Téléchargement du livret de l`atelier - MeetOchondrie

Téléchargement du livret de l`atelier - MeetOchondrie
Réseau
meet chondrie
GDR 3159
http://meetochondrie.ibgc.cnrs.fr
Atelier
Techniques d’investigation appliquées au diagnostic
des pathologies mitochondriales
Institut Cochin – Paris
17-19 Octobre 2013
Accueil 3ème étage Faculté de Médecine - pièce 3529
PLANNING - Atelier MeetOchondrie
"Techniques d'investigation appliquées au diagnostic des
pathologies mitochondriales"
Paris 17-19 octobre 2013
GDR 3159 CNRS "Réseau MeetOchondrie"
Jeudi 17
De 8h30
à 12h30
12h3014h
Vendredi 18
A:
Mise en place gr
(intervenants) 1
Accueil des
participants
–
Plateau repas
De 14h
à 18h
Exposés
théoriques
De 19h
à 20h30
Dîner
FIAP
B:
gr
2
C:
gr
3
Samedi 19
8h00
D:
gr
4
A:
gr
3
Plateau repas
A:
gr
2
B:
gr
1
C:
gr
4
D:
gr
3
B:
gr
4
C:
gr
1
D:
gr
2
Plateau repas
12h-13h
reprise à 13h !
A:
gr
4
B:
gr
3
C:
gr
2
D:
gr
1
Fin à 17h00 !
Dîner
FIAP
4 groupes de participants : 1, 2, 3, 4
4 ateliers : A, B, C, D
A : Respiration cellulaire (N. Gueguen, C. Wetterwald)
Pièce 3012
B : Activités des complexes respiratoires (C. Rocher, S. Allouche)
Pièce 3512
C : Quantification de l'ADNmit (B. Mousson de Camaret, V. Desquiret) Pièce 3012
D : Analyse histologique de la chaîne respiratoire (A. Lombès, V. Lenoir) Pièce 3514
LISTE DES PARTICIPANTS
ABRIAL
Maryline
maryline_abrial_1@hotmail.com
Lyon
gr1
BONY-GARAYT
Claire
claire.bony@inserm.fr
Montpellier
gr1
CORTI
Olga
olga.corti@upmc.fr
Paris
gr1
CROCHEMORE
Clément
clement.crochemore2@univ-rouen.fr
Rouen
gr1
DALOYAU
Marlène
marlene.daloyau@univ-tlse3.fr
Toulouse
gr2
DUROUX-RICHARD
Isabelle
isabelle.richard@inserm.fr
Montpellier
gr2
HARDONNIERE
Kévin
kevin.hardonniere@univ-rennes1.fr
Rennes
gr2
HOET
Delphine
delphine.hoet@sanofi.com
Vitry-sur-Seine
gr2
LAMBERT
Mireille
mireille.lambert@inserm.fr
Paris
gr3
MAHMUDI
Nasire
nasire.mahmudi@sanofi.com
Chilly-Mazarin
gr3
MALGOYRE
Alexandra
alexandra.malgoyre@irba.fr
Brétigny-sur-Orge
gr3
PANOZZO
Cristina
panozzo@cgm.cnrs-gif.fr
Gif-sur-Yvette
gr3
PECQUEUR-HELLMAN
Claire
claire.pecqueur@univ-nantes.fr
Nantes
gr4
RENVOISE
Margaux
margaux.renvoise@cea.fr
Gif-sur-Yvette
gr4
ROUBERT
Christine
christine.roubert@sanofi.com
Montpellier
gr4
ZOUYENE
Nidya
nidya.zouyene@sanofi.com
Toulouse
gr4
ENCADRANTS
Noms
Email
Naig Gueguen
Céline Wetterwald
NaGueguen@chu-angers.fr
CeWetterwald@chu-angers.fr
Christophe Rocher
Stéphane Allouche
crocher@u-bordeaux2.fr
allouche-s@chu-caen.fr
Bénédicte Mousson de Camaret
Valérie Desquiret
benedicte.mousson-de-camaret@chu-lyon.fr
VaDesquiret@chu-angers.fr
Anne Lombès
Véronique Lenoir
anne.lombes@inserm.fr
veronique.lenoir@inserm.fr
ATELIER
A
Respiration cellulaire : analyse de la chaîne
respiratoire par oxygraphie
Naig GUEGUEN et Céline WETTERWALD
Pièce 3012
ANALYSE DE LA CHAINE RESPIRATOIRE PAR
OXYGRAPHIE
(FIBROBLASTES PERMEABILISES)
1 : Objet
Ce Mode Opératoire explique comment analyser les respirations maximales liées aux différents
segments (complexes) de la chaîne respiratoire sur fibroblastes perméabilisés.
Cette Analyse se fait sur oxygraphe Oroboros (02k).
La perméabilisation des fibroblastes se fait selon le protocole de Greco et al., 1996 ; le tampon de
respiration et les concentrations en substrats correspondent à ceux de Rustin et al., 1994.
2 : Rappels généraux
La phosphorylation oxydative :
La chaîne respiratoire transfère les électrons du NADH (à partir du complexe I) ou du FADH
(complexe II / ETF) à l’oxygène.
La membrane interne est imperméable au NADH et au FADH2. Le pouvoir réducteur interne ne peut
donc venir que du métabolisme matriciel (navettes, oxydation du pyruvate, cycle de Krebs) alimenté
par des substrats externes spécifiques.
Le transfert des électrons par la chaîne respiratoire est couplé à un transport vectoriel de protons.
Dans les mitochondries intactes, ceci s’accompagne de la formation d’une différence
transmembranaire de potentiel électrochimique du proton appelée plus simplement force protomotrice.
Celle-ci freine le flux d’électrons qui lui donne naissance, c’est le contrôle respiratoire.
A l’état stationnaire, le flux actif transmembranaire de protons (transfert par la chaîne respiratoire) est
égal au flux passif (retour vers la matrice mitochondrial). Ce dernier est dû à des fuites de protons et à
la synthèse d’ATP. A l’équilibre synthèse/hydrolyse d’ATP, par exemple en absence d’ADP, il n’y a
pas de flux net de protons associé à la synthèse d’ATP, mais simplement à la fuite de protons. La
force protomotrice est maximale et la chaîne respiratoire est freinée au maximum : c’est l’état 4. Si l’on
ajoute de l’ADP, on déplace l’équilibre et la synthèse d’ATP démarre, ce qui diminue la force
protomotrice et accélère le flux respiratoire : c’est l’état 3. La synthèse d’ATP s’arrête lorsque
l’équilibre est à nouveau atteint (nouvel état 4), par exemple après inhibition de l’ATP synthase par de
l’oligomycine. On a alors à nouveau une forte valeur de la force protomotrice et une faible valeur du
flux respiratoire. Enfin, si l’on ajoute un découplant qui rend la membrane perméable aux protons, (tel
que le FCCP), la force protomotrice s’effondre et la respiration s’emballe pour attendre son niveau
maximum pour un substrat donné.
Les apports en substrats :
Complexe I, malate + pyruvate :
Le pyruvate permet l’aprrovisionnement
Du cycle de Krebs en acetylCoA.
Cette décarboxylation est dépendante de l’activité
De la PDH.
L’entré de malate s’effectue contre la sortie d’
oxoglutarate et citrate (transporteur dicarboxylate),
« by-passant » ainsi la formation
de succinate, et donc le complexe II.
Complexe I, malate + pyruvate + glutamate :
Le glutamate permet également le fonctionnement
du cycle de Krebs. Son entrée n’est pas contrôlée
par la PDH, par contre, elle est dépendante du
potentiel de membrane.
Complexe I + II, malate + pyruvate + succinate :
En présence de succinate, le cycle de Krebs
reprend avant le complexe II, les complexes
I et II peuvent oxyder leur substrat et le cycle
est pratiquement complet.
L’ajout de roténone inhibe le complexe I.
L’accumulation de NADH en résultant entraîne
une accumulation d’acétylCoA qui inhibe la PDH.
Le succinate entre en échange de Pi.
L’analyse par oxygraphie :
L’analyse par oxygraphie permet de mesurer la consommation d'oxygène à l'aide d'une électrode de
Clark. Sur cellules perméabilisées ou mitochondries isolées, l’apport en substrats à la chaîne
respiratoire peut être contrôlé afin de cibler les différents états respiratoires et les différents complexes
de la chaîne et tester ainsi les respirations maximales liées aux différents complexes.
Cependant, les résultats ont montré que, dans la plupart des cas, la manifestation phénotypique de
l'anomalie génétique se produit lorsqu'un seuil est dépassé, et ce phénomène a été nommé «l'effet de
seuil phénotypique » (pour revue, cf Rossignol et al., 2003). Ceci signifie qu’il est parfois possible
d'inhiber considérablement l'activité d'un complexe de la chaîne respiratoire, jusqu'à une valeur
critique, sans affecter la vitesse de respiration maximale ou la synthèse d'ATP. Ce phénomène est
appelé «effet de seuil biochimique ». Ceci est en particulier le cas pour le complexe IV (cytochrome
oxidase), dernier complexe de la chaîne respiratoire et dont l’activité est donc en excès par rapport à
celle des autres complexes.
Ces effets de seuil peuvent être très différents d’un tissu à l’autre (ex. muscle versus fibroblastes pour
le complexe IV, muscle ou fibroblastes versus foie pour le complexe I), et très différents également en
fonction de la mutation impliquée (par exemple, les mutations dans des sous-unités du complexe I
impliquées dans la translocation de protons ne modifie que peu l’activité catalytique de l’enzyme
isolée, mais conduisent généralement à une diminution de la consommation d’oxygène).
D’autre part, les études oxygraphiques peuvent permettent de détecter non seulement des déficits de
la phosphorylation oxydative, mais également des déficits en pyruvate déshydrogénase, en enzyme
du cycle de Krebs…toutes ces anomalies conduisant à une diminution de la production des
équivalents réduits utilisés par la mitochondrie.
2 : Préparation des réactifs
2-A) Liste et référence des réactifs :
- ADP
- Antimycine A
- Ascorbate
- Azide
- BSA
- Cytochrome c
- Digitonine
- FCCP
- Glutamate
- KCl
- KCN
- KH2PO4
- Malate
- Mannitol
- MgCl2
+
- NAD
- Oligomycine
- Pyruvate
- Roténone
- Succinate
- TMPD
SIGMA, A7699
SIGMA, A8674
SIGMA, A7631.
SIGMA, S2002
SIGMA, A6003
SIGMA, C7752
SIGMA, D141
SIGMA, C2920
SIGMA, G1251
SIGMA, P3911
SIGMA, 20781-0
SIGMA, P9791
SIGMA, M1000
SIGMA, M9647
SIGMA, M1028
ROCHE, 10127965001
SIGMA, O4876
SIGMA, P5280
SIGMA, R8875
SIGMA, S3674
SIGMA, T7394
2-B) Périodicité :
La solution mère de respiration est stable trois mois à 4°C, le tampon de respiration contenant de la
BSA est stable 1 mois.
Les substrats et inhibiteurs se préparent tous les trois mois, exceptés le KCN, le FCCP, l'antimycine A
et l'oligomycine à préparer tous les mois.
Tous les inhibiteurs dilués dans l’éthanol sont à conserver en tubes à bouchon à vis avec joint pour
éviter toute fuite ou évaporation.
2-C) Tampon de respiration
Tampon de respiration sans BSA :
- KH2PO4
10 mM
- Mannitol
300 mM
- KCl
10 mM
- MgCl2
5 mM
Ajuster le pH à 7.4 avec du KOH
conservation 3 mois à 4°C.
qsp 500 ml
681 mg
2733 mg
373 mg
2.50 ml
Tampon de respiration + BSA :
- BSA
1 mg/ml
QSP 50 ml de tampon Rustin sans BSA
conservation 1 mois à 4°C.
50 mg
2-D) Préparation des substrats et inhibiteurs :
à diluer dans l'H2O milliQ, sauf cas spécifiques indiqués.
- Pyruvate
0,5 M
- Malate
0,5 M
- Glutamate
0,5 M
- Succinate
0,5 M
- Cytochrome c 320 µM
- Roténone
2,5 mM
- FCCP
1 mM
- Oligomycine 8 mg/ml
- Antimycine A 1 mg/ml
- KCN
- Azide
200 mM
100 mM
stabilité 3 mois à -20°C
amener à pH 7 avec du KOH, stabilité 3 mois à -20°C
amener à pH 7 avec du KOH, stabilité 3 mois à -20°C
amener à pH 7 avec du KOH, stabilité 3 mois à -20°C
aliquoter en 120 µl, stabilité 3 mois à -20°C
diluer dans l'EtOH 100, conservation 3 mois à -20°C
ème
diluer au 1/40
la solution mère, conservation 1 mois à
-20°C
diluer dans l’EtOH, stabilité 1 mois à -20°C
diluer dans l'éthanol à partir de la solution mère à 10
mg/ml, stabilité : 1 mois à -20°C
stabilité 1 mois à -20°C
stabilité 1 mois à -20°C
A préparer le jour même :
- ADP
0,15 M
- Ascorbate
- NAD
+
- Digitonine
0,4 M
50 mM
5 mg/ml
- TMPD (cellules) 20 mM
Stabilité : 1 jour à 4°C
diluer dans l’eau au dernier moment.
Stabilité : 10 minutes une fois repris
Stabilité : 1 jour à 4°C
Peser dans un cryotube à joint, pas plus de 3 mg
Préparer le jour même, diluer dans l’eau.
Chauffer à 95°C pendant 2 minutes 30.
Stabilité : ½ journée à température ambiante
Chauffer à 37°C à l’avance.
Stabilité : ½ journée
Exceptionnellement :
- Palmytoylcarnitine
- Octanoylcarnitine
20 mM
20 mM
diluer dans ½ EtOH, ½ eau, stabilité 1 mois à -20°C
diluer dans ½ EtOH, ½ eau. stabilité 1 mois à -20°C
Aliquoter les différents substrats pour chaque jour de manipulation, et conserver à -20°C.
Ne pas recongeler les aliquots.
3 : Préparation du matériel
3-A) Précautions particulières :
Pendant les oxygraphies, porter des gants nitriles : Les inhibiteurs de la chaîne respiratoire sont
des toxiques !
3-B) Automate et/ou petits matériels :
-
Oxygraphe O2K
Block chauffant (Bain-sec) Bioblock
Agitateur à bascule bioblock
3-C) Préparation des réactifs :
Equilibrer les tampons de respiration sans et avec BSA à température ambiante.
Sortir à l'avance et conserver sur la glace :
Substrats : malate 0.5M,
pyruvate 0.5M,
succinate 0.5M
glutamate 0.5M
Inhibiteurs : Roténone 2.5 mM,
antimycine 1 mg/ml,
oligomycine, 8 mg/ml,
KCN 0.2 M,
Azide 100 mM,
FCCP 1 mM
Allumer le bloc chauffant à 95°C.
3 : Calibration des oxygraphes :
Allumer l’ordinateur puis l’oxygraphe. Quand tous les voyants sont allumés, double cliquer sur
l’icône « Datlab 4 ».
La fenêtre « oxygraph setup » doit s’ouvrir directement, sinon F7 (cette touche permet à tout
moment de connecter/déconnecter l’oxygraphe). Sélectionner le type d'analyse désiré :
37°C, agitation à 750 rpm (pour cellules ou mitochondries isolées). Cliquer sur
« connect ».
La fenêtre "Edit Experiment" apparaît : Vérifier les facteurs A0 et B0 renseignés et corrigés
ci-besoin (cf fiche de maintenance des oxygraphes).
Vider les chambres et les laver à l'EtOH 100. Rincer ensuite soigneusement à l’eau bidistillée
puis remplir les chambres de 2 ml de tampon Respiration sans BSA. Fermer
complètement les chambres et ajouter 100 µl de solution saturée en dithionite pour
obtenir le 0% oxygène. Quand le flux est stable, rincer soigneusement l'oxygraphe à l'eau
distillée puis ajouter 1.9 ml de tampon Rustin + BSA. Laisser le flux se stabiliser
chambres ouvertes pour obtenir le 100%.
Faire une marque au 100 % O2 (sur une zone où le flux est stable) en appuyant sur shift + clic
gauche sur la souris et faire glisser la souris jusqu’à la taille de marque désirée. Marquer
de la même façon le zéro. Cliquer en haut sur la marque pour la nommer (100 ou 0).
F5 pour effectuer la calibration.
- la chambre active (sur laquelle va s’effectuer la calibration) est celle en blanc, où
apparaît le logo Oroboros.
- Air calibration : rentrer le nom de la marque correspondant au 100 % O2.
- Zéro calibration : rentrer le nom de la marque du zéro. Le voltage correspondant, la
température et la pression en oxygène doivent s’afficher automatiquement.
- O2 solubility factor of medium : à 37°C, 0.834 pour le tampon Rustin (toutes les
valeurs en fonction de la température sont indiquées dans la table « oxygen
solubility in experimental media » du manuel Oroboros).
- Cliquer sur Calibrate.
- Sélectionner la deuxième chambre en cliquant dessus, puis recommencer la même
opération (F5).
- Dans l'onglet en bas de l'écran, choisir "flux per volume corrected".
4 : Préparation des cellules : A température ambiante !
Chauffer la digitonine diluée dans l'eau à 95°C pendant 2 minutes 30, agiter et la laisser
refroidir à température ambiante.
Trypsiner les cellules (3 à 5 millions de cellules par oxygraphie, en double, soit 2 T75), Stopper
la trypsine avec du PBS-5 % SVF, compter et centrifuger à 800 rpm, 5 minutes. Retirer le PBSSVF, et conserver les cellules en culot sec.
6
Reprendre le culot sec cellulaire avec 50 µl/10 cellules de tampon de respiration – BSA.
6
Ajouter 15 µg (soit 3 µl) de digitonine par 10 cellules ; incuber sous agitation douce (agitateur
à bascule) pendant 2 minutes 30.
Ajouter QSP 4 volumes de tampon de respiration + BSA.
Centrifuger à 800 g, pendant 2 minutes 30.
Reprendre les cellules dans 200 µl de tampon de respiration + BSA.
5 : Oxygraphie
Cliquer sur F7 pour déconnecter/ reconnecter l’oxygraphe. Sélectionner le type d'analyse désiré
: 37°C (pour cellules ou mitochondries isolées). Cliquer sur « connect ».
La fenêtre "Edit Experiment" apparaît : Indiquer le nom du patient dans l'onglet titre, puis le
nombre de cellules, le tampon utilisé…
Injecter les 200 µl de suspension cellulaire dans la cuve, adapter le capuchon doucement et
vérifier l'absence de bulles dans la chambre.
Ajouter 10 µl de pyruvate (2.5 mM) puis 20 µl de Malate (5 mM). (substrats du complexe I)
Attendre 2-3 minutes au moins la stabilisation du flux (ligne rouge).
+
Introduire 20 µl de NAD (0.50 mM) puis 20 µl d'ADP (1.50 mM). Attendre d’obtenir un plateau
pour le flux. (activation de la phosphorylation)
Ajouter 25 µl de cytochrome c (4 µM). Attendre d’obtenir un plateau pour le flux. (intégrité
membranaire)
Ajouter 20 µl de glutamate (5 mM). Attendre la stabilisation du flux (ligne rouge). (complex I)
Introduire 40 µl de succinate (10 mM). Attendre d’obtenir un plateau pour le flux. (complexe II)
Introduire 4 µl de roténone (5 µM). Attendre d’obtenir un plateau pour le flux. (inhibition du
complexe I)
Ajouter 2 µl d’oligomycine (8 µg/ml). Attendre d’obtenir un plateau pour le flux. (inhibition ATP
synthase)
Ajouter 2 µl de FCCP (1 µM). Attendre d’obtenir un plateau pour le flux. (découplant)
Introduire 4 µl d'Antimycine (2 µg/ml). Attendre d’obtenir un plateau pour le flux. (inhibition du
complexe III)
Introduire 20 µl d'Ascorbate (4 mM), dès que le flux est stable, ajouter 20 µl de TMPD (0.3 mM).
(complexe IV).
Dès que le flux est stable, Introduire 20 µl de KCN (2 mM), et 20 µl d'Azide (1 mM). Attendre
d’obtenir un plateau pour le flux. (inhibition du complexe IV)
A la fin de la séquence, prélever 4x400 µl dans chaque chambre et placer dans un tube
Eppendorf pour le dosage des protéines par la méthode PRBCA (voir BIO-9014-0147:
dosage des protéines par la méthode B.C.A.).
Rincer les cuves (eau puis éthanol 100) et remettre 2 ml d'EtOH 100. Rincer soigneusement les
bouchons avec de l’eau puis de l'EtOH 100 et les laisser sur les chambres pour éviter
l'évaporation de l'EtOH.
Centrifuger les aliquots prélevés, 1 minute à 16000g. Retirer le surnageants et laver le culot
avec du NaCl 0,9% vol/vol. Doser ensuite les protéines sur les différents aliquots. Si le disage
ne peut être réalisé immédiatement, congeler à -20°C.
6 : Analyse de
l'expériencede
Faisceaux
fibres / fibroblastes
En bas de l'écran, dans l'onglet graphique, vérifier que le graphique est bien en "corrected" " 5
– Flux per Volume corrected".
Tracer une marque sur chaque palier d'intérêt, au niveau où le flux est stable en appuyant sur
shift + clic gauche sur la souris, et faire glisser la souris jusqu’à la taille de marque
désirée. (Pour enlever la marque, shift + clic droit et repasser sur la marque à l'envers, de
la droite vers la gauche.)
Dissection perméabilisation
Complexe
II
Complexes
I+II
Complexe I
Exemple :
Cliquer sur le graphique de la chambre d'intérêt, puis "F2". Les résultats apparaissent pour
cette chambre (les résultats indiqués pour la chambre non active ne veulent rien
dire !!).
Copier ensuite les données dans Excel : Cliquer sur "copy to clipboard" et coller dans un
fichier Excel. Le graphique peut également être exporté : Cliquer sur l'onglet "Graph" /
copy to clipboard / BMP. Il peut alors être collé dans Excel, ou Powerpoint …
Les analyses ou copies peuvent également être réalisées en cours de mesures, ou
ultérieurement en ré-ouvrant le graphique (File/Open).
Corriger les valeurs obtenues par le dosage de protéines. Ces valeurs sont alors en pmol/s/mg
de protéines. Les convertir en nmol/min/mg de protéines (soit multiplier par 1000 et
diviser par 60).
Calculer la respiration liée au complexe IV = Respirations en présence de TMPD – ascorbate
Calculer ensuite les RCR (ratio de contrôle respiratoire) en présence des différents substrats :
- EIII malate+pyruvate / EIV Malate+pyruvate (respiration avant l’ajout d’ADP)
- EIII succinate+roténone / oligo succinate+roténone
La stimulation éventuelle par le cytochrome c :
- Cyt c / EIII SR
La stimulation par le FCCP
- FCCP / EIII SR
Les ratios des différentes respirations maximales entre elles :
- EIII SR / EIII MP
- EIII MPS / EIII MP
- COX / EIII MP
- COX / EIII SR
7 : Documents associés
- Manuel d’utilisation de l’oxygraphe Oroboros (site web : www.oroboros.at)
- Rustin P, Chretien D, Bourgeron T, Gérard B, Rötig A, Saudubray JM, Munnich A (1994).
Biochemical and molecular investigations in respiratory chain deficiencies. Clin Chim Acta. 228(1):3551.
- Sperl W, Skladal D, Gnaiger E, Wyss M, Mayr U, Hager J, Gellerich FN. (1997). High resolution
respirometry of permeabilized skeletal muscle fibers in the diagnosis of neuromuscular disorders.
Mol Cell Biochem. 174(1-2):71-8.
- Pesta D, Gnaiger E. (2012). High-resolution respirometry: OXPHOS protocols for human cells and
permeabilized fibers from small biopsies of human muscle. Methods Mol Biol. 2012;810:25-58.
ATELIER
B
Dosage spectrométrique des activités des
complexes de la chaîne respiratoire
Christophe ROCHER et Stéphane ALLOUCHE
Pièce 3512
Préparation des échantillons tissulaires pour les dosages des
complexes de la chaîne respiratoire
Principe :
- Dans le cadre du diagnostic des maladies mitochondriales, les activités des
complexes de la chaîne respiratoire sont mesurées régulièrement sur des fragments
de muscle, foie, des fibroblastes cutanés en culture, ou des lymphomonocytes isolés
sur Ficoll. Tous ces échantillons doivent avoir été congelés de façon très rapide (cf
protocole prélèvement et conservation). Ils ne doivent pas avoir été exposés à une
rupture de la chaîne du froid.
- Toutes les manipulations sont réalisées en chambre froide.
- Les prélèvements sont conservés en tubes à -80°C. Ils doivent être transportés dans
la carboglace.
En pratique :
- 5 échantillons de patients peuvent être analysés au cours d’une même série. Un
échantillon de mitochondries isolées de cœur de bœuf est toujours analysé en
parallèle et sert de témoin interne de la qualité des dosages.
- Préparer 2 séries de 5 tubes Eppendorf de 1,5 mL numérotés, et les placer dans la
glace pilée
-
Foie et muscle : Homogénat à 5% dans le tampon "Mannitol" :
1) Mettre les 5 tubes d'homogénéisateur de type Potter verre-verre (taille 20 chez
Kontes) à refroidir dans la glace pilée.
2) Prendre une petite quantité du fragment biopsique (20 à 50 mg)
Si besoin, couper le fragment de biopsie en évitant sa décongélation :
- Soit en le coupant au scalpel
Refroidir une boite en plastique en la posant sur la carboglace,
Y déposer le fragment biopsique sur un papier d'aluminium,
Remonter les bords du papier d’aluminium de chaque coté du fragment ,
Couper à l'aide d'un scalpel en maintenant le fragment avec une pince.
- Soit en le cassant dans un mortier refroidi à l’azote liquide
3) Le placer dans l’homogénéisateur de type Potter
4) Ajouter 9 volumes de tampon « Mannitol » (par exemple 270 µL pour 30 mg de
biopsie ou 450 µL pour 50 mg)
5) Homogénéiser en chambre froide (ou dans la glace pilée) à l'aide du piston en
verre rodé à bout conique, à une vitesse de 500 à 1000 RPM en 3 à 5 passages. Il
est important d’éviter la surchauffe de l’échantillon.
6) Transférer le broyat à l'aide d'une pipette pasteur dans un tube 1,5 mL Eppendorf
de la première série de tubes numérotés.
7) Centrifuger à 0-4°C pendant 20 min à 650 g (soit 2000 RPM pour la centrifugeuse
de paillasse).
8) RANGER LE RESTE DE LA BIOPSIE AU CONGELATEUR
9) Transférer le surnageant dans le tube Eppendorf 1,5 mL correspondant dans la
deuxième série de tubes numérotés.
10) Reprise du culot dans le volume de tampon « Mannitol » utilisé initialement,
transfert dans le tube de l’homogénéisateur de type Potter utilisé initialement, et
seconde homogénéisation dans les mêmes conditions.
11) Centrifugation à 0-4°C pendant 20 min à 650 g (2000 RPM, centrifugeuse de
paillasse).
12) Le surnageant de cette deuxième centrifugation est ajouté à celui obtenu après la
première centrifugation. On obtient « un surnageant dit post nucléaire à 5% final »
13) Les tubes contenant le surnageant sont ensuite gardés dans un portoir réfrigéré
pour toute la durée des dosages.
-
Suspension cellulaire dans le tampon "Mannitol" (culots de fibroblastes ou de
cellules mononucléées sanguines)
Resuspendre le culot cellulaire conservé congelé dans le tampon "Mannitol" (par
exemple le culot correspondant à une flasque T75 de fibroblastes peut être repris
dans 200 µL de tampon)
Sonication brève (5 secondes) à puissance modérée pour obtenir une solution
homogène.
-
Mitochondries de cœur de bœuf utilisées comme contrôle de qualité dans
chaque série de dosages
On utilise les "billes de mitochondries" fournies par le Prof. Joël Lunardi de Grenoble.
Dans un tube 1,5 mL Eppendorf, mettre une bille et la laisser décongeler à 4°C.
Préparer la dilution des mitochondries au 1/200 dans le tampon "Mannitol" : d’abord
dilution 1/40 (10 µL de suspension mitochondriale dans 390 µL) puis dilution 1/5 (200
µL de dilution 1/40 dans 800 µL de tampon). Cette dilution au 1/200 est utilisée pour
tous les dosages sauf ceux du complexe III et du complexe IV où l'on utilise une
dilution au 1/800 (50 µL de la dilution 1/200 dans 150 µL de tampon "Mannitol").
-
Dosage des protéines
On doit doser les protéines des différents surnageants tissulaires ou des suspensions
cellulaires (dilués 1/5 dans du PBS) et de la suspension de mitochondries diluée au
1/40 (mesurée pure).
Ce calcul permet :
- d’ajuster la concentration protéique à 2 mg/mL
- et de vérifier la concentration des billes au 1/40 (elle est proche de 1 mg/mL).
Réactifs pour dosages
des complexes de la chaîne respiratoire
DOSAGES DE 5 ECHANTILLONS ET UN CONTROLE
REACTIFS A PREPARER LE JOUR MEME
Réactifs
100 µM cytochrome c
réduit
(Poudre Sigma C7752 ; FW 12384,
corrigé 12900)
1 mM cytochrome c
(Poudre Sigma C7752 ; FW 12384,
corrigé 12900)
10 mM oxaloacétate
(Poudre Sigma O4126 ; FW 132,1
corrigé 134,8)
2 mM NADH
(Poudre Sigma N8129 ; FW 709,4,
corrigé786,8)
100% dithionite ou
hydrosulfite de
sodium
(Poudre Sigma S1256 ; FW 174.1,
corrigé197,8)
21,3 mM
décylubiquinol
(Poudre Sigma D7911 ; FW 322,4
corrigé 329,0)
Reconstitution
Rangement
Peser au moins 15 mg de cytochrome c et Congélateur –20°C
les diluer dans du 50 mM K phosphate pH
7,0 à raison de 0,930 mL/mg puis réduire la
préparation (cf protocole complexe IV)
10 mM KCN
(Poudre Fluka 60179
; FW 65,12)
Armoire "Poisons",
température
ambiante
Peser au moins 20 mg de cytochrome c (si
l'on ne dose pas l'activité I+III, sinon au
moins 30 mg), les diluer dans de l'eau
distillée à raison de 75,3 µL/mg
Peser au moins 2 mg d'oxalo-acétate et les
diluer dans du 0,1 M Tris HCl pH 8,1 à
raison de 0,758 mL/mg
Congélateur –20°C
Congélateur –20°C
Peser au moins 2 mg de NADH et les diluer Réfrigérateur
dans de l’eau distillée.à raison de 0,685
mL/mg
Peser au moins 200 mg de dithionite et les
diluer dans de l'eau distillée à raison de 1
µL/mg. Faire chauffer au bain Marie
bouillant jusqu'à dissolution complète et
s'en servir immédiatement pour la réduction
de la décylubiquinone.
Réduire un aliquote de 176 µL de 25 mM
décylubiquinone gardé au congélateur en
ajoutant 30 µL de solution de 100%
dithionite (voir ci dessus). Agiter au vortex
puis incuber à 37°C (bain Marie, la solution
doit devenir blanche avec la réduction de la
décylubiquinone en 15 à 20 min)
Peser un grain de KCN et le diluer dans de
l'eau distillée à raison de 1,536 mL/mg
Dessicateur,
température
ambiante
Congélateur -20°C
RÉACTIFS GARDÉS CONGELÉS Ă –20°C
Réactifs
5 mM DTNB
(Poudre Sigma D8130; FW 396,3)
10 mM acétylCoA
(Poudre Sigma A2181; FW 827,4
corrigé 891,4)
25 mM
décylubiquinone
(Poudre Sigma D7911; FW 322,4
corrigé 329,0)
200 mM succinate
(Poudre Sigma S7501; FW 118,1)
50 mg/mL albumine
bovine, sans acides
gras (Poudre Sigma
A-2153)
2,5 mg/mL antimycine
A (Poudre Sigma A8674)
2,5 mM roténone
(Poudre Aldrich R2001; FW 394,4)
Reconstitution
Peser du DTNB et le dissoudre dans
l'éthanol 95% à raison de 0,505 mL/mg.
Aliquotes de 500 µL
Peser l'acétylCoA et le diluer dans l'eau
distillée à raison de 0,112 mL/mg
Rangement
Poudre dans le
dessiccateur à
température ambiante
Poudre au congélateur
-20°C
Ajouter 1,216 mL de DMSO dans un
flacon de 100 mg (aspect liquide):
solution à 250 mM. Puis diluer 1/10 avec
du DMSO pour atteindre la concentration
de 25 mM. Aliquoter en deux volumes
différents : 88 et 176 µL.
Peser 472,4 mg et les diluer dans 15 mL
d'eau distillée, ajuster le pH à 7, 4 puis
compléter le volume à 20 mL. Aliquotes
de 500 µL.
Peser la poudre d'albumine et la diluer
dans de l'eau distillée à raison de 20
µL/mg. Aliquotes de 1 mL
Poudre au congélateur
-20°C
Diluer la poudre d'antimycine A d'un
flacon dans l’éthanol à 95% à raison de
0,4 mL/mg
Peser la poudre de roténone et la diluer
dans le mélange éthanol 95%/DMSO
(50/50) à raison de 1,014mL/mg.
Aliquotes de 200 µL.
Poudre au congélateur
-20°C
Poudre dans le
dessiccateur à
température ambiante
Poudre au réfrigérateur
Poudre au congélateur
-20°C
RÉACTIFS GARDÉS AU RÉFRIGÉRATEUR
Réactifs
5 mM DCPIP
(2,6,dichlorophénolindophénol de sodium
(Poudre Sigma D-1878; FW
290,1, corrigé 326,1)
50 mM K phosphate pH 7,0
(potassium dihydrogénophosphate (K1) Prolabo
33611-265 FW 136,09; Dipotassium hydrogénophosphate (k2) Prolabo
33612-268 FW 174,18)
Reconstitution
Peser 72.5 mg de la poudre de
DCPIP, diluer avec 50 mL d'eau
distillée. Marquer la date car le
mélange ne se garde que 1 mois.
Peser 3,4 g de poudre K1 et diluer
dans 500 mL d'eau distillée; peser
4,35 g de poudre K2 et diluer dans
500 mL d'eau distillée; Mélanger les
solutions sous contrôle du pH en
ajoutant la solution acide (K1) dans
la solution alcaline (K2) jusqu'à
obtention du pH 7,0. Aliquotes de
50 mL.
500 mM K phosphate pH 7,5 Peser 34 g de poudre K1 et diluer
(potassium dihydrogénodans 500 mL d'eau distillée; peser
phosphate (K1) Prolabo
43,5 g de poudre K2 et diluer dans
33611-265 FW 136,09; Di500 mL d'eau distillée Mélanger les
potassium hydrogénosolutions sous contrôle du pH en
phosphate (k2) Prolabo
ajoutant la solution acide (K1) dans
33612-268 FW 174,18)
la solution alcaline (K2) jusqu'à
obtention du pH 7,0. Aliquotes de
50 mL.
1 M Tris HCl pH 8,1
Peser 6,06 g de poudre de Tris
(Prolabo 28811-295 ; FW
base, diluer dans 30 mL d'eau
121,14)
distillée, ajuster le pH à 8,1 avec de
l'acide chlorhydrique 5N puis 1N,
compléter le volume à 50 mL avec
de l'eau distillée
100 mM Tris HCl pH 8,1
Peser 6,06 g de poudre de Tris
(Prolabo 28811-295 ; FW
base, diluer dans 400 mL d'eau
121,14)
distillée, ajuster le pH à 8,1 avec de
l'acide chlorhydrique 5N puis 1N,
compléter le volume à 500 mL avec
de l'eau distillée
10% Triton-X100 (solution
Diluer 5 mL de Triton-X100 avec 45
Sigma X-100)
ml d'eau distillée
Tampon "Mannitol" = pH 7.2 Peser 2,05 g de mannitol , 1,28 g
225 mM mannitol
de saccharose, 60,6 mg de Tris,
75 mM saccharose
ajouter 10 µL de solution0,5 M
10 mM Tris HCl
EDTA, diluer avec 40 mL d'eau
0,1 mM EDTA
distillée, ajuster le pH à 7,2 et
(Mannitol Sigma M-9546; FW compléter le volume à 50 mL avec
182,2 - Saccharose Fluka
de l'eau distillée.
84105; FW 342,3 - EDTA
Sigma E-7889; solution 0,5
M)
Rangement
Poudre dans le
dessiccateur à
température ambiante
Poudre à température
ambiante
Poudre à température
ambiante
Poudre à température
ambiante
Poudre à température
ambiante
Solution 100% à
température ambiante
Poudres de mannitol,
de saccharose, de Tris
et solution d'EDTA à
température ambiante.
Dosage du complexe I (NADH ubiquinone oxydo-réductase)
Principe :
- Le complexe I de la chaîne respiratoire permet l'oxydation du NADH en NAD+, son
activité sera donc évaluée par la disparition du NADH qui absorbe à 340 nm.
L’accepteur naturel des électrons du complexe I est le coenzyme Q10 ou ubiquinone.
Cette molécule très hydrophobe est remplacée dans l’essai par la décylubiquinone,
beaucoup plus hydrophile.
- L’activité parallèle, non respiratoire, d’oxydation du NADH due à l’activité cytochrome b5
oxydo-réductase, est insensible à la roténone, inhibiteur spécifique du complexe I. Elle
est mesurée par un dosage parallèle en présence de roténone.
- L’activité spécifique du complexe I est donc la partie sensible à la roténone de l’activité
NADH oxydase totale. Elle est mesurée par la différence entre l’activité totale et celle
résistante à la roténone.
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 12 dosages.
- Composition du milieu de réaction :
100 µM NADH
100 µM décylubiquinone
50 mM K Phosphate pH 7,5
3,75 mg/mL d’albumine bovine
Tissu : 40 µg de protéines (surnageant post-nucléaire de foie ou muscle) ou 4 µg de
mitochondries isolées
Inhibition par 12,5 µM roténone.
- Préparation du milieu de réaction :
1) Dans un tube de 50 mL, préparer le mélange pour effectuer 7 dosages
soit 14 cuves :
Réactifs
Quantité
Quantité/échantillon
globale
500 mM K Phosphate pH 7,5
1540 µL
220 µL
50 mg/mL BSA
1155 µL
165 µL
25 mM décylubiquinone
63 µL
9 µL
H 2O
11564 µL
1652 µL
2) Dans une cuvette de 2 mL, mettre 2045 µL du milieu de réaction et ajouter 44
µL d’homogénat tissulaire (préparé à une concentration finale de protéines de 2
mg/mL) ou de mitochondries de cœur de bœuf (diluées à 0,2 mg/mL soit 1/200).
Mélanger.
3) Transférer 950 µL du mélange dans chacune de 2 cuves de 1 ml qui seront
analysées en parallèle.
4) Ajouter 5 µL de 2,5 mM roténone dans l'une des cuves de 1 mL, mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 340 nm
Calibration initiale de la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Démarrer la réaction avec 50 µL de 2 mM NADH gardé à température ambiante.
4) Lecture toutes les 15 secondes durant 3 minutes,
Les 2 cuvettes correspondant au même échantillon sont lues en même temps. On
peut lire 4 cuvettes en même temps. Si la décroissance est trop rapide (non
linéaire), refaire le dosage avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée et rendue en nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le NADH est ε = 6,2
3) Le facteur de correction est donc 4032,3 pour 40 µg de protéines dans l'essai
(homogénat) et 40323 pour 4 µg de protéines dans l'essai (mitochondries isolées)
Dosage du complexe II (succinate ubiquinone oxydo-réductase)
Principe :
- Le complexe II de la chaîne respiratoire permet l'oxydation du succinate dont il transfère
les électrons au coenzyme Q10 ou ubiquinone. Cette molécule très hydrophobe est
remplacée dans l’essai par la décylubiquinone, beaucoup plus hydrophile. L’activité est
mesurée en suivant la réduction du 2,6-dichlorophénol-indophénol (DCPIP) par la
baisse de l’absorbance à 600 nm du DCPIP oxydé.
- La ligne de base est mesurée pour pouvoir soustraire une réaction spontanée de
transfert d’électrons au DCPIP. La spécificité de la réaction peut être vérifiée par son
Inhibition par le malonate 10 mM, inhibiteur spécifique du complexe II. Cette vérification
n’est pas obligatoire en routine diagnostique du fait de la grande spécificité de la
réaction (vérifiée au dessus de 90% sur l'homogénat de muscle et de foie).
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 6 dosages.
- Composition du milieu de réaction :
25 mM K Phosphate pH 7.5
20 mM succinate
100 µM décylubiquinone
50 µM DCPIP
1 mM KCN
100 µM ATP
2 mg/mL albumine bovine
Tissu : 40 µg de protéines (surnageant post-nucléaire ou suspension cellulaire) ou 4
µg de mitochondries isolées
- Préparation du milieu de réaction :
1) Dans un tube de 15 mL, préparer le mélange pour effectuer 7 dosages:
Réactifs
Quantité globale
Quantité/échantillon
500 mM K Phosphate pH 7,5
350 µL
50 µL
50 mg/mL BSA
280 µL
40 µL
200 mM succinate
700 µL
100 µL
5 mM DCPIP
70 µL
10 µL
10 mM KCN
700 µL
100 µL
10 mM ATP
70 µL
10 µL
H 2O
4662 µL
666 µL
2) Dans une cuvette de 1 mL, mettre 976 µL du milieu de réaction et ajouter 20
µL d’homogénat tissulaire ou de suspension cellulaire (préparé à une
concentration finale de protéines de 2 mg/mL) ou de mitochondries de cœur de
bœuf (diluées à 0,2 mg/ml soit au 1/200). Mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 600 nm. Calibration initiale de
la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Lire la ligne de base pendant 3 minutes à 37°C
4) Déclencher la réaction par 4 µL de 25 mM décylubiquinone
5) Lecture toutes les 15 secondes durant 3 minutes ; si la décroissance est trop
rapide (non linéaire), refaire le dosage avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée après soustraction de l'activité de base en
nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le DCPIP est ε = 19,1
3) Le facteur de correction est donc 1308,9 pour 40 µg de protéines et 13089 pour 4
µg de protéines dans l'essai.
Dosage du complexe III (ubiquinol cytochrome c oxydo-réductase)
Principe :
- Le complexe III de la chaîne respiratoire permet l'oxydation de l’ubiquinol (forme
réduite de l’ ubiquinone ou coenzyme Q10) dont il transfère les électrons au
cytochrome c dont la réduction est suivie par l’augmentation d’absorbance à 550 nm.
- Il existe des activités parallèles, non respiratoires, d’oxydation de l’ubiquinol.
L’antimycine A est un des inhibiteurs spécifiques du complexe III. L’activité spécifique
du complexe III est donc calculée par la différence entre l’activité totale et celle
résistante à l’antimycine A qui est mesurée par un dosage parallèle en présence
d’antimycine A.
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 12 dosages.
- Composition du milieu de réaction :
200 µM décylubiquinol
50 µM cytochrome c
100 mM K Phosphate pH 7,5
250 µM EDTA
Tissu : 30 µg de protéines (surnageant post-nucléaire (foie ou muscle) ou suspension
cellulaire) et 0,75 µg de mitochondries isolées
Inhibition par 12,5 µg/mL d’antimycine A
- Préparation du milieu de réaction :
1) Dans un tube de 50 mL, préparer le mélange pour effectuer 7 dosages
soit 14 cuves :
Réactifs
Quantité globale
Quantité/échantillon
500 mM K Phosphate pH 7,5
3080 µL
440 µL
1 mM cytochrome c
770 µL
110 µL
50 mM EDTA
77 µL
11 µL
H 2O
11116 µL
1588 µL
2) Dans une cuvette de 2 mL, mettre 2149 µL du milieu de réaction et ajouter 33
µL d’homogénat tissulaire (préparé à une concentration finale de protéines de 2
mg/mL) ou de mitochondries de cœur de bœuf (diluées à 0,05 mg/mL soit 1/800).
Mélanger.
3) Transférer 992 µL du mélange dans chacune de 2 cuves de 1 ml qui seront
analysées en parallèle.
4) Ajouter 5 µL de 2,5 mg/mL antimycine A dans l'une des cuves de 1 mL,
mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 550 nm
Calibration initiale de la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Démarrer la réaction avec 8 µL de 25 mM décylubiquinol gardé à 37°C.
4) Lecture toutes les 10 secondes durant 3 minutes,
Les 2 cuvettes correspondant au même échantillon sont lues en même temps.
On peut lire 4 cuvettes en même temps.
Si la croissance est trop rapide (non linéaire), refaire le dosage avec moins de tissu.
La linéarité obtenue est médiocre avec les mitochondries isolées pour lesquelles
l’activité est mesurée pendant la première minute.
- Calcul :
1) L'activité spécifique est calculée et rendue en nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le cytochrome c est ε = 18,5
3) Le facteur de correction est donc 1801,8 pour 30 µg de protéines dans l'essai
(homogénat) et 72072 pour 0,75 µg de protéines dans l'essai (mitochondries
isolées).
Dosage du complexe IV (cytochrome c oxydase)
Principe :
- Le complexe IV de la chaîne respiratoire permet l'oxydation du cytochrome c, son
activité sera donc évaluée par la disparition du cytochrome c réduit qui absorbe à 550
nm. L’accepteur naturel des électrons du complexe IV est l’oxygène.
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d'un même
série
- Composition du milieu de réaction :
50 mM K phosphate pH 7,0 (25 mM pour les fibroblastes)
100 µM cytochrome c réduit (50 µM pour les fibroblastes)
Tissu: 40 µg protéines (homogénat post-nucléaire ou suspension cellulaire) ou 1 µg de
mitochondries purifiées
- Préparation des solutions de référence de cytochrome c réduit, de cytochrome c oxydé
et de la solution qui sera utilisée pour les dosages :
1) Préparer 12 à 13 mL de solution de 100 µM cytochrome c dans 50 mM K
phosphate pH 7,0
2) Préparer la « Solution 100% oxydée » en transférant 1 mL de la solution initiale
de 100 µM cytochrome c dans une cuvette de 1 mL et en l’oxydant avec
quelques grains de ferricyanure de potassium (la solution devient orange
sombre)
3) Préparer la « Solution 100% réduite » en transférant 1 mL de la solution initiale
de 100 µM cytochrome c dans une cuvette de 1 mL et en la réduisant avec
quelques grains de dithionite de sodium (bisulfite) (la solution devient rose
saumon).
4) Dans le spectrophotomètre à 37°C, longueur d’onde 550 nm, faire le blanc sur l’air
puis mesurer l’absorbance de la « Solution 100% oxydée » qui doit être autour de
0,7 pour la solution à 100 µM
5) Refaire le blanc sur la « Solution 100% oxydée » pour avoir une absorbance nulle
pour une réduction nulle
6) Mesurer l’absorbance de la « Solution 100% réduite », la noter,
Réduire progressivement la solution initiale de 100 µM de cytochrome c avec des
aliquotes de la « Solution 100% réduite » (on commence par 50-100 µL). le degré de
réduction est suivi par la mesure de l’absorbance à 550 nm. On doit obtenir une
absorbance entre 90 et 95% de l’absorbance mesurée avec la solution « 100%
réduite ».
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 550 nm. Calibration initiale de
la lecture sur l'air.
2) Préparer des cuvettes contenant 980 µL de la solution de cytochrome c réduit.
3) Incuber les cuvettes 5 minutes à 37°C dans le spectrophotomètre thermostaté.
4) Déclencher la réaction par l’ajout de 20 µL d’homogénat tissulaire ou de
suspension cellulaire (préparé à une concentration finale de protéines de 2
mg/mL) ou de mitochondries de cœur de bœuf (diluées à 0,05 mg/ml soit 1/800).
Mélanger.
5) Lecture toutes les 10 secondes durant 3 minutes. On peut lire 2 cuvettes en
même temps. Si la décroissance est trop rapide (non linéaire), refaire le dosage
avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée et rendue en nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le cytochrome c est ε = 18,5
3) Le facteur de correction est donc 1351,4 pour 40 µg de protéines dans l'essai
(homogénat) et 54054 pour 1 µg de protéines dans l'essai (mitochondries isolées,
20 µL au 1/800).
Dosage des complexes I + III (NADH cytochrome C oxydo-réductase)
Principe :
- Les complexes I et III de la chaîne respiratoire permettent l'oxydation du NADH en
NAD+, et transfèrent les électrons au cytochrome c. Cette activité est évaluée par
l’augmentation de l’absorbance du cytochrome c réduit à 550 nm.
- L’activité parallèle, non respiratoire, d’oxydation du NADH est insensible à la roténone,
inhibiteur spécifique du complexe I. Elle est mesurée par un dosage parallèle en
présence de roténone. La partie spécifique, respiratoire, de l’activité NADH cytochrome
c oxydo-réductase est mesurée par la différence entre l’activité totale et celle résistante
à la roténone.
- L’oxydation du cytochrome c réduit par le complexe IV est inhibée par le cyanure de
potassium (KCN).
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 12 dosages.
- Composition du milieu de réaction :
200 µM NADH
100 µM cytochrome c
50 mM K Phosphate pH 7,5
1,0 mg/ml d’albumine bovine
1 mM KCN
Tissu : 40 µg de protéines (surnageant post-nucléaire (foie ou muscle) ou suspension
cellulaire) ou 4 µg de mitochondries isolées
Inhibition par 12,5 µM roténone.
- Préparation du milieu de réaction :
1) Dans un tube de 50 ml, préparer le mélange pour effectuer 7 dosages
soit 14 cuves :
Réactifs
Quantité
Quantité/échantillon
globale
500 mM K Phosphate pH 7,5
1540 µL
220 µL
50 mg/ml BSA
308 µL
44 µL
10 mM KCN
1540 µL
220 µL
1 mM cytochrome c
1540 µL
220 µL
H 2O
8624 µL
1232 µL
2) Dans une cuvette de 2 ml, mettre 1936 µL du milieu de réaction et ajouter 44
µL d’homogénat tissulaire (préparé à une concentration finale de protéines de 2
mg/ml) ou de mitochondries de cœur de bœuf (diluées à 0.2 mg/mL soit 1/200).
Mélanger.
3) Transférer 900 µL du mélange dans chacune de 2 cuves de 1 ml qui seront
analysées en parallèle.
4) Ajouter 5 µl de 2,5 mM roténone dans l'une des cuves de 1 mL, mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 550 nm. Calibration initiale de
la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Démarrer la réaction avec 100 µl de 2 mM NADH gardé à température ambiante.
4) Lecture toutes les 15 secondes durant 3 minutes,
Les 2 cuvettes correspondant au même échantillon sont lues en même temps. On
peut lire 4 cuvettes en même temps. Si la croissance est trop rapide (non linéaire),
refaire le dosage avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée et rendue en nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le cytochrome c est ε = 18,5
3) Le facteur de correction est donc 1351,4 pour 40 µg de protéines dans l'essai
(homogénat) et 13514 pour 4 µg de protéines dans l'essai (mitochondries isolées).
Dosage de l'activité II + III (succinate cytochrome c oxydo-réductase)
Principe :
- Les complexes II et III de la chaîne respiratoire permettent l'oxydation du succinate en
fumarate et transfèrent les électrons au cytochrome c. Cette activité est évaluée par
l’augmentation de l’absorbance du cytochrome c réduit à 550 nm.
- L’oxydation du cytochrome c réduit par le complexe IV est inhibée par le cyanure de
potassium (KCN).
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 6 dosages.
- Composition du milieu de réaction :
20 mM K Phosphate pH 7.5
20 mM succinate
100 µM cytochrome c
1 mM KCN
100 µM ATP
2 mg/ml albumine bovine
Tissu : 40 µg de protéines (surnageant post-nucléaire ou suspension cellulaire) ou 4
µg de mitochondries isolées
- Préparation du milieu de réaction :
1) Dans un tube de 15 ml, préparer le mélange pour effectuer 7 dosages:
Réactifs
Quantité
Quantité/échantillon
globale
500 mM K Phosphate pH 7,5
280 µL
40 µL
50 mg/ml BSA
280 µL
40 µL
200 mM succinate
700 µL
100 µL
10 mM KCN
700 µL
100 µL
10 mM ATP
70 µL
10 µL
H 2O
4662 µL
590 µL
2) Dans une cuvette de 1 ml, mettre 880 µL du milieu de réaction et ajouter 20
µL d’homogénat tissulaire ou de suspension cellulaire (préparé à une
concentration finale de protéines de 2 mg/ml) ou de mitochondries de cœur de
bœuf (diluées à 0,2 mg/ml soit 1/200). Mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 550 nm
Calibration initiale de la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Déclencher la réaction par 100 µL de 1 mM cytochrome c gardé à température
ambiante. On peut lire 6 cuves en même temps.
4) Lecture toutes les 20 secondes durant 3 minutes ; si l’augmentation d’absorbance
est trop rapide (non linéaire), refaire le dosage avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée en nanomoles/min/mg de protéines
2) Le coefficient d'extinction utilisé pour le cytochrome c est ε = 18,5
3) Le facteur de correction est donc 1351,4 pour 40 µg de protéines dans l'essai et
13514 pour 4 µg de protéines dans l'essai (mitochondries isolées)
Dosage de la Citrate synthase
Principe :
- La citrate synthase est une enzyme du cycle de Krebs qui forme du citrate à partir de
l’oxaloacétate et de l’acétylCoA. Cette activité est employée pour évaluer la quantité de
mitochondries dans les tissus. Le CoA réduit (CoA-SH) formé lors de la réaction réagit
avec le 5,5’ dithiobis 2 nitrobenzoic acid (DTNB) pour donner du TNB qui absorbe
spécifiquement à 412 nm. L’activité de la citrate synthase est donc mesurée en suivant
l’augmentation de l’absorbance à 412 nm.
- La ligne de base est mesurée pour pouvoir soustraire une réaction spontanée de
transfert d'électrons.
En pratique :
- 6 déterminations (5 patients et 1 contrôle) peuvent être effectuées au cours d’une
même série, soit 6 dosages.
- Composition du milieu de réaction :
100 µM DTNB
100 mM Tris HCl pH 8,1
300 µM acétyl CoA
500 µM oxaloacétate
0,1 % Triton X100
Tissu : 40 µg de protéines (surnageant post-nucléaire ou suspension cellulaire) ou 4
µg de mitochondries purifiées
- Préparation du milieu de réaction :
1) Dans un tube de 15 mL, préparer le mélange pour effectuer 7 dosages:
Réactifs
Quantité
Quantité/échantillon
globale
5 mM DTNB
140 µL
20 µL
10 mM acétylCoA
210 µL
30 µL
10% Triton X100
70 µL
10 µL
1 M Tris HCl pH 8,1
665 µL
95 µL
H 2O
5425 µL
775 µL
2) Dans une cuvette de 1 mL, mettre 930 µL du milieu de réaction et ajouter 20
µL d’homogénat tissulaire ou de suspension cellulaire (préparé à une
concentration finale de protéines de 2 mg/mL) ou de mitochondries de cœur de
bœuf (diluées à0,2 mg/ml soit 1/200). Mélanger.
- Réaction :
1) Lecture au spectrophotomètre, 37°C, longueur d'onde 412 nm. Calibration initiale de
la lecture sur l'air.
2) Incuber les cuves à 37°C, durant 5 min, dans le spectrophotomètre thermostaté
3) Lire la ligne de base pendant 4 minutes à 37°C. On peut lire 6 cuves en même
temps.
4) Déclencher la réaction par 50 µL de 10 mM acide oxaloacétique dans 100 mM
Tris HCl pH 8,1.
5) Lecture toutes les 20 secondes durant 4 minutes ; si l’augmentation de
l’absorbance est trop rapide (non linéaire), refaire le dosage avec moins de tissu.
- Calcul :
1) L'activité spécifique est calculée après soustraction de l'activité de base en
nanomoles/min/mg de protéines.
2) Le coefficient d'extinction utilisé pour le TNB est ε = 13,6
3) Le facteur de correction est donc 1838,2 pour 40 µg de protéines et 18382 pour 4
µg de protéines dans l'essai.
Mitochondrion 9 (2009) 331–339
Contents lists available at ScienceDirect
Mitochondrion
journal homepage: www.elsevier.com/locate/mito
Development and implementation of standardized respiratory chain
spectrophotometric assays for clinical diagnosis
F. Medja a, S. Allouche b, P. Frachon a, C. Jardel a,c,d, M. Malgat e, B. Mousson de Camaret f,
A. Slama g, J. Lunardi h, J.P. Mazat e, A. Lombès a,c,d,*
a
INSERM, U975, Paris F-75013, France
Laboratoire de Biochimie, Centre hospitalier et universitaire de Caen, F-14033 Caen cedex, France
c
Université Pierre et Marie Curie-Paris6 UPMC-Paris6, Paris F-75005, France
d
AP/HP, Laboratoire de Biochimie métabolique, GHU Pitié-Salpêtrière, Paris F-75651, France
e
INSERM, U688, Université Bordeaux II, F-33076 Bordeaux cedex, France
f
Centre de Biologie et de Pathologie Est, Service des Maladies Héréditaires du Métabolisme, F-69677 Bron, France
g
AP-HP, Laboratoire de Biochimie, Hôpital de Bicêtre, F-94275 Le Kremlin-Bicêtre, France
h
Laboratoire de Biochimie et Génétique Moléculaire, Centre hospitalier et universitaire, F-38043 Grenoble cedex, France
b
a r t i c l e
i n f o
Article history:
Received 27 November 2008
Received in revised form 30 April 2009
Accepted 4 May 2009
Available online 9 May 2009
Keywords:
Diagnostic test assessment
Mitochondrial disorders
Respiratory chain complexes
a b s t r a c t
Diversity of respiratory chain spectrophotometric assays may lead to difficult comparison of results
between centers. The French network of mitochondrial diseases diagnostic centers undertook comparison of the results obtained with different protocols in the French diagnostic centers. The diversity of protocols was shown to have striking consequences, which prompted the network to undertake
standardization and optimization of the protocols with respect to clinical diagnosis, i.e. high velocity
while maintaining linear kinetics relative to time and enzyme concentration. Assays were set up on animal tissues and verified on control human muscle and fibroblasts.
Influence of homogenization buffer and narrow range of optimal concentration of phosphate, substrate
and tissue were shown. Experimental data and proposed protocols have been posted on a free access
website. Their subsequent use in several diagnostic centers has improved consistency for all assays.
Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
1. Introduction
Abbreviations: AFM, Association Française contre les Myopathies; III, respiratory
complex III, i.e. antimycin-sensitive ubiquinol cytochrome c oxidoreductase (EC
1.10.2.2); Total III, ubiquinol-cytochrome c reductase in the absence of antimycin;
BSA, bovine serum albumin; IV, respiratory complex IV, i.e. cytochrome c oxidase
(EC 1.9.3.1); I, respiratory complex I, i.e. rotenone-sensitive NADH ubiquinone
oxidoreductase (EC 1.6.5.3); SDH, succinate dehydrogenase (proximal part of
respiratory complex II); II, respiratory complex II, i.e. succinate ubiquinone
oxidoreductase activity (EC 1.3.5.1); I + III, rotenone-sensitive NADH: cytochrome
c oxidoreductase; II + III, succinate cytochrome c oxidoreductase; CS, citrate
synthase; dUb, decylubiquinone; succ, succinate; DCPIP, 2,6-dichlorophenolindophenol; dUb-H2, decylubiquinol; cyt c, cytochrome c; red cyt c, reduced cytochrome
c; ACoA, acetylCoenzyme A; OA, oxaloacetate; DTNB, 5,50 dithiobis 2 nitrobenzoic
acid; I/CS, II/CS, III/CS, IV/CS and IV/I, are the ratios of the corresponding activities.
* Corresponding author. Present address: Inserm U975, Groupe hospitalier PitiéSalpêtrière, 47-83 Boulevard de l’Hôpital, 75651 Paris cedex 13, France. Tel.: +33 1
42 16 57 17; fax: +33 1 42 16 57 00.
E-mail addresses: l.medja@aliceadsl.fr (F. Medja), allouche-s@chu-caen.fr (S.
Allouche), paule.frachon@free.fr (P. Frachon), claude.jardel@psl.aphp.fr (C. Jardel),
monique.malgat@orange.fr (M. Malgat), benedicte.mousson-de-camaret@chu-ly
on.fr (B.M.de Camaret), abdel.slama@bct.aphp.fr (A. Slama), jlunardi@chu-greno
ble.fr (J. Lunardi), jp.mazat@u-bordeaux2.fr (J.P. Mazat), a.lombes@institut-myolo
gie.org (A. Lombès).
1.1. The need for standardized enzymatic investigations of patients
with mitochondrial diseases
Mitochondrial diseases, defined as the diseases that are due to
an inherited alteration of the oxidative phosphorylation pathway,
are highly complex disorders with diverse clinical presentation
with respect to age of onset, symptoms, and rate of progression
(DiMauro and Hirano, 2005). Their diagnosis relies upon a series
of metabolic, morphological, and biochemical investigations, the
results of which are disputable in terms of specificity (they may
be altered in non-mitochondrial diseases) as well as sensitivity
(they may be normal in authentic mitochondrial disorders) (Taylor
et al., 2004; Trijbels et al., 1993). Identifying the genetic cause
therefore represents the ultimate proof of the diagnosis but this
is an extraordinary challenge for the medical community because
of the high number of candidate genes, located either in mitochondrial DNA or in the nuclear genome. Recognition of homogeneous
groups of patients would significantly facilitate the search for the
cause of mitochondrial diseases.
1567-7249/$ - see front matter Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
doi:10.1016/j.mito.2009.05.001
332
F. Medja et al. / Mitochondrion 9 (2009) 331–339
However the nature, number and protocol of investigations applied to mitochondrial disorders may greatly vary between different diagnostic centers, thus preventing direct comparison of
patients results obtained in different centers. Previous work has
been done to standardize protocols for metabolic (Touati et al.,
1997) and morphological (Romero et al., 1996) analyses of mitochondrial patients. It has not been done for the assays of mitochondrial activities for which exist very diverse protocols (Bénit et al.,
2006; Birch-Machin et al., 1989; Chretien et al., 2004; Estabrook
and Pullman, 1967; Janssen et al., 2007; Kirby et al., 2007; Rustin
et al., 1994; Trounce et al., 1996; Zheng et al., 1990) that have been
shown to induce large variation of experimental results (Gellerich
et al., 2004).
1.2. Standardization of spectrophotometric assays within the frame of
the French network of mitochondrial diseases diagnostic centers
dicte Mousson de Camaret, Hospices Civils de Lyon and Dr. Catherine Godinot, Claude Bernard University, Lyon), Marseille (Dr. Marie
France Montfort, CHU La Timone), and Paris (Dr. Michèle Brivet, Dr.
Abdel Slama, CHU Bicêtre; Dr. Agnès Rötig, Dr. Pierre Rustin, CHU
Necker-Enfants malades; Paule Frachon, Dr. Claude Jardel, Dr. Anne
Lombès, CHU Pitié-Salpêtrière). The initial discussion led to the
decision to assay the respiratory chain complexes activities at
37 °C in order to allow comparison with polarography. Agreement
was also reached on the parameters that required experimental
validation so that optimal conditions for a diagnostic assay could
be established i.e. highest maximal velocity (to improve sensitivity
in order to better detect partial enzymatic failure) as well as linear
kinetics with time (to avoid common miscalculations of initial
velocity) and with amount of protein (to correctly assess the actual
activity).
2.2. Material
In 2000 a network regrouping all the French laboratories involved in the biochemical and genetic diagnosis of human mitochondrial diseases was initiated to improve identification of the
causes of mitochondrial diseases, to establish a national register
of patients and to set up inter-laboratory quality controls for the
diverse diagnostic investigations. The first analyses to be proposed
for evaluation were the spectrophotometric assays of respiratory
chain activities. The reasons for that choice was that these assays
were reputed very diverse and were used in all the centers, either
in isolation or in addition to other biochemical assays such as
polarography or ATP measurements. To simplify the matter, the assays of respiratory complexes I, II, III and IV as well as citrate synthase activity were first evaluated because they can be applied on
homogenates as well as on mitochondrial fractions.
The consequences of the diversity of the protocols on the range
of experimental results was initially analyzed; it was shown to be
striking as previously reported (Gellerich et al., 2004; Kirby et al.,
2007). That observation prompted members of the network to
try and standardize the assays protocols. To spare human samples,
animal tissues (beef heart mitochondria and mouse quadriceps
homogenate) were first assayed. Experimental conditions were
then verified in human control muscle homogenates and sonicated
human fibroblasts. Even though the biochemistry of the respiratory chain poses intrinsic difficulties, mainly due to the fact that
respiratory complexes and part of the substrates/products are located in a membrane environment, reliable protocols could be
developed. They are progressively implemented in the French diagnostic centers. Three centers have now used them for over a year
and have gathered enough results from control samples to allow
analyzing reproducibility and reliability. In this paper we summarize our results from testing the previous protocols to defining
optimal conditions for measurement of each respiratory chain
complex. Finally we discuss the compromises that were required
to develop protocols suitable for use in clinical diagnostic
laboratories.
2. Material and methods
2.1. Preliminary discussion
All diagnostic centers within the French network contributed to
preliminary discussions about the diverse protocols of sample
preparation and assays in use. The persons involved at the time
in the discussion were from the diagnostic centers that are located
in Angers (Dr. Olivier Douay, Dr. Gilles Simard, CHU d’Angers), Bordeaux (Dr. Thierry Letellier, Monique Malgat, Pr. Jean Pierre Mazat,
Université Bordeaux 2), Caen (Dr. Stéphane Allouche, CHU de la
Côte de Nacre), Grenoble (Pr. Joël Lunardi, CHU de Grenoble), Lille
(Pr. Bernard Sablonnière, Hôpital Roger Salengro), Lyon (Dr. Béné-
To spare human samples, it was decided to initially work on
animal tissues. Isolated beef heart mitochondria were chosen to
provide large stock of homogeneous mitochondrial fractions that
were needed for initial evaluations. They were prepared using a
method adapted from (Smith, 1967). All operations were conducted at a temperature of 6 °C. Ventricular cardiac muscle obtained from freshly slaughtered animals was homogenized in
cold 0.27 M sucrose, 10 mM K2HPO4 with pH adjusted at 7.4 by
addition of 1 M TrisÒ–base. Two centrifugations at 4 °C, first of
the homogenate for 15 min at 1000g then of the resulting supernatant for 30 min at 14,000g, gave a first mitochondrial pellet, which
was homogenized in 0.27 M sucrose, 2 mM TrisÒ–HCl, pH 7.4 and
submitted to the same two low speed-high speed centrifugations.
The final mitochondrial pellet was homogenized at a concentration
of 40 mg/mL and the mitochondrial suspension was frozen in liquid nitrogen as small beads of 50 lL volume and stored at
80 °C. Yield usually was 4–6 g of mitochondrial proteins for one
heart. Mouse quadriceps was elected as an easily accessible material allowing the analysis of homogenates preparation. It was obtained from normal animals anesthetized with 2% isoflurane
inhalation and kept at 80 °C before use. Muscle was homogenized
with a glass–glass Potter in 9 vol of homogenization buffer (typically 50 mg of muscle in 450 lL of buffer), and spun down at
650 g during 20 min at 4 °C. The supernatant was kept and the pellet was suspended in 10 vol of homogenization buffer and submitted to the same procedure. Both supernatants were pooled and
used for the assays.
Control human muscle and fibroblasts were obtained through
the AFM tissue repository bank in accordance to the local ethics
committee. Both muscle fragments and skin biopsy were obtained
during surgery of patients without neuromuscular disease. Muscle
homogenates were prepared in a manner similar to the mouse
muscle homogenates. Fibroblasts were cultured in a high glucose
medium supplemented with 1 mM pyruvate, 50 lg/mL uridine,
and 10% FCS. They were harvested using standard protocols. For
the assays, a pellet from a T75 flask, kept at 80 °C, was suspended
in 300 lL of homogenization buffer and sonicated during 5 s on ice.
All assays were performed in temperature-controlled single
wavelength spectrophotometer with a multi-cuvette sampler.
2.3. Methods
To establish optimal reaction conditions, each parameter was
separately assayed, beginning with the conditions proposed during
initial discussions. These parameters were assay buffer concentration, pH, substrate(s) concentration, possible inhibitor(s) and adjuvant(s) such as magnesium, bovine serum albumin (BSA), and
EDTA. The last parameter verified was the linearity of the assay
333
F. Medja et al. / Mitochondrion 9 (2009) 331–339
with respect to time and protein concentration. Additional tissue
preparations were tested only for the assay of respiratory complex
I as they were reported to improve the proportion of rotenone sensitive activity (Chretien et al., 1990). They were a supplementary
cycle of freezing and/or an osmotic shock performed by incubation
of the tissue sample in water at 37 °C during 5 min (weight/volume
from 0.05% to 0.00025% depending on the tissue). The nature, preparation and source of all reagents are indicated on the website of
the network of French laboratories, which is accessible at http://
lbbma.univ-angers.fr/fmdn. Protein concentration was evaluated
with the BCA protein assay (PierceÒ) or the Lowry method.
lish), were therefore posted at http://lbbma.univ-angers.fr/fmdn,
an open access website of one of the French network centers.
The experimental data represent 28 Excel documents, organized
as seven documents: one for each activity (respiratory complex I, II,
III, and IV, combined activities I + III and II + III, and citrate synthase) containing each four documents (one for each tissue: beef
heart mitochondria, mouse muscle homogenate, human muscle
homogenate and human skin fibroblasts suspension). Only the
most salient results are commented hereafter.
3.3. Different homogenization buffers resulted in different
mitochondrial activities
3. Results
3.1. The diversity of the protocols resulted in striking differences in
mitochondrial activities
Aliquots of a common preparation of isolated beef heart mitochondria were sent to all the French centers that were performing
biochemical evaluation of mitochondrial activities. All but one of
these centers sent back the mitochondrial activities observed using
their usual protocols (Table 1). These protocols varied with respect
to temperature, homogenization buffer, and assay medium composition. Evaluation of the protein content was consistent whatever
the method used for its measurement. In contrast, as previously reported in similar analyses (Gellerich et al., 2004; Kirby et al., 2007),
the differences of respiratory chain assays protocols had striking
consequences on the range observed for each individual activity.
As an example, the highest activity measured for citrate synthase
was 8.6 times the lowest measurement (Table 1). Furthermore
the ratios between activities also varied greatly between centers,
likely due to the heterogeneous impact of the variability in the protocols used (Table 1). For example the highest ratio of complex III
activity to citrate synthase activity was 9.7 times the lowest ratio.
This initial evaluation convinced the network members of the need
to find and apply standardized protocols in order to allow comparison between centers and to set up a quality control.
3.2. To allow sharing the experimental data underlying the proposed
protocols, an open access website was created
Access to the complete set of data was considered important for
a widespread standardization procedure. It also might be useful to
biologists with specific questions. All experimental results (in
French), as well as proposed assay procedures (in French and Eng-
Three different homogenization buffers were used in the different laboratories of the French network. These buffers have been
previously described (Letellier et al., 1992; Lombès et al., 1991;
Rustin et al., 1994). They share similar pH and osmolarity but have
different composition. Buffer ‘‘CCA” is 250 mM sucrose, 40 mM KCl,
2 mM EGTA, 1 mg/mL fatty acid free BSA and 20 mM Tris–HCl pH
7.2 (Rustin et al., 1994). Buffer ‘‘MAN” is 225 mM mannitol,
75 mM sucrose, 0.1 mM EDTA and 10 mM Tris–HCl pH 7.4 (Letellier et al., 1992). Buffer ‘‘CPT” is 150 mM KCl and 50 mM Tris–
HCl pH 7.4 (Lombès et al., 1991).
The composition of the homogenization buffer had an unexpected great impact on the observed activities. For example, respiratory complex IV and citrate synthase activity levels in the beef
heart mitochondria were significantly lower when ‘‘CCA” buffer
was used to dilute the mitochondrial pellet as compared to the
activities obtained with the two other buffers (Fig. 1). In contrast,
the results obtained using either ‘‘MAN” or ‘‘CPT” buffer did not
significantly differ (Fig. 1). The ‘‘MAN” buffer was more generally
utilized in the different diagnostic centers than the ‘‘CPT” buffer
and was therefore chosen for subsequent sample preparations.
3.4. Phosphate concentration of the reaction buffer had significant
impact on mitochondrial activities
All French diagnostic centers used phosphate buffer for the assay of respiratory complex activities and Tris buffer for citrate synthase analysis (summarized in Table 2). A consistent pH was used.
The influence of pH was systematically re-evaluated (see experimental data at http://lbbma.univ-angers.fr/fmdn). These experiments confirmed that pH has a strong influence on respiratory
chain activities and that the pH values in use in all the French diagnostic centers were optimal (values listed in Table 2).
Table 1
Impact on the activities measured by spectrophotometric assays of the mitochondrial respiratory chain of the diversity of protocols used in the different French centers.
Centers
1
2
3
4
5
6
7
8
9
Range
Activities
I
SDH
II + III
III
IV
CS
637
552
2244
–
2917
4517
763
988
544
589
3337
2036
2378
1890
1003
2774
3930
3697
860
938
872
2122
1636
3248
652
531
790
1632
4530
1997
697
780
476
2200
2010
1560
960
1190
1200
3745
3070
1330
–
358
550
1101
2200
527
–
–
792
–
1003
1793
637–2378
531–1890
476–2244
589–3745
1003–4530
527–4517
0.14
0.12
0.37
0.49
0.29
1.64
1.40
0.23
0.18
0.64
0.51
0.75
1.06
2.37
0.61
0.71
0.26
0.29
0.65
0.50
0.99
0.53
1.30
0.33
0.27
0.82
2.27
0.83
0.14
0.36
0.45
0.50
1.41
1.29
1.46
0.35
1.09
0.72
0.89
2.82
2.31
0.80
0.31
1.22
–
0.68
2.09
4.17
–
–
0.50
–
–
–
0.56
–
–
–
0.14–0.72
0.12–0.89
0.29–2.82
0.50–4.17
0.28–2.37
0.14–0.61
0.18–1.30
Ratios
I/CS
SDH/CS
III/CS
IV/CS
I/II + III
I/IV
III/IV
0.65
0.28
0.22
–
Activities are expressed as nanomoles per minute and milligram protein. I, rotenone-sensitive NADH ubiquinone oxidoreductase activity; SDH, succinate dehydrogenase
activity (proximal part of respiratory complex II); II + III, succinate cytochrome c oxidoreductase activity; III, antimycin-sensitive ubiquinol oxidoreductase activity; IV,
cytochrome c oxidase activity; CS, citrate synthase activity. Range = range of values between the different centers numbered from 1 to 9. –, data not available.
334
F. Medja et al. / Mitochondrion 9 (2009) 331–339
3.5. A narrow range of optimal substrate concentration was observed
for several respiratory complex activities
Activity
(nmol.min -1.mg -1)
Beef heart mitochondria
5000
Citrate synthase
4000
Some substrates showed a biphasic effect (activation followed
by inhibition) on the respiratory complex activity, which led to a
very narrow range for their optimal concentrations. This was particularly true for respiratory complexes III and IV (Fig. 3). It was
also observed for the combined I + III and II + III activities (see
experimental data at http://lbbma.univ-angers.fr/fmdn).
The activity of respiratory complex III is calculated after measuring ubiquinol cytochrome c oxidoreductase activity in the presence and in the absence of antimycin, a specific respiratory
complex III inhibitor. The specific complex III activity is obtained
by subtracting the antimycin insensitive activity from the total
activity. The optimal substrate concentration differed slightly between the two activities, being higher (75–125 lM) for the total
activity than for the antimycin-sensitive activity (50–75 lM)
(Fig. 3). The concentration of 50 lM cytochrome c was chosen to
favor the specific antimycin-sensitive activity. The mechanisms
underlying the biphasic effect of substrate concentration were
probably diverse and their amplitude and position in substrate
concentration depended on the tissue. They were particularly
striking with murine muscle homogenate (Fig. 3), but less pronounced for other tissues.
In the case of respiratory complex IV, the reaction rate initially
followed a hyperbolic relationship to increasing concentrations of
reduced cytochrome c followed by substrate inhibition (Fig. 3).
There again the extent of that behavior depended on the tissue,
most probably in connection to the level of enzyme activity. It
was much less pronounced in human sonicated fibroblasts than
in human muscle (Fig. 3).
Complex IV
3000
2000
1000
0
MAN
CPT
CCA
Fig. 1. Influence of the homogenization buffer on mitochondrial activities of beef
heart mitochondria. An identical sample of isolated beef heart mitochondria was
diluted to its working concentration with three different homogenization buffers:
‘‘MAN”, ‘‘CPT”, ‘‘CCA” as described in the text. Citrate synthase activity (grey bars)
was measured as the rate of appearance of thionitrobenzoic acid followed by the
increase of absorbance at 412 nm during 3 min in the presence of 10 lg of isolated
mitochondria proteins, 100 mM Tris–HCl pH 8.0, 0.1% Triton X-100, 300 mM
acetylCoA, 100 lM DTNB, and 500 lM oxaloacetate. Respiratory complex IV activity
(white bars) was measured as the rate of cytochrome c oxidation at 550 nm during
the first minute of the assay in the presence of 4 lg of isolated mitochondria,
50 mM K phosphate pH 7.0 and 80 lM of reduced cytochrome c. The results are
shown as the mean values of two assays, the range of which is shown with the error
bars; activities are expressed as nanomoles per minute per milligram protein.
Dilution of the sample in CCA buffer was associated with a significant decrease of
citrate synthase (twofold decrease) and of complex IV (threefold decrease)
activities.
In contrast to pH and composition, the phosphate concentration
varied between French diagnostic centers. This was shown to have
significant influence on all the respiratory chain activities with
some differences between tissues (Fig. 2). The sensitivity to phosphate concentration was particularly important for complex IV
activity and is shown in Fig. 2. The optimal buffer concentrations
chosen for each assay are summarized in Table 2.
3.6. Difficulty to obtain linear kinetics as a function of time
In most cases the high specific activity of the respiratory complex, and possibly its high concentration as compared to the sub-
Table 2
Conditions used in the standardized protocols for spectrophotometric assays of the respiratory chain.
Activity
I
II
III
IV
I + III
II + III
CS
pH
Phosphate
Tris
Inhibitor in
the
assay
Substrates
7.5
50
–
±12.5 lM rot
7.5
25
–
1 mM KCN
7.5
100
–
1 mM KCN ±12.5 lg/mL
antim
7.0
50 (25 for fibros)
–
–
7.5
50
–
1 mM KCN ±12.5 lM
rot
7.5
20
–
1 mM KCN
8.0
–
100
–
100 lM NADH
100 lM dUb
20 mM succ.
100 lM dUb
200 lM dUb-H2
50 lM cyt c
100 lM red cyt c
(50 for
fibroblasts)
200 lM NADH
100 lM cyt c
20 mM succ.
100 lM cyt c
100 lM DTNB
300 lM ACoA
Adjuvants
3.75 mg/mL
BSA
340
±rot
NADH
3
40 (4)
4032.3
(40,323)
250 lM EDTA
–
1 mg/mL BSA
550
±antim
dUb-H2
3*
30 (0.75)
1801.8 (72,072)
550
–
Tissue
3
40 (1)
1351.4 (54,054)
550
±rot
NADH
3
40 (4)
1351.4 (13,514)
100 lM ATP 2 mg/mL
BSA
550
–
cyt c
3
40 (4)
1351.4 (13,514)
500 lM OA
0.1% TritonX100
412
Baseline
OA
4
40 (4)
1838.2
(18,382)
k (nm)
Subtraction
Start
Reading
Tissue
Calculation
factor
50 lM DCPIP
2 mg/mL BSA 100 lM
ATP
600
Baseline
Dub
3
40 (4)
1308.9 (13,089)
Phosphate: concentration of potassium phosphate expressed as mmol/L; Tris: concentration of Tris buffer expressed as mmol/L; inhibitor: rot = rotenone, KCN = potassium
cyanide, antim = antimycin A. Substrates: dUb = decylubiquinone, succ. = succinate, DCPIP = 2,6-dichlorophenolindophenol, dUb-H2 = decylubiquinol, cyt c = cytochrome c,
red cyt c = reduced cytochrome c, ACoA = acetylCoenzyme A, OA = oxaloacetate, DTNB = 5,50 dithiobis 2 nitrobenzoic acid; adjuvants: reagents that are not substrates nor
inhibitors: BSA = bovine serum albumin; subtraction: ±rot or ±antim = the activity is measured in two parallel cuvettes, with and without the specified inhibitor and the
specific activity is calculated by subtracting the activity measured in the presence of the inhibitor from that measured in its absence, baseline = the specific activity is
calculated by subtracting the activity in the absence of substrate from that observed after its addition; k = wavelength used for the assay, the extinction coefficient
(L mmol1 cm1) used were 6.2 for NADH at 340 nm, 19.1 for DCPIP at 600 nm, 18.5 for cyt c at 550 nm, and 13.6 for TNB (thionitrobenzoic acid) at 412 nm; start = compound
used to start the reaction; reading = duration of the reaction measurement expressed as minutes, * duration of reading is 1 min for beef heart mitochondria; tissue = amount
of tissue used for the assay expressed as micrograms of proteins per assay; calculation factor = factor used to transform the recorded optic density into nanomoles min1.
mg prot1; the numbers between brackets are the amount of tissue or the calculation factor used for isolated beef heart mitochondria.
F. Medja et al. / Mitochondrion 9 (2009) 331–339
tionship. However, in tissues with less active respiratory chain enzymes (muscle homogenates or fibroblasts), we could define a
range of protein content per assay where the relationship between
protein content and activity was close to linear. That range was always narrow because it was the result of a compromise between
linearity and the need to observe significant activity (Fig. 5).
IV activity
(nmol.min-1.mg-1)
Beef heart mitochondria
4000
3000
2000
3.8. Standardized protocols have been applied in several French
centers and have given rise to independent sets of control values
1000
0
0
25
50
75
100
75
100
Phosphate
IV activity
(nmol.min-1.mg-1)
Human muscle homogenate
80
60
40
20
0
0
25
50
Phosphate
IV activity
(nmol.min-1.mg-1)
Human sonicated fibroblasts
80
60
40
20
0
335
0
25
50
75
100
Phosphate
Fig. 2. Influence on complex IV activity of the phosphate concentration used in the
assay medium. Complex IV activity was measured as the rate of cytochrome c
oxidation at 550 nm in the presence of various concentrations of potassium
phosphate buffer pH 7.0 (Phosphate), 80 lM of reduced cytochrome c (100 lM for
muscle), and either 4 lg beef heart mitochondria, 50 lg human muscle homogenate, or 30 lg suspension of sonicated human fibroblasts. Activities were expressed
as nanomoles cytochrome c oxidized per minute per milligram protein. The
sensitivity of respiratory complex IV to phosphate concentration was striking with a
sharp maximum of activity in both human muscle and skin fibroblasts. It was less
pronounced with isolated beef heart mitochondria.
During the months following the implementation of the standardized protocols in clinical practice in La Salpêtrière Hospital
in Paris, a sample of the large stock beef heart mitochondria was
included whenever patient samples were analyzed. Reproducibility of the protocols could therefore be evaluated using the repeated
analyses of the same beef heart mitochondria preparation (Table
3). The standard deviation for most assays was close to 10% of
the mean activity, thus showing their good reproducibility. This
was not true for the assays of complex III activity, either in isolation or as part of a combined activity. The standard deviation, expressed as % of the mean activity, was 57%, 41%, and 26% for the
antimycin-sensitive ubiquinol cytochrome c activity (complex
III), rotenone-sensitive NADH cytochrome c oxidoreductase activity (combined I + III) and succinate cytochrome c oxidoreductase
activity (combined II + III), respectively. These results show that
complex III activity is not reliably measured in isolated beef heart
mitochondria.
Since their implementation in clinical practice, standardized
protocols have also been applied to biopsies from patients who
were later deemed to be free from specific disease. These samples
were a posteriori considered as controls. Three different diagnostic
centers gathered a sufficient number of these ‘‘control samples” to
define the range of normal values in muscle, liver and cultured
fibroblasts (Table 3). Interestingly the range of normal values appeared similar in the three centers despite the absence of proper
inter-laboratory quality control process. Furthermore, in each center, the standard deviation of control complex III or combined I + III
and II + III activities was similar to that observed with the other
respiratory complexes activities. The unreliability of the evaluation
of complex III activity therefore appeared to be essentially confined
to the very active beef heart mitochondria. In addition, to validate
the new protocols we tried them on a dozen cultured skin fibroblasts with previously identified defects in the respiratory chain
complexes. In each case, the previously identified defect was confirmed with the new standardized protocols.
4. Discussion
strate concentration, gave rise to two exponential decays. The relevant measure, which is the initial slope of the first exponential,
was difficult to accurately evaluate. This was particularly obvious
with isolated beef heart mitochondria in the case of complex III
and IV activities (Fig. 4). Quasi-linear kinetics during at least
2 min could however most often be obtained by reducing the
amount of protein in the assay. When dealing with the two most
active respiratory complexes III and IV in isolated mitochondria,
this was only possible with minimal amount of protein (Fig. 4).
3.7. Difficulty to find a range of protein content in the assay with linear
relationship with activity
A linear relationship between the amount of protein and the observed activity is ideal to define and then compare specific activities in a diagnostic assay. It was however difficult to obtain with
most assays of the respiratory chain complexes. This was particularly the case with the very active beef heart mitochondria for
which we have never found conditions that conferred a linear rela-
4.1. Standardized procedures are indispensable for the improvement of
the screening and identification of mitochondrial diseases
This paper describes the development of standardized protocols
for the most frequently used assays of the respiratory chain activities. It has been an indispensable step in the improvement of the
screening and identification of mitochondrial diseases, which is the
goal of the network of French diagnostic centers for mitochondrial
diseases. Previously, results from the assays of respiratory chain
activities were difficult to compare between centers (as shown in
Table 1 and in Gellerich et al., 2004; Kirby et al., 2007). Asking a
second advice from a different diagnostic center might have therefore led to repeated invasive procedures such as biopsies, repeated
analyses, and conflicts between centers, all of which were detrimental for the patient. Standardized assays of respiratory chain
activities are mandatory because they allow sharing the results
of patients’ investigations among different diagnostic centers as
well as developing procedures for quality control.
336
F. Medja et al. / Mitochondrion 9 (2009) 331–339
Complex III - Mouse muscle homogenate
100
% antimycin sens.
Total activity
300
200
100
0
0
50
100
150
200
75
50
25
0
0
50
Cyt c (µM)
100
150
200
Cyt c (µM)
Complex IV – Human muscle/fibroblasts
Muscle homogenate
Sonicated fibroblasts
80
60
IV activity
IV activity
60
40
20
0
0
50
100
150
200
Cyt c (µM)
40
20
0
0
20
40
60
80
100
Cyt c (µM)
Fig. 3. A narrow range of optimal substrate concentration was observed for several respiratory complex activities. Complex III activity (ubiquinol cytochrome c
oxidoreductase) in mouse muscle was measured by the rate of cytochrome c reduction at 550 nm in the presence of various concentrations of cytochrome c (Cyt c), 25 lg
mouse muscle homogenate, 100 mM potassium phosphate buffer pH 7.5, 200 lM decylubiquinol, 1 mM KCN, 5 lM rotenone, 0.25 mM EDTA, and 1 mg/mL BSA. Total activity
(right panel, total activity) was measured in the absence of antimycin while the specific, antimycin sensitive, complex III activity (left panel, % antimycin sens.) was calculated
by subtraction of the activity measured in the presence of 5 lg/mL antimycin from the total activity. It was expressed as the percent of total activity due to the antimycinsensitive activity. Complex IV activity was measured as the rate of cytochrome c oxidation at 550 nm in the presence of various concentrations of reduced cytochrome c (Cyt
c), and either 50 mM potassium phosphate buffer pH 7.0 and 50 lg human muscle homogenate, or 10 mM potassium phosphate buffer pH 7.0 and 30 lg suspension of
sonicated human fibroblasts. Activities were expressed as nanomoles cytochrome c oxidized per minute and per milligram protein. Cytochrome c concentration had a
biphasic effect on the respiratory complex III and IV activity thus leading to a narrow range for its optimal concentration.
4.2. The proposed standardized protocols are only part of the
enzymatic evaluation of mitochondrial diseases
Our work evaluated the most commonly used protocols but left
aside a number of other useful techniques such as the evaluation of
oxygen consumption, ATP synthesis, and the preparation of isolated mitochondria. Despite their obvious usefulness, these methods were initially left aside because they were used in only some
of the diagnostic centers. Even within the framework of the present
standardization, we did not address every aspect of the techniques.
In the homogenate preparation for example, we only evaluated the
homogenization buffer composition and not procedures of homogenization and centrifugation that were very similar in all French
centers. The development of standard protocols for all respiratory
chain analyses is a monumental task that we do not intend to address before having proven the feasibility of a quality control program based on the present standardized protocols. Indeed, only a
quality control will be able to evaluate if the present standardization is sufficient to obtain comparable data in all centers.
4.3. Clinical practice has been the essential objective of the work
Our work is an additional demonstration of the complexity of
the enzymatic behavior of the respiratory chain complexes, which
has been extensively shown in numerous excellent previous papers (Bénit et al., 2006; Birch-Machin et al., 1989; Chretien et al.,
2004; Estabrook and Pullman, 1967; Kirby et al., 2007; Rustin
et al., 1994; Trounce et al., 1996; Zheng et al., 1990). To our knowledge however, such a comprehensive study has never been performed to try and find the simplest and optimal conditions to
assess respiratory chain complexes activities for use in clinical
practice. It is important to note that, in most instances, the huge
initial discrepancy in the recorded activities between different centers (Table 1) could be explained by the influence of only two factors, namely differences in the homogenization buffers and in
phosphate concentration in the assays.
The protocols we present in this paper represent compromises
between several factors. The wish to have linear kinetics both as a
function of time and as a function of enzyme concentration requires
the use of low amounts of tissue, but not too low otherwise the results become less reproducible. The search for the simplest protocols (consistent temperatures, buffers common to most assays,
addition of the sole inhibitors or adjuvants with significant and
reproducible impact on the recorded activity) is essential for a routine diagnostic procedure to be applied in different centers. The final protocols are therefore a compromise between these practical
considerations and the optimal conditions identified in research
laboratories. In the end, we have been able to find a good compro-
F. Medja et al. / Mitochondrion 9 (2009) 331–339
III: total ubiquinol cyt c oxidoreductase activity
2.3
Absorbance
2.0
1.7
1.4
1.1
0.8
0
1
2
3
Time (minutes)
III: antimycin resistant activity
Absorbance
1.2
1.1
1.0
0.9
0.8
0
1
2
3
Time (minutes)
IV activity
Absorbance
2.5
2.0
1.5
and linearity with time. Although essentially similar, the published
protocols differ from those set up in the present work, for example
in the presence of additional reagents (such as EDTA or magnesium), or in the chosen substrate and buffer concentration. These
differences may in part be due to the material assayed. Cultured
fibroblasts were most often the only tissue assayed in these reports
whereas we assayed several tissues and chose the simplest protocol compatible with muscle and fibroblasts analysis. In addition
the striking influence of the homogenization buffer composition
was shown by the comparison between centers that initiated our
work whereas it could not have been taken into account in a single
center standardization process. We did not undertake automation
of the assays within the French network for the two following reasons. We considered that automation would not bring significant
time saving to justify the required supplemental technical verifications as the manual preparation of samples and reagents represents at least half the time spent for the measurement in our
present protocol where we simultaneously assay five diagnostic
samples and a control. In addition, the inter-assay variability obtained with our standardized protocols is close to that reported
with automation procedures.
Our choice of first assaying beef heart mitochondria and mouse
muscle aimed at sparing control human muscle and cultured fibroblasts. It however illustrated the variability of respiratory chain
activities and their ratios in different tissues (Table 3). In the
end, beef heart mitochondria proved a suboptimal control sample
for establishing clinical diagnostic tests because this tissue exhibited behaviors due to high enzyme activity levels that were not
encountered with human tissue preparations. This was also true
for mouse muscle, whose kinetic behavior was often significantly
different from that of human muscle, for example in the inhibition
of complex III activity by high concentration of cytochrome c (see
Fig. 3). Most of the difficulties encountered probably stemmed
from the high specific activities of beef heart isolated mitochondria
and mouse muscle. Their analysis could therefore be considered to
act as a safeguard against errors with human specimens exhibiting
very high activities.
4.4. The standardization already brought a set of comparable data
1.0
0.5
337
0
1
2
3
4
Time (minutes)
Fig. 4. Quasi-linear kinetics with time were very difficult to obtain with very active
tissue. Time course of absorbance values are shown for the assays of Complex III
(two upper panels) and complex IV (lower panel). Absorbance values are shown
with black circles of increasing size with the increasing amount of mitochondrial
protein (1, 2, 4, 6 and 10 lg of beef heart mitochondria for the assays of complex III
activity and 1 and 2 lg of beef heart mitochondria for the assay of complex IV
activity). Total ubiquinol cytochrome c oxidoreductase activity was assayed in the
presence of 100 lM cytochrome c, 75 mM potassium phosphate buffer pH 7.5,
200 lM decylubiquinol, 1.5 mM KCN, 5 lM rotenone, 0.25 mM EDTA, and 1 mg/mL
BSA. Antimycin resistant ubiquinol cytochrome c oxidoreductase activity was
assayed in the same medium with the addition of 5 lg/mL antimycin. Complex IV
activity was measured in the presence of 100 lM reduced cytochrome c and 50 mM
potassium phosphate pH 7.0. Only the lowest amount of mitochondria gave a
decrease of absorbance with pseudo-linear kinetics with time.
mise for all the assays despite the fact that complex III assay remained unsatisfactory with respect to its reproducibility (Table
2). The precise protocols as well as the complete set of experimental
data may be found at http://lbbma.univ-angers.fr/fmdn.
Automation of respiratory chain assays have been described in
several papers (Kramer et al., 2005; Wibom et al., 2002; Williams
et al., 1998). It obviously implied standardization to make sure
the conditions were optimal with respect to maximal velocity
The standardized protocols are now progressively applied in six
centers in France, which allows for comparison and management
of larger sets of results on mitochondrial diseases. Proper quality
control process has not yet been established. It will require to produce sufficient quantity of a set of cell lines with diverse enzymatic
defect that will be sent to the diagnostic centers in order to serve as
blind test samples (Auré et al., 2007). The similarity of the results
obtained on control samples in three different centers (Table 3)
is a good indication that the network will be able to gather results
from numerous control samples analyzed in several diagnostic
centers. It will therefore be possible to define normal values for enzyme activities using appropriate large data sets, a situation which
is rarely possible in a single center.
Complex III remained a most difficult respiratory complex to assess (Chretien et al., 2004; Krahenbuhl et al., 1994). The difficulties
are due to the necessity to prepare reduced ubiquinone, to the high
specific activity of the enzyme, and to direct redox interactions between substrates and products of the complex, since auto-oxidized
quinone produces both superoxide and hydrogen peroxide, which
can directly modify (reduce) cytochrome c (Nohl et al., 1998).
The extent of the latter phenomenon greatly depends on the quality of cytochrome c preparation, even from the same manufacturer.
The difficulties in the measurement of isolated complex III activity
cannot be overcome by measuring the combined II + III or I + III
activities. First a partial defect of complex III can be masked in
the combined activities (Taylor et al., 1993, 1994) and second,
338
F. Medja et al. / Mitochondrion 9 (2009) 331–339
Beef heart mitochondria
15000
IV activity
(nmol.min-1.mg-1)
III activity
(nmol.min-1.mg-1)
10000
8000
6000
4000
2000
0
0
2
4
6
8
12000
9000
6000
3000
0
10
0
2
Protein (µg/assay)
4
6
8
10
Protein (µg/assay)
Human muscle
500
IV activity
(nmol.min-1.mg-1)
III activity
(nmol.min-1.mg-1)
800
600
400
200
0
0
10
20
30
40
400
300
200
100
0
50
0
10
20
Protein/assay
30
40
50
60
Protein/assay
Human fibroblasts
120
IV activity
(nmol.min-1.mg-1)
III activity
(nmol.min-1.mg-1)
160
120
80
40
0
0
10
20
30
40
50
Protein/assay
90
60
30
0
0
10
20
30
40
50
60
70
Protein/assay
Fig. 5. Narrow range of protein content in the assay showed linear relationship with activity. The influence of the amount of protein in the assay is shown for complex III (III
activity = antimycin-sensitive ubiquinol cytochrome c activity) and complex IV (cytochrome c oxidase activity = IV activity) in beef heart mitochondria (upper panel), human
muscle homogenate (middle panel) and sonicated human fibroblasts (lower panel). Activities were expressed as nanomoles per minute and per milligram protein. The rate of
cytochrome c oxido-reduction was followed at 550 nm. For beef heart mitochondria, III activity was measured in the presence of 100 lM cytochrome c, 75 mM potassium
phosphate pH 7.5, 200 lM decylubiquinol, 1.5 mM KCN, 5 lM rotenone, 0.25 mM EDTA, and 1 mg/mL BSA, ±5 lg/mL antimycin while IV activity was measured in the
presence of 80 lM reduced cytochrome c and 50 mM potassium phosphate pH 7.0. For human muscle homogenate, III activity was measured in the presence of 50 lM
cytochrome c, 100 mM potassium phosphate pH 7.5, 150 lM decylubiquinol, 0.5 mM KCN, and 0.5 mg/mL BSA, ±5 lg/mL antimycin while IV activity was measured in the
presence of 100 lM reduced cytochrome c and 50 mM potassium phosphate pH 7.0. For sonicated human fibroblasts, III activity was measured in the presence of 50 lM
cytochrome c, 100 mM potassium phosphate pH 7.5, 200 lM decylubiquinol, 1 mM KCN, and 1 mg/mL BSA, ±5 lg/mL antimycin while IV activity was measured in the
presence of 80 lM reduced cytochrome c and 25 mM potassium phosphate pH 7.0. Narrow ranges of protein concentration with linear relationship between activity and
amount of protein in the assay could be observed in human muscle homogenate and sonicated fibroblasts. In contrast such a linear relationship was never observed in beef
heart mitochondria with very high activities of respiratory complex III and IV.
some of the complications that arise when measuring isolated
complex III activity are also present in the assay of the combined
activities (Kubota et al., 1992).
5. Conclusion
Our work shows that standardization of the spectrophotometric
assays of respiratory chain activities is a feasible task. Its comple-
tion will require setting up a quality control procedure that is
indispensable for fine technical adjustments. Despite its difficulties, standardization of the enzymatic analyses is worth the effort.
For the patients, it allows investigations to take place in different
centers without the need to repeat the same assays. For the diagnostic centers, it allows comparison and discussion of results as
well as the possibility for control accreditation. We are very aware
that the present work is only a first step in the process of establish-
339
F. Medja et al. / Mitochondrion 9 (2009) 331–339
Table 3
Results of the standardized protocols in three different diagnostic centers.
I
II
III
IV
I + III
II + III
CS
I/CS
II/CS
III/CS
IV/CS
IV/I
Beef heart mito. (n = 581)
Human muscle (n = 891/392/263)
Human liver (n = 301/212)
Human fibroblasts (n = 501)
1809 ± 178
1813 ± 174
888 ± 507
8867 ± 780
426 ± 176
1261 ± 324
2165 ± 215
0.84 ± 0.10
0.59 ± 0.12
0.46 ± 0.29
4.90 ± 0.56
7.30 ± 1.54
42 ± 16/42 ± 8/56 ± 31
61 ± 22/68 ± 20/79 ± 38
166 ± 72/301 ± 77/252 ± 119
184 ± 64/210 ± 42/205 ± 98
32 ± 16/ND/ND
49 ± 16/48 ± 13/77 ± 46
220 ± 74/278 ± 52/202 ± 102
0.19 ± 0.05/0.19 ± 0.05/0.27 ± 0.06
0.29 ± 0.07/0.27 ± 0.07/0.40 ± 0.11
0.76 ± 0.25/1.21 ± 0.31/1.33 ± 0.46
0.90 ± 0.24/0.86 ± 0.21/1.02 ± 0.32
4.87 ± 1.51/4.99 ± 1.20/3.79 ± 1.30
27 ± 12/36 ± 12
125 ± 59/169 ± 24
84 ± 35/80 ± 28
69 ± 31/ND
–
55 ± 24/37 ± 3*
65 ± 31/80 ± 13
0.48 ± 0.28/0.50 ± 0.17
2.27 ± 1.30/2.10 ± 0.18
1.53 ± 0.79/1.08 ± 0.26
1.28 ± 0.66/0.95 ± 0.19
2.91 ± 1.03/2.11 ± 0.79
–
27 ± 8
55 ± 17
83 ± 15
24 ± 7
30 ± 7
79 ± 18
–
0.36 ± 0.10
0.79 ± 0.25
1.12 ± 0.22
–
n: number of samples; 1,2,3 data provided by the diagnostic center in La Salpêtrière hospital1, Paris, in CHU d’Angers2, and in CHU de Caen3; values of activities are expressed as
mean ± standard deviation and as nanomoles per minute and per milligram protein; I: respiratory complex I activity, i.e. rotenone-sensitive NADH ubiquinone oxidoreductase
activity; II: respiratory complex II activity, i.e. succinate cytochrome c oxidoreductase activity; III: respiratory complex III activity, i.e. antimycin-sensitive ubiquinol
cytochrome c oxidoreductase activity; IV: respiratory complex IV activity, i.e. cytochrome c oxidase activity; I + III: rotenone-sensitive NADH cytochrome c oxidoreductase
activity; II + III: succinate cytochrome c oxidoreductase activity; CS: citrate synthase activity; I/CS, II/CS, III/CS, IV/CS, and IV/I are the ratios of the corresponding activities; –:
data not available. Whatever the experimental conditions tested, rotenone sensitive I activity in control human skin fibroblasts suspension could appear to be null. This assay
was therefore considered unreliable in these cell preparations. *: data obtained on only three samples.
ing consistent and reproducible testing of mitochondrial function
in patients with a suspected mitochondrial disorder.
Acknowledgements
This work has been supported by grants from INSERM, the AFM
(Association Française contre les Myopathies) and the GIS-Maladies rares. We thank Dr. Nigel Clarke for his most useful comments
on the manuscript.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.mito.2009.05.001.
References
Auré, K., Mamchaoui, K., Frachon, P., Butler-Browne, G.S., Lombès, A., Mouly, V.,
2007. Impact on oxidative phosphorylation of immortalization with the
telomerase gene. Neuromusc Disord 17, 368–375.
Bénit, P., Goncalves, S., Dassa, E.P., Brière, J.J., Martin, G., Rustin, P., 2006. Three
spectrophotometric assays for the measurement of the five respiratory chain
complexes in minute biological samples. Clin Chim Acta 374, 81–86.
Birch-Machin, M.A., Shepherd, I.M., Watmough, N.J., Sheratt, H.S.A., Bartlett, K.,
Darley-Usmar, V.M., Milligan, D.W.A., Welch, R.J., Aynsley-Green, A., Turnbull,
D.M., 1989. Fatal lactic acidosis in infancy with a defect of complex III of the
respiratory chain. Pediatr Res 25, 553–559.
Chretien, D., Bourgeron, T., Rötig, A., Munnich, A., Rustin, P., 1990. The measurement
of the rotenone-sensitive NADH cytochrome c reductase activity in
mitochondria isolated from minute amount of human skeletal muscle.
Biochem Biophys Res Commun 173 (1), 26–33.
Chretien, D., Slama, A., Briere, J.J., Munnich, A., Rotig, A., Rustin, P., 2004. Revisiting
pitfalls, problems and tentative solutions for assaying mitochondrial respiratory
chain complex III in human samples. Curr Med Chem 11 (2), 233–239.
DiMauro, S., Hirano, M., 2005. Mitochondrial encephalomyopathies: an update.
Neuromusc Disord 15 (4), 276–286.
Estabrook, R.W., Pullman, M.E., 1967. Oxidation and Phosphorylation. Academic
Press, New York, London.
Gellerich, F.N., Mayr, J.A., Reuter, S., Sperl, W., Zierz, S., 2004. The problem of interlab
variation in methods for mitochondrial disease diagnosis: enzymatic
measurement of respiratory chain complexes. Mitochondrion 4 (5–6), 427–439.
Janssen, A.J., Trijbels, F.J., Sengers, R.C., Smeitink, J.A., van den Heuvel, L.P., Wintjes,
L.T., Stoltenborg-Hogenkamp, B.J., Rodenburg, R.J., 2007. Spectrophotometric
assay for complex I of the respiratory chain in tissue samples and cultured
fibroblasts. Clin Chem 53 (4), 729–734.
Kirby, D.M., Thorburn, D.R., Turnbull, D.M., Taylor, R.W., 2007. Biochemical assays of
respiratory chain complex activity. Method Cell Biol 80, 93–119.
Krahenbuhl, S., Talos, C., Wiesmann, U., Hoppel, C.L., 1994. Development and
evaluation of a spectrophotometric assay for complex III in isolated
mitochondria, tissues and fibroblasts from rats and humans. Clin Chim Acta
230 (2), 177–187.
Kramer, K.A., Oglesbee, D., Hartman, S.J., Huey, J., Anderson, B., Magera, M.J., Matern,
D., Rinaldo, P., Robinson, B.H., Cameron, J.M., Hahn, S.H., 2005. Automated
spectrophotometric analysis of mitochondrial respiratory chain complex
enzyme activities in cultured skin fibroblasts. Clin Chem 51 (11), 2110–2116.
Kubota, T., Yoshikawa, S., Matsubara, H., 1992. Kinetic mechanism of beef heart
ubiquinol:cytochrome c oxidoreductase. J Biochem 111 (1), 91–98.
Letellier, T., Malgat, M., Coquet, M., Moretto, B., Parrot-Roulaud, F., Mazat, J.P., 1992.
Mitochondrial myopathy studies on permeabilized muscle fibers. Pediatr Res 32
(1), 17–22.
Lombès, A., Nakase, H., Tritschler, H.J., Kadenbach, B., Bonilla, E., DeVivo, D.C., Schon,
E.A., DiMauro, S., 1991. Biochemical and molecular analysis of cytochrome c
oxidase deficiency in Leigh’s syndrome. Neurology 41, 491–498.
Nohl, H., Gille, L., Kozlov, A.V., 1998. Antioxidant-derived prooxidant formation
from ubiquinol. Free Radical Biol Med 25 (6), 666–675.
Romero, N.B., Lombès, A., Touati, G., Rigal, O., Frachon, P., Cheval, M.A., Giraud, M.,
Possekel, S., Fardeau, M., Ogier de Baulny, H., 1996. Morphological studies of
skeletal muscle in lactic acidosis. J Inher Metab Dis 19, 528–534.
Rustin, P., Chretien, D., Bourgeron, T., Gerard, B., Rotig, A., Saudubray, J.M., Munnich,
A., 1994. Biochemical and molecular investigations in respiratory chain
deficiencies. Clin Chim Acta 228 (1), 35–51.
Smith, A., 1967. Preparation, properties, and conditions for assay of mitochondria:
slaughterhouse material, small-scale. Method Enzymol 10, 81–86.
Taylor, R.W., Birch-Machin, M.A., Bartlett, K., Lowerson, S.A., Turnbull, D.M., 1993.
Succinate-cytochrome c reductase: assessment of its value in the investigation
of defects of the respiratory chain. Biochem Biophys Acta 1181, 261–265.
Taylor, R.W., Birch-Machin, M.A., Bartlett, K., Turnbull, D.M., 1994. The control of
mitochondrial oxidations by complex III in rat muscle and liver mitochondria.
Implications for our understanding of mitochondrial cytopathies in man. J Biol
Chem 269 (5), 3523–3528.
Taylor, R.W., Schaefer, A.M., Barron, M.J., McFarland, R., Turnbull, D.M., 2004. The
diagnosis of mitochondrial muscle disease. Neuromusc Disord 14 (4), 237–245.
Touati, G., Rigal, O., Lombès, A., Frachon, P., Giraud, M., Ogier de Baulny, H., 1997. In
vivo functional investigations of lactic acid in patients with respiratory chain
disorders. Arch Dis Child 76, 16–21.
Trijbels, J.M., Scholte, H.R., Ruitenbeek, W., Sengers, R.C., Janssen, A.J., Busch, H.F.,
1993. Problems with the biochemical diagnosis in mitochondrial (encephalo)myopathies. Eur J Pediatr 152 (3), 178–184.
Trounce, I.A., Kim, Y.L., Jun, A.S., Wallace, D.C., 1996. Assessment of mitochondrial
oxidative phosphorylation in patient muscle biopsies, lymphoblasts, and
transmitochondrial cell lines. Method Enzymol 264, 484–509.
Wibom, R., Hagenfeldt, L., von Dobeln, U., 2002. Measurement of ATP production
and respiratory chain enzyme activities in mitochondria isolated from small
muscle biopsy samples. Anal Biochem 311 (2), 139–151.
Williams, A.J., Coakley, J., Christodoulou, J., 1998. Automated analysis of
mitochondrial enzymes in cultured skin fibroblasts. Anal Biochem 259 (2),
176–180.
Zheng, X., Shoffner, J.M., Voljavec, A.S., Wallace, D.C., 1990. Evaluation of procedures
for assaying oxidative phosphorylation enzyme activities in mitochondrial
myopathies muscle biopsies. Biochem Biophys Acta 1019, 1–10.
ATELIER C
Quantification de gènes
mitochondriaux et nucléaires
par PCR quantitative en temps réel
Application à la quantification
des délétions et déplétions
de l’ADN mitochondrial
Valérie DESQUIRET
Bénédicte MOUSSON de CAMARET
CHU Angers
CHU Lyon
VaDesquiret@chu-angers.fr
benedicte.mousson-de-camaret@chu-lyon.fr
Institut Cochin
INSERM U1016 - CNRS UMR 8104
Université Paris Descartes
Paris 17-19 octobre 2013
1
I. Principe de la technique de PCR quantitative en temps réel
La quantification de gènes de l’ADN mitochondrial (ADNmt) dans les
tissus et cellules, est réalisée par une technique de PCR quantitative en temps
réel (qPCR). Cette technique est basée sur la détection et la quantification d’un
émetteur fluorescent pendant le processus d’amplification et l’augmentation
du signal d’émission fluorescente est directement proportionnelle à la quantité
d’amplicons produits pendant la réaction. Il existe deux principes généraux
pour la détection quantitative des amplicons : les agents se liant à l’ADN double
brin (ex. : SYBR Green I) et les sondes fluorescentes.
I.1. Méthodologie de détection
C’est le principe du SYBR Green se liant à l’ADN double brin qui a été
choisi dans la présente méthodologie (Figure 1). L’émission fluorescente
augmente lorsque le SYBR Green est lié à l’ADN double brin.
SYBRgreen
non fluorescent
Amorce
3’
5’
Dénaturation
Hybridation (Tm)
Elongation
xn
cycles
Fluo
Lecture
Détection de la
fluorescence
Figure 1 : Principe de la détection de la fluorescence du SYBR Green I
2
L’augmentation du signal de fluorescence, émise par le SYBR Green I, est
observée pendant l’étape de polymérisation de la PCR lorsque cette molécule
est fixée à l’ADN, et l’émission fluorescente décroît complètement lorsque
l’ADN est dénaturé à l’étape suivante. L’émission de fluorescence est mesurée
à la fin de chaque étape d’élongation, pour chacun des cycles, par un système
de lecture intégré à l’appareil de PCR en temps réel, ce qui permet de suivre
l’augmentation de la quantité d’ADN amplifié durant la réaction de PCR.
On obtient alors à la fin du programme de PCR, une courbe exponentielle
représentant l’augmentation de la fluorescence en fonction du nombre de
cycles de PCR effectués.
Phase
exponentielle
Bruit de
fond
Phase
plateau
Threshold cycle Ct
Figure 2 : Courbe de détection de la fluorescence
en fonction du nombre de cycles de PCR
I.2. Caractéristiques de la qPCR
I.2.1. Le cycle seuil (ou crossing point) : le concept de «cycle seuil» est à la base
d’une quantification précise et reproductible. A chaque cycle, l’intensité de la
fluorescence est proportionnelle à la concentration d’amplicons produits. Le
cycle seuil (Ct) (threshold cycle) représente le nombre de cycles requis où le
signal d’émission de fluorescence est significativement plus élevé que la ligne
de base (Figure 2). Le cycle seuil est également appelé « crossing point » (Cp) et
correspond au nombre virtuel de cycles où chaque échantillon contient le
même nombre de produits de PCR.
3
Plus il y a de copies d’ADN à amplifier, moins élevé sera le nombre de
cycles requis pour atteindre le Ct où le signal d’émission de fluorescence sera
statistiquement et significativement plus élevé que le bruit de fond.
Puis au cours de la phase exponentielle, la quantité d’ADN présent
double à chaque cycle.
I.2.2. La courbe de fusion : à la fin de la qPCR, une courbe de fusion est
réalisée. Cette étape consiste en une augmentation progressive de la
température du bloc du thermocycleur avec une lecture de la fluorescence à
chaque degré. Au cours de cette étape, l’ADN double brin se dissocie à une
température qui lui est propre (Tm : température à laquelle 50% de l’ADN
double brin est dissocié) et qui dépend notamment de sa composition
nucléotidique. A cette température, appelée température de fusion,
l’intercalant (SYBR Green I) est libéré et la fluorescence chute brutalement. Un
seul pic au niveau de la courbe de fusion signifie qu’ un seul produit a été
amplifié et que la PCR est spécifique (Figure 3A). En revanche, si l’amplification
n’est pas spécifique, un ou plusieurs autres pics seront mis en évidence sur la
courbe de fusion. La présence éventuelle de dimères d’amorces peut être
également repérée sur la courbe de fusion (Figure 3B).
(A)
(B)
Primer
dimers
Figure 3 : Exemple de courbe de fusion
(A) Amplification d’un seul produit (B) Amplification de deux produits
4
I.2.3. L’aspect quantitatif : la quantification proprement dite des produits de
qPCR peut se faire selon deux conceptions :
- quantification relative : elle s’effectue par mesure d’un gène cible par rapport
à un gène de référence et on établit un rapport entre les Ct (ou Cp) du gène
cible et du gène de référence pour chaque échantillon en tenant compte des
efficacités des deux PCR.
- quantification avec standard externe : il existe une relation linéaire entre les
valeurs de Ct (Cp) obtenues expérimentalement à partir des différentes
dilutions d’un échantillon de calibrateur (plasmide), et le log de la
concentration de chacune des dilutions, exprimée en nombre de copies par
volume total (en µl) de mélange réactionnel. L’équation de la droite
d’étalonnage est :
Ct (ou Cp) = - (1/logE) x logT0 + (logK/logE)
Ct (= y) : valeur du cycle seuil (crossing point) obtenue expérimentalement
T0 (= x) : quantité initiale d’ADN en nombre de copies / 20 µl de réaction
-1/logE (= pente de la droite)
E = Efficacité de la qPCR. L’efficacité maximale de 100% est obtenue pour E = 2
et la pente de la droite est alors égale à -3,33. Expérimentalement, on tolère
une efficacité entre 1,85 et 2 (Figure 4 : pente = -3,305 pour une efficacité de
2,01).
Figure 4 : Droite d’étalonnage obtenue à partir de 5 dilutions
de plasmide-calibrateur (107, 106, 105, 104, 103 copies / µl)
5
Plus le coefficient de régression est proche de 1, plus la gamme est
linéaire sur l’ensemble des points. Cette droite d’étalonnage renseigne surtout
sur l’efficacité de la qPCR (E). En effet, durant la phase linéaire, la quantité
d’ADN doit théoriquement doubler à chaque cycle avec une efficacité maximale
de 100% (E=2). Plus la pente négative est faible, moins la PCR est efficace ; en
pratique, on considère qu’une pente inférieure à -3,6 (c’est-à-dire 90%
d’efficacité) n’est pas acceptable.
Les efficacités de chaque échantillon d’une série de quantification
devront être comparables pour une interprétation correcte des données entre
elles. Pour corriger la différence d’efficacité des échantillons à l’intérieur d’une
série, le nombre de copies de chaque échantillon d’intérêt sera rapporté, pour
chaque gène quantifié, à la moyenne des copies de deux ADNs contrôles.
I.2.4. L’optimisation du programme de q-PCR : des mises au point sont
nécessaires pour obtenir une qualité et une efficacité de PCR maximales. Etant
donné que les conditions optimales de mesure ne sont pas transférables d’un
appareil de qPCR à l’autre, les échantillons devront être analysés sur le même
appareil qui a servi pour les mises au point préalables.
L’optimisation concerne les paramètres suivants :
- spécificité de l’amplicon : elle devra être vérifiée par PCR classique, dépôt sur
gel de l’amplicon (évaluation de la taille) et séquençage (séquence appropriée)
- température d’hybridation (TH) des amorces et concentration de MgCl2 : elles
devront être optimisées pour obtenir :
1) une courbe de fusion spécifique pour chaque produit de PCR
2) des gammes d’étalonnage avec une efficacité maximale (pente la plus
proche de -3,33).
6
II. Matériel et Méthodes
II.1. Echantillons d’ADNs
Les ADNs des contrôles et des patients sont extraits à partir soit de
fibroblastes cutanés cultivés soit de muscle squelettique.
- contrôles : ADNs témoins extraits de fibroblastes ou de muscle
- patients : ADNs de patients correspondant à trois types de situation :
1) déplétion de l’ADNmt : fibroblastes des patients 1 et 2
2) délétion hétéroplasmique de l’ADNmt : muscle du patient 4 porteur de la
délétion commune de 4977 paires de base (nt 8482 - nt 13460)
3) ni délétion, ni déplétion : muscle du patient 3
II.2. Précautions préliminaires
La qPCR est une technique très sensible permettant de détecter
seulement quelques copies d’ADN (mitochondrial ou nucléaire). Il est donc
impératif de travailler dans un environnement totalement exempt d’ADN
contaminant. Pour cela, avant chaque manipulation, le plan de travail ainsi que
les pipettes seront nettoyés avec une solution «DNA away» ou toute autre
solution permettant d’éliminer toutes traces d’ADN. Il est aussi indispensable
d’utiliser des pointes à filtres pour éviter les aérosols pouvant contaminer les
pipettes. Le port de gants et éventuellement d’une blouse à manches
resserrées, est également impératif.
Les plasmides utilisés pour les gammes d’étalonnage étant très
concentrés en ADN, ils représentent une source importante de contamination.
Il est indispensable de les manipuler avec le maximum de précautions :
centrifuger brièvement les tubes eppendorf avant ouverture pour faire tomber
les gouttes au fond, aucune ouverture brusque des tubes en particulier à
proximité d’autres tubes ouverts, changement de gants après chaque
manipulation de plasmides.
II.3. Choix des gènes quantifiés
Lors de cet atelier, l’amplification a porté sur :
- deux gènes mitochondriaux : MT-CO1 (COXI), gène codant pour la cytochrome
oxydase I (sous-unité I du complexe IV de la chaîne respiratoire) et MT-ND4
(ND4), gène codant pour la «mitochondrially-encoded NADH dehydrogenase 4»
(sous-unité 4 du complexe I).
- un gène nucléaire : B2M, gène codant pour la Beta-2-microglobuline.
7
Pour le diagnostic des anomalies qualitatives et quantitatives de
l’ADNmt, le protocole de qPCR des échantillons de patients dépendra du type
d’anomalie recherchée :
1) délétions hétéroplasmiques de l’ADNmt (coexistence au sein d’un tissu
d’ADNmt délété et d’ADNmt non délété) : détermination du nombre de copies
de deux gènes extra-délétion (exemple : 16S et ND2 pour la quantification de
l’ADNmt total) et de deux gènes intra-délétion (ex : COXI et ND4 pour la
quantification de l’ADNmt délété à condition que la délétion englobe ces deux
gènes ; sinon, on choisit deux autres gènes intra-délétion, par exemple ND4 et
ND5 pour la 1ère délétion comnune).
2) déplétion de l’ADNmt : détermination du nombre de copies de trois gènes
mitochondriaux (ex : 16S, ND2 et COXI) rapportées à un ou deux gènes
nucléaires de référence (ex : B2M et/ou ATP5B).
II.4. Choix des amorces
Dénomination
du gène
Position des
Séquence nucléotidique 5’→
→3’
amorces
For1 mt.7017*
TACGTTGTAGCCCACTTCCACT
COXI
2
Rev mt. 7224*
AGTAACGTCGGGGCATTCCG
For mt.11297*
ACTCTCACTGCCCAAGAACT
ND4
Rev mt.11501*
GTGTGAGGCGTATTATACCA
For exon 3 -112
CAGCCTATTCTGCCAGCC
B2M
Rev exon 3 +113
CAATGTTCTCCACATAGTGAGGG
1
Forward ou sens ; 2 Reverse ou antisens
*position du nucléotide en 5’ de l’amorce sur l’ADNmt
Taille de
l’amplicon
208 pb
205 pb
239 pb
II.5. Matériel
- Plasmides recombinants étalons pour chaque gène d’intérêt : COXI, ND4 et
B2M à la concentration de 1010 copies/µl
- IQ SYBR Green supermix (Bio-Rad)
- DNA away Surface Decontaminant, Thermo Scientific
- H20 DEPC
- Pipettes de précision mLine Biohit (2, 10, 20, 100 et 1000 µl) (Sartorius)
- Pointes à filtres ART, Softfit-L (10 µl, 20µl, 100 µl et 1000 µl) (VWR)
- Microtubes 1,5 ml DNAse free (Safelock Eppendorf)
- Bloc froid
- Appareil de PCR quantitative MyiQ Real-Time PCR system (Bio-Rad)
- Plaque et film optique adaptés à l’appareil de qPCR : Multiplate Low-Profile
plates (white) et Microseal C Optical Seal (Bio-rad)
8
II.6. Protocole opératoire
II.6.1. Courbes d’étalonnage
Les ADN de plasmides, COXI, ND4 et B2M (1010 copies/µl) sont dilués au
1/10e en cascade de manière à obtenir des concentrations de 109, 108, 107, 106,
105, 104 et 103 copies/µl. Pour cela, 5 µl d’ADN de la concentration 10 fois
supérieure sont ajoutés à 45 µl d’eau DEPC.
II.6.2. Préparation du mélange réactionnel
Pour chaque gène quantifié, on prépare 19 µl de mélange réactionnel
dans un bloc froid. On ajoute à ce mélange, 1 µl d’ADN du patient à 50 ng/µl ou
d’une dilution de plasmide.
Réactif
IQ SYBR Green
supermix
Amorce For
Amorce Rev
H2O DEPC
V du mélange
réactionnel
ADN
V final
Concentration
initiale
Concentration
finale
Volume pour
1 puit
2X
1X
10 µl
10 µM
10 µM
500 nM
500 nM
1 µl
1 µl
7 µl
Volume pour
n puits
19 µl
1 µl
20 µl
- Distribuer 19 µl de mélange réactionnel dans les puits suivant le plan de
plaque fourni et ajouter 1 µl d’ADN plasmidique ou d’ADN du patient.
- Sceller la plaque à l’aide du film plastique optique, en prenant garde à ne pas
le repositionner (risque de contamination).
- Centrifuger brièvement la plaque pour faire tomber toutes les gouttes au fond
des puits.
- Placer dans l’appareil de PCR quantitative.
- Lancer le logiciel Opticon Monitor ; l’onglet «Master File» s’ouvre et permet
d’avoir accès au plan de plaque et au protocole utilisé (Figure 5).
9
Figure 5 : Onglet «Master File» du logiciel Opticon Monitor (Bio-Rad)
- Dans l’onglet «Plate Setup», cliquer sur Edit pour annoter le plan de plaque
(Figure 6).
+ dans le cadre «Dyes», choisir SBG1 (SYBR Green I).
+ indiquer le type d’échantillon contenu dans le puits en sélectionnant les puits
et en cliquant sur la couleur correspondante : les puits contenant de l’eau
(Blank) seront matérialisés en bleu «B», ceux contenant les points de gamme
(Standard) en vert «Std» et ceux qui contiennent les échantillons (Sample)
seront matérialisés en rouge «Sa».
+ indiquer le nom des échantillons dans le tableau de droite et cliquer sur
«
Specify Quant Standards» pour rentrer les valeurs des différents points de
gamme.
10
Figure 6 : Onglet «Plate Setup» du logiciel Opticon Monitor
- Dans l’onglet «Protocol Setup», on introduit les conditions du programme
PCR : + line 1 : 95°C , 10 minutes
+ line 2 : 95°C, 30 secondes
+ line 3 : 64°C, 1 minute
Puis : + plate read
+ revenir à la line 2 et ajouter 49 more times (soit 50 cycles en tout)
+ melting curve : 55°C to 95°C, read plate every 1°C, hold 1 seconde
Le programme de 50 cycles de PCR dure environ deux heures.
11
II.7. Interprétation des résultats
Les résultats, obtenus après amplification des gènes mitochondriaux
COXI et ND4 et du gène nucléaire B2M, comportent trois volets :
1) la courbe de fusion de chaque gène
2) les courbes d’amplification
3) les tableaux de quantification.
Grâce à ces données, pourront être calculés les rapports entre le nombre
de copies des gènes mitochondriaux et celui du gène nucléaire qui sert de
référence pour les contrôles et les patients.
II.7.1. Courbes de fusion : il est possible de visualiser la courbe de fusion ou
«
melting curve» après le run, en cliquant sur l’onglet «Melting Curve» (Figure 7).
Figure 7 : Onglet “Melting curve” du locigiel Opticon Monitor (Bio-Rad)
12
Des exemples de courbes de fusion obtenues pour les trois gènes
d’intérêt sont reproduits ci-dessous. Une interprétation des courbes de fusion
est proposée aux participants.
COXI
Interprétation
ND4
Interprétation
B2M
Interprétation
13
II.7.2. Gammes d’étalonnage : ces données peuvent être visualisées dans
l’onglet «Quantitation/Graph» (Figure 8).
Figure 8 : Onglet «Quantitation/Graph» du logiciel Opticon Monitor (Bio-Rad)
Les résultats obtenus pour les gammes d’étalonnage des trois gènes
étudiés figurent ci-dessous.
COXI
14
ND4
• point aberrant supprimé
B2M
Une interprétation des gammes d’étalonnage est proposée aux
participants.
COXI
ND4
B2M
15
II.7.3. Résultats quantitatifs : les résultats des Ct (ou Cp) et du nombre de
copies d’ADN des échantillons peuvent être visualisés dans l’onglet
«
Quantitation/Calculations» du logiciel Opticon (Figure 9). Ces données
peuvent être exportées dans un fichier Excel par Copier/Coller en cliquant sur
Copy to clipboard.
Figure 9 : Onglet «Quantitation/Calculations»
du logiciel Opticon Monitor (Bio-Rad)
Le retraitement des données figure dans le tableau I, extrait du fichier
Excel. Une interprétation des résultats quantitatifs pour les trois gènes COXI,
ND4 et B2M, est proposée aux participants.
16
Tableau I : Retraitement des données quantitatives
COX I
Content
Blank
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Efficiency
C(t)
N/A
N/A
Fibroblastes
Temoin fibro
120.29%
13.88
Temoin fibro
106.6%
14.31
Temoin fibro
131.24%
13.88
Patient 1
134.94%
19.96
Patient 1
99.71%
20.07
Patient 1
126.44%
19.93
Patient 2
142.84%
16.82
Patient 2
154.26%
16.81
Patient 2
93.24%
17.72
Biospies musculaires
Temoin muscle 111.37%
10.08
Temoin muscle 121.34%
10.32
Temoin muscle 121.29%
9.15
Patient 3
111.37%
10.08
Patient 3
121.34%
10.32
Patient 3
146.04%
9.89
Patient 4
132.31%
7.93
Patient 4
111.46%
8.04
Patient 4
148.43%
7.74
Content
Blank
Description
Neg
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Description
Neg
copies
1.61E+05
1.19E+05
1.61E+05
2.20E+05
2.03E+05
2.24E+05
2.02E+04
2.04E+04
1.24E+04
3.53E+08
2.91E+08
5.37E+08
3.53E+08
2.91E+08
3.94E+08
2.10E+09
1.92E+09
2.48E+09
ND4
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Efficiency
C(t)
N/A
N/A
Fibroblastes
Temoin fibro
93.26%
13.48
Temoin fibro
93.09%
13.54
Temoin fibro
93.25%
13.47
Patient 1
113.21%
19.40
Patient 1
115.27%
19.37
Patient 1
87.22%
20.01
Patient 2
97.22%
16.60
Patient 2
99.64%
16.59
Patient 2
96.55%
16.67
Biospies musculaires
Temoin muscle 111.37%
10.08
Temoin muscle 121.38%
10.34
Temoin muscle 177.77%
10.40
Patient 3
206.39%
7.46
Patient 3
170.56%
7.88
Patient 3
96.39%
7.56
Patient 4
118.51%
13.27
Patient 4
106.21%
13.07
Patient 4
89.12%
13.51
17
copies
1.99E+07
1.92E+07
2.00E+07
3.34E+05
3.41E+05
7.32E+04
2.32E+06
2.33E+06
2.20E+06
3.53E+08
2.88E+08
2.52E+08
4.83E+08
3.49E+08
3.71E+08
5.45E+06
6.37E+06
3.82E+06
B2M
Content
Blank
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Sample
Description
Neg
Efficiency
C(t)
N/A
N/A
Fibroblastes
Temoin fibro
96.15%
21.55
Temoin fibro
98.26%
21.70
Temoin fibro
83.55%
21.41
Patient 1
148.32%
17.95
Patient 1
105.19%
18.05
Patient 1
107.71%
18.03
Patient 2
93.55%
21.01
Patient 2
90.89%
21.13
Patient 2
106.51%
20.96
Biospies musculaires
Temoin muscle 107.12%
19.26
Temoin muscle 100.30%
19.29
Temoin muscle 107.85%
19.23
Patient 3
129.57%
18.52
Patient 3
130.94%
18.48
Patient 3
116.44%
18.41
Patient 4
124.72%
18.49
Patient 4
133.45%
18.36
Patient 4
128.95%
18.48
copies
5.77E+04
5.18E+04
6.01E+04
6.93E+05
6.47E+05
6.55E+05
8.37E+04
7.70E+04
8.63E+04
1.07E+05
1.05E+05
1.09E+05
1.77E+05
1.82E+05
1.91E+05
1.80E+05
1.97E+05
1.82E+05
Interprétation des résultats
- Examen critique des triplicates
- Rapports du nombre de copies des patients / contrôles internes
- Moyenne du nombre de copies des gènes mitochondriaux
- Rapport du nombre de copies de l’ADNmt / gène nucléaire
- Rapport des gènes ADNmt intra-délétion / gènes ADNmt extra-délétion
+ Patient 1
18
+ Patient 2
+ Patient 3
+ Patient 4
19
III. REFERENCE
Quantification of mitochondrial DNA deletion, depletion and over replication :
Application to diagnosis.
Chabi B, Mousson de Camaret B, Duborjal H, Issartel J-P, Stepien G.
Clinical Chemistry 2003, 49, 1309-1317
IV. LE GENOME MITOCHONDRIAL
: origine de réplication du brin lourd (H) dans la D-loop
: origine de réplication du brin léger (L) dans la zone (WANCY) codant pour 5 ARNt
20
ATELIER
D
Analyse histologique de la chaîne
respiratoire
Anne LOMBES et Véronique LENOIR
Pièce 3514
Mise en place de l’analyse histochimique
des activités succinate déshydrogénase
et cytochrome c oxydase dans les tissus
Anne Lombès, Véronique Lenoir
Atelier du GDR Meetochondrie
17-19 octobre 2013
Institut Cochin-Faculté de médecine
Avec l’aide de Maryline Favier
(Plateforme Histologie de l’Institut Cochin)
Milieux de réaction
Succinate déshydrogénase
200 mM tampon phosphate (80% Na2HPO4, 20% KH2PO4)
0,1% Nitrobleu Tetrazolium
200 mM Succinate
Ajuster le pH à 7,6 et filtrer
Cytochrome c oxydase
100 mM tampon phosphate pH à 7,6
1mg/mL (~80 µM) cytochrome c type IV
1 comprimé/10 mL de DAB (cancérogène)
20 µg/mL catalase
0,25% DMSO
Ajuster le pH à 7,6 et filtrer
Matériel
Echantillons
Coupes tissulaires (cryostat)
Cellules en culture (fixation par séchage)
Etuve
Chambres humides ou récipient adapté
Lames dans cuve de Coplin,
Lamelles dans cuves de Columbia
1
Ajustement du temps
d’incubation
Précipitation du sel
Activité élevée
Activité faible
Temps
La durée d’incubation dépend :
- du type de tissu
- de la question posée: sous-type cellulaire, comparaison individuelle…
Foie de souris
Succinate déshydrogénase
15 minutes
x4
x 10
Foie de souris
Succinate déshydrogénase
x 10
15 min
30 min
45 min
60 min
75 min
2
Foie de souris
Cytochrome c oxydase
x4
15 min
30 min
45 min
60 min
75 min
Foie de souris
Cytochrome c oxydase
x 10
30 min
45 min
60 min
75 min
Foie de souris
Cytochrome c oxydase
75 minutes
x 20
Foie de souris
Succinate déshydrogénase
15 minutes
x 20
3
Foie de souris
Cytochrome c oxydase
75 minutes
x 40
Foie de souris
Succinate déshydrogénase
15 minutes
x 40
Rein de souris
Succinate déshydrogénase
15 minutes
glomérule
tube contourné distal/proximal
tube collecteur
x 10
Rein de souris, hématéine-éosine
x4
Rein de souris
Succinate déshydrogénase
15 minutes
x 20
Artérioles
Glomérules
Tubes contournés
Tubes collecteurs
Rein de souris
Succinate déshydrogénase
30 minutes
x 20
4
Rein de souris
Cytochrome c oxydase
60 minutes
x 20
Artérioles
Glomérules
Tubes contournés
Tubes collecteurs
Rein de souris
Cytochrome c oxydase
75 minutes
x 20
Quadriceps de souris
Succinate déshydrogénase
15 minutes
Fibres I
Fibres IIA
Fibres IIB
Fibres IIC
x 10
x 20
x 40
Quadriceps de souris
Cytochrome c oxydase
15 minutes
Fibres I
Fibres IIA
Fibres IIB
Fibres IIC?
x 10
x 20
x 40
5
Quadriceps de souris
15 minutes
x4
Cytochrome c oxydase
Succinate déshydrogénase
Cerveau de souris
Cytochrome c oxydase
75 minutes
Cytochrome c oxydase
Succinate déshydrogénase
Cerveau de souris
Cytochrome c oxydase
75 minutes
Cytochrome c oxydase
Succinate déshydrogénase
6
Cerveau de souris
Cytochrome c oxydase
30 minutes
45 minutes
75 minutes
Cerveau de souris
Succinate déshydrogénase
15 minutes
30 minutes
45 minutes
75 minutes
Conclusion
Préparation tissulaire++
Coupes au cryostat (pas de fixation++)
Qualité des coupes++ (épaisseur)
Hétérogénéité intra-tissulaire des activités
Préciser les cibles d’intérêt
Activité SDH>>COX (voire >>> COX)
Adapter les durées d’incubation
Co-marquage COX/SDH :
d’abord COX puis SDH+KCN
DAB est un carcinogène
Protocole d’utilisation++
7
DAB
(source: www.unil.ch/webdav/site/unisep/shared)
Dénomination complète: 3,3-diaminobenzidine tetrahydrochloride
Risques pour l’homme et pour l’environnement
-
Dispersion, giclures: irritant pour la peau, les voies respiratoires et les yeux
Nocif par ingestion
Cancérogène Suspecté ( CMR )
Toxique pour les milieux aquatiques
Mesures de protection et règles de comportement
-
Porter blouse, lunettes, gants appropriés, masque avec filtre spécifique, chaussures fermées
Travailler sous une chapelle type «Sorbonne»
Bien lire les étiquettes ( recommandations R et S, CMR )
Conduite à tenir en cas de danger
-
Renversement de petites quantités: neutraliser à la javel et rincer à l’eau. Jeter les éponges, kleenex et
autres papiers absorbants dans les poubelles jaunes
Renversement important: répandre l’absorbant approprié et traiter comme « Déchets DAB-Javel Solides»
En cas d’incendie, formation de gaz et/ou de vapeurs toxiques
Avertir vos collègues et interdire l’accès
Premiers secours ALARMER TEL.115
-
Retirer immédiatement les vêtements souillés
Laver soigneusement les parties touchées à l’eau et au savon ( petites surfaces touchées)
Douche de sécurité ( grandes surfaces touchées )
Douche oculaire
En cas d’ingestion: faire boire ( sauf si la personne est inconsciente )
NE PAS FAIRE VOMIR
Elimination des déchets
-
Neutralisation à la javel ( 1/3 javel 13-14%, 2/3 eau )
Recueillir dans un contenant en plastique ( type PEHD ) libellé «Déchets DAB-Javel»
Recueillir également le premier rinçage après neutralisation dans le contenant libellé «Déchets DAB-Javel»
En cas d’élimination du produit pur, laisser dans le contenant d’origine
Informations complémentaires
-
Vérifier les VME/VLE
Stockage: armoire ventilée et bac de rétention
Incompatible avec les oxydants
Ne pas mélanger avec d’autres substances à cause de la réactivité de la javel ( dégagement de chlore
gazeux toxique )
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising