Paradise Plus Guiide_RevC.book

Arcturus Paradise PLUS Reagent System
®
®
FFPE Tissue staining, extraction, isolation, amplification, and microarray labeling in one convenient kit
> perform gene expression
experiments using
archived tissue blocks
> utilize MICROARRAYS
OR QRT-PCR FROM AS
LITTLE AS 5 ng OF rna
from FFPE MATERIAL
The Paradise®PLUS reagent system from MDS
Analytical Technologies’ Arcturus® microgenomics
product line enables unprecedented gene expression
analysis of formalin-fixed, paraffin-embedded
(FFPE) samples. Using the ParadisePLUS reagent
system, researchers can now measure whole gene
expression profiles in these previously inaccessible
samples, using either microarray or quantitative
real-time PCR (QRT-PCR) analysis.
The ParadisePLUS reagent system has been
validated as a key component of MDS Analytical
Technologies’ Systems for Microgenomics®.
This reagent system has also been validated
with all Arcturus Laser Capture Microdissection
(LCM) instruments, which incorporate the most
advanced technologies for automated isolation of
pure cell populations.
the only complete
system for formalincorporate
corporate
8222
8222
fixed samples
PLUS
The Paradise
reagent system provides all
ensURE DOWNSTREAM SUCCESS
> REDUCE COST AND SAVE
corporate
8222
corporate
TIME BY PRE-QUALIFYING
8222
SAMPLES WITH THE
QUALITY ASSESMENT
KIT
Ephys
Ephys
8181
Ephys
Ephys
8303
8303
lifesci
8142
lifesci
8142
lifesci
8142
imaging
8263
imaging
8263
imaging
8263
imaging
8263
genomics
8183
genomics
integrated
8183
analyst
8243
8181
> Use samples prepared
analyst
8243
from a variety
of
fixation protocols
Flex
8303
Flex
8303
> Work directly with
FliPr
8303
FliPr
application
specialists
8303
8181
the components necessary
to prepare RNA 8181
from FFPE tissue samples for gene expression
analyst
analyst
analysis. To ensure successful
microarray results,
8243
8243
the system includes reagents optimized for
Flex
exceptional recovery Flex
of RNA, the most sensitive
8303
8303
RNA amplification available, and highly-efficient
RNA labeling.
FliPr
FliPr
dedicated to your
lifesci
8142
validation
success
genomics
time
saving
8183
genomics
8183
Not all FFPE samples contain high-quality RNA.
Using the ParadisePLUS QC Kit, FFPE tissue
samples can be qualified before performing
amplification and microarray experiments. The
QC kit’s simple QRT-PCR assay ensures that
the FFPE block contains usable RNA prior
to investing the time and expense of LCM
and RNA amplification. Researchers can then
proceed in their study with confidence using these
pre-qualified tissue samples.
labor saving
better results
Seamless Workflow Integration
Gene Expression Profiling in 5 Easy Steps
Step 1: Prepare Samples
Step 3: Extract and Isolate RNA
Step 2: Identify Cells of Interest
Step 4: Amplify RNA
Step 5: Profile Gene Expression
Cut a 7 micron section from a
paraffin block. Deparaffinize, stain
and dehydrate tissue sections
while keeping RNA intact.
Recover high-quality total RNA
using optimized extraction and
isolation reagents.
Isolate 5,000 to 10,000 pure cells
from FFPE tissue samples using
either Arcturus LCM Instruments
or use full tissue scrapes from
a slide.
Amplify as little as 5 ng of fixed
RNA using methods that overcome challenges of cross-linked
templates.
Generate gene expression
data using various compatible
microarray platforms.
Robust Data from FFPE Tissue Samples
GeneChip Reproducibility
cDNA Reproducibility
Probe Arrays
Sample 2
10
8
6
4
2
2
4
6
8
Sample 1
10
12
ParadisePLUS reproducibility on GeneChip
Human Genome X3P
array (Affymetrix).
Amplification was
performed on 5 ng of
RNA from FFPE breast
cancer samples. Biotinlabeled samples were
hybridized to duplicate
GeneChip microarrays,
resulting in intensity
correlation of R=0.983.
Integrate seamlessly into current
workflow
The ParadisePLUS reagent system is compatible
with all majorcorporate
microarray platforms.
The
corporate
8222
PLUS reagent
RNA obtained8222using the Paradise
system can be used in the same fashion as RNA
Ephys
Ephys
8181frozen tissue sources.
8181
generated from
Robust
and reproducible results are achieved using tools
analyst
analyst
and techniques
in today’s
8243commonly employed
8243
research laboratories.
Flex
8303
Flex
8303
FliPr
FliPr
COMPLETE WORKFLOW FOR GENE EXPRESSION
The ParadisePLUS reagent system contains all the
8303
materials needed
for a complete8303
gene expression
experiment. The kit includes components for:
lifesci
lifesci
8142
>Staining the
tissue to identify8142the cells of
interest imaging
imaging
validation
8263
8263
genomics
8183
genomics
integrated
8183
2.0
Oligo Arrays
R=0.993
0.0
–2.0
–2.0
0.0
2.0
Sample 1
ParadisePLUS reproducibility on cDNA arrays.
Two-round amplifications were performed
on independent laser
captured FFPE tissue
cells (~5,000 cells
each). Amplified aRNA
was labeled during
reverse transcription
and hybridized to two
cDNA arrays, resulting
in correlation of gene
expression ratios, R=
0.993 (log2 ratios).
2.0
R=0.986
Sample 2
R=0.983
Sample 2
12
Oligonucleotide Microarray Reproducibility
cDNA Arrays
0.0
–2.0
–2.0
0.0
Sample 1
2.0
ParadisePLUS reproducibility on oligonucleotide
microarrays (Agilent
Technologies). Two-round
amplifications were
performed on 5ng RNA
obtained from independent laser captured
FFPE human breast
cells. Labeled aRNA was
hybridized to customdesigned microarrays,
resulting in correlation of
gene expression ratios,
R=0.986 (log2 ratios). 
>Extraction
and isolation of total RNA from
the cells of interest
>Amplification of isolated RNA to generate
more material forcorporate
gene expression assays corporate
8222
8222
>Labeling for microarray experiments (optional)
Ephys
8181
Ephys
8181
analyst
analyst
lifesci
8142
lifesci
8142
imaging
8263
imaging
8263
SUPERIOR APPLICATIONS and TECHNICAL
SUPPORT
8243
8243 of
MDS Analytical Technologies
employs a team
highly qualified and expertly trained application
Flex support specialists. Our
Flex
scientists and technical
8303
8303
dedicated staff offers personalized training and
application support, FliPr
enabling researchers to FliPr
8303
8303
thrive in any research area.
genomics
time
saving
8183
genomics
8183
labor saving
better results
Superior Performance
RNA Yield Comparison
Frozen vs. FFPE Comparison
Company A
Company B
Company C
ParadisePLUS
Replicate
Delta Ct Frozen
vs. FFPE
Delta Ct Frozen
vs. FFPE
Delta Ct Frozen
vs. FFPE
Delta Ct Frozen
vs. FFPE
Day 1-1
10.2
10.3
8.7
8.1
Day 1-2
10.2
10.8
12.3
7.4
Day 2-1
8.0
9.4
10.4
7.6
Day 2-1
8.5
10.6
12.5
7.8
Overall
Mean
9.21
10.27
10.95
7.73
1145.1
SD
1.2
0.6
1.8
0.3
13.6
%CV
12.6
6.3
16.4
4.0
Company A
Company B
Company C
ParadisePLUS
Replicate
Yield (ng)
Yield (ng)
Yield (ng)
Yield (ng)
Day 1-1
1,173
756
155
8,235
Day 1-2
977
658
378
9,319
Day 2-1
2,342
351
384
9,185
Day 2-1
2,165
476
376
6,836
Overall
Mean
1,664
560
323
8,394
SD
688.9
181.4
112.2
%CV
41.4
32.4
34.7
A comparative QRT-PCR study of frozen tissue vs. FFPE tissue using various FFPE RNA extraction
kits. Each sample was run in triplicate. Real time PCR reactions were performed on the samples
using the house-keeping gene GAPDH. The same amount of RNA for frozen and FFPE RNA was
input into each reaction. The ParadisePLUS reagent system gave the lowest delta Ct difference
values between the frozen material and the FFPE material (Ct FFPE - Ct Frozen) indicating that RNA
extracted from the ParadisePLUS reagent system most accurately represents the RNA extracted
from pristine frozen material. Data provided by M. Davey and R. Oullette, Atlantic Cancer Research
Institute, Moncton, NB Canada.
A comparison of various extraction kits on RNA recovery yield using various FFPE
extraction kits. Breast cancer tissue scrapes were run in triplicate using serial
sections, each 1.0 cm x 1.1 cm. The ParadisePLUS reagent system gave the highest
and most consistent yield compared to alternate FFPE RNA extraction kits. Data
provided by M. Davey and R. Oullette, Atlantic Cancer Research Institute, Moncton,
NB Canada.
Comparative Microarray Data
Log2 scatter plots generated using raw fluorescence intensity data from
Affymetrix GeneChips, with Pearson correlation coefficients calculated for
(A) frozen LCM replicates, r=0.970; (B) FFPE LCM replicates, r=0.961; (C)
FFPE scrape compared to LCM, r=0.932; and (D) frozen LCM to FFPE LCM,
r=0.937. Genes that fall on the green line have equal intensities on both
arrays, and ones falling outside the red lines have two fold or greater difference in intensity between the two chips. The technical reproducibility of
FFPE samples in almost identical to that of frozen samples. The decrease
in correlation between scrape and LCM reflects the gene expression
differences between mixed cells and pure cells, highlighting the benefit
LCM provides over tissue scrapes to isolate more pure samples. A similar
decrease in correlation is seen between frozen and FFPE samples (D)
compared to replicate frozen (A) or FFPE (B). However, the correlation is
sufficiently high (r=0.937) to enable reliable gene expression profiling of
FFPE samples to represent expression levels in the tissue's native state.
validation
corporate
8222
corporate
8222
corporate
8222
corporate
8222
Ephys
8181
Ephys
8181
Ephys
8181
Ephys
8181
analyst
8243
analyst
8243
analyst
8243
analyst
8243
Flex
8303
Flex
8303
Flex
8303
Flex
8303
FliPr
8303
FliPr
8303
FliPr
8303
FliPr
8303
lifesci
8142
lifesci
8142
lifesci
8142
lifesci
8142
imaging
8263
imaging
8263
imaging
8263
imaging
8263
genomics
8183
genomics
integrated
8183
genomics
time
saving
8183
genomics
8183
labor saving
better results
Paradise Plus reagent system
CHOOSE THE PRODUCT CONFIGURATION FOR
YOUR APPLICATION
The Paradise®PLUS reagent system is available with
options customized for your research:
Biotin Labeling
> Cy3 Labeling
> Cy5 Labeling
> Amino-allyl incorporation
> Natural nucleotides
> QRT-PCR
>
Ordering information
The ParadisePLUS reagent system
includes
reagents for sample preparation, tissue staining,
RNA extraction, isolation, RNA amplification,
and microarray labeling.
ParadisePLUS
Reagent System
Part Number: KIT0312
>(12) two-round reactions
For Probe Arrays Requiring Biotin-Labeled
Material
Part Number: KIT0312B
>Perform 2-rounds of amplification generating
amplified aRNA
>Use Arcturus® Turbo Labeling™ kit to biotin
label enough material to hybridize to array*
>Remaining aRNA is unlabeled for further
comparison or validation (QRT-PCR or
alternative array platforms)
For Fluorescent and 2-color Arrays
Part Number: KIT0312C and/or KIT0312D
>Perform 2-rounds of amplification generating
amplified aRNA
>Use Arcturus Turbo Labeling kit to Cy3 or Cy5
label enough material to hybridize to array*
>Remaining aRNA is unlabeled for further
comparison or validation (QRT-PCR or
alternative array platforms)
For QRT-PCR Analysis
>Perform 1-round of amplification
>Convert amplified RNA to cDNA
>cDNA is ready for QRT-PCR reactions
ParadisePLUS Whole Transcript RT Reagent System
Part Number: KIT0315
>(12) reactions
Note: Many other configurations available customized for your research needs.
Turbo Labeling™ Biotin Kit
Part Number: KIT0608
>Microarray labeling kit
ParadisePLUS Reagent System with Biotin Labeling
Part Number: KIT0312B
>(12) two-round reactions
ParadisePLUS Reagent System with Cy3 Labeling
Part Number: KIT0312C
>(12) two-round reactions
ParadisePLUS Reagent System with Cy5 Labeling
Part Number: KIT0312D
>(12) two-round reactions
ParadisePLUS Reagent System with Amino Allyl
Labeling
Part Number: KIT0314
>(12) two-round reactions
ParadisePLUS Reagent System for Quantitative
Real-Time PCR
Part Number: KIT0310
>(12) one-round reactions
ParadisePLUS Reagent System for Quality
Assessment of FFPE Block (QC Kit)
Part Number: KIT0313
>(12) reactions
Turbo Labeling Cy3 Kit
Part Number: KIT0609
>Microarray labeling kit
Turbo Labeling Cy5 Kit
Part Number: KIT0610
>Microarray labeling kit
PEN Membrane Frame Slides
Part Number: LCM0521
>(50) slides
PEN Membrane Glass Slides
Part Number: LCM0522
>(50) slides
CapSure® Macro LCM Caps
Part Number: LCM0211
>(48) caps
CapSure HS LCM Caps
Part Number: LCM0214
>(32) caps
* Other labeling options also available.
Sales OFFICES
United States & Canada
MDS Analytical Technologies
Tel. +1-800-635-5577
Fax +1-408-747-3601
United Kingdom
MDS Analytical Technologies Ltd.
Tel. +44-118-944-8000
Fax +44-118-944-8001
Australia
MDS Analytical Technologies Pty. Ltd.
Tel. +61-3-9896-4700
Fax +61-3-8640-0742
www.moleculardevices.com
Brazil
Molecular Devices Brazil
Tel. +55-11-3616-6607
Fax +55-11-3871-9994
©2008 MDS Analytical Technologies (US) Inc. Printed in U.S.A.
9/08 1K #0120-1431A
ºMDS Analytical Technologies is the sole manufacturer of
Arcturus LCM instruments and microgenomics reagents
and sells directly to customers in the United States, Canada,
For research use only. Not for use in diagnostic
Australia, New Zealand and Brazil. Customers in other regions
procedures.
are served by a select group of distributors.
Specifications subject to change without notice.
Visit www.moleculardevices.com to locate your local
CAPSURE, MOLECULAR DEVICES, and PARADISE are registered
trademarks of MDS Analytical Technologies. All other trademarks
are the property of their respective owners. Polymerase Chain
Reaction (PCR) is a patented process owned by Hoffman-La
Roche AG.
representative.
PARADISE®PLUS REAGENT SYSTEM
User Guide
Part of the Arcturus Systems
for Microgenomics
MDS Analytical Technologies
Paradise®Plus Reagent System User Guide
Copyright
© Copyright 2008, MDS Analytical Technologies. All rights reserved. No part of this publication
may be reproduced, transmitted, transcribed, stored in a retrieval system, or translated into any
language or computer language, in any form or by any means, electronic, mechanical, magnetic,
optical, chemical, manual, or otherwise, without the prior written permission of MDS Analytical
Technologies, 1311 Orleans Drive, Sunnyvale, California, 94089, United States of America.
This product is licensed for sale only for research use. It is NOT licensed for any other use. There is
no implied license hereunder for any commercial use. Commercial use is any use other than internal
life sciences research and development, including: the sale, lease, license or other transfer of the
material, or any material derived or produced from it to any third party; the sale, lease, license or
other grant of rights to a third party to use this material or any material derived or produced from it;
and the use of this material to perform services for a fee for third parties. If you require a license to
use this material for commercial uses and do not have one, please return this material, unopened to
MDS Analytical Technologies and any money paid for the material will be refunded.
Trademarks
ARCTURUS, HISTOGENE, RIBOAMP, SYSTEMS FOR MICROGENOMICS, PICOPURE,
AUTOPIX, CAPSURE, PIXCELL, PARADISE, GENEPIX, and ACUITY are registered
trademarks, and ARCTURUSXT, TURBO LABELING, VERITAS, EXTRACSURE, MIRACOL
are trademarks of MDS Analytical Technologies. Other trademarks used in this manual are the
property of their respective owners. The PCR process is covered by patents owned by Hoffmann-La
Roche Inc. and F. Hoffman-La Roche Ltd. Some uses of the Paradise Plus Reagent System may
require licenses from third parties. Purchase of the Paradise Plus Reagent System does not include
any right or license to use, develop or otherwise exploit the product commercially. Any commercial
use, development, or exploitation of the Paradise Plus Reagent System or development using the
product without the express written authorization of MDS Analytical Technologies is strictly
prohibited.
This RNA Amplification product and/or its use may be covered by one or more U.S. Patent
numbers 5,716,785, 5,891,636,and 5,958,688, which are licensed exclusively to Incyte
Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, nontransferable right under these patents to use this product for laboratory use, as a General Purpose
Reagent, as an Analyte Specific Reagent or to provide gene expression services. The purchase of this
product does not include or carry any right or license to use the product in a clinical diagnostic test
for which the FDA Premarket Approval (PMA) and/or Premarket Notification under section
510(k) of the FFDCA is obtained or required. The buyer of this product acquires no rights to resell
or repackage for resale the product or components thereof. No other license is granted to the buyer
whether expressly, by implication, by estoppel or otherwise.
Disclaimer
MDS Analytical Technologies reserves the right to change its products and services at any time to
incorporate technological developments. This manual is subject to change without notice. Although
this manual has been prepared with every precaution to ensure accuracy, MDS Analytical
Technologies assumes no liability for any errors or omissions, nor for any damages resulting from
the application or use of this information.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Warranty
MDS Analytical Technologies warrants that the products described in this manual meet the
performance standards described in literature published by the company. If a product fails to meet
these performance standards, MDS Analytical Technologies will replace the product or issue credit
for the full purchase price, including delivery charges. MDS Analytical Technologies provides no
other warranties of any kind, expressed or implied. MDS Analytical Technologies’ warranty liability
shall not exceed the purchase price of the product and shall not extend to direct, indirect,
consequential or incidental damages arising from the use, results of use, or improper use of its
products. The Paradise Plus Reagent System is intended for laboratory use.
Related Documents
When using the Paradise Plus Reagent System User Guide, the following user guides may be helpful
references:
ArcturusXT, Veritas, AutoPix, or PixCell LCM System User Guide
Turbo Labeling kit user guide
CapSure HS Caps User Guide
Quality Control
MDS Analytical Technologies performs functional testing on all components of the Paradise Plus
Reagent System. The information sheet provided with the system highlights the tests performed.
Staining. MDS Analytical Technologies performs functional testing on the Paradise Plus Reagent
System staining components to confirm the absence of nucleic acids and nuclease activity. The
staining components are functionally tested using LCM to ensure proper dehydration and that good
quality RNA is recoverable.
Extraction/Isolation. MDS Analytical Technologies performs functional testing on the Paradise
Plus Reagent System RNA Extraction/Isolation using all components. MiraCol Purification
Columns are tested by lot to confirm the absence of nucleic acids and nuclease activity. Column
nucleic acid binding and recovery performance must meet quality standards.
Amplification. Functional Testing MDS Analytical Technologies performs functional testing on
each lot of materials using the amplification protocol described in this manual.
Reagent Testing. MDS Analytical Technologies tests each lot of enzymes to confirm activity.
Buffer components must perform correctly under reaction or nucleic acid purification conditions.
Purification Column Testing. Purification columns are tested by lot to confirm the absence of
nucleic acids and nuclease activity. Column nucleic acid binding and recovery performance must
meet quality standards.
Visual Inspection Finished kits are inspected for proper assembly.
Challenges of FFPE Tissue. MDS Analytical Technologies strongly recommends performing
quality assessment of FFPE samples. Tissue that has degraded RNA prior to fixation will not yield
good results, nor will samples that have been over-fixed. If the quality of the source tissue is
unknown, then performing a quality assessment of the tissue block prior to spending the time and
expense of Laser Capture and amplification is imperative.
The amplification process generates product from the 3’ end of the mRNA. For best results use
qRT-PCR primer sets designed within the first 300 bases from the poly A tail.
Expiration. All reagents included with the system should be used within six (6) months of receipt.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Questions?
Phone: +1-800-635-5577
+1-408-747-1700
Fax:
+1-408-747-3603
Web: www.moleculardevices.com
For additional offices, please see the contact information on the back cover of this User Guide.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Contents
1. Introduction
Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Performance Specifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Master-mixes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
RNA Input Requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Storage and Stability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Material Safety and Data Sheet (MSDS) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Related Arcturus Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Additional Equipment and Materials Required . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Recommendations for Nuclease-free Technique. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2. Configurations
Kit Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
3. Sample Preparation and Staining
Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Reagents and Supplies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Preliminary Steps. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Material and Protocol Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Protocol. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Slide Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Deparaffinization, Staining and Dehydration. . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
4. RNA Extraction/Isolation
Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Reagents and Supplies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Preliminary Steps. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
Material and Protocol Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
Protocol. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
Protocol For Use with Capsure Macro LCM Caps. . . . . . . . . . . . . . . . . . . . . . . . 18
Protocol For Use with Capsure HS LCM Caps . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Tissue Scrape Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
i
5. RNA Amplification
Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Reagents and Supplies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Preliminary Steps. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Material and Protocol Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Thermal Cycler Programming . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
Time Requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
Protocol Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Sample and Reagents Preparation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Nucleic Acid Elution Using Spin Columns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Control Amplifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Work Space Recommendations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Important Additional Considerations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Protocol. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
Paradise Plus Round One: 1st Strand cDNA Synthesis . . . . . . . . . . . . . . . . . . . . . 38
Paradise Plus Round One: 2nd Strand cDNA Synthesis . . . . . . . . . . . . . . . . . . . . 40
Paradise Plus Round One: cDNA purification. . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Paradise Plus Round One: In Vitro Transcription . . . . . . . . . . . . . . . . . . . . . . . . . 43
Paradise Plus Round One: aRNA Purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Paradise Plus Round Two: 1st Strand cDNA Synthesis . . . . . . . . . . . . . . . . . . . . . 47
Paradise Plus Round Two: 2nd Strand cDNA Synthesis . . . . . . . . . . . . . . . . . . . . 48
Paradise Plus Round Two: cDNA Purification . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
Paradise Plus Round Two: In Vitro Transcription. . . . . . . . . . . . . . . . . . . . . . . . . 51
Paradise Plus Round Two: aRNA Purification. . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
A. Applications of aRNA
Direct aRNA Labeling with Turbo Labeling Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
Direct cDNA Fluorescent Labeling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
Generation of Template for QRT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
B. Sample Assessment Protocol
C. Amino-Allyl aRNA Labeling
D. aRNA Analysis
RNA QuantitationUsing Spectramax Microplate Readers with
Absorbance Mode and Pathcheck Sensor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
aRNA Yield and Purity Determination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
ii
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Assessment of Rna Quality Using the Agilent Bioanalyzer . . . . . . . . . . . . . . . . . . . . . 76
Analysis of aRNA by Agarose Gel Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
E. Generation of Labeled aRNA Using
Alternative IVT Kits
F. Cleaning the Staining Jars
G. Centrifuge Information
H. Troubleshooting
Staining. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Extraction and Isolation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
Amplification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Quality Assessment Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
iii
iv
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
1. Introduction
1.1.
BACKGROUND
The Paradise®Plus Reagent System provides an integrated system enabling gene expression
studies using Formalin-Fixed Paraffin-Embedded tissue (FFPE).
Components provided include:
>
Sample preparation and staining reagents
>
RNA extraction and isolation reagents
>
RNA amplification reagents
The ParadisePlus components have been optimized to work together as a system.
Alternative components have not been tested and may lead sub optimal results.
This user guide is divided into sections describing the steps involved using staining,
extraction/isolation and amplification separately. To get the most out of the ParadisePlus
Reagent System, please examine the components and read each section of the user guide
carefully. A principal application of this kit is use in conjunction with Laser Capture
Microdissection (LCM). LCM experiments often involve the analysis of gene expression
patterns in cells captured from specimens. Obtaining accurate results from gene
expression analysis experiments, including microarray hybridization and quantitative
PCR, depends on careful preservation of intact RNA molecules in captured cells.
Staining
The ParadisePlus Reagent System Staining components are part of a series of LCMcertified LCM analysis products for preparing and staining tissues while preserving intact
nucleic acid and protein species from captured cell populations. The staining components
work with the additional modules provided in this reagent system. ParadisePlus extraction
and isolation reagents and RNA amplification reagents provide a complete solution for
studying RNA from cells isolated by LCM. The reagents and protocol have been
optimized for use with Formalin-Fixed Paraffin-Embedded (FFPE) samples.
Extraction/isolation
The ParadisePlus Reagent System RNA Extraction/Isolation reagents enable researchers to
recover total cellular RNA from formalin fixed paraffin embedded samples. They are
optimized for use with cells acquired using Laser Capture Microdissection (LCM) on
CapSure® LCM Caps. Total cellular RNA isolated using the ParadisePlus Reagent System
RNA Extraction/ Isolation reagents produces RNA in a small volume of low ionic
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
1
1. Introduction
strength buffer, ready for use in linear amplification using the Paradise Plus Reagent
System RNA amplification reagents. The Paradise Plus Reagent System RNA Extraction/
Isolation Kit contains RNA extraction and purification reagents and MiraCol™
Purification Columns.
Amplification
The ParadisePlus Reagent System RNA Amplification reagents enable the production of
large quantities of amplified antisense RNA (aRNA) from small quantities of total cellular
RNA. This process for linear amplification provides efficient, reproducible results through
protocols, reagents, and nucleic acid purification technology using MDS Analytical
Technologies’ MiraCol Purification Columns. The ParadisePlus RNA Amplification
reagents can amplify total cellular RNA to generate sufficient aRNA, ready for use in
microarray, quantitative real-time PCR or other applications.
1.2.
PERFORMANCE SPECIFICATIONS
The ParadisePlus kits should yield enough amplified RNA (aRNA) to complete multiple
microarray experiments when starting with the recommended amount of starting material
from a tissue block which contains good quality RNA.
1.3.
MASTER-MIXES
The ParadisePlus kits are designed with the assumption that master-mixes will be made
when using three or more samples, and will not be used for two or less samples. The kits
have been designed with a 10% overage for 3 samples. Exceeding 10% overage for mastermixes may result in insufficient material to complete all reactions. A suggested master mix
size for six samples is included where appropriate.
1.4.
RNA INPUT REQUIREMENTS
The ParadisePlus kits are designed and optimized for use with Formalin-Fixed Paraffin
Embedded tissue samples. The amplification kit is designed to for use with an expected
total RNA input amount of 5-40 ng. The amount of total RNA found in a cell varies by
cell type, length of fixation, age of the sample block and quality of the material prior to
fixation. Different sources of total RNA contain varying amounts of mRNA;
consequently, the total RNA input needed to obtain microgram quantities of aRNA
depends on the total RNA source. For example, RNA from rapidly dividing cells may be
relatively mRNA-rich and thus may result in higher output of aRNA. In general one can
expect anywhere from 1 - 10 pg of total RNA per cell based on factors mentioned above.
We recommend brining in a minimum of 5 ng of total RNA into the Paradise Plus system
amplification reaction.
1.5.
STORAGE AND STABILITY
MDS Analytical Technologies makes recommendations for storage temperatures
throughout this document. Realizing that not ever laboratory has a freezers set at these
2
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
1.6. Material Safety and Data Sheet (MSDS)
temperatures, we have defined the acceptable temperature ranges for our
recommendations.
Acceptable ranges for storage:
>
-70°C = -65°C to -80°C
>
-20°C = -15°C to -30°C
>
4°C = 2°C to 8°C
>
Room Temperature = 10°C to 30°C
Staining
Inspect all kit components upon receipt. Ethanol and xylene are flammable and should be
unpacked and stored at room temperature in a fireproof storage cabinet or fume hood
with adequate ventilation. Cap bottles tightly between uses. Store remaining kit supplies
at room temperature in a clean, dust-free environment.
Extraction and Isolation
Store the ParadisePlus Reagent System RNA Extraction/Isolation components at room
temperature. Store the DNase I solution and DNase Buffer at –70ºC until use. Once the
reagents are used, storage at –20ºC is recommended.
Amplification
The ParadisePlus amplification kits have both room temperature and frozen components.
The room temperature components should be stored at normal room temperature. The
frozen components are shipped on dry ice and should be stored at -70°C until initial use.
After initial use -20°C is recommended to prevent unnecessary freeze-thaws of the
enzymes. The control RNA and any RNA generated from ParadisePlus kits should always
be stored at –70°C.
The Control RNA vial should be stored at –70°C or below immediately upon arrival
to ensure maximum stability. For optimal results, using the reagents as soon as possible
after receipt is recommended.
Expiration
All reagents included with the system should be used within six (6) months of receipt.
1.6.
MATERIAL SAFETY AND DATA SHEET (MSDS)
Material Safety and Data Sheets (MSDS) for kit chemical components are available from
the MDS Analytical Technologies web site at www.moleculardevices.com. They may also
be acquired by calling MDS Analytical Technologies Technical Services 1-800-635-5577
or +1-408-747-1700, or send an email inquiry to support@moldev.com.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
3
1. Introduction
1.7.
RELATED ARCTURUS PRODUCTS
Most common part numbers provided. Additional configurations available depending on
individual need.
HistoGene® LCM Frozen Section Staining Kit
The HistoGene® LCM Frozen Section Staining Kit is used to process tissue sections for
LCM that maximizes the quality and yield of RNA from LCM cells. The kit comes with
all dehydration and staining reagents, disposable staining jars, specially treated slides, and
detailed protocol and troubleshooting guide.
KIT0401 – 72 slides
HistoGene® LCM Immunofluorescence Staining Kit
The HistoGene LCM Immunofluorescence Staining Kit is the only kit designed to enable
retrieval of high-quality RNA from immunofluorescently stained frozen tissue. It enables
convenient and reliable staining, dehydration and LCM of tissue sections with protocols
streamlined and optimized both for optimal LCM captures and maintaining RNA quality
for downstream applications that require intact RNA, like microarray analysis and RTPCR.
KIT0420 – 32 slides
PicoPure® RNA Isolation Kit
For extraction and isolation of total RNA from small samples, particularly Laser Capture
Microdissected (LCM) cells. The PicoPure® RNA Kit comes with optimized buffers,
MiraCol Purification Columns and an easy-to-use protocol to maximize recovery of highquality total cellular RNA ready for amplification with the RiboAmp® Plus RNA
Amplification Kits.
KIT0204 – 40 isolations
PicoPure® DNA Extraction Kit
The PicoPure DNA Extraction Kit is optimized to maximize the recovery of genomic
DNA from 10 or more cells captured by LCM. The kit comes with reagents and protocol
tested to ensure complete extraction of DNA from LCM samples prepared with any
standard tissue preparation procedure. DNA prepared using the kit is PCR-ready and
needs no additional purification to perform amplification.
KIT0103 – 150 HS cap or 30 Macro cap extractions
RiboAmp® Plus RNA Amplification Kit
The RiboAmp Plus RNA Amplification Kit enables the production of microgram
quantities of antisense RNA (aRNA) from as little as picogram quantities of total cellular
RNA. Amplified RNA produced using the kit is suitable for labeling and use for probing
expression microarrays. The kit achieves amplifications of 1,000-3,000-fold in one round
of amplification, and amplifications of up to 1,000,000-fold in two rounds. The kits
include microarray labeling options such as biotin, fluorescent dyes and amino allyl. Kits
4
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
1.8. Additional Equipment and Materials Required
are available in two sensitivity options, RiboAmp Plus (5-40 ng) and a high sensitivity
version RiboAmp HS Plus (0.1-5 ng).
KIT0521 RiboAmp Plus – (12) 1-round amplifications or (6) 2-round amplifications
KIT0525 RiboAmp HS Plus – (6) 2-round amplifications
Paradise® Plus Whole Transcript Reverse Transcription (WT-RT) Reagent
System
The Paradise PLUS WT-RT reagent system was developed specifically to overcome
obstacles such as chemical modification and fragmentation often associated with
formalin-fixed tissue. The kit provides RNA isolation and reverse transcription reagents
optimized for use with archived ffpe samples at small sample input amounts and delivers
unparalleled yield, fidelity and representation. the kit effectively designed with exonspanning primers at varying distances from the 3' end of the transcript and allow the
study splice variants in archived or degraded samples. the Paradise WT-RT system also
allows the use of gene-specific primers for RT to suit specific assay requirements.
KIT0315 – 12 Samples
Turbo Labeling™ Kits
The TURBO Labeling™ Kits provide a proprietary, non-enzymatic technology for
labeling of unmodified aRNA for Gene Expression profiling. The unmodified aRNA is
labeled post-amplification, thereby avoiding the need to incorporate modified
nucleotides. The use of natural nucleotides in the amplification step results in unmodified
aRNA with higher yields and longer aRNA fragments, thus providing better
representation of the mRNA transcript for downstream analysis.
KIT0608 – Biotin – 12 samples
KIT0609 – Cy3 – 12 samples
KIT0610 – Cy5 – 12 samples
1.8.
ADDITIONAL EQUIPMENT AND MATERIALS REQUIRED
Ensure that you have ready access to the following laboratory equipment and materials
before you begin. These items are not included with the Paradise Plus Reagent System
Staining
Equipment
>
Rotary Microtome
>
Fume hood
>
–70°C freezer
>
Tweezers
>
Cover glass forceps
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5
1. Introduction
>
Microslide box – plastic (VWR Cat. # 48444-004)
>
Tissue Flotation Water Bath
>
Oven
>
20 – 200 μL pipettor
Materials
>
Disposable gloves
>
Detergent (Fisher Scientific, Cat. # 04-355
>
RNase AWAY (Life Technologies, Cat. # 10328-011)
>
100% ethanol
>
Kimwipes or similar lint-free towels
>
Disposable microtome blades
>
Microslides
>
Pipette tips, nuclease free
Extraction/Isolation
Equipment
>
Microcentrifuge (Eppendorf 5415D or similar)
>
2–20 μL pipettor
>
20–200 μL pipettor
>
Incubation oven (50°C)
Materials
>
Nuclease-free pipette tips
>
0.5 ml extraction tubes (Applied BioSystems #N8010611 or USA Scientific, Inc,
#1605-0000)
Amplification
Equipment
6
>
Thermal cycler with heated lid
>
Microcentrifuge for 1.5 mL and 0.5 mL tubes (Eppendorf 5414D or similar)
>
0.5 – 10 μL pipettor
>
20 μL pipettor
>
200 μL pipettor
>
1000 μL pipettor
>
Ice bath or cold block (4*C)
>
Vortex mixer (optional)
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
1.9. Recommendations for Nuclease-free Technique
Materials
>
0.5 mL or 0.2 mL RNase-free microcentrifuge tubes
>
2 mL lidless tube for centrifuge (PGC Scientific, Cat # 16-8101-06)
>
Nuclease-free pipette tips
Reagents
>
1.9.
SuperScript III Reverse Transcriptase, 200 U/μL (Enzyme only) Invitrogen part
number: 18080-093, 18080-044 or 18080-085
RECOMMENDATIONS FOR NUCLEASE-FREE TECHNIQUE
Staining
RNase contamination will cause experimental failure. Minimize RNase contamination by
adhering to the following recommendations throughout your experiment:
>
Wear disposable gloves and change them frequently.
>
Use RNase-free solutions, glassware and plasticware.
>
Do not re-purify Paradise Plus Reagent System Section Staining Kit components. They
are certified Nuclease Free.
>
Wash scalpels, tweezers and forceps with detergent and bake at 210°C for four hours
before use.
>
Use RNase AWAY (Life Technologies) according to the manufacturer’s instructions on
the horizontal staining rack and any other surfaces that may come in contact with the
sample.
>
Use Kimwipe soaked in RNase Away to wipe down and clean the interior of tissue flotation water bath.
Extraction and Isolation
RNase contamination will cause experimental failure. Minimize RNase contamination by
adhering to the following recommendations throughout your experiment:
>
Always handle RNA in a manner that avoids introduction of RNases.
>
Wear disposable gloves and change them frequently to prevent the introduction of
RNases from skin surfaces.
>
After putting on gloves, avoid touching surfaces that may introduce RNases onto
glove surfaces.
>
Do not use reagents not supplied with the Paradise Plus Reagent System. Substitution
of reagents or Kit components may adversely affect yields or introduce RNases.
>
Use only new plasticware that is certified nucleic acid-free.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
7
1. Introduction
>
Use only new, sterile, RNase-free pipette tips and microcentrifuge tubes.
>
Clean work surfaces with commercially available RNase decontamination solutions
prior to performing reactions.
Amplification
RNase contamination will cause experimental failure. Minimize RNase contamination by
adhering to the following recommendations throughout your experiment:
>
Wear disposable gloves and change them frequently.
>
After putting on gloves, avoid touching surfaces that may introduce RNases onto the
glove surface.
>
Do not use reagents not supplied. Substitutions of reagents or components may
adversely affect yields or introduce RNases.
>
Use only new, sterile RNase-free pipette tips and microcentrifuge tubes.
>
Work surfaces should cleaned with commercially available RNase decontamination
solutions prior to performing reactions.
Amplified aRNA Contamination
Stray amplified aRNA and cDNA in work area can contaminate precious samples if the
work area is routinely used for performing amplifications. To ensure a work area free of
amplified aRNA, please do the following:
8
1
Irradiate the work area/hood with UV overnight every three to four days.
2
Clean surfaces and devices (pipettors, racks, centrifuge, etc.) with commercially
available decontamination solutions everyday or more frequently depending on use.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
2. Configurations
2.1.
KIT COMPONENTS
Table 2.1: Paradise® Plus Kit Configuration with Catalog Numbers.
Paradise® Plus Kit Configurations with Catalog
Numbers
Solvents / Stain
Description
Catalog
Number
# of
Samples
Room
temp
Room
temp
Frozen
Room
temp
Frozen
Room
temp
Frozen
Room
temp
Arcturus Paradise Plus 1.5
Round (12 reactions)
KIT0311
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7008
x
x
Arcturus Paradise Plus 1.5
Round (12 ext/iso, 6 amp)
KIT0321
6
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
1x
RA7018
1x
RA7011
1x
RA7008
x
x
Arcturus Paradise Plus 1.5
Round (6 Amplification only)
KIT0321-A
6
x
x
x
x
1x
RA7018
1x
RA7011
1x
RA7008
x
x
Arcturus Paradise Plus 1.5
Round (12 extractions only)
KIT0312-I
12
x
x
1x
RA7007
1x
RA7001
x
x
x
x
x
Arcturus Paradise Plus staining
components (24 samples)
KIT0312-S
12
1x
RA7013
1x
RA7014
x
x
x
x
x
x
x
Arcturus Paradise Plus stain,
KIT0312-J
24
x
1x
RA7014
x
x
x
x
x
x
x
Arcturus Paradise Plus 1.5
Round (12 reactions) - No
solvents
KIT0311-NS
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7008
x
x
Arcturus Paradise Plus 1.5
Round (12 ext/iso, 6 amp) - No
solvents
KIT0321-NS
6
x
x
x
slide jars & slides (24 samples)
Extraction /
Isolation
Amplification
IVT
1x
1x
1x
1x
1x
1x
RA7014
RA7007
RA7001
RA7018
RA7011
RA7008
Turbo
Label
Arcturus Paradise Plus 1.5
Round (Bulk, 48 reactions)
KIT0301*
48
2x
RA7013
4x
RA7014
4x
RA7007
4x
RA7001
8x
RA7018
8x
RA7011
8x
RA7008
x
x
Arcturus Paradise Plus 2 round
(12 reactions)
KIT0312
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
x
Arcturus Paradise Plus 2 Round
with Biotin Labeling (12
reactions)
KIT0312B
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0608
KIT0312C
Arcturus Paradise Plus 2 Round
with Cy3 Labeling (12 reactions)
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0609
KIT0312D
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0610
KIT0322
6
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
1x
RA7018
1x
RA7011
1x
RA7009
x
x
Arcturus Paradise Plus 2 Round
with Cy5 Labeling (12 reactions)
Arcturus Paradise Plus 2 Round
(12 ext/iso, 6 amp)
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
9
2. Configurations
Solvents / Stain
Paradise® Plus Kit Configurations with Catalog
Numbers
Description
Amplification
IVT
Turbo
Label
Catalog
Number
# of
Samples
Room
temp
Room
temp
Frozen
Room
temp
Frozen
Room
temp
Frozen
Room
temp
Arcturus Paradise Plus 2 Round
(6 Amplification only)
KIT0322-A
6
x
x
x
x
1x
RA7018
1x
RA7011
1x
RA7009
x
x
Arcturus Paradise Plus 2 Round
(12 reactions) - No solvents
KIT0312-NS
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
x
Arcturus Paradise Plus 2 Round KIT0322-NS
(12 ext/iso, 6 amp) - No solvents
6
x
1x
RA7014
1x
RA7007
1x
RA7001
1x
RA7018
1x
RA7011
1x
RA7009
x
x
Arcturus Paradise Plus 2 Round
with Biotin Labeling (12
reactions) - No solvents
KIT0312BNS
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0608
Arcturus Paradise Plus 2 Round
with Cy3 Labeling (12 reactions)
- No solvents
KIT0312CNS
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0609
Arcturus Paradise Plus 2 Round KIT0312DNS
with Cy5 Labeling (12 reactions)
- No solvents
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7009
x
1x
KIT0610
Arcturus Paradise Plus 2 round Amino Allyl (12 reactions)
KIT0314
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7010
2x
RA7012
x
Arcturus Paradise Plus 2 Round Amino Allyl (12 ext/iso, 6 amp)
KIT0324
6
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
1x
RA7018
1x
RA7011
1x
RA7010
1x
RA7012
x
Arcturus Paradise Plus 2 Round Amino Allyl (6 Amplification
only)
KIT0324-A
6
x
x
x
x
1x
RA7018
1x
RA7011
1x
RA7010
1x
RA7012
x
Arcturus Paradise Plus 2 Round - KIT0314-NS
Amino Allyl (12 reactions) - No
solvents
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
2x
RA7011
2x
RA7010
2x
RA7012
x
Arcturus Paradise Plus 2 Round - KIT0324-NS
Amino Allyl (12 ext/iso, 6 amp) No solvents
6
x
1x
RA7014
1x
RA7007
1x
RA7001
1x
RA7018
1x
RA7011
1x
RA7010
1x
RA7012
x
Arcturus Paradise Plus 2 round
(Bulk, 48 reactions)
KIT0302
48
2x
RA7013
2x
RA7014
4x
RA7007
4x
RA7001
8x
RA7018
8x
RA7011
8x
RA7009
x
x
Arcturus Paradise Plus 2 round
(Bulk, 48 reactions)
KIT0304
48
2x
RA7013
1x
RA7014
4x
RA7007
4x
RA7001
8x
RA7018
8x
RA7011
8x
RA7010
8x
RA7012
x
Arcturus Paradise Plus qrtPCR kit
(12 reactions)
KIT0310
12
1x
RA7013
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
1x
RA7011
2x
RA7008
x
x
12
x
1x
RA7014
1x
RA7007
1x
RA7001
2x
RA7018
1x
RA7011
2x
RA7008
x
x
48
2x
RA7013
1x
RA7014
4x
RA7007
4x
RA7001
8x
RA7018
4x
RA7011
8x
RA7008
x
x
48
x
1x
RA7014
4x
RA7007
4x
RA7001
8x
RA7018
4x
RA7011
8x
RA7008
x
x
12
x
x
1x
RA7007
1x
RA7001
1x
RA7018
x
x
x
x
Arcturus Paradise Plus qrtPCR kit KIT0310-NS
(12 reactions) - No Solvents
Arcturus Paradise Plus qrtPCR kit
KIT0300
(Bulk, 48 reactions)
Arcturus Paradise Plus qrtPCR kit KIT0300-NS
(Bulk, 48 reactions) - No
solvents
Arcturus Paradise Plus QC Kit
(12 reactions)
10
Extraction /
Isolation
KIT0313
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
2.1. Kit Components
* NOTE: Customers who order KIT0313 should follow the sample assessment protocol
otuline in Appendix B.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
11
2. Configurations
12
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
3. Sample Preparation and
Staining
3.1.
3.1.1.
COMPONENTS
REAGENTS AND SUPPLIES
The Paradise® Plus Reagent System Staining components include:
Table 3.1: Staining Solvents RA7013
Component
Size
100% Ethanol
0.5 L
95% Ethanol
0.5 L
75% Ethanol
1L
Nuclease-free Water
1L
Xylene
0.5 L
Table 3.2: Staining Components RA7014
3.2.
3.2.1.
Component
Size
Paradise Plus Stain
6 ml
Slide jars
10x
PRELIMINARY STEPS
MATERIAL AND PROTOCOL REVIEW
To get the most from your staining reagents, take a few moments to examine the
components of the kit and read the information in the following sections.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
13
3. Sample Preparation and Staining
3.3.
3.3.1.
PROTOCOL
SLIDE PREPARATION
NOTE: Wear clean disposable gloves throughout the Slide Preparation procedure. Use
clean RNase-free instruments.
NOTE: Depending on humidity in the environment, drying may take longer for the sections
to dry. The section must be dry before proceeding. Do not allow sections to air dry for
longer than 3 hours.
1
Prior to starting slide preparation, minimize RNase contamination of the equipment
by cleaning as follows:
a Rotary Microtome: Remove and discard old disposable microtome blade. Use a
Kimwipe soaked with RNase Away to wipe down the knife holder. Dry holder with
a clean Kimwipe. Install a new disposable microtome blade into holder.
b Tissue Floatation Bath: Use a Kimwipe soaked with RNase Away to wipe down and
clean the interior of the water bath. Rinse the interior with Milli-Q or RNase free
water. Fill the water bath with Milli-Q or RNase free water. Heat water to
appropriate temperature for the paraffin used in your laboratory, typically 41°C–
43°C. Do not add any adhesives to the water bath.
14
2
Set cutting thickness to 7 μm on the microtome.
3
Place paraffin block into specimen holder. Trim off any excess paraffin from the block
face. Cut and discard the first five sections after trimming.
4
From the fresh surface, cut 7 μm sections from your specimen. If you are cutting more
than one specimen, move to a new section of the blade, use gauze soaked in RNase
Away to clean blade, or use a new disposable blade for each one to avoid cross
contamination.
5
Remove section(s) from microtome and float them onto heated water bath. Allow
section(s) to flatten. Minimize time in water bath to no longer than 2 minutes. Mount
each section on a room-temperature slide.
6
Prop slide on end in a vertical, not horizontal, position to allow water to drain away
from section. Air-dry the slide for a minimum of 30 minutes at room temperature.
Discard any slides that have wrinkles or folds in the section.
7
Proceed immediately to the Deparaffinization, Staining and Dehydration segment of
the protocol or store slides at –70°C in a microslide box for up to two weeks.
8
After completion of the slide preparation process, remove any paraffin debris from the
microtome. Clean surfaces with a Kimwipe soaked with RNase Away and dry all
surfaces. Discard water from water bath and clean the interior with RNase Away and
dry all surfaces.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
3.3. Protocol
3.3.2.
DEPARAFFINIZATION, STAINING AND DEHYDRATION
1
Label 10 plastic slide jars as follows:
a Xylene
b Xylene
c 100% ethanol
d 95% ethanol
e 75% ethanol
f Nuclease free water
g 75% ethanol
h 95% ethanol
i 100% ethanol
j Xylene
2
Using the LCM-certified solutions provided, fill the labeled plastic slide jars with
25 ml of the appropriate solution.
3
Remove up to four slides from the slide box or from the –70°C freezer, and place in a
50–60°C oven for 2 minutes.
4
Place the slides in plastic slide jar “a” containing xylene for 2 minutes. Invert jar
gently.
5
Transfer the slides to plastic slide jar “b” containing xylene for 2 minutes. Invert jar
gently.
6
Transfer the slides to plastic slide jar “c” containing 100% ethanol for 2 minutes.
Invert jar gently.
7
Transfer the slides to plastic slide jar “d” containing 95% ethanol for 1 minute.
8
Transfer the slides to plastic slide jar “e” containing 75% ethanol for 1 minute.
9
Transfer the slides to plastic slide jar “f ” containing nuclease free water for 30 seconds.
10 Using an RNase free pipette tip, apply 100 μL of the Paradise® Plus Staining Solution
so that it covers the entire section. Stain for 15-45 seconds at room temperature. Tap
off excess stain before proceeding with the following steps.
11 Transfer the slides to plastic slide jar “g” containing 75% ethanol for 30 seconds.
12 Transfer the slides to plastic slide jar “h” containing 95% ethanol for 30 seconds.
13 Transfer the slides to plastic slide jar “i” containing 100% ethanol for 1 minute.
14 Transfer the slides to plastic slide jar “j” containing xylene. Hold slides in xylene until
ready for microdissection. The minimum incubation in xylene should be 5 minutes,
or up to a maximum of ~2 hours.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
15
3. Sample Preparation and Staining
15 Place the slides on a Kimwipe to dry in the hood for five to ten minutes prior to
LCM. LCM should be performed within 2 hours after removal from xylene.
16 Discard all used staining and dehydration solutions according to standard procedures.
NOTE: Carry out the Staining and Dehydration segment of the protocol in a fume hood.
Wear clean disposable gloves.
NOTE: Xylene jar “a” must be changed after processing up to a maximum of 4 slides.
NOTE: 75% Ethanol jar “e” must be changed after processing up to a maximum of 4 slides.
Staining times may vary depending on tissue types.
Performing Laser Capture Microdissection (LCM)
NOTE: Please consult the User Guide for the instrument you will use for detailed
instructions.
16
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4. RNA Extraction/Isolation
4.1.
4.1.1.
COMPONENTS
REAGENTS AND SUPPLIES
The Paradise® Plus Reagent System RNA Extraction/Isolation components include the
following items:
Table 4.1: Paradise® Extraction - Room Temperature RA7001
Component
Vial Color
Vial Label
Extraction Conditioning Buffer
Blue
CB
Extraction Ethanol Solution
Blue
EtOH
Extraction Wash Buffer 1
Blue
W1
Extraction Wash Buffer 2
Blue
W2
Extraction Elution Buffer
Blue
EB
Extraction Binding Buffer
Blue
BB
Pro-k Reconstitution Buffer
Pro K
0.5 mL Microcentrifuge Tubes
Purification columns
Table 4.2: Paradise® Extraction - Frozen RA7007
Component
Vial Color
Vial Label
DNase Buffer
Blue
DNB
DNase Mix
Blue
DNase
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
17
4. RNA Extraction/Isolation
4.2.
4.2.1.
PRELIMINARY STEPS
MATERIAL AND PROTOCOL REVIEW
To get the most from your extraction reagents, take a few moments to examine the
components of the kit and read the information in the following sections.
Overview
Separate protocols are provided for extraction/isolation of RNA from:
>
Microdissected samples using CapSure® LCM Macro caps,
>
Microdissected samples using CapSure LCM HS caps or
>
Tissue scrapes (0.5 cm x 0.5 cm)
The flow chart illustrates the Paradise Plus Reagent
System RNA Extraction/Isolation procedure:
1
Extract RNA from a CapSure LCM Cap or tissue
scrape.
2
Mix and load cell extract onto a preconditioned
purification column.
3
Spin the extract through the column to capture
RNA on the purification column membrane.
4
Wash.
5
DNase treat, and wash again.
6
Wash the column twice with wash buffer, and
7
Elute the RNA in low ionic strength buffer.
The entire isolation process, including incubations,
can be completed in less than an hour, and the isolated
total cellular RNA is ready for use in downstream
applications. The Paradise Plus Reagent System RNA
Extraction/Isolation reagents are capable of isolating
small amounts of RNA. It is important not to
introduce nucleic acid contamination.
4.3.
4.3.1.
PROTOCOL
PROTOCOL FOR USE WITH CAPSURE®
MACRO LCM CAPS
RNA Extraction
1
Dispense Pro K Mix and incubate as follows:
Figure 4.1: Paradise®Plus Reagent
System RNA Extraction/Isolation
procedure
a Capture cells using the CapSure Macro Cap.
Refer to the instrument User Guide for complete instructions.
18
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4.3. Protocol
b Add 300 μL of Reconstitution Buffer to vial of dried Pro K Mix (600 μg/tube).
Dissolve completely by gently vortexing the tube to mix the reagents and place the
tube on ice immediately. Excessive mixing may denature Proteinase K. One vial of
Pro K Mix is adequate for 12 extractions. All mixed proteinase K solution should
be used within one workday (up to 12 hours). Discard any mixed Proteinase K
solution that is not used within one day.
2
Pipette 50μL of mixed Proteinase K Extraction Solution into a 0.5 ml extraction tube
(not provided).
Figure 4.2: Proteinase K Extraction Solution
3
Insert the CapSure Macro LCM Cap with LCM captured cells into the
microcentrifuge tube using the LCM Cap Insertion Tool.
4
Invert the extraction tube with the inserted CapSure Macro LCM Cap and shake
down the 50 μL volume of Proteinase K Extraction solution until it completely covers
the inside surface of the CapSure Macro LCM Cap.
5
Incubate at 37°C for the correct time period according to the following table:
Table 4.3: RNA Incubation Times
Samples Age
Incubation Time
Samples >3 years old
16 hours
Samples <3 years old
5 hours*
* For complete extraction this time can be increased to 16 hours.
NOTE: If multiple LCM captures are performed, it is recommended that each cap be
incubated in Pro K Mix immediately after collection. Caps may be incubated up to 24
hours.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
19
4. RNA Extraction/Isolation
6
After incubation, remove the tubes from the incubator, place them in a
microcentrifuge and centrifuge for one minute at 800x g.
7
Remove the CapSure Macro LCM Cap. Close the microcentrifuge tube containing
the extract.
8
Proceed with RNA isolation protocol or freeze cell extract at –70°C.
It is okay to stop at this point in the protocol.
RNA Isolation
1
Pre-condition the MiraCol® Purification Column as follows:
a Pipette 200 μL Conditioning Buffer (CB) onto the purification column filter
membrane.
b Incubate the purification column with Conditioning Buffer for 5 minutes at room
temperature.
c Centrifuge the purification column in the provided collection tube at 16,000 x g
for one minute.
2
Pipette 53 μL of Paradise Plus Reagent System Binding Buffer (BB) into the cell
extract from Part 1 (RNA Extraction). Mix well by pipetting up and down. DO NOT
CENTRIFUGE. Pipette 103 μL of Ethanol Solution (EtOH) into tube and mix well.
3
The cell extract mixture will have a combined volume of approximately 206 μL.
4
To bind RNA, centrifuge for 2 minutes at 100 x g, immediately followed by a
centrifugation at 16,000 x g for 1 minute.
5
Pipette 100 μL Wash Buffer 1 (W1) into column and centrifuge for 1 minute at 8000
x g.
6
Mix 2 μL DNase Mix (DNase) with 18 μL of DNase buffer (DNB). Add 20 μL
mixture to the column and incubate at room temperature for 20 minutes.
7
Pipette 40 μL Wash Buffer 1 (W1) into the purification column and centrifuge for
one minute at 8000 x g.
8
Pipette 100 μL Wash Buffer 2 (W2) into the purification column and centrifuge for
one minute at 8000 x g.
9
Pipette another 100 μL Wash Buffer 2 (W2) into the purification column and
centrifuge for two minutes at 16,000 x g.
NOTE: Check the purification column for any residual wash buffer. If wash buffer
remains, re-centrifuge at 16,000 x g for one minute.
10 Transfer the purification column to a new 0.5 mL microcentrifuge tube provided.
20
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4.3. Protocol
11 Pipette 12 μL Elution Buffer (EB) directly onto the membrane of the purification
column (Gently touch the tip of the pipette to the surface of the membrane while
dispensing the elution buffer to ensure maximum absorption of EB into the
membrane).
12 Incubate the column for one minute at room temperature.
13 Place each column tube assembly into the 2 ml support tube in the rotor with the 0.5
ml tube cap trailing the tube.
14 Centrifuge the column for one minute at 1,000 x g to distribute EB in the column,
and then spin for one minute at 16,000 x g to elute RNA. The entire sample may be
used immediately or stored at –70°C.
NOTE: Flow through waste following centrifugation is usually present as only a small
volume, and therefore it is not necessary to discard the flow through waste after every
centrifugation step. Make sure that the accumulated flow through waste does not make
contact with the purification column. Flow through waste should be discarded when
the waste fluid level approaches the surface of the purification column.
NOTE: Prior to use, mix Binding Buffer (BB) thoroughly. Binding Buffer (BB) may form
precipitate upon storage. Dissolve precipitate prior to use by mixing thoroughly. If
necessary, warm the BB vial to re-dissolve Binding Buffer prior to use.
NOTE: Remove all traces of wash buffer prior to transferring purification column to the
new microcentrifuge tube. To remove wash buffer, discard flow through waste and recentrifuge the column for one minute at 16,000 x g.
Figure 4.3: Centrifuge.
NOTE: To avoid potential breakage of the microcentrifuge tube cap during
centrifugation, insert the purification column/ 0.5 mL tube assembly into a lidless 2.0
mL tube. Insert this assembly into adjacent rotor holes as illustrated. Rest the tube cap
against the tube immediately clockwise to it. Place an empty, lidless 2.0 mL tube into
the rotor hole adjacent in the clockwise direction to the last assembly.
4.3.2.
PROTOCOL FOR USE WITH CAPSURE® HS LCM CAPS
RNA Extraction
1
Dispense Pro K Mix and incubate as follows:
a Capture cells and assemble the CapSure HS Cap with the ExtracSure® Extraction
Device. Refer to the CapSure HS Caps User Guide for complete instructions.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
21
4. RNA Extraction/Isolation
b Add 300 μL of Reconstitution Buffer to vial of dried Pro K Mix (600 μg/tube).
Dissolve completely by gently vortexing the tube to mix the reagents and place the
tube on ice immediately. Excessive mixing may denature Proteinase K. One vial of
Pro K Mix is adequate for 60 extractions. All mixed proteinase K solution should
be used within one work day (up to 12 hours). The remaining unmixed
Reconstitution Buffer should be stored at -20°C. Discard any mixed Proteinase K
solution that is not used within one day.
2
Place the CapSure–ExtracSure assembly in a CapSure HS Alignment Tray and pipette
10 μL Pro K Mix solution into the buffer well. Place pipette tip down to the film
surface to avoid trapping a bubble.
Pipettor Tip
ExtracSure®
Sample
Extraction
Device
Figure 4.4: CapSure® HS Alignment Tray
3
Place a new 0.5 ml extraction tube (not provided) onto the CapSure–ExtracSure
assembly (see CapSure® HS Caps User Guide for more details about assembly).
4
Cover with Incubation Block.
Figure 4.5: Incubation Block
5
22
Incubate at 37°C for the correct time period according to the following table:
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4.3. Protocol
Table 4.4: RNA Incubation Times
Samples Age
Incubation Time
Samples >3 years old
16 hours
Samples <3 years old
5 hours*
* For complete extraction this time can be increased to 16 hours.
NOTE: If multiple LCM captures are performed, it is recommended that each cap be
incubated in Pro K Mix immediately after collection. Caps may be incubated up to 24
hours.
6
Centrifuge the microcentrifuge tube with the CapSure–ExtracSure assembly at 800 x
g for two minutes to collect cell extract into the tube.
7
After centrifugation, the microcentrifuge tube contains the cell extract required to
complete the protocol. Remove the microcentrifuge tube from the CapSure–
ExtracSure assembly and save the microcentrifuge tube with the cell extract in it.
8
Proceed with RNA isolation protocol or freeze cell extract at –70°C.
It is okay to stop at this point in the protocol.
RNA Isolation
1
Pre-condition the MiraCol Purification Column as follows:
a Pipette 200 μL Conditioning Buffer (CB) onto the purification column filter
membrane.
b Incubate the purification column with Conditioning Buffer for 5 minutes at room
temperature.
c Centrifuge the purification column in the provided collection tube at 16,000 x g
for one minute.
2
Pipette 11 μL of Paradise Plus Reagent System binding buffer (BB) into the cell extract
from Part 1 (RNA Extraction). Mix well by pipetting up and down. DO NOT
CENTRIFUGE. Pipette 21 μL of Ethanol Solution (EtOH) into tube and mix well.
3
Pipette the cell extract mixture into the preconditioned purification column. The cell
extract mixture will have a combined volume of approximately 42 μL.
4
To bind RNA, centrifuge for 2 minutes at 100 x g, immediately followed by a
centrifugation at 16,000 x g for 1 minute.
5
Pipette 100 μL Wash Buffer 1 (W1) into column and centrifuge for 1 minute at 8000
x g.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
23
4. RNA Extraction/Isolation
6
Mix 2 μL DNase Mix (DNase) with 18 μL of DNase buffer (DNB). Add 20 μL
mixture to the column and incubate at room temperature for 20 minutes.
7
Pipette 40 μL Wash Buffer 1 (W1) into the purification column and centrifuge for
one minute at 8000 x g.
8
Pipette 100 μL Wash Buffer 2 (W2) into the purification column and centrifuge for
one minute at 8000 x g.
9
Pipette another 100 μL Wash Buffer 2 (W2) into the purification column and
centrifuge for two minutes at 16,000 x g. Check the purification column for any
residual wash buffer. If wash buffer remains, at 16,000 x g for one minute.
10 Transfer the purification column to a new 0.5 mL microcentrifuge tube provided.
11 Pipette 12 μL Elution Buffer (EB) directly onto the membrane of the purification
column (Gently touch the tip of the pipette to the surface of the membrane while
dispensing the elution buffer to ensure maximum absorption of EB into the
membrane).
12 Incubate the column for one minute at room temperature.
13 Place each column tube assembly into the 2 ml support tube in the rotor with the 0.5
ml tube cap trailing the tube.
14 Centrifuge the column for one minute at 1,000 x g to distribute EB in the column,
and then spin for one minute at 16,000 x g to elute RNA. The entire sample may be
used immediately or stored at –70°C or below.
NOTE: Flow through waste following centrifugation is usually present as only a small
volume, and therefore it is not necessary to discard the flow through waste after every
centrifugation step. Make sure that the accumulated flow through waste does not make
contact with the purification column. Flow through waste should be discarded when
the waste fluid level approaches the surface of the purification column.
NOTE: Prior to use, mix Binding Buffer (BB) thoroughly. Binding Buffer (BB) may form
precipitate upon storage. Dissolve precipitate prior to use by mixing thoroughly. If
necessary, warm the BB vial to re-dissolve Binding Buffer prior to use.
NOTE: Remove all traces of wash buffer prior to transferring purification column to the
new microcentrifuge tube. To remove wash buffer, discard flow through waste and recentrifuge the column for one minute at 16,000 x g.
Figure 4.6: Centrifuge.
24
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4.3. Protocol
NOTE: To avoid potential breakage of the microcentrifuge tube cap during
centrifugation, insert the purification column/ 0.5 mL tube assembly into a lidless 2.0
mL tube. Insert this assembly into adjacent rotor holes as illustrated. Rest the tube cap
against the tube immediately clockwise to it. Place an empty, lidless 2.0 mL tube into
the rotor hole adjacent in the clockwise direction to the last assembly.
4.3.3.
TISSUE SCRAPE PROTOCOL
NOTE: One vial of proteinase K is adequate for 3 tissue scrape samples.
NOTE: Use a new scalpel blade for each sample to avoid cross-contamination.
NOTE: Discard flow through waste when the waste fluid level approaches the bottom
surface of the purification column.
Slide preparation
Follow slide prep protocol, Section 3.3.1.
Deparaffinization, Staining and Dehydration – no staining
IMPORTANT: If you are not staining your tissue, use the following protocol. Otherwise if
you are staining you tissue use the deparaffinization, staining and dehydration protocol
found in Chapter 3, section III, part b.
1
Label three plastic slide jars as follows:
a Xylene
b Xylene
c Xylene
2
Fill each of the three jars with 25 mL of certified histology grade Xylene.
3
Retrieve up to four of the prepared slides
4
If the slides have been frozen, place them in a 50–60°C incubation oven for 2
minutes.
NOTE: Do not perform this step if the slides have been at room temperature.
5
Place the slides in jar A. Xylene for 3 minutes. Invert the jar gently three or four times.
IMPORTANT: Jar A. Xylene must be changed after processing up to a maximum of
four slides.
6
Transfer the slides to jar B. Xylene for 3 minutes. Invert the jar gently three or four
times.
7
Transfer the slides to jar C. Xylene for 3 minutes. Invert the jar gently three or four
times.
8
Hold the slides in jar C. Xylene until ready to perform tissue scrape.
IMPORTANT: The minimum incubation in xylene should be 3 minutes, up to a
maximum of 2 hours.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
25
4. RNA Extraction/Isolation
9
When ready to perform tissue scrape, remove the slides from the xylene, then dry in a
fume hood for 5–10 minutes.
IMPORTANT: Perform RNA extraction and isolation within 2 hours after removing the
slides from the xylene.
10 Repeat steps 3 through 9 for any remaining slides.
11 Discard the used xylene according to standard procedures, and then clean the jars
following the procedure, Appendix F. “Cleaning the Staining Jars”.
12 Proceed to RNA extraction and isolation.
Scrape and RNA Extraction
1
Add 300 μL of Reconstitution Buffer to vial of dried Pro K Mix (600 μg/tube).
Dissolve completely by gently vortexing the tube to mix the reagents and place the
tube on ice immediately. Excessive mixing may denature Proteinase K.
2
Pipette enough Pro K solution to cover entire tissue section (25 μL, 50 μL, 75 μL, 100
μL or 150 μL) into a 0.5 ml extraction tube (not provided).
3
Using a clean, sterile scalpel blade, take the dried slide and scrape off the tissue section
and place the scrape into the microcentrifuge tube containing the Proteinase K
solution.
4
Vortex slightly. Visually inspect to ensure that the tissue scrape is in the Pro K solution
and not stuck to the side of the microcentrifuge tube.
5
Incubate at 37°C for the correct time period according to the following table:
Table 4.5: RNA Incubation Times
Samples Age
Incubation Time
Samples >3 years old
16 hours
Samples <3 years old
5 hours*
* For complete extraction this time can be increased to 16 hours.
6
Proceed to RNA isolation or store at –70°C or below.
RNA Isolation
1
Pre-condition the MiraCol Purification Column as follows:
a Pipette 200 μL Conditioning Buffer (CB) onto the purification column filter
membrane.
b Incubate the purification column with Conditioning Buffer for 5 minutes at room
temperature.
c Centrifuge the purification column in the provided collection tube at 16,000 x g
for one minute.
26
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
4.3. Protocol
2
Using the amounts indicated in the table below:
a Pipette the Binding Buffer (BB) into the cell extract, then mix well by pipetting up
and down.
b Pipette the Ethanol Solution (EtOH) into the cell extract, then mix well by
pipetting up and down.
Table 4.6: Binding solutions chart
Solution
Volume (μL)
Cell extract/PK Solution
25
50
75
100
150
Binding Buffera
27
53
80
106
159
Ethanol Solutionb
52
103
155
206
309
c The volume of Binding Buffer is 1.06 × the volume of cell extract/PK solution.
d The volume of Ethanol Solution is 2.06 × the volume of cell extract/PK solution,
rounded up.
3
Pipette up to 210 μL of the cell extract mixture onto the preconditioned purification
column.
IMPORTANT: Do not load more than 210 μL of the cell extract mixture onto the
purification column at one time.
4
Centrifuge the purification column for 2 minutes at 100 x g to bind the RNA on the
column membrane.
5
Repeat steps c and d until all of the cell extract mixture has been loaded and bound to
the purification column.
6
Once all of the cell extract mixture has been bound onto the purification column,
centrifuge the column for 1 minute at 16,000 x g to pellet the debris.
7
Repeat step d until all of sample mixture has been loaded and centrifuged.
8
Pipette 100 μL Wash Buffer 1 (W1) into column and centrifuge at 16,000 x g for 1
minute.
9
Mix 2 μL DNase Mix (DNase) with 18 μL of DNase buffer (DNB). Add 20 μL
mixture to the column and incubate at room temperature for 20 minutes.
10 Pipette 40 μL Wash Buffer 1 (W1) into the purification column and centrifuge for
one minute at 8000 x g.
11 Pipette 100 μL Wash Buffer 2 (W2) into column and centrifuge at 16,000 x g for 1
minute.
12 Pipette 100 μL Wash Buffer 2 (W2) into column and centrifuge at 16,000 x g for 2
minutes.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
27
4. RNA Extraction/Isolation
13 Transfer column to a 0.5ml microcentrifuge tube provided in the Kit.
14 Pipette 12 μL of Elution Buffer (EB) direction onto the membrane of the purification
column.
NOTE: Gently touch the tip of the pipette to the surface of the membrane while
dispensing the elution buffer to ensure maximum absorption of EB to the membrane.
15 Incubate for 1 minute at room temperature.
16 Centrifuge at 1,000 x g for 1 minute and then at 16,000 x g for 1 minute.
The sample maybe used immediately or stored at –70°C or below.
28
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5. RNA Amplification
5.1.
5.1.1.
COMPONENTS
REAGENTS AND SUPPLIES
Table 5.1: Paradise® Plus cDNA kit - RA7018
Component
Vial Color
Vial Label
1st Strand Master Mix
Red
1
1st Strand Enzyme Mix*
Red
2
Enhancer
Yellow
E
1st Strand Nuclease Mix
Gold
2nd Strand Master Mix
White
1
2nd Strand Enzyme Mix
White
2
Primer 1
Grey
1
Primer 2
Grey
2
Primer 3
Grey
3
Control RNA
White
C
*Also requires SuperScript III enzyme, not included
In Vitro Transcription (IVT)
Table 5.2: In Vitro Transcription (IVT) 1-round – RA7008
Component
Vial Color
Vial Label
IVT Buffer
Blue
1
IVT Master Mix
Blue
2
IVT Enzyme Mix
Blue
3
DNase Mix
Blue
4
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
29
5. RNA Amplification
Table 5.3: In Vitro Transcription (IVT) 2-round – RA7009
Component
Vial Color
Vial Label
IVT Buffer
Blue
1
IVT Master Mix
Blue
2
IVT Enzyme Mix
Blue
3
DNase Mix
Blue
4
Table 5.4: Amino-Allyl IVT – RA7010
Component
Vial Color
Vial Label
IVT Buffer
Blue
1
IVT Master Mix
Blue
2
IVT Enzyme Mix
Blue
3
DNase Mix
Blue
4
Amino-allyl IVT Master Mix
Light Blue
AA
Labeling Buffer
Light Blue
LB
DMSO
Light Blue
DMSO
Table 5.5: aRNA Purification – RA7011
Component
Vial Color
Vial Label
DNA Binding Buffer
Red
DB
DNA Wash Buffer
Red
DW
DNA Elution Buffer
Red
DE
RNA Binding Buffer
Blue
RB
RNA Wash Buffer
Blue
RW
RNA Elution Buffer
Blue
RE
0.5 mL Microcentrifuge Tubes
Purification columns
30
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.2. Preliminary Steps
Table 5.6: Amino-allyl aRNA Purification – RA7012
Component
Vial Color
Vial Label
RNA Binding Buffer
Blue
RB
RNA Wash Buffer
Blue
RW
RNA Elution Buffer
Blue
RE
0.5 mL Microcentrifuge Tubes
Purification columns
NOTE: Please read this entire protocol prior to performing amplifications.
NOTE: MDS Analytical Technologies recommends using quantitative real-time PCR for the
most accurate measurement of RNA quantity of FFPE samples.
NOTE: For maximum stability, store the frozen reagents at –70ºC or below until used. After
use, storage at -20ºC is recommended.
5.2.
5.2.1.
PRELIMINARY STEPS
MATERIAL AND PROTOCOL REVIEW
To get the most from your amplification reagents, take a few moments to examine the
components of the kit and read the information in the following sections.
5.2.2.
OVERVIEW
The Paradise® Plus Reagent System RNA Amplification reagents are optimized to amplify
formalin fixed RNA. The reagents utilize two rounds of a five-step process for linear
amplification of the mRNA fraction of total cellular RNA:
a first-strand synthesis reaction that yields cDNA incorporating a T7 promoter
sequence;
b second-strand synthesis reaction utilizing exogenous primers that yields double-
stranded cDNA;
c cDNA purification using specially designed MiraCol™ Purification Columns;
d in vitro transcription (IVT) utilizing T7 RNA polymerase yields antisense RNA
(aRNA); and
e aRNA isolation with the MiraCol Purification Columns.
To save time, in vitro transcription may be performed overnight with the proper thermal
cycler programming.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
31
5. RNA Amplification
Figure 5.1: Paradise® Amplification Schematic
NOTE: Using a thermal cycler with a heated lid is important. The heated lid ensures proper
temperature distribution within the reaction tube and prevents evaporative condensation
that alters the reaction mixture concentrations.
5.2.3.
THERMAL CYCLER PROGRAMMING
Thermal cyclers provide a convenient and reproducible method of incubating reactions
according to specified temperatures and times in the protocol. A thermal cycler program
for use appears on page 3-12. The program is not intended for automatic progression
from one time and temperature set to another. The program lists a 4°C hold after each
incubation or incubation cycle when it is necessary to remove the reactions from the
thermal cycler to add reagents. After the addition of reagents, place the sample back into
the thermal cycler and resume the program.
32
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.2. Preliminary Steps
Table 5.7: Paradise® Plus Thermal Cycler Program – Round 1
1st Strand Synthesis
2nd Strand Synthesis
IVT
°C
Time
70
1 hour
4
hold
42
1.5 hour
4
hold
37
30 minutes
95
5 minutes
4
hold
95
2 minutes
4
hold
25
10 minutes
37
30 minutes
70
5 minutes
4
hold
42
8 hours
4
hold (optional overnight hold)
37
15 minutes
4
hold
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
33
5. RNA Amplification
Table 5.8: Paradise® Plus Thermal Cycler Program – Round 2
1st Strand Synthesis
2nd Strand Synthesis
IVT
°C
Time
70
5 minutes
4
Hold
25
10 minutes
37
1.5 hour
4
Hold
95
5 minutes
4
Hold
37
30 minutes
70
5 minutes
4
Hold
42
8 hours
4
hold (optional overnight hold)
37
15 minutes
4
Hold
NOTE: Using a thermal cycler with a heated lid is important. The heated lid ensures proper
temperature distribution within the reaction tube and prevents evaporative condensation
that alters the reaction mixture concentrations.
5.2.4.
TIME REQUIREMENTS
The table below presents typical time requirements for completion of the protocol. Times
reflect total handling and reaction times of each step. Note that there are safe stopping
points for pausing the amplification process, and the times presented reflect a continuous,
uninterrupted process.
34
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.2. Preliminary Steps
Table 5.9: Paradise® Plus Time Requirements
Paradise® Plus
1st Round
2nd Round
Steps
(hours)
(hours)
1st Strand Synthesis
3.5
2
2nd Strand Synthesis
1
1
cDNA Purification
0.5
0.5
Total (before IVT)
5
3.5
In Vitro Transcription
8
8
aRNA Purification
0.5
0.5
Total
13.5
12
NOTE: Samples requiring labeling for microarrays (biotin, Cy3, Cy5) labeling protocol will
take an additional 30-45 minutes.
NOTE: For samples processed using the optional IVT Master Mix, an additional 2.5 hours
will be required for amino-allyl aRNA labeling.
NOTE: Do not allow incubation times and temperatures to deviate from the protocol.
NOTE: The 4°C steps in the thermal cycler program allow for buffer and reagent addition
and mixing steps at certain points during the amplification process and are not intended
for indefinite hold unless noted.
5.2.5.
PROTOCOL NOTES
1
When adding reagent to samples or master mixes, pipette mixtures up and down
several times to ensure complete transfer of reagent from the pipette tip.
2
Prior to the first use of an enzyme, gently mix (do not vortex) and briefly
microcentrifuge the vial to ensure that all enzyme is mixed and collected at the
bottom of the vial. Enzyme may collect on the vial wall or cap during shipment.
3
Keep thawed reagents and reaction tubes in cold blocks at 4°C while adding reagents
to samples.
4
Prior to each incubation, mix samples thoroughly by flicking the reaction tube (unless
noted otherwise in protocol) to ensure process performance. Spin down before
proceeding. DO NOT VORTEX REACTION SAMPLES.
5
Use a microcentrifuge to spin down all components and samples following each
mixing step.
6
Clean all amplification process equipment with an RNase eliminator such as RNase
AWAY (Life Technologies) to minimize the risk of RNase contamination.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
35
5. RNA Amplification
7
5.2.6.
During enzyme and buffer dispensing, keep the reaction tube with sample on ice
or chilled in a 4°C cold block. Do not freeze samples unless it is indicated to be safe
to do so in the protocol.
SAMPLE AND REAGENTS PREPARATION
1
Thaw frozen kit components, as needed, and mix with gentle vortexing or by
inverting the tubes several times, spin down, and place on ice. When enzyme mixtures
must be removed from –20°C storage for use, always keep them in a cold block or in
an ice bucket at the lab bench.
2
Allow In Vitro Transcription (IVT) Buffer (Blue-labeled Vial 1), Master Mix (Bluelabeled Vial 2) and Enhancer (Yellow-labeled Vial) to assume room temperature (22–
25°C), and mix by inverting or flicking the tube. Spin down if necessary. Dissolve all
visible solids prior to use.
3
The Paradise Plus Reagent System RNA Amplification reagents are optimized for the
input of formalin modified total cellular RNA.
4
Although excess enzyme and reagents are provided in all vials, there is insufficient
volume to prepare extra reactions.
5
Two IVT Master Mix reagents are provided with kits designed for amino-allyl
incorporation. The amino-allyl nucleotide mix should only be used in the second
round IVT mix.
NOTE: When making master mixes, use only 10% overage per sample to avoid running out
of reagent.
5.2.7.
NUCLEIC ACID ELUTION USING SPIN COLUMNS
Spin columns and 0.5 ml microcentrifuge tubes are provided for nucleic acid elution.
Improper orientation of tubes during centrifugation may result in cap breakage or sample
loss.
To correctly use the column-tube assembly, insert a spin column into the 0.5 ml tube,
aligning the two cap hinges as illustrated. Load Elution Buffer onto the column and
incubate as directed. Place the column-tube assembly into a 2 ml lidless support tube
(PGC Scientific, Catalog #16-8101-06 or similar) in the centrifuge rotor; alternately,
retain and reuse the 2 ml lidless collection tubes provided. (Some varieties of 2 ml tubes
will not provide enough support. Contact MDS Analytical Technologies Technical
Support for other alternatives). Skip one rotor position between assemblies and position
assemblies with the 0.5 ml tube cap trailing the tube during centrifugation as shown.
(Check for a mark on the centrifuge indicating rotation direction.) Centrifuge as directed
in the protocol.
36
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.2. Preliminary Steps
Figure 5.2: Centrifuge.
5.2.8.
CONTROL AMPLIFICATIONS
A control RNA sample is provided along with each kit to be used as a control template to
verify amplification efficacy. Use 10 μL of this RNA for control amplifications. 10 μL of
this RNA contains 5 ng of formalin-fixed total RNA. Enough control RNA is provided
for three control reactions per six-reaction kit. The control RNA provides a good positive
control to assess amplification efficiency and success when run in parallel with samples
following the procedures outline in the Appendix.
5.2.9.
WORK SPACE RECOMMENDATIONS
Due to the high sensitivity of the reagents, it is very important to prevent RNA, DNA,
and nuclease contamination. Work surfaces should be cleaned before and after each use.
Perform all dispensing in a work hood that has been irradiated with UV to remove
contaminants from previous amplification experiments.
5.2.10. IMPORTANT ADDITIONAL CONSIDERATIONS
MDS Analytical Technologies strongly recommends performing quality assessment of
FFPE samples. In order to complete the Sample Assessment Protocol, a universal reference
RNA (Stratagene) must also be run in parallel, in addition to the FFPE samples. Please see
the Appendix for protocol details.
NOTE: MDS Analytical Technologies recommends using quantitative real-time PCR for the
most accurate measurement of RNA quantity of FFPE samples.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
37
5. RNA Amplification
5.3.
5.3.1.
PROTOCOL
PARADISE® PLUS ROUND ONE: 1ST STRAND cDNA SYNTHESIS
NOTE: Read all Detailed Protocol notes on the previous pages prior to beginning.
1
Prepare RNA sample in a total volume of 10 – 11 μL in a 0.5 mL or 0.2 mL RNasefree microcentrifuge tube and place on 4-8°C block.
2
Thaw Primer 1 (Gray-1), thoroughly mix, and spin down.
Figure 5.3: Gray 1
3
Add 1.0 μL of Primer 1, mix thoroughly by flicking the tube and spin down.
4
Incubate at 70°C for 1 hour then chill the samples to 4-8°C for at least one minute.
Spin down the contents and place on 4-8°C block before proceeding to the next step.
5
Place 1st Strand Synthesis components (Red) at 4-8°C (cold block). 1st Strand Master
Mix (Red-1) and Enhancer (Yellow) must be thawed, thoroughly mixed with all
solids dissolved, and maintained at 4-8°C until used. 1st Strand Enzyme Mix (Red-2)
and SuperScript III enzyme do not require thawing and can be placed directly at 48°C. Mix enzyme thoroughly by inverting several times. Spin briefly.
Figure 5.4: Red 1, Red 2, Yellow E and SuperScript III
6
38
Add 1st Strand Synthesis components in the order listed in the following table. If you
are performing several amplifications, you may wish to prepare a Complete 1st Strand
Synthesis Mix based on the following table, and add 9.0 μL Complete 1st Strand
Synthesis Mix to each sample. Mix thoroughly by flicking the tube and spin down.
DO NOT VORTEX.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
Table 5.10: Complete 1st Strand Synthesis Mix
Amount
Component
(μL)
Vial #
6 reaction Master Mix
with 10% overage (μL)
Enhancer
2
Yellow E
13.2
1st Strand Master Mix
5
Red 1
33.0
1st Strand Enzyme Mix
1
Red 2
6.6
SuperScriptTM III Enzyme*
1
6.6
Total per sample
9
59.4
* Not included in the kit
NOTE: Place components back onto the cold block or refreeze immediately after
dispensing the reagent. Do not leave reagents at room temperature.
7
Incubate at 42°C for 1.5 hours then chill the sample to 4-8°C for at least one minute.
Do not hold samples at this step for a prolonged period of time. Keep samples at 48°C until next incubation.
8
(Optional) You may remove a 2.0 μL sample at this point in the protocol to assess the
integrity of the starting mRNA by Quantitative Real-Time PCR (qRT-PCR.)
NOTE: This may reduce your final yield.
IMPORTANT: QC Kit Customers (KIT0313): STOP HERE and continue to appendix
section II
9
Thoroughly mix and spin down 1st Strand Nuclease Mix. Place on ice.
10 Add 2.0 μL of 1st Strand Nuclease Mix (Gold) to the sample, mix thoroughly by
flicking the tube and spin down.
Figure 5.5: 1st Strand Nuclease Mix (Gold)
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
39
5. RNA Amplification
11 Incubate the sample at 37°C for 30 minutes followed by 95°C for five minutes.
12 Chill the sample to 4-8°C for at least one minute.
It is okay to stop at this point in the protocol. Sample may be stored at –20°C
overnight.
NOTE: Removal for qrtPCR confirmation may not be suitable for low RNA inputs.
5.3.2.
PARADISE® PLUS ROUND ONE: 2ND STRAND CDNA SYNTHESIS
1
Place sample on 4-8°C block and allow to thaw if frozen (at 4-8°C).
2
Thaw Primer 2 (Gray-2), thoroughly mix, and spin down.
Figure 5.6: Gray 2
3
Add 1.0 μL of Primer 2. Mix thoroughly by flicking the tube and spin down.
4
Incubate sample at 95°C for 2 minutes, then chill and maintain the sample at 4-8°C
for at least 2 minutes.
5
Thaw 2nd Strand Master Mix at 4-8°C (cold block) (White-1). Thoroughly mix and
spin 2nd Strand Master Mix. 2nd Strand Enzyme Mix (White-2) does not require
thawing. Mix enzyme thoroughly by inverting several times, spin briefly and place at
4-8°C.
Figure 5.7: White 1 and White 2
40
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
6
Add 2nd Strand Synthesis components separately in the order listed in the following
table. If you are performing several amplifications, you may wish to prepare a
Complete 2nd Strand Synthesis Mix based on the following table, and add 30 μL
Complete 2nd Strand Synthesis Mix to each sample. Mix thoroughly by flicking the
tube and spin down.
Table 5.11: Complete 2nd Strand Synthesis Mix
6 reaction Master Mix with
Component
Amount (μL)
Vial #
2nd Strand Master Mix
29
White 1
191.4
2nd Strand Enzyme Mix
1
White 2
6.6
Total per sample
30
10% overage (μL)
198.0
*Store at 4°C until use
7
Incubate the sample as follows:
• 25°C 10 minutes
• 37°C 30 minutes
• 70°C 5 minutes
• 4-8°C Hold until ready to proceed (up to a maximum of 30 minutes)
NOTE: Place components back onto the cold block or refreeze immediately after
dispensing the reagent. Do not leave reagents at room temperature for any extended
period of time.
5.3.3.
PARADISE® PLUS ROUND ONE: cDNA PURIFICATION
1
Add 250 μL of DNA Binding Buffer (DB) to a DNA/RNA Purification Column
seated in the collection tube provided. Hold for five minutes at room temperature.
Centrifuge at 16,000 x g for one minute.
Figure 5.8: Binding Buffer DB
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
41
5. RNA Amplification
NOTE: DNA Binding Buffer (DB) must be at room temperature and thoroughly mixed
by shaking before use. A precipitate may form during long term storage. Dissolve
precipitate prior to use by mixing. If necessary, warm the DB vial to re-dissolve.
2
Add 200 μL of DNA Binding Buffer (DB) to the 2nd Strand Synthesis sample tube,
mix well, and pipette the entire volume into the purification column.
3
To bind cDNA to column, centrifuge at 100 x g for two minutes (or lowest speed
setting available), immediately followed by a centrifugation at 10,000 x g for one
minute to remove flow-through.
4
Add 250 μL of DNA Wash Buffer (DW) to the column and centrifuge at 16,000 x g
for two minutes. Check the purification column for any residual wash buffer. If any
wash buffer remains, re-centrifuge at 16,000 x g for one minute.
Figure 5.9: Wash Buffer DW
5
Discard the flow-through and collection tube.
6
Place the column into the provided 0.5 mL microcentrifuge tube and carefully add 11
μL of DNA Elution Buffer (DE) onto the center of the purification column
membrane. (Gently touch the tip of the pipette to the surface of the membrane while
dispensing the elution buffer to ensure maximum absorption of DE into the
membrane). Gently tap the purification column to distribute the buffer, if necessary.
Incubate for one minute at room temperature.
Figure 5.10: Elution Buffer DE
7
Place the assembly into the centrifuge as shown, and centrifuge at 1,000 x g for one
minute and then at 16,000 x g for one minute Discard the column and retain the
elution containing the cDNA in the microcentrifuge tube for further processing.
NOTE: Avoid splashing flow-through in the collection tube onto the column. If flowthrough waste liquid wets the outside of the purification column, re-centrifuge the
column at16,000 x g to remove liquid.
42
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
Figure 5.11: Centrifuge.
NOTE: To avoid potential breakage of the microcentrifuge tube cap during
centrifugation, insert the purification tube/0.5 mL tube assembly into a lidless 1.7/2.0
mL tube. Insert this assembly into adjacent rotor holes as illustrated. Rest the tube cap
against the tube immediately clockwise to it. Place an empty, lidless 1.7/2.0 mL tube
into the rotor hole adjacent in the clockwise direction to the last assembly.
It is safe to stop at this point in the protocol. You may store the sample overnight at
–20°C.
5.3.4.
PARADISE® PLUS ROUND ONE: IN VITRO TRANSCRIPTION
1
Thaw IVT Buffer (Blue-1), Master Mix (Blue-2) and Enhancer (Yellow) to room
temperature and thoroughly mix to dissolve all solids. IVT Enzyme Mix (Blue-3)
does not require thawing and can be put directly 4-8°C. Mix enzyme thoroughly by
inverting several times. Spin briefly.
Figure 5.12: Blue 1, Blue 2, Blue 3 and Yellow E
NOTE: IVT reaction components must be thawed thoroughly mixed with all solids
dissolved, and brought to room temperature just before use.
2
Add IVT components in the order listed in the following table. If you are performing
several amplifications, you may wish to prepare a Complete IVT Reaction Mix
according to the following table, and add 12 μL Complete IVT Reaction Mix to each
sample. Mix thoroughly by flicking the tube and spin down.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
43
5. RNA Amplification
Table 5.12: Complete IVT Reaction Mix
3
6 reaction Master Mix with
Component
Amount (μL)
Vial #
IVT Buffer
2
Blue 1
13.2
IVT Master Mix
6
Blue 2
39.6
IVT Enzyme Mix
2
Blue 3
13.2
Enhancer
2
Yellow E
13.2
Total per sample
12
10% overage (μL)
79.2
Incubate at 42°C for 8 hours. Chill the sample(s) to 4-8°C.
At this point in the protocol, you may hold the reaction mixture at 4-8°C in the thermal
cycler overnight.
4
Move the samples directly to a 4-8°C block.
5
Add 1 μL DNase Mix (Blue-4). Mix thoroughly and spin down. Incubate at 37°C for
15 minutes. Chill the sample(s) to 4-8°C. Proceed immediately to aRNA
purification.
Figure 5.13: Blue 4
44
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
5.3.5.
PARADISE® PLUS ROUND ONE: aRNA PURIFICATION
1
Add 250 μL of RNA Binding Buffer (RB) to a new purification column and incubate
for five minutes at room temperature. Centrifuge at 16,000 x g for one minute.
Figure 5.14: Binding Buffer RB
NOTE: RNA Binding Buffer (RB) must be at room temperature and thoroughly mixed
before use. A precipitate may form during long-term storage. Dissolve precipitate prior
to use by mixing. If necessary, warm the RB vial to re-dissolve.
2
Add 120 μL of RB to the IVT reaction sample and mix thoroughly. Pipette the entire
volume into the purification column.
3
To bind aRNA, centrifuge at 100 x g (or lowest speed setting available) for two
minutes, immediately followed by a centrifugation at 10,000 x g for one minute to
remove flow-through.
4
Add 200 μL of RNA Wash Buffer (RW) to the purification column and centrifuge at
10,000 x g for one minute.
Figure 5.15: Wash Buffer RW
5
Add 200 μL of fresh RW to the purification column, and centrifuge at 16,000 x g for
two minutes. Check the purification column for any residual wash buffer. If any wash
buffer remains, re-centrifuge at 16,000 x g for one minute.
NOTE: Avoid splashing flow-through in the collection tube onto the purification
column. If flow-through waste liquid wets the outside of the purification column, recentrifuge the column at 16,000 x g to remove the liquid.
6
Discard the collection tube and flow-through.
7
Place the purification column into a new 0.5 mL microcentrifuge tube provided in
the kit and carefully add 12 μL of RNA Elution Buffer (RE) directly to the center of
the purification column membrane. Gently touch the tip of the pipette to the surface
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
45
5. RNA Amplification
of the membrane while dispensing RE to ensure maximum absorption of RE into the
membrane. Gently tap the purification column to distribute the buffer, if necessary.
Figure 5.16: Elution Buffer RE
8
Incubate at room temperature for one minute.
9
Place each column-tube assembly into the centrifuge rotor with the 0.5 mL tube cap
trailing the tube.
10 Centrifuge at 1,000 x g for one minute, immediately followed by 16,000 x g for one
minute. Discard the purification column and retain the elution containing the aRNA.
NOTE: Tubes must be properly oriented in the rotor during elution. See Section 5.2.7.
Figure 5.17: Centrifuge.
NOTE: To avoid potential breakage of the microcentrifuge tube cap during
centrifugation, insert the purification tube/0.5 mL tube assembly into a lidless 1.7/2.0
mL tube. Insert this assembly into adjacent rotor holes as illustrated. Rest the tube cap
against the tube immediately clockwise to it. Place an empty, lidless 1.7/2.0 mL tube
into the rotor hole adjacent in the clockwise direction to the last assembly.
11 Immediately proceed to Round Two or store the purified aRNA at –70°C overnight.
END OF ROUND 1.=
46
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
5.3.6.
PARADISE® PLUS ROUND TWO: 1ST STRAND cDNA SYNTHESIS
1
Thaw samples at 4-8°C if necessary. Place samples on a 4-8°C block.
2
Thaw Primer 2 (Gray-2), thoroughly mix, spin down and place on a 4-8°C block.
Figure 5.18: Gray 2
3
Into eluted aRNA product from Round One, add 1.0 μL of Primer 2, mix thoroughly
by flicking the tube and spin down.
4
Incubate the microcentrifuge tube at 70°C for 5 minutes then chill the samples to 48°C for one minute. Spin down the contents and place on 4-8°C block before
proceeding to next step.
5
Place 1st Strand Synthesis components (Red) at 4-8°C. 1st Strand Master Mix and
Enhancer (Yellow) must be thawed, thoroughly mixed with all solids dissolved, and
maintained at 4-8°C until used. 1st Strand Enzyme Mix does not require thawing and
can be placed directly at 4-8°C. Mix enzyme thoroughly by inverting several times.
Spin briefly.
Figure 5.19: Red 1, Red 2, Yellow Enhancer and SuperScript III Enzyme
6
Add 1st Strand Synthesis components in the order listed in the following table. If you
are performing several amplifications, you may wish to prepare a Complete 1st Strand
Synthesis Mix based on the following table, and add 9.0 μL Complete 1st Strand
Synthesis Mix to each sample. Mix thoroughly by flicking the tube and spin down.
DO NOT VORTEX.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
47
5. RNA Amplification
Table 5.13: Complete 1st Strand Synthesis Mix
6 reaction Master Mix with
Component
Amount (μL)
Vial #
Enhancer
2
Yellow E
13.2
1st Strand Master Mix
5
Red 1
33.0
1st Strand Enzyme Mix
1
Red 2
6.6
SuperScript III Enzyme*
1
6.6
Total per sample
9
59.4
10% overage (μL)
* Not included in the kit
7
Incubate the sample(s) at 25°C for 10 minutes then at 37°C for 1.5 hours.
8
Chill the sample(s) to 4-8°C, for at least one minute.
NOTE: Place components back onto the cold block or refreeze immediately after
dispensing the reagent. Do not leave reagents at room temperature for any extended
period of time.
It is safe to stop at this point in the protocol. You may store the sample overnight at –
20°C.
IMPORTANT: qRT-PCR Kit Customers (KIT0300 KIT0300-NS, KIT0310 & KIT0310-NS): STOP
HERE and continue with qRT-PCR protocol as directed by instrument manufacturer.
5.3.7.
PARADISE® PLUS ROUND TWO: 2ND STRAND cDNA SYNTHESIS
1
Place sample on 4-8°C block and allow to thaw if frozen (at 4-8°C).
2
Thaw Primer 3 (Gray-3), thoroughly mix, spin down, and place on 4-8°C block.
Figure 5.20: Gray 3
3
48
Add 1.0 μL of Primer 3 to the sample. Mix thoroughly by flicking the tube and spin
down.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
4
Incubate the sample at 95°C for five minutes then cool sample to 4-8°C for at least
one minute. Hold the sample at 4-8°C until ready to proceed. Spin down the contents
and place on 4-8°C block before proceeding to the next step.
5
Thaw 2nd Strand Master Mix at 4-8°C (cold block) (White-1). Thoroughly mix and
spin 2nd Strand Master Mix. 2nd Strand Enzyme Mix (White-2) does not require
thawing. Mix enzyme thoroughly by inverting several times, spin briefly and place at
4-8°C.
Figure 5.21: White 1 and White 2
6
Add 2nd Strand Synthesis components separately in the order listed in the following
table. If you are performing several amplifications, you may wish to prepare a
Complete 2nd Strand Synthesis Mix based on the following table, and add 30 μL
Complete 2nd Strand Synthesis Mix to each sample. Mix thoroughly by flicking the
tube and spin down.
Table 5.14: Complete 2nd Strand Synthesis Mix
6 reaction Master Mix with
Component
Amount (μL)
Vial #
2nd Strand Master Mix
29
White 1
191.4
2nd Strand Enzyme Mix
1
White 2
6.6
Total per sample
30
10% overage (μL)
198.0
*Store at 4°C until use
7
Incubate the sample(s) as follows:
• 37°C 30 minutes
• 70°C 5 minutes
• 4-8°C Hold until ready to proceed (up to a maximum of 30 minutes).
NOTE: Place components back onto the cold block or refreeze immediately after
dispensing the reagent. Do not leave reagents at room temperature.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
49
5. RNA Amplification
5.3.8.
PARADISE® PLUS ROUND TWO: cDNA PURIFICATION
1
Add 250 μL of DNA Binding Buffer (DB) to a new purification column seated in the
collection tube provided. Incubate for five minutes at room temperature. Centrifuge
at 16,000 x g for one minute.
Figure 5.22: Binding Buffer DB
NOTE: DNA Binding Buffer (DB) must be at room temperature and thoroughly mixed
before use. A precipitate may form during long-term storage. Dissolve precipitate by
mixing. If necessary, warm the DB vial to re-dissolve
2
Add 200 μL of DB to the 2nd Strand Synthesis sample tube, mix well, and pipette the
entire volume into the purification column.
3
To bind cDNA, centrifuge at 100 x g (or lowest speed setting available) for two
minutes, immediately followed by a centrifugation at 10,000 x g for 1 minute to
remove flow-through.
4
Add 250 μL of DNA Wash Buffer (DW) to the column and centrifuge at 16,000 x g
for two minutes. Check the purification column for any residual wash buffer. If any
wash buffer remains, re-centrifuge at 16,000 x g for one minute.
Figure 5.23: Wash Buffer DW
NOTE: Avoid splashing flow-through in the collection tube onto the column. If flowthrough waste liquid wets the outside of the purification column, re-centrifuge the
column at16,000 x g to remove liquid.
50
5
Discard the collection tube and flow-through.
6
Place the column into the provided 0.5 mL microcentrifuge tube and carefully add 11
μL of DNA Elution Buffer (DE) onto the center of the purification column
membrane. Gently touch the tip of the pipette to the surface of the membrane while
dispensing DE to ensure maximum absorption of DE into the membrane. Gently tap
the purification column to distribute the buffer, if necessary.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
Figure 5.24: Elution Buffer DE
7
Incubate for one minute at room temperature.
8
Place each column-tube assembly into the 2 mL support tube in the rotor with the 0.5
mL tube cap trailing the tube.
9
Centrifuge at 1000 x g for one minute, followed immediately by 16,000 x g for one
minute. Discard the column and retain the elution containing the cDNA.
Figure 5.25: Centrifuge.
NOTE: To avoid potential breakage of the microcentrifuge tube cap during centrifugation,
insert the purification tube/0.5 mL tube assembly into a lidless 1.7/2.0 mL tube. Insert this
assembly into adjacent rotor holes as illustrated. Rest the tube cap against the tube
immediately clockwise to it. Place an empty, lidless 1.7/2.0 mL tube into the rotor hole
adjacent in the clockwise direction to the last assembly.
It is safe to stop at this point in the protocol. You may store the sample overnight at –
20°C.
IMPORTANT: 1.5 Round Customer (KIT 0301, KIT0301-NS KIT0311, & KIT0311-NS): STOP
HERE and proceed to Appendix G.3., “Generation of Labeled aRNA Using Alternative IVT
Kits”.
5.3.9.
PARADISE® PLUS ROUND TWO: IN VITRO TRANSCRIPTION
1
Thaw IVT Buffer (Blue-1), Master Mix (Blue-2) and Enhancer (Yellow) to room
temperature and thoroughly mix to dissolve all solids. IVT Enzyme Mix does not
require thawing and can be put directly 4-8°C. Mix enzyme thoroughly by inverting
several times. Spin briefly.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
51
5. RNA Amplification
NOTE: IVT reaction components must be thawed thoroughly mixed with all solids
dissolved, and brought to room temperature just before use.
Figure 5.26: Normal IVT Blue-1, Blue-2, Blue-3, and Yellow E.
or
Figure 5.27: Amino-Allyl incorporation IVT: Blue-1, Light Blue AA Blue-3, and Yellow E.
2
Add IVT components in the order listed in the following table. If you are performing
several amplifications, you may wish to prepare a Complete IVT Reaction Mix
according to the following table, and add 12 μL Complete IVT Reaction Mix to each
sample. Mix thoroughly by flicking the tube and spin down.
NOTE: IVT reaction components must be thawed thoroughly mixed with all solids
dissolved, and brought to room temperature just before use.
Table 5.15: Complete IVT Reaction Mix
6 reaction Master Mix with
Component
Amount (μL)
Vial #
IVT Buffer
2
Blue 1
13.2
IVT Master Mix*
6
Blue 2*
39.6
IVT Enzyme Mix
2
Blue 3
13.2
Enhancer
2
Yellow E
13.2
Total per sample
12
10% overage (μL)
79.2
*If doing Amino-Allyl incorporation, substitute Amino-Allyl IVT Master Mix (light blue
AA) here
52
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
3
Incubate at 42°C for 8 hours. Chill the sample(s) to 4-8°C.
At this point in the protocol, you may hold the reaction mixture at 4-8°C in the
thermal cycler overnight.
4
Move the samples directly to a 4-8°C block.
Figure 5.28: Blue 4
5
Add 1 μL DNase Mix (Blue-4). Mix thoroughly and spin down. Incubate at 37°C for
15 minutes. Chill the sample(s) to 4-8°C. Proceed immediately to aRNA
purification.
5.3.10. PARADISE® PLUS ROUND TWO: aRNA PURIFICATION
1
Add 250 μL of RNA Binding Buffer (RB) to a new purification column seated in the
collection tube provided. Incubate for five minutes at room temperature. Centrifuge
at 16,000 x g for one minute.
Figure 5.29: RNA Binding Buffer
Note: RNA Binding Buffer (RB) must be at room temperature and thoroughly mixed
before use. A precipitate may form during long-term storage. Dissolve precipitate prior
to use by mixing. If necessary, warm the RB vial to re-dissolve.
2
Add 120 μL of RB to the IVT reaction sample and mix thoroughly. Pipette the entire
volume into the purification column.
3
To bind aRNA, centrifuge at 100 x g (or lowest speed setting available) for two
minutes, immediately followed by a centrifugation at 10,000 x g for 1 minute.
4
Add 200 μL of RNA Wash Buffer (RW) to the purification column and centrifuge at
10,000 x g for one minute.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
53
5. RNA Amplification
Figure 5.30: RNA Wash Buffer
NOTE: Avoid splashing flow-through in the collection tube onto the purification
column. If flow-through waste liquid wets the outside of the purification column, recentrifuge the column at 16,000 x g to remove the liquid.
5
Add 200 μL of fresh RW to the purification column, and centrifuge at 16,000 x g for
two minutes. Check the column for any residual wash buffer. If any wash buffer
remains, re-centrifuge at 16,000 x g for one minute.
6
Discard the collection tube and flow-through.
7
Place the purification column into a new 0.5 mL microcentrifuge tube provided in
the Kit and carefully add 30 μL of RNA Elution Buffer (RE) directly to the center of
the purification column membrane. Gently touch the tip of the pipette to the surface
of the membrane while dispensing RE to ensure maximum absorption of RE into the
membrane. Gently tap the purification column to distribute the buffer, if necessary.
Figure 5.31: RNA Elution Buffer
8
Incubate for one minute at room temperature.
9
Place each column-tube assembly into the 2 mL support tube in the rotor with the 0.5
mL tube cap trailing the tube.
10 Centrifuge at 1000 x g for one minute, followed immediately by 16,000 x g for one
minute. Discard the column and retain the elution containing the aRNA.
54
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5.3. Protocol
Figure 5.32: Centrifuge.
NOTE: To avoid potential breakage of the microcentrifuge tube cap during
centrifugation, insert the purification tube/0.5 mL tube assembly into a lidless 1.7/2.0
mL tube. Insert this assembly into adjacent rotor holes as illustrated. Rest the tube cap
against the tube immediately clockwise to it. Place an empty, lidless 1.7/2.0 mL tube
into the rotor hole adjacent in the clockwise direction to the last assembly.
11 Measure the O.D. of the product at A260 and A280
12 Analyze the aRNA using the Agilent Bioanalyzer or by gel electrophoresis.
13 The purified aRNA is ready for use in a labeling reaction with the TURBO Labeling™
microarray kit (see Appendix A.1, Application 1) or in a reverse transcription
application with the Paradise cDNA kit (see Section 1.7., “Related Arcturus Products”,
or www.molecualrdevices.com for more information)
END OF ROUND 2.=
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
55
5. RNA Amplification
56
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
A. Applications of aRNA
The Paradise® Plus Reagent System can be used to yield a suitable labeled RNA sample for
hybridization to nucleic acid in a variety of formats. The RNA sample may be labeled in a
number of different ways, including those listed below.
A.1.
DIRECT aRNA LABELING WITH TURBO LABELING KIT
After analysis of the aRNA with the Agilent Bioanalyzer (see Section G.1., “Assessment of
Rna Quality Using the Agilent Bioanalyzer”) or by gel electrophoresis (see Section G.2.,
“Analysis of aRNA by Agarose Gel Electrophoresis”) as described in Round Two: Antisense
RNA (aRNA) Purification, aRNA may be directly labeled with a biotin or a fluorescent
marker. Direct mRNA labeling can be accomplished using the Turbo Labeling™ kits:
KIT0608 Turbo Labeling – Biotin, 12 reactions
KIT0609 Turbo Labeling – Cy3, 12 reactions
KIT0610 Turbo Labeling – Cy5, 12 reactions
For more information go to www.moleculardevices.com/turbo.
A.2.
DIRECT cDNA FLUORESCENT LABELING
For use with complete 2 round kits
The protocol described here may be used to prepare Cy3- or Cy5-labeled cDNA from
aRNA generated using the Paradise Plus Reagent System RNA Amplification Kit for
hybridization to cDNA microarrays. This protocol provides labeled probe of sense
orientation from 5-10 micrograms of aRNA, a sufficient quantity for replicate
hybridizations on cDNA microarrays. However, such probes are typically not used for
oligonucleotide arrays, since the targets on such arrays are also generally in the sense
orientation.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
57
A. Applications of aRNA
Table A.1: Suppliers
Reagents Used
Maker
Catalog#
RNase AWAY
Invitrogen
10328-011
Cy3 labeled dUTP
Amersham
PA53022
Cy5 labeled dUTP
Amersham
PA55022
RNAsin Ribonuclease Inhibitor
Promega
N2515
SuperScript III RT and Buffer
Invitrogen
18080-044
Nuclease Free Water
Invitrogen
10977-023
Rnase H
Invitrogen
18021-071
Random Hexamer
Operon
custom-made
QiaQuick PCR Purification Kit
Qiagen
28106
Protocol
1
Take 5-10 μg of amplified aRNA and adjust the volume to 22 μL with nuclease-free
water.
NOTE: Adjust to 22 μL using a vacuum concentrator, paying attention to not completely
dry down the aRNA sample.
2
Add 2 μL of 5 mg/ml random hexamer.
3
Mix well by flicking, then briefly spin down by centrifugation.
4
Heat the tube to 70°C for 10 minutes, then 4OC for 2 minutes in the thermal cycler.
5
During incubation, prepare the first-strand master mix as described below.
Table A.2: First Strand Master Mix - 1x
58
First Strand Buffer
10 μL
0.1 M DTT
5 μL
25 mM dNTP
1 μL
1 mM dUTP-Cy3 or Cy5
2 μL
1 mM dTTP
2 μL
RNAsin
2 μL
SuperScript II RT
4 μL
Total
26 μL
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
A.3. Generation of Template for QRT-PCR
6
When incubation is complete, mix the tube well by flicking, and then briefly spin
down by centrifugation.
7
Add 26 μL of the above first stand master mix to each reaction tube.
8
Mix well by flicking, and then briefly spin down by centrifugation.
9
Incubate at 27°C for 10 minutes, followed by 37°C for 2 hours in the thermal cycler.
10 Treat with 2 units of RNase H for 20 minutes at 37°C in the thermal cycler.
11 Immediately proceed to PCR product purification using QiaQuick PCR Purification
Kit. Pre-treat the columns placed in collection tube by incubating 100 μL of
QiaQuick PB buffer for 5 minutes, and then centrifuge at 13200 rpm (or full speed
on a 5415C Eppendorf Centrifuge) for 1 minute.
12 Add 260 μL of QiaQuick PB buffer to the sample tube.
13 Mix well by flicking, and then briefly spin down by centrifugation.
14 Load the sample onto the pre-treated columns. Centrifuge at 6000 rpm for 1 minute.
15 Discard flow through. Place the column into the same collection tube.
16 Wash with 750 μL of QiaQuick PE buffer. Centrifuge at 13200 rpm for 1 minute.
17 Discard flow through. Place the column back into the same collection tube.
18 Centrifuge at 13200 rpm for an additional 2 minutes to remove residual wash
solution.
19 Place the column into a clean 2 ml microcentrifuge tube.
20 Add 50 μL of nuclease-free water, pH 8.5, directly onto the column membrane.
Incubate for 3–5 minutes, and then centrifuge at maximum speed for 1 minute.
21 If the column still shows residual probe, add another 30 μL of nuclease free water, pH
8.5, directly onto the column membrane, incubate for 1minute, and centrifuge at
maximum speed for 1 minute.
NOTE: After centrifuging, make sure that the entire sample has passed through the
column, and that the column is completely dry. If not, centrifuge for an additional 1 minute
at 6000 rpm. When dry, the column will be visibly pink (Cy3) or blue (Cy5) if the reaction
was successful.
NOTE: If the labeling reaction was successful, the eluate should be visibly pink (Cy3) or
blue (Cy5) in color.
A.3.
GENERATION OF TEMPLATE FOR QRT-PCR
The aRNA generated using the Paradise Plus Reagent System RNA Amplification reagents
can be used in reactions measuring relative gene expression using quantitative PCR
methods.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
59
A. Applications of aRNA
The amplification process generates product from the 3’ end of the mRNA. For best
results use qRT-PCR primer sets designed within the first 300 bases from the poly A tail.
The following protocol may serve as a guide for qRT-PCR experiments using aRNA
converted to cDNA as a template.
Protocol
Reverse Transcription
1
MDS Analytical Technologies recommends an aliquot of 100 ng of amplified RNA
from each sample in a volume of 10 μL.
2
Add 1 μL of 5 mg/ml random hexamer.
3
Mix well by flicking, and then briefly spin down by centrifugation for 2 minutes in
thermal cycler.
4
Incubate samples at 70ºC for 10 minutes. Chill sample to 4ºC.
5
Assemble a master mix with the following components: (components listed are for
one reaction)
Table A.3: Master Mix Components
Item
Volume (μL)
Vendor
Catalog #
First Strand Buffer
4
Invitrogen
18080-044
0.1M DTT
2
Invitrogen
18064-044
10 mM dNTP
1
Amersham
US77212-500μL
Rnasin
1
Promega
N2511
Superscript III
1
Invitrogen
18064-044
Total
9
6
When incubation (Step 4) is complete, mix the tube well by flicking, and then briefly
spin down by centrifugation.
7
Add 9 μL of the First Strand Master Mix to each reaction tube.
8
Incubate at 27°C for 10 minutes, followed by 37°C for 1.5 hours in the thermal
cycler.
9
The sample is now ready for Q-PCR.
qRT-PCR
Please consult the protocol from the system manufacturer.
60
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
B. Sample Assessment
Protocol
MDS Analytical Technologies recommends performing this simple, in process, protocol
to assess the quality of RNA in FFPE tissue blocks. This protocol will enable estimation of
RNA quantity and quality using a quantitative real-time PCR assay with primers designed
to ß-acting.
The assumption is that the ß-actin mRNA in the sample represents the average status of
other RNA molecules in the same sample. The total estimated RNA amount in a given
sample is expressed as an equivalent of universal RNA that contains the same amount of
ß-actin mRNA.
The protocol measures the average ß-actin cDNA length by quantification of the PCR
product yield from the 3’ end (primer 1650-1717) and another relative 5’ sequence
(primer 1355-1472). If all cDNA contains both the 3’ and 5’ sequence target, the ratio of
the PCR product for 3’/5’ would be 1. As the RNA from FFPE samples tends to exhibit
some degradation, the 3’/5’ ratio is usually greater than one. Depending on the ratio, an
estimation of the quality of the RNA can be made.
It is recommended to perform the reverse transcription steps with 100-200 ng of total
RNA. Be sure to determine the yield of the total RNA following isolation and make the
appropriate dilutions to ensure your samples are within this concentration range. Perform
necessary dilutions of total RNA in 10 ng/μL Poly-I.
In parallel to the testing sample, a control of 10 ng/ μL uRNA (100 ng in 10 μL)
(Stratagene 740000) needs to be carried through the complete analysis as the quantitation
standard for EVERY experiment. Dilution factor may vary for aRNA generated after one
round of amplification.
NOTE: MDS Analytical Technologies recommends this protocol to customers who are
starting a new set of FFPE samples or new type of FFPE samples. Experiments should be
done on scraped sections.
The RNA quantity derived from the 3’ primer set (1650-1717) should be used as the
quantity measurement of the RNA in the FFPE sample. The ratio of the RNA yield
obtained from both sets of PCR primers is the 3’/5’ used as an indication of RNA quality.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
61
B. Sample Assessment Protocol
Materials Needed
Table B.1: Materials needed
Component
Vendor
Catalog #
RNase free water
Invitrogen
18054-015
Universal Human Reference RNA
Stratagene
740000
Poly-I
Sigma
P4154
Uracil-DNA Glycosylase
Roche
1444646
Thermal cycler
MLS
--
Table B.2: Primer sequences:
HBAC1650
TCCCCCAACTTGAGATGTATGAAG
50 μM*
HBAC1717
AACTGGTCTCAAGTCAGTGTACAGG
50 μM*
HBAC1355
ATCCCCCAAAGTTCACAATG
50 μM*
HBAC1472
GTGGCTTTTAGGATGGCAAG
50 μM*
* Stock concentration
Table B.3: Materials needed for qrtPCR
Component
Vendor
Catalog #
QuantiTect SYBR Green PCR Master Mix
Qiagen
204143
ABI optical Reaction Plate
ABI
4314320
Optical Adhesive covers
ABI
4311971
Splash Free Support Base for 96well plate
ABI
4312063
Microseal F foil
MJ Research
MSF 1001
LightCycler DNA SYBR Green kit
Roche
2158817
BD Taqstart Antibody
BD-Clontech
639251
For ABI PRISM 7900HT:
For Roche Light Cycler:
62
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
IMPORTANT: Depending on the exact model of the real-time PCR instrument, the
protocol may vary. Provided are protocols for the ABI PRISM 7900 HT Sequence Detection
System and the Roche LightCycler.
Protocol
Extraction
Follow the protocol detailed in Section 4.3.3., “Tissue Scrape Protocol” of this user guide.
Quantitate the concentration of the RNA extracted (see Appendix F. , “aRNA Yield and
Purity Determination”).
Reverse Transcription
Your experimental design should include:
>
100-200 ng of each sample
>
100 ng of universal reference RNA (Stratagene cat # 740000) to be used later as a
standard curve for qRT-PCR
NOTE: It is not necessary to run the control that comes with the kit. That control RNA is an
amplification control and is not of high enough concentration for the standard curve.
NOTE: This is the same procedure as Section 5.3.1.: Paradise Plus Round one: 1st strand
cDNA synthesis of this user guide.
NOTE: Read all Detailed Protocol notes in Chapter 5 prior to beginning this procedure.
1
Prepare each 100-200 ng RNA sample in a total volume of 10 – 11 μL in a 0.5 mL or
0.2 mL RNase-free microcentrifuge tube and place on 4-8°C block.
2
Thaw Primer 1 (Gray-1), thoroughly mix, and spin down.
3
Add 1.0 μL of Primer 1, mix thoroughly by flicking the tube and spin down.
4
Incubate at 70°C for 1 hour then chill the samples to 4-8°C for at least one minute.
Spin down the contents and place on 4-8°C block before proceeding to the next step.
5
Place 1st Strand Synthesis components at 4-8°C (cold block). 1st Strand Master Mix
(Red-1) and Enhancer (Yellow) must be thawed, thoroughly mixed with all solids
dissolved, and maintained at 4-8°C until used. 1st Strand Enzyme Mix (Red-2) and
SuperScript enzyme do not require thawing and can be placed directly at 4-8°C. Mix
enzyme thoroughly by inverting several times. Spin briefly.
Figure B.1: Red 1, Red 2, Yellow Enhancer and SuperScript III Enzyme
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
63
B. Sample Assessment Protocol
6
Add 1st Strand Synthesis components in the order listed in the following table. If you
are performing several amplifications, you may wish to prepare a Complete 1st Strand
Synthesis Mix based on the following table, and add 9.0 μL Complete 1st Strand
Synthesis Mix to each sample. Mix thoroughly by flicking the tube and spin down.
DO NOT VORTEX.
Table B.4: Complete 1st Strand Synthesis Mix
6 reaction Master Mix with
Component
Amount (μL)
Vial #
Enhancer
2
Yellow E
13.2
1st Strand Master Mix
5
Red 1
33.0
1st Strand Enzyme Mix
1
Red 2
6.6
SuperScript III Enzyme*
1
6.6
Total per sample
9
59.4
10% overage (μL)
* Not included in the kit
7
Incubate at 42°C for 1.5 hours then chill the sample to 4-8°C for at least one minute.
Do not hold samples at this step for a prolonged period of time. Keep samples at 48°C while creating the standard curve.
Creating the Standard Curve
Using the cDNA generated from the 100 ng of Universal Human Reference RNA, create
other standard curve points from subsequent serial dilutions. Use the following
guidelines:
>
64
The standard curve should consist of four standard points:
>
100 ng, 10 ng, 1 ng, and 0.1 ng (per reverse transcription input of total RNA).
>
Use 10 ng/μL Poly-I as the diluent.
>
Perform the serial dilutions as illustrated below.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Figure B.2: cDNA dilutions for Real-Time PCR Standard Curve
>
Store the unused volume of 100-ng cDNA at –65 to –80°C for use in creating
subsequent standard curves.
NOTE: Set up one RT reaction for each testing samples, one for the blank, and one for the
uRNA standard.
NOTE: Use 10.0 μL of testing samples, 10.0 μl of water for a blank tube and 10.0 μL of the
uRNA standard.
NOTE: Many real-time PCR instrument systems utilize similar technology. We provide
protocols for the ABI PRISM 7900HT and the Light Cycler. Modification to these protocols
for other real-time platforms can be made according to the manufacturers’
recommendations.
Protocol
1
Following the RT reaction serially dilute the uRNA control for use as a standard
curve. The cDNA generated from the 100 ng of Universal Human Reference RNA
(Stratagene, PN 740000; see above) is used as the highest template mass point for the
standard curve. Therefore, the 100-ng sample represents 100% of the reverse
transcription product.
2
Set up the PCR reactions following the steps below for the instrument you are using:
• ABI PRISM 7900HT
• Roche Light Cycler
For ABI PRISM 7900HT:
1
Prepare the PCR reactions per the table below, combine the PCR master mix
components in a clean, nuclease-free microcentrifuge tube. To determine the total
amount of PCR master mix required, multiply the amount of each component by the
number of reactions you are performing (n), plus one: n + 1
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
65
B. Sample Assessment Protocol
Table B.5: For the 3' ß-actin Primers
Amount for Each Reaction
Component
Volume (μL)a
Final Conc.
SYBR Green PCR Master Mix
10
—
Uracil-DNA Glycosylase
0.5
—
3’ ß-actin Forward Primer, 50 μM
0.25
625 nM
3’ ß-actin Reverse Primer, 50 μM
0.25
625 nM
Water, nuclease-free
1
—
Table B.6: For the 5' ß-actin Primers
Amount for Each Reaction
Component
Volume (μL)a
Final Conc.
SYBR Green PCR Master Mix
10
—
Uracil-DNA Glycosylase
0.5
—
5’ ß-actin Forward Primer, 50 μM
0.25
625 nM
5’ ß-actin Reverse Primer, 50 μM
0.25
625 nM
Water, nuclease-free
1
—
a
The volumes listed above are specific to the Applied Biosystems 7900HT Fast RealTime PCR System. Other real-time PCR instruments may require adjustments to these
volumes. Please consult your instrument’s user manual.
2
Mix thoroughly by inverting, then spin quickly to collect the master mix at the
bottom of the tube.
3
Proceed to “Running the ABI PCR Reactions” on page 67.
Preparing the reaction plate
1
Assemble the reactions in an optical tube or optical reaction plate:
a Dispense 12 μL of the 3' Primer Set into the appropriate wells or tubes.
b Dispense 12 μL of the 5' Primer Set into the appropriate wells or tubes.
c Add 8 μL of the diluted cDNA into the appropriate wells or tubes.
d Add 8 μL of the nuclease-free water into the appropriate NTC wells or tubes.
66
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
NOTE: For both the 3' and 5' Primer Sets, include the RNA samples, positive control,
diluted control for a standard curve, and the blank (NTC) in the sample layout.
2
Seal the tube or reaction plate with an optical cap or optical adhesive cover.
3
Vortex the tube or reaction plate for 20 seconds, then spin quickly to collect the
reactions at the bottom of the tube or wells.
4
Proceed to “Running the ABI PCR Reactions” on page 67.
Running the ABI PCR Reactions
1
Place the tube or reaction plate in your real-time PCR instrument.
2
Program the thermal cycling conditions as follows:
Table B.7: Thermal Cycling Conditions
Temperature
Step
(°C)
Time
1
Hold
50
2 minutes
2
Hold
95
15 minutes
PCR
95
15 seconds
58
30 seconds
72
32 seconds
3
(40 cycles)
IMPORTANT: The thermal cycling conditions listed above have been optimized for
use on the Applied Biosystems 7900HT Fast Real-Time PCR System.
3
Optional. If your instrument has the ability, include a dissociation curve.
4
When the run is completed, export the results into Microsoft Excel software.
5
Proceed to “Interpreting the Results” on page 69
For Roche Light Cycler
Preparing the PCR reactions:
1
Prepare the PCR reaction mix according to the table below:
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
67
B. Sample Assessment Protocol
Table B.8: For the 3' ß-actin Primers
Amount for Each Reaction
Component
Volume (μL)a
Final Conc.
SYBR Green PCR Master Mix
2
—
BD Taqstart Antibody
0.16
25 mM MgCl2
2.4
—
Uracil-DNA Glycosylase
1.0
—
3’ ß-actin Forward Primer, 50 μM
0.25
625 nM
3’ ß-actin Reverse Primer, 50 μM
0.25
625 nM
Water, nuclease-free
11.94
—
Table B.9: For the 5' ß-actin Primers
Amount for Each Reaction
Component
68
Volume (μL)a
Final Conc.
SYBR Green PCR Master Mix
2
—
BD Taqstart Antibody
0.16
25 mM MgCl2
2.4
—
Uracil-DNA Glycosylase
1.0
—
5’ ß-actin Forward Primer, 50 μM
0.25
625 nM
5’ ß-actin Reverse Primer, 50 μM
0.25
625 nM
Water, nuclease-free
11.94
—
2
For each reaction, add 18 μL of the PCR mix into a LightCycler capillary.
3
Add 2 μL of the cDNA.
4
Spin the capillaries at 500g for 5 second in their adaptor. Load the capillaries into
LightCycler.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
5
Run the LightCycler following programs as listed below (set temperature transition
rate to 20):
Step
Target temp
Time
Acquisition
1
Denaturation
95
1 min
none
2
Amplification
95
0 sec
none
58
5 sec
none
72
10 sec
single
95
0 sec
none
65
10 sec
none
99
0 sec
cont
40
1 min
none
(35 cycles)
3
Melting
4
Cooling
6
Obtain Ct1650, Ct 1355 for the testing sample and the uRNA dilutions.
7
Quantify the input RNA:
a Plot the standard curve of log uRNA amount vs. Ct. For each pair of primers, one
standard curve is generated.
b Obtain the uRNA equivalent of the testing sample from the corresponding
standard curve (Standard curve 1650, Standard curve 1355).
c Use the uRNA equivalent from 1650 primer set to estimate the RNA quantity, use
the ratio of RNA 1650/RNA 1355 to estimate the RNA quality.
Interpreting the Results
The RNA concentration using the 3' Primer Set is the quantity of the sample RNA. The
ratio of 3'/5' is obtained for each sample using the corresponding RNA concentration.
Table B.10: Example of results
Primer
Ct
Quantity
Primer
Ct
Quantity
3'/5' Ratio
1355/1472
28.70
0.09
1650/1717
23.80
2.56
30.12
1355/1472
27.80
0.16
1650/1717
23.90
2.32
14.50
1355/1472
23.60
3.50
1650/1717
20.10
35.37
10.11
1355/1472
21.00
22.50
1650/1717
19.50
57.70
2.56
NOTE: The 3'/5' ratio is the ratio of the quantities of each Primer Set. For example, in
Sample 1 the ratio is equal to 30.12; this is derived from 2.56/0.085.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
69
B. Sample Assessment Protocol
Explanation of results
The 3'/5' ratio evaluates the abundance of the average ß-actin cDNA from the 3' end
(primer 1650-1717) compared to the abundance of a relatively 5' sequence (primer 13551472) using the quantified PCR yields of each amplicon. If most of the cDNA contains
both the 3' and 5' sequence target, the ratio of the PCR product for 3'/5' is close to 1. As
the RNA from FFPE samples starts exhibiting some level of degradation, the 3'/5' ratio
tends to become greater than 1. Depending on the ratio, an estimation of the RNA
quality can be made.
For studies in which a known set of genes is being evaluated, ratios that are in a higher
range (20 to 40) can be tolerated. In cases where the FFPE samples are being used to
discover gene sets, to maximize the success and enable discovery of the maximum number
of genes, samples with lower ratios (=20) are optimal.
NOTE: MDS Analytical Technologies does not have a strict cut-off for ratios from which no
data will be obtained. As individual studies will have different tolerance levels, MDS
Analytical Technologies recommends running a few samples with a variety of ratios to
determine where the cut-off should be for a specific study.
It is also important to remember that in addition to the ratio, the overall quantity
reported for the 3' Primer Set can be helpful in determining the quality of the sample. If a
ratio of <10 is reported, but the quantity for that sample is <5 pg, there is likely not
enough RNA in the sample to produce a quality result in a subsequent assay. The quantity
reported can serve as a guide for determining how much of the original sample should be
used to meet the input requirements for further sample processing.
70
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
C. Amino-Allyl aRNA Labeling
This protocol is intended for use with amino-allyl modified aRNA which was generated
using the optional Amino-Allyl IVT components of RA7010 and RA7012.
Table C.1: Amino-allyl aRNA Labeling Purification - RA7012
Component
Vial Color
Vial Label
RNA Binding Buffer
Blue
RB
RNA Wash Buffer
Blue
RW
RNA Elution Buffer
Blue
RE
0.5 mL Microcentrifuge Tubes
Purification columns
Table C.2: Fluorescent dyes (not supplied with the kit)
Reagent
Maker
Catalog #
Cy3 mono reactive dye
Amersham
PA23001
Cy5 mono reactive dye
Amersham
PA25001
Alexa Fluor 647 reactive dye
Molecular Probes
A-32756
Molecular Probes
A-32757
decapacks for microarrays
Alexa Fluor555 reactive dye
decapacks for microarrays
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
71
C. Amino-Allyl aRNA Labeling
Protocol
Labeling Reaction:
Re-suspend 1mg monoreactive dye in 51 μL of DMSO. Save unused vials in the dark at
2–6ºC.
Figure C.1: DMSO
1
Take 15 μg of amino-allyl aRNA in 7.5 μL of nuclease free water.
NOTE: Sample should be maintained on a cold block.
2
Add 2.5 μL of Labeling Buffer (LB) to the sample.
Figure C.2: Labeling Buffer
3
Add 10 μL of the re-suspended dye into 10 μL of the sample.
4
Mix thoroughly by flicking the tube. Spin down briefly.
5
Incubate at room temperature in the dark for 1 hour.
6
Proceed directly to purification of labeled aRNA.
aRNA Purification:
72
1
Pre-treat column by adding 250 μL of RNA Binding Buffer (RB) to a new
purification column. Incubate the column at room temperature for 5 minutes.
Centrifuge at 16,000 x g for one minute.
2
Add 225 μL of RB to the transcript labeling reaction sample and mix thoroughly.
Pipette the entire sample volume into the purification column.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Figure C.3: RNA Binding Buffer
3
Centrifuge at 100 x g (or lowest speed setting available) for 2 minutes, immediately
followed by a centrifugation at 10,000 x g for 1 minute.
NOTE: Do not use re-suspended dye that is over 2 days old. DMSO is hygroscopic.
Store tightly capped.
NOTE: To obtain 15 μg of aRNA in 7.5μL, you may dry down 15μg of aRNA and resuspend in 7.5 μL of nuclease free water, or concentrate the aRNA to 2 μg /μL and use
7.5 μL of the sample.
NOTE: Do not allow the samples to incubate longer than 1 hour. Use reagents supplied
in the Labeling Purification Reagents box.
4
Discard flow-through. Place the column into the same collection tube.
5
Add 250 μL of RNA Wash Buffer (RW) to the purification column and centrifuge at
10,000 x g for 1 minute.
Figure C.4: RNA Wash Buffer
6
Repeat Step 5.
7
Add 250 μL of fresh RW to the column and centrifuge at 16,000 x g (full speed) for 2
minutes. Check the purification column for any residual wash buffer. If any wash
buffer remains, re-centrifuge at 16,000 x g for one minute.
8
Discard the collection tube and flow-through.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
73
C. Amino-Allyl aRNA Labeling
9
Place the purification column into a new 0.5 mL microcentrifuge tube provided in
the kit and carefully add 50 μL of RNA Elution Buffer (RE) directly onto the center
of the purification column membrane. Gently touch the tip of the pipette to the
surface of the membrane while dispensing RE to ensure maximum absorption of RE
into the membrane. Gently tap the purification column to distribute the buffer if
necessary.
Figure C.5: RNA Elution Buffer
10 Incubate at room temperature for one minute.
11 Place the assembly into the 2 mL support tube in the rotor with the 0.5 mL tube cap
trailing the tube.
12 Centrifuge at 1000 x g for one minute, immediately followed by 16,000 x g for one
minute. Discard the purification column and retain the elution containing the labeled
aRNA.
Figure C.6: Centrifuge.
13 Measure the O.D. of the product at A260, A280, and A550/A650 to determine the
yield and frequency of incorporation (FOI) by making a dilution of 1:10 (5 μL
sample + 45 μL nuclease free water).
14 Store any remaining samples at –70ºC until ready for hybridization.
74
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
D. aRNA Analysis
D.1.
RNA QUANTITATION USING SPECTRAMAX®
MICROPLATE READERS WITH ABSORBANCE MODE AND
PATHCHECK® SENSOR
Introduction
This protocol describes how to measure RNA concentration using a 96-well, UV-clear
microplate (e.g., Corning P/N 3635) and SpectraMax® microplate reader featuring the
PathCheck® sensor. The PathCheck sensor measures the pathlength in each well of the
microplate and normalizes absorbance values to a 1 cm pathlength so that they are the
same as values obtained in a 1 cm cuvette. Please note that some SpectraMax microplate
readers are equipped with a cuvette port. See the user guide for your instrument for details
on use of the cuvette port.
Method
Dilute RNA in RNase-free water. A total of 200 μL/well of diluted RNA will be used for
quantitation, and diluting the sample more than 1:100 is not recommended. Prepare
additional diluted sample if multiple wells are desired for analysis. Reading samples in
triplicate is recommended. Pipette samples into a 96-well UV-transparent microplate;
include a set of wells containing 200 μL of RNase-free water as blanks. Assuming that all
well volumes are identical, and that all samples are blanked with the same solution
(water), use the following method to subtract background OD due to the microplate
itself:
1
In the template editor, select three or more wells in the microplate to contain the
blanking solution (typically water). Assign the appropriate wells as 'Blank'. Designate
the appropriate wells as 'Samples', and enter the dilution factor.
2
In the instrument settings dialogue box, make sure that the box for PathCheck is
checked, the Water Constant button is on, and the box for Plate Background
Constant is not checked.
3
Pipette blanks and RNA samples into the appropriate wells of the microplate.
4
Read the plate.
When the plate is read as indicated, SoftMax Pro automatically applies PathCheck to all
samples and blanks and also subtracts the average of the blanks from each well of the
microplate. Provided that all sample and blank path lengths are identical, potential error
from applying path length normalization to ODmicroplate is cancelled out.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
75
D. aRNA Analysis
Table D.1: SpectraMax® microplate reader settings for RNA quantitation. Other
instrument settings not listed here should be left on the default values.
Read Mode
Absorbance
Wavelengths
Lm1: 260 nm
Lm2: 280 nm
PathCheck
‘PathCheck’ box is checked
‘Water Constant’ button is checked
‘Plate background constants’ box is not checked
D.2.
Assay Plate Type
96 Well Standard clrbtm
Wells To Read (or Strips)
Highlight wells to be read
aRNA YIELD AND PURITY DETERMINATION
aRNA quantitation by ultraviolet light absorbance is the simplest approach to
determining amplification yield. An absorbance reading at 260 nm (A260) using a
spectrophotometer is taken on a diluted aliquot of aRNA. Typically, a 1:25 to 1:50
dilution of aRNA in nuclease free water is sufficient.
For single-stranded RNA, a measurement of A260 = 1.0 corresponds to 40 μg/mL. The
yield can by calculated by:
(A260) (dilution factor) (40) = μg/mL RNA
Measuring A280 and calculating the A260/A280 ratio indicates the purity of the RNA
sample. An A260/A280 ratio between 2.0 – 2.6 indicates very pure aRNA.
D.3.
ASSESSMENT OF RNA QUALITY USING THE AGILENT
BIOANALYZER
The Agilent Lab-on-a-Chip system provides a fast and effective approach to assessing the
integrity of an aRNA sample. The system requires very small quantity of sample. Refer to
the Agilent 2100 bioanalyzer and RNA LabChip Kit Instruction Manuals for details.
Equipment and Materials Required
Agilent 2100 bioanalyzer System (Agilent) RNA 6000 Nano Assay Kit (Agilent) Ice or
cold block (4-8°C) Spectrophotometer Before you begin, refer to the instruction manual
for the RNA 6000 Nano Assay Kit. Prepare necessary reagents and supplies as required by
the kit.
Use RNase-free technique. Wipe all surfaces and equipment with RNase decontamination
solution, use RNase-free solutions and plastic ware, and wear disposable gloves.
76
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
D.4. Analysis of aRNA by Agarose Gel Electrophoresis
Protocol
1
Determine the concentration of the aRNA generated through Paradise Plus by UV
spectrophotometry.
2
Based on the optical density reading, prepare a dilution of the sample to a
concentration of 200 – 300 ng/μL.
3
Store the sample on ice or in a cold block until ready to load on to the RNA chip.
4
Follow the RNA 6000 Nano Assay Kit protocol, loading 1 μL of the prepared sample
dilution (from step 2).
For details of data interpretation refer to the bioanalyzer instruction manual. The aRNA
appears on the bioanalyzer as a single, broad peak. The size of the aRNA ranges in length
from 200 to 2000 bases.
D.4.
ANALYSIS OF aRNA BY AGAROSE GEL
ELECTROPHORESIS
Analysis of aRNA using agarose gel electrophoresis is one method to visualize the RNA
profile and relative quantity after amplification. Standard protocols for agarose gel
electrophoresis can be used. The following is a suggested protocol using commercially
available reagents.
Materials
>
1.25% Agarose Portrait Gel or 1.25 Agarose Medium Gel
>
(EmbiTec cat. # GE-6010 or GE-6030)
>
10X RNA MOPS Running Buffer
>
(EmbiTec cat. # EC-1020) 2X Gel Loading Buffer (various) RNA Ladder (various)
SYBR Gold Nucleic Acid Gel Stain (Molecular Probes cat. # S-11494) or Ethidium
Bromide Stain
>
Nuclease-free Water
Protocol
1
Determine the concentration of the aRNA by UV absorbance with a
spectrophotometer. (Refer to Appendix A.)
2
Dilute the aRNA sample(s) with nuclease-free water. Each gel well can be loaded with
1 – 3 μg of aRNA.
3
Prepare aRNA gel sample by mixing 6 μL of diluted aRNA with 6 μL of 2X Gel
Loading Buffer.
4
Incubate for 3 – 5 minutes at 65°C. Cool on ice.
5
Prepare 1X RNA MOPS Running Buffer and fill gel electrophoresis unit. Place
agarose gel into the unit.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
77
D. aRNA Analysis
78
6
Load 12 μL of sample per well of the agarose gel. Include RNA Ladder in one or more
lanes.
7
Electrophorese at 5 – 7 volts per centimeter for 30 minutes.
8
Stain the gel with SYBR Gold Nucleic Acid Gel Stain for 30 minutes or according to
the protocol supplied with the reagent. Alternatively, stain with Ethidium Bromide
(0.5 – 1.0 μg/mL).
9
Visualize the gel on a UV transilluminator. The size of the aRNA ranges from 200 to
2000 bases in length.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
E. Generation of Labeled aRNA
Using Alternative IVT Kits
The Paradise Plus Kits can be used with alternative IVT labeling (such as Affymetrix
labeling kit 900449) to yield suitable RNA sample for hybridizing to GeneChip Probe
Arrays as described below. These kit reagents and protocol are substituted during the
second IVT reaction of the Paradise Plus Kit protocol. Labeled aRNA is subsequently
purified with the Paradise Plus Kit and MiraCol Purification Columns as described below.
1
Perform Round One of amplification according to the Paradise Plus Amplification Kit
protocol starting from the recommended input for the kit. It is not recommended to
use the minimum input amounts when using an alternative labeling kit due to IVT
efficiency.
2
Perform Round Two of amplification through cDNA Purification according to the
Kit protocol. (Stop at the end of Chapter 5, Section 3, Step H – “Round Two: cDNA
Purification)
3
Perform RNA transcript labeling according to the protocol of the IVT labeling kit
using the sample (from step #2 above) as the cDNA template. Adjust the final volume
of the cDNA sample, as necessary.
Antisense RNA Purification:
NOTE: Use the remaining components from RA7011 used during the amplification
process.
1
Add 250 μL of RNA Binding Buffer (RB) to a new purification column and incubate
for five minutes at room temperature. Centrifuge at 16,000 x g for one minute.
Figure E.1: RNA Binding Buffer
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
79
E. Generation of Labeled aRNA Using Alternative IVT Kits
2
Add 200 μL of RB to the Transcript Labeling Reaction sample and mix thoroughly.
Pipette the entire sample volume into the purification column.
3
Centrifuge at 100 x g (or lowest speed setting available) for two minutes, immediately
followed by a centrifugation at 10,000 x g for 1 minute.
4
Add 200 μL of RNA Wash Buffer (RW) to the purification column and centrifuge at
10,000 x g for one minute.
Figure E.2: Figure A.10: RNA Wash Buffer
NOTE: RNA Binding Buffer (RB) must be at room temperature and thoroughly mixed
before use. A precipitate may form during long-term storage. Dissolve precipitate by
mixing. If necessary, warm the RB vial to re-dissolve.
5
Add 200 μL of fresh RW to the column and centrifuge at 16,000 x g for two minutes.
Check the purification column for any residual wash buffer. If any wash buffer
remains, re-centrifuge at 16,000 x g for one minute.
6
Discard the collection tube and flow-through.
7
Place the purification column into a new 0.5 mL microcentrifuge tube provided in
the kit and carefully add 30 μL of RNA Elution Buffer (RE) directly onto the center
of the purification column membrane. Gently touch the tip of the pipette to the
surface of the membrane while dispensing RE to ensure maximum absorption of RE
into the membrane. Gently tap the purification column to distribute the buffer, if
necessary.
Figure E.3: Figure A.11: RNA Elution Buffer
8
80
Incubate at room temperature for one minute.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
9
Place the assembly into the 2 mL support tube in the rotor with the 0.5 mL tube cap
trailing the tube.
10 Centrifuge at 1,000 x g for one minute, immediately followed by 16,000 x g for one
minute. Discard the purification column and retain the elution containing the labeled
aRNA.
Figure E.4: Centrifuge.
11 Measure the O.D. of the product at A260 and A280 to determine the yield of labeled
aRNA. Perform electrophoretic analysis, if necessary.
12 Proceed to protocols for microarray hybridization.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
81
E. Generation of Labeled aRNA Using Alternative IVT Kits
82
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
F. Cleaning the Staining Jars
The staining jars can be reused, but must be cleaned. Rinse jars with 100% ethanol,
followed by distilled water, then treat with RNase AWAY according to the manufacturer’s
protocol. Rinse jars thoroughly with nuclease-free water and allow to dry completely in
the hood. Do not use reservoirs to store solutions.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
83
F. Cleaning the Staining Jars
84
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
G. Centrifuge Information
The table below shows corresponding centrifugal forces (g) for selected rotations per
minute (rpm) when working with the tabletop microcentrifuge Eppendorf 5415D.
Table G.1: Centrifugal Forces (g)
Rotations Per Minute (rpm)
Centrifugal Force (g)
14,000
13,000
12,000
10,000
10,000
7,000
8,000
4,500
5,500
2,200
5,000
2,000
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
85
G. Centrifuge Information
86
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
H. Troubleshooting
H.1.
STAINING
Symptom
Targeted cells do not
lift from the slide
Cause
Suggestion
The sample may contain
Ensure that the ethanol solutions
residual water.
are fresh. Ethanol is hygroscopic.
during LCM
Keep the ethanol bottles tightly
capped, and do not pour ethanol
solutions until you are ready to use
them. If you suspect that the 100%
ethanol solution has absorbed
water, discard and use a new bottle.
The sample may have
Carry out the Staining and
dried in between protocol
Dehydration segment of the
steps.
protocol at a steady pace.
RNA cannot be
The sample starting
Run a quality control assesmnet
recovered from the
material may contain
(detailed in this protocol) on the
poor quality RNA.
tissue block to ensure it contains
sample
useable quality RNA.
RNA may become
Wear gloves; use RNase-free
degraded during RNA
technique and RNase-free
isolation.
instruments and reagents.
RNA may not be fully
Perform RNA extraction
extracted and isolated
immediately after LCM to ensure
from cells on the LCM
complete extraction and optimum
cap.
recovery of RNA.
Amount of starting
Capture more cells. Amount of RNA
material may be
in each cell may vary depending on
insufficient.
cell type, RNA quality and length of
fixation. For troubleshooting
purposes, try starting with ~40,000
cells.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
87
H. Troubleshooting
H.2.
EXTRACTION AND ISOLATION
Symptom
Isolated RNA is of
Poor Quality
Cause
Suggestion
Source tissue is of
Verify quality of source tissue of LCM cells.
compromised quality
The greatest factor affecting the quality of
isolated RNA is the integrity of the RNA in
the original tissue sample. RNA degradation
due to RNase activity occurs rapidly,
especially upon tissue removal such as
through biopsy and needle aspiration. For
suggestions on verifying quality, please call
Technical Support.
RNA degradation during
Use the Paradise® Plus Reagent System
staining process
Staining components to prepare slides for
LCM. Specialized staining protocols and
reagents are required for optimal RNA
preservation in LCM samples. MDS
Analytical Technologies has developed and
validated the Paradise Plus Reagent System
Staining components for preparing and
staining tissues for LCM while maintaining
RNA integrity.
RNA degradation during
Perform LCM immediately after preparing
LCM
LCM slides. LCM sample slides are
dehydrated in the final step of preparation
so RNase activity is minimized. However,
the risk of moisture and RNases entering
the sample following preparation increases
with the amount of time between slide
preparation and RNA isolation.
RNA quality
Use FFPE sections that are within 2 weeks
compromised during
of cutting. Extended storage of sections
slide storage
after being cut from blocks may result in
RNA degradation.
RNA Yield is Low
RNA integrity has been
Verify quality of initial tissue sample or LCM
compromised.
slide (see A.1). Poor quality RNA may not
bind effectively to the purification column
membrane, decreasing overall RNA yield.
88
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
H.3. Amplification
H.3.
AMPLIFICATION
Symptom
Cause
Suggestion
Amplification
yield is Poor
Starting RNA sample quality
varies
If you observe low yields with different RNA
samples, run an amplification control using the
Control RNA provided in the Paradise® Plus Kit to
verify kit functionality.
Starting RNA sample quality
has been compromised.
The greatest factor affecting amplification
efficiency is the integrity of the RNA used in the
Paradise Plus amplification process. Suspend RNA
in nuclease-free water prior to amplification. Avoid
using organic solvents such as phenol in RNA
isolation protocols.
There is no RNA in the input
sample.
Run a control RNA sample with a known quantity
of RNA to ensure that amplification is successful.
Reagent concentrations in
reaction mixtures are
incorrect due to inadequate
thawing or mixing.
Ensure all reagents are completely thawed, mixed,
and all solids dissolved prior to use.
Reagent concentrations in
the reaction mixtures are
incorrect due to inadequate
reaction volume collection in
the reaction tube.
Thoroughly thaw and mix all reagents prior to
dispensing. Ensure all reagents are dispensed at
proper volumes. Briefly spin down the reaction mix
prior to incubation to ensure all reagents are
collected in the reaction volume and the reaction
mix has the proper concentrations of reagents.
Reagent concentrations in
reaction mixtures are
incorrect due to evaporative
condensation onto the wall
of the reaction tube during
incubation.
Briefly spin down the sample following incubation
steps to maintain proper volumes and
concentrations of reagents and ensure that all
nucleic acid templates are mixed with reaction
components. Use a thermal cycler with a heated
lid.
Incubation temperatures are
incorrect.
Verify the accuracy of all incubation temperatures.
If you are using a thermal cycler, make sure that the
programmed temperatures read correctly and the
instrument has been calibrated to establish and
maintain accurate temperature settings.
RNA yield is diminished
during column purification.
Verify centrifugal force used during nucleic acid
purification. Improper binding, washing, and
elution centrifugal forces can decrease the
recovery of nucleic acid from the purification
column. Microcentrifuges should be calibrated to
deliver the correct centrifugal force.
Message content is low
within the total RNA being
used in your study.
Check amplification efficiency using control RNA.
Use higher RNA inputs to compensate for lower
message content.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
89
H. Troubleshooting
Symptom
Cause
Suggestion
Low Molecular
Occasionally, a predominant band below the expected aRNA smear will appear on a
Weight Product
gel. This band will lead to improper estimation of yield and may result in high
Appears on a
Gel
backgrounds on microarrays. The Paradise Plus Kit components are formulated and
tested to avoid the synthesis of this material. However, if low molecular weight
material is present, one of the following may be occurring:
Quality of the starting RNA is
Poor RNA quality can lead to the formation of the
inadequate.
reaction artifact, visible as a low molecular weight
band. Check the quality of your input RNA. One
approach is to utilize the Agilent Bioanalyzer
System with an RNA LabChip Kit. For additional
recommendations to check for the quality of the
input RNA, contact Technical Support.
Concentrations of Primer 1,
Thaw and thoroughly mix each reagent vial prior to
Primer 2, Primer 3, or 1st
dispensing. If incompletely thawed and mixed, the
Strand Nuclease Mix are
concentrations of these reagents may not be
incorrect due to inadequate
dispensed at optimal concentrations for the
thawing or dispensing.
reaction. Ensure that all pipettes are properly
calibrated to dispense correct volumes.
Concentrations of Primer 1,
Primer 2, Primer 3, or 1
st
Thoroughly mix and spin down the sample after
adding the primers or 1st Strand Nuclease Mix into
Strand Nuclease Mix are
the reaction mix and prior to incubation. This
incorrect due to inadequate
ensures the correct concentration of primers or
mixing or reaction volume
nuclease in each respective reaction mix.
collection inside the reaction
tube.
Input RNA was not isolated
®
90
Low molecular weight material may result from
using the PicoPure RNA
lack of RNA and carrier. Using the Paradise Plus
Isolation Kit and no nucleic
Isolation Kit is recommended to prepare formalin
acid carrier was added.
fixed samples.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
H.4. Quality Assessment Protocol
H.4.
QUALITY ASSESSMENT PROTOCOL
Symptom
Cause
Suggestion
Tissue homogenate
is viscous and
difficult to pipet,
resulting in low RNA
yield
There was insufficient
disruption or lysis of cells.
Limit the extraction to 1 mm2 of tissue
scrape per 1 μL of PK solution:
• Use a minimum of 25 mm2 of tissue
area in 25 μL of PK solution per
extraction.
• Do not use over 150 μL of PK
solution per sample for isolation.
• For >150 μL of PK solution, perform
multiple isolations.
Rn = No template
Control Rn, and there
is no amplification
plot
Rn = No Template
Control Rn, and both
reactions show an
amplification plot
Inappropriate reaction
conditions.
Optimize QRT-PCR with positive
controls to monitor the QRT-PCR
performance.
Poor quality PCR
mastermix.
Contact the vendor/supplier of the PCR
master mix.
Incorrect dye
components were
chosen.
Check dye component prior to data
analysis.
The reaction component
was omitted.
Check that all the correct reagents
were added.
Incorrect primer or probe
sequence.
Verify primer and probe sequences. If
necessary, re-synthesize with the
appropriate sequence.
PCR is not optimized.
Optimize PCR with cDNA standard
curves to obtain a slope of –3.1 to –3.7
when plotting CT against the
concentration of cDNA.
Degraded template or no
template added.
Repeat the extraction and RT reaction
with fresh template.
Reaction inhibitor
present.
Repeat with purified template.
Contamination of
reagents or work area.
Check technique and equipment to
confine contamination. Repeat the
reaction with fresh reagents. Run
negative controls along with the
samples to monitor template
contamination.
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
91
H. Troubleshooting
92
Paradise®Plus Reagent System User Guide — 12872-00 Rev. C
Download PDF