS and three HMS sewage sludge samples.
Bacteria typed by gram staining were inoculated onto appropriate Biolog
media and subsequently onto specific Biolog 96-well microtiter plates for
identification as outlined in the Biolog user manual. Gram postive cocci and
rods were inoculated onto BUG (Biolog Universal Growth) + 5% sheep blood
and BUG + glucose media, respectively prior to suspension in the supplied
inoculating fluid. Gram negative bacteria were inoculated onto TSA with 5%
sheep blood prior to suspension in the supplied inoculating fluid.
Biolog
o
microplates were inoculated with bacteria and incubated at 30 C for 24 hrs
according to the manufacturer’s instructions. Colour formation in the individual
cells of the microtitre plates was measured at 590 nm using microplate reader
to determine the extent of reduction of the tetrazolium violet dye included with
53
University of Pretoria etd – Chale-Matsau, J R B (2005)
the individual substrate in each microplate well. Readings were taken at 6 hrs
and at 24 hrs following incubation.
3.3 Results and Discussion
3.3.1 Incidence of Organisms in Sludges from WWTPs in South Africa
Figure 3.1 indicates the faecal coliform counts from sludge samples studied
Faecal coliforms (Log CFU) per 10 g sludge
between 2001 to 2003.
14
FC 2001
FC 2002
FC 2003
12
10
8
6
4
2
0
Gau Mpuma FS
WC
KZN
Limp
NW
NC
EC
Provinces
Figure 3.1 Incidence of faecal coliforms detected in sewage sludge from
each of the South African provinces. Gau (Gauteng Province), Mpuma
(Mpumalanga), FS (Free State), WC (Western Cape), KZN (KwaZuluNatal), Limp (Limpopo), NW (North West), NC (Northern Cape) and EC
(Eastern Cape).
Table 3.3 details the number of sludge samples that tested positive for
Salmonella spp in each of the provinces. The results indicate that all
provinces in South Africa need to manage or at least monitor prevalence of
Salmonella spp in the wastewater sludges.
54
University of Pretoria etd – Chale-Matsau, J R B (2005)
Figure 3.3 indicates the numbers of Ascaris ova detected in samples obtained
from the WWTPs studied. Samples form Gauteng, Kwazulu-Natal and the
Northern Cape had the highest number of Ascaris ova.
Table 3.3 Incidence of Salmonella spp in WWTPs at different South
African Provinces.
Provinces
WWTP
% WWTP
% WWTP
% WWTP
% WWTP
per
with
with
with
without
Province
Salmonella
Salmonella
Salmonella
Salmonella
2001
2002
2003
2001-2003
Gauteng
20
60%
40%
30%
25%
Mpumalanga
2
0
50%
0
50%
Free State
5
40%
40%
80%
20%
Western
15
80%
13%
13%
13%
10
40%
40%
60%
20%
Limpopo
5
100%
60%
20%
0
North West
7
43%
57%
29%
14%
Northern
4
75%
50%
50%
0
4
0
0
25%
75%
Cape
KwaZuluNatal
Cape
Eastern Cape
55
University of Pretoria etd – Chale-Matsau, J R B (2005)
Total Ascaris ova per 10 g sludge
500
2001
2002
2003
400
300
200
100
0
Gau Mpuma
FS
WC
KZN
Limp
NW
NC
EC
Provinces
Figure 3.2 Incidence of Ascaris ova in sludge samples collected in all
the provinces between 2001 and 2003.
The KwaZulu-Natal province has the largest number of people, with 20.3% of
the population living in this area (Dorrington et al., 2002). However, a large
proportion of people in KwaZulu-Natal live in rural areas which do not receive
sanitation services.
The WWTPs studied from this region service urban
areas, which also yielded high prevalence of Ascaris ova and Salmonella spp.
Gauteng is the second largely populated province after KwaZulu-Natal, with
19.4% of people living in this province (Dorrington et al., 2002; Census, 2001).
Gauteng is the heartland of the country’s economy, and a province with the
highest incidence of urbanization as people move into this area for improved
quality of life. This migration results in increased number of informal
settlements with poor sanitation facilities that may have resulted in the high
incidence of Ascaris and Salmonella infections as noted in the sludge
samples from the Gauteng region.
Other than a couple of belt press sludge samples, samples obtained from the
Western Cape were mainly from drying beds or compost which show less
56
University of Pretoria etd – Chale-Matsau, J R B (2005)
prevalence of microorganisms, as a result of the unfavourable dry conditions.
Most of the WWTPs studied in the Western Cape service affluent
communities. This could also explain the limited prevalence of Salmonella spp
and Ascaris ova in this region. Samples from Mpumalanga were also
collected from drying bed and showed limited prevalence. The prevalence of
pathogens in the Eastern Cape appears limited, as a large proportion of
people in this province live in rural dwellings that do not receive any sanitation
services.
3.3.2 Microorganisms identified using API and the Biolog technique
Two known pure bacterial cultures were used as positive controls to validate
the proficiency of the Biolog technique and were positively identified (Table
3.4).
Table 3.4 Validation of the proficiency of Biolog
Culture
Species
Control A
Serratia marcescens
Control B
Photobacterium logei
57
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 3.5 Microorganisms occurring in sewage sludge, as found in this
study and elsewhere
Microorganism
Reference
This Study
Technique (Sludge Type)
Escherichia coli
Strauch, 1991
API (LMS and HMS)
Serratia spp.
Strauch, 1991
API (LMS and HMS)
Salmonella spp.
Carrington et al., 1982
API (LMS and HMS)
Citrobacter
Strauch, 1991
API (LMS and HMS)
Klebsiella ornilytica
Dudley et al., 1980
API (LMS and HMS)
Shigella spp
Strauch, 1991
X
Yersinia enterocolitica
Strauch,
1991,
Pell, X
1997
Clostridium spp
Strauch, 1991
X
Leptospira spp
Strauch, 1991
X
Mycobacterium spp
Strauch, 1991
X
Vibrio cholerae
Strauch, 1991
X
Streptococcus
Strauch, 1991
X
Enterobacter
Strauch, 1991
Biolog (LMS)
Serratia
Strauch, 1991
Biolog (LMS)
Proteus
Strauch, 1991
X
Providencia
Pelczar et al., 1993
X
Listeria monocytogenes
Strauch, 1991
X
Staphylococcus lentus
Dudley et al., 1980
API (LMS)
Achromobacter spp
Pelczar et al., 1993
Biolog (LMS)
Prazmo et al., 2003
Chromobacterium
Pelczar et al., 1993
violaceum
Prazmo et al., 2003
Pseudomonas spp
Pelczar et al., 1993
Biolog (LMS)
Biolog (HMS)
Prazmo et al., 2003
58
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 3.5 Continued
Microorganism
Reference
This Study
Technique (Sludge Type)
Pseudomonas
Pelczar et al., 1993
Biolog (HMS)
Pelczar et al., 2003
Biolog (HMS)
aeruginosa
Pantoea agglomerans
Serpens flexibilis
Biolog (LMS)
Oligella urethralis
Biolog (LMS)
Raoutella terrigena
Biolog (HMS)
Brevibacterium
Biolog (HMS)
liquefaciens
B. mcbrellneri
Biolog (HMS)
B. linens
Biolog (HMS)
B. otitidis
Biolog (HMS)
Leclercia
Biolog (HMS)
adecarboxylata
Rhodococcus
Biolog (HMS)
australis
Cellulomonas hominis
Biolog (HMS)
Acitenobacter
Biolog (HMS)
calcoaceticus
Exiguobacterium
Biolog (HMS)
acetylicum
X = these organisms were not detected in the present study.
Bold = present in the current study, but not reported elsewhere.
This study used sensitive tests and detected microorganisms that are not
commonly found in sludge. However these organisms are not indicated as
human pathogens, but are mainly associated with the environment and, thus,
may have originated from water or soil.
Most of the organisms identified using Biolog are not known to cause disease
in healthy people. However, they may cause opportunistic infections in people
who have weakened immune systems such as those undergoing antibiotic
59
University of Pretoria etd – Chale-Matsau, J R B (2005)
therapy,
cancer
treatment
or
those
with
HIV/AIDS.
For
instance
Brevibacterium strains usually present on the skin (Pelczar et al., 1993) have
been implicated in bloodstream infections in HIV/AIDS patients (Brazzola et
al., 2000).
Some
organisms
such
as
Achromobacter,
Chromobacterium
and
Pseudomonas identified in this study, have been reported as frequently
occurring in sewage (Pelczar et al., 1993; Prazmo et al., 2003). These
bacteria are responsible for denitrification in soil (Drysdale et al., 1999).
Achromobacter xylosoxidans often found in aqueous environmental sources
(Clermont et al., 2001) is an opportunistic pathogen that has been implicated
in serious infections (Ramos et al., 1996; Hernandez et al., 1998). Oligella
urethralis is an organism of the genital and urethral tracts and has been
implicated in urinary tract infection (Mammeri et al., 2003) and meningitis
(Graham et al., 1990), Serratia marcescens and Pseudomonas aeruginosa
with respiratory infections (Kirschke et al., 2003), Chromobacterium violaceum
is the causal agent of septicaemia (Perera et al., 2003) while Acinetobacter
species are often associated with nosocomial infections (McDonald et al.,
1998).
Children with chronic granulomatous disease are predisposed to infection
caused by Chromobacterium violaceum (Macher et al., 1982). Although
infections caused by C. violaceum are rare, when they occur they are
responsible for a high incidence of mortality (Ti et al., 1993).
The presence of the opportunistic pathogens in sludge may have serious
implications for the consumers if such sludges are used for soil amendment.
This is particularly pertinent for young children, expectant women, the elderly
and those infected with HIV/AIDS,
as
their
immune
systems
are
compromised.
The primary route of exposure to pathogens is by ingestion. If sludge is to be
used in the production of food crops, then there is a chance of exposure
60
University of Pretoria etd – Chale-Matsau, J R B (2005)
through ingestion. Consequently, there is a greater need to reduce pathogen
numbers prior to soil application.
Biochemical profiling using API has become popular in recent years
(Bezuidenhout et al., 2002). This technique although qualitative, identifies
organisms based on their biochemical reactions and it provides rapid
identification thereof (Juang and Morgan, 2001).
Organisms identified with API were common between the LMS and HMS
except for the Staphylococcus lentus, which was only identified in the LMS
(Table 3.3). Dudley et al., (1980) also found Klebsiella spp, Salmonella spp,
and Staphylococcus spp in the Texas sewage sludge. Salmonella and E.coli
are some of the most common organisms in sewage sludge (Jones, 1980;
Carrington et al., 1982; Strauch, 1991; Bouwer, 1991; Jones 1999).
Bezuidenhout and colleagues (2002) in KwaZulu-Natal, South Africa also
used API to identify similar species, namely E.coli, Serratia spp., and
Klebsiella spp. in contaminated water.
They however did not detect any
Salmonella spp in this region. Generally Salmonella spp frequently occur in
wastewater and sewage sludge and this organism has been reported to
persist in various environments due to its ability to withstand stressful
conditions (Strauch, 1991). For this reason outbreaks of Salmonellosis occur
frequently worldwide (Melloul and Hassani, 1999). Carrington and colleagues
(1982) have reported that Salmonella spp may multiply in sludge in the
absence of competition from other microorganisms.
3.4 Conclusion
Testing of sludge samples showed large numbers of Faecal coilforms,
indicating that intensive treatment of sludge from WWTPs across the country
is required to meet the type C and D class South African guidelines.
It is likely that the large numbers of Ascaris in the Gauteng area could be
related to increased urbanization in this province.
61
University of Pretoria etd – Chale-Matsau, J R B (2005)
The microbial population determined for LMS was similar to the population of
HMS except for the presence of Staphylococcus lentus in LMS.
Due to the presence of potentially noxious pathogens in the sewage sludge, it
is recommended that sewage sludge need to be adequately disinfected prior
to use in agricultural land.
Further research on the microbial quality in South African water and soil in the
Gauteng region will be necessary to establish the types of organisms present
in these environments.
62
University of Pretoria etd – Chale-Matsau, J R B (2005)
3.5 References
Bezuidenhout, C.C., Mthembu, N., Puckree, T. and Lin, J. 2002.
Microbiological Evaluation of the Mhlathuze River, KwaZulu-Natal (RSA).
Water SA. 28(3) 281-286
Bouwer, H. 1992. Agricultural and Municipal Use of Wastewater. Water
Science and Technology. 26(7-8) 1583-1591
Brazzola, P., Zbinden, R., Rudin, C., Schaad, U.B. and Heininger, U. 2000.
Brevibacterium case Sepsis in an 18 Year Old Female with AIDS. Journal of
Clinical Microbiology. 38(9) 3513-3514
Bridson, EY. 1998. The Oxoid Manual. 8th Edition. Oxoid Ltd. Hampshire, UK
Burge, W.D. and Marsh, P.B. 1978. Infectious Disease Hazards of
landspreading Sewage Wastes. Journal of Environmental Quality. 7(1). 1-9
Carrington, E.G., Harman, S.A. and Pike, E.B. 1982. Inactivation of
Salmonella during anaerobic digestion of sewage sludge. Journal of Applied
Bacteriology. 53. 331-334
Census, 2001. Statistics South Africa, Census 2001. Census in Brief. Pretoria.
http://www.statssa.gov.za
Clermont, D., Harmant, C. and Bizet, C. 2001. Identification of Strains of
Alcaligenes and Agrobacterium by a Polyphasic Approach. Journal of Clinical
Microbiology. 39(9). 3104-3109
Difco Laboratories, 1998. The Difco Manual. Difco. Maryland, USA
Dorrington, R., Bradshaw, D. and Budlender, D. 2002. HIV/AIDS Profile in the
Provinces of South Africa. Indicators for 2002. Medical Research Council,
South Africa. 31pp
63
University of Pretoria etd – Chale-Matsau, J R B (2005)
Drysdale, G.D., Kasan, H.C. and Bux, F. 1999. Denitrification by
Heterotrophic Bacteria During Activated Sludge Treatment. Water SA. 25(3).
357-362
Dudley, D.L., Guentzel, M.N., Ibarra, M.J., Moore, B.E. and Sagik, B.P. 1980.
Enumeration of Potentially Pathogenic Bacteria from Sewage Sludges.
Applied and Environmental Microbiology. 39(1) 118-126
Eikelboom, D.H. 2000. Process Control of Activated Sludge Plant by
Microscopic Investigation. IWA Publishing. 156pp
EPA, 1999. Environmental Regulations and Technology. Control of pathogens
and vector attraction in sewage sludge. U.S. Environmental Protection
Agency. EPA/625/R-92-013. 111pp
ERLAB, 2003. Ascaris Ova Method. East Rand Water Care Company.
Gauteng, South Africa
ERWAT, 2003. Sludge Analysis Report. East Rand Water Care Company,
South Africa
Graham, D.R., Band, J.D., Thornsberry, C., Hollis, D.G. and Weaver, R.E.
1990. Infections caused by Moraxella, Moraxella urethralis, Moraxella-like
Groups M-5 and M-6, and Kingella kingae in the United States, 1953-1980.
Review of Infectious Diseases. 12(3). 423-431
Hernandez, J.-A., Martino, R., Pericas, R., Sureda, A., Brunet, S. and
Domingo-Albos, A. 1998. Achromobacter xyloxidans bacteremia in Patients
with Hematologic Malignancies. Haematologica. 83(3). 283-284
Hyde, C.H. 1976. Utilization of Wastewater Sludge for Agricultural Soil
Enrichment. Journal of Water Pollution Control Federation. 48(1). 77-90
Jones, P.W. 1980. Health hazards associated with the handling of animal
wastes. Veterinary Record. 106. 4-7
64
University of Pretoria etd – Chale-Matsau, J R B (2005)
Jones, D.L. 1999. Potential Health Risks Associated with the Persistence of
Escherichia coli O157:H7 in Agricultural Environments. Soil Use and
Management. 15. 76-83
Juang, D.F. and Morgan, J.M. 2001. The Applicability of the API 20E and API
Rapid NFT Systems for the Identification of Bacteria from Activated Sludge.
Electronic Journal of Biotechnology. 4(1). 18-24
Kelley, W.D., Marterns, D.C., Reneau, Jr. R.B. and Simpson, T.W. 1984.
Agricultural Use of Sewage Sludge: A Literature Review. Virginia Water
Resources Research Center.
Virginia Polytechnic Institute and State
University. Bulletin 143. 46pp
Kirschke, D.L., Jones, T.F., Craig, A.S., Chu, P.S., Mayernick, G.G., Patel, A.
and Schaffner, W. 2003. Pseudomonas aeruginosa and Serratia marcescens
Contamination Associated with a Manufacturing Defect in Bronchoscopes.
The New England Journal of Medicine. 348(3). 214-220
Ligozzi, M., Bernini, C., Bonora, M.G., de Fatima, M., Zuliani, J. and Fontana,
R. 2002. Evaluation of the VITEK 2 System for Identification and Antimicrobial
Susceptibility Testing of Medically Relevant Gram-Positive Cocci. Journal of
Clinical Microbiology. 40(5). 1681-1686
Macher, A.M., Casale, T.B. and Fauci, A.S. 1982. Chronic Granulomatous
Disease of Childhood and Chromobacterium violaceum Infections in the
Southeastern United States. Annals of Internal Medicine. 97(1). 51-55
Mammeri, H., Poirel, L., Mangeney, N. and Nordmann, P. 2003.
Chromosomal Integration of a Cephalosporinase Gene from Acinetobacter
baumannii into Oligella urethralis as a Source of Acquired Resistance to βLactams. Antimicrobial Agents and Chemotheraphy. 47(5). 1536-1542
65
University of Pretoria etd – Chale-Matsau, J R B (2005)
McDonald, L.C. and Jarvis, W.R. 1998. Linking Antimicrobial Use to
Nosocomial Infections. Annals of Internal Medicine. 129(3). 245-247
Melloul, A.A. and Hassani, L. 1999. Salmonella infection in Children from the
Wastewater Spreading zone of Marrakesh City (Morocco). Journal of Applied
Microbiology. 87.536-539
Pelczar, M.J., Chan, E.C.S. and Krieg, N.R. 1993. Microbiology: Concepts
and Applications. McGraw-Hill, Inc. New York. 896pp
Perera, S., Punchihewa, P.M.G., Karunanayake, M.C.G. and de Silva, N.
2003. Fatal Septicaemia caused by Chromobacterium violaceum. Ceylon
Medical Journal. 48(1). 26-27
Prazmo, Z., Krysinska-Traczyk, E., Skorska, C., Sitkowska, J., Cholewa, G.
and Dutkiewicz, J. 2003. Exposure to Bioaerosols in a Municipal Sewage
Treatment Plant. Annals of Agricultural and Environmental Medicine. 10. 241248
Ramos, J.M., Domine, M., Ponte, M.C. and Soriano, F. 1996. Bacteremia
caused by Alcaligenes (Achromobacter) xylosoxidans. Description of 3 cases
and review of the literature. Enfermedades infecciosas microbiologia clinica.
14(7). 436-440
Sidhu, J., Gibbs, R.A., Ho, G.E. and Unkovich, I. 1999. Selection of
Salmonella Typhimurium as an Indicator for Pathogen Regrowth Potential in
Composted Biosolids. Letters in Applied Microbiology. 29. 303-307
Strauch, D. 1991. Survival of Pathogenic Microorganisms and Parasites in
Excreta, Manure and sewage Sludge. Revue Scientifique et Technique office
International des Epizooties. 10(3) 813-846
66
University of Pretoria etd – Chale-Matsau, J R B (2005)
Ti, T.Y., Chong, A.P. and Lee, E.H. 1993. Nonfatal and Fatal Infections
caused by Chromobacterium violaceum. Clinical Infectious Diseases. 17(3).
505-507
WRC, 1997. Permissible Utilisation and Disposal of Sewage Sludge. Water
Research Commission. TT 85/97
67
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 4
Survival of Mircoorganisms in Soil Amended with Sewage Sludge,
and their Subsequent Persistence in Crops.
4.1 Introduction
As indicated in Chapter 3, there are a number of microorganisms in a Type B sewage
sludge produced by many of the wastewater treatment plants in South Africa. While
the value of sludge use in agriculture is clearly understood, the potential persistence
of microorganisms in agricultural soil has not been fully investigated. Studies done
elsewhere on different crops have indicated the contamination of fruits and
vegetables following irrigation with sewage sludge or wastewater (Rudolfs et al.,
1951; Hyde, 1976; Bouwer, 1992; Armon et al., 1994; Wachtel et al., 2002; Petterson
et al., 2001).
Measures to reduce pathogen load in sludge such as composting are not always
successful in completely inactivating these microorganisms from sludge. For
instance, Salmonella spp and E.coli can survive the composting process and then
regrow in soil following amendment (Sidhu et al., 1999). As the regrowth potential is
affected by a number of different inherent and environmental factors the regrowth of
pathogens appears difficult to predict (Sidhu et al., 1999).
Kudva et al. (1998) reported that E.coli survived for more than a year in a nonaerated manure pile that was exposed to environmental conditions, and Jones (1999)
pointed out that this organism is capable of surviving for four months in soil.
Salmonella spp may survive over one year in slurry and may still be isolated in soil
for up to 20 weeks following application to land (Jones, 1980). It has been shown
that even processed sewage sludge still contains considerable proportions of viral,
bacterial, protozoan and helminthic agents of disease (Burge and Marsh, 1978;
Strauch, 1991).
68
University of Pretoria etd – Chale-Matsau, J R B (2005)
One of the major routes of exposure to sludge is by ingestion, although other routes
such as respiratory and ocular routes can be involved. If untreated or inadequately
treated sewage sludge is used in the production of food crops, particularly those that
are eaten raw, a chance of exposure to pathogenic microorganisms through
ingestion exists.
In South Africa, most studies on sewage sludge focused on the effects of nutrients
(Easton, 1983; Snyman et al., 1998; Henning et al., 1999) and heavy metals (Lotter
and Pitman, 1997). The effects of sewage sludge-borne microorganisms have not
been studied in detail. Apart from this study, there appears to be no other work done
on survival of microorganisms in agricultural soil, under South African conditions. The
research in this area was done in other countries with different climatic and socioeconomic conditions compared to South Africa.
The aim of this chapter is to determine the prevalence of microorganisms in soil
conditioned with sewage sludge and the persistence of these microorganisms in
crops grown in this soil, following a single application of a Type B sewage sludge
prior to planting. Faecal coliforms, Salmonella spp, E. coli and Ascaris were chosen
as organisms to study, as they are used as indicators in the South African sewage
sludge guidelines.
4.2 Materials and Methods
4.2.1 Green House Experiments
Potatoes (Solanum tuberosum) were obtained from a local farmer in the Tshwane
area, South Africa. Potato was selected as the study sought for high risk crop that
grows in contact with the soil, and the season was also appropriate. Samples of
sludge representing the high metal sludge and the low metal sludge were obtained
from the Eastern Gauteng region (South Africa). Experiments were done in
69
University of Pretoria etd – Chale-Matsau, J R B (2005)
greenhouses under controlled conditions (temp 25 – 28 oC) for a three month period.
The experimental layout is detailed in Table 4.1.
Table 4.1 Experimental lay-out of trials undertaken
Controls
No Sludge
Controls
8 pots
8 pots
Trials
Low Metal Sludge
8 tons/ha
8 pots
8 pots
High Metal Sludge
16 tons/ha
8 pots
8 pots
8 tons/ha
8 pots
8 pots
16 tons/ha
8 pots
8 pots
Each pot contained approximately 4 kg of oven sterilised sandy loam soil. Prior to
application, the sludge was sun-dried and crushed to achieve a fine product to
ensure homogeneous mixing with the soil. For each trial and the controls there were
duplicate pots dedicated for sampling
(shaded cell in Table 4.1). These pots,
although not planted, were subjected to the same conditions as the other pots. Soil
samples were collected in a manner to avoid cross-contamination every second
week, and analysed for microorganisms. The same amount of water (about a litre)
was added to each pot every second day. At the end of the experiment, the potatoes
were collected for microbiological analysis. Potatoes were harvested in a manner to
avoid cross-contamination and placed in sterile bags. At least two potatoes were
harvested per pot. In the laboratory, each potato was cleaned with sterile distilled
water prior to microbiological analysis.
4.2.2 Microbiological Determinations
Microbiological analysis were carried out for both soil and potato samples.
Procedures for analyses of Faecal coliforms, E.coli, Salmonella and Ascaris ova are
those adapted by the East Rand Water Care Company (ERWAT) in South Africa
(ERWAT, 1996; Clesceri et al .,1998).
70
University of Pretoria etd – Chale-Matsau, J R B (2005)
i Salmonella spp analysis
All chemicals used for this analysis were purchased from Oxoid. A 1 g of sample (soil
or portion of potato) was placed in a 10 ml Buffered Peptone Water, mixed and
incubated at 35 oC for 18 – 24 hrs. An aliquot (0.1 ml) of the mixture was transferred
to 10 ml Rappaport VS Broth, and incubated at 44 oC for 24 hrs. The enrichment
broth was subcultured by streaking the bacterial suspension onto the plates of
Brilliant Green agar and incubated at 35 oC for 18 – 24 hrs. A presumptive positive
result was suspected if red colonies grew. Selected colonies were then subcultured
onto Xylose-Lysine-Desoxycholate (XLD) agar (Batch number 230180), and
incubated at 35 oC for 18 – 24 hrs. Occurrence of black colonies confirmed the
presence of Salmonella spp in the original sample.
ii Analysis of faecal coliforms
A subsample of 1 g (soil or potatoes at the end of experiment) from the experimental
and control pots was added to 9 ml of peptone broth (Difco) and incubated overnight
to resuscitate the microorganisms and serially diluted and filtered using sterile 0.45
µm gridded membrane filter (Sartorius). When filtration was completed, the
membrane filter was removed with sterile forceps and rolled onto MFC agar (Difco)
and incubated inverted at 44.5 ± 0.5 oC for 18 – 24 hrs. Using a colony counter, all
blue colonies were counted. Results were expressed as colony forming units per
gram (CFU/g).
iii E. coli analysis
The membrane from the faecal coliforms was transferred to the nutrient agar
substrate containing MUG (4-methylumbeliferyl-β-glucoside) (Difco). The plates were
then incubated together with one blank at 35 ± 0.5 oC for 4 hours. Colonies were
observed using a long wavelength ultraviolet light source for the fluorescence on the
periphery. Results were expressed as CFU/g.
71
University of Pretoria etd – Chale-Matsau, J R B (2005)
iv Ascaris analysis
Before determining the amount of Ascaris ova, the moisture content of the sample
was determined (ERWAT, 1996).
Approximately 10 g of the sample was weighed
into a beaker and treated with an alkaline soap while mixing the preparation with an
orange stick. The sample was then washed through a treble Visser filter (comprising
mesh sizes 100 µm; 80 µm and 35 µm), by rinsing repeatedly with a strong jet of tap
water. The residue in the outer filter were rinsed with tap water and centrifuged at
3000 g for 3 minutes. The supernatant was removed using a Pasteur pipette, and
the pellet was resuspended in ZnSO4 (40%, 71 g/100ml H2O) and centrifuged further
for 3 minutes at 3000 g. The supernatant was transferred to a vacuum filtering
system, using a filter of 12 µm (Millipore). The ZnSO4 was rinsed off with distilled
water to avoid recrystalization. The membrane filter was then placed in a glass petri
dish and dried at 35 oC. A circular weight is usually placed around the edges of the
membrane to prevent curling. Once dried, the filter was cut across its diameter and
each of the half was placed onto a microscope slide, using a clear glue to hold it
down. Using an orange stick, immersion oil was spread over the filter. Ascaris ova
were counted using a phase light microscope (Olympus).
4.3 Results and Discussion
4.3.1 Microorganisms in Sludge
The quantity of microorganisms in sludge samples, together with amount expected to
be present in the sludge applied to the pots are indicated in Table 4.2.
72
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 4. 2 Microorganisms in sludge and expected quantities in the pot
Organisms in sludge
LMS
HMS
Ascaris (per g)
2
1
Faecal coliforms (CFU/g)
89 X 106
50 X 106
E.coli (CFU/g)
89 X 106
49 X 106
Salmonella
+ve
+ve
Expected in the pots
LMS 8
LMS 16
HMS 8
HMS 16
Ascaris
14
28
7
14
Faecal coliforms
6.23 X 108
12.46 X108
3.5 X 108
7 X 108
E.coli
6.23 X 108
12.46 X108
3.4X 108
6.86 X108
Salmonella
+ve
+ve
+ve
+ve
4.3.2 Survival of Microorganisms in Contaminated Soil
All the control samples tested negative for all indicator organisms throughout the
experiment. Descriptive statistics of the data used are shown in Appendix B. These
values were generated using both the T-test and the Wilcoxon Signed Ranks test.
73
University of Pretoria etd – Chale-Matsau, J R B (2005)
12
Controls
FC HMS 8
FC HMS 16
10
Log10 CFU/g
8
6
4
2
0
0
2
4
6
8
10
12
14
Weeks
Figure 4.1 Faecal coliforms for HMS at application rates of 8 and 16 tons/ha.
As shown in Figure 4.1, pots amended with HMS 8 tons/ha, had fewer organisms
than the HMS 16 tons/ha and these organisms were not detected from week eight
until the end of the experiment. An increase of Faecal coliforms observed in both the
8 and 16 tons/ha pots up until week six was probably due to sufficient food and
moisture as these pots were watered regularly.
There was a significant reduction in the number of organisms after week six. The
organisms in the soil that received a dose of 16 tons/ha showed complete die-off
after week ten.
74
University of Pretoria etd – Chale-Matsau, J R B (2005)
12
Controls
FC LMS 8
FC LMS 16
10
Log10 CFU/g
8
6
4
2
0
0
2
4
6
8
10
12
14
Weeks
Figure 4.2 Faecal coliforms for LMS at application rates of 8 and 16 tons/ha.
LMS treatment showed persistence of Faecal coliforms throughout the duration of the
experiment, although a decline was observed in weeks eight and ten for both 8
tons/ha and 16 tons/ha (Figure 4.2).
The greatest survival of organisms was
observed with LMS 16 tons/ha. In this treatment, although a decline in weeks eight
and ten was noted, by the twelfth week, both faecal coliforms and E. coli had
increased when compared to their initial values (week = 0) at the onset of the
experiment (Figures 4.2 and 4.3). This could probably be due to competition between
some microorganisms.
75
University of Pretoria etd – Chale-Matsau, J R B (2005)
12
Controls
EC LMS 8
EC LMS 16
10
Log10 CFU/g
8
6
4
2
0
0
2
4
6
8
10
12
14
Weeks
Figure 4.3 E. coli for LMS at an application of 8 and 16 tons tons/ha.
E. coli were detected throughout the study period with the exception of the LMS 8
samples taken in week 6 (Figure 4.3).
It appears that doubling the concentration of sludge (from 8 to 16 tons/ha) in the soil
did not yield a large number of microorganisms from these pots. Instead, in some
weeks there were more organisms in the 8 tons/ha than in the 16 tons/ha. For
instance, the number of E.coli counted in LMS 8 tons/ha for weeks two, eight and ten
were more than those counted in samples from pots containing LMS 16 tons/ha.
However, the number of E.coli for LMS 16 tons/ha samples in the twelfth week were
higher than the those counted in the LMS 8 tons/ha samples.
In South Africa
guidelines for use of sewage sludge require that the application rate should not
exceed 8 tons/ha (WRC, 1997). Despite a decline in the number of microorganisms
from the time of planting (time zero) to the harvest time (twelfth week), there was a
76
University of Pretoria etd – Chale-Matsau, J R B (2005)
clear persistence of bacteria studied. Earlier Jones (1999) reported on the potential
health risk associated with the persistence of E. coli in agricultural environment.
12
Controls
EC HMS 8
EC HMS 16
10
Log10 CFU/g
8
6
4
2
0
0
2
4
6
8
10
12
14
Weeks
Figure 4.4 E. coli for HMS at application rates 8 and 16 tons/ha.
The number of E.coli for both the LMS16 ( Figure 4.3) and HMS16 (Figure 4.4) pots
peaked at week four and declined in the sixth week, although in the high metal
sludge it is slightly lower than in the low metal sludge pots. By the twelfth week E.coli
numbers in LMS16 were high, while in the HMS16 were very small.
In this study it was shown that microorganism can persist for a period of three months
in soil amended with sewage sludge and thus may be a source of pre-harvest
contamination of food crops growing in the field. In some countries such as the
United States, sewage sludge is allowed to stand for up to three months before use
to encourage bacterial die-off (EPA, 1999). Although counts were minimal by the
77
University of Pretoria etd – Chale-Matsau, J R B (2005)
twelfth week (at harvest), it is likely that microorganisms will prevail in soil for a period
well exceeding duration of the three months period (Strauch, 1991).
The decline in the number of microorganisms could be attributed to competition for
food and space (Tester and Parr, 1983). As there was no nutritional addition made to
any of the pots during the experimental period, these microorganisms were no longer
able to reproduce at the rate observed in the earlier weeks (weeks two to six). As
microorganisms grow, they tend to form colonies of millions of individual cells. As
these colonies form, the food available to each cell becomes limited and excretions
from these millions of cells become toxic to a microbe, such that some of the cells
begin to die (Penner, 1998). Survival of bacteria is known to be influenced by a
number of factors, which includes optimum temperatures and availability of organic
matter (Bitton, 1994).
The HMS had far less persistence of both the Faecal coliforms and the E.coli as
compared to the LMS. These microorganisms were only detected in soil up until the
sixth week, with no further increase observed in subsequent weeks. This is probably
due to the high concentrations of metals found in the HMS (Chapter 3; ERWAT,
2002). Metals have been reported to inhibit microbial growth (Tsai and Olson, 1990).
Monpoeho et al. (2001) have pointed out that inorganic compounds such as heavy
metals and polyphenols are toxic and cause lysis of the cells. The effect of metal-rich
sludge on microbial community was also shown by Baath and colleagues (1998).
Table 4.3 provides an indication of whether Salmonella spp were found in the
samples at each application rate for every week sampled. The presence of
Salmonella spp was indicated with a positive sign, while the absence thereof was
indicated with a negative sign. At time zero, Salmonella spp were only observed in
the LMS at 8 tons/ha. All four treatments had Salmonella spp during weeks two and
four. No Salmonella spp were detected in 8 tons/ha treatment for both LMS and
HMS at week twelve.
78
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 4.3 Salmonella found in sludge pots ( + = Presence, - = absence)
Weeks
Controls
LMS8
LMS16
HMS8
HMS16
0
-
+
-
-
-
2
-
+
+
+
+
4
-
+
+
+
+
6
-
-
+
+
+
8
-
+
+
+
+
10
-
+
+
+
-
12
-
-
+
-
+
The persistence of Salmonella spp throughout the experiment suggests their
prolonged survival in soil. Salmonella spp have been indicated by other researchers
as surviving in soil for a long period. For instance Strauch (1991) has reported that
Salmonella spp could survive on and in the soil after a single application of sludge in
summer for 424 to 820 days, and in winter the survival times were reported to be 104
to 350 days. Baloda et al (2001) also confirmed the prolonged survival of Salmonella
spp, which he estimated to be about 299 days in soil. Sewage sludge spread on a
hospital lawn has been implicated in an outbreak of salmonellosis in a hospital
nursery (Burge and Marsh, 1978).
Table 4.4 shows the total number of Ascaris ova per gram of soil in all the pots for
each application rate and sludge type for every week sampled. Other than at zero
time and in the fourth week, there appeared to be no Ascaris detected in the soil
sampled. Most Ascaris were found in samples collected in the fourth week. For
instance, a total of four (4) Ascaris were counted in LMS 16 tons/ha samples.
Although Ascaris samples were expected to occur in sewage sludge contaminated
soil, this was not always the case. These pathogens might have been missed as a
result of dilution caused by mixing of soil and sludge or they may only be unavailable
in particular samples analysed. Although effort was done to ensure homogeneous
mixing of sludge with soil, it is possible that there might have been islands/pockets of
soil that might have not been affected.
79
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 4.4 Numbers of Ascaris found in sludge pots per gram of contaminated
soil
Weeks
Controls
LMS8
LMS16
HMS8
HMS16
0
0
1
0
0
2
2
0
0
0
0
0
4
0
2
4
1
0
6
0
0
0
0
0
8
0
0
0
0
0
10
0
0
0
0
0
12
0
0
0
0
0
4.3.3 Microorganisms in Potato
Indicated in Table 4.5 are the results of the analysis of microorganisms for the potato
peel and the inside of the potato (core). None of the microorganisms tested were
detected in the potato core. However, Faecal coliforms and E.coli were detected on
the potato peel at the end of the experiment, in the treatment LMS at 16 tons/ha.
Table 4.4 Microorganisms found in potato in the 12th week
Sample
Microorganism
Control LMS8
LMS16 HMS8 HMS16
Potato
Faecal coliforms (CFU/g)
0
0
2050
0
0
peel
E.coli (CFU/g)
0
0
1800
0
0
Salmonella
-
-
+
-
+
Ascaris ova
0
0
0
0
0
Potato
Faecal coliforms (CFU/g)
0
0
0
0
0
core
E.coli (CFU/g)
0
0
0
0
0
Salmonella
-
-
-
-
-
Ascaris ova
0
0
0
0
0
80
University of Pretoria etd – Chale-Matsau, J R B (2005)
These are the mean values of all the eight repetitions carried out. Faecal coliforms,
E.coli and Salmonella spp were found to be present on the outside (peel) of the
cleaned potatoes at harvest time. Experiments done elsewhere on tomatoes have
shown that even after field-grown tomatoes are washed with continuous vigorous
agitation for as long as 15 minutes, the numbers of organisms remaining on tomatoes
are essentially the same as on unwashed fruit (Rudolfs et al., 1951).
Although microorganisms studied were detected on the peel of the potato and none
were found to be present in the inside of the potato, studies done elsewhere on other
crops, have reported on the interior contamination of fruits and vegetables following
irrigation with sewage or waste water (Wachtel et al., 2002; Petterson et al., 2001).
Organisms such as E. coli have been reported as capable of entering the plant
(lettuce) through the root system and migrate to edible portion of the plant (Solomon
et al., 2002). It has also been indicated that E.coli can grow on raw salad vegetables
(Adul-Raouf et al., 1993). Cieslak and colleagues (1993) previously reported case of
outbreaks due to consumption of vegetables from a manured garden.
Another factor that should not be ignored is the possibility of cross contamination that
could occur during preparation of contaminated vegetables, leading to a
contaminated dish. Abdul-Raouf and colleagues (1993) demonstrated the ability of
E.coli to grow on raw salad vegetables subjected to processing and storage
conditions simulating those routinely used in commercial practice. However, through
appropriate sewage sludge management practice, such contamination may be
controlled.
Salmonella spp were only detected on the peel of potato samples from LMS 16
tons/ha grown in the 16 tons/ha for LMS and none of the core samples tested
positive. Although Salmonellosis have previously and commonly been associated
mainly with food of animal origin (Ayanwale et al., 1980; de Louvois, 1993; Blazer,
1996; Walls and Scott, 1997; Ebel and Schlosser, 2000; Sharma and Carlson, 2000),
recent studies have shown that Salmonella contamination can be due to sewage
81
University of Pretoria etd – Chale-Matsau, J R B (2005)
irrigation (Melloul and Hassani, 1999) which could lead to crop contamination
(Asplund and Nurmi, 1991; Guo et al., 2000). A number of Salmonella species have
been previously implicated in illness associated with the consumption of produce (del
Rosario and Beauchat, 1995). The health threat of Salmonella and E.coli is also
because the infectious dose of both these organisms is relatively low (Fratamico and
Strobaugh, 1998).
Potential infections due to these organisms necessitates that
sewage sludge be appropriately treated before it is used as a soil conditioner.
Ascaris ova were not detected on the potato peel at the end of the experiment.
Gaspard and Schartzbrod (1993) have shown that vegetables, namely, lettuce and
tomato can be contaminated with Ascaris following irrigation. Ascaris have been
reported to survive for up to two years in soil that has been irrigated with sewage
sludge (Strauch, 1991), thus can lead to crop contamination (Gaspard and
Schartzbrod, 1993) if untreated sewage sludge is used in agricultural land. Ascaris
infections, especially in children are amongst the most common in the world
(Carneiro et al., 2002).
Blumenthal and colleagues (1996) could show doing
experiments on lettuce, that the use of wastewater for irrigation causes transmission
of nematode infections. Crop contamination with Ascaris was also reported by Ayres
colleagues (1992). Considering that communities in developing countries such as
South Africa are not in the habit of de-worming themselves, the use of untreated or
inadequately treated sewage sludge, comprising viable Ascaris could result in serious
infections.
Although other microorganisms were not detected in the HMS at 16
tons/ha, Salmonella was present on the potato peel from this treatment.
4.4 Conclusion
It has been shown that Ascaris and microorganisms studied, namely faecal coliforms,
E.coli and Salmonella spp will survive in soil for 3 months following a single
application of sludge at planting.
82
University of Pretoria etd – Chale-Matsau, J R B (2005)
The presence of E.coli and Faecal coliforms on the potato peel indicates that use of
untreated sewage sludge for growing vegetables that come into contact with soil
could be potentially hazardous to public health.
Bacteria cannot penetrate undamaged vegetable skin (Penner, 1998), but they can
survive on the surfaces of vegetables, especially root vegetables such as potato.
Although there is a clear distinction between the LMS and HMS, there does not
appear to be any appreciable difference in terms of the numbers of microorganisms
between the two concentrations (8 tons/ha and 16 tons/ha) explored. It appears that
doubling the application rate from the 8 tons/ha to 16 tons/ha does not significantly
affect the persistence of microorganisms. The high metal sludge at an application
rate of 8 tons/ha, had a quicker die off (week eight) of microorganisms. Generally
microorganisms do not thrive in high metal sludge probably due to inhibition caused
by these metals (Tsai and Olson, 1990).
Due to the presence of potentially dangerous pathogens in the sewage sludge, it is
recommended that sewage sludge need to be adequately decontaminated prior to
use in agricultural land If sewage sludge is to be used for soil amendment when
growing crops meant for human consumption.
In this study, Ascaris viability was not investigated. Further research will need to
determine viability of Ascaris throughout the experiment.
Further study in this subject should also pay attention to other parasites commonly
found in sludge, such as Taenia spp.
Subsequent studies on this subject will need to include moisture content to evaluate
as a variable.
This study recommends E.coli as a reliable indicator in sewage sludge
microbiological investigations.
83
University of Pretoria etd – Chale-Matsau, J R B (2005)
4.5 References
Addul-Raouf, U.M, Beauchat, L.R. and Ammar, M.S. 1993. Survival and Growth of
Escherichia coli o157:H7 on Salad vegetables. Applied and Environmental
Microbiology. 59(7). 1999 -2006
Armon, R., Dosoretz, C.G., Azov, Y. and Shelef, G. 1994. Residual Contamination of
Crops Irrigated with Effluent of Different Qualities: A Field Study. Water Science and
Technology. 30(9). 239 -248
Asplund, K. and Nurmi, E. 1991. The Growth of Salmonellae in Tomatoes.
International Journal of Food Microbiology. 13. 177 - 182
Ayanwale, L.F., Kaneene, J.M.B., Sherman, D.M. and Robinson, R.A. 1980.
Investigation of salmonella Infection in Goats Fed Corn Silage Grown on Land
Fertilized with Sewage Sludge. Applied and Environmental Microbiology. 40(2). 285 286
Ayres, R.M., Stott, R., Lee, D.L., Mara, D.D. and Silva, S.A. 1992. Contamination of
Lettuces with Nematode Eggs by Spray Irrigation with Treated and Untreated
Wastewater. Water Science and Technology. 26(7-8). 1615-1623
Baath, E., Diaz-Ravina, M., Frostegard, A. and Campbell, C.D. 1998. Effect of MetalRich Sludge Amendements on the Soil Microbial Community. Applied and
Environmental Microbiology. 64(1) 238-245
Baloda S.B., Christensen, L. and Trajcevska, S. 2001. Persistence of a
Samonella enterica Serovar Tymphimurium DT12 Clone in a Piggery and in
Agricultural Soil Amended with Salmonella-contaminated Slurry. Applied and
Environmental Microbiology. 67(6). 2859 -2862
84
University of Pretoria etd – Chale-Matsau, J R B (2005)
Bitton, G. 1994. Wastewater Microbiology. Wiley-Liss, New York. 478pp
Blazer, M.J. 1996. How Safe is Our Food? The New England Journal of Medicine.
334(20). 1324 -1325
Blumenthal, U., Mara, D.D., Ayres, R.M., Cifuentes, E., Peasey, A., Stott, R., Lee,
D.L. and Ruiz-Palacios, G. 1996. Evaluation of the WHO nematode egg guidelines
for restricted and unrestricted irrigation. Water Science and Technology. 33(10-11).
277 -283
Bouwer, H. 1992. Agricultural and Municipal Use of Wastewater. Water Science and
Technology. 26(7-8) 1583 –1591
Burge, W.D. and Marsh, P.B. 1978. Infectious Disease Hazards of land spreading
Sewage Wastes. Journal of Environmental Quality. 7(1). 1-9
Carneiro, F.F., Cifuentes, E., Tellez-Rojo, M.M. and Romieu, I. 2002. The Risk of
Ascaris lumbricoides Infection in Children as an Environmental Health Indicator to
Guide Preventive Activities in Caparao and Alto Caparao, Brazil. Bulletin of the World
Health Organization. 80(1). 40-46
Cieslak, P.R., Barrett, T.J., Griffin, P.M., Gensheimer, K.F. Beckett, G., Buffington, J.
and Smith, M.G. 1993. Escherichia coli O157:H7 Infection from a Manured garden.
The Lancet. 342. 367
Clesceri, L.F., Greenberg, A. and Eaton, A.D. (eds). 1998. Standard Methods for
water and wastewater. American Public Health Association. Maryland, USA
De Louvois, J. 1993. Salmonella Contamination of Eggs. The Lancet. 342. 366-367.
Del Rosario, B.A. and Beauchat, L.R. 1995. Survival and growth of
85
University of Pretoria etd – Chale-Matsau, J R B (2005)
enterohemorrhagic Escherichia coli O157:H7 in cantaloupe and watermelon. Journal
of Food Protection. 58(1). 105 – 107
Easton, J.S. 1983. Utilisation and Effects of Anaerobically Digested Sludge on a
Red Sandy Soil of Natal. Water SA. 9(2) 71 – 78
Ebel, E. and Schlosser, W. 2000. Estimating the Annual Fraction of Eggs
Contaminated with Salmonella enteritidis in the United Sates. International Journal of
Food Microbiology. 61. 51-62
ERWAT, 1996. Ascaris Enumeration. East Rand Water Care Company. Gauteng,
South Africa
ERWAT, 2002. Sludge Analysis Report. Olifantsfontein. East Rand Water Care
Company. Gauteng, South Africa
EPA, 1999. Environmental Regulations and Technology. Control of pathogens
and vector attraction in sewage sludge. U.S. Environmental Protection Agency.
EPA/625/R-92-013. 111pp
Fratamico, P.M. and Strobaugh, T.P. 1998. Simultaneous Detection of Salmonella
spp and Escherichia coli O157:H7 by Multiplex PCR. Journal of Industrial
Microbiology and Biotechnology. 21. 92-98
Gaspard, P. and Schartzbrod, J. 1993. Determination of the Parasitic Contamination
of Irrigated Vegetables. Water Science and Technology. 27(7-8). 295 -302
Guo, X., Chen, J., Beuchat, L.R. and Brackett, R.E. 2000. PCR Detection of
Salmonella enterica Serotype Montevideo in and on Raw Tomatoes Using Primers
Derived from hilA. Applied and Environmental Microbiology. 66(12). 5248 - 5252
86
University of Pretoria etd – Chale-Matsau, J R B (2005)
Henning, B., Snyman, H.G. and Aveling, T.A.S. 1999. The Cultivation of Maize on
High Sewage Sludge Dosages at Field Scale. Proceedings of Specialised
Conference on Disposal and Utilization of Sewage Sludge: Treatment Methods and
Application Modalities. Athens, Greece
Hyde, H.C. 1976. Utilization of Wastewater Sludge for Agricultural Soil
Enrichment. Journal of Water Pollution Control Federation. 48(1). 77-90
Jones, P.W. 1980. Health hazards associated with the handling of animal wastes.
Veterinary Record. 106. 4-7
Jones, D.L. 1999. Potential Health Risks Associated with the Persistence of
Escherichia coli O157:H7 in Agricultural Environments. Soil Use and Management.
15. 76 –83
Kudva, I.T., Blanch, K. and Hovde, C.J. 1998. Analysis of Escherichia coli O157:H7
Survival in Ovine or Bovine manure and Manure Slurry. Applied and Environmental
Microbiology. 64(9). 3166-3174
Lotter, L.H. and Pitman, A.R. 1997. Aspects of Sewage Sludge Handling and
Disposal. WRC Report 316/1/97
Melloul, A.A. and Hassani, L. 1999. Salmonella infection in children from the
wastewater-spreading zone of Marrakesh city (Morocco). Journal of Applied
Microbiology. 87. 536 -539
Monpoeho, S., Maul, A., Mignotte-Cadiergues, B., Schwartzbrod, L., Billaudel, S.
Ferre, V. 2001. Best Viral Elution Method Available for Quantification of
Enteroviruses in Sludge by Both Cell Culture and Reveres Transcription-PCR.
Applied and Environmental Microbiology. 67(6). 2484 -2488
87
University of Pretoria etd – Chale-Matsau, J R B (2005)
Penner, K.P. 1998. Microorganisms and Foodborne Illness. Food Safety. Kansas
State University. http://www.oznet.ksu.edu
Petterson, S.R., Ashbolt, N.J. and Sharma, A. 2001. Microbial risk from wastewater
irrigation of salad crops: A screening-level risk assessment. Water Environment
Research. 72(6). 667 -672
Rudolfs, W., Falk, L.L. and Ragotzkie, R.A. 1951. Contamination of Vegetables
Grown in Polluted Soil. Sewage and Industrial Wastes . 23. 992 -1000
Sharma, V. K. and Carlson, S.A. 2000. Simultaneous Detection of Salmonella Strains
and Escherichia coli O157:H7 with Fuorogenic PCR and Single – Enrichment-Broth
Culture. Applied and Environmental Microbiology. 66(12). 5472 -5476
Sidhu,J., Gibbs, R.A., Ho, G.E. and Unkovich, I. 1999. Selection of Salmonella
Typhimurium as an Indicator for Pathogen Regrowth Potential in Composted
Biosolids. Letters in Applied Microbiology. 29. 303 –307
Snyman, H.G., De Jong, J.M. and Aveling, T.A.S. 1998. The Stabilization of Sewage
Sludge Applied to Agricultural land and the Effects on Maize Seedlings. Water
Science and Technology. 38(2). 87 –95
Solomon, E.B., Yaron, S. and Matthews, K.R. 2002. Transmission of Escherichia
coli O157:H7 from Contaminated Manure and Irrigation Water to Lettuce Plant Tissue
and its Subsequent Internalization. Applied and Environmental Microbiology. 68(1).
397 -400
Strauch, D. 1991. Survival of Pathogenic Micro-organisms and Parasites in Excreta,
Manure and Sewage Sludge. Revue Scientifique et Technique Office International
des Epizoooties. 10(3). 813 -846
88
University of Pretoria etd – Chale-Matsau, J R B (2005)
Tester, C.F. and Parr, J.F. 1983. Intensive vegetable production using compost.
Biocycle. 22(1). 34 -36
Tsai, Y-L. and Olson, B.H. 1990. Effects of Hg2+, CH3-Hg+, and Temperature on the
Expression of Mercury Resistance Genes in Environmental Bacteria. Applied and
Environmental Microbiology. 56(11). 3266-3272
Wachtel, M.R., Whitehand, L.C. and Mandrell, R.E. 2002. Association of Escherichia
coli O157:H7 with Preharvest Leaf Lettuce upon Exposure to Contaminated Irrigation
Water. Journal of Food Protection. 65(1). 18 -25
Walls, I. And Scott, V.N. 1997. Use of Predictive Microbiology in Microbial Food
Safety Risk Assessment. International Journal of Food Microbiology. 36. 97 -102
WRC, 1997. Permissible Utilisation and Disposal of Sewage Sludge. 1st Edition.
Water Research Commission. TT8597. 23pp
89
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 5
Identification of Pathogenic Bacteria from Solanum tuberosum
Grown in Sewage Sludge Amended Soil.
5.1 Introduction
Control of microbiological quality of crops is important, since microorganisms
may survive beyond the harvesting season and proliferate in crops during
storage or processing (Strauch, 1991). If pathogenic microorganisms prevail in
crops, it could become a source of microbial contamination that may eventually
cause disease.
Bacterial communities have traditionally been compared by analysing isolates
cultivated on media. However, a number of laboratories prefer the molecular
techniques, due to the increased sensitivity of these methods (Wintzingerode et
al., 1997; Boon et al., 2000; Amann and Ludwig, 2000). The Polymerase Chain
Reaction (PCR) is the basis of molecular identification methods. The technique
was developed to amplify DNA until there is enough to be detected, allowing
even organisms occurring in small numbers in an environment to be detected
(Wintzingerode et al., 1997).
The 16S rRNA gene, which codes for the small subunit of the ribosome is
commonly used to identify organisms (Borneman et al., 1996).
Ward and
colleagues (1992) have illustrated the value of rRNA sequence analysis in the
identification of bacteria . The rRNAs are universally distributed amongst cellular
forms, and therefore useful for studies of all microorganisms (Brown, 1994). The
functional constraints in this molecule result in a high degree of sequence
conservation that permits bacterial characterization based on sequence
information obtained from mixed communities (Klappenbach et al., 2001).
90
University of Pretoria etd – Chale-Matsau, J R B (2005)
Molecular methods for microbial diversity assessment rely primarily on PCRamplification of 16S rRNA genes from complex samples followed by cloning and
sequencing (Brown, 1994; Brown, 1995; Klappenbach et al., 2001). The use of
molecular techniques to investigate microbial diversity has been applied widely in
environmental samples (Wintzingerode et al., 1997; Boon et al., 2000; Wattiau et
al., 2001; Jeon et al., 2003). The ultimate goal of a PCR-mediated analysis of
16S rRNA genes is the retrieval of sequence information, which allows
determination of microbial diversity (Wintzingerode et al., 1997).
This chapter investigated the bacterial community present in contaminated soil
and potatoes using molecular techniques. The study sought to investigate the
prevalence of pathogenic microorganism in crops grown in soil treated with
sewage sludge in order to establish if these crops are potentially hazardous to
human health.
5.2 Materials and Methods
5.2.1 Potato Samples
Low and high metal sludges were used at the application rates of 8 and 16
tons/ha to grow potatoes. This experiment was carried out in green houses under
controlled conditions (the experimental layout was described in detail in Chapter
4). In chapter 4, the potatoes grown in LMS showed microbial contamination at
harvest time. These potatoes and the sludge-treated soil in which they were
grown (Chapter 4), warranted further study.
5.2.2 Extraction of Genomic DNA
Two (2) grams from each of the 3 soil samples and 2 g of the mashed potato
peel, from each of the 3 contaminated potatoes used, were suspended in ringer
solution. This was done in duplicate.
As samples were concentrated, serial
91
University of Pretoria etd – Chale-Matsau, J R B (2005)
dilutions were made. The suspension was plated out on nutrient agar and also on
Chromocult agar and incubated for 18-24 hrs at 37 oC.
Nutrient agar is a
universal medium in which most bacteria would grow, and the Chromocult
coliform agar is a selective culture medium for detection of Enterobacteriaceae
(Byamukama et al., 2000). Single colonies were picked and transferred to LB
(Luria Bertani) broth in Erlenmeyer flasks, and incubated at 37 oC for 18-24 hrs.
The cell suspensions were transferred to sterile plastic tubes. The optical density
(OD) of cell suspensions was measured at 620 nm. To calculate the number of
cells needed for further use the following formula was used:
V (µl) =
0.2
/OD260 X 1000 ……………………………………………………… (1)
The appropriate volume of
cells was harvested and transferred to a clean
Epperndorf tube and centrifuged at 12 000 g for 10 minutes.
The pellet was suspended in 100 µl Tris-HCl buffer (10mM, pH 8.2). DNA
extraction from the bacterial cultures was carried out using the DNA extraction kit
purchased from Qiagen and conducted according to the manufacturer’s
instructions.
5.2.3 PCR Amplification of the 16S rRNA Gene
The 16S rRNA gene was amplified using primers rP2 and fD1 as described by
Weisburg and colleagues (1991). Sequences for these primers are indicated in
Table 5.1. PCR amplification was carried out in 50 µl mixtures that comprised the
following: 5 µl template, 1.5 mM MgCl2, 1.5 mM dNTP, 12.5 ρmole FD1, 12.5
ρmole rP2 and 0.5U Taq DNA polymerase (Southern Cross Biotechnologies) and
10 mM Tris-HCl pH 9.0. Sterile distilled water was used to make the mixture up to
a volume of 50 µl.
92
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 5.1 Sequences of Primers used
Primer
Sequence
Reference
rP2
5’ ACGGCTACCTTGTTACGACTT 3’ Weisburg et al (1991)
FD1
5’ AGAGTTTGATCCTGGCTCAG 3’
Weisburg et al. (1991)
Amplification was carried out on a Perkin Elmer GeneAmp PCR System 2400
thermocycler using the following thermal profile: initial denaturation step at 95 oC
for 3 minutes, thirty cycles denaturation (94 oC for 30 seconds), annealing (55 oC
for 30 seconds), and extension (72 oC for 1 minute). An additional extension step
of 7 minutes was performed after completion of the thirty cycles.
5.2.4 Agarose Gel Electrophoresis
To evaluate the success of amplification, the PCR product was electrophoresed
through a 1% agarose gel (containing 3 µl ethidium bromide (10 mg/ml))
suspended in 1x TAE buffer (40mM Tris-HCl, 20 mM NaOAc and 1 mM EDTA,
pH 8.5) for 30 minutes at a current of 42 Amps and a voltage of 100 V. The gel
was assessed under UV for the presence of bands.
5.2.5 DNA Purification
Since residual reaction components, such as unincorporated dTNPs, primers
and residual enzyme can interfere with subsequent DNA sequencing
methodologies, PCR product was purified. This purification was done using the
Qiagen PCR Purification Kit (Southern Cross Biotechnologies, South Africa)
according to the manufacture’s instructions. To assess the purity and
concentration of the purified product, 1 µl was subjected to electrophoresis on a
1% agarose gel [Promega].
93
University of Pretoria etd – Chale-Matsau, J R B (2005)
5.2.6 Cloning
The PCR products were cloned into the pDrive cloning vector supplied in the
Qiagen PCR cloning kit (Southern Cross Biotechnologies) according to the
manufacture’s instructions.
Plasmids were introduced into competent E. coli
DH5α cells. Both a negative and a positive control were prepared. About 200 µl
drawn and plated on the AMP plates (smeared with 10 µl IPTG and 40 µl XGAL)
and incubated for 18 -24 hours at 37 oC. Recombinants were isolated according
to standard protocols (Saambrook et al., 1989).
5.2.7 Plasmid Extraction
About 1.5 ml cell suspension was centrifuged for 3 minutes. The pellet was
resuspended in 100 µl of Solution I and left on ice for 5 minutes. About 200 µl of
Solution II was added to the mixture and left on ice for a further 5 minutes.
Solution III (150 µl) was added and left on ice another 5 minutes. The mixture
was centrifuged at high speed for 5 minutes and transferred to a new
microcentrifuge tube. Two volumes of 100% EtOH were added and incubated at
room temperature for 1 hour. This mixture was centrifuged for 15 minutes at high
speed. The pellet was washed with 1 ml of 70% EtOH, centrifuged for 5 minutes
and air dried to remove excess EtOH. The pellet was dissolved in 30 µl TE
buffer.
5.2.8 Plasmid Purification
Sterile dH2O was added to the sample to a final volume of 200 µl. Phenol (200
µl) was added and centrifuged for 5 min. Chloroform-isoamyl alcohol (24:1) (200
µl) was added and centrifuged for 5 min at full speed. Two volumes of 100%
Ethanol (EtOH) and Sodium acetate (NaoAc) to a final concentration of 1.8 mM,
were added to the supernatant and this was left on ice for 1 hour. The precipitate
was washed with 70% EtOH, and suspended in 15 µl sterile distilled water.
94
University of Pretoria etd – Chale-Matsau, J R B (2005)
5.2.9 Restriction enzyme
The restriction enzyme reaction was carried out to determine successful cloning.
The reaction used the restriction enzyme, EcoRI (Roche Molecular Diagnostics,
South Africa) according to the manufacture’s instructions. Electrophoresis was
also carried out to evaluate the action of the restriction enzyme using the λ EcoRI
/ Hind III (Roche Molecular Diagnostics, South Africa) as a molecular weight
marker.
5.2.10 Sequencing
Sequencing was carried out in 10 µl reaction volumes that comprised of the
following: 2 µl of purified plasmid, 2 µl ready reaction pre-mix (supplied with the
sequencing kit, containing dye terminators, dNTPs, Taq DNA Polymerase,
MgCl2, and Tris-HCl buffer pH 9.0), and 10 ρmol of rP2 primer (Weisburg et al.,
1991). The reactions were carried out in a Perkin Elmer GeneAmp PCR System
2400 thermocycler and comprised of 25 cycles of denaturation (96 oC for 5
seconds), annealing (50 oC for 5 seconds) and extension (60oC for 4 minutes). At
the end of the cycles, the reactions were kept at 4oC until needed.
5.2.11 DNA Precipitation
Products of the sequencing reactions were precipitated with 60% (v/v) ethanol at
room temperature for 15 minutes, centrifuged at 12 000 g for 15 minutes, washed
with 70% (v/v) ethanol, vacuum dried and stored at -20 oC until needed.
95
University of Pretoria etd – Chale-Matsau, J R B (2005)
5.2.12 Sequence Determination
Sequencing samples were run overnight on an ABI 377 Automated Sequencer at
the sequencing facility at the University of Pretoria, South Africa. Sequence
identity was determined using the BLAST search tool.
5.3 Results and Discussion
5.3.1 DNA Extraction and PCR Amplification of the 16S Gene.
In this chapter, DNA was extracted from sewage contaminated soil and potatoes
grown in such soil, and the 16S rRNA genes of viable bacteria amplified.
Representative colonies from Nutrient agar and Chromocult coliform agar were
used for DNA extraction. The DNA extraction method described earlier resulted
in pure DNA suitable for PCR amplification. The PCR product showed sufficient
DNA amplification, which was subsequently cloned. The white colonies obtained
following plating of the ligation reaction, suggested successful cloning.
Restriction enzyme treatment confirmed DNA transfer to the vector (Figure 5.1).
96
λ
EcoRI/
HindIII
B14
B12
B10
B4
B3
B1
University of Pretoria etd – Chale-Matsau, J R B (2005)
21,227bp
5,148bp
2,027bp
1,904bp
1,587bp
1,375bp
564bp
125bp
Figure 5.1 Agarose gel electrophoresis following restriction enzyme
treatment.
Three bands were visualized from each of the samples. These were estimated to
be in the regions of 200, 500 and 800 bp (Figure 5.1), which are fragments
resulting from the restriction of the 1,5 kb PCR amplicon of the 16S rRNA
molecule (Weisburg et al., 1991). These estimates are based on the comparison
with the band sizes of the molecular weight marker (λ EcoRI/ HindIII). This
marker yields fragments ranging
in size
from 21kb to 125 bp.
The PCR
amplication of the 16S rRNA gene using primers fD1 and rP2 resulted in the
detection of an amplified fragment of about 1500 bp for all isolates. This
97
University of Pretoria etd – Chale-Matsau, J R B (2005)
corresponds to the size of 16S rRNA genes previously determined by Brosius
and colleagues (1978).
5.3.2 Homology Searches Using the BLAST.
Each 16S rRNA sequence was compared with the sequence in Genbank
according to the BLAST search tool. Organisms identified from the matched
sequences are tabulated below (Tables 5.2 and 5.3). Sequence analyses of the
16S rRNA gene remains one of the most reliable indicators for revealing the
identity of the organisms (Wintzingerode et al., 1997; Amann and Ludwig, 2000).
In this study, generated sequencing data of studied isolates, yielded unique
matches for most isolates, with the Genbank sequence database. However,
sequence similarity was observed between some isolates.
Most of the microorganisms identified in this study were found not to be primary
human pathogens, but those that normally exist in the environment, in the soil,
water or in plants. Plant pathogens in sewage sludge may originate from washing
of vegetable and fruit (Beauchat, 1998). These organisms may cause
opportunistic diseases in individuals with suppressed immune systems
(Greenwood, 1997).
As indicated in Table 5.2, according to the sequencing data, the sludge
contaminated soil yielded a variety of microorganisms. Other than the Klebsiella
spp., Enterobacter sp, Proteus sp and Escherichia coli, which are enteric
organisms found commonly in the gastrointestinal tract of humans and animals,
bacteria identified were predominantly Bacillus spp, which are usually found in
soil, water and rarely in plant material (Greenwood et al., 1997).
Infections associated with sewage sludge use may result from contaminated
crops (Rudolfs, 1951; Pahren et al., 1979; Cieslak et al., 1993), airborne particles
(Dutkiewicz, 1997) or unintentional ingestion of pathogens from contaminated
98
University of Pretoria etd – Chale-Matsau, J R B (2005)
hands, utensils or surfaces. Farm workers may also be infected (Pande et al.,
2000). Although agricultural application of sewage sludge on food crops has
been used by some countries over the years (Rudolfs, 1951; Dorn et al., 1985;
Strauch, 1991), it has been reported that use of pathogen containing sludge
could result in a broad variety of infections (Burge and Marsh, 1978; Pell, 1997;
NRC, 1996).
Table 5.2 Organisms identified in contaminated soil
Organism
Percentage match
Bacillus firmus
97%
Bacillus pumilis
99%
Enterobacter aerogenes
98%
Proteus mirabilis
100%
Klebsiela oxytoca
99%
Bacillus sphaericus
99%
Bacillus luciferensis
99%
Klebsiella pneumoniae
98%
Bacillus niacini
99%
Bacillus drentensis
99%
Pantoea sp.
98%
Klebsiella fusiformis
98%
Escherichia coli
99%
Klebsiela ornithinolytica
99%
Bacteria of the genus Klebsiella are opportunistic pathogens that can lead to
severe diseases such as septicemia, and urinary tract and soft tissue infections
(Jonas et al., 2004). For instance Klebsiella oxytoca is one of the organisms often
implicated in antibiotic associated diarrhoea (Ayyagari et al., 2003), while K.
oxytoca and K. pneumoniae have been associated with outbreaks in newborn
babies (Westbrook et al., 2000). These pathogens are also capable of being
airborne and have been implicated in respiratory problems that occurred
99
University of Pretoria etd – Chale-Matsau, J R B (2005)
following land application of sludge (Dutkiewicz, 1997). Small Wright (2002)
recently reported the occurrence of three deaths in Pennsylvania, USA that
occurred as a result of exposure to sludge spread fields.
Bacillus spp are usually implicated in food poisoning. They are capable of
forming endospores during unfavourable conditions, whereby the interior of the
cell transforms into a multi-layered structure around the bacterial DNA (Walker,
1998). The spores can survive adverse environments and grow again when
conditions improve. If contaminated food is cooled slowly or kept warm before
serving they will germinate (Walker, 1998). Some species such as Bacillus
licheniformis have been implicated in nosocomial infections (Matsumoto et al.,
2000), while B. fusiformis is the causative agent for noma (Deeb et al., 1999).
Bacteria detected in potato samples were mostly plant pathogens or
environmental organisms (Table 5.3). Erwinia spp are responsible for plant
diseases such as soft rot (Erwinia carotovora), vascular wilts (Erwinia stewartii)
and fire blight (Erwinia amylovora), especially in potato (Pérombelon and
Kelman, 1980; Cappellini et al., 1984, Prescott et al., 2002). Although these are
primarily plant invaders, some Erwinia spp such as E. amylovara are
opportunistic pathogens implicated in cases of septicimia, urinary tract infections,
conjunctivitis and endophthalmitis (Faulde et al., 2001). Pectobacterium spp are
also plant pathogens, known to cause blackleg and soft rot (Toth et al., 2003).
Four Buttiauxella spp were isolated from the potato samples. Of these,
Buttiauxella agrestis, B. noackie and B gaviniae have been implicated in the
urinary bladder infection of a spinal cord patient. The frequent occurrence of
Buttiauxella spp is normally in mollusks, mainly snails and slugs, and they have
been isolated from soil but rarely from humans (Muller et al., 1996).
Plant pathogens are not known to cause disease in humans with competent
immune systems. However they can provide a route of entry for human
pathogens as they cause lesions for easy entry. Earlier, Wells and Butterfield
100
University of Pretoria etd – Chale-Matsau, J R B (2005)
(1997) indicated that the incidence of Salmonella spp on fruits and vegetables
affected by bacterial soft rot is far greater than in healthy produce as this
provides favourable environment for replication.
Several Pantoea spp and an Enterobacter spp were identified in the samples.
Pantoea spp are coliform bacteria that are often isolated from the environment
(Greenwood et al., 1997).
Strauch (1991) also reported on the presence of
Enterobacter spp in sludge. Most Enterobacter spp are enteric organisms that
make up the normal flora of the human gastrointestinal tract. These species can
cause urinary tract infections and other opportunistic infections on various parts
of the body (Greenwood et al., 1997). Rolph and colleagues (2001) also using
the molecular technique found some Pantoea spp and Enterobacter spp in
endodontic infections.
Recently, Staskawicz and his colleagues (2001) have reported on the ability of
some bacteria to harm both animal and plant hosts. However, as their common
habitat is not directly linked to humans or animals, but the environment, their
presence in contaminated crop may not necessarily implicate sewage sludge as
the source.
Enterobacter agglomerans also referred to as Pantoea agglomerans, is found in
water and soil and has only occasionally been isolated from humans. P.
agglomerans is a causative agent for allergic alveolitis in workers exposed to
sewage sludge (Dutkiewicz, 1997). This organism has also been implicated in
neonatal meningitis and sepsis (Greenwood et al., 1997).
101
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 5.3 Organisms identified from potatoes following sequencing
Organism
Percentage closeness
Pantoea agglomerans
99%
Enterobacter agglomerans
99%
Pantoea agglomerans
99%
Erwinia carotovora
99%
Pantoea ananatis
98%
Pantoea toletana
98%
Erwinia amylovora
97%
Pectobacterium carotovorum
99%
Pectobacterium chrysanthemi
98%
Buttiauxela agrestis
98%
Buttiauxela ferragutia
97%
Buttiauxela noackiae
97%
Buttiauxela gaviniae
98%
5.3.3 Bacteria Associated with Sewage Sludge Use
Table 5.4 details the organisms that are usually found in sludge and organisms
detected in this study following sludge use. In this study, human pathogens
known to be sludge borne (Chapter 2) were mostly detected in the sewage
sludge samples as indicated earlier in Chapter 3.
However, most of these
organisms were not detected in the soil or potato samples.
102
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 5.4 Bacteria associated with sludge use
Organism
Sludge
Sewage
Sewage sludge
Potatoes from
borne
sludge
treated soil
sludge treated soil
(Chapter 2)
(Chapter 3)
(Chapter 4 & 5)
(Chapter 4 & 5)
Achromobacter spp
3
3
2
2
Acitenobacter calcoaceticus
2
3
2
2
Bacillus spp
3
2
3
2
Brevibacterium spp
2
3
2
2
Buttiauxela spp
2
2
2
3
Cellulomonas hominis
2
3
2
2
Chromobacterium violaceum
3
3
2
2
Citrobacter spp
3
2
2
2
Clostridium spp
3
2
2
2
Enterobacter spp
3
3
3
3
Erwinia spp
2
2
2
3
Escherichia coli
3
3
3
3
Exiguobacterium acetylicum
2
3
2
2
Klebsiella spp
3
3
3
2
Leclercia adecarboxylata
2
3
2
2
Leptospira spp
3
2
2
2
Listeria spp
3
2
2
2
Mycobacterium spp
3
2
2
2
Oligella urethralis
2
3
2
2
Pantoea spp
3
3
3
3
Pectobacterium spp
2
2
2
3
Proteus spp
3
2
3
2
Providencia spp
3
2
2
2
Pseudomonas spp
3
3
2
2
Raoutella terrigena
2
3
2
2
Rhodococcus australis
2
3
2
2
Salmonella spp
3
3
3
3
Serpens flexibilis
2
3
2
2
Serratia spp
3
3
2
2
Shigella spp
3
2
2
2
Staphylococcus spp
3
3
2
2
Streptococcus spp
3
2
2
2
Vibrio cholerae
3
2
2
2
Yersinia enterocolitica
3
2
2
2
103
University of Pretoria etd – Chale-Matsau, J R B (2005)
Organisms detected from soil or potato samples using molecular techniques
were mostly opportunistic pathogens that may cause infection at the advent of
limited immune capacity. They take advantage of weakened host defense
systems to colonize and elicit a variety of disease states. Thus, their presence in
crops could lead to adverse effects in individuals with compromised immune
system such as pregnant women, children, the elderly, cancer patients and those
suffering from HIV/AIDS (Greenwood et al., 1997). Considering the high
incidence of HIV infection in South Africa (Dorrington et al., 2002), the use of
inadequately treated sludge could result in a large number of the population
being sick.
Although a number of viable bacteria belonging to the Enterobacteriaceae were
found in the potato, neither E.coli nor Salmonella spp (also members of this
group) were identified from the sequencing results. Salmonella spp and E.coli are
amongst organisms of major concern with regards to sludge use (EPA, 1999).
The absence of Salmonella spp and E.coli in potato samples reserved for
molecular studies may be as a result of the unfavourable environmental and
refrigerator conditions.
Although the types of organisms identified in this study may not necessarily
present a complete community due to the cost of the molecular technique, they
however provide a representation of the types of pathogens in this environment.
104
University of Pretoria etd – Chale-Matsau, J R B (2005)
5.4 Conclusion
Bacteria identified in the sludge-contaminated soil were predominantly nonenteric and of environmental origin, probably out-competing the enteric
pathogens, as enteric organisms survive well in the human and animal gut and
not in the environment.
It appears that growing even high risk crops such as potato using sewage sludge
contaminated soil may not lead to a high infestation of produce with primary
human or animal pathogens. However, even though limited, the presence of
human pathogens detected at harvest may cause infection if ingested.
Considering the opportunistic tendency of the secondary pathogens and the
prevailing state of weakened immune systems of the South African population,
proper treatment of sewage sludge prior to use in agriculture is essential.
Organisms identified from potatoes were mainly plant pathogens. Bacterial soft
rot in crops caused by plant pathogens such as Erwinia spp could lead to interior
contamination of crops with human pathogens, if untreated sewage sludge is
used.
If sewage sludge is used in agricultural land, routine analysis of harvested crops
has to be in place for quality assurance purpose.
105
University of Pretoria etd – Chale-Matsau, J R B (2005)
5.5 References
Amann, R. and Ludwig, W. 2000. Ribosomal RNA-targeted Nucleic Acid Probes
for Studies in Microbial Ecology. FEMS Microbiology Reviews. 24. 555-565
Ayyagari, A., Agarwal, J. and Garg, A. 2003. Antibiotic Associated Diarrhoea:
Infectious Causes. Indian Journal of Medical Microbiology. 21(1). 6-11
Beauchat, L.R. 1998. Surface Decontamination of Fruits and vegetables Eaten
Raw:
A
Review.
Food
Safety
Issues.
World
Health
Organization.
WHO/FS/FOS/98.2. 16pp
Boon, N., Marlé, C., Top, E.M. and Verstraete, W. 2000. Comparison of the
Spatial Homogeneity of Physico-chemical parameters and bacterial 16S rRNA
genes in Sediment Samples from a Dumping Site for Dredfing Sludge. Applied
Microbiology and Biotechnology. 53. 742-747
Borneman, J., Skroch, P.W., O’Sullivan K.M., Palus, J.A., Rumjanek, N.G.,
Jansen, J.L., Niehuis, J. and Triplett, E.W. 1996. Molecular Microbial Diversity of
an Agricultural Soil in Winsconsin. Applied and Environmental Microbiology.
62(6). 1935-1945
Burge, W.D. and Marsh, P.B. 1978. Infectious Disease Hazards of landspreading
Sewage Wastes. Journal of Environmental Quality. 7(1). 1-9
Brosius, J., Palmer, M.L., Kennedy, P.J. and Noller, H.F. 1978. Complete
nucleotide Sequence of a 16S Ribosomal rRNA gene from E.coli. Proceedings of
the National Academy of Sciences USA. 75. 4801-4805
Brown, T.A. 1994. DNA Sequencing. Oxford University Press. New York. 101pp
106
University of Pretoria etd – Chale-Matsau, J R B (2005)
Brown, T.A. 1995. Gene Cloning. 3rd Ed.Chapman and Hall. New York. 334pp
Byamukama, D., Kansiime, F., Mach, R.L. and Farnleitner, A.H.
2000.
Determination of Escherichia coli Contamination with Chromocult Coliform Agar
Showed a High Level of Discrimination Efficiency for Differing Fecal Pollution
Levels in Tropical Waters of Kampala, Uganda. Applied and Environmental
Microbiology. 66(2). 864-868
Cappellini, R.A., Ceponis, M.J. and Lighter, G.W. 1984. Disorders in Potato
Shipments to the New york Market, 1972-1980. Plant Disease. 68. 1018-1020
Cieslak, P.R., Barrett, T.J., Griffin, P.M., Gensheimer, K.F. Beckett, G.,
Buffington, J. and Smith, M.G. 1993. Escherichia coli O157:H7 Infection from a
Manured garden. The Lancet. 342. 367
Deeb, G.R., Yih, W-Y., Merrill, R.G. and Lundeen, R.C. 1999. Noma: Report of a
Case Resulting in bony ankylosis of the Maxilla and Mandible. Dentomaxillofacial
Radiology. 28. 378-382
Dorrington, R., Bradshaw, D. and Budlender, D. 2002. HIV/AIDS Profile in the
Provinces of South Africa. Indicators for 2002. Medical Research Council, South
Africa. 31pp
Dorn, C.R., Reddy, C.S., Lamphere, D. N., Gaeuman, J.V. and Lanese, R. 1985.
Municipal Sewage Sludge Application on Ohio Farms: Health Effects.
Environmental Research. 38. 332-359
Dutkiewicz, J. 1997. Bacteria and Fungi in Organic Dust as Potential Health
Hazard. Annals of Agricultural and Environmental Medicine. 4. 11-16
EPA, 1999. Environmental Regulations and Technology. Control of pathogens
107
University of Pretoria etd – Chale-Matsau, J R B (2005)
and vector attraction in sewage sludge. U.S. Environmental Protection Agency.
EPA/625/R-92-013. 111pp
Faulde, M., Sobe, D., Burghardt, H. and Wermter, R. 2001. Hospital Infestation
by the Cluster Fly, Pollenia rudis sesu stricto Fabricus 1794 (Diptera:
Calliphoridae), and its Possible Role in Transmission of Baterial Pathogens in
Germany. International Journal of Hygiene and Environmental Health. 203. 201204
Greenwood, D., Slack, R.C.B. and Reutherer, J.F. 1997. Medical Microbiology. A
Guide to Microbial Infections: Pathogenesis, Immunity, Laboratory Diagnosis and
Control. 15th Ed. Churchill Livingstone. London. 690pp
Jeon, C.O., Lee, D.S. and Park, J.M. 2003 Microbial communities in Activated
Sludge Performing Enhanced Biological Phosphorus Removal in a Sequencing
Batch Reactor. Water Research. 37. 2195-2205
Jonas, D., Spitzmuller, B., Dashner, F.D., Verhoef, J. and Brisse, S. 2004.
Discrimination of Klebsiella pneumoniae and Klebsiella oxytoca Phylogenetic
Groups and othe Klebsiella species by use of Amplified Fragment Length
Polymorphism. Research Microbiology. 155(1). 17-23
Klappenbach, J.A., Saxman, P.R., Cole, J.R. and Schmidt, T.M. 2001. Rrndb: the
Ribosomal RNA Operon Copy Number Database. Nucleic Acids Research. 29(1)
181-184
Matsumoto, S. Suenaga, H., Naito, K., Sawazaki, M, Hiramatsu, T. and Agata, N.
2000. management of Suspected Nosocmial Infection: An Audit of 19
Hospitalized Patients with Septicemia Caused by Bacillus Species. Japanese
Journal of Infectious Diseases. 53. 196-202
108
University of Pretoria etd – Chale-Matsau, J R B (2005)
Muller, H.E., Brenner, D.J., Fanning, G.R., Grimont, P.D. and Kampfer, P. 1996.
Emended Description of Buttiauxella agretis with Recognition of Six New Species
of Buttiauxella and Two New Species of Kluyvera: Buttiauxella ferragutiae sp.
nov., Buttiauxella gaviniae sp. nov., Buttiauxella brennerae sp. nov., Buttiauxella
izardii sp. nov., Buttiauxella noackie sp. nov., Buttiauxella warmboldiae sp. nov.,
Kluyvera cochleae sp. nov., and Kluyvera Georgiana sp. nov. International
Journal of Systematic Bacteriology. 40(1) 50-63
NRC, 1996. Use of Reclaimed Water and Sludge in Food Crop Production.
Committee on the Use of Treated Wastewater Effluents and Sludge in the
Production of Crops for Human Consumption. Water Science and Technology
Board. Commission on Geosciences, Environment and Resources. National
Research Council. National Academy of Press, Washington, DC
Pande, B. N., Krysinska-Traczyk, E., Prazimo, Z., Skorska, C., Sitkowska, J. and
Dutkiewicz, J. 2000. Occupational Biohazards in Agricultural Dusts from India.
Annals of Agricultural and Environmental Medicine. 7. 133-139
Pahren, H.R., Lucas, J.B., Ryan, J.A. and Dotson, G.K.
1979. Health Risks
Associated with Land Application of Municipal Sludge. Journal of Water Pollution
Control Federation. 51(11) 2588-2601
Pell, A.N. 1997. Manure and Microbes: Public and Animal Health Problem?
Journal of Dairy Science. 80. 2673-2681
Pérombelon, M.C.M. and Kelman, A. 1980. Ecology of the Soft Rot Erwiniae.
Annual Reviews of Phytopathology. 18. 361-387
Prescott, L.M., Harley, J.P. and Klein, D.A. 2002. Microbiology 5th ed. McGrawHill. New York. 1026pp
109
University of Pretoria etd – Chale-Matsau, J R B (2005)
Rolph, H.J., Lennon, A., Riggio, M.P., Saunders, W.P., MacKenzie, D., Coldero,
L. and Bagg, J. 2001. Molecular Identification of Microorganisms from Endodontic
Infections. Journal of Clinical Microbiology. 39(9) 3282-3289
Rudolfs, W., Falk, L.L. and Ragotzkie, R.A. 1951. Contamination of Vegetables
Grown in Polluted Soil. Sewage and Industrial Wastes . 23. 992 -1000
Saambrook, J.E., Fritsch, E.F. and maniatis, T.A. 1989. Molecular Cloning: A
Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, New Yrok. Cold
Spring Harbor laboratory
Small Wright, M. 2002. Sewage Sludge/Biosolids. A health and Environmental
Crisis and Scandal. Perelandra Center for Nature Reseach. Perelandra Health
Watch http://www.prelandra-itd.com/AB1473/webpage.cfm
Staskawicz, B.J., Mudgett, M.B., Dangl, J.L. and Galan, J.E. 2001. Common and
Contrasting Themes of Plant and Animal Diseases. Science. 292. 2285-2289
Strauch,
D. 1991. Survival of pathogenic Microorganisms and Parasites in
Excreta, Manure and Sewage Sludge. Revue Scientifique et Technique office
International des Epizooties .10(3). 813-846
Toth, I.K, Bell, K.S., Holeva, M.C. and Birch, P.R.J. 2003. Soft Rot Erwiniae:
From Genes to Genomes. Molecular Plant Patholgy. 4(1). 17-30
Walker, T.S. 1998. Microbiology. W.B. Saunders Company, London. 504pp
Wattiau, P., Renard, M.E., Ledent, P., Debois, V., Blackman, G. and Agathos,
S.N. 2001. A PCR Test to Identify Bacillus subtilis and Closely Related Species
and its Application to the Monitoring of Wastewater Biotreatment. Applied
Microbiology and Biotechnology. 56. 816-819
110
University of Pretoria etd – Chale-Matsau, J R B (2005)
Ward, D.M., Bateson, M.M., Weller, R. and Ruff-Roberts, A. 1992. Ribosomal
RNA Analysis of Microorganisms as they Occur in Nature. In: Advances in
Microbial Ecology. Marshall, K.C. (Ed.) Plenum Press. New York. Vol 12. 219287
Weisburg, W.G., Barns, S.M., Pelletier, D.A. and lane, D,J. 1991. 16S Ribosomal
DNA Amplification for Phylogenetic Study. Journal of Bacteriology. 173. 697-703
Wells, J.M. and Butterfield, J.E. 1997. Salmonella Contamination Associated with
Bacterial Soft Rot of Fresh Fruits and Vegetables in the Marketplace. Applied
Environmental Microbiology. 62. 2567-2570
Westbrook, G.L., O’Hara, C.M., Roman, S.B. and Miller, J.M. 2000. Incidence
and Identification of Klebsiella planticola in Clinical Isolates with Emphasis on
Newborns. Journal of Clinical Microbiology. 38(4). 1495-1497
Wintzingerode, F.V., Gobel, U.B. and Stackebrandt, E. 1997. Determination of
Microbial Diversity in Environmental samples: Pitfalls of PCR-based rRNA
analysis. FEMS Microbiology Reviews. 21. 213-229
111
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 6
Microbial Risk Assessment of Using Sewage Sludge for Soil
Enrichment
6.1 Introduction
Changes in agricultural practice have over the years raised concern regarding the
risk of ingesting pathogens from vegetables irrigated with wastewater or sewage
sludge (Rudolfs et al., 1951; Brent et al., 1995; Shuval et al., 1997).
The
occurrence of foodborne diseases remains a widespread problem in both the
developing and developed world (Zwietering and van Gerwen, 2000). A systematic
evaluation of safety is therefore important to control the risk of foodborne diseases.
It is for this reason that worldwide, many initiatives are being taken to develop and
apply microbial risk analysis (Blumenthal et al., 1989; Rose and Gerba, 1991;
Zwietering and van Gerwen, 2000). While sewage sludge contaminated soil has
been shown to potentially lead to contaminated crops (Rudolfs et al., 1951), in parts
of Africa including South Africa, contaminated soil on its own is a hazard as
deliberate and direct soil ingestion is common in these areas, especially by
pregnant women in rural and peri-urban communities (Hunter, 1993; Walker et al.,
1997).
There is an increasing interest in the application of quantitative risk analysis in the
production of microbiologically safe products (Notermans and Teunis, 1996;
Petterson et al., 2001). However, the quantitative evaluation of food safety is very
complex, especially since in many case specific parameter values are difficult to
obtain (Zwietering and van Gerwen, 2000). Scarcity of data often leads to
qualitative assessments.
Individual adverse health effects related to microbial pathogens usually result from
a single acute exposure, rather than long term chronic exposure (Farber et al.,
1996). Attempts of microbial risk assessment have generally used thermotolerant
112
University of Pretoria etd – Chale-Matsau, J R B (2005)
faecal coliforms (Al-Nakshabandi et al., 1997; Shuval et al., 1997). However, unlike
many other hazards, risk assessment of bacterial pathogens is influenced by a
number of factors, including growth and possible inactivation from processing steps
such as cooking in the case of vegetables or desiccation in the case of soil.
Microorganisms are dynamic and adaptable. They can lose or acquire virulenceassociated characteristics and can also adapt to the control measures set to
manage microbial risks (Voysey and Brown, 2000). Also, consumption patterns
may vary between individuals. These differences may have strong demographic
components such as sex, age, culture and health status (Farber et al., 1996).
A risk assessment provides a means of estimating the probability of adverse effects
associated with measured or estimated levels of hazardous agents, and a tool for
predicting the extent of potential health effects (Genthe, 1998). It involves a
process that scientifically evaluates the probability of occurrence and severity of
known or potentially adverse health effects resulting from human exposure to
foodborne hazards (Zwietering and van Gerwen, 2000).
Risk assessments normally consist of four distinguishable but interacting phases
generally referred to as:
-
Hazard identification;
-
Exposure assessment;
-
Dose-response assessment and
-
Risk characterization.
These were detailed in Chapter 2 section 2.10.1
113
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.2 Health Considerations for Consumption of Contaminated vegetables
In assessing microbial risk, the benchmark of 1 infection in 10 000 people per year
is regarded as an acceptable level (Haas, 1996). This estimation is also supported
by the United States Environmental Protection Agency (Rose and Gerba, 1991;
Macler and Regli, 1993).
Infection with microbial hazard is complicated by a number of factors, that include
the fact that:
-
Microorganisms are capable of replicating;
-
The virulence and infectivity of microorganisms can change depending on
their interaction with the host and the environment;
-
Genetic material can be transferred between microorganisms leading to the
transfer of characteristics such as antibiotic resistance and virulence factors;
-
Microorganisms can be spread through secondary and tertiary transmission;
-
The onset of clinical symptoms can be substantially delayed following
exposure;
-
Microorganisms can persist in certain individuals leading to continued
excretion of the microorganism and continued risk of spread of infection and
-
Low doses of some microorganisms can cause a severe effect (Buchanan et
al., 2000).
Although sewage sludge contains various microorganisms as was indicated in
earlier chapters, for the purpose of this study, the risk assessment was carried out
only for Escherichia coli, Salmonella spp and Ascaris based on the laboratory
analysis outlined in Chapter 4.
114
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.3 Assumptions
The approach used in the health risk assessment in this study involved a
descriptive approach, which relies on estimating the frequency and severity of
exposure to health hazards. Some common assumptions include:
i
The population is equally susceptible to an exposure.
ii
Exposure is from consumption of contaminated crops (potatoes as a worst
case scenario) grown in sewage sludge amended soil. Individuals may also
be exposed to pathogens by accidentally or deliberately ingesting
contaminated soil (Walker et al., 1997).
iii Pathogenic
microorganisms
from
sludge
used
are
homogeneously
distributed in the soil.
iv It was assumed that there would be a certain degree of pathogen die-off
and/or removal from the sludge and soil until the final ingestion by an
individual in the home. These factors include settling, adsorption into soil,
biological competition, UV irradiation from sunlight and a degree of removal
and/or inactivation by washing of the vegetables. While other workers have
indicated a rapid die-off of microorganisms following wastewater irrigation of
soil (Rudolfs et al., 1951), a possible re-growth of bacteria on vegetables
have also been reported (Armon et al., 1995).
v While cooking or boiling of vegetables would reduce microorganisms, it was
assumed that cross contamination could occur during food preparation.
vi The risk of being infected by microbiological pathogens correlates with the
level of contamination and the amount of contaminated vegetables
115
University of Pretoria etd – Chale-Matsau, J R B (2005)
consumed. Higher numbers of microorganisms will indicate a higher risk of
contracting microbial infection.
vii All microorganisms ingested with the vegetable (or with the soil) are
infective.
6.4 Methodology
Due to the scarcity of epidemiological data, assessment of the risk to health from
the use of sewage sludge is based on a potential risk. This is based on accidental
consumption of contaminated soil during the growing season and also on detection
of microorganisms on the crops at the time of harvesting. The application rates of 8
tons/ha in high metal sludge and 16 tons/ha in low metal sludge were used.
Models used in this study are the beta-distribution infectivity probability model for
bacteria and the single hit exponential model for parasites (Rose and Gerba, 1991).
ß-distribution infectivity model
p = 1- (1 + (N/β)) –α………………………………………………………………… (1)
Single-hit exponential model
p = 1 – exp (-rN) ………………………………………………………….………. (2)
where p = probability of infection from a single exposure or daily risk of infection
N = exposure or number of organisms ingested per exposure
α,β,r = parameters characterized by dose response curves
In addition to the single exposure risk or daily infection, weekly, monthly and yearly
risk were calculated as 7, 30 or 365 days of exposure respectively, where
116
University of Pretoria etd – Chale-Matsau, J R B (2005)
P t = 1- ((1-Pcalc)t)
t = 7, 30 or 365
A risk of 1 in 10 000 per year is considered acceptable risk of infection.
6.4.1 E. coli
The presence of E. coli was established by culture method. The quantity of E. coli
present in 1 g of sample (soil or potatoes) was determined (Chapter 4).
Contaminated potatoes (16) were those obtained from the LMS16 in chapter 4.
This concentration was used to determine the E.coli present in 200 mg soil.
Risk estimation was based on the Beta–ditributed “infectivity probability” model.
The α and β values (0.1705 and 1.16) for E. coli are those proposed by Pepper et
al., 1996). Hypothetical values were also used to assess what levels of exposure
are associated with certain levels of risk, and to estimate what quantity of E. coli in
a (1) gram of potato or in 200 mg of soil would constitute acceptable risk.
6.4.2 Salmonella spp
The presence of Salmonella spp was determined by making use of culture method
as described in Chapter 4. Results were based on the presence (positive test) and
absence (negative test) of the organisms.
As the method used for Salmonella spp identification did not involve enumeration,
hypothetical numbers were used in the analysis. The α and β values (0.33 and
139.9) for Salmonella spp are those proposed by Rose and Gerba (1991).
117
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.4.3 Ascaris ova
At present, there appears to be no information on the dose-response data for
Ascaris. Therefore, there are no estimates for the r value for this organism. The
value (r = 0.0199) for Gardia (Rose and Gerba, 1991), another protozoan was used
in estimating the probability of infection as they have the same infective dose
(Brooks et al., 1991). Hypothetical numbers were used in analysis.
6.5 Results and Discussion
Although the present study assumed that all exposed individuals stand an equal
chance of infection, risk of infection will vary between individuals depending on a
number of factors. That is, a particular meal may pose no risk or a very high risk to
an individual depending on the processing and handling of contaminated crops.
Also factors such as the age, sex, previous exposure and immunocompetence of
an individual influence the risk of infection (Buchanan et al., 2000). Carneiro et al
(2002) could establish a link between rates of infection and socioeconomic status.
In their study, children with less intense infection came from affluent households
with higher socioeconomic and schooling profiles, while children from crowded
dwellings had most infections (Carneiro, et al., 2002).
Farm workers could be
among those at a high risk of infection, as a result of continued exposure at the
work place.
6.5.1 E. coli
Of the 224 contaminated soil samples studied throughout the experiment, 71 were
found not to have E.coli.
Estimates of risk of infection from accidentally or
deliberately ingesting 200 mg of soil contaminated with sewage sludge at different
treatment options are tabulated in Tables 6.1 to 6.4. For 8 tons/ha high metal
sludge (HMS), the risk is reduced by week six due to pathogen die-off (Table 6.1).
The HMS at an application rate of 16 tons/ha shows far less risk than both LMS 8
tons/ha and 16 tons/ha (Tables 6.3 and 6.4). Application rate of 16 tons/ha LMS
118
University of Pretoria etd – Chale-Matsau, J R B (2005)
shows a greater risk of infection when compared the other treatment options (HMS
8 tons/ha, HMS 16 tons/ha and LMS 8 tons/ha).
Using high metal sludge at 8 tons/ha resulted in a quick pathogen die-off as there
were no microorganisms detectable after the sixth week of planting.
All the
subsequent weeks showed no risk of infection (Table 6.1). At harvest, no
microorganisms were detected from potatoes grown in the HMS for both 8 tons/ha
and 16 tons/ha. The HMS shows low probability of infection, probably due to the
inhibitory role of heavy metals in this sludge (Tsai and Olson, 1990). Although
pathogen die off appears an answer for controlling crop contamination, some
researchers (Byrd et al., 1991; Amman and Ludwig, 2000; Buchanan et al., 2000)
argue that for microorganisms that release toxins and those that may be nonculturable, the absence of viable pathogens may not necessarily imply
microbiologically safe produce.
Table 6.1 Risk of ingestion of E.coli associated with accidental or deliberate
ingestion of 200 mg soil contaminated with High Metal Sludge applied at 8
tons/ha
Time
Organisms
P(Single
(Weeks)
CFU/200 mg Exposure)
P(Weekly)
P(Monthly)
P(Yearly)
0
89.25
5.24E-01
9.94E-01
1.00E+00
1.00E+00
2
1172.25
6.93E-01
1.00E+00
1.00E+00
1.00E+00
4
314.5
6.16E-01
9.99E-01
1.00E+00
1.00E+00
6
352500
8.84E-01
1.00E+00
1.00E+00
1.00E+00
8
0
0
0
0
0
10
0
0
0
0
0
12
0
0
0
0
0
119
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 6.2 Risk of ingestion of E.coli associated with accidental or deliberate
ingestion of 200 mg soil contaminated with High Metal Sludge applied at 16
tons/ha
Time
Organisms
P(Single
(Weeks)
CFU/200 mg Exposure)
P(Weekly)
P(Monthly)
P(Yearly)
0
309.5
6.14E-01
9.99E-01
1.00E+00
1.00E+00
2
3982.5
7.50E-01
1.00E+00
1.00E+00
1.00E+00
4
1398250
9.08E-01
1.00E+00
1.00E+00
1.00E+00
6
427511.2
8.88E-01
1.00E+00
1.00E+00
1.00E+00
8
1.5
1.32E-01
6.29E-01
9.86E-01
1.00E+00
10
1.25
1.17E-01
5.82E-01
9.70E-01
1.00E+00
12
0
0
0
0
0
Of the 64 potatoes studied from all the treatment options, 16 (25%) were found to
be contaminated. These potatoes were grown in LMS 16 tons/ha. Risks of infection
for exposure to E. coli calculated based on consumption of 1 g of contaminated
potato grown in LMS 16 tons/ha soil are shown in Table 6.3. The average of the
counts obtained from cleaned potato peels was 18 000 CFU/g. This number of
organisms yielded a high probability of exposure of 8.07 E01 for a single exposure.
The weekly, monthly and yearly exposures yielded even higher risk of infection
(100% probability). At harvest, none of the potatoes from HMS 8 tons/ha, HMS 16
tons/ha or LMS 8 tons/ha had any E. coli. The probability of exposure to
microorganisms from potato using these application rates is zero.
120
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 6.3 Risk of ingestion of E. coli associated with accidental or deliberate
ingestion of 200 mg of soil contaminated with Low Metal Sludge applied at 16
tons/ha
Time
Organisms
P(Single
(Weeks)
CFU/200mg
Exposure)
P(Weekly)
P(Monthly)
P(Yearly)
0
5050
7.60E-01
1.00E+00
1.00E+00
1.00E+00
2
5987.5
7.67E-01
1.00E+00
1.00E+00
1.00E+00
4
2040000
9.14E-01
1.00E+00
1.00E+00
1.00E+00
6
325895
8.82E-01
1.00E+00
1.00E+00
1.00E+00
8
136.9
5.57E-01
9.97E-01
1.00E+00
1.00E+00
10
32.9
4.38E-01
9.82E-01
1.00E+00
1.00E+00
12
20325
8.11E-01
1.00E+00
1.00E+00
1.00E+00
12
18 000 ( in
8.07E-01
1.00E+00
1.00E+00
1.00E+00
1 g potato)
Table 6.4 Risk of ingestion of E.coli associated with accidental or deliberate
ingestion of 200 mg soil contaminated with Low Metal Sludge applied at 8
tons/ha
Time
Organisms
P(Single
P(Weekly)
P(Monthly)
P(Yearly)
(Weeks)
CFU/200mg
Exposure)
0
435.75
6.36E-01
9.99E-01
1.00E+00
1.00E+00
2
5272500
9.27E-01
1.00E+00
1.00E+00
1.00E+00
4
925000
9.01E-01
1.00E+00
1.00E+00
1.00E+00
6
0
0
0
0
0
8
750
6.68E-01
1.00E+00
1.00E+00
1.00E+00
10
1355
7.00E-01
1.00E+00
1.00E+00
1.00E+00
12
45.25
4.67E-01
9.88E-01
1.00E+00
1.00E+00
Hypothetical numbers of E. coli were fitted to the model to predict what level of
contamination would produce a corresponding risk of 1 infection in 10 000 (Table
6.5). These numbers were used to determine risk of infection ranging from a single
121
University of Pretoria etd – Chale-Matsau, J R B (2005)
exposure to yearly exposure, and to estimate the quantity of organism that would
constitute acceptable risk (Rose and Gerba, 1991).
Table 6.5 Risks associated with hypothetical exposures to potato or soil
contaminated with E. coli (Beta Distribution Model)
N (Number of
P(Single
P(Weekly)
P (Monthly)
P (Yearly)
organisms)
Exposure)
10 000
7.87E-01
1.00E+00
1.00E+00
1.00E+00
1 000
6.84E-01
1.00E+00
1.00E+00
1.00E+00
100
5.33E-01
9.95E-01
1.00E+00
1.00E+00
10
3.20E-01
9.33E-01
1.00E+00
1.00E+00
1
1.01E-01
5.24E-01
9.58E-01
1.00E+00
0.1
1.40E-02
9.40E-02
3.45E-01
9.94E-01
0.01
1.46E-03
1.02E-02
4.30E-02
4.14E-01
0.001
1.47E-04
1.03E-03
4.40E-03
5.22E-02
0.0001
1.47E-05
1.03E-04
4.41E-04
5.35E-03
Number of organisms required for an acceptable risk
6.83X10-4
9.75X10-5
2.27X10-5
1.87X10-6
1.00E-04
1.00E-04
1.00E-04
1.00E-04
The present study has shown that for a daily consumption of vegetation grown from
contaminated soil (or ingestion of soil), the number of E. coli should be less than
6.83X10-4 (Table 6.5) for the risk of infection to meet the requirements suggested
by US EPA of 1 in 10 000 acceptable risk (Rose and Gerba, 1991; Macler and
Regli, 1993). For the annual risk of infection to be less than 1 in 10 000, the
number of organisms should be less than 1.87X10-6. The presence of 1 CFU/g E.
coli is likely to bring about a probability of infection of 1.01E-01, which is
approximately 1 in 10. This risk increases for a weekly, monthly and yearly infection
122
University of Pretoria etd – Chale-Matsau, J R B (2005)
with corresponding risks of 5.24E-01 (5 in 10), 9.58E-01 (9 in 10) and 100%
probability respectively (Table 6.5).
Handling of potatoes has been associated with E. coli infection in the United States
(Armstrong et al., 1996). Jones (1999) also indicated the potential health risks
associated with the persistence of E. coli in agricultural environments, yielding a
high incidence of human infections in the UK.
Figure 6.1 shows that even small numbers of bacteria could result in a high
probability of infection. Considering the high prevalence of HIV/AIDS in South
Africa (Dorington et al., 2002), the use of inadequately treated sludge could pose
serious health hazards in individuals with compromised immune systems.
250
1
200
0.8
0.7
150
0.6
0.5
100
0.4
0.3
50
0.2
Probability of Infection
CFU/200 mg (X 10 4)
0.9
0.1
0
0
0
2
4
6
8
10
12
14
Weeks
Figure 6.1 The relationship between the number of bacteria in 200 mg of
contaminated soil amended with 16 tons/ha LMS, and the probability of
infection (h= CFU/200 mg; g.= Probability of infection).
123
University of Pretoria etd – Chale-Matsau, J R B (2005)
Low metal sludge yielded high risk of infection throughout the duration of the
experiment based on the accidental ingestion of 200 mg of contaminated soil
(Figure 6.1; Table 6.3 and 6.4). This study assumed that people might be infected
from accidentally ingesting soil (WRC, 1997) or deliberately and willingly ingesting
soil (Hunter, 1993; Walker et al., 1997; Smith, 2002).
In Africa, eating soil
(geophagia) dates from the 18th century as observed in Nigeria, Ghana and SierraLeone (Hunter, 1993). It has become a common practice and spread to other
countries, namely Malawi, Zambia, Swaziland and South Africa (Walker et al.,
1997). Although the main reason for consuming soil is uncertain, it has been
associated with poverty and poor eating habits, and has been found to be prevalent
in pregnant women, those with poor nutrition and those with a family history of
geophagia (Geissler et al., 1998; Smith, 2002). The use of sewage sludge either in
their gardens or in the farms could have serious health effects for communities who
practice geophagia. Geissler and colleagues (1998) studied a relationship between
geophagy in school children in Western Kenya, and helminthes, and found that
77% of the children ate soil daily and 48% of the soil samples they tested were
contaminated with Ascaris.
Potatoes are rarely consumed raw, however there is evidence that contaminated
potatoes can lead to serious infections (Seals et al., 1981; Brent et al., 1995).
Although some organisms such as Clostridium botulinum can survive baking (Brent
et al., 1995) the prevalence of microorganisms in potato dishes is likely to be due to
a number of factors that include handling which could lead contamination of
utensils and surfaces. As microorganisms have a potential to replicate, such cross
contamination may eventually contaminate the finished product.
124
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.5.2 Salmonella spp
As the results for Salmonella spp were only based on the presence and absence of
this organism, risk assessment based on the beta distribution model for
consumption of Salmonella spp was based only on hypothetical numbers (Table
6.6). For this organism, to attain a risk of infection to be less than 1 in 10 000, there
need to be less than 4.25X10-2 organisms per g for daily exposure and 1.17X10-4
for yearly exposure. If one ingests a single organism, the probability of infection is
about 2 in a 1000 (2.35E-03) for a single exposure and about 2 in 100 (1.63E-02),
7 in 100 (6.81E-02) and 6 in 10 (5.76E-01) for weekly, monthly and yearly
exposures respectively.
Table 6.6 Risks associated with hypothetical exposures to Salmonella
(Beta Distribution Model)
N (Number of
P(Single
P(Weekly)
P (Monthly)
P (Yearly)
organisms)
Exposure)
10 000
7.57E-01
1.00E+00
1.00E+00
1.00E+00
1 000
5.00E-01
9.92E-01
1.00E+00
1.00E+00
100
1.63E-01
7.12E-01
9.95E-01
1.00E+00
10
2.25E-02
1.47E-01
4.95E-01
1.00E+00
1
2.35E-03
1.63E-02
6.81E-02
5.76E-01
0.1
2.36E-04
1.65E-03
7.05E-03
8.25E-02
0.01
2.36E-05
1.65E-04
7.07E-04
8.57E-03
0.001
2.36E-06
1.65E-05
7.08E-05
8.61E-4
0.0001
2.36E-07
1.65E-06
7.08E-06
8.61E-05
Number of organisms required for an acceptable risk
4.25X10-2
6.08X10-3
1.42X10-3
1.17X10-4
1.00E-04
1.00E-04
1.00E-04
1.00E-04
125
University of Pretoria etd – Chale-Matsau, J R B (2005)
Risk from infection due to Salmonella spp contaminated food was indicated by
Walls and Scott (1997) in USA where 1.2 million cases of Salmonella spp infection
are reported per year.
Based on their assessment and the number of cases
reported, they concluded that on any given day, 3190 individuals might become
infected with Salmonella (Wall and Scott, 1997).
6.5.3 Ascaris
Ascaris ova were detected in the soil only at the beginning of the experiment (1/g
soil for HMS in week 2, and 4/g soil for LMS in week 4) (Chapter 4). No Ascaris
were detected in samples analysed from the sixth week of the experimental period.
Table 6.7 Risks associated with hypothetical exposures to Ascaris
(Exponential Model)
N (Number of
P(Single
P(Weekly)
P (Monthly)
P (Yearly)
organisms)
Exposure)
10 000
1.00E+00
1.00E+00
1.00E+00
1.00E+00
1 000
1.00E+00
1.00E+00
1.00E+00
1.00E+00
100
8.50E-01
1.00E+00
1.00E+00
1.00E+00
10
1.73E-01
7.36E-01
9.97E-01
1.00E+00
1
1.88E-02
1.25E-01
4.34E-01
9.99E-01
0.1
1.90E-03
1.32E-02
5.54E-02
5.00E-01
0.01
1.90E-04
1.33E-03
5.68E-03
6.70E-02
0.001
1.90E-05
1.33E-04
5.70E-04
6.91E-03
0.0001
1.90E-06
1.33E-05
5.70E-05
6.93E-04
Number of organisms required for an acceptable risk
5.27X10-3
7.55X10-4
1.76X10-4
1.45X10-5
1.00E-04
1.00E-04
1.00E-04
1.00E-04
126
University of Pretoria etd – Chale-Matsau, J R B (2005)
According to the model, using hypothetical numbers, if only a single Ascaris is
consumed, there is a probability of infection is 1.88E-02 (approximately 2 in 100)
for daily exposure and 1.25E-01 (1 in 10), 4.34E-01 (4 in 10) and 9.99E-01 (9 in 10)
for weekly, monthly and yearly exposures respectively (Table 6.7). If less than
5.27X10-3 organism is consumed (from soil or vegetable), the risk of infection is
acceptable (< 1 in 10 000). For yearly exposure, infection will be less than 1 in 10
000 if less than 1.45X10-5 organisms are consumed.
Although no Ascaris ova were detected on the potato peel at the time of harvest,
the possibility of infection from these organisms may not be ignored. Recently,
Carneiro et al. (2002) reported prevalence of Ascaris lumbricoides infection from
consumption of contaminated water in Brazil. It has been earlier reported that
Ascaris infects approximately 25% of the world’s population annually (Crompton,
1988).
6.6 Conclusions and Recommendations
This risk assessment was based on the accidental or deliberate ingestion of
contaminated soil during the planting, growing or harvesting following sewage
sludge application, and also on the consumption of contaminated potato postharvest. Risk estimation was based on the quantity of organisms in the soil and on
the surface of potato.
It has clearly been shown that even very low numbers of pathogens may present a
high risk of infection from E. coli, Salmonella spp and Ascaris to those individuals
exposed to these pathogens. Risk assessment for these organisms required that
their numbers present on the crop should be extremely low to correspond to a less
than 1 in 10 000 annual risk of infection. Haas and colleagues (2000) who validated
their results with reference to two outbreaks have pointed out that comparison of
real world situations with the predictions these models are highly plausible.
127
University of Pretoria etd – Chale-Matsau, J R B (2005)
This study recommends the use of E. coli as an indicator for safe use of sewage
sludge in agricultural land.
Using HMS at 8 tons/ha resulted in limited risk of infection as pathogens die long
before crops are harvested. However, other agents such as heavy metals and
organic chemicals should be put into consideration when there is intended use of
sewage sludge.
Considering the risk associated with exposure to heavy metals, the LMS at 8
tons/ha appears a better option to use, if preceded by intense treatment.
The risk estimated in this study is based on the pathogens studied. Considering
that sewage sludge contains numerous pathogens (Chapters 2 and 3) including
viruses, undoubtedly the potential for sludge use in agricultural land to cause gross
health effects far exceeds the estimates made in this study.
The risk assessment is a useful tool to illustrate that management practices could
play an important role in reducing the health risk associated with the use of sewage
sludge on agricultural land.
Due to the prevalence of HIV/AIDS in the country and the poor hygienic practices of
most people including those living in informal settlements, use of inadequately
treated sludge in agricultural land used for crops meant for human consumption
holds potential to yield countless infections, and could pose a serious health hazard
for such communities.
Intensive pathogen reduction in sewage sludge will be necessary prior to using the
product as soil conditioner. This will ensure that sewage sludge to be applied to
land starts with low numbers that may eventually die off.
128
University of Pretoria etd – Chale-Matsau, J R B (2005)
As this study was based on conservative assumptions, and has estimated a high
risk, further studies especially those based on epidemiological data are
recommended.
This study was based on potato, which is one of the high risk crops, further
research on other crops will need to be investigated for evaluation of risk of
infection.
129
University of Pretoria etd – Chale-Matsau, J R B (2005)
6.7 References
Al-Nakshandi, G.A., Saqqar, M.M., Shatanawi, M.R., Fayyad, M. and Al-Horani, H.
1997. Some Environmental Problems Associated with the Use of Treated
Wastewater for Irrigation in Jordan. Agriculture Water Management. 34(1). 81-86
Amann, R. and Ludwig, W. 2000. Ribosomal RNA-targeted Nucleic Acid Probes for
Studies in Microbial Ecology. FEMS Microbiology Reviews. 24. 555-565
Armon, R., Dosoretz,C.G., Azov, Y. and Shelef, G. 1995. Residual contamination of
crops Irrigated with Effluent of Different Qualities: a Field Study. Water Science and
Technology. 30(9). 239-248
Armstrong, G.L., Hollingsworth, J. and Morris J.G. 1996. Emerging Foodborne
Pathogens: Escherichia coli O157:H7 as a Model of Entry of a New Pathogen into
the Food Supply of the Developed World. Epidemiological Reviews. 18. 28-51
Blumenthal, U.J., Strauss, M., Mara, D.D. and Cairncross, S. 1989. Generalised
model of the Effect of Different Control Measures in Reducing Health Risks from
Waste Reuse. Water Science and Technology. 21. 567-577
Brent, J., Gomez, H., Judson, F., Miller, K., Rossi-Davis, A., Shillam, P., Hatheway,
C. McCroskey, L., Mintz, E., Kallander, K., McKee, C., Romer, J., Sinlgeton, E.,
Yager, J. and Sofos, J. 1995. Botumism from Potato Salad. Dairy, Food and
Environmental Sanitation. 15(7). 420-422
Brooks, G.F., Butel, J.S. and Ornston, L.N. 1991. Medical Microbiology. 9th Edition.
488pp
130
University of Pretoria etd – Chale-Matsau, J R B (2005)
Buchanan, R.L., Smith, J.L. and Long, W. 2000. Microbial Risk Assessment: DoseResponse Relations and Risk Characterization. International Journal of Food
Microbiology. 58. 159-172
Byrd, J.J., Xu, H.S. and Colwell, R.R. 1991. Viable but non-culturable bacteria in
drinking water. Applied Environmental Microbiology. 57. 875-878
Carneiro, F.F., Cifuentes, E., Tellez-Rojo, M.M. and Romieu, I. 2002. The Risk of
Ascaris lumbricoides Infection in Children as an Environmental Health Indicator to
Guide Preventive Activities in Caparaó and Alto Caparaó, Brazil. Bulletin of the
World Health Organization. 80(1). 40-46
Crompton, D.W.T. 1988. The Prevalence of Ascariasis. Parasitology Today. 4. 162168
Dorrington, R., Bradshaw, D. and Budlender, D. 2002. HIV/AIDS Profile in the
Provinces of South Africa. Indicators for 2002. Medical Research Council, South
Africa. 31pp
Farber, J.M., Ross, W.H. and Harwig, J. 1996. Health Risk Assessment of Listeria
monocytogenes in Canada. International Journal of Food Microbiology. 30. 145-156
Geissler, P.W., Shulman, C.E., Price, R.J., Mutemi, W., Mzani, C., Friis, H. and
Lowe, B. 1998. Geophagy, Iron Status and Anaemia Among Pregnant Women on
the Coast of Kenya. Transactions of the Royal Society of Tropical Medicine and
Hygiene. 92(5). 549-553
Genthe, B. 1998. Specialist Study on the Potential Health Impacts of the Proposed
wastewater treatment facility on the West Bank of East London. Environmentek,
CSIR. 20pp
131
University of Pretoria etd – Chale-Matsau, J R B (2005)
Haas, C.N. 1996. Acceptable Microbial Risk. Journal of the American Water Works
Association. 88(12). 8
Haas, C.N., Thayyar-Madabusi, A., Rose, J.B. and Gerba, C.P. 2000. Development
of a Dose-Response relationship for Escherichia Coli O157:H7. International
Journal of Food Microbiology. 1748. 153-159
Hunter, J.M. 1993. Macroterm Geophagy and Pregnancy Clays in Southern Africa.
Journal of Cultural Geography. 14. 69-92
Hyde, H.C. 1976. Utilization of Wastewater Sludge for Agricultural Soil Enrichment.
Journal of Water Pollution Control Federation. 48(1). 77 - 90
Jones, D.L. 1999. Potential Health Risks Associated with the Persistence of
Escherichia coli O157:H7 in Agricultural Environments. Soil Use and Management.
15. 76-83
Macler, B.A. and Regli, S. 1993. Use of Microbial Risk Assessment in Setting US
drinking Water Sandards. International Journal of Food Microbiology. 19. 245-256
Notermans, S. and Teunis, P. 1996. Quantitative Risk Analysis and the Production
of Microbiologically safe Food: An Introduction. International Journal of Food
Microbiology. 30. 3-7
Pepper, I., Gerba, C.P. and Brusseau, M. 1996. Pollution Science. Academic
Press, San Diego. 397pp
Petterson, S.R., Ashbolt, N.J. and Sharma, A. 2001. Microbial Risks from
Wastewater Irrigation of salad Crops: A Screening-Level Risk Assessment. Water
Environment Research. 72(6) 667-672
132
University of Pretoria etd – Chale-Matsau, J R B (2005)
Rose, J.B., and Gerba, C.P. 1991. Use of Risk Assessment for Development of
Microbial Standards. Water Science and Technology. 24(2). 29-34
Rudolfs, W., Falk, L.L. and Ragotzkie, R.A. 1951. Contamination of Vegetables
Grown in Polluted Soil. Sewage and Industrial wastes. 23. 992-1000
Seals, J.E., Snyder, J.D., Edell, T.A., Hatheway, C.L., Johnson, C.J., Swanson,
R.C.
and
Hughes,
J.M.
1981.
Restaurant-Associated
Type
A
botulism:
Transmission by Potato Salad. American Journal of Epidemiology. 113. 436-444
Shuval, H., Lampert, Y and Fattal, B. 1997. Development of a Risk Assessment
Approach for Evaluating Wastewater Reuse Standards for Argriculture. Water
Science and Technology. 35(11/12). 15-20
Smith, B. 2002. Eating Soil. Planet Earth Autumn. 21-22
Tsai, Y-L. and Olson, B.H. 1990. Effects of Hg2+, CH3-Hg+, and Temperature on the
Expression of Mercury Resistance Genes in Environmental Bacteria. Applied and
Environmental Microbiology. 56(11). 3266-3272.
Voysey, P.A. and Brown, M. 2000. Microbiological Risk Assessment: A New
Approach to Food safety Control. International Journal of Food Microbiology. 58.
173-179
Walker, A.R.P., Walker, B.F., Sookaria, F.I. and Canaan, R.J. 1997. Pica. Journal
of Roy Health. 117. 280-284
Walls, I. And Scott, V.N. 1997. Use of Predictive Microbiology in Microbial Food
Safety Risk Assessment. International Journal of Food Microbiology. 36. 97-102
WRC, 1997. Permissible Utilisation and Disposal of Sewage Sludge. Water
Research Commission. TT 85/97
133
University of Pretoria etd – Chale-Matsau, J R B (2005)
Zwietering, M.H and van Gerwen, S.J.C. 2000. Sensitivity Analysis in Quantitative
Microbial Risk Assessment. International Journal of Food Microbiology. 58. 213221
134
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 7
Management Practices Regarding Sewage Sludge Use in
Agricultural Land
7.1 Introduction
The preceding sections have revealed the types of microorganisms found in
sludge, their potential to persist in soil and crops as well as the risk associated
with this persistence. This section focuses on managing the risk through
appropriate management practices.
This chapter sought to indicate that if farmers adhere to the regulations stipulated
regarding application of sewage sludge to agricultural land, application of sewage
sludge should not present a risk to food safety. This would ensure that noxious
pathogens such as E.coli and Salmonella spp would not be transferred into the
food chain when using sewage sludge in selected agricultural practices.
7.2 International Trends Regarding Microbiological Sludge Quality
The US Part 503, subpart D pathogen reduction requirements for sewage sludge
are divided into two categories, namely Class A and Class B. The implicit goal of
the Class A requirements is to reduce the pathogens in sewage sludge (including
enteric viruses, pathogenic bacteria and helminth ova) to below detectable levels.
The goal of Class B requirements is to reduce pathogens in sewage sludge to
levels that are unlikely to pose a threat to public health and the environment.
Another category, exceptional quality (EQ) refers to sewage sludge that has met
the Part 503 pollutant concentration limits. While Both A and B have site
restrictions, EQ may be land applied without site restrictions (EPA, 1999).
Mexico adopted the US guidelines, with a few modifications to suite their
environment and sludge quality (Jimenez et al., 2003). They use similar limits for
135
University of Pretoria etd – Chale-Matsau, J R B (2005)
heavy metals and Faecal coliforms and modified the limits for Salmonella spp
and helminth ova (Jimenez et al., 2003).
In Australia, regulatory responsibility is carried out by individual states. Recently,
the national guidelines (National Water Quality management Strategy (NWQMS):
Draft Guidelines for Sewage Management – biosolids Management) have been
drafted. These draft guidelines define three pathogen grades (P1, P2 and P3),
which are based on prescribed treatment processes and microbiological
standards. Vector attraction reduction measures are also detailed.
Grade P1 biosolids are considered suitable for unrestricted use, and grades P2
and P3 have increasing degrees of restrictions (Reid, 2003). The P1 grade
includes microbiological criteria of <1 Salmonella per 50 grams dw and <100
E.coli (or thermotolerant coliforms) per gram dw. The microbiological standards
for grade P2 are <10 Salmonella per 50 grams dw and <1000 E.coli
(thermotolerant coliforms) per gram dw (Reid, 2003).
In South Africa, sewage sludge is classified into three types, namely A, B and C.
This classification is based on the decreasing order of potential to cause odour
nuisances and fly breeding as well as to transmit pathogenic organisms to
humans and the environment (WRC, 1997). There is an additional type D, which
is similar in hygienic quality to Type C. However, as Type D is produced for
unrestricted use, the metal and inorganic content are limited to acceptable low
levels.
Sewage sludge generally contains a number of pathogenic microorganisms (as
indicated in Chapters 2 and 3). As it is impossible to analyse for all pathogenic
organisms, only the numbers of Ascaris ova, Salmonella spp and Faecal
coliforms are included in the analysis as indicator organisms for determining
hygienic quality of Type C and type D sludge.
136
University of Pretoria etd – Chale-Matsau, J R B (2005)
7.3 Factors that can Influence Sludge Management Practice in South Africa
There are a number of factors that affect the South African population and need
to be taken into consideration to ensure adequate protection of human health
with regard to sewage sludge use. These include the following:
i Compromised Immune Systems
A large number of South Africans are immuno-compromised as a result of the
high incidents of HIV/AIDS, which translates into diverse disease profiles such as
cholera, tuberculosis and more recently meningitis. Cancer patients, as a result
of the treatment they receive, tend to have suppressed immune systems. Other
groups with weak immune systems include children and the elderly. Appropriate
management of land application of sewage sludge has to place these individuals
into consideration.
ii Poverty and Unemployment
Large areas in South Africa are rural with the majority of people living in these
areas being unemployed and consequently living below the poverty line
(Parliamentary Bulletin, 1996).
Due to limited skills and illiteracy of a large
fraction of the population in the country, the rate of unemployment has increased
in recent years. These populations have to be taken into consideration when
formulating management practice for land application of sewage sludge. Sludge
producers and farmers should communicate at a level so that communities will
comprehend the risks and benefits of sludge use.
iii Population density
There is an increase in population size as a result of social behaviours, religions,
teenage pregnancies and immigration particularly from neighbouring countries.
There is also a tendency for people from rural areas to move to cities for an
137
University of Pretoria etd – Chale-Matsau, J R B (2005)
improved quality of life, resulting in an upsurge of urbanization, especially in
Provinces with better socio-economic status such as Gauteng, Western Cape
and KwaZulu-Natal. This resulted in dense informal settlements with limited
hygiene practices. Sewage sludges from these areas are likely to have high
incidence of pathogens (Chapter 3).
iv Sparse Sanitation
Adequate sanitation in South Africa is still limited to cities, with the majority of
people living in rural areas having no access to sanitation. People in these
communities rely on surface water or water from wells for all household activities
including drinking, bathing and cooking. If sludge is not adequately treated, runoff
from the land to which sewage sludge is applied could lead to contaminated
wells, and eventually infecting the waters from which these communities drink.
v Cultural diversity
South Africa is home for a number of diverse cultures. Some groups have
developed a habit of deliberately ingesting soil, a practice that has to be taken
into consideration with regard to using sewage sludge for soil amendment. If
adequately treated sludge is used, the chances of individuals ingesting soil to be
infected will be reduced or eliminated. Management practice may also prohibit
soil ingestion in these areas through warnings.
vi Climatic conditions
The survival of microorganisms depends on the surrounding temperature and
humidity conditions. South Africa is a semi-arid country. The survival of and the
potential infection of microorganims in sludge will be reduced by the high ultraviolet radiation and desiccation, as most microorganisms will not proliferate under
these conditions.
138
University of Pretoria etd – Chale-Matsau, J R B (2005)
vii Soil structure
Agricultural land in South Africa are carbon depleted in some areas as a result of
high microbial activity.
As a result, the number of pathogens from humans
sources added to soil from sewage sludge will be relatively small compared with
the densities of pathogens present in soil. Thus introduced pathogens into soil
have a minimal chance of survival as a result of competition (Apedaile, 2001;
Forcier, 2002).
7.4 Exposure pathways
The U.S EPA used various risk assessment procedures to develop exposure
pathways to establish the risk factor to humans and the environment (Table 7.1).
The risk assessment section discussed in Chapter 6 has demonstrated the
possibility of infection through some of these pathways if inadequately treated
sludge is used in agricultural land. An effective management plan is necessary to
protect the public from infection through these pathways. Pathways 1, 2, 3, 11
and 13 (Table 7.1) are of particular concern regarding human health safety.
Risk is defined as follows:
Risk = Hazard X Probability of infection
As shown in chapter 6, the risk of infection regarding sewage sludge use is
regarded as acceptable if 1 in 10 000 (1:104) infections occurs per year (Haas,
1996). Models computed in this section, have shown that the risk of infection
from contaminated crops become reduced as the period between application and
harvest is increased.
139
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 7.1 Exposure pathways for land applied sludge (WRC, 1997)
No.
Pathway
Description
1
Sludge-Soil
Consumers in regions heavily affected by spreading of sludge
Plant-Human
2
3
4
Sludge-Soil Plant
Farmland converted to residential home garden five years after reaching
Human
maximum sludge application
Sludge-Soil
Farmland converted to residential use five years after reaching maximum
Human
sludge application with children ingesting sludge-amended soil
Sludge-Soil-
Households producing a major portion of their dietary consumption of
Plant-Animal-
animal products on sludge-amended soil
Human
5
Sludge-Soil-
Households consuming livestock that ingest sludge-amended soil
Plant-Human
6
Sludge-Soil-
Livestock ingesting food or feed crop grown in sludge-amended soil
Plant-Animal
7
Sludge-Soil-
Grazing livestock ingesting sludge/soil
Animal
8
Sludge-Soil-Plant
Crops grown on sludge-amended soil
9
Sludge-Soil-Soil
Soil biota living in sludge-amended soil
Biota
10
Sludge-Soil-Soil
Animals eating soil living in sludge amended soil
Biota-Biota
Predator
11
Sludge-SoilAirborne
Tractor operator exposed to dust from sludge-amended soil
Dust-
Humans
12
Sludge-Soil-
Humans eating fish and drinking water from watersheds draining sludge-
Surface
amended soils
Water/FishHumans
13
Sludge-Soil-Air-
Humans breathing fumes from any volatile pollutants in sludge
Human
14
Sludge-Soil-
Humans drinking water from wells surrounded by sludge-amended soils
GroundwaterHuman
140
University of Pretoria etd – Chale-Matsau, J R B (2005)
7.5 Ranking of the Exposure Pathways for South African Conditions
Both the healthy individuals and those with compromised immune systems need
consideration. Healthy individuals are however less susceptible to infection.
People closely affected by the agricultural sludge application are the farm family,
as they live on the farm, and people living close to such farms (EPA, 2003).
In chapter 6, it was shown that the ingestion of crops grown in sewage-amended
soil may pose minimal probability of infection (pathways 1,2, 4, 6, 8), as a result
of the advantageous climatic conditions. Thus, adequately treated sewage
sludge is less likely to pose any unacceptable risk with regard to exposure
pathways for both the healthy and the immuno-compromised individuals, as the
pathogen load in this sludge is expected to be minimal. Safety for using sludge
can be enhanced by following the recommendations regarding its application
(WRC, 1997). The restrictions require that sludge is mixed or covered with soil
(WRC, 1997), reducing the pathogen load per area as a result of dilution.
Sludge use is regarded as yielding an unacceptable exposure if the risk of
infection or consequent is greater than 1: 104 (Haas, 1996). For instance if
sewage sludge use result in 1:10 deaths or acute infections leading to disease
profiles such as hemolytic uremia, the risk is unacceptable. The probability of
such infection is high (Table 7.2). If sludge use result in sporadic ailments or
occasional symptoms, the probability of infection does not pose an unacceptable
risk (Table 7.2).
141
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 7.2 Generic risk rating matrix based on human health. Numbers 1 to
10 indicate the probability of a hazard occurring
Hazard
Probability of hazard occurring
Loss of life
10
8
6
4
2
1
Acute
8
6
4
2
1
0
6
4
2
1
0
0
4
2
1
0
0
0
Occasional 4
2
1
0
0
0
illness
Chronic
illness
Sporadic
ailments
symptoms
No effect
0
0
0
0
0
0
The risk
1:101
1:102
1:103
1:104
1:105
1:106
If type A or B sludges are used, the probability of infection may be increased.
Tables 7.3 and 7.4 provides the risk ranking for both healthy and immunosuppressed individuals respectively, with regard to application of the three sludge
types. Individuals with weakened immune systems present a high probability of
infection. For this reason, the ranking was quantified to reflect high probability of
infection when using type A and type B sludges compared to using type C or D.
This will be a problem, particularly for exposed crops such as root crops,
including carrots and potatoes. However these risks can easily be managed by
prohibiting the use of type A and B wastewater sludge on such vegetable types
and also on public parks or recreational facilities.
Some members of the population may be exposed to multiple pathways
(Harrison, 1999). For instance, some adults and children who have a habit of
ingesting soil, may be exposed to pathway 3 in addition to other exposure
pathways, while this may not be the case in adults who do not practice
geophagia in their cultures (Hunter, 1993). The concentration of pathogens in
sludge-amended agricultural soil can be reduced by mixing the sludge and soil
142
University of Pretoria etd – Chale-Matsau, J R B (2005)
properly (effecting a dilution). If sludge is applied during warm summer days, a
rapid pathogen die-off can be encouraged such that soil ingestion would not lead
to serious infections (pathway 3, 7).
Some pathogens are capable of being air borne, often influenced by windy dry
days. Farm workers are at the risk of inhaling dust borne pathogens during
application, which can result in infection of the respiratory tract. This exposure
can be prevented by ensuring that each farm worker is provided with a protective
clothing such as a mask capable of covering both the nostril and mouth area,
during sludge application. People neighbouring the farms can be protected from
aerosols by irrigating the agricultural land following sludge application (Apedaile,
2001). Also, wetting the treated dry sludge prior application may reduce emission
of bio-aerosols. This would ensure that few particles are suspended in the air
(pathway 11 and 13).
Pathogens in the soil can enter a water body through runoff and erosion.
However, the concentration of pathogens in the leachate from agricultural land
may be diluted in the watersheds/groundwater system before reaching a nearby
well used for drinking (EPA, 2003). Regular monitoring of such water bodies will
ensure that the number of pathogens present in such water is kept at acceptable
levels (pathway 12 and 14), such that these waters would not pose a health risk
for rural communities who using the resource.
Ecological receptors are also exposed to contamination through ingestion of
terrestrial or aquatic food items. Their food chain include vegetation, soil and
prey items in their diet that they obtain from the farm field where sewage sludge
is applied (EPA, 2003). These receptors include beef or diary cattle raised by the
farm family. Protecting these receptors will ensure that humans feeding on their
products (such as meat or milk) are protected.
However, as the pathway
between sludge and the ecological receptor is often long (4,5, 6, 9, 10 and 12),
pathogen load may well be reduced to such an extent that the risk is negligible.
Human enteric pathogens such as Salmonella spp are capable of surviving in
143
University of Pretoria etd – Chale-Matsau, J R B (2005)
warm-blooded animals (Jones, 1980). Humans can be protected from infection
by avoiding raw products from such animals. For instance, by employing
adequate cooking of meat products and effective pasteurization of milk.
Table 7.3 Risk ranking per pathway for sludge types with regard to Healthy
individuals
Pathways
Type A Sludge
Type B sludge
Type C/D Sludge
1
6
4
0
2
6
4
0
3
8
6
0
4
4
2
0
5
4
2
0
6
4
2
0
7
4
2
0
8
6
4
0
9
6
4
0
10
6
4
0
11
4
2
0
12
4
2
0
13
4
2
0
14
6
4
0
144
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 7.4 Risk ranking per pathway for sludge types with regard to
immuno-compromised individuals (including HIV/AIDS and cancer patients)
Pathways
Type A Sludge
Type B sludge
Type C/D Sludge
1
8
6
0
2
8
6
0
3
10
8
0
4
8
6
0
5
8
6
0
6
8
6
0
7
8
6
0
8
8
6
0
9
8
6
0
10
8
6
0
11
10
8
0
12
10
8
0
13
10
8
0
14
10
8
0
7.6 Risk Management
The main challenge in risk management is not in predicting potential infection
due to pathogens in sewage sludge, but being able to introduce the interventions
necessary to prevent the occurrence of such infections. In most countries around
the world, recycling sewage sludge to agricultural land is still regarded as the
best practical environmental option. Understanding the pathways and the fates of
contaminants derived from sewage sludge, and their ultimate effect on the
environment and on human health is a useful tool in designing safety procedures
regarding sewage sludge use in agricultural land.
Table 7.6 provides a generic presentation of probability of exposure and severity
of hazard. Description of hazard severity is provided in Table 7.5.
145
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table 7. 5. Pathogen potential rating
Pathogen load
Description
High
Pathogens are present in sufficient quantities to cause
concern
Medium
Pathogens could be present at levels of concern
Low
Pathogens present in sludge, but monitoring indicates
minimal levels
Negligible
Pathogens not present in sufficient quantities in sludge
to cause concern
Table 7.6 Risk ranking based on the probability of exposure and severity of
hazard
Probability of exposure
Frequent
Reasonably Occasional Remote
probable
Hazard
High
severity
Higher
risk
Medium
Medium
risk
Low
Lower risk
Negligible
Acceptable
risk
The quality of sewage sludge and the probability of exposure of humans to the
sludge determine the risk of contracting an infection. The sludge quality in this
study is determined by the concentration of pathogens in sewage sludge. In raw
(untreated) sludge, it is expected that there will be large numbers (high
concentration) of disease causing pathogens. Application of such sludge would
certainly pose a ‘higher risk’ of infection. Type B sewage sludge (WRC, 1997)
could yield ‘medium risk’. Types C and D are likely to yield ‘lower risk’ as they
contain limited pathogenic organisms (WRC, 1997). As indicated in Table 7.2,
146
University of Pretoria etd – Chale-Matsau, J R B (2005)
the frequency of exposure and the pathogen content determines the extent of the
risk of infection. This implies that if sewage sludge is properly treated prior to
application to land, and the periods between applications, and between
application and harvesting are managed properly, the risk of contracting infection
becomes an ‘acceptable risk’. If farmers adhere to the 8 tons/ha application and
the sludge is well mixed with the soil and evenly spread, this will result in dilution
of the sewage sludge. The natural die-off of the microorganism will occur (as
demonstrated in Chapter 4) placing the hazard severity on the lower or negligible
end.
Although there are presently no known cases of infection or illness implicating
sewage sludge use in South Africa, considering the country’s large population of
immuno-compromised individuals as a result of the high incidence of HIV/AIDS, it
is necessary to introduce advanced precautionary steps to prevent any
occurrence of such infections.
Proper training in taking precautionary measures can reduce the chances of
infection during sludge handling by farm workers and personnel working at the
WWTPs. Continued proper management of sludge application to agricultural land
will require that effective skills transfer is implemented to increase the pool of
personnel knowledgeable regarding sludge use and management.
Scientific community need to work closely with sludge producers providing advise
on efficient but cost effective techniques that can be used to reduce pathogen
load.
Adequate sewage sludge treatment should ensure that offensive odours are not
generated from the final product, reduce vector attraction and that pathogen
regrowth is controlled (EPA, 1999).
Direct soil ingestion by toddlers or people who have adopted this habit
represents a risk of infection for this group if sludge is inadequately treated.
147
University of Pretoria etd – Chale-Matsau, J R B (2005)
Management may reduce a risk of infection by not allowing entry into the
premises or by educating these individuals.
7.7 Conclusion and Recommendations
Use of untreated (raw) sludge should not be allowed on any exposed crops or
root crops.
Farmers who are the recipients of sludge, have a responsibility to adhere to
proposed application rates and to educate farm workers on the precautionary
measures necessary for sludge handling.
For type B sludge, the period between sludge application and harvesting should
be such that pathogen reduction in soil is ensured. This study has shown that
significant pathogen reduction can occur in 12 weeks (3 months) following
application (Chapter 4). Prolonging this period will reduce the risk of infection.
EPA (1999) recommend a 14 month harvest restriction for crops that touch the
soil.
Sludge application may also be done well in advance (3 months) prior to planting
thus ensuring that the period between harvesting and application is long.
Access to land applied with sewage sludge may also be prohibited through
fencing and/or penalty for those who do not comply. In this way, the receptor will
be removed from the pathway, thus the risk of potential infection will be reduced.
Comprehensive management plan that involves regular monitoring processes
and public awareness campaigns needs to be in place to ensure understanding
by the public of the benefits of sewage sludge and steps taken to ensure sludge
safety.
148
University of Pretoria etd – Chale-Matsau, J R B (2005)
Monitoring techniques need to be well documented, rapid, less complicated, cost
effective and enforced.
Sludge producers may enhance safety use by supplying information to farmers
indicating the product quality and emphasizing the necessary precautions to be
taken.
149
University of Pretoria etd – Chale-Matsau, J R B (2005)
7. 8 References
Apedaile, E. 2001. A Perspective on Biosolids Management. The Canadian
Journal of Infectious Diseases 12(4)
http//www.pulsus.com/Infdis/12_04/aped_ed.htm
EPA, 1999. Environmental Regulations and Technology. Control of Pathogens
and Vector Attraction in Sewage Sludge. U.S. Environmental Protection Agency.
EPA/625/R-92-013. 111pp
EPA, 2003. Technical Background Document for the Sewage Sludge Exposure
and Hazard Screening Assessment. U.S. Environmental Protection Agency. EPA
822-B-03-001. 72pp
Forcier, F. 2002. Biosolids and Bioaerosols: The Current Situation. Biosolids and
Bioaerosols Solinov. Quebec Ministry of Environment. 22pp
Haas, C.N. 1996. Acceptable Microbial Risk. Journal of the American Water
Works Association. 88(12). 8-13
Harrison, E.Z. 1999. Review of the Risk Analysis for the Round Two Biolosilds
Pollutants (Dioxins, Furans and Co-planar PCBs). Cornell Waste Management
Institute. http://cwmi.css.cornell.edu/Sludge/review.html
Hunter, J.M. 1993. Macroterm Geophagy and Pregnancy Clays in Southern
Africa. Journal of Cultural Geography. 14. 69-92
Jimenez, B., Barrios, J.A., Mendez, J.M. and Diaz, J. 2003. Sustainable sludge
Management in Developing Countries. Proceedings of the IWA Biosolids 2003
Conference, Wastewater Sludge as a Resource 23-25 June 2003. Trondheim.
Norway
150
University of Pretoria etd – Chale-Matsau, J R B (2005)
Jones, P.W. 1980. Health hazards associated with the handling of animal
wastes. Veterinary Record. 106. 4-7
Parliamentary Bulletin, 1996. Poverty in South Africa – Poverty Week Debate. 21
October 1996. Parliamentary Bulletin No. 7. Republic of South Africa
Reid, H. 2003. Biosolids to Land: International Regulations Part II. Pathogens.
Water, Volume (August). 45-51
WRC, 1997. Permissible Utilisation and Disposal of Sewage Sludge. 1st Edition.
Water Research Commission. TT8597. 23pp
151
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 8
Concluding Remarks
8.1 Introduction
As sewage sludge comprises high levels of organic matter and nutrients such as
N and P, it can be used as soil conditioner, particularly in developing countries. In
South Africa one of the serious problems is the widespread degradation of
agricultural soil due to erosion and nutrient depletion.
Unfortunately, utilization of sewage sludge for agricultural purposes has
disadvantages as well. Apart from aesthetic reasons, the principal disadvantage
of the agricultural use of wastewater sludge is the potential of the transmission of
human bacterial and parasitic infections through consumption of produce, if the
sludge used was not adequately treated (Rudolfs et al., 1950).
While benefits that result from using sludge as soil conditioner have been studied
widely, knowledge on its limitations regarding microbial pathogens is limited. This
study sought to establish the potential prevalence of pathogenic microorganisms
in a high risk crop grown from soil amended with sewage sludge, and to provide
suggestions on management practice for beneficial use of sludge.
8.2 Research Findings
The two types of sludge, namely low metal (LMS) and high metal sludge (HMS)
were found to have several human pathogenic microorganisms, including the
E.coli and Salmonella spp (Chapter 3). This is consistent with other studies on
sludge pertaining to the types of microbes present in sludge (Strauch, 1991;
Juang and Morgan 2001).
152
University of Pretoria etd – Chale-Matsau, J R B (2005)
These organisms persisted in soil for a period of three months during planting
(Chapter 4). Earlier, other researchers (Strauch, 1991; Baloda et al., 2001)
reported on the survival of E.coli and Salmonella spp. Culture based technique
showed the prevalence of these microorganisms on the potatoes grown in 16
tons/ha LMS. None of the potatoes from other treatment options (LMS 8 tons/ha,
HMS 8 tons/ha and HMS 16 tons/ha) had any of these organisms (Chapter 4).
Further analysis of contaminated potatoes using molecular technique yielded no
viable primary pathogenic organisms (Chapter 5). Although some species of the
Enterobacteriaceae were found to be present in the potato, none of these were
indicated as primary pathogens to humans. None of the 16S rRNA sequences
from potatoes matched any of the Salmonella spp or E.coli from the data bank.
However, E.coli and other enteric pathogens, namely, Proteus sp, Enterobacter
sp and several Klebsiella spp were isolated from the sewage sludgecontaminated soil in which these potatoes were grown. Organisms isolated from
the crops were mainly plant organisms that are known to be responsible for
diseases such as rotting in potatoes.
Observations from this study suggest that if a single application of sludge is
made during planting, and crops remain in the field for a period no less than
three months, it is possible that pathogen load will be significantly reduced
(Chapter 4). However, proper sludge treatment and management prior to use is
essential. These management practices require taking into consideration the
unique prevailing conditions that affect agriculture in South Africa (Chapter 7).
8.3 Sewage Sludge Management Requirements
This study has shown that while pathogens are present in sewage sludge, this
can be managed to maximize on the benefits associated with land application of
sewage sludge can be realized. The underlying basic requirements are proposed
153
University of Pretoria etd – Chale-Matsau, J R B (2005)
to assist sludge producers, regulators and handlers with regard to sewage sludge
management:
8.3.1 Developing the awareness, understanding and commitment of the
community
If community groups and farmers are not completely convinced of the benefit of
land application of sewage sludge, the utilization system will not be successful.
The communication strategy should be open and transparent. In a country such
as
South
Africa
with
different
cultural
backgrounds
and
languages,
communication can be achieved by providing brochures and seminars in
languages spoken by predominant groups such as isiZulu, Afrikaans, seSotho,
isiXhosa and English. Citizen commitment can also be enhanced by site visits
and encouragement of community participation in advisory forums.
Farmers, constitute a group that will easily appreciate using sewage sludge in
fertilizing agricultural soil (Snyman and Van der Waals, 2003), but they still need
to comprehend the importance of adhering to code of practice regarding sludge
application.
8.3.2 Recruitment and training of competent people
Training of competent people to operate and manage the system will ensure
effective management.
8.3.3 Securing long-term support of politicians
In a country of widespread political diversity as is the case in South Africa, it is
necessary to reach all spheres of political interest, such that once the system is
in place it will remain sustainable irrespective of changes in the political interest
154
University of Pretoria etd – Chale-Matsau, J R B (2005)
of the ruling body. Political support can be gained through educating politicians
regarding the needs and benefits of the country’s people.
8.3.4 Foster knowledge and understanding by way of capacity building
By reaching the educational infrastructure, through awareness in undergraduate
and postgraduate programmes in the fields of science and engineering focusing
on specialized training in sewage sludge management. This will ensure that there
is always an available pool of individuals who appreciate the benefits of sewage
sludge utilization, who will eventually contribute to effective management of the
system.
8.3.5 Monitoring systems necessary to compliance
The quality of sewage sludge to be used for land application must be closely
monitored to ensure acceptable quality and to determine appropriate application
rates. Parameters of concern, both biological and chemical need to be regularly
checked to protect both human health and the environment.
8.4 Future Trends
Utilisation in agricultural land will continue to grow as the preferred sewage
sludge management practice because it is based on the fundamental concept of
sustainable waste management. Societies worldwide are recognizing that there
is an urgent need to change our thinking from resource consumption to
ecosystem protection, and from disposal of what is regarded as waste materials
to the extraction and reuse of the valuable portion of these resources.
The need for effective sewage sludge management systems in developing
countries is particularly urgent. In order to accelerate their process of formulating
management systems, some developing countries have adapted the experiences
155
University of Pretoria etd – Chale-Matsau, J R B (2005)
of existing systems to meet their local needs. For instance, Mexico adopted the
US limits for heavy metals and Faecal coliforms and modified the limits for
Salmonella spp and the Ascaris ova (Jimenez et al., 2003). Coupled to the
necessary management systems, is changing the perceptions of environmental
groups and improving the knowledge of the general public regarding sludge use.
156
University of Pretoria etd – Chale-Matsau, J R B (2005)
8.5 References
Baloda, S.B., Christensen, L. and Trajcevska, S. 2001. Persistence of a
Salmonella enterica Serovar Typhimurium DT12 Clone in a piggery and in
Agricultural Soil Amended with Salmonella-Contaminated Slurry. Applied and
Environmental Microbiology. 67(6). 2859-2862
Jimenez, B., Barrios, J.A., Mendez, J.M. and Diaz, J. 2003. Sustainable sludge
Management in Developing Countries. Proceedings of the IWA Biosolids 2003
Conference, Wastewater Sludge as a Resource 23-25 June 2003. Trondheim.
Norway
Juang, D.F. and Morgan, J.M. 2001. The Applicability of the API 20E and API
Rapid NFT Systems for the Identification of Bacteria from Activated Sludge.
Electronic Journal of Biotechnology. 4(1). 18-24
Rudolfs, W., Falk, L.L. and Ragotzkie, R.A. 1950. Literature review on the
occurrence and survival of enteric, pathogenic, and relative organisms in soil,
water, sewage, and sludges, and on vegetation. Sewage and Industrial Wastes.
22. 1261-1281
Snyman, H.G. and Van der Waals, J. 2003. Laboratory and field scale evaluation
of agricultural use of sewage sludge. Final Report of WRC Project Number
K5/1210
Strauch, D. 1991. Survival of Pathogenic Micro-organisms and Parasites in
Excreta, Manure and Sewage Sludge. Revue Scientifique et Technique office
International des Epizooties. 10(3). 813 - 846
157
University of Pretoria etd – Chale-Matsau, J R B (2005)
Chapter 9
Appendices
Appendix A
Table A.1 API 20E TESTS FOR ENTEROBACTERIACEAE
ABREVIATION
TEST
ADH
Arginine
AMY
Amygdalin
ARA
Arabinose
CIT
Sodium citrate
GEL
Kohn’s gelatin
GLU
Glucose
H2S
Sodium thiosulphate
IND
Tryptophane
INO
Inositol
LDC
Lysine
MAN
Mannitol
MEL
Melibiose
ODC
Ornithine
ONPG
Ortho-nitro-phenyl-β - galactopyranoside
OX
Oxidase
RHA
Rhamnose
SAC
Sucrose
SOR
Sorbitol
TDA
Tryptophane
URE
Urea
VP
Creatine
158
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table A.2 API STAPH FOR STAPHALOCOCCI AND MICROCOCCI
ABREVIATION
TEST
ADH
Arginine
FRU
Fructose
GLU
Glucose
LAC
Lactose
MAL
Maltose
MAN
Mannitol
MDG
α- methyl-glucoside
MEL
Melbiose
MNE
Mannose
NAG
N-acetyl-glucosamine
NIT
Potassium nitrate
PAL
β-naphthyl-acid phosphate
RAF
Raffinose
SAC
Sucrose
TRE
Trehalose
URE
Urea
VP
Sodium pyruvate
XLT
Xylitol
XYL
Xylose
159
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table A.3: Results of the API tests undertaken for microbial identification.
API Staph was used to identify Isolate in column labeled 6. Tests are
indicated in braces
TEST
Isolates
1
2
3
4
5
6
ONPG
+
+
+
+
+
(O) -
ADH
-
-
-
+
-
(ADH) -
IDC
+
+
+
-
+
(FRU) +
ODC
+
+
+
+
+
(MNE) +
CIT
-
+
+
+
+
(MAL) +
H2S
-
-
-
-
-
(LAC) +
URE
-
-
-
-
+
(URE) -
TDA
-
-
-
-
-
(TRE) +
IND
+
-
-
+
+
(XLT) -
VP
-
+
+
-
+
(VP) +
GEL
-
+
+
-
-
(NIT) +
GLU
+
+
+
+
+
(GLU) +
MAN
+
+
+
+
+
(MAN) +
INO
-
+
+
-
+
(PAL) -
SOR
+
+
+
+
+
(RAF) +
RHA
+
-
-
+
+
(XYL) +
SAC
-
+
+
-
+
(SAC) +
MEL
+
+
+
-
+
(MEL)+
AMY
-
+
+
+
+
(MDG) -
ARA
+
-
-
+
+
(NAG) +
OX
-
-
-
-
-
160
University of Pretoria etd – Chale-Matsau, J R B (2005)
Appendix B
Data generated from Statistical analysis
Table B.1: Summary of Descriptive Statistics for Faecal coliforms
Time
00
02
04
06
08
10
12
(weeks)
N
8
8
8
8
8
LMS 8 tons/ha
3628.75 36575000 7525000
Mean
15775074
8525
7049.63
955
SD
1873.66 23419757 15785595
25629047
15533
14967
2245.78
P
0.0009
0.0031
0.1252
0.1645
0.2245
0.2682
Median
2750
34000000 500000
3400000
0
0
0
P
0.0078
0.0078
0.0078
0.0156
0.2500
0.2500
0.5000
29937.5
14250000
14213225
870
327.87
395375
LMS 16 tons/ha
Mean
26125
8
8
0.2196
SD
10881.8 11724.33
12739590
18453896
1666.97 507.52
474287
P
0.0003
0.0002
0.0158
0.0658
0.1834
0.1104
0.0505
Median
31000
33500
11700000
3250000
30
69.5
195000
P
0.0078
0.0078
0.0078
0.0078
0.0625
0.0313
0.0313
5861.25
47455
9175000
0
0
0
HMS 8 tons/ha
Mean
470
SD
1105.74 6546.56
89300.87
16803890
0
0
0
P
0.2684
0.0391
0.1765
0.1664
-
-
-
Median
75
3550
665
2800000
0
0
0
P
0.0313
0.0078
0.0078
0.0313
-
-
-
HMS 16 tons/ha
Mean
1848.75 20162.50
7303750
6975056
7.5
6.25
0
SD
1195.04 10810.04
11065447
10933623
21.21
11.88
0
P
0.0033
0.0012
0.1042
0.1141
0.3506
0.1803
-
Median
1575
17600
4200000
2900000
0
0
0
P
0.0078
0.0078
0.0078
0.0313
1.0000
0.5000
-
161
University of Pretoria etd – Chale-Matsau, J R B (2005)
Table B.2: Summary of Descriptive Statistics for E. coli
Time
00
02
04
06
08
10
12
(weeks)
N
8
8
8
8
8
8
8
LMS 8 tons/ha
2178.75
Mean
26362500
4625000
0
3750
6775
226.25
SD
736.91
23884959
10825730
0
10606.6
14315
447.63
P
0.0001
0.0168
0.2667
-
0.3506
0.2225
0.1959
Median
2000
20000000
0
0
0
0
0
P
0.0078
0.0078
0.2500
-
1.0000
0.5000
0.5000
LMS 16 tons/ha
Mean
25250
29937.5
10200000
1629475
684.5
164.38
101625
SD
10361.47
11724.33
13249690
459475
1676.66
348.04
216955.5
P
0.0002
0.0002
0.0659
0.3492
0.2861
0.2234
0.2268
Median
29000
33500
5500000
0
5
6.5
0
P
0.0078
0.0078
0.0078
0.2500
0.1250
0.1250
0.2500
HMS 8 tons/ha
Mean
446.25
5861.25
1572.5
1762500
0
0
0
SD
1113.64
6546.55
3575.49
3624495
0
0
0
P
0.2944
0.0391
0.2536
0.2114
-
-
-
Median
50
3550
315
0
0
0
0
P
0.0313
0.0078
0.0313
0.5000
-
-
-
HMS 16 tons/ha
Mean
1547.5
19912.5
6991250
2137556
7.5
6.25
0
SD
1359.76
11092.78
11149352
4914364
21.21
11.88
0
P
0.0147
0.0014
0.1194
0.2583
0.3506
0.1803
-
Median
1450
17600
3600000
0
0
0
0
P
0.0078
0.0078
0.0078
0.2500
1.0000
0.5000
-
162
University of Pretoria etd – Chale-Matsau, J R B (2005)
Appendix C
Reagents
LB Medium
10g Bacto-tryptone
5g Bacto-yeast extract
5g NaCl
Adjust pH to 7.0 with NaoH
Ampicilin
Ampicilin 0.25g
Sterile dH20 5ml
Filter sterilise, make aliquots and store at –20 oC
LB plates with Ampicilin
Add 12g of agar to 1L of LB medium
Autoclave
Allow the medium to cool at 50oC before adding ampicilin to a final concentration
of 100 µg/ml
Pour 30-35 ml of medium into 85 mm petri dishes
Can be stored at 4 oC for up to a month or at room temp for a week
Nutrient Agar
20 g of nutrient agar in 1L of distilled water. Autoclaved at 121 oC
TE Buffer
10 mM Tris.HCl
1mM EDTA
pH 8.0
50X TAE Buffer
40 mM Tris.HCl
163
University of Pretoria etd – Chale-Matsau, J R B (2005)
20 mM NaoAc
1mM EDTA
pH 8.5
Dilute 1:50 in dH2O before use (1 X TAE)
IPTG stock
1.2g IPTG
Add water to 50 ml final volume
Filter sterilise and store at –4oC
X-Gal
100 mg 5-bromo-4-chloro-3-indolyl-β -D-galactoside
Dissolve in 2 ml N,N’-dimethyl-formamide
Cover with aluminium foil and store at –20oC.
Solution I
50 mM Glucose
10mM EDTA
25 mM Tris.HCl
pH 8.0
Solution II
0.2 N NaoH
1% SDS
Must be prepared fresh
Solution III
3 M NaoAC
pH 4.8
164
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement