Chapter 8 DNA Barcoding in Mammals

Chapter 8 DNA Barcoding in Mammals
Chapter 8
DNA Barcoding in Mammals
Natalia V. Ivanova, Elizabeth L. Clare, and Alex V. Borisenko
Abstract
DNA barcoding provides an operational framework for mammalian taxonomic identification and cryptic
species discovery. Focused effort to build a reference library of genetic data has resulted in the assembly of
over 35 K mammalian cytochrome c oxidase subunit I sequences and outlined the scope of mammalrelated barcoding projects. Based on the above experience, this chapter recounts three typical methodological pathways involved in mammalian barcoding: routine methods aimed at assembling the reference
sequence library from high quality samples, express approaches used to attain cheap and fast taxonomic
identifications for applied purposes, and forensic techniques employed when dealing with degraded material. Most of the methods described are applicable to a range of vertebrate taxa outside Mammalia.
Key words: Mammalia, Molecular diagnostics, Molecular biodiversity, Molecular methods, DNA
extraction, PCR, Primers, Sequencing, Cytochrome c oxidase subunit I
1. Introduction
Mammals represent a minute fraction of biological diversity, with
only ~5,500 species currently recognized. Despite their large size
and charismatic nature, garnering much taxonomic scrutiny, it is
projected that their global diversity is still severely underestimated
with at least 7,000 mammalian species in existence (1). The present rate of species discovery in mammals is surprisingly high (~10%
increase in 15 years (1, 2)) with more than half of newly recognized species classified as “cryptic” (2) and their discovery largely
attributable to the use of non-morphological character complexes.
The recently introduced Genetic Species Concept (3, 4) emphasizes genetic rather than reproductive isolation as key to mammalian species’ definition and utilizes genetic divergence to assess
species boundaries. While this concept does not define species
based on genetic divergence alone and is thus not analogous to
molecular taxonomy, it calls for collecting large amounts of
W. John Kress and David L. Erickson (eds.), DNA Barcodes: Methods and Protocols, Methods in Molecular Biology, vol. 858,
DOI 10.1007/978-1-61779-591-6_8, © Springer Science+Business Media, LLC 2012
153
154
N.V. Ivanova et al.
information on inter- and intraspecific genetic divergence as an
important first step in the process of elaborating taxonomic hypotheses. This coincides with the DNA barcoding approach (5, 6),
which offers an operational framework for species identification
and discovery using short, standardized gene fragments. Although
cytochrome b has been traditionally used for studying mammalian
alpha-taxonomy (e.g., ref. 3), cytochrome c oxidase subunit 1
(COI) was the marker of choice for many groups outside Chordata,
such as insects and certain marine invertebrates (7–9), and has
been adopted as the standard barcoding marker for the animal
kingdom (10). While COI evolves more slowly than cyt b (11), it
performs equally well in mammalian diagnostics (12) and can yield
complementary data for combined phylogenetic analyses (13). The
utility of COI DNA barcoding in mammals has been demonstrated
in a range of different studies, including bioinformatics (14–16),
verification of field-made taxonomic assignments (17, 18), and
assessment of genetic diversity patterns in regional (19, 20) and
continental faunas (21). The standard animal DNA barcode region
has been used in conjunction with other genes for taxonomic revision (13, 22–24) and new species’ description (25). As of 2010,
more than 35 K mammalian sequences from over 1 K species have
been assembled at the Biodiversity Institute of Ontario as part of
an ongoing international effort to build the reference library of
DNA barcodes. The sources from which our samples were obtained
ranged from degraded archival specimens to high quality cryopreserved tissue. This experience has helped to outline the scope of
mammal-related barcoding projects—from forensic cases to the
creation of the reference DNA barcode library—and the array of
methodological approaches that optimally suit each particular case.
While one should keep in mind that mammalian DNA barcoding
also intersects with important topics including the ethics of sampling vertebrate collections (26), approaches to conservation
genetics (27), specimen examination (28), and the front-end logistics of the barcoding pipeline (29) for efficient high throughput
molecular processing, these topics fall outside the scope of this
paper and are discussed elsewhere. Here, we have attempted to
summarize the methodological approaches employed for the
molecular aspects of DNA barcoding in mammals. The molecular
protocols are similar to those used in other animals (30), particularly vertebrates, and can be readily applied when dealing with
sample sets which include multiple vertebrate groups.
We describe three molecular pathways depending on
application.
1. Routine barcoding—the assembly of the reference barcode
library from high grade tissue samples. This approach frequently employs high throughput methodology in 96-well
plate-based manual applications but is also applicable to robotic
liquid handling protocols (31). The outcome is the generation
8
DNA Barcoding in Mammals
155
of high quality genomic DNA extracts suitable for long-term
archival and bidirectional reads of the full-length barcode
region of COI (657 bp).
2. Express barcoding—applied barcoding used in ecological surveys and rapid taxonomic assessments. Similar to routine methods, the approach generally utilizes high grade tissue sources
and high throughput techniques, but can be scaled down for
small numbers of samples. Express protocols use comparatively
fewer reagents and require simpler equipment to be cost-effective,
but the resulting DNA extracts are not of archival grade.
Unidirectional short length (420 bp) sequences are often
generated which are sufficient for reliable species-level identification in mammals (32). An offshoot of this approach is the
design and use of microarrays (12, 14).
3. Forensic barcoding—applied barcoding aimed at generating
DNA-based identifications when the DNA is degraded and
contaminated with fungi or bacteria or when the samples are
otherwise recalcitrant. This approach requires polymerase
chain reaction (PCR) primers amplifying shorter fragments of
DNA (33) and quality checks for cross-contamination. If the
tissue is fresh, quick alkaline lysis can be used for DNA extraction; otherwise, we recommend following the DNA extraction
protocol for routine barcoding (31).
The protocols below are centered on high throughput
approaches towards routine barcoding adopted for laboratories
lacking robotic liquid handling equipment, but highlight the methodological deviations required for express and forensic barcoding.
The utility of these protocols has been validated against a wide
range of mammalian taxa representing all major extant orders.
2. Materials
1. Tissue preservation (routine DNA barcoding):
(a) Ethanol 96% (store in a flammable liquid cabinet).
(b) ELIMINase (Decon Labs Inc.) for sterilizing instruments.
(c) Cryotubes with O-ring caps.
(d) Acid-free label paper (Rite-in-the-Rain or equivalent).
(e) Fine smooth-tip forceps (Dumont or equivalent; see
Note 1).
2. Tissue subsampling and lysis (routine DNA barcoding):
(a) Ethanol 96% (store in a flammable liquid cabinet).
(b) Hard-shell skirted microplate (Eppendorf twin-tec 96
PCR plate, Fisher Scientific; Fig. 1).
156
N.V. Ivanova et al.
Fig. 1. 96-Well microplate shown from below demonstrating the recommended amount of
tissue to sample in each well.
(c) 12-Strip flat PCR caps (Thermo Scientific).
(d) ELIMINase (Decon Labs Inc.).
(e) 12 × 8 Cryotube holding rack for arranging tubes in plate
format.
(f) Fine forceps (Dumont or equivalent, see Note 1).
(g) KimWipes (Kimberly-Clark, Inc.).
(h) Glass jars: one 4 oz for ELIMINase and three 8 oz for tool
rinsing.
(i) Multichannel pipette 5–200 mL LTS or Liquidator (Rainin);
see Note 2.
(j) Proteinase K: Proteinase K (20 mg/ml) in 10 mM Tris–
HCl pH 7.4, 50% glycerol v/v. (Add 20 ml of water and
0.5 ml of 1 M Tris–HCI pH 7.4, to a vial with 1 g of
Proteinase K, close the lid, mix well by inverting, and do
not shake. Pour into graduated cylinder, add water to
25 ml, then add 25 ml of glycerol, and mix well on
magnetic stirrer. Do not filter.)
(k) VLB buffer: 100 mM NaCl, 50 mM Tris–HCl pH 8.0,
10 mM EDTA pH 8.0, 0.5% SDS (20 ml 1 M NaCl,
10 ml 1 M Tris–HCl pH 8.0, 1 g sodium dodecyl sulfate
(SDS), water to 200 ml). Store at room temperature for
up to 6 months.
(l) Lysis mix: Mix 5 ml of VLB and 0.5 ml of Proteinase K in
sterile container.
8
DNA Barcoding in Mammals
157
3. DNA extraction [routine DNA barcoding: glass fiber (GF)
method]; see Note 3:
(a) ELIMINase (Decon Labs Inc.).
(b) Ethanol 96% (store in a flammable liquid cabinet).
(c) 8-Strip flat PCR caps (Thermo Scientific).
(d) GF plate: AcroPrep 96 1 ml filter plate with 1.0 mm GF
media (PALL, Catalog No. 5051).
(e) Matrix Impact2 pipette, 15–1,250 ml with tips (Matrix
Technologies).
(f ) Square-well block (PROgene Deep-Well Storage Plate
2 ml, Ultident).
(g) PALL collar (SBS Receiver Plate Collar, PALL) (see Note 4).
(h) Filter unit (0.2 mm CN membrane, Nalgene, Catalog No.
450-0020).
(i) Hard-shell skirted microplate; also used as collection plate
for DNA eluates.
(j) Aluminum Sealing Film (Axygene Scientific, VWR) (to
seal DNA plate).
(k) Clear Sealing Film (Axygene Scientific, VWR) (used to
cover GF plates during centrifugation).
(l) Refrigerated centrifuge with swinging deep-well plate
bucket rotor (Allegra 25R, Beckman Coulter) (see
Note 5).
(m) 1 M Tris–HCI pH 8.0 [26.5 g Trizma base (SigmaAldrich)], 44.4 g Trizma HCl (Sigma-Aldrich, water to
500 ml) (see Note 6 for all stock solutions and buffers).
(n) 1 M Tris–HCI pH 7.4 (9.7 g Trizma base, 66.1 g Trizma
HCl, water to 500 ml).
(o) 0.1 M Tris–HCI pH 6.4 (6.06 g Trizma base, water to
500 ml); dissolve in smaller volume than 500 ml, adjust
pH with HCl to 6.4–6.5, and then add water to attain the
final volume.
(p) 1 M NaCl (29.22 g NaCl, water to 500 ml).
(q) 1 N NaOH (20 g NaOH, water to 500 ml).
(r) 0.5 M EDTA pH 8.0 (186.1 g EDTA, ~20.0 g NaOH,
water to 500 ml). Vigorously mix on magnetic stirrer with
heater. Disodium salt of EDTA does not dissolve until pH
is adjusted to ~8.0 with NaOH. Briefly rinse NaOH granules with ddH2O in a separate glass before dissolving.
Adjust pH to 8.0 with 1 N NaOH, before bringing to the
final volume.
(s) BB buffer: 6 M guanidinium thiocyanate (GuSCN),
20 mM EDTA pH 8.0, 10 mM Tris–HCl pH 6.4, 4%
158
N.V. Ivanova et al.
Triton X-100 (354.6 g GuSCN, 20 ml 0.5 M EDTA
pH.8.0, 50 ml 0.1 M Tris–HCl pH 6.4, 20 ml Triton
X-100, water to 500 ml). Store at room temperature in
the dark for up to 2 months. Weigh dry components first,
then add required volumes of stock solutions, followed
by small volume of water; dissolve on a warm water bath
while constantly stirring; add water to attain the final volume. Filter while solution is still warm. Although the filtering is optional, it helps to minimize crystallization. If
crystallization occurs, heat to 56°C before use to redissolve any salts (caution: GuSCN is an irritant; see Note 7).
(t) WB buffer: 60% Ethanol, 50 mM NaCl, 10 mM Tris–
HCl pH 7.4, 0.5 mM EDTA pH 8.0 (600 ml ethanol
96%, 23.75 ml 1 M NaCl, 9.5 ml 1 M Tris–HCl pH 7.4,
0.950 ml 0.5 M EDTA pH 8.0, water to 950 ml; do not
adjust pH); store at –20°C.
(u) BM buffer: 250 ml of BB buffer, 250 ml ethanol 96% (store
at room temperature in the dark for up to 1 month).
(v) PWB buffer: 260 ml of BB buffer, 700 ml ethanol 96%,
40 ml water (store at room temperature in the dark for up
to 1 month).
4. PCR (same for all pathways):
(a) 10% Trehalose: 5 g of D-(+)-Trehalose dihydrate (SigmaAldrich, No. 90210-50g; see Note 8), molecular grade
water to 50 ml. Store in 1–2 ml aliquots at –20°C.
(b) 10× PCR Buffer, Minus Mg (Invitrogen); store at –20°C.
(c) 50 mM Magnesium Chloride (Invitrogen); store at –20°C.
(d) 10 mM Deoxynucleotide Solution Mix (Promega); store
in 100 ml aliquots at −20°C.
(e) 100 mM primer stock: Dissolve desiccated primer (IDT
DNA, USA) in the amount of water indicated by the
manufacturer to produce the final solution of 100 mM
(i.e., add the number of nmol × 10 ml of water; see Note 9);
store at –20°C.
(f ) 10 mM primer stock: 20 ml of 100 mM stock, 180 ml of
water; store at –20°C.
(g) Platinum Taq DNA Polymerase (Invitrogen); store at
–20°C.
(h) Eppendorf Mastercycler ep gradient S Thermocycler
(Eppendorf).
(i) Heat sealer (Eppendorf) (used to apply heat sealing film
on PCR plates prior to thermal cycling).
(j) Aluminum Sealing Film (Axygene Scientific, VWR) (used
to reseal DNA plate after use).
8
DNA Barcoding in Mammals
159
(k) Clear Sealing Film (Axygene Scientific, VWR) (used for
temporary cover of PCR plates prior to use).
(l) Heat sealing Film (GE Uniseal Al Heat Seal Film, Lab
Planet) (used to seal PCR plate prior to thermal cycling).
(m) Hard-shell skirted microplate (see Note 10).
(n) Swinging bucket centrifuge with microplate rotor
(Thermo Scientific).
5. PCR Product Check (same for all pathways):
(a) Gel documentation system (AlphaImager, Alpha Innotech).
(b) Pre-cast agarose gels (2% E-Gel 96, Invitrogen).
(c) E-Base Integrated power supply (Invitrogen).
6. Cycle sequencing reaction (same for all pathways):
(a) 10% Trehalose: 5 g of D-(+)-Trehalose dihydrate (SigmaAldrich, Catalog No. T9531-100g), molecular grade
water to 50 ml. Store in 1–2 ml aliquots at –20°C.
(b) 5× Sequencing Buffer (400 mM Tris–HCl pH 9.0 + 10 mM
MgCl2).
(c) 100 mM primer stock: Dissolve desiccated primer (IDT
DNA, USA) in the amount of water indicated by the
manufacturer to produce the final solution of 100 mM
(i.e., add the number of nmol × 10 ml of water; see Note
9); store at –20°C.
(d) 10 mM primer stock: 20 ml of 100 mM stock, 180 ml of
water; store at –20°C.
(e) BigDye Terminator v3.1 Cycle Sequencing Kit (Applied
Biosystems).
(f ) Microplate (any microplate can be used at this stage).
(g) AirClean Systems Ductless PCR Workstation (Fisher
Scientific).
7. Sequencing reaction cleanup (same for all pathways):
(a) Sephadex G50 (Sigma).
(b) Acroprep 96 Filter plate, 0.45 mm GHP (PALL Corporation
Catalog No. 5030).
(c) Pop-7 Polymer for 3730xl DNA Analyzers (Applied
Biosystems).
(d) 3730xl DNA Analyzer Capillary Array, 50 cm (Applied
Biosystems).
(e) 10× Running Buffer for 3730xl DNA Analyzers (Applied
Biosystems).
(f) Collection plate: MicroAmp 96-well reaction plate
(Applied Biosystems).
160
N.V. Ivanova et al.
Fig. 2. FTA Elute blotting card with blood blots demonstrating the recommended amount
of tissue to sample in each blotting circle.
(g) Hydroclave
MC8
International).
Steam
Sterilizer
(Barnstead
(h) AirClean Systems Ductless PCR Workstation (Fisher
Scientific).
(i) 3730xl DNA Analyzer (Applied Biosystems).
(j) 8-Channel Matrix multichannel pipette (Matrix Impact2
pipette, 15–1,250 ml, Matrix Technologies).
8. Tissue preservation (express DNA barcoding: FTA Elute
blotting cards; Fig. 2):
(a) Small cotton swabs, e.g., ear swabs for liquid tissue (see
Note 11).
(b) FTA Elute blotting cards (Whatman, GE Healthcare).
9. Tissue subsampling and lysis (express DNA barcoding: FTA
Elute blotting cards):
(a) Ethanol, 96%.
(b) Harris Micropunch (1.2 mm, Sigma-Aldrich).
(c) Harris self-healing cutting mat (Sigma Aldrich)—as
support surface for blotting and punching.
(d) Microplate (Eppendorf twin-tec PCR plate, Fisher
Scientific).
10. DNA extraction (express DNA barcoding: FTA Elute blotting
cards):
(a) Swinging bucket centrifuge with microplate rotor
(Thermo Scientific).
8
DNA Barcoding in Mammals
161
11. PCR (express DNA barcoding)—materials listed under item 4.
12. PCR product check (express DNA barcoding)—materials listed
under item 5.
13. Cycle sequencing reaction (express DNA barcoding)—materials listed under item 6.
14. Sequencing reaction cleanup (express DNA barcoding)—
materials listed under item 7.
15. Tissue preservation (forensic DNA barcoding): materials listed
under item 1.
16. Tissue subsampling and alkaline lysis (forensic DNA
barcoding)—materials listed under item 2.
17. DNA extraction (forensic DNA barcoding: alkaline lysis); see
Note 3:
(a) AL buffer: 0.1 N NaOH, 0.3 mM EDTA; pH 13.0 (5 ml
1 N NaOH, 30 ml 0.5 M EDTA pH 8.0). Store in small
aliquots at –20°C.
(b) NT buffer: 0.1 M Tris–HCl pH 7.0 (6.06 g Trizma base,
water to 500 ml). Adjust pH with HCl to 7.0; add water
to the final volume. Store in small aliquots at –20°C.
18. PCR (forensic DNA barcoding)—materials listed under item 4.
19. PCR product check (forensic DNA barcoding)—materials
listed under item 5.
20. Cycle sequencing reaction (forensic DNA barcoding)—
materials listed under item 6.
21. Sequencing reaction cleanup (forensic DNA barcoding)—
materials listed under item 7.
3. Methods
1. Tissue sampling and preservation (routine DNA barcoding):
(a) Dissect and remove piece of skeletal muscle (see Note 12)
with clean scissors/forceps.
(b) Fill cryotube with 96% ethanol (see Note 13) and label
the tube with individual specimen number (see Note 14)
on the outside (ethanol-resistant ink or pencil) or on paper
(use ethanol-resistant marker/pencil and acid-free paper).
Ensure that at least a 10:1 ratio is maintained between
fixative and tissue; e.g., the volume of tissue placed in a
2 ml cryotube should not exceed 5 × 5 × 5 mm.
(c) Mince tissue in the tube thoroughly with scissors to
allow fixative penetration; place label inside the tube (if
applicable).
162
N.V. Ivanova et al.
(d) Between samples, remove visible tissue particles from tool
tips, sterilize tool tips with detergent (e.g., ELIMINase)
and rinse with several changes of water to remove detergent residue (see Note 15).
(e) Replace fixative after 2–10 days of storage (see Note 16).
(f) Store tissues at low temperatures (ideally, below 0°C) and
away from light (see Note 17).
2. Subsampling and lysis (routine DNA barcoding; see Note 18):
(a) Prefill a 96-well microplate with 30 ml (or one drop) of
96% ethanol per well. Cover plate with 12-cap strips. Do
not use ethanol if the samples were previously fixed in
another medium (see Note 16).
(b) Assemble specimens and prepare a map, based on the alpha
numeric grid of well and row location of sample locations
in 96-well plate (see Note 19).
(c) Using forceps, sample ca. 1 mm3 of tissue into each well
of the plate. While working, keep only one row uncapped
at a time to minimize the chance of error and crosscontamination.
(d) Between samples, sterilize forceps by wiping with KimWipe,
washing in ELIMINase and rinsing with three changes of
distilled water.
(e) Seal each row firmly with cap strips.
(f) Prior to lysis, centrifuge plate for 1 min at 1,000 × g to
remove ethanol and tissue from cap strips.
(g) Remove cap strips and evaporate residual ethanol at 56°C
(secure plate against workbench surface and remove caps
slowly to prevent spraying of well contents).
(h) Add 50 ml of Lysis Mix to each well and reseal with sterile
8-cap strips.
(i) Incubate at 56°C for >12 h to allow digestion (see Notes 20
and 21).
3. DNA extraction—GF protocol for routine barcoding (see
Note 22):
This method utilizes a bind–wash–elute approach commonly
used in commercial kits for DNA extraction, but delivers similar or even better results at a fraction of the cost. The DNA
binds to a GF membrane in the presence of chaotropic salts,
while contaminants are washed away using two different wash
buffers. After two wash stages and drying, DNA is eluted from
membrane using molecular grade water or low-salt buffer (see
Note 23).
(a) Centrifuge plates with lysed samples [from step 1(i)] at
1,500 × g for 1 min to remove any condensate from cap
strips.
8
DNA Barcoding in Mammals
163
(b) Open cap strips (secure plate against workbench surface
and remove caps slowly to prevent spraying of lysate).
(c) Add 100 ml of BM buffer to each sample using multichannel pipette or Liquidator (see Note 2).
(d) Mix lysate by gently pipetting; transfer lysate (about
150 ml) from microplate to corresponding wells of GF
plate resting on square-well block. Seal GF plate with
clear film.
(e) Centrifuge at 5,000 × g for 5 min to bind DNA to GF
membrane.
(f ) Perform the first wash step: Add 180 ml of PWB buffer to
each GF plate well. Seal with new cover and centrifuge at
5,000 × g for 2 min.
(g) Perform the second wash step: Add 750 ml of WB buffer
to each GF plate well. Seal with new clear film and centrifuge at 5,000 × g for 5 min.
(h) Remove clear film and place GF plate over collection
microplate. Incubate at 56°C for 30 min to evaporate
residual ethanol.
(i) Position PALL collar on collection microplate and place
GF plate on top. Dispense 50–60 ml of ddH20 (prewarmed
to 56°C) directly on each GF plate well membrane to
elute DNA (see Note 23) and incubate at room temperature for 1 min. Seal GF plate with clear film.
(j) Place plate assembly on clean square-well block to prevent
collection plate cracking; centrifuge at 5,000 × g for 5 min
to collect eluted DNA.
(k) Remove GF plate and discard.
(l) Cover DNA plate with strip cap or aluminum PCR foil.
(m) Use 1–2 ml of DNA for PCR. DNA can be temporarily
stored at 4 or at –20°C for long-term storage.
(n) To reuse 2 ml square-well blocks, wash them with hot
water and ELIMINase and rinse with deionized water.
Dry and expose to UV light for >15 min prior to use.
4. PCR (routine DNA barcoding):
M13-tailed primer cocktails are more effective than conventional degenerate primers, allowing barcode work on taxonomically diverse samples to be performed in a high throughput
fashion.
(a) Select primer cocktails, depending on application (Table 1);
refer to volume proportions indicated in the column
“Ratio in cocktail” of Table 1 (see also Note 24).
(b) Prepare PCR reagent mix using volumes listed in Table 2.
FR1d_t1
FishR2_t1
VF2_t1
FishF2_t1
VR1i_t1
VR1_t1
VR1d_t1
LepR1_t1
VF1i_t1
VF1d_t1
VF1_t1
LepF1_t1
Primer name
Fish Cocktail [C_FishF1t1 + C_FishR1t1]
TGTAAAACGACGGCCAGTCGACTAA
TCATAAAGATATCGGCAC
TGTAAAACGACGGCCAGTCAACCAA
CCACAAAGACATTGGCAC
CAGGAAACAGCTATGACACTTCAGG
GTGACCGAAGAATCAGAA
CAGGAAACAGCTATGACACCTCAGG
GTGTCCGAARAAYCARAA
Mammal Cocktail (C_VF1LFt1 + C_VR1LRt1]
TGTAAAACGACGGCCAGTATTCAAC
CAATCATAAAGATATTGG
TGTAAAACGACGGCCAGTTCTCAAC
CAACCACAAAGACATTGG
TGTAAAACGACGGCCAGTTCTCAAC
CAACCACAARGAYATYGG
TGTAAAACGACGGCCAGTTCTCAAC
CAACCAIAAIGAIATIGG
CAGGAAACAGCTATGACTAAACTTC
TGGATGTCCAAAAAATCA
CAGGAAACAGCTATGACTAGACTTC
TGGGTGGCCRAARAAYCA
CAGGAAACAGCTATGACTAGACTTC
TGGGTGGCCAAAGAATCA
CAGGAAACAGCTATGACTAGACTTC
TGGGTGICCIAAIAAICA
Primer sequence
M13R
M13R
M13F
M13F
M13R
M13R
M13R
M13R
M13F
M13F
M13F
M13F
M13 seq
primer
1
1
1
1
3
1
1
1
3
1
1
1
Ratio
in cocktail
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
RB, EB
Application
Fish52
MammCOI
Thermocycler
program
652
658
(46)
(46)
Product
length (bp)a Reference
Table 1
Mammalian primer sets for various applications (RB routine DNA barcoding and reference library, EB express DNA barcoding
and ecological surveys, FB forensic DNA barcoding and museum samples)
164
N.V. Ivanova et al.
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
Primers for forensic and express barcoding of bats
TTCTCAACCAACCACAAAGACATTGG
GCATGAGCTGTTACGATTACG
CTGGGGCCCTATTAGGTGAT
TATATCGGGTGCGCCAATTA
GGGGGATTCGGTAATTGATT
GGCTAGTGGTGGGTATACGG
TACAGTTGAAGCTGGCGTTG
AGCTCCAAGGATTGACGAAA
TCTCTCTTCACCTAGCCGGA
GGCAGTGATTAAAACGGATCA
GCCCTCTCTCAATATCAAACAC
TAGACTTCTGGGTGGCCAAAGAATCA
Sequencing primers
TGTAAAACGACGGCCAGT
CAGGAAACAGCTATGAC
VF1b
BC1R
BC2F
BC2R
BC3F
BC3R
BC4F
BC4R
BC5F
BC5R
BC6F
VR1b
M13F (-21)c
M13R (-27)c
RB, EB, FB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
FB, EB
RB, EB, FB
RB, EB
RB, EB
FB, EB
FB, EB
RB, EB
RB, EB
Application
Seq3.1
ExpressCOI
RatCOI
ExpressCOI
MammCOI54
COIfast
Thermocycler
program
161
93
96
134
106
117
702
187
421
658
(50)
(31)
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
(49)
(48)
This study
(12)
(47)
Product
length (bp)a Reference
M13-tailed primer cocktails are more effective than conventional degenerate primers, allowing barcode work on taxonomically diverse samples to be performed in a high throughput fashion
a
Product lengths are given without primers
b
VF1/VR1 are universal vertebrate primers that can be used for some mammal species as a stand-alone primer pair; their tailed modification is used in the
M13-tailed mammal cocktail
c
M13F/M13R are used for sequencing products generated with M13-tailed primers and their cocktails. In all other sequencing reactions, use the same primers
as for the PCR reaction
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
Rat primers [BatL5310 + R6036R]
CCTACTCRGCCATTTTACCTATG
ACTTCTGGGTGTCCAAAGAATCA
AquaF2
RonM_t1
BatL5310
R6036R
M13F
N/A
N/A
Ratio
in cocktail
N/A
Folmer degenerate [dgLCO-1490 + dgHCO-2198]
GGTCAACAAATCATAAAGAYATYGG
TAAACTTCAGGGTGACCAAARAAYCA
dgLCO-1490
dgHCO-2198
M13 seq
primer
Forward primers for express and forensic barcoding
TGTAAAACGACGGCCAGTGGMGCMC
CMGATATRGCATTCCC
ATCACRACCATCATYAAYATRAARCC
Primer sequence
Primer name
8
DNA Barcoding in Mammals
165
166
N.V. Ivanova et al.
Table 2
PCR reagent mix used in mammal DNA barcoding
Each well (ml)
regular PCR
96-Well plate (ml)
regular PCR
Each well (ml)
FTA elute disks
96-Well plate (ml)
FTA elute disks
10% Trehalose
6.25
625.0
6.25
625.0
ddH2O
2.00
200
4.00
400
10× Buffer
1.25
125.0
1.25
125.0
50 mM MgCl2
0.625
62.5
0.625
62.5
10 mM primerA
0.125
12.5
0.125
12.5
10 mM primerB
0.125
12.5
0.125
12.5
10 mM dNTPs
0.0625
6.25
0.0625
6.25
Platinum Taq (5 U/ml)
0.060
6.0
0.060
6.0
Total
10.5
1/8 Aliquot
–
1,050
130
12.5
–
1,250
155
(c) Defrost reagents listed in Table 2 (except Taq polymerase)
at room temperature; briefly vortex and spin down in a
mini-centrifuge. Keep Taq polymerase at –20°C until
immediately before use (see Notes 25 and 26); prior to
use, spin the tube with Taq polymerase for 10–15 s in a
mini-centrifuge. Do not mix Taq polymerase by vortexing
or pipetting.
(d) Add reagents to a 2 ml tube in volumes listed for “96-well
plate” (Table 2).
(e) Mix vigorously with vortex or pipette (vortexing traps liquid under the cap of tube necessitating a subsequent 15-s
spin in a mini-centrifuge).
(f ) Dispense 10.5 ml of PCR mix into well of the 96-well plate
(the same pipette tip can be used for all transfers).
(g) Add 1–2 ml of DNA template to each well (use new filter
pipette tip for each sample).
5. PCR thermocycling (same for all pathways):
(a) Place aluminum foil or heat-seal cover over the top of
96-well plate and centrifuge for 1 min at 1,000 × g.
(b) Place the plate in a thermocycler block, close the lid and
run thermocycling program appropriate for the primer
cocktail employed (Table 1). Apply thermal cycling conditions from Table 3.
(c) The resulting PCR plate can be stored for several weeks at
4°C or several months at –20°C until ready for sequencing.
8
DNA Barcoding in Mammals
167
Table 3
PCR programs and thermal cycling parameters for different primer sets
used in mammal DNA barcoding
PCR program
Primer combinations
Thermal cycling conditions
MammCOI
Mammal Cocktail
(C_VF1LFt1 + C_VR1LRt1)
94°C for 2 min; 5 cycles (94°C for 30 s, 50°C for
40 s, and 72°C for 1 min); 35 additional cycles
(94°C for 30 s, 55°C for 40 s, and 72°C for
1 min); final extension at 72°C for 10 min; then
hold indefinitely at 10°C
Fish52
Fish Cocktail
(C_FishF1t1 + C_FishR1t1)
94°C for 2 min; 40 cycles (94°C for 30 s, 52°C for
40 s, and 72°C for 1 min); final extension at
72°C for 10 min; then hold indefinitely at 10°C
MammCOI54
421 bp Fragment
(RonM_t1 + C_VR1LRt1)
94°C for 2 min; 40 cycles (94°C for 30 s, 54°C for
40 s, and 72°C for 1 min); final extension at
72°C for 10 min; then hold indefinitely at 10°C
MammCOI54
419 bp Fragment
(RonM_t1 + C_FishR1t1)
Same as above, but use 52°C for annealing
RatCOI
Rat primers (34)
(BatL5310 + R6036R)
94°C for 2 min; 35 cycles (94°C for 30 s, 60°C for
30 s, and 72°C for 1 min); final extension at
72°C for 5 min; then hold indefinitely at 10°C
COIfast
Folmer degenerate
primers (dgLCO-1490 +
dgHCO-2198)
94°C for 2 min; 5 cycles (94°C for 30 s, 45°C for
40 s, and 72°C for 1 min); 35 additional cycles
(94°C for 30 s, 51°C for 40 s, and 72°C for
1 min); final extension at 72°C for 10 min; then
hold indefinitely at 10°C
ExpressCOI
~200 bp Fragment
(AquaF2 + C_VR1LRt1)
or (AquaF2 + C_FishR1t1)
94°C for 2 min; 40 cycles (94°C for 30 s, 51°C for
40 s, and 72°C for 30 s); final extension at 72°C
for 10 min; then hold indefinitely at 10°C
6. PCR product check (E-gel, same for all pathways; see Note 27):
(a) Preset program EG on Mother E-base; set the run time to
4 min.
(b) Remove gel from package and detach plastic comb. Slide
gel into electrode connections on Mother E-Base (caution:
gel contains ethidium bromide; see Note 27).
(c) Dispense 12 ml of ddH2O into each E-gel well.
(d) Load 4 ml of PCR product into each corresponding e-gel
well.
(e) Begin electrophoresis by briefly pressing “pwr/prg” button. Red indicator light should change to green during
the run. End of run is signaled by flashing red light and
sound alarm; press and release the “pwr/prg” button
when finished.
168
N.V. Ivanova et al.
Fig. 3. E-gel image of PCR products generated from an FTA Elute card.
(f ) Remove gel from base and capture a digital image (we use
Alpha Imager documentation system; Fig. 3). PCR products can be visualized under any UV-emitting source.
(g) If success rate is over 75%, all samples from the PCR plate
should be sequenced. Success rates below 75% require hitpicking of amplified products and failure tracking (amplification of failed samples with alternative primer sets) of
the remaining samples (see Note 28). Hit-picked PCR
products obtained with different M13-tailed primers (e.g.,
mammal and fish cocktails) can be combined in the same
plate for sequencing; ensure that the resulting position of
rearranged samples is plotted in the new plate map.
7. Cycle sequencing (same for all pathways):
(a) Defrost reagents (Table 4) at room temperature. BigDye
is light sensitive and should not be exposed to light for
more than a few minutes. Do not vortex undiluted BigDye
stock; gently mix by pipetting instead.
(b) Prepare “forward” and “reverse” sequencing mixes:
Combine forward primer with reagents from Table 4 in a
single 2 ml tube in proportions listed under “96-well
plate”; repeat the procedure for reverse primer. Mark tubes
accordingly.
(c) Mix contents of each tube gently but thoroughly by
pipetting or vortexing for about 5–10 s (vortexing traps
liquid under the cap of tube necessitating a subsequent
15-s spin in a mini-centrifuge).
8
DNA Barcoding in Mammals
169
Table 4
Cycle sequencing reaction recipe used in mammal
DNA barcoding
Reagents
Each well (ml)
96-Well plate (ml)
Primer
1
104
2.5× SEQ Buffer
1.875
195
BigDye
0.25
26
ddH2O
0.875
91
10% Trehalose
5
520
Subtotal
9
936
DNA template
1–1.5
N/A
Total
10–10.5
N/A
1/8 Aliquot
115
N/A
(d) Assemble “forward” and “reverse” sequencing plates:
Dispense 9.0 ml of forward-sequencing mix into each well
of an empty 96-well plate; repeat the procedure for reverse
mix. Use a new set of pipette tips to transfer forward- and
reverse-sequencing mixes (tips can be reused between
transfers within each plate). Mark plates accordingly.
(e) Add 1–1.5 ml of nonpurified PCR product (see Notes 29
and 30) from the PCR plate [step 6(g)] to each well of the
“forward” and “reverse” sequencing plates (use new
pipette tip for each well).
(f) Place aluminum foil or heat-seal cover over sequencing
plates and centrifuge at 1,000 × g for 1 min to collect
sequence cocktail and PCR template at the bottom of the
wells.
(g) Place each sequencing plate in a thermocycler block and
start program Seq3.1: initial denaturation at 96°C for
2 min; followed by 30 cycles at 96°C for 30 s, annealing at
55°C for 15 s, and extension at 60°C for 4 min; followed
by indefinite hold at 4°C.
(h) Store processed sequencing plates for up to 1 week at 4°C
in a dark enclosure to avoid degradation of light-sensitive
sequencing products (see Note 31).
8. Sequencing cleanup (same for all pathways; see Note 32):
(a) Measure dry Sephadex G50 with black column loader into
350 ml PALL filter plate. Prepare two plates to balance
170
N.V. Ivanova et al.
each other or prepare a single plate and appropriate
counterbalance.
(b) Add 300 ml molecular grade water to plate wells prefilled
with Sephadex powder; leave mixture to hydrate overnight
at 4°C or for 3–4 h at room temperature before use.
(c) Join Sephadex plate with MicroAmp collection plate to
catch water flow through and secure with two rubber
bands.
(d) Balance two sets of plates for centrifuging; use additional
rubber bands as needed.
(e) Centrifuge at 750 × g for 3 min to remove excess water
and generate a packed Sephadex column.
(f ) Add the entire sequencing reaction to the center of
Sephadex columns by pipette. Do not insert the pipette tip
into the column; dispense liquid onto the upper surface of
the column. Damaging the column with a pipette tip or
dispensing solution onto the side of the column may result
in incomplete removal of unincorporated BigDye terminators which will adversely affect sequencing results.
(g) Add 25 ml of 0.1 mM EDTA to each well of a new
MicroAmp collection plate (see Note 33).
(h) Elute clean sequencing reaction by attaching the collection plate containing EDTA to the bottom of Sephadex
plate and securing with rubber bands.
(i) Balance two sets of plates for centrifuging; use additional
rubber bands as needed.
(j) Centrifuge at 750 × g for 3 min and remove Sephadex
plate.
(k) Cover the top of collection plate with septum.
(l) Place collection plate into black plate base of capillary
sequencer and attach white plate retainer.
(m) Stack assembled plates into ABI 3730xl capillary sequencer
and import plate records using Plate Manager module of
the Data Collection software (Applied Biosystems).
(n) Begin sequencing run within Run Scheduler.
9. Tissue sampling and preservation (express DNA barcoding:
FTA Elute blotting card; see Note 34):
(a) Dissect and remove a 3–4-mm3 piece of skeletal muscle with
clean scissors/forceps. If sampling from live animal (see
Note 11), collect ca. 10–20 ml of blood on a cotton swab.
(b) Dab muscle or cotton swab against blotting circle of the
FTA Elute card. Do not oversample (see Note 35).
8
DNA Barcoding in Mammals
171
(c) If employing reusable tools, sterilize them between samples
as per step 1(d); if using swabs, discard them after each
sample.
(d) Map the position of samples on the recording portion of
the card (see Note 36).
(e) Leave the card to air dry with the blotting portion opened
(see Note 37). Do not expose to direct sunlight.
(f) Store the card away from light at room temperature in a
dry environment or in a sealed bag with desiccant (e.g.,
silica gel; see Note 38).
10. Tissue lysis (express DNA barcoding: FTA elute blotting card):
(a) Wipe Harris mat with ethanol; open FTA Elute card and
slide mat under blotting surface (filter paper portion).
(b) Punch FTA elute card (filter portion only) using a 1.2 mm
Harris Micropunch.
(c) Place one punch into each well of 96-well microplate and
create sample map as above [step 2(b)].
(d) Between sampling, clean micropunch by punching clean
filter paper.
11. DNA extraction—(express DNA barcoding: FTA elute blotting card—muscle blot or blood):
(a) Ensure that all supplies are ready. Protocol must be completed in timed consecutive steps (prolonged incubation
in water results in DNA loss).
(b) Add 100 ml of water to each well of 96-well microplate
from step 10(c) using pipette or Liquidator; seal with aluminum film. Vortex plate for 10–15 s and centrifuge
immediately for 1 min at 1,000 × g.
(c) Aspirate and discard water from each well using pipette or
Liquidator (make sure that disks remain in their wells after
water is removed). Incubate open plate with disks at 56°C
for 5 min to evaporate residual water. Do not cover the
plate because disks easily stick to film or cap strips during
movement. After drying, disks can be used directly in PCR
reaction.
12. PCR (express DNA barcoding):
(a) Select primer cocktails for express barcoding (Table 1);
refer to volume proportions indicated in the column
“Ratio in cocktail” (see also Note 24).
(b) Prepare PCR reagent mix using volumes indicated for FTA
Elute disks in Table 2.
(c) Follow step 4(a–d) for routine barcoding.
172
N.V. Ivanova et al.
(d) Dispense 12.5 ml of PCR mix into each well of plate
containing prewashed FTA disks. Change pipette tips after
each well.
13. PCR thermocycling (express DNA barcoding)—procedures
listed under step 5.
14. PCR product check (express DNA barcoding)—procedures
listed under step 6; see also Note 27.
15. Cycle sequencing (express DNA barcoding)—procedures listed
under step 7.
16. Sequencing cleanup (express DNA barcoding)—procedures
listed under step 8; see also Note 32.
17. Tissue sampling and preservation (forensic DNA barcoding; if
applicable)—procedures listed under step 1.
18. Tissue subsampling and lysis (forensic DNA barcoding: alkaline lysis protocol).
(a) Follow subsampling step 2(a–g), if applicable; when subsampling for immediate lysis, prefill plate with AL buffer
instead of ethanol in step 2(a).
19. DNA extraction (forensic DNA barcoding: alkaline lysis
protocol):
(a) Add 35 ml of AL buffer to ~0.5–1 mm3 of fresh skeletal
muscle or hairs with follicles in tubes or 96-well
microplate.
(b) Incubate for 5 min in a thermocycler at 95°C or in freshly
boiled water in a water bath.
(c) Centrifuge for 1 min to remove condensate from caps or
plate cover.
(d) Add 65 ml of NT buffer and mix by pipetting.
(e) Use 1–2 ml of crude lysate for PCR reaction (label PCR
plate for reference using sticker or alcohol-resistant
marker). Store at –20°C for up to 2 weeks (see Note 39).
20. PCR (forensic DNA barcoding):
(a) Select primer cocktails for forensic barcoding (Table 1);
refer to volume proportions indicated in the column
“Ratio in cocktail” (see also Note 24).
(b) Prepare PCR reagent mix using volumes indicated for regular PCR in Table 2.
(c) Follow step 4(a–g) for routine barcoding.
21. PCR thermocycling (forensic DNA barcoding)—procedures
listed under step 5.
22. PCR product check (forensic DNA barcoding)—procedures
listed under step 6; see also Note 27.
8
DNA Barcoding in Mammals
173
23. Cycle sequencing (forensic DNA barcoding)—procedures
listed under step 7.
24. Sequencing cleanup (forensic DNA barcoding)—procedures
listed under step 8; see also Note 32.
4. Notes
1. Do not use forceps with cross-hatched or serrated tips due to
the difficulty of removing tissue remains during sterilization.
2. There are multiple manufacturers of single- and multichannel
pipettes; however, pipetting accuracy and design features may
vary. The most important feature for a multichannel pipette is
the uniformity of tip loading and unloading. Pipettes should be
made from durable material; if O-rings are used to seal tips,
frequently check their integrity and have spare O-rings available
for replacement. In a high throughput facility, Liquidator 96
from Rainin can be utilized for convenient and fast liquid transfers; this device offers manual pipetting of 96 samples at a time.
Although the recommended range volume of the Liquidator is
5–200 ml, it can still be used for volumes of 1.5–2 ml.
3. All chemicals used for tissue lysis and DNA extraction should
be of molecular biology grade or equivalent—of the highest
purity. Wash all labware with ELIMINase and rinse with distilled or deionized dH2O. Weigh reagents using a clean spatula.
Use molecular grade doubly distilled (dd) H2O in all buffer
formulations. Millipore MilliQ purified water (18 MW) can be
used for lysis and DNA extraction buffers, while commercially
manufactured molecular grade water is preferred for PCR and
sequencing. Do not use DEPC-treated water, as it may inhibit
PCR and cycle sequencing reactions. Store molecular grade
water in small aliquots to prevent contamination. Filter buffers
through a 0.2 mm Nalgene filter into a clean sterile bottle; prepare working aliquots of smaller volume (e.g., 100 ml). Store
stock solutions and working aliquots at 4°C.
4. A PALL collar is used to secure a GF plate on top of the
Microplate during the elution stage.
5. The centrifuge for DNA extraction should have deep buckets
to handle filter plate assemblies and should deliver at least
5,000 × g.
6. To prepare stock solutions and buffers, dissolve salts and other
components in a smaller volume than that of the final solution
and then add water to attain the final volume.
7. GuSCN does not dissolve without heating (this is an endothermic reaction). Caution: All GuSCN solutions are irritants
174
N.V. Ivanova et al.
and toxic and should be disposed of with care. Use nitrile
gloves and goggles at all times and protective mask while handling powder; avoid contact with acids to prevent release of
cyanide gas.
8. Some trehalose brands contain traces of pig DNA which may
contaminate reactions.
9. To minimize the risk of contamination, do not mix 100 mM
stocks by pipetting. After adding water, incubate tubes for
15–30 min at room temperature, vortex for 30 s, and briefly
spin tubes in a tabletop mini-centrifuge prior to opening.
10. Although non-skirted microplates can be used in PCR setup,
we recommend hard-shell skirted microplates, such as
Eppendorf twin-tec 96 PCR plate, to prevent spraying of PCR
products while reopening cap strips. Skirted microplates are
compatible with heat sealing film, which is more convenient to
use in a high throughput setting. Alternatively, 8-cap strips,
sealing mats, aluminum-sealing film, or PCR-grade clear film
can be used to cover plates prior to thermal cycling. Prior to
running actual samples, test the sealing technique by thermal
cycling of a plate filled with water. Most clear sealing films do
not provide a good seal.
11. Although express barcoding is instrumental in analyzing tissue
taken from live mammals (17, 18), this chapter does not cover
the tools or methods used in biopsy and live sampling of liquid
tissue or the respective animal handling techniques; refer to
specialized literature (e.g., refs. 34, 35) for details.
12. While there are numerous guidelines on mammal tissue preservation, many existing tissue collections and protocols focus on
studies of chemical contaminants or other specialized tasks
(e.g., allozyme analyses) and promote collecting tissue from
internal organs, such as liver (e.g., ref. 36). Both liver and
muscle have high mitochondria content (37); however, our
experience corroborates other studies (38, 39) which indicate
that internal organs (e.g., liver and kidney) are suboptimal
sources of mitochondrial DNA. The yield of full-length mitochondrial PCR products is lower or complicated by pseudogenes (numts) Fig. 4 which impede or prevent accurate
sequencing. These effects appear inconsistent between samples,
presumably dependent on the time between euthanasia and
tissue collection, type and quality of initial fixation, and subsequent storage conditions. Liver is characterized by the early
(<1 h) onset of postmortem autolysis causing ultrastructural
changes in mitochondria while nuclear heterochromatin condenses and is less affected (40, 41); similar processes appear to
affect cardiac muscle (42). Chromatin structure protects DNA
against oxidative and other damages (43) and may provide
protection against autolysis. The preferential amplification of
8
DNA Barcoding in Mammals
175
Fig. 4. Fragment of a sequencer chromatogram trace file showing a nuclear pseudogene at the 5¢ end.
numts from some kidney, heart, and liver samples when
broad-range primer cocktails are used may reflect degradation
of the primary mtDNA target. Although liver, kidney, and
heart remain the most commonly preserved mammal tissues,
their use for high throughput amplification of mtDNA is discouraged in favor of skeletal muscle. Our data also show high
success of barcode recovery from brain tissue, perhaps as a result
of good protection of mtDNA against degradation (44).
13. The quality of DNA in ethanol-preserved tissues is dependent
on many factors, including ethanol acidity and concentration,
storage temperature, exposure to light, sample age, as well as
the quality of the tissue. Ethanol is a good preservative of morphological integrity of the tissue, but it does not suppress
enzymatic activity. Therefore, it is preferred that ethanolpreserved tissue is stored at low temperatures (ideally, −20°C
or lower). Do not use denatured ethanol with unknown additives for tissue preservation and DNA extraction. Although
200 proof ethanol is the traditionally preferred choice for
molecular protocols, reagent-grade (histological) ethanol (e.g.,
Fisher Scientific; Cat. No. A962-4) is also suitable for tissue
fixation and all molecular protocols described in this chapter.
Cryopreservation in liquid nitrogen is ideal for tissue (26), but
may not be feasible in many field situations. FTA cards are
convenient, but sensitive to oversampling and ambient humidity (17). When freezing or ethanol fixation is logistically
impractical, alternative methods of tissue preservation for
routine and express barcoding methods include (a) DMSO—a
common salt solution for tissue preservation (39). (b) Laundry
detergent with enzymes (e.g., Persil MegaPearls)—small tissue
samples should be placed in tubes/bags filled with dry detergent and stored away from moisture. Samples should be
removed from medium prior to lysis, but washing is not
required. (c) Dried muscle—DNA barcodes can be successfully
recovered from muscle of air-dried mammal carcasses prepared
176
N.V. Ivanova et al.
for clearing skeletons in a dermestarium and stored at room
temperature. Tissues can be shipped for analysis without additional fixation, but minute samples in microplate wells should
be soaked with ethanol to prevent static displacement. This
protocol can be used by small museums that prepare skin, skull,
and skeleton vouchers but do not have a designated tissue
collection. Biopsies (e.g., ear, skin, or hair samples) can be
preserved the same way as muscle tissues; do not use analgesics, such as EMLA cream, as they may cause DNA degradation. Regular lysis protocols can be used for fresh tissue and
wing membrane punches (in bats) while alkaline lysis is better
for hairs.
14. If using the Barcode of Life Data Systems (BOLD; http://
www.boldsystems.org) as the online workbench for barcode
data management, ensure that the syntax of individual
specimen/sample numbers matches the Sample ID numbers
submitted to BOLD.
15. Use of flame for instrument cleaning is discouraged as it quickly
degrades equipment.
16. This protocol describes the cheapest reliable solution for
preserving mammal tissue. If field cryopreservation in liquid
nitrogen is used (26), then ethanol fixation is not required.
Ethanol-preserved tissues can be stored in the same solution
indefinitely after the first change. If the fixative changes color,
a follow-up replacement is recommended. Do not change from
one type of fixative to another. In particular, transfer of samples
from DMSO to ethanol leads to rapid DNA degradation and
should be avoided.
17. Recommended storage is at –80°C; DNA preserves indefinitely
under these conditions. If ultracold storage is unfeasible, samples will preserve adequately at –20°C. For ethanol, use freezers rated for storage of flammable liquids. If unavailable,
ethanol can be drained after 1–2 weeks following the last fixative change.
18. An outline of standard sampling instructions for 96-well
microplates can be found on the iBOL Web site: http://ibol.org/
get-involved/for-scientists/ under “Sampling Instructions”.
19. Premade data templates for plate map creation can be used,
such as the CCDB electronic lab book (45) or CCDB plate
record available on the iBOL Web site.
20. If the plate is ready for immediate laboratory analysis (no transport), it can be prefilled with lysis buffer and Proteinase K
[step 2(h)] rather than ethanol; step 2(a–g) can thus, be
omitted.
21. In high throughput facilities, plates with mammal tissue can be
frozen after the lysis stage and stored at –20°C for up to several
8
DNA Barcoding in Mammals
177
weeks before extraction. Plates should be defrosted at room
temperature and prewarmed for 10–15 min at 56°C to ensure
that all precipitated salts are fully dissolved prior to extraction.
This approach can be used with other vertebrates, but is not
applicable for invertebrate samples.
22. With minor modifications, GF DNA extraction protocol can
be performed using individual spin columns (Epoch Biolabs
Cat. No. 1920-250). All reagent volumes will be the same as
in the plate-based protocol. This method requires a benchtop
centrifuge for microtubes. Use 5,000–6,000 × g for binding
and wash stages and 10,000 × g for elution. Replace collection
tubes with clean ones after the first wash step to prevent overflow (2 ml tubes can be used as a replacement with the caps
removed). After the final wash step, place spin column into a
clean collection tube and centrifuge at 10,000 × g for 4 min to
dry the membrane. Prior to drying and elution, replace collection tube again with a clean decapped 2 ml tube. After elution,
transfer DNA into clean tubes with caps.
23. Low-salt buffer, e.g., 10 mM Tris–HCl, pH 8.0, can be used
for DNA elution. We do not recommend using even diluted
EDTA in the elution buffer as it might inhibit PCR reactions.
24. Primer cocktails are routinely mixed in 1.5 ml tubes from 10 mM
primer stocks. Proportions are in volume; for example, to make
forward cocktail C_VF1LFt1, mix 100 ml of LepF1_t1, 100 ml
of VF1_t1, 100 ml of VF1d_t1, and 300 ml of VF1i_t1.
25. It is traditionally recommended to keep PCR reagents (dNTP,
primers, and Taq polymerase) on ice; however, using ice can
increase the chance of contamination and is not convenient in
a high throughput setting. All reagents, except Taq polymerase,
can be defrosted in a clean tube rack at room temperature.
After defrosting, briefly vortex all solutions (except Taq) and
spin down in the mini-centrifuge. To avoid multiple freeze–
thaw cycles (more than ten), store primers and dNTPs in
smaller aliquots. To extend the shelf-life of Taq polymerase, it
should be kept in the freezer or on a cooling block and added
as a last component, just before returning all reagents back to
the freezer. Platinum Taq is a very stable “hot-start” enzyme
which is not active at room temperature, thus allowing PCR
mix or premade plates to be kept at room temperature for at
least 15–20 min during the reaction setup.
26. In high throughput facilities, operations can be standardized by
premaking plate batches containing PCR and sequencing
reagent mixes with 5% trehalose used as a cryoprotector. In
order to prevent DNA contamination of batches, reagents for
PCR plates should be dispensed only using DNA-free equipment in a UV-sterilized workspace. Plates should be covered
with clear film and stored frozen at –20°C until use. Prior to
178
N.V. Ivanova et al.
premaking each large batch of plates, validation is recommended
both for individual reagents and for final reagent mixes.
Predispensed plates should be defrosted at room temperature
and centrifuged for 1 min at 1,000 × g before use.
27. To expedite confirmation of PCR recovery, we recommend
using precast agarose E-gels available in 96-well format. If kept
moist in original packaging, E-gels can be reused up to three
times, preferably within 24 h. Observe water content inside gel
wells if intended for reuse; water reloading is usually unnecessary if rerunning the gel within 1 h after the previous load.
Load the follow-up round of samples in the same positions as
in the previous run; read PCR yield from the top row of bands.
Use E-gel Editor software (Invitrogen) to process digital gel
images. Caution: E-gels are prestained with ethidium bromide
and should be handled and disposed of following appropriate
precautions (e.g., refer to MSDS requirements, http://fscimage.
fishersci.com/msds/45442.htm, or equivalent national safety
standards).
28. Hit-picking is recommended to avoid wasting sequencing
reagents (especially BigDye) on failed samples. Failure tracking
is a procedure for recovering barcode sequences from DNA
extracts that failed to yield PCR products or sequences of adequate quality during the first round of PCR. Routinely,
Mammal Cocktail (C_VF1LFt1 + C_VR1LRt1) is used for
first-pass PCR and Fish Cocktail (C_FishF1t1 + C_FishR1t1)
for failure tracking. Alternative forward primers (RonM_t1 or
AquaF2) can be combined with either C_VR1LRt1 or C_
FishR1t1 to recover short length sequences (approx. 400 or
200 bp, respectively) from degraded samples. Ensure that a
new plate map is assembled to track the position of each sample
following rearrangement.
29. We do not clean up PCR products to reduce the cost and minimize chances of contamination. The PCR master mix recipe
listed above contains low concentration of dNTP and primers,
thus allowing the normalization of the final concentration of
the PCR product and minimization of interference of unincorporated PCR primers with cycle sequencing reaction.
Sequencing of unpurified products might lead to lower
sequence quality for the first 20–50 bp. However, such signal
degradation is of little concern for bidirectional sequencing.
30. Severe overloading of sequencing reaction with PCR product
might lead to shorter reads; therefore, minor adjustments
might be required based on PCR product concentration (optimal range for products of 600–700 bp from 25 to 50 ng/reaction). The amount of required product may also vary, depending
on the sequencing cleanup protocol. For example, for Sephadex
cleanup described in this chapter, we do not dilute PCR products, but for other cleanup systems, such as AutoDTR 96
8
DNA Barcoding in Mammals
179
from Edge Biosystems or ethanol precipitation, PCR product
dilution is recommended.
31. Bidirectional sequencing is used in reference library applications, while unidirectional sequencing is sufficient for express
barcoding and some forensic applications.
32. For large-scale operations involving liquid handling robots, we
recommend performing sequence cleanup with AutoDTR96
kit from Edge Biosystems. The protocol for robotic Edge
cleanup can be downloaded from http://www.dnabarcoding.
ca/CCDB_DOCS/CCDB_Sequencing.pdf.
33. 0.1 mM EDTA is a less toxic substitute for Hi-Di Formamide
providing higher signal. Samples dissolved in EDTA should be
processed on the sequencer within 36 h. If preparation of the
sequencing reaction takes place in a separate facility or is
intended for sequencing run at a later date, then the purified
sequencing reaction can be collected into an empty plate and
dried in a SpeedVac concentrator. Dry purified sequencing
products can be stored in the dark at –20°C for up to 2 weeks.
34. FTA Elute cards are suitable for cheek swab, blood, and fresh
tissue (muscle, brain, or gonad) blots. In the latter case, a small
tissue aliquot should be blotted onto the card for safe and easy
shipment followed by quick processing in the molecular lab,
while the bulk tissue sample can be deposited in a cryostorage.
FTA Elute cards can serve as an additional tissue backup for
liquid nitrogen tanks during field collection, but are not recommended as the sole form of tissue archival storage.
35. FTA Elute cards are sensitive to excessive volume of sample;
large quantities of tissue prevent proper fixation and drying
and lead to DNA degradation and cross-contamination. Liquid
tissue (especially blood) should not saturate the filter paper in
the blotting circle; refer to Fig. 2 for an example of resulting
appearance.
36. This applies to the FTA Elute card with 96 blotting circles,
which has a portion for recording sample numbers in a
12 × 8-grid map. This step is optional and should be performed
in addition to filling a digital plate map.
37. If the blotting card is closed before the blotting circles have
dried, portions of tissue can transfer onto the cover and contaminate adjacent circles.
38. Humidity leads to extraction of preservation agents from the
filter paper and their crystallization on its surface; it can also
cause leakage of tissue blots between circles.
39. This extraction method is recommended only if DNA extracts
are not intended for long-term storage, e.g., for forensic
applications.
180
N.V. Ivanova et al.
Acknowledgments
We thank Judith Eger, Mark Engstrom, Burton Lim, Don Stewart,
Charles Francis, Sergey Kruskop, Andrey Lissovsky, Vladimir
Lebedev, Natalia Abramson, Ivan Kuzmin, Bernard Agwanda,
Anna Bannikova, Ticul Alvarez, Fernando Cervantez, Curtis
Strobeck, Jack Millar, and William Pruitt, Jr. for providing materials for analysis; Robert Hanner for advice on protocol development; Agata Pawlowski and Miranda Elliott for protocol testing;
and Paul Hebert for administrative support. DNA analyses were
performed at the Canadian Centre of DNA Barcoding, Biodiversity
Institute of Ontario, and University of Guelph, and supported by
grants to Paul Hebert from the Gordon and Betty Moore
Foundation, Genome Canada through the Ontario Genomics
Institute, (2008-OGI-ICI-03) the Canada Foundation for
Innovation, the Ontario Innovation Trust, and the Natural Sciences
and Engineering Research Council of Canada.
References
1. Reeder DM, Helgen KM, Wilson DE (2007)
Global trends and biases in new mammal species discoveries. Occas Papers Mus Texas
Technol Univ 269:1–35
2. Ceballos G, Ehrlich PR (2009) Discoveries of
new mammal species and their implications for
conservation and ecosystem services. Proc Natl
Acad Sci 106:3841–3846
3. Baker RJ, Bradley RD (2006) Speciation in
mammals and the genetic species concept. J
Mammal 87:643–662
4. Bradley RJ, Baker RD (2001) A test of the
genetic
species
concept:
cytochrome-b
sequences and mammals. J Mammal
82:960–973
5. Hebert PDN, Cywinska A, Ball S, deWaard JR
(2003) Biological identifications through DNA
barcodes. Proc R Soc Lond B 270:313–321
6. Hebert PDN, Ratnasingham S, deWaard JR
(2003) Barcoding animal life: cytochrome c
oxidase subunit 1 divergences among closely
related species. Proc R Soc Lond B
270:S96–S99
7. Broughton RE, Reneau PC (2006) Spatial
covariation of mutation and nonsynonymous
substitution rates in vertebrate mitochondrial
genomes. Mol Biol Evol 23:1516–1524
8. Folmer O, Black M, Hoeh W, Lutz R,
Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase
subunit I from diverse metazoan invertebrates.
Mol Mar Biol Biotechnol 3:294–299
9. Simmons RB, Weller SJ (2001) Utility and evolution of cytochrome b in insects. Mol
Phylogenet Evol 20:196–210
10. Consortium for the Barcode of Life [Internet].
http://www.barcoding.si.edu/
11. Meiklejohn C, Montooth K, Rand D (2007)
Positive and negative selection on the mitochondrial genome. Trends Genet 23:259–263
12. Pfunder M, Holzgang O, Frey J (2004)
Development of microarray-based diagnostics
of voles and shrews for use in biodiversity monitoring studies, and evaluation of mitochondrial
cytochrome oxidase I vs. cytochrome b as
genetic markers. Mol Ecol 13:1277–1286
13. Lissovsky AA, Ivanova NV, Borisenko AV
(2007) Molecular phylogenetics and taxonomy
of the subgenus Pika (Ochotona, Lagomorpha).
J Mammal 88:1195–1204
14. Hajibabaei M, Singer GA, Clare EL, Hebert
PDN (2007) Design and applicability of DNA
arrays and DNA barcodes in biodiversity monitoring. BMC Biol 5:24
15. Lorenz J, Jackson W, Beck J, Hanner R (2005)
The problems and promise of DNA barcodes
for species diagnosis of primate biomaterials.
Philos Trans R Soc B 360:1869–1877
16. Hajibabaei M, Singer G, Hickey D (2006)
Benchmarking DNA barcodes: an assessment
using available primate sequences. Genome
49:851–854
17. Borisenko AV, Lim BK, Ivanova NV, Hanner
RH, Hebert PDN (2008) DNA barcoding
8
in surveys of small mammal communities: a field
study in Suriname. Mol Ecol Resour 8:471–479
18. Ivanova NV, Borisenko AV, Hebert PDN
(2009) Express barcodes: racing from specimen
to identification. Mol Ecol Resour 9:35–41
19. Clare EL, Lim BK, Engstrom MD, Eger JL,
Hebert PDN (2007) DNA barcoding of
Neotropical bats: species identification and
discovery within Guyana. Mol Ecol Notes 7:
184–190
20. Francis CM, Borisenko AV, Ivanova NV, Eger
JL, Lim BK, Guillén-Servent A, Kruskop SV,
Mackie I, Hebert PDN (2010) The role of
DNA barcodes in understanding and conservation of mammal diversity in Southeast Asia.
PLoS ONE 5:e12575
21. Clare EL, Lim BK, Fenton MB, Hebert PDN
(2011) Neotropical bats: estimating species
diversity with DNA barcodes. PLoS ONE
6(7):e22648
22. Clare EL, Adams AM, Maya-Simoes AZ, Eger
JL, Hebert PDN, Fenton MB. Cryptic species in
Parnell’s Mustached Bat (Pteronotus parnellii):
molecular, morphological and acoustic evidence. Mol Phylogenet Evol (in review)
23. Clare EL. Cryptic species? Patterns of maternal
and paternal gene flow in 8 Neotropical bats.
PLoS ONE 6(7):e21460
24. Maya-Simões AZ, Clare EL, Fenton MB (2010)
Parnell’s mustached bat (Pteronotus parnellii):
a morphologically cryptic species complex.
Chiroptera Neotropical 16:130–132
25. Borisenko AV, Kruskop SV, Ivanova NV (2008)
A new mouse-eared bat (Mammalia: Chiroptera:
Vespertilionidae) from Vietnam. Russ J Theriol
7:57–69
26. Engstrom M, Murphy R, Haddrath O (1999)
Sampling vertebrate collections for molecular
research: practice and policies. In: Metsger D,
Byers S (eds) Managing the modern herbarium:
an interdisciplinary approach. Elton-Wolf,
Vancouver, pp 315–330
27. DeSalle R, Amato G (2004) The expansion of
conservation genetics. Nat Rev Genet 5:
702–712
28. Ruedas L, Salazar-Bravo J, Dragoo J, Yates T
(2000) The importance of being earnest: what,
if anything, constitutes a “specimen examined?”. Mol Phylogenet Evol 17:129–132
29. Borisenko AV, Sones JE, Hebert PDN (2009)
The front-end logistics of DNA barcoding:
challenges and prospects. Mol Ecol Resour
9:27–34
30. deWaard J, Ivanova N, Hajibabaei M, Hebert P
(2008) Assembling DNA barcodes: analytical
protocols. In: Martin C (ed) Environmental
genomics, methods in molecular biology, vol
410. Humana Press, Totowa, 275–283
DNA Barcoding in Mammals
181
31. Ivanova N, deWaard J, Hebert P (2006) An
inexpensive, automation-friendly protocol for
recovering high quality DNA. Mol Ecol Notes
6:998–1002
32. Borisenko AV (2008) Reconnaissance survey of
the small mammal community in the Churchill
Northern Studies Centre Area. Polar Barcode
Life Newsl 1:4
33. Hajibabaei M, Smith MA, Janzen DH, Rodriguez
J, Whitfield JB, Hebert PD (2006) A minimalist
barcode can identify a specimen whose DNA is
degraded. Mol Ecol Notes 6:959–964
34. American Society of Mammalogists Animal
Care and Use Committee (1998) Guidelines
for the capture, handling, and care of mammals
as approved by the American Society of
Mammalogists. J Mammal 79:1416–1431
35. Wilson DE, Cole FR, Nichols JD, Rasanayagam
R, Foster MS (eds) (1996) Measuring and
monitoring biological diversity. Standard methods for mammals. Smithsonian Institution
Press, Washington; London
36. Lillestolen T, Foster N, Wise S (1993)
Development of the National Marine Mammal
Tissue Bank. Sci Total Environ 139:97–107
37. Triant DA, DeWoody JA (2007) The occurrence, detection, and avoidance of mitochondrial
DNA translocations in mammalian systematics
and phylogeography. J Mammal 88:908–920
38. Hanner R, Corthals A, Dessauer H (2005) Salvage
of genetically valuable tissues following a freezer
failure. Mol Phylogenet Evol 34:452–455
39. Kilpatrick C (2002) Noncryogenic preservation
of mammalian tissues for DNA extraction: an
assessment of storage methods. Biochem Genet
40:53–62
40. Nunley WC, Schuit KE, Dickie MW, Kinlaw JB
(1972) Delayed, in vivo hepatic post-mortem
autolysis. Virchows Arch Abt B Zellpath
11:289–302
41. Tomita Y, Nihira M, Ohno Y, Shigeru S (2004)
Ultrastructural changes during in situ early
postmortem autolysis in kidney, pancreas, liver,
heart and skeletal muscle of rats. Leg Med
6:25–31
42. Herdson P, Kaltenbach J, Jennings R (1969)
Fine structural and biochemical changes in dog
myocardium during autolysis. Am J Pathol
57:539–557
43. Ljungman M, Hanawalt PC (1992) Efficient
protection against oxidative DNA damage in
chromatin. Mol Carcinog 5:264–269
44. Scheuerle A, Pavenstaedt I, Schlenk R, Melzner
I, Rödel G, Haferkamp O (1993) In situ autolysis of mouse brain: ultrastructure of mitochondria and the function of oxidative
phosphorylation and mitochondrial DNA.
Virchows Arch B Cell Pathol 63:331–334
182
N.V. Ivanova et al.
45. Borisenko A, Dooh R (2007) An electronic lab
book to facilitate high throughput DNA
barcoding. CCDB Adv Meth Release 8:1
46. Ivanova N, Zemlak T, Hanner R, Hebert P
(2007) Universal primer cocktails for fish DNA
barcoding. Mol Ecol Notes 7:544–548
47. Meyer CP (2003) Molecular systematics of cowries (Gastropoda: Cypraeidae) and diversification
patterns in the tropics. Biol J Linn Soc
79:401–459
48. Robins JH, Hingston M, Matisoo-Smith E,
Ross HA (2007) Identifying Rattus species
using mitochondrial DNA. Mol Ecol Notes
7:717–729
49. Ward R, Zemlak T, Innes B, Last P, Hebert
P (2005) DNA barcoding Australia’s fish
species. Philos Trans R Soc B 360:
1847–1857
50. Messing J (1983) New M13 vectors for cloning.
Methods Enzymol 101:20–79
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement