Biotechnology Explorer™ Kit de huella genética (ADN - Bio-Rad

Biotechnology Explorer™ Kit de huella genética (ADN - Bio-Rad
Biotechnology Explorer™
Kit de huella genética (ADN fingerprint)
Manual de instrucciones
Número de catálogo
166-0007-EDU
www.explorer.bio-rad.com
Los reactivos liofilizados se pueden almacenar a temperatura ambiente.
Los marcadores de ADN deben guardarse a 4ºC (o a temperaturas inferiores) durante
almacenamientos superiores a 4 semanas.
La duplicación de cualquier parte de este documento está autorizada sólo para su uso en clase.
Para soporte técnico llame a su oficina local de Bio-Rad (en España 91 590 52 00)
4006096
ADN Fingerprinting
Índice
Manual del profesor
Información básica para el profesor
Planificación de la práctica
Guía del profesor para la preparación de la práctica
Guía rápida para el uso del kit ADN Fingerprinting
Manual del alumno
Unidad 1
Introducción al ADN Fingerprinting
Unidad 2
Digestión de las muestras de ADN con enzimas de
restricción
Unidad 3
Electroforesis y tinción de las muestras de ADN
Unidad 4
Secado de los geles y análisis de las patrones de ADN
2
ADN Fingerprinting
Manual del Profesor
ADN Fingerprinting
Manual del profesor
Información básica para el profesor................................................................................ 3
Planificación de la práctica ............................................................................................. 7
Guía del profesor para la preparación de la práctica....................................................... 9
Guía rápida para el uso del kit ADN Fingerprinting......................................................... 15
3
ADN Fingerprinting
Manual del Profesor
Información básica para el profesor
Introducción
A los técnicos que trabajan en laboratorios forenses a menudo se les solicita que determinen la huella
genética o “ADN fingerprinting” para aportar evidencias en juicios o para otras aplicaciones
1
.
Determinar la huella genética implica la amplificación del ADN mediante la reacción en cadena de la
2
polimerasa (PCR ) para analizar pequeñas cantidades de ADN o mediante el polimorfismo de longitud
3
de fragmentos de restricción (RFLP ) si se dispone de grandes cantidades de ADN. Una etapa del
análisis mediante RFLP requiere que el estudiante compare los patrones de bandas producidas por las
muestras de ADN cuando se separan en un gel de agarosa. En esta práctica se comparan las bandas
producidas por una muestra que representa el ADN recogido en la escena del crimen, y cinco muestras
obtenidas de sospechosos en el caso. Es importante que indiques a tus alumnos que en esta práctica
se utiliza la técnica más sofisticada para muestras complejas de ADN humano.
Enzimas de restricción
Las enzimas de restricción se sitúan en la molécula de ADN y se desplazan por la hélice hasta que
reconocen unas secuencias específicas de pares de bases que indican a la enzima que deje de
desplazarse. Las enzimas entonces digieren (separan químicamente) la molécula de ADN en ese
punto (llamado “diana de restricción”) actuando como tijeras moleculares, cortando el ADN por
secuencias específicas de pares de bases.
Si existe más de una diana de restricción en una molécula de ADN, la enzima de restricción cortará
en cada uno de esos sitios, obteniéndose múltiples fragmentos. Así, si un fragmento lineal de ADN se
corta con una enzima de restricción cuya diana de restricción se encuentra en dos puntos diferentes de
la molécula de ADN, se obtendrán tres fragmentos de diferentes longitudes. La longitud de cada
fragmento dependerá de la localización de las dianas de restricción en la molécula de ADN.
Cuando las enzimas de restricción se usan para cortar cadenas de ADN plasmídico circular, como
las muestras incluidas en este kit, se obtienen fragmentos de ADN de varios tamaños. El ADN cortado
con enzimas de restricción puede ser separado y observado utilizando una técnica denominada
electroforesis en gel de agarosa. El término electroforesis significa “mover con electricidad”.
Electroforesis en gel de agarosa
La electroforesis separa los fragmentos de ADN en función de su tamaño. Los fragmentos de ADN
se cargan en un gel de agarosa, que se sitúa en una cubeta que contiene una solución líquida
conductora. La corriente eléctrica pasa a través de dos electrodos situados en cada extremo de la
cubeta. Los fragmentos de ADN están cargados negativamente, y cuando se sitúan en un campo
eléctrico migrarán hacia el polo positivo. La matriz del gel de agarosa actúa como un tamiz molecular a
través de la cual los fragmentos pequeños de ADN se pueden mover con más facilidad que los más
grandes. Tras cierto tiempo, los fragmentos pequeños avanzarán más que los más grandes. Los
fragmentos del mismo tamaño permanecen juntos y migran juntos produciendo una sola banda de
ADN.
Análogamente se podría comparar este proceso con lo que ocurriría si todos los pupitres y sillas se
hubieran dispersado simétricamente por todo un aula. Un solo estudiante podría avanzar por el
laberinto rápidamente y con poca dificultad, mientras que cuatro estudiantes unidos por las manos
tardarían más tiempo y tendrían más dificultades para avanzar entre el laberinto de sillas.
4
ADN Fingerprinting
Manual del Profesor
ADN Fingerprinting
Todas las personas tienen similitudes y diferencias en sus secuencias de ADN. Para demostrar que
un fragmento de ADN contiene una secuencia de nucleótidos específica, se puede construir una sonda
de ADN complementario marcado radiactivamente, de manera que reconozca y se una a la secuencia
en el fragmento original de ADN. Las sondas radiactivas permiten a los biólogos moleculares localizar,
identificar y comparar el ADN de diferentes personas. Esta sonda se puede describir como una etiqueta
radiactiva que se unirá a una cadena simple de ADN y producirá una banda en un gel o una banda en
una membrana de nylon que es una réplica del gel (Southern blot). Por su especificidad, la sonda
radiactiva se puede usar para demostrar similitudes genéticas entre individuos. Las posiciones relativas
de las bandas marcadas radiactivamente en un gel están determinadas por el tamaño de los
fragmentos de ADN que las forman. El tamaño de los fragmentos indica variaciones en el ADN de cada
individuo.
Estamos yendo más allá de lo que este manual pretende. Para tener información más detallada,
recomendamos revisar las referencias de la página 6.
La muestra necesaria para esta técnica se puede obtener de cualquier material biológico que
contenga ADN: tejidos, fluidos corporales (sangre y semen), folículos pilosos, etc. El análisis de ADN
se puede hacer incluso de material desecado, como una mancha de sangre o tejido momificado. Si la
muestra de ADN es muy pequeña se puede amplificar utilizando la PCR. El ADN se trata después con
enzimas de restricción que cortan el ADN en fragmentos de diferentes longitudes4.
Digestión enzimática del ADN
Dado que cortan el ADN, las enzimas de restricción son las “tijeras químicas” de los biólogos
moleculares. Cuando una determinada enzima de restricción reconoce una secuencia de
reconocimiento (de 4 o 6 pares de bases) en un fragmento de ADN, corta la molécula en ese punto.
Las secuencias de reconocimiento de dos enzimas usadas habitualmente, EcoRI y PstI, aparecen a
continuación. El lugar exacto en que se corta la cadena de ADN se señala con unas tijeras como
símbolo:
Para la enzima: Eco RI
Para la enzima: Pst I
Como todas las enzimas, las enzimas de restricción funcionan mejor en un tampón (buffer) y a una
temperatura específicos. El tampón apropiado para las enzimas de restricción se incluye con la
muestra de ADN, de manera que cuando el ADN rehidratado y las enzimas se mezclan, se crean las
condiciones ideales para el óptimo funcionamiento de las enzimas. El buffer contiene Tris 50 mM, NaCl
100 mM, MgCl2 10 mM, DDT 1 mM, pH 8.0, que son las condiciones ideales para el funcionamiento
correcto de las enzimas EcoRI y PstI.
5
ADN Fingerprinting
Manual del Profesor
Visualización de los fragmentos de restricción
El ADN es incoloro, de manera que los fragmentos de ADN no se pueden ver en el gel durante
la electroforesis. Se utiliza un tampón de carga, que contiene dos colorantes azules, y que se añade a
la solución de ADN. Los colorantes no tiñen el ADN, pero facilitan la carga de los geles y permiten ver
el avance de la electroforesis. Los colorantes migran hacia el polo positivo situado al final del gel, al
igual que los fragmentos de ADN. El colorante “rápido” migra con los fragmentos de ADN de
aproximadamente 500 pb, mientras que el colorante “lento” migra con los fragmentos de ADN de
tamaño aproximado de 5 kpb.
La tinción del ADN muestra su localización en el gel. Cuando el gel se sumerge en una solución
diluida de colorante Bio-Safe, las moléculas del colorante se unen a las moléculas de ADN atrapadas
en el gel de agarosa. Para aumentar el contraste y visualizar con facilidad las bandas de ADN, el
exceso de colorante se puede eliminar del gel destiñéndolo con agua. Cuando las bandas sean
visibles, tus alumnos pueden comparar los patrones de restricción de diferentes muestras de ADN.
El gel situado a continuación, muestra el patrón de ADN que obtendrían los estudiantes tras la
electroforesis. El ADN de la escena del crimen se ha marcado como CS, el del sospechoso 1 como S1,
y así sucesivamente. El ADN recogido en la escena del crimen se carga en el pocillo 2, y el ADN de
cada sospechoso se carga en los pocillos 3, 4, 5, 6 y 7 respectivamente. El pocillo 1 contiene los
marcadores (de tamaño conocido) obtenidos de la digestión de un ADN por la enzima HindIII. Por
acuerdo, los pocillos se numeran empezando por la parte superior izquierda. Los estudiantes deben
observar los patrones de bandas y comprobar si las bandas de algún sospechoso coinciden con las del
ADN recogido en la escena del crimen.
M
1
CS
2
S1
3
S2
4
S3
5
S4
6
S5
7
8
Se observa fácilmente que el ADN procedente de la escena del crimen y el del sospechoso 3 (S3)
son idénticos. Quizá quieras saber si este hallazgo es una prueba válida o no para condenar al
sospechoso. La realidad es que esta prueba sitúa al sospechoso en la escena del crimen, pero puede
que se necesiten más pruebas para probar que es el o la culpable 5, 6.
Puedes indicar a tus alumnos que esto es una simulación. En la realidad, los técnicos analizan
segmentos mucho más largos de ADN, y se obtienen muchas más bandas. Se buscan segmentos
específicos de ADN, comunes en una población, y que producirán un patrón de bandas único para
cada individuo.
6
ADN Fingerprinting
Manual del Profesor
Fiabilidad de las pruebas de ADN
Los dos principales factores que afectan a la fiabilidad de la tecnología del ADN en la medicina
forense son la genética de las poblaciones y la estadística genética. En los humanos hay miles de loci
RFLP o de segmentos de ADN que se pueden seleccionar y usar para analizar la huella genética. En
función de factores demográficos como el origen étnico o el aislamiento geográfico, algunos segmentos
mostrarán más variabilidad que otros.
Algunas poblaciones muestran mucha menos variabilidad en segmentos particulares de ADN que
otras. El grado de variabilidad afectará a la probabilidad de que exista más de un individuo con la
misma secuencia. Si el 90% de una población presenta el mismo patrón para un determinado
segmento de ADN, poca información se podrá obtener. Pero si la frecuencia de aparición de un patrón
de ADN para un determinado segmento en una población, es extremadamente baja, entonces este
segmento puede ser una herramienta muy útil para discriminar entre los individuos de esa población.
Cada población muestra diferentes patrones en sus genotipos debido a las distintas aportaciones
realizadas a sus genes individuales a lo largo del tiempo.
Por eso, para determinar hasta qué punto incrimina una prueba de ADN, se necesita hacer la
siguiente pregunta:
“Estadísticamente, ¿cuántas personas en una población presentarán un patrón idéntico al observado
en la muestra recogida en la escena del crimen? ¿1 de cada 10.000? o ¿1 de cada 10?
Notas y lecturas recomendadas
1.
ADN profiling Fast Becoming Accepted Tool For Identification, Pamela Zurer, Chemical and
Engineering News, Oct. 10, 1994.
2.
PCR significa Reacción en cadena de la polimerasa; es una técnica usada para amplificar
3.
RFLP significa Polimorfismo de longitud de los fragmentos de restricción (riff-lips, en la
pequeñas cantidades de ADN (en este caso para posibilitar el posterior análisis de ese ADN).
jerga). En esta técnica el ADN se corta con enzimas de restricción en fragmentos de diferentes
longitudes. Cada individuo posee distintos puntos de restricción, de manera que dos piezas de
ADN de diferente origen pueden producir fragmentos de diferente longitud cuando se cortan con
la misma enzima.
4.
Una excelente fuente de información para el profesor es: Genetic Fingerprinting, Pauline Lowrie
and Susan Wells, New Scientist, 16 November 1991.
5.
Is ADN Fingerprinting ready for the courts?, William C. Thompson and Simon Ford, New
Scientist, March 31, 1990.
6.
When Science Takes the Witness Stand, Peter Neufled and Nevelle Coleman, Scientific
American, Vol. 262: 5, May 1990.
7
ADN Fingerprinting
Manual del Profesor
Planificación de la práctica
Hay cinco unidades o prácticas en este cuaderno. Todas las sesiones se realizan en periodos de 50
minutos. Cada práctica incluye:
•
Una serie de consideraciones previas para los alumnos
•
Una tarea de investigación activa para los alumnos
•
Cuestiones para el análisis e interpretación de los resultados obtenidos
Programación para el alumno
Unidad 1:
Actividad
Introducción: “ADN fingerprinting”
Lecturas y discusión
Consideraciones previas 1 y 2.
Unidad 2:
Digestión de muestras de ADN con enzimas de restricción
Actividad
Preparar los geles; realizar la digestión con las enzimas de restricción
Hacer análisis preliminar y cuestiones de revisión
Unidad 3:
Electroforesis de ADN
Actividad
Cargar y correr los geles; teñir los geles (toda noche)
Contestar las preguntas de análisis y revisión
Unidad 4:
Actividad
Análisis e interpretación de resultados
Desteñir los geles
Contestar las preguntas de análisis
Hacer la curva estándar o patrón
Discutir y sopesar los resultados
Preparación de las prácticas por el profesor
En este apartado se perfila el calendario recomendado para la preparación anticipada de las
sesiones prácticas por parte del profesor. Para más detalles consultar la Guía del profesor para la
preparación de la práctica, en las páginas 10-16.
Actividad
Realización
Duración
Lectura del manual
Inmediatamente
1 hora
Antes de
o durante la Unidad 2
1 hora
Antes de la Unidad 2
20 minutos
Preparación del colorante para ADN Bio-Safe
Antes de la Unidad 2
10 minutos
Preparación puestos trabajo
Día de prácticas
10 minutos / día
Preparación del tampón de
(TAE) y de los geles de agarosa
electroforesis
Rehidratación de muestras de
enzimas, y preparación de alícuotas
ADN
8
y
ADN Fingerprinting
Manual del Profesor
Listado de material
Puesto de trabajo de los alumnos: El material necesario para el desarrollo de cada práctica y que
debe estar en cada puesto de trabajo al inicio de la misma, aparece en los siguiente listados. Los
componentes presentes en el kit son suficientes para montar 8 puestos de trabajo para alumnos.
Puesto común: El listado de material y equipos necesarios para cada práctica, y que deben estar en
una zona común a la que tengan acceso todos los grupos de trabajo, aparece a continuación. El
profesor decidirá si los alumnos acceden al material común y equipos, o si es el profesor el que
alícuota el material y maneja los aparatos.
Unidad 2
Digestión del ADN con enzimas de restricción
Puesto de trabajo alumnos
Número
(√
√)
Enzimas EcoRI/PstI
1 tubo (80 µl)
o
Puntas pipeta
15
o
Micropipeta P-10 o P-20
1
o
Microtubos de colores: verde, azul, naranja,
violeta, rojo, amarillo
1
o
Rotulador de tinta indeleble
1
Contenedor para residuos
1
o
Gradilla
1
o
Cubeta con hielo
1
o
ADN escena crimen, rehidratado con tampón
1 vial
o
ADN sospechoso 1, rehidratado con tampón
1 vial
o
ADN sospechoso 2, rehidratado con tampón
1 vial
o
ADN sospechoso 3, rehidratado con tampón
1 vial
o
ADN sospechoso 4, rehidratado con tampón
1 vial
o
ADN sospechoso 5, rehidratado con tampón
1 vial
o
Estufa o baño a 37 ºC
1/laboratorio
o
Agarosa líquida
35-40 ml/gel
o
Molde para preparar geles (cristales )
1/puesto
o
Cinta adhesiva
1/puesto
o
o
Puesto común
Se deben usar gafas protectoras mientras se está en el laboratorio.
Se deben seguir las medidas generales de seguridad, como no comer ni beber
en el laboratorio.
9
ADN Fingerprinting
Unidad 3
Manual del Profesor
Electroforesis de las muestras de ADN
Puesto de trabajo alumnos
Número
(√
√)
Gel de agarosa
1
o
Muestras con ADN digerido
5
o
Colorante para ADN (Tampón carga)
1
o
2 Rotuladores
1
o
Puntas pipeta
1 caja
o
Micropipeta P-10 o P-20
1
o
Contenedor para residuos
1
Gradilla
1
Cubeta electroforesis y fuente alimentación
1
o
Cristalizador o cubeta para tinción gel
1
o
Tampón electroforesis (TAE 1x)
275 ml gel/caja
o
Colorante Bio-Safe (1x)
500 ml
o
Marcadores HindIII
1
o
Puesto de trabajo alumnos
Número
(√
√)
Agua para desteñir geles
60 ml
o
Regla milimetrada
1
o
Papel semilogarítmico
1
o
Puesto común
Unidad 4
Análisis de resultados
Puesto común
No se necesita material común
10
ADN Fingerprinting
Manual del Profesor
Guía del profesor para la preparación de la práctica
Este apartado describe los preparativos que debe realizar el profesor antes de cada sesión práctica.
Se incluye una estimación del tiempo de preparación para cada sesión.
Unidad 2
Digestión con enzimas de restricción de las muestras de ADN
Preparación previa
Objetivos
Rehidratar las muestras de ADN y las enzimas de restricción
Alicuotar las enzimas de restricción
Preparar los puestos de trabajo comunes y de los alumnos
Preparar los geles de agarosa, o si los van a a preparar los alumnos,
preparar la agarosa y mantenerla en el baño a 50-55 ºC hasta que la
usen.
Calentar un baño a 37 ºC.
Tiempo a emplear
30 min – 1 hora (dependerá de quién prepare los geles de agarosa)
Material necesario
Cubetas, moldes y peines para electroforesis
Tampón electroforesis (TAE 50x)
Agarosa en polvo
16 microtubos
Metodología
1. Rehidratación de las muestras:
Nota: Todos los viales de ADN y de enzimas deben contener un residuo blanco, que aparecerá
como un polvo suelto en los viales de ADN. Las muestras liofilizadas de ADN se encuentran en
viales de cristal transparente marcados con etiquetas de colores. La mezcla liofilizada de las
enzimas EcoRI/PstI se encuentra en un vial de color ámbar.
A. Para rehidratar las muestras de ADN, añadir 200 µl de agua estéril en cada vial de ADN
liofilizado y agitarlo para resuspenderlo. Dejar que las muestras se rehidraten a temperatura
ambiente, durante 5 minutos o hasta que se disuelvan. Puede que sea necesario un suave
calentamiento a 37 ºC durante 10 minutos. Si quieres, puedes traspasar las muestras
rehidratadas a los tubos microtubos coloreados de 1.5 ml para facilitar el pipeteo a los alumnos.
Las muestras rehidratadas de ADN están en una solución tampón a una concentración de 0.3
µg/µl en Tris 100 mM, NaCl 200 mM, MgCl2 20 mM, DTT 2mM, pH 8.0. Al añadir las enzimas de
restricción la concentración final del tampón será Tris 50 mM, NaCl 100 mM, MgCl2 10 mM, DTT
1mM, pH 8.0, siendo éstas las condiciones óptimas para la actividad de las enzimas EcoRI y
PstI.
B. Para rehidratar la mezcla de enzimas EcoRI/PstI, añadir 750 µl de agua estéril y agitar para
resuspender las enzimas. Dejar que las enzimas se rehidraten en hielo durante 5 minutos. Es
crucial que la mezcla de enzimas se mantenga en hielo, pero sin congelar, una vez que se
hayan rehidratado. Las enzimas rehidratadas se deben usar en las 12 horas siguientes.
2.
Preparación de las alícuotas de la mezcla de enzimas. Transferir 80 µl de la mezcla enzimática
rehidratada a cada uno de los 8 microtubos de 1.5 ml marcados como ENZ.
11
ADN Fingerprinting
Manual del Profesor
3. Preparación del tampón de electroforesis. El tampón de electroforesis TAE (Tris, acetato,
EDTA) se encuentra en una solución concentrada 50x. Usaremos el tampón TAE 1x, necesitando
un volumen total de unos 275 ml para cada cubeta de electroforesis. Serán suficiente 3 litros de
tampón TAE-1x para las 8 cubetas de electroforesis y la preparación de los 8 geles de agarosa.
Para preparar 3 litros de TAE-1x a partir de TAE-50x, añadir 60 ml de TAE-50x a 2.94 litros de
agua destilada.
4.
Preparación de la agarosa. Esto puede hacerse con 1 ó 2 días de antelación por el profesor, o
durante la sesión práctica por los propios alumnos.
A. La concentración recomendada para la preparación del gel es de agarosa al 1%. Esta
concentración de agarosa proporciona una excelente resolución y minimiza el tiempo requerido
para la separación de los fragmentos de ADN en la electroforesis. Para preparar agarosa al 1%,
añadir 1 g de agarosa a 100 ml de tampón TAE-1x. La agarosa se debe preparar con tampón de
electroforesis, no con agua.
Si las cubetas de electroforesis son escasas, puedes utilizar moldes o cristales de 7 x 10 cm, y
dos peines con 8 pocillos, y preparar un gel para cargar las muestras de dos grupos de
estudiantes.
Esta tabla te puede servir de guía para saber los volúmenes a utilizar:
Volumen de agarosa al 1% necesario:
Número de geles
Molde 7 x 7 cm
1
40 ml
Molde 7 x 10 cm
50 ml
2
80
100
4
160
200
8
320
400
B. Añade la agarosa en polvo a un recipiente adecuado (p. ej. un matraz Erlenmeyer de 500 ml,
para preparar 200 ml). Añade la cantidad apropiada de TAE-1x y agita para resuspender la
agarosa en el tampón. Si utilizas un matraz Erlenmeyer, sitúa otro matraz Erlenmeyer de 25 ml
en la boca del primero y en posición invertida. El matraz pequeño actuará como una cámara de
reflujo, permitiendo una ebullición prolongada o vigorosa sin que se produzcan muchas pérdidas
por evaporación. La agarosa se puede fundir en un agitador magnético a temperatura elevada,
en un baño caliente, o en un horno microondas.
Precaución: Usar siempre guantes, gafas protectoras y bata mientras se prepara el gel de agarosa. La
agarosa hirviendo o los recipientes con agarosa caliente pueden producir graves quemaduras en la
piel.
Uso del horno microondas: Este es el método más rápido y seguro para disolver la agarosa.
Introduce el matraz o botella con el gel en el microondas. AFLOJA EL TAPÓN SI UTILIZAS UNA
BOTELLA. Déjalo 3 minutos a media intensidad. Para el horno cada 30 segundos y agita el matraz
para disolver la agarosa. Calienta y agita la solución hasta que todas las partículas de agarosa se
hayan disuelto. Déjalo enfriar hasta los (55-60) ºC antes de utilizarlo.
Uso del agitador magnético: Añade un imán a la solución de agarosa. Calienta hasta ebullición el
matraz en el agitador magnético. Se debe evitar que las burbujas alcancen el cuello del matraz.
12
ADN Fingerprinting
Manual del Profesor
Calienta y agita la solución hasta que todas las partículas de agarosa se hayan disuelto. Déjalo enfriar
hasta los (55-60) ºC antes de utilizarlo.
Si quieres, puedes preparar la agarosa con varias horas de antelación a la práctica, y mantenerla caliente
en un baño a 55-60 ºC hasta su uso.
5. Preparación de los geles de agarosa. Es necesario que cada gel tenga al menos 8 pocillos.
Siguiendo las instrucciones del apartado anterior, prepara la agarosa, calculando el volumen que
se necesita. Añade la agarosa al molde e introduce el peine. La cantidad de agarosa debe
alcanzar entre 0.5 y 0.7 cm de profundidad, o bien ser suficiente como para cubrir los dientes del
peine. No muevas ni toques el molde o el peine hasta que la agarosa haya solidificado. Una vez
solidificada, los geles pueden almacenarse en bolsas precintadas a temperatura ambiente o en el
frigorífico hasta el día siguiente. El tiempo necesario para preparar los geles para todos los grupos
de alumnos es de aproximadamente 30 minutos. Si es posible, prepara 1 ó 2 geles extra de
reserva.
6. Digestión con enzimas de restricción. Las condiciones óptimas para la digestión enzimática son
de 45 minutos a 37 ºC. Si no se dispone de una placa térmica, baño o estufa, las muestras se
pueden digerir introduciendo los tubos en una gradilla de plástico o corcho, que se situa en
aproximadamente 1 litro de agua a 37 ºC, y dejándolas en incubación toda la noche mientras el
agua se va enfriando.
Procedimiento para preparar los geles
Con el sistema Bio-Rad’s Mini Sub-Cell GT, los geles se pueden preparar fácilmente. En esta
sección se indica como preparar los geles de forma convencional. Se detallan otros métodos en el
manual de instrucciones del sistema Bio-Rad’s Mini Sub-Cell GT.
Paso 1
Sellar los bordes del molde o soporte donde se va a preparar el gel con cinta adhesiva de
laboratorio. Apretar la cinta firmemente a los bordes para formar un precinto hermético.
Paso 2
Nivelar el molde sobre una mesa usando el nivelador proporcionado.
Paso 3
Preparar la cantidad de agarosa adecuada en tampón TAE.
Paso 4
Dejar enfriar la agarosa hasta al menos los 60 ºC, y verterla sobre el soporte.
Paso 5
Mientras se enfría la agarosa, colocar el peine en el molde. El peine se debe colocar a
unos 2 cm del extremo del soporte (nunca en la mitad del gel).
Paso 6
Dejar que el gel solidifique a temperatura ambiente durante 10-20 minutos. Tendrá
aspecto opaco cuando esté listo para su uso.
Paso 7
Retirar el peine del gel con precaución.
Paso 8
Retirar la cinta de los bordes del soporte.
Paso 9
Colocar el molde o soporte en la cubeta de electroforesis, situando los pocillos en el
cátodo (negro). Las muestras de ADN migrarán hacia el ánodo (rojo) durante la
electroforesis.
Para preparar un gel doble en el soporte de 7 x 10 cm con dos peines de 8 pocillos, coloca un peine en
un extremo y el otro peine a la mitad del soporte.
13
ADN Fingerprinting
Unidad 3
Manual del Profesor
Electroforesis y tinción de las muestras de ADN
Preparación previa
Objetivos
Alicuotar el tampón de carga
Preparar los marcadores Lambda HindIII
Preparar la solución Bio-Safe 1x para la tinción de ADN
Preparar los puestos de trabajo para los alumnos y comunes
Tiempo requerido
20 minutos
Material requerido
Tampón de carga
Solución Bio-Safe
Marcadores Lambda HindIII
1. Alicuotar el tampón de carga
A.
Rotula 8 microtubos como TC (Tampón de carga). Alicuotar 35 µl del tampón de carga en cada
tubo. Distribuir los tubos a cada puesto de trabajo de los alumnos.
B.
Añadir 20 µl del tampón de carga al tubo que contiene los marcadores HindIII. Si es posible,
calentar los marcadores 5 minutos a 65 ºC, y luego enfriarlos en hielo –al hacer esto se separan
mejor las bandas de los marcadores. Rotular 8 microtubos con una M. Añadir 15 µl de los
marcadores con el tampón de carga a cada tubo M. Distribuir los tubos a cada puesto de trabajo
de los alumnos.
2. Preparar la solución Bio-Safe para la tinción de ADN.
Diluir 1 ml de la solución 500x en 499 ml de agua destilada en un recipiente adecuado. Cubrir el
recipiente y almacenarlo a temperatura ambiente hasta su uso.
3. Electroforesis de las muestras
El tiempo requerido es de 30 minutos, aunque si es posible dejarla correr 40 minutos se obtendrá
una mayor resolución.
Procedimiento de tinción del ADN con la solución Bio-Safe
El volumen de solución Bio-Safe 1x necesario para teñir un gel de 7 x 7 ó 7 x 10 cm es de
aproximadamente 60 ml. Los geles se deben separar del soporte antes de la tinción. Esto se realiza
fácilmente sujetando la base del gel en una mano y empujándolo suavemente con el pulgar de la otra
mano. Se debe tener especial precaución para no romper la zona de los pocillos al separar el gel.
Situar el gel en una cubeta o cristalizador y cubrirlo completamente con la solución colorante.
Para obtener mejores resultados, dejar los geles en agitación toda la noche. Se pueden teñir varios
geles en un recipiente grande, marcándolos con cortes en diferentes esquinas, para diferenciarlos. Si
se utilizan las cubetas del kit, cada gel se puede teñir de forma individual en una cubeta.
Dejar los geles tiñéndose toda la noche. Al día siguiente, aclarar los geles teñidos con agua y
desteñirlos al menos 10 minutos. Para obtener el máximo contraste, los geles se pueden dejar
destiñéndose en agua toda una noche. El colorante no es tóxico, pero se deben utilizar guantes
mientras se tocan los geles para evitar teñirse las manos.
14
ADN Fingerprinting
Unidad 4
Manual del Profesor
Secado de los geles y análisis de las bandas de ADN
Preparación previa
Objetivo
Preparar puestos de trabajo
Tiempo requerido
10 minutos
Material
No es necesario preparar ningún reactivo
Para obtener una copia permanente del gel antes de su secado, bien se puede calcar dibujando los
pocillos y las bandas de ADN en papel acetato, o se puede fotografiar con una cámara y película
normales (Bio-Rad’s Standard Polaroid gel documentation system).
Secado del gel de agarosa
Nota: El secado de los geles de agarosa requiere el uso de la agarosa de alta resistencia Bio-Rad.
Otras agarosas pueden resultar inapropiadas para este fin. Existen dos métodos para el secado de
geles de agarosa:
Método 1
El método 1 es el preferido y requiere el uso del film de soporte del gel (número de catálogo 1702984-EDU). Simplemente, sacar el gel de agarosa desteñido de la cubeta y recortar las zonas sin
bandas con un cuchillo. Situar el gel directamente sobre la cara hidrofílica de un trozo de film de
soporte del gel. El agua formará gotas en la cara hidrofóbica pero se esparcirá en la cara hidrofílica.
Centrar el gel en el film. Situar el film en una hoja de papel secante y dejar secar, evitando la
exposición directa a la luz. Al secarse, el gel se pegará al film y no encogerá. Si se deja el gel sobre el
film sin tocarlo, se secará completamente a temperatura ambiente en 2-3 días. Se obtendrá una copia
lisa, transparente y duradera del experimento.
Método 2
Después de teñir y desteñir el gel, dejarlo en la cubeta o cristalizador. Dejarlo secar al aire durante 2-3
días. Al secarse el gel encogerá considerablemente, pero proporcionalmente. Si se deja en la cubeta
sin tocarlo, el gel debería quedar relativamente liso, pero se puede arrugar mientras se seca.
Film de soporte del gel
Método 1
Método 2
Nota: Evitar la exposición prolongada de los geles secados a luz directa para evitar que
las bandas se decoloren.
Representación gráfica de los datos
Muchos de los alumnos pueden no estar familiarizados con el papel logarítmico y semilogarítmico.
Se sugiere que se les enseñe la manera adecuada de utilizarlo. Se puede incluir una explicación sobre
los diferentes usos del papel semilogarítmico frente al papel milimetrado lineal. Es una oportunidad
para repasar las matemáticas y recordar las secuencias numéricas lineales y exponenciales. Se
incluyen ambos tipos de papel, lineal y semilogarítmico en las páginas 37 y 38 de este manual.
15
ADN Fingerprinting
Manual del Profesor
Guía rápida para el uso del kit ADN Fingerprinting
Día 1
Preparación de las muestras de ADN
1. Colocar en hielo el tubo con la mezcla de enzimas
de restricción, rotulado como ENZ.
ENZ
hielo
2. Rotular cada uno de los microtubos coloreados de
la siguiente forma:
Verde
EC = Escena del crimen
Azul
S1 = Sospechoso 1
Naranja
S2 = Sospechoso 2
Violeta
S3 = Sospechoso 3
Rojo
S4 = Sospechoso 4
Amarillo
S5 = Sospechoso 5
CS
S1
S2
S3
S4
S5
Marca los tubos con tu nombre, fecha y sesión de
prácticas. Pon los tubos en la gradilla de corcho.
3. Pipetear 10 µl de cada muestra de ADN de los
tubos
del
kit
al
correspondiente
microtubo
Muestras ADN
+
mezcla de enzimas
coloreado. Usar una punta de pipeta diferente
para cada muestra de ADN. Asegurarse de que
las muestras quedan en el fondo de los tubos.
4. Pipetear 10 µl de la mezcla de enzimas (ENZ) en
el fondo de cada tubo. Cambiar la punta de la
pipeta para cada muestra de enzimas.
5. Tapar los tubos y mezclar los componentes
golpeando suavemente los tubos con el dedo. Si
se dispone de microcentrífuga, dar un pulso para
que todo el líquido quede en el fondo del tubo. De
Golpear con el dedo y
contra la mesa
lo contrario, golpear el tubo sobre la mesa.
6. Colocar los tubos en una gradilla de corcho e
incubar 45 minutos a 37 ºC, o toda la noche a
temperatura ambiente en un volumen elevado de
agua calentada a 37 ºC.
Baño
7. Después de la incubación, sacar los tubos del
baño y dejarlos en la nevera hasta su uso.
16
ADN Fingerprinting
Día 2
Manual del Profesor
Electroforesis
1. Sacar las muestras de ADN digerido de la nevera.
Si se dispone de centrífuga, dar un pulso a los
tubos para que todo el líquido quede en el fondo
del tubo.
2. Utilizando una punta de pipeta diferente para cada
muestra, añadir 15 µl de tampón de carga “TC” en
cada tubo. Cerrar los tubos y mezclar los
componentes golpeando suavemente los tubos
con el dedo.
3. Colocar un gel de agarosa en la cubeta de
electroforesis. Rellenar la cubeta con tampón TAE
1x hasta cubrir el gel, usando aproximadamente
275 ml de tampón.
4. Comprueba que los pocillos del gel están cerca
del electrodo negro (-) y que la base del gel está
cerca del electrodo rojo (+).
5. Utilizando una punta de pipeta diferente para cada
muestra, cargar el volumen indicado de cada
(-)
(+)
muestra en los 7 pocillos del gel en el siguiente
orden:
Pocillo 1:
M, Marcadores de ADN, 10 µl
Pocillo 2
EC, tubo verde, 20 µl
Pocillo 3
S1, tubo azul, 20 µl
Pocillo 4
S2, tubo naranja, 20 µl
Pocillo 5
S3, tubo violeta, 20 µl
Pocillo 6
S4, tubo rojo, 20 µl
Pocillo7
S5, tubo amarillo, 20 µl
6. Colocar la tapa en la cubeta de electroforesis. La
tapa encaja en una única posición. Los puntos
rojo y negro de la tapa se unen a los puntos rojo y
negro de la cubeta. Conectar los electrodos a la
fuente de alimentación.
7. Encender y dejar 30 minutos a 100 V
8. Cuando
la
electroforesis
haya
terminado,
desconectar y retirar la tapa. Con cuidado sacar
de la cubeta el molde con el gel. ¡Ten cuidado, el
gel es muy escurridizo! Poner el gel en el
cristalizador o cubeta de tinción.
9. Añadir 60 ml del colorante para ADN en la cubeta.
Cubrir la cubeta con una película de plástico. Deja
el gel tiñéndose toda la noche, en agitación.
Día 3
Análisis del gel
1. Eliminar el colorante traspasándolo a una botella.
Añadir 60 ml de agua al gel y dejar destiñendo 15
1.
minutos.
2. Eliminar el agua tirándola al contenedor de
residuos. Analizar los resultados con la ayuda del
profesor.
3. Dejar que el gel se seque sobre el film de soporte
o sobre la mesa del laboratorio. Cuando esté
seco, pégalo en tu cuaderno de laboratorio.
17
3.
2.
ADN Fingerprinting
Manual del Alumno
ADN Fingerprinting
Manual del alumno
Unidad 1
Introducción al ADN Fingerprinting………………………………………………18
Unidad 2
Digestión de las muestras de ADN con enzimas de restricción…………….. 20
Unidad 3
Electroforesis y tinción de las muestras de ADN……………………………… 27
Unidad 4
Secado de los geles y análisis de las patrones de ADN………………………32
18
ADN Fingerprinting
Unidad 1
Manual del Alumno
Introducción al “ADN fingerprinting”
Vas a realizar un procedimiento denominado “ADN fingerprinting”. Los datos obtenidos te permitirán
determinar si las muestras de ADN que te serán proporcionadas son del mismo individuo o de varios
diferentes. Para este experimento es necesario repasar la estructura de la molécula de ADN.
ESTRUCTURA DEL ADN
Molécula 1 de ADN
PLANTA
Molécula 2 de ADN
HUMANO
Molécula 3 de ADN
BACTERIA
El esquema anterior representa una pequeña porción de ADN de tres seres vivos diferentes. En esta
representación el sistema de símbolos es el siguiente:
Cadenas laterales:
S = Azúcar de 5 carbonos denominado desoxirribosa.
P = Molécula de fosfato compuesta de átomos de fósforo y oxígeno.
Bases nitrogenadas:
A = adenina
C = citosina
G = guanina
T = timina
El análisis de las tres muestras de ADN anteriores (mira la siguiente página) nos ayudará a detectar
similitudes y diferencias en las muestras de ADN de diferentes personas.
19
ADN Fingerprinting
Unidad 1
Manual del Alumno
Introducción al ADN fingerprinting
¿Cuál es la estructura del ADN?
1. Compara la estructura y colocación del azúcar y el fosfato en las cadenas laterales de las tres
muestras. ¿Hay alguna diferencia?
2. En la figura anterior, ¿las tres muestras contienen las mismas bases? Describe tus observaciones.
3. ¿Están las bases apareadas de la misma manera en las tres muestras? Describe el patrón de
apareamiento de las bases.
4.
En tu intento de analizar las muestras de ADN de tres seres vivos diferentes, ¿qué conclusiones
sacas sobre las similitudes y diferencias de las muestras de ADN?
5. ¿Qué necesitas para comparar esas muestras de ADN y determinar si son idénticas o no?
20
ADN Fingerprinting
Unidad 2
Manual del Alumno
Digestión de las muestras de ADN con enzimas de
restricción
¿Cómo podemos detectar diferencias en la secuencia de bases?
A primera vista, esta tarea te puede parecer difícil. ¡Necesitas determinar si la secuencia lineal de
pares de bases en las muestras de ADN es idéntica o no! La comprensión de algunos hallazgos
relativamente recientes en la tecnología del ADN recombinante te puede ayudar a elaborar un plan.
En 1968, el Dr. Werner Arber de la Universidad de Basel, Suiza, y el Dr. Hamilton Smith de la
Universidad Johns Hopkins, Baltimore, descubrieron varias enzimas en las bacterias, las cuales
cuando se añadían a cualquier ADN rompían (hidrolizaban) los enlaces entre las moléculas de azúcar
fosforilado, actuando de forma específica en algunas secuencias de bases (sitios de reconocimiento).
Esto producía la ruptura de la doble cadena de ADN en el sitio de reconocimiento y la molécula de
ADN se fracturaba en dos fragmentos. Estas tijeras moleculares o enzimas hidrolíticas son las
endonucleasas de restricción.
(¿Puedes imaginar por qué se llaman endonucleasas de restricción?)
Dos endonucleasas de restricción muy comunes son EcoRI y PstI, y las utilizarás en esta práctica.
Para comprender mejor cómo EcoRI y PstI te pueden ayudar a realizar el ensayo ADN fingerprinting,
primero debes entender y visualizar el efecto del corte del ADN por las endonucleasas de restricción:
La línea entre los pares de bases representa los puntos en los que se romperán los enlaces si la
endonucleasa de restricción reconoce la secuencia GAATTC. Las siguientes preguntas se refieren a
cómo se vería afectado un fragmento de ADN si la endonucleasa de restricción cortara la molécula de
la manera descrita arriba.
1. ¿Cuántos fragmentos de ADN se obtendrían tras el corte?
2. Escribe la secuencia de bases de los dos fragmentos, el izquierdo y el derecho:
Izquierdo:
Derecho:
3. ¿Qué diferencias hay entre los dos fragmentos?
21
ADN Fingerprinting
Manual del Alumno
4. El tamaño del fragmento de ADN se puede expresar como el número de pares de bases del
fragmento. Indicar el tamaño de los fragmentos obtenidos.
a.
El fragmento más pequeño tiene ............................. pares de bases (pb).
b.
¿Cuál es el tamaño del fragmento más largo?
5. Observa las dos muestras de ADN mostradas a continuación, en las que por simplificación se
representa una sola cadena:
Muestra 1
CAGTGATCTCGAATTCGCTAGTAACGTT
Muestra 2
TCATGAATTCCTGGAATCAGCAAATGCA
Si ambas muestras fueran tratadas con una enzima de restricción cuyo sitio de reconocimiento fuera
GAATTCC, indica el número de fragmentos y el tamaño de los mismos que se obtendrían para cada
muestra de ADN.
Muestra 1
Muestra 2
Nº de fragmentos:
Nº de fragmentos:
Escribe el tamaño de cada fragmento en orden, del más grande al más pequeño:
Muestra 1
Muestra 2
22
ADN Fingerprinting
Unidad 2
Manual del Alumno
Digestión de las muestras de ADN con enzimas de
restricción
Metodología
Tras observar con detenimiento, es evidente que la única diferencia entre el ADN de diferentes
individuos es la secuencia lineal de pares de bases. En esta práctica, tu grupo recibirá 6 muestras de
ADN. Recuerda que tu tarea es determinar si alguna de ellas pertenece al mismo individuo o si son
todas de diferentes individuos.
Hasta aquí tu análisis preliminar ha incluido los siguientes puntos:
•
Las similitudes y diferencias entre ADN de diferentes individuos.
•
Cómo las endonucleasas cortan (hidrolizan) las moléculas de ADN.
•
Cómo el añadir la misma endonucleasa de restricción a dos muestras de ADN puede
proporcionar algunas pistas sobre las diferencias entre la secuencia lineal de pares bases.
Ahora que tienes nociones básicas sobre estos tres puntos, estás listo para realizar la primera fase
del procedimiento de “ADN fingerprinting”: la digestión con enzimas de restricción de tus muestras de
ADN.
Listado de material necesario en tu puesto de trabajo
Asegúrate que los materiales de la siguiente lista están en tu puesto de trabajo antes de comenzar la
práctica.
Puesto de trabajo alumnos
Número
(√
√)
Enzimas EcoRI/PstI (ENZ)
1 tubo (80 µl)
o
Puntas pipeta
15
o
Micropipeta P-10 o P-20
1
o
Microtubos de colores: verde, azul, naranja, violeta
rojo, amarillo
1
o
Rotulador de tinta indeleble
1
o
Contenedor para residuos
1
o
Gradilla de corcho
1
o
Cubeta con hielo
1
o
ADN escena crimen
1 vial
o
ADN sospechoso 1
1 vial
o
ADN sospechoso 2
1 vial
o
ADN sospechoso 3
1 vial
o
ADN sospechoso 4
1 vial
o
ADN sospechoso 5
1 vial
o
Estufa o baño a 37 ºC
1/laboratorio
o
Puesto común
23
ADN Fingerprinting
Manual del Alumno
Unidad 2
Protocolo
Digestión de las muestras de ADN
1. Rotula los tubos
a.
Utiliza microtubos de los siguientes colores, y rotúlalos como se indica a continuación:
Verde
EC = Escena del crimen
Azul
S1 = Sospechoso 1
Naranja
S2 = Sospechoso 2
Violeta
S3 = Sospechoso 3
Rojo
S4 = Sospechoso 4
Amarillo
S5 = Sospechoso 5
Marca los tubos con tu nombre, fecha y sesión de prácticas. La digestión enzimática tendrá
lugar en estos tubos. Pon los tubos en la gradilla de corcho.
CS
S1
S2
S3
S4
S5
2. Localiza el tubo que contiene la mezcla de enzimas de restricción, marcado como “ENZ”.
ENZ = mezcla enzimática.
ENZ
3. Localiza tus muestras de ADN.
Usando una nueva punta de pipeta para cada muestra, pasa 10 µl de cada muestra de ADN al
correspondiente microtubo coloreado.
Stock ADN
CS
S1
24
S2
S3
S4
S5
ADN Fingerprinting
Manual del Alumno
Observaciones
1. Describe las muestras de ADN (propiedades físicas).
2. ¿Hay alguna diferencia observable a simple vista entre las muestras de ADN?
3. Describe la apariencia de la mezcla de endonucleasas de restricción.
4. Añade la mezcla enzimática.
Con la micropipeta, y utilizando una nueva punta de pipeta para cada muestra, pasa 10 µl de la
mezcla enzimática a cada tubo según se muestra a continuación.
Nota: Cambia las puntas siempre que cambies de reactivo, o si de forma accidental la punta toca
el líquido de uno de los tubos. Ante la duda, ¡cambia la punta!. El ADN se añade antes que las
enzimas. Añade siempre las enzimas en último lugar.
ENZ
CS
S1
25
S2
S3
S4
S5
ADN Fingerprinting
Manual del Alumno
Ahora tus muestras de ADN contendrán:
Muestras ADN
(10 µl)
Mezcla
EcoRI/PstI
Volumen total
de reacción
EC = Escena del crimen
10 µl
20 µl
S1 = Sospechoso 1
10 µl
20 µl
S2 = Sospechoso 2
10 µl
20 µl
S3 = Sospechoso 2
10 µl
20 µl
S4 = Sospechoso 2
10 µl
20 µl
S5 = Sospechoso 2
10 µl
20 µl
5. Mezcla el contenido.
Cierra todos los tubos. Mezcla los componentes golpeando suavemente los tubos con el dedo. Si
dispones de centrífuga, da un pulso a los tubos durante 2 segundos para hacer que el líquido
quede en el fondo del tubo y se mezclen y reaccionen los componentes. (Asegúrate de que los
tubos se colocan de forma equilibrada en la centrífuga). Si no dispones de centrífuga, golpea el
tubo (con una vez es suficiente) como si fuera un termómetro. Golpear los tubos sobre la mesa
también ayuda a mezclar los componentes.
CS
S1
S2
S3
S4
S5
Golpear con el dedo y contra
la mesa
6. Incuba las muestras.
Pon los tubos en la gradilla de corcho e incúbalos a 37 ºC en el baño durante 45 minutos.
Alternativamente, los tubos se pueden incubar dejándolos en un volumen elevado de agua
calentada a 37 ºC y dejando que se enfríe lentamente durante toda la noche hasta que alcance
la temperatura ambiental. Después de la incubación, guarda los tubos en la nevera hasta que los
necesites.
Baño
26
ADN Fingerprinting
Unidad 2
Manual del Alumno
Digestión de las muestras de ADN con enzimas de
restricción
Cuestionario
1.
Antes de incubar las muestras, describe cualquier cambio visible que se pudiera producir en los
tubos que contenían la muestra de ADN, después de añadir las enzimas de restricción.
2. ¿Puedes ver alguna evidencia que indique que las muestras de ADN estén fragmentadas o
alteradas de alguna forma por la adición de EcoRI/PstI? Explica tu respuesta.
3.
En ausencia de evidencia visible de cambio, ¿es posible que las muestras de ADN estén
fragmentadas?
4. (Contestar al día siguiente)
Después de incubar 24 horas, ¿hay alguna pista visible de que las enzimas de restricción
hayan modificado de alguna forma el ADN en los tubos? Razona tu respuesta.
27
ADN Fingerprinting
Unidad 3
Manual del Alumno
Electroforesis y tinción de las muestras de ADN
¿Cómo podemos detectar la posición de los sitios de restricción para
EcoRI y PstI en nuestras muestras de ADN?
Dado que intentamos detectar cambios a nivel molecular, y no hay pistas o evidencias visibles de
ellos, esta tarea puede parecernos imposible. Veamos si podemos entenderlo. Una manera para
determinar la localización de los sitios de restricción podría ser averiguar lo siguiente:
1) ¿Cuántos fragmentos de ADN de diferente tamaño hay en cada muestra?
2) ¿Cuales son los tamaños relativos de cada fragmento?
Por tanto, de alguna forma, debes obtener evidencias para contestar la siguiente pregunta:
¿Se encuentran los sitios de restricción para EcoRI y PstI localizados en los mismos puntos en
cada muestra de ADN?
Los siguientes hechos te serán de ayuda para determinar el tamaño de los fragmentos de ADN
en tus muestras.
Análisis de la digestión con enzimas de restricción
La estructura tridimensional de las enzimas de restricción les permite fijarse a una molécula de
ADN de doble cadena y desplazarse a lo largo de la hélice hasta que reconocen una secuencia
específica de pares de bases que indica a la enzima que deje de desplazarse. Las enzimas
entonces digieren (separan químicamente) la molécula de ADN en ese sitio (denominado “sitio de
restricción”) actuando como unas tijeras moleculares, que cortan el ADN en una secuencia
específica de pares de bases.
Si un sitio de restricción aparece en más de un punto en la molécula de ADN, la enzima de
restricción hará un corte en todos y cada uno de esos sitios, obteniéndose múltiples fragmentos. La
longitud de cada fragmento dependerá de la posición de los sitios de restricción en la molécula de
ADN.
Cuando las enzimas de restricción se usan para cortar una larga cadena de ADN, se pueden
obtener varios fragmentos. Esos fragmentos se pueden separar y visualizar usando una técnica
denominada electroforesis en gel de agarosa. El término electroforesis significa “mover con
electricidad”.
Electroforesis en gel de agarosa
La electroforesis separa fragmentos de ADN en función de su tamaño. Los fragmentos de ADN
se cargan en un gel de agarosa, que se sitúa en una cubeta rellena con una solución tampón
conductora. La corriente pasa a través de electrodos situados en cada extremo de la cubeta. Los
fragmentos de ADN están cargados negativamente, y cuando se sitúan en un campo eléctrico
migran hacia el polo positivo. La matriz del gel de agarosa actúa como una malla molecular a
través del cual los fragmentos pequeños de ADN se pueden mover con más facilidad que los
28
ADN Fingerprinting
Manual del Alumno
grandes. Tras un periodo de tiempo los fragmentos pequeños migrarán más lejos que los grandes.
Los fragmentos del mismo tamaño permanecen juntos y forman una sola “banda” de ADN.
Una analogía: Compara este proceso con lo que ocurriría si en un aula todos los pupitres y sillas
se hubieran dispersado simétricamente por todo el aula. Un solo estudiante podría avanzar por el
laberinto rápidamente y con poca dificultad, mientras que cuatro estudiantes unidos por las manos
tardarían más tiempo y tendrían más dificultades para avanzar entre el laberinto de sillas.
¡Compruébalo!
Unidad 3
Electroforesis de las muestras de ADN
Material necesario
Puesto de trabajo alumnos
Número
(√
√)
Gel agarosa
1
o
Muestras de ADN digerido
5
o
Tampón carga
1
o
Rotulador
1
o
Puntas pipeta
1 caja
o
Micropipeta P-10 o P-20
1
o
Contenedor para residuos
1
o
Gradilla de corcho
1
o
Cubeta electroforesis y fuente alimentación
1
o
Cristalizador o cubeta para tinción gel
1
o
Marcadores HindIII
1
o
Tampón electroforesis (TAE 1x)
275 ml gel/cubeta
o
Colorante Bio-Safe- 1x
500 ml
o
Puesto común
29
ADN Fingerprinting
Manual del Alumno
Unidad 3
Protocolo
Electroforesis de las muestras de ADN
1. Utiliza un gel de agarosa preparado por tu profesor, o si el profesor te enseña, prepáralo tu
mismo.
2. Cuando el gel esté preparado, saca de la nevera las muestras de ADN digeridas.
Usando una nueva punta de pipeta para cada muestra añade 5 µl de tampón de carga a cada
tubo:
Muestras ADN
Tampón de carga
Escena del crimen (EC)
5 µl
Sospechoso 1 (S1)
5 µl
Sospechoso 2 (S1)
5 µl
Sospechoso 3 (S1)
5 µl
Sospechoso 4 (S1)
5 µl
Sospechoso 5 (S1)
5 µl
Tampón de carga TC
CS
S1
S2
S3
S4
S5
Golpear con el dedo y contra la mesa
TC
Cierra los tubos. Mezcla los componentes golpeando suavemente los tubos con el dedo. Si
dispones de centrífuga, dales un pulso para que el contenido quede en el fondo de los tubos.
Si no, golpea los tubos suavemente sobre la mesa.
3. Coloca en la cubeta de electroforesis el molde con el gel preparado. Los pocillos deben estar
en el extremo en el que se sitúa el cátodo (-), donde se conecta el cable negro. Con mucho
cuidado, retira el peine del gel.
4. Añade 275 ml de tampón de electroforesis en la cubeta, justo hasta que cubra los pocillos.
(-)
(+)
5. Localiza los marcadores de ADN HindIII en el tubo rotulado como “M”.
Los geles se interpretan de izquierda a derecha. Así, la primera muestra se carga en el pocillo
del lado izquierdo del gel.
30
ADN Fingerprinting
Manual del Alumno
6. Utilizando una punta de pipeta diferente para cada muestra, cargar el gel de la siguiente manera:
Pocillo 1:
M, Marcadores de ADN, 10 µl
Pocillo 2
EC, tubo verde, 20 µl
Pocillo 3
S1, tubo azul, 20 µl
Pocillo 4
S2, tubo naranja, 20 µl
Pocillo 5
S3, tubo violeta, 20 µl
Pocillo 6
S4, tubo rojo, 20 µl
Pocillo7
S5, tubo amarillo, 20 µl
7. Colocar la tapa a la cubeta de electroforesis. La tapa encaja en una única posición: rojo con rojo
y negro con negro. Conectar los cables a la fuente de alimentación.
8. Encender la fuente a 100 V, y dejar correr la electroforesis durante 30-40 minutos.
Mientras, puedes ir contestando las preguntas de revisión de la siguiente página.
9. Cuando la electroforesis haya terminado, desconectar de la fuente de alimentación y quitar la
tapa de la cubeta. Con cuidado sacar de la cubeta el molde con el gel. Ten precaución, el gel
es muy resbaladizo. Para retirar el gel del molde, empuja el gel con el pulgar para que se
deslice, y con cuidado déjalo caer en el cristalizador o cubeta para la tinción.
10. Añade 60 ml del colorante Bio-Safe en el cristalizador, y cúbrelo con plástico. Deja que el gel
se tiña durante toda la noche, moviéndolo intermitentemente si no se dispone de agitador.
31
ADN Fingerprinting
Unidad 3
Manual del Alumno
Electroforesis de las muestras de ADN
Cuestionario de revisión
1.
El aparato de electroforesis origina un campo eléctrico con un polo positivo y otro negativo
situados en cada extremo del gel. Las moléculas de ADN están cargadas negativamente. ¿A
qué polo (+ o -) crees que migrarán las muestras de ADN?. Explica por qué.
2. ¿Qué color representa al polo negativo?
3.
Después de cargar las muestras de ADN en los pocillos, se las fuerza a moverse a través de la
matriz del gel. ¿Qué fragmentos (grandes o pequeños) crees que migrarán al extremo opuesto
del gel con mayor rapidez? Explica por qué.
4. ¿Qué fragmentos (grandes o pequeños) esperas que se desplacen la mínima distancia desde
el pocillo? Explica por qué.
32
ADN Fingerprinting
Unidad 4
Manual del Alumno
Secado de los geles y análisis de los patrones de ADN
¿Alguna de las muestras de ADN de los sospechosos coincide con la del
individuo presente en la escena del crimen?
Tómate un momento para pensar cómo analizarás tu gel. En los dos últimos pasos, tendrás que:
A.
Visualizar los fragmentos de ADN en tu gel.
B.
Analizar el número y posición de las bandas visibles de ADN en tu gel.
Visualización de los fragmentos de ADN
Un examen visual de los geles permite ver la posición del tampón de carga, pero no las
posiciones de los fragmentos de ADN. Los fragmentos de ADN se visualizan tiñendo el gel con un
colorante azul. El colorante tiene una alta afinidad por el ADN y se une fuertemente a los
fragmentos de ADN, haciéndolos visibles. Estas bandas visibles de ADN se pueden fotografiar,
dibujar o conservar secando el gel para su análisis.
El dibujo situado más abajo representa un ejemplo de un gel teñido después de una
electroforesis. Para analizarlo, es importante recordar la siguiente información:
• Cada carril contiene una muestra diferente de ADN.
• Cada muestra de ADN fue tratada con las mismas endonucleasas de restricción.
Analiza las bandas del siguiente gel, y luego contesta a las preguntas de la siguiente página.
Carril
1
2
3 4
5 6
33
ADN Fingerprinting
Unidad 4
Manual del Alumno
Cuestionario
1. ¿Qué crees que contiene cada banda?
2. En este gel, ¿cuántas muestras de ADN crees que se cargaron en cada pocillo?
3. ¿Cuál sería una explicación lógica a que haya más de una banda de ADN para cada muestra?
4. ¿Qué es lo que produjo la fragmentación del ADN?
5. ¿Cuál de las muestras de ADN tiene el mismo número de sitios de restricción para las
endonucleasas de restricción utilizadas? Indica los números de los pocillos.
6. ¿Qué muestra tiene el fragmento más pequeño de ADN?
7. Asumiendo que se utilizara un fragmento circular de ADN (plásmido) como material de partida,
¿cuántos sitios de restricción tendría la muestra del carril 3?
8. ¿Qué muestras de ADN parecen haber sido cortadas en el mismo número de fragmentos y del
mismo tamaño?
9.
Basándote en tu análisis de este gel, ¿cuál es tu conclusión sobre las muestras de ADN del
dibujo? ¿Alguna de las muestras parece proceder de la misma fuente? Si es así, ¿cuáles?
Describe las evidencias que justifican tus conclusiones.
34
ADN Fingerprinting
Unidad 4
Manual del Alumno
Análisis de los patrones de ADN
Protocolo
Puesto de trabajo alumnos
Agua para desteñir geles
Número
(√
√)
60 ml
o
Regla milimetrada
1
o
Papel milimetrado lineal
1
o
Papel milimetrado semilogarítmico
1
o
Puesto común
No se necesita material común
Pasos para teñir y desteñir el gel
1.
Elimina el colorante Bio-Safe recogiéndolo en una botella o similar y destiñe el gel con 60 ml
de agua durante unos 15 minutos.
2. Elimina el agua del cristalizador. Pregunta al profesor cómo tirar de forma adecuada el colorante.
3.
Recorta los carriles sin bandas del gel con un cuchillo. Deja secar el gel sobre la cara hidrofílica
de un trozo de film de soporte del gel o en el cristalizador sobre la mesa del laboratorio durante
3-5 días. Cuando el gel esté seco, pégalo en tu cuaderno de laboratorio como recuerdo.
35
ADN Fingerprinting
Manual del Alumno
Análisis cuantitativo del tamaño de los fragmentos de ADN
Si estuvieras en un juicio, ¿querrías confiar en la estimación ocular de coincidencia entre dos
muestras hecha por un técnico de laboratorio o querrías una medida más precisa?
Con el fin de hacer más precisa la comparación entre el ADN de la escena del crimen y el ADN
del sospechoso, algo que sea más que una impresión visual, se necesita crear una medida
cuantitativa del tamaño de los fragmentos. Se realiza de la siguiente manera:
1.
Usando la regla, mide la distancia a la que ha migrado cada banda. Mide la distancia en
milímetros desde el fondo del pocillo hasta el centro de cada banda de ADN, y apunta los
datos en la tabla de la siguiente hoja. Los datos de la tabla se usarán para construir una curva
patrón y para estimar el tamaño de los fragmentos de la escena del crimen y de los
sospechosos.
2.
Para hacer una estimación exacta del tamaño de los fragmentos tanto de la escena del crimen
como de los sospechosos, se construye una curva patrón usando las distancias (eje X) y el
tamaño de los fragmentos (eje Y) de los marcadores de tamaño Lambda/HindIII. Usando tanto
el papel lineal como el semilogarítmico, dibuja la distancia frente al tamaño de las bandas 2-6.
En cada gráfica, usa una regla y traza una línea uniendo los puntos. Continúa la línea hacia el
lado derecho del papel.
¿En qué papel se obtiene la línea más recta para estimar el tamaño de los fragmentos de la
escena del crimen y de los sospechosos?¿Por qué crees que una gráfica es más recta que la
otra?
3.
Decide qué gráfica, la del papel lineal o la del semilogarítmico, se debe usar para estimar el
tamaño de los fragmentos de ADN de las escena del crimen y de los sospechosos. Justifica tu
elección.
4.
Para estimar el tamaño de un fragmento de la escena del crimen o de un sospechoso, mide la
distancia a la que migró ese fragmento. Localiza esa distancia en el eje X de tu curva patrón, y
desde esa posición en el eje X, sube hasta la curva patrón, y luego sigue la línea milimetrada
del papel hasta el eje Y. Quizás quieras dibujar una marca en lápiz de la trayectoria que has
seguido desde el eje X al Y. El punto en el que la línea se encuentra con el eje Y, indica el
tamaño aproximado del fragmento de ADN. Haz esto para todos los fragmentos de la escena
del crimen y de los sospechosos.
5.
Compara los tamaños de los fragmentos de los sospechosos y de la escena del crimen. ¿Hay
algún sospechoso que coincida con la escena del crimen?
¿Estás seguro de que coinciden?
36
Manual del Alumno
ADN Fingerprinting
banda
1
Marcadores
Lambda/HindIII
Tamaño
(pb)
3
4,361
6,557
Distancia
(mm)
23,130
4
2,322
9,416
5
2,027
2
6
Tamaño
(pb)
Escena crimen
Distancia
(mm)
Tamaño
(pb)
Sospechoso 1
Distancia
(mm)
Tamaño
(pb)
Sospechoso 2
Distancia
(mm)
Tamaño
(pb)
Sospechoso 3
Distancia
(mm)
Tamaño
(pb)
Sospechoso 4
Distancia
(mm)
Tamaño
(pb)
Sospechoso 5
Distancia
(mm)
37
ADN Fingerprinting
Manual del Alumno
Tamaño (pares de bases)
Papel semilogarítmico
Distancia (mm)
38
ADN Fingerprinting
Manual del Alumno
39
ADN fingerprinting
Unidad 4
Manual del Alumno
Análisis de los patrones de ADN
Interpretación de resultados
Pega una foto, fotocopia, o tu gel seco en este espacio. Indica qué muestra hay en cada pocillo.
1. ¿Qué tratamos de determinar? Recuerda el objetivo principal.
2. ¿Cuál de las muestras de ADN se fragmentaron? ¿Cómo sería tu gel si el ADN no se hubiera
fragmentado?
3. ¿Qué produjo que el ADN se fragmentara?
4. ¿Qué es lo que determina el punto donde una endonucleasa de restricción corta una molécula
de ADN?
40
ADN fingerprinting
5.
Manual del Alumno
Una endonucleasa de restricción corta dos moléculas de ADN en el mismo punto. ¿Qué
asumes que es idéntico en las dos moléculas en ese punto?
6. ¿La muestra de algún sospechoso parece tener los mismos sitios de reconocimiento para
EcoRI o PstI en el mismo punto que el ADN procedente de la escena del crimen?
7.
Basándote en el análisis anterior, ¿la muestra de ADN de algún sospechoso parece ser del
mismo individuo que el ADN recogido en la escena del crimen? Describe la evidencia científica
que sustenta tu conclusión.
41
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement