to the PDF file. - Publikationsserver UB Marburg

to the PDF file. - Publikationsserver UB Marburg
Untersuchungen zur Biogenese
von Eisen-Schwefel Proteinen
und zur Eisenhomeostase
am Modellorganismus
Saccharomyces cerevisiae
Dissertation
zur Erlangung des
Doktorgrades der Naturwissenschaften
(Dr. rer. nat.)
dem Fachbereich Biologie
der Philipps-Universität-Marburg
vorgelegt von
Anja Hausmann
aus Herne
Marburg, August 2006
Vom Fachbereich Biologie der Philipps-Universität Marburg
als Dissertation angenommen am
Erstgutachter: Prof. Dr. Roland Lill
Zweitgutachter: Prof. Dr. Uwe Maier
Tag der mündlichen Prüfung: 8.11.2006
Erklärung
Ich versichere, dass ich die vorliegende Dissertation selbständig verfasst, keine
anderen als die angegebenen Hilfsmittel verwendet und sämtliche Stellen, die im
Wortlaut
oder
dem
Sinn
nach
anderen
Werken
entnommen
sind,
mit
Quellenangaben kenntlich gemacht habe. Die Versicherung schließt Zeichnungen
und Skizzen mit ein.
Die Dissertation wurde in der jetzigen oder ähnlichen Form noch bei keiner anderen
Hochschule eingereicht und hat noch keinen sonstigen Prüfungszwecken gedient.
Teile dieser Arbeit sind bereits in Fachzeitschriften veröffentlicht.
Marburg, 28. August 2006
Inhaltsverzeichnis
Inhaltsverzeichnis
1.
Abkürzungsverzeichnis....................................................................................... 6
2.
Zusammenfassung ............................................................................................. 8
3.
Einleitung.......................................................................................................... 11
3.1.
Eisen und seine physiologische Relevanz .................................................. 11
3.2.
Aufnahme und intrazelluläre Verteilung von Eisen in Saccaromyces
cerevisiae .................................................................................................... 11
3.2.1.
Die Aufnahme von freiem Eisen.......................................................... 11
3.2.2.
Siderophor-vermittelte Eisenaufnahme ............................................... 12
3.3.
Struktur und intrazelluläre Lokalisierung von Fe/S Proteinen...................... 14
3.4.
Funktionen von Fe/S Proteinen................................................................... 15
3.4.1.
Fe/S Cluster in Redoxprozessen......................................................... 15
3.4.2.
Die Rolle der Fe/S Cluster bei der Katalyse chemischer Reaktionen.. 16
3.4.3.
Fe/S Cluster als Regulatoren der Genexpression ............................... 16
3.5.
Die Biogenese von Fe/S Proteinen in Bakterien ......................................... 18
3.6.
Die Biogenese von Fe/S Proteinen in S. cerevisiae .................................... 21
3.6.1.
4.
Die Biogenese extra-mitochondrialer Fe/S Proteine ........................... 25
3.7.
Die Regulation der Eisenhomeostase in S. cerevisiae................................ 28
3.8.
Aufgabenstellung und Zielsetzung .............................................................. 29
Material und Methoden..................................................................................... 31
4.1.
Escherichia coli Stämme ............................................................................. 31
4.2.
Saccharomyces cerevisiae Stämme ........................................................... 31
4.3.
Kultivierung von E. coli................................................................................ 32
4.4.
Kultivierung von S. cerevisiae ..................................................................... 32
4.5.
Puffer .......................................................................................................... 33
4.6.
Oligonukleotide ........................................................................................... 33
4.7.
Verwendete Vektoren.................................................................................. 34
4.7.1.
E. coli Plasmide................................................................................... 34
4.8.
S. cerevisiae Plasmide................................................................................ 35
4.9.
Konstruktion verschiedener Stämme und Plasmide.................................... 36
4.9.1.
Gal-NBP35 Zellen ............................................................................... 36
4.9.2.
Gal-HEM15 Zellen............................................................................... 36
4.9.3.
Disruption des Hefe-Gens HMX1 ........................................................ 37
-1-
Inhaltsverzeichnis
4.9.4.
Plasmid p426NBP35-TAP zur Expression eines TAP-markierten
Nbp35p ............................................................................................... 37
4.9.5.
Plasmid p426∆1-52NBP35-TAP.......................................................... 37
4.9.6.
Plasmid p426NBP35-Strep ................................................................. 37
4.9.7.
Plasmid pET15B-HIS-NBP35.............................................................. 38
4.10. Rekombinante DNA-Techniken................................................................... 38
4.10.1. Isolierung von Plasmid-DNA aus E. coli.............................................. 38
4.10.2. Isolierung genomischer DNA aus S. cerevisiae .................................. 38
4.11. Reinigung und Analyse von DNA ................................................................ 39
4.11.1. Phenol-Chloroform Extraktion ............................................................. 39
4.11.2. Ethanol-Fällung ................................................................................... 39
4.11.3. Agarose-Gelelektrophorese ................................................................ 40
4.11.4. DNA Extraktion aus Agarose-Gelen.................................................... 40
4.11.5. Polymerasekettenreaktion (PCR)........................................................ 40
4.11.6. Konzentrationsbestimmung von Nukleinsäuren .................................. 41
4.11.7. Spaltung von DNA mit Restriktionsendonukleasen ............................. 41
4.11.8. Ligation von DNA-Fragmenten............................................................ 42
4.11.9. Transformation von E. coli mit rekombinanter DNA ............................ 42
4.11.10. Transformation von Hefe mit rekombinanter DNA............................... 42
4.12. RNA-Techniken........................................................................................... 43
4.12.1. Herstellung RNase-freier Geräte und Lösungen ................................. 43
4.12.2. Extraktion von Gesamt-RNA aus S. cerevisiae ................................... 43
4.12.3. RNA Konzentrierung mit Natriumacetat .............................................. 43
4.13. Northern Blot Analyse ................................................................................. 44
4.13.1. Auftrennung von RNA in denaturierenden Agarose-Gelen ................. 44
4.13.2. RNA Transfer auf Nylonmembranen ................................................... 44
4.13.3. Methylenblau-Färbung von RNA ......................................................... 45
4.13.4. Herstellung von 32P markierten DNA Sonden ..................................... 45
4.13.5. RNA/DNA Hybridisierung .................................................................... 45
4.13.6. Entfernung hybridisierter Sonden........................................................ 46
4.14. Bearbeitung von S. cerevisiae cDNA-Microarrays ...................................... 46
4.14.1. Herstellung Cy3- und Cy5 markierter cDNA........................................ 46
4.14.2. Hybridisierung der Microarrays ........................................................... 46
4.14.3. Microarray Daten-Analyse................................................................... 47
4.15. Zellbiologische und biochemische Methoden.............................................. 48
-2-
Inhaltsverzeichnis
4.15.1. Fluoreszenzmikroskopie ..................................................................... 48
4.15.2. Isolierung von intakten Mitochondrien und post-mitochondrialen
Überstand (PMS) aus S. cerevisiae .................................................... 50
4.15.3. Enzymaktivitäten mitochondrialer Proteine ......................................... 51
4.15.4. Enzymaktivitäten cytosolischer Proteine ............................................. 54
4.15.5. Bestimmung des Eisengehalts in Mitochondrien................................. 55
4.15.6. Bestimmung der Eisenaufnahme und der de novo Fe/S ClusterBiosynthese mittels 55Fe-Eisenchlorid Markierung .............................. 56
4.15.7. Messung des Häm-Gehalts mittels 55Fe-Eisenchlorid Markierung ...... 57
4.16. Proteinbiochemische Methoden .................................................................. 57
4.16.1. Überexpression und Reinigung von Nbp35p-His ................................ 57
4.16.2. Bestimmung der Proteinkonzentration ................................................ 58
4.16.3. TCA-Fällung von Proteinen ................................................................. 59
4.16.4. SDS Polyacrylamid-Gelelektrophorese (SDS-PAGE) ......................... 59
4.16.5. Färben von Proteinen mit Coomassie Brilliant-Blue ............................ 59
4.16.6. Transfer von Proteinen auf Nitrozellulose (Western Blot) ................... 60
4.16.7. Immundetektion................................................................................... 60
4.16.8. Kopplung des Antiserums an Protein-A-Sepharose ............................ 61
4.17. Promotorstudien.......................................................................................... 61
4.17.1. GFP-Reporter Assay........................................................................... 61
4.17.2. Luciferase-Reporter Assay.................................................................. 62
4.18. Laborgeräte................................................................................................. 62
4.19. Chemikalien ................................................................................................ 63
5.
Ergebnisse........................................................................................................ 65
5.1.
Nbp35p bindet einen Fe/S Cluster in vivo ................................................... 65
5.1.1.
Nbp35-TAP bindet Eisen in vivo.......................................................... 65
5.1.2.
Die mitochondriale ISC-Assemblierungs- und Exportmaschinerie ist
für die Reifung von Nbp35p essentiell................................................. 67
5.1.3.
5.2.
Analyse des rekombinanten Nbp35p .................................................. 71
Nbp35p ist an der Reifung cytosolischer und nukleärer Fe/S Proteine
beteiligt........................................................................................................ 73
5.2.1.
Die Depletion von Nbp35p führt zu einem Wachstumsdefekt ............. 73
5.2.2.
Nbp35p ist im Cytosol und Kern lokalisiert .......................................... 75
5.2.3.
Nbp35p kann Cfd1p nicht funktionell ersetzen .................................... 77
-3-
Inhaltsverzeichnis
5.2.4.
Nbp35p wird für die Reifung des cytosolischen Fe/S Proteins Leu1p
benötigt ............................................................................................... 79
5.2.5.
Nbp35p ist an der Reifung kernlokalisierter Fe/S Proteine beteiligt .... 82
5.2.6.
Nbp35p ist nicht an der Reifung mitochondrialer Fe/S Proteine
beteiligt................................................................................................ 83
5.3.
Transkriptom-Analysen in S. cerevisiae ...................................................... 85
5.3.1.
Die
Depletion
von
Nbp35p
resultiert
in
einer
schwachen
Veränderung der Genexpression ........................................................ 86
5.3.2.
Veränderte Genexpression durch Depletion von Atm1p und Yah1p ... 90
5.3.3.
Der Einfluss des Wachstumsmediums auf die Genexpression
Atm1p-depletierter Zellen.................................................................... 97
5.3.4.
Die Reprimierung von Genen der Atmungskette in Yah1p- und
Atm1p-depletierten Zellen wird durch einen Defekt der Atmung und
durch Eisenmangel hervorgerufen .................................................... 100
5.3.5.
Die Induktion von FET3 in Atm1p- und Yah1p-depletierten Zellen ist
auf einen Eisenmangel zurückzuführen ............................................ 104
5.3.6.
Eisenmangel und die Depletion von Yah1p und Atm1p resultieren
in ähnlichen Expressionsmustern...................................................... 105
5.4.
Atm1p- und Yah1p-depletierte Zellen besitzen einen HämSynthesedefekt ......................................................................................... 108
5.4.1.
Die
Depletion
von
Atm1p
und
Yah1p
führt
zu
einem
Aktivitätsverlust von Proteinen mit Häm-Cofaktoren ......................... 108
5.4.2.
Atm1p- und Yah1p-depletierte Zellen besitzen weniger Häm ........... 110
5.4.3.
Atm1p- und Yah1p-depletierte Zellen besitzen eine verminderte
Ferrochelatase Aktivität..................................................................... 111
5.4.4.
Die Verminderung der Ferrochelatase Aktivität etabliert den
geringeren zellulären Gehalt an Häm................................................ 111
5.4.5.
Der reduzierte Häm-Gehalt ist nicht auf die Aktivität der HämOxygenase Hmx1p zurückzuführen .................................................. 113
6.
Diskussion ...................................................................................................... 117
6.1.
Die CIA-Maschinerie wird für die Biogenese von extra-mitochondrialen
Fe/S Proteinen benötigt ............................................................................ 117
6.1.1.
Nbp35p ist ein Fe/S Protein .............................................................. 117
6.1.2.
Nbp35p ist eine Komponente der CIA-Maschinerie .......................... 118
6.1.3.
Die Biogenese von extra-mitochondrialen Fe/S Proteinen................ 119
-4-
Inhaltsverzeichnis
6.1.4.
Die Biogenese nukleärer Fe/S Proteine ............................................ 122
6.1.5.
Die Biogenese cytosolischer Fe/S Proteine als essentielle Funktion
der Mitochondrien ............................................................................. 124
6.2.
Transkriptom-Analysen in Saccharomyces cerevisiae .............................. 126
6.2.1.
Die Regulation der Eisenhomeostase wird nicht durch ein
cytosolisches Fe/S Protein vermittelt ................................................ 126
6.2.2.
ISC Mutanten besitzen ein charakteristisches Expressionsmuster ... 128
6.2.3.
Der
Status
der
mitochondrialen
ISC-Assemblierungs-
und
Exportmaschinerie ist zentral an der Regulation der zellulären
Eisenhomeostase beteiligt ................................................................ 129
6.2.4.
Mechanismen der Genregulation in Yah1p- und Atm1p-depletierten
Zellen ................................................................................................ 131
6.2.5.
Aktivierung des „retrograde response“ in Yah1p-depletierten Zellen 134
6.2.6.
Yah1p und Atm1p-depletierte Zellen besitzen eine eingeschränkte
Ferrochelatase Aktivität..................................................................... 137
6.2.7.
Die
ISC-Assemblierungsmaschinerie
ist
auch
in
höheren
Eukaryoten an der Regulation der Eisenhomeostase beteiligt .......... 138
7.
Literatur .......................................................................................................... 140
8.
Publikationen .................................................................................................. 151
9.
Lebenslauf ...................................................................................................... 152
-5-
Abkürzungsverzeichnis
1. Abkürzungsverzeichnis
ε
Molarer Extinktionskoeffizient
(v/v)
Volumen pro Volumen
(w/v)
Gewicht pro Volumen
Bp
Basenpaare
BSA
Bovines Serumalbumin
cDNA
Codierende DNA
CIA
Cytosolic iron-sulfur protein assembly
Cpm
Counts per minute
C-Terminus
Carboxyterminus
Da
Dalton
DAF
5΄ Deazaflavin
DAPI
4,6-Diamidino-2-phenylindol
DEPC
Diethylpyrocarbonat
DMSO
Dimethylsulfoxid
DANN
Desoxyribonukleinsäure
dNTPs
Desoxyribonukleosidtriphosphate
DTT
Dithiothreitol
EDTA
Ethylendiamintetraessigsäure
ESR
Elektronenspinresonanz-Spektroskopie
FAD/FMN
Flavin-Adenin-Dinucleotid/Flavin-Mononucleotid
Fe/S
Eisen-Schwefel
GSH
Glutathion, reduziert
HA
Hämagglutinin
IPTG
Isopropyl-ß-D-thiogalactosid
ISC
Eisen-Schwefel Cluster
MCS
Multiple cloning site
NADH
Nicotinamid-Adenin-Dinucleotid, reduziert
N-Terminus
Aminoterminus
OD600
Optische Dichte bei einer Wellenlänge von λ= 600 nm
p.a.
pro analysi = analysenrein
PCR
Polymerasekettenreaktion
PEG
Polyethylenglycol
-6-
Abkürzungsverzeichnis
PMS
Post-mitochondrialer Überstand
PMSF
Phenylmethylsulfonylfluorid
PPIX
Protoporphyrin IX
RNAi
RNA-Interferenz
RT
Raumtemperatur
SC
Minimalmedium („synthetic complete medium“)
SDS
Natriumdodecylsufat
SDS-PAGE
SDS-Polyacrylamid-Gelelektrophorese
SSC
Salin sodium citrat
TAP
Tandem affinity purification
TCA
Trichloressigsäure
TEMED
N,N,N΄,N΄,-Tetramethylethylendiamin
Tris
Tris(hydroxymethyl)-aminomethan
Upm
Umdrehungen pro Minute
w.E.
willkürliche Einheiten
Xg
x-fache Erdbeschleunigung (9,81 m/s2)
ZNG
Zellnassgewicht
-7-
Zusammenfassung
2. Zusammenfassung
Eisen-Schwefel- (Fe/S) Cluster sind anorganische Cofaktoren zahlreicher Proteine
und ubiquitär in allen Organismen zu finden. Fe/S Proteine übernehmen wichtige
Aufgaben beim Elektronentransport, in der Genregulation und in Enzymkatalysen. In
Eukaryoten wird die Reifung dieser Proteine von drei komplexen Maschinerien
übernommen. Die in der mitochondrialen Matrix lokalisierte ISC- (iron-sulfur cluster)
Assemblierungsmaschinerie ist an der Reifung mitochondrialer, cytosolischer und
nukleärer Fe/S Proteine beteiligt. Demgegenüber übernehmen die mitochondriale
ISC-Export- und die cytosolische CIA- (cytosolic iron-sulfur protein assembly)
Maschinerie eine spezifische Funktion in der Reifung cytosolischer und nukleärer
Fe/S Proteine. In den letzten vier Jahren wurden insgesamt sechs Proteine (Nbp35p,
Cfd1p, Nar1p, Cia1p, Cia2p und Met18) der CIA-Maschinerie identifiziert. Im ersten
Teil
dieser
Arbeit
Saccharomyces
konnte
cerevisiae
die
essentielle
als
zweite
P-Loop
NTPase
Komponente
der
Nbp35p
aus
CIA-Maschinerie
nachgewiesen werden. Nbp35p ist hauptsächlich im Cytosol, aber in geringer Menge
auch
im
Zellkern
lokalisiert.
Die
Depletion
von
Nbp35p
durch
regulierte
Genexpression in einer Hefemutante führte zur verminderten Aktivität des
cytosolischen
Fe/S
Proteins
Isopropylmalat-Isomerase
(Leu1p),
während
mitochondriale Fe/S Proteine (z.B. Aconitase) nicht beeinflusst wurden. Starke
Defekte in der de novo Reifung von cytosolischen und nukleären Fe/S Proteinen
belegten die spezifische Beteiligung von Nbp35p an der Biogenese von
cytosolischen und nukleären, nicht aber von mitochondrialen Fe/S Proteinen.
Nbp35p besitzt eine hohe Sequenzhomologie zu Cfd1p, mit dem es in vivo und in
vitro einen Komplex bildet, der aus je zwei Nbp35p und Cfd1p Dimeren besteht.
Nbp35p bindet am N-Terminus einen [4Fe-4S] Cluster, der durch vier essentielle und
konservierte Cysteinreste koordiniert wird und zu dessen Assemblierung die ISCund CIA-Maschinerien benötigt werden. Demzufolge ist Nbp35p auch an seiner
eigenen Reifung beteiligt. Die Identifizierung einer Rolle des Nbp35p in der
Biogenese
von extra-mitochondrialen
Fe/S
Proteinen eröffnet
jetzt
weitere
biochemische Untersuchungen zur Bestimmung seiner molekularen Funktion.
Die gestörte Biogenese von Fe/S Proteinen hat eine erhöhte Eisenakkumulation in
den Mitochondrien sowie die Aktivierung der Transkriptionsfaktoren Aft1p/Aft2p, den
Hauptregulatoren der Eisenhomeostase in Hefe zur Folge. Wie in dieser Arbeit
gezeigt werden konnte, sind diese Auswirkungen auf Defekte in den beiden
-8-
Zusammenfassung
mitochondrialen ISC-Maschinerien, nicht aber in der cytosolischen CIA-Maschinerie,
zurückzuführen. Im zweiten Teil der Arbeit wurden deshalb die genom-weiten
Auswirkungen von Depletionen der drei Fe/S Protein-Assemblierungsmaschinerien
durch Transkriptom-Analysen untersucht, um vergleichende Einblicke in die
Konsequenzen funktioneller Defekte der Fe/S Protein-Biogenese zu erhalten. Dazu
wurden konditionale Hefe-Mutanten verwendet, in denen das Ferredoxin Yah1p
(ISC-Assemblierung), der ABC-Transporter Atm1p (ISC-Export) oder die P-Loop
NTPase Nbp35p (CIA) als repräsentative Mitglieder der drei Biogenese-Maschinerien
depletiert wurden. Die Transkriptionsprofile von Nbp35p-depletierten Zellen zeigten
nur wenige differentiell exprimierte Gene. Keines dieser Gene weist auf eine
Verbindung zur Eisenhomeostase hin. Aus diesen Daten wird erkennbar, dass die
CIA-Maschinerie überraschenderweise keinen Einfluss auf die Eisenhomeostase
ausübt.
Somit
wurde
eine
frühere
Hypothese
widerlegt,
nach
der
die
Eisenhomeostase über ein cytosolisches Fe/S Protein vermittelt wird.
Die Depletion von Atm1p und Yah1p ist dagegen mit einer umfassenden sowie
weitgehend überlappenden Änderung des Genexpressionsmusters verbunden,
welches u.a. die Induktion Aft1p/Aft2p-abhängiger Gene und die Reprimierung von
Genen, die für Komponenten der mitochondrialen Atmungskette kodieren, beinhaltet.
Weitere transkriptionelle Veränderungen betrafen die Ergosterol- und BiotinSynthese, den Aminosäurestoffwechsel sowie Gene, die für Proteine der Synthese
oder des Abbaus von Häm oder für Häm-haltige Proteine kodieren. Insgesamt
ähneln die Transkriptionsprofile Atm1p- und Yah1p-depletierter Zellen dem einer
Eisen-depletierten
Zelle.
Unterstützt
wurden
diese
Beobachtungen
durch
Promotoranalysen und Northern Blots an ausgewählten Eisen-abhängigen Genen,
wie beispielsweise ERG3 (Ergosterol-Biosynthese), BIO2 (Biotin-Synthese) und
HEM15 (Häm-Biosynthese). Demnach signalisiert die Depletion von Yah1p und
Atm1p und damit die reduzierte Synthese von zellulären Fe/S Proteinen
offensichtlich der Zelle einen Eisenmangel. Die Daten legen nahe, dass die
Mitochondrien als Orte der Fe/S Cluster- und Häm-Biogenese entscheidend an der
Regulation der zellulären Eisenhomeostase beteiligt sind. Interessanterweise besitzt
die
Häm-Biosynthese
in
Hefe
keinen
vergleichbaren
Einfluss
auf
die
Eisenhomeostase. Nach einer vorläufigen Modellvorstellung könnte die ISCAssemblierungs- und Exportmaschinerie an der Synthese und dem Export einer
(noch unbekannten) Komponente beteiligt sein, die neben einer Funktion in der
Reifung extra-mitochondrialer Fe/S Proteine auch an der Inhibierung von Aft1p als
-9-
Zusammenfassung
Transkriptionsaktivator beteiligt ist. Zusätzlich könnte diese Komponente weitere
Stoffwechselwege (z.B. Respiration, Häm-Synthese), in denen Eisen benötigt wird,
regulieren.
Bereits aus früheren Arbeiten war bekannt, dass ein Funktionsverlust der
mitochondrialen ISC-Maschinerien zusätzlich mit einem Häm-Defekt einhergeht, der
den Aktivitätsverlust Häm-haltiger Proteine in Yah1p- und Atm1p-depletierten Zellen
erklärt. Der Häm-Mangel basiert zum einen auf der reversiblen Inhibierung der
Ferrochelatase (Hem15p). In dieser Arbeit konnte des Weiteren gezeigt werden,
dass das HEM15 Gen in Yah1p-, Atm1p- sowie in Eisen-depletierten Zellen
transkriptionell reprimiert wird. Folglich ist der Häm-Mangel sowohl durch Regulation
der Ferrochelatase auf Protein- als auch auf Genebene zu erklären. Diese
Beobachtungen erläutern zwanglos, wie die Hefezelle die Eisenverteilung zwischen
Fe/S Clustern und Häm reguliert.
Die vorgelegte Arbeit konnte damit zum einen eine neue Komponente der
CIA-Maschinerie für die Biogenese von Fe/S Proteinen identifizieren und
charakterisieren. Zum anderen wurde eine vergleichende Analyse der drei
Biogenese-Maschinerien
hinsichtlich
der transkriptionellen
Auswirkungen
von
Defekten auf die regulatorischen Effekte in der Zelle durchgeführt. Diese
Untersuchungen zeigten grundsätzliche funktionelle und regulatorische Unterschiede
der mitochondrialen ISC- und cytosolischen CIA-Maschinerien auf. Die Arbeit trägt
damit zu einem tieferen Verständnis der Fe/S Protein-Biogenese und deren Einfluss
auf die zelluläre Homeostase, insbesondere des Eisens, bei.
- 10 -
Einleitung
3. Einleitung
3.1. Eisen und seine physiologische Relevanz
Eisen ist eines der häufigsten chemischen Elemente der Erdkruste. Darüber hinaus
ist Eisen für alle Organismen essentiell, da es eine wichtige Rolle als Cofaktor
einnimmt. Dabei wird Eisen mononuklear, als Teil eines Eisen-Schwefel (Fe/S)
Clusters oder als Häm-Gruppe in Proteine eingebaut. Eisen-abhängige Proteine
übernehmen zentrale Aufgaben beim Elektronentransport in der bakteriellen oder
mitochondrialen Atmungskette, der Katalyse biochemischer Reaktionen, bei
regulatorischen Vorgängen, dem Sauerstofftransport im Blut (Hämoglobin) sowie in
der Biosynthese verschiedener Aminosäuren (Hefe) und Sterole. Außerdem sind
Eisen-abhängige Proteine an der Biosynthese von Ribosomen und tRNA beteiligt
und fungieren als Sensoren von Eisen, Sauerstoff und Stickoxiden.
Unter anaeroben Bedingungen liegt Eisen in Form von Eisen(II)-Ionen vor, deren
Verbindungen in Wasser sehr gut löslich sind. Unter aeroben Bedingungen hingegen
ist die Bioverfügbarkeit von Eisen gering und die Konzentration der Eisenionen wird
für Organismen zum wachstums-limitierenden Faktor. Bei neutralem pH liegt es als
nahezu unlöslicher Eisen(III)-Hydroxid-Komplex vor. Um Eisen dennoch verfügbar zu
machen, besitzen die Organismen verschiedene Systeme zur Aufnahme.
3.2. Aufnahme und intrazelluläre Verteilung von Eisen in
Saccaromyces cerevisiae
3.2.1. Die Aufnahme von freiem Eisen
In Hefe erfolgt die Aufnahme von freiem Eisen über hoch- und niedrigaffine
Eisenaufnahmesysteme.
Unter
Laborbedingungen
hat
allein
das
hochaffine
Aufnahmesystem eine Bedeutung. Dieses besteht aus einem in der Plasmamembran
lokalisierten Proteinkomplex, der Ferroxidase Fet3p und der Permease Ftr1p. Die
Cu2+-abhängige Ferroxidase Fet3p oxidiert Fe2+ zu Fe3+, um dieses anschließend
über die Permease Ftr1p ins Zellinnere zu transportieren. Die Kupferabhängigkeit
von Ferroxidasen ist die molekulare Ursache der Vernetzung von Kupfer- und
Eisenstoffwechsel in Eukaryoten (Dancis, 1998). Ftr1p gehört zusammen mit Fth1p,
einem vakuolären Eisentransporter, zu einer Familie von Oxidase-abhängigen
Transportern, deren Mechanismus und Energieabhängigkeit noch völlig unklar ist.
- 11 -
Einleitung
Das
hochaffine
Aufnahmesystem
beinhaltet
außerdem
die
Aktivität
von
Metalloreduktasen, hauptsächlich Fre1p und Fre2p, zwei Flavocytochrome. Diese
reduzieren Fe3+ zu Fe2+, welches dann als Substrat für Fet3p/Ftr1p dient. Fet4p
hingegen ist ein Transporter des niedrigaffinen Eisenaufnahmesystems, der direkt
Fe2+ transportieren kann (Kosman, 2003). Die Fet4p-vermittelte Eisenaufnahme
spielt allerdings nur eine untergeordnete Rolle, da der Km-Wert von 35 µM relativ
hoch ist (Dix et al., 1997; Dix et al., 1994).
Die Eisenaufnahme erfolgt streng reguliert, da reduziertes Eisen (Fe2+) über die
Fenton-Reaktion zur Bildung von zellschädigenden Hydroxylradikalen führt. Nicht nur
die intrazelluläre Eisenaufnahme, sondern auch die Verteilung und Speicherung des
Eisens muss genau koordiniert sein. Das Eisen wird hauptsächlich in den
Mitochondrien zur Synthese von Fe/S Clustern und Häm-Cofaktoren benötigt. Daher
nehmen diese Organellen im intrazellulären Eisenstoffwechsel eine zentrale Rolle
ein. Unter physiologischen Bedingungen wird überschüssiges Eisen in der Vakuole
gespeichert (Raguzzi et al., 1988). Dabei erfolgt die Eisenakkumulation über den
vakuolären Transporter Ccc1p (Li & Kaplan, 2004). Bei Bedarf kann das
gespeicherte Eisen re-mobilisiert werden, wobei der Export aus der Vakuole durch
die
Proteine
Smf3p,
Fth1p
und
Fet5p
vermittelt
wird.
Smf3p
weist
Sequenzähnlichkeiten zum zweiwertigen Metallionentransporter Nramp (Säuger) auf
(Portnoy et al., 2000). Dieser transportiert neben Eisen auch andere zweiwertige
Metallionen. Fth1p und Ftr1p gehören zur Klasse der Oxidase-abhängigen
Transporter. Abbildung 1 gibt einen Überblick über die Proteine, die in S. cerevisiae
an der Eisenaufnahme und der intrazellulären Verteilung beteiligt sind.
3.2.2. Siderophor-vermittelte Eisenaufnahme
Die Eisenaufnahme über Siderophore (Eisenträger) spielt unter Laborbedingungen
nur eine untergeordnete Rolle. S. cerevisiae kann selbst keine Siderophore
synthetisieren, exprimiert aber zahlreiche Gene, die mit einer Siderophor-vermittelten
Eisenaufnahme assoziiert sind. Siderophore sind niedermolekulare Substanzen
(300-2.000 Da), die in die Umgebung ausgeschieden werden und der Aufnahme
sowie der Speicherung von Eisen dienen. Insgesamt unterscheidet man drei
verschiedene Klassen: die Catecholamate (z.B. Enterobactin), Hydroxamate (z.B.
Ferrioxamin) und die α-Hydroxy/Keto-Carboxylate (z.B. Citrat). Siderophore besitzen
eine hohe Affinität zu dreiwertigem Eisen (Boukhalfa & Crumbliss, 2002; Neilands,
- 12 -
Einleitung
1995). Nach Reduktion zu zweiwertigem Eisen (Fe2+) nimmt die Affinität der
Siderophore zum Eisen ab. Wie viele Bakterienarten kann auch die Hefe
S. cerevisiae das an unterschiedliche Siderophor-Klassen gebundene Eisen für sich
nutzbar machen. Dieses kann sowohl an der Zelloberfläche, als auch im Zellinneren
freigesetzt werden (De Luca & Wood, 2000; Haas, 2003; Yun et al., 2000; Yun et al.,
2001). Eine Familie von Transportern (Arn1-4p) vermittelt die Eisenaufnahme über
Siderophore, indem sie diese binden und zwischen Zelloberfläche und Vakuole hin
und
her
wandern.
Zusätzlich
exprimiert
S. cerevisiae
eine
Gruppe
von
Glykosylphosphatidylinositol (GPI)-verankerten Proteinen (Fit1-3p), die vermutlich die
Siderophor-vermittelte Eisenaufnahme erleichtern, indem sie Siderophore in der
Zellwand anreichern.
Abb. 1: Eisenaufnahme und Verteilung in S. cerevisiae. Freies Eisen wird über die in der
Plasmamembran lokalisierten hoch- und niedrigaffinen Eisenaufnahmesysteme, bestehend aus
Fet3p/Ftr1p und Fet4p, aufgenommen. Fet3p/Ftr1p ist ein Proteinkomplex, der zunächst reduziertes
Eisen oxidiert und dann über die Permease Ftr1p ins Zellinnere abgibt. Fet4p kann direkt reduziertes
3+
2+
Eisen transportieren. Zwei Metalloreduktasen, Fre1-2p, reduzieren Fe zu Fe und liefern damit das
Substrat für den Fet3p/Ftr1p vermittelten Eisentransport. Die Fit1-3p Proteine dienen vermutlich der
Anreicherung von Siderophoren in der Zellwand. Arn1-4p sind eine Familie von SiderophorTransportern, die zwischen der Plasmamembran und der Vakuole hin und her pendeln.
Aufgenommenes Eisen wird aus dem Cytosol über den Transporter Ccc1p in die Vakuole transportiert
und gespeichert. Bei Bedarf wird das Eisen über die vakuolären Transporter Smf3p und Fet5p/Fth1p
re-mobilisiert und in reduzierter Form über die Transporter Mrs3/4p in die mitochondriale Matrix
transportiert, wo es zur Fe/S Cluster und Häm-Biosynthese benötigt wird. Aft1p ist ein Eisenabhängiger Transkriptionsaktivator, der bei Eisenmangel Gene exprimiert, deren Produkte der
Eisenaufnahme und der Re-Mobilisierung von intrazellulär vorhandenem Eisen dienen. (Modifiziert
nach J. C. Rutherford, 2004)
- 13 -
Einleitung
3.3. Struktur und intrazelluläre Lokalisierung von Fe/S Proteinen
Fe/S Proteine enthalten Fe/S Cluster als anorganische Cofaktoren. Sie werden aus
Fe2+ und/oder Fe3+ Ionen sowie anorganischem Sulfid (S2-) zusammengesetzt. In der
Regel sind die Eisenionen mit den Schwefelatomen der Cysteinreste einer
Polypeptidkette verknüpft, können aber auch mit Histidinresten und sehr selten mit
Serin oder Arginin koordiniert werden. Die einfachste Form ist der rhombische [2Fe2S] Cluster. Dieser findet sich in Proteinen vom Ferredoxin-Typ, der Biotin-Synthase
oder der Ferrochelatase (Enzym der Häm-Biosynthese). Proteine vom Rieske-Typ
besitzen einen [2Fe-2S] Cluster, bei dem eines der beiden Eisenionen mit zwei
Histidinresten koordiniert ist. Durch diese Koordination erfolgt eine Stabilisierung des
Fe/S
Zentrums
in
Reduktionspotentials.
seiner
Häufiger
reduzierten
sind
Form
kubische
und
eine
[4Fe-4S]
Erhöhung
Cluster,
bei
des
denen
mindestens drei der vier Eisenionen über Cysteinreste mit dem Protein koordiniert
sind. [4Fe-4S] Cluster finden sich im respiratorischen Komplex I und II und in
bakteriellen Ferredoxinen. Bei der Aconitase sind drei der vier Eisenionen mit
Cysteinresten koordiniert. Das vierte Eisenion dient der Substratbindung. Die
Aconitase katalysiert die reversible Reaktion von Citrat zu Isocitrat. Weitere Liganden
von [4Fe-4S] Clustern sind beispielsweise CO und CN¯. Seltener zu finden sind [3Fe4S] Cluster, Varianten des [4Fe-4S] Clusters. Darüber hinaus gibt es weitaus
komplexere Fe/S Cluster. Die Sulfit-Reduktase aus Escherichia coli enthält einen
[4Fe-4S] Cluster, der über ein Cystein mit dem zentralen Eisenatom eines SirohämMoleküls verbunden ist. In seltenen Fällen sind Fe/S Cluster mit Metallen wie z.B.
Molybdän, Nickel oder Vanadium koordiniert. Die Nitrogenase beispielsweise besitzt
einen Molybdän-Eisen Cluster (Rees & Howard, 2000; Rees, 2002).
In der bakteriellen oder mitochondrialen Atmungskette sind Fe/S Cluster besonders
zahlreich.
Allein
der
Komplex I
der
Atmungskette
enthält
insgesamt
acht
(Eukaryoten) bzw. neun (Bakterien) Fe/S Cluster (Hinchliffe & Sazanov, 2005). Der
Komplex II besitzt beispielsweise [2Fe-2S], [3Fe-4S] und [4Fe-4S] Cluster (Sun et al.,
2005). Im Cytosol der Hefe kennt man die [4Fe-4S] Cluster Proteine IsopropylmalatIsomerase (Leu1p), Glutamat-Synthase (Glt1p) und eine Untereinheit der SulfitReduktase (Ecm17p). Diese sind am Aminosäurestoffwechsel von Leucin, Glutamat
bzw. Methionin beteiligt. Darüber hinaus sind Ilv3p und Lip5p in der mitochondrialen
Matrix lokalisiert. Diese [4Fe4S] Cluster-tragenden Proteine sind an der Biosynthese
von verzweigtkettigen Aminosäuren bzw. der Liponsäure-Synthese beteiligt. Das in
- 14 -
Einleitung
der mitochondrialen Matrix lokalisierte Bio2p übernimmt eine Funktion in der BiotinBiosynthese und bindet sowohl einen [2Fe-2S] als auch [4Fe-4S] Cluster. Rli1p
befindet sich vorwiegend im Cytosol und hat eine essentielle Funktion in der
Ribosomen-Biogenese (Kispal et al., 2005). Mindestens ein Fe/S Protein, die DNAN-Glycosylase
Ntg2p,
befindet
sich
im
Zellkern.
Diese
ist
an
DNA-
Reparaturvorgängen beteiligt. Übersicht über die Vielfalt der Fe/S Cluster: (Beinert et
al., 1997; Beinert, 2000; Cammack, 1992). Die Abbildung 2 gibt einen Überblick über
die subzelluläre Lokalisierung von Fe/S Proteinen in S. cerevisiae.
Leu1, Ecm17, Glt1, Rli1,
Nar1, Nbp35, Cfd1
Aco1, Aco2, Lys4,
Ilv3, Yah1, Lip5, Bio2
Cytosol
Sdh2,
Rieske
Ntg2, Tyw1∗
Mitochondrium
Zellkern
Abb. 2: Subzelluläre Lokalisierung von Fe/S Proteinen in S. cerevisiae. Fe/S Proteine befinden
sich im Zellkern, Cytosol und in den Mitochondrien. Für die vorliegende Arbeit von Bedeutung sind alle
unterstrichenen Proteine. ∗Die subzelluläre Lokalisierung von Tyw1p, einem tRNA modifizierenden
Enzym, wurde noch nicht bestätigt.
3.4. Funktionen von Fe/S Proteinen
3.4.1. Fe/S Cluster in Redoxprozessen
Die wohl bekannteste Funktion von Fe/S Proteinen ist ihre Beteiligung an
unterschiedlichen Redox-Reaktionen. Die Funktion basiert auf der Eigenschaft von
Eisen, zwischen der reduzierten (Fe2+) und der oxidierten Form (Fe3+) zu wechseln.
Fe/S Cluster übertragen in der Regel nur ein Elektron (Beinert et al., 1997; Beinert,
2000; Johnson & Brown, 1998; Johnson et al., 2005). Das Redoxpotential von Fe/S
Clustern hängt größtenteils von der Struktur des umgebenden Proteins ab. Im
Allgemeinen liegen die Redoxpotentiale von Fe/S Clustern zwischen –500 mV und
+100 mV. Zu den am weitesten verbreiteten redoxaktiven Fe/S Proteinen gehören
die [2Fe-2S] oder [4Fe4S] Cluster-tragenden Ferredoxine. Das Zusammenspiel von
Fe/S Clustern und verschiedenen anderen Elektronenüberträgern ermöglicht die
schrittweise
Übertragung
von
Elektronen.
- 15 -
Beispielsweise
können
in
der
Einleitung
mitochondrialen Atmungskette zwei Elektronen von NADH+H+ zuerst auf FAD/FMN
bzw. Ubichinon und von dort nacheinander über Fe/S- und Häm-haltige
Redoxzentren auf den Ein-Elektron-Akzeptor Cytochrom c übertragen werden.
3.4.2. Die Rolle der Fe/S Cluster bei der Katalyse chemischer
Reaktionen
Als klassisches Beispiel für eine Enzymkatalyse durch einen Fe/S Cluster gilt die
Aconitase,
ein
essentielles
Enzym
im
Zitronensäurezyklus.
Das
in
der
mitochondrialen Matrix lokalisierte Protein enthält einen [4Fe-4S] Cluster, der Teil
des aktiven Zentrums ist. Drei der vier Eisenionen des Clusters sind über
Cysteinreste mit dem Protein koordiniert. Das vierte Eisenatom dient der
Substratbindung. Die Aconitase setzt Citrat zu Isocitrat um. Diese Isomerisierung
wird durch eine Verschiebung der Hydroxygruppe innerhalb des Substrats erreicht
(Beinert, 2000). Funktionell ähnliche Proteine sind das [4Fe-4S] Cluster-tragende
Protein Lys4p, welches in der Lysin-Biosynthese involviert ist, und ein putatives
mitochondriales Aconitase-Isozym (Aco2p).
In
manchen
Enzymen,
die
homolytische
Spaltungen
über
radikalische
Zwischenprodukte katalysieren, wie die Lysin 2,3-Aminomutase, interagiert ein
Schwefelatom eines [4Fe-4S] Clusters mit Adenosylmethionin. Dadurch wird dieses
homolytisch in ein Adenosylradikal und Methionin gespalten. Das Adenosylradikal
wird seinerseits zur radikalischen Spaltungen von C-C oder C-H Verbindungen
verwendet (Cheek & Broderick, 2001). Die Ribonukleotid-Reduktase/Aktivase aus
Escherichia coli, die Biotin-Synthase und die Isopropylmalat-Isomerase sind weitere
Beispiele für Fe/S Proteine, deren Cluster direkt an katalytischen Prozessen beteiligt
sind.
3.4.3. Fe/S Cluster als Regulatoren der Genexpression
Fe/S
Cluster-tragende
Proteine
erlauben
der
Zelle
sich
an
verschiedene
Umweltbedingungen anzupassen, indem sie auf Transkriptionsebene in die
Genregulation eingreifen. Dabei wird die Empfindlichkeit, von Fe/S Clustern
gegenüber Sauerstoff und Stickoxiden, ausgenutzt. Die folgenden Beispiele
demonstrieren wie Fe/S Cluster u.a. als Sensoren für Superoxide und Stickoxide
funktionieren oder in höheren Eukaryoten auf Translationsebene die zelluläre
Eisenhomeostase regulieren.
- 16 -
Einleitung
Das Sensorprotein SoxR
SoxR dient in E. coli als Sensor für Superoxide und Stickoxide. Das SoxR Protein ist
ein Homodimer mit einem [2Fe-2S] Cluster pro Untereinheit. Diese Cluster existieren
unter aeroben Bedingungen zu 95% in der reduzierten Form ([2Fe-2S]1+). In diesem
Zustand ist das SoxR Protein inaktiv, bindet aber an die Promotorregion des SoxS
Transkriptionsfaktors. SoxS ist ein Aktivator von Genen, deren Produkte an der
Beseitigung von Superoxiden beteiligt sind (z.B.
Superoxid-Dismutase). Die
Akkumulation von Superoxiden bewirkt eine Oxidation der SoxR Cluster ([2Fe-2S]2+).
Das Protein wird in die aktive Form überführt und bewirkt eine Modulierung des SoxS
Promotors. Dies induziert die Transkription des Transkriptionsfaktors SoxS. Die
Induktion von SoxR durch NO erfolgt durch die Bildung eines Dinitrosyl-Eisen-Dithiol
Addukts. Obwohl SoxS induziert wird, konnten in einer Microarray-Analyse keine
durch SoxS regulierten Gene gefunden werden (Green & Paget, 2004; Spiro, 2006).
Der O2-Sensor FNR
Bei einem O2-Mangel aktiviert das FNR Protein aus E. coli die Transkription von
Genen, welche für alternative Produkte der Atmungskette kodieren. Außerdem
werden unter anaeroben Wachstumsbedingungen solche Gene reprimiert, deren
Produkte unter aeroben Bedingungen eine Funktion ausüben. Die aktive Form des
FNR ist ein Homodimer mit einem [4Fe-4S]2+ Cluster pro Untereinheit, welches an
DNA bindet. Eine O2-Exposition wandelt den [4Fe-4S]2+ Cluster in einen [2Fe-2S]2+
Cluster um und beschleunigt den Übergang in die monomere Form des Proteins
(Crack et al., 2006). Das FNR Protein aus Bacillus subtilis hingegen existiert stets als
Homodimer unabhängig von der Integrität der [4Fe-4S]2+ Cluster und der
O2-Exposition. Das FNR Protein aus B. subtilis bindet in Anwesenheit eines intakten
[4Fe-4S]2+ Cluster pro Untereinheit an die Promotoren von Zielgenen und aktiviert
diese (Reents et al., 2006).
Der Transkriptionsrepressor IscR
Ein regulatorisches Fe/S Protein mit einer Bedeutung für die Biosynthese und/oder
Reparatur von Fe/S Clustern ist der Transkriptionsrepressor IscR in E. coli. Das IscR
Protein besitzt in der aktiven Form einen [2Fe-2S] Cluster und agiert als Repressor
des isc Operons. Bei Exposition zu Wasserstoffperoxid wird das Protein inaktiviert,
was die Neusynthese und/oder die Reparatur von Fe/S Clustern erlaubt (Green &
Paget, 2004).
- 17 -
Einleitung
Das IRP1/2 System
Der Transferrin-Rezeptor und Ferroportin, zwei Proteine, die der Eisenaufnahme
dienen,
die
Speicherproteine
H-
und
L-Ferritin,
5-Aminolävulinsynthase
(Schlüsselenzym der Häm-Biosynthese) sowie Aconitase werden in Abhängigkeit
von Eisenbedarf und Angebot post-transkriptionell durch die Proteine IRP1 und IRP2
reguliert.
Bei Eisenmangel liegen die „iron regulatory proteins“ (IRPs) in der Apoform vor und
binden an sog. „iron responsive elements“ (IREs). Das sind Sequenzen in den 5´oder 3´- nicht-translatierten Abschnitten bestimmter mRNAs, die Haarnadelstrukturen
ausbilden. Die Ausbildung eines IRE/IRP Komplexes im 5´-nicht-translatierten
Bereich führt zu einer Inhibierung der Translation, während die Komplexbildung im
3´-nicht-translatierten Bereich zu einer Stabilisierung der mRNA führt und diese vor
vorzeitigem Abbau schützt.
Ferritin und der Transferrin-Rezeptor werden in entgegengesetzter Weise durch die
IRP Proteine reguliert. Bei Eisenmangel bindet IRP1 an den 3´-nicht-translatierten
Abschnitt der Transferrin-Rezeptor mRNA. Dies führt zu einer Stabilisierung und zur
Translation des Transferrin-Rezeptors. Ungebundene Transferrin-Rezeptor mRNA
wird hingegen sehr schnell abgebaut. Die Ferritin mRNA besitzt ein IRE im 5´-nichttranslatierten Abschnitt. Durch die Ausbildung eines IRE/IRP Komplexes wird die
Translation der Ferritin mRNA verhindert. Bei einem Eisenüberangebot koordiniert
IRP1 einen [4Fe-4S] Cluster und funktioniert als cytosolische Aconitase, ein Enzym,
das Citrat in Isocitrat überführt. IRP2 hingegen kann Häm binden und wird bei einem
Eisenüberschuss im Proteasom abgebaut. Die IRP Proteine werden auch durch
andere Effektoren kontrolliert. IRP1 wird beispielsweise durch Wasserstoffperoxid
aktiviert, indem es den Fe/S Cluster destabilisiert (Hentze et al., 2004).
3.5. Die Biogenese von Fe/S Proteinen in Bakterien
Anfänglich glaubte man, dass Fe/S Cluster sich spontan zusammensetzen und in
Apoproteine inserieren. Diese Vorstellung basierte auf in vitro Experimenten, in
denen die Rekonstitution eines Fe/S Holoproteins mit reduziertem Eisen (Fe2+) und
einer Schwefelquelle gelungen war (Malkin & Rabinowitz, 1966). Diese Beobachtung
wurde auch für weitere gereinigte Proteine gemacht, allerdings sind hierzu
sauerstofffreie
Bedingungen
und
unphysiologisch
hohe
Eisen-
und
Sulfidkonzentrationen nötig, die in der Zelle toxisch wären. Daher verfügen sowohl
- 18 -
Einleitung
Eubakterien, als auch Eukaryoten über einen komplexen Apparat zur Assemblierung
von Fe/S Proteinen (Frazzon et al., 2002; Gerber & Lill, 2002; Kispal et al., 1999;
Muhlenhoff & Lill, 2000; Zheng et al., 1998). In Eubakterien existieren mindestens
drei unterschiedliche Systeme, die der Synthese von Fe/S Proteinen dienen und
deren Gene in Operons organisiert sind. Als erstes wurde das nif (nitrogen fixation)
System aus dem Stickstofffixierer Azotobacter vinelandii identifiziert (Frazzon &
Dean, 2003; Zheng et al., 1993). Das nif Operon kodiert einen Nitrogenase-Komplex,
der
atmosphärischen
Stickstoff
(N2)
zu
Ammoniak
reduzieren
kann.
Der
Enzymkomplex besteht aus zwei Komponenten, der Nitrogenase (MoFe-Protein) und
der Dinitrogenase-Reduktase. Die Nitrogenase, kodiert durch nifD und nifK, ist ein
α2β2 Heterodimer und besitzt sowohl einen Eisen-Molybdän-Cofaktor als auch einen
P-Cluster [8Fe-7S]. Dieser ist wahrscheinlich am Elektronentransport beteiligt. Die
Reduktase (Eisen-Protein), kodiert durch nifH, besteht aus zwei identischen
Untereinheiten, die durch einen [4Fe-4S] Cluster verknüpft sind. Die meisten Gene
im nif Operon kodieren keine strukturellen Bestandteile des Nitrogenase-Komplexes
(z.B. NifS und NifU). Allerdings führen Deletionen in den entsprechenden Genen zu
einem Aktivitätsverlust des MoFe-Proteins und der Reduktase. Daraus resultiert eine
generelle Bedeutung dieser Genprodukte bei der Synthese des NitrogenaseKomplexes (Jacobson et al., 1989). NifS war das erste Enzym, welches mit der
Biosynthese von Fe/S Clustern in Verbindung gebracht wurde. Es katalysiert die
Umsetzung von Cystein zu Alanin und Enzym-gebundenem Schwefel, welcher für
die Assemblierung eines Fe/S Clusters benötigt wird (Zheng et al., 1993; Zheng &
Dean, 1994; Zheng et al., 1994). NifU besteht aus drei funktionellen Domänen. Das
N-terminale und das C-terminale Drittel des Proteins enthält drei bzw. zwei
konservierte Cysteinreste, auf denen in vitro ein transienter Fe/S Cluster assembliert
werden kann (Smith et al., 2005; Yuvaniyama et al., 2000). Das mittlere Drittel bindet
über vier Cysteine einen permanenten [2Fe-2S] Cluster (Agar et al., 2000b). Da
dieser Cluster dem eines Ferredoxins ähnelt, wird vermutet, dass dieser Teil des
Proteins Elektronen übertragen kann. Deletionen von nifS oder nifU haben jedoch
keinen Einfluss auf die Aktivitäten anderer Fe/S Proteine in A. vinelandii.
Biochemische Untersuchungen in E. coli und aerob kultivierten A. vinelandii führten
zur Identifizierung einer weiteren Cystein-Desulfurase (IscS), die im sog. isc (ironsulfur-cluster) Operon von A. vinelandii und E. coli kodiert ist (Flint, 1996; Zheng et
al., 1998). Die im isc Operon kodierten Gene sind in den meisten Eubakterien
konserviert. Daher wurde schon früh postuliert und in den vergangenen Jahren
- 19 -
Einleitung
bestätigt, dass die entsprechenden Proteine für die generelle Biogenese bakterieller
Fe/S Proteine benötigt werden (Tokumoto & Takahashi, 2001; Zheng et al., 1998).
IscS und NifS sind homologe Proteine mit ähnlichen katalytischen Eigenschaften.
IscU ist homolog zum N-terminalen Drittel von NifU und dient ebenfalls als Gerüst für
die Assemblierung von Fe/S Clustern, die dann auf Apoproteine übertragen werden
(Agar et al., 2000a; Mansy et al., 2002). NifU und IscU sind daher als Fe/S Cluster
Assemblierungsproteine für die Biogenese von Fe/S Proteinen von zentraler
Bedeutung.
Das A. vinelandii isc Operon kodiert neben IscS und IscU noch IscA (ein Homolog zu
orf6 bzw.
NIF
IscA des nif Operons), Hsc66 und Hsc20 (zwei Chaperone der
DnaK/Hsp70 und DnaJ/Hsp40 Familie) (Seaton & Vickery, 1994) sowie Fdx (ein
[2Fe-2S] Ferredoxin) (Ta et al., 1992; Ta & Vickery, 1992).
Die Beobachtung, dass iscS in E. coli nicht essentiell ist, führte zur Identifizierung
eines dritten Systems, dem suf (sulfur mobilization) Operon (Patzer & Hantke, 1999;
Takahashi & Tokumoto, 2002). Homologe suf Gene wurden in manchen Bakterien,
Archaea, Plastiden und deren bakteriellen Vorläufern, den Cyanobakterien sowie den
Apicoplasten von Parasiten identifiziert. Wie die beiden anderen bakteriellen
Systeme, so kodiert auch das suf Operon für eine Cystein-Desulfurase (SufS)
(Loiseau et al., 2003; Outten et al., 2003) und ein Homolog zu IscA (SufA) (Ollagnierde Choudens et al., 2003). Interessanterweise enthält es jedoch keine homologen
Proteine zu IscU oder den Chaperonen Hsc66 und Hsc20. Stattdessen kodiert das
suf Operon diverse Proteine, die nicht Bestandteil der NIF oder ISC-Maschinerie
sind. SufC ist eine lösliche ABC-(ATP binding cassette) ATPase, die im Cytoplasma
zusammen mit SufBD an der Assemblierung und/oder Reparatur von Fe/S Clustern
beteiligt ist (Nachin et al., 2001; Nachin et al., 2003; Rangachari et al., 2002). Der
SufBCD Komplex und SufE stimulieren synergistisch die Cystein-Desulfurase
Aktivität von SufS (Loiseau et al., 2003; Outten et al., 2003). Obwohl sich die isc und
suf Systeme signifikant unterscheiden, können die Suf Proteine nach Überproduktion
die Funktion der Isc Proteine in E. coli ersetzen (Takahashi & Tokumoto, 2002). Es
wird vermutet, dass die Suf Proteine eine alternative Maschinerie für die
Assemblierung von Fe/S Clustern darstellen, die unter bestimmten Bedingungen
(z.B. oxidativem Stress und Eisenmangel) genutzt wird (Outten et al., 2004).
- 20 -
Einleitung
Die Systeme lassen sich untereinander austauschen. Dies beruht auf der Tatsache,
dass das NIF System aus Entamoeba histolytica sowohl das ISC als auch das SUF
System aus E. coli unter anaeroben Bedingungen ersetzen kann (Ali et al., 2004).
3.6. Die Biogenese von Fe/S Proteinen in S. cerevisiae
In Eukaryoten werden Fe/S Cluster in den Mitochondrien synthetisiert und in
mitochondriale Apoproteine eingebaut. Mittlerweile sind in der mitochondrialen Matrix
14
Proteine
identifiziert
worden,
die
in
ihrer
Gesamtheit
als
ISC-Assemblierungsmaschinerie bezeichnet werden (Abb. 3). Viele dieser Proteine
sind in ihrer Primärstruktur sehr ähnlich zu den bakteriellen Proteinen, die in den nif
und isc Operonen kodiert sind (Zheng et al., 1998). Daher ist es wahrscheinlich, dass
die ISC-Komponenten von prokaryotischen Vorfahren der Mitochondrien geerbt
wurden (Endosymbionten-Theorie) (Muller & Martin, 1999). Die ISC-Komponenten
werden ausnahmslos im Kern kodiert und enthalten Signalsequenzen zur
Translokation ins Mitochondrium.
Die Abbildung 3 fasst die Biosynthese von Fe/S Proteinen in S. cerevisiae
zusammen. Die wenigen Untersuchungen an eukaryotischen ISC-Komponenten
erlauben nur eine grobe Darstellung der Synthese von Fe/S Proteinen. Die
funktionellen Details wurden teilweise aus Experimenten mit den bakteriellen
Homologen abgeleitet und ergänzt.
In S. cerevisiae stellen die Isu Proteine (Isu1p/Isu2p) die zentralen Komponenten der
Fe/S Cluster-Biogenese dar. An ihnen erfolgt die Zusammensetzung des Fe/S
Clusters. Diese Proteine sind homolog zum bakteriellen IscU und dem N-terminalen
Drittel von NifU (Garland et al., 1999; Mühlenhoff et al., 2003; Schilke et al., 1999).
Die Mitglieder dieser sog. IscU/Isu Proteinfamilie gehören zu den evolutionär am
stärksten konservierten Proteinen.
Die Synthese des Clusters beginnt mit der Freisetzung eines Schwefelatoms aus
Cystein durch die Cystein-Desulfurase Nfs1p. Nfs1p ist ein Homolog von NifS bzw.
Ortholog von IscS (Kispal et al., 1999; Strain et al., 1998). Die Proteine dieser
IscS/Nfs1 Familie katalysieren die Pyridoxalphosphat (PLP)-abhängige Umsetzung
von Cystein zu Alanin unter Freisetzung von Schwefel. Der Reaktionsmechanismus
wurde für NifS aus A. vinelandii detailliert untersucht. Der Schwefel wird transient auf
einen konservierten Cysteinrest des Nfs1p unter Bildung eines Persulfids übertragen
(Kaiser et al., 2000; Zheng et al., 1993) und von dort auf die Isu Proteine überführt
- 21 -
Einleitung
(Smith et al., 2001; Urbina et al., 2001). Kürzlich wurde eine weitere Isc-Komponente
identifiziert, das essentielle Protein Isd11p. Überraschenderweise ist das Protein nur
in Eukaryoten, nicht aber in Eubakterien konserviert. Das Protein wird für die
Biogenese mitochondrialer und extra-mitochondrialer Fe/S Proteine benötigt. Nfs1p
und Isd11p bilden in vivo einen stabilen Komplex, der die Schwefelübertragung auf
die Isu Proteine ermöglicht. (Adam et al., 2006; Wiedemann et al., 2006). Die genaue
Funktion von Isd11p ist allerdings unklar.
Das zur Synthese eines Fe/S Clusters benötigte Eisen wird in reduzierter Form mit
Hilfe eines Membranpotentials (Lange et al., 1999) und den in der mitochondrialen
Innenmembran lokalisierten Transportern Mrs3p und Mrs4p aufgenommen (Foury &
Roganti, 2002; Muhlenhoff et al., 2003). Da die Doppelmutante ∆mrs3/4 noch
lebensfähig ist, müssen noch zusätzliche Transporter existieren (Zhang et al., 2005).
In welcher Form Eisen bis zum Gebrauch in der Fe/S Cluster Biogenese in der
mitochondrialen Matrix gespeichert wird, ist bislang unbekannt.
Von einigen Arbeitsgruppen wird vorgeschlagen, dass das importierte Eisen mittels
Yfh1p (Yeast frataxin homolog) zu den Isu Proteinen transportiert wird. Gereinigtes
Yfh1p kann Eisen binden und oxidieren, wobei allerdings unklar ist, ob diese Bindung
spezifisch ist (Aloria et al., 2004; Isaya et al., 2004; Nair et al., 2004; Yoon & Cowan,
2003). Es wurde eine durch Eisen stimulierte Interaktion zwischen Isu1p und Yfh1p
gefunden (Gerber et al., 2003). Diese Komplexbildung könnte den Transfer des
Eisens zu den Isu Proteinen möglicherweise erleichtern. Zusätzlich konnte gezeigt
werden, dass Yfh1p zur Assemblierung eines Fe/S Clusters auf Isu1p benötigt wird
(Mühlenhoff et al., 2003).
Für
Frataxin
wurden
allerdings
auch
andere
Funktionen
vorgeschlagen,
beispielsweise in der Häm-Biosynthese, bei der Eisenspeicherung und in der
Prävention von oxidativem Stress. Viele der Auswirkungen, die durch einen Mangel
an Frataxin entstehen sind sekundär und können auf eine gestörte Fe/S
Protein-Biogenese
sowie
auf
die
begleitende
Eisenanreicherung
in
den
Entstehung
der
Mitochondrien zurückgeführt werden.
Beim
Menschen
führt
ein
Mangel
an
Frataxin
zur
neurodegenerativen Erkrankung Friedreichs Ataxie. Die Krankheit hat neurologische
Störungen im Gehirn und Rückenmark zur Folge. Darüber hinaus kommt es zu
Eisenablagerungen im Gehirn und Herzen. Die erkrankten Personen entwickeln
schließlich eine Kardiomyophatie, die in einem Herzinfarkt enden kann. Als Ursache
- 22 -
Einleitung
wird eine Störung in der Biosynthese von Fe/S Clustern vorgeschlagen, da die Zellen
von erkrankten Personen auch einen Aktivitätsverlust von mitochondrialen Fe/S
Proteinen zeigen (Puccio & Koenig, 2000).
Zur Assemblierung eines Fe/S Clusters auf den Isu Proteinen werden zusätzlich
Elektronen benötigt, die höchstwahrscheinlich zur Reduktion des Sulfanschwefels
(S0) zu Sulfid (S2-) dienen, der durch den Komplex Nfs1p/Isd11p bereitgestellt wurde
(Mühlenhoff et al., 2003; Wiedemann et al., 2006). Die benötigten Elektronen werden
vermutlich durch eine Elektronentransportkette geliefert, bestehend aus einem [2Fe2S]-Ferredoxin (Yah1p) (Barros & Nobrega, 1999) und der NADH-abhängigen
Ferredoxin-Reduktase (Arh1p) (Lange et al., 2000; Li et al., 2001; Manzella et al.,
1998). Darüber hinaus wäre es auch denkbar, dass die Elektronentransportkette eine
weitere Funktion in der Dissoziation des Fe/S Clusters von den Isu Proteinen
übernimmt.
Es ist schon lange bekannt, dass an der Fe/S Cluster Biogenese ein ChaperonSystem, bestehend aus Ssq1p (Hsp70p), dem Co-chaperon Jac1p (Hsp40p) und
dem Nukleotid-Austauschfaktor Mge1p, beteiligt ist (Dutkiewicz et al., 2003; Kim et
al., 2001; Lutz et al., 2001; Schilke et al., 1999; Voisine et al., 2001). Kürzlich konnte
sowohl durch in vitro als auch in vivo Experimente gezeigt werden, dass diese nicht
zur de novo Synthese eines Fe/S Clusters auf den Isu Proteinen benötigt werden.
Denn die Depletion der Proteine führte zu einer 5-fach erhöhten Akkumulation von
Fe/S Clustern auf Isu1p (Dutkiewicz et al., 2006). Daher wird vorgeschlagen, dass
dieses Chaperon-System eine Funktion ausübt, die zeitlich zwischen der transienten
Bindung eines Fe/S Clusters auf den Isu Proteinen und dem Einbau dieser Fe/S
Cluster in die jeweiligen Apoproteine liegt. Man könnte vermuten, dass die
Chaperone ausschließlich mit der Apoform dieser Proteine interagieren, um deren
Konformation zu stabilisieren und somit befähigt sind, die Fe/S Cluster von den Isu
Proteinen zu übernehmen. Allerdings fehlt bislang der Beweis einer spezifischen
Interaktion zwischen diesen Proteinklassen.
Das Chaperon Ssq1p wird ausschließlich mit Hilfe seines Co-chaperons Jac1p zu
seinem Substrat Isu1p transportiert, wo es an einem konservierten Motiv des Isu1p
Proteins bindet (Dutkiewicz et al., 2003; Dutkiewicz et al., 2004; Hoff et al., 2000;
Hoff et al., 2003). Die Bindung von Ssq1p an Isu1p wird durch das Co-chaperon
Jac1p erleichtert, welches in vitro ebenfalls mit Isu1p interagiert. Obwohl die
Komplexformation weder für die Apo- noch für die Holoform von Isu1p spezifisch ist,
- 23 -
Einleitung
wird deutlich, dass das Chaperon-System eine Funktion in unmittelbarer Umgebung
der Isu Proteine ausübt. Deshalb wird für dieses eine Rolle in der Fe/S Cluster
Übertragung vorgeschlagen, bei der es entweder die Konformation der Isu Proteine
stabilisiert, die Fe/S Cluster Dissoziation erleichtert oder die Isu Proteine für eine
neue Runde der Fe/S Cluster Assemblierung regeneriert.
Eine weitere Komponente, die erst spät in der Biogenese von Fe/S Proteinen eine
Funktion einnimmt, ist das Monothiol-Glutaredoxin Grx5p. Die Depletion von Grx5p
führt ebenso wie ein Frataxin-Mangel zur Akkumulation von Fe/S Clustern auf den
Isu Proteinen (Mühlenhoff et al., 2003). Allerdings konnte bislang die genaue
Funktion von Grx5p nicht bestimmt werden.
Darüber hinaus gibt es drei weitere Proteine (Isa1p, Isa2p und Nfu1p) für die eine
Beteiligung an der Fe/S Cluster Biogenese gezeigt wurde, aber deren genaue
Funktion noch unklar ist.
Die Isa Proteine sind Homologe von IscA und SufA Proteinen in Bakterien. In Hefe
bilden die beiden Isa Proteine ein Heterodimer, während in den meisten Eukaryoten
ein Sequenzhomolog zu Isa1p vorkommt. Die Deletion dieser Gene hat ähnliche
Auswirkungen,
nämlich
einen
Wachstumsdefekt
auf
nicht
fermentierbaren
Kohlenstoffquellen, einen Verlust mitochondrialer DNA und einen generellen
Respirations-Defekt (Jensen & Culotta, 2000; Kaut et al., 2000; Pelzer et al., 2000).
Erste Experimente zeigten, dass es nach Depletion der Isa1p und/oder Isa2p
Proteine zu einem Defekt von Fe/S Proteinen kommt. Demgegenüber wurde durch
detaillierte Studien demonstriert, dass die Isa Proteine in den Mitochondrien
besonders für Fe/S Proteine vom Aconitase-Typ benötigt werden, während die
Reifung anderer Fe/S Proteine (Yah1p, Biotin-Synthase) unbeeinträchtigt ist. (U.
Mühlenhoff, persönliche Mitteilung). Um die genaue Funktion der Isa Proteine zu
bestimmen, bedarf es allerdings weiterer in vitro Experimente.
Nfu1p besitzt Sequenzhomologie zum C-Terminus von NifU aus A. vinelandii und ist
sowohl in Bakterien als auch in Eukaryoten konserviert (Leon et al., 2003; Lorain et
al., 2001; Schilke et al., 1999; Tong et al., 2003). Die Deletion von NFU1 hat keinen
Phänotyp, allerdings ist die Doppeldeletion ∆isu1∆nfu1 synthetisch letal (Schilke et
al.,
1999).
Im
Gegensatz
dazu
übernehmen
Nfu1p-ähnliche
Proteine
in
Mitochondrien von Pflanzen, in Chloroplasten und in Cyanobakterien eine zentrale
Rolle in der Assemblierung von Fe/S Clustern (Leon et al., 2003; Nishio & Nakai,
2000; Yabe et al., 2004).
- 24 -
Einleitung
3.6.1. Die Biogenese extra-mitochondrialer Fe/S Proteine
Die Biogenese extra-mitochondrialer Fe/S Proteine erfordert die Anwesenheit der
ISC-Assemblierungsmaschinerie. Dies wird dadurch deutlich, dass die Depletion
mitochondrialer
ISC-Proteine
zu
signifikanten
Defekten
in
der
Biogenese
cytosolischer Fe/S Proteine führt (Kaut et al., 2000; Kispal et al., 1999; Lange et al.,
2000; Li et al., 2001; Pelzer et al., 2000). Für zwei der ISC-Komponenten (Nfs1p,
Isu1p) konnte gezeigt werden, dass diese unbedingt im Mitochondrium lokalisiert
sein müssen, um ihre Funktion in der cytosolischen Fe/S Cluster Biogenese ausüben
zu können (Gerber et al., 2004; Mühlenhoff et al., 2004). Ins Cytosol fehllokalisiertes
Isu1p war nicht funktionell und führte zu Defekten von cytosolischen Fe/S Proteinen.
Es wird daher postuliert, dass die ISC-Assemblierungsmaschinerie ein noch
unbekanntes Substrat produziert, das für die Fe/S Cluster Synthese im Cytosol und
für die Insertion in Apoproteine benötigt wird (Abb. 3).
CIA-Maschinerie
Cfd1
Fe
S
S
Extra-mitochondriale
Fe/S Proteine
Holo
GSH
Apo
Fe
Cytosol
Erv1
ISC-Export
Maschinerie
Mitochondrium
Atm1
?
X
ISC-Assemblierungsmaschinerie
Fe
S
S
Apo
Ssq1/ATP
Jac1/Mge1
Grx5
Fe
S
Fe
S
Yfh1
Nfs1
Ala
Mrs3/4?
S
Holo
mitochondriale
Fe/S Proteine
e- Yah1 Arh1/NADH
Isd11
Isu1/2
∆Ψ
Fe
Fe
Isa1/2 ?
Nfu1 ?
Cys
Fe2+
Abb. 3: Arbeitsmodell zur Synthese von zellulären Fe/S Proteinen. Die Zusammensetzung eines
transienten Fe/S Clusters erfolgt auf den Isu1/2p Proteinen. Die Cystein-Desulfurase Nfs1p im
Komplex mit Isd11p liefert den Schwefel und überträgt diesen auf die Isu Proteine. Der gebundene
Schwefel wird zu Sulfid reduziert, die dazu benötigten Elektronen entstammen einer
Elektronentransportkette, bestehend aus dem Ferredoxin Yah1p und der NADH-abhängigen
Ferredoxin-Reduktase Arh1p. Reduziertes Eisen wird unter Ausnutzung eines Membranpotentials
- 25 -
Einleitung
über Mrs3/4p oder andere Transporter (?) ins Mitochondrium aufgenommen und möglicherweise
mittels Yfh1p zu den Isu Proteinen transportiert. Nach der Assemblierung des Clusters wird dieser
vermutlich mit Hilfe des Chaperonsystems Ssq1p, Jac1p und Mge1p sowie dem Glutaredoxin Grx5 in
mitochondriale
Fe/S
Proteine
inseriert.
Darüber
hinaus
synthetisiert
die
ISCAssemblierungsmaschinerie eine noch unbekannte Komponente X, die im Cytosol von der CIAMaschinerie zur Reifung extra-mitochondrialer Fe/S Proteine benötigt wird. Die Translokation von X
erfolgt über die ISC-Exportmaschinerie, bestehend aus dem ABC-Transporter Atm1p in der inneren
Mitochondrienmembran, der Sulfhydryloxidase Erv1p im Intermembranraum und Glutathion. Die
Proteine der CIA-Maschinerie waren zu Beginn dieser Arbeit unbekannt, abgesehen von Cfd1p.
Die Translokation des Substrats ins Cytosol wird durch eine sog. ISCExportmaschinerie vermittelt, von der gegenwärtig drei Komponenten bekannt sind.
Die Depletion dieser Komponenten führt zu einer gestörten Biogenese von
cytosolischen und nukleären Fe/S Proteinen, während mitochondriale unbeeinflusst
bleiben.
Zu
dieser
ISC-Exportmaschinerie
gehört
der
in
der
inneren
Mitochondrienmembran lokalisierte ABC-Transporter Atm1p. Die Orientierung des
Proteins mit der ATPase-Domäne in der mitochondrialen Matrix, lässt auf eine
Exportfunktion schließen. Die Erniedrigung der Menge an Atm1p führt ausschließlich
zu Defekten in der Reifung extra-mitochondrialer Fe/S Proteine und darüber hinaus
zu einer dramatischen Eisenakkumulation in den Mitochondrien (Kispal et al., 1997).
Das spezifische Substrat von Atm1p ist bislang unbekannt. Zur weiteren
Charakterisierung wurde das Protein bereits aufgereinigt und in Proteoliposomen
rekonstituiert. Es zeigte sich, dass die ATPase Aktivität des Proteins durch
Komponenten, die freie Sulfhydryl (-SH)-Gruppen enthalten, stimuliert wird (Kuhnke
et al., 2006). Daher könnte man vermuten, dass der ABC-Transporter Atm1p eine
Schwefelkomponente transportiert. Mutationen im menschlichen Ortholog hABC7
resultieren in einer Eisenspeichererkrankung, der X-Chromosom-gekoppelten
sideroblastischen Anämie und Ataxie (XLSA/A). Sideroblasten sind rote Blutzellen,
die mit Eisen angereicherte Mitochondrien besitzen. Dies verdeutlicht, wie wichtig
eine intakte Fe/S Protein-Biogenese für das Funktionieren einer Zelle ist.
Ein zweites Protein mit einer spezifischen Funktion in der Biogenese extramitochondrialer Fe/S Proteine wurde ausschließlich im Intermembranraum der
Mitochondrien identifiziert (Lange et al., 2001; Lisowsky, 1992). Es handelt sich um
die FAD-abhängige Sulfhydryloxidase Erv1p (Essential for respiration and vegetative
growth 1). Diese katalysiert unter Sauerstoffverbrauch die Einführung von
Disulfidbrücken in Proteine. Darüber hinaus ist Erv1p am Import von Präproteinen in
den Intermembranraum beteiligt (Mesecke et al., 2005). Die Funktion von Erv1p in
der Biogenese von Fe/S Proteinen ist noch völlig unklar.
- 26 -
Einleitung
Das
Tripeptid
Glutathion
(GSH)
ist
eine
dritte
Komponente
der
ISC-
Exportmaschinerie und normalerweise an der Beseitigung von oxidativem Stress
beteiligt (Sipos et al., 2002). Zellen mit geringem Gehalt an Glutathion und deren
Redoxpotential durch Zugabe von Dithiotreitol aufrechterhalten wurde, konnten keine
cytosolischen Fe/S Proteine assemblieren. Dies demonstriert, dass Glutathion
spezifisch an der Fe/S Cluster Biogenese im Cytosol beteiligt ist. Nahezu alle
Proteine der ISC-Assemblierungsmaschinerie wurden bisher ausschließlich in den
Mitochondrien detektiert, abgesehen von Nfs1p. Dieses befindet sich zusätzlich im
Zellkern. Kernlokalisiertes Nfs1p ist dort allerdings nicht an der Biogenese von Fe/S
Proteinen
beteiligt,
sondern
möglicherweise
an
der
Thiouridin-Modifikation
bestimmter tRNAs (Nakai et al., 2001). Auch das bakterielle Ortholog IscS aus E. coli
hat eine solche Doppelfunktion. Die Cystein-Desulfurase stellt den Schwefel für die
Fe/S Cluster-Biosynthese und die Biosynthese von Thionukleosiden bereit
(Kambampati & Lauhon, 1999; Kambampati & Lauhon, 2000; Lauhon, 2002).
In humanen Zellen wurden die Homologen von Nfs1p, Isu1p und Nfu1p überwiegend
in den Mitochondrien detektiert. Geringe Mengen dieser Proteine wurden jedoch
auch im Cytosol gefunden (Land & Rouault, 1998; Tong & Rouault, 2000; Tong et al.,
2003). Es wurde daher postuliert, dass im Cytosol eine Kopie der mitochondrialen
ISC-Assemblierungsmaschinerie existiert, die für die Reifung cytosolischer Fe/S
Proteine verantwortlich ist. Allerdings wurde die physiologische Relevanz einer
cytosolischen ISC-Assemblierungsmaschinerie bisher nicht gezeigt. Im Gegenteil
wurde nachgewiesen, dass im humanen System die mitochondrialen ISC-Proteine
für die Biogenese cytosolischer Fe/S Proteine benötigt werden (Biederbick et al.,
2006; Tong & Rouault, 2006).
Im Jahre 2003 wurde das erste cytosolisch lokalisierte Protein mit einer spezifischen
Funktion in der Biogenese von cytosolischen Fe/S Proteinen identifiziert. Dabei
handelt es sich um die essentielle P-Loop NTPase Cfd1p (cytosolic Fe/S deficient)
(Roy et al., 2003). Cfd1p übernimmt keine Funktion in der Reifung mitochondrialer
Fe/S Proteine. Das Protein weist eine entfernte Homologie zu einer großen Familie
von löslichen P-Loop ATPasen auf und zeigt eine nähere Verwandtschaft zu den
bakteriellen ApbC Proteinen, für die ebenfalls eine Funktion in der Fe/S Cluster
Biogenese beschrieben wurde (Skovran & Downs, 2003). Die erste in unserem
Arbeitskreis gefundene Komponente war Nar1p (Balk et al., 2004), gefolgt von
Nbp35p, dessen Charakterisierung ein Teil dieser Arbeit war.
- 27 -
Einleitung
3.7. Die Regulation der Eisenhomeostase in S. cerevisiae
Säuger und Hefen besitzen unterschiedliche Regulationssysteme zur Erhaltung der
intrazellulären
Eisenhomeostase.
Transkriptionsebene reguliert
Während
in
Hefe
der
Eisenhaushalt
auf
wird, findet die Regulation bei Säugern auf
Translationsebene statt (3.4.3).
In S. cerevisiae wird die Eisenhomeostase größtenteils durch zwei homologe Eisenabhängige Transkriptionsfaktoren (Aft1p und Aft2p) reguliert. Diese induzieren bei
einem Eisenmangel das sog. Eisen-Regulon, welches mindestens 30 Gene umfasst
(Abb. 1). Deren Produkte sind an der Eisenaufnahme über die Zellwand (Fit1-3p), die
Plasmamembran (Fet3p, Ftr1p, Fre1-3p, Arn1-4p) (Blaiseau et al., 2001; Rutherford
et al., 2001), am Eisenexport über die Vakuolenmembran (Fth1p, Fet5p, Smf3p) und
am Eisenimport ins Mitochondrium (Mrs3p, Mrs4p) (Foury & Roganti, 2002), beteiligt.
Darüber hinaus wird ein RNA bindendes Protein (Cth2p) kodiert, das die Stabilität
von Eisen-abhängigen Genen reguliert (Puig et al., 2005). Der Transkriptionsfaktor
Aft1p erkennt eine bestimmte DNA-Sequenz im 5´-nicht-translatierten Abschnitt von
Zielgenen, das sog. „Aft1p response element“ (ARE) (Yamaguchi-Iwai et al., 2002).
Aft2p aktiviert ebenso die Transkription durch die Bindung an „iron response
elements“, allerdings ist Aft2p ein schwächerer Transkriptionsaktivator als Aft1p
(Rutherford et al., 2003).
Aft1p und Aft2p sind in ihrer Funktion teilweise überlappend. Die Überexpression von
AFT2, kann den Eisenaufnahmedefekt einer ∆AFT1 Mutante teilweise aufheben.
Wodurch Aft1p und Aft2p letztendlich inhibiert bzw. aktiviert werden, ist bislang
unbekannt. Die zelluläre Lokalisierung von Aft1p wird durch den zellulären
Eisenspiegel beeinflusst. Aft1p befindet sich bei einem Eisenüberschuss im Cytosol
(Yamaguchi-Iwai et al., 2002) und wandert bei Eisenmangel in den Kern, um dort
Zielgene zu aktivieren.
Neben einem Eisenmangel führen auch Inaktivierungen von Komponenten der ISCAssemblierungs- und Exportmaschinerie zur konstitutiven Induktion der Gene des
Eisen-Regulons
und
zu
einer
Eisenakkumulation
in
den
Mitochondrien.
Demgegenüber bleibt die cytosolische Eisenmenge nahezu konstant (Chen et al.,
2004; Foury, 1999; Kispal et al., 1999; Lange et al., 2001; Li et al., 1999; Rutherford
et al., 2005). Seit längerem ist bekannt, dass Störungen in der Funktion der beiden
mitochondrialen ISC-Maschinerien zusätzlich einen Defekt der Häm-Biosynthese
hervorrufen (Lange et al., 2004). Dieser wird durch die Akkumulation eines Inhibitors
- 28 -
Einleitung
verursacht, der die Ferrochelatase (Enzym der Häm-Biosynthese) reversibel hemmt
(Lange et al., 2004).
Inaktivierungen von Komponenten der CIA-Maschinerie führen dagegen nicht zur
Induktion der Gene des Eisen-Regulons und auch nicht zu einer Eisenakkumulation
in den Mitochondrien (Rutherford et al., 2005). Folglich muss es einen
Zusammenhang geben, zwischen der mitochondrialen Eisenaufnahme und den
beiden mitochondrialen ISC-Maschinerien. Demnach übernehmen die Mitochondrien
eine entscheidende Funktion in der Regulation der zellulären Eisenhomeostase.
Gegenwärtig wird angenommen, dass die ISC-Assemblierungsmaschinerie eine oder
mehrere Komponenten synthetisiert, die über die mitochondriale Exportmaschinerie
ins Cytosol transportiert werden. Die Komponente könnte den Eisenstatus in den
Mitochondrien reflektieren und in Abhängigkeit von diesem die Lokalisierung des
Transkriptionsfaktors Aft1p beeinflussen. Möglicherweise ist dies derselbe Faktor,
der von der CIA-Maschinerie zur Reifung von extra-mitochondrialen Fe/S Proteinen
benötigt wird.
3.8. Aufgabenstellung und Zielsetzung
Diese Arbeit hatte zwei unterschiedliche Zielsetzungen. Im ersten Teil sollten neue
CIA-Komponenten identifiziert und charakterisiert werden um die Biogenese extramitochondrialer Fe/S Proteine besser zu verstehen. Man wusste, dass die Reifung
dieser
Fe/S
Proteine
in
Abhängigkeit
der
ISC-Assemblierungs-
und
Exportmaschinerie erfolgt. Demgegenüber waren cytosolische Komponenten in
diesem Prozess unbekannt, abgesehen von Cfd1p. In dieser Arbeit wurde die
cytosolische P-Loop NTPase Nbp35p (nucleotide binding protein of 35 kDa)
identifiziert und charakterisiert. Das für Hefe essentielle Protein war bereits 1996
entdeckt worden (Vitale et al., 1996), dennoch war die physiologische Rolle von
Nbp35p zu Beginn dieser Arbeit unbekannt. Nbp35p und Cfd1p gehören der
Mrp/MinD Familie an, deren besonderes Merkmal ein konservierter Bereich (KGG) im
Walker A Motiv ist, welches der Bindung eines Nukleotids dient (Leipe et al., 2002).
Es wurde bereits gezeigt, dass die Integrität der Nukleotid-Bindedomäne für die
Funktion des Proteins essentiell ist (Vitale et al., 1996). Es ist möglich, dass Nbp35p
ATP oder GTP binden und hydrolysieren kann. Allerdings war die mögliche ATPase
Aktivität von Nbp35p nicht Gegenstand dieser Arbeit. Ein weiteres Charakteristikum
von Nbp35p ist ein cysteinreicher N-terminaler Abschnitt, der in allen eukaryotischen
- 29 -
Einleitung
Nbp35p-Homologen, nicht aber in Eubakterien und Archaea präsent ist und ein
Bindemotiv für Metalle oder einen Fe/S Cluster darstellen könnte. Es galt die
Funktion dieses Sequenzmotivs zu klären. Darüber hinaus weist Nbp35p eine
erhebliche Homologie zu Cfd1p auf (Abb. 4). Auf Grund dessen stellte sich die
Frage, ob Nbp35p ebenfalls an der Biogenese von Fe/S Clustern beteiligt ist. Im
Folgenden werden Daten präsentiert, die zeigen, dass Nbp35p ein Fe/S Protein ist,
dessen Reifung von Komponenten der ISC-Assemblierungs- und Exportmaschinerie
abhängt. Weiterhin konnte gezeigt werden, dass Nbp35p an der Biogenese von
extra-mitochondrialen Fe/S Proteinen mitwirkt. Inzwischen wurden von Kollegen des
Arbeitskreises zwei weitere Komponenten in diesem Prozess (Nar1p, Cia1p)
identifiziert (Balk et al., 2004; Balk et al., 2005) und weitere Komponenten (Met18p,
Cia2p) werden gegenwärtig bearbeitet. Diese Proteine werden im Verlauf dieser
Arbeit als CIA-(cytosolic Fe/S cluster assembly) Maschinerie zusammengefasst.
Die Entdeckung der ersten Komponente der CIA-Maschinerie erlaubte eine
umfassende
und
vergleichende
Analyse
der
drei
Fe/S
Protein-Biogenese
Maschinerien anzustellen und den Einfluss von Störungen in diesen Maschinerien
auf andere zelluläre Funktionen zu testen.
Im zweiten Teil dieser Arbeit sollte daher die Bedeutung der zellulären Fe/S
Protein-Biogenese für die Regulation der Eisenhomeostase in der Zelle näher
untersucht werden. Wie oben beschrieben verursachen Störungen in den beiden
mitochondrialen ISC-Maschinerien die Induktion der Gene des Eisen-Regulons, eine
zusätzliche Eisenakkumulation in den Mitochondrien und einen Häm-Defekt. Um
diese Zusammenhänge besser verstehen zu können, wurden repräsentative
Mutanten der ISC-Assemblierungs- (YAH1), Export- (ATM1) und CIA- (NBP35)
Maschinerie einer genom-weiten DNA-Microarray-Analyse unterzogen. Die einzelnen
Expressionsprofile der Mutanten wurden untereinander verglichen um gemeinsam
und unterschiedlich regulierte Gene zu identifizieren. Darüber hinaus sollte dieser
Versuchsansatz zu einem besseren Verständnis der Zusammenhänge zwischen
Fe/S Cluster- und Häm-Biogenese führen.
- 30 -
Material und Methoden
4. Material und Methoden
4.1. Escherichia coli Stämme
Stamm
Genotyp
Referenz
DH5α
recA1 endA1 gyrA96 thi-1 hsdR17 (rK-, mK+) supE44
relA1 deoR ∆lacU169(φ80 lacZ DM15)
Promega, Mannheim
BL21 (DE3)
Novagen, Madison,
WI, USA
4.2. Saccharomyces cerevisiae Stämme
Stamm
Genotyp
Referenz
W303-1A
MATa ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3, 112
+
can1-100 GAL
DSMZ
1)
W303-1B
MATα ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3, 112
+
can1-100 GAL
DSMZ
1)
NBP35TAP
MATa ade2 arg4 leu2-3, 112 trp1-289 ura3-52, NBP35
mit fusioniertem TAP tag am C-Terminus
Euroscarf
Gal-NBP35
W303-1A, endogener NBP35 Promotor durch
GAL1-10 Promotor und HIS3 ersetzt
diese Arbeit
Gal-NFS1
W303-1A, endogener NFS1 Promotor durch
GAL1-10 Promotor und LEU2 ersetzt
(Kispal et al., 1999)
Gal-SSQ1
W303-1A, endogener SSQ1 Promotor durch
GAL1-10 Promotor und HIS3 ersetzt
(Mühlenhoff et al.,
2003)
Gal-YAH1
W303-1B, endogener YAH1 Promotor durch
GAL1-10 Promotor und LEU2 ersetzt
(Lange et al., 2000)
W303-1A ∆aco1
W303-1A, aco1::LEU2
(Hausmann et al.,
3)
2006)
W303-1A ∆sod1
W303-1A, sod1::LEU2
(Hausmann et al.,
3)
2006)
W303-1A ∆cyt2
W303-1A, cyt2::LEU2
(Steiner et al., 1995)
Gal-HEM15
W303-1A, endogener HEM15 Promotor durch
GAL1-10 Promotor und HIS3 ersetzt
(Hausmann et al.,
3)
2006)
Gal-ATM1
W303-1B, endogener ATM1 Promotor durch
GAL1-10 Promotor und LEU2 ersetzt
(Kispal et al., 1999)
W303-1A ∆hmx1
W303-1A, hmx1::HIS3
diese Arbeit
Gal-ATM1 ∆hmx1
W303-1B, hmx1::HIS3
diese Arbeit
Gal-YAH1 ∆hmx1
W303-1B, hmx1::HIS3
diese Arbeit
1)
2)
DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig
Hergestellt durch CellZome AG, Heidelberg, Genfusionskassette komplementiert URA3 Auxotrophie,
Accession Number: SC0234. 3)Manuskript in Bearbeitung.
2)
- 31 -
Material und Methoden
4.3. Kultivierung von E. coli
Die Kultivierung von E. coli erfolgte in LB-Medium (1% (v/v) Trypton, 0,5% (w/v)
Hefeextrakt und 1% (w/v) NaCl) und wurde je nach Bedarf mit Antibiotika (100 µg/ml
Ampicillin), versetzt (Sambrook & Russel, 2001). Die Anzucht von E. coli erfolgte
aerob bei 37°C. Flüssigkulturen wurden für eine ausreichende Belüftung auf einem
Schüttelinkubator (250 Upm) inkubiert. Festmedien enthielten 2% (w/v) Bacto-Agar.
4.4. Kultivierung von S. cerevisiae
Hefen wurden in Vollmedium (YP) oder unter Berücksichtigung der AuxotrophieMarker auf Minimalmedium (SC) bei 30°C kultiviert. Flüssigkulturen wurden bei
150 Upm auf einem Schüttelinkubator angezogen. Festmedien enthielten 2% (w/v)
Bacto-Agar.
Vollmedium (YP)
1% (w/v)
2% (w/v)
2% (w/v)
Hefeextrakt
Bacto-Pepton
Glukose oder Galaktose (Kohlenstoffquelle)
Vollmedium (YP) mit Laktat
0,3% (w/v)
0,1% (w/v)
0,05% (w/v)
0,05% (w/v)
0,06% (w/v)
0,1% (w/v)
0,1% (w/v)
2% (w/v)
Hefeextrakt
Glukose
CaCl2 x H2O
NaCl
MgCl2
KH2PO4
NH4Cl
90% Laktat
mit NaOH auf pH 5,5 eingestellt
Minimalmedium (SC)
0,17% (w/v)
0,5% (w/v)
2% (w/v)
Hefe-Stickstoff-Basis ohne Aminosäuren
Ammoniumsulfat
Glukose, Galaktose oder Glycerin als
Kohlenstoffquelle
Eisenarmes SC-Medium
20x Salze
200x Vitamine
50 ml/l
5 ml/l
1 ml/l
2% (w/v)
17 g/l
3 g/l
2 g/l
100 g/l
10 g/l
2 g/l
400 mg/l
400 mg/l
400 mg/l
4 mg/l
4 g/l
- 32 -
20x Salze
200x Vitamine
1000x Spurenelemente
Glukose oder Galaktose als
Kohlenstoffquelle
KH2PO4
K2HPO4
NaCl
NH2SO4
MgSO4
CaCl2
Pantothenat
Thiamin
Pyridoxin
Biotin
Inositol
Material und Methoden
1.000x Spurenelemente
500 mg/l
40 mg/l
100 mg/l
500 mg/l
200 mg/l
200 mg/l
H3BO3
CuSO4
KJ
MnCl2
NaMoO4
ZnSO4
Je nach Auxotrophie-Marker der kultivierten Stämme wurden folgende Aminosäuren und
Supplemente den SC-Medien zugesetzt
Aminosäuren/Supplemente
80 mg/l
20 mg/l
20 mg/l
40 mg/l
20 mg/l
60 mg/l
30 mg/l
Adenin
Uracil
Methionin
Tryptophan
Histidin
Leucin
Lysin
4.5. Puffer
20x SSC
0,4 M
4M
TNETG-Puffer
20 mM
150 mM
2,5 mM
10% (v/v)
0,5% (v/v)
Natrium-Citrat, pH 7,0
NaCl
Tris-HCl, pH 7,4
NaCl
EDTA
Glycerin
Triton X-100
4.6. Oligonukleotide
Alle in dieser Arbeit verwendeten Oligonukleotide wurden von der Firma Metabion
(Martinsried) synthetisiert.
Bezeichnung
Sequenz (5΄ – 3΄Richtung)
Promotoraustausch für Gal-NBP35 Zellen
NBP35 Prom
CGTAGGCTAGGCTAAACGTGAAGTCTTTCTGTTTTGAGAACAACAGTA
TCGATGAATTCGAGCTC
NBP35 ORF
TACTCTGCTGGTAGCACTTCGTCGTTTACATGTGGTAGTATCTCAGTC
ATCGAATTCCTTGAATTTTC
Promotoraustausch für Gal-Hem15 Zellen
Gal-Hem15 Prom
CAGTAAAATAATTACAAATATGTAGCATGTGTAGGATGCCTTGAAACAT
CGATG
Gal-Hem15 ORF
TTAGGAAGGAACCTTGTGTACGGATTGTTCTGGAAAGCATTCTTTAAA
CGA
Amplifizierung von Nbp35-TAP
Nbp35-HindIII
CCCCAAGCTTATGACTGAGATACTACCACA
TAP-XhoI
TATACTCGAGTCAGGTTGACTTCCCCGCGG
- 33 -
Material und Methoden
Bezeichnung
Sequenz (5΄ – 3΄Richtung)
Überprüfung: NBP35 Promotor Austausch durch GAL1-10
Gal10 forw
AAACTTCTTTGCGTCCATCC
BamHI-Nbp35 rev
CCGGATCCTACATCCCCCACAGC
Amplifizierung von ∆1-52Nbp35-TAP
HindIII-∆N forw
CACCCAAGCTTATGCTTCCGAAAGGCCCTGATCC
TAP-XhoI
TATACTCGAGTCAGGTTGACTTCCCCGCGG
Klonierung von NBP35-HIS in pET15b
Nbp35-VspI
CAACAGATTAATATGACTGAGATACTACCAC
Nbp35-XhoI
CGCTCGAGCTATACATCCCCCACAGC
Amplifizierung von NBP35-strep
Nbp35-cStrep-Xho1
CGCTCGAGTTATTTTTCGAACTGCGGGTGGCTCCAGTTTACATCCCCC
ACAGCATCTC
Amplifizierung von HMX1
HMX1-HindIII_forw
GGAAAAAGCTTATGGAGGACAGTAGCAATAC
HMX1-XhoI_rev
CAGAGCTCGAGTTATACTATGCTAAGAAAACTC
HMX1 Deletion
S1HMX1_N-term
ATGGAGGACAGTAGCAATACAATCATACCCTCACCCACTGACGTGCGT
ACGCTGCAGGTCGAC
S1HMX1_C-term
TTATACTATGCTAAGAAAACTCTTTACCAAGAAGTAAAGAACCCAATCG
ATGAATTCGAGCTCG
Überprüfung der HMX1 Deletion
5up-HMX1 forw
CTCATACTCTCTTGCTTAGTC
HIS5/Pst1 rev
TGCAGTGTGATGATCATCGATG
cDNA Synthese
Oligo T20/VN
TTTTTTTTTTTTTTTTTTTTVN
Erkennungssequenzen für Restriktionsendonukleasen sind fett gedruckt.
4.7. Verwendete Vektoren
4.7.1. E. coli Plasmide
Bezeichnung
Marker
pBluescript II KS+
Amp
pFA6a-HIS3
1)
P∆FA6a-HIS3
pET15b
Beschreibung
Referenz
R
leerer Vektor
Stratagene, La Jolla,
CA, USA
R
S. pombe HIS5 / GAL1-10 Promotor
(Muhlenhoff et al.,
2002)
R
S. pombe HIS5
(Muhlenhoff et al.,
2002)
R
leerer Vektor
Novagen, Madison, WI,
USA
Amp
1)
Amp
Amp
- 34 -
Material und Methoden
Bezeichnung
Marker
pET15b-NBP35-His
Amp
1)
R
Beschreibung
Referenz
NBP35
D. Aguilar-Netz
S. pombe HIS5 (Ortholog von S. cerevisiae HIS3)
4.8. S. cerevisiae Plasmide
Bezeichnung
Beschreibung
(Marker, ARS/CEN bzw. 2µ)
Referenz
pHK252
enthält 2 Kopien von GFP
(Rutherford et al.,
2005)
pFET3-GFP
basiert auf pHK12, GFP unter Kontrolle des
FET3 Promotors
(Rutherford et al.,
2005)
pCYC1-GFP
basiert auf pHK12, GFP unter Kontrolle des
CYC1 Promotors
U. Mühlenhoff
P416 Met25
R
(Amp , URA3, ARS/CEN)
leerer Vektor
(Mumberg et al.,
1995)
p416 Met-hRluc
R
(Amp , URA3, ARS/CEN)
Renilla reniformis Gen hRluc (HindIII/SalI) aus
dem Vektor pGL4.70 (Promega, Mannheim)
U. Mühlenhoff
p416 ERG3-hRluc
R
(Amp , URA3, ARS/CEN)
hRluc unter Kontrolle des ERG3 Promotors
(SacI/HindIII)
U. Mühlenhoff
p416 BIO2-hRluc
R
(Amp , URA3, ARS/CEN)
hRluc unter Kontrolle des BIO2 Promotors
(SacI/HindIII)
U. Mühlenhoff
p416 GLT1-hRluc
R
(Amp , URA3, ARS/CEN)
hRluc unter Kontrolle des GLT1 Promotors
(SacI/HindIII)
U. Mühlenhoff
p424 GPD
R
(Amp , TRP1, 2µ)
leerer Vektor
(Mumberg et al.,
1995)
P426 GPD
R
(Amp , URA3, 2µ)
leerer Vektor
(Mumberg et al.,
1995)
Plasmide zur Überexpression von Proteinen
p426 NBP35-TAP
R
(Amp , URA3)
NBP35-TAP unter Kontrolle des TDH3
Promotors
Diese Arbeit
p426 ∆1-52 NBP35-TAP
R
(Amp , URA3)
∆1-52 NBP35-TAP unter Kontrolle des TDH3
Diese Arbeit
p426 BIO2
R
(Amp , URA3)
BIO2 unter Kontrolle des TDH3 Promotors
K. Siegmund
p426 RLI1-HA
R
(Amp , URA3)
RLI1-HA unter Kontrolle des TDH3 Promotors
(Lange et al., 2001)
p426 CFD1
R
(Amp , URA3)
CFD1 unter Kontrolle des TDH3 Promotors
(Hausmann et al.,
2005)
p424 NBP35
R
(Amp , TRP1)
NBP35 unter Kontrolle des TDH3 Promotors
(Hausmann et al.,
2005)
p424 NAR1
R
(Amp , TRP1)
NAR1 unter Kontrolle des TDH3 Promotors
(Hausmann et al.,
2005)
p424 NTG2
R
(Amp , TRP1)
NTG2 unter Kontrolle des TDH3 Promotors
(Hausmann et al.,
2005)
Promotors
- 35 -
Material und Methoden
Bezeichnung
Beschreibung
(Marker, ARS/CEN bzw. 2µ)
Referenz
p426 NTG2-HA
R
(Amp , URA3)
NTG2 mit HA-tag unter Kontrolle des TDH3
Promotors
(Balk et al., 2004)
p426 NAR1-HA
R
(Amp , URA3)
NAR1 mit HA-tag unter Kontrolle des TDH3
Promotors
(Balk et al., 2004)
p426 NFS1
R
(Amp , URA3)
NFS1 unter Kontrolle des TDH3 Promotors
(Kispal et al., 1999)
p426 HMX1
R
(Amp , URA3)
HMX1 (HindIII/XhoI) unter Kontrolle des TDH3
Promotors
diese Arbeit
4.9. Konstruktion verschiedener Stämme und Plasmide
4.9.1.
Gal-NBP35 Zellen
In Wildtypzellen (W303-1A) wurde der endogene Promotor des Gens NBP35 durch
den regulierbaren Promotor GAL1-10 ersetzt. Das Plasmid pFA6a-HIS3 (4.7.1)
enthielt bereits den GAL1-10 Promotor und den Marker HIS5 von S. pombe. Mit den
Oligonukleotiden NBP35Prom, NBP35ORF und Plasmid-DNA (pFA6a-HIS3) wurde
ein PCR Produkt amplifiziert. Das resultierende Fragment bestand aus dem HIS5
Gen und dem GAL1-10 Promotor, eingerahmt von 48 bp bzw. 50 bp langen
Bereichen mit Homologie zum endogenen Promotor bzw. zum unmittelbaren NTerminus von NBP35. Das Fragment wurde nach Analyse auf einem Agarose-Gel
aus diesem aufgereinigt und in Wildtypzellen transformiert. Das Fragment ersetzte
über homologe Rekombination die Region -69 bis -1. Die korrekte Insertion wurde
mit
einer
PCR
unter
Verwendung
der
Oligonukleotide
Gal10 for
und
BamHI Nbp35 rev überprüft. Die Zellen ließen sich auf Minimalmedium ohne Histidin
selektionieren.
4.9.2. Gal-HEM15 Zellen
In Wildtypzellen (W303-1A) wurde der endogene HEM15 Promoter durch einen
GAL1-10
Promotor
ersetzt.
Zur
Amplifikation
des
Fragments
wurden
die
Oligonukleotide Gal-Hem15 Prom, Gal-Hem15 ORF und Plasmid-DNA (pFA6a-HIS3)
verwendet (4.9.1). Die Zellen ließen sich anschließend auf Minimalmedium ohne
Histidin selektionieren. Die Funktionalität der Zellen wurde mit einer Western Blot
Analyse überprüft.
- 36 -
Material und Methoden
4.9.3. Disruption des Hefe-Gens HMX1
Das endogene HMX1 Gen wurde in den Stämmen W303-1A, Gal-ATM1 und GalYAH1 disruptiert. Dazu wurde aus Plasmid-DNA (p∆FA6a-HIS3) und den
Oligonukleotiden S1HMX1_N-term und S1HMX1_C-term ein PCR Produkt generiert.
Das resultierende Fragment besaß den HIS5 Marker, flankiert von 50 bp langen
homologen Bereichen zum 5΄ und 3΄ Bereich des HMX1 Gens. Das PCR Produkt
wurde in die genannten Stämme transformiert und inserierte über homologe
Rekombination. Die korrekte Insertion wurde mit den Oligonukleotiden 5up-HMX1
forw und HIS5/Pst1 rev überprüft. Die Zellen ließen sich auf Minimalmedium ohne
Histidin selektionieren.
4.9.4. Plasmid p426NBP35-TAP zur Expression eines TAP-markierten
Nbp35p
Der vollständige NBP35 ORF mit einer am C-Terminus fusionierten TAP Sequenz
wurde durch PCR mit den Primern Nbp35-HindIII und TAP-XhoI aus genomischer
DNA (NBP35TAP-Stamm, 4.2) amplifiziert. Das Fragment wurde auf einem AgaroseGel analysiert und aus diesem aufgereinigt. Durch die Wahl der Oligonukleotide
wurde eine 5΄ HindIII und eine 3΄ XhoI Erkennungssequenz an das Fragment
angefügt. Das Fragment wurde mit den Restriktionsendonukleasen HindIII und XhoI
geschnitten und in den Vektor p426GPD (4.8), der ebenfalls mit HindIII und XhoI
geschnitten wurde, ligiert.
4.9.5. Plasmid p426∆1-52NBP35-TAP
Die Sequenz ∆1-52NBP35-TAP wurde durch PCR mit den Oligonukleotiden HindIII∆N forw und TAP-XhoI aus der p426NBP35TAP Vektor-DNA amplifiziert. Das
resultierende Fragment ist am 5΄ Abschnitt, gegenüber der Originalsequenz, um 52
Codons verkürzt. Der Vektor p426GPD und das Fragment ∆1-52NBP35-TAP wurden
mit HindIII und XhoI geschnitten, auf einem Agarose-Gel analysiert, und aus diesem
aufgereinigt und miteinander ligiert.
4.9.6. Plasmid p426NBP35-Strep
Der offene Leserahmen von NBP35 wurde durch PCR mit den Primern Nbp35HindIII und Nbp35-cStrep-Xho1 aus genomischer DNA (W303-1A, 4.2) amplifiziert.
Das 3΄ Oligonukleotid wurde so gewählt, dass am 3΄ Abschnitt von NBP35 eine
- 37 -
Material und Methoden
Strep-tag Sequenz angefügt wurde. Das resultierende Fragment und der Vektor
p426GPD wurden mit HindIII und XhoI geschnitten, auf einem Agarose-Gel
analysiert, aus diesem aufgereinigt und miteinander ligiert.
4.9.7. Plasmid pET15B-HIS-NBP35
Der offene Leserahmen von NBP35 wurde durch PCR mit den Primern Nbp35-VspI
und NBP35-XhoI aus genomischer DNA (W303-1A, 4.2) amplifiziert. Durch die
Konstruktion der Oligonukleotide wurde eine 5΄ VspI und eine 3΄ XhoI
Erkennungssequenz an das Fragment angefügt. Der Vektor (pET15b) wurde mit den
Restriktionsendonukleasen NdeI und XhoI geschnitten, während das Fragment mit
VspI und XhoI geschnitten wurde. Restriktionsendonukleasen, die VspI und NdeI
Schnittstellen erkennen, erzeugen kompatible Enden. Vektor und Fragment wurden
miteinander ligiert. Das Fragment wurde hinter eine HexaHistidin-Sequenz des
Vektors eingefügt (Klonierung hergestellt von D. Aguilar-Netz).
4.9.7.1.
Überprüfung der Vektoren
Die Integration der Gene in die Vektoren wurde durch eine Restriktionsanalyse
bestätigt. Die entstandenen Vektoren wurden durch eine DNA-Sequenzierung
überprüft.
4.10. Rekombinante DNA-Techniken
4.10.1. Isolierung von Plasmid-DNA aus E. coli
Die Präparation von Plasmid-DNA aus E. coli erfolgte durch alkalische Lyse
(Maniatis et al., 1982). Die Bakterien wurden in 5 ml LB-Amp über Nacht kultiviert.
Für DNA-Sequenzierungen wurden die Plasmide mit dem NucleoSpin Plasmid-Kit
von Macherey-Nagel (Düren) nach Angabe des Herstellers isoliert.
4.10.2. Isolierung genomischer DNA aus S. cerevisiae
Für die Präparation von genomischer DNA aus Hefe wurden 5 – 20 ml einer über
Nacht gewachsenen Kultur verwendet (Hoffman & Winston, 1987). Die Zellen wurde
durch Zentrifugation (3.000 Upm, 3 min) sedimentiert und in 200 µl TEST-Puffer
resuspendiert. Nach Zugabe von 200 µl Phenol-Chloroform (Phenol: Chloroform:
Isoamylalkohol = 25:24:1) und 0,3 g Glasperlen (Ø 0,45 mm) wurde die Probe kräftig
gemischt und anschließend mit 200 µl TE-Puffer versetzt. Die Suspension wurde
- 38 -
Material und Methoden
5 min bei 13.000 Upm zentrifugiert, die wässrige (obere) Phase wurde einer erneuten
Phenol-Chloroform-Extraktion unterzogen. Nach der DNA-Fällung aus der wässrigen
Phase mit Ethanol (4.11) wurde diese in 50 µl TE-Puffer + RNase (20 µg/ml)
aufgenommen und ca. 30 min bei 37°C inkubiert. Durch eine weitere Ethanol-Fällung
wurde die DNA wieder aufgereinigt und in 50 – 500 µl TE-Puffer aufgenommen. Die
Lagerung erfolgte bei -20°C.
TEST-Puffer
TE-Puffer
10 mM
1 mM
100 mM
2% (v/v)
1% (v/v)
Tris-HCl, pH 8,0
EDTA
NaCl
Triton X-100
SDS
10 mM
1 mM
Tris-HCl, pH 8,0
EDTA
4.11. Reinigung und Analyse von DNA
4.11.1. Phenol-Chloroform Extraktion
Um restliche Proteine aus DNA-Lösungen zu entfernen, wurde eine PhenolChloroform Extraktion durchgeführt (Sambrook & Russel, 2001). Diese Methode
beruht auf der Aggregation von Proteinen an der Phasengrenze zwischen
organischer und wässriger Phase, während Nukleinsäuren in der wässrigen Phase
gelöst bleiben. Zunächst wurde die DNA-Lösung mit Phenol-Chloroform (Phenol:
Chloroform: Isoamylalkohol = 25:24:1) im Verhältnis 1:1 versetzt und kräftig
gemischt. Die DNA-haltige wässrige (obere) Phase wurde nach Zentrifugation (5 min,
13.000 Upm) abgenommen und zur Entfernung von Phenolresten mit ChloroformIsoamylalkohol (24:1) gewaschen. Nach erneuter Zentrifugation wurde die DNA aus
der wässrigen Phase durch eine Ethanol-Fällung präzipitiert.
4.11.2. Ethanol-Fällung
Die Fällung von DNA aus wässrigen Lösungen erfolgte durch Zugabe von 1/10
Volumen 3 M Natriumacetat (pH 5,2) und 3 Volumen absolutem Ethanol (p. a.) bei 20°C (über Nacht) oder bei -80°C (ca. 1 h) (Shaprio, 1981). Die DNA wurde durch
Zentrifugation (30 min, 13.000 Upm, 4°C) sedimentiert, mit 70% (v/v) Ethanol
gewaschen, anschließend getrocknet und in H2O aufgenommen.
- 39 -
Material und Methoden
4.11.3. Agarose-Gelelektrophorese
Für analytische und präparative Zwecke wurden Plasmide und lineare DNAFragmente in einer Agarose-Gelelektrophorese getrennt (Sambrook & Russel, 2001).
Die
Gel-Matrix
bestand
aus
1–2%
(w/v)
Agarose
in
1x TAE-Puffer
und
Ethidiumbromid (1 µg/ml). Die DNA-Proben wurden mit 1/10 Volumen 10x
Probenpuffer versetzt, und die Elektrophorese erfolgte bei 80–120 V in 1x TAE
Puffer. Als Größenstandard diente die 1 kb DNA Leiter von MBI Fermentas (LeonRot). Mittels UV-Licht (302 nm) ließ sich die DNA visualisieren und mit einem
Thermoprinter dokumentieren.
4.11.4. DNA Extraktion aus Agarose-Gelen
Zur Extraktion und Reinigung der DNA aus Agarose-Gelen wurde das NucleoSpin®
Extract II Kit (Macherey-Nagel, Düren) nach Anleitung des Herstellers verwendet.
4.11.5. Polymerasekettenreaktion (PCR)
Alle PCR-Reaktionen zur Amplifizierung definierter DNA-Fragmente wurden in einem
50 µl PCR Reaktionsvolumen angesetzt. Als Original-DNA Vorlage dienten
genomische und Plasmid-DNA aus S. cerevisiae. Für die PCR wurde die
CombiZyme
DNA
Polymerase
(Invitek,
Berlin)
verwendet.
Die
mittlere
Schmelztemperatur Tm der Oligonukleotide wurde mit folgender Formel berechnet:
Tm = 69,3 + 0,41 x (%GC) - 650 x n-1 (n = Anzahl der Nukleotide).
50 µl PCR-Ansatz
variabel ≤1 µg
5 µl
1 µl
1 µl
0,25–1 µl
variabel
variabel
- 40 -
Original-DNA
2+
10x OptiPerform Puffer III ohne Mg
50x MgCl2 (Endkonzentration 2,5 mM)
dNTPs (Endkonzentration 0,25 mM pro
dNTP)
Primer 1 und 2 (Endkonzentration je 0,2–
1 µM)
Combi-Polymerase (1–4 Units)
H2O
Material und Methoden
Die Amplifikation wurde nach folgendem Schema im Thermocycler (Biometra,
Göttingen) durchgeführt:
Zeit
Temperatur
Reaktion
5 min
95°C
Initialschmelzung
30 Zyklen
30 sec
30 sec
1 min pro 1 kb
93°C
52–56°C
72°C
Denaturierung
Annealing
Elongation
10 min
72°C
Vervollständigung der PCR Produkte
4.11.6. Konzentrationsbestimmung von Nukleinsäuren
Nukleinsäurekonzentrationen
in
Lösungen
konnten
mit
Hilfe
eines
UV/VIS
Spektralphotometers V-550 (Jasco, Groß-Umstadt) bei einer Wellenlänge von
260 nm, dem Absorptionsmaximum von Nukleinsäuren, bestimmt werden. Für DNA
entspricht eine Absorption von A260 = 1 einer Konzentration von 50 µg/ml (Maniatis et
al., 1982). Für RNA entspricht eine Absorption von A260 = 1 einer Konzentration von
40 µg/ml. Der Quotient aus einer Absorption bei 260 nm und 280 nm (A260/A280) stellt
ein Maß für die Reinheit der Präparation dar. Für RNA sollte der Quotient zwischen
1,9–2,1 liegen.
4.11.7. Spaltung von DNA mit Restriktionsendonukleasen
DNA wurde mit Restriktionsendonukleasen der Firmen New England Biolabs und
Fermentas gemäß den Angaben der Hersteller in den entsprechenden mitgelieferten
Puffern bei einer Enzymkonzentration von ca. 2-3 U pro µg DNA für 1,5 h gespalten.
Anschließend erfolgte die Analyse der Proben durch Agarose-Gelelektrophorese.
- 41 -
Material und Methoden
4.11.8. Ligation von DNA-Fragmenten
Zur kovalenten Verknüpfung von DNA-Fragmenten wurde die T4 DNA-Ligase
(Promega, Mannheim) verwendet. Dieses Enzym katalysiert die Bildung einer
Phosphodiesterbindung durch die Verknüpfung einer freien 3'-Hydroxygruppe mit
einer freien 5'-Phosphatgruppe des DNA-Rückgrats unter Verbrauch von ATP. Die
Ligation erfolgte in einem Endvolumen von 20 µl mit 1 µl T4 DNA-Ligase (3 Units)
und 2 µl T4 DNA 10x Ligase-Puffer (Promega, Mannheim). Vektor und DNAFragment wurden im Verhältnis 1:3 eingesetzt. Der Ansatz wurde über Nacht bei
16°C inkubiert.
4.11.9. Transformation von E. coli mit rekombinanter DNA
Die Transformation von E. coli erfolgte mittels Elektroporation (Dower et al., 1988).
Um E. coli für diese Transformationstechnik kompetent zu machen, wurden die
Zellen in LB-Medium bis zu einer OD600nm = 0,5 – 0,7 kultiviert und dann 30 min auf
Eis gekühlt. Die Zellen wurden durch Zentrifugation (5 min, 3.000 Upm) geerntet,
zweimal mit 1 l eiskaltem H2O und einmal in ca. 20 ml 10% (v/v) Glycerin
gewaschen. Anschließend wurden die Zellen in 10% (v/v) Glycerin resuspendiert, so
dass die Suspension eine Zellzahl von ca. 3 x 1010 Zellen/ml aufwies. Die Lagerung
der elektrokompetenten Zellen erfolgte in Aliquots bei –80°C. Für die Transformation
wurden
die
Zellen
und
die
zu
transformierende
DNA
in
einer
0,2 cm
Elektroporationsküvette gemischt und einem elektrischen Puls von 2,25 kV für
4,5 ms bei 200 W und 25 µF ausgesetzt. Die Erholungsphase erfolgte für 1/2 h bei
37°C in LB-Medium. Danach wurde der Transformationsansatz auf LB-Amp-Platten
ausgestrichen und über Nacht bei 37°C inkubiert.
4.11.10.
Transformation von Hefe mit rekombinanter DNA
Die Hefe S. cerevisiae wurde in dieser Arbeit mit Hilfe der Lithiumacetat-Methode
transformiert (Ito et al., 1983). Diese Methode kam bei der Transformation von Hefe
mit Plasmid-DNA und mit linearen DNA-Fragmenten zur homologen Rekombination
ins Genom zum Einsatz. Dazu wurden die Zellen in Flüssigkultur bis zu einer OD600nm
= 0,6 – 1 inkubiert und durch Zentrifugation (5 min, 3.000 Upm) geerntet. Der
Zellniederschlag wurde jeweils einmal mit H2O und mit Lithiumacetat-Lösung
gewaschen. Anschließend wurde dieser in 1 ml Lithiumacetat-Lösung aufgenommen.
100 µl dieser Zellsuspension wurden mit 2,5 µl denaturierter Träger-DNA (aus
- 42 -
Material und Methoden
Lachssperma) und 5 – 10 µg zu transformierender DNA versetzt und 30 min bei 30°C
geschüttelt. Zu der Probe wurden 700 µl PEG-Lösung gegeben, es folgte ein
Hitzeschock bei 42°C für 15 min. Anschließend wurden die Zellen in H2O gewaschen
und auf Selektionsplatten (SC-Medium) ausgestrichen. Die Platten wurden bei 30°C
inkubiert, Transformanden konnten nach 2 – 5 Tagen isoliert werden.
Lithiumacetat-Lösung
100 mM
10 mM
1 mM
Lithiumacetat
Tris-HCl, pH 7,5
EDTA
PEG-Lösung
40%
100 mM
10 mM
1 mM
PEG 4.000
Lithiumacetat
Tris-HCl, pH 7,5
EDTA
4.12. RNA-Techniken
4.12.1. Herstellung RNase-freier Geräte und Lösungen
Glas und Metallgeräte wurden in Alufolie eingeschlagen und durch 6-stündiges
Erhitzen auf 160°C vorbereitet. Plastikgeräte wurden 20 min in 3%ige H2O2 Lösung
gelegt und anschließend mit DEPC-behandeltem H2O ausgespült. Wasser wurde mit
DEPC in einer Endkonzentration von 0,1% versetzt, bei 37°C über Nacht geschüttelt
und anschließend autoklaviert. Lösungen, die nicht mit DEPC behandelt werden
konnten, wurden mit Chemikalien aus original verschlossenen Behältern hergestellt.
4.12.2. Extraktion von Gesamt-RNA aus S. cerevisiae
Gesamt-RNA wurde aus exponentiell wachsenden Zellen (OD600 = 0,5–0,6) mit dem
RNeasy Kit von Qiagen (Hilden) nach Anleitung des Herstellers isoliert und durch
DNase I Behandlung von unerwünschter DNA gereinigt. Nach Zugabe von 20 Units
RNasin (Promega, Mannheim) wurde die RNA bei -80°C gelagert.
4.12.3. RNA Konzentrierung mit Natriumacetat
Zur Konzentrierung von RNA Proben wurden diese mit 0,3 M Natriumacetat pH 5,2
(Endkonzentration) und 2,5–3,0 Volumen Ethanol (p. a.) vermischt und 2 h bei -80°C
gefällt (Sambrook & Russel, 2001). Die RNA wurde anschließend bei 10.000 xg für
30 min bei 0°C abzentrifugiert. Der Niederschlag wurde mit 70%igen Ethanol
gewaschen und erneut bei 10.000 xg für 10 min zentrifugiert. Die gefällte RNA wurde
getrocknet und in H2O gelöst.
- 43 -
Material und Methoden
4.13. Northern Blot Analyse
4.13.1. Auftrennung von RNA in denaturierenden Agarose-Gelen
Zur gelelektrophoretischen Auftrennung von RNA wurde ein 1,5%iges Agarose-Gel
unter RNase-freien Bedingungen gegossen. Zu diesem Zweck wurden 1,5 g Agarose
in 72 ml DEPC-behandelten H2O durch Aufkochen gelöst. Nach Abkühlung auf 55°C
wurden 10 ml 10x MOPS und 18 ml Formaldehyd hinzugegeben. Das Gel wurde
möglichst dünn gegossen und nach Erkalten mit 1x MOPS Puffer als Laufpuffer
überschichtet.
Die Gelkammer sowie Gelträger und Kamm wurden zuvor mit 3%iger H2O2 Lösung
für 20 min vorbehandelt und anschließend mit DEPC-behandeltem H2O abgespült.
Nach einem 5-minütigen Vorlauf, bei 5 V/cm, erfolgte die elektrophoretische
Auftrennung der RNA bei gleicher Spannung. Es wurden 20 µg Gesamt-RNA/Spur
eingesetzt. Die RNA wurde mit 2 µl 10x MOPS Puffer, 4 µl Formaldehyd, 10 µl
Formamid und 1 µl Ethidiumbromid (200 µg/ml) vermischt. Die Proben wurden vor
dem Auftragen bei 85°C für 10 min denaturiert und anschließend sofort auf Eis
gegeben. Zum Ansatz wurden 2 µl 10x Ladepuffer (50% Glycerin, 10 mM EDTA
pH 8,0, 0,25% (w/v) Bromphenolblau, 0,25% (w/v) Xylen Cyanol FF) pipettiert. Nach
dem Lauf wurde die RNA unter UV-Licht sichtbar gemacht, mit einer Kamera
fotografiert und mit einem Thermoprinter dokumentiert.
10x MOPS Puffer
0,2 M
20 mM
10 mM
MOPS, pH 7,0
Natriumacetat
EDTA
4.13.2. RNA Transfer auf Nylonmembranen
Nach der elektrophoretischen Auftrennung der RNA in einem Agarose-Gel wurde
dieses durch 10 min waschen in 20x SSC (4.5) vom Formaldehyd befreit (Sambrook
& Russel, 2001). Die RNA wurde dann durch einen sog. „upward capillary transfer“
auf eine in 10x SSC equilibrierte Nylonmembran (Hybond N+, GE Healthcare,
Freiburg) übertragen. Als Transferpuffer diente 10x SSC. Der Transfer erfolgte bei
RT und dauerte 8 h. Anschließend wurde die RNA mittels UV Licht unter
Verwendung des Stratalinker UV Crosslinker (245 nm, 50 s, bei 120 mJ/cm2) mit der
Nylonmembran quervernetzt.
- 44 -
Material und Methoden
4.13.3. Methylenblau-Färbung von RNA
Zur Überprüfung der Transfereffizienz wurde die Nylonmembran nach der UVBehandlung bei RT 10 min mit einer Methylenblau-Lösung (0,04% Methylenblau in
0,5 M Natriumacetat) gefärbt und in DEPC-behandeltes H2O entfärbt, bis die Banden
der 18S und 26S rRNA sichtbar wurden. Bis zur weiteren Anwendung wurde die
Nylonmembran in Alufolie bei RT gelagert.
4.13.4. Herstellung von 32P markierten DNA Sonden
Die Markierung der DNA Sonden erfolgte mit dem HexaLabel DNA Labelling Kit von
MBI Fermentas (Leon-Rot) nach Anleitung des Herstellers. Die Template DNA wird
dabei zunächst denaturiert, es lagern sich Hexanukleotide an, diese werden von dem
Klenow-Fragment (exo-) als Oligonukleotide verwendet. Als Original-DNA wurden ein
Restriktionsfragment (HEM15) und PCR Produkte (HMX1, ACT1) verwendet. Jeder
Ansatz
wurde
mit
5 µl
α-32P-dATP
(3.000
Ci/mmol,
10 µCi/µl,
Hartmann
Analytic, Braunschweig) markiert. Die Entfernung freier Nukleotide erfolgte über
MicroSpinTM G-50 Säulchen (GE Healthcare) nach Anleitung des Herstellers. Die
Einbaurate von α-32P-dATP wurde in einem Szintillationszähler bestimmt (Sambrook
& Russel, 2001).
4.13.5. RNA/DNA Hybridisierung
Die Nylonmembran wurde in einer Hybridisierungsröhre, mit einem auf 42°C
vorgewärmten Hybridisierungspuffer 30 min (ULTRAhyb, Ambion), vorinkubiert.
Anschließend wurde der Puffer verworfen und durch eine
32
P-markierte DNA Sonde
in 10 ml vorgewärmten Hybridisierungspuffer ersetzt. Die DNA Sonde wurde kurz
vorher durch Erhitzen auf 100°C für 5 min denaturiert. Die RNA/DNA Hybridisierung
erfolgte bei einer Temperatur von 42°C in einem Hybridisierungsofen und dauerte
20 h. Unspezifisch gebundene Sonden wurden durch 2x Waschen mit 2x SSC, 0,1%
SDS für 5 min und 2x Waschen mit 0,1x SSC, 0,1% SDS für 15 min bei 42°C
entfernt. Die noch feuchte Membran wurde in Klarsichtfolie eingeschlagen und in
eine Filmkassette mit Verstärkerfolie gelegt. Zur Signaldetektion wurde ein
Röntgenfilm (Kodak Bio Max MS Film, MS-1, Sigma-Aldrich) aufgelegt, die
Exposition fand bei -80°C statt.
- 45 -
Material und Methoden
4.13.6. Entfernung hybridisierter Sonden
Auf Nylonmembranen hybridisierte Sonden wurden bei Bedarf unter Rotation in
einem Hybridisierungsofen entfernt (Sambrook & Russel, 2001). Dies erfolgte in 10
mM Tris-HCl, pH 7,4; 0,2% SDS bei 70–75°C für die Dauer von 2 h.
4.14. Bearbeitung von S. cerevisiae cDNA-Microarrays
4.14.1. Herstellung Cy3- und Cy5 markierter cDNA
Die Isolierung der RNA erfolgte wie unter 4.12.2 beschrieben. Zur Überprüfung der
RNA-Integrität wurde diese auf einem denaturierendem Agarose-Gel analysiert. Es
wurden 12–15 µg Gesamt-RNA mit dem CyScribe Post-Labelling Kit (GE Healthcare,
München) nach Anleitung des Herstellers, in cDNA umgeschrieben. Anstelle von
dATPs wurden Aminoallyl-dUTPs in die Erststrang cDNA eingebaut. Nach erfolgter
Synthese wurde der Ansatz kurz abzentrifugiert und auf Eis gestellt. Es wurden 4 µl
50 mM EDTA (pH 8,0), 2 µl 10 N NaOH hinzugegeben und der Ansatz wurde für
20 min bei 65°C inkubiert. Mit diesem Schritt wurde die RNA hydrolysiert. Die
Reaktion wurde anschließend durch Zugabe von 4 µl 5 M Essigsäure neutralisiert.
Die Aminoallyl-modifizierte cDNA wurde durch eine Ethanol-Fällung (4.11.2)
gereinigt.
An
die
Aminogruppe
Fluoreszenzfarbstoffe
konnten
Cy3
und
anschließend,
Cy5
durch
gekoppelt
eine
werden.
Veresterung,
Zum
Schutz
die
der
Fluoreszenzfarbstoffe erfolgten alle Arbeiten bei verminderter Lichtintensität. Nicht
eingebaute Nukleotide wurden durch Gelfiltration, unter Verwendung von MicroSpinTM G-50 Säulchen (GE Healthcare, München), entfernt. Die Effizienz der cDNA
Synthese und die Markierung mit Fluoreszenzfarbstoffen wurde mit einem
Spektralphotometer bei einer Absorption von 260 nm (cDNA), 550 nm (Cy3) und
650 nm (Cy5) detektiert.
4.14.2. Hybridisierung der Microarrays
Hefe Microarrays (Glasträger, Yeast Y6.4k6) wurden vom University Health Network
Centre (Toronto, Ontario, Kanada) bezogen. Die Microarrays bestehen aus 48
Blöcken mit jeweils 272 Spots. Jeder Block enthält neben den doppelt aufgetragenen
Hefe ORFs (6240) zusätzliche Kontrollen. Weitere Angaben zu den Microarrays
können unter folgender Internetseite bezogen werden: www.microarrays.ca. Die
- 46 -
Material und Methoden
Arrays wurden in 5x SSC Puffer mit 0,1% SDS und 1% BSA 2 h bei 37°C prähybridisiert, dann durch 5x Eintauchen in H2O gewaschen und durch 1x Eintauchen
in Isopropanol getrocknet. Die zuvor markierte cDNA wurde in einer Speed-vac auf
ein Volumen von ca. 3 µl reduziert. Die cDNA der Mutante und des Wildtyps wurden
gemischt und in 54 µl DIG Easy Hyb Puffer (Roche, Mannheim) mit 3 µl Hefe tRNA
(10 mg/ml, Invitrogen, Karlsruhe) und 3 µl denaturierter Lachssperma DNA
(10 mg/ml, Invitrogen, Karlsruhe) aufgenommen. Der Ansatz wurde 2 min bei 65°C
inkubiert, wieder auf RT abgekühlt und auf den Array gegeben. Die Array-Oberfläche
wurde mit einem Deckgläschen (24 x 60 mm, Kobe, Marburg) abgedeckt. Die
Hybridisierung erfolgte in Hybridisierungskammern (Corning) für 18 h bei 37°C unter
Lichtausschluss, um die Fluoreszenzfarbstoffe vor dem Ausbleichen zu schützen.
Nach der Hybridisierung konnten die Deckgläschen durch Schwenken in 1x SSC
Puffer bei Raumtemperatur entfernt werden. Die Glasträger wurden in 50 ml Falcon
Röhrchen überführt und 3x 15 min in 1x SSC/0,2% SDS (bei 50°C) unter ständiger
Bewegung gewaschen. Anschließend wurden die Glasträger bei Raumtemperatur 2x
in 1x SSC, dann in 0,1x SSC getaucht, und in einem 50 ml Falcon Röhrchen durch
Zentrifugation bei 1.500 Upm für 5 min getrocknet. Die Arrays wurden sofort oder
innerhalb der nächsten Stunden gescannt (ScanArray Express, PerkinElmer,
Wellesley, MA, USA). Die kurzfristige Lagerung fand unter Lichtschutz bei
Raumtemperatur statt. Die gescannten Arrays wurden zur weiteren Bearbeitung als
TIF Bild abgespeichert.
4.14.3. Microarray Daten-Analyse
Die Intensitäten einzelner DNA-haltiger Punkte (im Folgenden „Spot“ genannt)
wurden mit dem Programm ImaGene 3.0 (BioDiscovery, Inc., El Segundo, CA, USA)
bestimmt. Zur maximalen Reproduzierbarkeit der Daten wurden vorab verschiedene
Software Parameter optimiert (Details im ImaGene Benutzerhandbuch). Der Median
(Zentralwert) der Signalintensität (ICy5i und ICy3i) und die Intensität des lokalen
Hintergrundes (BgCy5i oder BgCy3i) wurde von jedem Spot im Cy3 und im Cy5 Kanal
gemessen, und voneinander subtrahiert:
R i = ICy5 i − Bg Cy5 i und G i = ICy3 i − Bg Cy3 i
Anschließend wurde für jeden Spot der Logarithmus zur Basis 2 des Quotienten der
Intensitätsverhältnisse nach folgender Formel berechnet (Yang et al., 2002):
- 47 -
Material und Methoden
Mi = log 2
Ri
Gi
Die Berechnung der mittleren Signalintensität Ai eines Spots erfolgte durch die
Formel:
A i = log 2
R i × Gi
Zur Normalisierung der Daten wurde die Lowess-Funktion verwendet (Yang et al.,
2002). Dies war nötig, um intensitätsabhängige Verzerrungen der M-Werte (logVerhältnis) zu kompensieren, die durch die Eigenschaften der Fluoreszenzfarbstoffe
entstehen. In einem zweiten Schritt wurde eine umfassende Standardisierung
vorgenommen, bei der die log-Verhältnisse auf Null gesetzt wurden:
M΄= M − c
Da jedes Gen auf dem Array zweimal vorhanden ist, wurde der Mittelwert des logVerhältnisses bestimmt. Die log-Verhältnisse der Replikate wurden ebenfalls
gemittelt. Um unterschiedlich regulierte Gene herauszufiltern, wurden diese nach der
relativen Änderung sortiert. Interessante Gene wurden unter Einbeziehung der
Intensität A und des log-Verhältnisses M manuell auf die Glaubwürdigkeit der Daten
überprüft. War die durchschnittliche Intensität dabei zu gering oder die Differenz der
beiden Gen-Replikate zu groß wurde das Gen nicht weiter inspiziert.
4.15. Zellbiologische und biochemische Methoden
4.15.1. Fluoreszenzmikroskopie
Die Zellen einer über Nacht gewachsenen Kultur wurden auf eine OD600 = 0,1
verdünnt und bis zu einer OD600 = 0,5 weiter kultiviert. 5 ml dieser Kultur wurden in
ein 15 ml Falcon-Röhrchen überführt und durch Zugabe von 3,7% Formaldehyd
(Endkonzentration) für 45 min bei ständiger Rotation fixiert. Dann wurden die fixierten
Zellen für 5 min bei 3.000 Upm abzentrifugiert und 2x in 1 ml 0,1 M Hepes (pH 7,4)
gewaschen. Die Zellsuspension wurde in ein 1,5 ml Reaktionsgefäß überführt,
abzentrifugiert (2 min, 6.000 Upm) und in 1 ml SP-Puffer gewaschen, abzentrifugiert
(2 min, 6.000 Upm) und in 200 µl SP-Puffer resuspendiert. Die Zellen wurden sofort
weiterbehandelt oder bei 4°C gelagert (maximal 4 Wochen). Zunächst wurden die
Zellen mit 1 µl DTT für 10 min bei RT inkubiert, dann durch Zugabe von 5 µl einer
gesättigten Zymolyase-Lösung (Spatelspitze Zymolyase in 1 ml SP-Puffer, vor
Zugabe kurz abzentrifugiert) bei RT für 10 min sphäroblastiert. Parallel erfolgte die
- 48 -
Material und Methoden
Präparation der Objektträger. Diese waren durch eine Teflonbeschichtung in mehrere
Reaktionsfelder unterteilt, so konnten mehrere Experimente parallel durchgeführt
werden. Die einzelnen Felder wurden mit jeweils 20 µl 0,3% poly-L-Lysin
(Sigma, >150 kDa) für 5 min inkubiert, anschließend mit H2O gewaschen und an der
Luft getrocknet. Durch diese Behandlung haften die Zellen über elektrostatische
Kräfte an der Oberfläche des Objektträgers. Die Sphäroblastenbildung wurde durch
Vergleich mit unbehandelten Zellen unter dem Mikroskop verfolgt. Im Verlauf dieser
Behandlung verschwand die dunkle Zellwand und die Zellen bekamen eine
unregelmäßige Form. Dann wurden die Zellen sofort abzentrifugiert (2 min,
6.000 Upm) und in 300 µl SP-Puffer resuspendiert. Jeweils 20 µl dieser
Zellsuspension wurden auf die Reaktionsfelder des Objektträgers pipettiert. Um die
Zellen zu permeabilisieren, wurden diese mit 20 µl 0,5% (v/v) Triton X-100 in SPPuffer für 5 min inkubiert. Der Puffer wurde später mit einer Pasteurpipette vorsichtig
vom Rand her entfernt. Die Zellen wurden anschließend für 1 h mit 20 µl Blockpuffer
inkubiert. Alle Inkubationsschritte erfolgten in einer feuchten Kammer, die das
Antrocknen der Zellen verhinderte. Nach Entfernung des Blockpuffers erfolgte die
Inkubation mit dem in Blockpuffer verdünntem Primärantikörper für 1 h bei RT.
Jeweils 20 µl pro Reaktionsfeld wurden auf den Objektträger pipettiert. Nach der
Inkubation wurde der Antikörper mit einer Pasteurpipette entfernt. Der Objektträger
wurde kurz in Waschpuffer 1 getaucht, dann 10 min und 30 min in Waschpuffer 1,
dann 10 min, anschließend 30 min in Waschpuffer 2 gewaschen. Alle Waschschritte
wurden bei RT durchgeführt. Der Objektträger wurde dazu für die angegebene Zeit in
ein mit Waschpuffer gefülltes Becherglas gestellt. Anschließend erfolgte die
Inkubation mit dem in Blockpuffer verdünntem Sekundärantikörper für 1 h bei RT.
Um die Fluoreszenz vor dem Ausbleichen zu schützen, fanden alle nachfolgenden
Schritte bei reduzierter Lichtintensität statt. Nach erfolgter Inkubation wurde der
Sekundärantikörper entfernt. Die Zellen wurden nach dem oben angegebenen
Schema gewaschen und anschließend bei RT oder wahlweise bei 37°C getrocknet.
Die Zellen wurden mit einem kleinen Tropfen „Vectashield“ Befestigungslösung
(Vector Laboratories Inc., Burlingame) immobilisiert und mit einem Deckgläschen
verschlossen. Die Befestigungslösung enthielt bereits DAPI (4,6-Diamidino-2phenylindol) und einen Ausbleichschutz. Das Präparat wurde mit Nagellack
versiegelt. Die Zellen konnten nach einer Inkubation von 5 min (das DAPI interkaliert
während dieser Zeit in die kleine Furche der DNA) unter dem Fluoreszenzmikroskop
betrachtet werden.
- 49 -
Material und Methoden
SP-Puffer
1,2 M
150 mM
100 mM
Sorbitol
NaCl
Hepes, pH 7,4
Blockpuffer
5%
0,3%
100 mM
150 mM
BSA
Triton x-100
Tris, pH 9,0
NaCl
Waschpuffer 1
100 mM
150 mM
Tris, pH 9,0
NaCl
Waschpuffer 2
100 mM
150 mM
Tris, pH 9,5
NaCl
4.15.2. Isolierung von intakten Mitochondrien und post-mitochondrialen
Überstand (PMS) aus S. cerevisiae
Die
Hefezellen
wurden in
Vollmedium mit Galaktose, Laktatmedium oder
Minimalmedium mit Glukose bei 30°C und 150 Upm bis zu einer OD600nm = 1,0–1,5
inkubiert und dann durch Zentrifugation sedimentiert (Daum et al., 1982; Diekert et
al., 2001). Die Zellen wurden in H2O und Tris-SO4-Puffer gewaschen, anschließend
wurde das Zellnassgewicht bestimmt. Nach dem Waschen in 1,2 M Sorbitol-Puffer
wurden die Zellen im gleichen Puffer resuspendiert (4 ml/g Zellen). Um die Zellwand
der Hefe aufzulösen (Sphäroblastenbildung), wurde die Zellsuspension mit
Zymolyase T100 (1,5 mg/g Zellen) versetzt und 30 bis 60 min bei 30°C und 150 Upm
inkubiert. Alle weiteren Schritte erfolgten auf Eis. Die Sphäroblasten wurden
sedimentiert (5 min, 3.000 Upm, 4°C) und 2x mit 1,2 M Sorbitol-Puffer gewaschen,
um die Zymolyase aus der Probe zu entfernen. Anschließend wurden die
Sphäroblasten in 2x BB-Puffer mit 1 mM PMSF (2 ml/g Zellen) aufgenommen, das
Volumen
bestimmt
und
mit
H2O
auf
das
doppelte
Volumen
verdünnt
(Endkonzentration 0,6 M Sorbitol). Mit Hilfe eines Glas-Homogenisators wurden die
Sphäroblasten aufgeschlossen, die Sedimentation der Zelltrümmer erfolgte durch
Zentrifugation (JA-20 Rotor, 5 min, 4.000 Upm, 4°C). Die im Überstand enthaltenen
Mitochondrien wurden durch Zentrifugation (12 min, 10.000 Upm, 4°C) pelletiert. Ein
Teil des Überstandes wurde als post-mitochondrialer Überstand (PMS) aliquotiert
und in flüssigem Stickstoff schockgefroren. Die Mitochondrien wurden 1x oder 2x in
1x BB gewaschen, um restliches PMSF und Verunreinigungen durch PMS zu
entfernen. Nach vorsichtiger Resuspension der Mitochondrien in 1x BB wurden diese
aliquotiert und in flüssigem Stickstoff schockgefroren. Die Lagerung von PMS und
Mitochondrien erfolgte bei –80°C.
- 50 -
Material und Methoden
Tris-SO4-Puffer
100 mM
10 mM
Tris-SO4, pH 9,4
Dithiothreitol (DTT)
1,2 M Sorbitol-Puffer
1,2 M
20 mM
Sorbitol
Kaliumphosphat, pH 7,4
2x BB
1,2 M
40 mM
1 mM
Sorbitol
Hepes-KOH, pH 7,4
PMSF
1x BB
0,6 M
20 mM
Sorbitol
Hepes-KOH, pH 7,4
4.15.3. Enzymaktivitäten mitochondrialer Proteine
4.15.3.1. Aconitase
Die Aconitase katalysiert die reversible Isomerisierung von Citrat zu Isocitrat über
das Zwischenprodukt cis-Aconitat (Fansler & Lowenstein, 1969). Der photometrische
Nachweis der Enzymaktivität beruht auf der Absorption der Doppelbindung von cisAconitat bei λ = 235 nm. ε235nm = 4.950 M-1 cm-1
Puffer
100 mM
0,5%
Lösungen
10 mM
Kaliumphosphat, pH 7,4
Triton X-100
cis-Aconitat
1 mg/ml
Mitochondrien
Probenküvette
435 µl
10 µl
5 µl
Puffer
Mitochondrien
cis-Aconitat
Referenzküvette
440 µl
10 µl
Puffer
Mitochondrien
4.15.3.2. Malat-Dehydrogenase
Die Malat-Dehydrogenase katalysiert die Umwandlung von Oxalacetat zu Malat unter
Verbrauch von NADH (Englard & Siegel, 1969). Die Oxidation von NADH kann bei
einer Wellenlänge von λ = 340 nm gemessen werden. ε340nm = 6.220 x 103 M-1 cm-1
Puffer
Lösungen
50 mM
100 mM
0,5%
10 mg/ml
5 mg/ml
- 51 -
Tris-SO4, pH 7,4
NaCl
Triton X-100
NADH
Oxalacetat in Tris-SO4, pH 7,4
Material und Methoden
Probenküvette
970-x µl
x µl
20 µl
10 µl
Puffer
Mitochondrien (10 µg)
NADH
Oxalacetat
Referenzküvette
980-x µl
x µl
20 µl
Puffer
Mitochondrien (10 µg)
NADH
4.15.3.3. Succinat-Dehydrogenase (SDH)
Der verwendete Aktivitätstest misst die Übertragung der Elektronen von Succinat auf
den farbigen Elektronenakzeptor DCPIP (2,6-Dichlorphenolindophenol) bei 600 nm.
Die Referenzküvette enthält den SDH-Inhibitor Malonat (Robinson & Lemire, 1995).
ε600nm = 21.000 M-1 cm-1
Puffer
Lösungen
100 mM
0,5%
1 mM
Tris-SO4, pH 7,4
Triton X-100
KCN (frisch)
20%
Succinat
20%
Malonat
1,4 mM
DCPIP
12 mg/ml
PM (Phenazin-Methosulfat)
10 mg/ml
Mitochondrien
Probenküvette
880 µl
12 µl
50 µl
42 µl
15 µl
Puffer
Succinat
DCPIP
PM
Mitochondrien
Referenzküvette
870 µl
12 µl
50 µl
42 µl
15 µl
12 µl
Puffer
Succinat
DCPIP
PM
Mitochondrien
Malonat
4.15.3.4. Cytochrom c Oxidase
In diesem Test wurde die Oxidation von reduziertem Cytochrom c durch Komplex IV
gemessen. Zur Präparation von reduziertem Cytochrom c wurden 2,5 ml einer
20 mg/ml Cytochrom c Lösung (in Puffer) durch die Zugabe von 10 mM Dithionit
reduziert (auf Eis). Der Ansatz wurde 2-5 min inkubiert und im Anschluss über eine
mit Puffer equilibrierte PD10 Säule gereinigt. ε550nm = 20.000 M-1 cm -1
- 52 -
Material und Methoden
Puffer
Lösungen
50 mM
50 mM
1M
Mes, pH 6,5
NaCl
Dithionit (frisch)
Probenküvette
900-x µl
100 µl
5 µg
Puffer
reduziertes Cytochrom c
Mitochondrien
Referenzküvette
890-x µl
100 µl
5 µg
10 µl
Puffer
reduziertes Cytochrom c
Mitochondrien
KCN (frisch)
4.15.3.5. Citrat-Synthase
Citrat-Synthase katalysiert die Kondensation von Oxalacetat und Acetyl-CoA zu
Citrat. Der Enzymtest weist die freie Sulfhydrylgruppe des dabei entstehenden
Coenzyms A anhand der Reaktion mit dem Thiolreagenz 5,5΄-Dithiobis-(2nitrobenzoesäure: DTNB) nach (Srere, 1963). ε412nm = 13.600 M-1 cm-1
Puffer
Lösungen
50 mM
100 mM
0,5 mM
Tris/HCl, pH 8,0
NaCl
DTNB
10 mg/ml
Acetyl-CoA
5 mg/ml
Oxalacetat
1 mg/ml
Mitochondrien
Probenküvette
965 µl
10 µl
5 µl
20 µl
Puffer
Acetyl-CoA
Mitochondrien
Oxalacetat
Referenzküvette
985 µl
10 µl
5 µl
Puffer
Acetyl-CoA
Mitochondrien
4.15.3.6. Zn-Protoporphyrin IX Bildung (Ferrochelatase Aktivität)
Die Ferrochelatase katalysiert den letzten Schritt der Häm-Biosynthese, die
Einlagerung von reduziertem Eisen in Protoporphyrin IX. Der Test nutzt die
fluoreszierenden Eigenschaften von Zn-Porphyrin aus (Anregung 418 nm, Emission
588 nm). Zur Messung der Aktivität wurden isolierte Mitochondrien (4.15.2)
verwendet.
- 53 -
Material und Methoden
Puffer
0,1 M
Lösungen
0,1 mM
1%
3%
Probenküvette
2,95-x ml
30 µl
20 µl
x µl
Tris, pH 7,5
(PPIX) Protoporphyrin IX (in Tris-Puffer)
Tween 80
Tween 80
Puffer
PPIX
Tween 80
Protein (50 µg Mito)
4.15.4. Enzymaktivitäten cytosolischer Proteine
4.15.4.1. Isopropylmalat-Isomerase (Leu1p)
Isopropylmalat-Isomerase ist ein cytosolisches Enzym und wurde im Zellextrakt
gemessen (Kohlhaw, 1988). Da das Protein sehr empfindlich ist, wurden die Zellen
schnell in eiskaltem TNTEG-Puffer mechanisch aufgeschlossen. Der Zellextrakt
wurde sofort verwendet. Das Enzym katalysiert die reversible Umsetzung von α- zu
β-Isopropylmalat über das Zwischenprodukt Dimethylcitraconat. Die photometrische
Aktivitätsbestimmung
beruht
auf
der
Absorption
der
Doppelbindung
von
Dimethylcitraconat bei 235 nm. ε235nm = 4.530 M-1 cm-1
Puffer
Lösungen
100 mM
10 mg/ml
5 mg/ml
K2HPO4/KH2PO4, pH 7,0
β-Isopropylmalat
Protein
Probenküvette
440 µl
10 µl
50 µl
Puffer
Zellextrakt
β-Isopropylmalat
Referenzküvette
490 µl
10 µl
Puffer
Zellextrakt
4.15.4.2. Alkohol-Dehydrogenase
Zur Messung der Alkohol-Dehydrogenase wurde PMS (4.15.2) verwendet.
ε340nm = 6.220 M-1 cm-1
Puffer
Lösungen
50 mM
50 mM
Tris/HCl, pH 8,0
NaCl
100%
Ethanol
0,1 M
NAD
- 54 -
Material und Methoden
Probenküvette
930 µl
30 µl
30 µl
10 µl
Puffer
Ethanol
NAD
PMS
Referenzküvette
940 µl
30 µl
30 µl
Puffer
Ethanol
NAD
4.15.4.3. Katalase
In S. cerevisiae ist die Katalase sowohl ein cytosolisches als auch peroxisomal
lokalisiertes Protein. Das Häm-haltige Enzym katalysiert die Umsetzung von
Wasserstoffperoxid in Wasser und molekularen Sauerstoff. Die Katalase wurde aus
dem PMS (4.15.2) bestimmt. ε240nm = 9.500 M-1 cm-1
Puffer
Lösungen
Probenküvette
Referenzküvette
50 mM
50 mM
3%
975-x µl
25 µl
x µl
975 µl
25 µl
MES, pH 6,5
NaCl
H2O2
Puffer
H2O2
Protein (50 µg)
Puffer
H2O2
4.15.5. Bestimmung des Eisengehalts in Mitochondrien
Die Menge an freiem Eisen (nicht Häm-gebunden, nicht in Fe/S Clustern koordiniert)
in den Mitochondrien wurde photometrisch mit Bathophenantrolin-Disulfonsäure (als
Natrium-Salz) bestimmt (Li et al., 1999). Dieser Chelator bildet mit Eisen einen roten
Komplex. ε540nm = 23.500 M-1 cm-1
Puffer
Lösungen
1M
10 mM
1M
10%
- 55 -
Tris-HCl, pH 7,4
Bathophenantrolin-Disulfonsäure
Natrium-Dithionit
SDS
Material und Methoden
Probenküvette
Referenzküvette
720-x µl
100 µl
60 µl
20 µl
100 µl
x µl
H2O
Puffer
SDS
Natrium-Dithionit
Bathophenantrolin-Disulfonsäure
Mitochondrien (0,2 mg)
720 µl
100 µl
60 µl
20 µl
100 µl
H2O
Puffer
SDS
Natrium-Dithionit
Bathophenantrolin-Disulfonsäure
4.15.6. Bestimmung der Eisenaufnahme und der de novo Fe/S ClusterBiosynthese mittels 55Fe-Eisenchlorid Markierung
Die Zellen wurden in 300 ml SC-Medium kultiviert, durch Zentrifugation (5 min,
3.000 Upm) geerntet und in H2O gewaschen. 0,5 g Zellen (Zellnassgewicht) wurden
in 10 ml eisenarmen Minimalmedium aufgenommen und für 2–4 h bei 30°C und
150 Upm mit
55
FeCl3 (10 µCi) in 1 mM Ascorbat (in H2O) inkubiert. Die radioaktiv
markierten Zellen wurden in ein 15 ml Falcon-Reaktionsgefäß überführt, sedimentiert
(Zentrifugation für 5 min, 3.000 Upm) und je 1x mit 10 ml Citrat-Puffer (50 mM Citrat,
1 mM EDTA, pH 7,0) und 500 µl Hepes-KOH (20 mM, pH 7,0) gewaschen. Alle
weiteren Schritte erfolgten auf Eis. Die Zellen wurden in 0,5 ml TNETG-Puffer mit
2 mM PMSF resuspendiert und mit 1/3 Volumen Glasperlen (Ø 0,45 mm) versetzt.
Der Zellaufschluss erfolgte durch Vortexen der Suspension (3x 1 min), die
Zelltrümmer wurden durch Zentrifugation sedimentiert (5 min, 3.000 Upm, 4°C). Der
Überstand wurde in ein 1,5 ml Eppendorf-Reaktionsgefäß überführt und durch einen
weiteren Zentrifugationsschritt (10 min, 15.000 Upm, 4°C) von Schwebstoffen befreit.
Durch Szintillationszählung von 5 µl dieses Zelllysats in 1 ml Szintillationscocktail
wurde die Eisenaufnahme der Zellen quantifiziert.
Dieses
55
Fe-markierte Zelllysat diente gleichzeitig zur Untersuchung der de novo
Biosynthese von Fe/S Clustern. Dazu wurden 250 µl des Zelllysats 1 h bei 4°C mit
10 – 40 µl einer 50%igen Suspension von Protein-A-Sepharose mit gekoppelten
Antiseren inkubiert (4.16.8). Je nach Fragestellung wurden gekoppelte Antiseren
gegen Leu1p und Bio2p verwendet. Um den Eiseneinbau in Markerproteine mit
fusioniertem HA- oder TAP-tag nachzuweisen wurden die Zelllysate mit 10 µl antiHA-Agarose (HA-tag) bzw. 20 µl IgG-Sepharose (TAP-tag) wie oben beschrieben
inkubiert. Als Kontrolle diente Prä-Immunserum. Die Protein-A-Sepharose, IgGSepharose oder anti-HA-Agarose wurden durch Zentrifugation (5 min, 3.000 Upm,
4°C) sedimentiert, 3x mit TNETG-Puffer gewaschen, in 50 µl H2O resuspendiert und
- 56 -
Material und Methoden
mit 1 ml Szintillationscocktail versetzt. Co-präzipitiertes radioaktives
55
Fe wurde
durch Szintillationszählung quantifiziert und als direktes Maß für dessen Einbau in
die Fe/S Cluster der Markerproteine und damit der de novo Synthese der Cluster
verwendet.
4.15.7. Messung des Häm-Gehalts mittels 55Fe-Eisenchlorid Markierung
Mit dieser Methode wurde der Häm-Gehalt in vivo erfasst. Dazu wurden die Zellen
über Nacht in eisenarmen Minimalmedium mit
55
FeCl3 (10 µCi) in 1 mM Ascorbat
kultiviert. Die über Nacht Kultur wurde geerntet und mit 10 ml Citrat-Puffer (50 mM
Citrat, 1 mM EDTA, pH 7,0) gewaschen und erneut sedimentiert. Die Zellen wurden
der Bestimmung des Zellnassgewichts in 500 µl Hepes-KOH (20 mM, pH 7,0)
aufgenommen.
500 µl
Zellsuspension
wurden
in
ein
1,5 ml
Eppendorf-
Reaktionsgefäß überführt und durch Zugabe von 25 µl Stopplösung (100 mM FeCl3,
5 N HCl) wurde der Einbau von
55
Fe in Häm gestoppt. Nach Zugabe von 500 µl
Butylacetat und 1/2 Volumen Glasperlen (Ø 0,45 mm) wurden die Zellen durch
Vortexen
bei
höchster
Stufe
(3x
aufgeschlossen. In vivo synthetisiertes
1 min,
zwischendurch
1
min
auf
Eis)
55
Fe-Häm wurde in die organische Phase
extrahiert. Die Phasen wurden durch Zentrifugation getrennt (12 min, 7.500 Upm,
4°C) und 250 µl der oberen organischen Phase wurden mit 1 ml Szintillationscocktail
vermischt. Es erfolgte die Quantifizierung von 55Fe-Häm durch Szintillationszählung.
4.16. Proteinbiochemische Methoden
4.16.1. Überexpression und Reinigung von Nbp35p-His
Das Plasmid pET15b-NBP35-His wurde in E. coli BL21 (DE3) Zellen transformiert
(4.11.9). 50 ml LB Medium mit Ampicillin (100 µg/ml) wurden mit einer Einzelkolonie
angeimpft und über Nacht bei 37°C und 250 Upm schüttelnd inkubiert. Die über
Nacht Kultur wurde in 1 l frisches Medium überimpft (Endkonzentration 1,5%) und bis
zu einer OD600 = 0,5-0,7 weiter kultiviert. Anschließend wurde die Temperatur auf
30°C
gesenkt
und
die
Zellen
wurden
durch
Zugabe
von
1 mM
IPTG
(Endkonzentration) induziert. 3 h nach der Induktion wurden die Zellen geerntet
(5.000 Upm, 10 min, 4°C) und der Überstand verworfen. Das Sediment wurde 1x in
50 ml Lysierungspuffer gewaschen. Der Zellaufschluss erfolgte im Hochdruck
Homogenisator bei 4°C, bei einem Druck von 1,0x 108 Nm-2. Nicht aufgeschlossene
Zellen und Membranbestandteile wurden durch Zentrifugation (100.000 xg, 45 min,
- 57 -
Material und Methoden
4°C) sedimentiert. Die Ni-NTA Agarose wurde zweimal mit Lysierungspuffer
gewaschen. Der lösliche Überstand (Rohextrakt) wurde auf die vorbereitete Ni-NTA
Agarose pipettiert und 1 h bei 4°C rotierend inkubiert. Im Anschluss wurde die NiNTA Agarose mit 5 Bettvolumen Waschpuffer gewaschen, um unspezifisch
gebundene Proteine zu entfernen. Da das Fusionsprotein nur mäßig an die NiAgarose gebunden hatte wurde das Imidazol durch Histidin ersetzt. Das Protein
wurde mit 5 ml Elutionspuffer eluiert. Das gereinigte Protein wurde direkt im
Anschluss mittels einer PD-10 Säule entsalzt, in flüssigem Stickstoff schockgefroren
und bei -80°C gelagert. Es wurden Proben vor und nach der Induktion (jeweils 1 ml
Kultur sedimentiert), jeweils 5 µl der einzelnen Reinigungsschritte und die
Sedimentfraktion in 1x Lämmli aufgenommen, bei 95°C für 5 min inkubiert und dann
zur Analyse auf einem SDS-Gel aufgetragen (durchgeführt von D. Aguilar-Netz).
Lysierungspuffer
50 mM
300 mM
1 mM
10% (v/v)
NaH2PO4 pH 8,0
NaCl
Histidin
Glycerin
Waschpuffer
25 mM
300 mM
5 mM
10%(v/v)
Tris/HCl pH 8,0
NaCl
Histidin
Glycerin
Elutionspuffer
25 mM
300 mM
150 mM
10%(v/v)
Tris/HCl pH 8,0
NaCl
Histidin
Glycerin
PD-10 Puffer
25 mM
150 mM
10% (v/v)
Tris pH 8,0
NaCl
Glycerin
4.16.2. Bestimmung der Proteinkonzentration
Die Proteinmengenbestimmung wurde nach der Methode von Bradford durchgeführt
(Bradford, 1976). Dazu wurde die zu bestimmende Probe in Tris-Puffer gelöst und
mit Bio-Rad Protein-Assay (Bio-Rad, München) im Verhältnis 1:4 versetzt. Die
Extinktion der Probe wurde bei 595 nm in einem Spektralphotometer gemessen. Als
Leerwert diente ein Ansatz der nur Tris-Puffer enthielt. Die Eichung erfolgte mit
BSA V in einem linearen Bereich von 0,2 bis 12 µg Protein. Die Proteinproben
wurden bis in den entsprechenden Bereich verdünnt.
- 58 -
Material und Methoden
4.16.3. TCA-Fällung von Proteinen
Proteine wurden mit Trichloressigsäure (TCA) gefällt. Dazu wurde die Proteinlösung
mit TCA (25% bzw. 72% (w/v) Stammlösung) gemischt (Endkonzentration 12,5%)
und 5 min auf Eis inkubiert. Das Präzipitat wurde durch Zentrifugation (20 min,
20.000 Upm, 4°C) sedimentiert, zweimal mit kaltem Aceton gewaschen, bei RT
getrocknet und in 20 µl 1x Lämmli-Puffer aufgenommen.
2x Lämmli-Puffer
1x Lämmli-Puffer mit ß-ME
120 mM
4% (w/v)
0,01% (w/v)
20% (w/v)
100µl
90µl
5% (v/v)
Tris-HCl, pH 6,8
SDS
Bromphenolblau
Glycerin
2x Lämmli
H2O
ß-Mercaptoethanol
4.16.4. SDS Polyacrylamid-Gelelektrophorese (SDS-PAGE)
Die analytische Auftrennung der Proteine gemäß ihrer Masse erfolgte nach einer
Methode von Lämmli (Laemmli, 1970) in einer vertikalen Gelapparatur. Die
Acrylamid-Lösung wurde in Form einer 30% igen (w/v) Acrylamid-Stammlösung mit
0,8% Bisacrylamid im Verhältnis 37,5:1 verwendet. Das Trenngel setzte sich aus 1012%tiger (w/v) Acrylamid-Lösung, 375 M Tris-HCl (pH 8,8) und 0,1% SDS
zusammen. Die Polymerisation erfolgte durch Zugabe von 0,001% (v/v) TEMED und
0,05% (w/v) Ammoniumperoxodisulfat (APS). Das Trenngel wurde bis zur
gewünschten Höhe in die Apparatur gefüllt und mit Isopropanol überschichtet. Das
Sammelgel setzte sich aus 5% (w/v) Acrylamid, 125 mM Tris-HCl (pH 6,8), 0,1%
(w/v) SDS, 0,003% (v/v) TEMED und 0,007% APS zusammen. Die Proben wurden in
Lämmli Probenpuffer aufgenommen, 5 min erhitzt (95°C) und anschließend auf das
Gel aufgetragen. Die Auftrennung der Proteine erfolgte in Elektrodenpuffer (25 mM
Tris, 192 mM Glycin, 0,1% (w/v) SDS, pH 8,8) bei einer konstanten Stromstärke von
30 mA für 2,5–3 h. Die aufgetrennten Proteine wurden anschließend mit Coomassie
Brilliant-Blue gefärbt oder auf Nitrozellulosemembranen transferiert. Es wurde jeweils
ein Proteingrößenstandard aufgetragen.
4.16.5. Färben von Proteinen mit Coomassie Brilliant-Blue
Diese Methode der Coomassie-Färbung von SDS-Polyacrylamid Gelen erlaubt die
Anfärbung der Proteine im Gel entsprechend ihrer Konzentration. Dazu wurden die in
der SDS-PAGE aufgetrennten Proteine mit 0,25% (w/v) Coomassie Brilliant-Blue R-
- 59 -
Material und Methoden
250 in 45% (v/v) Ethanol und 10% (v/v) Essigsäure über Nacht gefärbt. Die
Entfärbung erfolgte in 30% (v/v) Ethanol und 10% (v/v) Essigsäure. Durch
mehrfaches Austauschen dieser Lösung wurde das Gel transparent und die Proteine
traten als blaue Banden hervor.
4.16.6. Transfer von Proteinen auf Nitrozellulose (Western Blot)
Die durch SDS-PAGE aufgetrennten Proteine wurden elektrophoretisch mit dem
sogenannten „Semidry” Verfahren auf eine Nitrozellulosemembran transferiert
(Kyshe-Andersen, 1984). Für den Transfer in einer Blot Apparatur (PeqLab) wurden
die benötigten Filterpapiere (Whatman-3-MM Filterpapier) auf die entsprechende
Gelgröße zurechtgeschnitten. Es wurden zwei Filterpapiere in Transferpuffer getränkt
und
auf
die
Anodenplatte
gelegt.
Die
in
Transferpuffer
befeuchtete
Nitrozellulosemembran und das Gel wurden auf die Filterpapiere gelegt. Zum
Abschluß wurden zwei in Transferpuffer getränkte Filterpapiere auf das Gel gelegt
und letzte Luftblasen mit einem Glasstab entfernt. Die Apparatur wurde dann mit der
Kathodenplatte verschlossen. Der Transfer erfolgte bei einer konstanten Stromstärke
von 1 mA/cm2 für 60 min. Die auf die Nitrozellulosemembran übertragenen Proteine
wurden mit Ponceau S angefärbt und anschließend solange mit H2O entfärbt bis
deutliche Proteinbanden hervortraten. Die reversible Proteinanfärbung diente zur
Kontrolle der Vollständigkeit des Proteintransfers auf die Nitrozellulosemembran und
zur Abschätzung der Proteinmenge. Der Proteingrößenstandard wurde markiert,
spezifische Proteine konnten im Anschluss immundetektiert werden.
Transferpuffer
25 mM
200 mM
0,02% (w/v)
20% (w/v)
Ponceau S
0,2% (w/v)
3% (w/v)
Tris-Base
Glycin
SDS
Methanol
Ponceau S
TCA
4.16.7. Immundetektion
Der
Nachweis
definierter
Nitrozellulosemembranen,
Proteine
erfolgte
durch
eines
Proteingemisches,
Immundekoration
mit
auf
spezifischen
Antiseren und anschließender Detektion durch Chemilumineszenz mit Peroxidasegekoppelten Sekundärantikörpern (Enhanced Chemiluminescence System = ECL,
GE
Healthcare).
Zunächst
wurden
die
freien
Bindungsstellen
der
Nitrozellulosemembran durch 30 min Inkubation in Blocklösung (5% (w/v) Milchpulver
- 60 -
Material und Methoden
in TBST-Puffer) abgesättigt. Das jeweilige Antiserum wurde in Blocklösung verdünnt
(1:500 – 1:1.000) und die Membran wurde 1 h bei RT schüttelnd inkubiert. Nach
dreimaligem Waschen (je 10 min in TBS-Puffer mit 0,1% Tween 20) erfolgte die
Inkubation mit den Sekundärantikörpern (1 h bei RT). Als Sekundärantikörper wurde
entweder ein Peroxidase-gekoppelter anti-Kaninchen oder ein anti-Maus Antikörper
(1:1.000 in Blocklösung) eingesetzt. Im Anschluss wurde die Membran wie oben
beschrieben 3x gewaschen. Nun konnten die an die Proteine gebundenen Antikörper
mit dem ECL-Detektionssystem sichtbar gemacht werden. Sollten Proteine mit HA-
tag oder Strep-tag nachgewiesen werden, wurde die Membran in 1% BSA in TBSTPuffer geblockt. Zum Strep-tag Nachweis wurden die Membranen zusätzlich 20 min
mit Avidin (5 µg/ml) in TBST-Puffer inkubiert und anschließend mit StreptavidinPeroxidase Konjugat (1:2.000 in TBST) behandelt. Proteine mit fusioniertem TAP-tag
wurden mit einem Peroxidase-anti-Peroxidase Antikörper aus Kaninchen (Verd.
1:500, in Blocklösung) nachgewiesen.
TBST-Puffer
50 mM
0,9% (w/v)
0,1% (w/v)
Tris-HCl, pH 7,5
NaCl
Tween 20
4.16.8. Kopplung des Antiserums an Protein-A-Sepharose
Um Proteine mit Antikörpern zu fällen, wurden die entsprechenden Antiseren an
Protein-A-Sepharose gekoppelt. Protein-A bindet spezifisch an die schweren Ketten
des Antikörpers. Es wurden 50 mg Protein-A-Sepharose in 500 µl TNETG-Puffer
aufgenommen und 30 min auf Eis inkubiert. Die Sepharose-Kügelchen wurden
sedimentiert (10 s, 13.000 Upm) und mit 500 µl Antiserum versetzt. Die Kopplung
erfolgte bei 4°C für 1 h unter Rotation. Anschließend wurden die an Protein-ASepharose gekoppelten Antiseren 5x mit 500 µl TNETG-Puffer gewaschen, in 500 µl
bzw. in 250 µl (α-Leu1p Antikörper) TNETG-Puffer aufgenommen und bei 4°C
gelagert.
4.17. Promotorstudien
4.17.1. GFP-Reporter Assay
Zellen, die das Plasmid HK252-Fet3-GFP bzw. HK252-Cyc1-GFP enthielten, wurden
in
Minimalmedium
mit
Glukose
und
mit
200 µM
(Endkonzentration)
Eisenammoniumcitrat inkubiert. Über Nacht Kulturen wurden in frischem Medium auf
- 61 -
Material und Methoden
eine OD600 = 0,2 verdünnt und weiter kultiviert. Die Ernte der Zellen erfolgte durch
Zentrifugation (5 min, 3.000 Upm) bei OD600 = 0,5. Die Zellen wurden in 3 ml H2O
resuspendiert, so dass diese einer Zelldichte von OD600 = 1 entsprachen. Nach
Anregung bei 480 nm wurde die GFP-spezifische Fluoreszenzemission bei 513 nm in
einem Fluoreszenz Spektrophotometer bestimmt.
4.17.2. Luciferase-Reporter Assay
Zellen, die das Reporterkonstrukt p416Prom-hRluc enthielten, wurden über Nacht in
Minimalmedium
mit
Glukose,
ohne
Uracil
und
mit
bzw.
ohne
50 µM
Bathophenantrolin kultiviert. Die über Nacht Kulturen wurden in frischem Medium auf
eine OD600 = 0,2 verdünnt und weiter kultiviert. Die Zellen wurden bei OD600 = 0,5-0,8
durch Zentrifugation geerntet (5 min, 3.000 Upm) und auf eine OD600 = 0,1 in 1 ml
H2O verdünnt. Das Renilla reniformis Luciferase Substrat
ViviRen (Promega,
Mannheim) wurde bereits eine Woche vor dem eigentlichen Experiment in 95 µl
DMSO (60 mM Substrat) angesetzt. Dadurch ließ sich zum einen der Hintergrund
reduzieren und zum anderen konnte die Luciferase Aktivität verstärkt werden. Zur
Bestimmung des Hintergrunds wurden 2 µl Substrat in H2O verdünnt und sorgfältig
gemischt. Das Endvolumen der Reaktion betrug 100 µl. Der Ansatz wurde für 1 min
im Szintillationszähler quantifiziert (Hintergrund). Dann wurde die zu bestimmende
Probe hinzugegeben und der Ansatz wurde erneut sorgfältig gemischt. Die Probe
wurde, über einen Zeitraum von insgesamt 2 min quantifiziert. Messdaten wurden
nach 1 und 2 Minuten aufgenommen und anschließend gemittelt. Es empfahl sich,
mit einem Probenvolumen von 5 µl zu beginnen. Dadurch sollte verhindert werden,
dass das Detektionslimit des Gerätes überschritten wurde.
Reaktionsansatz
100-x µl H2O
2 µl Substrat
x µl Probe
4.18. Laborgeräte
Gerät
Modell, Hersteller
Agarose-Gelkammern
Owl Separation Systems
Anaerobenkammer
COY, Laboratory Products Inc.
Autoklav
Systek V-150
Blot Kammer
PeqLab Biotechnologie GmbH
Elektroporator
Gene Pulser, Bio Rad Laboratories GmbH
- 62 -
Material und Methoden
Gerät
Modell, Hersteller
Fluoreszenzmikroskop
Olympus BX61
Fluoreszenz Spektrophotometer
FP-6300, Jasco, Groß-Umstadt
Hochdruck Homogenisator
EmulsiFlex-C3, Avestin
Inkubatoren
Function line, Heraeus instruments
Steri Cult, Forma Scientific
Netzgerät
EPS600, Pharmacia Biotech
Peristaltik Pumpe
P-1, Pharmacia Fine Chemicals
pH-Meter
CG 840, Schott
Spektralphotometer
V-550, Jasco, Groß-Umstadt
Pipettierhilfen
Pipetman, Gilson
Schüttelinkubatoren
Multitron, HT INFORS
Sterilbank
NU-437-600E, Nuaire
Sterilisator
Modell 700, Memmert
Thermocycler
UNO Thermoblock, Biometra
Thermomixer
Thermomixer 5436, Eppendorf
UV-Transilluminator/Kamera
CN6 1.4 Raytest, Isotopenmessgeräte GmbH
Ultrazentrifuge
Combi Plus, OPTIMA TL, Sorvall,Beckman
Ultrazentrifugen-Rotor
SW-41 Ti, TLA 45, Beckman
Waagen
SBC 22, PT 1500, SCALTEC, SARTORIUS
Zentrifugen
Biofuge pico, Heraeus instruments
3K30, Sigma
Megafuge 1.0R, Heraeus instruments
J2-HS, Beckman
TM
Avanti J-20 XP, Beckman
Zentrifugen-Rotoren
JA-10, JA-20, JLA 8.1000, JLA 16.250, Beckman
4.19. Chemikalien
Die verwendeten Chemikalien waren, sofern nicht anders angegeben, vom
Reinheitsgrad p. a. oder für biochemische Zwecke.
Chemikalien
Hersteller
1 kb Marker
MBI Fermentas
55
NEN
Acrylamid-Stammlösung (Rotiphorese Gel 30)
Roth
Aminosäuren
Merck, Sigma
Bacto Pepton, Bacto Trypton
DIFCO
Blocking Reagent
Roche Diagnostics GmbH
Fe-Eisenchlorid, 10 mCi/ml, 30 mCi/mg
- 63 -
Material und Methoden
Chemikalien
Hersteller
Desoxyribonukleosidtriphosphate (dNTPs)
MBI Fermentas
Dithiothreitol (DTT)
GERBU
HA-Antikörper, HA-Sepharose
Santa Cruz
Hefe Stickstoff Base
Formedium
Hefe Stickstoff Base ohne Eisen
Formedium
Hefe-Extrakt
ICN
HEPES
GERBU
ICN Pharmacia X-Gal
GERBU
IgG-Sepharose 6 Fast Flow
GE Healthcare
IPTG
Roth
Lachssperma-DNA-Lösung
Gibco
Lambda-DANN
MBI Fermentas
Luciferase
Promega
NADH
GERBU
Ni-NTA Agarose
Quiagen
NucleoSpin Plasmid-Kit
Macherey-Nagel
NucleoSpin Extract II Kit
Macherey-Nagel
Peroxidase anti-Peroxidase Antikörper
Sigma
Peroxidase-gekoppelte Antikörper
Bio-Rad Laboratories GmbH
Phenol
ICN
Phenylmethylsulfonylfluorid (PMSF)
Roth
Polymerase (Combi-Pol)
Invitek
TM
Protein A-Sepharose
CL-4B
GE Healthcare
Proteingrößenstandard: DALTON MARK VII-L
Sigma
Proteinkonzentrationsbestimmungsreagenz
Bio-Rad Laboratories GmbH
Restriktionsenzyme und dazugehörige Puffer
Gibco, Boehringer Mannheim, MBI Fermentas
RNase A
Calbiochem
T4 DNA-Ligase
Promega
Zymolyase 100T
WAK-Chemie
Weitere, nicht aufgeführte Chemikalien wurden von den Firmen Sigma (München),
Merck (Darmstadt), Serva (Heidelberg) und Roth (Karlsruhe) bezogen.
- 64 -
Ergebnisse
5. Ergebnisse
5.1. Nbp35p bindet einen Fe/S Cluster in vivo
5.1.1. Nbp35-TAP bindet Eisen in vivo
In einer früheren Arbeit konnte gezeigt werden, dass das Cfd1p Protein aus
S. cerevisiae eine Funktion in der Biogenese cytosolischer Fe/S Proteine einnimmt
(Roy et al., 2003). Da Nbp35p eine hohe Homologie zum mittleren und C-terminalen
Bereich von Cfd1p aufweist, ist die Ausübung ähnlicher zellulärer Funktionen
denkbar (Abb. 4). Durch den Vergleich verschiedener eukaryotischer Cfd1p und
Nbp35p Sequenzen konnte C-terminal ein Bereich identifiziert werden, der vier
konservierte Cysteinreste enthält (Abb. 4). Die Sequenzen von Cfd1p und Nbp35p
weisen zusätzlich ein Walker A und B Motiv auf, welche der Bindung eines
Nukleotids bzw. eines Magnesiumions dienen (Leipe et al., 2002). Nbp35p
Sequenzen besitzen am N-Terminus eine Ferredoxin-ähnliche Domäne, mit vier
weiteren konservierten Cysteinresten, die möglicherweise ein Metall oder einen Fe/S
Cluster binden (Abb. 4).
1
NKEICES↓
↓LP
NQEICSSQTV
NQAICATAPNQQICAT-AP
NQRLCASGAG
NQKLCASGAG
NQRLCASGAG
NQGLCSDPNK
..........
MEEQEIGVP AASLAGIKHI ILILSGKGGV
MSSELLQEV PKSIEHVKHI ILILSGKGGV
MSLAKVKHI VLVLSGKGGV
MDKIKHK ILVLSGKGGV
MEAAA----E PGNLAGVRHI ILVLSGKGGV
MEAAAGERAE PGNLAGVRHI ILVLSGKGGV
MEAAA----E PGNLAGVRHI ILVLSGKGGV
MLDKVKNV IVVLSGKGGV
KGPDPDIPLI TDNLSGIEHK ILVLSGKGGV
KGPDPDLPII TERLSAIDHK ILVLSGKGGV
KGPDPDIPLI TARLSGVKHK ILILSGKGGV
KGPDPDIIEI EERMKTVKNK ILVLSGKGGV
AAPDPAVEEI REKMKTVRHK LLVLSGKGGV
AAPDPAVEEI REKMKTVRHR ILVLSGKGGV
ATPDTAIEEI KEKMKTVKHK ILVLSGKGGV
KLEDPGKALV VESMKDVKHK LLILSGKGGV
.......... ...$..!kh. il!LSGKGGV
GKSSVTTQTA
GKSSVTTQVA
GKSSVTTQLA
GKSTVSSQLA
GKSTISTELA
GKSTISTELA
GKSTISTELA
GKSTVSTQLS
GKSTFAAMLS
GKSTFTSMLA
GKSTFTSLLA
GKSTFSSQLS
GKSTFSAHLA
GKSTFSAHLA
GKSTFSAHLA
GKSTVTSLLT
GKStvstqla
LTLC--SMGF
LTLV--NKGF
LSLS--LAGH
LYLS--HIGY
LALR--HQGK
LALR--HQGK
LALR--HAGK
LALR--KNGF
WALS-ADEDL
WAIA-ADEEI
HAFA-TNAEQ
FALS-MDEKV
HGLA-EDGDT
HGLA-EDGDT
HGLA-EDENT
RYLARSNPDS
l.L. ...g.
KVGVLDIDLT
NVGVLDIDLT
SVGVLDVDLT
KVGLLDVDLC
KVGILDVDLC
KVGILDVDLC
KVGILDVDLC
KVGLLDIDLC
QVGAMDLDIC
EVGAMDLDIC
TVGVMDTDIC
EVGLLDIDIC
QVALLDIDIC
QVALLDIDIC
QIALLDIDIC
NFGVLDIDIC
.!G.LD!Dlc
130
GPSLPRMFGL
GPSLPRMFGV
GPSIPRMFGI
GPSIPKMMGL
GPSIPHMLHA
GPSIPHMLRA
GPSIPRMLGA
GPSVPYLLGL
GPSLPHMLGC
GPSLPRMLGA
GPSIPKMLGV
GPSIPKIMGL
GPSIPKIMGL
GPSIPKIMGL
GPSIPKIMGL
GPSQPRLMGA
GPSiP.m.g.
LLGDRGNSVI
LLGDRGNSVV
LLPKRGDAVV
LLGDKDTPVI
LLENPDEAVV
LLENPDEAVV
LLEKPDEAVV
LLKNREDPVI
MLPEDDSAII
MLPDPDSAII
MLPNRDDAII
LLEKEEDAVI
LLSSPDDAVI
LLSSPDDAVI
LLSSPDDAVI
LLGSVDDAII
LL...d.a!!
WRGPKKTSMI
WRGPKKTAMI
WRGPKKTAMV
WRGPKKNSMI
WRGPKKHALI
WRGPKKHALI
WRGPKKNALI
WRGPKKTMMI
WRGSKKNLLI
WRGAKKNGLI
WRGPKKNGLI
WRGPKKNGII
WRGPKKNGMI
WRGPKKNGMI
WRGPKKNGMI
WRGPKKNGMI
WRGPKK..$!
KQFISDVAWG
KQFLKDVVWG
RQFLSDVFWD
KQFIDDVNWG
KQFVSDVAWG
KQFVSDVAWG
KQFVSDVAWG
RQFLTDVRWD
KKFLKDVDWKQFLKDVNWG
KQFLKDVEWG
KQFLKDVYWN
KQFLRDVDWG
KQFLRDVDWG
KQFLRDVDWG
RQFLSEVDWG
kQFl.DV.Wg
E----LDYLL
STETPLDYLL
ET----DYLL
E----IDFLI
E----LDYLV
Q----LDYLV
E----LDYLV
E----LDYLI
D---KLDYLV
E---KLDYLV
D----LDFLL
D----LDYLV
D----VDYLI
D----VDYLV
E----VDYLI
N----LDLLL
#. .lD%L.
IDTPPGTSDE
IDTPPGTSDE
IDTPPGTSDE
IDTPPGTSDE
VDTPPGTSDE
VDTPPGTSDE
VDTPPGTSDE
IDTPPGTSDE
IDTPPGTSDE
VDTPPGTSDE
VDTPPGTSDE
IDTPPGTSDE
IDTPPGTSDE
IDTPPGTSDE
VDTPPGTSDE
LDTPPGTSDE
!DTPPGTSDE
HISIAEEL-R
HIAIAEEL-R
HISLAENLLQ
HISVTEELLK
HMATVEALRP
HMATMEALRP
HMATIEALRP
HITVMECLKE
HISINKYMRE
HLSVTTYMKE
HLSVNTYLKK
HLSIVQYLKT
HLSVVQYLAA
HLSVVQYLAA
HLSVVRYLAT
HLSVVSYLKD
His..e.L..
YSKP---DGG
WANP--IDGA
KARPGQLAGA
HNP----DGA
YKP----LGA
YRP----LGA
YQP----LGA
VGC----HGA
SGIDG----A
VGIDG----A
SGIDG----A
SNLSG----A
AHIDG----A
AHIDG----A
AHIDG----A
DANPESLR-A
........gA
IVVTTPQSVA
IIVTTPQQVA
VVVTTPQAVA
ILVTTPQAVS
LVVTTPQAVS
LVVTTPQAVS
LVVTTPQAVS
IIVTTPQEVA
LVVTTPQEVA
LIVTTPQEVA
VMVTTPQEVS
VIVTSPQDVA
VILTTPQEVA
VILTTPQEVA
VIITTPQELS
VMVTTPQEVS
..VTTPQ.Va
260
TADVKKEINF
TADVRKEINF
TADVRKELNF
ISDVKKEISF
IGDVRRELTF
IGDVRRELTF
VGDVRRELTF
LDDVRKEITF
LLDVRKEIDF
LLDVRKEIDF
LLDVRKEIDF
LIDVRKEINF
LQDVRKEISF
LQDVRKEISF
LQDVRKEINF
LLDVRKEINF
..DVrkEi.F
SEQFSVPYLG
SEQLNLTYLG
ANDFGVRFLG
AEQCNIKFLG
ARLAGVPFLG
ARLAGVPFLG
AQLAGVPFLG
ATYAQVPHLG
CKELGIKFLG
CEELGIPFLG
AEEMGIAFLG
SQDMNVPFLG
CQDLKIPLLG
CQALKIPLLG
CQDLEVPLLG
CAEMGIPLLG
a....!pfLG
NVPIDPKFVE
NVPIDPQFVE
RVPIDPQFLV
KLPIDPNLSI
SVPLDPQLTR
SVPLDSQLTR
SVPLDPALMR
TLPIDPRVGI
SVPLDPRIGK
SVPLDPRIGK
SVPLDPRIGM
RIPIDPLIAR
KVPLDPHIGK
KVPLDPHIGK
RVPLDPLIGK
SLPLDQQISK
.vPiDp....
MIENQVSSKLVELQNEQEN
LIETGKRPTY
CSERGIN--SLEEGRD--SLEEGRD--TLEEGHD--LAGTTTS--SCDMGES--ACDMGEC--ACDYGES--SCDEGKS--SCDKGQS--SCDKGQS--NCDKGQS--ACDSGED--..e.g.....
KTLVEMYRES
KKLIELYDDC
PAGTTVDGKD
--YFTEYPNS
--FIQEFPKS
--FIQEFPKS
--FIQEFPGS
--VLDELPDS
--FLDNYPDS
--FFDSYPDS
--FFDSFPDS
--YLITHPNS
--FFVEAPDS
--FFVEAPDS
--FFIDAPDS
--L--TEFKN
.......p.s
SLCPIFEEIM
ELKPILNGIV
ISTPAGASTS
STLASLKSFV
TAYSALTSIA
TAYSALTSIA
PAFAALTSIA
TTAEVLTHIV
PASSAVLNVV
PAATAILDVV
PACRALKGVV
EATKQYNLIF
PATAAYRSII
PATAAYKSII
PATLAYRSII
VTTEALEGIC
....al..i.
KKLRKQDTTT
DKILDKNLPS
EEEEVKD-GS
DNFNFKSSTT
HKVLHQMPAL
QRVVHRMSAL
QKILDATPAC
EKLKTMLVS
EALRDAVGDV
DALRDQVELS
KGLATEMGLD
NKIKEIVNNS
QRIRDFCNSR
QRIREFCNSR
QRIQEFCNLH
SKIMASFS
.k........
Sc.Cfd1
Ca.Cfd1
Nc.Cfd1
Dd.Cfd1
Rn.Cfd1
Mm.Cfd1
Hs.Cfd1
Dm.Cfd1
Sc.Nbp35
Ca.Nbp35
Nc.Nbp35
Dd.Nbp35
Mm.Nbp35
Rn.Nbp35
Hs.Nbp35
Dm.Nbp35
Consensus
MTEILPH VNDEVL--PA EYELNQPEPE HCPGPESDMA
M SPSQTQ--IE KSQLAAPEPE HCPGPESELA
MAPSLEAEPE SVASVLANPQ KPQLVAPEPE HCPGPESQQA
M SDQLVAPPPE NCPGTQSEMS
MEEAPH GCPGADSAQA
MEGAPH GCPGADSAQA
MEEVPH DCPGADSAQA
MQAPPPE HCPGVESEEA
. .......... ..........
GKSDACGGCA
GQGDACKGCA
GTADSCAGCP
GKSAACAGCP
GRGASCQGCP
GRGASCQGCP
GRGASCQGCP
GKGSACSGCP
..........
Sc.Cfd1
Ca.Cfd1
Nc.Cfd1
Dd.Cfd1
Rn.Cfd1
Mm.Cfd1
Hs.Cfd1
Dm.Cfd1
Sc.Nbp35
Ca.Nbp35
Nc.Nbp35
Dd.Nbp35
Mm.Nbp35
Rn.Nbp35
Hs.Nbp35
Dm.Nbp35
Consensus
131
ENESIYQGPE
ENKQVHQSTQ
EDAKVTQAPG
ESKDVHKSTK
QGKAVHQCDS
QGKAVHQCDN
QGRAVHQCDR
EGRDIFQCDD
IKETVHESNS
EGESVHQSNS
EGETIHVSST
EGENIHISGQ
EGEQVHQSGS
EGEQVHQSGS
EGEQVHQSGS
LGESVHQSGY
eg..!hqs..
GWQPVKVETN
GWVPVSVYNN
GWLPITVHEA
GWVPVYTDES
GWVPVFVDQE
GWVPVFVDQE
GWAPVFLDRE
GWVPVYTDES
GWTPVYVTDN
GWSPVYVADN
GWSPAWAMDN
GWDPVYVQDN
GWSPVYVDDN
GWSPVYVEDN
GWSPVYVEDN
GWSPVGIEDN
GW.P!.v...
ST-------NNNQGTDSKR
DPSAGV---Q--------Q--------Q--------Q--------Q--------------------------------------------------------------------------------......
GSLSVISLGF
GNLSLMSLGF
GSLRVMSLGF
-KLGVISIQF
-SISLMSVGF
-SISLMSVGF
-SISLMSVGF
-TLAVMSIGF
--LATMSIQY
--LGLMSISF
--LAVMSIQF
--LAVMSVGF
--LGVMSVGF
--LGVMSVGF
--LGVMSVGF
--VCLMSIGF
..l.vmS.gF
Sc.Cfd1
Ca.Cfd1
Nc.Cfd1
Dd.Cfd1
Rn.Cfd1
Mm.Cfd1
Hs.Cfd1
Dm.Cfd1
Sc.Nbp35
Ca.Nbp35
Nc.Nbp35
Dd.Nbp35
Mm.Nbp35
Rn.Nbp35
Hs.Nbp35
Dm.Nbp35
Consensus
261
CKKVDLKILG
CKKVNFQILG
CTKTNIRVLG
CNAMKLPIIG
CKKTGLQVIG
CKKTGLQVIG
CRKTGLRVMG
CKKTGINILG
CKKAGINILG
CRKANIKILG
CRKAGIKVLG
CKKVGVPIIG
CHKVKLPIIG
CHKVKLPIIG
CRKVKLPIIG
CKKQNIPIVG
Ckk....!lG
IIENMSGFVC
IVENMSGFIC
VVENMCGFVC
IIENMSGYVC
VIENMSGFAC
VIENMSGFTC
IVENMSGFTC
IVENMSGFVC
LVENMSGFVC
LVENMSGFVC
LVENMSGFVC
VVENMSGFVC
VVENMSGFIC
VVENMSGFIC
VVENMSPFIC
VIENMSSFRC
!!ENMsg%vC
PHCAECTNIF
PHCSECTNIF
PNCSECTNIF
PHCSECTNIF
PHCAECTNVF
PHCAECTNVF
PHCTECTSVF
PHCTSCTNIF
PNCKGESQIF
PNCKGESQIF
PKCTHESEIF
PKCNKESQIF
PKCKKESQIF
PKCKRESQIF
PKCKKESQIF
GHCGNSSEIF
PhC.ect#!F
--SSGGGKRL
--SSGGGKAL
--MSGGGEVM
--SSEGGKLL
--SSGGGEEL
--SSGSGEEL
--SRGGGEEL
--SSNGGVSL
KATTGGGEAL
KATTGGGKKL
KATTGGGRKL
IPTTGGAEKM
PPTTGGAEAM
PPTTGGAEAM
PPTTGGAELM
PAKTGGAAAM
..ssgGg..$
388
PVVDKHEQPQ IESPK
RI
RLVHKYKDCS LAPIFSKITA DVISAVQQ
TTATN
CS
CS
LP
LENLAIK
PEVVMPEEDD A
K
QSHAETLISP
QSHDENLISP
QSKEENLISS
.......... .......... .......
Abb. 4: Alignment von Nbp35p und Cfd1p Sequenzen. Das Multisequenz Alignment wurde mit
dem Programm MULTALIN angefertigt (Corpet, 1988). Konservierte Cysteinreste sind gelb und das
- 65 -
Ergebnisse
Walker A und B Motiv sind blau unterlegt. Der Ausgangspunkt der am N-Terminus verkürzten Nbp35p
Variante (∆1-52 Nbp35p-TAP) ist durch einen roten Pfeil dargestellt. Sc, Saccharomyces cerevisiae;
Ca, Candida albicans; Nc, Neurospora crassa; Dd, Dictyostelium discoideum; Rn, Rattus norvegicus;
Mm, Mus musculus; Hs, Homo sapiens; Dm, Drosophila melanogaster.
Zunächst wurde untersucht, ob Nbp35p Eisen in vivo binden kann, und hierfür die
konservierten Cysteinreste am N-Terminus des Proteins als Liganden fungieren. Zu
diesem Zweck wurden Wildtypzellen mit Plasmiden transformiert, welche die
vollständige NBP35 Sequenz mit einer am 3΄-Ende angefügten TAP-tag Sequenz
oder eine am 5΄-Ende um 52 Codons verkürzte Variante von NBP35 mit einer am
3΄-Ende angefügten TAP-tag Sequenz enthielten. Unter der Kontrolle des
konstitutiven TDH3 Promotors wurden ausreichende Proteinmengen für weitere
Analysen synthetisiert. Die Proteine konnten mit immobilisierten IgG-Antikörpern
(IgG-Sepharose) gefällt werden, da diese die Protein-A-Domäne des TAP-tag
erkennen (Rigaut et al., 1999). Als Kontrolle wurden Wildtypzellen zusätzlich mit dem
leeren Vektor transformiert. Die transformierten Zellen wurden 16 h in eisenarmen
Minimalmedium mit Glukose als Kohlenstoffquelle angezogen. Anschließend wurden
die Zellen sedimentiert, in eisenarmen Minimalmedium resuspendiert und für 4 h mit
55
Fe markiert. Nach Sedimentation der Zellen und mechanischem Zellaufschluss
(4.15.6) wurden die Extrakte mit IgG-Sepharose für 1 h bei 4°C inkubiert.
Anschließend wurde Nbp35p-TAP bzw. die um 52 Aminosäurereste verkürzte
Variante immunpräzipitiert. Die mit den Proteinen co-präzipitierte Menge an
55
Fe
wurde im Szintillationszähler quantifiziert. Wildtypzellen, die das Fusionsprotein
Nbp35p-TAP überproduzierten, bauten 18-mal mehr radioaktives Eisen ein, als
Kontrollzellen, die den leeren Vektor enthielten (Abb. 5) Dies ist signifikant, da die
Menge an co-präzipitiertem
55
Fe im Bereich dessen liegt, was für ein Fe/S Protein
erwartet wird (z.B. Isu1p 12.000 cpm/g Zellen). Schwankungen können sich durch
Variationen des Zellaufschlusses ergeben. Zellen die eine am N-Terminus verkürzte
Nbp35p Variante synthetisierten, konnten ähnlich wenig
55
Fe co-präzipitieren, wie
Kontrollzellen die kein Nbp35-TAP synthetisierten (Abb. 5). Die Expression der
Proteine wurde durch Western Blot Analysen von Zellextrakten untersucht. Der
Nachweis erfolgte über einen gegen den TAP-tag gerichteten Antikörper. Nbp35pTAP und die verkürzte Variante wurden in vergleichbaren Mengen synthetisiert (Abb.
5). In Kontrollzellen, die den leeren Vektor enthielten konnte kein Nbp35p-TAP
Protein nachgewiesen werden. Diese Daten belegen, dass Nbp35p-TAP Eisen in
vivo bindet, und dass die Eisenbindung am N-Terminus des Proteins erfolgt.
- 66 -
Immunpräzipitiertes 55Fe
(103 cpm x / g Zellen)
Ergebnisse
16
α-TAP
12
8
4
0
Glc
+
Nbp35p-TAP↑
Glc
−
Glc
∆1-52
Nbp35p-TAP
∆1-52Nbp35p-TAP
Por1p
+
Glc
− ∆
Abb. 5: Nbp35p bindet Eisen in vivo. Wildtypzellen, die eine TAP-tag Version von Nbp35p (+), eine
um 52 Aminosäurereste verkürzte Form von Nbp35p-TAP↑ (∆1-52) überproduzierten oder den leeren
Vektor (-) enthielten wurden 16 h in eisenarmen Minimalmedium mit Glukose (Glc) kultiviert. Die
55
Zellen wurden für 4 h mit Fe markiert, geerntet und anschließend mit Glasperlen mechanisch
aufgeschlossen. Die Zellextrakte wurden für 1 h bei 4°C mit IgG-Sepharose inkubiert und Nbp35pTAP (+) bzw. die verkürzte Variante (∆1-52) wurden anschließend bei 4°C immunpräzipitiert. Die
55
Menge an co-präzipitiertem Fe wurde durch Szintillationszählung quantifiziert und diente als direktes
Maß für den Einbau von Eisen in Nbp35p-TAP (+) bzw. dessen verkürzte Variante (∆1-52). Die
gemessene Radioaktivität wurde pro g Zellen (Zellnassgewicht) angegeben. Durch SDS-PAGE und
anschließender Immunfärbung wurden die Zellen auf ihren Gehalt an Nbp35p-TAP (+) bzw. ∆152Nbp35p-TAP (∆) überprüft. Porin (Por1) diente als Ladungskontrolle. Die Fehlerbalken geben die
Standardabweichung von vier unabhängigen Messungen an.
Die Eisenbindung an Nbp35p war stabil, auch gegen die Behandlung mit EDTA und
Triton X-100 in den verwendeten Zell-Aufschlusspuffern. Eine Eisenbindung an
Nbp35p wurde auch beobachtet, wenn die Immunfällung unter aeroben Bedingungen
stattfand.
5.1.2. Die mitochondriale ISC-Assemblierungs- und Exportmaschinerie
ist für die Reifung von Nbp35p essentiell
Komponenten der mitochondrialen ISC-Assemblierungs- und Exportmaschinerie sind
für die Reifung aller zellulären Fe/S Proteine essentiell (3.6). Der Nachweis einer
Abhängigkeit
der
Eisenbindung
an
Nbp35p
von
Komponenten
der
ISC-
Assemblierungs- und Exportmaschinerie kann daher als indirekter Beweis dafür
dienen, dass Nbp35p einen Fe/S Cluster bindet.
Das
Reporterkonstrukt
p426NBP35-TAP
wurde
in
die
konditionalen
ISC-
Assemblierungsmutanten, Gal-NFS1 (Mühlenhoff et al., 2003); Gal-YAH1 (Lange et
al., 2001) und der ISC-Exportmutante Gal-ATM1 (Kispal et al., 1999) sowie in
- 67 -
Ergebnisse
Wildtypzellen, transformiert. Detaillierte Angaben zur Funktion von Nfs1p, Yah1p
(ISC-Assemblierungsmaschinerie) und Atm1p (ISC-ExportMaschinerie) sind in der
Einleitung beschrieben. Bei diesen Stämmen wurde der endogene Promotor durch
einen
Galaktose
induzierbaren
GAL1-10
Promotor
ersetzt.
In
diesen
Promotoraustauschmutanten wird das entsprechende Gen bei Kultivierung der Zellen
in Gegenwart von Galaktose induziert, während die Kultivierung in Gegenwart von
Glukose das Gen reprimiert. Um die Synthese der ISC-Assemblierungs- und
Exportkomponenten unter die Nachweisgrenze (Western Blot) herabzusetzen,
wurden die Zellen insgesamt 48 h (Gal-YAH1) bzw. 40 h (Gal-ATM1) in Gegenwart
von Glukose in Flüssigmedium kultiviert. Gal-NFS1 Zellen wurden zunächst 3 Tage
auf Festmedium mit Glukose inkubiert und dann in Flüssigmedium überführt. Alle
Zellen wurden aus einer in Minimalmedium mit Glukose und Galaktose gewachsenen
Vorkultur in eisenarmes Minimalmedium mit Galaktose oder Glukose überimpft, nach
16 h
geerntet
und
in
frisches
eisenarmes
Anschließend wurden die Zellen 4 h mit
Minimalmedium
resuspendiert.
55
Fe markiert, geerntet und mechanisch
aufgeschlossen. Die Zellextrakte wurden mit IgG-Sepharose und mit an Protein-A
gekoppelten anti-Leu1p Antikörpern (Gal-ATM1) für 1 h bei 4°C inkubiert. Im
Anschluss wurden Nbp35p-TAP bzw. Leu1p immunpräzipitiert, gewaschen und die
co-präzipitierte Radioaktivität im Szintillationszähler quantifiziert. Gal-NFS1, GalYAH1 und Gal-ATM1 Zellen bauten unter reprimierenden Wachstumsbedingungen
im Vergleich zu den entsprechenden induzierten Zellen 4-mal (Gal-NFS1 und GalYAH1) bzw. 2-mal (Gal-ATM1) weniger radioaktives Eisen in Nbp35p-TAP ein (Abb.
6B und C). Die reduzierte Einbaurate von
verminderte
Synthese
der
55
Fe in Nbp35p-TAP war spezifisch auf die
ISC-Assemblierungs-
bzw.
Exportkomponenten
zurückzuführen, da Gal-YAH1 und Gal-ATM1 Zellen unabhängig von der
Kohlenstoffquelle
das
Nbp35p-TAP
Protein
in
vergleichbaren
Mengen
synthetisierten. In Gal-NFS1 Zellen wurde unter reprimierenden Bedingungen
deutlich weniger Nbp35p Protein nachgewiesen, eine Beobachtung die früher schon
für andere Fe/S Proteine in diesem Stammhintergrund gemacht wurde (Abb. 6B).
Möglicherweise ist Nbp35p-TAP in der Apoform instabil und wird schneller
proteolytisch abgebaut. Die Kohlenstoffquelle hatte einen vernachlässigbaren
Einfluss auf den Eiseneinbau in Nbp35p-TAP, da Wildtypzellen, die in Gegenwart
von Glukose kultiviert wurden, maximal 10% weniger Eisen in Nbp35p-TAP
einbauten als in Gegenwart von Galaktose (Abb. 6A). Zum Vergleich wurde die
Eisenbindung an das cytosolische Fe/S Protein Isopropylmalat-Isomerase (Leu1p)
- 68 -
Ergebnisse
parallel zu Nbp35p-TAP in Gal-ATM1 Zellen untersucht. Leu1p wird in der LeucinBiosynthese benötigt und katalysiert die Umwandlung von α- zu β-Isopropylmalat.
Zur Analyse der Eisenbindung an Leu1p sind die endogen produzierten Mengen des
Proteins ausreichend. Aus einer früheren Arbeit war bekannt, dass die Reifung von
Leu1p von der Funktion des Atm1p und Komponenten der mitochondrialen ISCAssemblierungsmaschinerie abhängig ist (Kispal et al., 1999). Die Eisenbindung von
Leu1p und Nbp35p-TAP verhielt sich in Gal-ATM1 Zellen vergleichbar. Unter
reprimierenden Bedingungen wurden 2-mal (Nbp35p-TAP) bzw. 2,5-mal (Leu1p)
weniger radioaktives Eisen in die jeweiligen Proteine eingebaut (Abb. 6C). Die
verminderte Synthese von Atm1p in Gal-ATM1 Zellen konnte nicht durch eine
Immunfärbung gezeigt werden, da Nbp35p-TAP und Atm1p im SDS-Gel auf gleicher
Höhe laufen. Allerdings wurde die verminderte Synthese von Atm1p unter
reprimierenden
Bedingungen
in
Zellen
ohne
Nbp35p-TAP
bereits
durch
Immunfärbung nachgewiesen (Daten nicht gezeigt). Die Daten belegen, dass der
radioaktive Eiseneinbau in Nbp35p-TAP von Komponenten der ISC-Assemblierungsund Exportmaschinerie abhängt. Daher ist es sehr wahrscheinlich, dass Nbp35p ein
Fe/S Protein ist.
- 69 -
Ergebnisse
B
16
Immunpräzipitiertes 55Fe
(103 x cpm / g Zellen)
Immunpräzipitiertes 55Fe
(103 cpm x / g Zellen)
A
α-TAP
12
8
4
0
Nbp35p-TAP↑
Gal
+
Glc
+
30
α-TAP
20
10
0
Gal
Glc
Gal
Glc
Gal-NFS1
Gal-YAH1
(Nbp35p-TAP↑) (Nbp35p-TAP↑)
TAP∗
Nfs1p
Yah1p
Por1p
TAP∗
TAP∗
Por1p
Por1p
Gal Glc
Gal Glc
Gal Glc
Immunpräzipitiertes 55Fe
(103 x cpm / g Zellen)
C
20
α-TAP
α-Leu1p
15
10
5
0
Gal
Glc
Gal
Glc
Gal-ATM1
Gal-ATM1
(Nbp35p-TAP↑) (Nbp35p-TAP↑)
TAP∗
Leu1p
Por1p
Gal Glc
Por1p
Gal Glc
Abb. 6: Die Eisenbindung an Nbp35p-TAP hängt von Komponenten der mitochondrialen ISCAssemblierungs- und Exportmaschinerie ab. A) Wildtyp-, (B) Gal-NFS1, Gal-YAH1 und (C) GalATM1 Zellen, die NBP35-TAP (Nbp35p-TAP↑) überexprimierten wurden 16 h in eisenarmen
Minimalmedium mit Galaktose (Gal) oder Glukose (Glc) als Kohlenstoffquelle kultiviert. Die Zellen
55
wurden 4 h mit Fe markiert und anschließend mit Glasperlen aufgeschlossen. Die Zellextrakte
wurden mit IgG-Sepharose bzw. (C, rechts) mit an Protein-A-Sepharose gekoppelten Antikörpern
gegen Leu1p für 1 h bei 4°C inkubiert und anschließend wurde Nbp35p-TAP bzw. Leu1p bei 4°C
55
immunpräzipitiert. Die Menge an co-präzipitiertem Fe wurde durch Szintillationszählung quantifiziert
und diente als direktes Maß für den Einbau von Eisen in den Fe/S Cluster von Nbp35p-TAP bzw.
Leu1p. Die gemessene Radioaktivität wurde pro g Zellen (Zellnassgewicht) angegeben. Die
Anwesenheit der Proteine wurde durch eine Western Blot Analyse unter Verwendung spezifischer
Antiseren gegen Leu1p bzw. Antikörpern gegen den TAP-tag von Nbp35p überprüft (TAP∗: Nbp35pTAP). Die Fehlerbalken geben die Standardabweichung von vier unabhängigen Messungen an.
- 70 -
Ergebnisse
5.1.3. Analyse des rekombinanten Nbp35p
Zur weiteren Unterstützung der Befunde in vivo wurde Nbp35p in E. coli heterolog
überproduziert und über einen am N-Terminus fusionierten His-tag durch MetallAffinitätschromatographie gereinigt. Die Reinigung des Proteins fand unter aeroben
Bedingungen statt und ist in Abbildung 7A gezeigt. Nbp35p konnte bis zur
apparenten Homogenität gereinigt werden. Im UV/Vis zeigte sich ein Spektrum, dass
sowohl auf ein [2Fe-2S] als auch auf ein [4Fe-4S] Cluster-tragendes Protein
hindeutet (Absorptionsmaxima bei 320 nm und 420 nm) (Abb. 7B). Die Präparation
enthielt 0,8 Mol säurelabilen Schwefel und 0,8 Mol Eisen pro Mol Polypeptidkette
(Abb. 7B, Säulendiagramm). Auch wenn die Fe/S Cluster Zusammensetzung am
rekombinanten Nbp35p unvollständig ist, so zeigen die Daten eindeutig, dass das
rekombinante Nbp35p ein Fe/S Protein ist. Dies wurde zusätzlich durch
Elektronenspinresonanz-Spektroskopie bei niedriger Temperatur mit reduziertem
Nbp35p bestätigt. Das Spektrum zeigt ein Signal mit einem g Wert von 1,94, welcher
typisch für ein [4Fe-4S] Cluster-tragendes Protein ist (Abb. 7C, von A. Pierik). Die
Analysen in vivo und des rekombinanten Proteins in vitro belegen eindeutig, dass
Nbp35p ein Fe/S Protein ist.
- 71 -
Ergebnisse
A
1 2 3 4 5 6 7 8 9
66
45
36
Ionen Gehalt / Protein
B
A bsorbance
Absorption
0.3
0.2
OX
0.1
1.0
0.8
0.6
0.4
0.2
0.0
Fe2+/3+
S2-
RED
0.0
300
400
W avelength (nm)
500
600
Wellenlänge (nm)
C
2,052
1,934
g -Werte
1,84
DT 0.2 mW
DAF 0.2 mW
DAF 50 mW
295
320
345
Field (mT)
370
395
Magnetisches Feld (mT)
Abb. 7: Gereinigtes Nbp35p ist ein Fe/S Protein. A) Fraktionen der Reinigungsschritte von Nbp35p
wurden durch SDS-PAGE und anschließender Coomassie-Färbung analysiert. Spur 1: vor Induktion,
Spur 2: 3 h nach Induktion mit IPTG, Spur 3: Pellet, Spur 4: Überstand, Spur 5: Durchfluss, Spur 6:
Waschfraktion, Spur 7: Eluat 2 der Affinitätsreinigung, Spur 8: Eluat 3, Spur 9: die Hälfte der unter
Spur 8 aufgetragenen Menge. B) UV/Vis Spektrum von gereinigtem Nbp35p mit N-terminal
fusioniertem His-tag (1.9 mg/ml in 50 mM Tris-HCl, pH 8,0/1 µM 5`-Deazaflavin). Gezeigt sind die
Spektren vor (OX) und nach 5`-Deazaflavin (RED) Photoreduktion durch 3 min Bestrahlung mit einem
herkömmlichen Dia-Projektor. Der Beitrag an oxidiertem 5`-Deazaflavin zum Spektrum vor der
Photoreduktion wurde subtrahiert. Das Säulendiagramm zeigt die kolorimetrische Bestimmung von
Eisen und säurelabilen Schwefel. Die Fehlerbalken geben die Standardabweichung von 5
unabhängigen Messungen an (durchgeführt von D. Aguilar-Netz). C) ESR Spektren von reduziertem
Nbp35p mit N-terminal fusioniertem His-tag (10,3 mg/ml in 100 mM Tris/Cl, pH8). Die Reduktion
erfolgte durch Zugabe von 0,2 mM (Endkonzentration) Natrium-Dithionit (DT) oder durch
Photoreduktion mit 5`-Deazaflavin (DAF). ESR Bedingungen: Temperatur 10 K; Mikrowellenleistung
(mW) wie angegeben; Modulationsamplitude 1,25 mT; Modulationsfrequenz 100 kHz;
Mikrowellenfrequenz 9,456 ± 0,002 GHz (durchgeführt von A. Pierik).
- 72 -
Ergebnisse
5.2. Nbp35p ist an der Reifung cytosolischer und nukleärer Fe/S
Proteine beteiligt
5.2.1. Die Depletion von Nbp35p führt zu einem Wachstumsdefekt
Wie eingangs erwähnt, übt das Cfd1p Protein aus S. cerevisiae eine Funktion in der
Biogenese cytosolischer Fe/S Proteine aus (Roy et al., 2003). Da Nbp35p eine hohe
Homologie zu Cfd1p aufweist, ist die Ausübung ähnlicher zellulärer Funktionen
denkbar. Im Folgenden wurde die Funktion von Nbp35p ausführlicher untersucht. Da
Nbp35p für das Überleben der Zelle essentiell ist (Vitale et al., 1996), wurde eine
regulierbare Mutante erzeugt (4.9.1), in welcher der endogene NBP35 Promotor im
Genom durch einen GAL1-10 Promotor ersetzt wurde. In dieser Gal-NBP35 Mutante
lässt sich NBP35 in Gegenwart von Galaktose induzieren und in Gegenwart von
Glukose
reprimieren.
Die
Gal-NBP35
Zellen
wurden
zunächst
auf
ihr
Wachstumsverhalten in Abhängigkeit von der angebotenen Kohlenstoffquelle
untersucht. Die Abbildung 8 zeigt, dass Gal-NBP35 Zellen auf Minimalmedium mit
Galaktose wie Wildtypzellen wachsen. Die verminderte Synthese von Nbp35p unter
reprimierenden Wachstumsbedingungen führte im Vergleich zu Wildtypzellen zu
einer
Wachstumsverzögerung
und
zur
Ausbildung
kleinerer
Kolonien.
Die
verminderte Nbp35p Synthese in Gegenwart von Glukose war nicht letal, was
vermutlich darauf zurückzuführen ist, dass der GAL1-10 Promotor durch Glukose
nicht vollständig reprimiert werden konnte und eine basale Expression von NBP35
weiter bestand. Nbp35p-depletierte Zellen wuchsen auf nicht-fermentierbaren
Kohlenstoffquellen
(wie
z.B.
Glycerin)
wie
Wildtypzellen,
unbeeinträchtigte Mitochondrienfunktion schließen lässt (Abb. 8).
- 73 -
was
auf
eine
Ergebnisse
WT
Gal
Gal-NBP35
WT
Glc
Gal-NBP35
WT
Gly
Gal-NBP35
Abb. 8: Gal-NBP35 Zellen zeigen unter reprimierenden Kultivierungsbedingungen einen
Wachstumsdefekt. Wildtyp- (WT) und Gal-NBP35 Zellen wurden in flüssigem Minimalmedium mit
Galaktose (Gal), Glukose (Glc) oder Glycerin (Gly) für 2 Tage bei 30°C kultiviert. Anschließend
wurden die Zellen auf eine OD600 von 0,5 eingestellt, jeweils 5 µl einer 1:10 Verdünnungsreihe wurden
auf Minimalmedium Agarplatten mit der angegebenen Kohlenstoffquelle aufgetropft. Die Zellen
wurden 3 Tage bei 30°C inkubiert.
Zur Demonstration, dass die Wachstumsverzögerung von Gal-NBP35 Zellen in
Gegenwart von Glukose allein auf die verminderte Synthese von Nbp35p
zurückzuführen ist, wurden die Zellen mit den Plasmiden p426NBP35-TAP oder
p426NBP35-Strep transformiert, die eine konstitutive Expression von NBP35 unter
der Kontrolle des TDH3 Promotors ermöglichten. Zunächst wurde das endogene
NBP35 durch Kultivierung in Gegenwart von Glukose reprimiert. Anschließend
wurden die Zellen auf eine Agarplatte mit Glukose als Kohlenstoffquelle
ausgestrichen und bei 30°C inkubiert. Gal-NBP35 Zellen, die NBP35 von einem
Plasmid exprimierten, entwickelten sich wie Wildtypzellen (Abb. 9). Gal-NBP35
Zellen,
die
den
leeren
Vektor
enthielten,
zeigten
weiterhin
eine
Wachstumsverzögerung. Diese Daten zeigen, dass die Wachstumsverzögerung
ausschließlich auf die geringere Synthese von Nbp35p zurückzuführen ist.
- 74 -
Ergebnisse
Glc
WT
Gal-NBP35
(Nbp35p-TAP↑)
Gal-NBP35
(-)
Gal-NBP35
(Nbp35p-Strep↑)
Abb. 9: Der Wachstumsdefekt von Gal-NBP35 Zellen unter reprimierenden Bedingungen wird
durch plasmidgestützte Expression von NBP35 aufgehoben. Wildtyp- (WT) und Gal-NBP35
Zellen, die NBP35 konstitutiv von dem Plasmid p426Nbp35-TAP (Nbp35-TAP↑) oder p426Nbp35Strep (Nbp35-Strep↑) exprimierten, oder den leeren Vektor (-) enthielten, wurden nach Verminderung
des endogenen Nbp35p Proteins, nochmals auf Festmedium mit Glukose (Glc) ausplattiert und 3
Tage bei 30°C inkubiert.
5.2.2. Nbp35p ist im Cytosol und Kern lokalisiert
Nbp35p wurde zunächst als ein im Zellkern lokalisiertes Protein beschrieben (Vitale
et al., 1996). Nachfolgende systematische Lokalisierungsstudien detektierten das
Protein auch im Cytosol (Huh et al., 2003). Zur Klärung der intrazellulären
Lokalisierung von Nbp35p in Hefezellen wurde eine in situ Immunfluoreszenz
(4.15.1) und eine Zellfraktionierung durchgeführt.
In situ Immunfluoreszenz
Wildtyp- und Gal-NBP35 Zellen wurden nach Fixierung in 3,7% Formaldehyd durch
Triton X-100 permeabilisiert, mit einem α-Nbp35p Antikörper (Kaninchen) inkubiert
und anschließend mit einem Alexa-488 gekoppelten Antikörper (anti-Kaninchen)
markiert
(Abb.
(kernlokalisiertes
10A).
Parallel
Markerprotein)
dazu
mit
wurden
einem
Wildtypzellen,
C-terminal
die
Ntg2p-HA
fusionierten HA-tag
überproduzierten, mit einem α-HA Antikörper (Maus) inkubiert und im Anschluss mit
einem Alexa-488 gekoppelten Antikörper (anti-Maus) markiert. Ntg2p ist eine DNA-NGlycosylase, die an DNA-Reparaturvorgängen beteiligt ist. Zusätzlich erfolgte eine
Anfärbung der DNA mit DAPI zur Darstellung des Zellkerns und der Mitochondrien.
Unter induzierenden Bedingungen zeigten Gal-NBP35 und Wildtypzellen eine
uniforme Fluoreszenz des Cytosols (Abb. 10A). Diese war in Gal-NBP35 Zellen
deutlich stärker, da NBP35 unter Kontrolle des GAL1-10 Promotors überexprimiert
wurde. Das Fluoreszenzsignal war spezifisch, da Gal-NBP35 Zellen unter
- 75 -
Ergebnisse
reprimierenden Bedingungen keine Fluoreszenz zeigten. Unter induzierenden
Bedingungen war auch im Bereich des Kerns eine signifikante Fluoreszenz zu
beobachten.
Zellfraktionierung
Alternativ wurde die Lokalisierung von Nbp35p durch eine Zellfraktionierung mit
nachfolgender Immunfärbung überprüft (Abb. 10B). Aus Wildtypzellen, die das
Fusionsprotein
Nbp35p-Strep
synthetisieren
wurden
Mitochondrien,
post-
mitochondrialer Überstand (PMS) und Cytosol (Cyt) präpariert. Letzteres wurde
durch Ultrazentrifugation aus dem PMS gewonnen und ist überwiegend frei von
Membranbestandteilen. Nbp35p-Strep ließ sich wie das cytosolische Markerprotein
Pgk1p (Phosphoglycerin-Kinase) ausschließlich im PMS und Cytosol nachweisen.
Da gleiche Mengen an Nbp35p im PMS und Cytosol nachweisbar waren, scheint
Nbp35p nicht mit Membranen assoziiert zu sein. In der Mitochondrienfraktion wurde
kein Nbp35p detektiert. Diese Daten belegen, dass Nbp35p vorwiegend als lösliches
Protein im Cytosol existiert, und eine geringere Menge im Kern lokalisiert ist. Die
Daten zeigen außerdem, dass eine Überproduktion von Nbp35p nicht zur
Fehllokalisierung führt.
- 76 -
Ergebnisse
A
WT
Ntg2-HA↑
Glc
WT
Gal-NBP35
Glc
Gal
Überlagerung
Alexa-488
DAPI
Glc
B
Mito PMS Cyt
Nbp35p-Strep
Pgk1p
Por1
Abb. 10: Nbp35p ist im Cytosol und Kern lokalisiert. A) In situ Lokalisierung von Nbp35p in
Wildtyp- (WT) und Gal-NBP35 Zellen, die unter reprimierenden (Glc) oder induzierenden Bedingungen
(Gal) kultiviert wurden und in situ Lokalisierung von Ntg2p-HA in Wildtypzellen, die Ntg2p-HA
überproduzierten (WT Ntg2p-HA↑). Zellen wurden in der exponentiellen Wachstumsphase geerntet, in
Formaldehyd fixiert und nach Permeabilisierung mit einem anti-Nbp35p Antiserum (Kaninchen) bzw.
einem monoklonalen anti-HA Antikörper (Maus) inkubiert und anschließend mit einem Alexa-488
gekoppelten anti-Kaninchen bzw. anti-Maus IgG Antikörper markiert (Absorption: 495 nm, Emission:
519 nm, Verd. 1:500). Parallel dazu erfolgte eine Markierung der DNA mit DAPI. Die Analyse der
Zellen erfolgte mit einem Fluoreszenzmikroskop. B) Je 50 µg isolierte Mitochondrien (Mito), postmitochondrialer Überstand (PMS) und Cytosol (Cyt) wurden in einem 12,5% SDS-Polyacrylamid Gel
aufgetrennt. Die subzelluläre Lokalisierung von Nbp35p erfolgte durch Immunfärbung des Strep-tag
mit einem Streptavidin-Peroxidase Antikörper (Verd. 1:2.000). Als Markerproteine dienten die
cytosolische Phosphoglycerin-Kinase (Pgk1p) und das mitochondriale Porin (Por1p).
5.2.3. Nbp35p kann Cfd1p nicht funktionell ersetzen
Das Protein Cfd1p aus S. cerevisiae ist an der Biogenese cytosolischer Fe/S
Proteine beteiligt (Roy et al., 2003). Eine verminderte Synthese von Cfd1p führt zu
Aktivitätsverlusten von cytosolischen Fe/S Proteinen. Da Nbp35p eine hohe
Homologie zu Cfd1p aufweist, ist die Ausübung ähnlicher zellulärer Funktionen
denkbar. Im folgenden Experiment wurde untersucht, ob Nbp35p und Cfd1p sich
funktionell ersetzen können. Zu diesem Zweck wurden die regulierbaren Mutanten
Gal-NBP35 und Gal-CFD1 (Hausmann et al., 2005) mit den Plasmiden p424NBP35,
- 77 -
Ergebnisse
p426CFD1, oder dem leeren Vektor transformiert. Die Plasmide ermöglichten eine
konstitutive Expression von NBP35 bzw. CFD1 in Hefe. Die transformierten Zellen
wurden in Minimalmedium mit Galaktose oder Glukose kultiviert, um das endogene
NBP35 und CFD1 im entsprechenden Stamm zu induzieren bzw. zu reprimieren.
Anschließend wurden die Zellen auf Festmedium mit Glukose oder Galaktose
aufgetropft und auf ihr Wachstumsverhalten überprüft.
Sowohl Gal-NBP35 als auch Gal-CFD1 Zellen zeigten unter induzierenden
Bedingungen keinen Wachstumsdefekt, unabhängig davon, ob NBP35 und/oder
CFD1 von einem Plasmid überexprimiert wurden oder ob die Zellen den leeren
Vektor enthielten (Abb. 11A, oben). Unter reprimierenden Bedingungen konnte der
Wachstumsdefekt von Gal-NBP35 Zellen durch die gemeinsame Überexpression von
NBP35 und CFD1 oder durch die alleinige Überexpression von NBP35, nicht aber
durch die alleinige Überexpression von CFD1 aufgehoben werden (Abb. 11A, oben).
Gal-CFD1 Zellen verhielten sich analog. Der Wachstumsdefekt von Gal-CFD1 Zellen
in Gegenwart von Glukose ließ sich nur durch Überexpression von CFD1, nicht aber
durch die Überexpression von NBP35 aufheben (Abb. 11A, unten). Ferner wurden
Gal-CFD1 Zellen mit Plasmiden transformiert, die eine Überexpression von NBP35,
NAR1 oder NTG2 ermöglichten. Nar1p ist ein Fe/S Protein, weches vorwiegend im
Cytosol lokalisiert ist und eine Funktion in der Biogenese von extra-mitochondrialen
Fe/S Proteinen einnimmt. Ntg2p ist ein kernlokalisiertes Fe/S Protein, mit einer
Funktion in der DNA-Reparatur. Gal-CFD1 Zellen wurden in Gegenwart von
Galaktose und Glukose auf Festmedium aufgetropft und hinsichtlich ihres
Wachstumsverhaltens analysiert. Gal-CFD1 Zellen zeigten unter induzierenden
Bedingungen keinen Wachstumsdefekt, unabhängig davon, ob sie Nbp35p, Nar1p
oder Ntg2p überproduzierten oder den leeren Vektor enthielten (Abb. 11B). Unter
reprimierenden Wachstumsbedingungen entwickelten Gal-CFD1 Zellen einen
Wachstumsdefekt. Dieser wurde durch die Überexpression von Nbp35p oder Nar1p
gleichermaßen verstärkt (Abb. 11B), während die Überexpression von Ntg2p keinen
Einfluss auf das Wachstum ausübte. In Wildtypzellen zeigte die Überproduktion von
Nbp35p und Nar1p keine schädlichen Auswirkungen (Daten nicht gezeigt). Diese
Daten demonstrieren, dass Nbp35p und Cfd1p sich nicht funktionell ersetzen
können. Zudem hängt die Funktionalität von Nbp35p, Cfd1p und Nar1p von
ausgewogenen Proteinmengen ab. Ein Überschuss an Nbp35p und Nar1p
beeinträchtigt die Lebensfähigkeit der Zellen.
- 78 -
Ergebnisse
A
Galaktose
Gal-CFD1
Gal-NBP35
Glukose
B
Glukose
p424- p426NBP35 CFD1
+
-
+
+
+
-
-
+
+
-
+
+
-
Galaktose
Gal-CFD1
NBP35
NAR1
NTG2
Abb. 11: Nbp35p kann Cfd1p nicht funktionell ersetzen. A) Gal-NBP35 und Gal-CFD1 Zellen
wurden mit den high-copy Plasmiden p424NBP35 (+) und / oder p426CFD1-HA (+), oder dem leeren
Vektor (-) transformiert, um NBP35 und / oder CFD1-HA unter der Kontrolle des TDH3 Promotors zu
überexprimieren. B) Gal-CFD1 Zellen wurden mit den high-copy Plasmiden p424NBP35, p424NAR1
und p424NTG2, oder dem leeren Vektor (-) transformiert. Diese überexprimierten NBP35, NAR1 und
NTG2 konstitutiv unter der Kontrolle des TDH3 Promotors. Die Zellen wurden in Gegenwart von
Galaktose oder Glukose kultiviert, um das endogene NBP35 oder CFD1 in der entsprechenden Zelle
zu induzieren (Galaktose) oder zu reprimieren (Glukose). Die Zellen wurden anschließend auf eine
OD600 von 0,5 eingestellt, jeweils 5 µl einer 1:10 Verdünnungsreihe auf Minimalmedium Agarplatten
mit der angegebenen Kohlenstoffquelle aufgetropft und 3 Tage bei 30°C inkubiert. (von D. AguilarNetz)
5.2.4. Nbp35p wird für die Reifung des cytosolischen Fe/S Proteins
Leu1p benötigt
Um eine mögliche Funktion von Nbp35p in der Biogenese zellulärer Fe/S Proteine
näher beurteilen zu können, wurden die Enzymaktivitäten verschiedener Fe/S
Proteine gemessen. Bereits für das Cfd1p Homolog wurde gezeigt, dass dieses für
die Aktivität der cytosolischen Proteine IRP1 (einer Aconitase) und dem
cytosolischen Leu1p benötigt wird (Roy et al., 2003). Wildtyp- und Gal-NBP35 Zellen
wurden in Minimalmedium mit Galaktose oder Glukose kultiviert, um die Synthese
von Nbp35p in Gal-NBP35 Zellen zu induzieren bzw. zu reprimieren. Aus diesen
Zellen wurden Mitochondrien und post-mitochondrialer Überstand isoliert. Unter
reprimierenden Bedingungen sank die Leu1p Aktivität im post-mitochondrialen
Überstand im Vergleich zu Wildtypzellen um den Faktor 7 (Tab. 1). Zellen, die in
Gegenwart von Galaktose kultiviert wurden, zeigten keine Abnahme der Leu1p
Aktivität. In Wildtypzellen hatte die Kohlenstoffquelle keinen Einfluss auf die Leu1p
Aktivität im post-mitochondrialen Überstand (Tab. 1). Zur Kontrolle wurde die Aktivität
- 79 -
Ergebnisse
der Alkohol-Dehydrogenase bestimmt, welche die Umsetzung von Ethanol zu
Acetaldehyd katalysiert. Dieses Enzym besitzt keinen Fe/S Cofaktor. Gal-NBP35
Zellen
zeigten
weder
unter
induzierenden
noch
unter
reprimierenden
Wachstumsbedingungen einen Aktivitätsverlust der Alkohol-Dehydrogenase. Die
Aktivitäten mitochondrialer Proteine blieben durch die Depletion von Nbp35p
unbeeinflusst, unabhängig davon, ob es sich um Fe/S Proteine (Aconitase, SuccinatDehydrogenase) oder um Proteine ohne Fe/S Cofaktor (Malat-Dehydrogenase,
Citrat-Synthase) handelte (Tab. 1). Diese Daten zeigen, dass Nbp35p spezifisch für
die Enzymaktivität von Leu1p, einem cytosolischen Fe/S Protein, nicht jedoch für
mitochondriale Fe/S Proteine benötigt wird.
Tab. 1: Enzymaktivitäten in NBP35p-depletierten Gal-NBP35 Zellen
Wildtyp
Kompartiment
Gal-NBP35
Gal
Glc
Gal
Glc
0,30 ± 0,01
0,31 ± 0,05
0,40 ± 0,09
<0,04
1,8 ± 0,3
2,0 ± 0,3
1,6 ± 0,2
2,4 ± 0,6
3,5 ± 0,9
3,2 ± 0,4
2,9 ± 0,5
3,7 ± 0,6
0,30 ± 0,03
0,20 ± 0,02
0,20 ± 0,01
0,30 ± 0,01
Malat-Dehydrogenase
2,0 ± 0,1
1,5 ±0,1
1,6 ± 0,1
1,5 ± 0,1
Citrat-Synthase
2,8 ± 0,4
2,9 ± 0,3
3,1 ± 0,6
3,7 ± 0,5
Enzym
Cytosol
Isopropylmalat-Isomerase (Leu1p)
Alkohol-Dehydrogenase
Mitochondrien
Aconitase (Aco1p)
Succinat-Dehydrogenase
Wildtyp- und Gal-NBP35 Zellen wurden auf Minimalmedium mit Galaktose (Gal) oder Glukose (Glc)
kultiviert. Mitochondrien und post-mitochondrialer Überstand wurden isoliert und anschließend die
Enzymaktivitäten mitochondrialer und cytosolischer Proteine bestimmt. Aktivitäten sind in Units/mg
Protein angegeben.
Mit dem folgenden Experiment sollte die Ursache gefunden werden, die zur Leu1p
Aktivitätsabnahme führte. Diese könnte auf einen beschädigten Fe/S Cluster, eine
verminderte
Expression
oder
auf
eine
gestörte
Fe/S
Cluster
Biogenese
zurückzuführen sein.
Um dies zu klären, wurde die de novo Synthese mehrerer Fe/S Proteine durch
Markierung mit radioaktivem Eisen und anschließender Immunpräzipitation verfolgt.
Zunächst wurde die Biogenese cytosolischer Fe/S Proteine untersucht. Gal-NBP35
Zellen wurden mit Plasmiden transformiert, die eine konstitutive Überexpression der
- 80 -
Ergebnisse
cytosolischen Fe/S Proteine Rli1p-HA oder Nar1p-HA mit einem C-terminalen HA-tag
ermöglichen. Die de novo Synthese des Fe/S Clusters von Leu1p konnte hingegen
am endogenen Protein ohne Überexpression beobachtet werden. Die resultierenden
Zellen wurden zunächst in Minimalmedium mit Galaktose oder Glukose und
anschließend 16 h in eisenarmen Minimalmedium kultiviert. Anschließend wurden die
Zellen in frischem eisenarmen Minimalmedium überimpft und 4 h mit
55
Fe markiert.
Nach der Zellernte wurden diese aufgeschlossen, die Zellextrakte wurden mit
gekoppelten α-Leu1 oder α-HA Antikörpern für 1 h bei 4°C inkubiert und
immunpräzipitiert. Die Quantifizierung von co-präzipitiertem
55
Fe erfolgte durch
Szintillationszählung der gewaschenen und an Protein-A-Kügelchen gekoppelten
Antikörper. Unter reprimierenden Bedingungen wurde aus Zellextrakten von GalNBP35 Zellen 23-mal weniger
55
Fe mit Rli1p-HA, 12-mal weniger Leu1p und 4-mal
weniger Nar1p-HA co-präzipitiert als unter induzierenden Bedingungen (Abb. 12).
Die Analyse der Zellextrakte mittels Western Blot zeigte, dass die untersuchten
Proteine unter induzierenden und reprimierenden Bedingungen in vergleichbaren
Mengen in Gal-NBP35 Zellen synthetisiert wurden. Diese Daten demonstrieren, dass
Immunpräzipitiertes 55Fe
(103 x cpm / g Zellen)
Nbp35p an der Reifung von cytosolischen Fe/S Proteinen beteiligt ist.
60
α-HA
20
α-Leu1p
15
40
3
α-HA
2
10
20
1
5
0
Gal
Glc
Gal-NBP35 (Rli1p-HA↑)
0
Gal
Glc
Gal-NBP35
Rli1p-HA
Gal
Glc
Gal-NBP35 (Nar1p-HA↑)
Leu1p
Por1p
Gal Glc
0
Nar1p-HA
Por1p
Por1p
Gal Glc
Gal Glc
Abb. 12: Nbp35 ist an der Reifung von cytosolischen Fe/S Proteinen beteiligt. Gal-NBP35 und
Gal-NBP35 Zellen, die Rli1p-HA↑ oder Nar1p-HA↑ überproduzierten wurden 16 h in eisenarmen
55
Minimalmedium mit Galaktose (Gal) oder Glukose (Glc) kultiviert. Die Zellen wurden für 4 h mit Fe
55
markiert und die Bindung von
Fe an Rli1p-HA, Nar1p-HA sowie Leu1p wurde durch
Immunpräzipitation mit anti-HA Agarose bzw. mit an Protein A-Sepharose gekoppelten Antikörpern
gegen Leu1p und anschließender Szintillationszählung bestimmt. Die gemessene Radioaktivität
wurde pro Zellnassgewicht angegeben. Die Anwesenheit der Proteine wurde in einer Western Blot
Analyse unter Verwendung spezifischer Antikörper gegen den HA-tag bzw. mit Antiseren gegen
Leu1p und Por1p nachgewiesen. Die Fehlerbalken geben die Standardabweichung von vier
unabhängigen Messungen an.
- 81 -
Ergebnisse
5.2.5. Nbp35p ist an der Reifung kernlokalisierter Fe/S Proteine beteiligt
Um zu untersuchen, ob Nbp35p zur Reifung von nukleären Fe/S Proteinen benötigt
wird, wurde als nächstes die in vivo Biogenese von Ntg2p verfolgt. Das Protein ist
eine im Kern lokalisierte DNA-N-Glycosylase und übt dort eine Funktion in der
DNA-Reparatur aus. Wildtyp- und Gal-NBP35 Zellen wurden mit high-copy
Plasmiden transformiert, die eine Überexpression von Ntg2p-HA erlauben. Die Zellen
wurden wie unter 5.2.4 beschrieben kultiviert, markiert und aufgeschlossen. Die
Zellextrakte
wurden
mit
α-HA-Agarose
für
1h
bei
4°C
inkubiert
immunpräzipitiert. Die Quantifizierung von mit Ntg2p-HA co-präzipitiertem
und
55
Fe
erfolgte durch Szintillationszählung. Aus Extrakten von unter reprimierenden
Bedingungen kultivierten Gal-NBP35 Zellen wurde 37-mal weniger
55
Fe mit Ntg2-HA
co-präzipitiert als unter induzierenden Bedingungen (Abb. 13, Mitte). Die Menge an
co-präzipitiertem Eisen entsprach dem von Wildtypzellen, die nur den leeren Vektor
enthielten (Abb. 13, rechts). Im Gegensatz dazu wurden aus Wildtypzellen, die
Ntg2p-HA überproduzierten, unabhängig von der Kohlenstoffquelle signifikante
Mengen
55
Fe mit Ntg2-HA co-präzipitiert (Abb. 13, links). Durch Immunfärbung
konnte bestätigt werden, dass Gal-NBP35 Zellen in Gegenwart von Galaktose und
Immunpräzipitiertes 55Fe
(103 x cpm / g Zellen)
Glukose ähnliche Mengen Ntg2p-HA synthetisierten.
15
α-HA
10
5
0
Gal
Glc
Gal
Glc
Gal-NBP35
WT
(Ntg2p-HA↑) (Ntg2p-HA↑)
Gal
Glc
WT
(-)
Ntg2p-HA
Por1p
Gal Glc
Gal Glc
Abb. 13: Nbp35p ist an der Reifung nukleär lokalisierter Fe/S Proteine beteiligt. Wildtyp- (WT)
und Gal-NBP35 Zellen die Ntg2p-HA↑ überproduzierten oder den leeren Vektor (-) enthielten wurden
in eisenarmen Minimalmedium mit Galaktose (Gal) oder Glukose (Glc) für 16 h kultiviert. Die Zellen
55
55
wurden für 4 h mit FeCl3 markiert und die Bindung von Fe an Ntg2-HA durch Immunpräzipitation
mit anti-HA-Agarose und Szintillationszählung bestimmt. Die gemessene Radioaktivität wurde pro g
Zellen (Zellnassgewicht) angegeben. Die Anwesenheit der Proteine wurde in einer Western Blot
Analyse unter Verwendung spezifischer Antikörper gegen den HA-tag bzw. mit Antiseren gegen Por1p
nachgewiesen. Die Fehlerbalken geben die Standardabweichung von fünf unabhängigen Messungen
an.
- 82 -
Ergebnisse
5.2.6. Nbp35p ist nicht an der Reifung mitochondrialer Fe/S Proteine
beteiligt
Abschließend wurde die de novo Synthese des mitochondrialen Markerproteins
Bio2p untersucht. Bio2p ist ein Fe/S Protein der mitochondrialen Matrix, das den
letzten Schritt der Biotin-Synthese, den Einbau von Schwefel in Desthiobiotin,
katalysiert. Gal-NBP35 Zellen, die Bio2p überproduzierten, wurden wie in 5.2.4
beschrieben kultiviert und markiert (2 h). Im Anschluss wurden die Zellen geerntet
und aufgeschlossen, Zellextrakte wurden mit α-Bio2p Protein-A-Sepharose für 1 h
bei 4°C inkubiert und immunpräzipitiert. Die Quantifizierung des mit Bio2p copräzipitierten
55
Fe erfolgte durch Szintillationszählung. Im Gegensatz zu den Fe/S
Proteinen im Cytosol wurden aus Gal-NBP35 Zellen, die Bio2p überproduzierten,
unabhängig von der Kohlenstoffquelle signifikante und vergleichbare Mengen
55
Fe
mit Bio2p co-präzipitiert. (Abb. 14A). Die Zellen synthetisierten sowohl in Gegenwart
von Galaktose, als auch Glukose vergleichbare Mengen Bio2p (Abb. 14A). Dies
zeigt, dass die Reifung des Bio2p Proteins von Nbp35p unabhängig ist. Dieses
Ergebnis ist in Übereinstimmung mit der Tatsache, dass Gal-NBP35 Zellen auf nichtfermentierbaren Kohlenstoffquellen wachsen können, also weitestgehend intakte
Mitochondrien besitzen müssen (Abb. 8).
Als weiteres Indiz dafür, dass Nbp35p nicht an der Reifung mitochondrialer Fe/S
Proteine beteiligt ist, wurde der Eisengehalt in den Mitochondrien bestimmt (4.15.5).
Es ist bekannt, dass Defekte der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerie eine Akkumulation von Eisen in den Mitochondrien hervorrufen
(Kispal et al., 1997). Wildtypzellen und Gal-NBP35 Zellen wurden in Vollmedium mit
Galaktose oder Laktat kultiviert. Nach ausreichender Verminderung von Nbp35p
durch reprimierende Wachstumsbedingungen (Lak) wurden Mitochondrien isoliert.
Die Bestimmung des Eisengehalts der Mitochondrien erfolgte photometrisch durch
Verwendung von Bathophenantrolin. Diese Substanz bildet mit Eisen einen farbigen
Komplex. Wie zu erwarten, enthielten Mitochondrien aus Gal-NBP35 Zellen auch
unter reprimierenden Bedingungen keine höheren Eisenmengen als Mitochondrien
aus Wildtypzellen (Abb. 14B). Nbp35p greift also offensichtlich nicht in die Regulation
der Eisenhomeostase ein. Die Funktion von Nbp35p beschränkt sich allein auf die
Reifung extra-mitochondrialer Fe/S Proteine.
- 83 -
Ergebnisse
B
40
α-Bio2p
30
20
10
0
Gal
Glc
Gal-NBP35 (Bio2p↑)
Eisengehalt
(nmol / mg mito. Protein)
Immunpräzipitiertes 55Fe
(103 x cpm / g Zellen)
A
6
4
2
0
Gal
Lak
WT
Gal
Lak
Gal-NBP35
Bio2p
Por1p
Gal Glc
Abb. 14: Nbp35p wird nicht für die Reifung mitochondrialer Fe/S Proteine benötigt. A) GalNBP35 Zellen die Bio2p↑ überexprimierten wurden 16 h in eisenarmen Minimalmedium mit Galaktose
55
(Gal) oder Glukose (Glc) kultiviert. Die Zellen wurden 2 h mit FeCl3 markiert und die Bindung von
55
Fe an Bio2p wurde durch Immunpräzipitation mit an Protein A-Sepharose gekoppelten anti-Bio2p
Antikörpern und Szintillationszählung bestimmt. Die Anwesenheit der Proteine konnte in einer
Western Blot Analyse unter Verwendung spezifischer Antiseren gegen Bio2p und Por1p
nachgewiesen werden. Die Fehlerbalken geben die Standardabweichung von drei unabhängigen
Messungen an. B) Wildtyp- (WT) und Gal-NBP35 Zellen wurden in Vollmedium mit Galaktose (Gal)
oder Laktat (Lak) kultiviert, anschließend wurden Mitochondrien isoliert und der Gehalt an freiem
reduziertem Eisen (d.h. nicht Häm, nicht Fe/S) wurde photometrisch durch die BathophenantrolinMethode bestimmt. Die Fehlerbalken geben den mittleren Fehler von drei unabhängigen Messungen
an.
Zusammenfassung der Nbp35p Experimente
Die essentielle P-Loop NTPase Nbp35p bindet am N-Terminus einen Fe/S Cluster.
Die Bindung des Clusters hängt von Komponenten der ISC-Assemblierungs- und
Exportmaschinerie ab. Das Protein ist hauptsächlich im Cytosol, aber auch im
Zellkern lokalisiert. Für Nbp35p wurde eine Funktion in der Biogenese von
cytosolischen und nukleären Fe/S Proteinen nachgewiesen. Die Funktion von
Nbp35p konnte nicht durch das homologe Cfd1p Protein ersetzt werden. Nbp35p hat
keinen Einfluss auf die Reifung von mitochondrialen Fe/S Proteinen und eine
verminderte Synthese von Nbp35p führt auch nicht zu einer Eisenanreicherung in
den Mitochondrien. Zusammenfassend zeigen die hier erhaltenen Daten, dass
Nbp35p ein essentielles Mitglied der „cytosolic iron-sulfur protein-assembly“ (CIA)Maschinerie ist. Die genaue Funktion von Nbp35p bei der Reifung von Fe/S
Proteinen im Cytosol bedarf weiterer Untersuchungen.
- 84 -
Ergebnisse
5.3. Transkriptom-Analysen in S. cerevisiae
In S. cerevisiae wurde gezeigt, dass Defekte in der Reifung von mitochondrialen
Fe/S Proteinen in der Regel eine Fehlregulierung der zellulären Eisenaufnahme, eine
Akkumulation von Eisen in den Mitochondrien und einen generellen Häm-Defekt
auslösen. Diese Auswirkungen sind allerdings nicht durch einen Funktionsausfall von
Fe/S Proteinen zu erklären, wie z.B. Defekte in der Respiration oder in der
Biosynthese von Aminosäuren wie Glutamat und Lysin. Es ist wahrscheinlicher, dass
die Reifung von zellulären Fe/S Proteinen regulatorisch auf die zelluläre
Eisenhomeostase und auf andere Eisen-abhängige zelluläre Stoffwechselprozesse
einwirkt, wie z.B. die Synthese von Häm. Zum besseren Verständnis dieser
Wechselwirkungen war ein Schwerpunkt dieser Dissertation eine vollständige
Übersicht über die durch Defekte in der Fe/S Protein-Biogenese ausgelösten
transkriptionellen Veränderungen aller Gene von S. cerevisiae zu erhalten.
Anschließend wurden Promotorstudien und Enzymmessungen zur Verifizierung und
Erklärung der Transkriptom-Analysen durchgeführt. Die Entwicklung der cDNAMicroarray-Technologie ermöglicht die simultane Analyse einer großen Anzahl von
Genen hinsichtlich ihrer Expression unter bestimmten experimentellen Bedingungen.
Brown und Mitarbeiter dokumentierten 1995 als Erste die Verwendung eines
Microarrays zur Quantifizierung differentieller Genexpression zwischen Blatt- und
Wurzelgewebe in Arabidopsis thaliana (Schena et al., 1995). Seit dieser Zeit hat sich
das Anwendungsgebiet der Microarray-Technologie auch auf andere Organismen
ausgedehnt, so dass DNA-Microarrays zur Untersuchung des Hefegenoms
kommerziell erhältlich sind.
Zur Untersuchung transkriptioneller Veränderungen durch Defekte in der Biogenese
von Fe/S Proteinen in S. cerevisiae wurden drei regulierbare Mutanten (Gal-NBP35,
Gal-ATM1 und Gal-YAH1) verwendet, in denen Beeinträchtigungen in der Biogenese
von Fe/S Proteinen induziert werden können. In diesen Mutanten wurde jeweils der
endogene Promotor der Gene YAH1, ATM1 und NBP35 durch einen Galaktoseinduzierbaren Promotor (GAL1-10) ersetzt. Das Protein Yah1p (Yeast Adrenodoxin
Homolog) ist eine Komponente der mitochondrialen ISC-Assemblierungsmaschinerie
und an der Reifung aller zellulären Fe/S Proteine beteiligt. Demgegenüber sind der
ABC-Transporter
Atm1p,
eine
Komponente
der
mitochondrialen
ISC-
Exportmaschinerie und die P-Loop NTPase Nbp35p, eine Komponente der CIAMaschinerie, spezifisch in der Biogenese von extra-mitochondrialen Fe/S Proteinen
involviert. Die Transkriptom-Analysen erfolgten unter Verwendung von cDNA- 85 -
Ergebnisse
Microarrays, die 6240 Gene des S. cerevisiae Genoms enthalten. Gal-YAH1, GalATM1 und Gal-NBP35 Zellen wurden in Minimalmedium mit Glukose kultiviert, um
die zellulären Konzentrationen von Yah1p, Atm1p bzw. Nbp35p zu depletieren. Das
Minimalmedium enthielt als weitere Komponenten die Aminosäuren Histidin, Leucin,
Tryptophan und Lysin sowie die Basen Adenin und Uracil. Wildtypzellen wurden
parallel
im
gleichen
Wachstumsphase
Medium
wurde
angezogen.
Gesamt-RNA
Aus
isoliert
Zellen
(4.12.2)
der
und
exponentiellen
zur
Synthese
fluoreszenzmarkierter cDNA Sonden eingesetzt (4.14.1). Die cDNAs aller Ansätze
wurden jeweils mit dem gelb-fluoreszierenden Cy3 und dem orange-fluoreszierenden
Cy5 Farbstoff markiert („flip-flop“ Markierung). Zum Vergleich der cDNAs aus
Wildtypzellen und Mutante wurden unterschiedlich markierte Sonden gemischt und
an DNA-Microarrays hybridisiert (4.14.2). Anschließend wurde die Fluoreszenz der
Microarrays mit einem Array-Scanner analysiert und dokumentiert. Die Auswertung
erfolgte mit dem Programm ImaGene 3.0 (4.14.3). Für die Gesamt-Auswertung
wurden die Ergebnisse aus zwei biologischen Replikaten (d.h. zwei unterschiedliche
RNA-Präparationen) miteinander kombiniert. Jedes biologische Replikat wurde in
Doppelbestimmung durchgeführt. Die Ergebnisse sind in den folgenden zwei
Kapiteln zusammengestellt.
5.3.1. Die Depletion von Nbp35p resultiert
Veränderung der Genexpression
in
einer
schwachen
Das Transkriptionsprofil einer Nbp35p-depletierten Zelle unterscheidet sich nur wenig
gegenüber Wildtypzellen. Insgesamt wurden 117 Gene mit einem 1,5- bis maximal
2,6-fachen Expressionsunterschied identifiziert. Daruter wurden auffällig viele YElemente induziert, die im subtelomeren Bereich der Chromosomen lokalisiert sind
und deren Produkte teilweise Helikase Aktivität besitzen (Tab. 2). Möglicherweise
übernehmen diese eine Funktion bei der Erhaltung der Telomeren in Telomerasedefizienten Zellen. Y-Elemente werden außerdem bei Stickstoffmangel, während der
stationären Phase oder in alternden Zellen induziert (Lesur & Campbell, 2004). In
Nbp35p-depletierten Zellen ist dieses Expressionsverhalten möglicherweise die
Reaktion einer sterbenden Zelle, da das Protein zum Überleben der Hefe benötigt
wird.
Die schwache, aber gehäufte Reprimierung von Genen, die für Untereinheiten
mitochondrialer Ribosomen und der F1FO-ATP-Synthase kodieren, deutet auf eine
mitochondriale Reaktion hin. Ähnliche Beobachtungen wurden in Zellen gemacht, die
- 86 -
Ergebnisse
ihren Stoffwechsel von Respiration auf Fermentation umstellen. Neben zahlreichen
Genen, die für Hexose-Transporter kodieren, wurde auch das CIT2 Gen induziert,
dessen Produkt eine peroxisomale Citrat-Synthase ist. Dieses Gen wird auch in
Zellen exprimiert, die einen respiratorischen Defekt aufweisen (Butow & Avadhani,
2004). Die Ursache für dieses Expressionsverhalten ist unklar, denn Nbp35pdepletierte Zellen besitzen keine signifikanten Beeinträchtigungen mitochondrialer
Enzymaktivitäten
(Tab.
1).
Eine
einfache
Methode,
die
Funktionalität
der
Mitochondrien zu testen, besteht darin, das Wachstum von Zellen auf nichtfermentierbaren
Kohlenstoffquellen
(z.B.
Glycerin)
zu
beobachten.
Nbp35p-
depletierte Zellen entwickelten auf Glycerin keinen Wachstums-Phänotyp und
besitzen daher funktionstüchtige Mitochondrien (Abb. 8).
In Nbp35p-depletierten Zellen wurde erstaunlicherweise trotz massiver Störungen in
der Reifung von extra-mitochondrialen Fe/S Proteinen lediglich das Gen ISU2
induziert,
dessen
Produkt
eine
zentrale
Komponente
der
ISC-
Assemblierungsmaschinerie ist (Abb. 3).
Die Induktion von SUL1, welches für eine Sulfat-Permease in der Plasmamembran
kodiert, könnte auf ein Problem in der Sulfat-Assimilierung hindeuten. An diesem
Prozess ist ein cytosolisches Fe/S Cluster-tragendes Protein beteiligt, die SulfitReduktase, deren Funktion in Zellen mit einem Defekt in der Reifung von extramitochondrialen Fe/S Proteinen beeinträchtigt ist. Auch die für Permeasen
kodierenden BAP2 und BAP3 Gene wurden induziert. Die Permeasen sind u.a. an
der Aufnahme von verzweigtkettigen Aminosäuren (Leucin, Isoleucin und Valin)
beteiligt (Regenberg et al., 1999). Möglicherweise ist dieses Transkriptionsverhalten
auf den Aktivitätsverlust des cytosolischen Fe/S Proteins Isopropylmalat-Isomerase
(Leu1p)
zurückzuführen.
Zusammenfassend
zeigen
diese
Daten,
dass bei
Funktionsstörungen der CIA-Maschinerie in S. cerevisiae das Expressionsmuster nur
geringfügig von dem einer Wildtypzelle abweicht.
- 87 -
Ergebnisse
Gal-YAH1
(2.8 -126)
Gal-ATM1
(2.0-128)
Gal-NBP35
(1.5 -2.6)
Eisen-Regulon (unter Aft1p/Aft2p Kontrolle)
Fe/S Protein-Biogenese
Häm-Biosynthese, Abbau und Häm Proteine
Respiration und Zitronensäurezyklus
Ergosterol-Biosynthese
Glukose-Transport and Fermentation
Aminosäure-Stoffwechsel
Paarungsfaktor Antwort
Y-Elemente
Retrograde response
20
0
20
20
0
20
20
0
20
Anzahl regulierter Gene
reprimierte Gene
induzierte Gene
Abb. 15: Veränderung des Expressionsmusters bei Störungen in der Biogenese von Fe/S
Proteinen. Gene wurden in Funktionsklassen eingeteilt. Angegeben ist die Anzahl regulierter Gene
pro Funktionsklasse und das Vielfache der Veränderung der Genexpression im Vergleich zu
Wildtypzellen (angegeben in Klammern). Detailiertere Angaben zur Genexpression einzelner Gene
sind in den Tabellen 2-4 nachzulesen. Repräsentative Vertreter der drei Fe/S Protein-BiogeneseMaschinerien wurden depletiert und die Auswirkungen auf die Genexpression analysiert. Hierzu
wurden drei regulierbare Mutanten (Gal-YAH1, Gal-ATM und Gal-NBP35) verwendet, in denen
Beeinträchtigungen in der Biogenese von Fe/S Proteinen induziert werden können.
Tab. 2: Auswahl induzierter und reprimierter Gene in Nbp35p-depletierten Zellen
Durchschnittliche
Expressionsveränderung
ORF
Gal-NBP35
Gen
Annotation
YRF1
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Y helicase (subtelomerically-encoded)
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Similar to other subtelomerically-encoded proteins
Y-Elemente
YEL075C
YGR296W
YHL050C
YIL177C
YLR464W
YLR466W
YML133C
YNR075W
YPR202W
YPR203W
YPR204W
COS10
- 88 -
1,72
1,67
2,00
-1,56
1,98
2,00
1,92
1,63
1,89
1,78
2,01
Ergebnisse
Durchschnittliche
Expressionsveränderung
ORF
Gen
Gal-NBP35
Annotation
Mitochondriale ribosomale Untereinheiten
YDR041W
YGL068W
YBR282W
YBR268W
YKL170W
YJL096W
RSM10
MNP1
MRPL27
MRPL37
MRPL38
MRPl49
Ribosomal protein; mitochondrial
Similar to ribosomal proteins
Ribosomal protein; mitochondrial L27
Ribosomal protein; mitochondrial L37
Ribosomal protein; mitochondrial L38
Ribosomal protein; mitochondrial large subunit
-1,73
-1,79
-1,74
-1,54
-1,61
-1,62
Glukose-Transport und Fermentation
YHR096C
YNR072W
YPL061W
HXT5
HXT17
ALD6
Hexose permease
Hexose permease
Aldehyde dehydrogenase
1,65
1,58
1,93
MAM33
ATP11
ATP12
SDH3
Mitochondrial acidic matrix protein
F1F0-ATPase complex assembly protein
F1F0-ATPase complex assembly (molecular chaperone)
Succinate dehydrogenase cytochrome b
-1,71
-1,62
-1,59
-1,66
Peroxisomal citrate synthase
1,88
Respiration
YIL070C
YNL315C
YJL180C
YKL141W
Zitronensäurezyklus
YCR005C
CIT2
Eisen-abhängige Proteine
YMR319C
FET4
Iron transporter
-1,63
Scaffold protein
1,52
ATP sulfurylase
Sulfate permease
1,57
2,67
Fe/S Protein-Biogenese
YOR226C
ISU2
Sulfat-Aufnahme
YJR010W
YBR294W
MET3
SUL1
Aminosäure-Stoffwechsel
YKL029C
YDR368W
YBR068C
YDR046C
YDR508C
YNL268W
YER081W
MAE1
YPR1
BAP2
BAP3
GNP1
LYP1
SER3
Precursor for synthesis of several amino acids
2-methylbutyraldehyde reductase
Branched-chain amino acid Permease
Branched-chain amino acid Permease
Glutamine permease
Lysine permease
3-phosphoglycerate dehydrogenase
1,56
-1,98
1,56
1,61
1,66
1,61
-1,72
A-factor precursor
-1,98
Repressible acid phosphatases
Serine/threonine protein kinase
-2,10
-1,73
Paarungsfaktor Antwort
YDR461W
MFA1
Protein Modifikation
YBR093C
YBR097W
PHO5
VPS15
Purin/Pyrimidin-Biosynthese
YAR015W
YLR359W
YMR120C
YMR271C
ADE1
ADE13
ADE17
URA10
SAICAR-synthetase
Adenylosuccinate lyase
AICAR-transformylase
Orotate phosphoribosyltransferase
- 89 -
-1,77
-1,52
-1,94
-1,79
Ergebnisse
Durchschnittliche
Expressionsveränderung
ORF
Gen
Gal-NBP35
Annotation
Multidrug Resistenz Transporter
YOR153W
PDR5
Multidrug resistance transporter
2,19
Die Genexpressionsdaten der Mutanten sind relativ zur Expression in Wildtypzellen angegeben. Der
Mittelwert basiert auf zwei biologischen Replikaten (insgesamt vier Arrays). Differentiell regulierte
Gene wurden in Funktionsklassen eingeteilt. Eine im Vergleich zu Wildtypzellen reprimierte
Genexpression wurde mit einem (-) Zeichen angegeben.
5.3.2. Veränderte Genexpression durch Depletion von Atm1p und Yah1p
In Yah1p- und Atm1p-depletierten Zellen wurden jeweils über 200 Gene identifiziert,
die mindestens eine 2-fach veränderte Expression gegenüber Wildtypzellen
aufwiesen (Tab. 3). Im Gegensatz zu Nbp35p-depletierten Zellen, zeigten Yah1pund Atm1p-depletierte Zellen ein weitgehend übereinstimmendes Expressionsmuster
(Abb. 15). Erwartungsgemäß wurden zahlreiche Gene des Eisen-Regulons induziert,
welche durch die Eisen-abhängigen Transkriptionsfaktoren Aft1p/Aft2p reguliert
werden. Die Gene des Eisen-Regulons werden sowohl bei einem Eisenmangel als
auch bei Störungen in der Funktion der mitochondrialen ISC-Maschinerien induziert
(Chen et al., 2004; Rutherford et al., 2005). Das Eisen-Regulon beinhaltet
überwiegend Gene, deren Produkte eine Funktion in der Eisen-, aber auch Kupferund Biotinaufnahme ausüben (Rutherford et al., 2003). Auch die Depletion weiterer
Komponenten der mitochondrialen ISC-Assemblierungsmaschinerie (Grx5p, Nfs1p
und Yfh1p) führte zur Induktion dieser Gene (Belli et al., 2004; Foury & Talibi, 2001;
Li et al., 1999). Darüber hinaus induzierten Atm1p- und Yah1p-depletierte Zellen
weitere Gene, deren Produkte an der Eisenaufnahme beteiligt sind, die jedoch bis
jetzt noch nicht als Aft1p/Aft2p-abhängige Gene identifiziert wurden.
Zahlreiche Gene, die für Untereinheiten der Komplexe II, III, IV, der ATP-Synthase
und der Cytochrom c Isoformen kodieren, wurden reprimiert (Tab. 3). In Yah1pdepletierten Zellen könnte die Ursache ein respiratorischer Defekt sein, da das
Protein neben einer Funktion in der Fe/S Protein-Biogenese auch essentiell an der
Synthese von Häm A (Cofaktor der Cytochrom c Oxidase) beteiligt ist. Die Ursache
warum Atm1p-depletierte Zellen zahlreiche Gene der Respiration reprimieren ist
weniger offensichtlich, da keine signifikanten Veränderungen in der Reifung
mitochondrialer Fe/S Proteine auftreten. Zudem sind diese Zellen auf Vollmedium
respiratorisch kompetent (Kispal et al., 1999). Demgegenüber wurden ∆atm1 Zellen
- 90 -
Ergebnisse
bei einer genetischen Suche nach Mutanten mit einem Cytochrom-Defekt isoliert.
Dieser Cytochrom-Defekt ist vermutlich sekundär und die Folge eines Atm1p
Mangels (Kispal et al., 1997; Kispal et al., 1999). Offensichtlich deutet sich in Atm1pdepletierten Zellen bereits auf Transkriptionsebene ein Atmungsdefekt an, welcher
sich auf Proteinebene aber noch nicht manifestiert hat (Vollmedium-Bedingungen).
Zahlreiche Gene, die für Hexose-Transporter und für Glukose-Stoffwechselproteine
kodieren, wurden in beiden Mutanten gleichermaßen induziert. Dies könnte
bedeuten, dass die Zelle auf fermentativen Stoffwechsel umschaltet. In diesem
Kontext passt auch die differentielle Expression von Genen, deren Produkte im
Zitronensäurezyklus eine Funktion ausüben.
Yah1p-depletierte Zellen exprimierten einen Satz von Genen (sog. „retrograde
response“), ähnlich dem einer respiratorisch defizienten Zelle (Tab. 3) (Epstein et al.,
2001). Dieses Expressionsverhalten ist nicht verwunderlich, da Yah1p, wie oben
beschrieben, an der Biogenese von Fe/S Clustern und Häm A (Cytochrom c
Oxidase) beteiligt ist. Demzufolge könnten auch Yah1p-depletierte Zellen eine
respiratorische Defizienz entwickeln, die auf einen Mangel an Cofaktoren in der
Atmungskette zurüchzuführen ist. Yah1p-depletierte und respiratorisch defiziente
Zellen induzieren u.a. CIT2, DIP5 und PYC1, welche für eine peroxisomale CitratSynthase, einen Glutamat/Aspartat-Transporter in der Plasmamembran bzw. eine
Pyruvat-Carboxylase kodieren. Diese Produkte sind mit peroxisomalen Aktivitäten
und anaplerotischen Reaktionswegen assoziiert.
Ähnlich wie in Nbp35p-depletierte Zellen zeigten auch Yah1p- und Atm1p-depletierte
Zellen kaum differentiell exprimierte Gene der Fe/S Protein-Biogenese. Diese
induzierten nur die Gene ISU1 und ISU2, deren Produkte zentrale Komponenten in
der Biogenese von Fe/S Proteinen darstellen. Die Reprimierung von LEU1, dessen
Produkt ein Fe/S Protein ist, könnte in Atm1p-depletierten Zellen auf eine gestörte
extra-mitochondriale Fe/S Protein-Biogenese zurückzuführen sein.
Sowohl in Atm1p- als auch in Yah1p-depletierten Zellen wurden auffällig viele Gene
reprimiert, die für Häm-haltige Proteine kodieren. Neben den Genen der Respiration
war dies CTT1 (cytosolische Katalase), YHB1 (mitochondriales Flavohämoglobin)
und CYB5 (Cytochrom der Ergosterol-Biosynthese). Dagegen wurden NCP1 und
HAP1 induziert. NCP1 kodiert für ein Cytochrom P450 mit einer Funktion in der
Ergosterol-Biosynthese und HAP1 für einen Häm-abhängigen Transkriptionsfaktor.
Trotz der transkriptionellen Veränderungen von Genen, die für Häm-haltige Proteine
- 91 -
Ergebnisse
kodieren, wurde nur das HEM15 Gen 5-fach (in Gal-YAH1) und 2,8-fach (in GalATM1) reprimiert. HEM15 kodiert für eine Ferrochelatase, welche den letzten Schritt
der Häm-Biosynthese katalysiert, die Einlagerung von reduzierten Eisen in
Protoporphyrin IX. Demgegenüber wurden Gene deren Produkte an der Synthese
von Porphyrinen beteiligt sind nicht differentiell exprimiert, abgesehen von HEM13,
welches für eine Coproporphyrinogen-III-Oxidase kodiert und in Yah1p-depletierten
Zellen 2-fach reprimiert wurde. Das HMX1 Gen, dessen Produkt eine putative HämOxygenase ist, wurde stark induziert (7,8-fach in Yah1p- und 7-fach in Atm1pdepletierten Zellen), (Protchenko & Philpott, 2003). Die Reprimierung von HEM15
(Häm-Synthese) in Kombination mit der Induktion von HMX1 (Häm-Abbau) deutet
darauf
hin,
dass
Assemblierungs-
es
und
bei
Funktionsstörungen
Exportmaschinerien
zu
der
mitochondrialen
beachtlichen
ISC-
intrazellulären
Veränderungen in Bezug auf die Menge und Verteilung von Häm kommt.
Die Depletion von Atm1p und Yah1p führte außerdem zu differentiell exprimierten
Genen mit Funktionen in der Biosynthese von Ergosterol, Biotin und im
Metabolismus diverser Aminosäuren. In S. cerevisiae werden die Gene der
Ergosterol-Biosynthese durch Eisen reguliert (Shakoury-Elizeh et al., 2004), so dass
das veränderte Expressionsverhalten in Atm1p- und Yah1p-depletierten Zellen
primär auf eine gestörte Eisenhomeostase zurückzuführen sein könnte. Das Gen
VHT1 kodiert für einen Biotin-Transporter in der Plasmamembran und das Produkt
des Gens BIO5 ist an der Synthese einer Biotin-Vorstufe beteiligt. Beide Gene
werden durch den Eisen-abhängigen Transkriptionsfaktor Aft1p reguliert. Alternativ
könnten die transkriptionellen Veränderungen in der Biotin-Synthese auf einen
Defekt in der Fe/S Protein-Biogenese zurückzuführen sein, da an der Biosynthese
von Biotin ein Fe/S Protein (Bio2p) beteiligt ist. Dies ist aber wenig wahrscheinlich,
da Bio2p ein mitochondriales Protein ist, dessen Reifung in Atm1p-depletierten
Zellen nicht beeinträchtigt sein sollte. Die veränderte Genregulation ist daher
wahrscheinlich primär auf eine Störung in der Eisenhomeostase zurückzuführen.
Diverse Gene, die am Metabolismus der Aminosäuren beteiligt sind, zeigten ein zu
Wildtypzellen verändertes Transkriptionsprofil. Diesbezüglich war der Effekt in
Atm1p-depletierten Zellen in der Regel deutlicher als in Yah1p-depletierten Zellen.
Es waren vorwiegend Gene betroffen, die für Proteine der Aufnahme und
Biosynthese von verzweigtkettigen Aminosäuren kodieren. Hier sind die Gene BAP2,
BAT2 und LEU1 zu nennen. Die Ursache könnte ein Defekt in der Biosynthese des
Fe/S Proteins Leu1p sein. In Atm1p-depletierten Zellen wurden die Gene des Lysin-,
- 92 -
Ergebnisse
Arginin- und Glycinstoffwechsels differentiell exprimiert. Die Ursache hierfür ist
unklar, könnte aber auf die Induktion des Transkriptionsfaktor GCN4 zurückzuführen
sein, welcher die Genexpression bei einem generellen Aminosäuremangel zentral
steuert. Gene die bei der Assimilierung von Schwefel eine Rolle spielen wurden in
Atm1p-, Yah1p- und auch in Nbp35p-depletierten Zellen differentiell zu Wildtypzellen
exprimiert. Möglicherweise ist dieses Transkriptionsverhalten auf einen Defekt in der
Reifung des cytosolischen Fe/S Proteins Sulfit-Reduktase zurückzuführen. Die in der
Tabelle
3
unter
der
funktionellen
Kategorie
„Paarungsfaktor
Antwort“
zusammengefassten Gene wurden weitaus zahlreicher in Yah1p-depletierten Zellen
differentiell exprimiert. Bei diesen handelt es sich um Gene, die für transponierende
Elemente kodieren und die gewöhnlich durch hohe Konzentrationen eines der beiden
Paarungsfaktoren induziert werden können. Die physiologische Bedeutung in diesem
Zusammenhang bedarf weiterer Untersuchungen. Die Tabellen 2, 3 und 4 zeigen nur
eine Auswahl der in Yah1p-, Atm1p- und Nbp35p-depletierten Zellen differentiell
exprimierten Gene. Die vollständigen Datensätze befinden sich auf der Internetseite
des Instituts für Zytobiologie und Zytopathologie (www.uni-marburg.de/cyto/).
Tab. 3: Auswahl induzierter oder reprimierter Gene in Yah1p- und Atm1p-depletierten Zellen
Durchschnittliche
ExpressionsVeränderung
ORF
Gen
Annotation
GalYAH1
GalATM1
33,22
52,52
5,97
14,61
17,36
30,11
4,06
14,52
2,05
2,49
13,39
Eisen-Regulon (unter Aft1p/Aft2p Kontrolle)
YHL040C
YHL047C
YEL065W
YOL158C
YNL259C
YDR270W∗∗
YMR058W
YMR319C
YFL041W
YDR534C
YOR382W
YOR383C
YLR214W
YKL220C
YOR381W
YOR384W
YBR207W
YER145C
YLR136C
YDR264C
YDR271C
ARN1
ARN2
SIT1/ARN3
ENB1/ARN4
ATX1
CCC2
FET3
FET4
FET5
FIT1
FIT2
FIT3
FRE1
FRE2
FRE3
FRE5
FTH1
FTR1
CTH2/TIS11
AKR1
Siderophore transporter
Siderophore transporter
Ferrioxamine B permease
Enterobactin transporter
Copper metallochaperone
Cu(2+)-transporting ATPase
Cell surface ferroxidase
Iron transporter
Multicopper oxidase
Retension of siderophore iron
Retension of siderophore iron
Retension of siderophore iron
Ferric (and cupric) reductase
Ferric (and cupric) reductase
Ferric reductase
Putative ferric reductase
Iron transporter
Iron permease
Downregulation of mRNAs
Palmitoyl transferase
Unknown
- 93 -
4,51
31,62
3,49
3,22
126,92
111,26
14,95
5,10
5,80
6,30
4,47
15,40
2,86
2,72
128,55
94,05
17,64
5,44
4,92
4,73
3,25
2,68
9,83
2,93
3,12
2,31
Ergebnisse
Durchschnittliche
ExpressionsVeränderung
ORF
Gen
Annotation
YNR056C
YOR387C
YBR012C
YBR072W
YGR146C
YMR041C
YGR065C
BIO5
Biotin synthesis
Unknown
Unknown
Small heat shock protein
Unknown
Unknown
Biotin transporter
HSP26
VHT1
GalYAH1
4,33
7,07
26,19
4,76
2,95
GalATM1
3,06
-3,32
3,90
4,79
Fe/S Protein-Biogenese
YPL059W
YPL135W
YOR226C
GRX5
ISU1
ISU2
Glutathione-dependent oxidoreduktase
Scaffold protein
Scaffold protein
SDH1
SDH3
SDH4
COR1
RIP1
QCR2
QCR6
QCR7
QCR8
QCR9
QCR10
CYC1
CYC7
CYT1
COX4
COX5A
COX6
COX7
COX15
COX17
NCA3
ATP20
Succinate dehydrogenase flavoprotein subunit
Succinate dehydrogenase cytochrome b
Succinate dehydrogenase anchor subunit
Ubiquinol cyt.-c reductase
Ubiquinol cyt.-c reductase / rieske iron-sulfur protein
Ubiquinol cyt.-c reductase core protein 2
Ubiquinol cyt.-c reductase subunit
Ubiquinol cyt.-c reductase subunit
Ubiquinol cyt.-c reductase subunit VIII
Ubiquinol cyt.-c reductase subunit 9
Ubiqunol cyt. c oxidoreductase complex subunit
Cytochrome-c isoform 1
Iso-2-cytochrome-c
Cytochrome c1
Cytochrome-c oxidase subunit IV
Cytochrome-c oxidase subunit Va
Cytochrome-c oxidase subunit VI
Cytochrome-c oxidase subunit VII
Cytochrome oxidase assembly factor
Copper metallochaperone
Regulates expression of F0F1 ATPase subunits
Mitochondrial ATP synthase subunit
3,91
4,81
-2,01
3,64
2,55
Respiration
YKL148C
YKL141W
YDR178W
YBL045C∗∗
YEL024W
YPR191W∗∗
YFR033C
YDR529C
YJL166W
YGR183C
YHR001W-A
YJR048W∗∗
YEL039C∗∗
YOR065W∗∗
YGL187C
YNL052W
YHR051W
YMR256C
YER141W
YLL009C
YJL116C
YPR020W
-5,04
-3,43
-3,46
-3,36
-6,17
-4,32
-4,52
-4,09
-2,83
-11,41
-3,11
-6,07
-3,53
-3,60
-3,14
-4,53
-3,49
-2,49
-2,50
-2,35
-3,83
-2,83
-2,12
-2,74
-2,23
-2,27
-2,26
-7,76
-2,58
-3,89
-2,38
-2,20
-2,38
-2,10
-2,03
-2,01
3,11
-3,05
Glukose-Transport und Fermentation
YHR094C
YDR345C
YHR092C
YHR096C
YDR343C
YDR342C
YEL069C
YPL026C
YOR374W
YPL061W
HXT1
HXT3
HXT4
HXT5
HXT6
HXT7
HXT13
SKS1
ALD4
ALD6
Hexose permease
Hexose permease
Hexose permease
Hexose permease
Hexose permease
Hexose permease
Hexose permease
Serine / threonine protein kinase
Mitochondrial aldehyde dehydrogenase
Acetaldehyde dehydrogenase
3,79
4,28
4,04
5,33
4,01
3,95
3,44
2,93
3,54
2,17
2,38
2,09
2,00
2,20
2,20
-2,50
Zitronensäurezyklus
YLR304C
YNL037C
ACO1
IDH1
Aconitase
Isocitrate dehydrogenase
- 94 -
8,71
-2,68
2,33
Ergebnisse
Durchschnittliche
ExpressionsVeränderung
ORF
Gen
Annotation
YOR136W
YNR001C
YCR005C
IDH2
CIT1
CIT2
Isocitrate dehydrogenase
Citrate synthase
Peroxisomal citrate synthase
GalYAH1
4,67
GalATM1
-2,07
2,89
Retrograde response
YOR374W
YML042W
YCR005C
YPL265W
YNL037C
YOR136W
YOR222w
YGL026w
ALD4
CAT2
CIT2
DIP5
IDH1
IDH2
ODC2
PYC1
Mitochondrial aldehyde dehydrogenase
Carnitine O-acetyltransferase
Peroxisomal citrate synthase
Glutamate/aspartate permease
Isocitrate dehydrogenase
Isocitrate dehydrogenase
Mitochondrial inner membrane transporter (2-oxoglutarate)
Pyruvate carboxylase isoform
3,54
3,1
2,89
5,30
8,71
4,67
-4,57
1,9
2,33
Häm-Biosynthese, Abbau und Häm-haltige Proteine
YDR044W
YOR176W
YLR205C
YGR088W∗∗
YGR234W∗∗
YNL111C
YHR042W
YJR048W∗∗
YEL039C∗∗
YPR191W∗∗
YOR065W∗∗
YLR256W
YPR065W
Coproporphyrinogen III oxidase
Ferrochelatase (protoheme ferrolyase)
Heme oxygenase
Catalase T (cytosolic)
Flavohemoglobin
Cytochrome b5
NADP-cytochrome P450 reductase
Cytochrome-c isoform 1
Iso-2-cytochrome-c
Ubiquinol cyt.-c reductase core protein 2
Cytochrome c1
Heme-responsive zinc finger transcription factor
Transcriptional repressor
-1,96
-5,25
7,83
-3,18
-5,68
-3,47
4,11
-11,41
-3,11
-4,32
-6,07
4,44
3,11
CYB5
ERG2
ERG3
ERG13
ERG20
ERG28
NCP1/CPR1
Cytochrome b5
C-8 sterol isomerase
C-5 sterol desaturase
3-hydroxy-3-methylglutaryl coenzyme A synthase
Farnesyl-pyrophosphate synthetase
ER membrane protein
NADP-cytochrome P450 reductase
-3,47
4,11
-2,66
-2,19
2,88
-2,11
-2,23
-2,31
2,47
CUP1
CCC1
Metallothionein
2+
2+
Putative vacuolar Fe /Mn transporter
3,00
-3,43
-2,37
General amino acid permease
Argininosuccinate lyase
Asparagine synthetase
Branched-chain amino acid Permease
Carbamoyl phosphate synthetase; arginine specific
Carbamoyl phosphate synthetase
Transcriptional activator
Glycine decarboxylase T subunit
Glycine decarboxylase P subunit
2,83
HEM13
HEM15
HMX1
CTT1
YHB1
CYB5
NCP1/CPR1
CYC1
CYC7
QCR2
CYT1
HAP1
ROX1
-2,87
7,27
-10,72
-2,66
2,47
-7,76
-2,58
-2,83
-3,89
2,39
Ergosterol-Biosynthese
YNL111C
YMR202W
YLR056W
YML126C
YJL167W
YER044C
YHR042W
6,80
Metalle
YHR053C
YLR220W
Aminosäure-Stoffwechsel
YFL055W
YHR018C
YPR145W
YBR068C
YOR303W
YJR109C
YEL009C
YDR019C
YMR189W
AGP3
ARG4
ASN1
BAP2
CPA1
CPA2
GCN4
GCV1
GCV2
- 95 -
2,29
3,23
2,31
3,28
2,50
2,05
2,73
2,22
Ergebnisse
Durchschnittliche
ExpressionsVeränderung
ORF
Gen
Annotation
YAL062W
YEL046C
YOR202W
YGL009C
YCL018W∗
YNL268W
YIR034C
YNR050C
YIL094C
YDL182W
YOR348C
YJR148W
YJL130C
YKR069W
YJR010W
YKL001C
GDH3
GLY1
HIS3
LEU1
LEU2
LYP1
LYS1
LYS9
LYS12
LYS20
PUT4
BAT2
URA2
MET1
MET3
MET14
NADP-glutamate dehydrogenase
L-threonine aldolase
Imidazoleglycerol-phosphate dehydratase
3-isopropylmalate isomerase
Beta-isopropyl-malate dehydrogenase
Lysine permease
Saccharopine dehydrogenase
Saccharopine dehydrogenase
Homo-isocitrate dehydrogenase
Homocitrate synthase
Proline specific-permease
Branched-chain amino acid aminotransferase
Carbamoyl-phosphate synthetase
SAM-uroporphyrinogen III transmethylase
ATP sulfurylase
Adenylylsulfate kinase
GalYAH1
3,07
8,76
2,88
GalATM1
2,00
2,60
-10,88
4,20
2,24
2,79
2,02
2,62
2,53
-2,78
2,03
3,56
3,94
-5,30
-2,15
-3,22
Paarungsfaktor Antwort
YDL223C
YGL032C
YNL145W
YPL156C
YPL187W
YAR009C
YAR010C
YBL005W-A
YBL005W-B
YBL101W-A
YBR012W-A
YCL020W
YER138C
YER160C
YHR214C-B
YJR026W
YJR027W
YML039W
YML040W
YML045W
YMR045C
YMR046C
YMR050C
YMR051C
HBT1
AGA2
MFA2
PRM4
Mating projection
A-agglutinin binding subunit
A-factor precursor
Pheromone-Regulated Membrane protein
Mating factor alpha
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
2,96
-2,99
-4,36
3,22
4,16
9,13
9,81
6,01
4,47
6,82
9,18
7,34
7,55
2,86
4,17
10,58
3,60
3,98
5,87
4,31
5,48
5,83
6,53
6,84
2,51
2,65
2,59
2,50
2,72
2,77
2,54
2,52
Die Genexpressionsdaten der Mutanten sind relativ zur Expression in Wildtypzellen angegeben. Der
Mittelwert basiert auf zwei biologischen Replikaten (insgesamt 4 Arrays). Die regulierten Gene wurden
in Funktionsklassen eingeteilt. Reprimierte Gene sind mit einem (-) Zeichen versehen, Aft1pabhängige sind fett, Aft2p-abhängige sind unterstrichen und Hap1p-abhängige Gene sind mit zwei ∗∗
angegeben. ∗ Marker für genetische Integration des GAL1-10 Promotors.
- 96 -
Ergebnisse
5.3.3. Der Einfluss des Wachstumsmediums auf die Genexpression
Atm1p-depletierter Zellen
Die bereits beschriebenen Transkriptom-Analysen zeigen, dass Atm1p-depletierte
Zellen zahlreiche Gene reprimieren, die für Produkte der Atmungskette kodieren.
Dies lässt auf eine respiratorische Beeinträchtigung schließen, die aus früheren
Studien nicht bekannt war, die allerdings ausschließlich an in Vollmedium kultivierten
Zellen durchgeführt wurden. Es sei vorweggenommen, dass in Minimalmedium
kultivierte Atm1p-depletierte Zellen im Vergleich zu Wildtypzellen eine 2-fach
reduzierte Cytochrom c Oxidase Aktivität besitzen (Abb. 21A), während in
Vollmedium kultivierte Atm1p-depletierte Zellen keinen Aktivitätsverlust aufweisen
(Abb. 21A). Zusätzlich wurden Transkriptom-Analysen an Atm1p-depletierten Zellen
durchgeführt,
die
Gegenüberstellung
in
Voll-
dieser
oder
Minimalmedium
Transkriptionsprofile
zeigt
kultiviert
ein
wurden.
relativ
Eine
ähnliches
Expressionsmuster, wenn auch grundsätzlich weniger Gene in Vollmedium
kultivierten Zellen differentiell exprimiert wurden (Tab. 4). Bei Betrachtung der
funktionellen Kategorie „Respiration“ fällt auf, dass in Vollmedium nur noch 11 Gene
reprimiert werden gegenüber 20 auf Minimalmedium. Dies zeigt, dass Atm1pdepletierte Zellen bereits in Vollmedium einen respiratorischen Defekt andeuten, der
sich allerdings auf Proteinebene noch nicht manifestiert.
Tab. 4: Auswahl induzierter und reprimierter Gene in Atm1p-depletierten Gal-ATM Zellen unter
verschiedenen Kultivierungsbedingungen.
Durchschnittliche
Expressionsänderung
ORF
Gen
Annotation
Gal-ATM1
SD
YPD
17,36
30,11
4,06
14,52
2,05
2,49
13,39
10,19
18,29
Eisen-Regulon (unter Aft1p/Aft2p Kontrolle)
YHL040C
YHL047C
YEL065W
YOL158C
YNL259C
YDR270W∗∗
YMR058W
YMR319C
YFL041W
YDR534C
YOR382W
YOR383C
YLR214W
ARN1
ARN2
SIT1/ARN3
ENB1/ARN4
ATX1
CCC2
FET3
FET4
FET5
FIT1
FIT2
FIT3
FRE1
Siderophore transporter
Siderophore transporter
Ferrioxamine B permease
Enterobactin transporter
Copper metallochaperone
Cu(2+)-transporting ATPase
Cell surface ferroxidase
Iron transporter
Multicopper oxidase
Retension of siderophore iron
Retension of siderophore iron
Retension of siderophore iron
Ferric (and cupric) reductase
- 97 -
2,72
128,55
94,05
17,64
5,44
4,46
9,91
2,62
2,00
143,09
79,46
181,76
Ergebnisse
Durchschnittliche
Expressionsänderung
ORF
Gen
Annotation
Gal-ATM1
SD
YKL220C
YOR381W
YOR384W
YBR207W
YER145C
YLR136C
YDR264C
YDR271C
YNR056C
YOR387C
YBR012C
YBR072W
YGR065C
Ferric (and cupric) reductase
Ferric reductase
Putative ferric reductase
Iron transporter
Iron permease
Downregulation of mRNAs
Palmitoyl transferase
Unknown
Biotin synthesis
Unknown
Unknown
Small heat shock protein
Biotin transporter
4,92
4,73
3,25
2,68
9,83
2,93
3,12
2,31
3,06
-3,32
GRX5
ISU1
ISU2
Glutathione-dependent oxidoreduktase
Scaffold protein
Fe/S protein biogenesis
-2,01
3,64
2,55
SDH1
SDH3
SDH4
COR1
RIP1
QCR2
QCR6
QCR7
QCR8
QCR9
QCR10
COX4
COX5A
COX6
COX7
COX13
COX15
COX17
CYC1
CYC7
CYT1
CCP1
Succinate dehydrogenase flavoprotein subunit
Succinate dehydrogenase cytochrome b
Succinate dehydrogenase anchor subunit
Ubiquinol cyt.-c reductase
Ubiquinol cyt.-c reductase / rieske iron-sulfur protein
Ubiquinol cyt.-c reductase core protein 2
Ubiquinol cyt.-c reductase subunit
Ubiquinol cyt.-c reductase subunit
Ubiquinol cyt.-c reductase subunit VIII
Ubiquinol cyt.-c reductase subunit 9
Ubiqunol cyt.-c oxidoreductase complex subunit
Cytochrome-c oxidase subunit IV
Cytochrome-c oxidase subunit Va
Cytochrome-c oxidase subunit VI
Cytochrome-c oxidase; subunit VII
Cytochrome-c oxidase; subunit Via
Cytochrome oxidase assembly factor
Copper metallochaperone
Cytochrome-c isoform 1
Iso-2-cytochrome-c
Cytochrome-c1
Cytochrome-c peroxidase
-3,49
-2,49
-2,50
-2,35
-3,83
-2,83
-2,12
-2,74
-2,23
-2,27
-2,26
-2,38
-2,20
-2,38
-2,10
FRE2
FRE3
FRE5
FTH1
FTR1
CTH2/TIS11
AKR1
BIO5
HSP26
VHT1
YPD
4,38
3,90
4,79
Fe/S Protein-Biogenese
YPL059W
YPL135W
YOR226C
2,74
Respiration
YKL148C
YKL141W
YDR178W
YBL045C
YEL024W
YPR191W∗∗
YFR033C
YDR529C
YJL166W
YGR183C
YHR001W-A
YGL187C
YNL052W
YHR051W
YMR256C
YGL191W
YER141W
YLL009C
YJR048W∗∗
YEL039C∗∗
YOR065W∗∗
YKR066C
-2,03
-2,01
-7,76
-2,58
-3,89
Glukose-Transport und Fermentation
YGL256W
YER073W
YPL061W
YHR094C
YDR345C
YHR092C
ADH4
ALD5
ALD6
HXT1
HXT3
HXT4
Alcohol dehydrogenase IV
Mitochondrial aldehyde dehydrogenase
Acetaldehyde dehydrogenase
Hexose permease
Hexose permease
Hexose permease
- 98 -
-9,71
2,03
-2,50
2,17
2,38
2,09
-2,56
-2,58
-6,11
-3,76
-3,05
-2,50
-2,76
-9,97
-6,98
-4,28
-2,18
Ergebnisse
Durchschnittliche
Expressionsänderung
ORF
Gen
Annotation
Gal-ATM1
SD
YHR096C
YDR343C
YDR342C
YCL040W
HXT5
HXT6
HXT7
GLK1
Hexose permease
Hexose permease
Hexose permease
Glucokinase
2,00
2,20
2,20
Isocitrate dehydrogenase
Aconitase
Citrate synthase
2,33
-2,68
-2,07
YPD
2,24
Zitronensäurezyklus
YNL037C
YLR304C
YNR001C
IDH1
ACO1
CIT1
Häm-Biosynthese, Abbau und Häm-haltige Proteine
YOR176W
YLR205C
YGR234W∗∗
YNL111C
YHR042W
YJR048W∗∗
YEL039C∗∗
YPR191W∗∗
YOR065W∗∗
YLR256W
YPR065W
Ferrochelatase (protoheme ferrolyase)
Heme-binding peroxidase
Flavohemoglobin
Cytochrome b5
NADP-cytochrome P450 reductase
Cytochrome-c isoform 1
Iso-2-cytochrome-c
Ubiquinol cytochrome-c reductase core protein 2
Cytochrome c1
Heme-dependent transcription factor
Transcriptional repressor
-2,87
7,27
-10,72
-2,66
2,47
-7,76
-2,58
-2,83
-3,89
CYB5
ERG2
ERG3
ERG20
ERG28
NCP1/CPR1
Cytochrome b5
C-8 sterol isomerase
C-5 sterol desaturase
Farnesyl-pyrophosphate synthetase
ER membrane protein
NADP-cytochrome P450 reductase
-2,66
-2,19
2,88
-2,23
-2,31
2,47
CUP1-2
CCC1
COT1
CTR2
ATX2
Metallothionein
Transmembrane transporter; putative
Vacuolar transporter
Copper transporter
Manganese-trafficking protein
HEM15
HMX1
YHB1
CYB5
NCP1/CPR1
CYC1
CYC7
QCR2
CYT1
HAP1
ROX1
-1,76
4,11
-2,18
-9,97
-6,98
-4,28
2,56
2,39
Ergosterol-Biosynthese
YNL111C
YMR202W
YLR056W
YJL167W
YER044C
YHR042W
-2,50
Metalle
YHR055C
YLR220W
YOR316C
YHR175W
YOR079C
-2,00
-2,37
2,61
2,87
2,04
Aminosäure-Stoffwechsel
YHR018C
YPR145W
YBR068C
YOR303W
YJR109C
YEL009C
YDR019C
YMR189W
YOR375C
YEL046C
YOR202W
ARG4
ASN1
BAP2
CPA1
CPA2
GCN4
GCV1
GCV2
GDH1
GLY1
HIS3
Argininosuccinate lyase
Asparagine synthetase
Branched-chain amino acid Permease
Carbamoyl phosphate synthetase; arginine specific
Carbamoyl phosphate synthetase
Transcriptional activator
Glycine decarboxylase T subunit
Glycine decarboxylase P subunit
Glutamate dehydrogenase
L-threonine aldolase
Imidazoleglycerol-phosphate dehydratase
- 99 -
2,29
3,23
2,31
3,28
2,50
2,05
2,73
2,22
-2,33
2,00
2,60
Ergebnisse
Durchschnittliche
Expressionsänderung
ORF
Gen
Annotation
Gal-ATM1
SD
YPD
-8,08
YGL009C
LEU1
3-isopropylmalate isomerase
-10,88
YCL018W∗
YNL268W
YIR034C
YNR050C
YIL094C
YDL182W
YOR348C
YHR208W
YJR148W
Yer175C
YJR010W
YKL001C
LEU2
LYP1
LYS1
LYS9
LYS12
LYS20
PUT4
BAT1
BAT2
TMT1
MET3
MET14
Beta-isopropyl-malate dehydrogenase
Lysine permease
Saccharopine dehydrogenase
Saccharopine dehydrogenase
Homo-isocitrate dehydrogenase
Homocitrate synthase
Proline specific-permease
Transaminase
Branched-chain amino acid aminotransferase
Trans-aconitate methyltransferase
ATP sulfurylase
Adenylylsulfate kinase
4,20
2,24
2,79
2,02
2,62
2,53
-2,78
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
Transposable element gene
2,51
2,65
2,59
2,50
2,72
2,77
2,54
2,52
3,25
2,82
-2,41
2,03
5,84
-2,15
-3,22
4,60
Paarungsfaktor Antwort
YAR010C
YBL005W-A
YBR012W-A
YJR026W
YML040W
YML045W
YMR046C
YMR051C
Die Genexpressionsdaten der Mutanten sind relativ zur Expression in Wildtypzellen angegeben. Der
Mittelwert basiert auf zwei biologischen Replikaten (insgesamt 4 Arrays). Die regulierten Gene wurden
in Funktionsklassen eingeteilt. Reprimierte Gene sind mit einem (-) Zeichen versehen, Aft1pabhängige sind fett, Aft2p-abhängige sind unterstrichen und Hap1p-abhängige Gene sind mit zwei ∗∗
angegeben. ∗ Marker für genetische Integration des GAL1-10 Promotors.
5.3.4. Die Reprimierung von Genen der Atmungskette in Yah1p- und
Atm1p-depletierten Zellen wird durch einen Defekt der Atmung
und durch Eisenmangel hervorgerufen
Die Induktion des Eisen-Regulons in Atm1p- und Yah1p-depletierten Zellen ist auf
die Aktivierung des Transkriptionsfaktors Aft1p zurückzuführen. Der Grund für die
Reprimierung so vieler Gene mit einer Funktion in der Respiration ist hingegen noch
ungeklärt. Ob Eisenmangel, ein Defekt in der Atmung oder in der Häm-Biosynthese
für die Reprimierung dieser Gene verantwortlich ist, wird im Folgenden dargestellt.
Die
transkriptionelle
Aktivität
respiratorischer
Gene
unter
den
jeweiligen
experimentellen Bedingungen erfolgte durch Messung der Promoteraktivität des
Gens CYC1, welches für ein Cytochrom c kodiert und das in allen durchgeführten
Transkriptom-Analysen deutlich reprimiert wurde (Tab. 3). Zunächst wurde ein
Reporterplasmid erzeugt, mit dem das grün-fluoreszierende Protein (GFP) unter der
- 100 -
Ergebnisse
Kontrolle des CYC1 Promotors in Hefe exprimiert werden konnte. Durch PCR
wurden 1 kb der CYC1 Promotorregion amplifiziert und in das Plasmid pHK252
ligiert. Dieses enthielt bereits die kodierende GFP Sequenz (4.8). Im Folgenden wird
das so entstandene Reporterplasmid als pCYC1-GFP bezeichnet. Neben Gal-ATM1
und Gal-YAH1 wurde eine weitere ISC Mutante (Gal-SSQ1) mit diesem Plasmid
transformiert und in Minimalmedium unter reprimierenden Bedingungen kultiviert.
SSQ1 kodiert für ein in der mitochondrialen Matrix lokalisiertes Hsp70 Chaperon mit
einer Funktion in der Fe/S Cluster Biogenese. Die Promotoraktivität des CYC1 Gens
konnte durch GFP-spezifische Fluoreszenzemission der Zellen detektiert werden
(4.17.1). Die CYC1 Promotoraktivität in Yah1p- und Atm1p-depletierten Zellen
reduzierte sich im Vergleich zu Wildtypzellen um das 3-fache und in Ssq1pdepletierten Zellen um das 4-fache (16A). Offensichtlich ist die Reprimierung von
Genen, die für Komponenten der Atmungskette kodieren ein Merkmal aller ISC
Mutanten. Um zu untersuchen, ob das Verhalten der Zellen durch einen Defekt in der
Atmung hervorgerufen wird, wurde das pCYC1-GFP Reporterplasmid zusätzlich in
die Deletionsstämme ∆aco1, ∆cyt2 und ∆sod1 transformiert. Allen Stämmen ist ein
Defekt der Atmung gemeinsam, der allerdings unterschiedliche Ursachen hat. In
∆aco1 Zellen ist der Zitronensäurezyklus gestört, da diese keine mitochondriale
Aconitase synthetisieren können. Der ∆cyt2 Stamm kann keinen funktionellen
respiratorischen Komplex III mehr zusammensetzen, da das kodierende Gen der
Cytochrom c1
Häm-Lyase
fehlt.
Im
∆sod1
Stamm
wurde
das
Gen
der
mitochondrialen Superoxid-Dismutase deletiert, welche die Zelle vor oxidativen
Stress bewahrt. Alle untersuchten Stämme zeigten ein ähnliches Expressionsmuster,
d.h. eine im Vergleich zu Wildtypzellen verringerte CYC1 Promotoraktivität (Abb.
16B). Daraus lässt sich ableiten, dass alle Zellen mit einem Defekt der Atmung
diesen Phänotyp hervorrufen. Dieser lässt sich auch durch mitochondriale DNA
Schäden verursachen (Butow & Avadhani, 2004). Allerdings zeigten die untersuchten
respiratorischen Defektmutanten mit einer im Vergleich zu Wildtypzellen 2,2 bis 2,6fachen Abnahme der GFP-spezifischen Fluoreszenzemission einen geringeren Effekt
als Mutanten mit Defekten in der Fe/S Protein-Biogenese (Abb. 16B). Es ist daher
wahrscheinlich, dass ein Atmungsdefekt nicht der einzige Grund für den Phänotyp in
Atm1p- und Yah1p-depletierten Zellen sein kann.
Es wurde bereits gezeigt, dass auch ein Eisenmangel in S. cerevisiae die Gene,
welche Komponenten der Atmungskette kodieren, reprimiert (Puig et al., 2005). Dies
- 101 -
Ergebnisse
erscheint sinnvoll, da Eisen als Teil eines Fe/S Clusters oder Häm-Moleküls ein
wichtiger Bestandteil der mitochondrialen Atmungskette ist und Eisenmangel folglich
mit einer Abnahme der respiratorischen Leistung einhergeht. Die Reprimierung der
Gene ACO1 (Aconitase) und RIP1 (Rieske Fe/S Protein) könnte folglich durch einen
Defekt in der Atmung erklärt werden.
Um zu untersuchen, ob Eisenmangel auch die Aktivität des CYC1 Promotors
beeinflusst, wurden Wildtypzellen, die das pCYC1-GFP Reporterplasmid enthielten in
Gegenwart von Eisen oder des Eisenchelators Bathophenantrolin kultiviert und
hinsichtlich ihrer CYC1 Promotoraktivität analysiert. Eisenmangel resultierte in einer
6-fachen
Verminderung
der
CYC1
Promotoraktivität
(Abb.16C).
Somit
hat
Eisenmangel einen weitaus größeren Einfluss auf die Regulation von Genen, welche
für Produkte der Atmungskette kodieren als z.B. ein Funktionsverlust der Aconitase.
Der
durch
Defekte
von
ISC-Assemblierungs-
oder
Exportkomponenten
hervorgerufene artifizielle Eisenmangel, der sich durch die massive Induktion des
Eisen-Regulons
andeutet,
könnte
somit
ebenfalls
für
die
Reprimierung
respiratorischer Gene in Atm1p- und Yah1p-depletierten Zellen verantwortlich sein.
In wie weit dieser Effekt in ISC Mutanten durch transkriptionelle Regulation oder
durch Defekte der respiratorischen Aktivität der Mitochondrien hervorgerufen wird,
bleibt offen. Vermutlich tragen beide Ursachen zur Reprimierung dieser Gene bei.
- 102 -
Ergebnisse
CYC1-Promotor Aktivität
(Fluoreszenzemission (w.E.))
A
300
200
100
0
WT
Gal- Gal- GalATM1 YAH1 SSQ1
C
300
200
100
0
WT
∆aco1 ∆cyt2 ∆sod1
CYC1-Promotor Aktivität
(Fluoreszenzemission (w.E.))
CYC1-Promotor Aktivität
(Fluoreszenzemission (w.E.))
B
300
200
100
0
WT
+Fe
WT
-Fe
Abb. 16: Die Depletion von Proteinen der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerie verursacht die Reprimierung von Genen der Atmungskette. A) Wildtypzellen
(WT), die regulierbaren Stämme Gal-ATM1, Gal-YAH1, Gal-SSQ1 und (B) ∆aco1, ∆cyt2, ∆sod1 Zellen
wurden mit dem Reporterplasmid pCYC1-GFP transformiert, welches die Expression von GFP unter
der Kontrolle des CYC1 Promotors ermöglicht. Die Stämme wurden in Minimalmedium mit Glukose
kultiviert, um Atm1p, Yah1p und Ssq1p im korrespondierenden Stamm zu depletieren. C)
Wildtypzellen, die das Reporterplasmid pCYC1-GFP enthielten, wurden in Minimalmedium mit
Glukose und in Abwesenheit (WT+Fe) oder mit 50 µM des Eisenchelators Bathophenantrolin kultiviert.
Promotoraktivitäten wurden durch Messung der GFP-spezifischen Fluoreszenzemission bei 513 nm
ermittelt (Anregung bei 480 nm). Die Fehlerbalken geben die Standardabweichung von vier
unabhängigen Messungen an. (w.E., willkürliche Einheiten)
Um zu zeigen, wie stark ein Eisenmangel die Aktivität mitochondrialer Proteine
beeinflusst, wurden Wildtyp-Mitochondrien untersucht, die in Vollmedium mit oder
ohne
Eisenchelator
Bathophenantrolin
kultiviert
wurden.
In
den
isolierten
Mitochondrien wurden die Aktivitäten verschiedener Eisen-abhängiger Enzyme
(Aconitase, Komplex II, Komplex IV und Ferrochelatase) sowie die Aktivität der
Eisen-unabhängigen Malat-Dehydrogenase (Kontrolle) bestimmt. Eisenmangel führte
gegenüber Wildtypzellen ohne Eisenmangel zu einem Aktivitätsverlust der Aconitase
(99%), der Succinat-Dehydrogenase (95%), der Cytochrom c Oxidase (90%) und der
- 103 -
Ergebnisse
Ferrochelatase (77%), (Abb. 17). Die Aktivität der Malat-Dehydrogenase reduzierte
sich hingegen nur um 25%.
Mitochondriale
Enzym Aktivitäten
(%)
80
60
40
20
0
Mdh
Aco
Sdh
Cox
FeCH
-Fe
Abb. 17 Eisenmangel führt zu Aktivitätsverlusten Eisen-abhängiger Enzyme. Mitochondrien
wurden aus Wildtypzellen isoliert, die auf Vollmedium mit (-Fe) oder ohne 80 µM Bathophenantrolin
kultiviert wurden. Die Enzymaktivitäten der angezeigten Proteine wurden bestimmt. Die Angaben
beziehen sich auf die gemessenen Werte in Abwesenheit des Chelators Bathophenantrolin. Mdh:
Malat-Dehydrogenase, Aco: Aconitase, Sdh: Succinat-Dehydrogenase, Cox: Cytochrom c Oxidase,
FeCH: Ferrochelatase. Die Fehlerbalken geben die Standardabweichung von drei unabhängigen
Messungen an.
5.3.5. Die Induktion von FET3 in Atm1p- und Yah1p-depletierten Zellen
ist auf einen Eisenmangel zurückzuführen
Die Transkriptom-Analysen Yah1p- und Atm1p-depletierter Zellen zeigten die
Reprimierung zahlreicher Gene, die für Komponenten der Atmungskette und für
Häm-haltige Proteine kodieren. Daher sollte untersucht werden, ob die Induktion des
Eisen-Regulons in Yah1p- und Atm1p-depletierten Zellen, durch eine gestörte HämBiosynthese oder einen Atmungsdefekt ausgelöst wird. Die Induktion der Gene des
Eisen-Regulons wurde in ∆aco1 (Atmungsdefekt) und Hem15p-depletierten Zellen
(Häm-Biosynthesedefekt) detaillierter untersucht. Zu diesem Zweck wurde ein
Reporterplasmid (pFET3-GFP) verwendet, welches die Expression von GFP unter
der Kontrolle des FET3 Promotors in S. cerevisiae ermöglichte (Rutherford et al.,
2005). FET3 kodiert eine Ferroxidase des hochaffinen Eisenaufnahmesystems und
wird als Teil des Eisen-Regulons durch den Transkriptionsfaktor Aft1p reguliert. Der
FET3 Promotor eignete sich für die folgenden Untersuchungen besonders gut, da die
Transkriptom-Analysen eine starke Induktion des Gens zeigten (13-fach in Atm1pund 31-fach in Yah1p-depletierten Zellen). Das pFET3-GFP Konstrukt wurde in
Wildtyp-,
Gal-HEM15,
und
∆aco1 Zellen
transformiert.
Gal-HEM15
Zellen
exprimierten HEM15 (Häm-Biosynthese) unter der Kontrolle eines Galaktoseinduzierbaren
Promotors
(GAL1-10).
- 104 -
Anhand
der
GFP-spezifischen
Ergebnisse
Fluoreszenzemission konnte die Induktion von FET3 in diesen Mutanten bestimmt
werden. Wildtyp-, Gal-Hem15 und ∆aco1 Zellen wurden in Glukose-haltigem
Minimalmedium mit oder ohne Bathophenantrolin kultiviert. Eisenmangel führte in
Wildtypzellen gegenüber jenen ohne Eisenmangel zu einer ca. 5-fachen Induktion
von FET3 (Abb. 18). In Gegenwart von Eisen wurde FET3 weder in Hem15pdepletierten Zellen noch in ∆aco1 Zellen induziert. Folglich können Defekte in der
Respiration oder der Synthese von Häm keine Induktion des Eisen-Regulons
auslösen. Somit ist allein die verminderte Synthese von Yah1p und Atm1p für die
FET3-Promotor Aktivität
(Fluoreszenzemission (w.E.))
Induktion des Eisen-Regulons verantwortlich.
300
200
100
0
WT
+Fe
WT
-Fe
Gal-HEM15 ∆aco1
+Fe
-Fe +Fe
Abb. 18 Die Induktion von FET3 in Atm1p- und Yah1p-depletierten Zellen ist auf einen
Eisenmangel zurückzuführen. Wildtyp- (WT), Gal-HEM15 und ∆aco1 Zellen, die das
Reporterplasmid pFET3-GFP enthielten, wurden unter reprimierenden Bedingungen in
Minimalmedium mit (-Fe) und ohne (+Fe) Bathophenantrolin kultiviert. Die FET3 Promotoraktivität von
exponentiell wachsenden Zellen wurde durch die Messung der GFP-spezifischen
Fluoreszenzemission bei 513 nm bestimmt. Die Fehlerbalken geben die Standardabweichung von drei
unabhängigen Messungen an. (w.E., willkürliche Einheiten)
5.3.6. Eisenmangel und die Depletion von Yah1p und Atm1p resultieren
in ähnlichen Expressionsmustern
Die folgenden Experimente sollten zeigen, in wie weit die Expressionsmuster von
ISC-Assemblierungs- und Exportmutanten mit denen unter Eisenmangel kultivierten
Zellen übereinstimmen. Zu diesem Zweck wurden Reporterplasmide hergestellt,
welche die Expression der Luziferase unter der Kontrolle diverser Eisen-regulierter
Promotoren in S. cerevisiae ermöglichten. Als Beispiele Eisen-regulierter Gene
wurden BIO2, ERG3, GLT1 und YHB1 gewählt. BIO2 und GLT1 kodieren für die
Fe/S
Proteine
Biotin-Synthase
und
Glutamat-Synthase,
YHB1
für
ein
Flavohämoglobin mit noch unbekannter Funktion und ERG3 kodiert eine C-5 SterolDesaturase mit einer Funktion in der Ergosterol-Biosynthese. Ihre Eisen-abhängige
Expression in S. cerevisiae wurde bereits dokumentiert (Puig et al., 2005; Shakoury-
- 105 -
Ergebnisse
Elizeh et al., 2004). Diese verschiedenen Reporterplasmide zur Promotoranalyse von
BIO2, ERG3, GLT1 oder YHB1 wurden in Wildtypzellen und in die ISC Mutanten
ATM1, YAH1 und SSQ1 transformiert. Die Zellen wurden unter reprimierenden
Bedingungen, d.h. auf Minimalmedium mit Glukose kultiviert. Die Promotoraktivitäten
wurden durch Messung der Luciferase-spezifischen Lichtemission in einem
Szintillationszähler ermittelt und mit denen von Eisen-depletierten Wildtypzellen
verglichen, die parallel im gleichen Medium, jedoch in Gegenwart des Eisenchelators
Bathophenantrolin kultiviert wurden. Die Promotoraktivität des ERG3 Gens stieg im
Vergleich zu Wildtypzellen ohne Eisenmangel 1,8-fach (Gal-ATM1), 2,4-fach (GalYAH1) und 3,6-fach (Gal-SSQ1), (Abb. 19A). Unter Eisenmangel wurde ERG3 auch
in Wildtypzellen 2,2-fach induziert. Sowohl ein Eisenmangel als auch eine
verminderte Synthese der ISC-Komponenten löste eine vergleichbar starke Induktion
des ERG3 Gens aus. Die Analysen der anderen Eisen-regulierten Promotoren
(BIO2, GLT1 und YHB1) ergaben ähnliche Resultate (Abb. 19B-D). Im Vergleich zu
Wildtypzellen ohne Eisenmangel wurde BIO2 4-fach (Gal-ATM1), 2,3-fach (GalYAH1) und 7-fach (Gal-SSQ1) reprimiert. Unter Eisenmangel zeigten auch
Wildtypzellen eine 3-fache Reprimierung der Promotoraktivität des BIO2 Gens (Abb.
19B). GLT1 und YHB1 verhielten sich analog (Abb. 19C-D). In Wildtypzellen unter
Eisenmangel und in Atm1p, Yah1p sowie in Ssq1p-depletierten Zellen reduzierte sich
ebenfalls die Promotoraktivität der Gene GLT1 und YHB1. Einige ISC Mutanten
zeigten eine stärkere Reprimierung als Wildtypzellen unter Eisenmangel, da
vermutlich noch andere Faktoren an der Regulation dieser Gene beteiligt sind.
Prinzipiell bestätigen diese Ergebnisse die Daten der Transkriptom-Analysen von
Atm1p- und Yah1p-depletierten Zellen. BIO2 und GLT1 werden zwar in den Tabellen
2 und 3 nicht aufgeführt, da die Veränderungen der Genexpression unter dem
gewählten Schwellenwert lagen (Gal-YAH1: BIO2 [-1,86] und GLT1 [-1,81]; GalATM1: GLT1 [-1,56]). Allerdings passen diese systematischen Genexpressionsdaten
gut zu den individuellen Ergebnissen der Promotorstudien. Zusammenfassend lässt
sich aus diesen Daten folgern, dass ISC Mutanten größtenteils die selben Gene
reprimieren oder induzieren wie Wildtypzellen unter Eisenmangel.
- 106 -
Ergebnisse
100
75
50
25
0
WT
WT Gal- Gal- Gal-Fe ATM1 YAH1 SSQ1
20
15
10
5
0
WT
WT Gal- Gal- Gal-Fe ATM1 YAH1 SSQ1
D
30
20
10
0
WT
WT Gal- Gal- Gal-Fe ATM1 YAH1 SSQ1
YHB1-Promotor Aktivität
(Lichtemission (w.E.))
C
GLT1-Promotor Aktivität
(Lichtemission (w.E.))
BIO2-Promotor Aktivität
(Lichtemission (w.E.))
B
ERG3-Promotor Aktivität
(Lichtemission (w.E.))
A
80
60
40
20
0
WT
WT
-Fe
Gal- Gal- GalATM1 YAH1 SSQ1
Abb. 19: Die Depletion von Proteinen der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerie verändert die Expression von Eisen-regulierten Genen. Wildtypzellen (WT)
und die regulierbaren Stämme Gal-ATM1, Gal-YAH1, Gal-SSQ1 wurden mit dem Reporterplasmid
p416ERG3-hRluc (A), p416BIO2-hRluc (B), p416GLT1-hRluc (C), p416YHB1-hRluc (D) transformiert.
Die Stämme wurden in Minimalmedium mit Glukose kultiviert, um Atm1p, Yah1p und Ssq1p im
korrespondierenden Stamm zu depletieren. Parallel wurden Wildtypzellen in Minimalmedium mit
(WT-Fe) und ohne 50 µM Bathophenantrolin (WT) kultiviert. Promotoraktivitäten wurden in
exponentiell wachsenden Zellen durch Messung der Luziferase-spezifischen Lichtemission bestimmt.
Die Fehlerbalken geben die Standardabweichung von vier unabhängigen Messungen an. (w.E.,
willkürliche Einheiten) (von U. Mühlenhoff).
Die Transkriptom-Analysen zeigten, wie bereits erwähnt, eine Reprimierung des
Gens HEM15, welches u.a. durch Eisen reguliert wird (Puig et al., 2005). Zur
Bestätigung der Reprimierung von HEM15 wurde eine Northern Blot Analyse
durchgeführt (4.13). Dazu wurde RNA aus Wildtyp-, Atm1p- und Yah1p-depletierten
Zellen
in
einem
denaturierenden
Agarosegel
elektrophoretisch
anschließend auf eine Nylonmembran transferiert und mit einer
aufgetrennt,
32
P-Sonde gegen
HEM15 hybridisiert. In Atm1p- und Yah1p-depletierten Zellen wurde ca. 10-mal
weniger Transkript detektiert als in Wildtypzellen (Abb. 20). In Wildtypzellen, die
unter Eisenmangel kultiviert wurden, war die Menge des Transkripts noch geringer
(Abb. 20). Zur Normalisierung der Hybridiserungsbedingungen wurde eine zweite
Sonde gegen das konstitutiv exprimierte Gen ACT1 verwendet. Da in allen Stämmen
- 107 -
Ergebnisse
vergleichbare Mengen ACT1 Transkript detektiert wurden, konnte die Reprimierung
von HEM15 in Atm1p- und Yah1p-depletierten Zellen durch die Northern Blot
Analyse bestätigt werden. Zusätzlich konnte gezeigt werden, dass auch Eisenmangel
die Transkription von HEM15 inhibiert (Abb. 20).
Aus den Ergebnissen der Transkriptom-Analysen und den Promotorstudien Eisenabhängiger Gene lässt sich schließen, dass sowohl Eisenmangel als auch Störungen
der mitochondrialen ISC-Assemblierungs- und Exportmaschinerien zu einem
ähnlichen Expressionsverhalten führen (Abb. 19).
WT
WT
-Fe
GalGalATM1 YAH1
HEM15
ACT1
Abb. 20: Northern Blot Analyse von HEM15 in Eisen-, Atm1p- und Yah1p-depletierten Zellen.
Gal-ATM1 und Gal-YAH1 Zellen wurden unter reprimierenden Bedingungen in Minimalmedium und
Wildtypzellen wurden in Minimalmedium mit Glukose und mit (WT-Fe) oder ohne (WT) 50 µM
Bathophenantrolin kultiviert. Gesamt-RNA wurde aus exponentiell wachsenden Zellen isoliert, in
32
einem Agarosegel aufgetrennt, anschließend auf eine Nylonmembran transferiert und mit einer Pmarkierten HEM15 und ACT1 Sonde hybridisiert.
5.4. Atm1p- und Yah1p-depletierte Zellen besitzen einen HämSynthesedefekt
5.4.1. Die Depletion von Atm1p und Yah1p führt
Aktivitätsverlust von Proteinen mit Häm-Cofaktoren
zu
einem
Das nächste Experiment sollte klären, ob die Reprimierung von Genen, die für
Proteine mit Häm-Cofaktoren kodieren, auch einen physiologischen Effekt auf die
Menge an zellulärem Häm bzw. auf die Aktivität Häm-abhängiger Enzyme ausübt.
Daher wurden zunächst die Enzymaktivitäten der Häm-haltigen Cytochrom c
Oxidase und Katalase sowie der Häm-unabhängigen Alkohol-Dehydrogenase als
Kontrolle gemessen (s 4.15.3.4, 4.15.4.3, 4.15.4.2). Wildtyp-, Gal-ATM1 und GalYAH1 Zellen wurden in Minimal- und Vollmedium (nur Wildtyp- und Gal-ATM1 Zellen)
mit Glukose kultiviert (reprimierende Bedingungen), um Mitochondrien und postmitochondrialen
Überstand
zu
isolieren.
Die
Aktivität
der
mitochondrialen
Cytochrom c Oxidase (Komplex IV), einem Häm-haltigen, aber nicht Fe/S Clustertragenden Protein, verminderte sich im Vergleich zu Wildtypzellen 2-fach (Gal-ATM1)
bzw. 4-fach (Gal-YAH1) (Abb. 21A). Der Aktivitätsverlust korrelierte mit der
- 108 -
Ergebnisse
reduzierten Cox4p (Untereinheit 4 der Cytochrom c Oxidase) Proteinmenge sowohl
in Atm1p- als auch in Yah1p-depletierten Zellen (Abb. 21D). In Vollmedium hatte die
Aktivität der Cytochrom c Oxidase Wildtyp Niveau (Abb. 21A). Der Häm-Defekt
Atm1p-depletierter Zellen ist daher offensichtlich sekundär, da er nur unter
bestimmten Wachstumsbedingungen auftrat. Als nächstes wurde die Aktivität der
Katalase bestimmt. Dieses Häm-haltige Protein ist in S. cerevisiae sowohl im Cytosol
als auch in den Peroxisomen lokalisiert und beseitigt übermäßig anfallendes
Wasserstoffperoxid. Die Aktivität der Katalase reduzierte sich 4-fach (in Gal-ATM1)
und 11-fach (in Gal-YAH1) gegenüber Wildtypzellen (Abb. 21B). Als Kontrolle wurde
die Aktivität der Alkohol-Dehydrogenase bestimmt. In Atm1p- und Yah1p-depletierten
Zellen war die Aktivität um den Faktor 4 bzw. 2 höher als im PMS von Wildtypzellen
(Abb. 21C). Die Western Blot Analyse zeigte, dass der Aktivitätsverlust der
Cytochrom c Oxidase und der Katalase in Atm1p- und Yah1p-depletierten Zellen mit
einer verminderten Synthese der Ferrochelatase (Hem15p) korrelierte. (Abb. 21D).
B
10.0
SD-Medium
YPD-Medium
7.5
5.0
2.5
0.0
WT
Gal- GalATM1 YAH1
WT
D
WT
30
400
300
200
100
0
GalATM1
C
Alkohol Dehydrogenase
Aktivität (U / mg Protein)
Katalase Aktivität
(mU / mg Protein)
Cytochrom c Oxidase
Aktivität (U / mg Protein)
A
WT
Gal- GalATM1 YAH1
Gal- GalYAH1 ATM1
Atm1p
Yah1p
20
Cox4p
10
0
Hem15p
Por1p
WT
Gal- GalATM1 YAH1
Abb. 21: Die Depletion von Atm1p und Yah1p führt zu einem Aktivitätsverlust von Proteinen mit
Häm-Cofaktoren. Wildtyp- (WT), Gal-ATM1 und Gal-YAH1 Zellen wurden in Minimal- oder
Vollmedium mit Glukose kultiviert, um die zellulären Proteine Atm1p und Yah1p zu depletieren. Aus
diesen Zellen wurden Mitochondrien und PMS isoliert. Die Aktivität der (A) Cytochrom c Oxidase
wurde in isolierten Mitochondrien, die (B) der Katalase und (C) Alkohol-Dehydrogenase im post-
- 109 -
Ergebnisse
mitochondrialen Überstand ermittelt. D) Mitochondriale Proteine wurden durch SDS-PAGE
aufgetrennt, auf Nitrozellulose übertragen und mit spezifischen Antiseren immundetektiert. Die
Western Blot Analyse zeigt die Depletion von Atm1p und Yah1p sowie die verminderte Synthese der
Untereinheit 4 der Cytochrom c Oxidase (Cox4p) und der Ferrochelatase (Hem15p). Die Fehlerbalken
geben die Standardabweichung von drei unabhängigen Messungen an.
5.4.2. Atm1p- und Yah1p-depletierte Zellen besitzen weniger Häm
Ob die oben beschriebene Aktivitätsabnahme der Häm-haltigen Proteine auf einen
Mangel an Häm-Cofaktoren zurückzuführen ist, sollte durch das nächste Experiment
geklärt werden. Dazu wurde der Häm-Gehalt in Wildtyp-, Atm1p- und Yah1pdepletierten
Zellen
in
vivo
gemessen
(4.15.7).
Die
Zellen
wurden
reprimierenden Bedingungen über Nacht in eisenarmen Minimalmedium mit
unter
55
Fe
kultiviert und markiert, anschließend sedimentiert und in Butylacetat mit Glasperlen
mechanisch aufgeschlossen. In vivo synthetisiertes
55
Fe-haltiges Häm wurde in die
organische Phase extrahiert und durch Szintillationszählung quantifiziert. Atm1pdepletierte Zellen enthielten 42% und Yah1p-depletierte Zellen 80% weniger Häm als
Wildtypzellen (Abb. 22). Der reduzierte Häm-Gehalt korrelierte mit den reduzierten
Aktivitäten der Cytochrom c Oxidase und der Katalase (Abb. 21A und B). Diese
Daten demonstrieren, dass neben der transkriptionellen Reprimierung von Genen,
die für Häm-haltige Proteine kodieren, auch die Verminderung des Häm-Gehalts zum
Aktivitätsverlust beiträgt. Möglicherweise ist die beobachtete transkriptionelle
Reprimierung
von
HEM15
für
die
verringerten
zellulären
Häm-Mengen
2000
1500
1000
500
3
55Fe-haltiges
Häm
(10 x cpm / g Zellen)
verantwortlich.
0
WT
Gal- GalATM1 YAH1
Abb. 22: Atm1p- und Yah1p-depletierte Zellen besitzen weniger Häm. Wildtyp- (WT), Gal-ATM1
und Gal-YAH1 Zellen wurden für 16 h in eisenarmen Minimalmedium mit Glukose kultiviert, um Atm1p
55
und Yahp1 im korrespondierenden Stamm zu depletieren. Die Zellen wurden gleichzeitig mit Fe
markiert. Anschließend wurden die Zellen in Anwesenheit von n-Butylacetat mechanisch
55
aufgeschlossen. Das in die organische Phase extrahierte
Fe-haltige Häm wurde durch
Szintillationszählung quantifiziert. Die Fehlerbalken geben die Standardabweichung von drei
unabhängigen Messungen an.
- 110 -
Ergebnisse
5.4.3. Atm1p- und Yah1p-depletierte Zellen besitzen eine verminderte
Ferrochelatase Aktivität
Der reduzierte Häm-Gehalt in Atm1p- und Yah1p-depletierten Zellen basiert
entweder auf einer verminderten Häm-Biosynthese oder auf einem erhöhten HämAbbau.
Eine
verminderte
Synthese
wurde
bereits
erkennbar
durch
die
transkriptionelle Reprimierung von HEM15 (Abb. 20). Andererseits zeigte die
Transkriptom-Analyse eine Induktion des Gens HMX1. Dieses Gen kodiert für ein
Enzym mit Häm-Oxygenase Aktivität, welches möglicherweise für den Häm-Abbau in
S. cerevisiae verantwortlich ist (Tab. 3). Zunächst wurde die Aktivität der
Ferrochelatase in isolierten Mitochondrien bestimmt (4.15.3.6). Im Vergleich mit
Wildtypzellen war die Ferrochelatase Aktivität in Atm1p- um 30% und in Yah1pdepletierten Zellen um 58% reduziert (Abb. 23). Die Aktivitätsabnahme der
Ferrochelatase korrelierte mit dem reduzierten Häm-Gehalt der entsprechenden
Mutanten, wobei Yah1p-depletierte Zellen stets stärker betroffen waren als Atm1p-
Ferrochelatase Aktivität
(Zn-PPIX Bildung)
(%)
depletierte Zellen (Abb. 22).
150
100
50
0
WT
Gal- GalATM1 YAH1
Abb. 23: In Atm1p- und Yah1p-depletierten Zellen ist die Aktivität der Ferrochelatase
vermindert. Die Ferrochelatase Aktivität in isolierten Mitochondrien aus Wildtyp-, Atm1p- und Yah1p2+
depletierten Zellen wurde anhand der Insertion von endogenem Zn in Protoporphyrin IX (PPIX)
bestimmt. Die Angaben beziehen sich auf den Wert für Wildtypzellen. Die Fehlerbalken geben die
Standardabweichung von vier unabhängigen Messungen an.
5.4.4. Die Verminderung der Ferrochelatase Aktivität etabliert den
geringeren zellulären Gehalt an Häm
Die transkriptionelle Reprimierung von HEM15 spiegelte sich in einer reduzierten
Aktivität der Ferrochelatase wider (Abb. 23). Ob die Aktivität der Ferrochelatase auch
allein für den reduzierten Häm-Gehalt und den Aktivitätsverlust von Häm-haltigen
Proteinen verantwortlich sein kann, sollte mit dem folgenden Experiment untersucht
werden. Zu diesem Zweck wurden regulierbare Gal-Hem15 Zellen als Modell
- 111 -
Ergebnisse
erzeugt, welche die Ferrochelatase in Abhängigkeit von der Kohlenstoffquelle
synthetisierten. Zuerst wurde der Häm-Gehalt in Hem15p-depletierten Zellen in vivo
gemessen. Dazu wurden Wildtyp- und Gal-HEM15 Zellen unter reprimierenden
Bedingungen und in Gegenwart von Galaktose in eisenarmen Minimalmedium
kultiviert und gleichzeitig mit
55
Fe markiert. Die Kulturen wurden über Nacht
angezogen, geerntet und die Zellen anschließend in Butylacetat mit Glasperlen
mechanisch aufgeschlossen. In vivo synthetisiertes
55
Fe-haltiges Häm wurde in die
organische Phase extrahiert und durch Szintillationszählung quantifiziert. Hem15pdepletierte Zellen synthetisierten 3,5-mal weniger Häm als Wildtypzellen (Abb. 24A).
In Gegenwart von Galaktose synthetisierten Wildtyp- und Gal-HEM15 Zellen nahezu
identische Mengen an Häm.
Wirkt sich ein verminderter Häm-Gehalt direkt auf die Enzymaktivität von Hämhaltigen Proteinen aus? Zu diesem Zweck wurde die Cytochrom c Oxidase Aktivität
in isolierten Mitochondrien bestimmt. Die Messung der Katalase und AlkoholDehydrogenase erfolgte im PMS. Unter reprimierenden Wachstumsbedingungen
sank in Gal-HEM15 Zellen die Katalase Aktivität im Vergleich zu Wildtypzellen um
92%, die der Cytochrom Oxidase um 75%, während die Alkohol-Dehydrogenase
Aktivität um 50% anstieg (Abb. 24B-D). Die Depletion der Ferrochelatase unter
reprimierenden Wachstumsbedingungen konnte in einer Western Blot Analyse
bestätigt werden (Abb. 24E). Die hier gezeigten Ergebnisse entsprachen denen der
Atm1p- und Yah1p-depletierten Zellen, mit der Ausnahme, dass diese unter
reprimierenden Bedingungen weniger Cox4p synthetisierten als Hem15p-depletierte
Zellen, bei denen die Synthese von Cox4p Apoprotein unverändert blieb (Abb. 21D,
Abb. 24E). Daraus lässt sich schließen, dass eine reduzierte Ferrochelatase Aktivität
allein die Aktivitätsabnahme von Häm-haltigen Proteinen in vivo verursachen kann,
jedoch nicht zu einer Verminderung in der Synthese der Apoproteine führt. Die
Aktivitätszunahme der Alkohol-Dehydrogenase ist erklärbar durch ein umschalten
der Zellen auf Fermentation. Häm ist ein wichtiger Cofaktor von Proteinen der
Atmungskette und ein Häm-Mangel vermindert die respiratorische Kompetenz.
Zusammenfassend zeigen diese Daten, dass Atm1p- und Yah1p-depletierte Zellen
einen Häm-Synthesedefekt aufweisen, der u.a. durch die verminderte Aktivität der
Ferrochelatase verursacht wird.
- 112 -
Ergebnisse
300
200
100
4
55Fe-haltiges
Häm
(10 x cpm / g Zellen)
A
0
WT
Gal
Gal-HEM15
Gal
Glc
WT
Glc
C
9
300
Katalase Aktivtät
(mU / mg Protein)
Cytochrom c Oxidase
Aktivität (U / mg Protein)
B
6
3
0
WT
Gal
WT
Glc
100
0
Gal-HEM15
Gal
Glc
D
Alkohol Dehydrogenase
Aktivität (U / mg Protein)
200
WT
Gal
WT
Glc
Gal-HEM15
Glc
Gal
E
7.5
WT
Gal
5.0
Gal-HEM15
Glc
Gal
Glc
α-Hem15p
2.5
0.0
α-Cox4p
α-Por1p
WT
Gal
WT
Glc
Gal-HEM15
Gal
Glc
Abb. 24: Zellen mit einer verminderten Ferrochelatase Aktivität besitzen weniger Häm. Wildtypund Gal-HEM15 Zellen wurden in Minimalmedium unter reprimierenden (Glc) oder induzierenden
(Gal) Bedingungen kultiviert. A) Die Zellen wurden weitere 16 h in eisenarmen Minimalmedium
55
kultiviert und gleichzeitig mit Fe markiert. Die Häm-Bestimmung erfolgte wie in Abb. 22 beschrieben.
B) Die Cytochrom c Oxidase Aktivität wurde in isolierten Mitochondrien und (C und D) die Katalase
sowie Alkohol-Dehydrogenase Aktivitäten wurden im PMS gemessen. E) Western Blot Analyse von
Hem15p, Cox4p und Por1p unter Verwendung spezifischer Antiseren. Die Fehlerbalken geben die
Standardabweichung von drei unabhängigen Messungen an.
5.4.5. Der reduzierte Häm-Gehalt ist nicht auf die Aktivität der HämOxygenase Hmx1p zurückzuführen
Die Transkriptom-Analysen zeigten neben der Reprimierung von HEM15 die
signifikante Induktion des Gens HMX1 (Tab. 3). HMX1 kodiert für eine putative Häm- 113 -
Ergebnisse
Oxygenase, die in Hefe für den Häm-Abbau verantwortlich ist (Protchenko & Philpott,
2003). Durch die Aktivität des Enzyms wird Fe2+ freigesetzt. Die folgenden
Experimente sollten klären, ob Hmx1p am reduzierten Häm-Gehalt der Atm1p- und
Yah1p-depletierten Zellen mitverantwortlich sein könnte. Zunächst wurde die
Induktion von HMX1 in einer Northern Blot Analyse bestätigt (Abb. 25A). RNA aus
Wildtypzellen, die mit und ohne Eisenchelator Bathophenantrolin kultiviert wurden
sowie aus Atm1p- und Yah1p-depletierten Zellen, wurde gelelektrophoretisch
aufgetrennt, auf eine Nylonmembran transferiert und mit
32
P-markierten Sonden
gegen HMX1 und ACT1 hybridisiert. Wildtyp-, Yah1p- und Atm1p-depletierte Zellen
unter
Eisenmangel
synthetisierten
ca.
20-mal
mehr
HMX1
Transkript
als
Wildtypzellen ohne Eisenmangel (Abb. 25A). Um zu klären, ob die Überexpression
von HMX1 tatsächlich den Häm-Gehalt der Zelle beeinflusst, wurde dieser in
Wildtypzellen bestimmt, welche ein plasmidlokalisiertes HMX1 überexprimierten
(Abb. 25B). Zusätzlich wurde eine ∆hmx1 Deletionsmutante untersucht, die entweder
ein plasmidlokalisiertes HMX1 oder den leeren Vektor enthielt. Die Überexpression
von HMX1 senkte den Häm-Gehalt um 24% (Abb. 25B). Dagegen hatten ∆hmx1
Zellen 27% mehr Häm als Vergleichszellen. Der Häm-Gehalt der Deletionsmutante
ließ sich durch die plasmidlokalisierte Expression von HMX1 erneut auf Wildtyp
Niveau senken (Abb. 25B).
Zur Untersuchung, ob die reduzierten Häm-Mengen in Atm1p- und Yah1pdepletierten Zellen ebenfalls durch eine erhöhte Häm-Oxygenase Aktivität bedingt
sind, wurde der Häm-Gehalt von Wildtyp-, Atm1p- und Yah1p-depletierten Zellen, mit
jenen
verglichen,
in
denen
zusätzlich
HMX1
deletiert
war
(∆hmx1,
ATM1∆hmx1, YAH1∆hmx1). Unter reprimierenden Wachstumsbedingungen besaßen
Atm1p-depletierte Zellen 41% und Yah1p-depletierte Zellen 80% weniger Häm als
Wildtypzellen (Abb. 25C). Der Häm-Gehalt der isogenen Mutanten (ATM1 und
YAH1) war mit dem der Doppelmutanten (ATM1∆hmx1 und YAH1∆hmx1)
vergleichbar (Abb. 25C). Zusammenfassend zeigt dies, dass die Häm-Oxygenase
HMX1 in Atm1p- und Yah1p-depletierten Zellen keinen Einfluss auf den Häm-Gehalt
hat. Dies bedeutet, dass die verminderte Synthese und nicht der erhöhte Abbau von
Häm für die Häm-Defizienz von Mutanten mit Defekten in der mitochondrialen ISCAssemblierungs- und Exportmaschinerie verantwortlich ist. In Wildtypzellen scheint,
in Übereinstimmung mit den Daten einer anderen Arbeitsgruppe, die Häm-
- 114 -
Ergebnisse
Oxygenase einen wenn auch geringen Einfluss auf die Häm-Menge auszuüben
(Protchenko & Philpott, 2003).
B
GalGalATM1 YAH1
HMX1
ACT1
100
(%)
WT
-Fe
55Fe-haltiges
WT
150
Häm
A
50
0
HMX1
WT
-
WT ∆hmx1 ∆hmx1
+
+
2000
1500
1000
500
55
Fe-haltiges Häm
(103 x cpm / g Zellen)
C
0
WT
∆hmx1 ATM1 ATM1/ YAH1 YAH1/
∆hmx1
∆hmx1
Abb. 25: Die Häm-Oxygenase Hmx1p ist nicht verantwortlich für den reduzierten Häm-Gehalt in
Atm1p- und Yah1p-depletierten Zellen. A) Northern Blot Analyse von RNA aus Wildtypzellen (WT),
die mit (WT-Fe) und ohne (WT) den Chelator Bathophenantrolin kultiviert wurden sowie RNA aus
Atm1p- und Yah1p-depletierten Zellen, wurde gelelektrophoretisch aufgetrennt, auf eine
32
Nylonmembran transferiert und mit einer P-markierten Sonde gegen HMX1 und ACT1 hybridisiert.
Die in (B und C) untersuchten Stämme wurden unter reprimierenden Bedingungen in eisenarmen
55
Minimalmedium kultiviert und über Nacht mit Fe markiert. Die Bestimmung des Häm-Gehaltes
erfolgte wie in Abb. 22 beschrieben. Die Fehlerbalken geben die Standardabweichung von drei
unabhängigen Messungen an.
Zusammenfassung der Transkriptom-Analysen
Störungen in der Funktion der ISC-Assemblierungs- und Exportmaschinerie führen
zu
gravierenden
Veränderungen
der
Genexpression.
Diese
beobachteten
Veränderungen in beiden Situationen überlappen weitgehend. Sie umfassen die
Induktion des Eisen-Regulons und die Reprimierung von Genen, die für
Komponenten der Atmungskette kodieren. Daneben sind die Ergosterol-, Biotin-, und
Häm-Synthese betroffen sowie Gene, die für Häm-haltige Proteine kodieren oder am
Häm-Abbau beteiligt sind. Veränderungen der CIA-Maschinerie ziehen dagegen
keine drastischen Veränderungen der Genexpression nach sich.
- 115 -
Ergebnisse
Anhand von Promotorstudien Eisen-regulierter Gene konnte gezeigt werden, dass
sich das Expressionsmuster von ISC Mutanten mit dem von Zellen unter
Eisenmangel größtenteils deckt. Der Aktivitätsverlust von Häm-haltigen Proteinen in
ISC Mutanten beruht auf einem Häm-Mangel, der im Wesentlichen auf eine
reduzierte Ferrochelatase Aktivität, nicht aber auf den Häm-Abbau durch die HämOxygenase
Hmx1p,
zurückzuführen
ist.
Die
Ferrochelatase
wird
transkriptionell reprimiert als auch biochemisch inhibiert (Lange et al., 2004).
- 116 -
sowohl
Diskussion
6. Diskussion
6.1. Die CIA-Maschinerie wird für die Biogenese von extramitochondrialen Fe/S Proteinen benötigt
6.1.1. Nbp35p ist ein Fe/S Protein
In dieser Arbeit wurde die essentielle P-Loop NTPase Nbp35p als ein neues Fe/S
Protein identifiziert (Hausmann et al., 2005). Durch Immunfluoreszenz und
Zellfraktionierung konnte gezeigt werden, dass Nbp35p hauptsächlich im Cytosol,
aber auch im Kern lokalisiert ist. Durch Markierung mit radioaktivem Eisen in vivo
und anschließender Immunpräzipitation wurde eine spezifische, nicht chelatierbare
Eisenbindung an Nbp35p demonstriert. Die Eisenbindung an Nbp35p war von der
Funktionsfähigkeit der mitochondrialen ISC-Assemblierungs- und Exportmaschinerie
abhängig. Die Depletion der Cystein-Desulfurase Nfs1p und des Ferredoxins Yah1p
(ISC-Assemblierung) sowie des ABC-Transporters Atm1p (ISC-Export) durch
regulierte Genexpression führte zu einem stark verminderten Eiseneinbau in
Nbp35p. Somit verhält sich Nbp35p in Bezug auf seine Reifung wie das cytosolische
Fe/S Protein Isopropylmalat-Isomerase (Leu1p), was darauf hindeutet, dass das an
Nbp35p gebundene Eisen Bestandteil eines Fe/S Clusters ist. Der Fe/S Cluster ist
am N-Terminus von Nbp35p assoziiert, da eine N-terminal verkürzte Variante des
Proteins in vivo kein Eisen binden kann.
Die Fe/S Cluster-Bindung wurde in vitro durch spektroskopische Analysen an einem
rekombinanten Nbp35p aus Escherichia coli unabhängig bestätigt. Sowohl ein
UV/Vis als auch ein ESR-Spektrum deuteten auf einen [4Fe-4S] Cluster hin
(Hausmann et al., 2005), (A. Pierik, persönliche Mitteilung). Das ESR-Signal ergab
g-Werte von 2,052; 1,934 und 1,84. Erstere sind typisch für einen [4Fe-4S] Cluster.
Der Cluster wird wahrscheinlich durch vier konservierte Cysteine am N-Terminus von
Nbp35p koordiniert. Der N-terminale Fe/S Cluster stellt einen essentiellen Teil des
Proteins dar, da eine gerichtete Mutagenese der beiden zentralen Cysteine zum Tod
der Zelle führt (Vitale et al., 1996). Weitere hochkonservierte Cysteine am CTerminus von Nbp35p können einen zusätzlichen Fe/S Cluster koordinieren
(D. Aguilar-Netz, persönliche Mitteilung).
- 117 -
Diskussion
6.1.2. Nbp35p ist eine Komponente der CIA-Maschinerie
Diese Arbeit identifiziert Nbp35p als eine Komponente der bislang wenig
charakterisierten CIA-Maschinerie, die spezifisch zur Biogenese von extramitochondrialen Fe/S Proteinen benötigt wird (Hausmann et al., 2005). Die
Biogenese mitochondrialer Fe/S Proteine (z.B. Biotin-Synthase) erfolgte nach
Depletion des Nbp35p mit Wildtyp-Effizienz. Im ersten Jahr dieser Arbeit wurde
zudem die P-Loop NTPase Cfd1p identifiziert (Roy et al., 2003), die eine hohe
Sequenzhomologie zu Nbp35p aufweist. Mutationen in Cfd1p verursachen in
Saccharomyces cerevisiae einen spezifischen Defekt in der Reifung extramitochondrialer Fe/S Proteine (Roy et al., 2003). Nbp35p und das homologe Cfd1p
besitzen außerdem Sequenzhomologie zu einer Unterfamilie von bakteriellen P-Loop
ATPasen (Leipe et al., 2002). Zu diesen gehört u.a. die Reduktase NifH des
Nitrogenase-Komplexes
(Dean
al.,
et
1993).
NifH
ist
selbst
ein
Fe/S
Cluster-tragendes Protein. Die den Fe/S Cluster koordinierenden Reste sind in
Nbp35p allerdings nicht konserviert. Eine enge Verwandtschaft besteht zu dem aus
Salmonella enterica Serovar Typhimurium stammenden Protein ApbC (Mrp). Der
Funktionsverlust von ApbC oder von Isc Proteinen in S. enterica geht mit einer
Thiaminauxotrophie einher (Skovran & Downs, 2003). Auf Grund des ähnlichen
Phänotyps von isc und apbC Mutanten wurde auch für das ApbC Protein aus
S. enterica eine Funktion in der Assemblierung und/oder Reparatur von Fe/S
Clustern
vorgeschlagen.
Weitere
Untersuchungen
ergaben,
dass
der
Funktionsverlust von ApbC in einem Aktivitätsverlust Fe/S Cluster-tragender Proteine
(Aconitase, Succinat-Dehydrogenase) resultierte, während Proteine ohne Fe/S
Cluster von der Mutation unbeeinflusst blieben. Im Unterschied zu isc Mutanten
konnte der Aktivitätsverlust der Aconitase in apbC Mutanten durch einen FeCl3
Überschuss aufgehoben werden. Die in S. enterica bestehende Thiaminauxotrophie
ist vermutlich eine sekundäre Folge des Aktivitätsverlustes von ThiH, einem in der
Thiamin-Biosynthese beteiligten putativen Fe/S Protein.
Auf Grund der Sequenzhomologie zu Cfd1p (Roy et al., 2003) und ApbC war auch
für Nbp35p eine Rolle in der Assemblierung von Fe/S Clustern wahrscheinlich. Um
die Funktion von Nbp35p in der Biogenese von Fe/S Proteinen in vivo zu
untersuchen, wurde zunächst eine konditionale Hefemutante hergestellt, in der die
Expression von NBP35 durch einen Galaktose-regulierbaren Promotor kontrolliert
wurde. Durch Kultivierung dieser Zellen in Abwesenheit von Galaktose konnte
- 118 -
Diskussion
Nbp35p spezifisch depletiert werden. Die Depletion führte zu einem signifikanten
Aktivitätsverlust des cytosolischen Fe/S Proteins Isopropylmalat-Isomerase (Leu1p)
und zu einem stark verminderten Einbau von radioaktivem Eisen in die cytosolischen
Fe/S Proteine Leu1p, Rli1p, Nar1p und das nukleäre Fe/S Protein Ntg2p (Hausmann
et al., 2005). Dies zeigt, dass Nbp35p nicht nur zur Erhaltung der Aktivität, sondern
auch zur de novo Synthese von Fe/S Proteinen benötigt wird.
Nbp35p-depletierte Zellen konnten uneingeschränkt auf nicht-fermentierbaren
Kohlenstoffquellen wachsen. Dies zeigt, dass diese Zellen funktionstüchtige
Mitochondrien besitzen. Daher ist es nicht überraschend, dass Nbp35p keinen
Einfluss auf die Aktivitäten (Aconitase, Succinat-Dehydrogenase) und die de novo
Synthese mitochondrialer Fe/S Proteine (Biotin-Synthase) ausübt. Auch Cfd1p
besitzt keine erkennbare Funktion in den Mitochondrien (Roy et al., 2003). In
Übereinstimmung mit der cytosolischen Lokalisierung von Cfd1p ist es wie Nbp35p
spezifisch an der Reifung cytosolischer Fe/S Proteine beteiligt (Roy et al., 2003).
Folglich verhält sich Nbp35p wie sein Homolog Cfd1p.
Basierend auf der hohen Sequenzhomologie von Nbp35p zu Cfd1p wurde
untersucht, ob diese sich funktionell ersetzen könnten. Die Überexpression von
NBP35 konnte den Wachstumsdefekt Cfd1p-depletierter Zellen allerdings nicht
kompensieren (Hausmann et al., 2005). Nbp35p und Cfd1p übernehmen trotz
phänotypischer Ähnlichkeiten ihrer Depletionsmutanten unterschiedliche Funktionen
in der Biogenese extra-mitochondrialer Fe/S Proteine. Möglicherweise ist der
Unterschied auf den konservierten Fe/S Cluster-tragenden N-Terminus in Nbp35p
zurückzuführen, der in Cfd1p Proteinen fehlt (Abb. 4). Die Überexpression von
NBP35 in Cfd1p-depletierten Zellen führte zu einer Verstärkung des bestehenden
Wachstumsdefekts. Ungleiche Konzentrationen an Cfd1p und Nbp35p in der Zelle
scheinen demnach toxisch für die Lebensfähigkeit von Hefe zu sein. In der
Zwischenzeit wurde gezeigt, dass Nbp35p und Cfd1p in vitro und in vivo interagieren
(D. Aguilar-Netz, persönliche Mitteilung). Die Proteine bilden einen stabilen,
heterotetrameren Komplex, der aus je zwei Nbp35p und Cfd1p Dimeren besteht.
6.1.3. Die Biogenese von extra-mitochondrialen Fe/S Proteinen
Parallel zu dieser Arbeit wurden weitere Komponenten der CIA-Maschinerie
identifiziert, wie z.B. das Fe/S Protein Nar1p, welches homolog zu bakteriellen
Hydrogenasen ist (Balk et al., 2004). Die Depletion von Nar1p zeigte einen ähnlichen
- 119 -
Diskussion
Phänotyp wie für Nbp35p- und Cfd1p-depletierte Zellen. Eine Überproduktion von
Nar1p oder Nbp35p in Cfd1p-depletierten Zellen wirkte sich negativ auf das
Wachstumsverhalten dieser Zellen aus (Hausmann et al., 2005). Das vor kurzem
identifizierte Protein Cia1p wird für den Einbau von Fe/S Clustern in cytosolische und
nukleäre Proteine, wie Leu1p, Rli1p und Ntg2p, benötigt (Balk et al., 2005). Cia1p ist
allerdings nicht an der Biogenese aller cytosolischen Fe/S Proteine beteiligt. In
Abwesenheit von Cia1p können z.B. Nbp35p und Nar1p ihre Fe/S Cluster mit
normaler Effizienz assemblieren. Im Unterschied zu Nbp35p und Nar1p besitzt Cia1p
keinen Fe/S Cluster und ist spezifisch an der Reifung von Fe/S Proteinen beteiligt,
die selbst keine Funktion in der Biogenese von Fe/S Proteinen (z.B. Leu1p, Rli1p
oder Ntg2p) ausüben (Balk et al., 2005). Gegenwärtig werden zwei weitere CIAKomponenten (Cia2p und Met18p) untersucht, die ähnlich dem Cia1p erst nach der
Assemblierung eines Fe/S Clusters auf Nbp35p und Nar1p benötigt werden (J.
Mascarenhas, persönliche Mitteilung). Durch die Identifizierung diverser CIAKomponenten stellte sich heraus, dass sich die CIA-Maschinerie aus zwei
funktionellen Proteingruppen zusammensetzt, die zu unterschiedlichen Zeitpunkten
in der Biogenese von extra-mitochondrialen Fe/S Proteinen benötigt werden. Den
früh in der Biogenese genutzten Proteinen Nbp35p, Cfd1p und Nar1p sowie den erst
später notwendigen Proteinen Cia1p, Cia2p und Met18p (Balk et al., 2005, J.
Mascarenhas, persönliche Mitteilung), (Abb. 26).
Auf der Basis der hier vorgestellten Daten ist es möglich, dass die Fe/S Cluster
Bindung an Nbp35p und Nar1p einen transienten Charakter besitzt und diese
Proteine eine Art Gerüstfunktion („scaffold“) übernehmen. Die neu-synthetisierten
Fe/S Cluster könnten anschließend mit Hilfe von Cia1p und weiteren Proteinen in
Apoproteine eingebaut werden (Balk et al., 2005). Diese Hypothese wird u.a. durch
in vivo Experimente unterstützt, die zeigen, dass die Fe/S Cluster Bindung an
Nbp35p im Vergleich mit Leu1p, weitaus weniger stabil ist (P. Smith, persönliche
Mitteilung). Dieses Modell setzt eine Proteininteraktion von Nbp35p und Nar1p mit
Cia1p voraus. In der Tat konnte eine Interaktion zwischen Cia1p und Nar1p, nicht
aber mit Nbp35p nachgewiesen werden (Balk et al., 2005). Weitere Untersuchungen
zu diesem mechanistischen Problem und allgemein zur Biogenese von extramitochondrialen Fe/S Proteinen werden gegenwärtig durchgeführt. Es wird nötig
sein, ein in vitro System zu etablieren, das die Rekonstitution eines cytosolischen
Fe/S Proteins mit definierten Komponenten erlaubt.
- 120 -
Diskussion
CIA-Maschinerie
Ι
ΙΙ
Cfd1, Nbp35 Cia1, Cia2
Nar1
Met18
S
Mitochondrium
Fe
S
Extra-mitochondriale
Fe/S Proteine
Holo
GSH
Apo
Cytosol
Fe
Erv1
ISC-Export
Maschinerie
Atm1
X
ISC-Assemblierungsmaschinerie
Abb. 26: Modell zur Biogenese extra-mitochondrialer Fe/S Proteine. Die im Mitochondrium
lokalisierte ISC-Assemblierungsmaschinerie synthetisiert eine bislang unbekannte Komponente X, die
im Cytosol zur Biogenese von extra-mitochondrialen Fe/S Proteinen benötigt wird. Der Transport von
X erfolgt über den ABC-Transporter Atm1p. Da die ATPase Aktivität von Atm1p durch freie
Sulfhydrylgruppen stimuliert wird, könnte Atm1p eine Schwefel-haltige Komponente ins Cytosol
exportieren. Eine im Cytosol lokalisierte CIA-Maschinerie setzt sich aus zwei unterschiedlichen
Proteingruppen zusammen: (Ι) Cfd1p, Nbp35p und Nar1p sowie (ΙΙ) Cia1p, Cia2p und Met18p.
Zunächst werden Fe/S Cluster (unabhängig von Proteingruppe ΙΙ) auf Nbp35p und Nar1p assembliert.
Möglicherweise binden diese Fe/S Cluster nur transient an Nbp35p und Nar1p. Nbp35p und Nar1p
könnten als Gerüst dienen, an dem die neuen Fe/S Cluster zusammengesetzt werden. Mit Hilfe von
Cia1p und weiterer Komponenten könnten die Fe/S Cluster in extra-mitochondriale Apoproteine, wie
z.B. Leu1p, eingebaut werden.
Unter physiologischen Bedingungen werden Nbp35p, Cfd1p und Nar1p nur in
geringen Mengen synthetisiert (Balk et al., 2004). Im Unterschied dazu wird CIA1 in
wesentlich höheren Mengen exprimiert und das kodierte Protein ist vorwiegend im
Zellkern lokalisiert (Balk et al., 2005). Daher ist es möglich, dass Cia1p und die
gegenwärtig untersuchten Proteine Cia2p und Met18p noch eine zusätzliche
Funktion im Zellkern ausüben. Auf Grund der hier gezeigten Daten wird deutlich,
dass die Biogenese von extra-mitochondrialen Fe/S Proteinen durch ein komplexes
System vermittelt wird, in dem mindestens zwei funktionell zu unterscheidende
Gruppen von Proteinen beteiligt sind.
Nbp35p, Cfd1p, Nar1p und Cia1p werden sowohl zur Reifung cytosolischer als auch
nukleärer Fe/S Proteine benötigt (Balk et al., 2004; Balk et al., 2005; Hausmann et
al., 2005; Roy et al., 2003, D. Aguilar-Netz, persönliche Mitteilung). Demzufolge
werden alle extra-mitochondrialen Fe/S Proteine von derselben Maschinerie
synthetisiert.
Nbp35p,
Cfd1p,
Nar1p
und
Cia1p
übernehmen
dabei
eine
entscheidende Rolle in der Reifung dieser Fe/S Proteine (Balk et al., 2004; Balk et
al., 2005; Hausmann et al., 2005; Roy et al., 2003, D. Aguilar-Netz, persönliche
Mitteilung). Die Proteine existieren in allen bislang sequenzierten Eukaryoten
- 121 -
Diskussion
(Säuger, Pflanzen, Pilzen, Parasiten) und werden in moderaten Mengen im Cytosol
und Kern exprimiert. In S. cerevisiae geht bereits die Depletion dieser Proteine mit
einem deutlichen Wachstumsdefekt einher. Nbp35p, Cfd1p Nar1p und Cia1p sind
spezifisch an der Biogenese von extra-mitochondrialen Fe/S Proteinen beteiligt.
Überraschenderweise führt ein Mangel an Nbp35p, Cfd1p, Nar1p und Cia1p nicht zu
einer zusätzlichen Akkumulation von Eisen in den Mitochondrien und zur Induktion
des Eisen-Regulons, wie im Falle von mitochondrialen ISC Mutanten (Balk et al.,
2004; Balk et al., 2005; Hausmann et al., 2005; Rutherford et al., 2005). Der zuvor
beschriebene Phänotyp bei Depletion der bislang identifizierten CIA-Komponenten
lässt sich zur Identifizierung neuer Komponenten in der Biogenese extramitochondrialer Fe/S Proteine verwenden.
Die Reifung von Nbp35p und Nar1p hängt, wie auch für andere extra-mitochondriale
Fe/S Proteine beschrieben, von den Komponenten der beiden mitochondrialen ISCMaschinerien ab (Balk et al., 2004; Hausmann et al., 2005). Vermutlich ist die
ISC-Assemblierungsmaschinerie direkt oder mit Hilfe eines mitochondrialen Fe/S
Proteins an der Synthese einer noch unbekannten Komponente (X in Abb. 26)
beteiligt, die im Cytosol zur Biogenese von extra-mitochondrialen Fe/S Proteinen
benötigt wird. Anschließend erfolgt der Transport dieser Komponente X mit Hilfe der
ISC-Exportmaschinerie. Die Translokation dieser Komponente X ins Cytosol erfolgt
über den in der inneren Mitochondrienmembran lokalisierten ABC-Transporter
Atm1p, der einen zentralen Teil der ISC-Exportmaschinerie darstellt. Die ATPase
Aktivität von ABC-Transportern wird generell durch ihr natürliches Substrat stimuliert.
Diese Eigenschaft wurde ausgenutzt, um die Natur des von Atm1p transportierten
Substrats zu definieren. Für den ABC-Transporter Atm1p konnte gezeigt werden,
dass die ATPase Aktivität durch freie Sulfhydrylgruppen stimuliert wird, insbesondere
wenn diese Teile von Peptiden waren, was auf den Transport einer Schwefelhaltigen Komponente aus dem Mitochondrium hindeutet, die für die Biosynthese
cytosolischer Fe/S Proteine benötigt wird (Kuhnke et al., 2006). Die transportierte
Komponente X könnte einerseits Proteine der CIA-Maschinerie aktivieren oder aber
direkt zur Reifung der Fe/S Proteine verwendet werden.
6.1.4. Die Biogenese nukleärer Fe/S Proteine
Die Reifung nukleärer Fe/S Proteine ist bislang ein wenig charakterisierter Prozess.
In dieser Arbeit konnte gezeigt werden, dass auch die Komponenten der CIAMaschinerie zur Reifung nukleärer Fe/S Proteine benötigt werden (Balk et al., 2004;
- 122 -
Diskussion
Balk et al., 2005; Hausmann et al., 2005). Allerdings bleibt hier die Frage offen, in
welchem zellulären Kompartiment die Insertion der Fe/S Cluster in die jeweiligen
Apoproteine erfolgt. Zwei Modelle werden vorgeschlagen (Abb. 27): A) Die Fe/S
Cluster Insertion in die jeweiligen nukleären Apoproteine erfolgt im Cytosol.
Anschließend werden die Holoproteine in den Zellkern transportiert. B) Die nukleären
Apoproteine werden direkt in den Zellkern transportiert und erhalten erst dort ihre
Fe/S Cluster. Dies erfolgt möglicherweise durch die dort in geringen Konzentrationen
vorhandenen Proteine der CIA-Maschinerie. Allerdings könnten diese Proteine im
Zellkern noch eine zusätzliche Funktion besitzen, wie schon für die ISC-Komponente
Nfs1p beschrieben. In den Mitochondrien lokalisiertes Nfs1p besitzt eine Funktion in
der Fe/S Cluster Biogenese, während kernlokalisiertes Nfs1p eine weitere essentielle
Funktion ausübt, z.B. in der Biogenese eines Thiouridins zur Modifikation von
cytosolischen und mitochondrialen tRNAs (Kispal et al., 1999; Mühlenhoff et al.,
2004; Nakai et al., 2001; Nakai et al., 2004). Es werden weitere Untersuchungen
nötig sein, um die genaue Funktion der CIA-Komponenten im Zellkern zu bestimmen
und den molekularen Mechanismus der Reifung von nukleären Fe/S Proteinen zu
klären.
A
B
Zellkern
Zellkern
CIA
Apo
CIA
Holo
Holo
Apo
CIA
Apo
Holo
Apo
Cytosol
Holo
CIA
Holo
Cytosol
Abb. 27: Zwei mögliche Modelle zur Assemblierung nukleärer Fe/S Proteine. A) Durch eine im
Cytosol lokalisierte CIA-Maschinerie erfolgt die Reifung cytosolischer und nukleärer Fe/S Proteine. Die
nukleären Fe/S Holoproteine werden anschließend in den Zellkern transportiert. Die im Zellkern
lokalisierte geringe Menge an CIA-Komponenten könnte demnach an der Reparatur der Fe/S Proteine
beteiligt sein oder eine gänzlich andere Funktion ausüben. B) Die nukleären Fe/S Proteine werden in
der Apoform in den Zellkern transportiert. Dort ermöglicht die nukleäre CIA-Maschinerie die Insertion
der Fe/S Cluster in die nukleären Apoproteine. Die im Cytosol lokalisierte CIA-Maschinerie ist
spezifisch an der Reifung cytosolischer Fe/S Proteine beteiligt.
In Säugerzellen wurden einige der ISC-Komponenten in geringen Mengen auch im
Cytosol und Zellkern detektiert (Land & Rouault, 1998; Tong & Rouault, 2000; Tong
- 123 -
Diskussion
et al., 2003). Daher wurde angenommen, dass es eine cytosolische Kopie der ISCAssemblierungsmaschinerie
gibt,
die
bei
der
Zusammensetzung
extra-
mitochondrialer Fe/S Proteine eine Funktion ausübt. Bisher konnte allerdings nicht
gezeigt werden, dass diese Proteine im Cytosol auch funktionell sind. Im Gegenteil,
es konnte sowohl für das humane Isu1p als auch für das humane Nfs1p gezeigt
werden, dass nur mitochondrial lokalisierte Proteine eine Funktion in der de novo
Biogenese cytosolischer Fe/S Proteine ausüben (Biederbick et al., 2006; Tong &
Rouault, 2006). Für S. cerevisiae war eine solche Duplikation der Funktion der ISCAssemblierungsmaschinerie im Cytosol schon früher ausgeschlossen worden. Es
zeigte sich, dass ein Funktionsverlust von Isu1p und Isu2p nur dann durch bakterielle
oder humane Isu Homologe komplementiert werden konnte, wenn diese ins
Mitochondrium dirigiert wurden (Gerber et al., 2004). Desgleichen erfordert die
Assemblierung eines Fe/S Clusters auf den Isu Proteinen eine mitochondriale
Lokalisierung. Zum anderen übernimmt cytosolisch lokalisiertes Nfs1p keine Funktion
in der Reifung cytosolischer Fe/S Proteine (Kispal et al., 1999). Folglich ist es
unwahrscheinlich, dass die ISC-Komponenten auch außerhalb der Mitochondrien
eine Funktion in der Biogenese von Fe/S Clustern ausüben (Gerber et al., 2004).
Stattdessen scheinen die CIA-Komponenten eine im Cytosol lokalisierte Maschinerie
zu repräsentieren, die zur Reifung extra-mitochondrialer Fe/S Proteine essentiell
notwendig ist.
6.1.5. Die Biogenese cytosolischer
Funktion der Mitochondrien
Fe/S
Proteine als essentielle
Die Biogenese von Fe/S Proteinen ist die bislang einzige Funktion der
Mitochondrien, die den essentiellen Charakter dieser Organellen erklärt. Dies lässt
sich besonders gut am Modellorganismus S. cerevisiae erkennen, bei dem ungefähr
die Hälfte der ISC-Komponenten unverzichtbar für die Lebensfähigkeit dieser Hefe
sind. Dazu gehören die Cystein-Desulfurase Nfs1p, das mit Nfs1p interagierende
Isd11p, das Ferredoxin Yah1p, die NADH-abhängige Ferredoxin-Reduktase Arh1p,
das Chaperon Jac1p und die Sulfhydryl-Oxidase Erv1p (Lill et al., 1999). Die
simultane Deletion der ISU Gene ist ebenfalls letal (Garland et al., 1999; Schilke et
al., 1999). Demgegenüber kann die Hefe auf so bedeutende Reaktionswege wie den
Zitronensäurezyklus und die oxidative Phosphorylierung verzichten. Hefe als
fakultativer Anaerobier kann seine Energie vollständig aus der Glykolyse mit
anschließender Alkoholgärung beziehen. Selbst Säugerembryonen können die
- 124 -
Diskussion
ersten acht bis zehn Tage ohne eine funktionelle oxidative Phosphorylierung, nicht
aber ohne intakte Fe/S Protein-Biogenese überleben (Larsson et al., 1998; Pondarre
et al., 2006). Scheinbar wird bei höheren Eukaryoten erst relativ spät in ihrer
Embryonalentwicklung die Energiegewinnung durch oxidative Phosphorylierung
essentiell. Eukaryoten sind jedoch frühzeitig von einer funktionellen Fe/S ProteinBiogenese abhängig. Im Mitochondrium selbst wurde bislang kein essentielles Fe/S
Protein identifiziert, abgesehen von Yah1p. Dieses Protein ist allerdings an seiner
eigenen Biogenese beteiligt und erklärt damit nicht, warum Mitochondrien essentiell
sind.
Die vorwiegend im Cytosol lokalisierten Fe/S Proteine Nbp35p und Nar1p werden
ebenfalls zum Überleben der Zelle benötigt und könnten daher den essentiellen
Charakter der Mitochondrien erklären (Balk et al., 2004; Hausmann et al., 2005).
Allerdings werden auch diese Komponenten für ihre eigene Biogenese benötigt und
geben daher keine befriedigende Erklärung für den essentiellen Charakter dieser
Organellen bzw. der Fe/S Cluster Biogenese ab. Schon vor längerem wurde im
Cytosol das lebensnotwendige Fe/S Protein Rli1p lokalisiert, dessen Reifung von den
beiden mitochondrialen ISC-Maschinerien und der cytosolischen CIA-Maschinerie
abhängt (Balk et al., 2004; Balk et al., 2005; Hausmann et al., 2005). Kürzlich wurde
gezeigt, dass Rli1p eine Funktion in der Ribosomen-Biogenese und am Export der
ribosomalen Untereinheiten ins Cytosol besitzt. Der N-terminale Fe/S Cluster ist für
die Funktion des Proteins unverzichtbar (Kispal et al., 2005; Yarunin et al., 2005).
Damit ist die Rolle des Fe/S Proteins Rli1p bei der Ribosomen-Biogenese die erste
bekannte Funktion, die Mitochondrien in einer Hefezelle unverzichtbar macht. Bei
einem Defekt in der Biogenese von Rli1p kommt es zu einer Akkumulation von
ribosomalen Untereinheiten im Kern. Auch die Depletion der CIA-Komponenten
Cfd1p, Nbp35p, Nar1p und Cia1p bewirken diesen Phänotyp. Allerdings sind diese
Auswirkungen höchstwahrscheinlich sekundäre Folgen und auf den Funktionsverlust
von Rli1p zurückzuführen (Kispal et al., 2005). Diese Ergebnisse demonstrieren
eindrucksvoll eine Verbindung von zwei zentralen zellulären Prozessen, nämlich der
Fe/S Cluster- und der Ribosomen-Biogenese. Rli1p gehört zu den am stärksten
konservierten Proteinen in der Evolution. Homologe Proteine existieren in
Eukaryoten und Archaea, nicht aber in Eubakterien.
- 125 -
Diskussion
6.2. Transkriptom-Analysen in Saccharomyces cerevisiae
6.2.1. Die Regulation der Eisenhomeostase wird nicht durch ein
cytosolisches Fe/S Protein vermittelt
In S. cerevisiae erfolgt die Regulation der Eisenaufnahme durch die beiden Eisenabhängigen Transkriptionsfaktoren Aft1p und Aft2p. In Eisen-angereicherten Zellen
befindet sich Aft1p im Cytosol, bei einem Eisenmangel hingegen wandert Aft1p in
den Zellkern und aktiviert die Gene des Eisen-Regulons (Yamaguchi-Iwai et al.,
2002). Auch Funktionsverluste der beiden mitochondrialen ISC-Maschinerien
bewirken die Induktion des Eisen-Regulons und zusätzlich eine drastische Erhöhung
der mitochondrialen Eisenmenge (Kispal et al., 1997; Rutherford et al., 2005). Die
beschriebene Anreicherung von Eisen in den Mitochondrien geht nicht wie
angenommen auf Kosten der cytosolischen Eisenmenge (Chen et al., 2004).
Offensichtlich verursachen Defekte der Fe/S Protein-Biogenese die Induktion des
Eisen-Regulons unabhängig von der cytosolischen Eisenmenge.
Diese Befunde weisen auf einen Zusammenhang zwischen der Biogenese von Fe/S
Proteinen, der Eisenaufnahme (Eisen-Regulon) und der Eisenhomeostase hin. Da
die
ISC-Exportmaschinerie
gegenüber
der
ISC-Assemblierungsmaschinerie
spezifisch an der Reifung cytosolischer Fe/S Proteine beteiligt ist, wurde anfangs
angenommen, dass die Detektion der mitochondrialen Eisenmenge über ein
cytosolisches Fe/S Protein vermittelt wird. Ähnlich dem IRP1 System in höheren
Eukaryoten (Hentze et al., 2004) könnte das Verhältnis der Apo- zur Holoform dieses
Fe/S Proteins die Eisenaufnahme und die adequate Verteilung des Eisens zwischen
Mitochondrium und Cytosol gewährleisten.
Eine defekte Biogenese cytosolischer Fe/S Proteine in Folge einer Depletion von
CIA-Komponenten kann weder die Induktion des Eisen-Regulons noch die
Akkumulation von Eisen in den Mitochondrien auslösen. So konnte in Nbp35pdepletierten Zellen und in anderen CIA-Mutanten wie NAR1 und CIA1 keine
zusätzliche Eisenanreicherung in den Mitochondrien nachgewiesen werden (Balk et
al., 2004; Balk et al., 2005; Hausmann et al., 2005). Eine andere Arbeitsgruppe
konnte zusätzlich zeigen, dass die Induktion des Eisen-Regulons in Nbp35p-, Cfd1pund Nar1p-depletierten Zellen unterbleibt (Rutherford et al., 2005). Diesbezüglich
unterscheidet sich die CIA- von der ISC-Exportmaschinerie. Folglich wird die
zelluläre Eisenmenge nicht durch ein cytosolisches Fe/S Protein reguliert.
- 126 -
Diskussion
Zum besseren Verständnis der funktionellen Bedeutung der CIA-Maschinerie wurden
Nbp35p-depletierte Zellen mit DNA-Microarrays analysiert. In der Tat zeigte das
Transkriptionsprofil Nbp35p-depletierter Zellen keine Verbindung zu Genen, deren
Produkte in der Eisenhomeostase eine Funktion ausüben. Es wurden überraschend
wenig Gene differentiell exprimiert, obwohl NBP35 essentiell ist. Vorläufige
Microarray-Analysen, bei denen die CIA-Komponenten Cia1p und Nar1p depletiert
wurden, zeigten ähnliche Ergebnisse (J. Mascarenhas, persönliche Mitteilung). Aus
den Transkriptionsprofilen von CIA Protein-depletierten Zellen kann man schließen,
dass Defekte in der Funktion der CIA-Maschinerie grundsätzlich keinen Phänotyp
verursachen, der auf eine Beteiligung in der Eisenhomeostase hindeutet. Mit großer
Wahrscheinlichkeit beschränkt sich die Funktion der CIA-Maschinerie auf die Reifung
extra-mitochondrialer Fe/S Proteine.
Die Ergebnisse dieser Arbeit zusammen mit Daten der Literatur verdeutlichen, dass
allein der Status der beiden mitochondrialen ISC-Maschinerien, nicht aber der Status
der CIA-Maschinerie, die Eisenhomeostase in S. cerevisiae beeinflusst (Rutherford
et al., 2005). Ein Funktionsverlust der beiden mitochondrialen ISC-Maschinerien
durch regulierte Genexpression bewirkt eine durch Aft1p/Aft2p vermittelte Induktion
der Gene des Eisen-Regulons (Abb. 28). Offensichtlich
verhält sich der
Transkriptionsfaktor Aft1p in ISC-depletierten Zellen wie bei einem Eisenmangel.
Nach dem derzeitigen Wissensstand könnte die ISC-Assemblierungsmaschinerie
neben ihrer Funktion in der Biogenese zellulärer Fe/S Proteine zusätzlich an der
Synthese einer Komponente Y beteiligt sein, welche Aft1p den Eisenstatus der
Mitochondrien anzeigt. Ein Mangel an dieser Komponente im Cytosol würde
demnach einem Eisenmangel gleichkommen. Der ähnliche Phänotyp von ISCAssemblierungs- und Exportmutanten erklärt sich aus der Tatsache, dass die ISCExportkomponenten an der Translokation der Komponente Y ins Cytosol beteiligt
sind. Es ist bislang unklar, ob die aus den Mitochondrien exportierte Komponente Y
mit derjenigen identisch ist, die zur Fe/S Protein-Biogenese im Cytosol benötigt wird
(X in Abb. 26).
- 127 -
Diskussion
A
B
ISC
Aktiv
ISC
Inaktiv
Mitochondrium
Zellkern
ISC
Eisen-Regulon
reprimiert
Apo
Y
Holo
Mitochondrium
Zellkern
ISC
Eisen-Regulon
induziert
Apo
Y
ISC-Export
ISC-Export
Cytosol
Aft1
Cytosol
Y
Y Aft1
Aft1
Abb. 28: Modell zur Regulation der zellulären Eisenhomeostase in S. cerevisiae. A) Die ISCAssemblierungsmaschinerie assembliert und inseriert Fe/S Custer in mitochondriale Apoproteine.
Zusätzlich synthetisiert sie eine noch unbekannte Komponente Y, die über die ISC-Exportmaschinerie
ins Cytosol transportiert wird. Diese verhindert direkt oder indirekt, dass Aft1p in den Zellkern
transloziert. Bei einer intakten mitochondrialen Fe/S Protein-Biogenese und in Eisen-angereicherten
Zellen befindet sich Aft1p grundsätzlich im Cytosol. B) Kommt es zu einem Defekt in der
mitochondrialen Fe/S Protein-Biogenese oder der ISC-Exportmaschinerie, können keine Fe/S
Proteine mehr assembliert werden. Gleichzeitig wird die Synthese der Komponente Y eingestellt. Dies
signalisiert dem im Cytosol lokalisierten Transkriptionsfaktor Aft1p einen Eisenmangel, worauf dieser
in den Zellkern transloziert und die Gene des Eisen-Regulons induziert. Möglicherweise wird dieselbe
Komponente von der CIA-Maschinerie zur Reifung extra-mitochondrialer Fe/S Proteine verwendet
(X in Abb. 26).
6.2.2. ISC Mutanten besitzen ein charakteristisches Expressionsmuster
Sowohl die Microarray- als auch Promotoranalysen von Yah1p- und Atm1pdepletierten Zellen zeigten gegenüber Nbp35p-depletierten Zellen ein ähnlich starkes
und größtenteils übereinstimmendes Transkriptionsprofil. Entsprechend früherer
Arbeiten wurden erwartungsgemäß sowohl in Atm1p- als auch in Yah1p-depletierten
Zellen zahlreiche Gene des Eisen-Regulons induziert (Rutherford et al., 2005).
Demgegenüber wurden Gene, deren Produkte Komponenten der Atmungskette sind,
reprimiert. Parallel dazu erfolgte eine Induktion solcher Gene, die eine Funktion in
der Glukose-Aufnahme besitzen. Darüber hinaus wurden verschiedene Gene
welche, für Proteine des Zitronensäurezyklus, der Biotin-Synthese bzw. Aufnahme
und der Ergosterol-Biosynthese kodieren differentiell reguliert. Auffällig viele Gene,
die für Proteine mit Fe/S- (z.B. LEU1, GLT1) oder Häm-Cofaktoren (z.B. YHB1,
CTT1, Gene der Atmungskette) kodieren, wurden reprimiert. Zusätzlich zeigten die
Transkriptionsprofile von Yah1p- und Atm1p-depletierten Zellen eine beachtliche
Übereinstimmung mit denen von Grx5p- und Nfs1p-depletierten Zellen, zwei weiteren
ISC-Komponenten. Die Kongruenz zu den GRX5 und NFS1 Profilen legt nahe, dass
dieses Transkriptionsverhalten bei Störungen in der Funktion der mitochondrialen
ISC-Assemblierungs- und Exportmaschinerien charakteristisch ist (Belli et al., 2004).
- 128 -
Diskussion
Dieser Befund wurde weiter gestützt durch Promotorstudien an Ssq1p-depletierten
Zellen.
6.2.3. Der Status der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerie ist zentral an der Regulation der zellulären
Eisenhomeostase beteiligt
Insgesamt zeigen die Transkriptionsprofile von Yah1p- und Atm1p-depletierten
Zellen eine beachtliche Übereinstimmung mit denen von Zellen, die unter
Eisenmangel kultiviert wurden (Lan et al., 2004; Puig et al., 2005; Shakoury-Elizeh et
al., 2004). Wie bereits oben erwähnt induziert S. cerevisiae, bei einem Eisenmangel
und in diversen ISC Mutanten, die unter Aft1p Kontrolle stehenden Gene des EisenRegulons. Zu diesen Aft1p-abhängigen Genen zählen u.a. solche, deren Produkte an
der Biotin-Synthese und Aufnahme beteiligt sind (Shakoury-Elizeh et al., 2004). Bei
einem Eisenmangel und in Yah1p- und Atm1p-depletierten Zellen werden die für
Produkte der Biotin-Aufnahme kodierenden Gene induziert, während die Gene
welche für Produkte der Biotin-Synthese kodieren reprimiert werden. Dies ist sinnvoll,
da an der Biotin-Synthese das Fe/S Protein Bio2p beteiligt ist, welches bei einem
Eisenmangel und in ISC Mutanten als Folge einer eingeschränkten Fe/S Cluster
Biogenese
seine
Funktion
verliert.
Durch
diesen
reziproken
Regulationsmechanismus soll sichergestellt werden, dass der Zelle genügend Biotin
zur Verfügung steht. Dieses ist ein wichtiger Cofaktor von Enzymen wie
beispielsweise der Pyruvat-Carboxylase oder Acetyl-CoA-Carboxylase.
Durch die Induktion eines Gens, dessen Produkt eine putative Häm-Oxygenase ist,
kann zusätzlich zur Eisenaufnahme über die Plasmamembran Eisen aus Häm
freigesetzt werden (Protchenko & Philpott, 2003). Dieses Eisen könnte erneut
essentiellen Eisen-abhängigen Prozessen zur Verfügung gestellt werden.
Die weitgehende Übereinstimmung der Transkriptionsprofile ISC-depletierter Zellen
mit denen von Zellen unter Eisenmangel bestätigt eine Beteiligung der beiden
ISC-Maschinerien an der Regulation der zellulären Eisenhomeostase. Defekte in der
Funktion der mitochondrialen ISC-Maschinerien lösen demnach zumindest einen
Großteil der transkriptionellen Antwort von Hefe auf einen Eisenmangel aus.
Dies bedeutet, dass der Status der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerien maßgeblich an der Regulation der zellulären Eisenhomeostase
auf Transkriptionsebene beteiligt ist. Die beiden mitochondrialen ISC-Maschinerien
- 129 -
Diskussion
sind demnach nicht nur an der Biogenese von Fe/S Proteinen und der Aktivierung
von Aft1p beteiligt, sondern zusätzlich an der Regulation zahlreicher Gene, deren
Produkte Eisen benötigen wie z.B. die Komponenten der Atmungskette und Hämhaltige Proteine, im Folgenden als ISC-abhängige Gene zusammengefasst
(Abb. 29).
Zellkern
Eisen-Regulon
Aft1
ISC-abhängige
Gene
Aft1
Y
CIA
X
?
Cytosol
Atm1
Fe/S
Proteine
TCA
Zyklus
mt Fe
Pool
Atmungskette
Y X
FeCH
Z
Mitochondrium
ISC
Abb. 29: Zelluläre Effekte bei Störungen in der Funktion der ISC-Assemblierungs- und
Exportmaschinerie. Störungen in der Funktion der mitochondrialen ISC-Assemblierungs- und
Exportmaschinerien verursachen: (1) einen Ausfall der CIA-Maschinerie, (2) die Translokation
(Aktivierung) des Transkriptionsfaktors Aft1p in den Zellkern (roter Pfeil), (3) eine differentielle
Expression ISC-abhängiger Gene (graue unterbrochene Pfeile) und (4) die Akkumulation einer
Komponente Z, welche die Ferrochelatase reversibel hemmt. Der Transkriptionsfaktor Aft1p induziert
die Gene des Eisen-Regulons, deren Produkte der Eisenaufnahme über die Plasmamembran sowie
der Mobilisierung von Eisen aus intrazellulären Speichern (Vakuole) dienen. Das durch Defekte in der
ISC-Maschinerie hervorgerufene Transkriptionsmuster entspricht im Wesentlichen dem einer Eisendepletierten Hefezelle. Atm1p repräsentiert in diesem Modell die ISC-Exportmaschinerie. Es ist
bislang unbekannt, welche Proteine zur beobachteten Eisenakkumulation in den Mitochondrien (mt
Fe-Pool) beitragen und ob die Komponenten X und Y identisch sind.
Somit könnte die aus den Mitochondrien stammende Komponente Y außerdem als
Indikator dienen, der den Status Eisen-verbrauchender Reaktionswege in der Zelle
anzeigt. Diese Prozesse könnten über die Konzentration dieser Komponente im
Cytosol detektiert werden. Y könnte entsprechend seiner Konzentration die
Genexpression
im
Zellkern
beeinflussen.
- 130 -
Dadurch
wäre
es
möglich,
ein
Diskussion
Gleichgewicht zwischen dem intrazellulären Eisenbedarf und der Eisenaufnahme
über die Plasmamembran zu schaffen. Die Herkunft der Komponente Y aus den
Mitochondrien erscheint sinnvoll, da zelluläres Eisen hauptsächlich in diesen
Organellen zur Synthese von Fe/S Clustern und Häm benötigt wird.
6.2.4. Mechanismen der
depletierten Zellen
Genregulation
in
Yah1p-
und
Atm1p-
Neben der Induktion von Genen des Eisen-Regulons wurden in Yah1p- und Atm1pdepletierten Zellen zahlreiche ISC-abhängige Gene reprimiert. Wie bereits erwähnt,
handelt es sich u.a. um Gene, deren Produkte Komponenten der Atmungskette sind.
Bislang gibt es keinen Hinweis darauf, dass die Transkriptionsfaktoren Aft1p/Aft2p
neben der Induktion des Eisen-Regulons auch direkt an der Regulation dieser Gene
beteiligt sind. Es ist allerdings möglich, dass diese Isc-abhängigen Gene indirekt
durch die Produkte Aft1p/Aft2p-abhängiger Gene beeinflusst werden.
Das Eisen-Regulon beinhaltet beispielsweise ein Gen, dessen Produkt das RNAbindende Protein Cth2p ist (Puig et al., 2005). Dieses kann an 5΄-UUAUUUAUU-3΄Nonamere im 3΄-nicht-translatierten Bereich bestimmter mRNAs binden und bewirkt
dadurch einen vorzeitigen Abbau. Die Produkte dieser mRNAs nehmen an
verschiedenen
Eisen-abhängigen
Prozessen
teil,
beispielsweise
am
Zitronensäurezyklus, der Häm-Biosynthese oder der Respiration. Ein mögliches Ziel
des Transkriptabbaus könnte die Anpassung des zellulären Stoffwechsels an einen
Eisenmangel sein. Da das Transkriptionsprofil einer CTH2-deletierten Zelle
gegenüber Wildtypzellen moderat verändert ist, kann die gehäufte Reprimierung von
Genen, die für Produkte der Atmungskette kodieren, nur teilweise auf die Wirkung
von Cth2p zurückgeführt werden (Puig et al., 2005). Demnach scheinen zusätzliche
Faktoren an der Regulation dieser Gene beteiligt zu sein. Die Expression von Genen,
die für Produkte der Atmungskette kodieren, werden durch unterschiedliche Faktoren
beeinflusst, wie z.B. der Kohlenstoffquelle im Medium, dem Sauerstoffangebot und
durch den zellulären Häm-Gehalt. Zusätzlich wurde gezeigt, dass auch ein
respiratorischer Defekt unabhängig von der Ursache die Reprimierung von Genen
der Atmungskette bewirkt. Daher ist es schwierig abzuleiten, wodurch diese Gene
bei einem Eisenmangel bzw. bei einem Defekt der ISC-Assemblierungs- und
Exportmaschinerien reprimiert werden. Eisen als Bestandteil von Fe/S Clustern und
Häm findet sich gehäuft in Enzymen der Atmungskette. Die Reprimierung dieser
- 131 -
Diskussion
Gene bei einem Eisenmangel dient vermutlich der Adaption an den aktuellen
intrazellulären Status und der Eisenkonservierung.
Ferner wurde postuliert, dass Defekte in der Fe/S Cluster Biogenese mit oxidativem
Stress einhergehen (Belli et al., 2004; Rodriguez-Manzaneque et al., 2002). Diese
Feststellung kann durch die hier präsentierten Daten nicht bestätigt werden. Die
Transkriptionsprofile der beiden mitochondrialen ISC Mutanten weisen lediglich eine
geringe Übereinstimmung mit Zellen auf, die unter oxidativem Stress leiden. Reaktive
Sauerstoffspezies
reichern
sich
normalerweise
unter
aeroben
Wachstumsbedingungen an. Da die respiratorische Kompetenz in Atm1p- (in
Minimalmedium) und Yah1p-depletierten Zellen eingeschränkt zu sein scheint,
werden vermutlich nur wenig Gene exprimiert, deren Produkte der oxidativen
Stressbeseitigung dienen.
Fermentierende Zellen zeigen eine ähnliche Reprimierung von Genen der
Atmungskette, da diese unter fermentierenden Bedingungen nicht benötigt werden
(Gancedo, 1998; Schüller, 2003). Die gehäufte Induktion von Genen, deren Produkte
in der Glukose-Aufnahme und der Fermentation eine Funktion ausüben, deutet auf
einen Wechsel zur Fermentation hin. In Hefe sorgt der Hap2-5p Komplex für ein
optimales Wachstum auf nicht-fermentierbaren Kohlenstoffquellen (Schüller, 2003).
Daher könnte man vermuten, dass dieser Komplex und ihn regulierende Faktoren
eine wichtige Funktion in der Reprimierung von Genen der Atmungskette bei ISC
Mutanten bzw. bei einem Eisenmangel ausüben.
Gene, deren Produkte Komponenten der Atmungskette sind, und solche, die an der
oxidativen
Stressbeseitigung
beteiligt
sind,
werden
durch
Sauerstoffmangel
reprimiert. Die Erfassung der Sauerstoffkonzentration wird in S. cerevisiae über Häm
vemittelt, da die letzten zwei Schritte der Porphyrinsynthese molekularen Sauerstoff
als Substrat benötigen (Hon et al., 2003). Selbst die Funktionalität der
Ferrochelatase scheint sauerstoffabhängig zu sein (Hon et al., 2003). Somit besteht
in
S. cerevisiae
eine
direkte
Verbindung
zwischen
der
intrazellulären
Sauerstoffkonzentration und der Funktionalität der Häm-Biosynthese. Zu den Hämabhängigen Genen zählen beispielsweise CYC1 (Cytochrom c Isoform 1), CYC7
(Cytochrom c Isoform 2), CYT1 (Cytochrom c1) sowie CTT1 (Katalase) und YHB1
(Flavohämoglobin). Diese werden über den Häm-abhängigen Transkriptionsfaktor
Hap1p (heme activator protein 1) in Anwesenheit von Häm induziert und bei einem
- 132 -
Diskussion
Häm-Mangel reprimiert (Kwast et al., 1999; Zhang & Hach, 1999; Zitomer & Lowry,
1992).
Studien zur Hap1p-abhängigen Genregulation und dem Hap2-5p Komplex wurden
hauptsächlich am CYC1 Gen durchgeführt. Analysen der Kontrollregionen (UAS) des
CYC1 Gens enthüllten zwei unterschiedliche regulatorische Elemente: UAS1 und
UAS2 („upstream activating sequence“ 1 bzw. 2), (Guarente & Hoar, 1984). An UAS1
erfolgt die Bindung des Transkriptionsaktivators Hap1, während UAS2 eine
Bindesequenz des Hap2-5p Komplexes darstellt (Schüller, 2003). Letztere vermittelt
die
Kohlenstoffquellen-abhängige
Genexpression.
Zu
UAS2
verwandte
Sequenzmotive treten in weiteren kernkodierten Genen auf, deren Produkte eine
Funktion in den Mitochondrien besitzen, z.B. in der Cytochrom c Oxidase (COX6),
Cytochrom c1 (CYT1), Ubiquinol-Cytochrom c Oxidoreduktase (QCR8) und der
Citrat-Synthase (CIT1) (Schüller, 2003).
Die Funktion des Transkriptionsfaktors Hap1p und somit des Häms bei der
Regulation respiratorischer Gene in Abhängigkeit von Eisen oder der beiden ISCMaschinerien wird kompliziert durch eine Transposon-Insertion im C-Terminus des
HAP1 Gens im verwendeten Hefe-Stamm W303, wodurch Hap1p funktionslos wird.
Hap1p würde auch unter den Bedingungen der Atm1p- und Yah1p Depletion
induziert. Daher würde man eine Induktion Hap1p-regulierter Gene vermuten. Da das
Gegenteil der Fall ist, scheint Hap1p im Stamm W303 tatsächlich keine Rolle in der
Eisenregulation zu spielen.
Da Yah1p- und Atm1p-depletierte Zellen kein funktionelles Hap1p Protein
synthetisieren, erfolgt die Regulation des CYC1 Gens möglicherweise hauptsächlich
durch den Hap2-5p Komplex. Es lässt sich daher vermuten, dass bei ISC Mutanten
oder Eisenmangel die Beeinträchtigung des Status der respiratorischen Kompetenz
wichtiger sein könnte als der Status von Häm, obwohl sowohl Eisenmangel als auch
Defekte der ISC-Assemblierungs- und Exportmaschinerie mit einer Häm-Defizienz
einhergehen. Dies entspricht der Expression des Eisen-Regulons, das auch unter
normalen Bedingungen unabhängig vom zellulären Häm-Spiegel reguliert wird. Im
Rahmen dieser Arbeit konnte letztendlich nur darüber spekuliert werden, wodurch die
Gene, deren Produkte Komponenten der Atmungskette sind, in ISC Mutanten
reprimiert werden. Weitere Untersuchungen werden nötig sein, um die zu Grunde
liegenden Regulationsmechanismen zu erklären.
- 133 -
Diskussion
6.2.5. Aktivierung des „retrograde response“ in Yah1p-depletierten
Zellen
Eine Fehlfunktion der Mitochondrien kann durch verschiedene Ursachen ausgelöst
werden, beispielsweise durch den Verlust mitochondrialer DNA (sog. rho0 Zellen)
oder durch inaktive Enzyme des Zitronensäurezyklus. Diese Fehlfunktionen lösen
eine veränderte Genexpression im Zellkern aus, den sog „retrograde response“ (Liu
& Butow, 2006). Die transkriptionellen Veränderungen sind ein Versuch der Zelle den
zellulären Stoffwechsel an einen in den Mitochondrien aufgetretenen Defekt zu
adaptieren (Abb. 30). Der „retrograde response“ beinhaltet hauptsächlich die
Aktivierung von Genen, deren Produkte in anaplerotischen Reaktionen eine Rolle
spielen. In rho0 Zellen wird beispielsweise CIT2 dramatisch induziert (Liu & Butow,
2006), welches für eine in den Peroxisomen lokalisierte Citrat-Synthase kodiert (Liao
et al., 1991). Auch Yah1p-depletierte Zellen induzierten CIT2. Die Überproduktion
von Cit2p könnte mit dem Ziel verbunden sein einen Substratmangel im
Zitronensäurezyklus auszugleichen. Das durch den Glyoxylatzyklus hergestellte
Citrat könnte über einen Citrat-Transporter ins Mitochondrium eingeschleust werden.
Citrat wird zur Synthese von α-Ketoglutarat benötigt, eine Vorstufe von Glutamat,
welches seinerseits für zahlreiche Biosynthesen benötigt wird (z.B. Purine und
Aminosäuren). Allerdings ist die Induktion von CIT2 in Yah1p-depletierten Zellen im
Vergleich zu rho0 Zellen eher moderat. Es wird postuliert, dass der „retrograde
response“ durch ein Absinken des Glutamatspiegels induziert wird (Liu & Butow,
2006). Auf Grund der Induktion von DIP5, einer „hochaffinen“ Glutamat/AspartatPermease, könnte man annehmen, dass auch Yah1p-depletierte Zellen unter einem
Glutamatmangel leiden. Yah1p-depletierte Zellen zeigten weitere transkriptionelle
Veränderungen, die teilweise mit den Transkriptionsprofilen von rho0 Zellen
übereinstimmten (Epstein et al., 2001). So wurde beispielsweise das IDH1 Gen,
welches für die Isocitrat-Dehydrogenase des Zitronensäurezyklus kodiert, differentiell
zu Wildtypzellen exprimiert. Dieses Produkt wird neben der Aconitase und CitratSynthase zur Synthese von α-Ketoglutarat im Mitochondrium benötigt. Darüber
hinaus induzierten Yah1p-depletierte Zellen PYC1, dessen Produkt eine PyruvatCarboxylase ist. Diese katalysiert die Synthese von Oxalacetat aus Pyruvat und CO2
(anaplerotische Reaktion), eine Vorstufe von Aspartat. Da respiratorisch defekte
Zellen durch den Zitronensäurezyklus kein Oxalacetat nachliefern können, muss
dieses zur Erhaltung des Kreislaufs extern eingeschleust werden (Abb. 30). Sowohl
Atm1p- als auch Yah1p-depletierte Zellen induzierten zahlreiche Gene, deren
- 134 -
Diskussion
Produkte Hexose-Transporter sind. Auch der Hexose-Transporter Hxt2p ist mit dem
„retrograde response“ assoziiert. Dies könnte bedeuten, dass beide Mutanten unter
einem generellen Mangel an Vorstufen für Biosynthesen leiden, die durch einen
verlangsamten Fluss durch den Zitronensäurezyklus gehemmt sind. Insgesamt
zeigten Yah1p-depletierte Zellen einen eher gemäßigten „retrograde response“. Der
in dieser Arbeit verwendete Stamm W303 ist allerdings grundsätzlich mit einem
schwachen „retrograde response“ assoziiert (Kirchman et al., 1999). Dennoch
wiesen die Transkriptionsprofile von Yah1p-depletierten einige Übereinstimmungen
zu denen von rho0 Zellen auf. Es ist möglich, dass in Yah1p-depletierten Zellen der
„retrograde response“ durch den Aktivitätsverlust des Fe/S Proteins Aconitase
ausgelöst wird. Yah1p übernimmt auch eine Funktion in der Häm A Synthese (Barros
et al., 2002), einem wichtigen Cofaktor der Cytochrom c Oxidase. Daher könnte der
„retrograde response“ auch spezifisch durch einen Funktionsverlust dieses Enzyms
bedingt sein.
- 135 -
Diskussion
Pyruvat
Phospholipid
Acetaldehyd
ALD4 ∗
SPO1
Fettsäure
Acetat
PYC1∗
ACS1
Acetyl-CoA
Peroxisom
CRC1
Oxalacetat
Acetyl-Carnitin
Acetyl-Carnitin
CAT2 ∗
PXA1
Fettsäure
β-Oxidation
Carnitin
Acetyl-Carnitin
Acetyl-CoA
CAT2 ∗
Acetyl-CoA
Oxalacetat
CIT2 ∗
CIT1
Oxalacetat
Citrat
RTG Kontrolle
ACO1
Citrat
CTP1
Glyoxylat-Zyklus
IDH1/2 ∗
Zitronensäurezyklus
Succinat
α-Ketoglutarat
α-Ketoglutarat
ODC2
Mitochondrium
Biosynthese
Glutamat
DIP5 ∗
Plasmamembran
Glutamat
AGP2
Carnitin
Abb. 30: Stoffwechselveränderungen in Zellen mit einem respiratorischen Defekt. Ein
respiratorischer Defekt führt zu diversen Stoffwechselveränderungen, die das Resultat einer
veränderten Genexpression im Zellkern sind („retrograde response“). Dadurch wird eine ausreichende
Synthese von α-Ketoglutarat gewährleistet, welches eine Vorstufe von Glutamat ist und seinerseits für
diverse Biosynthesen benötigt wird. Die Abbildung beschränkt sich auf die Darstellung von Genen,
deren Produkte in der Glutamat-Biosynthese sowie in anaplerotischen Stoffwechselwegen eine
Funktion ausüben. Die unterbrochene Linie im Zitronensäurezyklus weist darauf hin, dass die
Umsetzung von Succinat zu Oxalacetat in Zellen mit einem respiratorischen Defekt unterbrochen ist.
Gene die in Zellen mit einem respiratorischen Defekt oder in Yah1p-depletierten Zellen induziert
wurden sind unterstrichen bzw. mit einem Sternchen (∗) markiert. (Modifiziert nach Liu und Butow,
2006)
- 136 -
Diskussion
6.2.6. Yah1p und Atm1p-depletierte Zellen besitzen eine eingeschränkte
Ferrochelatase Aktivität
Eisen wird zur Synthese von Häm und Fe/S Clustern benötigt, zwei zentrale
Prozesse, von denen angenommen wurde, dass diese unabhängig voneinander
ablaufen.
In
S. cerevisiae
sind
Störungen
in
der
mitochondrialen
ISC-
Assemblierungs- und Exportmaschinerie jedoch fast grundsätzlich mit einem HämMangel und einem Cytochrom-Defekt assoziiert (Lange et al., 2004; Lesuisse et al.,
2003; Santos et al., 2004; Zhang et al., 2005). In Zellen, die einen Defekt in der
Biosynthese von mitochondrialen Fe/S Proteinen aufweisen, ist die Aktivität der
Ferrochelatase (Hem15p) inhibiert. Diese Beobachtung wurde zuerst in Zellen
gemacht, denen das Protein Frataxin (Yfh1p) fehlt. Daher wurde vermutet, dass es
eine funktionelle Beziehung zwischen Yfh1p und der Ferrochelatase geben muss
(Lesuisse et al., 2003; Santos et al., 2004; Zhang et al., 2005). Diese Hypothese
wurde scheinbar durch Beobachtungen gefestigt, die eine direkte Interaktion
zwischen Yfh1p und der Ferrochelatase in vitro zeigen. Diese Protein-Interaktion
konnte in vivo jedoch nicht reproduziert werden (Lange et al., 2004). Vielmehr wurde
gezeigt, dass Mitochondrien mit gestörter Fe/S Cluster Biogenese eine Substanz
anreichern, die die Ferrochelatase reversibel hemmt (Lange et al., 2004). In dieser
Arbeit konnte zusätzlich belegt werden, dass das HEM15 Transkript in ISCAssemblierungs- und Exportmutanten reprimiert wird. An der Reprimierung des
Transkripts könnte teilweise das RNA-bindende Protein Cth2p beteiligt sein. CTH2
wird bei einem Eisenmangel und in ISC Mutanten durch den Transkriptionsfaktor
Aft1p induziert. Die HEM15 mRNA besitzt im 3΄-nicht-translatierten Bereich mehrere
überlappende 5΄-UUAUUUAUU-3΄-Nonamere, die als Bindestellen von Cth2p
fungieren. Es wurde bereits gezeigt, dass HEM15 mRNA bei einem Eisenmangel in
Anwesenheit von Cth2p abgebaut wird (Puig et al., 2005). Die Regulation der
Ferrochelatase
erfolgt
demzufolge
nach
zwei
unterschiedlichen,
parallelen
Mechanismen, einerseits auf Transkriptionsebene und andererseits biochemisch
durch Blockierung der Ferrochelatase mit einem Inhibitor (Lange et al., 2004). Diese
Inhibierung ist allerdings reversibel, da ihre Aktivität nach Reinigung aus
mitochondrialen Extrakten von ISC Mutanten wieder Wildtyp Niveau aufwies.
Möglicherweise handelt es sich bei diesem Inhibitor um eine Substanz mit
regulatorischer Funktion.
Nach den hier vorgelegten Daten beeinflusst die gestörte Eisenhomeostase in Zellen
mit einer inaktivierten ISC-Assemblierungs- und Exportmaschinerie den zellulären
- 137 -
Diskussion
Häm-Spiegel.
Folglich
ist
die
mitochondriale
ISC-Assemblierungmaschinerie
maßgeblich an der Regulation des zellulären Häm-Spiegels in S. cerevisiae beteiligt.
6.2.7. Die ISC-Assemblierungsmaschinerie ist auch in höheren
Eukaryoten an der Regulation der Eisenhomeostase beteiligt
Die Hefe S. cerevisiae und höhere Eukaryoten nutzen unterschiedliche Strategien,
um
ihren
Eisenhaushalt zu
regulieren. Trotz dieser Unterschiede
können
Untersuchungen in Hefe einen gewissen Aufschluss über die Situation in höheren
Eukaryonten geben. Die folgenden Beispiele demonstrieren, dass Mutationen in ISCKomponenten der Hefe und in höheren Eukaryoten trotz unterschiedlicher
Regulationsmechanismen teilweise ähnliche phänotypische Konsequenzen nach
sich ziehen:
1) Eine Mutation im Gen GRX5 führt sowohl in Hefe als auch im Modellsystem
Zebrafisch zu einer Beeinträchtigung der Fe/S Cluster- und Häm-Biogenese.
Allerdings unterscheiden sich die zu Grunde liegenden Mechanismen deutlich
(Wingert et al., 2005). Eine GRX5 Mutation im Zebrafisch bedingt eine reduzierte
Reifung des IRP1 Fe/S Proteins (Hentze et al., 2004). Dadurch wird der Zelle ein
Eisenmangel signalisiert. IRP1 bindet an den 5΄-nicht-translatierten Bereich einer
mRNA, die für δ-Aminolävulinsäure-Synthase 2 kodiert (Schlüsselenzym der HämBiosynthese) und blockiert deren Translation. Als Folge entwickelt sich eine
hypochromatische Anämie.
2) Das in Säugern synthetisierte Protein Abcb7 ist ein funktionelles Ortholog des
Hefe ABC-Transporters Atm1p (Csere et al., 1998). Ein Funktionsverlust des HefeProteins verursacht einen starken Wachstumsdefekt, eine Akkumulation von Eisen in
den Mitochondrien sowie eine Beeinträchtigung in der Assemblierung von
cytosolischen Fe/S Proteinen (Kispal et al., 1997; Kispal et al., 1999). Dieser
Phänotyp kann durch die Expression von humanem ABCB7 aufgehoben werden
(Csere et al., 1998). Eine Mutation im menschlichen Ortholog hABCB7 resultiert in
einer Eisenspeichererkrankung, der X-Chromosom-gekoppelten sideroblastischen
Anämie und Ataxie (XLSA/A) (Allikmets et al., 1999; Bekri et al., 2000).
In Mäusen ist die Deletion von ABCB7 letal. Eine Gewebs-spezifische Deletion von
ABCB7 in der Leber führt dagegen zu lebensfähigen Tieren, die allerdings eine
reduzierte Reifung cytosolischer Fe/S Proteine zur Folge hat (z.B. Xanthin-Oxidase).
Die Abcb7 Inaktivierung bedingt zusätzlich eine reduzierte Umwandlung von IRP1 in
- 138 -
Diskussion
die cytosolische Aconitaseform und führt schließlich zu einer weitreichenden
Fehlregulation des Eisenstoffwechsels (Pondarre et al., 2006).
3) Die gezielte Depletion von Frataxin und Nfs1 mittels RNAi Technologie verursacht
in HeLa Zellen einen Aktivitätsverlust mitochondrialer und cytosolischer Fe/S
Proteine, während Proteine ohne Fe/S Cluster unbeeinflusst bleiben (Stehling et al.,
2004). Im Menschen manifestiert sich ein Mangel an Frataxin in einer degenerativen
Erkrankung des zentralen Nervensystems (Friedreich Ataxie). Die betroffenen
Personen besitzen in der Regel eine GAA-Triplett Wiederholung im ersten Intron des
FRDA Gens, wodurch sich eine ungewöhnlich stabile mRNA-DNA Überstruktur
ausbildet, die die Transkription verlangsamt (Bidichandani et al., 1998; Vetcher et al.,
2002). Als Folge akkumulieren humane Zellen verstärkt Eisen in den Mitochondrien
(Biederbick et al., 2006; Stehling et al., 2004).
Obwohl die der Eisenregulation zu Grunde liegenden Mechanismen in Hefe und
höheren Eukaryoten völlig anders sind, wird auch in jenem Organismus, wie oben
diskutiert, Eisen in den Mitochondrien als Folge von Defekten in der Fe/S ProteinBiogenese akkumuliert. Die biologische Bedeutung dieser offensichtlich allgemein
gültigen Konsequenzen liegt in der universellen Steuerung der Eisenaufnahme und
Verteilung in der eukaryotischen Zelle durch die mitochondriale Fe/S ProteinBiogenese.
- 139 -
Literatur
7. Literatur
Adam, A. C., Bornhovd, C., Prokisch, H., Neupert, W. & Hell, K. (2006). The Nfs1 interacting
protein Isd11 has an essential role in Fe/S cluster biogenesis in mitochondria. Embo J 25, 174-183.
Agar, J. N., Krebs, C., Frazzon, J., Huynh, B. H., Dean, D. R. & Johnson, M. K. (2000a). IscU as a
scaffold for iron-sulfur cluster biosynthesis: sequential assembly of [2Fe-2S] and [4Fe-4S] clusters in
IscU. Biochemistry 39, 7856-7862.
Agar, J. N., Yuvaniyama, P., Jack, R. F., Cash, V. L., Smith, A. D., Dean, D. R. & Johnson, M. K.
(2000b). Modular organization and identification of a mononuclear iron-binding site within the NifU
protein. J Biol Inorg Chem 5, 167-177.
Ali, V., Shigeta, Y., Tokumoto, U., Takahashi, Y. & Nozaki, T. (2004). An intestinal parasitic protist,
Entamoeba histolytica, possesses a non-redundant nitrogen fixation-like system for iron-sulfur cluster
assembly under anaerobic conditions. J Biol Chem 279, 16863-16874.
Allikmets, R., Raskind, W. H., Hutchinson, A., Schueck, N. D., Dean, M. & Koeller, D. M. (1999).
Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and
ataxia (XLSA/A). Hum Mol Genet 8, 743-749.
Aloria, K., Schilke, B., Andrew, A. & Craig, E. A. (2004). Iron-induced oligomerization of yeast
frataxin homologue Yfh1 is dispensable in vivo. EMBO Rep 5, 1096-1101.
Balk, J., Pierik, A. J., Netz, D. J., Mühlenhoff, U. & Lill, R. (2004). The hydrogenase-like Nar1p is
essential for maturation of cytosolic and nuclear iron-sulphur proteins. Embo J 23, 2105-2115.
Balk, J., Aguilar Netz, D. J., Tepper, K., Pierik, A. J. & Lill, R. (2005). The essential WD40 protein
Cia1 is involved in a late step of cytosolic and nuclear iron-sulfur protein assembly. Mol Cell Biol 25,
10833-10841.
Barros, M. H. & Nobrega, F. G. (1999). YAH1 of Saccharomyces cerevisiae: a new essential gene
that codes for a protein homologous to human adrenodoxin. Gene 233, 197-203.
Barros, M. H., Nobrega, F. G. & Tzagoloff, A. (2002). Mitochondrial ferredoxin is required for heme A
synthesis in Saccharomyces cerevisiae. J Biol Chem 277, 9997-10002.
Beinert, H., Holm, R. H. & Munck, E. (1997). Iron-sulfur clusters: nature's modular, multipurpose
structures. Science 277, 653-659.
Beinert, H. (2000). Iron-sulfur proteins: ancient structures, still full of surprises. J Biol Inorg Chem 5, 215.
Bekri, S., Kispal, G., Lange, H., Fitzsimons, E., Tolmie, J., Lill, R. & Bishop, D. F. (2000). Human
ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with
disruption of cytosolic iron-sulfur protein maturation. Blood 96, 3256-3264.
Belli, G., Molina, M. M., Garcia-Martinez, J., Perez-Ortin, J. E. & Herrero, E. (2004).
Saccharomyces cerevisiae glutaredoxin 5-deficient cells subjected to continuous oxidizing conditions
are affected in the expression of specific sets of genes. J Biol Chem 279, 12386-12395.
Bidichandani, S. I., Ashizawa, T. & Patel, P. I. (1998). The GAA triplet-repeat expansion in
Friedreich ataxia interferes with transcription and may be associated with an unusual DNA structure.
Am J Hum Genet 62, 111-121.
Biederbick, A., Stehling, O., Rosser, R., Niggemeyer, B., Nakai, Y., Elsasser, H. P. & Lill, R.
(2006). Role of human mitochondrial Nfs1 in cytosolic iron-sulfur protein biogenesis and iron
regulation. Mol Cell Biol 26, 5675-5687.
Blaiseau, P. L., Lesuisse, E. & Camadro, J. M. (2001). Aft2p, a novel iron-regulated transcription
activator that modulates, with Aft1p, intracellular iron use and resistance to oxidative stress in yeast. J
Biol Chem 276, 34221-34226.
- 140 -
Literatur
Boukhalfa, H. & Crumbliss, A. L. (2002). Chemical aspects of siderophore mediated iron transport.
Biometals 15, 325-339.
Bradford, M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the principle of protein dye binding. Analytical Biochemistry 72, 248-254.
Butow, R. A. & Avadhani, N. G. (2004). Mitochondrial signaling: the retrograde response. Mol Cell
14, 1-15.
Cammack, R. (1992). Iron-sulfur clustersin enzymes: Themes and variations. In Iron-sulfur proteins,
pp. 281-322. Edited by R. Cammack. San Diego: Academic Press.
Cheek, J. & Broderick, J. B. (2001). Adenosylmethionine-dependent iron-sulfur enzymes: versatile
clusters in a radical new role. J Biol Inorg Chem 6, 209-226.
Chen, O. S., Crisp, R. J., Valachovic, M., Bard, M., Winge, D. R. & Kaplan, J. (2004). Transcription
of the yeast iron regulon does not respond directly to iron but rather to iron-sulfur cluster biosynthesis.
J Biol Chem 279, 29513-29518.
Corpet, F. (1988). Multiple sequence alignment with hierachial clustering. Nucleic Acids Research 16,
10881-10890.
Crack, J. C., Green, J., Le Brun, N. E. & Thomson, A. J. (2006). Detection of sulfide release from
the oxygen-sensing [4Fe-4S] cluster of FNR. J Biol Chem.
Csere, P., Lill, R. & Kispal, G. (1998). Identification of a human mitochondrial ABC transporter, the
functional orthologue of yeast Atm1p. FEBS Lett 441, 266-270.
Dancis, A. (1998). Genetic analysis of iron uptake in the yeast Saccharomyces cerevisiae. J Pediatr
132, S24-29.
Daum, G., Gasser, S. M. & Schatz, G. (1982). Import of proteins into mitochondria: Energydependent, two step processing of the intermembrane space enzyme cytochrome b2 by isolated yeast
mitochondria. J Biol Chem 257, 13075-13080.
De Luca, N. G. & Wood, P. M. (2000). Iron uptake by fungi: contrasted mechanisms with internal or
external reduction. Adv Microb Physiol 43, 39-74.
Dean, D. R., Bolin, J. T. & Zheng, L. (1993). Nitrogenase metalloclusters: structures, organization,
and synthesis. J Bacteriol 175, 6737-6744.
Diekert, K., de Kroon, A. I., Kispal, G. & Lill, R. (2001). Isolation and subfractionation of
mitochondria from the yeast Saccharomyces cerevisiae. Methods Cell Biol 65, 37-51.
Dix, D., Bridgham, J., Broderius, M. & Eide, D. (1997). Characterization of the Fet4p protein of
yeast. Evidence for a direct role in the transport of iron. J Biol Chem 272, 11770-11777.
Dix, D. R., Bridgham, J. T., Broderius, M. A., Byersdorfer, C. A. & Eide, D. J. (1994). The FET4
gene encodes the low affinity Fe (II) transport protein of Saccharomyces cerevisiae. J Biol Chem 269,
26092-26099.
Dower, W., Miller, J. & Ragsdale, C. (1988). High efficiency transformation of Erischia coli by high
voltage electroporation. Nucleic Acids Res. 16, 6127-6145.
Dutkiewicz, R., Schilke, B., Knieszner, H., Walter, W., Craig, E. A. & Marszalek, J. (2003). Ssq1, a
mitochondrial Hsp70 involved in iron-sulfur (Fe/S) center biogenesis. Similarities to and differences
from its bacterial counterpart. J Biol Chem 278, 29719-29727.
Dutkiewicz, R., Schilke, B., Cheng, S., Knieszner, H., Craig, E. A. & Marszalek, J. (2004).
Sequence-specific interaction between mitochondrial Fe-S scaffold protein Isu and Hsp70 Ssq1 is
essential for their in vivo function. J Biol Chem 279, 29167-29174.
- 141 -
Literatur
Dutkiewicz, R., Marszalek, J., Schilke, B., Craig, E. A., Lill, R. & Muhlenhoff, U. (2006). The hsp70
chaperone ssq1p is dispensable for iron-sulfur cluster formation on the scaffold protein isu1p. J Biol
Chem 281, 7801-7808.
Englard, S. & Siegel, L. (1969). Mitochondrial L-malate dehydrogenase of beef heart. Methods in
Enzymology 13.
Epstein, C. B., Waddle, J. A., Hale, W. t., Dave, V., Thornton, J., Macatee, T. L., Garner, H. R. &
Butow, R. A. (2001). Genome-wide responses to mitochondrial dysfunction. Mol Biol Cell 12, 297308.
Fansler, B. & Lowenstein, J. M. (1969). Aconitase from pig heart. Methods in Enzymology 13, 26-30.
Flint, D. H. (1996). Escherichia coli contains a protein that is homologous in function and N-terminal
sequence to the protein encoded by the nifS gene of Azotobacter vinelandii and that can participate in
the synthesis of the Fe-S cluster of dihydroxy-acid dehydratase. J Biol Chem 271, 16068-16074.
Foury, F. (1999). Low iron concentration and aconitase deficiency in a yeast frataxin homologue
deficient strain. FEBS Lett 456, 281-284.
Foury, F. & Talibi, D. (2001). Mitochondrial control of iron homeostasis. A genome wide analysis of
gene expression in a yeast frataxin-deficient strain. J Biol Chem 276, 7762-7768.
Foury, F. & Roganti, T. (2002). Deletion of the mitochondrial carrier genes MRS3 and MRS4
suppresses mitochondrial iron accumulation in a yeast frataxin-deficient strain. J Biol Chem 277,
24475-24483.
Frazzon, J., Fick, J. R. & Dean, D. R. (2002). Biosynthesis of iron-sulphur clusters is a complex and
highly conserved process. Biochem Soc Trans 30, 680-685.
Frazzon, J. & Dean, D. R. (2003). Formation of iron-sulfur clusters in bacteria: an emerging field in
bioinorganic chemistry. Curr Opin Chem Biol 7, 166-173.
Gancedo, J. M. (1998). Yeast carbon catabolite repression. Microbiol Mol Biol Rev 62, 334-361.
Garland, S. A., Hoff, K., Vickery, L. E. & Culotta, V. C. (1999). Saccharomyces cerevisiae ISU1 and
ISU2: members of a well-conserved gene family for iron-sulfur cluster assembly. J Mol Biol 294, 897907.
Gerber, J. & Lill, R. (2002). Biogenesis of iron-sulfur proteins in eukaryotes: components, mechanism
and pathology. Mitochondrion 2, 71-86.
Gerber, J., Muhlenhoff, U. & Lill, R. (2003). An interaction between frataxin and Isu1/Nfs1 that is
crucial for Fe/S cluster synthesis on Isu1. EMBO Rep 4, 906-911.
Gerber, J., Neumann, K., Prohl, C., Muhlenhoff, U. & Lill, R. (2004). The yeast scaffold proteins
Isu1p and Isu2p are required inside mitochondria for maturation of cytosolic Fe/S proteins. Mol Cell
Biol 24, 4848-4857.
Green, J. & Paget, M. S. (2004). Bacterial redox sensors. Nat Rev Microbiol 2, 954-966.
Guarente, L. & Hoar, E. (1984). Upstream activation sites of the CYC1 gene of Saccharomyces
cerevisiae are active when inverted but not when placed downstream of the "TATA box". Proc Natl
Acad Sci U S A 81, 7860-7864.
Haas, H. (2003). Molecular genetics of fungal siderophore biosynthesis and uptake: the role of
siderophores in iron uptake and storage. Appl Microbiol Biotechnol 62, 316-330.
Hausmann, A., Aguilar Netz, D. J., Balk, J., Pierik, A. J., Mühlenhoff, U. & Lill, R. (2005). The
eukaryotic P loop NTPase Nbp35: an essential component of the cytosolic and nuclear iron-sulfur
protein assembly machinery. Proc Natl Acad Sci U S A 102, 3266-3271.
- 142 -
Literatur
Hausmann, A., Samans, B., Urzica, E., Lill, R. & Mühlenhoff, U. (2006). Analysis of genome-wide
transcriptional responses to defects in cellular Fe/S biogenesis in Saccharomyces cerevisiae. in
preparation.
Hentze, M. W., Muckenthaler, M. U. & Andrews, N. C. (2004). Balancing acts: molecular control of
mammalian iron metabolism. Cell 117, 285-297.
Hinchliffe, P. & Sazanov, L. A. (2005). Organization of iron-sulfur clusters in respiratory complex I.
Science 309, 771-774.
Hoff, K. G., Silberg, J. J. & Vickery, L. E. (2000). Interaction of the iron-sulfur cluster assembly
protein IscU with the Hsc66/Hsc20 molecular chaperone system of Escherichia coli. Proc Natl Acad
Sci U S A 97, 7790-7795.
Hoff, K. G., Cupp-Vickery, J. R. & Vickery, L. E. (2003). Contributions of the LPPVK motif of the
iron-sulfur template protein IscU to interactions with the Hsc66-Hsc20 chaperone system. J Biol Chem
278, 37582-37589.
Hoffman, C. & Winston, F. (1987). A ten-minute DNA preparation from yeast efficiently releases
autonomous plamids for transformation of Escherichia coli. Gene 57, 267-272.
Hon, T., Dodd, A., Dirmeier, R., Gorman, N., Sinclair, P. R., Zhang, L. & Poyton, R. O. (2003). A
mechanism of oxygen sensing in yeast. Multiple oxygen-responsive steps in the heme biosynthetic
pathway affect Hap1 activity. J Biol Chem 278, 50771-50780.
Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S. & O'Shea, E.
K. (2003). Global analysis of protein localization in budding yeast. Nature 425, 686-691.
Isaya, G., O'Neill, H. A., Gakh, O., Park, S., Mantcheva, R. & Mooney, S. M. (2004). Functional
studies of frataxin. Acta Paediatr Suppl 93, 68-71; discussion 72-63.
Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983). Transformation of intact yeast cells treated with
alkali cations. J Bacteriol 153, 163-168.
Jacobson, M. R., Cash, V. L., Weiss, M. C., Laird, N. F., Newton, W. E. & Dean, D. R. (1989).
Biochemical and genetic analysis of the nifUSVWZM cluster from Azotobacter vinelandii. Mol Gen
Genet 219, 49-57.
Jensen, L. T. & Culotta, V. C. (2000). Role of Saccharomyces cerevisiae ISA1 and ISA2 in iron
homeostasis. Mol Cell Biol 20, 3918-3927.
Johnson, A. E. & Brown, R. C. (1998). Measurement of the performance of air cleaners against the
particulate element of rosin-based solder flux fume. Ann Occup Hyg 42, 511-519.
Johnson, D. C., Dean, D. R., Smith, A. D. & Johnson, M. K. (2005). Structure, function and
formation of biological iron-sulfur clusters. Annu Rev Biochem 74, 247-281.
Kaiser, J. T., Clausen, T., Bourenkow, G. P., Bartunik, H. D., Steinbacher, S. & Huber, R. (2000).
Crystal structure of a NifS-like protein from Thermotoga maritima: implications for iron sulphur cluster
assembly. J Mol Biol 297, 451-464.
Kambampati, R. & Lauhon, C. T. (1999). IscS is a sulfurtransferase for the in vitro biosynthesis of 4thiouridine in Escherichia coli tRNA. Biochemistry 38, 16561-16568.
Kambampati, R. & Lauhon, C. T. (2000). Evidence for the transfer of sulfane sulfur from IscS to ThiI
during the in vitro biosynthesis of 4-thiouridine in Escherichia coli tRNA. J Biol Chem 275, 1072710730.
Kaut, A., Lange, H., Diekert, K., Kispal, G. & Lill, R. (2000). Isa1p is a component of the
mitochondrial machinery for maturation of cellular iron-sulfur proteins and requires conserved cysteine
residues for function. J Biol Chem 275, 15955-15961.
- 143 -
Literatur
Kim, R., Saxena, S., Gordon, D. M., Pain, D. & Dancis, A. (2001). J-domain protein, Jac1p, of yeast
mitochondria required for iron homeostasis and activity of Fe-S cluster proteins. J Biol Chem 276,
17524-17532.
Kirchman, P. A., Kim, S., Lai, C. Y. & Jazwinski, S. M. (1999). Interorganelle signaling is a
determinant of longevity in Saccharomyces cerevisiae. Genetics 152, 179-190.
Kispal, G., Csere, P., Guiard, B. & Lill, R. (1997). The ABC transporter Atm1p is required for
mitochondrial iron homeostasis. FEBS Lett 418, 346-350.
Kispal, G., Csere, P., Prohl, C. & Lill, R. (1999). The mitochondrial proteins Atm1p and Nfs1p are
essential for biogenesis of cytosolic Fe/S proteins. Embo J 18, 3981-3989.
Kispal, G., Sipos, K., Lange, H. & other authors (2005). Biogenesis of cytosolic ribosomes requires
the essential iron-sulphur protein Rli1p and mitochondria. Embo J 24, 589-598.
Kohlhaw, G. B. (1988). Isopropylmalate dehydratase from yeast. Methods Enzymol 166, 423-429.
Kosman, D. J. (2003). Molecular mechanisms of iron uptake in fungi. Mol Microbiol 47, 1185-1197.
Kuhnke, G., Neumann, K., Muhlenhoff, U. & Lill, R. (2006). Stimulation of the ATPase activity of the
yeast mitochondrial ABC transporter Atm1p by thiol compounds. Mol Membr Biol 23, 173-184.
Kwast, K. E., Burke, P. V., Staahl, B. T. & Poyton, R. O. (1999). Oxygen sensing in yeast: evidence
for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes.
Proc Natl Acad Sci U S A 96, 5446-5451.
Kyshe-Andersen, J. (1984). Electroblotting of multiple geles: a simple apparatus without buffer tank
for rapid transfer of proteins from polyacrylamide to nitrocellulose. Bioch? 10, 203-207.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227, 680-685.
Lan, C., Lee, H. C., Tang, S. & Zhang, L. (2004). A novel mode of chaperone action: heme activation
of Hap1 by enhanced association of Hsp90 with the repressed Hsp70-Hap1 complex. J Biol Chem
279, 27607-27612.
Land, T. & Rouault, T. A. (1998). Targeting of a human iron-sulfur cluster assembly enzyme, nifs, to
different subcellular compartments is regulated through alternative AUG utilization. Mol Cell 2, 807815.
Lange, H., Kispal, G. & Lill, R. (1999). Mechanism of iron transport to the site of heme synthesis
inside yeast mitochondria. J Biol Chem 274, 18989-18996.
Lange, H., Kaut, A., Kispal, G. & Lill, R. (2000). A mitochondrial ferredoxin is essential for biogenesis
of cellular iron-sulfur proteins. Proc Natl Acad Sci U S A 97, 1050-1055.
Lange, H., Lisowsky, T., Gerber, J., Muhlenhoff, U., Kispal, G. & Lill, R. (2001). An essential
function of the mitochondrial sulfhydryl oxidase Erv1p/ALR in the maturation of cytosolic Fe/S proteins.
EMBO Rep 2, 715-720.
Lange, H., Muhlenhoff, U., Denzel, M., Kispal, G. & Lill, R. (2004). The heme synthesis defect of
mutants impaired in mitochondrial iron-sulfur protein biogenesis is caused by reversible inhibition of
ferrochelatase. J Biol Chem 279, 29101-29108.
Larsson, N. G., Wang, J., Wilhelmsson, H., Oldfors, A., Rustin, P., Lewandoski, M., Barsh, G. S.
& Clayton, D. A. (1998). Mitochondrial transcription factor A is necessary for mtDNA maintenance
and embryogenesis in mice. Nat Genet 18, 231-236.
Lauhon, C. T. (2002). Requirement for IscS in biosynthesis of all thionucleosides in Escherichia coli. J
Bacteriol 184, 6820-6829.
- 144 -
Literatur
Leipe, D. D., Wolf, Y. I., Koonin, E. V. & Aravind, L. (2002). Classification and evolution of P-loop
GTPases and related ATPases. J Mol Biol 317, 41-72.
Leon, S., Touraine, B., Ribot, C., Briat, J. F. & Lobreaux, S. (2003). Iron-sulphur cluster assembly
in plants: distinct NFU proteins in mitochondria and plastids from Arabidopsis thaliana. Biochem J 371,
823-830.
Lesuisse, E., Santos, R., Matzanke, B. F., Knight, S. A., Camadro, J. M. & Dancis, A. (2003). Iron
use for haeme synthesis is under control of the yeast frataxin homologue (Yfh1). Hum Mol Genet 12,
879-889.
Lesur, I. & Campbell, J. L. (2004). The transcriptome of prematurely aging yeast cells is similar to
that of telomerase-deficient cells. Mol Biol Cell 15, 1297-1312.
Li, J., Kogan, M., Knight, S. A., Pain, D. & Dancis, A. (1999). Yeast mitochondrial protein, Nfs1p,
coordinately regulates iron-sulfur cluster proteins, cellular iron uptake, and iron distribution. J Biol
Chem 274, 33025-33034.
Li, J., Saxena, S., Pain, D. & Dancis, A. (2001). Adrenodoxin reductase homolog (Arh1p) of yeast
mitochondria required for iron homeostasis. J Biol Chem 276, 1503-1509.
Li, L. & Kaplan, J. (2004). A mitochondrial-vacuolar signaling pathway in yeast that affects iron and
copper metabolism. J Biol Chem 279, 33653-33661.
Liao, X. S., Small, W. C., Srere, P. A. & Butow, R. A. (1991). Intramitochondrial functions regulate
nonmitochondrial citrate synthase (CIT2) expression in Saccharomyces cerevisiae. Mol Cell Biol 11,
38-46.
Lill, R., Diekert, K., Kaut, A., Lange, H., Pelzer, W., Prohl, C. & Kispal, G. (1999). The essential role
of mitochondria in the biogenesis of cellular iron-sulfur proteins. Biol Chem 380, 1157-1166.
Lisowsky, T. (1992). Dual function of a new nuclear gene for oxidative phosphorylation and
vegetative growth in yeast. Mol Gen Genet 232, 58-64.
Liu, Z. & Butow, R. A. (2006). Mitochondrial retrograde signaling. Annu Rev Genet.
Loiseau, L., Ollagnier-de-Choudens, S., Nachin, L., Fontecave, M. & Barras, F. (2003). Biogenesis
of Fe-S cluster by the bacterial Suf system: SufS and SufE form a new type of cysteine desulfurase. J
Biol Chem 278, 38352-38359.
Lorain, S., Lecluse, Y., Scamps, C., Mattei, M. G. & Lipinski, M. (2001). Identification of human and
mouse HIRA-interacting protein-5 (HIRIP5), two mammalian representatives in a family of
phylogenetically conserved proteins with a role in the biogenesis of Fe/S proteins. Biochim Biophys
Acta 1517, 376-383.
Lutz, T., Westermann, B., Neupert, W. & Herrmann, J. M. (2001). The mitochondrial proteins Ssq1
and Jac1 are required for the assembly of iron sulfur clusters in mitochondria. J Mol Biol 307, 815-825.
Malkin, R. & Rabinowitz, J. C. (1966). The reconstitution of clostridial ferredoxin. Biochem Biophys
Res Commun 23, 822-827.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular cloning - A laboratory manual. Cold
Spring Harbor, USA: Cold Spring Harbor Laboratory Press.
Mansy, S. S., Wu, G., Surerus, K. K. & Cowan, J. A. (2002). Iron-sulfur cluster biosynthesis.
Thermatoga maritima IscU is a structured iron-sulfur cluster assembly protein. J Biol Chem 277,
21397-21404.
Manzella, L., Barros, M. H. & Nobrega, F. G. (1998). ARH1 of Saccharomyces cerevisiae: a new
essential gene that codes for a protein homologous to the human adrenodoxin reductase. Yeast 14,
839-846.
- 145 -
Literatur
Mesecke, N., Terziyska, N., Kozany, C., Baumann, F., Neupert, W., Hell, K. & Herrmann, J. M.
(2005). A disulfide relay system in the intermembrane space of mitochondria that mediates protein
import. Cell 121, 1059-1069.
Mühlenhoff, U. & Lill, R. (2000). Biogenesis of iron-sulfur proteins in eukaryotes: a novel task of
mitochondria that is inherited from bacteria. Biochim Biophys Acta 1459, 370-382.
Mühlenhoff, U., Richhardt, N., Ristow, M., Kispal, G. & Lill, R. (2002). The yeast frataxin homolog
Yfh1p plays a specific role in the maturation of cellular Fe/S proteins. Hum Mol Genet 11, 2025-2036.
Mühlenhoff, U., Stadler, J. A., Richhardt, N., Seubert, A., Eickhorst, T., Schweyen, R. J., Lill, R.
& Wiesenberger, G. (2003). A specific role of the yeast mitochondrial carriers MRS3/4p in
mitochondrial iron acquisition under iron-limiting conditions. J Biol Chem 278, 40612-40620.
Mühlenhoff, U., Gerber, J., Richhardt, N. & Lill, R. (2003). Components involved in assembly and
dislocation of iron-sulfur clusters on the scaffold protein Isu1p. Embo J 22, 4815-4825.
Mühlenhoff, U., Balk, J., Richhardt, N., Kaiser, J. T., Sipos, K., Kispal, G. & Lill, R. (2004).
Functional characterization of the eukaryotic cysteine desulfurase Nfs1p from Saccharomyces
cerevisiae. J Biol Chem 279, 36906-36915.
Muller, M. & Martin, W. (1999). The genome of Rickettsia prowazekii and some thoughts on the origin
of mitochondria and hydrogenosomes. Bioessays 21, 377-381.
Mumberg, D., Muller, R. & Funk, M. (1995). Yeast vectors for the controlled expression of
heterologous proteins in different genetic backgrounds. Gene 156, 119-122.
Nachin, L., El Hassouni, M., Loiseau, L., Expert, D. & Barras, F. (2001). SoxR-dependent response
to oxidative stress and virulence of Erwinia chrysanthemi: the key role of SufC, an orphan ABC
ATPase. Mol Microbiol 39, 960-972.
Nachin, L., Loiseau, L., Expert, D. & Barras, F. (2003). SufC: an unorthodox cytoplasmic
ABC/ATPase required for [Fe-S] biogenesis under oxidative stress. Embo J 22, 427-437.
Nair, M., Adinolfi, S., Pastore, C., Kelly, G., Temussi, P. & Pastore, A. (2004). Solution structure of
the bacterial frataxin ortholog, CyaY: mapping the iron binding sites. Structure 12, 2037-2048.
Nakai, Y., Nakai, M., Hayashi, H. & Kagamiyama, H. (2001). Nuclear localization of yeast Nfs1p is
required for cell survival. J Biol Chem 276, 8314-8320.
Nakai, Y., Umeda, N., Suzuki, T., Nakai, M., Hayashi, H., Watanabe, K. & Kagamiyama, H. (2004).
Yeast Nfs1p is involved in thio-modification of both mitochondrial and cytoplasmic tRNAs. J Biol Chem
279, 12363-12368.
Neilands, J. B. (1995). Siderophores: structure and function of microbial iron transport compounds. J
Biol Chem 270, 26723-26726.
Nishio, K. & Nakai, M. (2000). Transfer of iron-sulfur cluster from NifU to apoferredoxin. J Biol Chem
275, 22615-22618.
Ollagnier-de Choudens, S., Nachin, L., Sanakis, Y., Loiseau, L., Barras, F. & Fontecave, M.
(2003). SufA from Erwinia chrysanthemi. Characterization of a scaffold protein required for iron-sulfur
cluster assembly. J Biol Chem 278, 17993-18001.
Outten, F. W., Wood, M. J., Munoz, F. M. & Storz, G. (2003). The SufE protein and the SufBCD
complex enhance SufS cysteine desulfurase activity as part of a sulfur transfer pathway for Fe-S
cluster assembly in Escherichia coli. J Biol Chem 278, 45713-45719.
Outten, F. W., Djaman, O. & Storz, G. (2004). A suf operon requirement for Fe-S cluster assembly
during iron starvation in Escherichia coli. Mol Microbiol 52, 861-872.
Patzer, S. I. & Hantke, K. (1999). SufS is a NifS-like protein, and SufD is necessary for stability of the
[2Fe-2S] FhuF protein in Escherichia coli. J Bacteriol 181, 3307-3309.
- 146 -
Literatur
Pelzer, W., Muhlenhoff, U., Diekert, K., Siegmund, K., Kispal, G. & Lill, R. (2000). Mitochondrial
Isa2p plays a crucial role in the maturation of cellular iron-sulfur proteins. FEBS Lett 476, 134-139.
Pondarre, C., Antiochos, B. B., Campagna, D. R. & other authors (2006). The mitochondrial ATPbinding cassette transporter Abcb7 is essential in mice and participates in cytosolic iron-sulfur cluster
biogenesis. Hum Mol Genet 15, 953-964.
Portnoy, M. E., Liu, X. F. & Culotta, V. C. (2000). Saccharomyces cerevisiae expresses three
functionally distinct homologues of the nramp family of metal transporters. Mol Cell Biol 20, 78937902.
Protchenko, O. & Philpott, C. C. (2003). Regulation of intracellular heme levels by HMX1, a
homologue of heme oxygenase, in Saccharomyces cerevisiae. J Biol Chem 278, 36582-36587.
Puccio, H. & Koenig, M. (2000). Recent advances in the molecular pathogenesis of Friedreich ataxia.
Hum Mol Genet 9, 887-892.
Puig, S., Askeland, E. & Thiele, D. J. (2005). Coordinated remodeling of cellular metabolism during
iron deficiency through targeted mRNA degradation. Cell 120, 99-110.
Raguzzi, F., Lesuisse, E. & Crichton, R. R. (1988). Iron storage in Saccharomyces cerevisiae. FEBS
Lett 231, 253-258.
Rangachari, K., Davis, C. T., Eccleston, J. F., Hirst, E. M., Saldanha, J. W., Strath, M. & Wilson,
R. J. (2002). SufC hydrolyzes ATP and interacts with SufB from Thermotoga maritima. FEBS Lett 514,
225-228.
Reents, H., Gruner, I., Harmening, U., Bottger, L. H., Layer, G., Heathcote, P., Trautwein, A. X.,
Jahn, D. & Hartig, E. (2006). Bacillus subtilis Fnr senses oxygen via a [4Fe-4S] cluster coordinated
by three cysteine residues without change in the oligomeric state. Mol Microbiol 60, 1432-1445.
Rees, D. C. & Howard, J. B. (2000). Nitrogenase: standing at the crossroads. Curr Opin Chem Biol 4,
559-566.
Rees, D. C. (2002). Great metalloclusters in enzymology. Annu Rev Biochem 71, 221-246.
Regenberg, B., During-Olsen, L., Kielland-Brandt, M. C. & Holmberg, S. (1999). Substrate
specificity and gene expression of the amino-acid permeases in Saccharomyces cerevisiae. Curr
Genet 36, 317-328.
Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M. & Seraphin, B. (1999). A generic protein
purification method for protein complex characterization and proteome exploration. Nat Biotechnol 17,
1030-1032.
Robinson, K. M. & Lemire, B. D. (1995). Flavinylation of succinate: ubiquinone oxidoreductase from
Saccharomyces cerevisiae. Methods in Enzymology 260, 34-51.
Rodriguez-Manzaneque, M. T., Tamarit, J., Belli, G., Ros, J. & Herrero, E. (2002). Grx5 is a
mitochondrial glutaredoxin required for the activity of iron/sulfur enzymes. Mol Biol Cell 13, 1109-1121.
Roy, A., Solodovnikova, N., Nicholson, T., Antholine, W. & Walden, W. E. (2003). A novel
eukaryotic factor for cytosolic Fe-S cluster assembly. Embo J 22, 4826-4835.
Rutherford, J. C., Jaron, S., Ray, E., Brown, P. O. & Winge, D. R. (2001). A second iron-regulatory
system in yeast independent of Aft1p. Proc Natl Acad Sci U S A 98, 14322-14327.
Rutherford, J. C., Jaron, S. & Winge, D. R. (2003). Aft1p and Aft2p mediate iron-responsive gene
expression in yeast through related promoter elements. J Biol Chem 278, 27636-27643.
Rutherford, J. C., Ojeda, L., Balk, J., Muhlenhoff, U., Lill, R. & Winge, D. R. (2005). Activation of
the iron regulon by the yeast Aft1/Aft2 transcription factors depends on mitochondrial but not cytosolic
iron-sulfur protein biogenesis. J Biol Chem 280, 10135-10140.
- 147 -
Literatur
Sambrook, J. & Russel, D. W. (2001). Molecular cloning - A laboratory manual, 3rd edn. ColdSpring
Harbour, USA: Cold Spring Harbor Laboratory Press.
Santos, R., Buisson, N., Knight, S. A., Dancis, A., Camadro, J. M. & Lesuisse, E. (2004). Candida
albicans lacking the frataxin homologue: a relevant yeast model for studying the role of frataxin. Mol
Microbiol 54, 507-519.
Schena, M., Shalon, D., Davis, R. W. & Brown, P. O. (1995). Quantitative monitoring of gene
expression patterns with a complementary DNA microarray. Science 270, 467-470.
Schilke, B., Voisine, C., Beinert, H. & Craig, E. (1999). Evidence for a conserved system for iron
metabolism in the mitochondria of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 96, 1020610211.
Schüller, H. J. (2003). Transcriptional control of nonfermentative metabolism in the yeast
Saccharomyces cerevisiae. Curr Genet 43, 139-160.
Seaton, B. L. & Vickery, L. E. (1994). A gene encoding a DnaK/hsp70 homolog in Escherichia coli.
Proc Natl Acad Sci U S A 91, 2066-2070.
Shakoury-Elizeh, M., Tiedeman, J., Rashford, J. & other authors (2004). Transcriptional
remodeling in response to iron deprivation in Saccharomyces cerevisiae. Mol Biol Cell 15, 1233-1243.
Shaprio, D. (1981). Quantitative ethanol precipitation of nanogram quantites of DNA and RNA.
Analytical Biochemistry 110, 229-231.
Sipos, K., Lange, H., Fekete, Z., Ullmann, P., Lill, R. & Kispal, G. (2002). Maturation of cytosolic
iron-sulfur proteins requires glutathione. J Biol Chem 277, 26944-26949.
Skovran, E. & Downs, D. M. (2003). Lack of the ApbC or ApbE protein results in a defect in Fe-S
cluster metabolism in Salmonella enterica serovar Typhimurium. J Bacteriol 185, 98-106.
Smith, A. D., Agar, J. N., Johnson, K. A., Frazzon, J., Amster, I. J., Dean, D. R. & Johnson, M. K.
(2001). Sulfur transfer from IscS to IscU: the first step in iron-sulfur cluster biosynthesis. J Am Chem
Soc 123, 11103-11104.
Smith, A. D., Jameson, G. N., Dos Santos, P. C. & other authors (2005). NifS-mediated assembly
of [4Fe-4S] clusters in the N- and C-terminal domains of the NifU scaffold protein. Biochemistry 44,
12955-12969.
Spiro, S. (2006). Nitric oxide-sensing mechanisms in Escherichia coli. Biochem Soc Trans 34, 200202.
Srere, P. A. (1963). Citryl-CoA. A substrate for the citrate-cleavage enzyme. Biochim Biophys Acta
73, 523-525.
Stehling, O., Elsasser, H. P., Bruckel, B., Muhlenhoff, U. & Lill, R. (2004). Iron-sulfur protein
maturation in human cells: evidence for a function of frataxin. Hum Mol Genet 13, 3007-3015.
Steiner, H., Zollner, A., Haid, A., Neupert, W. & Lill, R. (1995). Biogenesis of mitochondrial heme
lyases in yeast. Import and folding in the intermembrane space. J Biol Chem 270, 22842-22849.
Strain, J., Lorenz, C. R., Bode, J., Garland, S., Smolen, G. A., Ta, D. T., Vickery, L. E. & Culotta,
V. C. (1998). Suppressors of superoxide dismutase (SOD1) deficiency in Saccharomyces cerevisiae.
Identification of proteins predicted to mediate iron-sulfur cluster assembly. J Biol Chem 273, 3113831144.
Sun, F., Huo, X., Zhai, Y., Wang, A., Xu, J., Su, D., Bartlam, M. & Rao, Z. (2005). Crystal structure
of mitochondrial respiratory membrane protein complex II. Cell 121, 1043-1057.
Ta, D. T., Seaton, B. L. & Vickery, L. E. (1992). Localization of the ferredoxin (fdx) gene on the
physical map of the Escherichia coli chromosome. J Bacteriol 174, 5760-5761.
- 148 -
Literatur
Ta, D. T. & Vickery, L. E. (1992). Cloning, sequencing, and overexpression of a [2Fe-2S] ferredoxin
gene from Escherichia coli. J Biol Chem 267, 11120-11125.
Takahashi, Y. & Tokumoto, U. (2002). A third bacterial system for the assembly of iron-sulfur clusters
with homologs in archaea and plastids. J Biol Chem 277, 28380-28383.
Tokumoto, U. & Takahashi, Y. (2001). Genetic analysis of the isc operon in Escherichia coli involved
in the biogenesis of cellular iron-sulfur proteins. J Biochem (Tokyo) 130, 63-71.
Tong, W. H. & Rouault, T. (2000). Distinct iron-sulfur cluster assembly complexes exist in the cytosol
and mitochondria of human cells. Embo J 19, 5692-5700.
Tong, W. H., Jameson, G. N., Huynh, B. H. & Rouault, T. A. (2003). Subcellular
compartmentalization of human Nfu, an iron-sulfur cluster scaffold protein, and its ability to assemble a
[4Fe-4S] cluster. Proc Natl Acad Sci U S A 100, 9762-9767.
Tong, W. H. & Rouault, T. A. (2006). Functions of mitochondrial ISCU and cytosolic ISCU in
mammalian iron-sulfur cluster biogenesis and iron homeostasis. Cell Metab 3, 199-210.
Urbina, H. D., Silberg, J. J., Hoff, K. G. & Vickery, L. E. (2001). Transfer of sulfur from IscS to IscU
during Fe/S cluster assembly. J Biol Chem 276, 44521-44526.
Vetcher, A. A., Napierala, M., Iyer, R. R., Chastain, P. D., Griffith, J. D. & Wells, R. D. (2002).
Sticky DNA, a long GAA.GAA.TTC triplex that is formed intramolecularly, in the sequence of intron 1
of the frataxin gene. J Biol Chem 277, 39217-39227.
Vitale, G., Fabre, E. & Hurt, E. C. (1996). NBP35 encodes an essential and evolutionary conserved
protein in Saccharomyces cerevisiae with homology to a superfamily of bacterial ATPases. Gene 178,
97-106.
Voisine, C., Cheng, Y. C., Ohlson, M., Schilke, B., Hoff, K., Beinert, H., Marszalek, J. & Craig, E.
A. (2001). Jac1, a mitochondrial J-type chaperone, is involved in the biogenesis of Fe/S clusters in
Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 98, 1483-1488.
Wiedemann, N., Urzica, E., Guiard, B. & other authors (2006). Essential role of Isd11 in
mitochondrial iron-sulfur cluster synthesis on Isu scaffold proteins. Embo J 25, 184-195.
Wingert, R. A., Galloway, J. L., Barut, B. & other authors (2005). Deficiency of glutaredoxin 5
reveals Fe-S clusters are required for vertebrate haem synthesis. Nature 436, 1035-1039.
Yabe, T., Morimoto, K., Kikuchi, S., Nishio, K., Terashima, I. & Nakai, M. (2004). The Arabidopsis
chloroplastic NifU-like protein CnfU, which can act as an iron-sulfur cluster scaffold protein, is required
for biogenesis of ferredoxin and photosystem I. Plant Cell 16, 993-1007.
Yamaguchi-Iwai, Y., Ueta, R., Fukunaka, A. & Sasaki, R. (2002). Subcellular localization of Aft1
transcription factor responds to iron status in Saccharomyces cerevisiae. J Biol Chem 277, 1891418918.
Yang, Y. H., Dudoit, S., Luu, P., Lin, D. M., Peng, V., Ngai, J. & Speed, T. P. (2002). Normalization
for cDNA microarray data: a robust composite method addressing single and multiple slide systematic
variation. Nucleic Acids Res 30, e15.
Yarunin, A., Panse, V. G., Petfalski, E., Dez, C., Tollervey, D. & Hurt, E. C. (2005). Functional link
between ribosome formation and biogenesis of iron-sulfur proteins. Embo J 24, 580-588. Epub 2005
Jan 2020.
Yoon, T. & Cowan, J. A. (2003). Iron-sulfur cluster biosynthesis. Characterization of frataxin as an
iron donor for assembly of [2Fe-2S] clusters in ISU-type proteins. J Am Chem Soc 125, 6078-6084.
Yun, C. W., Ferea, T., Rashford, J., Ardon, O., Brown, P. O., Botstein, D., Kaplan, J. & Philpott,
C. C. (2000). Desferrioxamine-mediated iron uptake in Saccharomyces cerevisiae. Evidence for two
pathways of iron uptake. J Biol Chem 275, 10709-10715.
- 149 -
Literatur
Yun, C. W., Bauler, M., Moore, R. E., Klebba, P. E. & Philpott, C. C. (2001). The role of the FRE
family of plasma membrane reductases in the uptake of siderophore-iron in Saccharomyces
cerevisiae. J Biol Chem 276, 10218-10223.
Yuvaniyama, P., Agar, J. N., Cash, V. L., Johnson, M. K. & Dean, D. R. (2000). NifS-directed
assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc Natl Acad Sci U S A 97, 599604.
Zhang, L. & Hach, A. (1999). Molecular mechanism of heme signaling in yeast: the transcriptional
activator Hap1 serves as the key mediator. Cell Mol Life Sci 56, 415-426.
Zhang, Y., Lyver, E. R., Knight, S. A., Lesuisse, E. & Dancis, A. (2005). Frataxin and mitochondrial
carrier proteins, Mrs3p and Mrs4p, cooperate in providing iron for heme synthesis. J Biol Chem 280,
19794-19807.
Zheng, L., White, R. H., Cash, V. L., Jack, R. F. & Dean, D. R. (1993). Cysteine desulfurase activity
indicates a role for NIFS in metallocluster biosynthesis. Proc Natl Acad Sci U S A 90, 2754-2758.
Zheng, L. & Dean, D. R. (1994). Catalytic formation of a nitrogenase iron-sulfur cluster. J Biol Chem
269, 18723-18726.
Zheng, L., White, R. H., Cash, V. L. & Dean, D. R. (1994). Mechanism for the desulfurization of Lcysteine catalyzed by the nifS gene product. Biochemistry 33, 4714-4720.
Zheng, L., Cash, V. L., Flint, D. H. & Dean, D. R. (1998). Assembly of iron-sulfur clusters.
Identification of an iscSUA-hscBA-fdx gene cluster from Azotobacter vinelandii. J Biol Chem 273,
13264-13272.
Zitomer, R. S. & Lowry, C. V. (1992). Regulation of gene expression by oxygen in Saccharomyces
cerevisiae. Microbiol Rev 56, 1-11.
- 150 -
Publikationen
8. Publikationen
Hausmann, A., Aguilar Netz, D. J., Balk, J., Pierik, A. J., Mühlenhoff, U. & Lill, R. (2005). The
eukaryotic P loop NTPase Nbp35: an essential component of the cytosolic and nuclear iron-sulfur
protein assembly machinery. Proc Natl Acad Sci U S A 102, 3266-3271.
Lill, R., Dutkiewicz, R., Elsasser, H. P., Hausmann, A., Netz, D. J., Pierik, A. J., Stehling, O.,
Urzica, E., Mühlenhoff, U. (2006). Mechanisms of iron-sulfur protein maturation in mitochondria,
cytosol and nucleus of eukaryotes. Biochim Biophys Acta 7, 652-667
Hausmann, A., Samans, B., Urzica, E., Lill, R. & Muhlenhoff, U. (2006). Analysis of genome-wide
transcriptional responses to defects in cellular Fe/S biogenesis in Saccharomyces cerevisiae. in
preparation.
- 151 -
Lebenslauf
9. Lebenslauf
Name:
Hausmann
Vorname:
Anja
Geburtsdatum:
22.04.1969
Geburtsort:
Herne
Schulausbildung
1975-1979
Grundschule, Waltrop
1979-1985
Hauptschule, Waltrop
1985-1987
Berufsfachschule für Ernährungs- und Hauswirtschaft
1992-1995
Abendgymnasium, Dortmund
1995
Abschluss: Allgemeine Hochschulreife
Berufsausbildung
1987-1988
Pflegevorschule, Datteln
1988-1991
Krankenpflegeschule, Datteln
Berufsausübung
1991-1996
Anstellung als Krankenschwester
Studium
09/1996-02/2001
Studium der Biologie, Philipps-Universität Marburg
04/2001-02/2002
Diplomarbeit in der Abt. Genetik der Philipps-Universität Marburg bei
Herrn Prof. Dr. A. Klein mit dem Thema: Einfluss der DNA-Struktur auf
die Transkriptionsregulation der Gengruppe der selenfreien [NiFe]Hydrogenase frc aus Methanococcus voltae
03/2002-09/2002
Wissenschaftliche Angestellte in der Abt. Genetik an der PhilippsUniversität Marburg bei Herrn Prof. Dr. A. Klein
Promotion
Seit 09/2002
Dissertation im Institut für Zytobiologie und Zytopathologie der PhilippsUniversität Marburg bei Herrn Prof. Dr. R. Lill
- 152 -
Danksagung
Ich möchte Herrn Prof. Dr. R. Lill für die sehr gute Betreuung während der Arbeit, für
seine wertvollen Ratschläge und für seine ständige Diskussionsbereitschaft danken.
Herrn Prof. U. Maier danke ich für die Erstellung des Zweitgutachtens.
Herrn Dr. U. Mühlenhoff danke ich für die stete Unterstützung und sein Interesse am
Fortgang der Arbeit.
Ein großer Dank geht an B. Samans für die konstruktive Zusammenarbeit bei der
Datenanalyse der Microarrays am Institut für Molekularbiologie und Tumorforschung,
Marburg.
Herrn Dr. M. Krause danke ich für wertvolle Tips zum Umgang mit Microarrays.
Ich danke allen Mitgliedern der Arbeitsgruppe für das sehr gute Arbeitsklima und für
die ständige Hilfsbereitschaft. Besonders bedanken möchte ich mich bei Karina,
Nadine, Daili, Antonio, Martin und Holger.
Allen Mitgliedern des Instituts danke ich für die ständige Hilfsbereitschaft und für die
gute Stimmung im Haus.
Ganz besonders möchte ich mich bei Ulf Grunwald bedanken, einfach für alles.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement