Rôle de la régulation stomatique et de la capacité de détoxication

Rôle de la régulation stomatique et de la capacité de détoxication
AVERTISSEMENT
Ce document est le fruit d'un long travail approuvé par le jury de
soutenance et mis à disposition de l'ensemble de la
communauté universitaire élargie.
Il est soumis à la propriété intellectuelle de l'auteur. Ceci
implique une obligation de citation et de référencement lors de
l’utilisation de ce document.
D'autre part, toute contrefaçon, plagiat, reproduction
encourt une poursuite pénale.
illicite
Contact : ddoc-theses-contact@univ-lorraine.fr
LIENS
Code de la Propriété Intellectuelle. articles L 122. 4
Code de la Propriété Intellectuelle. articles L 335.2- L 335.10
http://www.cfcopies.com/V2/leg/leg_droi.php
http://www.culture.gouv.fr/culture/infos-pratiques/droits/protection.htm
FACULTE DES SCIENCES & TECHNOLOGIES
Thèse cofinancée par la région Lorraine et le projet ANR Vulnoz
Collegium Sciences & Technologies
UMR1137 Ecologie et Ecophysiologie Forestières
Ecole Doctorale RP2E
Département de Formation Doctorale Sciences agronomiques et forestières, biologie et
écologie, biotechnologies
Thèse
présentée pour l'obtention du titre de
Docteur de l'Université de Lorraine
en biologie végétale et forestière
par Jennifer DUMONT
Rôle de la régulation stomatique et de la capacité de détoxication foliaire
dans l’estimation d’un seuil de risque à l’ozone pour la végétation
Soutenance publique le 19 avril 2013
Membres du jury :
Président :
M. Yves JOLIVET
Professeur, Université de Lorraine, Nancy
Rapporteurs :
M. Daniel LAFFRAY
Professeur, Université Paris Est Créteil, Paris
Mme Nathalie LEONHARDT
Chargée de Recherche, CEA, Cadarache
M Pierre DIZENGREMEL
Professeur émérite, Université de Lorraine, Nancy
M Markku KEINÄNEN
Senior assistant, University of Eastern Finland, Joensuu
M. Didier LE THIEC
Directeur de Recherche, INRA, Nancy (Directeur de thèse)
Mrs. Elina OKSANEN
Professor, University of Eastern Finland, Joensuu
Examinateurs :
UMR1137 INRA/UL Ecologie et Ecophysiologie Forestières
Faculté des Sciences & Technologies - 54500 Vandœuvre-lès-Nancy
A mes parents qui m’ont toujours soutenue et aimée ;
c’est grâce à vous que je suis arrivée jusque là, soyez fiers de vous !
A Fabien, sans qui cette thèse ne serait pas la même,
merci pour tout ce que tu m’apportes chaque jour.
A mon oncle et parrain qui m’a appris que la vie vaut le coup,
qu’il ne faut jamais abandonner, qu’il faut se battre
pour le bonheur qui nous entoure,
pour la vie tout simplement.
Regarde moi, je suis heureuse
Dans la vie, tout n’est qu’une question de volonté.
REMERCIEMENTS
Je remercie l’ANR Vulnoz et la Région Lorraine pour avoir cofinancé cette thèse,
ainsi que, l’INRA, l’IFR 110 EFABA, le COST Action FP0903, the University of Eastern
Finland, la plate-forme Métabolome-Fluxome de Bordeaux et le LABEX Arbre pour leur
soutien financier et matériel.
Mes remerciements s’adressent d’abord à toi, Didier Le Thiec, pour m’avoir offert l’opportunité de
réaliser cette thèse. Tout au long de ces 3 ans (et demi), tu m’as toujours guidée efficacement. Toujours à
l’écoute, nous avons pu construire ensemble cette étude grâce à tes conseils et à ta réactivité. Tu m’auras
permis de voyager pour exposer mes résultats, d’acquérir des compétences variées, et ce jusqu’au pays du père
Noël, que demander de plus ?!
Un grand merci à Pierre Dizengremel qui aura été là pour me présenter avec passion la
problématique de l’ozone lors de mes premiers pas à Nancy et qui a accepté de participer à mon jury de thèse
pour voir l’aboutissement de cette belle histoire qu’il aura suivi tout du long.
Yves Jolivet, tu m’as soutenue toujours avec calme et sérieux, tu as accepté d’être mon président de
jury et surtout mon tuteur de monitorat. Grâce à toi j’ai pu enseigner comme je le souhaitais, merci, ça
représentait beaucoup pour moi.
Marie-Noëlle Vaultier, merci d’avoir relu mon manuscrit et d’avoir toujours accepté de mettre la
main à la pâte pour m’aider. Garde la bonne humeur qui te caractérise si bien.
Je remercie vivement Nathalie Leonhardt et Daniel Laffray pour avoir accepté de juger mon
manuscrit de thèse en tant que rapporteurs.
Elina Oksanen et Markku Keinänen, je vous suis très reconnaissante d'avoir fait le déplacement à
Nancy pour faire partie de mon jury de thèse. Merci à vous deux, mais aussi à Sari, Sarita, Inna, Jenna,
Maarit, sans oublié Matti, pour m’avoir tellement bien accueillie et m’avoir tant aidée. Je garderai toujours
en mémoire ces trois mois passés avec vous tous en Finlande.
Je remercie aussi Yves Gibon qui m’aura accueillie dans son équipe à Bordeaux et Pierre Baldet qui
m’aura aidée à venir à bout de l’ascorbate et du glutathion.
Je crois qu’il convient ensuite de remercier comme il se doit ceux qui ont du me supporter durant
quelques mois ou quelques années dans leur bureau, me connaissant ça n’a pas du être facile tous les jours
pour eux ! Rémy, Silvère, Inna et le « petit » dernier François. Tous à votre façon vous m’avez aidée au
quotidien.
Et puis, il y a aussi ceux qui ont du me supporter dans leur bureau malgré que ce ne soit pas le mien,
tout particulièrement David et Cyril! David, tu auras été d’un grand soutien pour moi, tant au niveau
technique que moral. Merci d’avoir été toujours disponible pour moi, de m’avoir conseillée et écoutée. Sans
toi, ça n’aurait décidément pas été pareil, tu resteras toujours mon maître Jedi. Cyril merci d’avoir accepté
mes entrées intempestives et surement trop fréquentes dans ton bureau ^^ Je n’oublie pas non plus ton aide
technique et ton efficacité.
NathNath, je n’aurai pas compté les mots et tu es après David, mais comme tu m’auras toujours
aidée de bon cœur et qu’avec toi mes journées auront été bien plus joyeuses grâce à ta spontanéité, ta bonne
humeur et ton rire communicatif (surtout quand tu as bu), je te remercie beaucoup.
Irène, je te dois une spéciale dédicace car sans toi et ton esprit de générosité, il n’y aurait pas eu de
manuscrit ! En tout cas, toujours directe, tu n’en restes pas moins quelqu’un d’essentiel pour l’équipe car tu
es avant tout quelqu’un d’humain, toujours là pour veiller sur les autres.
J’ai pu découvrir le monde de la microscopie en autre grâce à vous Lu et Joëlle. Vous m’aurez appris
toujours avec patience. Vous aurez été mes guides vers l’infiniment petit !
J’ai aussi pu faire mes premiers dans l’univers de R et des statistiques. Pierre merci de m’avoir fait
profiter de tes connaissances et de tes conseils, à tes côtés on en apprend toujours.
Franck tu auras été mon sauveur, tu auras su préserver mes données, et ce, malgré mon karma
quelque peut capricieux, ce n’était pas gagné, alors merci et félicitations.
Je n’oublierai certes pas Cyndie, un petit rayon de soleil. Ca fait du bien en Lorraine mais
malheureusement ça dure jamais assez longtemps, ce fut un plaisir de travailler avec toi.
Stéphane, merci pour ton aide dans la gestion des chambres phytotroniques. Désolée de t’avoir
autant embêté, soir et week-end compris. Ce n’était pas toujours facile, mais on aura réussi.
Aurélie, tu auras été une stagiaire telle que l’on espère toujours en avoir. Ton encadrement aura
toujours été facile et agréable.
En complément de mes recherches j’ai pu transmettre un peu de mes connaissances (enfin j’espère !)
par l’intermédiaire de l’enseignement. Ceci n’aurait pas été possible sans Jean-Claude, Dany, Valérie,
Pierrick et bien sûr Yves. Grâce à vous, l’expérience aura été une réussite.
Enfin j’ai une pensée particulière pour les autres doctorants ayant déjà soutenu, en particulier Ata
mon « binôme » de fumigation, mais aussi Nicolas, Rana, Rémy, Pauline, Cyril, Sacha, Fahad, Clément,
Nianguiri, Daniel, ou en train de s’en rapprocher. Julien, Silvère et Florian courage c’est la dernière ligne
droite. Emilie j’espère que tu as trouvé ta voie. Morgane, même si tu manques d’assurance parfois, tu iras
loin si tu gardes confiance en toi. Tu es capable de tout si tu le veux vraiment. François et Charlotte vous
avez encore un peu de temps profitez en bien, ça passe vite, et longue vie à la journée des doctorants ^^
Nicolas, sans avoir travaillé directement avec toi, tu m’auras marquée par ta gentillesse. Je me
souviendrai toujours de toi qui avais toujours un mot agréable accompagné d’un sourire.
Pour finir, je remercie tous ceux qui m’ont apporté de la bonne humeur au quotidien. En premier
lieu Christian sans qui la pause café serait moins agréable mais aussi Marie-Béatrice, Oliver, Patrick,
Béatrice, Audrey, André, Jacqueline, Nicolas, Agnès, Dominique, Adeline, Pascal, Pascale, Erwin, Rosine,
Sandrine, Mireille, Lysiane, Laurence, Marie-Paule, Damien, Bernard, Caroline, François, Jean-Marie,
Daniel, Bernard, Stéphane, Patrick, Claude, Raphaël, Damien, Nathalie, Carole, Dorine…
LISTE DES FIGURES ET DES TABLEAUX
FIGURES
Figure 1 : Structure de la molécule d'ozone
Figure 2 : Répartition de l'ozone atmosphérique selon l'altitude. (Document émis par la
NASA)
Figure 3 : Cycle de génération-destruction de l'ozone ou cycle de Chapman (Yip, 2000)
Figure 4 : Cycles de l'ozone stratosphérique et troposphérique (U.S. EPA, 2006)
Figure 5 : Evolution des concentrations européennes en ozone (ppb) mesurées entre 1870 et
2000 (Marenco, 1994)
Figure 6 : Concentrations annuelles passées, actuelles et prédites en ozone troposphérique
(Vingarzan, 2004)
Figure 7 : Cartes des valeurs d’AOT40, indicateur de seuil de risque à l’ozone pour la
végétation, en 2005, pour les cultures et pour les forêts (EEA, 2009)
Figure 8 : Exemples de symptômes foliaires sur des feuilles de peupliers soumis à un
traitement à l'ozone (Photos: F. Spicher) A) Décoloration (feuille de droite) Par rapport à
une feuille témoin (feuille de gauche), B) et C) nécroses plus ou moins importantes entre
les nervures de feuilles de peuplier, et D) marbrures sur des aiguilles de pin d’Alep
(Photo: V. Calatayud)
Figure 9 : Variation en pourcentage de la biomasse totale, biomasse foliaire, surface foliaire
(par unité de surface), biomasse ligneuse aérienne, biomasse aérienne, biomasse racinaire
et ratio feuille-racine, hauteur et diamètre de tous les arbres exposés à des concentrations
élevées d’ozone par rapport aux témoins exposés à l’air filtré par charbon actif. (Wittig et
al., 2009)
Figure 10 : Variation en pourcentage de la biomasse totale, biomasse foliaire, surface foliaire,
biomasse aérienne, biomasse racinaire et ratio feuille-racine pour les gymnospermes et
angiospermes exposés à des concentrations élevées d’ozone par rapport aux témoins
exposés à l’air filtré par charbon actif. (Wittig et al., 2009)
Figure 11 : Variation en pourcentage de la photosynthèse en lumière saturante (Asat) et de la
conductance stomatique (gs) des arbres soumis à des concentrations ambiantes en ozone
(O3) par rapport aux témoins exposés à l'air filtré par charbon actif (cf) en incluant les
différences entre gymnospermes et angiospermes. (Wittig et al., 2007)
Figure 12 : Variation en pourcentage de la photosynthèse en lumière saturante (Asat) et de la
conductance stomatique (gs) des arbres soumis à des concentrations élevées en ozone
(O3) par rapport aux témoins exposés à l'air filtré par charbon actif (cf) et l’impact de
différentes concentrations en ozone [O3] sur la réponse. (Wittig et al., 2007)
Figure 13 : Variation en pourcentage de la photosynthèse, de la conductance stomatique, de la
transpiration, de la respiration, de la chlorophylle totale, de la chlorophylle a, de la
chlorophylle b, du ratio entre chlorophylle a et b, du contenu en rubisco, de l'activité de
la rubisco, du contenu en nitrogène, du sucrose et de l’amidon des arbres soumis à des
concentrations élevées en ozone par rapport aux témoins exposés à l’air filtré par
charbon actif. (Wittig et al., 2009)
Figure 14 : A) Stomate et B) épiderme inférieur de feuille de peuplier observés au microscope
électronique à balayage
Figure 15 : Canaux et transporteurs ioniques impliqués dans les mouvements stomatiques
Figure 16 : Schéma de la cascade de réactions impliquée dans la réponse à la lumière bleue et
à la lumière rouge (Lawson, 2009)
Figure 17 : Processus d'ouverture stomatique en réponse à la lumière bleue (Shimazaki, 2007)
Figure 18 : Modèle simplifié illustrant les fonctions de gènes récemment identifiés et de
mécanismes impliqués dans le contrôle des mouvements stomatiques en réponse au CO2
(Kim et al., 2010)
Figure 19 : Nouveau modèle montrant la séquence d'évènements induits par le CO2 entraînant
l'activation des canaux anioniques de type S et la fermeture des stomates (Xue et al.,
2011)
Figure 20 : Schéma illustrant le modèle PYR/RCAR-PP2C-SnRK2 de réponse à l'ABA
(Hubbard et al., 2010)
Figure 21 : Modèle d’amorçage de la sensibilité au Ca2+ (Hubbard et al., 2011)
Figure 22 : Double effet des ROS générés par l'ozone sur les processus de détoxication et sur
la régénération métabolique du pouvoir réducteur (Dizengremel et al., 2009)
Figure 23. Voie d'Halliwell-Asada (Castagna et Ranieri, 2009)
Figure 24 : Schéma des systèmes de détoxication des ROS dans les différents organites des
cellules végétales
Figure 25 : Voies de synthèse de l'ascorbate
Figure 26 : Voie de biosynthèse du glutathion
Figure 27. Absorption d'ozone et effets biologiques (Tausz et al., 2007)
Figure 28 : Plantation des boutures de peuplier
Figure 29 : Début de l'acclimatation en phytotrons des peupliers âgés de 5 semaines
Figure 30 : Restant d'une feuille de peuplier après les prélèvements pour la microscopie
électronique
Figure 31 : Les Chambres phytotroniques (UMR1137, UL)
Figure 32 : Présentation d’une chambre phytotronique contenant 6 peupliers
Figure 33 : Exemple de racines de peuplier après lavage, prêtes pour le séchage
Figure 34: Schéma de principe du poromètre (issu du manuel d'utilisation)
Figure 35 : Mesure de la conductance stomatique sur la face adaxiale de la feuille réalisée à
l'aide du poromètre SC1
Figure 36: Schéma de fonctionnement de l’appareil Li-6200
Figure 37 : Mesures réalisées à l'aide de l'appareil de mesure d'échanges gazeux Licor 6200
Figure 38: Schéma de fonctionnement de l’appareil Li-6400
Figure 39: Paramètres mesurés utilisés dans le calcul de la transpiration et de la conductance
stomatique
Figure 40 : Mesures réalisées à l'aide de l'appareil de mesure d'échanges gazeux Licor 6400
Figure 41 : Schéma du dispositif de mesure avec 3 appareils Li-6400 intercalibrés
Figure 42 : Exemple de réponses de la conductance stomatique A) à une augmentation de
lumière bleue et B) à une augmentation de VPD
Figure 43 : Plateau robotisé de phénotypage enzymatique à haut débit
Figure 44 : Principe de la technique de RT-qPCR (méthode au fluorochrome SYBR Green).
(Gerlier et al., 2007)
Figure 45 : (A) Système de microdissection laser Palm Microbeam (Zeiss), (B) Principe de
fonctionnement du système de microdissection laser, (C) Morceaux d’épiderme restant
sur la lame après microdissection, (D) Stomates propulsés dans le tube Eppendorf
Figure 46 : Schéma des interactions entre le faisceau d'électrons et la matière
Figure 47: Analyse en composantes principales basée sur les concentrations des caroténoïdes,
des chlorophylles et des terpénols
Figure 48 : Concentration en caroténoïdes (A), en chlorophylles (B) et en terpénols (C) dans
trois génotypes de peuplier, Carpaccio, Cima et Robusta après 2, 4, 11, 15 et 17 jours de
traitement ozone ou control
Figure 49: Analyse en composantes principales basée sur les concentrations des composés
phénoliques chez 3 génotypes de peuplier euraméricain, Carpaccio en orange, Cima en
vert et Robusta en bleu soumis ou non à un traitement ozone
Figure 50: Analyse en composantes principales basée sur les concentrations des métabolites
primaires chez trois génotypes de peuplier (Carpaccio en rouge et rose, Cima en jaune et
beige et Robusta en bleu foncé et bleu clair) soumis à un traitement ozone (couleurs
vives) ou ambiant (couleurs pastelles) à cinq dates de prélèvements (1, 2, 3, 4, 5 pour 2,
4, 11, 15 et 17 jours de traitement respectivement)
Figure 51 : Concentration en (A) citrate, (B) succinate, (C) fumarate, (D) malate, dans les
feuilles de trois génotypes de peupliers (Carpaccio, Cima et Robusta) après 2, 4, 11, 15
et 17 jours de traitement ozone ou ambiant
Figure 52 : Concentration en (A) fructose, (B) glucose, (C) raffinose, (D) galactinol, (E)
galactose, (F) mannose et (G) sucrose dans les feuilles de trois génotypes de peuplier
(Carpaccio, Cima et Robusta) après 2, 4, 11, 15 et 17 jours de traitement ozone ou
ambiant
TABLEAUX
Tableau 1: Equations des principaux modèles de calcul de conductance stomatique, issu de
Damour et al. (2010)
Tableau 2. Mécanismes de détoxication des ROS dans les cellules végétales (Moller et al.,
2007)
Tableau 3. Principaux indicateurs d'évaluation de l'impact de l'ozone sur la végétation
Tableau 4: Caractéristiques des 6 sections du genre Populus
Tableau 5 : Les surfaces (en ha) de peuplier de production de bois, en France et par région
Tableau 6: Récolte annuelle de grumes de peupliers (m3)
Tableau 7: Conditions environnementales avant et après variation d'un des paramètres à
l'intérieur de la chambre de mesure de l’appareil Li-6400
SOMMAIRE
SOMMAIRE
SYNTHESE BIBLIOGRAPHIQUE .................................................................................................................... 1
I.
OZONE ....................................................................................................................................................... 2
1.
Généralités sur l’ozone ........................................................................................................................ 2
2.
Cycle de l’ozone ................................................................................................................................... 2
3.
Evolution des concentrations en ozone troposphérique ....................................................................... 3
4.
Impact de l’ozone sur la végétation ..................................................................................................... 4
Sites d'action de l'ozone .............................................................................................................................................. 4
Effets visibles sur les feuilles ..................................................................................................................................... 6
Effets sur la biomasse et la croissance ........................................................................................................................ 7
Effets sur les échanges gazeux foliaires...................................................................................................................... 7
Effets biochimiques .................................................................................................................................................... 8
II.
ROLE DES STOMATES ................................................................................................................................. 8
1.
Généralités ........................................................................................................................................... 8
2.
Modèles de conductance stomatique .................................................................................................... 9
3.
Régulation des mouvements stomatiques ........................................................................................... 10
Effet du VPD (Vapor Pressure Deficit) et de la température .................................................................................... 10
Effet de la lumière .................................................................................................................................................... 11
Effet du CO2 ............................................................................................................................................................. 12
Effets de l’ozone ....................................................................................................................................................... 13
III.
SYSTEMES DE DETOXICATION .................................................................................................................. 13
1.
Système de défense antioxydatif ......................................................................................................... 13
2.
Voie d'Halliwell-Asada ...................................................................................................................... 14
3.
Autres enzymes et molécules antioxydantes ....................................................................................... 15
4.
Voie de biosynthèse de l’ascorbate .................................................................................................... 15
5.
Voie de biosynthèse du glutathion...................................................................................................... 16
OBJECTIFS DE RECHERCHE ....................................................................................................................... 17
I.
PROBLEMATIQUE ..................................................................................................................................... 18
1.
Seuils de risque à l’ozone................................................................................................................... 18
2.
Flux effectif d'ozone ........................................................................................................................... 19
II.
OBJECTIFS................................................................................................................................................ 20
MATERIEL ET METHODES ........................................................................................................................... 21
I.
MATERIEL VEGETAL ................................................................................................................................ 22
1.
Généralités sur le peuplier ................................................................................................................. 22
2.
Génotypes utilisés .............................................................................................................................. 23
3.
Conditions de culture ......................................................................................................................... 23
4.
Prélèvement........................................................................................................................................ 23
II.
FUMIGATION A L’OZONE .......................................................................................................................... 24
1.
Plan d’expérience .............................................................................................................................. 24
2.
Conditions environnementales ........................................................................................................... 25
III.
SUIVI DE CROISSANCE, BIOMASSES ET CHLOROPHYLLES .......................................................................... 25
1.
Mesures de hauteur, de diamètre et chutes de feuilles ....................................................................... 25
2.
Mesures de biomasses ........................................................................................................................ 25
3.
Mesures du contenu en chlorophylles ................................................................................................ 26
Principe de l’appareil ................................................................................................................................................ 26
Utilisation ................................................................................................................................................................. 26
IV.
1.
MESURES DES ECHANGES GAZEUX........................................................................................................... 26
Conductance stomatique à la vapeur d’eau (poromètre SC1) ........................................................... 26
Principe de l’appareil ................................................................................................................................................ 26
Utilisation ................................................................................................................................................................. 27
2.
Assimilation nette de CO2 et conductance stomatique à la vapeur d’eau (Li-6200).......................... 27
Principe de l’appareil ................................................................................................................................................ 27
Utilisation ................................................................................................................................................................. 28
3.
Assimilation nette de CO2 et conductance stomatique à la vapeur d’eau (Li-6400).......................... 29
Principe de l’appareil ................................................................................................................................................ 29
Utilisation ................................................................................................................................................................. 30
V.
ANALYSES METABOLOMIQUES................................................................................................................. 31
1.
Principes des analyses ....................................................................................................................... 31
2.
Ascorbate et glutathion ...................................................................................................................... 31
3.
Caroténoïdes ...................................................................................................................................... 32
4.
Composés phénoliques ....................................................................................................................... 32
5.
Acides aminés..................................................................................................................................... 33
6.
Sucres ................................................................................................................................................. 33
VI.
ANALYSES TRANSCRIPTOMIQUES............................................................................................................. 34
1.
Principes des analyses ....................................................................................................................... 34
2.
Analyses transcriptomiques à partir de feuilles broyées .................................................................... 34
Préparation des matrices ........................................................................................................................................... 34
Dessin des amorces .................................................................................................................................................. 35
PCR en temps réel (qPCR) ....................................................................................................................................... 36
3.
Analyses transcriptomiques à partir de stomates microdisséqués ..................................................... 36
Préparation des matrices ........................................................................................................................................... 36
Dessin des amorces .................................................................................................................................................. 37
PCR en temps réel (qPCR) ....................................................................................................................................... 37
VII. TECHNIQUES DE MICROSCOPIE ................................................................................................................. 37
1.
Préparation d’échantillons de stomates microdisséqués ................................................................... 37
2.
Détermination de la densité stomatique et de la taille des stomates (Microscopie Electronique à
Balayage)..................................................................................................................................................... 38
Principe de l’appareil ................................................................................................................................................ 38
Utilisation ................................................................................................................................................................. 38
3.
Microanalyse X des éléments minéraux (Microscopie Electronique à Balayage) ............................. 39
4.
Analyse ultrastructurale des cellules de garde (Microscopie Electronique à Transmission) ............ 39
Principe de l’appareil ................................................................................................................................................ 39
Utilisation ................................................................................................................................................................. 39
RESULTATS ....................................................................................................................................................... 40
I.
REGULATION STOMATIQUE
1.
...................................................................................................................... 41
Effets de l’ozone sur la réponse stomatique aux paramètres environnementaux (lumière bleue,
lumière rouge, CO2 et déficit de pression de vapeur d’eau) dans trois génotypes de Populus deltoides x
nigra ........................................................................................................................................................... 41
2.
Réponses distinctes des stomates sur la face abaxiale et adaxiale en réponse à l’ozone chez trois
génotypes de peuplier euraméricain ............................................................................................................ 55
II.
DETOXICATION FOLIAIRE .........................................................................................................................
1.
75
Effets de l’ozone sur les voies de synthèse de l’ascorbate et du glutathion en relation avec les
contenus en acide aminés chez trois génotypes de peuplier : Une combinaison d’approches moléculaire et
métabolomique ............................................................................................................................................ 75
2.
Effets de l’ozone sur les concentrations en composés phénoliques et en caroténoïdes ................... 105
3.
Capacité de régénération du NADPH dans les feuilles de deux génotypes de peuplier présentant des
différences de sensibilité à l’ozone ............................................................................................................ 107
4.
Changements induits par l’ozone dans les métabolites primaires de trois génotypes de peuplier .. 124
CONCLUSION ET PERSPECTIVES ............................................................................................................ 126
ANNEXES ......................................................................................................................................................... 133
I.
PROTOCOLE DU DOSAGE DE L'ASCORBATE ET DU GLUTATHION (FORMES OXYDEES ET REDUITES) EN
MICROPLAQUE .................................................................................................................................................
134
5.
Extraction......................................................................................................................................... 134
6.
Dosage ascorbate............................................................................................................................. 135
7.
Dosage glutathion ............................................................................................................................ 137
II.
PROTOCOLE D’EXTRACTION ET D’ANALYSE PAR HPLC DES CAROTENOÏDES ......................................... 139
III.
PROTOCOLE D’ANALYSE DES SUCRES, COMPOSES PHENOLIQUES ET ACIDES AMINES ............................. 140
1.
Extraction......................................................................................................................................... 140
2.
Analyse des sucres ........................................................................................................................... 142
3.
Analyse des composés phénoliques .................................................................................................. 143
4.
Analyse des Acides aminés ............................................................................................................... 144
IV.
PROTOCOLE D’EXTRACTION DES ARNS AVEC LE KIT RNEASY® PLANT MINI......................................... 147
V.
PROTOCOLE DE TRAITEMENT DNASE I AMBION .................................................................................... 148
VI.
PROTOCOLE DE VERIFICATION DE LA QUALITE DES ARNS A L’EXPERION .............................................. 149
VII. PROTOCOLE DE DOSAGE DES ARNS EN RIBOGREEN .............................................................................. 150
VIII. PROTOCOLE DE RETROTRANSCRIPTION AVEC LE KIT ISCRIPT ET L’ALIEN............................................... 151
IX.
PROTOCOLE D’INCLUSION EN RESINE POUR OBSERVATIONS AU MET .................................................... 151
RÉFÉRENCES .................................................................................................................................................. 156
SYNTHESE BIBLIOGRAPHIQUE
1
Figure 1 : Structure de la molécule d'ozone
Figure 2 : Répartition de l'ozone atmosphérique selon l'altitude. (Document émis par la NASA)
Figure 3 : Cycle de génération-destruction de l'ozone ou cycle de Chapman (Yip, 2000)
I.
OZONE
1. GENERALITES SUR L’OZONE
La molécule d’ozone (O3) est une variété allotropique de l'oxygène, composée de trois
atomes, présente naturellement dans l’atmosphère (Figure 1). La découverte de l’ozone est
attribuée au chimiste suisse Christian Friedrich Schönbein, qui lui donne le nom d’ozone en
1840 en se basant sur le mot grec ozein signifiant « exhaler une odeur ». Cependant, l’odeur
âcre caractéristique de l’ozone avait déjà été mise en évidence par le chimiste Hollandais
Martin Van Marum en 1789. Contenu à 90% dans la stratosphère (entre 15 et 35 km
d'altitude), constituant la couche d’ozone, l’ozone protège la vie terrestre des irradiations aux
Ultra-violets provenant du soleil, tandis que les 10% d'ozone compris dans la troposphère
(entre 0 et 15 km d'altitude) représentent une menace pour la vie terrestre (Figure 2). En effet,
c'est un puissant polluant, gaz à effet de serre, nocif pour la santé, qui agit comme une
phytotoxine. Sa toxicité pour la végétation se traduit surtout par un stress oxydatif.
2. CYCLE DE L’OZONE
L’ozone stratosphérique constituant la couche d’ozone est produit et dégradé
naturellement par le cycle de formation-destruction ou cycle de Chapman (Figure 3), ce qui
dans une atmosphère non polluée, lui confère une concentration stable. Ce cycle se base sur la
succession de plusieurs réactions commençant par la photolyse de molécules d’oxygène sous
l’action des UV (1) (longueurs d’onde inférieures à 242 nm). Les atomes d’oxygène produits
réagissent rapidement avec le dioxygène pour former une molécule d’ozone (2). L’ozone peut
alors lui-même être rapidement photolysé (3), entraînant un équilibre entre les réactions (2) et
(3). L’ozone peut aussi être détruit par une réaction lente en réagissant avec un atome
d’oxygène (4).
(1)
O2 + hν → O + O
(2)
O + O2 + M → O3 + M
où M est un partenaire de collision non affecté par la réaction
(3)
O3 + hν → O + O2
(4)
O + O3 → 2O2
2
Figure 4 : Cycles de l'ozone stratosphérique et troposphérique (U.S. EPA, 2006)
Figure
5
: Evolution des concentrations Figure 6 : Concentrations annuelles passées,
européennes en ozone (ppb) mesurées entre 1870 actuelles et prédites en ozone troposphérique
et 2000 (Marenco, 1994)
(Vingarzan, 2004).
Synthèse bibliographique
Dans la troposphère les même réactions ont lieu mais sont néanmoins limitées par le
faible rayonnement UV dans la troposphère. Un cycle de l’ozone troposphérique décrit la
formation naturelle limitée d’ozone à partir des précurseurs primaires que sont les oxydes
d'azote (NOx), en présence de composés organiques volatils (VOCs) et de lumière (Figure 4).
Le cycle photochimique de l’ozone dans la troposphère repose sur la photolyse du dioxyde
d’azote (NO2) par le rayonnement des UV-A qui produit du monoxyde d’azote (NO) et un
atome d’oxygène (5). L’atome d’oxygène réagit ensuite avec du dioxygène pour former de
l’ozone (6). L’ozone peut alors réagir avec NO pour reformer du NO2 (7). Les VOC peuvent
néanmoins former des espèces réactives (radicaux comme HO2. ou RO2.) qui vont substituer
l’ozone dans cette dernière réaction (8). Les NOx et les VOCs produits par l’activité humaine
peuvent donc déséquilibrer ce cycle et entraîner une hausse des concentrations en ozone dans
la troposphère.
(5)
NO2 + hν → NO + O
(6)
O + O2 + M → O3 + M
où M est un partenaire de collision non affecté par la réaction
(7)
NO + O3 → NO2 + O2
(8)
NO → NO2
En été, les concentrations ponctuelles en ozone deviennent parfois si importantes que
l’on parle de pics d’ozone. En effet, l’ensoleillement et la température étant plus forts, le vent
plus limité dispersant moins les polluants, les réactions décrites sont favorisées.
3. EVOLUTION DES CONCENTRATIONS EN OZONE
TROPOSPHERIQUE
Les concentrations en ozone troposphérique ont été multipliées par 2 à 5 au cours du
XXème siècle (Figure 5 et 6). Afin d’éviter que ces concentrations continuent de croître, des
mesures ont été prises pour limiter la production des précurseurs de l’ozone par l’activité
humaine (conventions de Sophia 1988 et Genève 1991), des suivis de concentration d’ozone
ont été réalisés et des seuils de risque pour la santé et pour la végétation ont été définis (ICP
M&M, 2004; Journal Officiel des Communautés Européennes, directive 2002/3/CE du
parlement européen et du conseil). Cependant malgré la baisse des émissions de précurseurs
3
Figure 7 : Cartes des valeurs d’AOT40, indicateur de seuil de risque à l’ozone pour la végétation, en
2005, pour les cultures et pour les forêts (EEA, 2009)
Synthèse bibliographique
en Europe, les changements climatiques (notamment les augmentations de température) et la
hausse des productions de précurseurs (due en partie à l’augmentation du trafic automobile)
sur d’autres continents semblent estomper la baisse attendue des concentrations en ozone en
Europe (Wilson et al., 2012). Sur la base de 26 modèles de prédiction différents, le
changement de concentration moyenne en ozone troposphérique devrait être compris entre 5% et +15% pour 2030 (Stevenson et al., 2006). L’application mondiale plus ou moins stricte
des limitations de production de précurseurs et les prédictions variables concernant les
changements climatiques entraînent une forte imprécision des modèles de prédiction des
concentrations en ozone (IPCC, 2007; Cape, 2008; Fuhrer, 2009).
4. IMPACT DE L ’OZONE SUR LA VEGETATION
L’exposition des plantes de grandes cultures est évaluée, comme définie à l’échelle de
l’Europe par la Directive Ozone, selon les valeurs d’AOT40 (Accumulated Ozone over a
Threshold of 40 ppb for global radiations > 50 W.m-2) de mai à juin, tandis que celle des
forêts s’étend sur toute la période de végétation, d’avril à septembre. Selon les connaissances
actuelles, un niveau critique d’ozone à partir duquel des effets directs nocifs pour la
végétation peuvent se produire, est fixé pour les espèces de grandes cultures et pour les forêts
dans le Mapping Manual de l’ICP M&M (2004) à 6000 µg.m-3 et 10000 µg.m-3
respectivement. Ces niveaux étant régulièrement dépassés (Figure 7), un impact sur la
végétation et les écosystèmes, ainsi que des baisses de productivité conséquentes sur
l'agriculture et les activités forestières, sont à prévoir. Par exemple, en 2002 en Grèce, dans la
région de Thessalonique, on estime la perte économique totale due à l’impact de l’ozone sur
les cultures à 43 M€ (Vlachokostas et al., 2010). Au niveau de la production forestière, on
estime la perte économique en 2004 au niveau de la Suède à 56 M€ (Karlsson et al., 2005).
De plus, l’ozone a un effet indirect sur les capacités de séquestration du CO2 des écosystèmes,
agissant ainsi doublement sur le changement climatique (Sitch et al., 2007).
S ITES D ' ACTION DE L ' OZONE
Les flux d'ozone dans l’atmosphère sont dépendants des résistances qui s'y opposent
(résistance aérodynamique, résistance de couche limite, résistance aérodynamique de la
canopée, résistance intrinsèque du sol, résistance de la cuticule...). En contact avec les
feuilles, l'ozone est confronté à une surface hétérogène. Les flux d'ozone à travers la cuticule
sont négligeables (Kerstiens and Lendzian, 1989). Ils se réalisent essentiellement en passant
4
Synthèse bibliographique
par les stomates. Il convient alors d'identifier correctement les flux stomatiques entrants
d'ozone. Le nombre de stomates ainsi que leur ouverture influent sur l'entrée d'O3 (Castagna
and Ranieri, 2009).
L'ozone est hautement réactif et peut interagir avec les composants de la paroi
cellulaire des stomates et du mésophylle. Il est dissous en quasi totalité dans l'apoplasme
produisant des ROS (Reactive Oxygen Species) comme le peroxyde d'hydrogène (H2O2), le
radical hydroxyle (OH.), le radical perhydroxyle (HOO.), le radical superoxyde (O2.-), le
radical hyperoxyde (.O2H) ou l'oxygène singulet (1O2) (Langebartels et al., 2002; Ashmore,
2005; Wittig et al., 2007; Wittig et al., 2009). Ces composés sont des molécules très toxiques
pouvant modifier ou détruire les constituants cellulaires comme les protéines, les lipides, les
pigments, les acides nucléiques... (Ishida et al., 1999). Cependant, les ROS sont aussi des
molécules de signalisation produites naturellement par la plante (Mittler et al., 2004;
Karuppanapandian et al., 2011). Les ROS sont majoritairement produites au niveau des
chloroplastes lors de la photosynthèse et la photorespiration (Asada, 2006), des mitochondries
par la chaîne de transport des électrons (Rhoads et al., 2006), des peroxysomes lors de la
photorespiration (Del Rio et al., 2006). Les ROS interviennent notamment dans le contrôle de
la réponse de défense aux pathogènes et du programme de mort cellulaire (Foyer and Noctor,
2005). Le peroxyde d'hydrogène est relativement stable et son habileté à traverser les
membranes, notamment par les aquaporines, en fait un bon messager (Bienert et al., 2007). Il
peut néanmoins être transformé en radical hydroxyle par la réaction de Fenton catalysée par
des ions métalliques libres (Fe et Cu) (9) (10) et la réaction de Haber-Weiss (11). Les
radicaux superoxyde et hyperoxyde sont en équilibre dans les cellules vivantes. La forme
hyperoxyde étant plus hydrophobe, elle pénètre plus facilement les bicouches lipidiques des
membranes. Dans des conditions de pH neutre ou légèrement acide, ces deux radicaux
peuvent, dans des milieux aqueux, se dismuter en H2O2 et O2 spontanément ou sous l’action
de la superoxyde dismutase (SOD) (Wojtaszek, 1997) (12) (13) (14). Un équilibre entre
production et détoxication régule la toxicité et la signalisation des ROS (Mittler et al., 2004).
Réactions de Fenton:
(9)
H2O2+ Fe2+ (Cu+)  Fe3+ (Cu2+) + .OH + OH-
(10)
O2.- + Fe3+ (Cu2+)  Fe2+ (Cu+) + O2
5
Synthèse bibliographique
Réactions de Haber-Weiss:
(11)
H2O2 + O2.- + .OH + OH- + O2
Dismutation de superoxyde:
(12)
2 .O2H  H2O2 + O2
(13)
2 .O2H + O2.- + H+  H2O2 + O2
(14)
2 .O2.-+ 2 H+  H2O2 + O2
E FFETS VISIBLES SUR LES FEUILLES
Tandis qu’une exposition chronique à la pollution à l’ozone peut induire une perte de
biomasse sans signe visible, une exposition aigüe à l’ozone entraîne l’apparition de dégâts
visibles sur les feuilles ou les aiguilles des plantes, ce qui peut représenter des pertes
économiques sur des espèces horticoles (ICP forests, 2010). En Europe, les niveaux ambiants
d'ozone sont suffisamment élevés pour causer des blessures visibles chez les espèces natives.
L'évaluation des lésions visibles est utilisée pour détecter des zones de risques potentiels où
les effets de l’ozone sur les forêts sont les plus marqués. Le suivi de ces dommages foliaires
est incorporé dans des programmes de surveillance à une échelle européenne dans le cadre des
protocoles d’ICP-Forest et FutMon (EU Life). Les dégâts foliaires dus à l’ozone peuvent se
voir à l’œil nu et sont caractéristiques de ce polluant. Ces symptômes sont plus marqués sur
les feuilles âgées, où ils apparaissent en premier, et moins importants sur les feuilles d’ombre,
où ils sont presque inexistants. Ils se limitent généralement à la face supérieure des feuilles et
peuvent prendre la forme d’une décoloration (Figure 8), de rougeur ou de brunissage entre les
nervures, ou encore de plus ou moins grandes nécroses (Figure 8 B et C) (Vollenweider,
2003). L’ozone entraîne une chute prématurée des feuilles. Chez les conifères, comme pour
les feuilles, les symptômes sont limités à la face supérieure des aiguilles et on retrouve un
effet âge et un effet lumière. Les marbrures chlorotiques sont le symptôme le plus commun
décrit pour les aiguilles de conifères. Elles peuvent être décrites comme une alternance de
jaune ou de vert pâle de taille similaire, sans frontières nettes (Figure 8D).
6
A
B
C
D
Figure 8 : Exemples de symptômes foliaires sur des feuilles de peupliers soumis à un traitement à
l'ozone (Photos: F. Spicher) A) Décoloration (feuille de droite) par rapport à une feuille témoin (feuille
de gauche), B) et C) nécroses plus ou moins importantes entre les nervures de feuilles de peuplier, et
D) marbrures sur des aiguilles de pin d’Alep (Photo: V. Calatayud)
Figure 9 : Variation en pourcentage de la biomasse totale, biomasse foliaire, surface foliaire (par
unité de surface), biomasse ligneuse aerienne, biomasse aérienne, biomasse racinaire et ratio feuilleracine, hauteur et diamètre de tous les arbres exposés à des concentrations élevées d’ozone par rapport
aux témoins exposés à l’air filtré par charbon actif. Les symboles sont encadrés par des intervalles de
confiance à 95%, les degrés de liberté et les moyennes des concentrations à l’ozone sont données le
long de l’axe Y. (Wittig et al., 2009)
Synthèse bibliographique
E FFETS SUR LA BIOMASSE ET LA CROISSANCE
Les concentrations actuelles en ozone entraînent déjà une baisse de la croissance en
diamètre et en biomasse chez de nombreuses espèces, dont une perte de biomasse totale de
7% chez les espèces forestières (Wittig et al., 2009). On estime une baisse de rendement
d’environ 4% pour le maïs, 9% pour le blé et 11% pour le soja (Avnery et al., 2011;
Wilkinson et al., 2011). Les baisses de croissance et les pertes en biomasse à des
concentrations un peu plus élevées (Figure 9) laissent envisager que, dans les années à venir,
l’impact de la pollution à l’ozone sur la croissance et la biomasse sera, pour les arbres, 10%
plus important qu’aujourd’hui (Wittig et al., 2009). De plus, les angiospermes sont plus
sensibles que les gymnospermes (Figure 10).
E FFETS SUR LES ECHANGES GAZEUX FOLIAIRES
Les concentrations actuelles en ozone (50 ppb) sont suffisantes pour réduire les
capacités photosynthétiques des angiospermes (Figure 11) (Wittig et al., 2007). Si les
concentrations en ozone continuent de croître, la photosynthèse des gymnospermes, moins
sensibles à l’ozone, pourrait elle aussi être réduite. Dans le cas d’une exposition aigüe mais
ponctuelle, l’ozone entraîne une baisse réversible de la conductance stomatique et donc de la
photosynthèse, tandis que dans le cas d’une exposition chronique, même à des concentrations
d’ozone plus faibles, la réduction de la conductance stomatique et de la photosynthèse est
cumulative (Figure 12) (Ainsworth et al., 2012). Suite à une exposition chronique, l’effet de
l’ozone sur la conductance stomatique a été attribué à un effet direct sur la photosynthèse, lié
à une baisse de l’activité de la Rubisco, notamment due à une diminution des concentrations
de l’enzyme, entraînant une hausse de la concentration interne en CO2 (Ci) et une fermeture
stomatique (Figure 13) (Dizengremel, 2001; Fiscus et al., 2005). Néanmoins, il existe un effet
direct de l’ozone sur le fonctionnement des cellules stomatiques, induisant des changements
de la réponse dynamique des stomates impliquant un découplage de la photosynthèse et la
conductance stomatique (Lombardozzi et al., 2012). De plus, si l’ozone réduit les capacités
photosynthétiques, la respiration est à l’inverse stimulée, tout comme l’activité de la PEPC, ce
qui permet de contrebalancer en partie la diminution de la photosynthèse (Dizengremel, 2001;
Dghim et al., 2012).
7
Figure 10 : Variation en pourcentage de la biomasse totale, biomasse foliaire, surface foliaire,
biomasse aérienne, biomasse racinaire et ratio feuille-racine pour les gymnospermes et angiospermes
exposés à des concentrations élevées d’ozone par rapport aux témoins exposés à l’air filtré par charbon
actif. Les symboles sont encadrés par des intervalles de confiance à 95%, les degrés de liberté et les
moyennes des concentrations à l’ozone sont données le long de l’axe Y. (Wittig et al., 2009)
Figure 11 : Variation en pourcentage de la photosynthèse en lumière saturante (Asat) et de la
conductance stomatique (gs) des arbres soumis à des concentrations ambiantes en ozone (O3) par
rapport aux témoins exposés à l'air filtré par charbon actif (cf) en incluant les différences entre
gymnospermes et angiospermes. Les degrés de liberté (d.f.) et les concentrations ambiantes moyennes
en ozone [O3] sont donnés le long de l’axe y. (Wittig et al., 2007)
Figure 12 : Variation en pourcentage de la photosynthèse en lumière saturante (Asat) et de la
conductance stomatique (gs) des arbres soumis à des concentrations élevées en ozone (O3) par rapport
aux témoins exposés à l'air filtré par charbon actif (cf) et l’impact de différentes concentrations en
ozone [O3] sur la réponse. Les degrés de liberté (d.f.) et les concentrations en ozone sont donnés le
long de l’axe y. (Wittig et al., 2007)
Figure 13 : Variation en pourcentage de la photosynthèse, de la conductance stomatique, de la
transpiration, de la respiration, de la chlorophylle totale, de la chlorophylle a, de la chlorophylle b, du
ratio entre chlorophylle a et b, du contenu en rubisco, de l'activité de la rubisco, du contenu en
nitrogène, du sucrose et de l’amidon des arbres soumis à des concentrations élevées en ozone par
rapport aux témoins exposés à l’air filtré par charbon actif. Les degrés de liberté (d.f.) et les
concentrations ambiantes moyennes en ozone [O3] sont donnés le long de l’axe y. (Wittig et al., 2009)
A
B
Figure 14 : A) Stomate et B) épiderme inférieur de feuille de peuplier observés au microscope
électronique à balayage.
Synthèse bibliographique
E FFETS BIOCHIMIQUES
Au niveau cellulaire, l’ozone entraîne une hausse des ROS qui va induire toute une
cascade d’évènements et des modifications biochimiques importantes. Outre la réduction de
l’activité et des concentrations de la Rubisco, la réduction du contenu en chlorophylles
provoquée par l’ozone va impacter négativement la disponibilité en carbone (Figure 13). Un
coût en carbone est ajouté pour lutter contre les effets de l’ozone, sous la forme d’une
synthèse de métabolites impliqués dans les processus de détoxication des ROS (ascorbate,
glutathion, caroténoïdes, flavonoïdes…), d’une production supplémentaire des enzymes
neutralisant les ROS (peroxydase, SOD…), d’une stimulation de la voie de synthèse de la
lignine et d’un cycle de réparation intense des protéines dégradées (Cabané et al., 2004;
Ainsworth et al., 2012). Les ROS produits suite à l'entrée d'ozone, altéreront l'expression de
nombreuses protéines (Heath, 2008).
II.
ROLE DES STOMATES
Comme nous l’avons mis en avant précédemment, les stomates représentent la
première barrière mécanique de défense permettant de réguler l’entrée d’ozone dans les
plantes. Ce sont les premières cellules en contact avec l’ozone, et elles sont donc susceptibles
d’être soumises à un stress oxydatif important. Les stomates ont un fonctionnement complexe,
qu’il est important de rappeler, et le calcul de la conductance stomatique (voir ci-après) est
par conséquent, délicat et toujours améliorable.
1. GENERALITES
Les stomates sont des pores situés sur l’épiderme des parties aériennes des plantes
(Figure 14). Ils sont constitués de deux cellules de gardes entourant un orifice appelé ostiole.
La paroi des cellules stomatiques est dissymétrique et plus épaisse du côté interne. Les
stomates contrôlent deux des plus importants processus des plantes, la photosynthèse et la
transpiration. Plus de 95% du dioxyde de carbone (entrant pour la photosynthèse) et de la
vapeur d'eau (sortante pour la transpiration et le refroidissement de la surface foliaire)
échangés entre la feuille et l'atmosphère passent par les stomates. De par ces fonctions, ils
sont essentiels pour la croissance des plantes et sont de première importance dans toutes les
considérations de rendements des cultures.
8
Tableau 1: Equations des principaux modèles de calcul de conductance stomatique, issu de Damour
et al. (2010)
Synthèse bibliographique
2. MODELES DE CONDUCTANCE STOMATIQUE
Comme la régulation de la conductance stomatique joue un rôle clé dans l’adaptation
aux variations des conditions environnementales, notamment en situation de stress, il apparaît
d’une importance capitale d’améliorer notre compréhension de ces mécanismes afin de
pouvoir modéliser le mieux possible cet élément clé. De par son importance, le calcul de la
conductance stomatique a été largement étudié au cours des 50 dernières années. Il existe un
nombre important de modèles essentiellement empiriques, très peu étant mécanistes (Tableau
1). La majorité est toutefois semi-empirique, associant des fonctions empiriques à des
hypothèses physiologiques (Damour et al., 2010). Certains modèles généraux intègrent les
principaux facteurs environnementaux régulant la conductance stomatique grâce à des
fonctions empiriques à paramétrer en fonction des situations. C’est le cas du modèle
multiplicatif de Jarvis (1976) et du modèle de White et al. (1999) qui mettent en relation les
différentes fonctions du modèle par rapport à la conductance maximale, puis celui de Noe et
Giersch (2004) qui pondère l’influence des fonctions environnementales en ne prenant que le
minimum de ces limitations. D’autres modèles calculent la réponse de la conductance
stomatique non pas en fonction des paramètres environnementaux directement, mais en
fonction de facteurs physiologiques comme la photosynthèse. C’est le cas du modèle de Ball,
Woodrow et Berry (1987) qui a ensuite été amélioré par Aphalo et Jarvis (1993) pour prendre
en compte de manière explicite la dépendance de la conductance stomatique à l’humidité de
l’air et à la température. D’autres modifications du modèle ont été faites afin d’en améliorer
les résultats (Leuning, 1990; Leuning, 1995), mais il est important de souligner qu’un tel
modèle nécessite d’être couplé à un modèle approprié de photosynthèse comme le modèle de
Farquhar et al. (1980).
Le calcul de la conductance stomatique à l’ozone, gs, consiste à appliquer un facteur
de diffusion au calcul de la conductance stomatique à la vapeur d’eau, gsw (15). Le modèle
d’Emberson-Jarvis (16) utilise une conductance stomatique maximale et des fonctions
réductrices dépendantes de facteurs environnementaux (phénologie, lumière, température,
déficit de pression de vapeur d’eau (VPD), potentiel hydrique du sol (swp)). Mais celui-ci ne
tient pas compte de l'impact temporel de l'ozone sur la conductance stomatique, il faut donc
réussir à inclure une fonction ozone, fO3, dans le modèle comme l’ont fait Danielsson et al.
(2003) sur la pomme de terre. L’ozone ayant des répercussions sur la réponse des stomates
aux facteurs environnementaux, il convient d’étudier son impact sur les différents facteurs
entrant dans le calcul, afin de définir la fonction ozone et la place adéquate où l’intégrer.
9
Figure 15 : Canaux et transporteurs ioniques impliqués dans les mouvements stomatiques. A gauche,
les protéines de transport activées lors de la fermeture, et à droite, lors de l’ouverture des stomates. Les
gènes correspondants identifiés chez Arabidopsis sont encadrés.
Synthèse bibliographique
(15)
(16)
3. REGULATION DES MOUVEMENTS STOMATIQUES
La régulation des mouvements stomatiques est un élément déterminant pour les
capacités d'adaptation des plantes lors de changements de facteurs environnementaux. En
effet, la conductance stomatique régule l'entrée de CO2 et les pertes en eau au niveau des
feuilles. Les variations de facteurs environnementaux entraînent la fermeture ou l’ouverture
des stomates afin d’optimiser les échanges gazeux, en fonction des conditions
environnementales. L'ouverture des stomates est provoquée par la force motrice liée à
l'augmentation du volume des cellules de garde et la pression de turgescence causées par une
entrée d’eau dans l’apoplasme. Ces flux d’eau accompagnent l’accumulation d'ions K+
provoquée par une hyperpolarisation de la membrane, suite à l’activation d’une pompe à
proton (Fischer, 1968; Outlaw and Manchester, 1979). L’ouverture stomatique est ensuite
maintenue par l’accumulation de sucres. La fermeture des stomates résulte d'un processus
inverse, impliquant en plus le calcium (Ca2+). En effet, plusieurs facteurs comme l'acide
abscissique (ABA) ou une hausse de concentration en CO2 peuvent stimuler l'absorption de
Ca2+ ce qui entraîne une dépolarisation de la membrane puis une sortie d’ions Cl- et malate2et enfin une diffusion passive des ions K+ (Hopkins, 2003; Lawson, 2009). Les flux d’ions
permettant les mouvements stomatiques nécessitent la participation de nombreux canaux
plasmiques et vacuolaires (tonoplastiques) (Figure 15) (Pandey et al., 2007).
E FFET DU VPD (V APOR P RESSURE D EFICIT ) ET DE LA TEMPERATURE
Les stomates sont sensibles au VPD et à la température, deux paramètres liés, dont les
effets sont difficilement séparables. Si certaines espèces apparaissent plus ou moins sensibles
aux variations de VPD, on observe cependant une réponse commune : la conductance
stomatique baisse avec l’augmentation du VPD (Day, 2000; Yong et al., 1997). Le
mécanisme de réponse des stomates aux variations de VPD est peu connu, alors que ce
paramètre environnemental est un facteur dominant par rapport aux variations de lumière ou
de concentrations de CO2, ce qui lui donne une grande importance dans la prédiction des
mouvements stomatiques (Aasamaa et al., 2011). Certains pensent que les mécanismes de
réponse au VPD pourraient être indépendants de l’ABA (Assmann et al., 2000), tandis que
10
Figure 16 : Schéma de la cascade de réactions impliquée dans la réponse à la lumière bleue et à la
lumière rouge (Lawson, 2009)
Figure 17 : Processus d'ouverture stomatique en réponse à la lumière bleue (Shimazaki, 2007)
Synthèse bibliographique
d’autres avancent l’hypothèse que la réponse au VPD soit liée aux concentrations en ABA
(Bunce, 1998; Xie et al., 2006). Pour la température, on observe un optimum et la
conductance baisse lorsque l’on s’éloigne de celui-ci (Jarvis, 1976). Le contrôle de la réponse
stomatique aux variations de température semble lié à la respiration (Lu et al., 2000).
E FFET DE LA LUMIERE
La lumière induit une ouverture des stomates. Cependant, cette ouverture dépend de
l’intensité et du type de longueur d'onde de celle-ci (Figure 16), et implique plusieurs
photorécepteurs tels que les cryptochromes, les phytochromes et les phototropines. De plus, la
réponse à la lumière résulte d’au moins deux composantes, une composante indépendante et
une autre dépendante de la photosynthèse (Wang et al., 2011).
La réponse à la lumière rouge est dépendante de la photosynthèse intervenant dans le
mésophylle et les cellules de garde (Lawson et al., 2002; Mott 2009; Zeiger et al., 2002). Le
pigment impliqué dans la réponse à la lumière rouge serait la chlorophylle contenue dans les
chloroplastes des cellules de garde et du mésophylle. L’importance respective de la
photosynthèse dans les cellules de garde et dans le mésophylle, dans la réponse à la lumière
rouge, fait actuellement débat. Des études récentes ont montré que la réponse à la lumière
rouge n’est cependant pas due à la baisse de la concentration intracellulaire en CO2 par la
photosynthèse (Wang et al., 2008). De plus,Wang et al. (2010) montrent que le phytochrome
B interviendrait dans la réponse à la lumière rouge. Un mutant d’Arabidopsis thaliana
surexprimant PhyB a une sursensibilité à la lumière rouge, tandis qu’inversement, le mutant
négatif PhyB a une sensibilité à la lumière rouge fortement réduite.
La lumière bleue provoque une ouverture rapide des stomates. Cette réponse est
principalement indépendante de la photosynthèse. Plusieurs photorécepteurs à la lumière
bleue ont été candidats, la zéaxanthine et les phototropines (Kinoshita et al., 2001). Il est
maintenant admis que les phototropines sont les récepteurs à la lumière bleue, et qu’elles
induisent une phosphorylation et une activation de l'ATPase à protons membranaire, ce qui
entraîne une hyperpolarisation de la membrane et une entrée massive d’ions K+ (Figure 17).
Enfin, Chez Arabidopsis thaliana, COP1 agit comme un régulateur négatif des signaux émis
par les cryptochromes et les phototropines à la lumière bleue (Mao et al., 2005).
La lumière rouge active la photosynthèse et stimule l’accumulation de sucrose dans les
cellules de garde en l’absence d’apport d’ions K+, alors que la lumière bleue stimule l’entrée
11
Figure 18 : Modèle simplifié illustrant les fonctions de gènes récemment identifiés et de mécanismes
impliqués dans le contrôle des mouvements stomatiques en réponse au CO2 (Kim et al., 2010).
Figure 19 : Nouveau modèle montrant la séquence d'évènements induits par le CO2 entraînant
l'activation des canaux anioniques de type S et la fermeture des stomates (Xue et al., 2011)
Synthèse bibliographique
de K+ et de Cl-, la synthèse de malate et l’hydrolyse de l’amidon (Zeiger et al., 2002). De
plus, les cryptochromes CRY1 et CRY2 agissent, en plus des phototropines, lors de la réponse
des stomates à la lumière bleue et en parallèle des phytochromes, lors de la réponse à la
lumière rouge (Boccalandro et al., 2012). Les cryptochromes interviendraient dans la réponse
à la lumière bleue et à la lumière rouge, en réduisant les niveaux d’ABA. D’une manière
générale, il semble que PhyB agisse de concert avec les phototropines, les cryptochromes et le
phytochrome A dans la réponse à la lumière blanche (Wang et al., 2010).
E FFET DU CO 2
Une forte concentration en CO2 entraîne une fermeture des stomates tandis que des
concentrations faibles vont avoir l’effet inverse. En effet, le CO2 va activer les canaux
anioniques, et provoquer un fort efflux d’ions K+, entraînant une sortie de Cl- et de malate2- et
une dépolarisation de la membrane (Figure 18) (Kim et al., 2010). Cependant, les étapes du
signal précédent l’activation des canaux anioniques restent encore mal connues, bien que des
avancées aient permis l’élaboration d’un nouveau modèle de réponse au CO2 (Figure 19) (Xue
et al., 2011). La forte concentration en CO2 va, par le biais des anhydrases carboniques βCA1
et βCA4, entraîner une hausse de la concentration en HCO3-. Deux cascades de signaux se
mettent en place. Indépendamment des concentrations en Ca2+, la forte concentration en CO2
et HCO3- va activer les canaux ioniques de type S (Hu et al., 2010), inhiber les canaux
d’entrée de K+, inhiber les ATPases entraînant ainsi la fermeture des stomates et l’inhibition
de l’ouverture stomatique. En parallèle, les canaux anioniques SLAC1-dépendants vont aussi
être activés par l’amorçage de la sensibilité au Ca2+ (Figure 20).
Les signaux de fermeture des stomates dus au CO2 et à l’ABA deviennent les mêmes à
partir de cet instant, bien que les récepteurs soient différents (Xue et al., 2011). Dans les deux
cas, la sensibilité est amorcée, et les deux signaux deviennent commun avant ou à partir de la
protéine kinase OST1 aussi appelée SnRK2.6 et SnRK2E. Contrairement au CO2, l’action de
l’ABA se base sur le modèle PYR/RCAR–PP2C–SnRK2, décrit par Hubbard et al. (2010),
pour activer OST1 (Figure 21). Des études supplémentaires sont nécessaires pour élucider les
mécanismes par lesquels les stimuli au CO2 et à l’ABA amorcent la sensibilité au Ca2+. Enfin,
il faut rappeler que la protéine kinase HT1 joue un rôle important dans la régulation du
mouvement stomatique sous forte concentration en CO2. Elle agit comme un régulateur
négatif majeur (Hashimoto et al., 2006).
12
Figure 20 : Schéma illustrant le modèle PYR/RCAR-PP2C-SnRK2 de réponse à l'ABA (Hubbard et
al., 2010)
Figure 21 : Modèle d’amorçage de la sensibilité au Ca2+ (Hubbard et al., 2011). L’amorçage et
l’augmentation des [Ca2+] sont nécessaires pour l’activation des canaux anioniques et potassiques de
type-S résultant en la fermeture des stomates.
Synthèse bibliographique
E FFETS DE L ’OZONE
D’une manière générale l’ozone entraîne une réduction de la conductance stomatique.
Cependant, les mécanismes de perception de l’ozone et la cascade signalétique associée sont
toujours inconnus. Néanmoins, il a été montré que les mutants de Nicotiana tabacum et
Arabidopsis thaliana, NtMPK4, ost1, abi1-1, abi2-1 et slac1 ont une sensibilité à l’ozone
accrue, due à une conductance stomatique supérieure et à une régulation de la conductance
stomatique perturbée en réponse à l’ozone. (Gomi et al., 2005; Marten et al., 2008 Vahisalu et
al., 2010). Ces travaux indiquent l’implication des canaux anioniques et de phénomènes de
phosphorylation/déphosphorylation de protéines dans la réponse des cellules de garde à
l’ozone.
De plus, suite à un stress ozone, la réponse des stomates aux autres facteurs
environnementaux est modifiée. En effet, après un traitement ozone, les stomates ont une
vitesse d’ouverture et de fermeture plus lente en réponse aux variations de lumière (Paoletti,
2005; Paoletti and Grulke, 2010). Le même effet est observé pour la réponse à une variation
de VPD (Grulke et al., 2007).
III.
SYSTEMES DE DETOXICATION
1. SYSTEME DE DEFENSE ANTIOXYDATIF
Les défenses de la plante comprennent la capacité à restreindre les flux d'ozone
entrants dans les tissus (reflétée par les modifications de la conductance stomatique), mais
aussi à détoxiquer l'ozone une fois les stomates franchis. Un système de détoxication,
constitutif puis inductif, agit sur les ROS pour limiter le stress oxydatif (Wieser and
Matyssek, 2007). La détoxication constitutive est déjà opérationnelle à l'entrée de l'ozone
dans les feuilles. En effet, les ROS étant produits naturellement dans différents compartiments
cellulaires, les acteurs de la détoxication sont toujours actifs. Chaque compartiment cellulaire
contient ses propres agents de détoxication. L'ascorbate présent dans l’apoplasme sous forme
réduite (ASA) constitue la première barrière à s'opposer à l'ozone et aux ROS (Castagna and
Ranieri, 2009). Plus les concentrations en ozone et en ROS sont fortes, plus l’ascorbate réduit
sera oxydé. La détoxication inductive renforce la détoxication constitutive en produisant et en
régénérant les antioxydants, mais nécessite beaucoup d'énergie (Musselman et al., 2006),
alors que la photosynthèse est limitée par l’ozone. Le métabolisme primaire joue alors un rôle
13
Synthèse bibliographique
important pour supporter ces processus. Les sucres solubles en tant que source d’énergie
représentent de ce fait un facteur clé. De plus, ils associent un rôle de signalisation impactant
l’expression de gènes (Gupta et Kaur, 2005) à des capacités d’osmoprotection et de
détoxication, notamment le galactinol et le raffinose qui seraient capables de détoxiquer les
radicaux hydroxyles (Nishizawa et al., 2008). Le pouvoir réducteur des systèmes de
détoxication dérive directement ou indirectement du NAD(P)H ou de la ferrédoxine (sauf la
SuperOxyde Dismutase (SOD) et la catalase) (Dizengremel et al., 2008; Moller et al., 2007)
(Figure 22), rendant le maintien d’un pool de NADPH par le métabolisme primaire, essentiel
à la détoxication inductive.
2. VOIE D'HALLIWELL-ASADA
Le rôle antioxydant de l'ascorbate est directement dépendant de la capacité de la
cellule à le maintenir à son état réduit. La voie d'Halliwell-Asada (Figure 23) est alors
sollicitée (Dizengremel et al., 2008). L'entrée d'ozone entraîne l'apparition d'H2O2 dans
l'apoplasme. L'ascorbate peroxydase (APX) réduit l'H2O2 en eau en utilisant le pouvoir
réducteur de l'ascorbate (ASA) (vitamine C) qui devient du monodéhydroascorbate (MDHA).
(17)
H2O2 + 2 ASA → 2 H2O + 2 MDHA
Du déhydroascorbate (DHA) se forme ensuite spontanément par dismutation de deux
MDHA.
(18)
2 MDHA → DHA
Le DHA passe ensuite dans le cytosol puis dans les chloroplastes éventuellement. On
y retrouve les mêmes réactions (17) et (18) pour neutraliser l'H2O2 réussissant à passer la
membrane. De plus, la monodéhydroascorbate réductase (MDHAR) présente dans ces
compartiments permet de régénérer l'ascorbate en utilisant du NAD(P)H selon la réaction
suivante :
(19)
2 MDHA + NAD(P)H → 2 ASA + NAD(P)
14
Figure 22 : Double effet des ROS générés par l'ozone sur les processus de détoxication et sur la
régénération métabolique du pouvoir réducteur (Dizengremel et al., 2009) Abréviations : CW : Paroi
cellulaire, P : Membrame plasmique, Asc : Ascorbate réduit, DHA : Ascorbate oxydé, GSSG :
Glutathion oxydé, GSH : Glutathion réduit
Figure 23 : Voie d'Halliwell-Asada (Castagna et Ranieri, 2009)
Tableau 2 : Mécanismes de détoxication des ROS dans les cellules végétales (Moller et al., 2007)
Mécanismes
Consommés (produits)
Localisation cellulaire
SOD
O2.- (H2O2)
Chl, Cyt, Mit, Per
Catalase
H2O2 (H2O)
Mit?, Per
Peroxydases (PODs)
H2O2 (H2O)
Nombreuses localisations
Ascorbate/ Cycle Glutathion
H2O2 (H2O)
Chl, Cyt?, Mit, Per
H2O2 (H2O)
Glutathion peroxydases
Lipides hydroperoxydes
Chl, Cyt, RE, Mit
Autres hydroperoxydes
H2O2 (H2O)
Système peroxyredoxine
Alkyle hydroperoxydes
Chl, Cyt, Mit, Noy
Peroxynitrite
Système Thioredoxine
Système glutaredoxine
Carotènes et tocophérol
H2O2 (H2O)
H2O2 (H2O)
Hydroperoxydes
1
O2 (O2)
Chl, Cyt, Mit
Chl, Cyt, Mit, Sec
Chl
Chl, Chloroplastes; Cyt, Cytosol; RE, Réticulum Endoplasmique; Mit, Mitochondrie; Noy, Noyau; Per,
Peroxysomes; Sec, Voie sécrétoire
Synthèse bibliographique
La déhydroascorbate réductase réduit le DHA obtenu par dismutation spontanée (18)
du MDHA, en utilisant le glutathion réduit (GSH), produisant du glutathion oxydé (GSSG)
(20).
(20)
DHA + 2 GSH → ASA + GSSG
Le glutathion oxydé est ensuite régénéré à son tour par la glutathion réductase (GR) en
utilisant du NADPH (21). Puis l'ascorbate retourne dans l'apoplasme.
(21)
GSSG + NADPH → 2 GSH + NADP
3. AUTRES ENZYMES ET MOLECULES ANTIOXYDANTES
D'autres mécanismes moins importants, ou moins connus, servent à la détoxication des
ROS issus de l'ozone et viennent en complément de la voie d'Halliwell-Asada. On les retrouve
répartis dans la plupart des organites des cellules (Tableau 2 et Figure 24).
Le tocophérol stabilise les radicaux produits lors de la peroxydation des lipides,
stoppant ainsi les réactions en chaîne. Les caroténoïdes, dont la zéaxanthine, permettent de
neutraliser l'oxygène singulet et de reconvertir le tocophérol porteur d’un radical en
tocophérol. Les composants phénoliques ont généralement un fort pouvoir antioxydant,
notamment les flavonoïdes quercétine, anthocyanidines cyanidine et delphinidine (Rice-Evans
et al., 1997). Les anthocyanines peuvent détoxiquer l'H2O2. Il se peut donc qu'ils agissent
dans les mécanismes de détoxication de l'ozone. Les superoxydes dismutases (SOD) sont des
enzymes qui lient deux ions superoxydes à deux ions hydrogène pour produire de l'oxygène
moléculaire et de l'eau oxygénée, neutres et moins toxiques. La catalase est une enzyme qui
dismute le peroxyde d'hydrogène en eau. Les peroxydases sont une famille d'enzymes
catalysant la dégradation du peroxyde d'hydrogène avec comme second substrat un composé
réducteur. L'ascorbate peroxydase et la glutathion peroxydase en font partie.
4. VOIE DE BIOSYNTHESE DE L’ASCORBATE
L’ascorbate est un élément important pour la régulation des radicaux libres oxygénés
dans plusieurs compartiments cellulaires à travers la voie d’Halliwell Asada. La voie de
synthèse principale de l’ascorbate utilise le galactose (Figure 25), cependant d’autres voies
15
Figure 24 : Schéma des systèmes de détoxication des ROS dans les différents organites des cellules
végétales. Abréviations : APX : Ascorbate peroxydase, ASA : Ascorbate, CAT : Catalase, DHA :
Déhydroascorbate, DHAR : Déhydroascorbate réductase, EIM : Espace inter membranaire, F :
Flavonoïde, F . : Radical Flavonoïde, GLR : Glutaredoxine, GPX : Glutathion peroxydase, GR :
Glutathion réductase, GSH : Glutathion réduit, GSSG : Glutathion oxydé, GuPx : Guaiacol
Peroxydase, MDHA : Monodéhydroascorbate, MDHAR : Monodéhydroascorbate réductase, NAD(P) :
Nicotinamide adénine dinucléotide (phosphate) oxydé, NAD(P)H : Nicotinamide adénine dinucléotide
(phosphate) réduit, P : Polymère, PrxR : Peroxiredoxine, SOD : Superoxyde dismutase ,Trx :
Thioredoxine
Polysaccharides
paroi
Me-Dgalacturonate
Dégradation
7
Dgalacturonate
6
L-galactose
pathway
GDP-LGalactose
2
Salvage
pathway
L-galactonate
3
L-Galactose1-P
4
L-Galactose
5
L-Galactono1,4-lactone
8
1
L-Ascorbate
GDP-Dmannose
1
GDP-L-gulose
9
L-gulono-1,4lactone
10
L-gulose-1-P
11
L-gulose
14
5
L-gulonate
L-gulose
pathway
glycoprotéines
12
Dglucoronate
Animal-like
pathway
13
Myo-inositol
Figure 25 : Voies de synthèse de l'ascorbate 1: GDP-D-mannose 3’,5’-epimerase (GME)  GME, 2:
GDP-L-galactose phosphorylase  VTC2/VTC5, 3: L-galactose-1-P phosphatase  VTC4, 4: Lgalactose dehydrogenase  L-GalDH, 5: aldonolactonase, 6: D-galacturonase reductase  GalUR, 7:
methylesterase, 8: L-galactono-1,4-lactone dehydrogenase (GLDH)  GLDH, 9: nucleotide
pyrophosphatase ou sugar-1-P-guanylyltransferase, 10: sugar phosphatase, 11: sugar dehydrogenase,
12:
uronate
reductase,
déhydrogenase/oxydase
13:myo-inositol
oxygenase

MIOX4,
14:
L-gulono-1,4-lactone
Photorespiration
glycolate
10
S
assimilation
O-AcetylL-Serine
Sulfide
5
6
glyoxylate
Serine
3
Glutamine
9
1
2
2-oxo-glutarate NAD+ +
+ NADH
glutamate
9
Glutamate
Alanine
Glycine
7
Cysteine
TCA
cycle
9
8
Threonine
Glutathion
Gammaglutamylcysteine
Glutamate
4
ADP + Pi
ATP + NH3
N
assimilation
Figure 26 : Voie de biosynthèse du glutathion. 1: glutathione synthase (GSH2), 2 : gammaglutamylcysteine synthase (GSH1), 3 : glutamate synthase NADH (GOGAT), 4 : Glutamine synthetase
(GS), 5 : Cysteine synthase (OAS), 6 : Serine o-acétyltransferase (SATase), 7 : glycine
hydroxymethyltransferase (glyA), 8 : threonine aldolase (THA), 9 : alanine – glyoxylate transaminase
(AGT), 10 : glycolate oxydase
Synthèse bibliographique
plus ou moins détaillées sont parfois décrites dans la littérature, mais sont pour certaines
controversées. La GDP-L-galactose phosphorylase (VTC2) produit le premier métabolite
dédié à la principale voie de biosynthèse de l’ascorbate, le L-galactose-1-P. C’est le point de
régulation le plus important dans le contrôle transcriptionnel de la biosynthèse de l’ascorbate
(Linster and Clarke, 2008).
5. VOIE DE BIOSYNTHESE DU GLUTATHION
Le glutathion est lui aussi un élément clé du mécanisme de détoxication des radicaux
libres oxygénés puisqu’il sert à renouveler le pool d’ascorbate réduit dans la voie d’HalliwellAsada. Le glutathion est un cofacteur de nombreuses enzymes impliquées dans la
détoxication des ROS et joue donc un rôle central comme antioxydant mais aussi comme
composant de la signalisation cellulaire. (Galant et al., 2011; Noctor et al., 2012). Sa voie de
biosynthèse est très simple, car rapidement reliée aux acides aminés (Figure 26). Les deux
principaux points de régulation sont la disponibilité en cystéine et l’activité de la gammaglutamylcysteine synthétase (γ-ECS) (Noctor, 2006).
16
OBJECTIFS DE RECHERCHE
17
Tableau 3 : Principaux indicateurs d'évaluation de l'impact de l'ozone sur la végétation
Mesure
Danger
Exposition
Évaluation du
risque
[O3]
Ozone atmosphérique
Paramètres
Unité
AOT40 ou SUM60
ppb.h
Entrée d’O3 (gs)
POD ou CUO ou AFstY
Conductance stomatique
(∑ flux O3)
mmol.m-²
Flux effectif
Conductance stomatique et
indicateur de la détoxication
∑ (flux O3 – Détoxication)
mmol.m-²
Objectifs de recherche
I.
PROBLEMATIQUE
1. SEUILS DE RISQUE A L’OZONE
Les effets néfastes de l’ozone sur la santé, l’environnement et l’économie agricole et
forestière représentent une préoccupation importante pour l'Union Européenne, qui exige une
amélioration des seuils de risque à l'ozone pour la végétation. En effet, aujourd’hui l’impact
de l’ozone est évalué à l’aide de plusieurs indicateurs (Tableau 3). Ces indicateurs, varient en
fonction des paramètres de mesure utilisés et en fonction de leur précision. Un bon indicateur
doit être le plus précis possible, tout en restant le plus simple d'utilisation, d'où certains
compromis.
L'AOT40 (1), mesuré en ppb, a été développé et adopté au niveau européen dans les
années 90’s (Fuhrer et al., 1997). Il correspond à l'exposition cumulée au delà d'une
concentration limite de 40 ppb chaque jour (éclairements  50 W.m-2) pendant la période de
végétation. Il permet actuellement de définir des seuils critiques à ne pas dépasser. De mai à
juillet, c'est l'indicateur d'exposition des cultures et d'avril à septembre, c'est l'indicateur
d'exposition des forêts. Le SUM00 et le SUM60 (Sum of hourly ozone concentrations
equaling or exceeding 0 and 60 ppb) sont aussi employés et correspondent à l'exposition
cumulée sans ou au delà d'une concentration limite de 60 ppb.
(1)
L'AFstY (Accumulated Stomatal Flux above a threshold of Y nmol m-2 s-1) ou le PODY
(Phytotoxic Ozone Dose above a threshold flux of Y nmol m−2 s−1) (2), accepté en 2005 lors
de la convention de Genève sur la pollution atmosphérique transfrontalière, sont plus
représentatifs de l'impact de l'ozone sur la végétation car, étant basés sur le modèle de
conductance stomatique multiplicatif de Jarvis (Jarvis, 1976), ils prennent en compte les
conditions climatiques (influence de la température, du déficit de pression de vapeur d'eau
(VPD), de la lumière, du potentiel hydrique du sol, de la concentration en ozone) et la
phénologie des plantes. Ils simulent l'entrée d'ozone dans les feuilles et représentent le flux
moyen horaire accumulé au-dessus d'un seuil Y par surface de feuille pendant la période de
croissance de la plante.
18
Figure 27 : Absorption d'ozone et effets biologiques (Tausz et al., 2007)
Objectifs de recherche
(2)
Fst représentant les flux d’ozone stomatique (nmol m−2 s−1)
En présence d'ozone, les plantes disposent de deux moyens de résistance : la régulation
de la conductance stomatique pour limiter l'entrée d'ozone dans les feuilles et un système de
détoxication complexe pour éliminer l'ozone et les ROS formés. L'évaluation des seuils de
risque à l'ozone doit prendre en compte les différentes barrières et défenses des végétaux, et
ne pas seulement tenir compte des concentrations en ozone extérieures (Karlsson et al., 2007).
Il reste maintenant à prendre en compte les aspects de détoxication des feuilles, en plus des
flux entrants d'ozone, afin d’expliquer la variabilité inter et intra spécifique due à ces deux
facteurs.
2. FLUX EFFECTIF D'OZONE
On peut utiliser la notion de "flux effectif d'ozone", balance entre les flux stomatiques
et l'intensité de la détoxication cellulaire (Musselman et al., 2006). Une chaîne de 3 ou 4
évènements est décrite suivant les auteurs (Dizengremel et al., 2009; Tausz et al., 2007)
(Figure 27):

concentration du polluant dans l'atmosphère (conditions environnementales).

dépôt de l'ozone sur les surfaces (sols, feuilles) (exposition).

degré d'intrusion de l'ozone dans les feuilles à travers les stomates (absorption).

niveau d'antioxydants en réponse à la pression oxydative (effets biologiques).
L’AFstY et le PODY prennent en compte la régulation des flux par la conductance
stomatique en se basant sur le modèle multiplicatif de Jarvis. Or, ce modèle ne prend pas en
compte l’impact direct de l’ozone sur ses différentes fonctions. Afin de calculer finement les
flux effectifs d’ozone, il convient donc d’améliorer le calcul de la conductance stomatique
pour prendre en compte l’impact direct de l’ozone sur la régulation des mouvements
stomatiques aux différents paramètres environnementaux et de définir l’intensité de
détoxication cellulaire.
19
Objectifs de recherche
II.
OBJECTIFS
Cette thèse a pour but d’indiquer des pistes pour améliorer les seuils de risque à
l’ozone. Mon travail comporte deux volets complémentaires visant d’une part à améliorer
l’aspect détoxication à inclure dans les seuils de risques à l’ozone, et d’autre part, à prendre en
compte dans les calculs de conductance stomatique l’impact de l’ozone sur la régulation
stomatique. L’utilisation de trois génotypes de peupliers nous aide à comprendre les
différences intra-spécifiques et à cibler des processus ou métabolites clés impliqués dans la
sensibilité à l’ozone. Un suivi de traits écophysiologiques tels que le diamètre, la hauteur, les
biomasses, le nombre de feuilles tombées, la conductance stomatique… nous permet de relier
les autres résultats à une sensibilité à l’ozone.
Pour comprendre l’importance des processus de détoxication, des analyses
métabolomiques (analyse de l’ascorbate, du glutathion, des caroténoïdes, des sucres…) ont
été réalisées au niveau foliaire. Une approche génomique par PCR quantitative en temps réel,
au niveau foliaire, complète les résultats en analysant l’expression de gènes impliqués dans
les processus de détoxication. Ces résultats viennent enrichir nos connaissances pour
identifier un indicateur du niveau de détoxication, ce qui permettra in fine, de calculer des flux
effectifs. Parallèlement, afin d’améliorer le modèle de Jarvis permettant de calculer la
conductance stomatique, nous avons caractérisé l’impact de l’ozone sur la réponse de la
conductance stomatique à différents paramètres environnementaux (lumière bleue, lumière
rouge, CO2 et VPD). De plus, l’expression de gènes impliqués dans la régulation des
mouvements stomatiques a été étudiée par qPCR sur des échantillons de stomates
microdisséqués
pour
comprendre
les
mécanismes
impactés
par
l’ozone.
20
MATERIEL ET METHODES
21
Tableau 4: Caractéristiques des 6 sections du genre Populus
Section
Bourgeon
Feuille
Jaune non
collant
Unicolore.
Dentelée
Brun peu
collant
Bicolore.
Crénelée
Leuce or
Populus
Eurasie,
Afrique
du Nord
et
Amérique
du Nord
alba
guzmanantlensis
monticola
simaroa
adenopoda
gamblei
grandidentata
sieboldii
tremula
tremuloides
Brun un
peu
collant
Bicolore.
Crénelée,
lobée ou
lobulée
Aigeiros
Eurasie et
Amérique
du Nord
deltoides
fremontii
nigra
RougeBrun
collant
Eurasie
Est, et
Amérique
du Nord
augustifolia
balsamifera
cathayana
ciliata
koreana
laurifolia
maximowiczli
simonii
suaveolens
szechuanica
trichocarpa
yunnanensis
Rouge,
Brun
collant
Turanga
Leucoides
Tacamahaca
Abaso
Aire
d’origine
Eurasie
Est et
Afrique
Nord
Eurasie
Est et
Amérique
du Nord
Mexique
Principales
espèces
euphratica
ilicifolia
pruniosa
glauca
heterophylla
lasiocarpa
mexicana
Uni ou
bicolore.
Deltoïde ou
rhomboïdale
Crénelée.
Oblongue à
ovale
Rameau
Critères de différentiation
Bractée Ecorce
florale
Port
habitat
Etroite
non
ciliée
Crevassée
Seconde
grandeur
déjeté
Zone aride,
supporte la
salinité
Circulaire
Large
non
ciliée
Crevassée
Houppier
ample
Feuillage
brillant
Ornemental
en Europe
Circulaire
Large
Ciliée
Lisse et
claire
Crevassée
au pied
Grand
développement
Peupliers
forestiers
Circulaire
ou un peu
anguleux
Large
non
ciliée
Rugueuse
Sillonnée
longitudinalement
Pyramidale
port assez
étroit,
verticillé
Ligniculture
Prairie
Hors forêt
anguleux
Large
non
ciliée
Lisse
puis légèrement
fissurée
Pyramidale
port large,
verticillé
Ligniculture
Prairies et
forêts dans
son aire
d’origine
Forêt
tropicale,
Ornemental
au Mexique
Matériel et Méthodes
I.
MATERIEL VEGETAL
1. GENERALITES SUR LE PEUPLIER
L'étude a été réalisée sur le peuplier, arbre modèle depuis 2002, grâce entre autre à sa
croissance rapide et à son génome de taille modeste déjà séquencé (Brunner et al., 2004;
Renaut et al., 2009). Il fait partie de la famille des salicacées (angiospermes dicotylédones) et
est originaire de la zone tempérée de l’hémisphère nord. Le genre Populus comprend une
trentaine d’espèces ainsi que de nombreux hydrides naturels ou créés par l’homme, classées
en 6 sections botaniques (Abaso, Aigeiros, Leucoides, Populus, Tacamahaca et Turanga) sur
la base de critères écologiques et morphologiques (Eckenwalder J. E., 1996; Dickmann et
Kuzovkina, 2008) (Tableau 4). En France, trois espèces pures sont naturellement présentes, le
peuplier noir (P. nigra), le peuplier tremble (P. tremula. L.) et le peuplier blanc (P. alba).
Le peuplier tient une place importante pour la foresterie française avec environ
200 000 ha de peupleraie (Tableau 5) et une production d’environ 1 400 000 m3 de grumes de
peuplier (Tableau 6). L’importance de la populiculture s’explique par la croissance rapide de
l’essence (récolte en 15-20 ans) et par la propriété polyvalente du bois permettant son emploi
dans des débouchés variés. Parmi ces utilisations on compte notamment les filières suivantes :

Le déroulage : boîtes d’allumettes, emballages, panneaux contreplaqués…

Le sciage : voligeage sous toitures, palettes, literie…

Les panneaux dérivés : fibres, agglomérés…

La pâte à papier

Le bois-énergie (taillis à courte rotation ou à très courte rotation, TCR/TTCR)

La construction
C'est aussi une essence de pleine lumière, très exigeante en eau et en éléments
nutritifs. On le retrouve donc fréquemment en ripisylves et en fond de vallon. Afin d’avoir la
meilleure production possible, différents cultivars (variétés obtenues en culture) sont utilisés
en fonction des stations (sol + climat), de son comportement face aux maladies et au vent, de
sa facilité de conduite, de ses qualités de bois. La majorité des plantations françaises sont
22
Tableau 5 : Les surfaces (en ha) de peuplier de production de bois, en France et par région.
Peupleraies en plein
Peupleraies en plein
Source
Source
SCEES Teruti Lucas 2006 Cadastre 2003
Alsace
2 000
2 176
Aquitaine
17 200
24 974
Auvergne
1 400
3 329
Basse Normandie
4 700
4 586
Bourgogne
11 900
14 442
Bretagne
6 100
8 235
Centre
22 600
22 814
Champagne-Ardenne
21 100
26 864
Corse
0
0
Franche-Comté
2 900
4 134
Haute Normandie
1 600
1 890
Ile de France
2 400
9 576
Languedoc-Roussillon
900
1 143
Limousin
900
329
Lorraine
3 600
3 540
Midi-Pyrénées
12 500
14 824
Nord Pas de Calais
9 000
12 863
Pays de la Loire
18 900
22 147
Picardie
23 900
32 108
Poitou-Charentes
13 000
12 177
Provence Alpes Côte d'azur 900
418
Rhône-Alpes
7 700
10 836
Total
185 100
233 406
Régions
Tableau 6: Récolte annuelle de grumes de peupliers (m3)
Année Déroulage
1988 1.271.267
1989 1.459.434
1990 1.543.139
1991 1.514.798
1992 1.331.655
1993 1.254.010
1994 1.381.740
1995 1.334.250
1996 1.246.355
1997 1.267.212
1998 1.239.646
1999 1.196.186
2000 1.125.856
2001 1.086.718
2002
943.446
2003
902.922
2004
872.668
2005
847.124
2006
862.145
2007
993.568
2008
914.245
2009
885.706
Sciage
1.594.960
1.798.902
1.865.680
1.722.431
1.525.557
1.223.380
1.216.459
1.225.594
1.075.937
1.059.475
991.653
966.518
821.908
710.237
536.793
528.433
443.402
478.151
531.006
581.716
508.278
407.043
Total
2.866.227
3.258.336
3.408.819
3.237.229
2.857.212
2.477.390
2.598.199
2.559.844
2.322.292
2.326.687
2.221.299
2.162.704
1.947.764
1.796.955
1.480.239
1.431.355
1.316.070
1.325.275
1.393.151
1.575.284
1.422.523
1.292.749
Figure 28 : Plantation des boutures de peuplier
Figure 29 : Début de l'acclimatation en phytotrons des
peupliers âgés de 5 semaines
Matériel et Méthodes
constituées de cultivars issus de croisements entre deux espèces nord-américaines (P.
deltoides x P. trichocarpa, peuplier interaméricain) ou une espèce nord-américaine et une
espèce eurasiatique (P. deltoides x P. nigra, peuplier euraméricain).
2. GENOTYPES UTILISES
Trois génotypes euraméricains (Populus deltoides x Populus nigra), Carpaccio, Cima
et Robusta ont été sélectionnés dans l’équipe par des expériences antérieures pour leurs
réponses contrastées à l'ozone (nécroses, chute de feuilles, conductance stomatique, activité
PEPC, croissance...). Carpaccio apparait comme le génotype le plus tolérant, suivi de Cima,
puis de Robusta qui est le génotype le plus sensible. Ce choix permet une meilleure
compréhension des différents mécanismes utilisés en réponse à l'ozone et d'approcher les
différences intra-spécifiques.
3. CONDITIONS DE CULTURE
Pour chaque expérience de fumigation, le matériel végétal a été cultivé dans les
mêmes conditions. Les boutures de peuplier (issues de la pépinière forestière de GuéménéPenfao) ont été plantées dans des pots de 5 L remplis de terreau (N/P/K 14/16/18, 1.2 kg.m–3,
Gramoflor SP1 Universel) 6 semaines avant le début de la fumigation d’ozone (Figure 28).
Au fond des pots, 1 à 2 cm de billes d'argile de diamètre 8/16 permet d’améliorer le drainage
de l’eau. De plus, 10 mg de nutricote T-100 (Nutricote T-100, N/P/K/MgO 13/13/13/2, Fertil,
Boulogne-Billancourt, France) ont été ajoutés pour fertiliser le milieu ce qui correspond à une
dose finale de 20 mg/pot. Enfin, pour tamponner le pH, 1 mg.l-1 de calcaire magnésium a été
utilisé. Dans la chambre de culture, la température et l’humidité relative ont été maintenues à
23°C/75% le jour et 20°C/85% la nuit avec une photopériode de 14 h (8 h-22 h). Les arbres
ont été irrigués manuellement tous les jours. Avant le transfert en phytotrons, 5 semaines
après la plantation des boutures, une tige unique a été gardée, ils atteignaient alors entre 60 et
80 cm de hauteur (Figure 29). La fumigation a débuté après une semaine d’acclimatation dans
les phytotrons.
4. PRELEVEMENT
Durant les périodes de fumigation, des prélèvements de feuilles ont été effectués,
toujours à 15 h, pour le dosage des métabolites et l’étude de l’expression des gènes. Pour
23
Figure 30 : Restant d'une feuille de peuplier après les prélèvements pour la microscopie électronique
Figure 31 : Les Chambres phytotroniques
(UMR1137, UL)
Figure
32
: Présentation d’une chambre
phytotronique contenant 6 peupliers
Matériel et Méthodes
réaliser ces prélèvements dans des conditions optimales, toutes les feuilles à prélever ont été
identifiées avec de la ficelle dès la mise en phytotrons. Il s’agissait des deux premières
feuilles matures en partant du haut (10ème et 11ème feuille). La nervure principale a été
découpée aux ciseaux et les feuilles prélevées ont été immédiatement plongées dans des
pochettes d’aluminium identifiées, et congelées dans de l’azote liquide. Une partie des
échantillons, dédiée aux analyses métabolomiques (sauf ascorbate et glutathion) et à la microdissection laser, a été lyophilisée à -40°C pendant 40 h à une pression de 10 Pa dans un
lyophilisateur FreeZone Plus freeze-dryer (Labconco, Kansas City, Missouri), puis la
température a été remontée progressivement à 20°C en 10 h. Les autres échantillons ont été
broyés dans l'azote liquide avant analyse.
Les échantillons utilisés pour la microscopie électronique ont été prélevés
différemment (Figure 30). Un emporte-pièce nous a servi à prélever le matériel nécessaire à
nos observations et analyses au microscope électronique à balayage (MEB) avant de le
déposer dans un cryotube plongé immédiatement dans de l’azote liquide. Pour les échantillons
dédiés à l’observation au microscope électronique à transmission (MET), un petit carré de
1 cm² a été découpé à la lame de rasoir et plongé dans un tube Eppendorf contenant du
fixateur (voir Analyse ultrastructurale des cellules de garde (Microscopie Electronique à
Transmission) pour la composition du fixateur).
II.
FUMIGATION A L’OZONE
Les résultats présents dans cette thèse sont issus de mesures et de l’analyse
d’échantillons prélevés au cours de deux expériences de fumigation distinctes.
1. PLAN D’EXPERIENCE
Lors de chacune des expérimentations de fumigation, 8 chambres ont été utilisées : 4
chambres 'témoin' et 4 chambres avec 120 ppb d'ozone (Figure 31). Lors de la première
expérience, nous avons disposé 15 arbres par chambre, 5 de chaque génotype, puis nous
avons sacrifié un arbre de chaque génotype dans chaque chambre, après 2 et 4 jours de
fumigation, pour des mesures de biomasse, ne laissant à la fin que 9 arbres par chambre. Lors
de la seconde expérience, nous n’avions mis que 6 arbres par chambre (Figure 32).
L’expérience a été réalisée sur Carpaccio et Cima dans un premier temps, puis elle a été
dupliquée sur Robusta.
24
Figure 33 : Exemple de racines de peuplier après lavage, prêtes pour le séchage
Matériel et Méthodes
2. CONDITIONS ENVIRONNEMENTALES
Les conditions environnementales dans les phytotrons sont similaires pour les deux
expérimentations de fumigation afin de faciliter la synthèse des résultats. Pour les 4 chambres
'témoin', l’air est filtré à travers du charbon actif, tandis que pour les 4 chambres du traitement
ozone, 120 ppb d’ozone ont été injectés de 9h à 22 h, directement dans l’air entrant dans les
chambres. L’ozone a été produit à partir d’O2 par deux générateurs d’ozone (OZ500; Fischer,
Bonn, Germany and CMG3-3; Innovatec II, Rheinbach, Germany). Les concentrations en
ozone de chaque chambre ont été enregistrées sur ordinateur par un système automatique lié à
un analyseur (O341M; Environnement S.A., Paris, France). La photopériode durait de 8 h à
22 h avec 5 lampes par chambre, le taux d’humidité relative était maintenu à 85% la nuit et à
75% le jour et la température était stabilisée à 20°C la nuit et 23°C le jour.
III.
SUIVI DE CROISSANCE, BIOMASSES ET CHLOROPHYLLES
1. MESURES DE HAUTEUR , DE DIAMETRE ET CHUTES DE FEUILLES
Afin de réaliser un suivi de croissance, des mesures de hauteur et de diamètre à la base
de la tige, ainsi que le décompte du nombre de feuilles et du nombre de feuilles tombées, ont
été réalisées sur tous les arbres deux fois par semaine, à l’aide d’un mètre et d’un pied à
coulisse.
2. MESURES DE BIOMASSES
Ces mesures permettent d’évaluer la croissance des plants et d’identifier s’il y eu une
modification de l’allocation des ressources carbonées vers les parties aériennes ou
souterraines.
Les arbres ont été découpés et les parties aériennes et souterraines ont été isolées. Les
feuilles et les tiges ont été séparées dans des pochettes de papier avant d’être mises à sécher
dans une étuve à 60°C jusqu’à stabilisation du poids, tandis que les racines ont nécessité
préalablement au séchage, un lavage à l’eau afin de retirer toute la terre (Figure 33).
25
Figure 34: Schéma de principe du poromètre (issu du manuel d'utilisation)
Matériel et Méthodes
3. MESURES DU CONTENU EN CHLOROPHYLLES
P RINCIPE DE L ’APPAREIL
Les mesures en chlorophylles sont importantes car elles sont directement liées aux
capacités photosynthétiques de la plante. Les mesures rapides au chlorophylle-mètre CCM200 ont l’avantage de ne pas être destructives. L’absorbance optique est mesurée à deux
longueurs d’onde différentes pour tenir compte de la transmission de la chlorophylle et de
l’épaisseur de la feuille : 653 nm (chlorophylle) et 931 nm (près des infrarouges).
U TILISATION
Le contenu en chlorophylle de la première feuille mature a été suivi 2 fois par semaine
grâce à un chlorophylle-mètre CCM-200 (Opti-Sciences, Hudson, NH, USA). Les valeurs
obtenues (Chlorophyll Content Index, CCI) ont ensuite été converties en g.m-2 grâce à la
relation suivante (Bagard et al., 2008; Wellburn, 1994):
(1)
IV.
MESURES DES ECHANGES GAZEUX
1. CONDUCTANCE STOMATIQUE A LA VAPEUR D ’EAU
(POROMETRE SC1)
P RINCIPE DE L ’APPAREIL
Le poromètre permet de mesurer la conductance stomatique des feuilles sur chacune
des faces séparément. Pour réaliser ces mesures, la conductance de la feuille est mise en série
avec deux éléments de conductance connue (Figure 34). La différence d’humidité mesurée
entre les éléments permet d’obtenir le flux de vapeur d’eau. La conductance stomatique peut
ensuite être calculée en se basant sur les hypothèses suivantes :

l’humidité relative dans la feuille est égale à 1
26
Figure 35 : Mesure de la conductance stomatique sur la face adaxiale de la feuille réalisée à l'aide du
poromètre SC1
Figure 36: Schéma de fonctionnement de l’appareil Li-6200.
Matériel et Méthodes

toutes les valeurs de conductance sont en série, le flux est donc constant entre
deux points

la température de la feuille est égale à la température du premier capteur
d’humidité
La conductance peut donc être exprimée comme une fonction des distances entre les
capteurs d’humidité, de la température et des deux mesures d’humidité relative (2).
(2)
avec la densité molaire de l’air, Dvapor la diffusivité de la vapeur d’eau, hr l’humidité relative, es(Ta)
la pression de vapeur saturée à température ambiante, d1 la distance entre la feuille et le premier capteur et d2
la distance entre les deux capteurs.
U TILISATION
Lors de la seconde expérience de fumigation, un suivi de la conductance stomatique
sur la face abaxiale et adaxiale de la première feuille mature de tous les arbres a été réalisé 3
fois par semaine, deux heures après le début de la photopériode, à l’aide d’un poromètre SC-1
(Decagon Devices, Pullman, USA) (Figure 35).
2. ASSIMILATION NETTE DE CO2 ET CONDUCTANCE STOMATIQUE
A LA VAPEUR D ’EAU (LI-6200)
P RINCIPE DE L ’APPAREIL
L’appareil Li-6200 est un système fermé portable de mesure de photosynthèse
permettant de réaliser des mesures d’échanges gazeux (pas de distinction des faces). La feuille
est placée dans une chambre laissant passer la lumière, dans laquelle sont mesurées la
température de l’air et de la feuille, et l’humidité relative. Une pompe aspire l’air de la
chambre pour le faire passer par un analyseur de CO2, avant d’être réinjecté dans la chambre
(Figure 36).
27
Figure 37 : Mesures réalisées à l'aide de l'appareil de mesure d'échanges gazeux Licor 6200
Matériel et Méthodes
Lorsque la feuille respire, elle dégage du CO2 et lorsqu’elle photosynthétise, elle
consomme du CO2. L’échange de CO2 entre la feuille et l’atmosphère est calculé en mesurant
le changement de concentration de CO2 dans la chambre fermée contenant la feuille, dans un
intervalle de temps court (30 s). L’assimilation nette de CO2 est alors calculée en utilisant le
taux de changement de CO2 mesuré et d’autres facteurs, comme la surface de feuille
enfermée, le volume de la chambre, la température et la pression atmosphérique.
Lorsque les stomates sont ouverts, la plante transpire entraînant une hausse de
l’humidité de l’air dans le circuit fermé. L’utilisation de dessicant (perchlorate de magnésium)
permet de maintenir une humidité constante (+/- 5%). Le taux de transpiration est calculé par
le changement d’humidité dans le temps en tenant compte du flux d’air sec traversant le
dessicant. Le taux de transpiration est alors utilisé avec la température de l’air et de la feuille
et la conductance de couche limite connue dans la chambre, pour calculer la conductance
stomatique grâce à la formule (3)
(3)
avec E la transpiration nette, Tl la température de feuille, e la pression de vapeur dans la
chambre, gsw la conductance à la vapeur d’eau, gbwo la conductance de couche limite d’une
face, es<> la fonction de pression de vapeur saturante, K le ratio stomatique, P la pression.
U TILISATION
Lors de chacune des deux expériences, un suivi de la conductance stomatique à la
vapeur d’eau (gw) et de l’assimilation nette de CO2 (face adaxiale et abaxiale confondue) a été
réalisé avec le système de mesure d’échanges gazeux foliaires Li-6200 (LI-COR®Inc,
Lincoln, NE, USA) (Figure 37), 3 fois par semaine, deux heures après le début de la
photopériode. En combinaison avec le suivi horaire des concentrations en ozone dans chaque
chambre, nous avons pu calculer l’AOT40 (4), le PODY (5) et le CUO (6). L’AOT40
(Accumulated Ozone over a threshold of 40 ppb) correspond à l'exposition horaire cumulée
au delà d'une concentration limite de 40 ppb. Le CUO (Cumulative Uptake of Ozone) et le
PODY (Phytotoxique Ozone Dose over a threshold of Y nmol.m-2.s-1) correspondent aux flux
d’ozone horaires (Fst) (7) cumulés, de l’atmosphère à travers les stomates, au-delà ou non
28
Figure 38: Schéma de fonctionnement de l’appareil Li-6400
Matériel et Méthodes
d’un seuil de Y nmol.m-2.s-1. Comme recommandé par Fagerli et al. (2011), nous avons utilisé
un seuil de 1 nmol.m-2.s-1.
(4)
(5)
(6)
(7)
avec n le nombre d’heures, ∆t = 1h et Y = 1 nmol.m-2.s-1
Comme les conditions environnementales dans les phytotrons étaient stables, nous
avons appliqué pour nos calculs de flux une conductance stomatique constante au cours de la
journée. De plus, les valeurs de conductance stomatique des jours sans mesure ont été
évaluées à partir des jours adjacents (Bagard et al., 2008). Même si nous ne prenons pas en
compte une éventuelle baisse de conductance au cours de la photopériode, nous appliquons le
même principe pour tous les arbres.
3. ASSIMILATION NETTE DE CO2 ET CONDUCTANCE STOMATIQUE
A LA VAPEUR D ’EAU (LI-6400)
P RINCIPE DE L ’APPAREIL
L’appareil Li-6400 est un système ouvert portable de mesure de photosynthèse
permettant de réaliser des mesures d’échanges gazeux (pas de distinction des faces). La feuille
est placée dans une chambre dont les conditions lumineuses (intensité et qualité) sont
contrôlées et dans laquelle l’air est renouvelé (circuit ouvert) (Figure 38). Les paramètres
environnementaux sont contrôlés (température, VPD, CO2, lumière). Les concentrations en
H2O et CO2, le rayonnement quantique, la température de bloc, de l’air et de la feuille, le débit
d’air et la pression sont mesurés de manière simultanée à l’aide de toute une série de capteurs
majoritairement groupés au niveau de la chambre de mesure : un IRGA (analyseur de gaz à
infrarouge) pour les concentrations d’H2O et de CO2, un capteur Quantum sensor Li 190 pour
la lumière extérieure, un capteur GaAsP pour la lumière à l’intérieur de la chambre, une
thermistance pour la température de bloc et d’air, un thermocouple pour la température de
feuille, un capteur de flux pour le débit d’air (dans la console) et un capteur de pression (dans
29
Figure 39: Paramètres mesurés utilisés dans le calcul de la transpiration et de la conductance
stomatique
E transpiration nette, a assimilation, ue et uo flux nets entrant et sortant, we et wo concentrations en eau
entrante et sortante, ce et co concentration en CO2 entrante et sortante.
Figure 40 : Mesures réalisées à l'aide de l'appareil de mesure d'échanges gazeux Licor 6400
Matériel et Méthodes
la console). La transpiration et la conductance stomatique sont ensuite calculées selon (8) et
(9) en se basant sur des mesures faites sur un circuit de référence (air similaire à l’entrée de la
chambre) en comparaison avec la sortie de la chambre (Figure 39).
(8)
(9)
avec E la transpiration nette, ue le flux net, wo et we les concentrations en eau entrante et
sortante, s la surface, gsw la conductance à la vapeur d’eau, gtw la conductance totale de la
feuille (calculée à partir de la pression de vapeur saturante à la température de la feuille et
de l’air, la pression atmosphérique, et la transpiration), gbw la conductance de couche limite
et kf facteur déduit du ratio stomatique.
U TILISATION
Lors de la première expérience de fumigation, des mesures de conductance stomatique
à la vapeur d’eau et de photosynthèse (Asat) en condition de lumière saturante (1200 µmol m2
s-1 de lumière (dont environ 10% de bleu et 90% de rouge), température foliaire à 25°C,
concentration en CO2 à 400 µmol.mol-1, VPD à 0.9 kPa) ont été réalisées avec l’appareil de
mesure d’échanges gazeux Li-6400 (LI-COR®Inc, Lincoln, NE, USA) aux temps t0, t14 et
t18 (en jour), sur 1 arbre de chaque génotype dans chaque chambre (Figure 40).
Lors de la seconde expérience de fumigation, des mesures de conductance stomatique
à la vapeur d’eau et de photosynthèse ont été réalisées à l’aide de 3 appareils Li-6400 (LICOR®Inc, Lincoln, NE, USA) intercalibrés (Figure 41). Les mesures ont été réalisées sur 3
arbres par génotypes dédiés à ces mesures. Après avoir clampé la feuille, nous avons attendu
la stabilisation de la conductance (gs0), puis nous avons fait varier un seul paramètre
environnemental, avant d’attendre qu’elle se stabilise de nouveau (gs1). Nous avons ensuite
calculé la vitesse de réponse (v) (10) grâce au temps nécessaire à la stabilisation de la
conductance stomatique après variation d’un paramètre (t) (Figure 42).
(10)
30
Entrée d’air
Volume tampon (1)
Homogénéiser l’air afin de
minimiser les variations de
CO2 et de température
Piège à CO2 (2)
Bonbonne d’eau (3)
Sature l’air en eau
Appareil de
mesure
d’échanges
gazeux de type
Licor-6400 (5)
Le système de piège à
eau (4)
Modifie la température à
l’aide d’éléments Peltier
pour condenser l’eau
Figure 41 : Schéma du dispositif de mesure avec 3 appareils Li-6400 intercalibrés
A
B
∆g
s
gs0
t
Temps (s)
gs0
gs (mmol.m-2.s-1)
gs (mmol.m-2.s-1)
gs1
∆g
s
t
gs1
Temps (s)
Figure 42 : Exemple de réponses de la conductance stomatique A) à une augmentation de lumière
bleue et B) à une augmentation de VPD
Tableau 7 : Conditions environnementales avant et après variation d'un des paramètres à l'intérieur
de la chambre de mesure de l’appareil Li-6400
Paramètres
environnementaux
\Paramètre
testé
Lumière
bleue
CO2
(mol CO2. mol-1)
Initial
400 ± 2.0
400 ± 3.0
100 ± 1.0
400 ± 3.0
Final
400 ± 2.0
400 ± 3.0
100 ± 1.0
1200 ± 3.0
Initial
25 ± 0.3
25 ± 0.3
25 ± 0.3
25 ± 0.4
Final
25 ± 0.3
25 ± 0.3
25 ± 0.3
25 ± 0.4
Température (°C)
Lumière
rouge
VPD
CO2
Lumière
rouge/bleue
(mol.m-2.s-1)
Initial
0/0
200/30 ± 5.0
0/0
800/30 ± 5.0
Final
0/30 ± 1
800/30 ± 5.0
0/0
800/30 ± 5.0
VPD
(kPa)
Initial
0.8 ± 0.2
0.8 ± 0.2
Final
0.8 ± 0.2
0.8 ± 0.2
Figure 43 : Plateau robotisé de phénotypage enzymatique à haut débit
0.8 ± 0.2
3.0 ± 0.3
0.8 ± 0.2
0.8 ± 0.2
Matériel et Méthodes
Chaque semaine, nous avons mesuré la réponse de la conductance stomatique et de la
photosynthèse à une variation de lumière bleue, de lumière rouge, de concentration en CO 2 et
de VPD, dans les conditions résumées dans le Tableau 7. Afin de s’affranchir des effets dus à
la photosynthèse, la réponse à la lumière bleue a été mesurée dans l’obscurité, tout comme la
réponse au VPD afin de permettre une fermeture des stomates plus rapide. Les mesures
réalisées à l’obscurité étaient faite le matin pour que les arbres ne soient pas mis en présence
de lumière avant la mesure, et les autres mesures étaient faites l’après-midi.
V.
ANALYSES METABOLOMIQUES
1. PRINCIPES DES ANALYSES
Le COST Action FP0903 a financé une mission scientifique de 3 mois, me permettant
de partir dans le laboratoire du Pr Elina Oksanen (University of Eastern Finland) à Joensuu,
afin de procéder à des analyses métabolomiques sur les échantillons de feuilles entières. J’ai
dosé les composés phénoliques, les caroténoïdes et les chlorophylles, qui jouent un rôle dans
les processus de détoxication, ainsi que les acides aminés et les sucres, afin de voir si le
métabolisme carboné est modifié par l’ozone. Les analyses ont été réalisées à l’aide d’une
chromatographie en phase liquide à haute performance (HPLC) et d’une chromatographie en
phase gazeuse (GC) couplées à différents types de détecteurs. Ces outils de séparation
analytique permettent de séparer les métabolites injectés dans la phase mobile (liquide ou
gazeuse) en les faisant passer dans une phase stationnaire, en fonction de leurs propriétés
chimiques et donc de leur affinité avec la phase stationnaire.
De plus, dans le cadre d'une collaboration avec le Plateau enzymatique de la
plateforme Métabolome - Fluxome de l'INRA de Bordeaux sous la direction d'Yves Gibon,
les formes réduite et oxydée de l'ascorbate et du glutathion ont été dosées en microplaques
préparées à l’aide d’un robot de pipetage (Figure 43). Ces mesures spectrométriques se basent
sur le suivi spectrométrique d’un composé coloré, qui apparait ou disparait en fonction d’une
activité chimique dépendante de l’élément à mesurer.
2. ASCORBATE ET GLUTATHION
L’ascorbate et le glutathion ont été extraits à partir de 20 mg de poudre de feuille dans
400 µL d'acide métaphosphorique 5% à 4°C (Protocole détaillé en annexe 1). L’homogénat a
31
Matériel et Méthodes
ensuite été centrifugé à 4°C pendant 10 min à 14000 g. L’ascorbate et le déhydroascorbate ont
été mesurés à l’aide de la méthode décrite par Kampfenkel et al. (1995), adaptée à l’utilisation
d’un robot de pipetage par le remplacement de l’acide trichloracétique par de l’acide
métaphosphorique à 5%. La méthode est basée sur la réduction du Fe(III) en Fe(II) par l'ASA,
et la réaction ultérieure des produits Fe(II) avec le 2,2 bipyridyl, pour former un complexe
coloré dont on suit l'apparition à 550 nm. Pour doser l'ascorbate total, un traitement préalable
avec l'agent réducteur Dithiothreitol (DTT) est nécessaire afin de réduire l’ascorbate oxydé.
Pour le dosage du glutathion, nous avons suivi à 405 nm la réduction glutathion réductasedépendante du 5,5'-dithiobis(2-nitro benzoic acid), avec ou sans prétraitement avec du 2vinylpyridine (VPD), qui vient neutraliser la forme réduite du glutathion pour ne doser que la
forme oxydée, selon la méthode décrite par Griffith (1980).
3. CAROTENOÏDES
Toutes les étapes, de l’extraction à l’analyse des échantillons, ont été réalisées en
maintenant les échantillons à 4°C à l’obscurité, les caroténoïdes étant photosensibles
(Protocole détaillé en annexe 2). Les caroténoïdes et les chlorophylles ont été extraits à partir
de 10 mg de poudre de feuille lyophilisée dans 1 mL de méthanol, puis 1 mL d'hexane,
contenant chacun 0.01% de butylhydroxytoluène (BHT). Les surnageants ont ensuite été
séchés sous un flux de nitrogène par 400 µL, et redissouts dans des bouteilles opaques dans
un mélange de 600 µL de dichlorométhane (DCM), 1200 µL d’acétonitrile (ACN) et 200 µL
de méthanol (MeOH). Les analyses de chlorophylles et de caroténoïdes ont été réalisées par
chromatographie liquide à haute performance -Ionisation Chimique à Pression Atmosphérique
- Spectromètre de masse (HPLC/APCI/MS)
4. COMPOSES PHENOLIQUES
Les extractions des échantillons ont été réalisées dans du méthanol 85% avec 0.005%
de butylated hydroxytoluène (BHT) (Protocole détaillé en annexe 3). Durant l’extraction,
200 µL de solution de standard interne (la solution est faite à partir de 2 mL d’acide benzoicd5 à 1 mg/mL dans un mélange 1:1 MeOH:H2O, 2 mL de D-glucose-C13 à 1 mg/mL dans un
mélange 1:1 MeOH:H2O, 1 mL de biochanin A à 1 mg/mL dans du méthanol 100%, 600 µL
de glycérol-d8 à 2.8 mg/mL dans un mélange 1:1 MeOH:H2O et 1 mL d’alanine-d3 à
0.1 mg/mL dans un mélange 1:1 MeOH:H2O) sont ajoutés. Les surnageants sont divisés en
aliquots dédiés à différentes analyses. Un aliquot de 500 µL est séché et redilué dans 250 µL
32
Matériel et Méthodes
de MeOH et 250 µl d’eau pour ensuite servir aux analyses de composés phénoliques. Nous
avons analysé les composés phénoliques par chromatographie liquide haute performance
(HPLC) avec ionisation par électronébulisation (ESI) équipé de détecteurs Photo Diode Array
(Finnigan Surveyor PDA Detector), Corona Ultra à aérosol chargé (Esa Corona Ultra), et
spectromètre de masse.
5. ACIDES AMINES
L’extraction des échantillons pour l’analyse des acides aminés est la même que pour
les composés phénoliques (Protocole détaillé en annexe 3). Le même jour, un aliquot de
100 µL d’extrait a été préparé avec le kit EZ:FAAST (Phenomenex). Les prescriptions du
fournisseur ont été suivies avec un ajustement du volume de réactif 1 à 50 µL au lieu de
100 µL. La procédure consiste en une extraction en phase solide, suivie d’une dérivatisation et
d’une extraction liquide/liquide. L’analyse a été réalisée par chromatographie liquide haute
performance, couplée à un spectromètre de masse (MS Finnigan LTQ detector) (HPLC/MS).
6. SUCRES
L’extraction des échantillons est la même que pour les composés phénoliques
(Protocole détaillé en annexe 3). Un aliquot de 150 µL est complètement séché et stocké à 70°C, pour ensuite servir aux analyses des sucres. Les flacons, une fois sortis du congélateur,
doivent rester 1h à température ambiante avant ouverture. Une solution de standard C8-C20
alcane est ajoutée (80 µL) et aussitôt évaporée. Pour la dérivatisation, nous ajoutons 80 µL de
MAHC (20 mg/mL de méthoxyamine hydrochoride dans de la pyridine) et laissons 90 min à
37°C. Une autre étape de dérivatisation suit dans 80 µL de MSTFA (N-méthyle-N(trimethylsilyl) trifluoro-acétamide), pendant 1 h à 37°C. Les échantillons sont ensuite
transférés dans des inserts pour procéder à l’analyse. Les sucres, les alcools de sucres, les
polyols et les acides phénoliques ont pu être analysés par chromatographie en phase gazeuse
(Agilent Technologies 6890N Network GC system) couplée à un spectromètre de masse
(Agilent 5973 Network détecteur sélectif de masse) (GC/MS) avec une injection à débit
divisé.
33
Figure 44 : Principe de la technique de RT-qPCR (méthode au fluorochrome SYBR Green). Dans
une première étape, les ARN totaux (trait discontinu rouge) sont rétrotranscrits en ADN
complémentaire (ADNc, trait continu noir) par une transcriptase inverse, en présence d’une amorce
spécifique antisens et d’oligos (dT). Dans une seconde étape, un petit fragment (100-200 nucléotides)
de l’ADNc (trait continu rouge) est amplifié par PCR à l’aide d’une paire d’amorces sens et antisens
spécifiques du gène à étudié, en présence de SYBR Green (étoiles grises). Ce produit devient
fortement fluorescent (étoiles roses) lorsqu’il s’intercale dans un ADN double brin. À chaque cycle de
PCR, le morceau d’ADN est amplifié et l’intensité de fluorescence est lue et enregistrée. Cela permet
de quantifier le nombre de molécules d’ADN double brin, et par comparaison avec une gamme-étalon,
d’en déduire la quantification absolue du nombre de molécules d’ADNc, et donc, d’ARN présent dans
l’échantillon inconnu. (Gerlier et al., 2007)
Matériel et Méthodes
VI.
ANALYSES TRANSCRIPTOMIQUES
1. PRINCIPES DES ANALYSES
Des analyses transcriptomiques ont été réalisées sur des échantillons de feuilles
fraîches broyées et aussi sur des stomates microdisséqués à partir de feuilles lyophilisées. Ces
deux types d’échantillons nécessitent des traitements différents. Lors d’un stress comme
l’ozone, l’expression de gènes peut être modifiée, c’est cette réponse que l’on mesure par les
analyses transcriptomiques. Dans un premier temps les transcrits des gènes sont extraits
(ARNs totaux) et ils sont rétrotranscrits en ADNc. Dans le cas des stomates microdisséqués,
une amplification des ADNc est nécessaire pour obtenir un signal suffisant. Les mesures sont
réalisées sur cet ADNc, par PCR quantitative (ou PCR en temps réel). C’est une méthode de
réactions en chaîne par polymérase, permettant d’amplifier une portion d’ADN ciblée et de
mesurer la quantité initiale d'ADN, grâce au suivi d’un marqueur fluorescent (Figure 44). Elle
nécessite de dessiner des amorces (morceaux d’ADN simple brin) complémentaires et
spécifiques de la séquence du gène à étudier.
2. ANALYSES TRANSCRIPTOMIQUES A PARTIR DE FEUILLES
BROYEES
P REPARATION DES MATRICES
L’extraction des ARNs totaux a été réalisée à partir de 100 mg de poudre de feuilles
fraîches, grâce au kit RNeasy Plant Mini (Qiagen) selon le protocole du fabricant (Protocole
détaillé en annexe 4). Un traitement à la Dnase I (Ambion) enlève l’ADN résiduel (Protocole
détaillé en annexe 5). La qualité des ARNs ainsi obtenus est vérifiée par le système de gel
d’électrophorèse automatisé Experion (Bio-Rad) (Protocole détaillé en annexe 6) et une
quantification précise est permise grâce à une mesure au Quant-iT riboGreen (Invitrogen)
(Protocole détaillé en annexe 7). La rétrotranscription a été réalisée sur 700 ng d’ARNs grâce
au kit iScript cDNA Synthesis (Bio-Rad), en contrôlant l’efficacité par l’ajout du kit Alien
QRT-PCR Inhibitor Alert (Stratagene) suivant les recommandations du fabricant (Protocole
détaillé en annexe 8).
34
Matériel et Méthodes
D ESSIN DES AMORCES
Toutes les cibles ont été identifiées dans la littérature sur Arabidopsis thaliana. Les
homologues chez le peuplier ont ensuite été déterminés grâce à l’outil de bioinformatique
phytozome V8.0 (Goodstein et al., 2012), sur la base de blast de séquences protéiques et
génomiques. Les gènes les plus proches des cibles chez le peuplier ont été étudiés. Des
amorces ont été dessinées en se basant sur la version 2 du génome de Populus trichocarpa et
sur les transcrits prédits par phytozome. Certaines règles ont été suivies pour le dessin des
amorces :

Taille des amorces égales à 20 ou 21 bases (b)

Pourcentage de (G+C) compris entre 38 et 50%

Les amorces doivent avoir le même Tm

Tm égale à 58°C ou 60°C grâce à la formule

Taille de l’amplicon (zone transcrite entre les amorces, additionnée à la taille de
chacune des amorces) comprise entre 100 et 150 pb

La séquence de l’amorce doit être au moins différente de 3 b par rapport à toute
autre séquence dans le génome

Les amorces ne doivent pas avoir plus de 4 nucléotides identiques consécutifs

Dans les 5 derniers nucléotides de l’extrémité 3’ il ne doit pas y avoir plus de 2 C
ou G

Les couples d’amorces doivent être vérifiés pour éviter la formation de dimère ou
d’épingle à cheveux, grâce aux logiciels en ligne primer3 (Untergasser et al.,
2012) et clustalw2 (Larkin et al., 2007)

Les amorces doivent être dessinées de préférence dans la seconde moitié du gène
Ont été choisis comme cibles, des gènes codant pour les enzymes de la voie de
biosynthèse du glutathion et la principale voie de biosynthèse de l’ascorbate. La spécificité
des couples d’amorces a été testée par PCR sur de l’ADNc de chacun des 3 génotypes étudiés,
35
Matériel et Méthodes
ainsi que de la référence trichocarpa, suivie d’un dépôt et migration sur gel. La spécificité a
ensuite été confirmée par séquençage de l’amplicon par l’entreprise Beckman coulter
genomic.
PCR EN TEMPS REEL ( Q PCR)
La PCR en temps réel a été réalisée par le système Mx3000P QPCR (Agilent
technologies) en suivant les recommandations du fabricant pour le programme (10 min 95°C,
40 cycles de 5 s à 95°C, et 20 s à 58 ou 60°C en fonction des amorces), suivie d’une courbe
de dissociation pour vérifier la spécificité de l’amplification. Le MIX réactionnel contenait
10 µL de Brillant III Ultrafast SYBR green QPCR Master mix, 0.3 µL de ROX dilué au
500ème (Agilent Technologies), 250 nM d’amorces spécifiques et 2 μL de cDNA (dilué au
1/5), pour un volume total de 20 µL par puit. Des contrôles (NTC) ont été ajoutés à chaque
plaque. Des gammes ont été réalisées en triplica pour chacun des gènes et chacun des
génotypes. L’efficience de la PCR a ensuite été calculée grâce à elles, pour chaque gène et
chaque génotype. Les valeurs de Ct ont été caractérisées pour un même seuil. L’expression
des gènes a ensuite été normalisée grâce à 2 gènes de référence (alien et UBL) et deux gènes
d’intérêt stables (GOGAT6 et VTC21) déterminés par le logiciel GeneNorm.
3. ANALYSES TRANSCRIPTOMIQUES A PARTIR DE STOMATES
MICRODISSEQUES
P REPARATION DES MATRICES
L’extraction des ARNs totaux a été réalisée à partir d’échantillons de 500 stomates
microdisséqués, en suivant les instructions du fabricant avec le kit Qiagen Micro Plus
(Qiagen). Les ARNs ont été par la suite retrotranscrits et les ADNc amplifiés en suivant les
recommandations du fabricant avec le kit TransPlex® Complete Whole Transcriptome
Amplification (Sigma). Les ADNc ainsi obtenus ont ensuite été purifiés avec le kit QIAamp
DNA Micro (Qiagen) et quantifiés par Nanodrop. Toutes les matrices ont été diluées pour
atteindre une concentration de 5 ng/µL.
36
Matériel et Méthodes
D ESSIN DES AMORCES
Le dessin des amorces s’est fait de la même manière que décrit précédemment, mais
pour des cibles différentes. Ont été choisis comme cibles, des gènes codant pour les canaux
plasmiques ou vacuolaires des stomates, connus pour jouer un rôle dans les mouvements
stomatiques, ainsi que les récepteurs de la lumière bleue (phytotropines) et du CO 2 (les
anhydrases carboniques). La spécificité des couples d’amorces a été testée par qPCR sur de
l’ADNc de chacun des 3 génotypes étudiés ainsi que par séquençage de l’amplicon par
l’entreprise Beckman coulter genomic.
PCR EN TEMPS REEL ( Q PCR)
La PCR en temps réel a été réalisée par le système Mx3000P QPCR (Agilent
technologies) en suivant les recommandations du fabricant pour le programme (10 min 95°C,
40 cycles de 5 s à 95°C, et 20 s à 58 ou 60°C en fonction des amorces), suivie d’une courbe
de dissociation pour vérifier la spécificité de l’amplification. Le MIX réactionnel contenait
10 µL de Brillant III Ultrafast SYBR green QPCR Master mix, 0.3 µL de ROX dilué au
500ème (Agilent Technologies), 250 nM d’amorces spécifiques et 2.2 μL de cDNA (à
5 ng/µL), pour un volume total de 20 µL par puit. Des contrôles (NTC) ont été ajoutés à
chaque plaque. Comme pour les qPCR réalisées sur les feuilles, des gammes ont été réalisées
en triplicat pour chacun des gènes et chacun des génotypes. L’efficience de la PCR a ensuite
été calculée grâce à elles pour chaque gène et chaque génotype. Les valeurs de Ct ont été
caractérisées pour un même seuil. L’expression des gènes a ensuite été normalisée grâce à 2
gènes de référence (GOGAT6 et UBL) et trois gènes d’intérêt stable (OST26, KAT3 et GLR2)
déterminés par le logiciel GeneNorm.
VII.
TECHNIQUES DE MICROSCOPIE
1. PREPARATION D’ECHANTILLONS DE STOMATES
MICRODISSEQUES
Les techniques de microdissection laser permettent d’isoler les stomates pour ensuite
réaliser des mesures sur des échantillons de stomates purs. Afin de microdisséquer ces
derniers, il convient d’isoler l’épiderme des feuilles lyophilisées. Ne pouvant détacher
37
Matériel et Méthodes
l’épiderme simplement, des morceaux d’épiderme sont décrochés par grattage de la surface de
la feuille avec une lame de rasoir, au dessus d’une lame de verre. Les fragments d’épiderme
sont fixés à la lame par l’ajout et l’évaporation de quelques gouttes d’éthanol. Les cellules de
garde sont alors découpées par microdissection laser et catapultées dans un tube Eppendorf,
grâce au système PALM MicroBeam (Zeiss) (Figure 45 A et B). Les stomates se retrouvent
isolés dans le tube Eppendorf tandis que sur la lame, il ne reste que des morceaux d’épiderme
(Figure 45 C et D).
2. DETERMINATION DE LA DENSITE STOMATIQUE ET DE LA
TAILLE DES STOMATES
(MICROSCOPIE ELECTRONIQUE A
BALAYAGE)
P RINCIPE DE L ’APPAREIL
Le Microscope Electronique à Balayage (MEB) permet d’obtenir des images en haute
résolution du relief de la surface d’un échantillon. Un faisceau d’électrons vient balayer la
surface de l’échantillon qui va alors émettre des particules (électrons secondaires, électrons
rétrodiffusés, rayons X…) (Figure 46) qui sont collectées par des détecteurs. Les informations
collectées par les détecteurs d’électrons permettent alors de reconstruire une image en trois
dimensions et ceux collectant les rayons X permettent de déterminer la composition minérale
de l’échantillon. En effet, les énergies des rayons X émis sont spécifiques des éléments
minéraux constituant l’échantillon.
U TILISATION
Trois échantillons de feuilles par arbre, prélevés à l’emporte pièce, ont été lyophilisés.
Ils ont ensuite été découpés en deux et déposés sur portoirs, de manière à avoir un demidisque laissant voir la face supérieure et l’autre la face inférieure de la feuille. Les portoirs ont
ensuite été rendus conducteurs aux électrons par dépôt d'une couche de carbone (pulvérisation
cathodique). Des observations au MEB ont permis de déterminer, grâce à l’utilisation du
détecteur d'électrons rétrodiffusés (BSD), la densité stomatique de chaque génotype pour
chaque traitement sur chaque face de la feuille. Les observations ont été faites avec les
réglages suivants : tension d'accélération des électrons (EHT) = 15 kV, Intensité de Sonde
(ISonde) = 1 nA, distance focale (WD) = 12 mm, grandissement = 250X. La taille des
38
A
B
C
D
Figure 45 : (A) Système de microdissection laser Palm Microbeam (Zeiss), (B) Principe de
fonctionnement du système de microdissection laser, (C) Morceaux d’épiderme restant sur la lame
après microdissection, (D) Stomates propulsés dans le tube Eppendorf
Figure 46 : Schéma des interactions entre le faisceau d'électrons et la matière
Matériel et Méthodes
stomates a été mesurée dans les même conditions, mais à un grandissement de 800X. Chaque
demi-disque a donné lieu à 3 répétitions sur 3 champs différents, pour l’observation de la
densité stomatique et à un champ permettant d’observer 6 stomates, pour les mesures de taille.
3. MICROANALYSE X DES ELEMENTS MINERAUX (MICROSCOPIE
ELECTRONIQUE A BALAYAGE)
La microanalyse des rayons X a permis de doser les concentrations minérales à
l’intérieur des cellules de garde. Les analyses ont été réalisées sur les mêmes échantillons que
ceux ayant servis pour l’observation au MEB, avec 2 champs de 5 stomates par demi-disque.
Les µanalyses X ont été accomplies grâce à un spectromètre à dispersion d’énergie (EDS)
avec les réglages suivants : EHT = 15 kV, ISonde = 800 pA, WD = 15 mm, grandissement =
1000X. De plus, toutes les deux heures et au début et à la fin de chaque portoir analysé, une
recalibration de l'énergie des spectres avec un standard manganèse était effectuée.
4. ANALYSE ULTRASTRUCTURALE DES CELLULES DE GARDE
(MICROSCOPIE ELECTRONIQUE A TRANSMISSION )
P RINCIPE DE L ’APPAREIL
Le Microscope Electronique à Transmission (MET) permet de visualiser des objets de
taille inférieure à une cellule avec une haute résolution et donc d’étudier les structures
cellulaires. Un faisceau d’électrons à haute tension, focalisé à l’aide de lentilles
électromagnétiques, traverse un échantillon très mince (10 à 100 nm). Les électrons vont alors
réagir avec les atomes de l’échantillon (Figure 46). En MET, seuls les électrons traversant
l’échantillon sont analysés. La distinction entre les électrons transmis (n’ayant pas interagit
avec l’échantillon) et les électrons diffusés (résultant de l’interaction avec l’échantillon)
permet de recréer les images.
U TILISATION
Des observations au MET de coupes tangentielles ultrafines (100 nm) de feuilles
incluses en résine (Protocole détaillé en annexe 9), ont permis d’étudier l’ultrastructure des
stomates et d’apprécier l’état et la présence d’organites, tels que les chloroplastes et les
mitochondries. Les observations ont été produites à 80 kV sur un MET PHILIPS CM12.
39
RESULTATS
40
Résultats
I.
REGULATION STOMATIQUE
1. EFFETS DE L ’OZONE SUR LA REPONSE STOMATIQUE AUX
PARAMETRES ENVIRONNEMENTAUX (LUMIERE BLEUE ,
LUMIERE ROUGE , CO2 ET DEFICIT DE PRESSION DE VAPEUR
D’EAU) DANS TROIS GENOTYPES DE POPULUS DELTOIDES X
NIGRA
Les stomates régulent les échanges gazeux entre la plante et l’atmosphère, et plus
particulièrement, la transpiration et l’entrée de CO2. La conductance stomatique varie en
fonction des conditions environnementales, les stomates étant ouverts quant les conditions
sont les plus favorables. La lumière (bleue et rouge) induit une ouverture stomatique, tandis
qu’une augmentation de VPD et de CO2 entraîne une fermeture stomatique. La vitesse de
réaction des stomates permet, dans un environnement en constante variation, de saisir les
meilleures opportunités pour limiter l’évapotranspiration tout en assimilant un maximum de
carbone. De plus, la régulation de la conductance stomatique joue un rôle important pour
limiter les flux entrants d’ozone et ainsi le stress oxydatif induit par celui-ci. Cependant, il a
été montré que la réponse des stomates aux facteurs environnementaux est altérée sous l’effet
de l’ozone, avec des vitesses ralenties (Paoletti, 2005; Paoletti and Grulke, 2010).
L’objet de l’étude présentée ci-après était de caractériser précisément l’effet de
l’ozone sur la réponse des stomates aux variations de lumière bleue, de lumière rouge, de CO2
et de VPD, chez trois génotypes de peuplier variant en tolérance (basée sur des mesures de
croissance, de biomasse et de nécroses). Elle a permis de mettre en avant les résultats
suivants :

l’ozone entraîne une baisse de la conductance stomatique, de l’assimilation nette
de CO2, des teneurs en chlorophylles et une perte de biomasse.

l’ozone provoque un ralentissement de l’ouverture des stomates lors d’une
augmentation de l’intensité de lumière bleue.
41
Résultats

l’ozone conduit à un ralentissement de la fermeture des stomates lors d’une
augmentation de la concentration en CO2 ou d’une hausse du VPD.

l’ozone induit une baisse de l’amplitude de l’ouverture des stomates lors d’une
augmentation de l’intensité de lumière rouge.

le génotype le plus sensible (Robusta) est caractérisé par des vitesses de réponse
plus lentes et par des conductances stomatiques initiales plus importantes.
Ces résultats ont été publiés dans le journal Environmental Pollution (2013) 173 : 85-96.
42
Environmental Pollution 173 (2013) 85e96
Contents lists available at SciVerse ScienceDirect
Environmental Pollution
journal homepage: www.elsevier.com/locate/envpol
Effects of ozone on stomatal responses to environmental parameters (blue light,
red light, CO2 and vapour pressure deficit) in three Populus deltoides Populus
nigra genotypes
Jennifer Dumont a, b, c, Fabien Spicher a, b, c,1, 2, Pierre Montpied a, b, c, Pierre Dizengremel a, b, c,
Yves Jolivet a, b, c, Didier Le Thiec a, b, c, *
a
b
c
INRA, UMR 1137, Ecologie et Ecophysiologie Forestières, Champenoux F-54280, France
Université de Lorraine, UMR 1137, Ecologie et Ecophysiologie Forestières, VandœuvreelèseNancy F-54506, France
IFR110 EFABA, VandoeuvreelèseNancy Fe54500, France
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 27 July 2012
Received in revised form
17 September 2012
Accepted 28 September 2012
The effect of ozone (O3) on stomatal regulation was studied in three Euramerican poplar genotypes
(Populus deltoides Populus nigra: Carpaccio, Cima and Robusta). The impact of O3 on stomatal
conductance responses to variations in blue light, red light, CO2 concentration and vapour pressure
deficit (VPD) was studied. Upon O3 exposure, a sluggish response of stomatal movements was observed,
characterized by slower reactions to increases in blue light intensity, CO2 concentration and VPD, and
lower amplitude of the response to variations in light intensity. That sluggish response should be taken
into account in stomatal conductance models for phytotoxic ozone dose (PODY) calculations. The speed of
the response to variations in environmental parameters appears as a determining factor of genotyperelated sensitivity.
Ó 2012 Elsevier Ltd. All rights reserved.
Keywords:
Ozone
Stomatal conductance
Light
CO2 concentration
VPD
1. Introduction
Tropospheric ozone (O3) is a powerful greenhouse gas which
acts as a phytotoxin (IPCC, 2007). Its toxicity results in oxidative
stress in plants. The concentration of tropospheric O3 is currently
still rising while there are already impacts on vegetation and
ecosystems (Sitch et al., 2007; Vingarzan, 2004). Annual O3
concentrations are increasing, but they are not homogeneous at
a global scale. Between 2008 and 2009, maximum O3 concentration
decreased by 1e2 nmol mol1 in the south of Europe, whereas in
France and Belgium it increased by 2e4 nmol mol1 of O3 (Fagerli
et al., 2011). Currently, in France, O3 concentrations exceed
120 nmol mol1 several days a year, depending on the area (ASPA,
* Corresponding author.
E-mail addresses: jdumont@nancy.inra.fr (J. Dumont), fabien.spicher@
agroparistech.fr
(F.
Spicher),
montpied@nancy.inra.fr
(P.
Montpied),
pierre.dizengremel@univ-lorraine.fr (P. Dizengremel), yves.jolivet@univ-lorraine.fr
(Y. Jolivet), lethiec@nancy.inra.fr (D. Le Thiec).
1
Present address: INRA, UMR 1092, Laboratoire d’étude des ressources forêtbois, Champenoux F-54280, France.
2
Present address: AgroParisTech e ENGREF, UMR 1092, Laboratoire d’étude des
ressources forêt-bois, Nancy F-54042, France.
0269-7491/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.envpol.2012.09.026
2010 and MEDDTL, 2010). Such concentrations might be more
frequent in the future. O3 stress leads to physiological (Ainsworth
et al., 2012; Matyssek et al., 2010 in beech), biochemical
(Dizengremel, 2001; Renaut et al., 2009 in poplar and Wittig et al.,
2009), and molecular effects (Castagna and Ranieri, 2009; Heath,
2008; Kangasjärvi et al., 1994). This causes substantial declines in
agriculture and forestry productivity linked to economic losses
(Avnery et al., 2011; Felzer et al., 2007; Van Dingenen et al., 2009).
Differences in O3 sensitivity between tree species, and even within
species between genotypes, are observed (Betzelberger et al., 2010;
Hayes et al., 2007). Sensitivity depends on the two defence mechanisms set up by plants, i.e. regulation of stomatal conductance and
detoxification of the reactive oxygen species generated during O3
degradation (Brosché et al., 2010; Dizengremel et al., 2008).
As the present situation is becoming worrying, it is urgent to
improve the accuracy of the exposure indices used to assess O3 risk.
Critical level indicators, based only on atmospheric O3 concentrations, as AOT40 (Accumulated Ozone over a Threshold of
40 mg1 m3 h1) and SUM60 (sum of all hourly average concentrations over 60 nmol mol1) were previously used because they
were easy to calculate but inaccurate (Fuhrer et al., 1997; Gerosa
et al., 2009; Karlsson et al., 2007). They were progressively
replaced by indicators of the O3 uptake through stomata: CUO
86
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
(Cumulative Uptake of Ozone) or AFstY (Accumulated stomatal flux
above a threshold of Y nmol m2 s1) recently renamed PODY
(Phytotoxic Ozone Dose over a threshold of Y nmol m2 s1). This
latter indicator takes into account the O3 flux by modelling O3
stomatal conductance with models such as the DO3SE model
(Büker et al., 2012; Emberson et al., 2000) which computes
stomatal conductance using the additive algorithm of Jarvis (1976).
That model calculates conductance with a maximum conductance
value and reducing functions that depend on phenology and
environmental factors such as irradiance, Vapour Pressure Deficit
(VPD), temperature and soil water potential. Nevertheless, it does
not integrate the effect of O3 on those factors although O3 is known
to impair stomatal functioning (Fagerli et al., 2011). Danielsson et al.
(2003) and Pleijel et al. (2002) added the effect of O3 to the
phenology function in potato and wheat. That new function is being
increasingly used, but more knowledge is needed to determine if
the effects of O3 on trees should really be integrated in the same
way because no attempt has been made to link the O3 function to
another function than phenology so far.
Stomatal movements are due to the regulation of guard cell
turgor via the control of osmolyte concentrations in their cytosol
(Pandey et al., 2007). Stomata react to changes in environmental
parameters by opening or closing. O3 has been shown to have
different effects on stomatal movements: it modifies opening and/
or closing speed, but also opening and/or closing rate in response to
variations in light intensity (Hoshika et al., 2012; Paoletti, 2004;
Paoletti and Grulke, 2010), VPD (Grulke et al., 2007), soil moisture
(Hayes et al., 2012), CO2 concentration (Onandia et al., 2011) and
ABA concentration (Mills et al., 2009).
The purpose of this study was to characterize the impact of O3
on the stomatal responses to four major environmental parameters,
i.e. blue light, red light, CO2 concentration and VPD, on three
Euramerican poplar genotypes. The stomatal opening by light
consists of two components, the red light response driven by
photosynthesis and the specific-blue light response which is
photosynthesis-independent (Shimazaki et al., 2007; Wang et al.,
2011). We tested these components separately by studying blue
light in darkness. We focused on the speed and the amplitude of
stomatal responses while studying the link with net CO2 assimilation. The regulation of stomatal conductance and thereby the
regulation of stomatal uptake can be involved in the characterization of O3 sensitivity. We hypothesized that the difference in O3
sensitivity could also be linked to different stomatal behaviours in
response to variations in environmental parameters under O3
treatment. In this context, we also monitored the global impact of
O3 on biomass, growth, chlorophyll content, photosynthesis, and
stomatal conductance by gas exchange measurements. All our
results were linked to POD1 to determine if other parameters than
biomass could be modelled as a linear regression in relation with
POD1, or if other types of adjustments are necessary.
2. Material and methods
2.1. Plant culture and exposure conditions
Cuttings of three Euramerican poplar genotypes (Populus deltoides Populus
nigra: ‘Carpaccio’, ‘Cima’ and ‘Robusta’) with similar stomatal densities were selected
from a previous study on the basis of contrasting responses to O3 (i.e. visible injury,
growth, number of fallen leaves., data not shown) and planted in 5-L pots filled with
loam (N/P/K 14/16/18, 1.2 kg m3, Gramoflor SPI Universel), fertilized by adding
20 mg of slow-release nutritive granules (Nutricot T-100, N/P/K/MgO 13/13/13/2,
Fertil, Boulogne-Billancourt, France). One mg L1 of magnesian limestone was added
to regulate the pH. The experiment was first conducted for 3 weeks on Carpaccio and
Cima, and was later duplicated on Robusta with half of the chambers. The plants were
grown in growth chambers for 5 weeks at 75/85% relative humidity (day/night) with
a 14-h light period (250 mmol m2 s1 PPFD at mid-leaf height from 08 h00 to 22 h00)
and a temperature of 23/20 C. Twenty-nine individuals of each genotype were
distributed in 8 phytotronic chambers with growth conditions identical to those in
the growth chamber, half of which were set for O3 treatment (120 nmol mol1 for
13 h). At the end of a 7-day long acclimation period, the O3 treatment started while
control trees were exposed to charcoal-filtered air for 18 days. O3 was produced from
pure O2 with two ozone generators (OZ500; Fischer, Bonn, Germany and CMG3-3;
Innovatec II, Rheinbach, Germany) and injected directly in the chambers 1 h after
the beginning of the photoperiod until its end. A set of analysers (O341M; Environment S.A., Paris, France) was used to monitor O3 concentrations.
2.2. Plant growth and biomass
Before fumigation, five plants of each genotype were cut to measure initial
biomass. At the end of the experiment, all the plants were harvested, divided into
stems, leaves, and roots and oven-dried (60 C) until constant weight was reached,
and then weighed. Diameter at collar (D) and height (H) were recorded twice a week
until the end of the experiment on each individual.
2.3. Total chlorophyll content
Total chlorophyll content was measured twice a week using a CCM-200 chlorophyll meter (Opti-Sciences, Hudson, NH, USA) on the first fully-expanded mature
leaf at the beginning of the experiment (11th for Cima and Robusta and 15th for
Carpaccio, the age of leaves being the same between genotypes). The values obtained from the CCM (Chlorophyll Content Index, CCI) were converted to g m2
thanks to a known relation (Bagard et al., 2008; Wellburn, 1994):
½chl ¼ 0:0214ðCCIÞ þ 0:0424
2.4. CUO and POD1 calculations
CUO and PODY with a threshold of 1 nmol m2 s1, recommended by Fagerli
et al. (2011), are modelled as the flux of O3 from the atmosphere through stomata
(Fst; [nmol m2 s1]). POD1 and CUO are calculated from hourly values of Fst.
PODY ¼
n
X
½maxðFst Y; 0ÞDti
(1)
i¼1
CUO ¼
n
X
ðFst DtÞi
(2)
i¼1
n being the number of hours and Dt ¼ 1 h, Y ¼ 1 nmol m2 s1
The O3 flux was estimated based on the measurements of stomatal conductance
to O3 ðgO3 Þ, which is related to stomatal conductance to water vapour (gs) by the
following formula: gO3 ¼ gs =1:51 (Massman, 1998). gw measurements were performed three times a week. As our experiment was conducted in phytotronic
chambers where environmental conditions were stable, we applied a constant value
of gw all day long. When gs measurements were not available, we estimated them
from the values of the flanking days (Bagard et al., 2008).
2.5. Gas exchange measurements
Gas exchange (A, net CO2 assimilation and gw, stomatal conductance to water
vapour) was monitored using a portable photosynthesis system (Li-6200, LiCor,
Lincoln, NE, USA) in phytotronic environmental conditions. Measurements were
carried out 3 times a week, 2 h after lights were switched on, on the first fullyexpanded mature leaf at the beginning of the experiment.
Gas exchange responses to varying blue light, red light, leaf-to-air vapour
pressure deficit (VPD) and CO2 were measured once a week, on three plants of each
genotype for each treatment, on the leaf below the one used for Li-6200 measurements (the 12th for Cima and Robusta and the 16th for Carpaccio, the age of leaves
being the same between genotypes), with three intercalibrated open gas exchange
systems with 6400-40 Leaf Chamber Fluorometer (Li-6400, LiCor Lincoln, NE, USA)
coupled with a custom-built water trap. Data were recorded automatically every
30 s. For each test, only one environmental parameter was changed, as summarized
in Table 1. Leaf temperature was 25 C for all conditions. Blue light and VPD
responses were studied in complete darkness in order to bypass the effects of
photosynthesis and in case of VPD response to allow the control of leaf temperature.
Red light response was studied in presence of blue light and CO2 response was
studied at saturating light conditions in order to have a complete aperture of
stomata. We used 400 mmol CO2 mol1 for red light, blue light and CO2 responses in
order to keep the CO2 concentration used in phytotronic chambers. To study VPD
responses we used 100 mmol CO2 mol1 to open stomata even in the dark.
For calculating closing or opening speeds, we used, as shown in Fig. 1:
Stomatal conductance at the initial state gs0 (means of 10 measurements after
reaching a steady state, before changing environmental parameters)
Stomatal conductance at the final state gs1 (means of the last 10 measurements
after reaching a steady state, after changing environmental parameters)
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
87
Table 1
Environmental conditions at the initial state and at the final state inside the Li-6400 chamber.
Environmental parameters
Parameter studied
CO2 (mmol CO2 mol1)
Initial
Final
Blue light
400 2.0
400 2.0
Red light
400 3.0
400 3.0
100 1.0
100 1.0
400 3.0
1200 3.0
Temperature ( C)
Initial
Final
25 0.3
25 0.3
25 0.3
25 0.3
25 0.3
25 0.3
25 0.4
25 0.4
Red (630 nm)/blue light (470 nm)
(mmol m2 s1)
Initial
Final
VPD (kPa)
Initial
Final
200/30 5.0
800/30 5.0
0/0
0/30 1
0.8 0.2
0.8 0.2
The evolution of stomatal conductance between the two states: Dgs ¼ gs1 gs0
The time taken for stomata to close (for CO2 and VPD) or to open (for red or
blue light), T.
Finally, we calculated closing or opening speed values, v ¼ Dgs/T.
2.6. Statistical analyses
The data obtained from Li-6400 measurements were fitted with a linear mixed
effect model, with individuals as random variables, and genotype, treatment and
time as fixed variables. To cope with heteroscedasticity, variances were modelled as
different for each genotype. Contrast analyses were performed to test for treatment
effect at each time-point for each genotype, genotype effect at each time-point on
ambient values, and the genotype treatment interaction at each time-point. All the
biomass data were fitted with a linear model, with treatment and genotype as
factors. Contrast analyses were performed to test for genotype effect before fumigation and treatment effect for each genotype. Other data were modelled as linear
time-dependent responses so that the responses before fumigation (time ¼ 0), i.e.
intercepts, were identical within each genotype, and slopes depended on genotype
and treatment factors and their interaction. These models were fitted as linear
mixed effect models with individuals as random variables. Normality and homoscedasticity of standardized residuals were graphically checked using quantile-toquantile and residual-vs-predicted plots. An ANOVA was used to test the differences between genotypes on initial values before fumigation and treatment effect
and genotype treatment interaction on slopes. In case of an interaction, contrast
analyses were performed to test for treatment effect on slopes within each genotype.
Data were analysed using R 2.14.2 (R Development Core Team, 2012) and the nlme
(Pinheiro et al., 2012) and multcomp (Hothorn et al., 2008) packages. Effects were
considered significant when p < 0.05.
3. Results
0.8 0.2
0.8 0.2
VPD
0/0
0/0
0.8 0.2
3.0 0.3
CO2
800/30 5.0
800/30 5.0
0.8 0.2
0.8 0.2
genotypes in the absence of O3 treatment. O3 treatment had no
significant effect on those parameters in Cima and Robusta, but in
Carpaccio height significantly increased by 9% and diameter
decreased by 10%.
The significant effects of O3 on Carpaccio height (Fig. 3A) and
diameter (Fig. 3B) as related to POD1 were modelled by linear
regression, which explained a high percentage of the variance, 94%
and 97% respectively, but a polynomial regression of order 2 was
found to fit better for height (98% of the variance explained).
Carpaccio had also significantly more leaves than the other two
genotypes (Table 2). O3 exposure significantly decreased the number
of leaves produced during the experimentation by all genotypes, with
13%,10% and 14% loss for Carpaccio, Cima and Robusta, respectively. In
parallel, O3 increased leaf fall significantly in Carpaccio (10 times
more) and Robusta (8 times more), and non significantly in Cima (4
times more). Regarding biomass, and in accordance with previous
results, Carpaccio had a significantly higher stem biomass than the
other genotypes (1.7 times more than Cima and 2.6 times more than
Robusta) and a significantly higher leaf biomass than Cima (1.3 times
more). The only significant effect of O3 on biomass was a 35% decrease
of the root biomass of Carpaccio. These results lead to a significantly
higher root-shoot ratio in Robusta (twice as much) than in the other
genotypes. O3 treatment had no significant effect on that ratio, even
though a decrease in the ratio was observed for Carpaccio. Although
the effect of O3 on total biomass was not significant, we observed
a trend for a decrease in total biomass values in all three genotypes
(5% in Carpaccio and Robusta and 12% in Cima).
3.1. Effects of ozone on growth and biomass
Height and stem diameter appeared to be significantly higher
(p < 0.001) in Carpaccio than in the other two genotypes, especially
in Robusta which was the smallest (Fig. 2). During the experiments,
we observed a similar increase in height and diameter for the three
A
3.2. Effects of ozone on chlorophyll content, net CO2 assimilation
and stomatal conductance
Robusta differed significantly from the other two genotypes,
with higher chlorophyll content (about 1.5 times more) (Fig. 4C). An
B
gs
gs0
gs (mmol.m-2.s-1)
gs (mmol.m-2.s-1)
gs1
gs
t
gs0
t
Time (s)
gs1
Times (s)
Fig. 1. Examples of A light curve (stomatal opening) and B VPD or CO2 curve (stomatal closure) showing the parameters used for calculations, i.e. gs0 stomatal conductance before
changing environmental parameters, gs1 stomatal conductance at equilibrium after changing environmental parameters, t the time needed to reach equilibrium, Dgs the difference
between gs0 and gs1.
88
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
A
160
Diameter (mm)
Height (cm)
Carpaccio
120
100
80
60
T : ***
160
10
15
10
9
8
20
T : ***
0
13
120
100
80
60
T : ns
40
5
10
15
20
E
12
Diameter (mm)
Height (cm)
5
B
140
11
10
9
8
7
T : ns
6
0
160
5
10
15
20
0
C
12
120
100
80
60
T : ns
5
10
15
20
F
13
Diameter (mm)
140
Height (cm)
11
6
0
Cima
12
7
40
Robusta
D
13
140
11
10
9
8
7
T : ns
6
40
0
5
10
15
20
0
Time (day)
5
10
15
20
Time (day)
Fig. 2. Effects of O3 treatment (-Ozone ,Ambient) on height (cm) (A, B and C) and stem diameter (mm) (D, E and F) of Carpaccio (A and D), Cima (B and E) and Robusta (C and F)
ns ¼ no significant effect, and significant differences between treatments (T) are indicated by * (p < 0.05) ** (p < 0.01) or *** (p < 0.001).
important effect of O3 appeared more or less rapidly in all genotypes, from 3 days after O3 treatment started in Cima to one week in
the other two genotypes (Fig. 4AeC). During the experimentation,
although leaves were fully expanded, chlorophyll content
continued to increase in ambient conditions, and then tended to
stabilize. Exposure to O3 resulted in a decrease in chlorophyll
content, with 36%, 41% and 30% less chlorophyll under O3 exposure
than in ambient conditions for Carpaccio, Cima and Robusta,
respectively.
A
Significant stomatal closure was observed after O3 treatment for
the three genotypes (Fig. 5AeC). It was linked with a significant
decrease in net CO2 assimilation (Fig. 4DeF). Robusta differed
significantly once again, with higher stomatal conductance values
and thus higher net CO2 assimilation. Ci values were stable
throughout the experiment (data not shown). Stomatal conductance differences led to genotype differences in the amplitude
variations of POD1 (Fig. 6). The effect of O3 on chlorophyll content in
relation to POD1 was modelled as a linear adjustment. A polynomial
B
Fig. 3. Relationships between height (A) and diameter (B) relative to the control treatment (%) and phytotoxic ozone dose over a threshold of 1 nmol m2 s1 in Carpaccio. Two
adjustment models were used: a linear regression (lin: solid line) and a polynomial regression of order 2 (pol: dotted line) with y ¼ 1.3327x 2.2598 and
y ¼ 0.1407x2 0.0596x þ 0.4639 as equations respectively.
ns
ns
ns
ns
<0.001
<0.001
ns
ns
ns
0.013
ns
ns
0
0
0
0
0
0
0.12 0
0.06 0
0.09
0.06
0.08
0.07
0.10
0.10
0.06 0
T18
T0
54.0 51.3 34.3 30.2 29.4 28.0 23.6 0.9
16.2 0.4
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.00643
ns
0.01282
0.0184
ns
ns
4.6 0.1
ns
ns
ns
1.8 0.1
0.5 0.0
4.4 2.9 2.5 2.1 2.8 2.7 4.2 0.3
T0
0.3 0.1
27.2 1.5
24.1 1.1
15.2 0.8
13.5 0.9
10.2 0.6
10 0.6
T18
T0
9.8 0.3
<0.001
ns
<0.001
ns
ns
ns
<0.001
ns
0.00621
32 0
28 1
0.00039
0.03936
0.03937
00
00
10
10 2
10
41
10
81
5.1 0.3
T18
22.4
24.4
16.6
14.6
16.4
15.3
T0
T0
00
1
1
1
1
1
1
52
45
40
36
35
30
T18
T0
38 0
89
regression of order 2 did not improve the relation (Fig. 6AeC). For
net CO2 assimilation, a linear regression was sufficient for Carpaccio
and Robusta (Fig. 6A and C), although a polynomial regression of
order 2 fitted better for Carpaccio. On the other hand, a real
improvement was noted for Cima with a polynomial regression of
order 2 (Fig. 6E).
Finally, A/gw was about the same for all three genotypes
(Fig. 5DeF), and it increased with O3 treatment during the first
week only. After 10 days, the difference disappeared.
3.3. Effects of ozone on the responses to variations in blue light
In control air conditions, dark-to-blue-light transition induced
a significant genotypic effect on the amplitude of stomatal opening
(Table 3). Cima displayed the biggest amplitude, more than double
compared to Robusta which displayed the lowest. In addition, there
was also a significant genotypic effect on the opening speed.
Robusta was the slowest, with reaction rates 2e3 times lower than
Carpaccio and Cima.
O3 had no effect on the opening rate or speed of Robusta,
whereas the amplitude and the speed of the response were reduced
for the other two genotypes (Table 3). Under O3 treatment, the
amplitude of the response decreased in Carpaccio by around 75%
and was around 40% lower for Cima. Opening speed was reduced by
around 65% and 55% for Carpaccio and Cima, respectively, from the
second week onward. The effects of O3 on stomatal conductance
were not linked to Ci variations, whose values remained stable
(data not shown).
In control air conditions, there was no genotype effect on net
CO2 assimilation in the dark or in blue light conditions (Table 3). In
the dark, the respiration of the three genotypes increased with O3
treatment, especially from the second week, by around 90%, 30%
and 55% for Carpaccio, Cima and Robusta, respectively. In addition,
from the second week, the three genotypes continued to respire
under blue light when submitted to O3 treatment, whereas the
controls began to photosynthesize.
3.4. Effects of ozone on the responses to variations in red light
Ambient
Ozone
Cima
Ambient
Ozone
Robusta
Ambient
Ozone
Treatment effect
Carpaccio
Cima
Robusta
Genotype effect
Carpaccio:Cima
Cima:Robusta
Robusta:Carpaccio
Carpaccio
T18
12.3 0.5
1.3
0.5
1.0
0.9
1.6
1.5
10 0.3
T18
0.4
0.3
0.2
0.4
0.4
0.4
9.8 0.6
3.0
1.9
2.0
2.0
2.5
2.5
T18
T0
Root-shoot ratio
Total biomass (g)
Root biomass (g)
Stem biomass (g)
Leaf biomass (g)
Number of fallen leaves
Number of leaves
Treatment\day
Genotype
Table 2
Evolution of the numbers of leaves, of fallen leaves and of biomass (means SE) of the three poplar genotypes Carpaccio, Cima and Robusta, before (T0) and after being submitted to 120 nmol mol1 of O3 or not (control
treatment) for 18 days (T18). Treatment and genotype effect are considered as significant when p < 0.05 using the contrast method.
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
In control air conditions, there was no significant genotypic
effect on the amplitude or the speed of opening in response to an
increase in red light (Table 4). From the second week, the amplitude
of the reaction was significantly reduced by O3 treatment in
Carpaccio (by around 85%) and in Robusta (by around 75%), while it
was reduced only during the last week in Cima (by around 75%).
Finally, opening speed was not altered by O3 exposure, except
during the second week for Carpaccio and Robusta. The effects of O3
on stomatal conductance were not linked to variations in Ci values,
which remained stable (data not shown).
In control air conditions, the photosynthesis rate, under low or
intense red light was more important in Robusta than in the other
two genotypes (around 1.3 times more) (Table 4). From the second
week, there was a decrease of photosynthesis under O3 treatment.
It was significant from the second week for Robusta with around
40% decrease and from the last week with 55% and 45% decrease for
Carpaccio and Cima, respectively.
3.5. Effects of ozone on the responses to variations in CO2
In control air conditions, Robusta closed its stomata significantly
more slowly than the other two genotypes under an increased CO2
concentration (3.3 and 1.7 times more slowly than Carpaccio and
Cima, respectively), leading to a significant lengthening of the time
needed for stomatal conductance to stabilize (Table 5). The treatment had no effect on closing speed or stabilization time in Robusta.
90
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
A
1.10
1.00
0.90
0.80
0.70
0.60
0.50
0.40
0.30
B
1.10
1.00
0.90
0.80
0.70
0.60
0.50
0.40
0.30
10
15
T : ***
8
6
4
0
20
T : ***
5
10
E
10
15
20
T : ***
8
6
4
2
5
C
1.10
1.00
0.90
0.80
0.70
0.60
0.50
0.40
0.30
10
15
0
20
T : ***
5
F
10
A (μmol.m -2.s-1)
Chlorophylls (g.m )
Ozone
D
10
A (μmol.m -2.s-1)
Chlorophylls (g.m )
-2
Cima
T : ***
5
0
-2
Ambient
2
0
Robusta
Ozone
A (μmol.m -2.s-1)
Chlorophylls (g.m-2)
Carpaccio
Ambient
10
15
20
T : ***
8
6
4
2
0
5
10
15
20
0
Time (day)
5
10
15
20
Time (day)
Fig. 4. Effects of O3 treatment (-Ozone ,Ambient) on chlorophyll content (g m2) (A, B and C) and net CO2 assimilation A (mmol m2 s1) (D, E and F) in the leaves of Carpaccio (A
and D), Cima (B and E) and Robusta (C and F). Significant differences between treatments (T) are indicated by * (p < 0.05) ** (p < 0.01) or *** (p < 0.001).
In contrast, from the second week the opening speed was cut by half
and the stabilization time was twice as long under O3 treatment in
Carpaccio and Cima. Although Ci values increased along with
increased CO2, the Ci/Ca ratio remained stable (data not shown).
In control air conditions, Robusta displayed a significantly
higher photosynthesis rate under low and high CO2 concentrations
than Carpaccio and Cima (around 1.3 times more) (Table 5). Under
O3 treatment, with low or high CO2 concentrations, all three
genotypes had a lower photosynthesis rate than under ambient
conditions. The effect was more and more pronounced as fumigation time increased and appeared from the first week for Robusta
and from the second week for Cima and Carpaccio, with around 55%
less photosynthesis the third week.
3.6. Effects of ozone on the responses to variations in VPD
In control air conditions, Robusta was the slowest to close its
stomata in response to increased VPD, and Carpaccio was the
fastest with almost a 10-fold difference between these extremes
and a 6-fold difference for stabilization time (Table 6). O3 had no
clear effect on closing time or speed in Cima and Robusta, but
decreased Carpaccio closing speed significantly by almost one half,
and increased its stabilization time by almost 40%. The effects of O3
on stomatal conductance were not linked to variations in Ci values,
which remained stable (data not shown).
In control air conditions, there was no significant genotype
effect on photosynthesis (Table 6). From the second week, whether
with high or low VPD, O3 increased respiration in the three genotypes (35%, 50% and 80% increase under low VPD, 65%, 90% and 50%
increase under high VPD, for Carpaccio, Cima and Robusta,
respectively). Such increases were only significant for Robusta.
4. Discussion
4.1. Effects of ozone on net CO2 assimilation
In our experiments, we observed a decrease of stomatal
conductance which reduced ozone uptake directly followed by an
important decrease in net CO2 assimilation. As highlighted by
Wittig et al. (2009), net CO2 assimilation reduction can have
important effects on plant biomass that are in accordance with the
slight decrease in total biomass we observed, but it can also result
to important ecosystem effects with a decrease of the carbon-sink
strength. In dark conditions, respiration was more important
under O3 treatment, and in the presence of low light, when
photosynthesis prevailed on respiration for the control plants,
respiration remained more important than photosynthesis for the
plants under O3 treatment. When light intensity was sufficient to
have higher photosynthesis than respiration for the plants under O3
treatment, net CO2 assimilation was still much lower than in the
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
Ambient
A
Ambient
0.5
0.4
0.3
0.2
0.1
0
10
15
20
10
0
0.5
0.4
0.3
0.2
0.1
5
10
15
20
5
10
15
20
10
15
20
E
50
T : ***
40
30
20
10
0
0
0
5
C
0.7
10
15
0
20
F
50
T : ***
A/gs (μmol.mol -1)
0.6
gs (mol.m .s )
30
20
A/gs (μmol.mol -1)
-2 -1
gs (mol.m .s )
0.6
Cima
5
B
0.7
-2 -1
40
0
0
Robusta
Ozone
D
50
T : ***
0.6
A/gs (μmol.mol -1)
gs (mol.m-2.s-1)
Carpaccio
0.7
Ozone
91
0.5
0.4
0.3
0.2
0.1
40
30
20
10
0
0
0
5
10
15
20
Time (day)
0
5
Time (day)
Fig. 5. Effects of O3 treatment (-Ozone ,Ambient) on stomatal conductance gs (mol m2 s1) (A, B and C) and on the water use efficiency A/gs (mmol mol1) (D, E and F) of
Carpaccio (A and D), Cima (B and E) and Robusta (C and F). Significant differences between treatments (T) are indicated by * (p < 0.05) ** (p < 0.01) or *** (p < 0.001).
controls. That effect can be due to the important decrease in
chlorophyll content that results from O3 exposure, and can also be
linked, as suggested by Dghim et al. (in press), Dizengremel (2001),
Dizengremel et al. (2008) and Wittig et al. (2009), to lower rubisco
content and activity. The energy needs that remain unfulfilled by
photosynthesis can be partly compensated for by respiration.
4.2. Effects of ozone on stomatal conductance
As previously written, O3 flux, net CO2 assimilation and transpiration are tightly linked to stomatal conductance. This requires
a balance between O3 entrance, water loss and CO2 needs. Trees have
to adjust their stomatal conductance to each change in environmental
parameters to take advantage of the best conditions. Therefore
stomatal opening and closing speed is a parameter of importance. We
showed that O3 had a first effect on stomatal conductance, so that
decreased stomatal conductance reduced net CO2 assimilation. That
shift led to an increase in water use efficiency during the first week,
which vanished once stomatal conductance had stabilized.
In the early morning, the increase in blue light opens the
stomata and the increase in red light keeps them open (Shimazaki
et al., 2007). O3 slowed stomatal opening in response to an increase
in blue light, but reduced stomatal aperture (Dgs) in response to an
increase in red light or blue light. These results suggest that the blue
light-specific signalling cascade was slowed down at some point.
The reduced amplitude of the response to variations in red or blue
light may result from the alteration of the ion channels implied in
stomatal opening (Torsethaugen et al., 1999). Decreased Dgs led to
a reduction of the O3 flux, but as the reaction to an increase in blue
light under O3 treatment was slower, the trees may open their
stomata more slowly in the morning when O3 concentration is low,
although conditions for stomatal opening are optimal.
Concerning the effect of O3 on stomatal closure in response to
high CO2 or VPD, although there was no impact on Dgs, the speed of
the response was once again slowed down, so that more time was
required to achieve a steady state under new environmental
conditions. Trees with slower reactions may take more time to
close their stomata when the air gets dry and then may lose more
water because of higher transpiration rates.
This stomatal sluggishness should be taken into account in the
models for calculating conductance by adding an O3 function not
only linked to phenology but also to the other functions, because the
responses to variations in the environmental parameters we tested,
i.e. blue light, red light, CO2 and VPD, were altered under O3 exposure in accordance with other studies (Grulke et al., 2007; Hayes
et al., 2012; Hoshika et al., 2012; Onandia et al., 2011; Paoletti and
Grulke, 2010). The mechanisms that account for sluggish stomatal
responses during O3 exposure are not fully understood yet. O3
exposure mediates increases in apoplastic H2O2, which alters
membrane permeability, specifically to cation influx (Castillo and
Heath, 1990; Le Thiec et al., 1994; McAinsh et al., 2002; Pei et al.,
2000; Torsethaugen et al., 1999). Recent advances have demonstrated that ABA plays an important role in response to pathogens
and that the signalling pathways are very similar to the one of
92
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
A
D
B
E
C
F
Fig. 6. Relationships between chlorophyll content (A, B and C) and CO2 net assimilation (D, E and F) relative to the control treatment (%) in Carpaccio (A and D), Cima (B and E) and
Robusta (C and F) and phytotoxic ozone dose over a threshold of 1 nmol m2 s1. Two adjustment models were used: a linear regression (lin: solid line) with y ¼ 6.6588x þ 13.964,
y ¼ 2.0817x 10.446 and y ¼ 3.0586x þ 17.438 as equations respectively for Carpaccio, Cima and Robusta for chlorophyll content and y ¼ 4.5184x 11.267,
y ¼ 3.0024x þ 1.1513 and y ¼ 1.6972x þ 4.7525 for CO2 net assimilation, and a polynomial regression of order 2 (pol: dotted line) with y ¼ 0.0283x2 6.9386x þ 14.511,
y ¼ 0.0588x2 1.0742x 13.742 and y ¼ 0.0803x2 4.5982x þ 23.145 as equations respectively for Carpaccio, Cima and Robusta for chlorophyll content and
y ¼ 0.4423x2 8.4054x 6.2965, y ¼ 0.2457x2 þ 0.4456x 5.7112 and y ¼ 0.0404x2 2.4066x þ 6.5356 for CO2 net assimilation.
abiotic stress tolerance (Lee and Luan, 2012). In fact, response to
pathogens leads to ABA signal which, via NADPH oxidase, produce
H202 (Ton et al., 2009). Ozone mimics this ROS production which
acts as a signal to regulate several ion channels finally causing
a stomatal closure (Wilkinson and Davies, 2010). If O3 can change
the functioning of different channels as in the study of Vahisalu et al.
(2010), it would be relevant to study their gene expression in
response to O3 directly in guard cells.
4.3. Differences between the three genotypes
The three genotypes are characterized by differences in stomatal
responses to O3. Robusta was the shortest genotype and displayed
the most important decrease in leaf production and the highest
percentage of fallen leaves. It seemed more sensitive to O3, with
more visible leaf injuries (data not shown). It had the highest
stomatal conductance and the highest chlorophyll content, but it
also showed slower stomatal reactions than the other two genotypes in the control treatment. Its sensitivity may be linked to
that stomatal conductance characteristic, in accordance with the
study of Brosché et al. (2010) which concluded about a major
role of stomatal conductance in O3 sensitivity. Indeed, Robusta
experienced a higher O3 flux, thus a higher POD1 and, as suggested
by Paoletti and Grulke (2010), a slower stomatal response could
play a major role in O3 sensitivity. Carpaccio and Cima reacted quite
similarly and appeared less sensitive than Robusta. Nevertheless,
Carpaccio, which seemed the less sensitive, closed its stomata more
than Cima under O3 treatment, reducing O3 entrance more than
Cima, and reacted more quickly in adjusting its stomatal conductance to environmental parameters. While Robusta sensitivity can
be explained by slower stomatal conductance responses, Cima
sensitivity was not found linked to stomatal behaviour, and may
thus be explained by the second type of defence reactions, i.e.
detoxification processes.
Finally, we can hypothesize that in natural conditions, Robusta
may take more time than Cima and Carpaccio to reach a steady
state due to slower stomatal opening and higher final conductance
(Fig. 7A). At midday, if the VPD rises too much, Carpaccio and Cima
may partially close their stomata to save water, but Robusta is less
reactive and then will lose more water. Finally, at the end of the day,
Robusta may take more time to close its stomata. In the morning,
the stomatal conductance of Robusta may limit its photosynthesis
(Fig. 7A, spotted area). Rapidly, Robusta stomatal conductance may
become higher, leading to higher water losses, especially in the
2
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.07 0.11 0.13 0.10 0.11 0.11 ns
ns
ns
0.03
0.02
0.02
0.04
0.01
0.05
ns
ns
ns
0.07 0.06 0.07 0.17 0.16 0.14 0.02
0.01
0.02
0.01
0.04
0.01
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.08
0.09
0.09
0.12
0.12
0.08
0.01
0.04
0.02
0.01
0.03
0.04
ns
ns
ns
ns
<0.001
ns
ns
ns
ns
0.13
0.10
0.19
0.12
0.06
0.10
1
Dgs
0.01
0.02
0.03
0.02
0.01
0.02
0.04
0.02
0.02
0.01
0.02
0.01
ns
0.03377
ns
ns
0.02477
ns
ns
0.00291
ns
0.12
0.05
0.16
0.05
0.07
0.08
2
0.01
0.01
0.02
0.03
0.02
0.01
ns
ns
ns
ns
0.00386
ns
ns
ns
ns
0.13
0.03
0.16
0.12
0.06
0.04
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
58
60
59
52
28
28
1
v
13
4
8
7
5
2
8
20
4
6
7
5
15
8
23
4
5
8
1.03
0.96
1.37
1.52
0.69
1.09
1
0.00668 ns
ns
ns
ns
ns
82
25
67
34
25
20
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.02759 0.00982 ns
<0.001 <0.001 ns
ns
ns
ns
75
28
61
23
22
31
2
A0
0.16
0.27
0.17
0.12
0.45
0.26
0.21
0.33
0.3
0.16
0.38
0.39
ns
ns
ns
ns
ns
ns
<0.001
ns
ns
1.09
2.39
1.90
2.35
1.18
1.65
2
ns
ns
ns
ns
ns
ns
ns
ns
ns
1.01
1.59
1.05
1.56
1.08
1.85
3
0.05
0.06
0.15
0.27
0.16
0.22
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.49 0.31
0.44 0.18
0.32 0.55
0.37 0.37
0.29 0.39
0.35 0.24
1
A1
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.07 0.31
1.10 0.48
0.17 0.53
0.80 0.18
0.39 0.28
0.09 0.17
2
ns
ns
ns
ns
ns
ns
ns
ns
0.015
0.55 0.18
0.32 0.14
0.79 0.28
0.66 0.12
0.48 0.28
0.85 0.25
3
Carpaccio Ambient
Ozone
Cima
Ambient
Ozone
Robusta Ambient
Ozone
Treatment effect
Carpaccio
Cima
Robusta
Genotype effect
Carpaccio:Cima
Cima:Robusta
Robusta:Carpaccio
Genotype treatment
Carpaccio:Cima:O3
Cima:Robusta:O3
Robusta:Carpaccio:O3
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.27
0.30
0.35
0.36
0.39
0.28
2
ns
ns
ns
0.00
0.03
0.02
0.01
0.06
0.04
ns
ns
ns
ns
ns
ns
0.29
0.30
0.29
0.26
0.31
0.29
Genotype Parameters
gs 0
treatment\time
1
0.06
0.03
0.03
0.01
0.02
0.03
0.03
0.03
0.03
0.05
0.03
0.03
ns
ns
ns
0.00991
ns
ns
ns
ns
ns
0.21
0.16
0.37
0.30
0.24
0.21
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.07
0.06
0.07
0.06
0.12
0.09
1
Dgs
0.01
0.02
0.02
0.03
0.00
0.02
ns
ns
ns
ns
ns
ns
0.0057
ns
<0.001
0.08 0.03
0.01 0.01
0.09 0.05
0.10 0.00
0.11 0.02
0.02 0.01
2
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.07
0.03
0.15
0.04
0.08
0.03
3
0.02
0.01
0.03
0.01
0.03
0.00
ns
ns
ns
ns
ns
ns
ns
ns
ns
29
25
32
21
27
26
1
v
10
8
10
8
7
11
30
32
42
21
24
40
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
ns
0.00243 ns
ns
ns
ns
ns
52 13
1 8
37 22
45 8
42 7
71
2
6
11
13
11
7
26
ns
ns
ns
ns
ns
ns
ns
ns
ns
7.57 0.74
7.43 0.93
7.88 1.03
7.93 0.72
10.90 0.40
9.58 0.85
1
A0
ns
ns
ns
ns
ns
ns
ns
ns
0.03424
7.58 0.21
5.32 0.41
7.93 0.96
5.79 0.64
10.26 0.83
6.86 0.90
2
0.54
0.48
0.71
1.10
0.92
0.30
ns
ns
ns
ns
ns
ns
0.00122
<0.001
<0.001
8.16
3.82
8.71
4.68
9.67
5.07
3
ns
ns
ns
ns
ns
0.02205
ns
ns
ns
13.78
14.02
15.40
15.38
20.50
18.39
1
A1
1.12
1.88
2.46
0.89
0.39
1.83
ns
ns
ns
ns
ns
0.01514
ns
0.02613
<0.001
14.02 0.89
8.87 0.86
16.23 2.27
10.77 0.98
20.98 0.22
12.19 1.97
2
ns
ns
ns
ns
ns
ns
0.00285
<0.001
<0.001
13.76 1.28
6.02 0.62
19.20 1.09
6.43 0.59
17.77 0.25
7.61 0.66
3
Table 4
Dynamic gas exchange responses to a red light increase (from 200 to 800 mmol m2 s1) (means SE) of the three poplar genotypes Carpaccio, Cima and Robusta, submitted to 120 nmol mol1 of O3 or not (control treatment)
after 1, 2 or 3 weeks. Dgs (mmol m2 s1), span of stomatal conductance variation, v (mmol m2 s2), stomatal opening speed, A0 (mmol m2 s1), assimilation before red light variation, A1 (mmol m2 s1), assimilation after red
light variation. Treatment and genotype effect and treatment genotype interaction are considered significant when p < 0.05.
Carpaccio Ambient
Ozone
Cima
Ambient
Ozone
Robusta Ambient
Ozone
Treatment effect
Carpaccio
Cima
Robusta
Genotype effect
Carpaccio:Cima
Cima:Robusta
Robusta:Carpaccio
Genotype treatment
Carpaccio:Cima:O3
Cima:Robusta:O3
Robusta:Carpaccio:O3
Genotype Parameters
gs0
treatment\time
1
Table 3
Dynamic gas exchange responses to a blue light increase (from 0 to 30 mmol m2 s1) (means SE) of the three poplar genotypes Carpaccio, Cima and Robusta, submitted to 120 nmol mol1 of O3 or not (control treatment) after 1,
2 or 3 weeks. Dgs (mmol m2 s1), span of stomatal conductance variation, v (mmol m2 s2), stomatal opening speed, A0 (mmol m2 s1), assimilation before blue light variation, A1 (mmol m2 s1), assimilation after blue light
variation. Treatment and genotype effect and treatment genotype interaction are considered significant when p < 0.05.
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
93
Parameters treatment\time
ns
ns
ns
ns
ns
ns
ns
ns
ns
1734
3677
4673
6081
5873
6274
ns
ns
ns
120
780
1344
1245
2052
1657
0.00247
ns
ns
ns
ns
ns
2309
2151
4414
4939
6670
5321
109
206
433
1386
2389
2026
0.0088
ns
ns
ns
ns
0.0064
0.03739
<0.001
ns
2162 291
3728 94
3699 306
10826 975
8830 887
7852 1513
ns
ns
ns
ns
ns
ns
ns
ns
ns
67
58
42
38
30
25
v
3
1
2
t
1
6
20
14
7
5
5
ns
ns
ns
ns
ns
0.032
ns
ns
ns
85
41
39
22
22
15
2
30
4
3
7
5
1
ns
ns
ns
ns
ns
0.0212
ns
ns
ns
85
40
42
18
19
18
3
31
6
3
3
0
5
A0
ns
ns
ns
ns
0.00689
ns
ns
ns
ns
14.47 0.74
14.64 1.23
12.4 1.49
14.25 0.77
19.21 0.67
13.71 1.36
1
ns
ns
ns
ns
ns
ns
0.00591
<0.001
0.00433
14.27 1.28
9.19 1.22
16.35 1.66
8.55 1.19
17.75 1.76
10.15 1.94
2
A1
ns
ns
ns
ns
ns
ns
ns
0.00642
0.04074
ns
ns
ns
<0.001
<0.001
<0.001
ns
ns
ns
16.90
15.23
15.65
19.40
26.31
19.00
1
12.75 0.97
5.66 0.35
15.74 2.02
6.70 0.35
17.61 0.52
6.20 0.51
3
1.85
3.36
1.39
1.38
2.28
0.34
2
ns
ns
ns
ns
ns
ns
ns
ns
ns
18.88
12.88
19.76
13.13
24.59
15.35
2.01
1.98
3.47
1.87
3.45
2.36
ns
ns
ns
ns
ns
ns
0.01960
<0.001
<0.001
16.93 1.43
7.37 0.34
19.99 2.41
9.32 1.18
23.42 0.87
10.09 0.54
3
Parameters treatment\time
Ambient
Ozone
Cima
Ambient
Ozone
Robusta
Ambient
Ozone
Treatment effect
Carpaccio
Cima
Robusta
Genotype effect
Carpaccio:Cima
Cima:Robusta
Robusta:Carpaccio
Genotype treatment
Carpaccio:Cima:O3
Cima:Robusta:O3
Robusta:Carpaccio:O3
Carpaccio
Genotype
ns
ns
ns
ns
ns
ns
ns
ns
<0.001
1221
1824
3798
1768
8785
4643
0.0022
ns
<0.001
169
275
2770
1183
58
1743
ns
ns
ns
ns
ns
ns
1723
2262
6520
5040
8982
9016
145
122
553
256
2324
250
90
519
108
1106
1756
629
ns
ns
ns
ns
ns
0.01401
ns
ns
ns
1040
1399
1663
4435
5469
6857
0.00118
ns
0.02246
<0.001
0.00935
<0.001
<0.001
ns
<0.001
ns
ns
ns
0.01162
ns
ns
173 5
90 25
79 24
131 6
18 6
17 6
2
0.01605
ns
ns
161 6
81 9
35 14
43 12
16 7
11 2
v
1
3
1
2
t
ns
ns
ns
ns
0.00278
<0.001
ns
ns
ns
149 9
117 34
111 31
72 21
31 9
18 2
3
ns
ns
ns
ns
ns
ns
ns
ns
ns
1.26
1.04
1.76
1.64
1.21
1.33
1
A0
0.34
0.13
0.26
0.01
0.02
0.11
ns
ns
ns
ns
ns
ns
ns
ns
0.0096
1.44 0.15
1.83 0.24
1.62 0.36
2.28 0.25
1.2 0.14
1.91 0.16
2
ns
ns
ns
ns
ns
ns
ns
ns
<0.001
1.37
1.98
1.35
2.13
1.04
2.17
3
0.19
0.19
0.42
0.22
0.2
0.27
ns
ns
ns
ns
ns
ns
ns
ns
ns
1.22
0.78
1.52
1.62
1.54
1.15
1
A1
0.03
0.06
0.64
0.17
0.04
0.11
ns
ns
ns
ns
ns
ns
ns
ns
0.0419
1.57 0.19
1.33 0.09
1.33 0.39
2.14 0.17
1.19 0.13
2 0.26
2
ns
ns
ns
ns
ns
ns
0.0296
ns
ns
1.15
1.91
0.89
2.11
1.29
1.79
3
0.17
0.36
0.39
0.48
0.25
0.24
Table 6
Dynamic gas exchange responses to a VPD increase (from 0.8 to 3 kPa) (means SE) of the three poplar genotypes Carpaccio, Cima and Robusta, submitted to 120 nmol mol1 of O3 or not (control treatment) after 1, 2 or 3 weeks. t
(s), time taken for stomata to close, v (mmol m2 s2), stomatal closing speed, A0 (mmol m2 s1), assimilation before VPD variation, A1 (mmol m2 s1), assimilation after VPD variation. Treatment and genotype effect and
treatment genotype interaction are considered significant when p < 0.05.
Ambient
Ozone
Cima
Ambient
Ozone
Robusta
Ambient
Ozone
Treatment effect
Carpaccio
Cima
Robusta
Genotype effect
Carpaccio:Cima
Cima:Robusta
Robusta:Carpaccio
Genotype treatment
Carpaccio:Cima:O3
Cima:Robusta:O3
Robusta:Carpaccio:O3
Carpaccio
Genotype
Table 5
Dynamic gas exchange responses to a CO2 increase (from 400 to 1200 mmol CO2 mol1) (means SE) of the three poplar genotypes Carpaccio, Cima and Robusta, submitted to 120 nmol mol1 of O3 or not (control treatment) after
1, 2 or 3 weeks. t (s), time taken for stomata to close, v (mmol m2 s2), stomatal closing speed, A0 (mmol m2 s1), assimilation before CO2 variation, A1 (mmol m2 s1), assimilation after CO2 variation. Treatment and genotype
effect and treatment genotype interaction are considered significant when p < 0.05.
94
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
middle of the day, and higher net CO2 assimilation (Fig. 7A, undulated area). When light decreases, Robusta may lose more water,
but its carbon gain may be limited by low light. In the presence of
O3 but before any effects of O3 on stomatal conductance, the O3
uptake of Robusta may be higher at midday, leading to higher
sensitivity.
Since 2011, the threshold for PODY calculations for trees has
been 1 nmol m2 s1, so that a linear relation with biomass loss can
normally be obtained. In our study we show that the use of POD1 to
get a linear relation with physiological parameters is not always
sufficient. Differences of sensitivity within the same species
between genotypes were even observed, indicating that the best
adapted threshold can vary from one genotype to another, from one
species to another and that maybe, for some parameters, the best
adapted relation is not linear.
4.4. Suggested impact of ozone on the daily time course of stomatal
conductance and its effects
Based on our results, we can infer the effect of O3 on the daily
course of stomatal conductance in natural conditions (Fig. 7B). We
showed that (i) in the early morning, opening speed in response to
the increase in blue light could be reduced, (ii) the opening rate in
response to an increase in light was also reduced, and (iii) the
closing speed in response to an increase in CO2 or VPD was reduced.
Thus, such changes may lead to water saving in the morning and
throughout the day (Fig. 7B, spotted area), but in the evening, they
may lead to a loss of water in the presence of O3 compared to the
control (Fig. 7B, undulated area). The O3 flux may be reduced by the
A
95
impact of O3 on stomatal conductance during the day, but in the
evening, as stomata may close more slowly, the O3 flux may be
more important. Finally, net CO2 assimilation may be limited by the
lower stomatal conductance in the morning and during the day,
and in the evening, the limitation may come from lower light, so
that the higher conductance has no positive effect.
5. Conclusions
O3 impacts stomatal conductance by decreasing it, but in this
study we report specific effects of O3 on poplar responses to four
different environmental parameters. Our results show that the
effect of O3 should be taken into account in the stomatal conductance models used for O3 risk assessment, and not only as related to
phenology. The responses of stomatal conductance to variations in
blue light, red light, CO2 and VPD are directly altered by O3. Further
studies are needed to characterize these impacts and improve
stomatal conductance models like the DO3SE model. Moreover, to
explain how O3 modifies the response to those parameters, we
need to improve our knowledge of the impact of O3 on the different
signalling steps, and of the ion channels involved in the stomatal
movements due to variations in environmental parameters.
Acknowledgements
The authors are thankful to Cyril Buré, Stéphane Martin, Franck
Radnai and Aurélie Heinis for technical assistance. The research was
supported by the French National Research Agency, ANR, project
VMCS “Vulnoz”, and Jennifer Dumont was supported by a PhD
grant from the ANR and the Lorraine Region. We thank the nursery
of Guéméné Penfao for providing the cuttings.
Stomatal conductance
References
Stomatal conductance
B
Time
Fig. 7. Hypothetical daily courses of stomatal conductance in natural conditions. (A)
Differences between genotypes with an ambient ozone concentration for Robusta
(dotted line), Carpaccio and Cima (solid line) (B) Differences between low (solid line)
and high (dotted line) ozone concentrations on Carpaccio and Cima.
Ainsworth, E.A., Yendrek, C.R., Sitch, S., Collins, W.J., Emberson, L.D., 2012. The
effects of tropospheric ozone on net primary productivity and implications for
climate change. Annual Review of Plant Biology 63, 15.1e15.25.
ASPA, 2010. Bilan de qualité de l’air en Alsace: Période 2000 à 2009.
Avnery, S., Mauzerall, D.L., Liu, J., Horowitz, L.W., 2011. Global crop yield reductions
due to surface ozone exposure: 1. Year 2000 crop production losses and
economic damage. Atmospheric Environment 45, 2284e2296.
Bagard, M., Le Thiec, D., Delacote, E., Hazenfratz-Sauder, M.P., Banvoy, J., Gérard, J.,
Dizengremel, P., Jolivet, Y., 2008. Ozone-induced changes in photosynthesis and
photorespiration of hybrid poplar in relation to the developmental stage of the
leaves. Physiologia Plantarum 134, 559e574.
Betzelberger, A.M., Gillespie, K.M., McGrath, J.M., Koester, R.P., Nelson, R.L.,
Ainsworth, E.A., 2010. Effects of chronic elevated ozone concentration on
antioxidant capacity, photosynthesis and seed yield of 10 soybean cultivars.
Plant, Cell & Environment 33, 1569e1581.
Brosché, M., Merilo, E., Mayer, F., Pechter, P., Puzõrjova, I., Brader, G., Kangasjärvi, J.,
Kollist, H., 2010. Natural variation in ozone sensitivity among Arabidopsis
thaliana accessions and its relation to stomatal conductance. Plant, Cell &
Environment 33, 914e925.
Büker, P., Morrissey, T., Briolat, A., Fall, R., Simpson, D., Tuovinen, J.-P., Alonso, R.,
Barth, S., Baumgarten, M., Grulke, N., Karlsson, P.E., King, J., Lagergren, F.,
Matyssek, R., Nunn, A., Ogaya, R., Penuelas, J., Rhea, L., Schaub, M., Uddling, J.,
Werner, W., Emberson, L.D., 2012. DO3SE modelling of soil moisture to determine
ozone flux to forest trees. Atmospheric Chemistry and Physics 12, 5537e5562.
Castagna, A., Ranieri, A., 2009. Detoxification and repair process of ozone injury:
from O3 uptake to gene expression adjustment. Environmental Pollution 157,
1461e1469.
Castillo, F.J., Heath, R.L., 1990. Ca2þ transport in membrane vesicles from pinto bean
leaves and its alteration after ozone exposure. Plant Physiology 94, 788e795.
Danielsson, H., Karlsson, G.P., Karlsson, P.E., Pleijel, H., 2003. Ozone uptake modeling
and flux-response relationships e an assessment of ozone-induced yield loss in
spring wheat. Atmospheric Environment 37, 475e485.
Dghim, A.A., Dumont, J., Hasenfratz-Sauder, M.-P., Dizengremel, P., Le Thiec, D.,
Jolivet, Y. Capacity for NADPH regeneration in the leaves of two poplar genotypes differing in ozone sensitivity. Physiologia Plantarum, in press.
Dizengremel, P., 2001. Effects of ozone on the carbon metabolism of forest trees.
Plant Physiology and Biochemistry 39, 729e742.
Dizengremel, P., Le Thiec, D., Bagard, M., Jolivet, Y., 2008. Ozone risk assessment for
plants: central role of metabolism-dependent changes in reducing power.
Environmental Pollution 156, 11e15.
96
J. Dumont et al. / Environmental Pollution 173 (2013) 85e96
Emberson, L.D., Ashmore, M.R., Cambridge, H.M., Simpson, D., Tuovinen, J.-P., 2000.
Modelling stomatal ozone flux around Europe. Environmental Pollution 109,
403e413.
Fagerli, H., Gauss, M., Benedictow, A., Griesfeller, J., Jonson, J.E., Nyiri, A., Schulz, M.,
Simpson, D., Steensen, B.M., Tsyro, S., Valdebenito, A., Wind, P., Aas, W.,
Hjellbrekke, A.-G., Mareckova, K., Wankmüller, R., Iversen, T., Kirkevag, A.,
Seland, O., Vieno, M., 2011. Transboundary Acidification, Eutrophication and
Ground Level Ozone in Europe in 2009. EMEP Status Report 1/2011. The
Norwegian Meteorological Institute, Oslo, Norway.
Felzer, B.S., Cronin, T., Reilly, J.M., Melillo, J.M., Wang, X., 2007. Impacts of ozone on
trees and crops. Comptes Rendus Geoscience, 11e12.
Fuhrer, J., Skärby, L., Ashmorer, M.R., 1997. Critical levels of ozone effects on vegetation in Europe. Environmental Pollution 97, 91e106.
Gerosa, G., Marzuoli, R., Desotgiu, R., Bussotti, F., Ballarin-Denti, A., 2009. Validation
of stomatal flux approach for the assessment of ozone visible injury in young
forest trees. Results from the TOP (transboundary ozone pollution) experiment
at Curno, Italy. Environmental Pollution 157, 1497e1505.
Grulke, N.E., Neufeld, H.S., Davison, A.W., Roberts, M., Chappelka, A.H., 2007.
Stomatal behavior of ozone-sensitive and -insensitive coneflowers (Rudbeckia
laciniata var. digitata) in Great Smoky Mountains National Park. New Phytologist 173, 100e109.
Hayes, F., Jones, M.L.M., Mills, G., Ashmore, M., 2007. Meta-analysis of the relative
sensitivity of semi-natural vegetation species to ozone. Environmental Pollution 146, 754e762.
Hayes, F., Wagg, S., Mills, G., Wilkinson, S., Davies, W., 2012. Ozone effects in a drier
climate: implication for stomatal fluxes of reduced stomatal sensitivity to soil
drying in a typical grassland species. Global Change Biology 18, 948e959.
Heath, R.L., 2008. Modification of the biochemical pathways of plants induced by
ozone: what are the various routes to change? Environmental Pollution 155,
453e463.
Hoshika, Y., Watanabe, M., Inada, N., Koike, T., 2012. Ozone-induced stomatal
sluggishness develops progressively in Siebold’s beech (Fagus crenata). Environmental Pollution 166, 152e156.
Hothorn, T., Bretz, F., Westfall, P., 2008. Simultaneous inference in general parametric models. Biometrical Journal 50 (3), 346e363.
IPCC, 2007. Climate Change 2007: Synthesis Report. Summary for Policymakers.
WG1, AR4. Available from: http://ipccwg1.ucar.edu/wg1/wg1-report.html.
Jarvis, P.G., 1976. The interpretation of variations in leaf water potential and
stomatal conductance found in canopied in the field. Philosophical Transactions
of The Royal Society B: Biological Sciences 273, 593e610.
Kangasjärvi, J., Talvinen, J., Utriainen, M., Karjalainen, R., 1994. Plant defence
systems induced by ozone. Plant, Cell & Environment 17, 783e794.
Karlsson, P.E., Braun, S., Broadmeadow, M., Elvira, S., Emberson, L., Gimeno, B.S., Le
Thiec, D., Novak, K., Oksanen, E., Schaub, M., Uddling, J., Wilkinson, M., 2007.
Risk assessments for forest trees: the performance of the ozone flux versus the
AOT concepts. Environmental Pollution 146, 608e616.
Lee, S.C., Luan, S., 2012. ABA signal transduction at the crossroad of biotic and
abiotic stress responses. Plant, Cell & Environment 35, 53e60.
Le Thiec, D., Rose, C., Garrec, J.P., Laffray, D., Louguet, P., Galaup, S., Loosveldt, P.,
1994. Alteration of element content in guard cells of Norway spruce (Picea
abies) subjected to ozone fumigation and (or) water stress: X-ray microanalysis
study. Canadian Journal of Botany 72, 86e92.
Massman, W.J., 1998. A review of the molecular diffusivities of H2O, CO2, CH4, CO,
O3, SO2, NH3, N2O, NO, and NO2 in air, O2 and N2 near STP. Atmospheric Environment 32, 1111e1127.
Matyssek, R., Wieser, G., Ceulemans, R., Rennenberg, H., Pretzsch, H., Haberer, K.,
Löw, M., Nunn, A.J., Werner, H., Wipfler, P., Oßwald, W., Nikolova, P., Hanke, D.E.,
Kraigher, H., Tausz, M., Bahnweg, G., Kitao, M., Dieler, J., Sandermann, H.,
Herbinger, K., Grebenc, T., Blumenröther, M., Deckmyn, G., Grams, T.E.E.,
Heerdt, C., Leuchner, M., Fabian, P., Häberle, K.-H., 2010. Enhanced ozone
strongly reduces carbon sink strength of adult beech (Fagus sylvatica) e resume
from the free-air fumigation study at Kranzberg Forest. Environmental Pollution 158, 2527e2532.
McAinsh, M.R., Evans, N.H., Montgomery, L.T., North, K.A., 2002. Calcium signalling
in stomatal responses to pollutants. New Phytologist 153, 441e447.
MEDDTL, 2010. Bilan de la qualité de l’air en France en 2010.
Mills, G., Hayes, F., Wilkinson, S., Davies, W.J., 2009. Chronic exposure to increasing
background ozone impairs stomatal functioning in grassland species. Global
Change Biology 15, 1522e1533.
Onandia, G., Olsson, A.-K., Barth, S., King, J.S., Uddling, J., 2011. Exposure to moderate
concentrations of tropospheric ozone impairs tree stomatal response to carbon
dioxide. Environmental Pollution 159, 2350e2354.
Pandey, S., Zhang, W., Assmann, S.M., 2007. Roles of ion channels and transporters
in guard cell signal transduction. FEBS Letters 581, 2325e2336.
Paoletti, E., 2004. Ozone slows stomatal response to light and leaf wounding in
a Mediterranean evergreen broadleaf, Arbutus Unedo. Environmental Pollution
134, 439e445.
Paoletti, E., Grulke, N.E., 2010. Ozone exposure and stomatal sluggishness in
different plant physiognomic classes. Environmental Pollution 158, 2664e2671.
Pei, Z.-M., Murata, Y., Benning, G., Thomine, S., Klusener, B., Allen, G., Grill, E.,
Schroeder, J.I., 2000. Calcium channels activated by hydrogen peroxide mediate
abscisic acid signalling in guard cells. Nature 406, 731e734.
Pinheiro, J., Bates, D., DebRoy, S., Deepayan, S., R Development Core Team, 2012. nlme:
Linear and Nonlinear Mixed Effects Models. In: R Package Version 3.1-103.
Pleijel, H., Danielsson, H., Vandermeiren, K., Blum, C., Colls, J., Ojanperä, K., 2002.
Stomatal conductance and ozone exposure in relation to potato tuber yield e
results from the European CHIP programme. European Journal of Agronomy 17,
303e317.
R Development Core Team, 2012. R: a Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria, ISBN 3900051-07-0. URL. http://www.R-project.org/.
Renaut, J., Bohler, S., Hausman, J.F., Hoffmann, L., Sergeant, K., Ahsan, N., Jolivet, Y.,
Dizengremel, P., 2009. The impact of atmospheric composition on plants: a case
study of ozone and poplar. Mass Spectrometry Reviews 28, 495e516.
Shimazaki, K.I., Doi, M., Assmann, S.M., Kinoshita, T., 2007. Light regulation of
stomatal movement. Annual Review of Plant Biology 58, 219e247.
Sitch, S., Cox, P.M., Collins, W.J., Huntingford, G., 2007. Indirect radiating forcing of
climate change through ozone effects on the land-carbon sink. Nature 448,
791e795.
Ton, J., Flors, V., Mauch-Mani, B., 2009. The multifaceted role of ABA in disease
resistance. Trends in Plant Science 14, 310e317.
Torsethaugen, G., Pell, E.J., Assmann, S.M., 1999. Ozone inhibits guard cell Kþ
channels implicated in stomatal opening. Proceedings of the National Academy
of Sciences of the United States of America 96, 13577e13582.
Vahisalu, T., Puzorjova, I., Brosche, M., Valk, E., Lepiku, M., Moldau, H., Pechter, P.,
Wang, Y.S., Lindgren, O., Salojarvi, J., Loog, M., Kangasjarvi, J., Kollist, H., 2010.
Ozone-triggered rapid stomatal response involves the production of reactive
oxygen species, and is controlled by SLAC1 and OST1. Plant Journal 62, 442e453.
Van Dingenen, R., Dentener, F.J., Raes, F., Krol, M.C., Emberson, L., Cofala, J., 2009.
The global impact of ozone on agricultural crop yields under current and future
air quality legislation. Atmospheric Environment 43, 604e618.
Vingarzan, R., 2004. A review of surface ozone background levels and trends.
Atmospheric Environment 38, 3431e3442.
Wang, Y., Nogushi, K., Terashima, I., 2011. Photosynthesis-dependent and -independent responses of stomata to blue, red and green monochromatic light:
differences between the normally oriented and inverted leaves of sunflower.
Plant and Cell Physiology 52, 479e489.
Wellburn, A.R., 1994. The spectral determination of chlorophylls a and b, as well as
total carotenoids, using various solvents with spectrophotometers of different
resolution. Journal of Plant Physiology 144, 307e313.
Wilkinson, S., Davies, W.J., 2010. Drought, ozone, ABA and ethylene: new insights
from cell to plant to community. Plant, Cell & Environment 33, 510e525.
Wittig, V.E., Ainsworth, E.A., Naidu, S.L., Karnosky, D.F., Long, S.P., 2009. Quantifying
the impact of current and future tropospheric ozone on tree biomass, growth,
physiology and biochemistry: a quantitative meta e analysis. Global Change
Biology 15, 396e424.
Résultats
2. REPONSES DISTINCTES DES STOMATES SUR LA FACE ABAXIALE
ET ADAXIALE EN REPONSE A L ’OZONE CHEZ TROIS GENOTYPES
DE PEUPLIER EURAMERICAIN
Sous l’effet de l’ozone, nous avons montré que la conductance stomatique des feuilles
baisse et que les vitesses d'ouverture et de fermeture des stomates aux différents facteurs
environnementaux sont ralenties. Les mouvements stomatiques sont liés à des flux d’ions
impliquant des canaux plasmiques et vacuolaires. L’impact de l’ozone sur les mouvements
stomatiques en réponse aux variations de paramètres environnementaux pourrait être le
résultat de différents effets directs sur les cellules de garde comme une modification de
l’ultrastructure, une perturbation du contenu en éléments minéraux ou encore une altération
des flux par les canaux ioniques.
Nous avons donc cherché à comprendre par quels mécanismes les mouvements
stomatiques étaient perturbés par l’ozone, grâce à la combinaison d’approches
microscopiques et génomique. De plus, le peuplier étant une espèce amphistomatique, nous
avons choisi d’étudier l’effet de l’ozone sur la conductance stomatique de chacune des faces
de la feuille distinctement, afin de voir s’il existait des différences. Cette étude montre que :

la conductance stomatique baisse d’abord sur la face supérieure avant d’être
légèrement réduite sur la face inférieure.

l’ozone entraîne un accroissement du nombre de mitochondries dans les cellules
de garde des deux faces.

l’ozone induit une augmentation du contenu en calcium dans les cellules de garde
de la face supérieure des feuilles. Chez le génotype résistant (Carpaccio)
l’augmentation a lieu sur les deux faces.

l’ozone provoque une diminution du contenu en chlore dans les cellules de garde
sauf chez le génotype le plus sensible (Robusta), où nous observons un
accroissement.
55
Résultats

l’ozone conduit à une hausse du contenu en potassium dans les cellules de garde
qui apparait plus tôt chez le génotype le plus sensible (Robusta).

l’ozone engendre une baisse du contenu en phosphore dans les cellules de garde
des deux faces avec un effet plus marqué sur la face inférieure.

l’expression des gènes codant pour les canaux de calcium vacuolaires et les
anhydrases carboniques impliquées dans la réponse des stomates au CO2 est
fortement diminuée.
Ces résultats ont été soumis dans le journal Plant, Cell & Environment.
56
Résultats
Distinct responses to ozone of abaxial and adaxial stomata in three euramerican poplar
genotypes
Running title: Guard cells response for ozone tolerance
Dumont Jennifer, Cohen David, Gérard Joëlle, Jolivet Yves, Dizengremel Pierre, Le Thiec
Didier.
ABSTRACT
Ozone induces stomatal sluggishness impacting photosynthesis and transpiration. Here, we
seek the origin of stomatal movements change on abaxial and adaxial sides of the leaf of three
euramerican poplar genotypes differing in ozone sensitivity. Effect of ozone on stomatal
conductance of each leaf side was studied by gas exchange measurements. Ultrastructural
modifications of guard cells were studied by TEM. Gene expression of ions channels and
transporters involved in stomatal movements and the related element contents were quantified
by qPCR and X-ray microanalyses, directly in stomata. We report a more important impact of
ozone on stomatal conductance of the adaxial side of leaf correlated with higher calcium
content in guard cells. The expression of H+/Ca2+-antiports (CAX1 and CAX3 homologues)
and β-carbonic anhydrases (βCA1 and βCA4) was strongly decreased. Decoupling between
the rate of stomatal opening and potassium concentrations in guard cells seems to settle earlier
in the sensitive genotype, Robusta. The number of mitochondria in guard cells was increased
with ozone. Ozone impacts stomatal movements via ion fluxes, with a specific calcium signal.
The increased number of mitochondria could answer to an increasing energy request for
detoxification and repair processes and may act as calcium buffer.
Key words: Populus deltoides x nigra; ozone; guard cell; abaxial and adaxial sides; gas
exchange; element content; ultrastructure; gene expression.
57
Résultats
INTRODUCTION
Forest ecosystems, covering 30% of land area of Earth (FAO, 2006), are ecologically crucial,
currently constituting the most important carbon sinks. Ozone (O3) is a tropospheric gaseous
pollutant formed by photochemical reactions between sunlight and air containing nitrogen
oxides emitted from human activities (with biotic and abiotic VOCs). Key player of global
warming, O3 is a greenhouse gas which causes a major impact on plants growth and yield,
thus limiting the carbon sink possibilities (Sitch et al. 2007; ICP vegetation, 2012). O3 causes
important economic losses and represents a threat to ecosystems (Hayes et al. 2007; Avnery
et al. 2011a; Ainsworth et al. 2012). As the tropospheric ozone concentrations are predict to
increase in the coming decades, the declines in agriculture and forestry productivity will
become more important and the food security will be reduced (Felzer et al. 2007; Van
Dingenen et al. 2009; Avnery et al. 2011b).
Ozone enters the leaf through stomata and is rapidly converted in the apoplast in reactive
oxygen species (ROS), leading to an oxidative stress. This results in visible and physiological
damages in plants (Wittig et al. 2009). At leaf level, ozone impairs photosynthesis, reduces
stomatal conductance and increases respiration (Heath, 1994; Dizengremel, 2001; Ainsworth
et al. 2012). Stomatal conductance, which modulates ozone entrance in the leaf, and the
capacity of ROS detoxification processes, which limits biological effect of ozone, are the two
major protections involved in ozone effective flux calculation (Dizengremel et al. 2008;
Castagna and Ranieri, 2009).
The regulation of stomatal conductance plays a key role in plant adaptation to
environmental conditions changes, especially under stress. It has been shown that ozone
impairs the stomatal movements, leading to perturbation of the stomatal responses to
environmental parameters and sluggish stomatal behaviour. Indeed, after ozone treatment,
stomata behave slower to open or close when changing light conditions, VPD or CO2
concentrations (Paoletti, 2005; Grulke et al. 2007; Paoletti & Grulke, 2010; Dumont et al.
2013).
Stomatal movements are due to ion fluxes which require the participation of many plasma
membrane and vacuolar ion channels (Pandey et al. 2007). Stomatal opening is driven by a
membrane hyperpolarisation which leads to an accumulation of K+ and sugars accompanied
by their counter ions (Cl-, NO3- and malate2-), leading to an increase of osmotic potential and
water uptake in apoplasm (Fischer, 1968; Outlaw & Manchester, 1979). The closure is the
58
Résultats
reverse situation under the control of a Ca2+ signal which induces anion efflux leading to
membrane depolarisation and K+ efflux.
In the present study, we examine whether the direct effect of ozone on stomatal
conductance is different on each leaf side in three poplar genotypes more or less sensitive to
ozone. We attempt to precise which step of stomatal movement was disturbed to explain the
sluggish behaviour of stomata induced by ozone. In order to see if a particular ion flux was
modified and at what channels it could be linked, we combine element content X-ray
microanalyses and gene expression analyses on microdissected stomata of adaxial and abaxial
sides. Finally, a possible change in the ultrastructure of guard cells was checked by
microscopy techniques.
MATERIALS AND METHODS
Plant culture and exposure conditions
The plant material was grown as described in Dumont et al. (2013). Briefly, cuttings of three
Euramerican poplar genotypes (Populus deltoides x Populus nigra: 'Carpaccio', 'Cima' and
'Robusta'), selected from a previous study on the basis of contrasting responses to O3 (i.e.
visible injury, growth, number of fallen leaves., data not shown), were planted and grown in a
growth chamber for 5 weeks. Twenty-nine plants of each genotype were transferred for an
acclimated week in eight fumigation chambers at 75/85 % relative humidity (day/night) with
a 14h light period (250 µmol.m-2.s-1 at mid leaf height from 08:00 to 22:00) and a temperature
of 23/20 °C (day/night). The experiment was first conducted for 3 weeks on Carpaccio and
Cima, and was later duplicated on Robusta with half of chambers. Four fumigation chambers
were used for each treatment (charcoal-filtered air or fumigation of ozone at 120 nmol mol-1
during 13h). O3 was produced from pure O2 with two ozone generators (OZ500; Fischer,
Bonn, Germany and CMG3-3; Innovatec II, Rheinbach, Germany) and injected directly in the
chambers 1 h after the beginning of the photoperiod until its end. A set of analysers (O341M;
Environment S.A., Paris, France) was used to monitor O3 concentrations. The O3 flux was
calculated and data are shown in Dumont et al. (2013).
Gas exchange measurements
The first fully-expanded leaf was identified for the gas exchange measurements (15th, 11th and
11th leaf from the top for Carpaccio, Cima and Robusta respectively). The stomatal
59
Résultats
conductance (gs) of the abaxial (lower) and adaxial (upper) sides were measured with a leaf
porometer (SC-1 porometer, Decagon Devices, Inc., Pullman, Washington). The
measurements were carried out 3 times a week, two hours after switching on the lighting in
the morning.
Sampling for microscopy analysis
At day 0, the first fully-expanded leaf at the beginning of the experiment (15th, 11th and 11th
leaf from the top for Carpaccio, Cima and Robusta respectively) of four trees of each
genotype was sampled. At day 11, the second fully-expanded leaf at the beginning of the
experiment of four and two other trees of each genotype submitted to ozone and control
treatment respectively. At day 18, the first fully-expanded leaf at the beginning of the
experiment of four trees of each genotype of each treatment was sampled. A square of 1cm²
was cut and immediately immersed in a fixative solution of 2.5 % glutaraldehyde and 0.2 M
phosphate buffer pH 7.2 at 4°C for Transmission Electron Microscopy observations. Three
discs of leaves were sampled by a punch, put in an eppendorf tube and immediately flash
frozen in liquid nitrogen for Scanning Electron Microscopy analysis. They were freeze-dried
at -40°C for 40 h at a pressure of 10 Pa in a FreeZone Plus freeze-dryer (Labconco, Kansas
City, Missouri) and then the temperature was turned back progressively to 20°C within 10 h.
Transmission electronic microscopy observations
One to 2 mm² were cut using a razor blade from the square immersed in fixative solution of
2.5% (v/v) glutaraldehyde fixative in 0.1 M phosphate buffer pH 7.2. Leaf samples were
infiltrated under vacuum in fixative solution and were maintained at 8°C for 4h. After being
rinsed in the same phosphate buffer by 5 washes, samples were post-fixed in 2% osmium
tetroxide in the rinsing buffer for 1 h at 4°C. The samples were washed in rinsing buffer 3
times of 5min followed by distilled water prior to slow dehydration through a graded acetone
series. Samples were embedded in Epon 812 (EMS, Hatfield, US) according to the
manufacturer’s instructions. These samples were orientated in moulds and the resin
polymerised at 60°C for 48 hours. The resultant resin blocks were trimmed before ultra-thin
sections (80nm) were obtained on a RMC MT7 ultramicrotome, mounted on Formwar copper
grids, stained with uranyl acetate and lead citrate 4%. Examination of sections was performed
with a transmission electron microscope (TEM) PHILIPS CM12 operating at 80kv.
60
Résultats
Stomatal density and size of stomata
As stomata are located on both sides of Populus leaf, the three freeze-dried discs of each
sample were divided in two pieces to study separately the two sides of each sample. They
were observed under a controlled pressure scanning electron microscope (SEM) with the use
of a backscattered secondary electron detector (BSD) at accelerating voltage of 15kV and
magnification of 250x for stomatal density and 800x for size measurements, after being
evaporated by carbon. Three and one digital images of each side of each disc of each sample
at 250x and 800x were captured. The total number of stomata within an image was
determined by manual counting, using the convention of excluding stomata overlapping the
margins of the image, and was converted to the number of stomata per mm2 of abaxial and
adaxial leaf surface. Stomata length and width were also measured on 6 stomata by image at
800x.
X-ray microanalysis
The material to be analysed was prepared according to the method used in Le Thiec et al.
(1994). Leaves were examined under a SEM (model 1450VP, Leo, Cambridge, UK)) at 15
kV, equipped with a dispersive energy microanalysis system (EDX, silicon drift detector of
80mm2, Oxford Instruments). Point and Identify Module was used to target guard cell across
the freeze-dried surface at magnification 1000x. X-ray microanalyses of element content were
performed on 10 guard cells of each leaf side of each disc of each sample.
Guard cells microdissection
After 18 days from the beginning of the fumigation, the first fully-expanded leaf at the
beginning of the experiment (15th, 11th and 11th leaf from the top for Carpaccio, Cima and
Robusta respectively) of three trees of each genotype of each treatment was sampled. The
leaves were cut in half by removing the midrib and were immediately flash frozen in liquid
nitrogen. They were freeze-dried at -40°C for 40 h at a pressure of 10 Pa in a FreeZone Plus
freeze-dryer (Labconco, Kansas City, Missouri) and then the temperature was turned back
progressively to 20°C within 10 h. Leaves were stored under vacuum in a desiccator at room
temperature to avoid rehydration. Pieces of lower and upper epidermis were isolated by
scraping gently the epidermis with a razor blade above a glass side. The pieces were fixed by
evaporation of few drops of ethanol. Laser microdissection and pressure catapulting of guard
61
Résultats
cells were carried out using the PALM MicroBeam system (Carl Zeiss MicroImaging GmbH,
Jena, Germany). For each sample, 500 stomatal complexes were cut and catapulted in 0.2 ml
tubes with adhesive cap. The room temperature was kept at 19°C and air humidity decreased
to 45% to avoid rehydration and subsequent RNA degradation.
RNA extraction and cDNA amplification.
Total RNA was extracted from 500 microdissected stomata using Qiagen Micro Plus Kit
(Qiagen) according to the manufacturer’s instructions. TransPlex® Complete Whole
Transcriptome Amplification (Sigma) was used for RNA reverse-transcription and cDNA
amplification according to the manufacturer’s instructions. Amplification was performed on a
Mx3000P QPCR System (Agilent technologies). SYBR Green (Sigma-Aldrich) and ROX
(Agilent Technologies) were added to the reaction mixture to monitor amplification yield.
Amplified cDNA was purified using the QIAamp DNA Micro Kit (Qiagen) according to the
manufacturer’s instructions and quantified on a Nanodrop ND-1000 spectrophotometer
(Thermo-Fischer). cDNA concentration was adjusted to 5 ng µL-1 for each sample.
Quantitative real-time polymerase chain reaction (qPCR) analyses
Gene-specific primers (Supporting Information, Table S1) were designed based on the last
version of Populus Trichocarpa genome sequence assembly on Phytozome V8.0 (Goodstein
et al. 2012) using Primer 3 software (Untergasser et al. 2012). Primer specificity was checked
by sequencing PCR products (Beckman Coulter Genomics). Quantitative PCR was performed
using an Mx3000P QPCR System (Agilent technologies) according to the manufacturer’s
recommended cycling program (10 min 95°C, 40 cycles of 5 s at 95°C, and 20 s at 58 or 60°C
depending on primers). A dissociation curve was generated in order to check amplification
product specificity. The reaction mixture contained 10µL Brillant III Ultrafast SYBR green
QPCR Master mix, 0.3µL ROX (Agilent Technologies), 250 nM of gene-specific primers and
2.2 μL cDNA (diluted at 5 ng µL-1) in each 20 μL reaction. No-template control (NTC)
reactions were prepared for each gene. The Ct values were determined with the same
threshold and PCR efficiency was estimated using a standard curve for each gene and each
genotype. Efficiency values were taken into account in all subsequent calculations. Gene
expressions were analysed using GeneNorm program (Vandesompele et al. 2002; Mestdagh
62
Fig. 1 Effects of ozone (control in white and ozone in black) on stomatal conductance (gs) of leaf (a,
b, c), of the upper side only (d, e, f) and the lower side only (g, h, i) of Carpaccio (a, d, g) (circles),
Cima (b, e, h) (squares) and Robusta (c, f, i) (triangles). Significant differences between the two
treatments are indicated by * (p<0.05) ** (p<0.01) or *** (p<0.001).
Résultats
et al. 2009) allowing the identification of five reference genes (GOGAT6, UBL, OST26,
GLR2 and KAT3V2) for gene expression normalization.
Statistical analyses
The data obtained from MEB analyses were fitted with a linear model, with treatment, side
and genotype as factors. Contrast analyses were performed to test for genotype and side effect
before fumigation and treatment effect for each genotype and each side. All the porometer
data were modelled as linear model, with treatment and genotype as factors. Normality and
homoscedasticity of standardized residuals were graphically checked using quantile-toquantile and residual-vs-predicted plots. An ANOVA was used to test the differences between
genotype and the treatment effect at each data for each leaf side. In case of an interaction,
contrast analyses were performed to test for treatment effect within each genotype. Data were
analysed using R 2.15.2 (R Core Team, 2012) and multcomp package (Hothorn et al. 2008).
Effects were considered significant when p < 0.05. Cluster analysis was performed using
Euclidean distance on the gene expression dataset with MeV (Saeed et al. 2003,
2006).
RESULTS
Characterization of the effect of ozone on stomatal conductance of each leaf side
Under filtered air conditions, Carpaccio has a 20% lower total stomatal conductance than
Cima and Robusta (Fig. 1a,b,c). The stomatal conductance of the upper side of the leaves
represents 41, 37 and 34% of the total stomatal conductance of Carpaccio, Cima and Robusta
respectively (Fig. 1d,e,f).
Ozone decreases significantly the total stomatal conductance of the three genotypes (Fig.
1a,b,c). It declines by around a quarter from the fifth day of treatment in Cima (Fig. 1b) and
Robusta (Fig. 1c) and from the eighth day of treatment in Carpaccio (Fig. 1a). Since the fifth
day, the stomatal conductance of the upper side is halved in all three genotypes (Fig. 1d,e,f)
whereas the stomatal conductance of the lower side is stable in Cima (Fig. 1h) and shows a
globally non significant diminution of around 20% in Carpaccio and Robusta (Fig. 1g,i).
Observation by microscopy
On the lower side, stomatal density is more than twice as important as on the upper side with
65% of the total number of stomata on the lower side in Carpaccio and 62% in the other two
63
Table 1
Stomatal density and size of stomata of adaxial and abaxial sides of leaf of three poplar genotypes
under ozone or charcoal filtered air treatment. (mean ± SE)
Genotype Treatment
Carpaccio
(C)
Cima
(I)
Robusta
(R)
Genotype
effect
Side effect
Control
Ozone
Control
Ozone
Control
Ozone
Carpaccio
Cima
Robusta
Carpaccio
Ozone
effect
Cima
Robusta
Stomatal
Stomata length
density
(µm)
(stomata/mm²)
138 ± 2
32.1 ± 0.2
Lower
76 ± 1
32.6 ± 0.3
Upper
134 ± 2
32.5 ± 0.2
Lower
77 ± 1
32.9 ± 0.3
Upper
138 ± 2
32.0 ± 0.2
Lower
85 ± 1
29.6 ± 0.2
Upper
132
±
2
32.8 ± 0.2
Lower
85 ± 1
30.9 ± 0.2
Upper
146 ± 1
31.6 ± 0.2
Lower
90 ± 1
30.4 ± 0.2
Upper
144 ± 2
33.5 ± 0.2
Lower
87 ± 1
30.6 ± 0.3
Upper
Statistical analyses
Leaf
side
Lower
Upper
Lower
Upper
Lower
Upper
Stomata
width (µm)
17.0 ± 0.2
16.7 ± 0.2
16.5 ± 0.2
15.7 ± 0.2
17.5 ± 0.2
15.7 ± 0.2
17.2 ± 0.2
14.6 ± 0.2
17.4 ± 0.2
15.8 ± 0.2
17.9 ± 0.2
15.4 ± 0.2
<0.001
<0.001
ns
<0.001
<0.001
<0.001
ns
ns
ns
ns
ns
ns
ns
<0.001
<0.001
ns
ns
0.0128
<0.001
<0.001
ns
ns
<0.001
<0.001
ns
<0.001
ns
<0.001
ns
ns
Résultats
genotypes (Table 1). Robusta has the highest stomatal density on both sides with 6% more
stomata/mm² than the other two genotypes on the lower side and 6 and 18% more than Cima
and Carpaccio respectively, on the upper side of the leaf. Stomata are equally large in all the
genotypes but a little bit longer in Carpaccio than in Cima or Robusta. The size of stomata is
the same between the two sides of leaf in Carpaccio but stomata are 11% larger and around
6% longer on the lower side of the other two genotypes. The ultrastructure observation with
TEM revealed no difference between side and genotype (Fig. 2).
Ozone has no effect on the stomatal density on both sides of the leaves (Table 1) and only
minimal effects on the size of stomata. In ozone conditions, the length of stomata in Cima
increases slightly by only 4% on the upper side and 3% on the lower side and in Robusta by
6% only on the lower face. Regarding the width of stomata, it is slightly decreased only on
the upper side by 6% in Carpaccio and 8% in Cima. No ultrastructural damage in guard cells
was visible in response to ozone (Fig 2). Ozone has no effects on the number of chloroplasts
or starch grains but it increases strongly the number of mitochondria in guard cells of both
sides of leaf (Fig 2b,c).
Analyses of the element content in guard cells
In ambient condition, the calcium, chlorine, potassium and phosphorus contents are 30%,
15%, 20% and up to 25% higher respectively in the guard cells of the lower side than of the
upper side of leaf in all the genotypes. The calcium content is around 25% lower in Cima than
in Carpaccio and Robusta on both sides (Fig. 3a). The chlorine content in Robusta is twice as
important as in Carpaccio and Cima (Fig. 3b). The potassium content is slightly lower in
Carpaccio than in Cima and Robusta on both sides (Fig. 3c). The phosphorus content in guard
cell of the lower side of the leaf is more than 10% higher in Cima than in the other two
genotypes whereas on the upper side there is no difference.
From 11 days of treatment, ozone increases strongly the calcium content of guard cells of
the upper side of leaf in the three genotypes, especially in Carpaccio (Fig. 3e). In contrast, on
the lower side, the calcium content is only increased in Carpaccio and is even decreased by
10% in Robusta.
In response to ozone, from 11 days of treatment, while in Carpaccio the chlorine content in
guard cells on both sides of the leaf is greatly reduced, in Robusta the opposite effect is
64
Fig. 2 General view of guard cells submitted to (a) control and (b) ozone treatments. Proliferation of
mitochondria was typical in ozone treatment (c). Mitochondria (m), vacuoles (v), cell wall (cw) and
starch grain (st) inside chloroplasts can also be seen. Bars = 1 µm
Fig. 3 Element contents (Ca (a) and (e), Cl (b) and (f), K (c) and (g), P (d) and (h)) in guard cells of
the upper (pastel colour) and lower sides (bright colour) of leaves of three poplar genotypes, Carpaccio
(orange), Cima (green) and Robusta (blue), before fumigation (a, b, c, d) and effect of ozone relative
to control (%) after 11 and 18 days of treatment (e, f, g, h). Significant differences between genotypes,
sides of leaves or treatments are indicated by * (p<0.05) ** (p<0.01) or *** (p<0.001).
Fig. 4 Heat map representing the effects of ozone on the expression of putative genes of channels
involved in stomatal movements in guard cells of the upper (Upp) and lower (Low) sides of leaves of
three poplar genotypes, Carpaccio (C), Cima (I) and Robusta (R) after 18 days of treatment.
Compounds are clustered using Euclidean distance.
Résultats
observed (Fig. 3f). In Cima, the chlorine content is decreased only in guard cells of the lower
side and is slightly increased after 18 days of treatment in guard cells of the upper side.
Ozone increases significantly potassium content in guard cells of both sides of leaves in
Robusta from 11 days of treatment, whereas in Carpaccio and Cima, it is increased only from
18 days of treatment (Fig. 3g).
The phosphorus content in guard cells of both sides of the leaf is significantly decreased
from 11 days of ozone treatment, especially on the lower side (Fig. 3h). The decrease is more
important in Cima in which it is almost halved, than in Carpaccio or Robusta.
Effect of ozone on the expression in guard cells of genes involved in stomatal movements
Most of the genes involved in stomatal movements exhibit a repressed expression under
ozone treatment (See Fig. S1 for complete dataset). Hierarchical clustering reveals four main
groups of genes with different pattern of regulation of expression in response to ozone (Fig.
4). (i) The expression of CAX1, CAX3 and CA1 is strongly repressed (more than 10 times) in
guard cells of both side of leaf in all genotypes. (ii) The expression of AHA1115, CAX16 and
OST2 is quite strongly repressed in guard cells of both side of leaf in almost all the genotypes.
(iii) The expression of OST218, CLCa, TPK11, CHL, NHX114, CLCa6, GORK and SLAC1 is
globally enhanced, especially for OST218, in guard cells of both side of leaf in almost all
genotypes. (iv) The expression of genes such as AKT2, GLR25, CA4, KAT1/2, TPC1, PHOT2,
NHX1, QUAC1, PHOT1 and GORK4 is repressed in guard cells of both side of leaf in almost
all genotypes.
As illustrated by the PCA, the variance in gene expression in guard cells was explained by
27%, 15%, 10% and 8% by four components, PC1, PC2, PC3 and PC4, respectively (Fig. 5).
PC1 shows the ozone effect by separating ambient and ozone samples. PC2 isolates the
sensitive genotype, Robusta from Cima and Carpaccio (Fig. 5a). PC3 separates samples from
the two sides of leaf only in Carpaccio and Cima, even if the separation is clearer in
Carpaccio than in Cima (Fig. 5b). PC4 differentiates Cima from Carpaccio.
The PC1 separation is mainly due to genes shown in Fig. 4 to be regulated under ozone
treatment such as CAX1 and CA1 or OST218 and TPK11 (Fig. 5c). Robusta is principally
characterized by a higher expression of PHOT29 and CA4 and a lower expression of CHL,
TPK1, CAX16 and CAX3 than Carpaccio and Cima. Carpaccio is essentially typified by
higher expression of NHX110 and KAT36 (under ambient conditions) and a lower expression
65
(a)
(b)
(c)
(d)
Fig. 5 Principal Component Analysis score plot of PC1 and PC2 (a), PC3 and PC4 (b) and the
corresponding PCA loading plots (c and d) of the normalized gene expression in guard cells of the
upper (upp) or lower (low) sides of leaves of three poplar genotypes, Carpaccio (orange circles), Cima
(green squares) and Robusta (blue triangles) submitted to ambient (A) or ozone treatment (O) after 18
days.
Résultats
of CLCa than Cima (Fig. 5d). Cima is mostly characterized by higher expression of TPK11
and lower expression of GLUR3, OST218 and PHOT29 than Carpaccio. The differentiation
between the two sides is due to some genes preferentially expressed on the lower side of
leaves such as AHA11, QUAC1 or CLCa6 (except in Robusta). GLUR32 is also more
expressed on the lower side but only in ambient conditions whereas SLAC1 and OST2 have
higher expression in ozone conditions only on the lower side.
DISCUSSION
Whatever the genotype, in response to ozone, the total stomatal conductance is lower, thus
limiting ozone uptake and risk of oxidative stress, but also carbon assimilation. This reduction
is almost only due to the ozone effect on the leaf upper side. Indeed, stomatal conductance on
the lower side is weakly impacted, or even not at all in Cima. A deposition effect of ozone
from top to bottom is not excluded, despite the air renewal in growth chamber, and could
result in higher ozone flux on the leaf upper side than on the lower side. In addition, the upper
side is exposed to a more intense light which may generate additional ROS production (Apel
and Hirt, 2004). The lower stomatal conductance in response to ozone may be due to an
amplified ROS production caused by higher ozone flux and light intensity on the upper side.
Ozone leads to sluggish stomatal responses to variation of environmental parameters.
(Paoletti 2005; Paoletti and Grulke, 2010; Dumont et al. 2013). This effect is not caused by
ultrastructural damage but is more likely due to a perturbation of the ion fluxes in guard cells.
In our study, we observed a lower stomatal conductance under ozone, resulting from a smaller
and/or lower opening in the morning, since the measurements have been carried out two hours
after the beginning of the light phase. This is coherent with the slower opening in response to
increase of blue light and the lower amplitude of opening in response to increased red light
shown in response to ozone (Dumont et al. 2013).
Phototropins function as blue-light receptors in guard cells whereas stomatal response to
red light is linked to reduction in internal CO2 concentrations (Ci), even if a direct effect of
red light on guard cell chloroplasts is not excluded (Shimazaki et al. 2007). A light-signal is
transmitted from PHOT1 and PHOT2 to the plasma membrane H+-ATPase which is activated.
Protons efflux causes a hyperpolarisation of the membrane which drives the accumulation of
K+ by inward potassium channels, a decrease in water potential and water uptake (Schroeder
et al. 2001). Sugars produced by photosynthesis or resulting from degradation of starch can
66
Résultats
also accumulate in guard cells to maintain stomatal opening (Lawson, 2009). In response to
ozone, we observed a decreased expression of PHOT1 and PHOT2 genes which can be linked
to the slower opening to blue light (Dumont et al. 2013). In addition, ROS have been shown
to inhibit the blue light-dependent H+ pumping and thus, stomatal opening (Shimazaki et al.
2004). The observed phosphorus content decreased in guard cell by ozone treatment could
participate to
the inhibition
of H+-ATPase.
Phosphatidylinositol
4,5-bisphosphate
[PtdIns(4,5)P2] is an important signal molecule involved in various processes such as guard
cell movements (Jung et al. 2002; Lee et al. 2007) and especially in light-induced stomatal
opening. We can hypothesize that if less phosphorus is present in the guard cell it will impact
the concentration of PtdIns(4,5)P2. It has also been reported that ozone and ROS inhibit
inward K+ channels (Torsethaugen et al. 1999; Zhang et al. 2001) as confirmed here at the
gene expression level with the ozone inhibition of the expression of inward K+ channels
genes.
However, as we observed a lower opening with ozone, we should notice lower potassium
content in guard cell with lower counter ions concentrations and stronger calcium content. In
our study, a decrease in chlorine is observed except in the sensitive genotype Robusta, and an
increase in potassium, earlier in Robusta than in Carpaccio and Cima. Chlorine is not the only
potassium counter ions, the anion influx may take the form of other anions, like malate2-. Xray microanalyses technique only gives the global element content of cells, with no distinction
between subcellular compartments. The increase in potassium content in response to ozone
compared to ambient treatment may be caused by potassium retention in the vacuole or in the
cytosol due to a deregulation of outward potassium channels on tonopast or plasma
membrane.
Indeed, there is a time effect leading to a progressive increase of potassium content in
guard cell, earlier in the sensitive genotype. This progressive increase should be linked to a
wider opening; it therefore needs to be counterbalanced by other factors to cause lower
opening, such as a lower sugar concentration in stomata. In response to ozone, the increased
calcium content is correlated with the reduced stomatal conductance on the upper side in the
three genotypes and on the lower side only in Carpaccio. During stomatal opening, the
cytosolic Ca2+ concentration decreases because of Ca2+ efflux and storage in organelles,
especially the vacuole. Genes encoding the Ca2+/H+ vacuolar antiporters are strongly downregulated which can lead to an impaired Ca2+ storage in the vacuole and higher Ca2+ cytosolic
67
Résultats
concentrations. In addition, these genes are constitutively much less expressed in the sensitive
genotype Robusta, which is characterized by slower stomatal opening and closure, even under
ambient conditions (Dumont et al. 2013). In response to ozone, guard cells exhibit more
mitochondria. This increase could support the higher respiration in order to provide enough
energy to meet the increased needs for detoxification and repair processes as observed
previously in Norway spruce (Kivimäenpää et al. 2001; 2004). They can also act as calcium
buffer with a possible resting free Ca2+ concentration of 200 nM in mitochondria (Stael et al.
2012), and then be a key player in the spatiotemporal patterning of Ca 2+ signals by rapidly
removing Ca2+ from the cytosol (Hetherington and Brownlee, 2004). Moreover, it has recently
been suggested that an influx of Ca2+ in mitochondria can lead to a pulse of mitochondrial
membrane potential to regulate respiratory bioenergetics and counteract ROS production in
response to stress (Schwarzländer et al. 2012). At last, the higher number of mitochondria in
guard cells of O3-treated plants could be related to the impairment of CO2 assimilation in
response to ozone and subsequently the need to oxidize the excess of reducing power initially
formed in the chloroplasts by photochemical reactions (Scheibe et al. 2005). Generally these
conditions were suitable for an higher activity of the alternative oxidase, a mitochondrial
enzyme known as an antioxidant enzyme, susceptible to dampen ROS generation and for
which genes were more expressed under ozone conditions (Ederli et al. 2006; Vanlerberghe et
al. 2009). The increase of calcium content observed in response to ozone may be due to an
alteration of the calcium efflux, or an alteration of a channel among the many involved in
calcium released from cellular compartments. The initial activation of anion channel involved
in stomatal closure is carried by an increase in cytosolic Ca2+ concentration (Schroeder et al.
2001). In response to ozone, if the cytosolic calcium content is maintained higher, then it can
affect anion efflux and inhibits stomatal opening. The stomatal closure in response to an
increased CO2 concentration is also slowed under ozone treatment (Dumont et al. 2013). The
CO2 signaling leading to stomatal closure is mediated by β-carbonic anhydrases, βCA1 and
βCA4 (Hu et al. 2010; Xue et al. 2011). We showed that expression of the genes coding for
βCA1 and βCA4 is strongly inhibited by ozone. Ca2+ and HCO3- are involved in signal
transduction to activate anion efflux. The perturbation of calcium content observed previously
may have an impact on the stomatal response to CO2 increase. However, calcium signaling is
complex and involves various cellular compartments; it is therefore difficult to interpret the
higher calcium content in guard cell in response to ozone with no information on the
68
Résultats
distribution of calcium in cellular compartments (Dodd et al. 2010). In addition, it has been
shown that ozone induces a stress-specific calcium signature leading to specific gene
expression regulation and that it is not simply a ROS-induced regulation (Short et al. 2012).
In conclusion, it appears that ozone impacts firstly stomatal conductance of the upper side
probably due to greater exposure to ROS. Modification of stomatal responses does not result
from ultrastructural changes but more likely from a disturbance of ion fluxes and regulation of
the expression of genes involved in signal transduction. Expression of a majority of the
studied genes coding for plasma membrane and vacuolar channels is inhibited by ozone,
especially the expression of genes coding for the vacuolar calcium channels (CAX1 and
CAX3). Low constitutive expression of CAX1 and CAX3 genes in Robusta could be linked to
its slower stomatal responses and thus, could participate to its sensitivity. Kinetics of mineral
element content during 24 hours with measurements of stomatal conductance and calcium
analyses in each cellular compartment could help to understand the origin of the ionic
disturbance caused by ozone.
ACKNOWLEDGEMENTS
The authors are thankful to Cyndie Clément for microdissection of guard cells, Aurélie Heinis
and Fabien Spicher for gas exchanges measurements, Nathalie Ningre for molecular analyses,
Christophe Rose for elements microanalyses and Stéphane Martin for technical assistance.
The research was supported by the French National Research Agency, ANR, project
“Vulnoz", the IFR 110 EFABA and Jennifer Dumont was supported by a PhD grant from the
ANR and the Lorraine Region. We thank the nursery of Guéméné Penfao for providing the
cuttings.
69
Résultats
REFERENCES
Ainsworth E.A., Yendrek C.R., Sitch S., Collins W.J. & Emberson L.D. (2012) The effects of
tropospheric ozone on net primary productivity and implications for climate change.
Annual Review of Plant Biology 63, 637–661.
Apel K. & Hirt H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal
transduction. Annual Review of Plant Biology 55, 373-399.
Avnery S., Mauzerall D.L., Liu J. & Horowitz L.W. (2011a) Global crop yield reductions due
to surface ozone exposure: 1. Year 2000 crop production losses and economic damage.
Atmospheric Environment 45, 2284–2296.
Avnery S., Mauzerall D.L., Liu J. & Horowitz L.W. (2011b) Global crop yield reductions due
to surface ozone exposure: 2. Year 2030 potential crop production losses and economic
damage under two scenarios of O3 pollution. Atmospheric Environment 45, 2297-2309.
Castagna A. & Ranieri A. (2009) Detoxification and repair process of ozone injury: From O 3
uptake to gene expression adjustment. Environmental Pollution 157, 1461-1469.
Dizengremel P. (2001) Effects of ozone on the carbon metabolism of forest trees. Plant
Physiology and Biochemistry 39, 729-742.
Dizengremel P., Le Thiec D., Bagard M. & Jolivet Y. (2008) Ozone risk assessment for
plants: central role of metabolism-dependent changes in reducing power. Environmental
Pollution 156, 11-15.
Dodd A.N., Kudla J. & Sanders D. (2010) The language of calcium signaling. Annual Review
of Plant Biology 61, 593-620.
Dumont J., Spicher F., Montpied P., Dizengremel P., Jolivet Y. & Le Thiec D. (2013) Effects
of ozone on stomatal responses to environmental parameters (blue light, red light, CO2 and
vapour pressure deficit) in three Populus deltoides x Populus nigra genotypes.
Environmental Pollution 173, 85-96.
Ederli L., Morettini R., Borgogni A., Wasternack C., Miersch O., Reale L., Ferranti F., Tosti
N. & Pasqualini S. (2006) Interaction between nitric oxide and ethylene in the induction of
alternative oxidase in ozone-treated tobacco plants. Plant Physiology 142, 595-608.
FAO. 2006. Global Forest Resources Assessment (2005) Progress towards sustainable forest
management. In. FAO Forestry Paper. Rome: Food and Agricultural Organisation of the
United Nations.
70
Résultats
Felzer B.S., Cronin T., Reilly J.M., Melillo J.M. & Wang X. (2007) Impacts of ozone on trees
and crops. Comptes Rendus Geoscience 339, 784-798.
Fischer R.A. (1968) Stomatal opening: role of potassium uptake by guard cells. Science 160,
784-785.
Goodstein D.M., Shu S., Howson R., et al. (2012) Phytozome: a comparative platform for
green plant genomics. Nucleic Acids Research 40, 1178-1186.
Grulke N.E., Neufeld H.S., Davison A.W., Roberts M. & Chappelka A.H. (2007) Stomatal
behavior of ozone-sensitive and -insensitive coneflowers (Rudbeckia laciniata var.
digitata) in Great Smoky Mountains National Park. New Phytologist 173, 100-109.
Hayes F., Jones M.L.M., Mills G. & Ashmore M. (2007) Meta-analysis of the relative
sensitivity of semi-natural vegetation species to ozone. Environmental Pollution 146, 754762.
Heath R.L. (1994) Possible mechanisms for the inhibition of photosynthesis by ozone.
Photosynthesis Research 39, 439-452.
Hetherington A.M. & Brownlee C. (2004) The generation of Ca2+ signals in plants. Annual
Review of Plant Biology 55, 401-427.
Hothorn T., Bretz F. & Westfall P. (2008) Simultaneous inference in general parametric
models. Biometrical Journal 50, 346-363.
Hu H., Boisson-Dernier A., Israelsson-Nordström M., Böhmer M., Xue S., Ries A., Godoski
J., Kuhn J.M. & Schroeder J.I. (2010) Carbonic anhydrases are upstream regulators in
guard cells of CO2-controlled stomatal movements. Nature Cell Biology 12, 87-93.
ICP Vegetation. (2012) Harmens H, Mills G, eds. Ozone pollution : Impacts on carbon
sequestration in Europe. Bangor, UK, NERC/Centre for Ecology & Hydrology, 88pp.
Jung J.Y., Kim Y.W., Kwak J.M., Hwang J.U., Young J., Schroeder J.I., Hwang I. & Lee Y.
(2002) Phosphatidylinositol 3- and 4-phosphate are required for normal stomatal
movements. Plant Cell 14, 2399-2412.
Kivimäenpää M., Sutinen S., Medin E.L., Karlsson P.E. & Selldén G. (2001) Diurnal changes
in microscopic structures of mesophyll cells of Norway spruce, Picea abies (L.) Karst. and
the effects of ozone and drought. Annals of Botany 88, 119-130.
Kivimäenpää M., Sutinen S., Medin E.L., Karlsson P.E. & Selldén G. (2003) Cell structural
changes in the needles of norway spruce exposed to long-term ozone and drought. Annals
of Botany 92, 779-793.
71
Résultats
Lawson T. (2009) Guard cell photosynthesis and stomatal function. New Phytologist 181, 1334.
Lee Y., Kim Y.W., Jeon B.W., Park K.Y., Suh S.J., Seo J., Kwak J.M., Martinoia E., Hwang
I. & Lee Y. (2007) Phosphatidylinositol 4,5-bisphosphate is important for stomatal
opening. The Plant Journal 52, 803-816.
Le Thiec D., Rose C., Garrec J.P. Laffray D., Louguet P., Galaup S. & Loosveldt P. (1994)
Alteration of element subjected to ozone fumigation and (or) water stress: X-ray
microanalysis study. Canadian Journal of Botany 72, 86-92.
Mestdagh P., Van Vlierberghe P., De Weer A., Muth D., Westermann F., Speleman F. &
Vandesompele J. (2009) A novel and universal method for microRNA RT-qPCR data
normalization. Genome Biology 10, 61-74.
Outlaw W.H. & Manchester J. (1979) Guard cell starch concentration quantitatively related to
stomatal aperture. Plant Physiology 64, 79-82.
Pandey S., Zhang W. & Assmann S.M. (2007) Roles of ion channels and transporters in guard
cell signal transduction. FEBS 581, 2325-2336.
Paoletti E. (2005) Ozone slows stomatal response to light and leaf wounding in a
Mediterranean evergreen broadleaf, Arbutus unedo. Environmental Pollution 134, 439445.
Paoletti E. & Grulke N.E. (2010) Ozone exposure and stomatal sluggishness in different plant
physiognomic classes. Environmental Pollution 158, 2664-2671.
Pei Z-M, Murata Y., Benning G., Thomine S., Klusener B., Allen G.J., Grill E. & Schroeder
J.I. (2000) Calcium channels activated by hydrogen peroxide mediate abscisic acid
signalling in guard cells. Nature 406, 731-734.
R Core Team. (2012) R: A language and environment for statistical computing. R Foundation
for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, URL http://www.Rproject.org/.
Saeed A.I., Sharov V., White J., et al. (2003) TM4: a free, open-source system for microarray
data management and analysis. Biotechniques 34, 374-378.
Saeed A.I., Bhagabati N.K., Braisted J.C., Liang W., Sharov V., Howe E.A., Li J.,
Thiagarajan M., White J.A. & Quackenbush J. (2006) TM4 microarray software suite.
Methods in Enzymology 411, 134-93.
Scheibe R., Backhausen J.E., Emmerlich V. & Holtgrefe S. (2005) Strategies to maintain
72
Résultats
redox homeostasis during photosynthesis under changing conditions. Journal of
Experimental Botany 56, 1481-1489.
Schroeder J.I., Allen G., Hugouvieux V., Kwak J. & Waner D. (2001) Guard cell signal
transduction. Annual Reviews in Plant Biology 52, 627-658.
Schwarzländer M., Logan D.C., Johnston I.G., Jones N.S., Meyer A.J., Fricker M.D. &
Sweetlove L.J. (2012) Pulsing of membrane potential in individual mitochondria: A stressinduced mechanism to regulate respiratory bioenergetics in Arabidopsis. The Plant Cell 24,
1188-1201.
Shimazaki K., Doi M., Assmann S.M. & Kinoshita T. (2007) Light regulation of stomatal
movement. Annual Reviews in Plant Biology 58, 219-247.
Short E.F., North K.A., Roberts M.R., Hetherington A.M., Shirras A.D. & McAinsh M.R.
(2012) A stress-specific calcium signature regulating an ozone-responsive gene expression
network in Arabidopsis. The Plant Journal 71, 948-961.
Sitch S., Cox P.M., Collins W.J. & Huntingford C. (2007) Indirect radiative forcing of climate
change through ozone effects on the land-carbon sink. Nature 448, 791-794.
Stael S., Wurzinger B., Mair A., Mehlmer N., Vothknecht U.C. & Teige M. (2012) Plant
organellar calcium signalling: an emerging field. Journal of Experimental Botany 63,
1525-1542.
Torsethaugen G., Pell E.J. & Assmann S.M. (1999) Ozone inhibits guard cell K +
channels implicated in stomatal opening. Proceedings of the National Academy of
Sciences of the United States of America 96, 13577-82.
Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M. & Rozen SG.
(2012) Primer3--new capabilities and interfaces. Nucleic Acids Research 40, 1-12.
Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. & Speleman F.
(2002) Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biology 3, 1-11.
Vanlerberghe G.C., Cvetkovska M. & Wang J. (2009) Is the maintenance of homeostatic
mitochondrial signaling during stress a physiological role for alternative oxidase?
Physiologia Plantarum 137, 392-406.
Wittig V.E., Ainsworth E.A., Naidu S.L., Karnosky D.F. & Long S.P. (2009) Quantifying the
impact of current and future tropospheric ozone on tree biomass, growth, physiology and
biochemistry: a quantitative meta-analysis. Global Change Biology 15, 396-424.
73
Résultats
Xue S., Hu H., Ries A., Merilo E., Kollist H. & Schroeder J.I. (2011) Central functions of
bicarbonate in S-type anion channel activation and OST1 protein kinase in CO2 signal
transduction in guard cell. The EMBO Journal 30, 1645-1658.
Zhang X., Miao Y.C., An G.Y., Zhou Y., Shangguan Z.P., Gao J.F. & Song C.P. (2001) K+
channels inhibited by hydrogen peroxide mediate abscisic acid signaling in Vicia guard
cells. Cell Research 11, 195-202.
Zhang X., Wang H,. Takemiya A., Song C., Kinoshita T. & Shimazaki K. (2004) Inhibition of
blue light-dependent H+ pumping by abscisic acid through hydrogen peroxide-induced
dephosphorylation of the plasma membrane H+-ATPase in guard cell protoplasts. Plant
Physiology 136, 4150-4158.
74
Phytozome v3 name
Potri.012G071600
Potri.015G066000
Potri.003G018800
Potri.015G053400
Potri.008G118600
Potri.010G127400
Gene Name
AHA11
AHA1115
AKT2
ALMT6
ALMT68
ALMT610
POPTR_0010s13750
fgenesh4_pm.C_LG_X000501
GCGACAGAGAACGTGATTTT
POPTR_0008s11740
TGGCTGATTGAACACGCTAT
TGCGGGTTACAAGATTAGGA
gw1.VIII.1158.1
POPTR_0015s06340
AGAACCTCTTGGAAGACGAA
gw1.82.136.1
TATCGGCAGCTCAATAGGTT
Ref|XM_002314840.1|
Ref|XM_002312350.1|
At2g17470,At1g25480,At1g68600]
thaliana; [ortholog of
Similar to expressed protein in Arabidopsis
thaliana; [ortholog of At3g18440]
Similar to expressed protein in Arabidopsis
CAA71598,At4g22200,T12130]
POPTR_0003s01270
AAAGTGCTAGTGCGTTGTCT
(fragment). [ORG:Vicia faba]; [ortholog of
gw1.III.1210.1
Similar to potassium channel protein - fava bean
Pt-AKT2.1
GATCAATCTCCCAGCTTCCA
CAB69826, CAC28221, BAC77533]
CAC28224, CAA64406, AAQ55291,
GGTGTGAAGGGGAACAAGAA
Ref|XM_002328624.1|
(2of2) of CAB85497, At3g47950, CAB69824,
POPTR_0015s07710
At5g62670, BAC77532, T52414, CAC29435,
ATPase. [ORG:Prunus persica]; [co-ortholog
gw1.XV.1202.1
Similar to putative plasma membrane H+
Pt-HA2.2
CCAACGACATTGACTACCAT
CAB69826, CAC28221, BAC77533]
CAC28224, CAA64406, AAQ55291,
CGCTGGTTGTTTTCTACACT
Ref|XM_002322091.1|
(1of2) of CAB85497, At3g47950, CAB69824,
POPTR_0012s07350
At5g62670, BAC77532, T52414, CAC29435,
ATPase. [ORG:Prunus persica]; [co-ortholog
gw1.XII.988.1
Similar to putative plasma membrane H+
Phytozome description
GGCAACAGATGACATGAAAC
Ref|XM_002318578.1|
NCBI reference
Pt-HA2.1
Alias
TAATCATCGTGGCAGCCAAT
Primers F and R 5’- 3’
List of genes studied with their specific primers.
Table S1
Potri.001G348900
Potri.010G041100
Potri.016G115500
Potri.001G251200
Potri.006G099900
Potri.003G111500
Potri.001G331700
Potri.006G064000
CA1
CA4
CAX1
CAX3
CAX16
CHL
CLCa
CLCa6
Ref|XM_002298278.1|
Ref|XM_002303476.1|
POPTR_0006s06280
Ref|XM_002330988.1|
Similar to chloride channel-like (CLC) protein;
At3g27170,At5g40890]
estExt_fgenesh4_pm.C_LG_I0924
CCCTGTTGTGGGTATATTGA
(AtCLC-a).; [ortholog of
POPTR_0001s33920
CCGCTGTAATCACTCAACTT
Similar to Chloride channel protein CLC-a
Pt-CLC.5
TCTTGCTTGCCTTTCCTCAT
Ref|XM_002300065.1|
BAC81420, At1g12110, BAD22820,
POPTR_0003s11080
CAD33927]
persica]; [co-ortholog (1of2) of CAD32549,
eugene3.00030833
TCTTTTCAGTGAGTGCTGCT
Similar to nitrate transporter. [ORG:Prunus
Pt-PPNRT1.2
At3g51860, BAA25753, At2g38170, T07821]
grail3.0023029601
AGTTGCCAGAAGAGTGCTTA
radiata]; [co-ortholog (2of2) of At5g01490,
POPTR_0006s10080
TGCCATATGCCACCTTCTAT
Similar to Ca2+/H+ exchanger. [ORG:Vigna
Pt-CAX3.1
TCCCTTCAAAGCTGAAATGC
AATCCTATCACCGCCTTTTC
POPTR_0001s25830
At3g51860, BAA25753, At2g38170, T07821]
grail3.0025015501
GAGTGAGCAGCATTGTTATG
radiata]; [co-ortholog (1of2) of At5g01490,
POPTR_0016s12290
Similar to Ca2+/H+ exchanger. [ORG:Vigna
Pt-CAX3.2
AAGCTGCAATGACTGATCCA
estExt_fgenesh4_kg.C_LG_X0015
GTTCCCTTGACAAAGTCGTA
Ref|XM_002314581.1|
_D,1EKJ_E]
793,1EKJ_A,P17067,T09797,AAB65822,1EKJ
1EKJ_B,AAA33652,CAA36792,1710354A,T09
TGTTATTGGGGCGTGCTTTT
POPTR_0010s05080
GAAGGAGGCTGTTAATGTGT
At3g01500,S10200,1EKJ_H,AAC49785,1EKJ_
estExt_Genewise1_v1.C_LG_I2426
C,At5g14740,AAF78507,1EKJ_G,AAD27876,
[ORG:Pyrus pyrifolia]; [ortholog of
POPTR_0001s34950
Similar to carbonic anhydrase isoform 1.
CCATCATAAGGGAAGGACAT
Ref|XM_002298488.1|
Pt-CA1.3
AGACTAAGTACGCTGGAGTT
Potri.005G102700
Potri.014G152200
Potri.002G230000
Potri.006G038400
Potri.004G083300
Potri.012G043000
GLR25
GLUR3
GLUR32
GOGAT6
GORK4
GORK12
GLR2
Pt-SKOR.2
eugene3.00120017
TTCCACCAATACGAGCTTCA
Ref|XM_002317669.1|
K(+) outward rectifying channel).; [co-ortholog
Similar to Potassium channel SKOR (Stelar
(2of4) of At3g02850]
POPTR_0004s08170
GAACACCTTTGCACATTGCT
K(+) outward rectifying channel).; [co-ortholog
gw1.IV.3720.1
AGAACCATCTGGAAGCTGTA
Similar to Potassium channel SKOR (Stelar
Pt-SKOR.3
ATGGGGTGCAAAAGAACAGA
Ref|XM_002305858.1|
ortholog (1 of 2) of T06228, AAP33664,
POPTR_0006s03660
At2g41220, At5g04140]
synthase. [ORG:Securigera parviflora]; [co-
estExt_fgenesh4_pg.C_LG_VI0304
TCTCTAACAATGGGGATGCT
Similar to ferredoxin-dependent glutamate
Pt-GLU1.2
TTATCGGGGAAACAGAATGC
Ref|XM_002308848.1|
glutamate receptor GLR6).; [co-ortholog (2of3)
POPTR_0002s23060
of At1g05200, At2g32390]
(Ligand-gated ion channel 3.5) (Ionotropic
eugene3.00002112
Similar to Glutamate receptor 3.5 precursor
ACAATTGGAGGCAGACAAGA
Ref|XM_002301591.1|
Ref|XM_002321087.1|
Pt-GLUR3.3
POPTR_0014s15030
ortholog (1of2) of At3g51480]
GCTCAACATCGCAGAATCTA
TCTCCATGTGTCAGCCATTT
TGGGCCAAGAGTTCACAAAA
PMID:11379626; similar to member of Putative
POPTR_0005s10570
ligand-gated ion channel subunit family; [co-
plant glutamate receptor family; similar to
eugene3.00050411
Glutamate receptor family protein; similar to
Pt-GLR3.5
Ref|XM_002306400.1|
At5g33280]
similar to PIR:T02939; [co-ortholog (1of2) of
channel protein ClC-1 - Nicotiana tabacum;
At5g49890 (Arabidopsis thaliana) and chloride
putative; similar to CLC-c; similar to
CAAGCAAGCAAGCTATTCCA
estExt_fgenesh4_pm.C_1520034
GGCTTATGAGAAGTGCATGT
TTGACTCCAACGCTCTAGAA
Potri.017G135400
Potri.004G132200
Potri.018G035500
Potri.006G245000
Potri.005G045100
Potri.010G031500
Potri.013G031700
Potri.014G134900
GORK
KAT1/2
KAT3
KAT36
NHX1
NHX110
NHX113
NHX114
POPTR_0010s03270
eugene3.00140792
POPTR_0014s12940
Pt-NHX1.2
Ref|XM_002320330.1|
euphratica]; [co-ortholog (2of2) of CAH69218]
Similar to Na+/H+ antiporter. [ORG:Populus
POPTR_0013s03220
AATTTCCGCCACAAGTGATG
At3g05030, AAS84487]
eugene3.00130299
GCCAATGGACAAGATTCAGA
sativa]; [co-ortholog (2of2) of At5g27150,
Pt-NHX2.2
Similar to Na+/H+ antiporter. [ORG:Medicago
euphratica]; [co-ortholog (1of2) of CAH69218]
Similar to Na+/H+ antiporter. [ORG:Populus
GCTAACATACATCGCAAAGC
Ref|XM_002319556.1|
Ref|XM_002315496.1|
AAGCCCTGCTACATCTTTGA
fgenesh4_pm.C_LG_X000073
Pt-NHX1.1
TTGACAAGCCATAGCCACAA
At3g05030, AAS84487]
POPTR_0005s04660
CAATCGGCTTTTGGTGTGAA
sativa]; [co-ortholog (1of2) of At5g27150,
Similar to Na+/H+ antiporter. [ORG:Medicago
eugene3.00700146
Ref|XM_002328349.1|
Pt-NHX2.1
(2of5) of At4g32650]
POTASSIUM CHANNEL 1; [co-ortholog
RECTIFYING CHANNEL; similar to
TTCGGAGAATTGCGCTCTGT
Ref|XM_002333916.1|
fgenesh4_pm.C_LG_VI000755
Similar to ARABIDOPSIS THALIANA K+
ACCCCAACACACACTGTTCA
Ref|XM_002333915.1|
POPTR_0006s26140
GCAACGATGCTATGGAAAAG
Ref|XM_002308592.1|
Pt-ATKC1.4
CCAGAAGGATTGAGAAAGCA
CATGTATTTCCCTCCCTTGT
Ref|XM_002324221.1|
POPTR_0004s13910
POPTR_0018s00970
At5g46240,At4g18290,CAC87141]
gw1.IV.4469.1
GGCAATTCTGAGCAACTCTT
CATTCCATCATCAGCCTACA
tremula x Populus tremuloides]; [ortholog of
Pt-KAT1.1
TCACTATCCACATGCAGCTT
Similar to K+ channel protein. [ORG:Populus
(1of4) of At3g02850]
fgenesh4_pm.C_LG_II001048
Ref|XM_002305301.1|
K(+) outward rectifying channel).; [co-ortholog
Similar to Potassium channel SKOR (Stelar
POPTR_0017s02430
Ref|XM_002301629.1|
Pt-SKOR.4
GCATGCAGCAGGAACAAGAA
(3of4) of At3g02850]
GATTGATGGTGGCCAGAAGT
POPTR_0012s04000
Potri.006G275000
Potri.018G006000
Potri.001G342000
Potri.004G209700
Potri.009G170600
Potri.001G144300
Potri.001G114300
Potri.013G131100
Potri.016G007200
OST26
OST218
PHOT1
PHOT2
PHOT29
QUAC1
SLAC1
TPC1
TPK1
AAQ19041, AAA81349, CAB85496,
estExt_Genewise1_v1.C_LG_XVIII2227
GAAATGTCACAGCCTCAGAT
POPTR_0013s13470
GCATTGGAGCATTCTGGTTT
POPTR_0016s00890
estExt_fgenesh4_pm.C_1420009
Pt-CCH1.1
POPTR_0001s08280
POPTR_0001s02700
CAAGGAAGGAAGCAACTCAA
CCAAACAAAAGCGTGCAGAA
AATGTCCCTGGTGTTCTAAG
GTATAGCCCGATATCCATAG
TTTAAACCCGGAGATGAGGT
POPTR_0009s17190
GTGGTTGGCTCCTTGATCTT
POPTR_0009s17180
POPTR_0009s17170
POPTR_0004s21940
CCGTGACTTGAAGCCTGAAA
GCCTTCGGATCTTTTCCAAT
GGATCAAAAGCTGGTGCTAA
Ref|XM_002323090.1|
Ref|XM_002330597.1|
Ref|XM_002326677.1|
Ref|XM_002328252.1|
Ref|XM_002328251.1|
T06809,AAQ63177,E41139,At3g45780,AAB41
POPTR_0001s35680
Similar to pulvinus outward-rectifying channel
At4g03560]
Similar to calcium channel 1; [ortholog of
023,D41139]
[ORG:Pisum sativum]; [ortholog of
gw1.I.2683.1
TGTCTGTAGATCCTGCATTC
Similar to protein kinase homolog - garden pea.
Pt-PHOT1.1
TCCATTCTTCAAGGGTGTCA
AAC43034, CAA59799, AAQ19038]
truncatula]; [co-ortholog (2of2) of At2g24520,
POPTR_0018s03700
CCTTCTTCGTCGTCATATAG
Similar to H+-ATPase. [ORG:Medicago
Pt-VHA1.1
ATGTGGAATCAGTGGTGAAG
Ref|XM_002298523.1|
AAQ19041, AAA81349, CAB85496,
estExt_fgenesh4_pg.C_1470038
AAC43034, CAA59799, AAQ19038]
truncatula]; [co-ortholog (1of2) of At2g24520,
POPTR_0006s28990
Similar to H+-ATPase. [ORG:Medicago
TAATCCCCTCTGGGTTTGAA
Ref|XM_002330768.1|
Pt-VHA1.2
AGAAGGCTGGAAGCGAAAAT
Potri.001G366800
Potri.005G198700
TPK11
UBL
estExt_Genewise1_v1.C_LG_V0494
TGTAGTCGCGAGCTGTCTTG
POPTR_0005s22060
Pt-SUBI.4
POPTR_0001s37550
GATGGTTCAGTCACTTGTGT
TGAGGCTTAGGGGAGGAACT
gw1.I.4741.1
fgenesh4_pm.C_LG_XVI000011
ATGGGAAAGATCAGCGAAGA
CTTATCTTCCCCATCTCCTT
Ref|XM_002306689.1|
Ref|XM_002298826.1|
BAA05085, CAA06197]
AAP31578, AAF70460, AAQ08999,
AAL33551, AAF31707, BAA85750,
BAA76429, BAA05670, AAQ08998,
CAA10056, CAA38256, P03993,
melo]; [co-ortholog (10 of 11) of
Similar to polyubiquitin. [ORG:Cucumis
saman]; [co-ortholog (3of4) of AAD16279]
for potassium SPOCK1. [ORG:Samanea
Similar to pulvinus outward-rectifying channel
saman]; [co-ortholog (1of4) of AAD16279]
for potassium SPOCK1. [ORG:Samanea
Figure S1
Résultats
II.
DETOXICATION FOLIAIRE
1. EFFETS DE L’OZONE SUR LES VOIES DE SYNTHESE DE
L’ASCORBATE ET DU GLUTATHION EN RELATION AVEC LES
CONTENUS EN ACIDE AMINES CHEZ TROIS GENOTYPES DE
PEUPLIER
: UNE COMBINAISON D’APPROCHES MOLECULAIRE
ET METABOLOMIQUE
Nous avons vu que la régulation des mouvements stomatiques permet de limiter
l’entrée d’ozone dans les feuilles, notamment par l’épiderme supérieur. Néanmoins, l’ozone
altère les mouvements stomatiques ce qui peut induire des pertes en eau et une diminution de
l’assimilation. L’ozone parvenant à entrer dans la feuille va créer un stress oxydatif par la
formation de radicaux libres oxygénés (ROS) dans l’apoplaste. Un processus de détoxication
combiné à un processus de réparation doit permettre de lutter contre les effets délétères de ces
ROS. Une des principales voies de détoxication est la voie d’Halliwell-Asada-Foyer dont
l’ascorbate et le glutathion sont les acteurs majeurs. De plus, l’ascorbate étant présent dans
l’apoplaste, c’est le premier à pouvoir s’opposer aux effets induits par les ROS.
Cette étude vise à mettre en évidence l’effet de l’ozone sur les concentrations en
ascorbate et en glutathion, sous leurs différentes formes, oxydée et réduite. Afin de ne pas être
débordé par les ROS, le pouvoir réducteur, dont l’ascorbate et le glutathion sont deux acteurs
majeurs, doit être maintenu grâce aux processus de régénération et de synthèse de novo. Nous
avons étudié l’expression des gènes impliqués dans la voie de biosynthèse de l’ascorbate et du
glutathion, en complément de l’analyse des teneurs en acides aminés utilisés dans ces voies.
Les conclusions suivantes ont pu être tirées :

l’ozone engendre une augmentation des concentrations en ascorbate. Chez le
génotype sensible, cette augmentation n’est due qu’à une hausse de la forme
oxydée, tandis que chez les autres génotypes, c’est une hausse de la forme réduite
qui est observée.
75
Résultats

l’expression des gènes impliqués dans les voies de biosynthèse de l’ascorbate est
globalement induite par l’ozone et la régulation semble s’effectuer grâce au gène
VTC2 principalement.

l’ozone entraîne une augmentation des concentrations en glutathion et le ratio
redox est maintenu. Cette augmentation est plus intense chez le génotype le plus
résistant.

l’expression des gènes impliqués dans les voies de biosynthèse du glutathion est
globalement induite par l’ozone et la régulation semble s’effectuer grâce aux
gènes codant pour les enzymes GSH1 et GSH2 principalement. Chez le génotype
le plus résistant (Carpaccio), une très forte induction de l’expression d’un gène
codant pour la thréonine aldolase pourrait permettre la synthèse de glycine à
partir de la thréonine.

l’ozone provoque une remobilisation des acides aminés vers la synthèse
d’antioxydants et de nouvelles sources d’énergie. Nous observons une hausse de
la cystéine disponible pour la synthèse de glutathion, une hausse des acides
aminés aromatiques utilisés pour la synthèse des phénols, des flavonoïdes, et une
hausse de la putrescine acteur de la détoxication induisant une augmentation de
l’activité de certaines enzymes antioxydantes, surtout chez le génotype le plus
résistant.
Ces résultats ont été soumis dans Plos One
76
Résultats
Ozone effects on ascorbate and glutathione biosynthesis pathways in relation with amino
acid contents on three poplar genotypes
Running title: Detoxification and amino acids in ozone tolerance
Jennifer Dumont, Sarita Keski-Saari, Markku Keinänen, David Cohen, Nathalie Ningre, Sari
Kontunen-Soppela, Pierre Baldet, Yves Gibon, Pierre Dizengremel, Marie-Noëlle Vaultier,
Yves Jolivet, Elina Oksanen & Didier Le Thiec.
Abstract
Ozone is an air pollutant causing oxidative stress by generation of reactive oxygen species
(ROS) within leaf. The capacity to detoxify ROS and repair ROS-induced damages may
contribute to define ozone tolerance. Ascorbate and glutathione are known to be key players
of detoxification. Ozone effects on their biosynthesis and on amino acid metabolism were
investigated in three euramerican poplar genotypes (Populus deltoides x Populus nigra)
differing in ozone sensitivity. Total ascorbate and glutathione contents were increased in
response to ozone in all genotypes. Reduced ascorbate (ASA) increased in the two least
sensitive genotypes (Carpaccio and Cima), whereas the most sensitive genotype (Robusta)
seemed unable to regenerate ASA from oxidized ascorbate (DHA). Increased ascorbate (ASA
+ DHA) content correlated with the increase in gene expression on its biosynthetic pathway,
especially VTC2. Increased cysteine availability combined to increased expression of
glutathione synthetase (GSH1) and gamma-glutamylcysteine synthetase (GSH2) genes allow
higher glutathione biosynthesis in response to ozone, particularly in Carpaccio. In addition,
ozone caused a remobilization of amino acids with a decrease of total amino acids pool, an
increase of cystein and putrescine, especially in Carpaccio. In addition, the expression of gene
encoding threonine aldolase was strongly induced, only in the most resistant genotype,
77
Résultats
Carpaccio. ASA level could partly explain the sensitivity to ozone for Robusta but not for
Cima. ASA level is not sufficient to account for ozone tolerance in poplar, but that a sum of
different factors is necessary including glutathione content.
78
Résultats
Introduction
Tropospheric ozone (O3) is a powerful oxidizing agent which acts as a phytotoxin [1]. Its
concentrations are still increasing and thus, represent a significant threat to earth life with a
decrease of vegetation growth, reduced productivity and economic losses [2], [3]. In France,
the usual ozone concentrations are lower than 60 nmol mol-1, but concentrations greater than
120 nmol mol-1 are frequently recorded on several days each year [4], [5]. The current O3
concentrations lead to economic losses due to a decline in forestry and agriculture
productivity [6], [7], [8]. Indeed, in addition to a decrease of stomatal conductance and net
CO2 assimilation by O3, a direct effect of O3 is observed on primary metabolism [9], [10].
This can reduce energy resources, leading to slower growth and loss of biomass [11], [12],
[13].
Ozone enters the leaves through stomata and is degraded in the apoplast generating
reactive oxygen species (ROS) [14]. These chemically reactive molecules can destroy or
modify several cellular components like proteins, lipids or nucleic acids [15], but in parallel,
they have a key role in cell signalling [16], [17], [18]. A balance between ROS production and
detoxification must be maintained by the two ways of plant defence against O3, i.e. regulation
of stomatal conductance and detoxification of ROS generated during O3 degradation [14],
[19], [20]. Differences in sensitivity to ozone between species or genotypes may be related to
one of these two processes [21], [22], [23].
A constitutive detoxification system is already operative at the entrance of O 3 in the leaf.
The pool of reduced ascorbate (ASA) in the apoplast is the first line of defence to avoid ROS
to reach the plasmalemma, where it would initiate an oxidative burst and induce a wide range
of metabolic changes [14]. The Foyer-Halliwell-Asada pathway ensures the reduction of
79
Résultats
ascorbate by a sequence of redox reactions involving glutathione and NAD(P)H [18]. The
antioxidant power is not only limited to ascorbate and glutathione, the detoxification process
being a complex network of different types of metabolites and enzymes such as polyphenols,
carotenoids, tocopherols, superoxide dismutase and catalase [17], [24]. In combination with
the regeneration of reducing power, de novo synthesis of antioxidants and repair processes of
oxidized proteins participate to limit ozone effects, these processes being costly in energy
[25], [26].
Amino acids are key elements in the balance between catabolism and biosynthesis of
various compounds. Amino acids of the aspartate family can be used as substrate for
alternative way of respiration during stress, and thus represent a source of energy [27]. Some
amino acids are directly linked to antioxidants biosynthesis, such as aromatic amino acids for
phenolic compounds biosynthesis [28], or cysteine which appears as a rate-limiting factor in
glutathione biosynthesis [29].
The purpose of this study was to characterize the impacts of ozone on the ascorbate and
glutathione content, and particularly on their biosynthetic pathways, in three Euramerican
poplar genotypes differing in ozone sensitivity. Based on visible injuries and number of
abscised leaves, Robusta was the most sensitive, Cima showed an intermediate sensitivity
whereas Carpaccio was the least sensitive to ozone. Two complementary approaches were
combined: i) the expression of genes encoding enzymes involved in the main ascorbate and
glutathione biosynthesis pathways was investigated in response to ozone, and ii) the
ascorbate, glutathione and amino acids contents were quantified. Our work intends to provide
a new insight on the effect of ozone on ascorbate and glutathione biosynthesis and attempts to
explain ozone tolerance among poplar genotypes, through a comprehensive study of
interactions between gene expression and metabolites.
80
Résultats
Materials and Methods
Ethics statement
We declare that cuttings have been bought from National Forest State nursery of
Guémené-Penfao where poplar genotypes and provenances are conserved (France, LoireAtlantique, 47°37′46″N, 1°53′33″W, 20 m a.s.l.). The master certificate has the number F5211B004. The plant health passport has the number SPV-F PL00736.
Plant culture and exposure conditions
Three Euramerican hybrid poplar genotypes (Populus deltoides x Populus nigra),
“Carpaccio”, “Cima” and “Robusta” differing in ozone sensitivity based on foliar injuries,
leaf fall and total biomass losses, were studied. The plant material was grown as described in
[30]. Briefly, rooted cuttings were planted and kept in growth chambers (situated at Lorraine
University) for 5 weeks at 23°C/21°C (day/night) with 14-h light period (250-300 µmol m-2 s1
photon flux at leaf height). At the end of this period, 40 individuals of each genotype were
divided in eight phytotronic chambers with the same environmental conditions. The plants
were let to acclimate to phytotronic chambers for seven days. Four phytotronic chambers
were used for each treatment during 17 days: 1) ambient treatment with charcoal-filtered air
(O3 concentration < 4 nmol mol-1) and 2) ozone treatment (120 nmol mol-1 O3 for 13 h, from
09:00 to 22:00). Fumigation started one hour after the beginning of the photoperiod and ran
until its end.
Sampling and storage
After 2, 4, 11, 15 and 17 days from the beginning of the fumigation, the 10th and 11th
leaves from the top were sampled. These leaves were mature at the start of the fumigation.
81
Résultats
Each time different plants were used for sampling. The leaves were cut in half by removing
the midrib and were immediately flash frozen in liquid nitrogen. For RNA extraction,
ascorbate and glutathione quantification, half of each leaf was crushed into powder (in liquid
N2) and stored at -80°C. For metabolomic analyses, the other half was freeze-dried at -40°C
for 40 h at a pressure of 10 Pa in a FreeZone Plus freeze-dryer (Labconco, Kansas City,
Missouri) and then the temperature was turned back progressively to 20°C within 10 h.
Freeze-dried samples were crushed with TissueLyser (Qiagen, Helsinki, Finland) 3x15 s in
Safe-Lock Eppendorf tube, and stored at -80°C.
Leaf fall and biomass measurement
At the end of the experiment, the number of fallen leaves was count and all the plants were
harvested, divided into stems, leaves, and roots and oven-dried (60 °C) until constant weight
was reached, and then weighed.
Glutathione and ascorbate extraction and analysis
Ascorbate and glutathione were measured at 2, 4, 11 and 17 days. They were extracted
from 20 mg of fresh leaf powder in 400 µL of metaphosphoric acid 5% (w/v). Homogenates
were centrifuged for 10 min at 4°C with 14,000 g. Ascorbate and dehydroascorbate were
measured by the method of [31], scaled down for microplates. To allow the use of a pipetting
robot, the trichloroacetic acid was replaced by metaphosphoric acid 5% (w/v). Glutathione
and glutathione disulfide were measured using glutathione and 2-vinylpyridine as described
by [32].
82
Résultats
Real-time quantitative RT-PCR
Total RNA was extracted from 100mg of fresh leaf powder using the RNeasy Plant Mini
Kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol. Residual
genomic DNA was removed by Dnase I (Life Technologies, Saint Aubin, France) treatment.
RNA quality was assessed using the automated gel electrophoresis Experion system (BioRad, Marnes la coquette, France). Quantification was performed by Quant-iT riboGreen assay
(Life Technologies, Saint Aubin, France). Reverse transcription was performed on 700 ng
RNA using an iScript cDNA Synthesis Kit (Bio-Rad, Marnes la coquette, France). The Alien
QRT-PCR Inhibitor Alert kit (Agilent technologies, Massy, France) was used to assess
reverse transcription efficiency, following the manufacturer's protocol. Real-time PCR was
performed in a Mx3000P QPCR System (Agilent technologies, Waghaeusel-Wiesental,
Germany) according to the manufacturer’s recommended cycling program (10 min 95°C, 40
cycles of 5 s at 95°C, and 20 s at 58 or 60°C depending on primers) followed by the
generation of a dissociation curve to check for specificity of amplification. The reaction
mixture contained 10µL Brillant III Ultrafast SYBR green QPCR Master mix, 0.3µL ROX
(Agilent technologies, Massy, France), 250 nM of gene-specific primers and 2 μL cDNA
(diluted 1/5) in each 20 μL reaction. We studied genes coding for enzymes of the main
biosynthesis pathway of ascorbate and glutathione, based on homology with genes described
in Arabidopsis thaliana (Supporting Information Table S1). The study of the glutathione
pathway was extended to the links with major amino acids. Specificity of all primers has been
checked by sequencing the products (Beckman Coulter Genomics, Essex, UK). No-template
control (NTC) reactions were prepared for each gene. The Ct values were determined with the
same threshold and PCR efficiency was estimated using a standard curve for each gene and
each genotype. Efficiency values were taken into account in all subsequent calculations. The
83
Résultats
expression values were normalized to two control genes (the internal control alien and UBL)
and two stable genes of interest determined by the GeneNorm program (GOGAT6 and
VTC21).
Amino acid and polyamines extraction and analysis
Freeze-dried leaf powder (30 mg) was mixed with 1500 µL 0.005% (w/v) butylated
hydroxytoluene (BHT) in 80% (v/v) MeOH and 200 µL of internal standard mixture
(containing 0.3 mg/ml benzoic-d5 acid (Campro Scientific GmbH, Berlin, Germany), 0.3 mg
mL-1 D-glucose-C13 (Campro Scientific GmbH, Berlin, Germany), 0.25 mg mL-1 glycerol-d8
(Campro Scientific GmbH, Berlin, Germany), 0.15 mg mL-1 biochanin A (Extrasynthese,
Genay, France) and 0.015 mg mL-1 alanine-d4 (Aldrich, Steinheim, Germany) in 6:4
MeOH:H2O). Samples were extracted for 15 min at 4°C with 1400 rpm of agitation using a
thermomixer (Eppendorf, Germany). After a centrifugation for 2 min at 10°C with 13500 g,
the supernatant was taken. A second extraction in 1300 µL of 0.005% (w/v) BHT in 100%
MeOH was done with the same protocol and the supernatants were combined. One aliquot of
100 µL was dedicated to amino acid and polyamines analysis performed the same day using
the EZ:faast kit (Phenomenex, Torrance, CA, USA) as described in the kit, except that 50 µL
of the internal standard solution was used. The samples were run with EZ:faast AAA column
by HPLC-MS (Thermo LTQ, Thermo Finnigan) with electrospray ionization. The areas for
the amino acids and polyamines were integrated using Xcalibur software (Thermo Electron
Corporation, Waltham, MA, USA) and alanine-d4 was used as internal standard.
Statistical analyses
The data obtained from ascorbate and glutathione assays were fitted with a linear mixed
effect model, with individuals as random variables, and treatment, genotype and time as fixed
84
Table 1 Ozone effect on leaf fall and total biomass
Genotypes
Carpaccio
Cima
Robusta
Leaf fall relative to ambient
(% relative to number of leaf )
-27
-34
-37
Total biomass relative to ambient
(%)
-20
-41
-18
Effect of ozone on leaf fall and total biomass relative to ambient condition in three poplar
genotypes (Carpaccio, Cima and Robusta) after 18 days of treatment.
A
D
B
E
C
F
Figure 1. Ozone-induced leaf injury on three poplar genotypes.
Comparison of ozone-induced leaf injury after 17 days when submitted to charcoal-filtered air
(A, B, C) or to 120 nmol mol-1 O3 (D, E, F) on three poplar genotypes differing in ozone
sensitivity from the most resistant to the most sensitive: Carpaccio (A, D), Cima (B, E) and
Robusta (C, F).
Résultats
variables. Normality and homoscedasticity of standardized residuals were graphically checked
using quantile-to-quantile and residual-vs-predicted plots. Glutathione concentrations were
log transformed to meet the assumptions of ANOVA. Factorial ANOVA was used to test for
significant differences among genotypes and treatments. Student test was used to precise the
genotype effect. Data were analyzed using R 2.14.2 [33] and the nlme package [34]. Effects
were considered significant when p < 0.05. Principal component analysis (PCA) made with
SIMCA-P+ 12.0.1 (Umetrics, Umeå, Sweden) was used for the amino acid data, with log
transformation when necessary and UV scaling, to find out if there were any dominant
patterns in the data regarding the treatment, sampling time or genotype. Heat map and
clustering were performed on MeV [35], [36].
Results
Sensitivity to ozone
The sensitivity of Cima was mainly characterised by total biomass losses (Table 1)
whereas Robusta was the most sensitive based on foliar injuries, with the largest necrosis
(Figure 1) and the highest percentage of leaf fall (Table 1). Carpaccio appeared to be the most
resistant genotype displaying only brown stippling on the leaves located at the bottom of the
trees, with the lowest percentage of fallen leaves and biomass losses twice smaller than Cima.
Effects of ozone on ascorbate concentrations
In ambient condition, the concentration of total ascorbate was significantly higher in
Carpaccio than in Cima and Robusta (Table 2). Ozone treatment had a strong effect on
ascorbate availability. The concentration of ASA increased significantly in response to ozone
in particular at the last sampling date in Carpaccio with a 2.8-fold increase and in Cima, with
85
Table 2 Concentration of total ascorbate and total glutathione in ambient condition in three
poplar genotypes.
Genotypes
Carpaccio
Cima
Robusta
Constitutive total ascorbate
concentration (µmol g-1)
9.95 ± 0.17a
7.68 ± 0.15c
8.62 ± 0.28b
Constitutive total glutathione
concentration (nmol GSH mg-1)
0.47 ± 0.01a
0.36 ± 0.01b
0.35 ± 0.01b
Concentration of total ascorbate and total glutathione in ambient condition in three poplar
genotypes (Carpaccio, Cima and Robusta). Mean of all the sampling dates (2, 4, 11, 15 and 17
days) (Mean ± SE). Genotype effect tested by a Student test and considered significant if
p<0.05.
Résultats
a 2-fold increase after 11 days of treatment (Figure 2A). The concentration of DHA increased
significantly in Robusta in response to ozone, with the strongest response of 1.8-fold at the
last sampling date, in contrast to Cima that was characterized by a decreased DHA
concentration after 11 days of ozone treatment, whereas no effect was observed in Carpaccio
(Figure 2B). The concentration of total ascorbate increased significantly in all three genotypes
in response to ozone, with the strongest response at the last sampling date with a 1.4-fold, 1.3fold and 1.7-fold increase in Carpaccio, Cima and Robusta respectively (Figure 2C). As a
result of the lack of increase in the concentration of DHA in Carpaccio and Cima, an increase
in the ascorbate redox ratio took place in response to ozone with a 1.6-fold and 1.7-fold
increase, respectively, at day 11 (Figure 2D). For detailed statistical analyses see Supporting
Information Table S1.
Effects of ozone on glutathione concentrations
The constitutive concentration of total glutathione was significantly higher in Carpaccio
than in Cima or Robusta (Table 2). The concentration of GSH increased progressively and
significantly in all three genotypes in response to ozone, with the strongest response in
Carpaccio with a 2.6-fold increase compared to a 1.6-fold and 2.2-fold increase in Cima and
Robusta respectively at the last sampling date (Figure 3A). The concentration of GSSG
follows the same trend in all three genotypes in response to ozone, with the strongest response
of 2-fold, 1.7-fold and 1.5-fold at the last sampling date in Carpaccio, Cima and Robusta
respectively (Figure 3B). Thereby, the concentration of total glutathione increased
progressively and significantly in all three genotypes in response to ozone, with the strongest
response at the last sampling date with a 2-fold, 1.7-fold and 1.7-fold increase in Carpaccio,
Cima and Robusta respectively (Figure 3C). The higher increase in GSH in Carpaccio
86
Figure 2. Ozone effects on ascorbate
concentration and redox state in poplar
leaf.
Effects of ozone treatment on ascorbate
concentrations (percentage relative to
ambient), with reduced ascorbate ASA
(A), oxidised ascorbate DHA (B), total
ascorbate (ASA + DHA) (C) and ascorbate
redox ratio (reduced form/total) (D) on
three poplar genotypes, Carpaccio, Cima
and Robusta at four sampling times (2, 4,
11 and 17 days).
Figure 3. Ozone effects on glutathione
concentration and redox state in poplar
leaf.
Effects of ozone treatment on glutathione
concentrations
(percentage
relative
to
ambient), with reduced glutathione GSH
(A), oxidised glutathione GSSG (B), total
glutathione
(GSH + GSSG)
(C)
and
glutathione redox ratio (reduced form/total)
(D) on three poplar genotypes, Carpaccio,
Cima and Robusta at four sampling times (2,
4, 11 and 17 days).
Figure 4. Ozone effects on the expression of genes encoding enzymes involved in
ascorbate biosynthesis.
Heat maps representing the effects of ozone on the expression of putative genes of enzymes
involved in the ascorbate biosynthesis and more precisely, the L-galactose pathway, on three
poplar genotypes, Carpaccio (orange border), Cima (green border) and Robusta (blue border)
at five sampling dates (1, 2, 3, 4 and 5 corresponding to 2, 4, 11, 15 and 17 days respectively).
Résultats
resulted in a non significant increase in the redox state of glutathione in this genotype (Figure
3D). For detailed statistical analyses see Supporting Information Table S2.
Effects of ozone on the expression of genes involved in ascorbate biosynthesis
Ozone had a noticeable effect on the expression of genes attributed to the major ascorbate
biosynthesis pathway (Figure 4; see also Supporting Information Figure S1 for complete
dataset), with major effects appearing at the third sampling date (11 days) and often before in
Cima. Expression of all the putative genes encoding enzymes involved in the main ascorbate
biosynthesis pathway were increased in response to ozone in the three genotypes, except for
the expression of LGalDH9 which decreased, GlDH16 and GME5 which were almost stable
in the three genotypes in response to ozone, and GME13 which was induced in Carpaccio and
Robusta whereas it decreased in Cima. The expression of VTC25 was the most enhanced in
response to ozone, with a 9.5-fold, 43.3-fold and 1.9-fold increase in Carpaccio, Cima and
Robusta respectively.
Effects of ozone on the expression of genes involved in glutathione biosynthesis
Ozone treatment had a strong effect on gene expression related to glutathione biosynthesis
(Figure 5; see also Supporting Information Figure S2 for complete dataset). Major effects of
ozone appeared mainly from the third sampling date (11 days) and often slightly before in
Cima. Expression of the putative genes encoding enzymes involved in the direct glutathione
biosynthesis pathway from Cys, Glu and Gly were increased in response to ozone in the three
genotypes. Expression of most of the putative genes encoding enzymes involved in the
synthesis of these three amino acids from other amino acids were also increased in response to
ozone in the three genotypes except for the expression of GOGAT12, GOGAT16, GS10, GS8,
GlyA8, GT10, GT8 and THA19 that decreased in response to ozone in the three genotypes.
87
corresponding to 2, 4, 11, 15 and 17 days respectively).
poplar genotypes, Carpaccio (orange border), Cima (green border) and Robusta (blue border) at five sampling dates (1, 2, 3, 4 and 5
Heat maps representing the effects of ozone on the expression of putative genes of enzymes involved in the glutathione biosynthesis on three
Figure 5. Ozone effects on the expression of genes encoding enzymes involved in glutathione biosynthesis.
Résultats
There were only few genes that showed very contrasting response to ozone between
genotypes. Thus, the expression of GlyA10 decreased strongly in Carpaccio while it was quite
stable in response to ozone in the other two genotypes. The expression of GT6 and GT16
decreased in Cima, but increased, in Carpaccio and Robusta. The expression of GSH13 was
more than 1.8-fold lower in ambient condition in Robusta than in Cima and Carpaccio and
was also less increased in Robusta (2.1-fold) than in Carpaccio (3.5-fold) and Cima (2.3-fold)
(Figure 6A). The expression of GSH25 and THA13 were 3.6-fold and more than 1.5-fold
higher in ambient condition in Carpaccio than in the other two genotypes (Figure 6B, C). In
response to ozone, the expression of GSH25 was still 2.4-fold higher in Carpaccio than in the
other two genotypes (Figure 6B). The expression of THA13 increased very strongly in
Carpaccio in response to ozone (5.3-fold) while the increase was much lower in Cima (1.4fold) and Robusta (1.5-fold) (Figure 6C).
Effects of ozone on amino acid contents
Ozone treatment had a contrasted effect on amino acid contents. The major effects of
ozone appeared mainly from the third sampling date. As illustrated by the PCA, the variance
in concentrations of the amino acids was explained at 40%, 17% and 11% by three
components, PC1, PC2 and PC3, respectively (Figure 7). PC1 and PC2 show the ozone effect
by separating ambient and ozone samples, and stronger separation in later time points
especially in Carpaccio (Figure 7A). PC2 and PC3 show the genotype effect, in addition to the
ozone effects, by separating Carpaccio and Robusta samples whereas Cima is not separated
from the two genotypes (Figure 7C). The variations in concentrations of Val, Asn, Thr, Ser,
and Leu explain the time effect (Figure 7B). The ozone effect was mainly accounted for by
variations in Trp, Ile, His, Tyr and Asp concentrations and the genotype effect, especially the
difference between Carpaccio and Robusta, by a difference in Put, Lys and Phe concentrations
88
Figure 6. Ozone effects on gene expression of gamma-glutamylcysteine synthase,
glutathione synthase and threonine aldolase.
Effects of ozone on the expression of putative genes (mean ± SE) of gamma-glutamylcysteine
synthase (A), glutathione synthase (B) and threonine aldolase (C) on three poplar genotypes,
Carpaccio (orange border), Cima (green border) and Robusta (blue border) at five sampling
dates (2, 4, 11, 15 and 17 days).
Figure 7. Representation of genotype and ozone effects on amino acid concentrations in
poplar leaf.
Principal Component Analysis score plot of PC1 and PC2 (A), PC3 and PC2 (C) and the
corresponding PCA loading plots (B and D) of the Amino acids and polyamines
concentrations in leaves of three poplar genotypes, Carpaccio (orange circles), Cima (green
squares) and Robusta (blue triangles) submitted to ambient (A, dotted line) or Ozone
treatment (O, solid line) at five sampling dates (1, 2, 3, 4 and 5 corresponding to 2, 4, 11, 15
and 17 days respectively).
Figure 8. Ozone effects on amino acid concentrations in poplar leaf
Heat map representing the effects of ozone on the Amino acids and polyamines
concentrations in leaves of three poplar genotypes, Carpaccio (orange border), Cima (green
border) and Robusta (blue border) at five sampling dates (1, 2, 3, 4 and 5 corresponding to 2,
4, 11, 15 and 17 days respectively). Compounds are clustered by Pearson correlation.
Résultats
(Figure 7D). Most of the amino acids and polyamines concentrations decreased with time in
response to ozone, except for Put, Trp, Cys, Phe, Ile, His, Leu and Tyr (Figure 8, see also
Supporting Information Figure S3 for complete dataset). Asp, which is one of the most
abundant amino acids decreased strongly, thus there was a strong decrease in total amino
acids content (Figure 9, Supporting Information Figure S3).
Discussion
Reduced ascorbate and glutathione availability may be linked to ozone tolerance
in poplar.
Each compartment controls the redox signaling independently by its own antioxidative
capacities [39]. Ozone generates ROS in apoplastic space before to spread in other cellular
compartments. Ascorbate is present in various cell compartments, including apoplast, where it
is limited in O3 scavenging, because of low levels of its reduced form [37], [38]. Transport of
ascorbate in the cell is necessary for its regeneration, thus, we focus on the overall response of
ascorbate. Carpaccio, the least sensitive genotype to ozone [23], [30], had the highest total
leaf ascorbate concentration, but not higher constitutive ASA level than Cima and Robusta
showing that constitutive ASA level is insufficient for explaining ozone resistance in poplar
[40], [21]. In response to ozone, Carpaccio and Cima showed a strong increase in total
ascorbate due to a strong increase in ASA. In contrast, in Robusta, the most sensitive to
ozone, the total ascorbate concentration increased due to an increase of DHA concentration,
while ASA concentration remained stable. Thus, Robusta produced de novo ascorbate in
response to ozone, but was unable to regenerate it efficiently. Ascorbate is regenerated by
monodehydroascorbate reductase (MDHAR) and dehydroascorbate reductase (DHAR) at the
expense of NAD(P)H or GSH [18]. Ozone leads to an increase of respiration which can
89
Figure 9. Ozone effect on the total amino acid concentration.
Total amino acids content in leaves of three poplar genotypes (Carpaccio, Cima and Robusta)
exposed to ambient or ozone treatment at 2, 4, 11, 15 and 17 days. (Mean ± SE) (µmol g-1
DW with alanine-d4 as the internal standard)
Résultats
participate in the supply of reducing power when the photosynthesis is decreased [30]. As
shown by [30], in ozone treated leaves, Carpaccio sustains high levels of NAD(P)H while in
Robusta, NAD(P)H levels decreased. The inability of Robusta to regenerate its ASA pool in
response to ozone was not due to a decrease of GSH. It may be linked to the decrease of
NAD(P)H, an alteration of NAD(P)H turnover [30], or an insufficient activity of MDHAR
and DHAR. The tolerance of Carpaccio to ozone might be related to its capacity to regenerate
ASA, but must be combined with other factors of tolerance. GSH is the reducing co-factor for
several enzymes involved in ROS detoxification, thus playing a central role as an antioxidant
but also as a component of cell signalling [41], [42]. The glutathione redox ratio remained
stable under ozone, preserving cell signalling which suggests that the activity of glutathione
reductase (GR) was sufficient to maintain the glutathione pool in O3-treated leaves [21]
Carpaccio had higher glutathione concentrations, in its two forms and their increases under
ozone are stronger than in other genotypes. The higher de novo synthesis of glutathione, and
therefore, the higher availability of glutathione in Carpaccio, could be an important tolerance
trait, as found in another tolerant poplar genotype [21].
Ascorbate de novo synthesis in response to ozone correlated with VTC2 gene
expression regulation in poplar.
There are several routes of ascorbate biosynthesis in plants although it occurs mainly via
the L-galactose pathway [43]. GDP-D-mannose 3,5-epimerase (GME) catalyzes the first step
of two ascorbate biosynthesis pathways, the L-galactose and the L-gulose pathways [44].
GME plays a key role at the intersection of ascorbate and non-cellulosic cell-wall biosynthesis
[45]. Even if its regulation at the gene expression level was weak, it could be completed by an
induced activity of GME caused by an increase in NAD(P)+ due to oxidative stress [46].
90
Résultats
GDP-L-galactose phosphorylase (VTC2) produces the first metabolite dedicated to ascorbate
biosynthesis pathway and has been shown to represent the major controlling step at the
transcriptional level of ascorbate synthesis [43]. This is consistent with our results, as the
expression of VTC25, the most responsive gene involved in the L-galactose pathway,
correlated with ascorbate accumulation in response to ozone. Although we observed an
increased expression of VTC416, VTC4162, VTC46 and LGalDH1, it has been suggested that
a gene expression increase of L-Galactose-1-P phosphatase (VTC4), which is involved in both
L-galactose and animal-like pathways [47], is not always correlated with change of VTC4
activity and that L-Galactose dehydrogenase (LGalDH) exerts little control on ascorbate
biosynthesis [43], [48]. L-Galactono-1,4-lactone dehydrogenase (GLDH) catalyzes the last
step of ascorbate biosynthesis by the L-galactose pathway and the salvage pathway. Although
the transcript level of GLDH generally follows the same trend as ascorbate content, the effect
of increase in GLDH gene expression can vary between species and even between organs, and
is not always correlated with ascorbate content [49], [50], [51]. In our experiment, GLDH16
expression was barely increased in response to ozone and thus, cannot explain the increase in
ascorbate.
In conclusion, our results suggest that in poplar, under ozone stress, increased ascorbate
levels are associated to a transcriptional induction of ascorbate biosynthesis mainly by genes
encoding VTC2.
91
Résultats
Glutathione de novo synthesis in response to ozone may be linked to increase in
GSH1 and GSH2 genes expression combined with remobilization processes in
poplar.
The glutathione biosynthesis pathway consists of a two-step reaction sequence from Cys,
Glu and Gly: 1) gamma-glutamylcysteine synthetase (γ-ECS) catalyses the formation of
gamma-glutamylcysteine and 2) final step catalyzed by glutathione synthetase (GSH-S) from
Gly and gamma-glutamylcysteine [42]. The activity of γ-ECS is one of the controlling factors
of glutathione synthesis, whereas the activity of GSH-S has less impact [52]. Here, Cys
content and γ-ECS activity increased under ozone, suggesting that GSH-S activity could
become limiting in turn, justifying the increased gene expression of GSH-S observed. Higher
expression of these genes in Carpaccio could, in part, explains the increase in its tolerance to
ozone. The glutamine synthetase (GS) family has been previously described by [53]. The
expression of the two genes coding for the chloroplastic GS isoenzyme in poplar, GS8 and
GS10, decreased in response to ozone, whereas the expression of genes coding for the
cytosolic isoenzyme increased. Ozone led to the same responses as senescence and pathogen
attack, i.e. a decreased expression of chloroplastic gene proteins (GS8, GS10, GOGAT12 and
GOGAT16) whereas the expression of genes of the cytosolic isoforms is induced to allow a
remobilization of N and to sustain glutamate availability [54]. The major Gly biosynthesis
pathway is linked to photorespiration [55]. The fact that photorespiration is inhibited by ozone
treatment [56] may explain the large decrease observed in our experiment, in the expression
of genes coding for enzymes involved in photorespiration such as glyoxylate
aminotransferase. Gly and Ser are two amino acids that are readily interconvertible. As
described by [57], there is a serine-to-glycine conversion by cytosolic Serine
hydroxymethyltransferase (SHMT) connected with C1 metabolism and a glycine-to-serine
92
Résultats
conversion by mitochondrial SHMT. The expression of genes of mitochondrial SHMT
(GlyA3 and GlyA10) decreased in response to ozone, whereas the expression of genes of
cytosolic SHMT isoform was induced by ozone. Ozone stimulates C1 metabolism via
enhanced lignification in leaves [58], and thus could increase the production of Gly by
cytosolic SHMT, which could be used for glutathione production. Gly can also be synthesised
from Thr, but this reaction has been poorly studied. It has been suggested that Thr aldolase
could contribute to maintaining Gly homeostasis in plants at times of transition in the use of
the photorespiratory cycle [59]. In response to ozone, Thr aldolase could maintain Gly content
and thus, the observed increase of THA13 expression in Carpaccio could be helpful to tolerate
ozone.
The stronger upregulation of GSH1, GSH2 and THA13 genes expression correlated with
the increased concentration of reduced glutathione in the ozone tolerant genotype, Carpaccio.
Our results suggest that in poplar, the enhanced glutathione biosynthesis is mainly due to an
increased GSH1 and GSH2 genes expression combined with remobilization processes.
Regulation of plant amino acid metabolism in response to ozone.
De novo synthesis of antioxidants and repair processes induced by ozone lead to increased
needs for amino acids, requiring remobilization processes. The central position of amino acids
in between anabolic and catabolic pathways complicates the interpretation of their
concentrations. Monitoring pools of amino acids at five measurement points allows to
highlight the strongest trends characterizing the remobilization of amino acids under ozone
treatment. While concentrations of most of the amino acids decreased in response to ozone,
Cys, Ile and the aromatic amino acids (Phe, Tyr, Trp) as well as the polyamine Put, increased.
Cys content is one of the limiting factors of glutathione biosynthesis [52] and was increased in
93
Résultats
response to ozone, mainly in Carpaccio, probably due to a redox regulation of APS reductase
activity [60]. The increase in aromatic amino acids may be due to an induction of shikimate
pathway under ozone [58], [61], [62]. Aromatic amino acids are precursors of various
important metabolites [28] like lignins, phenolic acids and flavonoids that have been shown to
strongly increase in response to ozone in many studies [58], [63], [64], [65]. Under ozone, an
increase of putrescine content occurred mainly in Carpaccio and elevated levels of putrescine
are correlated with ozone resistance in various species [66], [67], [68]. Aspartate-family
amino acids (Ile, Asn, Lys, Met, Thr, and Asp) have been suggested to represent an
alternative catabolic pathway as substrate for TCA cycle under various abiotic stresses that
cause energy deprivation, such as ozone [27]. This could explain the final decrease of the
aspartate-family amino acid-levels in response to ozone.
Our results suggest an important remobilization of amino acids in response to ozone, in
order to provide energy and antioxidants to limit the negative effects. Ozone appeared to lead
to energy deprivation and to induce regulation at the transcriptomic level linked with
metabolomic changes. The response to ozone is highly complex as it consists of many
interactions at different scales and involves several metabolic and catabolic pathways. Studies
aiming to understand the resistance to ozone should incorporate several techniques to obtain a
more comprehensive view. Here we report that the higher resistance of Carpaccio could reside
in its capability to increase and regenerate its antioxidants, like ASA and GSH, and to find
energy resources by remobilizing its amino acids pool (Figure 10). Although Cima shared
some of these factors and responded even more rapidly than Carpaccio, it is not enough to
make it as tolerant as Carpaccio, but allowed it to better withstand than Robusta. Indeed, it
seems that a unique indicator of resistance is very unlikely; but it is rather the sum of several
factors that increases the resistance.
94
Figure 10. Scheme of the factors partly explaining ozone sensitivity among poplar
genotypes.
Synthesis of parameters that may be involved in the difference in ozone sensitivity between
the three genotypes. Colour frames (Carpaccio in orange, Cima in green and Robusta in blue)
represent an increase of concentration or gene expression (italics), the thickness showing the
intensity of the increase. Only parameters that varied differently among genotypes are colour
framed. No decrease has been shown in our study to be involved in the differences of
sensitivity between the genotypes.
Résultats
Acknowledgements
The authors are thankful to Stéphane Martin, Fabien Spicher and Patricia Ballias for
technical assistance. We thank Olivier Forestier and his team from the State Forest nursery of
Guémené Penfao for providing the cuttings. This work was supported by the COST action
FP0903 (STSM), the IFR110 EFABA, the French National Research Agency, ANR, project
VMCS “Vulnoz", the Lorraine Region and the Academy of Finland (project nro 138161)
95
References
1. Sandermann H (1996) Ozone and plant health. Annu Rev Phytopathol 34: 347-366.
2. Vingarzan R (2004) A review of surface ozone background levels and trends. Atmos
Environ 38: 3431-3442.
3. Sitch S, Cox PM, Collins WJ, Huntingford G (2007) Indirect radiating forcing of climate
change through ozone effects on the land-carbon sink. Nature 448: 791-795.
4. ASPA (2010) Bilan de qualité de l’air en Alsace: Période 2000 à 2009. ASPA 10083002 –
ID.
5. MEDDTL (2010) Bilan de la qualité de l’air en France en 2010.
6. Felzer BS, Cronin T, Reilly JM, Melillo JM, Wang X (2007) Impacts of ozone on trees
and crops. CR Geosci 39: 11-12.
7. Van Dingenen R, Dentener FJ, Raes F, Krol MC, Emberson L, et al. (2009) The global
impact of ozone on agricultural crop yields under current and future air quality
legislation. Atmos Environ 43: 604-618.
8. Avnery S, Mauzerall DL, Liu J, Horowitz LW (2011) Global crop yield reductions due to
surface ozone exposure: 1 Year 2000 crop production losses and economic damage.
Atmos Environ 45: 2284-2296.
9. Dizengremel P (2001) Effects of ozone on the carbon metabolism of forest trees. Plant
Physiol Biochem 39: 729-742.
10. Wittig VE, Ainsworth EA, Naidu SL, Karnosky DF, Long SP (2009) Quantifying the
impact of current and future tropospheric ozone on tree biomass, growth, physiology and
biochemistry: a quantitative meta-analysis. Glob Chang Biol 15: 396-424.
96
Résultats
11. Matyssek R, Le Thiec D, Löw M, Dizengremel P, Nunn AJ, et al. (2006) Interactions
between drought and O3 stress in forest trees. Plant Biol. 8: 11-17.
12. Heath RL (2008) Modification of the biochemical pathways of plants induced by ozone:
What are the varied routes to change? Environ Pollut 155: 453-463.
13. Ainsworth EA, Yendrek CR, Sitch S, Collins WJ, Emberson LD (2012) The effects of
tropospheric ozone on net primary productivity and implications for climate change.
Annu Rev Plant Biol 63: 15.1-15.25.
14. Castagna A, Ranieri A (2009) Detoxification and repair process of ozone injury: From
O3 uptake to gene expression adjustment. Environ Pollut 157: 1461-1469.
15. Ishida H, Makino A, Mae T (1999) Fragmentation of the large subunit of ribulose-1,5bisphosphate carboxylase by reactive oxygen species occurs near Gly-329. J Biol Chem
274: 5222-5226.
16. Apel K, Hirt H (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal
transduction. Annu Rev Plant Biol 55: 373-399.
17. Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene
network in plant. Trends Plant Sci 9: 490-498.
18. Foyer CH, Noctor G (2011) Ascorbate and Glutathione: the heart of the redox hub. Plant
Physiol 155: 2-18.
19. Dizengremel P, Le Thiec D, Bagard M, Jolivet Y (2008) Ozone risk assessment for
plants: Central role of metabolism-dependent changes in reducing power. Environ Pollut
156: 11-15.
97
Résultats
20. Matyssek R, Wieser G, Calfapietra C, De Vries W, Dizengremel P, et al. (2012). Forests
under climate change and air pollution: Gaps in understanding and future directions for
research. Environ Pollut 160 : 57-65.
21. Di Baccio D, Castagna A, Paoletti E, Sebastiani L, Ranieri A (2008) Could the
differences in O3 sensitivity between two poplar clones be related to a difference in
antioxidant defense and secondary metabolic response to O3 influx? Tree Physiol 28:
1761-1772.
22. Brosché M, Merilo E, Mayer F, Pechter P, Puzõrjova I, et al. (2010) Natural variation in
ozone sensitivity among Arabidopsis thaliana accessions and its relation to stomatal
conductance. Plant Cell Environ 33: 914-925.
23. Dumont J, Spicher F, Montpied P, Dizengremel P, Jolivet Y, et al. (2013) Effects of
ozone on stomatal responses to environmental parameters (blue light, red light, CO2 and
vapour pressure deficit) in three Populus deltoides x nigra genotypes. Environ Pollut
173: 85-96.
24. Rice-Evans CA, Miller NJ, Paganga G (1997) Antioxidant properties of phenolic
compounds. Trends Plant Sci 2: 152-159.
25. Moller IM, Jensen PE, Hansson A (2007) Oxidative modifications to cellular
components in plants. Annu Rev Plant Biol 58: 459-481.
26. Wieser G, Matyssek R (2007) Linking ozone uptake and defense towards a mechanistic
risk assessment for forest trees. New Phytol 174: 7-9.
27. Kirma M, Araujo WL, Fernie AR, Galili G (2012) The multifaceted role of aspartatefamily amino acids in plant metabolism. J Exp Bot 63: 4995-5001.
98
Résultats
28. Maeda H, Dudareva N (2012) The Shikimate pathway and aromatic amino acid
biosynthesis in plants. Annu Rev Plant Biol 63: 73-105.
29. Noctor G, Strohm M, Jouanin L, Kunert KJ, Foyer CH, et al. (1996) Synthesis of
glutathione in leaves of transgenic poplar overexpressing [gamma]-glutamylcysteine
synthetase. Plant Physiol 112: 1071-1078.
30. Dghim AA, Dumont J, Hasenfratz-Sauder MP, Dizengremel P, Le Thiec D, et al. (2013)
Capacity for NADPH regeneration in the leaves of two poplar genotypes differing in
ozone sensitivity. Physiol Plant 148: 38-50.
31. Kampfenkel K, Van Montagu M, Inzé D (1995) Extraction and determination of
ascorbate and dehydroascorbate from plant tissue. Anal Biochem 225: 165-167.
32. Griffith OW (1980) Determination of glutathione and glutathione disulfide using
glutathione reductase and 2-vinylpyridine. Anal Biochem 106: 207-212.
33. R Development Core Team (2012) R: A language and environment for statistical
computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-070.
34. Pinheiro J, Bates D, DebRoy S, Deepayan S, R Development Core Team (2012) Nlme:
Linear and Nonlinear Mixed effects Models. R package version 3.1-103.
35. Saeed AI, Sharov V, White J, Li J, Liang W, et al. (2003). TM4: a free, open-source
system for microarray data management and analysis. Biotechniques 34: 374-378.
36. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, et al. (2006). TM4
microarray software suite. Methods Enzymol 411: 134-93.
99
Résultats
37. D’Haese D, Vandermeiren K, Asard H, Horemans N (2005). Other factors than
apoplastic ascorbate contribute to the differential ozone tolerance of two clones of
Trifolium repens L. Plant Cell Environ 28: 623-632.
38. Booker FL, Burkey KO, Jones AM (2012) Re-evaluating the role of ascorbic acid and
phenolic glycosides in ozone scavenging in the leaf apoplast of Arabidopsis thaliana L.
Plant Cell Environ 35: 1456-1466.
39. Munné-Bosch S, Queval G, Foyer CH (2013) The impact of global change factors on
redox signaling underpinning stress tolerance. Plant Physiol 161: 5-19.
40. Ranieri A, Castagna A, Padu E, Moldau H, Rahi M, et al. (1999) The decay of O3
through direct reaction with cell wall ascorbate is not sufficient to explain the different
degrees of O3-sensitivity in two poplar clones. J Plant Physiol 154: 250-255.
41. Galant A, Preuss ML, Cameron JC, Jez JM (2011) Plant glutathione biosynthesis:
diversity in biochemical regulation and reaction products. Front Plant Sci 2: 1-7.
42. Noctor G, Mhamdi A, Chaouch S, Han Y, Neukermans J, et al. (2012) Glutathione in
plants: an integrated overview. Plant Cell Environ 35: 454-484.
43. Linster CL, Clarke SG (2008) L-Ascorbate biosynthesis in higher plants: the role of
VTC2. Trends Plant Sci 13: 567-573.
44. Wolucka BA, Van Montagu M (2007) The VTC2 cycle and the de novo biosynthesis
pathways for vitamin C in plants: An opinion. Phytochemistry 68: 2602-2613.
45. Gilbert L, Alhagdow M, Nunes-Nesi A, Quemener B, Guillon F, et al. (2009) GDP-Dmannose 3,5-epimerase (GME) plays a key role at the intersection of ascorbate and noncellulosic cell-wall biosynthesis in tomato. Plant J 60: 499-508.
100
Résultats
46. Wolucka BA, Van Montagu M (2003) GDP-mannose 3,5-epimerase forms GDP-Lgulose, a putative intermediate for the de novo biosynthesis of vitamin C in plants. J Biol
Chem 278: 47483-47490.
47. Torabinejad J, Donahue JL, Gunesekera BN, Allen-Daniels MJ, Gillaspy GE (2009)
VTC4 is a bifunctional enzyme that affects myoinositol and ascorbate biosynthesis in
plants. Plant Physiol 150: 951-961.
48. Gatzek S, Wheeler GL, Smirnoff N (2002) Antisense suppression of L-galactose
dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate
synthesis and reveals light modulated L-galactose synthesis. Plant J 30: 541-553.
49. Ishikawa T, Dowdle J, Smirnoff N (2006) Progress in manipulating ascorbic acid
biosynthesis and accumulation in plants. Physiol Plant 126: 343-355.
50. Alhagdow M, Mounet F, Gilbert L, Nunes-Nesi A, Garcia V, et al. (2007) Silencing of
the
mitochondrial
ascorbate
synthesizing
enzyme
L-Galactono-1,4-lactone
dehydrogenase affects plant and fruit development in tomato. Plant Physiol 145: 14081422.
51. Tsuyoshi I, Mamiko N, Yusuke B, Masashi H, Kazuko O, et al. (2009) Importance of the
l-galactonolactone pool for enhancing the ascorbate content revealed by lgalactonolactone dehydrogenase-overexpressing tobacco plants. Plant Cell Tissue Organ
Cult 96: 105-112.
52. Noctor G (2006) Metabolic signalling in defence and stress: the central roles of soluble
redox couples. Plant Cell Environ 29: 409-425.
101
Résultats
53. Castro-Rodriguez V, Garcia-Gutiérrez A, Canales J, Avila C, Kirby EG, et al. (2011)
The glutamine synthetase gene family in Populus. BMC Plant Biol 11: 1-16.
54. Masclaux-Daubresse C, Daniel-Vedele F, Dechorgnat J, Chardon F, Gaufichon L, et al.
(2010) Nitrogen uptake, assimilation and remobilization in plants: challenges for
sustainable and productive agriculture. Ann Bot 105: 1141-1157.
55. Igarashi D, Tsuchida H, Miyao M, Ohsumi C (2006) Glutamate:glyoxylate
aminotransferase modulates amino acid content during photorespiration. Plant Physiol
142: 901-910.
56. Bagard M, Le Thiec D, Delacote E, Hasenfrat-Sauder MP, Banvoy J, et al. (2008)
Ozone-induced changes in photosynthesis and photorespiration of hybrid poplar in
relation to the developmental stage of the leaves. Physiol Plant 134: 559-574.
57. Mouillon JM, Aubert S, Bourguignon J, Gout E, Douce R, et al. (1999) Glycine and
serine catabolism in non-photosynthetic higher plant cells: their role in C1 metabolism.
Plant J 20: 197-205.
58. Cabané M, Pireaux JC, Leger E, Weber E, Dizengremel P, et al. (2004) Condensed
lignins are synthesized in poplar leaves exposed to ozone. Plant Physiol 134: 586-594.
59. Joshi V, Laubengayer KM, Schauer N, Fernie AR, Jander G (2006) Two Arabidopsis
threonine aldolases are nonredundant and compete with threonine deaminase for a
common substrate pool. Plant Cell 18: 3564-3575.
60. Bick JA, Setterdahl AT, Knaff DB, Chen Y, Pitcher LH, et al. (2001) Regulation of the
plant-type 5′-adenylyl sulfate reductase by oxidative stress. Biochemistry 40: 9040-9048.
102
Résultats
61. Janzik I, Preiskowski S, Kneifel H (2005) Ozone has dramatic effects on the regulation
of the prechorismate pathway in tobacco (Nicotiana tabacum L. cv. Bel W3). Planta 223:
20-27.
62. Betz GA, Gerstner E, Stich S, Winkler B, Welzl G, et al. (2009) Ozone affects shikimate
pathway genes and secondary metabolites in saplings of European beech (Fagus sylvatica
L.) grown under greenhouse conditions. Trees 23: 539-553.
63. Yamaji K, Julkunen-Tiitto R, Rousi M, Freiwald V, Oksanen E (2003) Ozone exposure
over two growing seasons alters root-to-shoot ratio and chemical composition of birch
(Betula pendula Roth). Glob Chang Biol 9: 1363-1377.
64. Peltonen PA, Vapaavuori E, Julkunen-Tiitto R (2005) Accumulation of phenolic
compounds in birch leaves is changed by elevated carbon dioxide and ozone. Glob Chang
Biol 11: 1305-1324.
65. Kontunen-Soppela S, Ossipov V, Ossipova S, Oksanen E (2007) Shift in birch leaf
metabolome and carbon allocation during long-term open-field ozone exposure. Glob
Chang Biol 13: 1053-1067.
66. Langebartels C, Kerner K, Leonardi S, Schraudner M, Trost M, et al. (1991)
Biochemical plant responses to ozone. 1. Differential induction of polyamine and
ethylene biosynthesis in tobacco. Plant Physiol 95: 882-889.
67. Ye B, Müller HH, Zhang J, Gressel J (1997) Constitutively elevated levels of putrescine
and putrescine-generating enzymes correlated with oxidant stress resistance in Conyza
bonariensis and wheat. Plant Physiol 115: 1443-1451.
103
Résultats
68. Durmus N, Kadioglu A (2005) Spermine and putrescine enhance oxidative stress
tolerance in maize leaves. Acta Physiol Plant 27: 515-522.
104
name
POPTR_0016s03990
POPTR_0001s32770
POPTR_0005s16360
POPTR_0006s24840
Name
GlDH16
GlyA1
GlyA5
GlyA6
v2.2
Phytozome
Gene
serine/threonine aldolase; putative; similar to
fgenesh4_pm.C_LG_V000326
hydroxymethyltransferase; putative; similar to
estExt_fgenesh4_pg.C_LG_VI1584
(Chlamydomonas reinhardtii) GI:17066746...
serine hydroxymethyltransferase
serine/threonine aldolase; putative; similar to
putative; similar to serine
SHMT8
CTGTTCTTGCACCATACATG
similar to glycine hydroxymethyltransferase;
Potri.006G232300
(Chlamydomonas reinhardtii) GI:17066746...
CTGCGCTAAGTTGATACTTG
Ref|XM_002309477.1|
hydroxymethyltransferase; putative; similar to
POPTR_0005s16370
serine hydroxymethyltransferase
putative; similar to serine
SHMT5
similar to glycine hydroxymethyltransferase;
CCAGTTTGCGGGTTCACTTT
Ref|XM_002307369.1|
gb|EF150637.1|
dehydorogenase; [ortholog of At3g47930]
similar to L-galactono-1; similar to 4-lactone
Phytozome description
Potri.005G170800
Potri.001G320400
Ref|XM_002322605.1|
NCBI reference
ACACAGGGCTTTTGTTGCCT
TGACATTCATCCCAGCATGA
CCGTTCTTGGTCTTGTAGTT
Pt-ATGLDH.1
CAGTATGGGGTTGTATGGTA
gw1.XVI.1375.1
Potri.016G040300
Alias
ATGGTCTCCTGCTTCCTTAA
Primers F and R 5’- 3’
List of genes studied with their specific primers.
Table S1
POPTR_0008s00350
POPTR_0010s26130
POPTR_0017s08600
POPTR_0001s21950
POPTR_0002s10990
GlyA8
GlyA10
GlyA17
GlyA19
GlyA23
hydroxymethyltransferase) (SHMT).; [co-
gw1.VIII.2633.1
hydroxymethyltransferase) (SHMT).; [co-
estExt_fgenesh4_pm.C_LG_X0942
SHMT9
CACCGCTGTAACAAAATCAG
SHMT3
AGATCTGCGTGGTATACATG
grail3.0003095602
Potri.002G109200
TGCAAGGTGTGTGGATTCTT
gw1.I.9830.1
Potri.001G212000
GATGTACAGGTTGGTGATTG
Ref|XM_002302321.1|
gb|EF150645.1|
At4g13890]
Pt-SHM4.2
estExt_fgenesh4_pm.C_880008
[co-ortholog (2 of 2) of At4g13930,
SHMT6
ATCATCACTTGCACGAAAGC
similar to serine hydroxymethyltransferase 4;
Potri.017G059300
TTCTTGGGATGAATGGTCCT
Ref|XM_002328874.1|
2.1.2.1) (Serine methylase) (Glycine
Pt-SHM1.3
ortholog (1 of 3) of At4g37930]
similar to mitochondrial precursor (EC
SHMT7
GGCAGTAGAAACTCGAAAGC
similar to Serine hydroxymethyltransferase;
Potri.010G254700
CCAGTGCTGAGGAAAGCAAT
Ref|XM_002335387.1|
2.1.2.1) (Serine methylase) (Glycine
Pt-SHM1.2
ortholog (2 of 3) of At4g37930]
similar to mitochondrial precursor (EC
SHMT2
similar to Serine hydroxymethyltransferase;
TTCGTCTCGGCAGTATGTTT
Ref|XM_002310880.1|
Potri.008G002900
TCCGTCATGAAGTGGAAGAA
POPTR_0002s09080
POPTR_0005s05450
POPTR_0013s03790
POPTR_0006s03660
POPTR_0012s01860
GlyA24
GME5
GME13
GOGAT6
GOGAT12
synthase. [ORG:Medicago sativa]; [coortholog (2 of 3) of At5g53460, AAB41904]
Pt-GLT1.3
eugene3.06620001
GATTTTCAAGCCAGCAGGTT
similar to NADH-dependent glutamate
Potri.012G011700
AAGATTGGGTAGACGTGAGA
Ref|XM_002332695.1|
ortholog (1 of 2) of T06228, AAP33664,
estExt_fgenesh4_pg.C_LG_VI0304
At2g41220, At5g04140]
synthase. [ORG:Securigera parviflora]; [co-
Pt-GLU1.2
similar to ferredoxin-dependent glutamate
TCTCTAACAATGGGGATGCT
Ref|XM_002308848.1|
At5g28840]
GI:9937230; [co-ortholog (1 of 2) of
BlmG from Streptomyces verticillus
family protein; similar to sugar epimerase
NAD-dependent epimerase/dehydratase
At5g28840]
GI:9937230; [co-ortholog (2 of 2) of
BlmG from Streptomyces verticillus
family protein; similar to sugar epimerase
NAD-dependent epimerase/dehydratase
Potri.006G038400
estExt_fgenesh4_pg.C_LG_XIII0193
TTCATCACAGACCACCAATG
Ref|XM_002319603.1|
Ref|XM_002328306.1|
(Chlamydomonas reinhardtii) GI:17066746...
serine hydroxymethyltransferase
TTATCGGGGAAACAGAATGC
Potri.013G040600
eugene3.00700070
TTCCCAGATGACTGCGTAGA
AGCTTTTATGCCCTCATTCC
Potri.005G053000
TAATAGCCGTGGACCTTGCT
hydroxymethyltransferase; putative; similar to
eugene3.00020834
serine/threonine aldolase; putative; similar to
putative; similar to serine
SHMT4
similar to glycine hydroxymethyltransferase;
CGTCTCAAAATCAGCCTCTAT
Ref|XM_002300986.1|
Potri.002G090200
GTGGGACTGATAACCATTTGT
POPTR_0015s01950
POPTR_0016s03630
POPTR_0004s08380
POPTR_0005s09610
GOGAT15
GOGAT16
GS4
GS5
estExt_fgenesh4_pg.C_LG_XVI0276
of AAM71227, AAR05531, AAP51252,
estExt_Genewise1_v1.C_LG_V3325
AAR05523, AAO41662, AAR05,...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
AAM71231, AAR05581, AAR05506,
AAR05559, AAR05552, AAM71209,
[ORG:Glycine falcata]; [co-ortholog (7 of 8)
Pt-NCPGS.4
similar to glutamine synthetase.
Potri.005G093200
GGTTGAGAGAGGAGCAGTTT
CAA63963, ...]
AAD52008, 1211328A, P00965, AJFBQ,
S62712, AAQ01729, AAP20795, AAB03492,
CTTCAATGATCGCCGAAACC
Ref|XM_002306349.1|
bean. [ORG:Phaseolus vulgaris]; [co-ortholog
estExt_fgenesh4_pm.C_LG_IV0266
(2 of 5) of JQ0937, AAB23379, P08282,
6.3.1.2) gamma; similar to cytosolic - kidney
Pt-CYTGS.4
GAACTCACTTGCTGCCTCAA
similar to glutamate-ammonia ligase (EC
Potri.004G085400
AACCTCAACAAGCCCCTCTT
Ref|XM_002305849.1|
ortholog (2 of 2) of T06228, AAP33664,
Pt-GLU1.1
GGATGCTCTTGGGTGATGTT
At2g41220, At5g04140]
synthase. [ORG:Securigera parviflora]; [co-
Potri.016G036900
CCCCAACCTGTACAGATCAA
similar to ferredoxin-dependent glutamate
ortholog (1 of 3) of At5g53460, AAB41904]
estExt_fgenesh4_pg.C_LG_XV0172
Ref|XM_002322587.1|
synthase. [ORG:Medicago sativa]; [co-
Pt-GLT1.2
similar to NADH-dependent glutamate
AGCAAGCTGGTTGAAAGCTA
Ref|XM_002321400.1|
Potri.015G017500
TGGGGACTTGGAATGATTGA
POPTR_0007s07960
POPTR_0008s20460
POPTR_0010s03010
GS7
GS8
GS10
AAR05559, AAR05552, AAM71209,
estExt_fgenesh4_pg.C_LG_VII0739
of AAM71227, AAR05531, AAP51252,
estExt_Genewise1_v1.C_LG_X4165
AAR05523, AAO41662, ...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
AAM71231, AAR05581, AAR05506,
AAR05559, AAR05552, AAM71209,
[ORG:Glycine falcata]; [co-ortholog (3 of 8)
Pt-NCPGS.7
GGTCCAAAACAGTGATGGTT
similar to glutamine synthetase.
Potri.010G029100
AAR05523, AAO41662, ...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
AAM71231, AAR05581, AAR05506,
TAAAGACCCTGGTGTGGATT
Ref|XM_002314390.1|
of AAM71227, AAR05531, AAP51252,
estExt_fgenesh4_pg.C_LG_VIII1790
AAR05559, AAR05552, AAM71209,
[ORG:Glycine falcata]; [co-ortholog (4 of 8)
Pt-NCPGS.8
CCACGGGATGTCTTCAATCT
similar to glutamine synthetase.
Potri.008G200100
AAR05523, AAO41662, AAR05, ...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
CGCATGGGAAACTTCTCTCT
Ref|XM_002312697.1|
of AAM71227, AAR05531, AAP51252,
POPTR_0007s07970
AAM71231, AAR05581, AAR05506,
[ORG:Glycine falcata]; [co-ortholog (6 of 8)
Pt-NCPGS.5
similar to glutamine synthetase.
ACAGGAGGAGGATATGTTCA
Ref|XM_002310630.1|
Potri.007G069600
TGATGGCTTGCATTTCATTCT
POPTR_0012s04090
POPTR_0015s05010
POPTR_0017s02770
GS12
GS15
GS17
bean. [ORG:Phaseolus vulgaris]; [co-ortholog
estExt_Genewise1_v1.C_LG_II2125
CAA63963, ...]
AAD52008, 1211328A, P00965, AJFBQ,
S62712, AAQ01729, AAP20795, AAB03492,
(1 of 5) of JQ0937, AAB23379, P08282,
6.3.1.2) gamma; similar to cytosolic - kidney
Pt-CYTGS.5
GAAATCTGGGCATCCATGAA
similar to glutamate-ammonia ligase (EC
Potri.017G131100
AAR05523, AAO41662, AAR05, ...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
AAM71231, AAR05581, AAR05506,
CGGAAGGATTTGAGTCAGTA
gb|EF147238.1|
of AAM71227, AAR05531, AAP51252,
estExt_fgenesh4_pg.C_1220090
AAR05559, AAR05552, AAM71209,
[ORG:Glycine falcata]; [co-ortholog (1 of 8)
Pt-NCPGS.3
TCCCAACTATCTTCCAACAG
similar to glutamine synthetase.
Potri.015G034700
AAR05523, AAO41662, ...]
AAC37356, AAM71193, AAM71233,
AAP51256, AAO41677, AAO41668,
AAM71231, AAR05581, AAR05506,
GGATTTCTGAATGCCCAATG
Ref|XM_002329679.1|
of AAM71227, AAR05531, AAP51252,
estExt_fgenesh4_pm.C_LG_XII0003
AAR05559, AAR05552, AAM71209,
[ORG:Glycine falcata]; [co-ortholog (8 of 8)
Pt-NCPGS.6
similar to glutamine synthetase.
CCAGCTCTACCAAATTTCAC
Ref|XM_002318269.1|
Potri.012G043900
TGCCTCTTCGTTGTCCATTT
POPTR_0001s09340
POPTR_0003s12700
POPTR_0013s02780
POPTR_0005s04040
POPTR_0003s07020
POPTR_0006s10740
POPTR_0007s06190
POPTR_0008s19160
GSH11
GSH13
GSH213
GSH25
GT3
GT6
GT7
GT8
Pt-AGT2.1
TGCCAATGCCCTTTGCCATA
aminotransferase 1; [co-ortholog (1 of 2) of
At1g70580, At1g23310]
Pt-AOAT1.2
eugene3.00081764
CAGGTATTCATGCAGACGAT
similar to alanine-2-oxoglutarate
2; [co-ortholog (1 of 2) of At4g39660]
similar to alanine:glyoxylate aminotransferase
precursor ...
aminotransferase 2 ; similar to mitochondrial
SP|Q64565|Alanine glyoxylate-
similar to AGT; putative; similar to similar to
alanine-pyruvate aminotransferase; putative;
aminotransferase; putative; similar to beta-
similar to alanine-glyoxylate
Potri.008G187400
Ref|XM_002312643.1|
Ref|XM_002310555.1|
Ref|XM_002309139.1|
Ref|XM_002304219.1|
Ref|XM_002304457.1|
Ref|XM_002297999.1|
ATTGGGCAGTTCAAGCCTTT
gw1.VII.1999.1
Potri.007G085600
gw1.VI.969.1
CGGGCCAGTTTGTGAATGAT
GCATAGCTGATGAGGTGCAA
Potri.006G106800
Potri.003G072600
Potri.005G038100
Potri.013G026800
TGTTTTCAGAATTACACCTCCA
AAGGTAACATCCATCGTTGTA
GGATGAGTTTCGCGATTGAA
GGGTGAAACAGCAGGAAAGA
GCCCGAGCTATTTGTGATGA
TGGGCGAAACCATAGGAAAA
GCCTGATCTCTTTGTGATGA
ATCCGGGTGTATTCAATGAG
Potri.003G126900
estExt_Genewise1_v1.C_LG_I8937
ACCTGTGCTAACCACATCAG
TTTGGGTGTAAGCCTTGTTC
Potri.001G104500
ATTTCGGGGTGGACTGTTGA
POPTR_0010s05530
POPTR_0016s13970
POPTR_0001s29390
POPTR_0009s08490
GT10
GT16
LGalDH1
LGalDH9
Pt-AGT3.1
AGTAAGAACCCAAAGAGAGG
Potri.009G081300
estExt_fgenesh4_pm.C_LG_IX0390
TTGAGTTTCGGATCCATCAG
estExt_fgenesh4_pg.C_LG_I2703
GCGGAAAATGAAGGATTGAC
GGCTCTCCAATCCATATTTG
Potri.001G287100
GCTGATGGATCCAAAGTTCA
estExt_fgenesh4_pm.C_LG_XVI0476
Potri.016G132200
Potri.010G045100
CCTACTGGTTGATCATATGC
GTAGCTAGCTCATCAGACTA
CAATCGACTGGATGAATGTG
Ref|XM_002313170.1|
Ref|XM_002298766.1|
Ref|XM_002323619.1|
Ref|XM_002315639.1|
family; [co-ortholog (1 of 2) of At4g3367...]
GI:829054; similar to aldo/keto reductase
dehydrogenase (Pseudomonas sp.)
GI:16555790; similar to L-fucose
dehydrogenase (Arabidopsis thaliana)
GalDH); similar to L-galactose
similar to L-galactose dehydrogenase (L-
family; [co-ortholog (2 of 2) of At4g3367...]
GI:829054; similar to aldo/keto reductase
dehydrogenase (Pseudomonas sp.)
GI:16555790; similar to L-fucose
dehydrogenase (Arabidopsis thaliana)
GalDH); similar to L-galactose
similar to L-galactose dehydrogenase (L-
3; [ortholog of At2g38400]
similar to alanine:glyoxylate aminotransferase
POPTR_0013s04350
POPTR_0019s03530
POPTR_0005s22060
POPTR_0001s36560
THA13
THA19
UBL
VTC21
Pt-VTC2.2
AGATGCTCAAGTTCCACAAG
grail3.0032000401
Potri.001G355600
CCTGGTGTGGATTGTTATGT
Ref|XM_002298780.1|
CAA38256, P03993, BAA76429,
estExt_Genewise1_v1.C_LG_V0494
(1 of 2) of At5g55120, At4g26850]
similar to vitamin c defective 2; [co-ortholog
CAA06197]
AAF70460, AAQ08999, BAA05085,
AAF31707, BAA85750, AAP31578,
BAA05670, AAQ08998, AAL33551,
melo]; [co-ortholog (10 of 11) of CAA10056,
Pt-SUBI.4
similar to polyubiquitin. [ORG:Cucumis
gb|R90493; ...
gb|R30517|; similar to gb|T42772; similar to
{{Aeromonas jandaei}}; similar to ESTs
acetaldehyde-lyase) (SP:O07051)
4.1.2.-) (L-allo-TA) (L-allo-threonine
similar to L-allo-threonine aldolase (EC
similar to L-allo-threonine aldolase-related;
TGTAGTCGCGAGCTGTCTTG
Ref|XM_002306689.1|
Ref|XM_002325298.1|
gb|T42772; similar to gb|R90493; ...
similar to ESTs gb|R30517|; similar to
lyase) (SP:O07051) {{Aeromonas jandaei}};
(L-allo-TA) (L-allo-threonine acetaldehyde-
similar to L-allo-threonine aldolase (EC 4.1.2)
similar to L-allo-threonine aldolase-related;
Potri.005G198700
estExt_fgenesh4_pg.C_LG_XIX0195
Ref|XM_002319070.1|
TGAGGCTTAGGGGAGGAACT
Potri.019G018500
GACCATGAGTTGACTTGAGA
estExt_Genewise1_v1.C_LG_XIII1664
CAGAGATCGCTTTTGGACTT
TACGCACTCTCCTGCTTTAA
Potri.013G046400
CAGGTGGTTGTTCAGTGAAA
POPTR_0011s08940
POPTR_0005s14440
POPTR_0006s01600
POPTR_0016s01220
POPTR_0016s01230
VTC211
VTC25
VTC46
VTC416
VTC4162
Pt-VTC2.1
CCCATGCAGTACATACAAAG
TCTCTCAGTTTCTTTAAGCCT
TGAGGTTTTGCAGCAATCAG
GTGGTCTGCATGATCAACAA
Potri.010G156300
Potri.016G011000
estExt_Genewise1_v1.C_LG_VI0423
AGGCATGCTTTCTGCTCAAT
TGAGAGAGTGGCAACATCAA
Potri.006G014900
eugene3.00002305
ACCATGCAATCTTGGGGTAA
CTGAGAGTCTTCCAATTGCT
Potri.017G126100
TATTGGAAGCAGCAGGCTTT
grail3.0062001301
Potri.011G087200
CACTAGTGTGTTTGTGGATTA
Ref|XM_002337620.1|
Ref|XM_002323105.1|
Ref|XM_002307859.1|
Ref|XM_002302931.1|
Ref|XM_002316719.1|
IMP) (3 Inositol) ...
monophosphatase)-3 EC (3 1.3.25.IMPase) (3
to SP|P54928|Inositol 1-(or 4
putative; similar to IMPase; putative; similar
putative; similar to inositol monophosphatase;
similar to inositol-1(or 4)-monophosphatase;
(2 of 2) of At5g55120, At4g26850]
similar to vitamin c defective 2; [co-ortholog
Table S2
ANOVA, the main effects, and significant interactions of genotype, O3 treatment and
sampling date on the concentrations of ascorbate (total, reduced form oxidized form
and redox ratio)
DF: Degrees of Freedom
Metabolite name
DF
F-value
p-value
Genotype
2
40.310
<0.0001
Treatment
1
44.752
<0.0001
Time
4
4.315
0.003
Genotype x time
4
9.977
<0.0001
Genotype
2
10.3582
0.0001
Treatment
1
8.1068
0.0056
Time
4
5.4790
0.0006
Genotype x time
8
4.1325
0.0004
Treatment x time
4
6.2252
0.0002
Genotype x treatment x time
10
2.5310
0.0107
Genotype
2
76.9992
<0.0001
Treatment
1
3.7923
0.0554
Time
4
8.3456
<0.0001
Genotype x treatment
2
5.5870
0.0056
Genotype x time
8
5.0058
0.0001
Genotype x treatment x time
12
2.3456
0.0134
Genotype
2
23.4853
<0.0001
Treatment
1
0.8656
0.3553
Time
4
6.3915
0.0002
Genotype x time
8
3.7001
0.0012
Treatment x time
4
2.8703
0.0290
Genotype x treatment x time
10
2.5797
0.0100
Total ascorbate (ASA+DHA)
Reduced ascorbate (ASA)
Oxidized ascorbate (DHA)
Redox ratio (ASA/(ASA+DHA))
Table S3
ANOVA, the main effects, and significant interactions of genotype, O3 treatment and
sampling date on the concentrations of glutathione (total, reduced form oxidized
form and redox ratio)
DF: Degrees of Freedom
Metabolite name
DF
F-value
p-value
Genotype
2
54.474
<0.0001
Treatment
1
279.081
<0.0001
Time
4
14.622
<0.0001
Treatment x time
4
10.790
<0.0001
Genotype
2
20.348
<0.0001
Treatment
1
99.539
<0.0001
Time
4
4.349
0.0029
Treatment x time
4
4.777
0.0015
Genotype
2
34.803
<0.0001
Treatment
1
158.216
<0.0001
Time
4
8.115
<0.0001
Treatment x time
4
7.447
<0.0001
Genotype
2
1.2317
0.2963
Treatment
1
2.7861
0.0983
Time
4
0.1552
0.9602
Total glutathione (GSSG+GSH)
Reduced glutathione (GSH)
Oxidized glutathione (GSSG)
Redox ratio (GSH/(GSH+GSSG))
Figure S1
Normalized expression of genes involved in Ascorbate biosynthesis in leaves of three
poplar genotypes (Carpaccio, Cima and Robusta) exposed to ambient or ozone
treatment at 2, 4, 11, 15 and 17 days. (Mean ± SE)
Figure S2
Normalized expression of genes involved in glutathione biosynthesis in leaves of
three poplar genotypes (Carpaccio, Cima and Robusta) exposed to ambient or ozone
treatment at 2, 4, 11, 15 and 17 days. (Mean ± SE)
Figure S3
Amino acids and polyamines content in leaves of three poplar genotypes (Carpaccio,
Cima and Robusta) exposed to ambient or ozone treatment at 2, 4, 11, 15 and 17
days. (Mean ± SE) (µmol g-1 DW with alanine-d4 as the internal standard)
A
O
5
1C
4I
4
1I
PC2 (17%)
3
5I
2
4I
4C 1C 5I
1
2C
0
3C
5C
-1
4C
4C
-2
4R
5R
3C
2R
-3
-4
3C
5C 4R
3R
3R
1R
3C
3R1I
4I
4C
1R
3I
2R
3R
4R
5R
2I 5I
4C
3C1I 2R2I
2C
3I 2I
1R
1I
1I
4C
1R 5C2R
5R
2I
5C
4R
2C
1C
2C
5R
5C1R 3I
1C 3C
1I
2I
3I
4I5C
5R
5I
4R
5R
4I
4R
2R
-5
-9
-8
-7
-6
-5
-4
-3
-2
-1
0
1
2
3
4
5
6
7
8
9
PC1 (52%)
SIMCA-P+ 12.0.1 - 2013-02-04 16:06:30 (UTC+1)
Figure 47: Analyse en composantes principales basée sur les concentrations des caroténoïdes, des
chlorophylles et des terpénols. En rouge, le traitement control ; en bleu, le traitement ozone. Les
échantillons sont représentés par un chiffre correspondant aux prélèvements (1, 2, 3, 4, 5 pour 2, 4, 11,
15 et 17 jours de traitement respectivement) et une lettre pour le génotype (C, I R pour Carpaccio,
Cima et Robusta respectivement)
Résultats
2. EFFETS DE L ’OZONE SUR LES CONCENTRATIONS EN COMPOSES
PHENOLIQUES ET EN CAROTENOÏDES
L’ascorbate et le glutathion sont deux acteurs majeurs du processus de détoxication,
mais d’autres métabolites sont capables de détoxiquer les ROS produits par l’ozone. Parmi
ces métabolites, on peut citer les composés phénoliques et les caroténoïdes. En effet, les
composés phénoliques sont connus comme représentant des composés de défense importants
contre les dommages dus à l’ozone. Il a été montré chez différentes espèces qu’ils
s’accumulaient en réponse à l’ozone chez Betula pendula Roth (Saleem et al., 2001); chez
Populus tremula x tremuloides (Häikiö et al., 2009) et chez Trifolium pratense L. (Saviranta
et al., 2009). Or, nous avons pu voir précédemment que la remobilisation des acides aminés
était favorable à la voie de synthèse de ces composés. Les caroténoïdes quant à eux, peuvent
agir comme antioxydants par oxydation du radical anion superoxyde et enrayer ainsi la
production d’autres ROS (Galano et al., 2010 ; Han et al., 2012).
Afin de confirmer, chez nos trois génotypes de peuplier euraméricain, s’il existait la
même augmentation des concentrations en composés phénoliques et en caroténoïdes, et afin
d’étudier leur rôle potentiel dans leur différence de sensibilité, nous avons conduit une
analyse métabolomique ciblée de ces composés.
Lors de l’extraction et l’analyse des caroténoïdes, les chlorophylles a et b, ainsi que
des terpénols, ont été extraits. Comme le montre la figure 47, l’ozone a un fort effet sur les
caroténoïdes, les chlorophylles et les terpénols. En effet, une analyse en composante
principale permet de mettre en avant l’importance du traitement à l’ozone qui explique plus
de 50% de la variance des échantillons (PC1). D’une manière générale, le génotype le plus
résistant, Carpaccio, se caractérise par des concentrations en chlorophylles et en caroténoïdes
légèrement plus faibles que les deux autres génotypes (Fig. 48a,b). Néanmoins, en réponse à
l’ozone on observe une baisse de ces composés chez les trois génotypes (Fig. 48). Les
différences de sensibilité à l’ozone entre nos génotypes ne sont donc pas liées aux
concentrations en caroténoïdes, en chlorophylles ou en terpénols.
L’analyse des composés phénoliques a mis en avant une différence très nette dans le
profil de concentrations en composés phénoliques entre génotype, en particulier chez Cima
(Fig. 49). En effet, les trois premières composantes séparent nettement les trois génotypes et
105
A
B
C
Figure 48 : Concentration en caroténoïdes (A), en chlorophylles (B) et en terpénols (C) dans trois
génotypes de peuplier, Carpaccio, Cima et Robusta après 2, 4, 11, 15 et 17 jours de traitement ozone
ou control
C
I
R
1O
14
4T
4O
12
3T
10
2T
4T1O
8
3O
1T
2O
3T
3T 1T
2O
6
5O
5O
2T2O
1T
3O
2T
1T
5O 2O
4
PC2 (21%)
2T
5T
4O 4O3O
3O
5T 4T
5T 3T
4O 5T
5T
1T5T3O
5T 5O
2T 4O1O 4T
4O
5T
3T
1T
3O
1O
5O
1O
5T
4T 5O
3O
4T
2T
2T
3O 5O2O
3O
4O3T
2O
4O
4T
3T
4T
2O
1T
3T
4O
5T
5T4T
2O 3T 5O
1T
4O 5T
2T 1T
5O
2T
1O
2
0
-2
-4
-6
-8
2T
-10
1O
5O
1O
2T 3T
2O
3O 4T
3T
1T
4O
5O
2T
4T
5O
4T3T
2O
2O
1O
1O
3O 1O
1O
3O
-12
2O
-14
-16
-14
-12
-10
-8
-6
-4
-2
0
2
4
6
8
10
12
14
16
PC1 (24%)
SIMCA-P+ 12.0.1 - 2013-05-14 12:57:42 (UTC+1)
Figure 49: Analyse en composantes principales basée sur les concentrations des composés
phénoliques chez 3 génotypes de peuplier euraméricain, Carpaccio en orange, Cima en vert et Robusta
en bleu soumis ou non à un traitement ozone. Les échantillons sont représentés par le temps de
prélèvement (1 à 5) suivi d’une lettre en fonction du traitement (Ozone : O et Témoin : T).
Résultats
expliquent à elles trois 57% de la variance. La quatrième composante montre un effet ozone
qui sur les trois génotypes dès la troisième date et expliquant 8% de la variance. Si nos
analyses témoignent d’un effet de l’ozone sur les concentrations en composés phénoliques
avec principalement une hausse des concentrations, cet effet reste mineur en face des
différences constitutives entre génotypes. Ceci semble indiquer que si les composés
phénoliques jouent un rôle dans les processus de détoxication, c’est surement leurs
concentrations constitutives qui permettent de lutter plus ou moins efficacement face au stress
oxydatif induit par l’ozone. L’identification des composés discriminant les profils de chaque
génotype pourrait peut être révéler un facteur de tolérance à l’ozone.
106
Résultats
3. CAPACITE DE REGENERATION DU NADPH DANS LES FEUILLES
DE DEUX GENOTYPES DE PEUPLIER PRESENTANT DES
DIFFERENCES DE SENSIBILITE A L ’OZONE
Si la synthèse de novo est importante pour maintenir un pouvoir réducteur suffisant,
elle doit être couplée avec de bonnes capacités de régénération des molécules oxydées. La
régénération repose sur une suite de réactions d’oxydo-réduction qui se basent principalement
sur la disponibilité en NADPH. Or, la capacité de régénération du NADPH est fortement
dépendante de réactions enzymatiques liées au métabolisme carboné. L’assimilation de
carbone est réalisée par l’intermédiaire des enzymes carboxylantes, Rubisco et PEPC. En
réponse à l’ozone, la photosynthèse est limitée, provoquant un déficit énergétique et une
diminution de l’assimilation de carbone.
Afin de déterminer ce qui provoque la baisse de l’assimilation de carbone, le contenu
en chlorophylle et les activités des enzymes carboxylantes ont été mesurés. De plus, cette
étude s’intéresse à l’effet de l’ozone sur le contenu en NADPH, ainsi que sur l’activité des
enzymes recyclant le NADP. Cette étude a été réalisée en collaboration avec Dr Dghim dans
le cadre de sa thèse. Toutes les analyses d’activité ont été réalisées par Dr Dghim, ma
participation consistant principalement dans les mesures de chlorophylles, d’échanges gazeux
folaires et dans le calcul du POD. Le manuscrit issu de cette coopération met en avant les
conclusions suivantes :

l’ozone entraîne une baisse de l’assimilation nette de CO2 qui résulte
probablement d’une diminution du contenu en chlorophylle ainsi que d’un
ralentissement de l’activité de la Rubisco.

l’ozone provoque en revanche une augmentation de l’activité de la PEPC,
probablement liée à une fonction anaplérotique pour soutenir la production
d’intermédiaire du cycle de Krebs.

l’ozone induit une hausse des activités des enzymes régénérant le NADPH, et ce
de manière plus prononcée chez le génotype résistant (Carpaccio).
107
Résultats

la disponibilité en NADPH est maintenue chez le génotype résistant, tandis
qu’elle chute chez le génotype sensible en réponse à l’ozone.
Ces résultats ont été publiés dans Physiologia Plantarum (2013) 148 : 36-50.
108
012345657480689
8
!"# $%&#%&'!&()*+,*-.//0++1,231,4
567689:;<=>?@ABC>DEDFD>6:9=F9F:GDHD6IDJ=<:K=
7=7H6>EDF=:;7DJL9<<D>9FE9F=M=FDJDFJ9:9I9:;
N!&N%%& O )&-P-&Q--R
S''TSO()'!&&--P-P-QQ-U&S2#&(%SV&$&S-P-'T
&!W2/&(XS&-P-QPQ
Q
]
#SSOWS'S)S% -OXSYSZ SQ &'X[\S$R%\S!
^_`abbcdeefg_hi
jklminkopkqrll^ihkgfstutvvgw^hprkxjlksykzms{^h|}g~kpkgfl^h|k
€_`abbcdeefg
{a‚gfstuƒ„vg~…^†‡khrxgfl^h|k
|
fabbvef‚ˆ‚gfstutvvgw^hprkxjlksykzms{^h|}g~kpkgfl^h|k
‰Š‹‹ŒŽŠŒ‘Œ
’~rllkm‡rhpih“^xn…rlg
ks†^iy”•ryijkn–m|€iry—x…‡sh^h|}—˜l
ak|kijkpbc™xhkƒvbƒ
pri”bv—bbbbš•—bc››scvtu—ƒvbƒ—vbœ„œ—
½F:>=L¾8:9=F
ž66Ÿ8 8Ÿ4
2¡5Ÿ2
53564Ÿ¢£¤0¥ž7ž9ž8
459¦2¢£¤0§¨ž12¨57ž983ž3
©8349ªž3
478
ž¨ 49 1ž 6ž8ªž35¡
©5 12¦4̈ 5 68«05 63¨ž6§
54̈ž3¬05 639478­7ž95
2 ž349ž3 593ž
55®59ž«¯­
ž8
ž9
« ¦¡5°¨823­±©57ž95
2 ž3©4
1¨4¡¡žž9
486¯ 3ž934
4ª4
2©žž
3ž6žŸ
ž¨²¦83ž¨59ª438632 5389¨¡866ž96ž8ªž3³5¦3
8«3ž934
4ªž­89¨
8 8ŸŸ45«
56ž89
­±1žž3
48
ž¨¯´µ«0¯¤­²
18
ž9
žž¨
1ž6ž8ªž3²
©8334468¡5
1ž
©57ž95
2 ž3
15715
1ž
ž8
ž9
¶9ž3 593ž
5
18
¡5648¯´µ²¯8334468
459©834914¦4
ž¨
5
1ž38žžµ
ž9
¡5
1ž
©5
7ž95
2 ž3²©14Ÿ1Ÿ56̈¦žžµ 6849ž¨¦28¨žŸž83ž49³¦43Ÿ5«·¸­
8Ÿ
4ª4
259ªž3ž62²8949Ÿž83ž490·0«·­8Ÿ
4ª4
2©835¦3žªž¨²
57ž
1ž©4
1
1ž8Ÿ
4ª8
4595¡Ÿž
849Ÿ2
53564Ÿ¢£¤0§¨ž12¨57ž983ž38¦5ªž
1ž4Ÿ593
4
4ªž6žªž6²4ž¢£¤0§¹0¤¥«·¸­²¢£¤0§º·«864Ÿ
ž9®2ž­«·­89¨¢£¤0§¶¤¥ «¢£¤0§435Ÿ4
8
ž¨ž12¨57ž983ž­
«·­¥5©žªž²
1ž8Ÿ
4ª4
25¡959§ 153 15268
497¢£¤0§¹£0¤¥
«·¸­ž849ž¨9Ÿ1897ž¨»5 1ž
1¡478
459¨82²¢£¤0§
¹0¤¥ 89¨¢£¤0§º· 5¼6ž38¨ž4
5334¦6ž
5¨4¡¡žž9
48
ž¦ž
©žž9
1ž
©57ž95
2 ž3²©4
181471ž8Ÿ
4ª4
2498 8ŸŸ45
18949³5¦3
8£
1ž38ž
4ž²8 8ŸŸ45©838¦6ž
5849
84914716žªž635¡¢£¤0¥ 49
1žŸž663²©146ž¢£¤0¥6žªž63¨žŸž83ž¨49³5¦3
8¯§
ž8
ž¨6ž8ªž3£66
1ž3žž36
33 5
1ž12 5
1ž343
18
1žŸ8 8Ÿ4
2¡5Ÿž663
5ž7ž9ž8
ž
1žž¨Ÿ497 5©ž²ž3 žŸ48662
1žŸ2
53564Ÿ¢£¤0¥ 556²Ÿ59
4¦
ž3
5
4 5ªž
56ž89Ÿž
514715®59žžµ 53ž
¯®59ž«¯­43818¡6 12
5
5µ4Ÿ3
ž335¡5 689
3
«»1žž
86¸¸°²º8
233ž¿89¨¶99ž3¸¸¸²£315ž
²À8953¿2ž
86°²Á4
47ž
86¸­¶
Ÿ83ž3
3ž453¨887ž²49Ÿ6¨497ª434¦6ž49Â289¨75©
1
¨žŸ649ž
18
Ÿ896ž8¨3ž934
4ªž3 žŸ4ž3
5¨ž8
1¶9
žž3²
4
318¡6ž¡¡žŸ
Ÿ89ª82©4
175©
1Ÿ59¨4
4593²87ž²
3
Ÿ
ž5
1ž ž3ž9Ÿž5¡5
1ž3
ž3353«×566ž9©ž4̈ž
ž
86²º8
233ž¿ž
86²À8953¿2ž
86²
Ø¢··²ºŸÙ871649ž
86°­05 68183
¦žž9¨ž593
8
ž¨
5¦ž8597
1ž53
3ž934
4ªž
žž3 žŸ4ž3²¦
4
33ž934
4ª4
2ª84ž3¨ž ž9¨49759
Ÿ659ž3Ú7ž95
2 ž3«À8953¿2 ž
86¸¸²Û9 89¨
ÃÄÄÅÆÇÈÉÊÈËÌÍÎ~…yg~…yrlr‡…}yyÏМÑÒÓg“yx|rmksœs‡…rm‡…^nkpk…}plr“kh^mkÏЂÑÒÓg“y}|kl^ypk…}pkscs‡…rm‡…^nk
pk…}plr“kh^mkρ~ÒÓg{‚ÒÑsimr|inl^nkpk…}plr“kh^mkÏ`eg†^yi|khÔ}†kÏ`qg†^nxlkyk^jkmÏ{‚Òghi|rnih^†ipk^pkhihk
pihx|ykrnipkÏ{‚ÒÑghi|rnih^†ipk^pkhihkpihx|ykrnipk‡…rm‡…^nkÏÑeÑ~g‡…rm‡…rkhry‡}lxj^nk|^l€r}y^mkÏÑÕÒg‡…}nrnri|
rÔrhkprmkÏaÕÖglk^|nijkr}“khm‡k|ikmÏax€im|rgli€xyrmksbgts€im‡…rm‡…^nk|^l€r}y^mkr}“kh^mk—
ÜÝ
х}miry—Ñy^hn—bu„gƒvbc
0123456478889
343419
16641
9451241893444177346
443451446515944315613
63614414!44534541"#413
$39%&'(2123#1431)465645315
43'3*+(2 23# 65645,
3151!4134+!235)1#)
234)3-5)415-43425431#24
(.45!23)/3678880-4439445613
-434!1451436656453159154#
-434414513122,!14564261
/3 (/5#572645441!41343
5 54- 5421645166254
341 12245435)44132)11(.431
418915!14515436145)
1165261564(%7898+:565649
4341645166254535642#5)
1!#44645;2459-63415
3#65-5(
12)1345418*34645#
463!49- 15 ,42#5)!133432
!465434915134)# 131!44455)5
464<)45#4(445)344414=3
544454116163!14(35788'9
/>641?451!1334343345
!# 3431491465 6#6
544454111!4-5464*63!149
)21549115154566251344
15163446542#5)!133439)443
-14,6145)5)454#4(911)5115
15438#16 163!14 34)454314
!# 44316#6 42#5) 341651134
15#655464401-45*115$#436#64
($#4315763779-6)#4455
43445646#67*/0 ($)729
34)454315546#62!46543411
64#163364164,)45431421434
(763'9445)344418
4 6116# 36#6 7*/0 34)454315
)#4455454#1634165564613!5
41!:5 169 42234)415)-
134265 4915 6#64235,439135)
-146341452!616#(/4417889
445)34479
1)13419445)344
418*215425634145/8/916#
1!445!434544319 15(01541
788@9445)34479445)344418
/8/921556441514363445,
4563146#645434149!21)43
16#-7*/0,445456#6454#4A
7*/,16454#4(7*/,&8157*/,6314
4#3)4514 (7*/,:90 ($) 7 7*/,&8
611#4443443!42144613!2#15
0,1145#32 14-641434414
HIJKLMNOHNPQROSTUVWXSY
7*/0546#($)7*5563414516#
1!4455641541!63454 132
!6151!6344(442!5431B15#11B
7731344-15954345)#9635615
16242)15($51544178889445)344
4189.24187*/,:90611#44
43C15,2)213143 6314925)
7*/ 116163:4437*/0346#5
46#($)70)437*/,:90 16#1
!44556415345421434(&D43
1512578890)4417*/03,
264!#7*/,:90653!2434241
55#534541!634(445)34479
4441"9!21546141)45
1166(&1417456341457*/,
:90 16#6151!4133416555)
15163445453641545156433413
3644(445)344418
9#6 7*/0 615 1 !4 3264 !#
437*/,346#65) 454#426 1)264,',
144#3)4514(7*/,.'/01555,
3#15)9 7*/,44545 )#64314#4,
,144#3)4514(7*/,.*/0($)7
/157*/,.'/0 1#!445243
341153157*/0 236451,3265)
15 55,#54624(8415 74212
788@9?16141*5563414516#
1!445412345152!4 132!6
151!6344(
144178897415
116219E14331141'136213#5
34542)15(445)34479$5154
4178889.1264341434)215
55,3#15) 7*/,.*/0 16# 5-4,65-59!26155214
3434541!44541!4(
241
$51#9-45 24 521#9
447*/,44545454#4-434254
564F6116#56341442#6#6
7*/0 53454214340-443915
54)3142#4144341431564
416454#415!445613342#494461#5
3454)1#4
415!G46423-36-12#43426,
5)-43(7*/034)4543156116#13
41425434543414554!14 !4
11)49-13)45#4-4344464A!21
(4=541,45415 913166 (4=541
,4315?45-44244-)45#4
1)47! 37@1#94#1#4
13 512245414(!145/ 124
44345645 45#62!413!24
14345116#541!64613454
:565429-46134444634145
Z[
5
01234
5 5
01234
01234
5
01234
5
01234
6789
9!""!#$%"%&$'"$"
(#""")!$!*+$"!$"(,-#*".!/'%"$"(012*$%!3
$"$"%"""$""(*+%4"!$"(24#*".!
/&%&'"""!(#5*+6%7$"&"!(58*""3
"7$%&%.$"""!7!!$%.""$7'!"(8-*"!""!$"(5#*+
!$%."(8*"'"""(1*"$$.!%7$"&$"$!"$"+!$"!9
"!$"(2#*$""%!!""!7!"$%&#"6+
!$%."/"(:*""!"&!!""!$%!$%."+3"$7";-<3";#3!$"$7";
2#=223$%='%";2>3%"$%";:3!$%.""/"+(?*$&$#$%7!
!!$"+
@ABCDEFGHCDIJKFLMHNFOOMOOPDQDMKRSTFOOPUPVFKPCD
FDWEFGHCXNVFOMFEKPYPKPMO@ZIHPOECFDW[\[RB]@TBCD
ENKCOCVPE^_`[aGMENEVPDQMDbNUFKPEFEKPYPKPMOGMVFKMW
KC[\[RFEKPYPKNFDW@cBCDJNGPWPDMDIEVMCKPWMECDKMDKO]
HNFOOCEPFKPDQKdMPGYFGPFKPCDOKCKdMFEKPYPKNVMYMVOCe
KdM^_`[aWMJMDWMDKMDbNUMOfMFOOFNMWg
hijklminiopqkjrspt
uvwxyz{|}~€~v7~|y{‚}~ƒ78|
ZCCKMW EIKKPDQOCeKfC \IGFUMGPEFD dNHGPW JCJVFG
@[CJIVIOWMVKCPWMO„[CJIVIODPQGFBQMDCKNJMO]ZCHIOKF
FDWRFGJFEEPC]fMGMKGFDOJVFDKMWKC…aVJVFOKPEJCKOECDa
KFPDPDQC‹JcKPUPbMWQGCfKdOCPVUPXKIGM@^†[†‡Aˆ†A‰†AŠ]
AgTLQU ]ŒGFUCCGŽ[A DPYMGOMVBeMGKPVPbMW HN
žŸ
FWWPDQTQCeOVCfaGMVMFOMDIKGPMDKQGFDIVMO@^IKGPECKM
‘aA] ^†[†‡†’QS Ac†Ac†Ac†T] “MGKPV] ”CIVCQDMa
”PVVFDECIGK]“GFDEMBg`GFPDFQMfFOPUJGCYMWHNFTaEU
KdPELV‹FANMGCeEVFNHFVVOFKKdMHCKKCU CeKdMJCKOFDW
AUQV CeUFQDMOPIU VPUMOKCDMfFOFWWMWKCHIeeMG
KdMJ•g‘dMJVFDKOfMGMVMeKPDQGCfKdEdFUH
MGOeCG
–R—A–R
…fMMLOg‘MUJ
M
G
F
K
I
G
MfF
OUF
P
D
K
F
P
D
M
WF
KT
c
@WFNBFDWT–R—A–R@DPQdKBfPKdFGMVFKPYMdIUPWPKN
Ce˜…™—…™ @WFNBFDWŠ…™ @DPQdKBFDWfPKdFAˆad
VPQdKJMGPCW @ŽID ‘ _QGC][‹dTPVP‹JAO]\PDWdCYMD]‘dM
^MKdMGVFDWOšT…‹c›UCVU O JdCKCDIXFKVMFe
dMPQdKBg‘dMJVFDKOfMGMPGGPQFKMWWFPVNIOPDQKFJfFKMGg
`IGPDQKdMQGCfKdJMGPCW]CDMKMGUPDFVOdCCKfFO
LMJKgœdMDKdMKGMMOfMGMFJJGCXPUFKMVN‰EU dPQd]
OMVMEKMWIDPeCGUJVFDKOfMGMKGFDOeMGGMWPDKCJdNKCKGCDPE
EdFUHMGOeCGCbCDMMXJCOIGMgDCGWMGKCCHKFPDF
!+"+ ¡¢30£ 9
0121301342556785892
1353425785342183
393250 ??A
31208
13
8 3
=227 81253N
8248
16887830173183
83142870 @820788
1082
2621873213
012718
25347428708780817178218
1 2
018182621873213
8
8264N
!"#$%"%&'("#)*$+$%*
,#"-*'"('("#$%
.6117
34428708784
012
15698
13521831
427425/0518782372
714
313
087823
/
123
838
12334251
1083
1871428731
15 0241
565758985178218
1
01271821188
27/265
24453213
873
207487 783 3118
88
/
8721709:;<30487=
>872
62
?@>/;
A
92184AAB83
24>872
62
3
C84183784156
25
31180518782378
1873
1842870?
/
1751788087886081238
1 4
48
17213
0
D17118178218
1873E 081
212180601802
2
25688704@;F
937
8
1
GE.2730<72
48878081
317184
48
/
17213
02
1858
1 86078H852
10
8788608143I4 74JK1
33K2356747260<3213
01271842187
1883
3
1818732
72
1353108
H852
10878042118782
024823561293
023
H88
856208013218208
18
820788
10121254
412
4818
8
343078521810121254
412
4812187927
0618553
752KLMMN0<27808125
3N0@820788
108788778898763260
<72608
820788
120877820
8013218712382C248
192580=22781253N
.O5 208013218603
756
8
812P801711858868738
1A
130
4
1861721279383
3421398.O80132180
^",(%!,S$'*&S*
G258087812P8
@Z25
1847/265
86078
26037442
4721871883
3
3213
H58298054218
8611824187
87802588717882
874287@37302
8135808784171853275303
27287
528Z820258087845584183
253
287
72356
788
3
53_3
3178
2
383218560178
21]N`?
aS$#*%*U#S"'#$%"%&b"%#c'"#$%
E 5828786172412
4d e
5693
655667753
887836831:5
86172413
874
123
3
YF.FG2fY Y 7:
4@.g.3:Mde.F>37de@?53
:@F>HE:@5648754d 9e92
:d 9e9
7182083
331736178G32/E5734.J:JJH8
47`88617241087818
48
173821M2
21
?H8087
212
1087805187817G8286
>3:45
0.272432.O/47026<72
482447/
3
1182
241787h03
017413
0H88513
87
4
123
8YF.FG2fY Y 7:5648754d 9e9
@?53 :@ 2
OHH3@H`8851895820
8
3882
017821]N?771872
256030
H12505587183
087881873
824473
1i3528
8125342714522187
34752180841718176H8
/347531875342180
7183
86172410878381183
11885502JM/
85552182
36831187183
2002668=3/72
Z27217380A
4@
34>872
6=93
8087
53
G32/E5734@
34>872
62008
Q*"RS**%#$T!"R*U'V"%!*,"S"*#*SR"%&$T 2
2
0242537213
012
27
#$#"('V($S$,VW(('$%#*%#R
X81?3 200335213
E15?3 230242
j%+W"#'"'#)#W"RR"WR
0122
1254
412
481218792705Y3
3024878 82078 03
1 3
18742537218[ E55 8
862134 2413931380 878 200268 03
2
71258106
18030G60180ZA/?BM3ZA/?B 34752180841718187=318P.87i298k
A
4Z3
45
XF\GE@820788
10878 56 YH\GE<73878
1582861724107 83187
8778
185201556862
82178582980 4
1757/178218178808780878240253
@Z47780
3
1 18 N1241 582980
218E4139313803
824 8617241878 82078 3
7 18070123425582H78817880878
16887 534218021`?
5653
827088
1087808
4287878P8178017413980253
2
56 1 42545218 18 263 7218018 8
862134
087208642
8B85213984576554
18
103
782413
0B304F?44J241393162081873
8
??A
31878801321803
2??@/3?57655 6
3173
XEOY 8613
413
21
24473
?
18
1@818713/G]3438
480Y0
XY\GEH125 11871458047386<
123
881254JJJ
?5875822782 2081873
803
2P
H8782413
361782028=343
8Y N
785213
038012530871788582980?5L34 4@X2Y? 3:@XEOY @@?53
lmnopqrslrtuvswxyz{|w}
~
89:;<;=>?@@A<>B>:C;=DB;@=
6
277,0"0"978
(8)876
#977,967
7567756
7)5632678#,432997#
5(697676
78024
8594!997
765
779789
))
E#40797
011'"48627F4 112
7,,57(
(86727302(60#
8)84#8*
896331 2G
"(6 2
7,00 0H40H"7
27,01 1!03
040"!62G#
(89
,# 2111,7
1268#5
(8#
3!
)87
)9
2112(8,
1I7,655
75
32465
897,01I
7,688G
9#8K29
75859
7567
72
+7%47(
J4 4L6"!3G2#2
8
(
99##729)65
87,
(
65
7988#839
787,G9!
MBDB;NB;ODAD=DA9N;N
668
9
5
8828P6!
968254(5
,7
2QR777S(7(
887,4
901T"4#8**4752
²³
7
2401 "4(675
28
4
),97
8!6(
7
27,,
98)(97
718258
(
978
8F9,U1!1!79725
6
7#5284601T 8(8,77()
8F9U1!1"#%
8!V
887
(8#878697
78)(,,
3299440(8,77()(7
(01T 79725
!L8
7
629
27*478898F9962)
,,9
(8,7#,7
7,685
2
86
7#67#
6(67,#275
7!
WXYZ[\Y
];N;^A>;=_`:9D=<A>DaaDAA
6737b#G89#2#458726
)897,6
8674#11"(
99#,7
5997*7)#8!6(
4
#86
4#87)6,7#
1 567
79962)
8!
6
7#67#6(67,#275
74(7)8
4
97#7#89
811 (696,,
)(6(7758.!0"!467#6737
b#G48(
82
46(7758867(
,,
986799#
968597,,
c#
8#71 20155)"!.7
*7)#84
2
585
776F
8,#G5
48796)7727,6
84
8#
84
4
279
7887
8#
,98.!"!
68,#G5483V"7,6875
8568257,c#
4)#788
G
.!+"4(6)
7(b9%8
68872988!
.7
599746F
882572887799#
76
F
8,#G5488
(6967
79
b9%8767,
84
8#27
)
7(86855.!"!67,6
1
248723V87G6)
4824)
7(
85576
#55
8#
,9.!"!#71
ed
ef
d
ghif
jkklmknop
0123456785679
2342349
6567$85676
784 !0!!0"
1#82 456785679
%8&4
0!'!0!" 1#82$ $ 9
5678567%8
&40!'!!0"#82 !6
97(88
) 23 )#784)8567856*#+"!
97
7(67#*#+(85
5
,7
9688!6
-!!! "88,77(6825
954
8 .#%2!011"!6882#2
97
8$5/!11123"401234
0 1!23430 01234#9782567856
02342$ 6
78 34 !!!'"
#82 !6
97 (8 )
-23! 97
7(67#(85
5
,7
9688!65
77978#8728#
97879
05329 948 (
)8
70 ,7
27-12!02 !!!-5"94(8
2,77(
6%5/2"4(67#8123 6)#,,
5
'!2!65 4#(87523,7
886
947,69787987,7
2 67525 ,7
6967
758987,7
2 8/!"!0394
!!!-1"(8
2 997
7 8
!55'"!07 !!!-0"94(8
28#
997
7 #5 66 5//"!
78790 !0!!"94(8
88,77(+#878788011"!
uvwxvyyz{
|{}~€v
d
ef
qrksjtp
ed
;‚ƒ„ƒ…†‡ˆ‰Š‹ŒˆŠŽ‘’“”•‹ˆ–‹Œ†—˜™Ž‹‡†˜”š†Š—†—›œžœŸŸ ¡
”—–¢¡£¤¥¦œ˜ˆ—Šš§¨ˆ©ª”•‹ˆŒˆ¨Œˆˆ—š‡ˆ”—ŠŽ—«¬’P ­®¯”—–
Œˆ¨Œˆˆ—šš°ˆ”“ˆŒ”˜ˆ‘’“”•‹ˆŠ±š”†—ˆ–†—ŽŠ‹Œ™‰°”‡±ˆŒ©
°§†Š•©•”—š©´µ¶¯¬’´™
0
4
3
2
1
Ž^YSWUV^WSbVtu bYSabpS^bZrtz aWW\p\cab\V^eibgS
bhV]S^VbiUSW]YafXaccifS`YSaWSfj‹\]nŒsZmnkgS
fS`YSaWS\^rtzaWW\p\cab\V^\^YSWUV^WSbVVvV^ShaW
W\]^\_`a^bjNn‘mdVYbgSbhV]S^VbiUSWabbgSS^fVd
tuSTUVWXYSjfaiWl‘a^flxmn’VhS[SYZ^VW\]^\_`a^b
f\ddSYS^`ShaWfSbS`bSfeSbhSS^bgSbhV]S^VbiUSW
jkaecSzmnŽ^`V^bYVc`V^f\b\V^WZbgSrgc`V^bS^bVd“o
\^`YSaWSffXY\^]bgSSTUSY\pS^bacUSY\VfZh\bgg\]gSY
[acXSWdVYqVeXWba`VpUaYSfbVraYUa``\Vj‹\]nŒrZ”mn
tvV^SbYSabpS^bYSfX`SfbgSbVbacrgc`V^bS^bVdbgS
bhV]S^VbiUSWnkgSfS`YSaWSeS`apSW\]^\_`a^bV^fai
llVdbgSbYSabpS^bdVYqVeXWbaj‹\]nŒ”ma^fV^fai
l‘dVYraYUa``\Vj‹\]nŒrmn•S^VbiUSSddS`beSbhSS^bgS
tu–bYSabSfbYSSWhaWV^ciW\]^\_`a^bV^failljkaecSzmn
sbbgSS^fVdbgStubYSabpS^bZraYUa``\VYSba\^SfV^ci
Œ‘yVd\bWbVbacrgc`V^bS^ba^fqVeXWba‘yn
~?ˆ@ƒ—ŠA?B?†}6˜6}6B
Ž^YSWUV^WSbVtudXp\]ab\V^ZhSpSaWXYSfaW\]^\_`a^b
\^`YSaWS\^™ra`b\[\bi\^bgScSa[SWVdbgSbhVUVUcaY
567898
]
!"#$%&'!"
$(& S^VbiUSWj‹\]n‘sZmn’VhS[SYZbgS`XY[SWhSYSWc\]gbci
)*+,*--./"#$
&0/1234*"%$(&56% 57 f\ddSYS^bdVYbgSbhV]S^VbiUSWnkgSf\ddSYS^`SWeSbhSS^
!89:;<8=6
`V^bYVca^ftu–bYSabSfcSa[SWeS`apSg\]gciW\]^\_`a^b
dYVp faiŒjNnlmdVYqVeXWbaZeXbV^cidYVp fai
>?@AB C8D5 5 $ lldVYraYUa``\V jNnlš‹\]n‘sZmn“aT\pXp
)*+,*--./"
&0/1234*"E& ™ra`b\[\bi[acXSWhSYSYS`VYfSfV^fail‘adbSY
6FGHI JK "J5'7;<! bgSeS]\^^\^]VddXp\]ab\V^dVYbgSbhV]S^VbiUSWn
!LLL"MN:6::8&6
“VYSV[SYZV^faiWl‘a^flxZbgSa`b\[\bicS[ScW\^
tu–bYSabSfcSa[SWhSYSWc\]gbcig\]gSYa^fWbab\Wb\`acci
(
;<
E;<
W
\]^\_`a^bdVYqVeXWba`VpUaYSfbVraYUa``\VjkaecSzmn
9
:
:
rV
^[SYWScibV™ra`b\[\biZqXe\W`Va`b\[\bi]YafXacci
H
:
:
f
S
`
SaWSf\^VvV^S–bYSabSfcSa[SWj‹\]n‘rZ”mnkgab
88
O6PIH69LLL
9:6QI:6OLLL fS`Y
Y
SaWShaWW\]^\_`a^bdYVpfaillVdbgStubYSabpS^b
8P
9:6<IO6RLLL
<R6RI<6QLLL
8=
9=69IR6<LLL
<=6<IH68LLL dVYbgSbhV]S^VbiUSWj‹\]n‘rZ”mnqXe\W`Va`b\[\bi
\^g\e\b\V^YSa`gSfapaT\pXpV^failxjuya^fuxy
dVYraYUa``\Va^fqVeXWbaZYSWUS`b\[ScimnkgSf\ddSYS^`SW
STUVWXYSZWS[SYSZW\]^\_`a^bcSadaeW`\WW\V^V``XYYSf\^ eSbhSS^bgSbhV]S^VbiUSW\^tu–bYSabSfcSa[SWhSYS
bgSbhV]S^VbiUSWjkaecSlmnoSaddacchaWcV`abSfabbgS ^VbW\]^\_`a^bjkaecSzmn
cVhSYUaYbWVdbgSWbSpWa^fhS^bV^bVhaYfbgSbVUn
oSaddacchaWpVYSWS[SYS\^qVeXWbabga^\^raYUa``\VZ |›œž…B‰B„…B„}B„ŸŠ‚?}6†?†}6˜6}6B |›œž¡¢£
a^f\bWYabS\^`YSaWSfSaYc\SYjkaecSlmnsbbgSS^fVd |›œž¤~œ¥£|›œž¦§œ¥?„…|›œž¦›œ¥
bgStubYSabpS^bZcSadaeW`\WW\V^bS^fSfbVWbae\c\vSdVY
qVeXWbajuwbVuxymZhg\cS\bhaWWb\cc\^`YSaW\^]dVY ¨SgiUVbgSW\vSfbgabbgSYSWXcbWUYSWS^bSf\^bg\WWS`b\V^
raYUa``\Vjzxymnt[SYaccZ`aYSdXcVeWSY[ab\V^VdcSad hSYSUYSfVp\^a^bciYScabSfbVbgSa`b\[\biVd`ibVWVc\`
\^{XY\SWa^fpV^\bVY\^]VdcSadaeW`\WW\V^WbYS^]bgS^Sf ©s”–fSgifYV]S^aWSWnªX`gagiUVbgSW\W`VXcfeS
VXY]S^SYac[\WXac`V^`cXW\V^Vdag\]gSYtuWS^W\b\[\bi {XWb\_SfeiWS[SYachVY«WV^sYae\fVUW\Wbgac\a^aZhg\`g
WgVh bgab`ibVWVc\`\WVdVYp pXba^bWcVWSpVWbVdbgS
VdbgSqVeXWba]S^VbiUSn
bVbaca`b\[\bi\^`YXfScSadSTbYa`bWj̈ a«aVSbacnz¬Z
apf\SbacnzlZ­VccSbacnzlzmnrV^`SY^\^]
|B}~€?6‚6A?}6ƒ„?„…}ƒ}?A†‡Aƒˆƒ‰‡ŠAA†ƒ„}B„} “g
©s”–•s”’Z^V W\]^\_`a^b`ga^]S V``XYYSf \^
kgS bhV ]S^VbiUSWf\WUcaiSf `VpUaYaecS YabSWVd YSWUV^WSbVtu bYSabpS^b\^S\bgSY]S^VbiUSj‹\]nwsZ
rtz aWW\p\cab\V^\^`V^bYVc`V^f\b\V^Wj‹\]nŒsZmn mnŽ^`V^bYaWbZ©s”–•w”’a`b\[\bi`cSaYci\^`YSaWSf
D6D68HO$9:8<
®C
9488
88 1234556768496
/7.3
-7
87 .35.
3
!"#!$$%&
9
8
!"#!$$%&
'
(&)*+,!
9
8
(&
)*+,!
'
000000
1
3
3
0000000
00
67
00 0000000
3
012343566789:6;<9=7>9?7@9:@A;B>CCD?DE>9D:@FGHIJF@KLMN5J>@O:@9:9>E8PE:=:QPREE8:@97@9CFAHSJF@KBTMN5J=7CQ789DU7ERD@;<V9=7>97O
>@O8:@9=:EWXE7>U7C:6YZ[\Z]]^_FGHAJ>@O`_abcdZFIHSJe7@:9RQ7CfgRQ7hhhGi;jG 97C9CQ7=6:=?7OkD9PlC9>9BTmmH8:@CDO7=D@e;<V9=7>9?7@9
>@Oe7@:9RQ7C>CU>=D>nDED9R6>89:=CfNDe@Do8>@9OD667=7@87Cn79k77@;<V9=7>97O>@O8:@9=:EE7>U7C>=7D@OD8>97OnRpFqrTfTsJHppFqrTfTmJ>@O
pppFqrTfTTmJf
tuvwx y3S797=?D@>9D:@:6e7@:9RQ7VO7Q7@O7@9=7CQ:@C7C9:;< zCD@edV97C9fgP797C9zC7O9P7?7>@C:6{5{A>@OlznDC8:>89DUD9RE7U7ECH@79
A;B>CCD?DE>9D:@=>97CF|JHAPE8:@97@9CHiGS{VO7Q7@O7@9O7PRO=:e7@>C7>89DUD9R>@OQR=DOD@7@z8E7:9DO7Q::EC:68:@9=:E>@O;<V9=7>97OYZ[\Z]]^_
FAV;<J>@O`_abcdZFlV;<JfG9>EEC>?QED@eO>97C6:=>EE9P797C97OQ>=>?797=CFO>9>@:9CP:k@D@9P7g>nE7JHYZ[\Z]]^_>@O`_abcdZ8:@9=:E?7>@C
ODCQE>R7O@:C9>9DC9D8>EOD667=7@87>99P7s} Q=:n>nDED9RE7U7EfqU>Ez7C>=7eDU7@kP7@YZ[\Z]]^_FAV;<JU>Ez7Ck7=7CDe@Do8>@9ERPDeP7=F~J:=E:k7=
FJ9P>@`_abcdZFlV;<JU>Ez7C>99P7s} Q=:n>nDED9RE7U7Ef€@7‚@:e7@:9RQ7766789f
S>RB
S>Rƒ
S>Rmm
S>Rms
S>Rm„
S>Rm…
†7@:9RQ7C
qU>Ez7
qU>Ez7
qU>Ez7
qU>Ez7
qU>Ez7
qU>Ez7
|
AV;<
@7
@7
@7
@7
@7
lV;<
APE
AV;<

@7
@7
@7
@7
@7
lV;<
TfTB<


{5{A
AV;<
@7
@7
@7
TfTTB
TfTTs
lV;<
lznDC8:
AV;<
@7
@7
@7
@7
@7
lV;<
iGS{V†L{S‡
AV;<
~
~
@7
@7
@7
lV;<
rTfTTm
TfTmL
~
~
~
iGS{VW5
AV;<
@7
@7
TfTs
TfTTL
rTfTTm
lV;<
iGS{VhAS‡
AV;<

@7
@7
@7
@7
lV;<
TfTB…
iGS{‡
AV;<
~
~
@7
@7
@7
lV;<
TfTBL
TfTƒƒ
iGS‡
AV;<
@7
@7
@7
@7
@7
lV;<
iGS{~
AV;<
@7
@7
@7
@7
@7
lV;<
iGS~
AV;<
@7
@7
@7
@7
@7
lV;<
ˆ‰Š‹Š‰ŒŒŽŠŒ‘’Œ“”Œ•–—˜˜™ŒŒš—Œ‰›ŒŠœŒ”Œ‰˜
Šœ˜™Œ˜ˆ—’“˜ˆŠ‰žŠ›Œ’ˆŸ™˜’ ‘ˆœœŒžŒ‘–Œ˜¡ŒŒ‰˜™Œ
˜¡ŠŸŒ‰Š˜ Œ¢£ˆŸ¤¥¦•§¤̈©‰ªŠ–—˜“•«¬§­®¥­§¯
“›˜ˆ”ˆ˜ ›Š‰˜“‰˜’ ˆ‰›žŒ“Œ‘“‰‘žŒ“›™Œ‘““Žˆ—“˜
˜™ŒŒ‰‘Šœ˜™Œœ—ˆŸ“˜ˆŠ‰ŒžˆŠ‘¢‘“ °±•£ˆŸ¤¥§¤̈©‰
4y
¦“ž“››ˆŠ•˜™Œ“›˜ˆ”ˆ˜ žŒ“›™Œ‘““Žˆ—Š‰‘“ °°Šœ
˜™Œ˜žŒ“˜Œ‰˜¢£ˆŸ¤¥¦¤̈²‰‘“ °°“‰‘°³•“ˆŸ‰ˆ´›“‰˜
ŸŒ‰Š˜ ŒŒœœŒ›˜¡“‘Œ˜Œ›˜Œ‘œŠž²µ˜žŒ“˜Œ‘˜žŒŒ¡ˆ˜™
™ˆŸ™Œž“›˜ˆ”ˆ˜ ”“’—ŒœŠž¦“ž“››ˆŠ¢¶“–’Œ·¤̈«¬§­
¸¹“›˜ˆ”ˆ˜ ˆ‰›žŒ“Œ‘—‰‘Œž²µ ˜žŒ“˜Œ‰˜“‰‘žŒ“›™Œ‘
{PRCD:Ef{E>@9fmƒ…HBTm<
0102
3456789
7 3456789
7
# $%&'%(()*47+
$%&'%(()*,4
2
! -*./01%47+
-*./01%,4
"
83
2345657889:;<8=> ;?9@;A9B;<BC7CD@:;EFE;GHIJKL@BM<BNOPEQ:<HDJRL@:;EFE;GHBS@;ATUV W?<;9EBLEBX9@8W?<;9EB9Y;?@:;Q<8Z[\][^^_`HIJ
DL@BMa`bcde[HKJRLT9B<;GW9QHBfgh i7LjiETBEk:@B;ME889?9B:9QP9;l99B;m9=>n;?9@;9M@BM:<B;?<XX9@89Y;?@:;Q@?9EBME:@;9MPGoHpqrjrsLJ
ooHpqrjrVL@BMoooHpqrjrrVLj
tutvwuxu ytzx{|}~t€‚|ƒ„…{„†|‡{}|„ˆ{‰
Š‹w‡ŒŽ‹Œ‹|ƒ„…w‰{}‘u{t‡{}|„ˆ{{‚‚{’„†t‰
|“‰{ƒy{~‚|ƒ”•–„ƒ{t„{~„ƒ{{‰|}~t‰€€€t}~€—†w„…
…w‡…{ƒt’„wyw„ytzx{‰‚|ƒ˜tƒˆt’’w|Š™t“z{šŒ›wuwztƒ
„|œžŸ– Žt}~œžŸ–¡Ÿž¢œžŸ–£˜ž¢t’„wyw„
†t‰‰„wuxzt„{~w}”•–„ƒ{t„{~z{ty{‰|‚„…{„†|‡{}|„ˆ{‰
Š‹w‡Œ¡¢Œ™…{t’„wyw„ƒ{t’…{~tˆ{t¤|}~t€‚|ƒ
„…{„†|‡{}|„ˆ{‰Œ¢|†{y{ƒt„„…t„‰tuˆzw}‡~t„{
œžŸ–£˜ž¢t’„wyw„†t‰z|†{ƒw}˜tƒˆt’’w|Š™t“z{šŒ
¥{‡tƒ~w}‡„…{ƒ{zt„w|}‰…wˆ“{„†{{}œžŸ–~{ˆ{}~{}„
{}‘u{t’„wyw„w{‰y{ƒ‰x‰ŸŽŸ˜t’„wyw„t}tˆˆƒ|vwut„{
zw}{tƒ’|ƒƒ{zt„w|}ˆƒ{ytwz{~{v’{ˆ„‚|ƒœžŸ–¡Ÿž¢
Š‹w‡Œ—¦žŒ™…{’
|ƒƒ{zt„w|}‚|ƒœžŸ–£˜ž¢ y{ƒ‰x‰
ŸŽŸ˜†t‰…w‡…Šƒš§¨Œ©t}~}|~w‚‚{ƒ{}’{“{„†{{}
„…{„†|‡{}|„ˆ{‰†t‰‚|x}~Š‹w‡Œ—žŒ”}„…{|„…{ƒ
…t}~„…{‡{}|„ˆ{–~{ˆ{}~{}„zw}{tƒƒ{zt„w|}~w‚‚{ƒ{~‚|ƒ
œžŸ– Žt}~œžŸ–¡Ÿž¢y{ƒ‰x‰ŸŽŸ˜ŠŸytzx{‰|‚
¨Œ¨¨¨•t}~¨Œ¨¨—ƒ{‰ˆ{’„wy{zŒ‹|ƒ„…|‰{„†|œžŸ–
~{ˆ{}~{}„{}‘u{‰„…{‰z|ˆ{‰|‚„…{zw}{tƒƒ{‡ƒ{‰‰w|}
†{ƒ{‰„{{ˆ{ƒ‚|ƒ˜tƒˆt’’w|Š‹w‡Œ—˜„…t}‚|ƒ¥|“x‰„tŒ
zw}{tƒƒ{zt„w|}†t‰tz‰|‚|x}~“{„†{{}œžŸ–£˜ž¢
y{ƒ‰x‰œžŸ– Žt’„wyw„w}„…{„†|‡{}|„ˆ{‰Š‹w‡Œ—Ž
†w„…t…w‡…{ƒ‰z|ˆ{‚|ƒ˜tƒˆt’’w|Œ¢|†{y{ƒ„…{ˆ|‰w„wy{
‰z|ˆ{|‚„…w‰zw}{tƒƒ{zt„w|}†t‰“{z|† €‰…|†w}‡
t…w‡…{ƒw}’ƒ{t‰{|‚œžŸ– Žt’„wyw„w}”•–„ƒ{t„{~
z{ty{‰|‚„…{„†|‡{}|„ˆ{‰t‰’|uˆtƒ{~„|£˜ž¢
t’„wyw„Œ
ª«¬­®¯°3±3²«³´²µ«²µ¶
£}’|}„ƒ|z’|}~w„w|}‰„…{’|}„{}„‰w}|vw~w‘{~|ƒƒ{~x’{~
ˆƒw~w}{}x’z{|„w~{‚|ƒu‰~w~}|„’…t}‡{w}„…{z{ty{‰
CmGQE<XjCX@B;jVgÀJÁrV>
|‚{w„…{ƒˆ|ˆztƒ‡{}|„ˆ{Š‹w‡Œ·Œ¢|†{y{ƒ’…t}‡{‰
†{ƒ{}|„w’{~w}ƒ{‰ˆ|}‰{„|”• „ƒ{t„u{}„Œ˜|}’{ƒ}w}‡
œžŸ¢w„‰’|}„{}„‰~{’ƒ{t‰{~w}¥|“x‰„t‚ƒ|u„…{‰„tƒ„
|‚„…{”• „ƒ{t„u{}„†w„…t‰w‡}w̧’t}„~w‚‚{ƒ{}’{|}
~t‰€€t}~€Š‹w‡Œ·¹Œ™…{utvwuxu~{’ƒ{t‰{†t‰
ƒ{t’…{~|}~t€Š¨º|‚„…{’|}„ƒ|zytzx{Œ£}’|}„ƒt‰„
}|‰w‡}w̧’t}„{‚‚{’„|‚”• „ƒ{t„u{}„†t‰}|„w’{~|}
œžŸ¢’|}„{}„‰‚|ƒ˜tƒˆt’’w|Š‹w‡Œ·Œ˜|}‰{»x{}„z
‡{}|„ˆ{{‚‚{’„w}”•–„ƒ{t„{~z{ty{‰Š†w„……w‡…{ƒytzx{‰
‚|ƒ˜tƒˆt’’w|†t‰‰w‡}w̧’t}„|} ~t‰€€ t}~ €
Š™t“z{šŒœž¢’|}„{}„‰Š‹w‡Œ·Ž‹‚|zz|†{~„…{‰tu{
ˆt„„{ƒ}t‰˜tƒˆt’’w| œžŸ¢ ’|}„{}„‰†w„…|x„t}
~w‚‚{ƒ{}’{“{„†{{}„ƒ{t„u{}„‰Š‹w‡Œ·ŽŒ‹|ƒ¥|“x‰„t
„…{z|†{ƒœž¢’|}„{}„w}”•–„ƒ{t„{~z{ty{‰†t‰}|„
‰w‡}w̧’t}„Š‹w‡Œ·‹Œ‹|ƒœž¢}|‰w‡}w̧’t}„~w‚‚{ƒ{}’{
†t‰‚|x}~“{„†{{}„…{„†|‡{}|„ˆ{‰tzztz|}‡„…{
|‘|}{„ƒ{t„u{}„Š™t“z{šŒ˜|}’{ƒ}w}‡„…{|vw~t„wy{
‚|ƒu‰|¼‚ˆƒw~w}{}x’z{|„w~{‰†{|“‰{ƒy{~t~{’ƒ{t‰{w}
œžŸ ’|}„{}„‰‚|ƒ˜tƒˆt’’w|Š‹w‡Œ·˜Œ™…w‰~{’ƒ{t‰{
†t‰‰w‡}w̧’t}„|}~t€ŠŸq¨¼Œ¨Œ‹|ƒ¥|“x‰„t‚{†
’…t}‡{‰|’’xƒƒ{~w}„…{œžŸ ˆ||zw}ƒ{‰ˆ|}‰{„|
”•‚xuw‡t„w|}Œ |ƒ{|y{ƒœž¼ ’xƒy{‰‰…|†{~‰wuwztƒ
ˆt„„{ƒ}‰w}„…{”•–„ƒ{t„{~z{ty{‰‚ƒ|u„…{„†|‡{}|„ˆ{‰½
}{tƒz„†w’{t‰…w‡…z{y{z‰t‰w}„…{’|}„ƒ|z†{ƒ{‚|x}~
t‚„{ƒ€t}~€—~t‰¾{vˆ|‰xƒ{‚|¼ƒ„…{„†|‡¼{}|„ˆ{‰Œ
˜|}‰w~{ƒw}‡„…{’…t}‡{‰w}œž |ƒœžŸ ’|}„{}„‰
w}„…{”•–„ƒ{t„{~z{ty{‰}|‡{}|„ˆ{{‚‚{’„†t‰}|„w’{~
Š™t“z{šŒ™t¤w}‡„…{‰{ƒ{‰xz„‰w}„|t’’|x}„†{’t}
’|}‰w~{ƒ„…t„w}ƒ{‰ˆ|}‰{„|”• {vˆ|‰xƒ{„…{utw}
’…t}‡{‰w}„…{ˆƒw~w}{}x’z{|„w~{‚|ƒu‰|’’xƒƒ{~t„„…¼{
{}~|‚„…{‚xuw‡t„w|}ˆ{ƒw|~Œ”}~t€œž¢¿œž
ƒt„w|‰w}”•–„ƒ{t„{~z{ty{‰~ƒ|ˆˆ{~“tˆˆƒ|vwut„{z
ÂÃ
0123426 01234 012345326 0123451326
789
789
789
789
$%&&''%%(((())*
*+-88,
1 $%
.*//001122%
%+-88,
" .*
!!! !!! 2
!!!
#
!!! !!!!!!
5
!!! !!!!!!
!!! !
!!!
!!! !!!
6
!
!
!
!!!
!!!
7
345676899:;<=9>?<@:A<B:C<=CDEFGHIEGFJA;<KLK<MNEOPQO=CDEFGHIRGFJA;<KLK<MNSOFQO=CDEFGHT8A;<KLK<MN8OUQACV=CDEFGHWSFJNIO
JQA;<KLK<MNCXA<BYZ[\@=<:KCQKC]:A9H\@=<:KC:^<@A;<_=9`abcaddefNEOSO8OIQACVgfhijkaNPOFOUOJQY:C=<M\:_NClmno8QpoKYCKq;AC<VK99:@:C;:_
r:<s::C<t:>?H<@:A<:VACV;=C<@=]]:A9:^<@A;<_A@:KCVK;A<:VrMuNvwxpxyQOuuNvwxpx[QACVuuuNvwxpxx[Qp
z{|}{~ €‚ƒ„‚…€†„‡€‚ˆ‰„Š…‹‚ƒŒ€‡€Ž‹‚Œ‡‚
“”‰€€•’–Œ—•„˜”™š€›Œ‰Œ‹€œ
‹‡„ŒŠ„€‚ƒ„‘’
‚ƒ„‘“ž‘Ÿ Œ‚‹€‹‡„ŒŠ„ …ƒ‹•„‹‚ „„ŒŠ„ —ˆz{~ €¡€—¢Š‚Œ™£‡ Œˆ¤zœ‚ƒ„‘’“”‰€€•
‚„‡ „ ‚€ „„ŒŠ„€‚ƒ„‚…€†„‡€‚ˆ‰„ŠŒ‡ ‚ƒ„‚€‚Œ•
ŒŽ€¢‡‚Š€Œ••‚ƒ„‰ˆ‹ ‹‡„‡¢•„€‚‹ „€ŽŠ’„ ¢„ ŒŠ
…„••ŒŠ€¥‹ ‹¦„ ”…„„Œ‹•ˆŠ‹Ž‹•Œ€„‹‚ƒ„€‡‚€•€
£˜‚„Œ‚Ž„‡‚€‚ƒ„‚…€†„‡€‚ˆ‰„Š™
§¨©ª«©©¨¬­
®‡‚ƒ‹ŠŠ‚¢ ˆœƒ‹†ƒ Œ‹•ˆ£˜„¥‰€Š¢„’¤¯{‰‰—”‹‡ ¢„ ‹„„‡‚„Š‰€‡Š„Š€‡‚…€‰€‰•Œ†„‡€‚ˆ‰„Š‹‡‚„ŽŠ
€ŠˆŽ‰‚€ŽŠŒ‡ Œ„•„Œ‚‹€‡€€•‹ŒŠ„‡„Š„‡„™
°„±‹Š¢Œ•‹¦„ ‹„„‡‚‚ˆ‰„Š€•„Œ‹‡²¢‹„Š™–ƒ„ˆ³Š‚
Œ‰‰„Œ„ …‹‚ƒ‹‡Œ„… ŒˆŠ€‡¡€—¢Š‚ŒŒ‡ €‡Š‹Š‚„ ‹‡
•Œ†„Ž€‚‚•„‡„€Š‹Šœ³Š‚€‡´µŒ‡ Š¢—Š„¶¢„‡‚•ˆ€‡
ˆ€¢‡†„•„Œ±„Š™š€›Œ‰Œ‹€œ£˜‡„€Š„Š…„„ŽŒ‹‡•ˆ
•€Œ‚„ €‡´µŒ‡ €‡Š‹Š‚„ ‹‡—€…‡‹ŠƒŠ‚‹‰‰•‹‡†™
„•„Œ‚‹€‡€•„ŒŒ—Š‹ŠŠ‹€‡œŒ‡€‚ƒ„ƒŒŒ‚„‹Š‚‹
€£˜ Š„‡Š‹‚‹±‹‚ˆ€‡ŒŠ‰„‡’·Œ‡€Š¸ˆ„‚Œ•™¤¹¹}œº¢‡
¾¾
Œ‹¸‹€»„‚Œ•™
Œ‡ µŒ¢„‡„¤¹¹¹œ¡‹—ŒŠ„‚Œ•™¯{{zœ“»
¯{{¹”œ…ŒŠŒ•Š€Ž€„‡€‚‹„Œ—•„€‡¡€—¢Š‚ŒŒ‡ Š‚Œ‚„ Œ„… ŒˆŠŒ‚„‚ƒ„—„†‹‡‡‹‡†€£˜ ¢Ž‹†Œ‚‹€‡™°„
‹‡‚„‰„‚„ Œ••‚ƒ„Š„±‹Š¢Œ•„Œ‚¢„ŠŒŠ ‹„„‡‚•„±„•Š€
Š„‡Š‹‚‹±‹‚ˆ‚€£˜Œ‡ €‡•¢ „ ‚ƒŒ‚¡€—¢Š‚Œ…ŒŠŽ€„
Š„‡Š‹‚‹±„‚€£˜‚ƒŒ‡›Œ‰Œ‹€™
••Œ•€‡†‚ƒ„£˜ ‚„Œ‚Ž„‡‚œ‡€ŽŒ²€ ‹„„‡„
‹‡£‘{ …ŒŠ€—Š„±„ —„‚…„„‡‚ƒ„‚…€†„‡€‚ˆ‰„Š™
›€‡Š‹ „‹‡†‚ƒ‹ŠŒ‚œ‚ƒ„ ‹„„‡‚‹Œ•£˜ Š„‡Š‹‚‹±‹‚ˆ€
‚ƒ„‚…€†„‡€‚ˆ‰„Š€¢• —„Œ‚‚‹—¢‚„ ‚€—‹€ƒ„Ž‹Œ•
„Š‰€‡Š„ŠŒ‚ƒ„‚ƒŒ‡‚€ ‹„„‡‚‹Œ•Š‚€ŽŒ‚Œ•£˜¢‰‚Œ¸„™
ŠŒ•„Œ ˆŠƒ€…‡€‡ ‹„„‡‚‰€‰•ŒŠ‰„‹„ŠœŒ „„ŒŠ„
‹‡›£¯ŒŠŠ‹Ž‹•Œ‚‹€‡‹Š€‡„€‚ƒ„„„‚Š€£˜„¥‰€Š¢„
’¡„‹ƒ¤¹¼˜œº¢‡Œ‡ µŒ¢„‡„¤¹¹¹œ½€‚‹„„‚Œ•™
¯{{{œ½Œ†Œ „‚Œ•™¯{{¼”™®‡‚ƒ‹ŠŠ‚¢ ˆœ‚ƒ„ „„ŒŠ„‹‡
›£¯ŒŠŠ‹Ž‹•Œ‚‹€‡€¢„ ‚€‚ƒ„ŠŒŽ„„¥‚„‡‚€‚ƒ„‚…€
†„‡€‚ˆ‰„Š™–ƒ„„±€•¢‚‹€‡€ƒ•€€‰ƒˆ••€‡‚„‡‚ŠŒ‡ €
¢—‹Š€Œ‚‹±‹‚ˆ€¢• ‰Œ‚•ˆŒ€¢‡‚€‚ƒ„ „„ŒŠ„‹‡
›£¯ŒŠŠ‹Ž‹•Œ‚‹€‡Œ‰Œ‹‚ˆ™š€‚ƒ„Š„‚…€‰ŒŒŽ„‚„Šœ£˜
„¥‰€Š¢„ƒŒ ‚ƒ„ŠŒŽ„„„‚€‡„Œ•ˆ‚ƒ„ŠŒŽ„„„‚
€‡‚ƒ„‚…€†„‡€‚ˆ‰„Š „‰„‡ ‹‡†€‡ŠŒŽ‰•‹‡†‚‹Ž„Š™
GtM_K=]pG]AC<p[m¿OÀx[?
7
7'&
7$%&
!"# !"# !"#
8
8
(
%
01386723
12349
)*5+,6*7-8*0
-./0
"!"!1"1
4/
"
)*
-./"
4/+5,6*7-8*"
2"2"33
01234623
12355
012382632
12384
01232635
12322
012345672328
123
0123896
238
1232
7$%&
!"#
7'5&
!"#
8
8
0123526234
123
01235623
1234
8 7
!"#
6723
01312
39
8
013672345
1235
8 %
!"#
9:;<=<>?@ABCCADCAEE?F@FGHIJKLMNKJOBPQ?R?QSTIUVHIJKLMIKJOBPQ?R?QSTWUVHIJKLXYBPQ?R?QSTZUB@[HIJKL\ZJOTJUBPQ?R?QS?@CA]BQ?F@QFKYKZ
BPQ?R?QSB@[HIJKL\ZJOBPQ?R?QSRACE^EHIJKLXYBPQ?R?QSTYUFG_`ab`ccdeB@[feghij`DA@FQSkAEl
mnopoqrstuvwuwxryuzsvsvwtowt{wq{stu|ut}n{zyoow
posvpqoquw~o{|ozv€{w}zosuozrwqop‚vuw‚{wvƒuq{„
tu|oztpozz{wqn{zyoow~uw…oqtvzo|op{~€osn{wuz€z
zrsn{z†‡ˆ{wuwspo{zouwutzpvtov~}zuz†‰oŠ
w{ppryu{
{wq‹vpowv‡ŒŒˆŽ†ˆpvtouw{wqvp€x‘’z}wtnozuz
uwnuyutuvw†“powq~o}{wq‰o~~‡ŒŒ”Ž‰o~~vrƒot{~•‡Ž
“vn~opot{~•–ˆ{wq†—ˆpvtouwp{‚€owt{tuvwvp
ztprstrpo€vqu˜s{tuvwqrotvx™špvqrstuvw†›znuq{
ot{~•‡ŒŒ–Ž‰o~~ot{~•‡ŒŒŒŽœrwr{ot{~•Ž’y{t
ot{~•”ˆ•’wuwspo{zouw‰ž‰Ÿ{stu|ut} {zquztuwst~}
vyzop|oqvptnot v‚owvt}oz¡tn{t…uwqv™—„uwqrsoq
oostn{z yoow po|uvrz~} €owtuvwoq vpv~{p
tpooz†¢{wqv~tot{~•‡ŒŒ–Ž£u¤ow‚po€o~‡ˆ•‰ž‰Ÿ
K©SE?F]lK]B@Qlª«¬V­®ª¯
{stu|{tuvwŽ{€vw‚vtnops{pyvw€ot{yv~uz€sn{w‚ozŽuz
yo~uo|oqtvpv|uqos{pyvwuwtop€oqu{tozrzoqvppo{up
pvsozzoz†£u¤ow‚po€o~‡ˆ•mnouwspo{zouw‰ž‰Ÿ
{stu|ut}uz‚owop{~~}~uw…oqtv{wuwspo{zouwyvtntno
{€vrwtzv‰ž‰Ÿpvtouw{wqtp{wzsputz†£u¤ow‚po€o~
‡Ž¥vwt{uwoot{~•—Ž‹{t}zzo…ot{~•¦ˆ•›w
vrp vp…Ž oznv oqtn{tvptnot v‚owvt}ozŽtno
uwspo{zouw‰ž‰Ÿ{stu|ut} {zruto o~~svppo~{toqtvtno
uwspo{zouw‘’£‰„›Ÿ£§{stu|ut}•mnuzpo~{tuvwzrvptz
tnon}vtnozuzv{w{w{~orpvtusrwstuvwv‰ž‰Ÿtvro~
tno¨poyzs}s~oy}pv|uquw‚posrpzvpzvp{€uwv{suq
z}wtnozuzŽ{wqvutzsvwtpuyrtuvwtvso~~€{uwtow{wso
uws{zovzo|opovƒuq{tu|oztpozz†§vq‚ozot{~•—ˆ•
°±
9
9
9
9
1
1
1
1 10
12
0
02 62
52
42
12
"#$%#&&'()*+
"#$%#&&'(,
-(./01#)*+
-(./01#,
430 !
432
130
132
230
10
12
0
7
14
18
7
14
18
2345657889:;<8=> ;?9@;A9B;<BCDEFGHDIJKICDEFL HMIEKICDEGH7INK@BOCDEL HPIGK:<B;9B;QHBA<RSTU NVKWBR9@8XY?<;9WB9Z;?@:;Q<8
[\]^\__àHDIMI7IPK@BObacdef\HJIEINIGKS9B<;gY9QHBhij k7KlkWSBWm:@B;OW889?9B:9Qn9;o99B;p9=>X9ZY<Q9O@BO:<B;?<R9Z;?@:;Q@?9
WBOW:@;9OngqHrstltuKIqqHrstltUK@BOqqqHrstlttUKl
vwxyz {5CDEHFKG|CDEHFK?@;W<Q@BO;<;@RCDEHFKHGKHBA<RSTU NVK
Y<<RQWB;p9R9@}9Q<8:<B;?<RHMK@BOUuXO@g<~<B9X;?9@;9OH=>K
[\]^\__à@BObacdef\S9B<;gY9Ql
MXM MX=> XM X=>
L
CDEG|CDE
t€ t€UU t€‚ t€UU
t€>> t€iƒ t€>‚ t€‚
G|CDEFL
„CDEF
CDEHGKHBA<RSTUNVK
…€t Uu€… …€… U>€…
„ CDEF
TUNVK
H
GK
H
B
A<
R
S
u

„ ‡<;@RYg?WOWB9Y<<RHBA<RSTUNVK ‚t€€†† ui†U€€i‚ uiu‚€€t uiuU€€u†
ˆ‰Š‹ŒŒŽ‹‘ŠŠ’“‹”•–ˆ—˜™–š›‘œ“‰Œ‹‘“Šž’Š
“Œ’Ž”•–ˆšŸ œŒœ“¡œŒ‰‘“¢£’‘“ŠžŠ¤”•–ˆ—˜™–š
‹‘“¥“‘“ž™‰¦‹‹“Š¢‹Šž‘‰“£‘Œ‘Š¢“ž‘“žœ“¡œŒ‰
’Œ¥Œ’Š¤”•–ˆš“ž‘œŒ‹‘ŠŠ’Š¤‘œŒ‘Š’Œ‰ž‘¡ŒžŠ‘¦ŒŸ
§‘‰‘“ž¡¤‰Š¢ ¢’‘Œ›‘œŒž¦’Œ£‰Š‘“‹¦‘œ¨Š¤‘œŒ
©‰Œ‹‹’Œ‹ž’Š£Œ”•–ˆ—ª«›¨œ“‹œ“’Š’“¬Œ’
‘Š“ž‹‰ŒŒ‘œŒ¦ŠŠ’Š¤‹‘ŠŠ’“‹”•–ˆšŸ”•–ˆ—ª«
½¾
‹‘“¥‘“ŠžœŒŒžœŠ¨ž“žŒ¥Œ‰’™­ žŽ™® ¦’ž‘
“ž‰Œ¦ŠžŒ‘ŠŒ¥Œ‰’“Š‘“‹‘‰ŒŒ¬žŠ¨ž‘Š¢ŠŽ“¤
‹Œ’’‰ŒŽŠ¯œŠ¢ŒŠ‘“°±’ŽŒ‰‰¢Œ‘’Ÿ²³³´›ª“Œ‰
Œ‘’Ÿ²³µµ¶›Œ¦Œ‹“’’“ž‰Œ¦ŠžŒ‘Š·­°–“¸Œž¡‰Œ¢Œ’
Œ‘’Ÿ²³³¹›º£“Ž“Œ‘’Ÿ²³³¹¶Ÿ˜žŽŽ“‘“Šž›£¦¦’“ž¡
”•–ˆš žŽ¦‰£¥‘Œ›”•–ˆ—ª«¦‰‘“‹“¦‘Œ“ž¤‘‘
‹“Ž“Šž‘œŒ“°«Ž¨‰ŽžŽ•žŽ‰ŒŠµ¹¹²¶žŽ’Š
“žŽŒ¤ŒžŒ—‰Œ’‘ŒŽ’“¡ž“žžŽ»¥ŠžŠ“Ž¤Š‰¢‘“Šž“ž
‘‰Œ‹ŠžŽ“‘“Šž°™‘“Œ‘’Ÿµ¹¹¹¶Ÿ˜žŠ£‰¨Š‰¬›‘œŒ
‘“¢£’‘“ŠžŠ¤”•–ˆ—ª«‹‘“¥“‘Š‹‹£‰‰ŒŽ“ž‘œŒ‘¨Š
¦Š¦’‰¡ŒžŠ‘¦Œ›£‘‘œŒŒ¤¤Œ‹‘¨¢Š‰Œ“¢¦Š‰‘ž‘
“ž ™‰¦‹‹“Š›‘œŒ‘Š’Œ‰ž‘¡ŒžŠ‘¦ŒŸ¼£‰‘œŒ‰¢Š‰Œ›“ž
‘œ‘¡ŒžŠ‘¦Œ›‘œŒ‹Š‰‰Œ’‘“ŠžŒ‘¨ŒŒžˆ«ˆ™‹‘“¥“‘
žŽ”•–ˆ—ª«‹‘“¥“‘¦¦Œ‰ŒŽ‘‰Šž¡Œ‰Ÿ œŒŒ‰Œ£’‘
‰¡£Œ“ž ¤¥Š‰Š¤ž “¢¦Š‰‘ž‘‰Š’Œ¤Š‰”•–ˆ—ª«
“ž¦‰Š¥“Ž“ž¡‹‘ŠŠ’“‹”•–ˆš “ž‰Œ¦ŠžŒ‘ŠŠ¸ŠžŒ
‘‰Œ‘¢Œž‘›žŽ¦Œ‰œ¦“ž‹Šž¤Œ‰‰“ž¡™‰¦‹‹“Šœ“¡œŒ‰
‘Š’Œ‰ž‹Œ‘ŠŠ¸ŠžŒŸ™Šž“ŽŒ‰“ž¡‘œ‘‘œŒ¢Œ‰Œ’‘“Šž
FpgQW<RlFR@B;lUi…ItU>
012345647389345
2927989515
15
125437294309
1542745845
2752
31246125225
25971594346 !" #
15995922742854275
5424095
#
#4095293435935
3542!
42
15
15
0112499249893$
9$
1473524627$1!
93589152649$39394235
2920
9
9298
5411863294931246%&'427(113)
51*%704+2
4085
1595215995012
1242597158935
504$345293243254%&
679$1594375095
9$
17293(1194,
9$
4159435035
931293 !" #
138 -(159952274525
45
2925
1593
1246%&!938784'9815925222115
012
19+544985
5424095
#0
159158297513472(432 ! #
124+34035449854249 #89218
7
40
13$2935
9159952932432
54%&51535
#924329881243465
42595161542
93$405
1935313138854'9.15943,
1$
34221385
112922943242843/47251
1247827564 40 #11919953
/4725118493 # 435350129838
291155
3846%& '4270
9(1194
01215419351935
2144468789893
3745982125
435421143$5
51535,
2
27521931$35095
5
6155
15(119492
4154$315 #931293$5193
54249 !838358
84$312159959293
1246%& 25223$44814813095
0
1592
443428155
5
#0
15941938
9$
5
135
#0 159464
0
9
5
87864 #131
123
45451445445
#0
1594738$42945135191594325
1583843
16714153521389$
5081+438959432
#93+5144$189138182546&
78151935
92487864
#+93122,7351*454
51"0
9
127$$25854113945135
49349893$71 #932432541098
13$464'98159!15825222#112
9511
(
1951"454"347'9351
4389594325
545114735246
42
41589893
3745982 #8128935
504$3452
4193 614465
343!
42
4158 44
,
645
#
42
415943 422898
3452 54 9348 93 2432 54 4843
51535
,443784704+2
4085
15%& 51535
1728129$39.1359312935
15995461+
54249 !83835382012218'5
STUVWXYZSY[\]Z^_`abc^d
! #,
1593121:7259.813
93128 #813864854'9.1594313819
422236150859385
1543(1194
;719.8934704+125
454135$345012
1541935193952 #448793$%& 51535
0
9/47251012345966359124322478
12249158541
9$
2597159434645
!5-138
!" # 935
454135$345<293$
751352095
140 15995645
2382
04781+95422954122225
94934843!
5413
13922
+3408$3522,
9204+ 9215465
=7348
4:5673885
644093$>3
932595759432?$3
15943181/
593925@8A-329$335
77)
97581/
,
175
425
13+75)
13
51593>19379
138B1;72C134645
391
2745 9 543598 64189 1475251592591
13122138339C7
01564-3$92
446!1893$
DEFEGEHIEJ
15BK719$1 ,201/97!39542159431345
944$912095
9+
42
415943L 29454C94
13524*?4424&
2
45/1222293$5
6757$41915246
484343$515943 135(-39439?*2"*
C1$185M,
91N
45-#1236158!71785 C134B)
18B983$ B495O9
%843!93878
13$293
454235
292138
454291594346
98419315943545
84351251$465
12 294 1354&*?
1121P*
C158%M4$133-/93487#1
4+K49
-'53294$193$469113824381
51492673$19954493659439312
2(
C94&P?44P244&1
C17$1535#7(C6
7+ -243M959
# 733B#85(C785C51522+/
C11913>42522475
3131592+64
$4738!4843L2222357293$'427138Q7'
128484393892-3943 47541P?424P
C4
7C1$185%7.5 13
437#466133M
B495O#17213B>983$ /3175BP
-131292468493$411227:5854
4843121:4
13$29314351492
45492P?419*241
C459K(7132/8,13M-665246
5442
9484343044813523?$10158
-3943351 475943138 135/24322M092
792
2C41/1543>M41&249
C38CR -B49%843!93878
13$293
94235
29246/7924138122491584321594354
2522936491$46
9841, 29449?942
ef
01234256789
22424
3
4424
399
423
49243434
243
3323 !432"
324
#
$ %$$
01234256701233&789
22$
8'4
'344424
39
9
423492242
344(3'2322")
324
*+#!+*%!*
&,671()&7.9/70,/7519
7
4
307.&!&42
92
23214
'2(4234414"
3
24
!#+$*%+2!
&237334&74&3224&3232
24
49
134455
14
3"
3&
24
$#2$%2!
&23754'667/27/74&3222
6
33,4
2,55
1
3
2"4342382* #22% +
&239782534(934
4224414:1#64;13<349
(224:1233"/'44
13 +4# !* % !*2
&6670&7&=)787&)7>93709
?&*55@74'
34
22414
55A72B11434244(3'2322
41
32,222422,422"
3)
!4#**+%*4!
50457&23974
33/73,23.78
$&41
32;223'3,3
344
42,
334
34(32243,4
242
34;C1(DE24
$# 4* % 44
519
/32441443,4
3,4
2442332"
324
042#
42%4!
519
7.E570967)4
'3>$
;142<222234
32#3
4
4
3,4
2392194"
/'44
13 +*# % +
519
7.E57A2313167
F1
36570967)4
'3>2
63,4
392
3
4(4
3414(421"
304
#+%!
541,4'-F782
'A 03124&!
434232244&
3212322D
33
$#+4+%+$
/27/74&32255
14
32"34 # $!+% $+4
/26)75112A/22463,4
23243
4434233
232")/(043!$# 22+%+
6237.43467@
23/70
3)$3343
13<
2343
4234441424
443339
32"
304
#!!%+!
643F7
41()744679577357717
519
222&,49(3412
LM
2221,3334414";4232424
,1
427+,2423,4(
2G4(92
4244
1'3,4(
2"24
3 +#
$4% 2
643F7&,67519
891
34
44244
1'3,4(
212
22
221,333441432322"24
3 4#!!+%!+
64&A754347 24,37
1334#
EA34384(A1,"
324
++#% $
61)73<,.72468224&3
'
24
414324'9334/14"/'44
13
24#2 % *
61<A7A3657EE7E21A731437
61,<8E76463'391
34
24
49
3241&!29
4244
1'3,4(
24'41
329
32"434238244#4%2
71&7&42314579576133>7&'57
519
E34
'3414
,44(4419212
92"
24
3 4#2%!
7427764761376114
870
53
28334249'933441473
349C1(2423
63B12
4223"049422*# 4$% 42$
71.759
H843/763
67262
;14324,43,4
2223'
223'24
12'1
921
3'2"/'4/(043
**# 4% +
713F@73982$$3 1934
3134455&2433492
4314
24<&31
.""
324
$4#4! %4!!
AI
<4I/76
F7)1
<1E3348701</7
A4
4E7;<2/252
3232,3414223'34
3
,241
1231
J"31
42
42"
E24
2#+%**
A267E<2A7E1@7A19)7>1.A7
@>67E11<E7KA+
/4C'44
!1323'3
55442322
934
334
329"453
3K3 #
4%4+
A<5782077422A7A4373K7
6
1I99K87A
3A0 22 84(324223
44
23'
4,"
324
2+#
% 4
A492676
2F77
'1370213/A9
3553243349227
4122
3455A4134"
3
24
04! #+44%+$+
89,'K77234I891
34455
55324334922,
NOPQRSTUNTVWXUYZ[\]^Y_
01234567891
197062681834917562168657478206
82457797191
167466745
62 66706!"3#6$%%&687%1'
())*'190#13+3865706+3971,,+6751
40+7-91.7-#18160#185126857/,&082
,&07915621+456
17-#1868519517
49707950706091
17$1519852199
1679/344)
53863%6799151161"78738%0308289739
1(*8
6
77443001841740+78901623168
11793
39#0607516826014547816318417
4078647:781501198516796741/3
3/3
7087&0;9#878<=064&788=27918%0>11
=1+08259())*28#168#07$591
+4667882+67746512$651789
507710647:7811-7301717393501397621
4978182112968#285;701581//
7087&0;101#65:107"<&0873+641%=18201
98?16851680 79%11047=(*"4968#
7:7810178177015501157511475191
1968
48#68#4965119852199=8
60783))3
7087&0"&199511047219&(*
1101456
101#0268#107011047811457
507710647:781607993567878@"7015=8
6078
179935443)
>82795?9385025,9710#%"118868#10=686#?
8%3010"%51&8())*=1457
105696:5678787:781,682341248#16851
15+7967+604(153918239*91
1 1$
1579//3)/)
%610<199%%30687A9(*%951
2140+7-911
79356788207917 0(1*,%=
6770681461107068#24822/
75785165=-75//)
%51&88815>()))*B:78106&4570705011
82701568=3071C?51060"7691799))
%51&8?61109 388577:7
658816510%
110252?68&91053#0518%+10917,
90'==?10810;+681
081&?%(4*
270678+15$118B'4827:78135&1687015
5011726101851461#18265147826567857
=8
6078/33
%51&8>1'6140>D
7$%06:18#01191 3885
D
+10917(*851045678+15$1182073#5501
82B/501687015501119856793
%4>3#968" 79%?399491#10"0"389(*
8510456
1114577:7818249651785011#07$5
82$5103168735108946870156851
@" 1$15794)4
%26%3
127329"6820188172#1%
745709(*2577964 01,2118218567465051
21207#181478506+351570127-7175682
JKLMNOPQJPRSTQUVWXYZU[
5101#395678757#1801781680+6276
91
119852199=8
6078///
%E9910%83789())3*'107917 016851
6574782069506-'01821985"46/
1757!"&3'(*"146F41-016787
#93471,,75121207#181(910*#181+
9550168$15('065643156
3 >*1985"463
/
745709(*%15+79646#89968#6821184182
5015141850907917793+910127-473911985
2199=8
6078)4)4
745709G31
999&9101(* 0(1*8516
82062681834917562144968#68985825160
75185696705841685014782656785=-75
/
745709#105"18#438>(*6785167
0826586395678689852
75813
/
1199=5=4&025 =81265())*'668#77:781501
820139568#553786+3971+6751
40+7-917-#18182746512815
7578516 1$1579/)4
1199=5"68851018291?"31978>
A68518,578182'618%"&69985()))*
0610185690178177305011146157
7:781,6823412441910567877960181418411985
2199=8
6078))
119973-55796
15!;785681A8
7506:18#01191
(*28#16883+6478283+647456
1#181
1-01678827915621478518568168391186
%3+H14512577:781822073#519852199=8
6078
4//
11I
8003+6>%701875())*84011234156+69657
06+3971,,+675140+7-91.7-#18157
07517956421#0256784312+7-6256
15015185
046741673/)//
1651952196&?%()3*=1456
18170751456
1
#185706840168#456
657F
118:107
1#1556
156317$6510341285754/)44
197D49%>78'B991018$508150(*
"639568#7:7812157-6F45678685191795
5073#512601450145678$65470+511985
444
G31
99 745709(*951,0121015727051
13011857 0 01#9355678182
470+516856311-5045964567857012707F968#23068#0+627607155121
19718589
6741//3)
801
1971852701'1(*898#3#182
18
6078185705565649473568#8;7382567870
"5565649273568#A61883506"
/,),,@8>55..$$$8,07H14570#.
81641()3/*=145797$4784185056787B/78815
757851620&01605678824970799
\]
0123423562786289
61747457239
561
4273194 !75"72#!1$$"722%484723&
'5972(1643)*6+4284"4,--./946"7031$
73"15946001"15636121272357075453
1$
1+12472170755 4031"41233
675'44
2475567 66"421 ,--3.
71237536284$$40351$1+124246$$44238734
5645623810463472472344540645'3"15
5261213
"4435&7
45'%7"40935'4"724!143
972%744'97281254,--3.:2036121$
1;67364534557272361;67364"4097265"562
97541587657$347760736127239
561
61094"22222
"621$$(,./94$20361272"437165"1$
750160706627235'22131
3443(/7650/0<41509=
40&72875>7?6
17"47180/7
16,-./949
56118607
3725063612772842436045125451$72
1+124@5425636472721+1243147231772
5440344;34"451$3946#1842
5261213
32332
+7*7185<7A07"486674531?"
0934
',--1.7972845624248
537351$47$045757
01254B42041$"6310912678421"477284"423
7237-
/24C%C747972442442C',--2.
7126287209770346+736121$381('*<627545$1"
'76156564236D0736121$707"16262628
651$1"7239
5613233
E(575,--2.076280727E(575712423612$1
%128@7284/725127
'613612072712
"439111864572063467$1"1462872"7628
063607175724457276136124$$403565<5
723425933FF88814<173701"F60"7628FF
"727G--2F"7"72G--2$
E(575,--3.#1453/445C1<62861413
763607%441$H+124#3947
62872
441628394I;4@754012043H488/
1
'53673
9747"77175#77475'61"4+@1684+
09797<6047>75#42724+@H0727'*461
%'7151,--./9449
1842754@"46734
40
06281$('*!657<4
72361;67235
534"7876253
573@62041;673645345562164723572374
526122223
91%0A40528451$/7'C944406
*62016090#C44'00762196,-.%155
1$0
315160('*@"76042+
"462'761565
39767276575510673486394297204550436663
31
714313609"9688625672"(489
313
1-
91428464C11010<!&43
0!1$40,--.
4036121$534"81839725634442420
1$47$
62>
6207557095433570<0946454;96636281+124
5
"31"552612133221C7<71 '2474226287,--1.#2036127727
545
1$0
31516080154@@915973449
1842754572
39460123636123154416700"7361262
'7615657239
561211
C697842!*?
5936284224248!,--.
47512726318420
0628623947<1$D4@8182
64
17650147348639"4341118607$70315
7284244;4556121$7<531784134625/44
9
561--C6336895'62581395'(76 %&7215<6*#%128 ,--.J7236$
6283946"7031$042372$34
311594601+1241234461"755818399
56118
7261094"653
7B723637364"437@727
56561
79728461322
)2 @7%74204,./944512541$012451$
1534"16456$$462862542563663
311+12462
394D45(489
31222
5634
674531?"
KL
MNOPQRSTMSUVWTXYZ[\]X^
Figure 50: Analyse en composantes principales basée sur les concentrations des métabolites
primaires chez trois génotypes de peuplier (Carpaccio en rouge et rose, Cima en jaune et beige et
Robusta en bleu foncé et bleu clair) soumis à un traitement ozone (couleurs vives) ou ambiant
(couleurs pastelles) à cinq dates de prélèvements (1, 2, 3, 4, 5 pour 2, 4, 11, 15 et 17 jours de
traitement respectivement)
Résultats
4. CHANGEMENTS INDUITS PAR L’OZONE DANS LES METABOLITES
PRIMAIRES DE TROIS GENOTYPES DE PEUPLIER
Malgré les barrières mécaniques et biochimiques que représentent la régulation de la
conductance stomatique et le système complexe de détoxication, l’ozone entraîne une
privation d’énergie. En réponse à l’ozone, les flux de carbone du métabolisme primaire vers le
métabolisme secondaire sont stimulés pour répondre aux besoins de réparation et de
détoxication (Iriti et Faoro, 2009).
Afin de mieux caractériser les modifications du métabolisme primaire en réponse à
l’ozone, nous avons procédé à une analyse des métabolites primaires, par GC/MS, chez trois
génotypes de peuplier euraméricain. Le métabolisme carboné étant la base de la réponse de
détoxication et de réparation, cette analyse a aussi pour but de mettre en évidence un
marqueur potentiel de résistance à l’ozone.
Comme le montre la figure 50, l’ozone a un fort effet sur le métabolisme primaire et
explique 26% de la variance des échantillons (PC1). De plus, chez le génotype le plus
résistant, Carpaccio, l’effet de l’ozone n’est visible qu’à partir de la 3ème date de prélèvement
(11ème jour de traitement), tandis que chez Robusta et Cima, la séparation entre les deux
traitements est déterminée dès le premier prélèvement (2ème jour de traitement). Un effet
temps au sein des échantillons soumis au traitement ozone est responsable de 16.5% de la
variance des échantillons (PC2). Parmi les modifications observées, on note une augmentation
de la plupart des métabolites impliqués dans le cycle de Krebs (Fig. 51), ce qui est cohérent
avec une forte activité respiratoire. Une des modifications majeures des métabolites primaires
en réponse à l’ozone est l’accumulation de sucres (glucose, fructose, galactose, raffinose,
mannose, sucrose) (Fig. 52).
Les sucres solubles sont très sensibles aux stress environnementaux qui agissent sur
l’apport de glucides des organes-sources vers les organes-puits (Rosa et al., 2009). La hausse
des concentrations en sucre solubles dans les feuilles en réponse à l’ozone peut être due à une
inhibition de la mise en réserve du carbone et à une inhibition de l’export en carbone
nouvellement assimilé (Einig et al., 1997; Dizengremel, 2001). Les sucres solubles, en plus de
leur rôle en tant que ressource métabolique et constituants cellulaires, agissent comme
signaux de régulation du métabolisme en réponse aux facteurs environnementaux. L’ozone
124
A
C
B
D
Figure 51 : Concentration en (A) citrate, (B) succinate, (C) fumarate, (D) malate, dans les feuilles de
trois génotypes de peupliers (Carpaccio, Cima et Robusta) après 2, 4, 11, 15 et 17 jours de traitement
ozone ou ambiant.
A
E
B
F
C
G
D
Figure 52 : Concentration en (A)
fructose, (B) glucose, (C) raffinose,
(D) galactinol, (E) galactose, (F)
mannose et (G) sucrose dans les
feuilles de trois génotypes de peuplier
(Carpaccio, Cima et Robusta) après 2,
4, 11, 15 et 17 jours de traitement
ozone ou ambiant.
Résultats
entraîne une hausse des besoins en glucides et une baisse de l’assimilation en carbone. Des
changements physiologiques et biochimiques se mettent alors en place pour permettre de
soutenir les besoins prioritaires de la respiration et des processus métaboliques nécessaires
pour faire face au stress, comme dans le cas de l’ozone, les processus de détoxication et de
réparation. Les sucres solubles agissent comme molécules de signal régulant l’expression de
gènes, et principalement ceux impliqués dans la photosynthèse, le métabolisme du sucrose et
la synthèse d’osmolytes (Gupta et al., 2005). Les sucres solubles sont des signaux distincts et
n’agissent pas tous de la même manière. Le sucrose et le glucose en plus de leur rôle
osmoprotecteur servent de substrat à la respiration cellulaire. Le glucose peut alimenter les
hexokinases mitochondriales et chloroplastiques afin de réduire la production de ROS dans
ces compartiments cellulaires (Valluru et Van den Ende, 2011). Le fructose, quand à lui,
pourrait être lié, par l’intermédiaire de la production d’erythrose-4-Phosphate, à la synthèse de
métabolites secondaires comme la lignine ou les composés phénoliques dont la synthèse est
induite par l’ozone (Hilal et al., 2004). Le raffinose et le galactinol pourraient agir comme
détoxiquants lorsqu’ils sont accumulés lors d’un stress, notamment au sein des chloroplastes
(Nishizawa et al., 2008; Valluru et Van den Ende, 2011).
Or, le génotype le plus résistant (Carpaccio) se caractérise par des concentrations
constitutives en sucre (notamment glucose, fructose, mannose et galactose) plus importantes
que les deux autres génotypes. La disponibilité en sucres solubles plus importante peut
s’avérer un facteur de résistance au stress ozone, grâce aux caractéristiques antioxydantes de
certains sucres, mais aussi pour pouvoir répondre plus facilement aux besoins nécessaires à la
réparation et à la détoxication.
125
CONCLUSION ET PERSPECTIVES
126
Conclusion et perspectives
Dans les années à venir, une augmentation des concentrations de fond en ozone
troposphérique est prédite du fait de la production par l’activité humaine d’oxydes d'azote
(NOx) et de composés organiques volatils (VOCs), mais aussi du fait de l'augmentation
des températures de la planète qui favorise les réactions photochimiques. Conscients des
enjeux liés à cette hausse, les pouvoirs politiques, dont les instances européennes, tentent
de limiter ces productions afin de limiter les conséquences économiques et
environnementales. Pour ce faire, un certain nombre d’indicateurs de seuil de risque
aident à déterminer les concentrations en ozone à ne pas dépasser pour ne pas engendrer
d’effets délétères pour la santé humaine, mais aussi pour la végétation. Néanmoins, si des
indicateurs de seuil de risque pour la végétation basés uniquement sur les concentrations
en ozone troposphérique, tels que l’AOT40 ou le SUM60, donnent une indication du
danger, les indicateurs mesurant les flux d’ozone par le calcul de la conductance
stomatique, tels que le CUO, l’AFstY ou le POD, permettent quand à eux de déterminer le
risque d’exposition. En revanche, pour évaluer le risque réel encouru, il faut mesurer le
flux effectif d’ozone qui prend en compte les deux moyens de défense mis en œuvre par
les plantes, à savoir : la régulation de la conductance stomatique et les processus de
détoxication.
L’objectif principal de cette thèse était de donner des pistes d’amélioration de
l’estimation des seuils de risque à l’ozone pour la végétation en approfondissant nos
connaissances sur les effets de l’ozone sur la régulation stomatique et les processus de
détoxication. De plus, l’étude de trois génotypes de peuplier euraméricain, caractérisés par
une sensibilité plus ou moins forte à l’ozone, avait pour but de définir un ensemble de
marqueurs de tolérance.
Les indicateurs de seuils de risque utilisant les flux d’ozone sont basés sur l’utilisation
de modèles de prédiction de conductance stomatique, car les mesures de conductance
stomatique en continu sur le terrain ne sont pas réalisables. Deux grands types de modèles
de conductance stomatique existent. Parmi ceux-ci, l’un des principaux est le modèle de
« Ball-Berry » (Ball et al., 1987) qui se base sur l’assimilation nette de CO2, tandis que
d’autres, tels que le modèle de « Jarvis » (Jarvis, 1976), représentent la conductance
stomatique comme le produit de la conductance maximale, relevée dans la littérature, par
des fonctions réductrices décrivant la réponse de la conductance stomatique aux facteurs
environnementaux et phénologiques. Il est admis qu’en plus de dommages visuels,
127
Conclusion et perspectives
l’ozone impacte les processus physiologiques entraînant une baisse différente de la
conductance stomatique et de l’assimilation de CO2 (Wittig et al., 2007). Ainsi, il a été
observé un découplage entre les deux (Lombardozzi et al., 2012). Comme nous l’avons
aussi montré (Dghim et al., 2012), l’ozone impacte directement la photosynthèse, en plus
de la conductance stomatique, en induisant une modification de l’activité des enzymes
carboxylantes (Rubisco et PEPC) et en modifiant, chez les espèces les plus sensibles, la
disponibilité
en
NADPH,
ce
qui
pourrait
ralentir
la
régénération
du
RibuloseBisPhosphate. La relation étroite liant l’assimilation et la conductance stomatique
n’est donc plus valide en présence d’ozone et rend les modèles de prédiction de la
conductance stomatique utilisant cette relation, tels que le modèle de Ball-Berry,
inadaptés. De la même manière, nous avons montré que l’ozone modifie la réponse des
stomates aux variations de différents facteurs environnementaux (Dumont et al., 2013). Là
encore, les fonctions sur lesquelles se fondent les modèles multiplicatifs de prédiction de
conductance stomatique ne sont plus valides lors d’un stress ozone et rendent les modèles
incertains. Cependant, ces modèles peuvent être améliorés pour prendre en compte les
effets directs de l’ozone sur la photosynthèse et sur la réponse stomatique aux variations
de paramètres environnementaux (Pleijel et al., 2002 ; Danielsson et al. 2003 ;
Lombardozzi et al., 2012). Nous avons montré que l’utilisation d’une conductance
maximale fixe est inappropriée car celle-ci est réduite par l’ozone et qu’il faudrait
paramétrer chaque fonction réductrice avec une fonction ozone pour traduire les
ralentissements d'ouverture et de fermeture observés. De plus, nous avons mis en évidence
que chez Robusta, le génotype le plus sensible, l’ozone n’induit pas de ralentissement
supplémentaire, celui-ci ayant des vitesses initiales de réponse très lentes. Il faut donc
poursuivre les études visant à caractériser plus finement ces effets, pour définir ces
nouvelles fonctions et vérifier que notre étude soit transposable sur des arbres plus âgés,
en conditions naturelles et sur d’autres espèces.
Afin de définir précisément l’effet de l’ozone sur les mouvements stomatiques, il
convient de comprendre les étapes altérées en amont qui entraînent le ralentissement de
l’ouverture et de la fermeture des stomates en réponse à différents stimuli. Nous avons
montré que les flux ioniques dans les cellules de garde sont modifiés sous ozone et que
l’expression des gènes des canaux calciques vacuolaires était fortement inhibée. Ainsi, il
est important de vérifier si les perturbations des flux ioniques concernent majoritairement
128
Conclusion et perspectives
certains compartiments cellulaires en mesurant le contenu minéral de chaque
compartiment séparément, grâce à l'utilisation d’un microscope électronique à balayage à
haute résolution (à effet de champ), couplé à des platines de cryofracture pour éviter les
mouvements d'éléments solubles et mobiles. De plus, une étude de cinétique journalière
complète (jour + nuit) permettrait de tester un éventuel effet d’accumulation de certains
ions sous stress ozone. Enfin, les flux d’ions aboutissant à des flux d’eau, l’ozone pourrait
aussi agir sur les aquaporines qui sont principalement des canaux plasmiques et
tonoplastiques (PIP, TIP) facilitant les mouvements d’eau. L’expression des gènes de
cette large famille de protéines semble régulée sous l’effet de différentes contraintes
abiotiques (Cohen et al., 2013). Elle pourrait donc l’être aussi par l’ozone au sein des
cellules de garde et ainsi modifier les vitesses d’ouverture et de fermeture des stomates.
Pour améliorer les indicateurs de seuils de risque, il faut aussi prendre en compte les
processus de détoxication qui limitent les effets biologiques dus à l’ozone. Pour tenir
compte de la part d’ozone détoxiquée, les indicateurs incluent un seuil de concentration en
ozone dans leur calcul. Néanmoins, les capacités de détoxication variant d’une espèce à
une autre, d’un génotype à un autre, le seuil ne peut être fixe. Il faut donc intégrer
différemment les processus de détoxication dans le calcul des indicateurs de seuils de
risque. L’ascorbate apoplastique est le premier acteur de la détoxication à agir sur les ROS
produits par l’ozone. Certains modèles se basent donc sur les concentrations en ascorbate
pour essayer de représenter la détoxication (Tuzet et al., 2011). Néanmoins, ces modèles
restent limités, puisque l’ascorbate apoplastique n’est pas le seul métabolite impliqué dans
les processus de détoxication. Les acteurs de la détoxication sont nombreux, et nous avons
mis en évidence que la capacité de détoxication résulte de la combinaison de facteurs
multiples, tels que les concentrations de différents antioxydants, leur régénération,
l’activité d’enzymes détoxifiantes. Il faut cependant rappeler que la sensibilité à l’ozone,
si elle peut être due à une mauvaise régulation de la conductance stomatique, à des
conductances maximales plus importantes, ou à des capacités de détoxication trop faibles,
elle peut aussi être limitée par une forte disponibilité en ressources énergétiques et une
bonne remobilisation des ressources. Dans l’absolu, l’ensemble de ces paramètres
devraient être pris en compte afin d’obtenir un modèle le plus proche possible de la réalité
physiologique des végétaux, mais l’intégration de multiples mécanismes ne semble pas
129
Conclusion et perspectives
être applicable à de grandes échelles de temps et d'espace car nécessitant trop de
paramétrages.
Les différences de tolérance sont difficiles à appréhender du fait de la complexité des
mécanismes mis en jeu. Robusta, le génotype de peuplier le plus sensible parmi les trois
que nous ayons étudiés, se caractérise par une chute de feuilles précoce et importante.
D’après nos résultats, sa sensibilité peut s’expliquer par différents facteurs. Au niveau
stomatique, il se distingue par une conductance stomatique plus élevée et surtout par des
vitesses de réactions très faibles. La lenteur de ses réponses ne lui permet pas de tirer
partie des conditions favorables au cours d’une journée et entraîne probablement des
pertes en eau plus importantes et une entrée d’ozone plus forte. De plus, il n’arrive pas à
maintenir un pool de NADPH nécessaire au processus de régénération des antioxydants,
dont l’ascorbate, laissant s’accumuler la forme oxydée. Carpaccio, à l’inverse, est le
génotype le plus résistant que nous ayons étudié. Sa tolérance se traduit par la
combinaison de nombreux facteurs de résistance, tant au niveau stomatique qu’au niveau
métabolique. Il se caractérise par des vitesses de réponse des stomates rapides, lui
permettant de saisir toutes les opportunités pour perdre le moins d’eau possible, laisser
entrer peu d’ozone et assimiler suffisamment de carbone. A ceci s’ajoute de bonnes
capacités de détoxication avec notamment des concentrations constitutives en ascorbate et
en glutathion importantes. Il arrive à maintenir un pool de NADPH suffisant pour
régénérer ses antioxydants. Il dispose aussi constitutivement de concentrations en sucres
plus importantes et remobilise fortement ses acides aminés vers les processus de
réparation et de détoxication, tout en trouvant des ressources énergétiques alternatives.
Cima quant à lui, se définit par un niveau de sensibilité intermédiaire entre Carpaccio et
Robusta, avec une réduction de biomasse toutefois importante. Les facteurs justifiant sa
sensibilité sont moins clairs que pour Robusta. En effet, contrairement à Robusta, il
cumule certains facteurs de tolérance comme des concentrations constitutives en ascorbate
importantes, un maintien des formes réduites de l’ascorbate et du glutathion, des vitesses
de réactions des stomates importantes. Néanmoins, il semblerait que Cima se distingue de
Carpaccio par une ressource primaire plus faible, notamment au niveau des sucres, et par
un profil en composés phénoliques particulier, qui pourrait constituer un pool antioxydant
moins performant, bien que cette hypothèse nécessite d’être vérifiée. Ainsi, la notion de
résistance à l’ozone résulte bien de la combinaison de marqueurs de tolérance multiples.
130
Conclusion et perspectives
En ne prenant pas ses facteurs dans leur globalité, on ne peut donc pas prédire la tolérance
d’un génotype.
Cette thèse aura permis de mettre en évidence des pistes à suivre pour l’amélioration
des seuils de risque à l’ozone pour la végétation, en approfondissant les connaissances
concernant les effets de l’ozone sur la régulation stomatique et concernant les processus
de détoxication. L’importance du métabolisme primaire en soutien aux mécanismes de
détoxication et de réparation a été soulignée et nous avons montré que les phénomènes de
tolérance ou de sensibilité à l’ozone, ne peuvent être appréhendés que par une étude
approfondie avec un point de vue global sur tous ces facteurs. Les conclusions de ces
travaux nécessitent d’être confirmées en conditions naturelles, toutes les expériences ayant
été conduites en conditions contrôlées. Il faudrait aussi vérifier leur pertinence au sein
d’autres espèces et sur des arbres plus âgés. Dans notre étude, l’ozone seul, à des
concentrations correspondant à un stress chronique, a été étudié pour nous permettre de
comprendre finement les mécanismes de réponse à ce stress, mais il est important de noter
que les prédictions face au changement climatique indiquent entre autre, une tendance à
une augmentation des températures, des concentrations en CO2 et de la fréquence des
sécheresses, ainsi que de leur intensité. Différentes études se sont intéressées aux
interactions entre l’ozone et d’autres stress, comme le fort CO2 ou la sécheresse (Matyssek
et al., 2006; Imai et Kobori, 2008; Kontunen-Soppela et al., 2010; Lindroth, 2010; Iyer et
al., 2013). Les interactions entre différents stress dépendent de l’intensité de ces derniers,
de leur durée, mais aussi de l’ajustement temporel des uns par rapport aux autres. La
chronologie peut avoir un effet non négligeable du fait des variations du métabolisme au
fil des saisons pour répondre à des besoins saisonniers. Deux stress en interaction peuvent,
en fonction des scénarios, avoir des effets antagonistes, additifs ou synergétiques. Si l’on
prend l’exemple de l’interaction ozone/sécheresse, au printemps nous observons souvent
une hausse des concentrations en ozone, du fait de l’augmentation de l’éclairement, des
températures et des émissions biologiques des Composés Organiques Volatils (COV), qui
peut impacter le comportement stomatique et induire une faiblesse pour lutter contre les
sécheresses de l’été. Les effets d’une sécheresse après un stress ozone seraient donc
amplifiés par celui-ci. A l’inverse, une sécheresse précoce provoquerait une fermeture des
stomates qui pourrait limiter les flux entrant d’ozone et avoir ainsi un effet protecteur.
Néanmoins, ces deux stress induisent une perte de biomasse et auront donc, au final, quel
131
Conclusion et perspectives
que soit le scénario, un effet délétère (Matyssek et al., 2006). Comprendre les mécanismes
de chaque stress indépendamment est primordial pour pouvoir ensuite interpréter
correctement les études de stress combinés; ceci pour être capable de prédire la réponse de
la végétation au changement climatique, pour pouvoir prendre des mesures politiques dans
le but de protéger les écosystèmes et pour adapter les pratiques forestière et agricole afin
de limiter les pertes économiques.
132
ANNEXES
133
Annexes
I.
PROTOCOLE DU DOSAGE DE L'ASCORBATE ET DU
GLUTATHION (FORMES OXYDEES ET REDUITES) EN
MICROPLAQUE
La vitamine C et le glutathion ne sont pas stables surtout à température ambiante, par
conséquent essayer de travailler rapidement et laisser les extraits sur la glace. FAIRE LES
PLAQUES LE MEME JOUR QUE L'EXTRACTION et commencer par l'ascorbate. On peut
cependant doser les extraits pour le glutathion pendant 1 semaine s'ils sont stockés à -80°C.
1 roborack = 21 blancs, 3 extraits de référence (extrait dont on connait la teneur en ascorbate
et glutathion), 72 échantillons. Pour chaque roborack d'extraction, faire 2 plaques de dosage
(réplica technique).
Attention, pour chaque produit pipeté par le robot, compter 15mL supplémentaire de volume
mort!
5. EXTRACTION
- Peser dans des tubes micronics 1 mL 20 mg d'échantillon. Attention à ne pas laisser
l'échantillon décongeler. Plonger le tube dans l'azote liquide, vider l'azote et faire la tare.
Mettre 20 mg de poudre et attendre la stabilisation, replonger aussitôt dans l'azote. Une fois
les roboracks prêts, les stocker à -80°C
- Mettre un petit film d'azote dans une cuvette et y disposer le roborack. Décapsuler les tubes.
Attention à ne pas décongeler les échantillons. Ne pas hésiter à remettre le roborack sur
l'azote. Une fois décapsulés, mettre à -20°C
- Mettre la centrifugeuse à 4°C et préparer le robot, remplir une cuve avec de l'acide
métaphosphorique 5%. Lancer le programme, et apporter les roboracks quand nécessaire.
Le robot va ajouter à chaque tube 400 µL d'acide métaphosphorique 5% gardé au préalable
dans la glace. Il va ensuite agiter.
- Vérifier que l'agitation était suffisante. Sinon, capsuler les tubes de nouveaux pour les agiter
manuellement.
134
Annexes
- Centrifuger 10 min à 4°C à 4000 g (puissance max). Une fois centrifugés, remettre dans la
glace.
Solution à préparer
Acide métaphosphorique 5% (5 g dans 100 mL d'eau), se conserve 1 mois à 4°C
6. DOSAGE ASCORBATE
- Placer 4 fois plus de plaques numérotées que de nombre de roboracks d'extraits sur le robot.
- Préparer une cuvette de NEM 0.5%, une cuvette de DTT 5 mM et une cuvette de tampon
phosphate 0.4 M pH7.4
- Remplacer 6 blancs par une gamme étalon:
Ascorbate (nmol) dans le puit
0
5
10
15
20
30
Ascorbate 5 mM (µL)
0
25
50
75
100
150
Acide métaphosphorique 5% (µL)
500
475
450
425
400
350
Le robot va déposer 20 µL d'extrait dans chaque plaque. Il va ajouter 20 µL de tampon
phosphate dans la moitié des plaques et 20 µL de DTT dans l'autre moitié. (Commence par
une plaque Tampon puis une DTT et ainsi de suite)
- Mettre les plaques à incuber 20 min à 37°C. Pendant ce temps, préparer le mix A+B.
Remplacer la cuve de tampon par une cuve d'eau.
- Remettre les plaques sur le robot dans le bon ordre. Il va ajouter 10 µL de NEM sur les
plaques DTT et 10 µL d'eau sur les autres.
- Laisser incuber 1 min à température ambiante.
- Ajouter sous hotte 80 µL par puits de réactif A+B. Attention ne pas trop exposer à la
lumière.
135
Annexes
- Laisser incuber 40 min à 37°C.
- Lire sur lecteur de plaque à 550 nm
Les plaques avec le DTT permettent de doser l'ascorbate + le déhydroascorbate. Les plaques
sans DTT ne dosent que la forme réduite de l'ascorbate.
Solution à préparer
- 0.4 M Tampon phosphate pH 7.4:
(a)Na2HPO4. 12H2O (35.8 g+250 mL d'eau) (di-sodium hydrogen orthophosphate 12hydrate. BDH cat No. 102 485B)
(b)NaH2PO4. 1H2O (5.52 g + 100 mL d'eau) (sodium dihydrogen orthophosphate 1hydrate. BDH cat no. 102454R)
Ajouter (b) à (a) pour être à pH7.4, se conserve 1 mois à 4°C, utiliser à température ambiante
- Acide métaphosphorique 5% (5 g dans 100 mL d'eau) : se conserve 1 mois à 4°C
- 5 mM DTT (agent réducteur) : dissoudre 8 mg DTT (dithiothreitol) dans 10 mL de 0.4 M
tampon phosphate pH7.4. Peut être stocké à -20°C par aliquots de 1.2 mL ou par 15 mL
- 0.5% NEM (N-ethylmaleimide) (retire le DTT en excès) : 50 mg NEM dans 10 mL d'eau (A
utiliser sous hotte!). Peut être stocké à -20°C par aliquots de 0.6 mL ou par 15 mL
- Réactif coloré :
(A) H3PO4 + FeCl3
18.5 mL d'acide orthophosphorique 85% + 31.5 mL d'eau. (Attention, on en donne jamais à
boire à un acide!). Ajouter 0.3 g de Ferric Chloride (=0.6%)
(B) 4% 2,2 bipyridyl
1 g dans 25 mL
136
Annexes
Chaque réactif est stable à température ambiante dans le noir pendant 2 à 3 semaines MAIS
PAS LE MELANGE DES DEUX. Préparer le réactif colorant chaque jour au dernier moment
en ajoutant 2.2 mL de (A) à 0.8 mL de (B)
- 5 mM d'acide ascorbique : 1 mg/mL d'acide métaphosphorique, stocker à -20°C
Références
Gatzek, S., Wheeler, G.L., and Smirnoff, N. (2002). Antisense suppression of L-galactose
dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate synthesis
and reveals light modulated l-galactose synthesis. Plant J 30, 541-553
Kampfenkel, K., Van Montagu, M., and Inze, D. (1995). Extraction and determination of
ascorbate and dehydroascorbate from plant tissue. Anal Biochem 225, 165-167.
7. DOSAGE GLUTATHION
- Placer 4 fois plus de plaques numérotées que de nombre de roboracks d'extraits sur le robot.
- Remplacer 6 blancs par une gamme étalon GSH:
- Prendre 10 µL GSH 10 mM dans 990 µL d'eau (0.1 mM final). Mettre 500 µL d'acide
métaphosphorique dans 6 tubes. Ajouter 500 µL de GSH 0.1 mM dans le premier (50 µM
final), prélever de ce tube 500 µL et les mélanger avec le suivant. Procéder à cette dilution en
cascade pour tous les tubes sauf le 0 pour avoir :
Concentration (µM)
50
25
12.5
6.25
3.12
0
nmol par puit
0.5
0.25
0.125
0.06
0.03
0
- Faire de même avec une gamme étalon GSSG mais à partir de: 25 µL GSSG 4 mM dans
975 µl d'eau (0.1 mM final)
Le robot va prélever 10 µL d'extrait pour chaque plaque.
- Ajouter 1 µL de VPD 0.4 M à la moitié des plaques
- Mettre toutes les plaques à incuber 1 h à RT
137
Annexes
- Pendant ce temps, préparer le tampon 1X: pour 24 mL: 5.2 mL de KH2/K2H 0.5 M pH7 +
0.24 mL EDTA 0.5 M + 18.56 mL d'eau
- Préparer la GR : 8 µL de GR dans 492 µL de Tp 1X
- Préparer le NADPH (2 mM) : 200 µL de 50 mM dans 4.8 mL de Tp 1X
- Préparer le DTNB
- Préparer le MIX : Mélanger 16mL de tampon 1X + 460 µL de GR + 460 µL de DTNB. Ne
pas mettre le MIX dans la glace et faire au dernier moment
- Mettre une cuve avec le MIX et une plaque PCR avec du NADPH sur le robot
Le robot va ajouter 150 µL de MIX en agitant. Il ajoute ensuite 5 µL de NADPH plaque par
plaque avec entre chaque plaque un message demandant s'il passe à la suivante.
- Prendre chaque plaque, l'agiter et lire toutes les 30 sec pendant 10 min à 405 nm.
Solution à préparer
- 0.5 M tampon phosphate pH7:
(a) K2HPO4. 12H2O à 0.5 M
(b) KH2PO4. 1H2O à 0.5 M
Ajouter (b) à (a) pour être à pH7. Se conserve 1 mois à 4°C, utiliser à température ambiante
- EDTA 0.5 M pH7 : Se conserve 1 mois à 4°C
- Acide métaphosphorique 5% (5 g dans 100 mL d'eau) : Se conserve 1 mois à 4°C
- Glutathion Réductase : 100 U/220µL (Baker yeast (Sigma) dans 3.6 M (NH4)2SO4, pH7
0.1 mM DTT) et à bien mélanger avant de prélever. Se conserve 1 mois à 4°C
- Stock glutathion réduit (GSH) 10m M : 3 mg (PM 307.3 g/mol) dans 1 mL d'eau. Se
conserve à -20°C
- Stock glutathion oxydé (GSSG) 4 mM : 2.45 mg (PM 612.6 g/mol) dans 1 mL d'eau. Se
conserve à -20°C
138
Annexes
- DTNB (5,5'Dithio-2-nitro benzoic acid) 1.5 mg/mL: Préparer frais au dernier moment dans
DMSO. Conserver pendant le dosage à RT
- NADPH 50 mM : 41.7 mg (PM 833.4 C21H26N7Na4O17P3 anhydre) dans 1 mL NAOH
50 mM. Se conserve à -20°C
II.
PROTOCOLE D’EXTRACTION ET D’ANALYSE PAR HPLC
DES CAROTENOÏDES
Toutes les étapes doivent être réalisées dans l’obscurité (lumière rouge sombre). Stocker les
échantillons sous atmosphère azotée.
- Peser environ 10 mg de materiel vegetal broyé dans un tube Eppendorf (Le poids précis doit
être connu).
- Ajouter 1000 µL de méthanol contenant 0.01% de BHT (butylated hydroxytoluene)
- Ajouter 20 µL de 1 mg/mL β–apo-caroten-8-al dans de l’hexane contenant 0.01% de BHT.
- Vortexer à 4 °C à 1400 rpm pendant 10 min.
- Centrifuger à 12000 rpm pendant 5 min à 4°C.
- Prendre le surnageant et commencer à le sécher sous atmosphère azotée.
- Ajouter 1000 µL d’hexane contenant 0.01% de BHT.
- Vortexer doucement à 4°C à 1400 rpm pendant 10 min.
- Centrifuger à 12000 rpm pendant 5 min à 4 °C.
- Mettre en commun les surnageants.
- Sécher les surnageants sous atmosphère azotée.
- Dissoudre les surnageants désséchés dans 600 µL de dichlorométhane.
- Ajouter 1.4 mL de mélange acétonitrile:méthanol (6:1), les proportions finales de
ACN:MeOH:DCM seront 60:10:30.
139
Annexes
- Prélever deux aliquots de 400 µL dans des bouteilles opaques. Lancer l’analyse d’un des
deux sous HPLC.
- Sécher l’autre sous atmosphère azotée et le stocker à – 20 °C.
HPLC-MS
Volume d’injection 10 µL, colonne Kinetex 2.6 u C18 (150 x 4.6 mm), flux 1.6 mL/min,
température de colonne 25°C, température de plateau 4°C, détection UV à 240-700 nm. A:
ACN-MeOH (75:25, v/v), B= ACN-MeOH-dichlorométhane (75:10:15, v/v/v), avec un
gradient de 0% B à 50% B en 4 min, isocratique 50% B pendant 6 min et 9 min
d’équilibration avec 0% B avant l’échantillon suivant. APCI en mode positif, balayage total
des ions de 300-1000 m/z.
III.
PROTOCOLE D’ANALYSE DES SUCRES, COMPOSES
PHENOLIQUES ET ACIDES AMINES
1. EXTRACTION
- Transférer 30mg de matériel végétal dans un tube Eppendorf de 2mL et le plonger dans de
l’azote liquide.
- Broyer les échantillons avec une spatule refroidie au préalable dans de l’azote liquide.
Ajouter une bille métallique refroidie au préalable.
- Broyer les échantillons dans les tubes Eppendorf insérés dans des blocs froids dans un
TissueLyser 3 fois pendant 15 s avec une vitesse de 20 fois/s la première fois puis 24 fois/s.
Entre les broyages, refroidir les échantillons dans de l’azote liquide et mélanger les
échantillons.
- Faire un blanc avec seulement du solvant et le mélange de standards internes chaque jour.
140
Annexes
- Ajouter 650 µL de 0.005% de BHT dans 80% de MeOH. (Dégazer le solvant chaque jour
après usage sous atmosphère azotée pendant 5 min et stocker à -20°C).
- Ajouter 200 µL de mélange de standards internes (Pour faire le mélange : 2 mL de 1 mg/mL
d’acide benzoïque-d5 dans 1:1 MeOH:H2O, 2 mL de 1 mg/mL D-glucose-C13 dans 1:1
MeOH:H2O,, 1 mL de biochanin A dans 100% de MeOH, 600 µL de 2.8 mg/mL glycerol-d8
dans 1:1 MeOH:H2O et 1 mL de 0.1 mg/mL d’alanine-d3 dans 1:1 MeOH:H2O).
- Secouer 15 sec avec le TissueLyser.
- Ajouter de nouveau 650 µL de 0.005% de BHT dans 80% de MeOH et mélanger pendant
15 sec avec le TissueLyser. (Dégazer le solvant chaque jour après usage sous atmosphère
azotée pendant 5 min et stocker à -20°C).
- Extraire 15 min à 4°C à1400 rpm.
- Centrifuger pendant 2 min à 10°C à 12000 rpm (environ 13500 g).
- Prélever le surnageant et le garder sur la glace.
- Ajouter 2 fois 650 µL de 0.005% de BHT dans 100% de MeOH.
- Vérifier que l’échantillon est bien mélanger dans le solvant et mélanger 15 sec avec le
TissueLyser.
- Faire une seconde extraction de 5 min à 4°C à 1400 rpm.
- Centrifuger à 12000 rpm (environ 13500 g) pendant 2 min à 10°C.
- Combiner les surnageants.
Les aliquots de surnageants qui seront utilizes pour les analyses de composes phénoliques et
les analyses en GC doivent être complètement évaporés à sec le jour même de l’extraction.
Prendre deux aliquots de 150 µL pour les analyses en GC, deux aliquots de 150 µL pour les
analyses d’acides aminés et deux aliquots de 500 µL pour les analyses de composés
phénoliques. Vérifier la température d’évaporation (30°C). Il est important qu’aucun résidu
d’eau ne reste pour les analyses en GC.
141
Annexes
Les échantillons sont stockés dans des flacons en verre. Dégazer les échantillons avec un jet
d’azote avec la fermeture du flacon. Les échantillons peuvent être stockés à -70°C jusqu’aux
analyses mais pas plus d’un mois pour les analyses en GC.
2. ANALYSE DES SUCRES
Après avoir sorti les échantillons du congélateur:
- Laisser à température ambiante pendant une heure avec d’ouvrir les flacons.
- Ajouter 20 µL de standard de temps de rétention (C7-C40 alcanes saturés dans de l’hexane,
Sigma). Assécher (évaporation rapide)
- Ajouter 80 µL de MAHC (20 mg/mL de methoxyamine hydrochloride dans de la pyridine,
faire le mélange chaque jour), laisser dériver 90 min à 37°C.
-
Ajouter80 µL
de
MSTFA
(N-methyl-N-(trimethylsilyl)trifluoro-acetamide),
laisser
dériver60 min à 37°C. Transférer les échantillons dans des inserts et lancer l’analyse.
Notes: Les échantillons sont extraits et analysés dans un ordre aléatoire. L’utilisation d’azote
liquide nécessite le port de gants de protection au dessus des gants normaux. Après avoir pesé
le MAHC, bien nettoyer la balance car il est corrosif.
GC/MS
Volume d’injection: 1 µl, injection à debit divisé avec un ratio supérieur à 1:50, colonne:
Restek, USA Rxi®-5Sil MS 30 m, 0.25 mmID, 0.25 µm df avec 10 m Integra-Guard, Cat #
13623-127, serial # 870087, température d’injection 260˚C, température d’interface 280˚C,
température de la source ionique 230˚C, MS Quad 150˚C, programme de température du
four : 2 min isothermique 60°C, puis 10°C/min jusqu’à 325°C, 6 min à 325°C et 7 min pour
équilibrer à 60°C entre chaque analyse. Flux d’hélium 1 mL/min, plage de détection m/z 50550, délai du solvent: Acétate d'éthyle (bouteille 1) et hexane (bouteille 2) sont utilisés pour
nettoyer l’aiguille plus fois avant et après injection. Les échantillons de peuplier sont « sale »,
La gaine doit être changée tous les deux jours. L’aiguille et le canon doivent être lavés à
l’acétone tous les jours. Laisser sécher à l’air libre.
142
Annexes
3. ANALYSE DES COMPOSÉS PHÉNOLIQUES
- Diluer les aliquots dans 250 µL de MeOH et 250 µL d’eau, lancer l’analyse
- Ajouter le PDA et le Corona dans la configuration – vérifier la taille de la boucle de
l’échantillon.
C : 0.1% d’acide formique dans de l’eau
D : 0.1% d’acide formique dans de l’acétonitrile
Flux : 1.1 mL/min
Entre chaque analyse:
- Vérifier que toutes les analyses aient réussies
- Vérifier qu’il reste suffisamment de place sur le disque dur
- Vider la bouteille poubelle
- Nettoyer la surface dans le bouclier ionique avec 50:50 MeOH:H2O
- Purger les canaux
- Nettoyer avec 98% d’acétonitrile et 0.1% de formique acide pendant 15 min à 0.4 mL/min
puis avec du meOH pendant au moins 30 min jusqu’à ce que la colonne semble propre
(vérifier sur le PDA : Direct control- Start data-zero data. Les lignes doivent être stables)
- Nettoyer le spectromètre de masse avec 50:50 MeOH:H2O à 0.2 mL/min pendant 10-20 min
- Laisser le spectromètre de masse allumer 5 min de plus avec un flux nul.
- Laisser la phase soluble se stabiliser avant de lancer une nouvelle analyse (environ 10 min)
et vérifier de nouveau sur le PDA la stabilisation.
- Vérifier que le Corona donne une ligne de base inférieure à 0.5 pA
- La pression de départ doit toujours rester la même (dépend de la colonne)
- Laisser les appareils en veille après les analyses chaque jour.
143
Annexes
S’il n’y a pas d’analyses prévues pendant une journée, ne pas oublier de vider la bouteille
poubelle après le nettoyage, éteindre le spectromètre de masse, éteindre les lampes du PDA.
Dans le cas où aucune analyse n’est prévue pendant plus d’une journée, éteindre le Corona.
Quand toutes les analyses sont finies, purger les canaux utilisés (C et D) avec de l’eau
Millipore. Nettoyer les filtres des bouteilles de solvant dans un bain à ultrasons avec de l’eau
Millipore puis 5 min dans du MeOH. Si un filtre avec de l’acétonitrile est mis directement
dans une solution contenant des sels, il s’encrasse.
Ne pas oublier de lester les pompes binaires une fois par semaine. L’azote doit être coupé
pour le Corona avant de vider les bouteilles poubelles du Corona. Le MS doit être calibré une
fois par mois, pour cela :
- Préparer un mélange frais de calibration, les solutions de stockage peuvent être utilisées
pendant 4 mois si elles sont gardées à 4°C.
- Utiliser la seringue réservée à cette usage.
- Régler la position de la sonde
- Régler à 195.1 et sauvegarde le fichier de réglage.
- Autocalibrer et nettoyer toutes les surfaces et tuyauteries après calibration.
4. ANALYSE DES ACIDES AMINÉS
- Appliquer exactement le protocol établit par le producteur du kit EZ :faast (sauf pour le
volume de réactif 1 50 µL au lieu de 100 µL). Brièvement :
- Sortir les réactifs du frigo
- Sortir les échantillons du congélateur -20°C
- Préparer le mélange 3A-3B dans la bouteille à bouchon rouge
ex: 8 échantillons préparer pour 9 (avec le blanc) 1200 µL (3A) et 800 µL (3B)
- Mettre un flacon allongé / échantillon +1 et les identifier
- Mettre 100 µL d'échantillons sauf pour le blanc
144
Annexes
- Ajouter 50 µL dans tous de Réactif 1
- Mettre un piston dans une seringue de 1.5 mL auquel on ajoute un embout adsorbant dans
chaque flacon
- Aspirer doucement par étape jusqu'à ce que tout passe dans la seringue
- Mettre 200 µL de R2 (washing solution) dans le flacon
- Aspirer doucement
- Détacher l’embout et le laisser dans le flacon. Vider les seringues et les mettre à laver
- Ajouter 200 µL du milieu d'élution préparé le jour même
- Insérer les embouts sur des seringues de 0.6 mL avec le piston à moitié enfoncé
- Aspirer jusqu'au filtre et expulser
- Refaire jusqu’à ce que la totalité des billes soient expulsées
- Mettre les seringues à laver, jeter les embouts vident.
- Mettre 50 µL de R4 avec le microdoseur sans toucher les flacons
- Vortexer 8 s et attendre 1 min
- Vortexer 5 s et attendre 1 min
- Ajouter 100 µL de R5 avec le microdoseur sans toucher les flacons
- Vortexer 5 sec et attendre 1 min
- Prélever la phase organique (celle du dessus) dans un flacon avec une pipette pasteur.
- Mettre les flacons à sécher moins de 10 min sous un jet d’azote
- Redissoudre dans 90 µL de phase mobile HPLC
- Transférer dans un insert, mettre l'insert dans le flacon et boucher.
- Mettre du MeOH dans un flacon sans insert et boucher.
HPLC/MS
145
Annexes
Pas d’utilisation de Corona ou PDA. Flux 0.28 mL/min.
C: 10 mM de formiate d'ammonium dans de l’eau
D: 10 mM de formiate d'ammonium dans du MeOH
Chaque jour à la fin des analyses :
- Vérifier que toutes les analyses aient réussies
- Vérifier qu’il reste suffisamment de place sur le disque dur
- Vider la bouteille poubelle
- Nettoyer la surface dans le bouclier ionique avec 50:50 MeOH:H2O
- Purger les canaux
- Rincer les têtes de pompe avec de l'eau Millipore pur lentement à l'aide d'une seringue au
moins deux fois
- Purger avec de l’eau Millipore pendant au moins 2 min
- Laver avec 98% de MeOH à 0.4 mL/min pendant au moins 30 min jusqu’à ce que la colonne
semble propre en allumant de spectromètre de masse.
- Laver le spectromètre de masse avec 50:50 MeOH:H2O à 0.2 mL/min pendant 10-20 min.
Le tube de transfert d’ions doit être lavé tous les jours.
- Laisser le spectromètre de masse allumé pendant 5 min supplémentaire avec un flux nul.
- Purger les canaux utilisés (C et D)
- Laisser la phase soluble se stabiliser avant de lancer une nouvelle analyse (environ 10 min)
La pression de départ doit toujours être la même (dépend de la colonne)
- Les appareils peuvent être éteints après chaque analyse.
Ne pas oublier de lester les pompes binaires une fois par semaine. Vider la bouteille poubelle
de nouveau après avoir nettoyé le système quand il n’y a pas d’analyse à lancer le même jour.
146
Annexes
Après avoir fini toutes les analyses, nettoyer les analyses dans un bain à ultrasons avec de
l’eau Millipore puis 5 min dans du MeOH. Purger les canaux utilisés (C et D) en utilisant la
bouteille d’eau pure Millipore pendant 10-30 min. Il est important de supprimer les sels avant
de changer de phase mobile.
IV.
PROTOCOLE D’EXTRACTION DES ARNS AVEC LE KIT
RNEASY® PLANT MINI
- Sortir le nombre d’échantillons à extraire en une demis journée
- Préparer par échantillons : Une colonne lilas, une colonne rose, 2 tubes eppendorf 2 mL, 2
tubes collecteurs 1.5 mL
- Vérifier que le tampon RPE est prêt (ajout d’éthanol)
- Prélever 550 µL de tampon RLT par échantillon et sous la hotte, ajouter 10 µL de βmercapto-éthanol par mL de tampon RLT.
- Mettre au maximum 100 mg de poudre dans un tube eppendorf 2 mL gardé dans l’azote
liquide.
- Disposer tous les échantillons dans un bloc froid, tubes ouverts, pour les garder congelés en
manipulant.
- Ajouter dans chaque tube 550 µL du mélange RLT. Vortexer à température ambiante 30sec
à 1min après avoir mixer manuellement.
- Centrifuger 2 min à vitesse max (14500 rpm)
- Transférer la totalité du surnageant sur une colonne lilas pour chaque échantillon
- Centrifuger 2 min à vitesse max (14500 rpm)
- Mettre 250 µL d’éthanol dans un nouveau tube eppendorf par échantillon, vider y
directement le lysat et jeter la colonne lilas.
- Homogénéiser en pipetant doucement avec une P1000, et transférer au maximum 700 µL sur
une colonne rose par échantillon.
147
Annexes
- Centrifuger 15 s à 8000 g
- Vider le réservoir
- Ajouter 700 µL de tampon RW1
- Centrifuger 15 s à 8000 g
- Vider le réservoir
- Ajouter 500 µL de tampon RPE
- Centrifuger 15 s à 8000 g
- Vider le réservoir
- Ajouter 500 µL de tampon RPE
- Centrifuger 2 min à 8000 g
- Jeter le tube collecteur et le remplacer par un nouveau
- Centrifuger 1 min à vitesse max (14500 rpm)
- Jeter le tube collecteur et le remplacer par un tube eppendorf 1.5 mL
- Ajouter sur la membrane directement sans la toucher 50 µL d’eau (on peut chauffer l’eau à
65°C au préalable pour améliorer le rendement)
- Centrifuger 1 min à 100 g puis 1 min à 8000 g
- Mettre les tubes dans la glace avant un dosage au Nanodrop. Si besoin, procéder à une
seconde élution de 30 µL dans un nouveau tube.
V.
PROTOCOLE DE TRAITEMENT DNASE I AMBION
- Calculer le volume d’extrait nécessaire pour avoir 5 µg d’ARN environ en se basant sur une
mesure au nanodrop.
- Compléter avec de l’eau pour avoir un volume final de 44 µL.
148
Annexes
- Ajouter 5 µL de DNA buffer
- Ajouter 1 µL de rDNAse I
- Mélanger doucement en retournant le tube
- Incuber pendant 20-30 min à 37°C
Ajouter 5 µL de réactif d’inactivation Dnase
- Incuber 2 min à température ambiante en mélangeant occasionnellement
- Centrifuger 1 min 30 à 10000 g
- Transférer le surnageant dans un nouveau tube.
- Aliquoter sur barette 4 µL pour le dosage au Ribogreen et la vérification à l’expérion.
VI.
PROTOCOLE DE VERIFICATION DE LA QUALITE DES
ARNS A L’EXPERION
- Préparer le gel marqué en mélangeant 65 µL de gel filtré à 1 µL de marqueur. Attention,
vortexer puis ranger tout de suite à l’obscurité.
- Mettre 1.5 µL d’échantillons en barrettes.
- Dénaturer les échantillons en mettant 2 min à 70 °C, puis conserver à 4°C
- Laver l’électrode en mettant 800 µL de solution de lavage dans la puce de lavage et en
l’insérant dans la machine pendant 2 min (ensuite vider et ranger la puce de lavage)
- Laver l’électrode 2 fois en mettant 800 µL d’eau dans la puce de rinçage et en l’insérant
dans la machine pendant 2 min (ensuite vider et ranger la puce de rinçage)
- Mettre 9 µL de gel marqué dans le trou gs orange d’une nouvelle puce. Attention à ne pas
faire de bulle et à ne pas toucher le fond !
- Initialiser la puce dans la machine en choisissant la pression et le temps indiqués en fonction
du type de puce.
149
Annexes
- Mettre 9 µL de gel marqué dans le trou gs jaune de la puce initialisée. Attention à ne pas
faire de bulle et à ne pas toucher le fond !
- Mettre 9 µL de gel NON marqué dans le trou G. Attention à ne pas faire de bulle et à ne pas
toucher le fond !
- Mettre 5 µL de loading buffer dans les puits 1 à 12 et le puit L.
- Mettre 1 µL d’échantillon dans les puits 1 à 12.
- Mettre 1 µL de ladder dans le puit L
- Mettre la plaque à vortexer
- Lire la plaque
- A la fin, ne pas oublier de refaire la procédure de nettoyage de l’électrode.
VII.
PROTOCOLE DE DOSAGE DES ARNS EN RIBOGREEN
- Préparer le tampon TE : 1 mL de TE20X + 19 mL d’eau
- Préparer la solution Ribogreen en la diluant 200 fois dans du tampon TE
- Préparer la solution mère d’ARN pour la gamme étalon : 1 aliquot de 2 µL à 1 µg/µL +
998 µL de TE (dilution au 500X)
- Si nécessaire, diluer les échantillons pour avoir des concentrations comprises entre 10 et
100 ng/µL
- Sur une plaque, faire 3 réplicas de gamme (0, 5, 10, 20, 40, 60, 80, 100 ng/100µL final dans
le puit)
- Déposer 50 µL d’échantillon avec 50 µL de solution Ribogreen.
- Mélanger et centrifuger quelques secondes à 2500 g
- Lire la plaque (le Ribogreen est équivalent au réglage Sybrgreen sur la machine)
150
Annexes
VIII.
PROTOCOLE DE RETROTRANSCRIPTION AVEC LE KIT
ISCRIPT ET L’ALIEN
- Effectuer les dilutions des échantillons pour avoir 10 µL à 70 ng/µL
- Dénaturer 5 min à 70°C et conserver dans la glace
- Procéder à la dilution de la solution mère en suivant les étapes suivantes. Mélanger 1 µL
d’alien stock avec 59 µL d’eau (Concentration finale 5*108 copies/µL). En prendre 10 µL et y
ajouter 90 µL d’eau. Recommencer avec la nouvelle dilution 3 fois pour avoir une
concentration finale de 5*104 copies/µL.
- Faire un mix avec 1 µL de RTase, 4 µL de buffer 5X, 3 µL d’eau et 2 µL d’alien dilué.
- Mettre 10 µL de MIX dans chaque échantillon
- Vortexer et centrifuger quelques secondes à 2500 g
- Procéder à une PCR avec les conditions suivantes : 5 min à 25°C, 45 min à 42°C, 5 min à
85°C et maintenir à 8°C.
IX.
PROTOCOLE D’INCLUSION EN RESINE POUR
OBSERVATIONS AU MET
Matériel nécessaire :
- éprouvettes
- béchers
- barreaux aimantés
- sorbonne
- gants
151
Annexes
- pH mètre
- pipettes automatiques
- pipettes pasteur
- capsules d’inclusion et moules
- étuve thermostatée
Produits :
- Na2HPO4 anhydrous : Acros Organics réf. : température ambiante
- NaH2PO4 2 H2O Prolabo réf. : 28015.294 température ambiante
- *Glutaraldéhyde 25% EM grade, distillation purified : EMS réf. : 16210 (réfrigérateur et
congélateur)
http://www.emsdiasum.com/microscopy/technical/msds/16200.pdf
- *Acétone : Sigma (armoire à solvant)
- *Osmium tetroxide 4% aqueous solution : EMS réf. : 19150 (Réfrigérateur)
http://www.emsdiasum.com/microscopy/technical/msds/19150.pdf
- *Résine Epon Kit Embed-812/DER73 EMS réf. : 14130 température ambiante
Précautions à prendre pour la manipulation et l’utilisation de ses différents produits :
* Ces produits sont dangereux, ils sont nocifs pour les voies respiratoires et sont irritants pour
la peau et peuvent causer de graves maladies, (voir les fiches de sécurité des produits).
Toutes les manipulations effectuées ci-dessous, ainsi que l’utilisation des différents produits
sont à faire sous sorbonne, le port de la blouse et des gants est obligatoire, ainsi que les
lunettes de protection.
Les déchets seront éliminés dans les différents containers correspondants aux produits.
152
Annexes
Produits à préparer :
Préparation du tampon phosphate 0.2 M pH 7.2: pour 100 mL
A - NaH2PO4 (2H2O), 0.2 M
3.12 g/100 mL
B – Na2HPO4, 0.2 M
2.84 g/100 mL
Mélanger 28 ml de A et 72 ml de B
Préparation du fixateur :
Concentration finale
Volume (10 ml)
Volume (50 ml)
Glutaraldéhyde 25%
2,5%
1
5
Tampon phosphate 0.2 M pH 7.2
0.1 M
5
25
4
20
Eau distillée
Faire le mélange des différents produits et mettre dans la glace.
Préparation de la résine EPON
DER 736
8 mL
EMbed 812
2 mL
NMA
8.9 mL
DMP 30
0.28 mL
- Mélanger les différents produits dans l’ordre avec un barreau aimanté, en les ajoutant les uns
après les autres. Conserver le mélange à 4°C. Sortir la résine à température ambiante avant de
l’utiliser, voir la mettre quelques minutes à l’étuve à 50 °C. Ne pas agiter trop fortement, il
faut éviter les bulles.
153
Annexes
- Une faible quantité de fixateur est déposée sur la zone à prélever, à l’aide d’une lame de
scalpel le matériel est découpé et plongé dans un tube contenant du fixateur à 4°C.
- Temps de la fixation 4 heures à 8 °C, un léger passage sous vide permet une meilleure
pénétration du fixateur.
- Lavage dans le tampon phosphate 0.1 M pH 7.2, plusieurs bains de 15 min. ou la nuit à 4°C,
puis le lendemain 3 lavages de 5 min.
- Postfixation avec le tetroxide d’osmium à 2% tamponné avec le tampon phosphate 0.1 M
pH 7.2 pendant une heure à 4°C.
- Lavage dans le tampon phosphate, 3 fois 5 min, puis dans l’eau distillée.
- Déshydratation dans des bains croissants d’acétone :
- 10% 15 min.
- 20% 15 min.
- 40% 15 min.
- 60% 15 min.ou la nuit
- 80% 15 min. ou la nuit
- 95% 20 min. X 2
- 100% 20 min. X3
- Imprégnation dans la résine. Si les échantillons restent à la surface, un léger passage sous
vide sera nécessaire, les temps sont indicatifs peuvent être diminués ou augmentés suivant les
échantillons. Pour les temps longs bien fermer les tubes et mettre à 4°C.
- 1/3 résine + 2/3 acétone 24 heures
- ½ résine + ½ acétone une journée
- ¾ résine + ¼ acétone une journée
- Résine pure une nuit
- Le lendemain la résine est remplacée par de la résine fraîche, laisser au moins ½ journée
puis inclure dans les capsules, ou des moules (éviter les bulles d’air, les retirer si il y en a).
154
Annexes
Mettre à polymériser à 60°C dans une étuve pendant 48 heures. Attendre que la résine
polymérisée revienne à température ambiante avant de démouler les échantillons.
155
RÉFÉRENCES
156
Références
Aasamaa K, Söber A. Responses of stomatal conductance to simultaneous changes in two
environmental factors. Tree physiology (2011) 31: 855-864.
Ainsworth EA, Yendrek CR, Sitch S, Collins WJ, Emberson LD. The effects of tropospheric
ozone on net primary productivity and implications for climate change. Annual Review of
Plant Biology (2012) 63: 637–61.
Asada K. Production and scavenging of reactive oxygen species in chloroplasts and their
functions. Plant physiology (2006) 141: 391-396.
Ashmore MR. Assessing the future global impacts of ozone on vegetation. Plant, Cell &
Environnement (2005) 28: 949-964.
Assmann SM, Snyder JA, Lee Y-RJ. ABA-deficient (aba1) and ABA-insensitisve (abi1-1, abi
1-2) mutants of Arabidopsis have a wild-type stomatal response to humidity. Plant, Cell &
Environment (2000) 23: 387–395.
Avnery S, Mauzerall D.L, Liu J, Horowitz L.W. Global crop yield reductions due to surface
ozone exposure: 1. Year 2000 crop production losses and economic damage. Atmospheric
environment (2011) 45: 2284-2296.
Bagard M, Le Thiec D, Delacote E, Hazenfratz-Sauder MP, Banvoy J, Gérard J, Dizengremel
P, Jolivet Y. Ozone-induced changes in photosynthesis and photorespiration of hybrid poplar
in relation to the developmental stage of the leaves. Physiologia Plantarum (2008) 134: 559–
574.
Ball JT, Woodrow IE, Berry JA. A model predicting stomatal conductance and its ontribution
to the control of photosynthesis under different environmental conditions. Progress in
Photosynthesis Research (ed. I. Biggins), Martinus Nijhoff Publishers, Netherlands. (1987)
221-224.
Boccalandro HE, Giordano CV, Ploschuk EL, Piccoli PN, Bottini R, Casal JJ. Phototropins
but not cryptochromes mediate the blue light-specific promotion of stomatal conductance,
while both enhance photosynthesis and transpiration under full sunlight. Plant physiology
(2012) 158: 1475-1484.
157
Références
Bienert GP, Moller ALB, Kristiansen KA, Schulz A, Moller IM, Schjoerring JK, Jahn TP.
Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes. Journal
of Biological Chemistry (2007) 282: 1183-1192.
Brunner AM, Busov VB, Strauss SH. Poplar genome sequence: functional genomics in an
ecologically dominant plant species. Trends in Plant Science (2004) 9: 49-56.
Bunce JA. Effects of humidity on short-term responses of stomatal conductance to an increase
in carbon dioxide concentration. Plant, Cell & Environment (1998) 21: 115-120.
Cabané M, Pireaux J-C, Leger E, Weber E, Dizengremel P, Pollet B, Lapierre C. Condensed
lignins are synthesized in poplar leaves exposed to ozone. Plant physiology (2004) 134: 586594.
Cape JN. Surface ozone concentrations and ecosystem health: Past trends and a guide to
future projections. Science of the Total Environment (2008) 400: 257-269.
Castagna A, Ranieri A. Detoxification and repair process of ozone injury: From O-3 uptake to
gene expression adjustment. Environmental Pollution (2009) 157: 1461-1469.
Cohen D, Bogeat-Triboulot M-B, Vialet-Chabrand S, Merret R, Courty P-E, Moretti S, Bizet
F, Guilliot A, Hummel I. Developmental and environmental regulation of aquaporin gene
expression across Populus species: Divergence or redundancy? PLoS ONE 8: e55506.
Damour G, Simonneau T, Cochard H, Urban L. An overview of models of stomatal
conductance at the leaf level. Plant, Cell & Environment (2010) 33: 1419-1438.
Danielsson H, Karlsson GP, Karlsson PE, Håkan P. Ozone uptake modelling and fluxresponse relationships--an assessment of ozone-induced yield loss in spring wheat.
Atmospheric Environment (2003) 37: 475-485.
Day ME. Influence of temperature and leaf-to-air vapor pressure deficit on net photosynthesis
and stomatal conductance in red spruce (Picea rubens). Tree Physiology (2000) 20: 57-63.
Del Rio LA, Sandalio LM, Corpas FJ, Palma JM, Barroso JB. Reactive oxygen species and
reactive nitrogen species in peroxisomes. Production, scavenging, and role in cell signaling.
Plant physiology (2006) 141: 330-335.
158
Références
Dghim AA, Dumont J, Hasenfratz-Sauder M-P, Dizengremel P, Le Thiec D, Jolivet Y.
Capacity for NADPH regeneration in the leaves of two poplar genotypes differing in ozone
sensitivity. Physiologia Plantarum (2012) doi: 10.1111/j.1399-3054.2012.01686.x.
Dickmann DI, Kuzovkina J. Poplars and willow of the world, with emphasis on silviculturally
important species. In: Isebrands JG, Richardson J Chapter 2 (eds) Poplars and willows in the
world: meeting the needs of society and the environment. FAO/IPC, Rome, Italy, (2008)
135p.
Dizengremel P. Effects of ozone on the carbon metabolism of forest trees. Plant physiology
and biochemistry (2001) 39: 729-742.
Dizengremel P, Le Thiec D, Bagard M, Jolivet Y. Ozone risk assessment for plants: Central
role of metabolism-dependent changes in reducing power. Environmental Pollution (2008)
156: 11-15.
Dizengremel P, Le Thiec D, Hasenfratz-Sauder MP, Vaultier MN, Bagard M, Jolivet Y.
Metabolic-dependent changes in plant cell redox power after ozone exposure. Plant Biology
(2009) 11: 35-42.
Dumont J, Spicher F, Montpied P, Dizengremel P, Jolivet Y, Le Thiec D. Effects of ozone on
stomatal responses to environmental parameters (blue light, red light, CO2 and vapour
pressure deficit) in three Populus deltoides x Populus nigra genotypes. Environmental
Pollution (2013) 173: 85-96.
Eckenwalder J. E. Systematics and evolution of Populus. In biology of Populus and its
implications for management and conservation. Part I, Chapter 1. Edité par Stettler R. F.,
Bradshaw H. D. Jr., Heilman P. E. et Hinckley T. M. NRC Research Press, National Research
Council of Canada, Ottawa, Canada. (1996) pp. 7-32.
Einig W, Lauxmann U, Hauch B, Hampp R, Landolt W, Maurer S, Matyssek R. Ozoneinduced accumulation of carbohydrates changes enzyme activities of carbohydrate
metabolism in birch leaves. New Phytologist (1997) 137: 673-680.
European Environment Agency, Spatial assessment of PM10 and ozone concentrations in
Europe (2005). EEA Technical report (2009) n°1 .
159
Références
Fischer RA. Stomatal opening: role of potassium uptake by guard cells. Science (1968) 160:
784-785.
Fiscus EL, Booker FL, Burkey KO. Crop responses to ozone: uptake, modes of action, carbon
assimilation and partitioning. Plant, Cell & Environment (2005) 28: 997-1011.
Foyer CH, Noctor G. Redox homeostasis and antioxidant signaling: A metabolic interface
between stress perception and physiological responses. (2005) 17: 1866-1875.
Fuhrer J, Skarby L, Ashmore MR. Critical levels for ozone effects on vegetation in Europe.
Environmental Pollution (1997) 97: 91-106.
Fuhrer J. Ozone risk for crops and pastures in present and future climates.
Naturwissenschaften (2009) 96: 173-194.
Galano A, Vargas R, Martinez A. Carotenoids can act as antioxidants by oxidizing the
superoxide radical anion. Physical Chemistry Chemical Physics (2010) 12: 193-200.
Galant A, Preuss ML, Cameron JC, Jez JM. Plant glutathione biosynthesis: diversity in
biochemical regulation and reaction products. Frontiers in Plant Science (2011) 2 :1-7.
Gerlier D, Plumet S, Herschke F. Dynamique de l’ARNome du virus de la rougeole.
Virologie (2007) 11: 231-245.
Gomi K, Ogawa D, Katou S, Kamada H, Nakajima N, Saji H, Soyano T, Sasabe M, Machida
Y, Mitsuhara I, et al. A mitogen-activated protein kinase NtMPK4 activated by SIPKK is
required for jasmonic acid signaling and involved in ozone tolerance via stomatal movement
in Tobacco. Plant & Cell Physiology (2005) 46: 1902–1914.
Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Miltros T, Dirks W,
Hellsten U, Putnam N et al. Phytozome: a comparative platform for green plant genomics.
Nucleic Acids Research (2012) 40: 1178-1186.
Griffith OW. Determination of glutathione and glutathione disulfide using glutathione
reductase and 2-vinylpyridine. Analytical Biochemistry (1980) 106: 207-212.
Grulke NE, Neufeld HS, Davison AW, Roberts M, Chappelka AH. Stomatal behavior of
ozone-sensitive and -insensitive coneflowers (Rudbeckia laciniata var. digitata) in Great
Smoky Mountains National Park. New Phytologist (2007) 173: 100-109.
160
Références
Häikiö E, Freiwald V, Julkunen-Tiitto R, Beuker E, Holopainen T, Oksanen E. Differences in
leaf characteristics between ozone-sensitive and ozone-tolerant hybrid aspen (Populus
tremula x Populus tremuloides) clones. Tree Physiology (2009) 29: 53-66.
Han R-M, Zhang J-P, Skibsted LH. Reaction dynamics of flavonoids and carotenoids as
antioxidants. Molecules (2012) 17: 2140-2160.
Hashimoto M, Negi J, Young J, Israelsson M, Schroeder JI, Iba K. Arabidopsis HT1 kinase
controls stomatal movements in response to CO2. Nature Cell Biology (2006) 8: 391-397.
Heath RL. Modification of the biochemical pathways of plants induced by ozone: What are
the varied routes to change? Environmental Pollution (2008) 155: 453-463.
Hopkins WG. Physiologie végétale--Université DB, ed. (2003).
Hu H, Boisson-Dernier A, Israelsson-Nordstrom M, Bohmer M, Xue S, Ries A, Godoski J,
Kuhn JM, Schroeder JI. Carbonic anhydrases are upstream regulators of CO2-controlled
stomatal movements in guard cells. Nature Cell Biology (2010) 12: 87-93; sup pp 81-18.
Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI. Early abscisic acid signal
transduction mechanisms: newly discovered components and newly emerging questions.
Genes & Development (2010) 24: 1695-1708.
Hubbard KE, Siegel RS, Valerio G, Brandt B, Schroeder JI. Abscisic acid and CO2 signalling
via calcium sensitivity priming in guard cells, new CDPK mutant phenotypes and a method
for improved resolution of stomatal stimulus–response analyses. Annals of Botany (2011) 113.
Imai K, Kobori K. Effects of the interaction between ozone and carbon dioxide on gas
exchange, ascorbic acid content, and visible leaf symptoms in rice leaves. Photosynthetica
(2008) 46: 387-394.
International Co-operative Programme Modelling & Mapping (ICP M&M). Modelling and
Mapping Manual of the LRTAP Convention. Chapter III Mapping Critical Levels for
Vegetation (2004) 114p.
International Co-operative Programme on Assessment and Monitoring of Air Pollution
Effects on Forests (ICP Forests). Manual on methods and criteria for harmonized sampling,
161
Références
assessment, monitoring and analysis of the effects of air pollution on forests. Part VIII.
Assessment of Ozone Injury. (2010)
IPCC In: Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller
HL (eds) Climate change 2007: the physical science basis. Contribution of working Group I
to the fourth assessment report of the Intergovernmental Panel on Climate Change.
Cambridge University Press, Cambridge, (2007) 996 pp.
Iriti M, Faoro F. Chemical diversity and defence metabolism: How plants cope with
pathogens and ozone pollution. International Journal of Molecular Sciences (2009) 10: 33713399.
Ishida H, Makino A, Mae T. Fragmentation of the large subunit of ribulose-1,5-bisphosphate
carboxylase by reactive oxygen species occurs near Gly-329. Journal of Biological Chemistry
(1999) 274: 5222-5226.
Iyer NJ, Tang Y, Mahalingam R. Physiological, biochemical and molecular responses to a
combination of drought and ozone in Medicago truncatula. Plant, Cell & Environment (2013)
36: 706-720.
Jarvis PG. The interpretation of the variations in leaf water potential and stomatal
conductance found in canopies in the field. Philosophical transactions of the Royal Society of
London. B, Biological Sciences (1976) 273: 593-610.
Journal officiel des Communautés européennes. Directive 2002/3/CE du parlement européen
et du conseil relative à l'ozone dans l'air ambiant. (2002) L67: 14-30.
Kampfenkel K, Van Montagu M, Inzé D. Extraction and determination of ascorbate and
dehydroascorbate from plant tissue. Analytical Biochemistry (1995) 225: 165-167.
Karlsson PE, Pleijel H, Belhaj M, Danielsson H, Dahlin B, Andersson M, Hansson M,
Munthe J, Grennfelt P. Economic assessment of the negative impacts of ozone on crop yields
and forest production. A case study of the estate Ostads Sateri in southwestern Sweden.
Ambio (2005) 34: 32-40.
Karlsson PE, Braun S, Broadmeadow M, Elvira S, Emberson L, Gimeno BS, Le Thiec D,
Novak K, Oksanen E, Schaub M, et al. Risk assessments for forest trees: The performance of
the ozone flux versus the AOT concepts. Environmental Pollution (2007) 146: 608-616.
162
Références
Karuppanapandian T, Moon J-C, Kim C, Manoharan K, Kim W. Reactive oxygen species in
plants: their generation, signal transduction, and scavenging mechanisms. Australian journal
of crop science (2011) 5: 709-725.
Kerstiens G, Lendzian K.J. Interactions between ozone
and plant cuticles. I. Ozone
deposition and permeability. New Phytologist (1989) 112: 13–19.
Kim TH, Bohmer M, Hu H, Nishimura N, Schroeder JI. Guard cell signal transduction
network: advances in understanding abscisic acid, CO2, and Ca2+ signaling. Annual Review
of Plant Biology (2010) 61: 561-591.
Kinoshita T, Doi M, Suetsugu N, Kagawa T, Wada M, Shimazaki K. Phot1 and phot2
mediate blue light regulation of stomatal opening. Nature (2001) 414: 656-660.
Kontunen-Soppela S. Riikonen J, Ruhanen H, Brosché M, Somervuo P, Peltonen P,
Kangasjärvi J, Auvinen P, Paulin L, Keinänen M, Oksanen E, Vapaavuori E. Differential
gene expression in senescing leaves of two silver birch genotypes in response to elevated CO2
and tropospheric ozone. Plant, Cell & Environment (2010) 33: 1016-1028.
Langebartels C, Wohlgemuth H, Kschieschan S, Grün S, Sandermann H. Oxidative burst and
cell death in ozone-exposed plants. Plant Physiology and Biochemistry (2002) 40: 567–575.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin
F, Wallace IM, Wilm A, Lopez R, et al. Clustal W and Clustal X version 2.0. Bioinformatics
(2007) 23: 2947-2948.
Lawson T. Guard cell photosynthesis and stomatal function. New Phytologist (2009) 181: 1334.
Lawson T, Oxborough K, Morison JI, Baker NR. Responses of photosynthetic electron
transport in stomatal guard cells and mesophyll cells in intact leaves to light, CO 2, and
humidity. Plant Physiology (2002) 128: 52-62.
Leuning R. Modelling stomatal behaviour and photosynthesis of Eucalyptus grandis.
Australian Journal of Plant Physiology (1990) 17: 159-175.
Leuning R. A critical appraisal of a combined stomatal-photosynthesis model for C3 plants.
Plant, Cell & Environment (1995) 18: 339-355.
163
Références
Lindroth RL. Impacts of elevated atmospheric CO2 and O3 on forests: phytochemistry,
trophic interactions, and ecosystem dynamics. Journal of Chemical Ecology (2010) 36: 2-21.
Linster CL, Clarke SG. L-Ascorbate biosynthesis in higher plants: the role of VTC2. Trends
in Plant Science (2008) 13: 567-573.
Lombardozzi D, Sparks JP, Bonan G, Levis S. Ozone exposure causes a decoupling of
conductance and photosynthesis: implications for the Ball-Berry stomatal conductance model.
Oecologia (2012) 169: 651-659.
Lu Z, Quiñones MA, Zeiger E. Temperature dependence of guard cell respiration and
stomatal conductance co-segregate in an F2 population of Pima cotton. Australian Journal of
Plant Physiology (2000) 27(5): 457-462.
Mao J, Zhang YC, Sang Y, Li QH, Yang HQ. From The Cover: A role for Arabidopsis
cryptochromes and COP1 in the regulation of stomatal opening. Proceedings of the National
Academy of Sciences of the United States of America (2005) 102: 12270-12275.
Marenco A. The troposheric ozone evolution during the XXth century. Lettre du Programme
International Géosphère Biosphère-Programme Mondial de Recherches sur le Climat (PIGBPMRC) (1994) n°1:10.
Marten H, Hyun T, Gomi K, Seo S, Hedrich R, Roelfsema MRG. Silencing of NtMPK4
impairs CO2-induced stomatal closure, activation of anion channels and cytosolic Ca2+ signals
in Nicotiana tabacum guard cells. The Plant Journal (2008) 55: 698-708.
Matyssek R, Le Thiec D, Low M, Dizengremel P, Nunn AJ, Haberle KH. Interactions
between drought and O3 stress in forest trees. Plant Biology (Stuttg) (2006) 8: 11-17.
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. Reactive oxygen gene network of
plants. Trends in Plant Science (2004) 9: 490-498.
Moller IM, Jensen PE, Hansson A. Oxidative modifications to cellular components in plants.
Annual Review of Plant Biology (2007) 58: 459-481.
Mott KA. Opinion: Stomatal responses to light and CO2 depend on the mesophyll. Plant, Cell
& Environment (2009) 32: 1479-1486.
164
Références
Musselman RC, Lefohn AS, Massman WJ, Heath RL. A critical review and analysis of the
use of exposure- and flux-based ozone indices for predicting vegetation effects. Atmospheric
Environment (2006) 40: 1869-1888.
Nishizawa A, Yabuta Y, Shigeoka S. Galactinol and raffinose constitute a novel function to
protect plants from oxidative damage. Plant Physiology (2008) 147: 1251-1263.
Noctor G. 2006. Metabolic signalling in defence and stress: the central roles of soluble redox
couples. Plant, Cell & Environment 29: 409-425.
Noctor G, Mhamdi A, Chaouch S, Han Y, Neukermans J, Marquez-Garcia B, Queval G,
Foyer CH. Glutathione in plants: an integrated overview. Plant, Cell & Environment (2012)
35: 454-484.
Noe SM, Giersch C. A simple dynamic model of photosynthesis in oak leaves: coupling leaf
conductance and photosynthetic carbon fixation by a variable intracellular CO2 pool.
Functional Plant Biology (2004) 31: 1196-1204.
Outlaw WH, Manchester J. Guard cell starch concentration quantitatively related to stomatal
aperture. Plant Physiology (1979) 64: 79-82.
Pandey S, Zhang W, Assmann SM. Roles of ion channels and transporters in guard cell signal
transduction. FEBS (2007) 581: 2325-2336.
Paoletti E. Ozone slows stomatal response to light and leaf wounding in a Mediterranean
evergreen broadleaf, Arbutus unedo. Environmental Pollution (2005) 134: 439-445.
Paoletti E, Grulke NE. Ozone exposure and stomatal sluggishness in different plant
physiognomic classes. Environmental Pollution (2010) 158: 2664-2671.
Pleijel H, Danielsson H, Vandermeiren K, Blum C, Colls J, Ojanperä K. Stomatal
conductance and ozone exposure in relation to potato tuber yield—results from the European
CHIP programme European Journal of Agronomy (2002) 17: 303-317.
Renaut J, Bohler S, Hausman JF, Hoffmann L, Sergeant K, Ashan N, Jolivet Y, Dizengremel
P. The impact of atmospheric composition on plants: a case study of ozone and poplar. Mass
Spectrometry Reviews (2009) 28: 495-516.
165
Références
Rhoads DM, Umbach AL, Subbaiah CC, Siedow JN. Mitochondrial reactive oxygen species.
Contribution to oxidative stress and interorganellar signaling. Plant physiology (2006) 141:
357-366.
Rice-Evans CA, Miller J, Paganga G. Antioxidant properties of phenolic compounds. Trends
in Plant Science (1997) 2: 152-159.
Rosa M, Prado C, Podazza G, Interdonato R, Gonzalez JA, Hilal M, Prado FE. Soluble sugars
- Metabolism, sensing and abiotic stress. Plant Signaling & Behavior (2009) 4: 388-393.
Saleem A, Loponen J, Pihlaja K, Oksanen E. Effects of long-term open-field ozone exposure
on leaf phenolics of European silver birch (Betula pendula Roth). Journal of Chemical
Ecology (2001) 27: 1049-1062.
Saviranta NMM, Julkunen-Tiitto R, Oksanen E, Karjalainen RO. Leaf phenolic compounds in
red clover (Trifolium pratense L.) induced by exposure to moderately elevated ozone.
Environmental Pollution (2010) 158: 440-446.
Sitch S, Cox PM, Collins WJ, Huntingford C. Indirect radiative forcing of climate change
through ozone effects on the land-carbon sink. Nature (2007) 448: 791-794.
Stevenson DS, Dentener FJ, Schultz MG, Ellingsen K, Van Noije TPC, Wild O, Zeng G,
Amann M, Atherton CS, Bell N, et al. Multimodel ensemble simulations of present-day and
near-future tropospheric ozone. Journal of Geophysical Research (2006) 111: D08301.
Tausz M, Grulke NE, Wieser G. Defense and avoidance of ozone under global change.
Environmental Pollution (2007) 147: 525-531.
Tuzet A, Perrier A, Loubet B, Cellier P. Modelling ozone deposition fluxes: The relative roles
of deposition and detoxification processes. Agricultural and Forest Meteorology (2011) 151:
480–492.
Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG.
Primer3-new capabilities and interfaces. Nucleic Acids Research (2012) 40: 1-12.
U.S. EPA. Air quality criteria for ozone and related photochemical oxidants (2006 FINAL).
U.S. Environmental Protection Agency, Washington, DC, EPA/600/R-05/004aF-cF, 2006.
166
Références
Vahisalu T, Puzõrjova I, Brosché M, Valk E, Lepiku M, Lindgren O, Moldau H, Pechter P,
Wang Y-S, Salojärvi J, et al. Ozone-triggered rapid stomatal response involves production of
reactive oxygen species and is controlled by SLAC1 and OST1. The Plant Journal (2010)
62(3): 442–453.
Valluru R, Van den Ende W. Myo-inositol and beyond - Emerging networks under stress.
Plant Science (2011) 181: 387-400.
Vingarzan R. A review of surface ozone background levels and trends. Atmospheric
Environment (2004) 38: 3431-3442.
Vlachokostas C, Nastis SA, Achillas C, Kalogeropoulos K, Krmiris I, Moussiopoulos N,
Chourdakis E, Banias G, Limperi N. Economic damages of ozone air pollution to crops using
combined air quality and GIS modelling. Atmospheric Environment (2010) 44: 3352-3361.
Vollenweider P, Ottiger M, Günthardt-Goerg M.S. Validation of leaf ozone symptoms in
natural vegetation using microscopical methods. Environmental Pollution (2003) 124: 101118.
Wang FF, Lian HL, Kang CY, Yang HQ. Phytochrome B is involved in mediating red lightinduced stomatal opening in Arabidopsis thaliana. Molecumar Plant (2010) 3: 246-259.
Wang Y, Noguchi K, Terashima I. Distinct light responses of the adaxial and abaxial stomata
in intact leaves of Helianthus annuus L. Plant, Cell & Environment (2008) 31: 1307-1316.
Wang Y, Noguchi K, Terashima I. Photosynthesis-dependent and -independent responses of
stomata to blue, red and green monochromatic light: differences between the normally
oriented and inverted leaves of sunflower. Plant & Cell Physiology (2011) 52: 479-489.
Wellburn, A.R. The spectral determination of chlorophylls a and b, as well as total
carotenoids, using various solvents with spectrophotometers of different resolution. Journal of
Plant Physiology (1994) 144: 307–313.
White DA, Beadle C, Sands PJ, Worledge D, Honeysett JL. Quantifying the effect of
cumulative water stress on stomatal conductance of Eucalyptus globulus and Eucalyptus
nitens: a phenomenological approach. Australian Journal of Plant Physiology (1999) 26: 1727
167
Références
Wieser G, Matyssek R. Linking ozone uptake and defense towards a mechanistic risk
assessment for forest trees. New Phytologist (2007) 174: 7-9.
Wilkinson S, Mills G, Illidge R, Davies W.J. How is ozone pollution reducing our food
supply? Journal of Experimental Botany (2011) 63: 527-536.
Wilson RC, Fleming ZL, Monks PS, Clain G, Henne S, Konovalov IB, Szopa S, Menut L.
Have primary emission reduction measures reduced ozone across Europe? An analysis of
European rural background ozone trends 1996–2005. Atmospheric Chemistry and Physics
(2012) 12: 437-454.
Wittig VE, Ainsworth EA, Long SP. To what extent do current and projected increases in
surface ozone affect photosynthesis and stomatal conductance of trees? A meta-analytic
review of the last 3 decades of experiments. Plant, Cell & Environment (2007) 30: 11501162.
Wittig VE, Ainsworth EA, Naidu SL, Karnosky DF, Long SP. Quantifying the impact of
current and future tropospheric ozone on tree biomass, growth, physiology and biochemistry:
a quantitative meta-analysis. Global Change Biology (2009) 15: 396-424.
Wojtaszek P. Oxidative burst : an early plant response to pathogen infection. Biochemistry
journal (1997) 322: 681-692.
Xie X, Wang Y, Williamson L, Holroyd GH, Tagliavia C, Murchie E, Theobald J, Knight
MR, Davies WJ, Ottoline Leyser HM, et al. The identification of genes involved in the
stomatal response to reduced atmospheric relative humidity. Current Biology (2006) 16: 882–
887.
Xue S, Hu H, Ries A, Merilo E, Kollist H, Schroeder JI. Central functions of bicarbonate in
S-type anion channel activation and OST1 protein kinase in CO(2) signal transduction in
guard cell. The Embo Journal (2011) 1-14.
Yip M. Ozone in the atmosphere. Environmental Physics (2000) Lettner VO 437-503
Yong JWH, Wong SC, Farquhar GD. Stomatal responses to changes in vapour pressure
difference between leaf and air. Plant, cell & Environment (1997) 20: 1213-1216.
168
Références
Zeiger E, Talbott LD, Frechilla S, Srivastava A, Zhu JX. The guard cell chloroplast: a
perspective for the twenty-first century. New Phytologist (2002) 153: 415-424.
169
Rôle de la régulation stomatique et de la capacité de détoxication foliaire
dans l’estimation d’un seuil de risque à l’ozone pour la végétation
Résumé :
L’ozone troposphérique est un polluant atmosphérique majeur qui agit comme une phytotoxine. Il
pénètre dans les feuilles par les stomates avant d’être dissout dans l’apoplaste en générant des
radicaux libres oxygénés (ROS) provoquant ainsi un stress oxydatif. Deux barrières existent pour
restreindre les effets de l'ozone : (i) les stomates qui peuvent limiter les flux entrants par contrôle
de la conductance stomatique et (ii) le système de détoxication des ROS issus de la dégradation de
l'ozone. Nous avons étudié les effets de l’ozone (120 ppb) sur ces deux moyens de défense chez
trois génotypes de peuplier euraméricain (Populus deltoides x Populus nigra) placés en conditions
contrôlées dans des chambres phytotroniques. Un effet direct de l’ozone sur la photosynthèse et
sur les mouvements stomatiques en réponse à des variations de facteurs environnementaux
(ralentissement des phénomènes d'ouverture et de fermeture) a été mis en évidence. Les modèles
de calcul de la conductance stomatique, sur lesquels se basent les indicateurs de seuil de risque à
l’ozone pour la végétation, doivent donc les prendre en compte. De plus, ces travaux ont mis en
évidence le rôle prépondérant des concentrations constitutives en antioxidants dans la tolérance à
l'ozone ainsi que la complexité de ces mécanismes de détoxication. La notion de flux effectif
d'ozone doit prendre en considération ces deux aspects afin de caractériser au mieux les
différences de sensibilité à l’ozone intra et inter spécifique.
Mots clés : Ozone, peuplier, détoxication, conductance stomatique
Role of stomatal regulation and capacity of foliar detoxification in the
estimation of ozone critical level for vegetation
Abstract :
Tropospheric ozone is a major air pollutant that acts as a phytotoxin. It enters the leaf through the
stomata before being dissolved in the apoplast by generating reactive oxygen species (ROS)
causing oxidative stress. Two defenses exist to restrict the effects of ozone: (i) the stomata which
can limit ozone uptake by regulating stomatal conductance and (ii) the detoxification processes of
ROS generated by ozone.We studied the effects of ozone (120 ppb) on these two mechanisms of
defense in three euramerican poplar genotypes (Populus deltoides x Populus nigra) under
controlled conditions in phytotronic chambers. A direct effect of ozone on photosynthesis and
stomatal movements in response to changes in environmental factors (by slowing the stomatal
opening and closure) has been highlighted. Models of stomatal conductance, on which indicators
of critical level of ozone for vegetation are based, must take them into account. In addition, these
studies have highlighted the role of constitutive concentrations of antioxidants in tolerance to
ozone as well as the complexity of these detoxification mechanisms. The notion of effective
ozone flux must consider these two aspects to better characterize the intra-and inter-specific
differences in sensitivity to ozone.
Keywords: Ozone, poplar, detoxification, stomatal conductance
Cette thèse cofinancée par l’ANR VULNOZ et la région Lorraine a été effectuée au sein de l’UMR 1137 –
Ecologie et Ecophysiologie Forestières. INRA, UMR1137 EEF, F-54280 Champenoux. Université de Lorraine,
UMR1137 EEF, F-54500 Vandoeuvre-lès-Nancy.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising