1901-01 RC Manual

1901-01 RC Manual
Idaho
Technology Inc.
The RapidCycler®
Vent
Capillary
Tube
Modules
Keypad
Display
Screen
Note: This illustration is optimized for printing.
SETTING UP
PROGRAMMING
Introduction ..........................................................................................................................1
SAMPLE
HANDLING
Contents
Setting Up the RapidCycler ................................................................................................3
Programming .................................................................................................................... 21
Service and Maintenance ................................................................................................38
SERVICE AND
MAINTENANCE
Trouble-Shooting ................................................................................................................34
TROUBLE
SHOOTING
Sample Handling ................................................................................................................ 4
Warranty and Upgrades .................................................................................................. 46
RapidCyclist Newsletter ....................................................................................................76
Index
RAPIDCYCLIST
NEWSLETTER
Rapid cycle DNA amplification:
time and temperature optimization .................................................................. 63
ARTICLES
Minimizing the time required
for DNA amplification by efficient heat transfer
to small samples .................................................................................................. 54
WARRANTY
AND UPGRADES
Articles ................................................................................................................................47
Automated polymerase
chain reaction in capillary tubes
with hot air ............................................................................................................ 48
................................................................................................................................76
INDEX
Introduction
The RapidCycler® is a rapid temperature cycling system based on heat transfer by hot air to samples contained in thin capillary tubes. For most reactions,
products can easily be visualized with ethidium bromide on agarose gels after a
total reaction time of 15-30 minutes. The rapid temperature response of this instrument can improve product specificity significantly while decreasing the required
reaction time by up to an order of magnitude.
Average temperature transition rates in most instruments are commonly
about 1° C/sec when metal blocks or water are used for thermal equilibration
and samples are contained in plastic microfuge tubes. A significant fraction of
the cycle time is spent heating and cooling the sample, as opposed to being
spent at optimal temperatures. Long reaction times of 2-6 hours are common,
and slow transition rates make it difficult to determine optimal temperatures and
times for each stage of the cyclic reactions. Instantaneous temperature changes
are not possible because of sample, container and cycler heat capacities.
"Second generation" instrumentation can complete 30-cycles in about one hour.
It is unlikely any instrument based on samples contained in conical tubes with
heating and cooling through a metal block can achieve faster cycles at any
price. However, with capillary tubes and air heating, transition rates of 510°C/sec are easily obtained. Complete 30-cycle reactions can be finished in as
little as 10 min. Biochemical reactions are fast. The RapidCycler is the first instrument engineered to match this speed.
The advantages of an air-cycling system include simplicity, low cost, and
rapid temperature cycling. Air is an ideal heat transfer medium which can
change temperature quickly because of its low density. Temperature homogeneity problems are solved by rapidly mixing air with a fan to provide homogeneous temperature exposure over the sample containers. The sample container
is just as important as the heat transfer medium. An optimal sample container
should be water-vapor tight and have:
1
(i) low thermal mass,
(ii) good thermal conductivity,
(iii) minimal internal condensation,
(iv) easy sample recovery without cross contamination,
(v) No adverse effects on the reaction.
Whatever the container material, temperature equilibration will always be
achieved faster if the sample volume is small, if the container wall is thin, and if
the surface-to-volume ratio of the sample exposed to the container wall is high.
Problems with condensation can be reduced by minimizing the free air space
surrounding the sample.
Microfuge tubes are kept water-vapor tight by mechanical closure and, if
necessary, overlaid mineral oil. Thermal conductivity is poor because of the
material and its thickness (about 1 mm). Internal condensation can occur if mineral oil is not used and particularly if different parts of the tube are at different
temperatures. Sample mixing by convection has been used in conical tube
instruments. The temperature gradients that cause convection are not a good
idea for a temperature-dependent reaction.
Capillary tubes are kept vapor tight by flame closure of the ends. They conduct heat to the sample better than microfuge tubes because of decreased wall
thickness (ca. 0.2 mm) and a better surface-to-volume ratio. Dead air space is
minimized to prevent significant condensation. Different volumes of a sample
can be placed in the same diameter capillary tube so that rapid heat transfer is
maintained.
After amplification, the ends of the glass capillaries can be quickly scored
with a file and snapped off with less risk of aerosolization and contamination than
microcentrifuge tubes. The capillary tubes serve both as a transfer pipette and
container for temperature cycling. The reaction product, already containing
Ficoll and Sucrose, an electrophoresis indicator dye can be directly emptied into
a gel well without exposure to an intermediate pipette tip or to extraction procedures.
Decreasing the heat capacity of the cycling system can markedly decrease
the total time required for reactions that require temperature cycling. In addition,
air cycling and miniaturization can significantly decrease the costs of reagents
and the personnel time required to optimize reactions.
2
SETTING UP
Setting up the
RapidCycler
A
STORING YOUR RAPIDCYCLER
In choosing a location to set up your RapidCycler, remember that it uses
room air for cooling. Keep the RapidCycler open on all four sides to allow air to
flow into the air intake beneath the machine. Also, do not set the RapidCycler on
any material which may be sucked into or cover the intake.
NOTE: Lab bench paper is particularly effective at blocking the air intake.
Heated air (up to 90°C) is expelled from the top rear of the RapidCycler, so
it is important that the exhaust area be kept clear to avoid restricting the airflow
through the RapidCycler. Be especially careful to keep the exhaust area clear
of anything that could be damaged by heat especially volatile organic solvents.
B
PROTECTING YOUR RAPIDCYCLER
Plug the power cord into the RapidCycler and into a grounded surge
suppressor. The RapidCycler, like all microprocessor controlled equipment, is sensitive to damaging power fluctuations.
3
SAMPLE
HANDLING
SETTING UP
Sample Handling
PROGRAMMING
TROUBLE
SHOOTING
The RapidCycler is the only instrument which can approach the kinetic limits
of amplification reactions. The high surface area to volume ratio of capillary
tubes and the use of air as the cycling medium makes the RapidCycler the
fastest thermal cycler in the world. This comes at the cost of non-standard sample handling techniques.
SERVICE AND
MAINTENANCE
Sometimes it may not be necessary to have the highest possible reaction
specificity. In this case it may be more convenient to use thin-walled microcentrifuge tubes. While much slower, these allow the use of standard reagents and
protocols. Following are instructions for rapidcycling with (A) GLASS CAPILLARY
TUBES and (B) THIN-WALLED MICROCENTRIFUGE TUBES, and (C) CAPILLARY TUBE
HANDLING WITH THE RAPIDCYCLER.
WARRANTY
AND UPGRADES
A
RAPIDCYCLING WITH
GLASS CAPILLARY TUBES
ARTICLES
Using a capillary based air cycler is different from using a heat block
instrument. Samples must be prepared, loaded into the capillary tubes, sealed,
and after the reaction is complete, analyzed. Following are instructions for sample preparation, loading and sealing samples into capillary tubes, cycling and
after cycling sample handling.
NOTE: Detailed instructions for the preparation of buffers and optimizing protocols
can be found in the Rapidcyclist Newsletters section of this manual.
RAPIDCYCLIST
NEWSLETTER
INDEX
4
SETTING UP
1. SAMPLE PREPARATION
3. Use one of the 10X buffers included in the Optimizer kit from Idaho
Technology that already contains BSA. These buffers are optimized for rapid
cycling and include 10, 12, 30, 40 or 50 Mg++ buffers.
To prepare individual samples, first distribute DNA, primers, or which ever element is unique to each sample into a row of individual wells of the microtiter
INDEX
5
RAPIDCYCLIST
NEWSLETTER
To simplify preparation of multiple samples, we suggest making a master mix
containing all solutions common to the samples you intend to run in one well of
a microtiter plate with U-shaped wells. If you are not using the buffer/BSA supplied by Idaho Technology, make sure BSA is added to the master mix before the
enzyme to avoid possible absorption of enzyme to the surface. Alternately, use
enzyme diluent to make a 10X enzyme solution that already contains BSA.
ARTICLES
2. PREPARING MULTIPLE SAMPLES
WARRANTY
AND UPGRADES
If a plasmid is your source of template, cutting the plasmid with a restriction
enzyme may increase yield, although it is usually not necessary.
SERVICE AND
MAINTENANCE
If your reaction involves primer extension, briefly denature template nucleic
acid before rapid cycling is begun. We recommend linking a preliminary 15-30
sec. hold at 94° C to your rapid cycle program. Prolonged exposure of template
to high temperatures is not recommended, especially when long products are
desired, because of the possibility of strand breakage. Only partial renaturation
occurs on cooling, allowing rapid denaturation to occur during cycling.
TROUBLE
SHOOTING
2. Dilute your concentrated enzyme stock to a 10X enzyme solution with an
enzyme diluent containing BSA (10 mM Tris, pH 8.0, 2.5 mg/ml BSA). You can
make the diluent yourself or it is included in the Optimizer kit from Idaho
Technology.
PROGRAMMING
1. Add 10X BSA (2.5 mg/ml) to your master mix. You can either make the solution yourself, or it is included in the Optimizer Kit from Idaho Technology.
SAMPLE
HANDLING
All reactions in glass capillary tubes must contain 250-500 ug/ml bovine
serum albumin to prevent surface denaturation of the enzyme. The same high
surface-area-to-volume ratio that allows rapid temperature cycling also provides
many sites for enzyme inactivation. We recommend three alternatives for adding
adequate BSA to your reaction:
SAMPLE
HANDLING
SETTING UP
plate. Then transfer the appropriate volume of master mix and aspirate several
times with the pipette tip to ensure complete mixing. It is helpful to use a set of
colored markers to keep track of your samples. A color code can be used both
on the rim of the microtiter plate wells and on the upper portion of the capillary
tube as colored bands.
PROGRAMMING
Rapid air cycling is optimized for 10 µl samples. Larger samples (25 and 50 µl)
can be used but require 10-15 second hold times, which compromise cycling
and reaction time.
Larger volumes can be prepared and cycled with no loss of cycling speed by
simply loading the solution into several 10 µl capillary tubes at once. As the liquid wicks up into multiple tubes it distributes itself evenly between the tubes.
TROUBLE
SHOOTING
3. LOADING AND SEALING SAMPLES INTO CAPILLARY TUBES
SERVICE AND
MAINTENANCE
After the samples have been mixed in individual wells of a microtiter plate,
they can be loaded into capillary tubes either singly or using the capillary rack
module. To load a single sample, simply insert a capillary tube into the microtiter
well containing the sample. Capillary action will draw the sample into the tube.
Run the capillary tip along the bottom of the microtiter well to ensure the entire
volume is drawn up into the tube.
WARRANTY
AND UPGRADES
It is helpful to hold the microtiter plate in one hand and the capillary tube in
the other. Tilting the microtiter plate will ensure complete transfer into the capillary tube.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
Once loaded, the position of the sample in the tube can be shifted by tilting
the tube. Adjust the sample so that it is roughly centered in the capillary tube.
Using a lighter, candle, or regular labora- Figure 1.
tory burner, flame seal Seal extreme tip of
capillary tube in outer
both ends of the cap- most portion of the
illary tube. (Fig. 1) flame. If the tube is
Only a few seconds of heated too much or
heating the extreme inserted too far into
the flame, it will sag
tip of the capillary is and deform.
necessary. This will
take some practice
initially, but becomes
simple with repetition.
With careful observa-
INDEX
6
RAPIDCYCLIST
NEWSLETTER
INDEX
7
ARTICLES
The modules can then be placed back into the machine and cycled. Care
must be taken with the capillary tubes when reinserting the module into the
machine. Before running, make certain that all three modules are completely
seated into the instrument top.
WARRANTY
AND UPGRADES
Seal the tubes individually, tipping the module to adjust the liquid level. We
suggest starting with 8 tubes at a time to gain experience handling and sealing
the capillary tubes.
SERVICE AND
MAINTENANCE
Prepare samples in two rows of a microtiter plate. Then lower the capillary
tips into the wells and run them around the bottom of the wells to ensure that all
the liquid has been drawn up into the tubes.
TROUBLE
SHOOTING
For ease of handling, the modules may be removed from the instrument top.
Up to sixteen capillary tubes may be inserted into the modules. After the capillary
tubes are in place, align the tubes by pressing against a clean flat surface.
PROGRAMMING
Preparing
samples using the 16place capillary tube
module (Fig. 2), is similar to preparing tubes
i n d i v i d u a l l y .
However, since the
spacing of the holes
in the modules are
the same as the spacing of microtiter wells,
up to sixteen samples Figure 2. Capillary tube module.
can be aspirated
simultaneously. The modules also greatly simplify the ordering and labeling of the
capillary tubes.
SAMPLE
HANDLING
After the tubes are sealed, insert them into the holes in the capillary modules
located in the instrument top. Push the tubes gently downward until they lightly
touch the padded chamber bottom. This will place the sample column completely into the air chamber. Then program and operate the cycler as detailed
in section 4, Programming.
SETTING UP
tion, the capillary tip appears to "clear up" at the instant of closure. If sealing is
not complete, the sample will evaporate during cycling.
SETTING UP
SAMPLE
HANDLING
4. Cycling
PROGRAMMING
For information on how to enter and run a program see Section 4,
Programming. The choice of cycling protocols depends on many factors. Use the
tables to adjust temperatures and times when using 25 or 50 µl capillary tubes.
Keep in mind that the RapidCycler is optimized for use with 10 µl capillary tubes.
The larger 25 or 50 µl tubes require hold times of 10 and 15 seconds at each temperature to allow the sample enough time to come to temperature.
A listing of common cycling protocols for 10, 25, and 50 µl tubes can be found
in the Programming section of this manual. See: PREPROGRAMMED RAPIDCYCLER CYCLE PROTOCOLS 51-99, cycles 51-61.
TROUBLE
SHOOTING
5. After Cycling
SERVICE AND
MAINTENANCE
After cycling is complete, remove the modules from the instrument and
remove tubes. If desired, the modules may be left in place and the tubes
removed directly. Verify that no fluid has evaporated from the tubes. If sample
has evaporated, the tubes were not completely sealed.
Score the tubes approximately 1 cm from each end using the sapphire cutter supplied. One small stroke with the cutter is sufficient to score the glass.
Holding the tube horizontally, gently snap off scored ends.
WARRANTY
AND UPGRADES
Next, insert the capillary tube into the white silicone tip of the microaspirator/dispenser approximately 2 cm. While inserting capillary tube into microaspirator/ dispenser you will notice the sample tends to be pushed out of the tube
because of back pressure. This requires the user to turn the black knob on the dispenser counterclockwise to prevent the sample from being pushed out of the
capillary tube as it is being inserted into the silicon tip.
ARTICLES
The user may now dispense the amplified sample from the capillary tube by
inserting the capillary tip directly into a gel well and slowly turning the microaspirator/ dispenser knob clockwise to dispense the sample.
RAPIDCYCLIST
NEWSLETTER
NOTE: With extensive use the silicon tip of the microaspirator/dispenser will lose
its seat and need to be replaced.
INDEX
8
SETTING UP
SAMPLE
HANDLING
B
Use of Thin Walled Microcentrifuge
Tubes with the RapidCycler
1. Introduction
PROGRAMMING
TROUBLE
SHOOTING
The development of thin walled micro test tubes makes it possible to combine the speed of the air cycling with the convenience of that “universal vessel”
of molecular biology, the microcentrifuge tube. While the RapidCycler was
developed for use with glass capillaries, it provides excellent results with thin
walled microcentrifuge tubes. Using modified sample modules, the RapidCycler
can hold up to 48 micro test tubes Figure 1 shows that all 48 positions give a
clean, bright, 500 bp product in a DNA amplification from Human genomic DNA.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Figure 1. Amplification
of a 500 bp target
from human genomic
DNA in all 48 sample
positions of the Air
T h e r m o - C y c l e r.
Reactions
volume
was 50 µl, no oil overlay. Reactions contained
Idaho
Technology medium
buffer, 200 µM each
dNTP, 5 µM each
primer (RS/KM), 50 ng
human genomic DNA.
Cycling parameters
were 96° for 30 seconds, then 30 cycles
of 96° for 30 seconds,
55° for 30 seconds, 75°
for 20 seconds.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
9
SAMPLE
HANDLING
SETTING UP
Thin walled micro test tubes have many advantages over capillary tubes.
First, handling of the sample tube is much simpler; reactions can be made up in
the micro test tube, no heat sealing is required, concern about breaking the
tubes is eliminated. Second, there is no need to adjust buffers or protocols. The
buffers that manufacturers provide with their thermostable polymerases work in
these tubes without modification. Published protocols developed in heat block
instruments seem to transfer more readily to the RapidCycler when micro test
tubes are used.
PROGRAMMING
TROUBLE
SHOOTING
The thermal properties of thin walled microcentrifuge tubes are much better
than their thick walled ancestors, but they are still no match for a capillary tube.
Using thin walled microcentrifuge tubes requires a sacrifice in speed and in sample temperature uniformity. A 10 µl reaction that would take 15 minutes in a capillary tube, takes 35 minutes in a thin walled microcentrifuge tube, a 50 µl reaction that would take 20 minutes in a capillary, takes 50 minutes in a microcentrifuge tube.
SERVICE AND
MAINTENANCE
Because the RapidCycler was developed for capillary tubes the temperature
values that you program into the machine, and the temperatures displayed during cycling, reflect what the temperature would be in a 10 µl capillary. When
using microcentrifuge tubes you must modify the program parameters to compensate for the thermal differences between capillaries and microcentrifuge
tubes.
WARRANTY
AND UPGRADES
2. THIN WALLED MICROCENTRIFUGE TUBE
CYCLING PROTOCOLS FOR THE RAPIDCYCLER
ARTICLES
There are two possible approaches when using microcentrifuge tubes. You
can set the machine to the temperature you want, and wait for the microcentrifuge tube to get to that temperature (Figure 2B. This is what the slower heat
block cyclers do). This method is slow, but it assures you that no part of your sample is ever over the target temperature. A faster approach is to overheat and
under heat the air. This brings the sample to temperature more quickly (Figure
2A. The faster heat block instruments do this), but some parts of your sample may
be slightly above or below the target temperatures.
RAPIDCYCLIST
NEWSLETTER
INDEX
10
SETTING UP
SAMPLE
HANDLING
Figure 2. Temperature
traces of the hold method
(2B) versus the over heat
and under heat method
(2A). Traces are of air
temperature and actual
sample
temperature.
Notice how the sample
temperature always lags
behind the air temperature,
and
how
the
over/under heat method
brings the sample to temperature more quickly.
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
I have had good success with the faster overheat and under heat approach.
The following protocols have been successful with a variety of primers and DNA
sources and are preprogrammed as cycle number 82-87.
RAPIDCYCLIST
NEWSLETTER
INDEX
11
SETTING UP
SAMPLE
HANDLING
10 µl Reactions
Predenature: 98°C for 10 seconds
Cycle:
PROGRAMMING
Denature ______98°C for 10 seconds
Anneal ________40°C to 60°C for 10 seconds
(as appropriate for your primers)
Extend ________74°C for 25 nucleotides per seconds
50 µl Reactions
TROUBLE
SHOOTING
Predenature: 96°C for 30 seconds
Cycle:
SERVICE AND
MAINTENANCE
Denature______96°C for 30 seconds
Anneal _______40°C to 60°C for 30 seconds
(as appropriate for your primers)
Extend ________74°C for 25 nucleotides per seconds
WARRANTY
AND UPGRADES
If you prefer the sit and wait approach 10 µl samples require 40 second holds
at denaturation and annealing, 50 µl samples 60 second holds at denaturation
and annealing. Elongation requires 25 nucleotides per second plus about 15 seconds.
ARTICLES
Figure 3. Optimization of RS/KM
primer pair in microfuge tubes.
Lanes 1-3: 60°C annealing, 4, 3
and 2 mM MgCl. Lanes 4-6: 50°C
annealing, 4, 3 and 2 mM MgCl.
Lanes 7-9: 40°C annealing, 4,3
and 2 mM MgCl. 10 µl reaction
volume, no oil, 10 sec. holds at
annealing and denaturation.
RAPIDCYCLIST
NEWSLETTER
INDEX
12
TROUBLE
SHOOTING
I have used this optimization protocol successfully with Idaho Technology
buffers (low, medium and high MgCl buffers), Promega 10X Taq buffer and
Stratagene 10X Pfu buffer.
PROGRAMMING
Optimal reaction conditions are found by running amplifications at 40C°,
50C° and 60C° with 2 mM, 3 mM and 4 mM MgCl at each temperature. This
allows you to test 9 different stringencies, while only requiring you make up three
different reaction mixes.
SAMPLE
HANDLING
The same optimization protocol that has been recommended in capillaries
(Optimizing Rapid Cycle DNA Amplification Reactions, Rasmussen and Reed,
Rapid Cyclist 1:1-5 (1992) has provided excellent results in thin walled microcentrifuge tubes.
SETTING UP
3. OPTIMIZATION OF REACTIONS IN THIN WALLED
MICROCENTRIFUGE TUBES
4. ARE MINERAL OIL OVERLAYS REQUIRED?
WARRANTY
AND UPGRADES
50 µl reactions show minimal condensation, but will occasionally pop open
during reactions if no oil is used. The frequency with which this occurs seems to
vary with reaction buffer and with tube manufacturer, so you may wish to experiment with your particular combination.
SERVICE AND
MAINTENANCE
The thin walled microcentrifuge tube holders for the RapidCycler put the
entire tube inside the reaction chamber. This keeps the whole tube at the same
temperature and thus reduces condensation. A small amount of condensation
occurs on the leeward side of the tubes, but I have not found this to be a practical problem, even for 10 µl reactions. While a little mineral oil does stop this condensation, in general, oil is not needed for 10 µl reactions.
ARTICLES
5. REAL VERSUS SET TEMPERATURES
INDEX
13
RAPIDCYCLIST
NEWSLETTER
The fast protocols given above both give a sample temperature of 94°
denaturation and 72° to 74° extension. The actual sample annealing temperature may not be important to you if you optimize the reaction experimentally as
recommended above. If you do need a particular annealing temperature, the
value you should set can be calculated using the equations in figure 4. I have
provided graphs for 10 µl reactions with a 10 second hold (figure 4A) and for 50
µl reactions with a 30 second hold (figure (4B).
SAMPLE
HANDLING
SETTING UP
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
Figure 4. Linear relationship between the temperature programmed
into the air cycler and the actual sample temperature for thin walled
capillary tubes. 4A: 10 µl samples, 10 second holds, no oil overlay. 4B:
50 µl samples, 30 second holds, no oil overlay.
INDEX
14
SETTING UP
1. SINGLE TUBE HANDLING
SERVICE AND
MAINTENANCE
You can mix your reaction in any sort of container, I use low protein absorbing microtiter dishes (IT#2590). Take care at the mixing step as one of the most
common causes of reaction failure is forgetting a component of the reaction
(see “The 10 most common mistakes”, Rapid Cyclist 2:11-12). The chances of
leaving something out can be reduced by making up “master mixes” that contain everything but primer and template. The mix can be stored at 4° C for up to
3 months (see “Reaction mixes and buffer recipes”, Rapid Cyclist 2:9).
TROUBLE
SHOOTING
Mixing the Sample
PROGRAMMING
One of the biggest concerns for new users of air-cyclers is the handling and
sealing of glass capillary tubes. While they are a bit more difficult to use than the
traditional microcentrifuge tube, the rapid cycle times and temperature homogeneity made possible by the capillaries makes them more than worth the extra
trouble. After a little practice, you may wonder why you ever worried.
SAMPLE
HANDLING
C
CAPILLARY TUBE HANDLING
with the RapidCycler
WARRANTY
AND UPGRADES
ARTICLES
Figure 1. Tipping the capillary tube sideways
to increase the rate of liquid uptake.
INDEX
15
RAPIDCYCLIST
NEWSLETTER
Figure 2. Directly
injecting sample
into the tube using
a pipetman.
SETTING UP
SAMPLE
HANDLING
Figure 3. Sealing capillary with a
Blazer mini butane torch.
PROGRAMMING
TROUBLE
SHOOTING
Loading the capillary
SERVICE AND
MAINTENANCE
Glass capillary tubes are easily loaded by capillary action. You can increase
the rate of liquid uptake by tipping the capillary tube sideways (Figure 1). You
can also load the capillaries using a Drummond microaspirator (IT#1690) to draw
the reaction mix up into the tube, or you can use a pipetman to directly inject
sample into the tube (Figure 2).
WARRANTY
AND UPGRADES
The 10 µl size tubes hold 2.2 µl/cm and can be used for reaction volumes from
5 to 15 µl. The 10 µl capillaries come to temperature so quickly that they require
no holds at denaturation or annealing. The 50 µl tubes hold 9 µl/cm and are useful for reaction volumes from 15 to 70 µl. These tubes require a 15 second hold at
the denaturation and annealing temperature.
Sealing the capillary
ARTICLES
The glass capillaries sold by Idaho Technology are made out of a high sodium, low melting temperature glass. This makes them very easy to flame seal with
just about any flame. They can be sealed with a Bic lighter, a Bunsen burner, a
candle, or a Blazer mini propane torch (Figure 3, IT#2721).
RAPIDCYCLIST
NEWSLETTER
After the capillary is loaded, tip the tube to center the liquid. Hold the tube
in the center and place the end just into the flame. Rotate the tube in the flame
by rolling it between your thumb and index finger. You should be able to see the
glass slowly close in on itself. Try to avoid leaving the tube in the flame too long,
as you can end up with a big glob of glass which will not fit into the holder . This
is more likely in very hot flames. Cutting down the air to the flame will cool these
burners down and make the capillaries easier to seal.
INDEX
16
SAMPLE
HANDLING
PROGRAMMING
Repeat the sealing process on the other end and then insert the tube into the
capillary holding module. A module rack (IT#1735) makes these manipulations
easier.
SETTING UP
You can confirm that the end is sealed by looking carefully at the end for a
continuous wall of glass around the end. You can also confirm sealing by blowing on the hot end of the capillary and watching to see if the liquid moves
toward the end of the capillary as the glass cools (This is more dramatic for the
first seal than the second).
Figure 4. Scoring capillary ends
with sapphire cutter.
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Figure 5. Using capillary tube as a
"pipet tip" and directly loading sample into gel.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
17
SETTING UP
SAMPLE
HANDLING
Sample Recovery
After your reaction is done you pull the tube from the module, lightly score
the two ends with a sapphire cutter (Figure 4, IT#1691) and break off the ends.
The capillary tube then becomes a “pipet tip” for the Drummond microaspirator
(IT#1690) and can be used to directly load your sample into a gel (Figure 5), or
into a storage tube.
PROGRAMMING
Beware, the pressure caused by sliding the capillary into the microaspirator
can cause your sample to be blown out of the tube. This is easily prevented by
dialing the microaspirator back a bit as you insert the capillary tube. The silicon
tips of the microaspirator wear out quite quickly, so if your microaspirator stops
working try replacing the tip (IT#1870).
TROUBLE
SHOOTING
2. MULTIPLE TUBE HANDLING
Once you get single sample handling down, you may want to try some of
these "advanced" multiple sample handling tricks.
SERVICE AND
MAINTENANCE
Eight Sample Handling
WARRANTY
AND UPGRADES
When sample modules are made with microtiter spacing it is possible to mix
up eight samples at a time in a microtiter dish and draw them up simultaneously
by capillary action (Figure 6). All eight samples can be centered by tilting the
module and then the tubes can be sealed by passing the tubes through a flame
one at a time (Figure 7). Once the reaction is done you can score all eight tubes
at once by lightly drawing the sapphire knife across the top of the module (Figure
8) and then breaking off each tube top (Figure 9). Press the module down to the
other end of the capillary tubes and repeat the scoring and breaking.
ARTICLES
Figure 6. Mixing eight
samples at a time and
drawing them up
simultaneously with
capillary action.
RAPIDCYCLIST
NEWSLETTER
INDEX
18
SETTING UP
SAMPLE
HANDLING
Figure 7. Sealing capillaries by passing the
tubes through the
flame one at a time.
PROGRAMMING
TROUBLE
SHOOTING
Figure 8. Scoring all
eight tubes at once
by lightly drawing the
sapphire knife across
the top of the module.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Figure 9. Breaking off
tube top after scoring.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
19
SETTING UP
SAMPLE
HANDLING
Sixteen Sample Handling
PROGRAMMING
After mastering the eight sample tricks, you may want to try 16 at a time. All
sixteen tubes in the module can be filled simultaneously by capillary action, similar to the process for sampling 8 tubes. After centering the samples the two rows
of eight tubes can then be staggered off from each other by pressing the tubes
down on a bench top. The bottom of the first row of eight tubes, and the top row
of the second row of eight can then be sealed one at a time by passing through
the flame. The staggered rows can then be switched and the remaining two
ends can be sealed. After the reaction is done the ends can be scored as done
in the eight sample example.
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
20
SETTING UP
PROGRAMMING
TROUBLE
SHOOTING
A
OVERVIEW: PROGRAM MODES
AND USER INTERFACE
SAMPLE
HANDLING
Programming
1. RAPIDCYCLER FUNCTION:
WARRANTY
AND UPGRADES
RAPIDCYCLER FUNCTION:
1. CYCLE MODE
2. HOLD MODE
3. LINK MODE
SERVICE AND
MAINTENANCE
When you switch the RapidCycler on, a title screen which contains the software version number is displayed while the controller boots up. After a few seconds, the RAPIDCYCLER FUNCTION screen appears. This is the main menu of the
RapidCycler. To enter one of the three operating modes of the RapidCycler simply press the corresponding number:
To return to the RAPIDCYCLER FUNCTION screen from within the three modes,
press the FUNCTION key. If you have pressed RUN/STOP in any of the modes while
you are running a program, you must first stop the program by pressing RUN/STOP,
then press FUNCTION to return to the RAPIDCYCLER FUNCTION screen.
ARTICLES
At start-up, program number 01 in each of the three modes is reset to the
standard parameters found in the Program Tables at the end of this section.
Each of the other 98 programs in each mode retain whatever values have been
entered in them.
RAPIDCYCLIST
NEWSLETTER
INDEX
21
SETTING UP
PROGRAMMING
SAMPLE
HANDLING
If you have not already done so, you may wish to familiarize yourself with the
function of the machine by entering each of the three modes and pressing
RUN/STOP. Cycle program C-01 will take about 15 minutes but can be stopped
at any time by pressing RUN/STOP. Hold program H-01 only takes a few minutes.
Link program 01 runs hold program H-01 and cycle program C-01 in sequence
and can also be interrupted at any time by pressing RUN/STOP.
2. USER INTERFACE: EDITING NUMBERS
Programming the RapidCycler is easy. It is done by first entering Cycle, Hold,
or Link mode. Move the blinking cursor using the cursor keys (arrows), and enter
the desired values using the numeric keypad.
TROUBLE
SHOOTING
When editing a number, remember to type in the same number of digits as
the number you are editing. For example, if you want to change the program
number from “01” to “02”, type “0” and “2” - rather than just typing “2”. Programs
02 through 99 in each mode will be remembered by the RapidCycler even if the
machine is turned off.
SERVICE AND
MAINTENANCE
Note that there are not any numbers to edit when the RapidCycler is in the
RAPIDCYCLER FUNCTION mode or while running a program, therefore no blinking
cursor will be displayed.
WARRANTY
AND UPGRADES
B
CYCLE MODE
When you enter CYCLE MODE the screen should appear as follows:
ARTICLES
CYCLE MODE
PROG#C01
TEMP D94
A55
E72
TIME 0:00 0:00 00:15
SLOPE=9.9 CYCLES=30
RAPIDCYCLIST
NEWSLETTER
INDEX
22
D
A
E
TIME
E
CYCLES
ARTICLES
CYCLE MODE
PROG#C03
TEMP D94
A65
E72
TIME 0:00 0:00 00:15
SLOPE=9.9
CYCLES=3
WARRANTY
AND UPGRADES
Change to program #C03 by pressing 0 and 3. The parameters should all be
null. Use the cursor keys and numeric keys to enter the following temperatures,
hold times, slope and cycle count.
SERVICE AND
MAINTENANCE
2. CHANGING BETWEEN AND EDITING PROGRAMS
TROUBLE
SHOOTING
SLOPE
PROGRAMMING
D
A
Program number C (01 THROUGH 99)
Temperatures in °C (~30°C - 99°C)
Typically 90° - 96°
Typ. 40° - 68°
Typ. 70° - 74°
Corresponding hold times in minutes
and seconds
0 sec for 10µl sample in capillary tube
0 sec for 10µl sample in capillary tube and
highest stringency
1 sec/50 bp for products < 500 bp.
1 sec/25 bp for products < 2 kbp
1 sec/15 bp for products < 5 kbp
Ramp rate between A and E in °C/sec.
Typically 9.9 for highest stringency 2 - 6
for low stringency.
Number of cycles
SAMPLE
HANDLING
PROG# C01
TEMP
SETTING UP
1. DESCRIPTION OF CYCLE MODE PARAMETERS
3. A CYCLE PROGRAM MUST MEET THE FOLLOWING CRITERIA TO RUN
INDEX
23
RAPIDCYCLIST
NEWSLETTER
D must be greater than E
E must be greater than or equal to A
For two temperature cycling, set A=E with a 0 second hold at A.
Slope must be greater than 0
Cycles must be greater than 0
SETTING UP
SAMPLE
HANDLING
Since there are many programs available it may be difficult to remember
which programs “belong” to whom. We suggest making copies of the Program
Tables at the end of this chapter and posting them near the RapidCycler. Name
the Cycle, Hold, and Link programs and thereby “claim” them as your own.
PROGRAMMING
Diagram showing restraints when programming temperature parameters.
Denaturation: <99ºC
Elongation: The elongation temperature
must be between annealing and
denaturation temperatures. Set a 0 sec.
hold for two temperature cycles
TROUBLE
SHOOTING
Annealing: <30ºC
SERVICE AND
MAINTENANCE
To edit a program, tab to the PROG# position and enter both digits of the
program you wish to modify. The program you were in will be saved automatically as you exit to the new program number. Keep in mind that whenever you
enter numbers, the program is changed. If you edit a program that someone
else routinely uses in a link program they may not see the changes you have
made and it may ruin their run.
WARRANTY
AND UPGRADES
4. RUNNING A CYCLE PROGRAM
ARTICLES
After all required parameters are entered, you are ready to run the program.
Press the “RUN/STOP” key to start the program. Should you want to stop the program before it reaches completion, press the “RUN/STOP” to halt the program.
The RapidCycler will then return to the CYCLE MODE screen.
RAPIDCYCLIST
NEWSLETTER
If you try to run a program that does not meet the criteria for a valid cycle
program, the RapidCycler will display an error message and beep, then return to
the program you tried to run. See the “Changing between and editing programs:” section earlier in this chapter for a list of the cycling criteria.
When running a cycle program the RapidCycler displays the current temperature as well as the cycle count. Line 3 of the display: “CYCLE 1 D OF 30”
describes the cycling status as being on cycle #1 of 30 cycles.
INDEX
24
When you enter HOLD MODE the screen should appear as follows.
Change to program #H03 by pressing 0 and 3. The parameters should all be
null. Use the cursor keys and numeric keys to enter a temperature of 94° and hold
time of 15 seconds. The screen should appear as follows:
INDEX
25
RAPIDCYCLIST
NEWSLETTER
Now create another hold program for an extended elongation period after
cycling. Select program 04 and enter 72° for 15 seconds.
ARTICLES
HOLD MODE
PROG#H03
TEMPERATURE=94
TIME=00HR
00MN 15SEC
WARRANTY
AND UPGRADES
1. CHANGING BETWEEN AND EDITING PROGRAMS
SERVICE AND
MAINTENANCE
Description of HOLD MODE parameters:
PROG# H
Program number H(01 THROUGH 99)
TEMPERATURE
Temperature in °C (~30°C - 99°C)
TIME
Hold time in hours, minutes,
and seconds
TROUBLE
SHOOTING
HOLD MODE
PROG#H01
TEMPERATURE=94
TIME=00HR 00MN 15SEC
PROGRAMMING
HOLD MODE
SAMPLE
HANDLING
C
SETTING UP
After completion of a program, the RapidCycler will display “PROGRAM
COMPLETED” and prompt you to “PRESS ANY KEY” to continue. While waiting
for you to press a key, the RapidCycler will beep every thirty seconds to remind
you that it is finished. Once a key is pressed, the RapidCycler will return to the
CYCLE MODE screen for the program you have just completed.
SETTING UP
PROGRAMMING
SAMPLE
HANDLING
HOLD MODE
PROG#H04
TEMPERATURE=72
TIME=00HR
00MN 15SEC
The only requirement for a hold program to run is that the temperature can
not be 0 or greater than 99, however, if a temperature below room temperature
is entered the machine will be unable to reach it.
2. RUNNING A HOLD PROGRAM
TROUBLE
SHOOTING
Press the “RUN/STOP” key to start the program. If you wish you may also press
the “RUN/STOP” to halt the program.
SERVICE AND
MAINTENANCE
While running a HOLD MODE program the RapidCycler displays the current
temperature and begins a count-down once the desired temperature has been
reached.
WARRANTY
AND UPGRADES
After completion of a program, the RapidCycler will display “PROGRAM
COMPLETED” and prompt you to “PRESS ANY KEY” to continue. While waiting
for you to press a key, the RapidCycler will beep every thirty seconds to remind
you that it is finished. Once a key is pressed, the
RapidCycler will return to the HOLD MODE screen for the program you have
just completed.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
26
SETTING UP
D
LINK MODE
INDEX
27
RAPIDCYCLIST
NEWSLETTER
For example, if you want to link an extended denaturation to a cycle program then finish with an extended elongation, enter hold program #03, cycle
program #03, and hold program #04 in sequence. Tab the cursor to the first segment (right arrow cursor key) and type “203” for hold program #03. Tab to the
next segment and enter “103” for cycle program #03. Finally, tab to the third
segment and enter “204”. Note that when you tab away from a link segment,
the first digit is changed from a “2” to an “H” or from a “1” to a “C”.
ARTICLES
Change to program #03 by pressing 0 and 3. The parameters should all be
null, or 0. Press the right arrow cursor key to enter the first link segment. To link
hold or cycle programs using a link program, you must enter 3 digits for each segment. The first digit must be either a “1” or “2”, which represent a “C” for Cycle
program or “H” for Hold program respectively. Note that the “1” key has the
word “CYCLE” on it and the “2” key has the word “HOLD” on it. The next two digits represent the program number of that cycle or hold program.
WARRANTY
AND UPGRADES
Link mode can be programmed to run up to ten cycle or hold programs
sequentially, but the programs to be linked must fulfill all the criteria for cycle or
hold programs for the link program to run to completion. Segments are run in
order from the upper left to lower right. Empty segments are skipped.
SERVICE AND
MAINTENANCE
1. CHANGING BETWEEN AND EDITING PROGRAMS
TROUBLE
SHOOTING
Description of LINK MODE parameters:
PROG#
Program number (01 through 99)
10 LINK SEGMENTS
Up to 10 cycle or hold programs
to be run sequentially. Cycle
programs are designated CXX
and hold programs are HXX.
PROGRAMMING
LINK MODE
PROG#01
H01-C01-XXX-XXX-XXXXXX-XXX-XXX-XXX-XXX
SAMPLE
HANDLING
When you enter LINK MODE the screen should appear as follows.
SETTING UP
If you have not set up cycle program C03 and hold programs H03 and H04
as described in the CYCLE MODE and HOLD MODE sections of this chapter, you
may wish to modify them now. Otherwise the link program will not run properly.
SAMPLE
HANDLING
PROGRAMMING
2. RUNNING A LINK PROGRAM
Press the “RUN/STOP” key to start the program. If you wish you may press the
“RUN/STOP” to halt the program and the RapidCycler will return to the LINK
MODE screen.
Running a link program displays the appropriate screen (cycle or hold) for
each individual link segment and adds a fourth line to the display of each
screen. This additional line lets you know what link segment you are on.
TROUBLE
SHOOTING
Should you try to run a program that is not valid, the RapidCycler will display
an error message, beep, and return to the failed program.
SERVICE AND
MAINTENANCE
E
RAPIDCYCLER'S MEMORY
1. FACTORY-SET PROGRAMS
WARRANTY
AND UPGRADES
ARTICLES
The RapidCycler is preprogrammed with 32 cycle programs, 51 hold programs, and 10 link programs. For a description of these programs, see the
accompanying pages. These programs, in addition to any you may add, will
remain in memory even when the RapidCycler is turned off. However, this means
that once a preprogrammed protocol is altered, the original program is lost and
the altered program will remain in memory. There is one exception, however. In
each mode, program #1 is reset to default values whenever the RapidCycler is
powered up. This means that modifications to program #1 in cycle hold and link
modes will not be saved when the RapidCycler is turned off.
RAPIDCYCLIST
NEWSLETTER
2. PROGRAM TABLES
The tables on the following pages list the preprogrammed cycle, hold, and
link programs. Each table also includes space for you to add your own programs.
We recommend making copies of these tables and posting them near the
RapidCycler.
INDEX
28
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
29
SETTING UP
PREPROGRAMMED RAPIDCYCLER HOLD PROGRAMS
SAMPLE
HANDLING
PROGRAMMING
SETTING UP
PREPROGRAMMED RAPIDCYCLER CYCLE PROTOCOLS 1-50
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
30
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
31
SETTING UP
PREPROGRAMMED RAPIDCYCLER CYCLE PROTOCOLS 51-99
SAMPLE
HANDLING
PROGRAMMING
SETTING UP
PREPROGRAMMED RAPIDCYCLER CYCLE LINK PROTOCOLS 1-50
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
32
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
33
SETTING UP
PREPROGRAMMED RAPIDCYCLER CYCLE LINK PROTOCOLS 51-99
SETTING UP
SAMPLE
HANDLING
Trouble-Shooting
TROUBLE
SHOOTING
PROGRAMMING
Phone numbers to call for service problems:
US and Canada: 1-800-735-6544
Outside the US: 1 (801) 736-6354
Fax: 1 (801) 588-0507
E-mail addresses:
Idaho Technology: [email protected]
User's Group: [email protected]
Web address:
www.idahotech.com
SERVICE AND
MAINTENANCE
Q. There is no display when the instrument is turned on?
WARRANTY
AND UPGRADES
A. Make sure that it is plugged in, if so then check electrical fuses as per
instructions found in the Service and Maintenance section of this manual. If the
problem persists, please call our service department at the appropriate number
listed at the beginning of this section.
ARTICLES
Q. When RUN is pressed nothing happens?
RAPIDCYCLIST
NEWSLETTER
A. Be sure the proper protocol screen is visible on the LCD display as per the
instructions found in the Programming section of this manual. If the desired protocol is being displayed, press the RUN/STOP button several times and watch the
display. The display should change with each press of the RUN/STOP button, shifting from a “SET PROTOCOL” screen to a “RUN” screen as shown in the
Programming section of this manual. When the “RUN” screen is showing, the
internal fan should be running and the quartz halogen bulb will go on as needed to heat the sample to the desired temperatures.
INDEX
34
If an obstruction is seen, unplug the machine and remove the instrument
(see instructions for removal in light bulb replacement in Service and
Maintenance). When the cover is up and the chamber is accessible, check the
INDEX
35
RAPIDCYCLIST
NEWSLETTER
<< Do not reach into the instrument while it is running. >>
ARTICLES
A. First, check underneath the instrument to verify that the air intake fan is free
of obstruction. If there are no visible obstructions, go to a standard cycle protocol, put on protective eye wear, remove the front module and press RUN. When
the instrument starts, the heating lamp will illuminate the chamber, allowing you
to check for debris or obstructions.
WARRANTY
AND UPGRADES
Q. There is unusual noise coming from the machine?
SERVICE AND
MAINTENANCE
If the problem continues, it is possible the thermal fuse in the instrument needs
to be replaced. Unplug the machine and follow the thermal fuse replacement
instructions shown in the Service and Maintenance section of this manual. If the
problem persists, please call our service department at the appropriate number
listed at the beginning of this section.
TROUBLE
SHOOTING
A. If the RUN/STOP key has been pressed and the display shows the “RUN”
screen, but the instrument is not heating up, first check the values of the protocol
entered to ensure the proper temperature shows on the running protocol. If the
proper values are displayed it is possible that the quartz halogen heating bulb
has burned out. Check the chamber for light before replacing the bulb. If the
bulb has burned out, unplug the machine and replace the bulb following instructions shown in the Service and Maintenance section.
PROGRAMMING
Q. When RUN is pressed, the fan runs but the temperature does not
increase?
SAMPLE
HANDLING
If the problem persists, please call our service department at the appropriate
number listed at the beginning of this section.
SETTING UP
If the screen does not change back and forth between the two screens
when the RUN/STOP key is pressed, shut the instrument off and unplug the power
cord for 30 seconds to 1 minute. Then plug the cord back in and turn the instrument back on. Remember, the protocols set at CYCLE 1, HOLD 1, and LINK 1 will
reset to factory preset values if the power is turned off. The remainder of the protocols will remain at their last set values even after power loss.
SETTING UP
SAMPLE
HANDLING
cover for obstructions or debris. If the interior requires cleaning, use only water or
water-based cleaners. Care must be taken not to bend or harm the thermocouple probe, which looks like a small wire protruding 1/2" (1.25 cm) into the chamber from the side wall.
TROUBLE
SHOOTING
PROGRAMMING
If there are no obstructions in the chamber, turn off the instrument, unplug the
power cord, lay the instrument on its side, and using pencil or pen, carefully turn
the lower fan blade; be very careful not to bend the lower blade. Check the
lower fan blade for contact with the fan guard. If the lower fan blade has one
blade which contacts the guard, carefully use the pencil or pen to gently bend
the contacting blade slightly up. If anything more than a very slight contact is
occurring, please call our service department at the appropriate number listed
at the beginning of this section.
If no problem is found in the lower fan blade area and the noise problem persists, please call our service department at the appropriate number listed at the
beginning of this section.
SERVICE AND
MAINTENANCE
Q. The machine is slow to heat up?
WARRANTY
AND UPGRADES
A. If the instrument is taking an excessively long time to reach a set temperature, it is possible there is an air leak from the reaction chamber. First, check to
be certain that all three of the sample modules are in place and firmly seated. It
is not necessary for all of the modules to contain sample tubes, but the instrument
cannot operate correctly without all three modules in place.
ARTICLES
If all modules are seated correctly, inspect the perimeter of the instrument
top for fit, and check the four corner screws securing the instrument top to ensure
they are tightened snugly. If the instrument top is not aligned correctly, undo the
top and reset in place following the instruction for top removal and replacement
in the Service and Maintenance section of this manual.
RAPIDCYCLIST
NEWSLETTER
The other potential source for a leak is the solenoid operated door located
at the top of the rear air duct. If the door does not completely close when the
instrument is attempting to reach a denaturation temperature, look around the
door for any obstructions. If the door does not close and no obstructions are
apparent, please call our service department at the appropriate number listed
at the beginning of this section.
INDEX
36
ARTICLES
Keep in mind that of the many factors influencing the outcome of a reaction,
the RapidCycler affects only one - namely the temperature profile. If the temperature on the display seems to indicate the sample is being cycled as expected, you can be confident that the reading accurately reflects the sample temperature.
WARRANTY
AND UPGRADES
While Idaho Technology does not warrant the RapidCycler for any specific
biochemical reaction, technical assistance for the instrument is available. For
assistance, call our service department at the appropriate number listed at the
beginning of this section.
SERVICE AND
MAINTENANCE
A. There are numerous factors influencing the outcome of reactions including
reagents, reaction kinetics, and secondary DNA or RNA structure. The most common mistakes affecting the outcome of a reaction have been outlined in the
Rapid Cyclist Vol. 2, located in the back of this manual.
TROUBLE
SHOOTING
Q. The machine cycle normally but reactions are not working?
PROGRAMMING
If after clearing all obstructions the cool down is still slow, run a cycle protocol and watch the solenoid activated door during the transition between denaturation and annealing. The door is visible by looking through the grill at the top
rear of the instrument. If the door does not open roughly 2 cm, or if very little
hot air is being vented from the duct, please call our service department at the
appropriate number listed at the beginning of this section.
SAMPLE
HANDLING
A. The RapidCycler requires an unobstructed supply of room temperature air
around the entire base of the machine. Setting the machine too close to a wall
or surrounding it with books or other objects cuts off the air supply and slows the
cooling down. It is also important for the air outlet at the top rear of the
machine to be unobstructed.
SETTING UP
Q. The machine is slow to cool down (>15 sec. from denaturation to
annealing temperatures)?
RAPIDCYCLIST
NEWSLETTER
INDEX
37
SETTING UP
SAMPLE
HANDLING
Service and
Maintenance
SERVICE AND
MAINTENANCE
TROUBLE
SHOOTING
PROGRAMMING
Phone numbers to call for service problems:
US and Canada: 1-800-735-6544
Outside the US: 1 (801) 736-6354
Fax: 1 (801) 588-0507
E-mail addresses:
Idaho Technology: [email protected]
User's Group: [email protected]
Web address:
www.idahotech.com
LIGHT BULB REPLACEMENT
WARRANTY
AND UPGRADES
Tools & supplies needed:
Flat blade screwdriver
Replacement Bulb
(Ushio 500 W Mini-Candella halogen bulb)
ARTICLES
1. Turn off the power switch on the back of the instrument. Unplug instrument.
If the instrument has been recently in operation, wait for approximately five minutes for the light bulb to cool.
<< NEVER ATTEMPT TO REMOVE A HOT BULB >>
RAPIDCYCLIST
NEWSLETTER
2. Completely loosen the four top corner screws.
(Figure 1) These screws are “captive” style screws and do
not come completely out of the instrument top, but can
be completely loosened in place.
3. Lift the back of the top duct straight up.(Figure 2).
The top of the instrument and the top duct should lift up
INDEX
38
Figure 1.
Figure 2.
Figure 3.
SETTING UP
SAMPLE
HANDLING
approximately 7/16” (1 cm). If
the instrument top does not lift
up, check the four corner
screws to ensure they are completely loose. If the top still does
not easily lift up, gently pry up
the back of the instrument top
near the back duct. (Figure 3).
Figure 4.
9. Once proper fit is established, the four corner screws should be retightened. Do not over-tighten the screws.
INDEX
39
RAPIDCYCLIST
NEWSLETTER
10. Plug instrument back in. Turn switch back on. Check for proper operation
of instrument. If problems persist, call our service department.
ARTICLES
8. Lift and tip the instrument cover back to a horizontal position. Then, holding the top level, carefully align the top in place and press down. There is an
electrical plug inside the top cover which must mate into contacts in the instrument frame. If the top does not fit in place easily, do not force. Lift up on the
cover, realign, and press.
WARRANTY
AND UPGRADES
7. While the top is open, check the chamber for foreign materials. If you clean the chamber for any reason,
only water or water-based cleaners should be used. Care must be taken not to
bend or harm the thermocouple probe, which looks like a small wire sticking
about 1/2” (1.25 cm) into the chamber from the side wall. It should be sticking
straight into the chamber and should not be disturbed.
SERVICE AND
MAINTENANCE
6. Insert new bulb. Do not touch the glass portion of
the new light bulb with bare hands. Use protective liner
included with bulb.
TROUBLE
SHOOTING
5. Carefully check the bulb to ensure it is cool.
Unscrew and remove the old bulb, being careful to not
break the bulb.
PROGRAMMING
4. After the instrument top
lifts straight up, raise the front of the instrument top up and back to allow access
to the bulb. (Figure 4).
SETTING UP
ELECTRIC FUSE REPLACEMENT
SAMPLE
HANDLING
Tools & supplies needed:
Flat blade screwdriver
Replacement fuses
SERVICE AND
MAINTENANCE
TROUBLE
SHOOTING
PROGRAMMING
1. Turn off the power switch
on the back of the instrument.
Unplug instrument.
Locate
fused switch on back of instrument. (Figure 1)
Figure 1.
Figure 2.
2. Insert a small flat bladed
screwdriver in fuse tray release
slot (Figure 2) and gently lift up.
This will allow the fuse tray to
be removed.
3. Replace fuses with appropriately sized new fuses. Fuse size and style located on the instrument tag on back of instrument. Install fuse tray.
4. Plug instrument back in. Turn switch back on. Check for proper operation
of instrument. If problems persist, call our service department at (800) 524-6354.
WARRANTY
AND UPGRADES
THERMAL FUSE REPLACEMENT
Tools & supplies needed:
Flat blade screwdriver
5/64” hex wrench
replacement thermal fuse
Figure 1.
ARTICLES
1. Turn off the power switch on the back of the instrument. Unplug instrument. If the instrument has been
recently in operation, wait for approximately five minutes
for the light bulb to cool.
RAPIDCYCLIST
NEWSLETTER
<< NEVER ATTEMPT TO REMOVE A HOT BULB >>
2. Completely loosen the four top corner screws. (Figure 1) These screws are
“captive” style screws and do not come completely out of the instrument top,
but can be completely loosened in place.
INDEX
40
Figure 2.
SAMPLE
HANDLING
Figure 3.
TROUBLE
SHOOTING
5. Carefully check the bulb to ensure it is cool.
Unscrew and remove the bulb and set it aside, being
careful to not break the bulb. Do not touch the glass portion of the light bulb with bare hands.
Figure 4.
Figure 5.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
41
WARRANTY
AND UPGRADES
The thermal fuse is connected to the duct with a hex
head screw. A 5/64” hex wrench is needed to remove
the screw. Remove the screw and remove the tripped
thermal fuse. Insert the new fuse in the same location as
the old fuse, and replace and tighten the screw.
Reconnect the wires to the thermal fuse, and ensure that
all wiring is placed correctly.
SERVICE AND
MAINTENANCE
6. The thermal fuse is inside the top duct (Fig 5).
Unplug the two wires connected to the thermal fuse.
These are regular slip spade connections and should be
relatively easy to remove.
8. Replace the bulb. Do not touch the glass portion of
the light bulb with bare hands.
PROGRAMMING
4. After the instrument top lifts straight up, raise the
front of the instrument top up and back to allow access
to the bulb. (Figure 4).
7. While the top is open, check the chamber for foreign materials. If you clean the chamber for any reason,
only water or water-based cleaners should be used.
Care must be taken not to bend or harm the thermocouple probe, which looks like a small wire sticking about
1/2” (1.25 cm) into the chamber from the side wall. It
should be sticking straight into the chamber and should
not be disturbed.
SETTING UP
3. Lift the back of the top duct straight up.(Figure 2).
The top of the instrument and the top duct should lift up
approximately 7/16” (1 cm). If the instrument top does
not lift up, check the four corner screws to ensure they
are completely loose. If the top still does not easily lift up,
gently pry up the back of the instrument top near the
back duct. (Figure 3).
SETTING UP
SAMPLE
HANDLING
9. Lift and tip the instrument cover back to a horizontal position. Then, holding the top level, carefully align the top in place and press down. There is an
electrical plug inside the top cover which must mate into contacts in the instrument frame. If the top does not fit in place easily, do not force. Lift up on the
cover, realign, and press.
10. Once proper fit is established, the four corner screws should be retightened. Do not over-tighten the screws.
PROGRAMMING
SERVICE AND
MAINTENANCE
TROUBLE
SHOOTING
11. Plug instrument back in. Turn switch back on. Check for proper operation
of instrument. If problems persist, call our service department at (800) 524-6354.
A
PERIODIC MAINTENANCE LIST
DAILY
1. Make sure power switch is off after use (not required but recommended.
2. Make sure nothing is underneath the machine blocking the air intake. Look
under the instrument to inspect the fan guard on the bottom of the instrument to
ensure there is nothing blocking the air flow.
MONTHLY
WARRANTY
AND UPGRADES
1. Inspect chamber for debris.
Remove the four screws that hold the top down. Lift the top straight up about
one inch, then swing towards the back of the machine, being careful not to
touch the halogen bulb. Make sure there are no broken tubes or debris on the
foam.
ARTICLES
2. Inspect the thermocouple for damage.
The thermocouple protrudes horizontally from the chamber wall halfway
between the top and bottom of the chamber at the 5 o'clock position.
RAPIDCYCLIST
NEWSLETTER
3.Inspect halogen bulb for debris and darkening around the mount.
Slight discoloration around the base of the halogen bulb is normal. Using a
dust free cloth, remove any dust or lint that may have collected around the bulb
mount. Do not touch the bulb with bare fingers as any residue can shorten the
bulb life.
INDEX
42
Inspect the area where the fan blade attaches to the mounting collar for any
bending or cracking. Check the tightness of the set screw in the fan collar.
Wipe the entire chamber down with a damp cloth (light soap and water)
including the chamber fan blade. Be careful not to bend the thermocouple.
PROGRAMMING
2. Inspect and clean chamber including fan blade, foam and modules.
SAMPLE
HANDLING
1. Inspect fan blade for fatigue at collar attachment point and tighten set
screw.
SETTING UP
MONTHLY MAINTENANCE, CONTINUED.
3. Inspect the condition of the duct foam and the door foam
On the 1002 RapidCycler, wipe the keypad and display area clean with a
damp cloth. On the 1605 Air Thermo-cycler use a dry cloth.
SERVICE AND
MAINTENANCE
4. Clean Keypad with damp cloth.
TROUBLE
SHOOTING
Inspect the foil-covered foam and make sure it is not beginning to peel off
the duct sides or top. Make sure the black high temperature foam on the chamber door is not binding with the movement of the door.
EVERY SIX MONTHS
2. Tighten all exterior screws and clean all surfaces.
3. Tighten thermal fuse screw.
Remove the four screws that hold the top down. Lift the top straight up about
one inch, then swing towards the back of the machine being careful not to
touch the halogen bulb. With the hex driver, tighten the screw holding the ther-
INDEX
43
RAPIDCYCLIST
NEWSLETTER
Using the hex driver supplied with the start-up kit, tighten all of the exterior
screws and wipe the surface of the instrument with a damp cloth.
ARTICLES
Lay the machine on its side and inspect the lower cooling fan and fan guard
for anything blocking the air path. If necessary, remove the four screws on the fan
guard and wipe the fan blade to remove excessive dust. Also ensure that there
is nothing rubbing on the fan blade and it does not hit anything. REPHRASE THIS!
WARRANTY
AND UPGRADES
1. Inspect lower (cooling) fan blade and dust if necessary.
SETTING UP
mal fuse (Brown rectangle with two wire connectors) located next to the bulb
mount on the duct sidewall.
SAMPLE
HANDLING
4. Inspect door motor and hinge for friction
SERVICE AND
MAINTENANCE
TROUBLE
SHOOTING
PROGRAMMING
Remove the four screws on the rear duct and swing it up. Move the door
hinge assembly and make sure that it moves freely and does not bind. If it binds
on the leverage arm oil the connecting points with light machine oil - DO NOT OIL
THE NYLON HINGE.
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
44
SETTING UP
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
45
SETTING UP
SAMPLE
HANDLING
Warranty and
Upgrades
PROGRAMMING
WARRANTY
AND UPGRADES
SERVICE AND
MAINTENANCE
TROUBLE
SHOOTING
A
Warranty
Idaho Technology warrants the RapidCycler and related equipment for
a period of one year from the date of purchase. If problems occur with your
machine, a replacement machine will be shipped immediately via next day air.
In the event of a failure, please call us at 800-735-6544 to arrange for the
return, repair and temporary replacement of your machine.
B
Upgrades
Because of the modular nature of the Idaho Technology RapidCycler, it
will be possible to upgrade the performance of both the hardware and software
in the future. Any such upgrades will be offered at low cost and zero downtime.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
46
SETTING UP
PROGRAMMING
Automated polymerase chain reaction
in capillary tubes with hot air
Pg. 48
TROUBLE
SHOOTING
Nucleic Acids Research, Vol. 17, No. 11, 4353-4357 (1989)
C.T.Wittwer, G.C.Fillmore and D.R.Hillyard
University of Utah Medical School
Pg. 54
WARRANTY
AND UPGRADES
Analytical Biochemistry,
Vol. 186, 328-331 (1990)
Carl T. Wittwer, G. Chris Fillmore, and David J. Garling
Department of Pathology University of Utah Medical School,
and Associated Regional and University Pathologists
INDEX
47
Pg. 63
RAPIDCYCLIST
NEWSLETTER
BioTechniques, Vol. 10, No.1, 76-83 (1991).
Carl T. Wittwer and David J. Garling
University of Utah Medical School
ARTICLES
Rapid cycle DNA amplification:
time and temperature optimization
SERVICE AND
MAINTENANCE
Minimizing the time required for DNA amplification by
efficient heat transfer to small samples
SAMPLE
HANDLING
Articles
SETTING UP
SAMPLE
HANDLING
Automated polymerase
chain reaction in
capillary tubes
with hot air
PROGRAMMING
Nucleic Acids Research, Vol. 17, No. 11, 4353-4357 (1989)
C.T.Wittwer, G.C.Fillmore and D.R.Hillyard
University of Utah Medical School
TROUBLE
SHOOTING
ABSTRACT
SERVICE AND
MAINTENANCE
We describe a simple, compact, inexpensive thermal cycler that can be used
for the polymerase chain reaction. Based on heat transfer with air to samples in
sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The
temperature is regulated via thermocouple input to a programmable set-point
process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller
activates a solenoid that opens a door to vent hot air and allows cool air to enter.
Temperature-time profiles and amplification results approximate those obtained
using water baths and microfuge tubes.
WARRANTY
AND UPGRADES
ARTICLES
INTRODUCTION
RAPIDCYCLIST
NEWSLETTER
Cyclic DNA amplification using a thermostable DNA polymerase allows automated amplification of primer specific DNA, widely known as the “polymerase
chain reaction” (1,2). Automation requires repetitive temperature cycling.
Commercial programmable heat blocks are available and low cost machines
using water baths with fluidic switching (3) or mechanical transfer (4) have been
described. Instead of heat transfer from metal blocks or water through high thermal resistance plastic microfuge tubes we describe a device that uses hot air for
temperature control of samples in thin glass capillary tubes.
INDEX
48
SETTING UP
SAMPLE
HANDLING
Figure 1. Drawing of
the capillary tube, hot
air DNA amplifier. l)
reaction
chamber
where a removable
stand for capillary
tubes can be placed,
2) aluminum housing,
3) air blower, 4) solenoid
mechanically
coupled to open door
on activation, 5) door,
normally held closed
with a spring, 6) temperature controller.
PROGRAMMING
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
49
SERVICE AND
MAINTENANCE
The device for temperature cycling is a closed-loop hot air chamber resembling a recirculating hair dryer (Fig. 1 and 2). The heating element is a 1000 W (125
VAC) nichrome wire coil (Johnstone Supply, Portland Oregon) wound around a
mica support. The heating coil is activated via a 25 A, 125 VAC solid state relay
(Crydom D1225, available
as Omega SSR 240 D25
through
Omega
Engineering Inc, Stamford,
CT), connected to a
Partlow MIC-6000 proportional temperature controller (available through
Omega as the CN8600
process controller) with
thermocouple input and
at least one SSR driver and
one relay output. The relay
output controls a solenoid
(Dormeyer
2A173,
Chicago, IL) mechanically
coupled to open a door
on activation that interrupts the recirculating hot
air and introduces ambi- Figure 2. Scale diagram of the amplifier. A) heating coil conent-temperature air during nected to the controller via a solid state relay, B) baffles to
the cool-down portion of uniformly mix the hot air, C) thermocouple leads connected
to controller, D) reaction chamber, E) air blower.
each cycle. The door piv-
TROUBLE
SHOOTING
MATERIALS AND METHODS
SETTING UP
SAMPLE
HANDLING
ots on a central axis and is normally held shut with a spring attached to a cam
along the central axis. Baffles are placed downstream of the heating coil to mix
the air efficiently before it reaches the sample compartment. Air is circulated
through the system with an “in-line” 75 cubic feet per minute air blower (Fasco
B75, Cassville, MO). Temperature monitoring during routine operation of the
cycler is achieved by a 30-gauge iron-constantan “J-type” thermocouple
placed just before the sample compartment in the air stream and connected to
the temperature controller. The sample compartment is a 5 cm wide x 5 cm long
x 10 cm high chamber accessible by manually opening the solenoid-controlled
door. The housing of the apparatus is formed from aluminum sheeting.
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
ARTICLES
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
The polymerase chain reaction was run in a 100 µl volume with 1 ug template
DNA, 1.5 mM of each deoxynucleotide, 50 pmol of each oligonucleotide primer
and 10% dimethyl sulfoxide in a reaction buffer consisting of 17 mM ammonium
sulfate, 67 mM Tris-HCl (pH 8.8 at 25° C), 6.7 mM magnesium chloride, 10 mM
beta-mercaptoethanol, 6.7 uM EDTA, and 170 ug/ml bovine serum albumin (5).
After denaturing the reaction mixture at 94° C for 5 minutes, 1 unit of Thermus
aquaticus polymerase (Taq polymerase - Stratagene, La Jolla, CA) was added,
the samples placed
in 10 cm long, thinwalled
capillary
tubes (Kimble, Kimax
34500), and the ends
fused with an oxygen-propane torch
so that an air bubble
was present on both
sides of the sample.
The capillary tubes
were placed vertically in a holder constructed of 1 mm
thick “prepunched
perfboard” (Radio
Shack, Fort Worth
TX). The mixture was
cycled 30 times
through denaturation (94° C - 1 min),
annealing (37° C - 2
min) and elongation
(70° C - 3 min) steps.
Temperature moni-
INDEX
50
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
The temperature profile of a sample in the cycling apparatus was compared
to that obtained by manually transferring microfuge tubes between water baths.
Response times at each phase of the thermal cycle were roughly equivalent (Fig.
3). The temperature response of samples transferred between water baths is limited only by the heat conduction properties of the microfuge tube. The response
times of commercial machines is also limited by the heat capacity of their metal
heating/cooling blocks. The air cycler has the advantage that heat transfer
occurs through a low heat capacity medium (air) that can be warmed very rapidly. The response time for sample cooling depends strongly on the heat capacity of the system materials. The current cycler was constructed from materials to
approximate the heating response of microfuge tubes transferred between
water baths. Although the current performance profile seems perfectly adequate, thinner housing material and an external fan motor (with only the blades
and shaft exposed to the circulating hot air) could give even faster response
SAMPLE
HANDLING
RESULTS AND DISCUSSION
SETTING UP
toring within the capillary tubes was done with 30-gauge J-type thermocouple
wire placed in 100 µl of deionized water and connected to a thermocouple
meter (Precision Digital PD710, Watertown, MA). Amplification products (5/100 µl)
were fractionated by electrophoresis on a 1.5% agarose gel.
A B C D E F G H
1060 bp
929
E. Coli: 560
B-Globin: 536
441
WARRANTY
AND UPGRADES
1857 bp
383
121
INDEX
51
RAPIDCYCLIST
NEWSLETTER
Figure 4. Ethidium bromide stained amplification products. Lane A shows the product of amplification in microfuge tubes manually transferred between water baths for comparison to the hot air
amplifier in lanes B-G. Lanes A-C) 560 bp fragment of E. coli DNA defined by primers TGAATCTGTACTCTGATGTAAC and CACTAATAGCAAGAGGGTACTCAG covering a portion of the regulatory
region for pyelonephritis-associated pili (6). An asymmetric amplification (50 pmol of one primer and
0.5 pmol of the other is shown in lane C. Lanes D-G) amplification products of 4 different combinations of the human ß-globin gene primers PC03, PC04 (7), KM29, and RS42 (8). Lane H) BstN I digest
of pBR322 DNA size markers (0.5 ug).
ARTICLES
205
110
SETTING UP
SAMPLE
HANDLING
times. This might allow optimization of denaturation, annealing, and elongation
steps in terms of time and temperature, and shorten the “ramp” times between
temperatures. This could decrease the time required for a complete amplification, as well as allow specific study of annealing, denaturation and enzyme kinetics within a polymerase chain reaction protocol.
PROGRAMMING
Because of the low heat capacity of air, thin glass capillary tubes were used
to contain the samples rather than plastic tubes. Attempts to amplify DNA in various plastic tubes with the air cycler were unsuccessful and temperature profiles
were sluggish. Capillary tubes require a torch to seal the ends, but this can be
readily achieved with only minimal practice. In order to obtain adequate temperature homogeneity within the sample compartment, baffles were installed
between the heating coil and the samples. With the cycler set at a constant temperature (from 70 to 95° C), simple structural baffles decreased the temperature
variation observed throughout the sample compartment from about 10° C, to 2°
C. This can be improved further by more complicated baffles if necessary .
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
Amplification products obtained with the device are qualitatively and quantitatively similar to those observed after manual water bath cycling (Fig. 4). We
have used the apparatus to amplify both bacterial and human genomic DNA.
Best results have been obtained with denaturation temperatures between 90
and 94° C. At temperatures above 94° C, amplifications are often not successful,
apparently due to enzyme denaturation. This may result from faster equilibration
of the sample at high temperature with the air cycler compared to other
machines. This would effectively expose the polymerase to the high denaturation
temperature for a longer period of time.
WARRANTY
AND UPGRADES
ARTICLES
ACKNOWLEDGEMENTS
We thank Mr. Charles Schaemal for design and construction assistance and
Dr. David Low for the E. coli probes and DNA.
RAPIDCYCLIST
NEWSLETTER
INDEX
52
SETTING UP
REFERENCES
1.
4.
Foulkes,N.S., Pandolfi de Rinaldis,P.P., Macdonnell,J.,
Cross,N.C.P. and Luzzatto,L. (1988) Nucleic Acids Res 16,
5687-5688.
5.
Kogan,S.C., Doherty,M. and Gitschier,J. (1987) N Eng J Med
317, 985-990.
6.
Blyn,L.B., Braaten,B.A., White-Ziegler,C.A., Rolfson,D.H. and
Low,D.A. (1989) EMBO, 8, 613-620.
7.
Saiki,R.K., Scharf,S., Faloona,F., Mullis,K.B., Horn,G.T.,
Erlich,H.A. and Arnheim,N. (1985) Science 230, 1350-1354.
8.
Saiki,R.K., Chang,C.A., Levenson,C.H., Warren,T.C.,
Boehm,C.D., Kazazian,H.H. and Erlich,H.A. (1988) N Eng J
Med 319, 537-541.
WARRANTY
AND UPGRADES
Rollo,F., Amici,A., and Salvi,R. (1988) Nucleic Acids Res 16,
3105-3106.
SERVICE AND
MAINTENANCE
3.
TROUBLE
SHOOTING
Saiki,R.K., Gelfand,D.H., Stoffel,S., Scharf,S.J., Higuchi,R.,
Horn,G.T., Mullis,K.B. and Erlich, H.A. (1988) Science 239, 487491.
PROGRAMMING
2.
SAMPLE
HANDLING
Mullis,K.B. and Faloona,F.A. (1987) Methods in Enzymology,
Vol. 155, Academic Press, New York, pp. 335-350.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
53
SETTING UP
SAMPLE
HANDLING
Minimizing the time required
for DNA amplification by
efficient heat transfer
to small samples
PROGRAMMING
Analytical Biochemistry,
Vol. 186, 328-331 (1990)
TROUBLE
SHOOTING
Carl T. Wittwer, G. Chris Fillmore, and David J. Garling
Department of Pathology University of Utah Medical School,
and Associated Regional and University Pathologists
SERVICE AND
MAINTENANCE
Hot-air temperature cycling of 1- to l0 µl samples in glass capillary tubes can
amplify DNA by the polymerase chain reaction in 15 min or less. A rapid temperature cycler of low thermal mass was constructed to change sample temperatures among denaturation, annealing, and elongation segments in a few seconds. After 30 cycles of 30 s each, a 536-bp, B-globin fragment of human genomic DNA was easily visualized with ethidium bromide on agarose gels. With rapid
cycling, amplification yield depended on polymerase concentration. The time
required for DNA amplification can be markedly reduced from prevailing protocols if appropriate equipment and sample containers are used for rapid heat
transfer to the sample. 1990 Academic Press, Inc.
ARTICLES
WARRANTY
AND UPGRADES
The minimum time required for DNA amplification by the polymerase chain
reaction (1,2) has not been rigorously investigated. No systematic study of optimal times for annealing, elongation, and denaturation is available because no
device has been able to change the sample temperature quickly enough to
make such study meaningful. Commercial instruments spend a significant
amount of time changing the sample temperature (3) .
RAPIDCYCLIST
NEWSLETTER
A number of commercial cyclers use aluminum blocks and microfuge tubes
to cycle temperature for the polymerase chain reaction. Standard protocols for
a 30-cycle amplification are usually 2-6 h in length, and a large fraction of this
time is spent heating and cooling the sample. Time is required both to bring the
Abbreviations used: DMSo, dimethyl sulfoxide;
dNTP, deoxynucleoside triphosphate.
INDEX
54
SETTING UP
SAMPLE
HANDLING
Figure 1. Diagram of the
rapid DNA amplifier. A horizontal section through the
air
cycler
is
shown.
Recirculating air is heated
by a 1000W coil and mixed
by fan blades while a thermocouple monitors the
airstream temperature in the
sample area and provides
input to the proportional
controller. ‘The fan motor is
mounted outside of the
airstream to decrease the
thermal mass of the system.
A solenoid-activated door
opens for rapid cooling
between denaturation and
annealing stages. The air
chamber is 10 cm in height,
10 cm in width, and 20 cm in
depth. Samples are contained in glass capillary
tubes that are placed vertically in the sample area of
the cycler.
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
INDEX
55
RAPIDCYCLIST
NEWSLETTER
An alternative approach for thermal cycling uses air for heat transfer (4-6)
and contains samples in thin glass capillary tubes (5,6). With forced-air heating
and 100 - µl samples, temperature profiles similar to those obtained by transferring microfuge tubes between water baths can be obtained (6). None of the aircycling systems have capitalized on the potential for even faster response times.
Our objective was to see if amplification times could be significantly reduced by
decreasing both the heat capacity of the air-cycling system and the sample volume.
ARTICLES
sample block to temperature and to transfer heat to the sample through a
microfuge tube (3). These systems have limited response times because of high
heat capacity of the metal blocks and low heat transfer through thick plastic
microfuge tubes.
SETTING UP
MATERIALS AND METHODS
SAMPLE
HANDLING
The rapid air cycler is based on a previously described design (6). Its thermal
mass was reduced by using thin aluminum sheeting for the housing and placing
the fan motor (3000 rpm, 1/40 HP, ball bearing C-frame motor No. 4M080,
Grainger, Salt Lake City, UT) outside of the airstream (Fig. 1). The fan blades (3.5in aluminum No. 2C951, Grainger) were placed downstream from the heating
coil to mix the heated air before reaching the samples. Up to 30 capillary tubes
could easily be placed in the sample compartment. The sensing thermocouple,
proportional temperature controller, and solenoid-activated door (for cooling
with ambient air) have been previously described (6).
PROGRAMMING
TROUBLE
SHOOTING
The proportional controller was programmed to obtain desired cycle times of
20, 30, 60,120, and 180 s. The temperature response of the sample was recorded
from the analog output of a BAT-12 temperature monitor (Sensortek, Clifton, NJ)
connected to a miniature thermocouple (IT-23, 0.005-s time constant, Sensortek)
placed within a 10-µl sample in a microcapillary tube (KIMAX 46485-1, Kimble,
Vineland, NJ).
SERVICE AND
MAINTENANCE
ARTICLES
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
DNA amplification was performed with 50 mM Tris, pH 8.5 (at 25°C), 3 mM
MgC12, 20 mM KCI, 500 ug/ml bovine serum albumin, 5% DMSO, 0.5 ,uM each of
the human B-globin genomic primers KM29 and RS42 (7), 0.5 mM of each dNTP,
50 ng of placental human genomic DNA, and 0.1 -0.8 U of Taq polymerase/10 µl.
One unit (U) of polymerase activity was the amount of enzyme required to incorporate 10 nmol of [3H]dTTP in 30 min at 80°C as defined by the manufacturer
(Stratagene, La Jolla, CA). All other reagents were from Sigma (St. Louis, MO). The
DMSO, KCI, albumin, and MgC12 concentrations were optimized by individual
titrations for amplifying the KM29/RS42 primer pair region of genomic DNA.
Samples (10 µl) were placed in 8-cm capillary tubes (KIMAX 46485-1) and the
ends fused with an oxygen-propane torch. Samples of 100 µl were placed in larger diameter l0-cm tubes (KIMAX 34500). The capillary tubes were placed vertically in the sample area of the rapid air cycler. The temperature of the samples
was cycled 30 or 40 times through denaturation, annealing, and elongation steps
of 90-92°C, 50-55°C, and 71-73°C, respectively, for the times indicated in individual experiments. Amplification products (9 µl unless indicated otherwise) were
fractionated by electrophoresis on a 1.5% agarose gel and visualized with ethidium bromide and uv transillumination.
INDEX
56
SETTING UP
RESULTS
SAMPLE
HANDLING
The temperature response of 10-u1 samples during 30- and 60-s cycles of the
rapid air cycler is shown in Fig. 2 and Fig. 3, respectively. The annealing segment
of each temperature profile is a spike corresponding to cooling of the sample
with ambient air. The denaturation segment of the 30-s cycle is also a spike with
very little time spent at the high temperature. The major difference between the
30- and the 60-s cycles is the length of the elongation segment. Some oscillation
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
Figure 3. Sample temperature during a
60-s cycle. Conditions of measurement
were as described in Fig. 2.
INDEX
57
RAPIDCYCLIST
NEWSLETTER
Figure 2. Sample temperature during
a 30-s cycle. Chart recording of the
analog output of a BAT-12 temperature monitor with an IT-23 thermocouple probe (time constant 0.005 s,
Sensortek, Clifton NJ). The thermocouple was placed in 10 µl of water within
a microcapillary tube.
Figure 4. Micro DNA amplification.
Ethidium bromide-stained amplification
products of human genomic DNA
delimited by the ß-globin primers KM29
and RS42(7). From 1- to l00-µl samples
were amplified in capillary tubes using
40 cycles of amplification (1 min at
90°C, 1 min at 55°C, 1 min at 72°C) and
the air cycler previously described (6).
The resulting product, 1 to 10 µl, was
applied to a 1.5% agarose gel.
PhiX 174 RF Haelll Digest
536 bp
603 bp
310 bp
Amount per slot (µl)
10
Amount Amplified (µl) 1 0 0
Figure 5. Rapid DNA amplification is
dependent on polymerase concentration. The total amplification time was 20
min and consisted of 40 30-s cycles as
shown in Fig. 2. The amount of Taq polymerase varied from 0.1 to 0.8 U in each
10-µl sample.
10
10
5
5
2
2
1
1
PhiX 174 RF Haelll Digest
536 bp
603 bp
310 bp
8
4
2
1
ARTICLES
[Taq] Units per 100 µl
Figure 6. Rapid DNA amplification.
Each 10-u1 sample contained 0.8U of
Taq polymerase and 30 cycles of amplification were performed.Sample temperature profiles for the 15- and 30-min
amplifications are given in Figs. 2 and 3,
respectively. Other temperature profiles are described in the text.
PhiX 174 RF Haelll Digest
536 bp
603 bp
RAPIDCYCLIST
NEWSLETTER
310 bp
90
60
30
15
10
Total Amplification
Time (min)
INDEX
58
around the elongation temperature is evident in the 60-s cycle from the proportional controller. Temperature profiles for the 20s cycle showed only a slight inflection at a sample elongation temperature of 72°C (not shown). The 120-s and 180s cycles had elongation times twice their denaturation times (not shown).
Samples of 10 µl can be amplified with a yield equivalent to l00 µl samples in
the air cycler (Fig. 4). In capillary tubes, the amplification volume can be
reduced to 1 µl with the product still detected by ethidium bromide staining in
agarose gels.
Gels from rapid amplifications are shown in Figs. 5 and 6. In Fig. 5, the
dependence of amplification on polymerase concentration is shown for 30-s
cycles. Band intensity is strongly dependent on the amount of polymerase
added. Figure 6 shows that although amplification efficiency is reduced with
extremely rapid cycling, significant amplification still occurs after a total amplification time of only 10 min. Control samples without template DNA or polymerase
did not show visible bands ( not shown) .
DISCUSSION
The advantages of an air-cycling system for DNA amplification include simplicity, low cost, and rapid temperature cycling. Air is an ideal heat transfer medium which can change temperature quickly because of its low density. Air can he
rapidly mixed with baffles (6) or by a fan (Fig. l) to provide homogeneous temperature exposure over the sample containers. The low thermal conductivity of
air requires that air be rapidly blown past the heating coils and sample containers for efficient heat transfer.
Annealing and denaturation are claimed to occur almost instantaneously
once the sample has reached the appropriate temperature (3). Classical kinetic
studies on DNA renaturation (8,9) also predict rapid annealing because of the
high primer concentration used in DNA amplification. However, to our knowledge, this has not previously been tested. Our results suggest that denaturation
59
ARTICLES
Any temperature cycling protocol for DNA amplification can be divided into
six segments: three endpoint temperatures and three temperature transitions.
Time spent in transition is usually wasted, although theoretically a slow transition
between annealing and elongation may be useful for a poorly annealing primer.
Transition times after elongation and denaturation have no function; the faster
the sample can be cooled after denaturation the better. Rapid cooling after
denaturation favors the kinetic process (primer annealing to template/product)
over the equilibrium process (product dimerization).
and annealing do in fact occur very quickly in DNA amplification, with good
amplification occurring even when the denaturation and annealing segments
are reduced to spikes ( Figs. 2, 5, and 6). The polymerase chain reaction need not
take hours to perform; with appropriate temperature cycling equipment, DNA
amplification can occur in minutes.
The ultimate limit of how fast DNA amplification can occur is not answered
by this study. The times required for denaturation and annealing are apparently
minimal. Primer extension is not instantaneous and the elongation time required
depends on the length of the amplified product. Taq polymerase is highly processive with an extension rate of >60 nucleotides/s at 70°C (10). The large effect
of polymerase concentration on band intensity with rapid cycling (Fig. 5) suggests
that polymerization time becomes the limiting factor at very short cycle times (Fig.
6).
For rapid temperature cycling, the sample container is just as important as
the thermal cycler. An optimal sample container should be water-vapor tight and
have (i) low thermal mass, (ii) good thermal conductivity, (iii) minimal internal
condensation, (iv) easy sample recovery without cross contamination, and (v) no
inhibition of DNA amplification. Whatever the container, temperature equilibration will always be achieved faster if the sample volume is small, if the container
wall is thin, and if the surface-to-volume ratio of the sample exposed to the container wall is high. Problems with condensation can be reduced by minimizing the
free air space surrounding the sample.
ARTICLES
Microfuge tubes are kept water-vapor tight by mechanical closure and, if
necessary, overlaid mineral oil. Thermal conductivity is poor because of the
material and its thickness (ca. 1 mm). Internal condensation can occur if mineral
oil is not used and particularly if different parts of the tube are at different temperatures (which depends on the temperature cycler configuration).
In contrast, glass capillary tubes are made vapor tight by flame closure of the ends. They conduct heat to the sample better than microfuge tubes
because of decreased wall thickness (ca. 0.2 mm) and a better surface-to-volume ratio. Dead air space can be minimized to prevent significant condensation.
Different diameter capillary tubes can be chosen for the sample volume desired.
Decreasing the heat capacity of the cycling system can markedly decrease
the total time required for the polymerase chain reaction. In addition, air cycling
and miniaturization significantly decrease the cost of DNA amplification. There
may be other advantages of rapid cycling; decreased annealing and denaturation times should theoretically reduce nonspecific amplification and polymerase inactivation, respectively.
60
When the temperature response of the cycler and thermal equilibration of
the sample are not limiting, questions about optimal temperatures and times for
DNA amplification can be answered to much greater accuracy than before. The
physical processes of denaturation and annealing and the enzymatic process of
elongation can be specifically studied, without the confounding effects of long
transitions between temperatures. This should lead to a more detailed understanding of DNA amplification and improved reaction efficiency and specificity.
ACKNOWLEDGMENT
We thank Mr. Charles Schamel for design and
construction assistance.
ARTICLES
61
SETTING UP
ARTICLES
REFERENCES
1.
Mullis, K. B ., and Faloona, F. A. ( 1987) in Methods in
Enzymology (Wu, R., Eds.), Vol. 155, pp. 335-350, Academic
Press, San Diego.
2.
Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi,
R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988)
Science 239, 487-491 .
3.
Saiki, R. K. (1989) in PCR Technology (Erlich, H. A., Ed.),
pp. 7 1 6, Stockton Press, New York.
4.
Hoffman, L. M., and Hundt, H. (1988) BioTechniques 6,
932-936.
5.
Cao, T. M. (1989) BioTechniques 7, 566-567.
6.
Wittwer, C. T., Fillmore, G. C., and Hillyard, D. R. (1989)
Nucleic Acids Res. 17, 4353 4357.
7.
Saiki, R. K., Chang, C. A., Levenson, C. H., Warren, T. C.,
Boehm, C. D., Kazazian, H. H., and Erlich, H. A. (1988) N
Engl. J. Med. 319, 537-541.
8.
Smith, M. (1983) in Methods of RNA and DNA Sequencing
(Weissman, S. M., Ed.), pp. 23-68, Praeger Press,New York.
9.
Wetmur, J. G., and Davidson, N. ( 1968) J. Mol. Biol. 31, 349370. 10. Innis, M. A., Myambo, K. B., Gelfand, D. H., and
Brow, M. A. D. (1988) Proc. Natl. Acad. Sci. USA 85, 94369440.
INDEX
62
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Rapid temperature cycling with hot air allows rigorous optimization of the
times and temperatures required for each stage of the polymerase chain reaction. A thermal cycler based on recirculating hot air was used for rapid temperature control of 10 µl samples in thin glass capillary tubes with the sample temperature monitored by a miniature thermocouple probe. The temperatures and
times of denaturation, annealing, and elongation were individually optimized for
the amplification of a 536-base pair ß-globin fragment from human genomic
DNA. Optimal denaturation at 92°-94°C occurred in less than one second; yield
decreased with denaturation times greater than 30 seconds. Annealing for one
second or less at 54°-56°C gave the best product specificity and yield. Non-specific amplification was minimized with rapid denaturation to annealing temperature transition (9 seconds) as compared to a longer transition (25 seconds). An
elongation temperature of 75°-79° C gave the greatest yield and increased yields
were obtained with longer elongation times. Product specificity was improved
with rapid air cycling when compared to slower conventional heat block cycling.
Rapid thermal control of the temperature-dependent reaction in DNA amplification can improve product specificity significantly while decreasing the required
amplification time by an order of magnitude.
PROGRAMMING
ABSTRACT
SAMPLE
HANDLING
BioTechniques, Vol. 10, No.1, 76-83 (1991).
Carl T. Wittwer and David J. Garling
University of Utah Medical School
SETTING UP
Rapid cycle DNA amplification:
time and temperature optimization
ARTICLES
INTRODUCTION
INDEX
63
RAPIDCYCLIST
NEWSLETTER
Automated in vitro DNA amplification with a heat stable DNA polymerase
requires temperature cycling of the sample (11,14). Temperature transition rates
in commercial instruments are usually less than 1° C/s when metal blocks or water
are used for thermal equilibration and samples are contained in plastic microcentrifuge tubes (10,12). A significant fraction of the cycle time is spent heating
and cooling the sample, as opposed to being spent at optimal denaturation,
annealing, and elongation temperatures. Extended amplification times of 2-6
hours are common, and long transition times make it difficult to determine opti-
SETTING UP
mal temperatures and times for each stage. Instantaneous temperature changes
are not possible because of sample, container and cycler heat capacities.
SAMPLE
HANDLING
We have recently constructed a rapid cycling system of low heat capacity
based on heat transfer by hot air to samples contained in thin glass capillary
tubes (20,21). Amplified product from genomic DNA can be easily visualized with
ethidium bromide on agarose gels after a total amplification time of 15 min or less
(21). The rapid temperature response of this instrument allows systematic study of
the times and temperatures required for annealing, elongation, and denaturation in DNA amplification because transition times can be reduced to a minimum.
PROGRAMMING
MATERIALS AND METHODS
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
ARTICLES
WARRANTY
AND UPGRADES
DNA amplification was performed in 50 mM Tris, pH 8.5 (25°C), 3 mM MgC12,
20 mM KCl, 500 µg/ml bovine serum albumin, 0.5 µM each of the human ß-globin
genomic primers RS42 and KM29 (13), 0.5 mM of each deoxynucleoside triphosphate (dNTP), 2.5% (wt/vol) Ficoll® 400, 50 ng of human genomic DNA, and 0.4 U
of Taq polymerase per 10 µl unless specified otherwise. Although 5% dimethyl sulfoxide (DMSO) was used with this primer pair in our previous study (21), it was omitted here because of its reported effect on polymerase activity (4). Tartrazine (l
mM) or xylene cyanole (0.02% wt/vol) was sometimes added to the reaction mixture for easy visualization. Ficoll 400 and the indicator dyes could be added to
the reaction mixture at the concentrations listed without significantly affecting
product yield or specificity. Ten times stock solutions of the primers, dNTPs, and
DNA contained 10 mM Tris, pH 8.0 and 0.1 mM EDTA. Human genomic DNA (50
µg/ml) was denatured for 1 min by boiling and then rapidly cooled on ice before
use in amplification. One unit of polymerase activity was the amount of enzyme
required to incorporate 10 nmol of dNTPs in 30 min at 74°C as defined by the
manufacturer (Promega, Madison, Wl). All other reagents were from Sigma
Chemical (St. Louis, MO).
RAPIDCYCLIST
NEWSLETTER
A single amplification mixture was used for all samples viewed on one gel. Taq
polymerase was accurately measured with a 1-µl microcapillary pipet
(Microcaps®, Drummond Scientific, Broomall, PA) and diluted in 10 mM Tris, pH
8.5, 100 µg/ml bovine serum albumin if necessary. Samples (10 µl) were placed in
8-cm lengths of microcapillary tubing (KIMAX 46485-1, Kimble, Vineland, NJ), and
the ends were sealed with a Bunsen burner. A 1-2-cm column of air on each side
of the sample allowed easy sealing (and opening) of the tubes. Thirty cycles of
DNA amplification performed in a custom-made hot-air thermal cycler. Inclusion
of Ficoll 400 and a dye (tartrazine or xylene cyanole) into the amplification mixture allowed samples to be directly emptied into wells of a l.5% agarose gel (using
INDEX
64
100
97
91
88
85
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
65
WARRANTY
AND UPGRADES
The hot air cycler uses a solenoid-activated
door to allow room temperature air to cool the
samples between denaturation and annealing
(21). Under normal operation, a low-temperature
“spike” occurs at the annealing temperature with
a quick rebound to the elongation temperature.
With the door open, the airstream and sample
temperatures are not in equilibrium with the system (aluminum housing, fan blades, heating coil)
so when the door closes, the sample temperature
is quickly increased by heat transfer from the system back to the airstream and sample. This has
previously prevented study of extended annealing times or low elongation temperatures. This limitation was overcome by only partly opening the
solenoid-activated door, resulting in partial air recirculation and a slower denaturation to annealing transition. The transition time was increased from 9 to 20-25 s
and the system and sample were in temperature equilibrium when the door
closed. This allowed annealing times at 54°-56°C longer than 1 s (Figure 4) and
elongation temperatures below 70°C ( Figure 5 ) .
SERVICE AND
MAINTENANCE
Figure 1. Effect of denaturation temperature on DNA amplification yield.
DNA amplification was performed for
30 cycles as described in Materials
and Methods except that the denaturation temperature was varied from
85-103 C. Temperatures greater than
boiling could be attained because
sealed capillary tubes were used for
sample containment. The denaturation time at each temperature (+/- 1°
C) was 1 sec or less, the total amplification time was 14-16 mln, and the
temperature-time profiles approximated that shown in Figure 7D. Ethidium
bromide-stained amplification products of human genomic DNA delimited by the beta-globin primers RS42
and KM29 (7) were electrophoresed
on a 1.5% agarose gel.
TROUBLE
SHOOTING
PhiX 174 RF
Hae III Digest
PROGRAMMING
94
The hot-air thermal cycler (20) and modifications necessary for rapid cycling (21) have been
previously described. The temperature response of
the sample was recorded with a miniature thermocouple (IT-23, 0.005 s time constant, Sensortek,
Clifton, NJ). Unless otherwise specified, the times
and temperatures of the sample for each amplification stage were as follows: denaturation, 1 s at
92°-94° C; annealing, 1 s at 54°-56°C; and elongation, 10 s at 75°-79 ° C. Transition times were usually as follows: denaturation to annealing (92°56°C), 9 s; annealing to elongation (56°-75° C), 4 s;
and elongation to denaturation (79°-92°C), 5 s.
SAMPLE
HANDLING
103
Captrol III, Drummond Scientific), electrophoresed
and viewed with ethidium bromide/UV transillumination. All experiments included a control without
genomic DNA where no amplification was
observed.
SETTING UP
Denaturation Temperature (ºC)
SETTING UP
SAMPLE
HANDLING
The time or temperature of individual amplification stages was varied systematically as indicated in each figure. The optimum temperature was first determined, and then the effects of varying the time at that temperature were investigated. Finally, rapid cycling was compared to conventional heat block cycling
using an identical amplification mixture.
RESULTS
PROGRAMMING
TROUBLE
SHOOTING
Using the RS42/KM29 primer pair for amplifying a 536-base pair fragment of ß-globin
from human genomic DNA, the effects of
varying temperatures and times for denaturation, annealing, and elongation were studied.
Figure 1 shows that momentary denaturation
(<1 s) at 91°-97° C was adequate for DNA
amplification. Little amplification occurred
with a denaturation temperature below 91°C,
presumably because of inadequate strand
separation. Above 97° C product amplification was also minimal. Figure 2 shows equivalent amplification with denaturation times
from 1-16 s when the denaturation temperature was 92°-94° C. Decreased yield with long
denaturation time (>30 s) or high denaturation
temperatures may be secondary to polymerase inactivation, or to compromise of
other reaction components (dNTP breakdown, albumin coagulation, etc.).
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
Denaturation Temperature (ºC)
<1
2
4
8
16
32
64
PhiX 174 RF
Hae III Digest
Figure 2. Effect of denaturation time
on DNA amplification yield. The
denaturation time at 92-94°C was varied from 1-64 sec. Other conditions
were as given in Figure 1.
RAPIDCYCLIST
NEWSLETTER
The optimal annealing temperature was
about 55° C (Figure 3). Lower annealing temperatures resulted in decreased yield of the desired product and an increase in
nonspecific amplification. Little specific amplification occurred at an annealing
temperature of 40°C. Although nonspecific amplification was minimized at temperatures > 55° C , desired product yield also decreased, presumably because
of incomplete annealing. Figure 4 shows that the shortest possible annealing time
(<l s ) and the fastest denaturation to annealing transition (9 s ) gave the highest
yield and the least nonspecific amplification.
The optimal elongation temperature was between 75°-79°C with little amplification above 80°C or below 70°C (Figure 5). Longer elongation times increased
product yield as shown in Figure 6, although the increase in yield appeared to
plateau after 40-80 s.
INDEX
66
SETTING UP
SAMPLE
HANDLING
PROGRAMMING
Figure 7 compares the 30-cycle amplification product obtained with four different temperature profiles. Conventional heat block/microcentrifuge tube
cycling was used in Figure 7A and 7B. The transitions between temperatures were
relatively slow and many nonspecific amplification bands were present.
Nonspecific amplification was reduced by limiting the time at each temperature
(Figure 7B compared to Figure 7A). Using rapid hot air cycling (Figures 7C and 7D)
nonspecific amplification was dramatically reduced. Easily visible specific product was apparent using only a 10 s elongation (Figure 7D), although extending
the elongation time to 60 s did increase the yield ( Figure 7C ) .
TROUBLE
SHOOTING
Annealing Temperature (ºC)
70
Annealing Time
at 55ºC (sec)
<1
65
25
<1
60
25
5
55
25
10
25
20
25
40
25
80
45
WARRANTY
AND UPGRADES
9
SERVICE AND
MAINTENANCE
Ramp Time
29 to 55ºC (sec)
40
Figure 4. Effect of annealing time, and denaturation to annealing transition time on DNA amplification yield. The denaturation to annealing
transition time was either 9 sec (door completely
open) or 25 sec (door partially open). The
annealing time at 54-56 C° was varied from 1-80
sec. Other conditions were as given in Figure 3.
INDEX
67
RAPIDCYCLIST
NEWSLETTER
Figure 3. Effect of annealing temperature on DNA amplification yield.
Amplification was performed for 30
cycles as described in Materials and
Methods except that the annealing
temperature was varied from 40 to
70°C. The annealing time at each
temperature (+/- 1°C) was <1 sec.
PhiX 174 RF
Hae III Digest
ARTICLES
PhiX 174 RF
Hae III Digest
SETTING UP
Elongation Temperature (ºC)
Elongation Time at 77 (ºC) sec
160
83
80
79
40
75
20
71
10
67
5
63
2.5
PhiX 174 RF
Hae III Digest
PhiX 174 RF
Hae III Digest
Figure 5. Effect of elongation temperature on DNA amplification yield.
Amplification was performed as
described in Materials and Methods
except for the following: the elongation temperature was varied from 63
to 87°C, the elongation time was
extended to 40 sec to decrease the
“artifact” of transitions to and from the
elongation temperature, only 0.1 U of
polymerase was used per 10 µl reaction, and a 20-sec denaturation to
annealing transition time was used.
Figure 6. Effect of elongation time on
DNA amplification yield. The elongation time at 75-79°C was varied from
2.5-160 sec., a 9 sec denaturation to
annealing transition and 0.4 U polymerase per 10 µl amplification mixture
were used. Other conditions were as
given in Materials and Methods.
SAMPLE
HANDLING
87
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
DISCUSSION
RAPIDCYCLIST
NEWSLETTER
It is well recognized that DNA amplification is critically dependent on the
sample temperature-time profile. However, a precise description of this profile is
seldom achieved. Often, heat block temperatures are used instead of actual
sample temperatures. The temperature of a 100 µl sample within a microcentrifuge tube in a heat block instrument reportedly lags 20 s behind the heat block
temperature (12). In a representative commercial instrument, we found that 35 s
were required for the sample to reach the block temperature (Figure 7B and legend). This lag time may vary with the exact position of the tube in the heat block,
as uneven heating and cooling have been reported (8,22).
The actual sample temperature can be monitored by a thermocouple probe
in the sample. The probe needs to be small enough so that it does not significantly affect the temperature response. The thermocouple should be positioned
to accurately reflect the sample temperature, which is presumably homoge-
INDEX
68
SETTING UP
SAMPLE
HANDLING
Figure 7. Effect of sample temperature-time profiles on product
specificity. Samples were cycled
30 times through profiles A, B, C or
D and 10 µl of the product electrophoresed and viewed by
ethidium
bromide
staining.
Profiles A and B were obtained
using a commercial heat block
instrument (Perkin-Elmer Cetus
Thermal Cycler) set to “Step
Cycle” mode (fastest possible
transition times). Mineral oil (60 µl)
was used to overlay 100 µl samples contained in microfuge
tubes as recommended by the
manufacturer. Samples were
placed in a center well (D-5) and
sample temperature profiles
determined with a miniature
thermocouple probe. Profile A
resulted when the instrument was
programmed to denature at 93
C for 1 min, anneal at 55°C for 2
min, and elongate at 74°C for 3
min. Profile B was obtained by
modifying the program to minimize sample times at each temperature (35 sec at 55 C, 45 sec
at 77 C, and 35 sec at 93°C). The
rapid air cycler was used for profiles C and D. In profile C a 1 min
elongation time at 77° C was
used. Profile D uses a 10 sec elongation time at 77°C and is the 30
sec base profile described in
Materials and Methods.
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
INDEX
69
ARTICLES
neous. Homogeneity of sample temperature is better with small samples and with
symmetric, high surface area-to-volume containers. Small, thin capillary tubes are
ideal; microcentrifuge tubes are not. Capillary tubes can be sealed with a Bunsen
burner in less time than it takes to overlay the sample with mineral oil and close a
microcentrifuge tube. After amplification, the ends of the glass capillaries can be
quickly scored with a file and snapped off easily with less risk of aerosolization and
contamination than microcentrifuge tubes. The capillary tubes serve both as a
SETTING UP
SAMPLE
HANDLING
transfer pipette and a container for temperature cycling. The amplified sample,
already containing Ficoll and an electrophoresis indicator dye, can be directly
emptied into a gel well without exposure to an intermediate pipette tip or to
extraction procedures.
PROGRAMMING
A common protocol for DNA amplification is 1 min at 94° C for denaturation,
2 min at 55° C for annealing, and 3 min at 72° C for elongation (16). If instantaneous temperature transitions were possible, one cycle would take 6 min.
However, in conventional heat block machines it takes perhaps an additional 2
min to change the block temperature during each cycle (Figure 7A). When both
heat block temperature transitions and sample time lags are considered, about
4 out of 8 min in each cycle, or 50% of the time is spent changing the sample temperature (Figure 7A). When rapid cycling or “turbo polymerase chain reaction” is
attempted in conventional machines, the sample may be in continuous temperature transition (Figure 7B). It is understandably difficult to optimize the time/temperature settings for the three stages of DNA amplification when the sample temperature is always changing.
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
Recently, there has been a trend toward faster protocols for DNA amplification (5,15). Denaturation and annealing are claimed to occur “almost instantaneously” or “within a few seconds” once the appropriate temperatures have
been reached by the sample (5,12,15). Adequate denaturation does appear to
occur in less than 1 s (Figure 2) as long as the DNA is denatured by boiling before
amplification is begun. Thoroughly boiling the template DNA before amplification is apparently necessary when very short denaturation times are used during
cycling.
ARTICLES
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
An annealing time of less than 1 sec was also found optimal (Figure 4). Kinetic
studies on DNA renaturation predict rapid annealing because of the high primer
concentration used in DNA amplification (18,19). Product yield and specificity
were improved with shorter annealing times and faster denaturation to annealing transitions. Current commercial machines are limited to temperature transitions of less than 1°C/s for a total transition time (90°-55°C) of at least 35 s. In addition, most protocols call for an annealing time of 20-120 s According to Figure 4,
poor specificity would be expected under these conditions. Experimentally, relatively poor specificity was seen when slow heat block amplifications (Figure 7A
and 7B) were compared to rapid cycling amplifications (Figure 7C and 7D).
Although short denaturation and annealing times appear desirable, decreasing the elongation time can limit product yield. Primer extension is not instantaneous; Taq polymerase has an extension rate of 35-100 nucleotides/s at 72°C
(5,6). As elongation times are decreased, product yields are eventually compromised (Figure 6). For the RS42/KM29 primer pair, a 10-s elongation time (total
INDEX
70
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
The amplification volume can be scaled up as desired to 25, 50 or 100 µl.
Flexible silica capillary tubing as currently used in capillary electrophoresis can be
coiled to provide a wide range of volumes with excellent heat transfer characteristics. A less expensive alternative is to use rigid glass capillaries of larger diameter. Temperature transitions and total amplification times are somewhat longer
with larger diameter tubes. For example, while a 10-µl sample can be amplified
in a 0.52-mm-i.d. tube in 15 min (base profile described in Materials and
Methods), a 20-40-µl sample takes 20 min in a 0.96-mm tube, and a 50-100-µl sample takes 25 min in a 1.26-mm tube.
PROGRAMMING
The optimal annealing temperature for DNA amplification depends on the
base content, nucleotide sequence and length of the primers and is related to
the primer TM (5,12). Equations are available for estimating oligonucleotide TMs
(7). However, in DNA amplification adjustments for lower monovalent cation
concentration (17) and higher [Mg++] (3) are necessary. In our buffer system (20
mM KCl and 3 mM MgCl2) with the RS42/KM29 primer pair, the optimal denaturation temperature was around 92°-94°C (Figure 1), and an annealing temperature of about 55°C resulted in maximal specificity and yield (Figure 3). The
propensity to anneal can most accurately be described by nearest-neighbor
base-stacking interactions (1). The free energy released on heteroduplex formation should be related to the required annealing temperature in DNA amplification. The "mean stacking temperature" of an oligo has been correlated with the
temperature at which 50% hybridization occurs (9). This "T50-hyb" for the RS42
and KM29 primers averages 59°C and 51°C for the two buffers investigated (9),
close to the optimal 55°C annealing temperature found for DNA amplification in
our system.
SAMPLE
HANDLING
The amplification yield was greatest at an elongation temperature of 75°79°C (Figure 5). This is a higher elongation temperature than conventionally
employed, but is nearer the reported temperature optimum for the enzyme (2).
Surprisingly, some 536-base pair product was detected even with an elongation
time of 2.5 s at 75°-79°C (Figure 6). Elongation rates in DNA amplification may be
higher at 75°-79°C than at 72°C and some elongation is expected to occur during temperature transitions.
SETTING UP
amplification time of 15 min for 30 cycles) gives a moderately strong, specific
band (Figures 6 and 7). If desired, the elongation time can be further reduced
while maintaining product yield by increasing the concentration of polymerase
(21). However, if maximal yield is more important than rapid amplification, total
amplification times of less than 15 min will seldom be of practical value.
The choice of buffer and reactant concentrations in Figure 7 were optimized
for rapid cycling. Other buffer systems may give a single specific band with conINDEX
71
SETTING UP
SAMPLE
HANDLING
ventional slower cycling. For instance, the rapid cycling buffer included 500 µM
dNTPs rather than 200 µM dNTPs which may decrease expected specificity.
Nevertheless, using identical reactant concentrations (the same "master mix"),
the relative specificity of rapid cycling was surprisingly superior to slower cycling.
PROGRAMMING
Other modification in the buffer used deserve brief comment. Bovine serum
albumin was required for amplification in capillary tubes. No amplification was
obtained with gelatin, perhaps because of surface denaturation of the polymerase on the large surface area of the tube. Inclusion of Ficoll and an indicator dye in the amplification mixture is convenient and to our knowledge has not
been previously reported. Xylene cyanole or tartrazine can be used as dyes, but
bromphenol blue strongly inhibits the amplification reaction.
TROUBLE
SHOOTING
Increased specificity of DNA amplification by rapid cycling should be useful
in sequencing, mutation detection and infectious disease diagnosis. With
improved specificity, simple agarose gel electrophoresis may be sufficient for
diagnosis in many cases without use of a probe internal to the primers. However,
high specificity is not always desirable. Relatively low specificity is required when
consensus primers are used to detect a group of related or rapidly mutating
sequences or when the sequence to be amplified is not precisely known.
Therefore, rapid cycling may be less suitable than slower, conventional cycling
when primers have one or more mismatches with the template and equal amplification is desired. Conversely, better discrimination of mismatches should be
attainable with rapid cycling.
SERVICE AND
MAINTENANCE
ARTICLES
WARRANTY
AND UPGRADES
This study was based entirely on a single primer pair for DNA amplification .
However, we have also used rapid cycling to amplify the DNA defined by 20 different primer pairs from 6 different genes. The GC content of the primers varied
from 23%-90% and the product lengths ranged from 80-1400 base pairs. The
increased temperature/time definition of rapid cycling may allow rigorous correlation of the free energy released by nearest-neighbor base-stacking interactions
with optimal annealing temperatures. This could be incorporated into an expert
system for DNA amplification that suggests time, temperature and reaction conditions for any given primer pair.
RAPIDCYCLIST
NEWSLETTER
Unfortunately, we are not aware of any rapid temperature cyclers that are
commercially available. The apparent advantages of rapid cycling include
decreased amplification times, increased specificity and decreased reagent
cost because of smaller reaction volumes. Until the biomedical community and
commercial manufacturers realize the advantages of rapid cycling, the technique will only be available to those willing to build, calibrate and optimize their
own machines.
INDEX
72
SETTING UP
ACKNOWLEDGMENTS
Chien, A., D.B. Edgar, and J.M.Trela, 1976. Deoxyribonucleic
acid polymerase from the extreme thermophile Thermus
aquaticus. J. Bacteriol. 127:1550-1557.
3.
Dove, W.F. and N. Davidson. 1962. Cation effects on the
denaturation of DNA. J. Mol. Biol. 5:467-478.
4.
Gelfand, D.H. and T.J. White. 1990. Thermostable DNA
polymerases, p. 129-141. In M. A. Innis, D.H. Gelfand, J. J.
Sninsky and T. J. White (Eds.), PCR Protocol: A Guide to
Methods and Applications. Academic Press, San Diego.
5.
Innis, M.A. and D.H. Gelfand. 1990. Optimization of PCRs, p.
3-12. In M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White
(Eds.), PCR Protocols: A guide to methods and applications.
Academic Press, San Diego.
6.
Lathe, R. 1985. Synthetic oligonucleotide probes deduced
from amino acid sequence data: Theoretical and practical
considerations. J. Mol. Biol. 183:1-12.
8.
Linz, U. 1990. Thermo-cycler temperature variation invalidates
PCR results. BioTechniques 9:286-293.
INDEX
73
RAPIDCYCLIST
NEWSLETTER
7.
ARTICLES
Innis, M.A., K.B. Myambo, D.H. Gelfand and M.A.D. Brow. 1988.
DNA sequencing with Thermus aquaticus DNA-polymerase and
direct sequencing of polymerase chain reaction-amplified DNA.
Proc. Natl. Acad. Sci. USA 85:9436-9440.
WARRANTY
AND UPGRADES
2.
SERVICE AND
MAINTENANCE
Breslauer, K.J., R. Frank, H. Blocker and L.A. Marky. 1986.
Predicting DNA duplex stability from the base sequence.
Proc. Natl. Acad. Sci. USA 83:3746-3750.
TROUBLE
SHOOTING
1.
PROGRAMMING
REFERENCES
SAMPLE
HANDLING
We thank Mr. Charles Schamel for design and construction assistance of the
hot air thermal cyclers, Dr. David Hillyard for helpful discussions and encouragement and Robert Brower for the figure illustrations.
SETTING UP
9.
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
McGraw, R.A., E.K. Steffe and S.M. Baxter. 1990. Sequencedependent oligonucleotide-target duplex stabilities: rules
from empirical studies with a set of twenty-mers.
BioTechniques 8:674-678.
RAPIDCYCLIST
NEWSLETTER
10.
McLeod, A. 1990. A comparison of thermo-cycling devices for
automating the polymerase chain reaction. J. Med. Eng.
Technol. 14:60-68.
11.
Mullis, K.B. and F.A. Faloona. 1987. Specific synthesis of DNA
in vitro via a polymerase-catalyzed chain reaction. Methods
in Enzymol. 155:335-350.
12.
Saiki, R.K. 1989. The design and optimization of the PCR, p. 7-16.
In H. A. Erlich (Ed.), PCR Technology. Stockton Press, New
York.
13.
Saiki, R.K., C.A. Chang, C.H. Levenson, T.C. Warren, C.D.
Boehm, H.H. Kazazian and H.A. Erlich. 1988. Diagnosis of sickle
cell anemia and beta-thalassemia with enzymatically
amplified DNA and nonradioactive allele-specific
oligonucleotide probes. N. Engl. J. Med. 319:537-541.
14.
Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T.
Horn, K.B. Mullis and H.A. Erlich. 1988. Primer-directed
enzymatic amplification of DNA with a thermostable DNA
polymerase. Science 239:487-491.
15.
Saiki, R.K., U.B. Gyllensten and H.A. Erlich. 1988. The
polymerase chain reaction, p.141-152. In K.E. Davies (Ed.),
Genome Analysis: A Practical Approach. IRL Press, Washington, DC.
16.
Sambrook, J., E.F. Fritch and T. Maniatis. 1989. In vitro
amplification of DNA by the polymerase chain reaction, p.
14.1-14.35. In Molecular Cloning: A Laboratory Manual, 2nd Ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
17.
Schildkraut, C. 1965. Dependence of the melting temperature of
DNA on salt concentration. Biopolymers 3:195-208.
INDEX
74
Wetmer, J.G. and N. Davidson. 1968. Kinetics of renaturation
of DNA. J. Mol. Biol. 31:349-370.
20.
Wittwer, C.T., G.C. Fillmore and D.R. Hillyard. 1989. Automated
polymerase chain reaction in capillary tubes with hot air.
Nucleic Acids Res. 17:4353-4357.
Wittwer, C.T., G.C. Fillmore and D.J. Garling. 1990. Minimizing
the time required for DNA amplification by efficient heat
transfer to small samples. Anal. Biochem. 186:328-331.
21.
Zimran, A., W.C. Kuhl, and E. Beutler, 1990. Detection of the
1226 (Jewish) mutation for Gaucher’s disease by color PCR.
Am. J. Clin. Pathol. 93:788-791.
TROUBLE
SHOOTING
22.
PROGRAMMING
19.
SAMPLE
HANDLING
Smith, M. 1983. Synthetic oligonucleotides as probes for nucleic
acids and as primers in sequence determination, p. 23-68.
In S.M. Weissman (Ed.), Methods of RNA and DNA sequencing.
Praeger Press, New York.
SETTING UP
18.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
75
The RAPIDCYCLIST
Newsletter
Volume 1 , Number 1, Spring 1992
Pg. 77
Optimizing RapidCycler™ DNA Amplification Reactions
Buffers and Reaction Components for RapidCycling
A R.A.P.I.D. Protocol for the ATC
Research in Progress at Idaho Technology
Volume 2 , Number 1, Spring 1994
Pg. 91
Creating a DNA Probe, Thermal Cycling with Degenerate Primers
Superior Quantitation of Rare mRNA's Using Rapid Cycling
Rapid Cycle Amplification of VNTR Loci for Engraftment in
Bone Marrow Transplantation
New from Idaho Technology
Reaction Mixes and Buffer Recipes
Rapid Cycle DNA Amplification - The 10 Most Common Mistakes
RAPIDCYCLIST
NEWSLETTER
Volume 3 , Number 1, Fall 1995
Pg. 112
Capillary Tube Handling with the Rapidcycler
Use of Thin Walled Microcentrifuge Tubes with the Rapidcycler
Direct Sequencing of Long PCR Products
Rapid PCR Fingerprinting of Bacterial Genomes with REP Primers in
Capillary Tubes Using the Air Thermo-Cycler
Comparison of PCR Cycler Machines for Rapid and Sensitive Detection of
Pathogens
New from Idaho Technology
The RAPIDCYCLIST newsletter has been modified to best fit into this manual. All of the
articles that were published in the original versions of the newsletter have been
included. There were only three publications of The RAPIDCYCLIST.
INDEX
76
SETTING UP
The
Spring 1992
Optimizing Rapid Cycle DNA
Amplification Reactions
INDEX
77
RAPIDCYCLIST
NEWSLETTER
What follows is a short discussion of each of the components of an amplification reaction and then an outline of a systematic optimization protocol. This
protocol has allowed the successful amplification of both DNA and RNA (via
cDNA) using many different primer pairs.
ARTICLES
Failure to meet any of these conditions will cause failure of the amplification
reaction. You may notice that two of these conditions involve DNA duplex stability, so it's not surprising that two of the most important variables in DNA amplification, annealing temperature and salt concentration, both affect DNA duplex
stability.
WARRANTY
AND UPGRADES
1.the template melts at the denaturation temperature,
2.the primers pair with their complement at the annealing temperature, but
not with non-specific sequences.
3.Temperature and time conditions are adequate for the complete extension
of the product.
SERVICE AND
MAINTENANCE
The complete optimization of a DNA amplification reaction unfortunately
requires some trial and error. Optimizing an amplification requires finding conditions such that:
TROUBLE
SHOOTING
Randy Rasmussen
Department of Biology, University of Utah
Gudrun Reed
Department of Pathology, University of Utah
PROGRAMMING
Volume 1 , Number 1
SAMPLE
HANDLING
RAPIDCYCLIST
A. Components of an Amplification Reaction.
1. Primers
Primer selection can greatly influence amplification success. Sometimes
there is little or no latitude in the selection of primer position, in which case the following discussion is moot. Since the amplification reaction is quite robust, the
chances are good that any primer pair can be made to work. However, with
forethought, the optimization time can be minimized.
Given flexibility in primer selection, an intelligent choice of primers can simplify the optimization process and maximize both product yield and specificity.
There are several commercially available programs for selection of primer pairs
and we have found them helpful. These programs can help you avoid cross
hybridization with other parts of your sequence, internal primer complementarity
and the like.
If you are picking primers by eye you should try to make them similar in length
(20 - 30 nucleotides) and GC content (30 -70%) as balanced primers are easier
to optimize. We have found that using longer primers (25 - 30 nt) and relatively
GC rich primers (50-60%) increases product yield with rapid cycling. There are
reports of primer dimer formation when the last two 3' bases are complementary, but they are seldom seen in rapid cycling reactions.
RAPIDCYCLIST
NEWSLETTER
Primer selection and DNA sequence analysis programs will provide a Tm
value or even an "annealing temperature" for a given primer sequence. All of
these numbers should be viewed with healthy skepticism. Different programs can
give Tm values for the same primer that differ by as much as 20° C. In fact, the
actual Tm value of primers under DNA amplification conditions is controversial
because of the unknown effects of buffer constituents and changing DNA concentrations. We use primers at a final concentration of 0.5 µM. We make a 10X 5
µM stock solution containing one or both primers.
2. Template DNA
DNA amplifications are normally done on one of two types of template,
genomic DNA or plasmid DNA. We usually put about 104 to 105 copies of the ta
get sequence into a 10 µl reaction. For human genomic DNA that is about 50 ng
of DNA, for Escherichia coli genomic DNA it is about 50 pg and for plasmid DNA
it is about 100 fg.
The template DNA should be denatured before the cycling reaction begins.
We link a two minute hold at 94° to the beginning of the cycling program.
Alternately, genomic DNA that has been denatured by boiling and then stored
at -20° never reanneals.
INDEX
78
SETTING UP
SAMPLE
HANDLING
3. Mg Concentrations
We use 3 different reaction
buffers in our amplification reactions and they differ only in Mg2+
concentration. The low, medium
and high Mg2+ buffers contribute
1.0 mM Mg2+, 2.0 mM Mg2+, and
3.0 mM Mg2+ to the final reaction
respectively.
INDEX
79
RAPIDCYCLIST
NEWSLETTER
If you wish, you may use commercially available reaction buffers for rapid
cycling but you must add BSA. Failure to add BSA will cause denaturation of the
polymerase and therefore failure of the reaction.
ARTICLES
If you plan to run your finished reaction on an agarose gel you can add 5%
Ficoll 400 and 10 mM tartrazine to your 10X buffer. This allows you to add the reaction directly from the capillary tube to an agarose gel well. We use tartrazine
instead of bromphenol blue or xylene cyanol because it does not affect the
amplification reaction. Tartrazine runs faster than bromphenol blue.
WARRANTY
AND UPGRADES
5. Reaction Buffer
Our standard reaction buffer is a 10X buffer containing 500 mM Tris pH 8.3, 2.5
mg/ml crystalline BSA and MgCl2 at 10, 20, or 30 mM. The BSA is critical for preventing denaturation of the polymerase on the glass surface of the capillary.
SERVICE AND
MAINTENANCE
4. dNTP's
Our usual final dNTP concentration is 200 µM of each dNTP. Increasing this
concentration does not effect the yield of the reaction. If you are using low Mg2+
concentrations remember that each dNTP chelates a magnesium ion, so you
need at least 0.8 mM Mg2+ to have any free Mg2+ at all.
TROUBLE
SHOOTING
It has been reported that high Mg2+ leads to an increased rate of nucleotide
misincorporation so if you are cloning your DNA products you may wish to avoid
the high Mg2+ buffer.
PROGRAMMING
The optimal Mg2+ concentration is different for every templateprimer set and must be determined
experimentally.
Magnesium ions stabilize DNA Figure 1. Effect of Mg2+ concentration and anealing
duplexes. Therefore lowering temperature on stringency.
Mg2+ concentration increases
stringency while raising Mg2+ concentration lowers stringency (Figure 1).
SETTING UP
SAMPLE
HANDLING
6. Enzymes
Most heat stable enzymes come at a concentration of 5 U/µl. We make a
1:12.5 dilution in a enzyme dilution buffer that consists of 10 mM Tris pH 8.3 and 2.5
mg/ml crystalline BSA. This gives a 10X stock solution. This dilute enzyme solution is
stable for at least 2 days at 4°C. We have found little significant difference
between the enzymes from different suppliers. However, different heat stable
enzymes may differ in their reaction rates, and temperature and time paramters
may need to be adjusted accordingly .
PROGRAMMING
TROUBLE
SHOOTING
7. Reaction Volume
Our standard reaction volume is 10 µl. This produces enough DNA product for
most applications. If you do need more DNA, multiple 10 µl capillaries can be
filled from the same master mix or you can use larger 25 or 50 µl capillaries. The
larger capillaries require a short (5-20 second) hold at denaturation and annealing to allow the larger sample to reach temperature. Because the temperature
is not as well defined, we prefer to use multiple small capillaries.
SERVICE AND
MAINTENANCE
8. Cycling Times and Temperatures
A cycling protocol requires setting three temperatures: denaturation, annealing, and elongation temperatures.
Denaturation should be set at as high a temperature as possible without
killing the enzyme. We routinely use 94° C. Altering this temperature has not been
helpful.
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
A rapid air cycler (Idaho Technology, Salt Lake City, Utah) can hold the
denaturation time for as long as
desired but we have not found
any advantage in holding denaturation. We recommend a denaturation time of 0 seconds when
using the standard 10 µl capillary
tubes. Because of a larger thermal mass, samples in the 25 µl
tubes require a hold time of 5-10
sec, and samples in 50 µl tubes
require 10-20 sec.
We use 70° C as our standard
elongation temperature. The
extension rate vs. temperature
curve (Figure 2) for Taq polymerase activity shows a broad
Figure 2. Extension rate vs temperature for Taq polymerase.
INDEX
80
SETTING UP
peak of about 100 nucleotides per
second between 70 and 80° C.
SAMPLE
HANDLING
PROGRAMMING
Figure 3. Correlation of optimum annealing temperature of GC content of lowest primer.
SERVICE AND
MAINTENANCE
The annealing temperature is
the most important variable in a
DNA amplification. As mentioned
above, calculated values of Tm
should not be taken too seriously,
but the consistent use of a single
program can be helpful in predicting effective relative annealing temperatures for different
primer sets.
TROUBLE
SHOOTING
The amount of time at elongation should be varied with product
length. Taq polymerase catalyzes
the addition of about 100
nucleotides per second at 70°C.
For very small DNA products (target<100 bp) no elongation time at
all is required. These products will
elongate in transit. For medium
length targets (100 - 500 bp) 5 to
15 seconds elongation is sufficient.
Longer products must use proportionally longer times, approximately 15 and 30 seconds per kilobase of product.
WARRANTY
AND UPGRADES
INDEX
81
RAPIDCYCLIST
NEWSLETTER
The amount of time spent at annealing has a direct effect on the specificity
of the amplification reaction (Figure 5). The longer you spend at the annealing
temperature the more non-specific priming you see. You will notice in Figure 1
ARTICLES
In a group of 15 pairs of twenty nucleotide long primers we correlated the percentage GC and Figure 4. Correlation of optimum annealing temperature to Tm of lowest primer.
the Tm calculated by a commercially available program to the
final optimized annealing temperature. We found that the best predictor of
annealing temperature was the GC percentage of the lowest GC primer (Figure
3). The Tm of the least stable primer was almost as good at predicting annealing
temperatures (Figure 4).
SETTING UP
SAMPLE
HANDLING
that the polymerase has significant
activity at temperatures that are
commonly used for annealing. As
you spend more time at the annealing temperature there is a greater
chance of non-specific priming and
extension of undesirable product. We
recommend that when using the
standard 10 µl capillary tubes, you set
your annealing time at 0 seconds to
maximize specificity. As with the
denaturation temperature, the 25 µl
tubes require a hold time of 5-10 sec.,
and the 50 µl tubes require 10-20 sec.
Some amplifications, especially those
with low Tm's, may also require longer
annealing times (5 to 15 sec).
Ramp Time
29 to 55ºC (sec)
Annealing Time
at 55ºC (sec)
PROGRAMMING
9
<1
25
<1
25
5
25
10
25
20
25
40
25
80
TROUBLE
SHOOTING
Figure 5. Effect of annealing time on DNA amplification reactions specificity and yield.
SERVICE AND
MAINTENANCE
B. Systematic Optimization B. B.
Protocol for Rapid Cycling
WARRANTY
AND UPGRADES
When trying to optimize a new primer pair we run test reactions at annealing
temperatures of 40°, 50° and 60° C. At each of these temperatures we run high,
medium and low Mg2+ concentrations (1.0, 2.0 and 3.0 mM MgCl2). This gives
nine different reaction conditions which cover a wide range of DNA hybridization
stringencies. The low Mg2+ buffer at 60° gives the highest stringency while the
high Mg2+ buffer at 40° gives very low stringency (Figure 1). Usually one or more
of these conditions will provide good specificity and yield. If needed, intermediate temperatures or Mg2+ concentrations can be tried in a second experiment.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
If you are running a large number of primer pairs then nine reactions per pair
can get a little out of hand. About 80% of primer pairs can be successfully amplified in the medium Mg2+ buffer at 40°, 50°, or 60°C. Even if none of these three
conditions is ideal you will often get a clue as to what conditions to try next. If you
have no band at 50° or 60° and a weak band at 40° then you will want to try the
high Mg2+ buffer next. If 60° is giving non-specific amplification you will want to
try the low Mg2+ buffer.
INDEX
82
SETTING UP
Conclusion
INDEX
83
RAPIDCYCLIST
NEWSLETTER
BSA is required when capillary tubes are used; gelatin is a poor substitute and
greatly reduces amplification yield. Although we have tried conventional buffers
that contain 50 mM KCl (2), a greater number of amplifications with various
primers were successful at lower KCl concentrations. In sequencing reactions, the
best extensions are reportedly obtained when no KCl is included (3). We now routinely use a buffer system without KCl:
ARTICLES
20 mM KCl
50 mM Tris, pH 8.5
3 mM MgCl2 (with 500 µM each dNTP)
500 ug/ml BSA
WARRANTY
AND UPGRADES
Many different buffers and reactant concentrations have been reported for
DNA amplification. Rapid cycle DNA amplification was originally optimized with
the following buffer (1):
SERVICE AND
MAINTENANCE
Carl T. Wittwer
Department of Pathology
University of Utah Medical School
TROUBLE
SHOOTING
Buffers and Reaction
Components for Rapid Cycling
PROGRAMMING
Good Luck
SAMPLE
HANDLING
To paraphrase Robert Pirsig, "optimization of new primer pairs requires great
peace of mind." Our lack of understanding of the amplification reaction prevents
the formation of a set of rules for predicting conditions that will be successful. This
lack of simple rules can make the optimization process frustrating. Fortunately
there are usually only two variables to worry about, and the reasonable range of
these variables is limited. Annealing temperatures are rarely less than 37° or more
that 70°. Magnesium concentration is never less than about 1 mM and rarely
more than 5 mM. It doesn't take many experiments to cover this range. With perseverance you can eventually get any primer pair to work.
SETTING UP
50 mM Tris, pH 8.3
2 mM MgCl2 (with 200 µM each dNTP)
250 ug/ml BSA
SAMPLE
HANDLING
PROGRAMMING
Some primer pairs have only amplified with this "no KCl" buffer; conventional
high KCl and our original buffer were not effective. Although it is probably true
that no single buffer is best for all amplifications, we have successfully amplified
about 80% of untested primer pairs with this buffer. Most of the remainder can be
amplified by varying the Mg concentration from 1-3 mM.
TROUBLE
SHOOTING
DNA amplification reactions are very resilient, and many additives appear to
have little or no effect on the reaction. Ficoll 400 (0.5 - 1%) and tartrazine (1 mM)
are convenient to add to a reaction mixture before amplification if the products
are going to be analyzed by gel electrophoresis. This allows direct transfer of the
solution into a gel well from the capillary tube after amplification, without intermediate mixing (1). If you run many reactions and are looking for quick results, this
is very convenient. By running parallel reactions with and without Ficoll/tartrazine,
no significant differences in specificity or yield have been observed.
SERVICE AND
MAINTENANCE
Whether certain buffers are more amenable to rapid vs conventional cycling
has not been adequately studied. Reaction kinetics and equilibrium constants
will change with different buffers, but the effects on amplification are poorly
understood. Buffers other than those suggested here can be used for rapid cycle
amplification, but BSA must be included in the reaction. It is convenient to add
the BSA with the enzyme. A 10X enzyme solution of 0.4U/µl can be obtained from
a 5U/µl enzyme stock by diluting in an "enzyme diluent" as follows:
WARRANTY
AND UPGRADES
11.5 µl enzyme diluent
(10 mM Tris, pH 8.3, 2.5 mg/ml BSA)
+ 1.0 µl enzyme
RAPIDCYCLIST
NEWSLETTER
ARTICLES
This is enough to run about 12 reactions. When the 10X enzyme solution is
diluted, enough BSA is included for efficient amplification, even if no additional
BSA is added with the buffer. The 50% glycerol storage media of most, enzyme
preparations makes pipetting 1 µl very difficult. If accurate volumes are desired,
microcapillary pipets (1 µl Microcaps, available from Sigma) can be used. The
other components of a master mix can also be stored as 10X stocks. A 10X solution of human genomic DNA (50 µg/ml) conveniently has an absorbance of 1.0
at 260 nm. One µl of this 10X solution provides about 15,000 template copies per
10 µl reaction.
INDEX
84
SETTING UP
Rapid Cycle Reactant Concentrations
Table 1.
[1X Reaction]
Volume/10µl
Buffer
500 mM Tris, pH 8.3
50 mM Tris
1 µl
2.5 mg/mL BSA
250 µg/mL BSA
5-10%Ficoll
0.5-1.0% Ficoll
10 mM Tartrazine
1 mM Tartrazine
Low Mg
10 mM MgCl2
1 mM MgCl2
Med Mg
20 mM MgCl2
2 mM MgCl2
High Mg
30 mM MgCl2
3 mM MgCl2
dNTPs
2 mM each dNTP
200 uM dNTP
1 µl
Left Primer
5 µM
0.5 µM
1 µl
Right Primer
5 µM
0.5 µM
1 µl
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
DNA
PROGRAMMING
[10X Stock]
SAMPLE
HANDLING
Component
1 µl
5ng/µL
5-50 pg/µl
0.5-5 pg/µl
Plasmid DNA
0.1-1.0 pg/µl
10-100 fg/µl
0.4 U/µL
0.4 U/10µL
2.5 mg/ml BSA
250 µg/ml
dH2O
1 µl
ARTICLES
Bacterial DNA
Diluted Enzyme
WARRANTY
AND UPGRADES
Genomic DNA 50 ng/µL
(mammalian) or A (260)=1.0
4 µl
RAPIDCYCLIST
NEWSLETTER
Note: BSA is present in both the 10X buffer and the enzyme diluent for a final concentration in the reaction of 500 ug/ml.
INDEX
85
SETTING UP
SAMPLE
HANDLING
We usually use a 5 µM 10X solution of each primer. The concentration of
primer stocks should be determined spectrophotometrically at 260 nm. The
extinction coefficient of an oligonucleotide is affected by base sequence and is
best estimated by considering neighboring pairs (4). Commercially available
computer programs, such as Oligo 4.0 (National Biosciences, Hamel, MN) automatically perform the calculation.
PROGRAMMING
A summary of reactant concentrations is given in Table 1. Suggested volumes
of reaction components for a master mix for 4, 8, 16, 10 µ l samples are listed for
convenience in Table 2 (below). Kits supplying the components of this system
(exclusive of primers, template DNA, and enzyme) are commercially available
(Idaho Technology, Salt Lake City, Utah).
Table 2
TROUBLE
SHOOTING
Component(10X)
Number of 10µl Reaction Tubes
4
8
16
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Buffer
5 µl
9 µl
17 µl
dNTP's
5 µl
9 µl
17 µl
Left Primer
5 µl
9 µl
17 µl
Right Primer
5 µl
9 µl
17 µl
Template DNA
5 µl
9 µl
17 µl
Taq (0.4 U/µl)
5 µl
9 µl
17 µl
dH2O
20 µl
36 µl
68 µl
Total Volume
50 µl
90 µl
170 µl
RAPIDCYCLIST
NEWSLETTER
ARTICLES
INDEX
86
SETTING UP
References
2.Wittwer, CT and JL Cherry. Momentary denaturation and annealing for DNA
amplification, submitted.
4.Fasman GD, ed., Handbook of Biochemistry and Molecular Biology, 3rd ed.,
Nucleic Acids - Vol. 1, pp 589, CRC Press, Cleveland, OH, 1975.
TROUBLE
SHOOTING
A RAPD Protocol for the Air Thermo-Cycler
PROGRAMMING
3.Innis, MA, KB Myambo, DH Gelfand and MAD Brow. DNA sequencing with
Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain
reaction-amplified DNA. PNAS 85:9436-9440, 1988.
SAMPLE
HANDLING
1.Wittwer, CT and DJ Garling. Rapid cycle DNA amplification: time and temperature optimization. BioTechniques 10:76-83, 1991.
SERVICE AND
MAINTENANCE
Paul W. Skroch
Jim Nienhuis
Department of Horticulture
University of Wisconsin-Madison
RAPIDCYCLIST
NEWSLETTER
INDEX
87
ARTICLES
Template DNA should be clean and relatively free of RNA. Treatment with
RNase followed by an alcohol precipitation is sufficient to remove most of the
RNA. Clean DNA may give good RAPD products even when it is significantly
degraded. 5X solutions of template and primer are prepared in a TE buffer that
is 1mM Tris (pH=7.5) and .1mM EDTA (pH=8.0). A 25X dNTP and MgCl2 solution is
prepared in distilled H20. 5X reaction buffer contains 250 mM Tris (pH=8.5), 5mM
MgCl2, 100 mM KCL, 2.5 mg/ml BSA, 12.5% Ficoll 400 and .1% xylene cyanole. For
a set of 100 reactions a master mix containing dNTP's, MgCL2, Taq DNA polymerase (Promega Corp.), and reaction buffer is prepared by mixing 200 µl 5X
WARRANTY
AND UPGRADES
Idaho Technology's Air Thermo-Cycler is unique among commercial thermal
cyclers in the speed with which PCR reactions can be performed. The RAPD
reaction, a PCR technique for generating useful genetic markers (Williams et. al.
1990. Nucleic Acids Research. 18: 6531-6535), also runs much faster in the ATC.
Published RAPD protocols are based on the use of metal block machines and
require relatively long total cycling times. The RAPD reaction can be economically performed in the Idaho Technology ATC with a total cycling time of less
than 90 minutes.
SETTING UP
SAMPLE
HANDLING
buffer, 40 µl 25X MgCl2- dNTP's, 12 µl Taq polymerase (5 units/µl), and 348 µl distilled H20. Reactions are then prepared in 10 µl volumes by combining master
mix, 5X template, and 5X primer in the ratio 3:1:1. The final concentrations in volumes of 10 µl should be 2 ng/µl template DNA, .4 µM primer, 100 µM each dNTP,
2 mM MgCl2, .06 U/µl polymerase and 1X reaction buffer.
PROGRAMMING
Amplification is divided into two steps. For the first two cycles the thermal profile is 1 minute at 92° C, 7 seconds at 42° C, and 70 seconds at 72° C.
Subsequently, an additional 38 cycles are performed with denaturation for 1
second at 92°C, annealing at 42° C for 7 seconds, and elongation at 72° C for 70
seconds. Following these forty cycles the temperature should be held constant
at 72° C for 4 minutes.
Some Comments on Reaction Optimization
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
A particular RAPD product generated from a unique primer and template
combination will require a specific set of optimum conditions. Our goal was to
get good bands for a large number of primers making our protocol as general as
possible. Also, we wanted to be able to run the reactions in a short amount of
time to maximize throughput. Interactions between concentrations, times, and
temperatures are important. Changing the value of any parameter may change
some reaction results. However, reaction parameters near those given here will
give good results. For example, annealing for 7 instead of 8 seconds is somewhat
arbitrary. Attempts to improve the efficiency of the reaction by significantly lowering or raising the polymerase concentration has not worked, in general. Using
the protocol described above, we have obtained satisfactory reaction products
from thousands of RAPD reactions.
WARRANTY
AND UPGRADES
Results
The following figures show some results from our lab using the above protocol.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
INDEX
88
SETTING UP
SAMPLE
HANDLING
PROGRAMMING
Figure 2. The gel compares 10 different P. vulgaris genotypes amplified with a single primer.
Idaho Technology is committed to improve the state-of-the-art in rapid
cycling, instrumentation and accessories. Several recent developments are
worth noting.
WARRANTY
AND UPGRADES
Kirk M. Ririe
Idaho Technology
SERVICE AND
MAINTENANCE
Research In Progress at Idaho Technology
TROUBLE
SHOOTING
Figure 1. The gel shows RAPD amplification products from 10 different primers with a single
Phaseolus vulgaris (bean) DNA preparation. The
number of bands amplified for a given primer
can vary from 1 to about 16.
Linear Actuator Tests:
RAPIDCYCLIST
NEWSLETTER
INDEX
89
ARTICLES
We recently tested a prototype instrument outfitted with a linear actuator in
place of the solenoid on the 1605 ATC. Our primary objectives are to eliminate
the noise produced by the solenoid and to gain better control of the temperature/ time curve. While we have done our best to make the 1605 ATC a flexible
instrument, there are some restrictions imposed by the original design. Since the
solenoid is either fully open or fully closed, the machine is limited to a single cool
down rate. This rate is factory set by adjusting the solenoid to cool down from 94°
C to 55° C in about 8 sec. Cool down rates as low as three secs are possible with
this design, however, product yield is decreased with rapid cooling. This is due to
the temperature rebound which occurs when the door closes. Apparently, there
SETTING UP
SAMPLE
HANDLING
is not enough time for the primers to anneal and the enzyme to function before
the increasing temperature causes denaturation. A linear actuator can in theory produce cool down rates in the range of 3-4 secs and then hold the lower
temperature for precisely the required time. This would allow a slight decrease in
cycle time, yet substantially increase product yield. This work is especially important for low annealing temperature protocols such as RAPD.
PROGRAMMING
We are committed to developing a more flexible instrument, while retaining
the simplicity of the ATC. The linear actuator will allow much finer control of the
temperature/time curve. Two temperature cycling and three temperature cycles
with unusually high annealing temperatures will be facilitated. Upgrades to a linear actuator system should be available by the summer of 1992.
Sample Handling Advances
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
We recently received sample quantities of a 25 µ l plastic capillary tube. Initial
tests confirm that the reaction runs at slightly reduced speeds compared to glass
capillary tubes. Using the 25 µ l plastic capillary tubes, the sample comes to temperature in 5-10 secs, which is comparable to sample response when using 25 µ l
glass capillary tubes. We intend to continue our tests and make a positive displacement sample handling system available soon.
We have recently tested a microscope slide rack using 24 x 60 mm cover slips
(Fisher Scientific). Early test results look promising. The slide rack will be available
for purchase in May.
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
INDEX
90
SETTING UP
The
Spring 1994
Creating a DNA Probe,Thermal Cycling
with Degenerate Primers
PROGRAMMING
Volume 2 , Number 1
SAMPLE
HANDLING
RAPIDCYCLIST
TROUBLE
SHOOTING
Marianne Schroeder
Dept. of Biology
University of Utah
INDEX
91
RAPIDCYCLIST
NEWSLETTER
Each primer was 26 nucleotides long. All combinations of nucleotides at
codon wobble positions were synthesized with the following exceptions: inosines
were used for 4-fold degeneracy at the wobble position when appropriate
ARTICLES
The protein of interest was digested with endo-Asp-N to obtain protein fragments for amino acid sequencing. Of these, a 35 amino acid peptide was chosen to design degenerate primers for amplification of the peptide DNA. Coding
(1c) and non-coding (1nc)
primers were made from terminally located amino acids with
minimal codon degeneracy. A
third non-coding (2nc) primer
was made internal to 1nc
primer (see figure).
WARRANTY
AND UPGRADES
Primer Design
SERVICE AND
MAINTENANCE
We are cloning the DNA from a structural protein in Xenopus leavis to further
characterize it. A DNA probe was needed for Southerns, northerns and probing
libraries for our gene of interest. The following is our procedure using the Air
Thermo-Cycler to clone and amplify a fragment of DNA using degenerate
primers. We found increased primer concentration as well as longer annealing
times were beneficial in obtaining DNA products from degenerate primers.
SETTING UP
SAMPLE
HANDLING
(according to Molecular Cloning, a Laboratory Manual. Sambrook et al., page
11.18); to accommodate a serine in 1c and a leucine in 1nc, primers had to be
made in duplicate; for serine, the codons TCI and AGT/C were used; for leucine
(1nc, 2nc), IAG and T/CAA were used. Each primer was synthesized with a GGC
clamp and an EcoR1 site at the 5 ? terminus. The degeneracy of the 1c, 1nc, and
2nc primers were respectively 48 fold, 8 fold and 48 fold. The expected size of the
product from the 1c and 1nc primers was 100 bp, and from the 1c and 2nc
primers, 94 bp.
PROGRAMMING
Reaction Mix
7 µM working concentration; 1 µl each of 1c and 1nc
template
7.6 ng/µl Xenopus leavis oocyte cDNA; 1µl
[Mg2+]
30 mM; 1 µl
dNTP mixture
2 mM each dNTP; 1 µl
SERVICE AND
MAINTENANCE
10 X buffer
500 mM tris pH 8.3, 2.5 mg/ ml BSA, 1 µl
enzyme
1 µl Taq polymerase diluted 1:12.5 in enzyme dilution
buffer (10 mM tris pH 8.3, 2.5 mg/ml BSA)
WARRANTY
AND UPGRADES
water
to 10 µl total volume
TROUBLE
SHOOTING
primers
Thermal Cycling Conditions
RAPIDCYCLIST
NEWSLETTER
ARTICLES
These conditions produced the expected 100 bp fragment in small amounts
as visualized on a 4% Nusieve low melting temperature agarose gel. The band
was cut from the gel (approximately 2X2X4 mm chunk) and used as a template
in subsequent thermocycling reactions.
Each 10 ul reaction was done in heat sealed glass capillaries.
Initial hold -- 2 minutes 94°C
2 cycles
D: 94°C 0 sec,
A: 40°C 7 sec,
E: 74°C 5 sec
5 cycles
D: 94°C 0 sec,
A: 42°C 7 sec,
E: 74°C 5 sec
23 cycles
D: 94°C 0 sec,
A: 45°C 7 sec,
E: 74°C 5 sec
INDEX
92
The thermal cycling reaction was run with an initial 2 minute denaturation at
94 ° C followed by 30 cycles: 0 sec at 94 °C (denaturation), 12 sec at 50 °C
(annealing), 5 sec at 74 °C (elongation).
SERVICE AND
MAINTENANCE
The 100 bp product was cloned directly into the pCRII® vector from the
Invitrogen TA Cloning Kit. Subsequent DNA sequencing of this vector confirmed
that this product coded for the original amino acid sequence and will be used
as a probe for subsequent experiments.
TROUBLE
SHOOTING
This reaction produced a 94 bp band as seen on a 4% Nusieve agarose gel
indicating that the 100 bp fragment was the correct DNA sequence. A duplicate
reaction to the one directly above was done with the 100 bp fragment as template and the original outside primers (1c and 1nc) to amplify the 100 bp fragment. One 10 µl reaction gave approximately 30 ng of product.
PROGRAMMING
The 100 bp product isolated in agarose was heated at 100 °C until melted,
and 500 µl TE was added. Two µl of this mixture were used as the template in a 10
µl reaction. One µl each of the 1c and 2nc primers was used, and the other
parameters were as described above.
SAMPLE
HANDLING
To confirm the accuracy of our 100 bp product, we attempted to amplify a
smaller fragment using the 100 bp cycling product as a template with the internal non-coding primer (2nc) and the original coding primer (1c).
SETTING UP
Confirmation of the 100 bp product
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
93
SETTING UP
SAMPLE
HANDLING
Superior Quantitation of Rare mRNA's
Using Rapid Cycling
Randy P. Rasmussen
Dept. of Biology
University of Utah
PROGRAMMING
TROUBLE
SHOOTING
After a long period of skepticism, quantitative PCR is finally gaining acceptance in the molecular biology community. No one doubted that PCR could be
quantitative in theory, but there was a general consensus that the efficiency of
DNA amplification would be too sensitive to interference for practical quantitation. Small effects on the reaction's efficiency, it was argued, would destroy the
quantitative value of PCR. Quantitation of mRNA added the additional complication of the reverse transcription step.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Despite these initial concerns, it has
now been thoroughly demonstrated
that the quantitative power of reverse
transcriptase PCR (RT-PCR) is as good
or better than the traditional methods
of mRNA quantitation such as northern
blot (1), dot blot (2), and in situ
hybridization (3). Two recent papers
from the John Weis lab report a sensitive RT-PCR assay using rapid air thermocycling (4,5). The Weis lab was trying
to measure mRNA for the complement
receptor Cr2, a rare mRNA in mouse
spleens. They were unable to quantitate the message when they used slow
heat block cyclers because of very low
yields of product DNA and highly variable amounts of product. They
switched to an Air Thermo-Cycler and
solved both of these problems. The
amount of DNA produced was at least
100 fold greater in the air cycler than in
the heat block instrument and the variability problem disappeared (Figure 1).
INDEX
94
Heat Block Cycler
1 2 3 4 5
M
Air Thermo-Cycler
1 2 3 4 5
Figure 1. Comparison of RT-PCR products using
heat block instrument and the Air Thermo-Cycler
(ATC). Five different spleen cDNA samples were
set up for PCR amplification and equally split
between the standard heat block instrument
(first 5 lanes) and the ATC (last 5 lanes) for the
same number of cycles. Quantitation of these
results (cutting the bands out of the gel and
counting incorporated 32P-dCTP) indicated that
there was at least 100 fold more product from
the ATC than the heat block machine.
The amount of DNA produced in a PCR reaction is predicted by the well
known equation:
This equation can be linearized to:
TROUBLE
SHOOTING
where y is the concentration of DNA produced by the amplification
x is the initial concentration of DNA
E is the efficiency of the reaction. For example, in a reaction where the
amount of DNA is doubled every cycle, the efficiency is 2.
n is the number of amplification cycles
PROGRAMMING
y = x(E)n
SAMPLE
HANDLING
The Linearity Problem
SETTING UP
This short review will include some general considerations in quantitative PCR
followed by the detailed Weis protocol.
log(y) = nlog(E) + log(x)
SERVICE AND
MAINTENANCE
ARTICLES
Figure 2. Amplification of mouse splenic cDNA with
primers complimentary to the complement receptor Cr2.
Eight identical samples were prepared with 250 ng of
cDNA and removed sequentially every third cycle. After
electrophoresis and autoradiography, bands were
excised and quantitated by liquid scintillation counting
(from Weis 1991).
INDEX
95
RAPIDCYCLIST
NEWSLETTER
When the DNA concentration of an amplification is determined after varying numbers of
cycles, the results fit quite nicely
to the equation above during
the early cycles. Efficiency is
reduced during the later cycles
of an amplification reaction
(Figure 2). This is probably due to
primers competing less effectively with template reannealing
and a lower molar ratio of
enzyme to product. The number
of cycles after which these
effects
become
important
depends on the initial concentration of DNA.
WARRANTY
AND UPGRADES
The y intercept of this line
gives the log of the starting concentration of DNA while the
slope of the line gives the log of
the efficiency of the reaction.
SETTING UP
SAMPLE
HANDLING
When doing a quantitation experiment with the Air Thermo-Cycler, a typical
experiment would include making up a large master mix, filling multiple capillaries from that master mix, and starting all the tubes at the same time. As the reaction goes on, tubes are pulled out at increasing numbers of cycles. The amount
of DNA in each tube can be quantitated in various ways. The points that fall in
the log-linear portion of the curve can be used to determine the amount of starting material and the efficiency of the reaction. For Figure 2, the efficiency of the
reaction during the log-linear phase was about 1.7, which is typical for a real
reaction.
PROGRAMMING
The Quantitation and Detection Problem
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
The most common technique for detection and quantitation of DNA is radiolabeling with 32P. Amplified products can be labeled by incorporation of radiolabeled nucleotides or by end labeling one of the primers. End labeling tends to
be more sensitive because a higher fraction of the product carries a label (6) ,
but labeling by incorporation is
1
2
3
4
5
6
easier if you don't need the sensitivity. After the amplification,
reactions are size separated by
gel electrophoresis. The gels can
then be directly quantitated by
autoradiography using film or a
PhosphorImager type system .
The limited linear range of film
(usually 3 orders of magnitude or
less) makes this approach difficult. Phosphor Imager type systems are convenient and have
extended linear ranges (5 to 9
orders of magnitude) but are
very expensive. The Weis protocol uses labeling by incorporation of 32P-dCTP, location of the
product by autoradiography,
and quantitation by excision of
the band and liquid scintillation
Figure 3. Effect of amplifying two different gene products
counting.
Some users of the Air
Thermo-Cycler are hesitant to
load glass capillaries with a
radioactive reaction mixture
in one reaction. PCR analysis of 100 ng of splenic cDNA
with Cr2 and ß-actin oligos. Lanes 1-3 were done for 18
cycles. Lane 1, Cr2 oligos alone; lane 2, ß-actin oligos
alone; lane 3, Cr2 + ß-actin oligos. Lanes 4-6 were done
for 24 cycles. Lane 4, Cr2 oligos alone; lane 5, Cr2 + ßactin oligos; lane 6, ß-actin oligos alone (from Tan 1992).
INDEX
96
RAPIDCYCLIST
NEWSLETTER
INDEX
97
ARTICLES
Figure 4. Reproducibility of PCR amplification for quantitation of products: multiple tissue samples. PCR analysis
for 24 cycles with Cr2 oligos (lanes 1-6) and ß-actin oligos
(lanes 7-12) with 100 ng of cDNA generated from three
different spleens (lanes 1-3 and 7-9) and livers (lanes 4-6
and 10-12) (from Tan 1992).
WARRANTY
AND UPGRADES
The simplest internal standard is to simultaneously quantitate the sequence of interest
with some more or less invariant
"housekeeping" mRNA. If the
level of the housekeeping
gene's message is constant
SERVICE AND
MAINTENANCE
When measuring product by radiolabel, it is difficult to convert CPM's to
absolute measures of DNA
quantity. One solution to this
1 2 3 4 5 6 7 8 9 10 11 12
problem is to set up an external
standard curve by running
known amounts of DNA each in
their
own
reaction
tube.
Unfortunately this straightforward method has run into trouble due to large variation in the
efficiency of different reactions.
Further complications arise with
RT-PCR because of the desire to
control for the efficiency of the
reverse transcriptase step. These
problems have led to the use of
internal standards of various
types (7).
TROUBLE
SHOOTING
The Relative versus Absolute Quantitation Problem
PROGRAMMING
In most protocols the reverse transcription is primed with the same primer that
is later used for the amplification. The Weis group uses random hexamers to prime
the cDNA synthesis and they report several advantages to this approach. First, it
ensures that all RNA's are represented equally in the cDNA pool. Second, as
reverse transcription is done at low temperatures, using 20-mers to 30-mers can
lead to synthesis of cDNA's from non-specifically hybridized primers. These products might be specifically amplified during the quantitation.
SAMPLE
HANDLING
The Reverse Transcriptase Problem
SETTING UP
because of a fear of breakage. While Weis reports that this has not been a problem, plastic capillary tubes are now available (see "New from Idaho Technology"
in this issue).
SETTING UP
SAMPLE
HANDLING
between samples, then the amount of the unknown transcript can be reported
in relative terms. Popular genes for standardization are ß-actin and HLA genes. All
of these internal standard methods are based on the presumptions that: 1) the
reverse transcription is not biased between the standard and test transcripts, 2)
the amplification of the standard and the unknown occur with the same efficiency, and 3) the amplifications do not interfere with each other significantly.
PROGRAMMING
Weis uses ß-actin mRNA as an internal standard (Figure 3). The autoradiograph shown in figure 3 shows that both products can be simultaneously amplified with minimal interference.
The Variability Problem
TROUBLE
SHOOTING
Sample-to-sample variability has long been a problem with RT-PCR. The efficiency of reverse transcription has been reported to vary from 5% to 90% (8),
while the amplification itself may vary up to 200-300% between duplicate reactions. The Weis group reports good reproducibility not only between duplicate
aliquots of the same cDNA but also between tissue samples (Figure 4).
SERVICE AND
MAINTENANCE
The Protocol
1.Total RNA was prepared by the method of Chirgwin et al. (9)
WARRANTY
AND UPGRADES
2.RNA (5 µgs) was reverse transcribed in 1X RT buffer(GIBCO-BRL), 0.125 mM
each dNTP, 0.5 µg random hexamers (New England Biolabs) and 400 units of
Moloney virus reverse transcriptase (GIBCO-BRL) in a 50 µl reaction. The reaction
was incubated at 37°C for 60 minutes. DNase free RNase was added and incubated for 5 minutes at 37°C. The reaction volume was adjusted to 270 µl with 0.4
M NaCl and was phenol extracted and precipitated with ethanol. cDNA concentration was determined by UV absorbance.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
3.The optimal cDNA concentration and number of cycles was determined
by a titration from 1 to 500 ng of cDNA and from 18 to 39 cycles. Optimal parameters were 200 ng of cDNA for 20 cycles. Each 10 µl reaction contained 200 ng of
cDNA, 70 pmoles of each primer, 50 mM tris pH 8.3, 3 mM MgCl2, 20 mM KCl, 0.5
mg/ml BSA, 0.2 mM each dNTP, 2.5 uCi [32P]dCTP(3000 Ci/mmol; New England
Nuclear), 0.72 units AmpliTaq DNA Polymerase (Cetus). To improve reproducibility, a master mix was prepared without primers and then aliquoted to separate
tubes containing the different primer pairs. These mixtures were then aliquoted to
the cDNA samples. Each 10 µl reaction was loaded into a glass microcapillary
tube (Idaho Technology) and the ends were flame sealed. Capillaries were
cycled in the 1605 Air Thermo-Cycler (Idaho Technology). Cycling parameters
INDEX
98
2.Noonan, K.E., C. Beck, T.A. Holzmayer, J.E. Chin, J.S. Wunder, I.L. Andrulis, A.F.
Gazdar, C.L. Willman, B. Griffith, D.D. Von Hoff, I.B. Roninson. 1990. Quantitative
analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction. Proc. Natl. Acad. Sci. 87: 7160-7164.
5.Tan, S.S., Weis, J.H. 1992. Development of a sensitive reverse transcriptase
PCR assay, RT-RPCR, utilizing rapid cycle times. PCR Methods and Application 2:
137-143.
7.Wang, M., M.V. Doyle, and D.F. Mark. 1989. Quantitation of mRNA by the
polymerase chain reaction. Proc. Natl. Acad. Sci. 86: 9717-9721.
9.Chirgwin, J.M., A.E. Przybyla, R.J. MacDonald, and W.J. Rutter. 1979.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299.
INDEX
99
RAPIDCYCLIST
NEWSLETTER
8.Ferre, F. 1992. Quantitative or semi-quantitative PCR: reality versus myth.
PCR Methods and Applications 2: 1-9.
ARTICLES
6.Gilliland, G., S. Perrin, and H.F. Bunn. 1990. Competitive PCR for quantitation
of mRNA. In PCR Protocols (ed M.A. Innis, D.H. Gelfand, J.J. Sninsky, T.J. White) pp.
60-69. Academic Press, New York.
WARRANTY
AND UPGRADES
4.Weis, J.H., S.S. Tan, B. K. Martin,. C.T. Wittwer. 1991. Detection of rare mRNAs
via quantitative RT-PCR. Trends in Genetics 8: 263-264.
SERVICE AND
MAINTENANCE
3.Park, O.K., K.E. Mayo. 1991. Transient expression of progesterone receptor
messenger RNA in ovarian granulosa cells after the preovulatory luteinzing hormone surge. Molecular Endocrinology 5: 967-978.
TROUBLE
SHOOTING
1.Murphy, L.D., C.E. Herzog, J.B. Rudick, A.T. Fojo, S.E. Bates. 1990. Use of the
polymerase chain reaction in the quantitation of mdr-1 gene expression.
Biochemistry 29: 10351-10356.
PROGRAMMING
References
SAMPLE
HANDLING
4.Following amplification the ends of the capillary tubes were scored and
the samples removed using a microaspirator and then 5 µl were electrophoresed
in a 6% acrylamide gel. Radioactive bands were detected by autoradiography
and then the bands were cut from the gel for quantitation by liquid scintillation
counting. A 32P-end labeled MspI digest of pBR322 was used as a size standard.
SETTING UP
were denaturation, 94°C for 1 sec; annealing, 59°C for 1 sec; elongation, 72°C for
4 seconds (products ranged in size from 80 to 200 base pairs). Total cycle time
was 24 seconds.
SETTING UP
SAMPLE
HANDLING
Rapid Cycle Amplification of VNTR Loci for
Engraftment in Bone Marrow Transplantation.
Gudrun Reed
Dept. of Pathology
University of Utah Medical School
PROGRAMMING
TROUBLE
SHOOTING
Bone marrow transplantation is now standard therapy for a range of diseases
including many hematologic malignancies, some solid tumors, and some
acquired or inherited hematologic and immunologic diseases. Many of these disorders result from a malfunctioning bone marrow, and the only cure is to inactivate the diseased bone marrow and replace it with healthy marrow. After the
original marrow is destroyed, healthy marrow from a donor is infused into the
recipient. Bone marrow transplantation may be: 1) autologous (where healthy
stem cells have been previously harvested from the same individual), 2) syngeneic (where the donor is an identical twin), and 3) allogeneic (where the
donor is different genetically from the recipient). In allogeneic transplantation, it
is possible to determine the success of transplantation by monitoring the genotype of cells appearing in the peripheral blood. If the recipient type converts to
the donor type, successful engraftment has occurred.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Variable number of tandem repeat (VNTR) loci are regions in the human
genome where a short nucleotide sequence is repeated in tandem for a variable number of times. If flanking primers are
placed outside of the repeats, the number of
5
4
3
2
1
M
tandem sequences in any particular allele
determine the length of the amplified product. Some VNTR loci are highly polymorphic
with over 10 different alleles and are very useful for establishing individuality by genotype.
For highly polymorphic loci, homozygosity is
uncommon and two bands are expected at
each locus because of the diploid nature of
human cells. VNTR loci are commonly used in
forensics to establish identity and can also be
used to establish donor vs. recipient type in
peripheral blood leukocytes after bone marrow transplantation. Since peripheral blood
leukocytes originate in the bone marrow, the Figure 1. DNA samples from five unrelattype of circulating leukocytes establishes the ed individuals amplified with primers for
type of hematopoietic cells populating the the D1S80 locus2.
INDEX
100
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
Siblings are often used as
VNTR Amplification in Bone Marrow Transplantation
donor/recipient pairs in bone
marrow transplantation because
4
3
2
1
M
they may match at HLA loci and
bp
have fewer problems with
graft/host acceptance. HLA and
- 1000
VNTR loci are not linked and follow classical Mendelian inheri- 700
tance. If siblings are matched at
- 500
HLA loci for transplantation, they
have a one in four chance of
- 400
receiving the same parental
VNTR alleles at any particular
- 300
locus. If they do receive the same
VNTR alleles at one locus, that
particular locus is not useful for
- 200
distinguishing donor vs. recipient
type. However, most of the time,
siblings will differ by either one Figure 2. Bone marrow transplant engraftment by 1
allele (50% of the time) or two month.
The VNTR locus HGM D17S301 was used.
alleles (25% of the time). DNA Lane 1: Recipient before transplantation.
from peripheral blood leukocytes Lane 2: Donor.
needs to be isolated from donor Lane 3: Recipient 2 weeks after transplantation.
and recipient before bone mar- Lane 4: Recipient 4 weeks after transplantation.
In lane 3 the patient shows bands from both the
row transplantation, so that recipient and the donor. In lane 4 the patient shows
informative VNTR loci can be only donor bands suggesting successful engraftment.
identified. Since there are many
VNTR loci, finding differences between recipient and donor is not difficult, even
for siblings. In the case of syngeneic or autologous transplantation, genotyping
studies are not informative. The VNTR loci used here are HGM locus D17S301 and
D1S802. All PCR reactions were run with standard rapid cycling techniques3-5 in
an Idaho Technology 1605 air cycler with buffers and reagents supplied by Idaho
Technology (1761 Optimizer Kit). The Mg2+ concentration was 2.0 mM. Cycling
parameters were denaturation at 94° C for 0 sec, annealing at 55° C for 0 sec,
and elongation at 73° C for 20 sec for 30 cycles. The total cycle time was 23.7
min. The samples were loaded directly on a 1.5% Agarose gel and electrophoresed at 5 V/cm.
SETTING UP
bone marrow. An example of DNA amplification of a VNTR locus in 5 unrelated
individuals is shown in Figure 1.
Figure 2 illustrates a typical example of engraftment. This is a sibling transplant
where all four alleles are different. At 14 days after transplantation, both donor
INDEX
101
SETTING UP
SAMPLE
HANDLING
and recipient bands were observed.
Residual recipient lymphocytes may circulate for 2-3 weeks after transplantation.
However, recipient bands should disappear
by 4 weeks if engraftment has occurred.
PROGRAMMING
Figure 3 illustrates a typical example of
disease recurrence after bone marrow transplantation. This is a sibling transplant where
one allele is shared between donor and
recipient types. At 36 days post bone marrow transplantation, both donor-specific and
recipient-specific alleles are apparent. This
indicates that the donor marrow has not
entirely supplanted the recipient marrow at
36 days. At 100 days post bone marrow
transplantation, only the recipient bands are
present, indicating failure of engraftment
and recurrence of disease.
4
3
2
1
M
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
Figure 3. Disease recurrence after bone
marrow transplantation. The VNTR locus
HGM D1S802 was used.
1: Recipient before transplantation.
2: Donor.
3: 36 days after bone marrow transplantation.
4: 100 days after bone marrow transplantation.
In lane 3, alleles from both the donor
and recipient are present at approximately equal amounts. After 100 days
(lane 4), the unique donor band has disappeared and only the original recipient alleles are present.
References
WARRANTY
AND UPGRADES
1.Horn GT, B Richards, KW Klinger. 1989. Amplification of a highly polymorphic
V Res. 17: 2140.
ARTICLES
2.Nakamura Y, M Carlson, V Krapcho, R White. 1988. Isolation and mapping
of a polymorphic DNA sequence (pMCT118) on chromosome 1p (D1S80). Nucl.
Acids Res. 16: 9364.
RAPIDCYCLIST
NEWSLETTER
3.Wittwer, CT, DJ Garling. 1991. Rapid cycle DNA amplification: time and temperature optimization. BioTechniques 10: 76-83.
4.Rasmussen R, G Reed. 1992. Optimizing rapid cycle DNA amplification reaction. The Rapid Cyclist 1: 1-5.
5.Wittwer, CT, G Reed, K Ririe. 1994. Rapid Cycle DNA Amplification. The
Polymerase Chain Reaction , Mullis, Ferre, and Gibbs, eds. pp. 174-181.
INDEX
102
SAMPLE
HANDLING
Kirk Ririe
Idaho Technology Inc.
SETTING UP
New From Idaho Technology
Polycarbonate tubes
RAPIDCYCLIST
NEWSLETTER
INDEX
103
ARTICLES
We hope to be completely finished with the final tests on the plastic tubes
and have the tubes and the sealers available in June of '94, barring major catastrophe. (10 µl tubes, part number 1714; tube sealer, part number 1740)
WARRANTY
AND UPGRADES
The last potential problem with plastic tubes is price. At a cost of approximately $80 per 1000, plastic tubes will be about twice as expensive as similar glass
tubes. Even at that price, plastic tubes would still be less expensive than other
second generation sample containers. We will know more about pricing after
final testing on the tubes is complete.
SERVICE AND
MAINTENANCE
The second drawback is sealing the ends of the plastic tubes. It is tricky but
possible to flame seal plastic tubes by intentionally igniting the ends. For many
people, this tends to be somewhat disconcerting; therefore, we have developed
an electric tip sealer.
TROUBLE
SHOOTING
Glass tubes can be easily loaded either singly or eight at a time by capillary
action. However, hydrophobic plastic tubes require a loading mechanism such
as a micro-aspirator or a similar device. We are working on ways of loading and
sealing eight tubes at a time; but at present it can only be done one tube at a
time.
PROGRAMMING
There has been a great deal of interest displayed by users of the 1605 Air
Thermo-Cycler (ATC) in the possibility of using plastic capillary tubes to augment
the glass capillary tubes currently standard in our instrument. The results of our
tests on various plastic tubes have been very encouraging. Our selection for final
testing is poly carbonate tubing which has thermal response characteristics
almost identical to our 10 µl glass tubes. The polycarbonate does not interfere
with the reaction and it should be of great help in those situations where the
fragility of glass capillary tubes is an excessive hazard. However, those who are
interested in using plastic capillary tubes should be aware that plastic tubes are
not without their drawbacks.
SETTING UP
Modular Tops
SAMPLE
HANDLING
In other hardware news, some of our earlier customers may be interested in
a change made in the design of the 1605 cycler. The plastic top now has removable modules for loading and unloading tubes. The entire module is removable
from the rest of the top to allow easier loading and unloading. Each module
holds 16 tubes. To help ensure a good fit of all sizes of tube, modules are available in two sizes, 10 µl and 50 µl. An upgrade kit to a modular top is available from
Idaho Technology, part number 1869.
PROGRAMMING
Module Racks
TROUBLE
SHOOTING
A rack for holding the capillary tube modules is also now available. Each rack
will hold three filled capillary tube modules. These module racks should help eliminate damage to capillary tubes when filled modules are set down prior to reinsertion into the instrument top. The part number is 1735.
Improved Buffer System
SERVICE AND
MAINTENANCE
We have made several improvements to the buffers optimized for rapid
cycling. Traditionally we have used Ficoll and tartrazine to increase the density of
our buffer and make it visible for direct loading of product onto gels. We now recommend substituting sucrose for Ficoll, and cresol red for tartrazine.
WARRANTY
AND UPGRADES
For optimizations we have traditionally recommended using a three-by-three
matrix of 3 mM, 2 mM, and 1 mM Mg2+ run at three annealing temperatures;
40°C, 50°C, and 60°C. However, our experience is that most reactions optimize at
the higher end of the Mg2+ concentration, therefore we now recommend using
2 mM, 3 mM and 4 mM Mg2+ in the high, medium and low buffers.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
We will include the new buffers free with all reagent orders for the next few
months and if the reaction is positive, we will switch to the new system for individual buffer orders and the Optimizer Kit. As usual we are also publishing the
reagent constituents in case you choose to make your own buffers. On the following pages are procedures for running individual reactions, making mastermixes, and making the reaction constituents themselves.
INDEX
104
SETTING UP
Reaction Mixes and Buffer Recipes
from Carl Wittwer's laboratory
[10X]
[Reaction]
Separate
Combined
DNA
50 ng/µL
or A 260 = 1.0
50 ng/10µl
1 µl
1 µl
Primers
Separate
Primer 1
Primer 2
or Combined
Primer 1 + 2
5 µM
5 µM
0.5 µM
0.5 µM
1 µl
1 µl
5 µM each
0.5 µM each
Nucleotides
2 mM each dNTP
200 µM each dNTP
1 µl
1 µl
Buffer
500 mM Tris, pH 8.3
2.5 mg/ml BSA
20% (w/v) Sucrose
1mM Cresol Red
50 mM Tris, pH 8.3
250 µg/ml BSA
2% (w/v) Sucrose
0.1 mM Cresol Red
1 µl
1 µl
20 mM MgCl2
30 mM MgCl2
40 mM MgCl2
2 mM MgCl2
3 mM MgCl2
4 mM MgCl2
0.4 U/µL
0.4U/10µl
1 µl
1 µl
4 µl
5 µl
(human genomic)
WARRANTY
AND UPGRADES
dH20/other
SERVICE AND
MAINTENANCE
Enzyme
1 µl
TROUBLE
SHOOTING
Low Mg2+
Medium Mg2+
High Mg2+
PROGRAMMING
Component
SAMPLE
HANDLING
Reaction Constituents for One 10 µl Reaction
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
105
SETTING UP
Amplification Procedure
1. Prepare master mix without DNA and without primers weekly:
SAMPLE
HANDLING
For >50 runs at a 10 µl reaction volume:
For <50 runs at a 10 µl reaction volume:
Dilute Enzyme to 0.4 U/µl
PROGRAMMING
11.5 parts Enzyme diluent
(10 mM Tris pH 8.3, 2.5 mg/ml BSA)
1 part Enzyme (5 U/µl)
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
For separate 5 uM primers:
4 parts dH20
1 part buffer
1 part 2 mM dNTPs
1 part 0.4U/µl Enzyme
For separate 5 uM primers:
308 (61.5 parts) dH20
63 µl (12.5 parts) buffer
63 µl (12.5 parts) 2 mM dNTPs
5 µl (1 part) 5U/µl Enzyme
For combined 5 uM primers:
5 parts dH20
1 part buffer
1 part 2 mM dNTPs
1 part 0.4U/µl Enzyme
For combined 5 uM primers:
370 (74 parts) dH20
63 µl (12.5 parts) buffer
63 µl (12.5 parts) 2 mM dNTPs
5 µl (1 part) 5U/µl Enzyme
Mix and store at 4°C for < 1 week.
Mix and store at 4°C for < 1 week.
2. For each run with a specific primer pair, make a primer-specific mix:
WARRANTY
AND UPGRADES
For separate 5 µM primers
1 part 5 µM primer 1
1 part 5 µM primer 2
7 parts master mix
For separate 5 µM primers
1 part 5 µM primer 1
1 part 5 µM primer 2
7 parts master mix
RAPIDCYCLIST
NEWSLETTER
ARTICLES
3. Add 1 µl of each sample DNA (for genomic DNA, 50 ug/ml or A260=1.0) to
individual wells in a microtiter plate. Pipette 9 µl of the specific-primer mix into
each well and mix by pipetting up and down. Load capillary tubes into the modular tops and aspirate 8 samples at a time by capillary action. Flame seal the
loading end of the tubes, then seal other end. Place into the Air Thermo-Cycler
and run at desired protocol. When reaction is complete, score each end of the
glass tubes while still in the modular top, break glass and transfer directly into the
gel wells.
INDEX
106
SETTING UP
Working Solutions
3. 10X Nucleotides (2 mM each dATP, dCTP, dGTP, dTTP)
50X TE' solution, pH 8.3 (500 mM Tris, 5mM EDTA)
250 µl 100 mM
250 µl 100 mM
250 µl 100 mM
250 µl 100 mM
to 12.5 ml with
10 m l 2 M Tris, pH 8.3
400 µl 0.5 M EDTA
dH2O to 40 ml
or
2.5
0.5
5.0
1.0
10 ml 50X TE'
dH2O to 500 ml
2. Make 50 µM primer stocks with 1X TE'.
For 10X separate primers
40 µl (1 part) 50 µM Primer
360 µl (9 parts) 1X TE'
Tris, pH 8.3 (2 M stock)
BSA (50 mg/ml stock)
40% Sucrose
10 mM Cresol Red
Low Mg2+
Medium Mg2+
High Mg2+
200 µl (1M MgCl2) + 800 µl H2O
300 µl (1M MgCl2) + 700 µl H2O
400 µl (1M MgCl2) + 600 µl H2O
TROUBLE
SHOOTING
Make10X primers (5 µM) either separately or combined:
ml
ml
ml
ml
PROGRAMMING
4. 10X Buffer
1X TE' solution, pH 8.3 (10 mM Tris, 0.1 mM EDTA)
200 µl 50X TE'
dH2O to 10 ml
dATP (Sigma D4788)
dCTP (Sigma D4913)
dGTP (Sigma D5038)
dTTP (Sigma T9656)
dH2O
SAMPLE
HANDLING
1. Primers and DNA are prepared in 1X TE':
5. Enzyme diluent (10 mM Tris, pH 8.3, 2.5 mg/ml BSA)
40 µl (1 part) 50 µM Primer 1
40 µl (1 part) 50 µM Primer 2
320 µl (8 parts) 1X TE'
SERVICE AND
MAINTENANCE
50 µl 2 M Tris, pH 8.3
500 µl 50 mg/ml BSA
9.5 ml dH2O
For 10X combined primers
WARRANTY
AND UPGRADES
Stock Solutions
ARTICLES
All solutions are made from deionized, distilled water. No stir bars or pH meters
are to be used in the preparation of stock or working solutions. Check pH
by withdrawing 10 µl of solution and placing it on pH paper.
2 M Tris, pH 8.3
or
INDEX
107
RAPIDCYCLIST
NEWSLETTER
14.80 g Tris base (Sigma T1503)
12.28 g Tris HCI ( Sigma T 3253)
to 100 ml with H2O
SETTING UP
27.08 g TRISMA Preset, pH 8.3 (Sigma T5128)
to 100 ml with H2O
SAMPLE
HANDLING
1 M MgCl2
20.3 g MgCl2 (Sigma M9272)
to 100 ml dH2O
PROGRAMMING
or
Sigma M1028 ( ready made)
50 mg/ml BSA
TROUBLE
SHOOTING
0.50 g BSA (Sigma A2153)
to 10 ml dH2O (use 15 ml tube)
10 mM Cresol Red
SERVICE AND
MAINTENANCE
404 mg cresol red (Sigma C9877)
to 100 ml dH2O
40% (w/v) Sucrose
WARRANTY
AND UPGRADES
40.0 g sucrose (Sigma S5016)
to 100 ml dH2O
0.5 M EDTA, pH 8.3
RAPIDCYCLIST
NEWSLETTER
ARTICLES
18.6 g disodium EDTA (Sigma ED2SS)
10 ml 5 N NaOH (Baxter H369-1*NY)
to 100 ml dH2O
INDEX
108
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
109
WARRANTY
AND UPGRADES
Mistake #4.
Adding polymerase to a microtiter plate before BSA. For convenience, many
people mix reactions in a microtiter plate so they can be loaded simultaneously
by capillary action into tubes already placed in modular tops. However, if the
polymerase is added to a microtiter well before BSA, the polymerase can be
adsorbed onto the plastic surface and not loaded into the capillaries. To prevent
adsorption of polymerase during handling, we recommend diluting the polymerase to a 10X concentration with a diluent that includes BSA at 2.5 mg/ml. In
addition, always block the well surface with BSA by adding the BSA-containing
buffer before the polymerase. Microtiter plates that do not absorb protein can
also be used and are available from Idaho Technology (microtiter plate, part
SERVICE AND
MAINTENANCE
Mistake #3.
Using Triton X-100. Some manufacturers of heat stable polymerases state that
0.1% Triton X-100 is needed for enzyme activation. Triton X-100 does activate
some enzymes when BSA is not present and amplification occurs in microfuge
tubes. However, Triton X-100 is not necessary when BSA is present. Furthermore, if
Triton X-100 is added, yield substantially decreases in capillary amplifications that
include BSA.
TROUBLE
SHOOTING
Mistake #2.
Using acetylated bovine serum albumin. It is expensive and does not work.
Presumably, the same sites that are acetylated are those sites necessary to coat
the glass walls and prevent polymerase inactivation.
PROGRAMMING
Mistake #1.
Not having bovine serum albumin in the reaction. You will not get amplification in capillary tubes without BSA. Most buffers supplied by manufacturers of the
enzyme do not include BSA. BSA is necessary to prevent surface adsorption/inactivation of the DNA polymerase on the large surface area of the capillary tubes.
Yield increases with BSA concentrations up to 500 µg/ml in the reaction. Using
gelatin gives a poor yield in capillary tubes. You can make up your own buffers.
We recommend including 2.5 mg/ml BSA in the 10X buffer and 2.5 mg/ml in a 10X
polymerase dilution. The grade of BSA is not critical. We use Sigma #A2153.
SAMPLE
HANDLING
Carl Wittwer
Dept. Pathology
University of Utah Medical School
SETTING UP
Rapid Cycle DNA Amplification –
The 10 Most Common Mistakes
SETTING UP
number 2590; lid, part number 2591) , but BSA is still necessary for the capillary
tubes, whether glass or plastic.
SAMPLE
HANDLING
Mistake #5.
Pulling tubes out near the denaturation temperature. If double stranded
product is cooled rapidly (by pulling a tube out of an air cycler that is near
denaturation temperatures), not all the product will reanneal and multiple
apparent products may appear on gels.
PROGRAMMING
TROUBLE
SHOOTING
Mistake #6.
Using excessive denaturation times. There is no reason for denaturation times
longer than "0" sec at 94° C. The Tm of products in amplification buffer is around
85-90° C and complete denaturation of product at 94° C occurs faster than can
be measured (< 1 sec. See Wittwer and Garling, 1991, BioTechniques, 10: 76-83,
or Wittwer et al., 1994, in: The Polymerase Chain Reaction , Mullis, Ferre, and
Gibbs, eds., pp. 174-181). The only possible exception is on the first cycle when
high quality, complex genomic DNA is used as template. An initial denaturation
of 5-15 sec at 94° C on the first cycle may allow more complete initial denaturation. However, extended times at high temperatures degrade DNA, and are particularly harmful in long product amplifications (CE Gustafson et al., 1993, Gene
123:241-244, and W.M. Barnes, 1994, PNAS, 91: 2216-2220).
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Mistake #7.
Using nonstandard capillary tubes. The tubular metal-sheathed thermocouple that monitors temperature in the air cycler is precisely matched in thermal
response to aqueous samples in the 10 µl capillary tubes sold by Idaho
Technology. When nonstandard capillary tubes are used, the temperature of the
sample will not correspond to the temperature indicated on the instrument readout. If you optimize a reaction in 10 µl tubes, and later run the reaction in larger
tubes, you should not expect similar results. Larger tubes will not reach target
temperatures without setting a hold time. If you insist on using larger or nonstandard tubes, you can monitor the sample temperature inside the tube with an IT23 micro-thermocouple probe available from Sensortek (Clifton, NJ) and empirically adjust target temperatures and hold times. Be aware that some types of
glass interfere with the reaction, presumably because ions on or near the surface
of the glass are absorbed into the reaction buffer.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
INDEX
110
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Mistake #10.
Poor temperature/time optimization. Rapid cycle temperature/time parameters are very different from slower cyclers. It is a mistake to directly transfer a protocol like, "1 min at 94° C, 2 min at 55° C, and 3 min at 72° C," to a rapid cycler.
Denaturation should be set at 94° C for 0" sec. The annealing time should almost
always also be set at "0" sec. The extension temperature should be 70-74° C. The
extension time should be "0" sec for products up to 100 bp, 5-15 sec for products
up to 500 bp, and about 30 sec for a 1000 bp product. Most amplifications with
20-mer primers will work well using 3 mM MgCl2 at an annealing temperature of
50° C. Rapid cycling makes it feasible to rapidly test all combinations of 3 different annealing temperatures (40° C, 50° C, and 60° C) and 3 different Mg concentrations (2 mM, 3 mM, and 4 mM).
SAMPLE
HANDLING
Mistake #9.
Inappropriate Mg2+ concentration. Rapid cycling generally requires higher
magnesium concentrations than slow cycling. For example, whereas 1.5 mM
magnesium chloride is standard in slow cycling, 2-4 mM is more typical for rapid
cycling. With 2-4 mM magnesium chloride, excellent yield and specificity can be
obtained with annealing times of "0" sec. Magnesium chloride is hygroscopic and
it may be difficult to prepare accurate solutions from the solid salt. We use a 1 M
solution of magnesium chloride available from Sigma (#M1028).
SETTING UP
Mistake #8.
Forgetting to add a critical component. Accidental omission of polymerase,
dNTP1s, or buffer components can be avoided by "master mixes" that include
everything necessary for amplification except primers and template. Such a
master mix, if sterile, lasts for 3-6 weeks at room temperature, >15 weeks at 4° C,
and > 26 weeks at -20° C. Master mixes also minimize pipetting errors, particularly with small volumes.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
111
SETTING UP
The
SAMPLE
HANDLING
RAPIDCYCLIST
PROGRAMMING
Volume 3 , Number 1
Fall 1995
Capillary Tube Handling
with the Rapidcycler
TROUBLE
SHOOTING
Randy P. Rasmussen
Dept. of Biology
University of Utah
SERVICE AND
MAINTENANCE
One of the biggest concerns for new users of air-cyclers is the handling and
sealing of glass capillary tubes. While they are a bit more difficult to use than the
traditional microcentrifuge tube, the rapid cycle times and temperature homogeneity made possible by the capillaries makes them more than worth the extra
trouble. After a little practice, you may wonder why you ever worried.
WARRANTY
AND UPGRADES
Single Tube Handling
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Mixing the Sample
You can mix your reaction in any sort
of container, I use low protein absorbing
microtiter dishes (IT#2590). Take care at
the mixing step as one of the most common causes of reaction failure is forgetting a component of the reaction (see
"The 10 most common mistakes", Rapid
Cyclist 2:11-12). The chances of leaving
something out can be reduced by making up "master mixes" that contain everything but primer and template. The mix
can be stored at 4° C for up to 3 months
(see "Reaction mixes and buffer recipes",
Rapid Cyclist 2:9).
INDEX
112
Figure 1. Tipping the capillary tube sideways
to increase the rate of liquid uptake.
SETTING UP
SAMPLE
HANDLING
PROGRAMMING
Figure 2. Directly
injecting sample
into the tube using
a pipetman.
Figure 3. Sealing
capillary with a
Blazer mini butane
torch.
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
After the capillary is
loaded, tip the tube to
center the liquid. Hold
the tube in the center
and place the end just
into the flame. Rotate the
tube in the flame by
rolling it between your
thumb and index finger.
You should be able to see
the glass slowly close in
on itself. Try to avoid leaving the tube in the flame
too long, as you can end
up with a big ugly glob of
glass which will not fit into
the holder . This is more
SERVICE AND
MAINTENANCE
Sealing the capillary
The glass capillaries sold by Idaho Technology are made out of a high sodium, low melting temperature glass. This makes them very easy to flame seal with
just about any flame, They can be sealed with a Bic lighter (Figure 3), a Bunsen
burner, a candle, or, my favorite, a Blazer mini propane torch (IT#2721).
TROUBLE
SHOOTING
Loading the capillary
Glass capillary tubes are easily loaded
by capillary action. You can increase the
rate of liquid uptake by tipping the capillary tube sideways (figure 1). You can also
load the capillaries using a Drummond
microaspirator (IT#1690) to draw the reaction mix up into the tube, or you can use a
pipetman to directly inject sample into
the tube (Figure 2). The 10 ul size tubes
hold 2.2 ul/cm and can be used for reaction volumes from 5 to 15 ul. The 10 ul capillaries come to temperature so quickly
that they require no holds at denaturation
or annealing. The 50 ul tubes hold 9 ul/cm
and are useful for reaction volumes from
15 to 70 ul. These tubes require a 15 second hold at the denaturation and annealing temperature.
INDEX
113
SETTING UP
SAMPLE
HANDLING
likely in very hot flames.
Cutting down the air to the
flame will cool these burners down and make the
capillaries easier to seal.
Figure 4. Scoring
capillary ends with
sapphire cutter.
PROGRAMMING
You can confirm that
the end is sealed by looking
carefully at the end for a
continuous wall of glass
around the end. You can
also confirm sealing by
blowing on the hot end of
the capillary and watching
to see if the liquid moves
toward the end of the capillary as the glass cools (This
is more dramatic for the first
seal than the second).
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Repeat the sealing
process on the other end
and then insert the tube
into the capillary holding
module. A module rack
(IT#1735) makes these
manipulations easier.
Figure 5. Using
capillary tube
as a "pipet tip"
and
directly
loading sample into gel.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Sample Recovery
After your reaction is done you pull the tube from the module, lightly score
the two ends with a sapphire knife (Figure 4, IT#1691) and break off the ends. The
capillary tube then becomes a 3pipet tip2 for the Drummond microaspirator
(IT#1690) and can be used to directly load your sample into a gel (Figure 5), or
into a storage tube.
Beware, the pressure caused by sliding the capillary into the microaspirator
can cause your sample to be blown out of the tube. This is easily prevented by
dialing the microaspirator back a bit as you insert the capillary tube. The silicon
tips of the microaspirator wear out quite quickly, so if your microaspirator stops
working try replacing the tip (IT#1870).
INDEX
114
SAMPLE
HANDLING
PROGRAMMING
TROUBLE
SHOOTING
Eight Sample Handling
When sample modules are made with microtiter spacing it is possible to mix
up eight samples at a time in a microtiter dish and draw them up simultaneously
by capillary action (Figure 6). All eight samples can be centered by tilting the
module and then the tubes can be sealed by passing the tubes through a flame
one at a time (Figure 7). Once the reaction is done you can score all eight tubes
at once by lightly drawing the sapphire knife across the top of the module (Figure
8) and then breaking off each tube top (Figure 9). Press the module down to the
other end of the
capillary tubes and
repeat the scoring
and breaking.
SETTING UP
Multiple Tube Handling
Once you get single sample handling down, you may want to try some of
these "advanced" multiple sample handling tricks.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Figure 6. Mixing
eight samples at
a
time
and
drawing them
up simultaneously with capillary
action.
ARTICLES
Figure 7. Sealing capillaries by passing
the tubes through the flame one at a
time.
RAPIDCYCLIST
NEWSLETTER
INDEX
115
Sixteen Sample Handling
After mastering the eight sample tricks, you may want to try 16 at a time. All
sixteen tubes in the module can be filled simultaneously by capillary action. After
centering the samples the two rows of eight tubes can then be staggered off
from each other by pressing the tubes down on a bench top. The bottom of the
first row of eight tubes, and the top row of the second row of eight can then be
sealed one at a time by passing through the flame. The staggered rows can then
be switched and the remaining two ends can be sealed. After the reaction is
done the ends can be scored as in the eight sample example.
Figure 8. Scoring all eight
tubes at once by lightly
drawing the sapphire knife
across the top of the module.
RAPIDCYCLIST
NEWSLETTER
Figure 9. Breaking off
tube top after scoring.
INDEX
116
INDEX
117
RAPIDCYCLIST
NEWSLETTER
Figure 2. Temperature traces of the hold method (2B) versus the over heat and under heat
method (2A). Traces are of air temperature and actual sample temperature. Notice how the
sample temperature always lags behind the air temperature, and how the over/under heat
method brings the sample to temperature more quickly.
SETTING UP
SAMPLE
HANDLING
Use of Thin Walled Microcentrifuge Tubes
with the RapidCycler
Randy P. Rasmussen
Dept. of Biology
University of Utah
PROGRAMMING
TROUBLE
SHOOTING
The development of thin walled micro test tubes makes it possible to combine the speed of the air cycling with the convenience of that "universal vessel"
of molecular biology, the microcentrifuge tube. While the Rapidcycler was
developed for use with glass capillaries, it provides excellent results with thin
walled microcentrifuge tubes. Using modified sample modules, the Rapidcycler
can hold up to 48 micro test tubes Figure 1 shows that all 48 positions give a
clean, bright, 500 bp product in a DNA amplification from Human genomic DNA.
SERVICE AND
MAINTENANCE
Thin walled micro test tubes have many advantages over capillary tubes.
First, handling of the sample tube is much simpler; reactions can be made up in
the micro test tube, no heat sealing is required, concern about breaking the
tubes is eliminated. Second, there is no
need to adjust buffers or protocols. The
buffers that manufacturers provide with
their thermostable polymerases work in
these tubes without modification.
Published protocols developed in heat
block instruments seem to transfer more
readily to the Rapidcycler when micro
test tubes are used.
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
The thermal properties of thin walled
microcentrifuge tubes are much better
than their thick walled ancestors, but
they are still no match for a capillary
tube. Using thin walled microcentrifuge
tubes requires a sacrifice in speed and
in sample temperature uniformity. A 10
µl reaction that would take 15 minutes
in a capillary tube, takes 35 minutes in a
thin walled microcentrifuge tube, a 50
µl reaction that would take 20 minutes
in a capillary, takes 50 minutes in a
microcentrifuge tube.
INDEX
118
Figure 1. Amplification of a 500 bp target
from human genomic DNA in all 48 sample
positions of the Air Thermo-Cycler. Reactions
volume was 50 µl, no oil overlay. Reactions
contained Idaho Technology medium buffer,
200 µM each dNTP, 5 µM each primer (RS/KM),
50 ng human genomic DNA. Cycling parameters were 96° for 30 seconds, then 30 cycles
of 96° for 30 seconds, 55° for 30 seconds, 75°
for 20 seconds.
WARRANTY
AND UPGRADES
50 µl Reactions
SERVICE AND
MAINTENANCE
74°C for 25 nucleotides per seconds
TROUBLE
SHOOTING
Extend
Predenature: 96°C for 30 seconds
Cycle: Denature 96°C for 30 seconds
Anneal
40°C to 60°C for 30 seconds
(as appropriate for your primers)
Extend
74°C for 25 nucleotides per seconds
ARTICLES
RAPIDCYCLIST
NEWSLETTER
I have had good success
with the faster overheat and
under heat approach. The following protocols have been
successful with a variety of
primers and DNA sources. If you
prefer the sit and wait
approach 10 µl samples require
40 second holds at denaturation and annealing, 50 µl samples 60 second holds at denaturation
and
annealing.
Elongation
requires
25
nucleotides per second plus
about 15 seconds.
PROGRAMMING
There are two possible approaches when using microcentrifuge tubes. You
can set the machine to the temperature you want, and wait for the microcentrifuge tube to get to that temperature (Figure 2B) This is what the slower heat
block cyclers do). This method is slow, but it assures you that no part of your sample is ever over the target temperature. A faster approach is to overheat and
under heat the air. This brings
the sample to temperature
more quickly (Figure 2A). The
10 µl Reactions
faster heat block instruments do
Predenature: 98°C for 10 seconds
this), but some parts of your
sample may be slightly above
Cycle: Denature 98°C for 10 seconds
or below the target temperaAnneal
40°C to 60°C for 10 seconds
tures.
(as appropriate for your primers)
SAMPLE
HANDLING
Thin Walled Microcentrifuge Tube Cycling protocols for the
Rapidcycler
SETTING UP
Because the Rapidcycler was developed for capillary tubes the temperature
values that you program into the machine, and the temperatures displayed during cycling, reflect what the temperature would be in a 10 µl capillary. When
using microcentrifuge tubes you must modify the program parameters to compensate for the thermal differences between capillaries and microcentrifuge
tubes.
INDEX
119
SETTING UP
Optimization of Reactions in Thin Walled Microcentrifuge Tubes
SAMPLE
HANDLING
The same optimization protocol that has been recommended in capillaries
(Optimizing Rapid Cycle DNA Amplification Reactions, Rapid Cyclist 1:1-5,1992)
has provided excellent results in thin walled microcentrifuge tubes.
PROGRAMMING
Optimal reaction conditions are found by running amplifications at 40°C,
50°C and 60°C with 2 mM, 3 mM and 4 mM MgCl2 at each temperature. This
allows you to test 9 different stringencies, while only requiring you make up three
different reaction mixes.
I have used this optimization protocol successfully with Idaho Technology
buffers (low, medium and high MgCl buffers), Promega 10X Taq buffer and
Stratagene 10X Pfu buffer.
TROUBLE
SHOOTING
Are Mineral Oil Overlays Required?
SERVICE AND
MAINTENANCE
The thin walled microcentrifuge tube holders for the Rapidcycler put the
entire tube inside the reaction chamber. This keeps the whole tube at the same
temperature and thus reduces condensation. A small amount of condensation
occurs on the leeward side of the tubes, but I have not found this to be a practical problem, even for 10 µl reactions. While a little mineral oil does stop this condensation, in general, oil is not needed for 10 µl reactions.
WARRANTY
AND UPGRADES
50 µl reactions show minimal condensation, but will occasionally pop open
during reactions if no oil is used. The frequency with which this occurs seems to
vary with reaction buffer and with tube manufacturer, so you may wish to experiment with your particular combination.
Real Versus Set Temperatures
RAPIDCYCLIST
NEWSLETTER
ARTICLES
The actual sample annealing temperature may not be important to you if
you optimize the reaction experimentally as recommended above. If you do
need a particular annealing temperature, the value you should set can be calculated using the equations in figure 4. I have provided graphs for 10 µl reactions
with a 10 second hold (Figure 4A) and for 50 µl reactions with a 30 second hold
(Figure 4B).
INDEX
120
Figure 3. Optimization of RS/KM
primer pair in microfuge tubes.
Lanes 1-3: 60°C annealing, 4, 3
and 2 mM MgCl. Lanes 4-6: 50°C
annealing, 4, 3 and 2 mM MgCl.
Lanes 7-9: 40°C annealing, 4,3
and 2 mM MgCl. 10 µl reaction
volume, no oil, 10 sec. holds at
annealing and denaturation.
Figure 4. Linear relationship between the temperature programmed into the air cycler and the actual
sample temperature for thin walled capillary tubes. 4A: 10 µl samples, 10 second holds, no oil overlay.
4B: 50 µl samples, 30 second holds, no oil overlay.
RAPIDCYCLIST
NEWSLETTER
INDEX
121
SETTING UP
Direct Sequencing of Long PCR Products
SAMPLE
HANDLING
Eric Kofoid
Dept. Biology, University of Utah
Introduction
PROGRAMMING
Vitamin B12 is an essential cofactor of many non-photosynthetic eukaryotes.
It is synthesized by prokaryotes and archebacteria both aerobically and anaerobically. In Salmonella typhimurium the anaerobic pathway is dependent on at
least 30 genes. Several of these genes also occur in Escherichia coli, allowing synthesis from intermediates.
TROUBLE
SHOOTING
In spite of the fact that over 1% of the Salmonella genome is dedicated to
B12 synthesis, cells unable to make the cofactor do well anaerobically under laboratory conditions. Only a few B12 dependent pathways are known and none
seem essential. For example, the eut enzymes enable growth on ethanolamine
as a source of carbon or nitrogen; the pdu regulon allows utilization of propanediol as a carbon source; and the MetH protein provides an alternate route for the
final step in methionine biosynthesis.
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
Knowing the sequence of the eut operon forms a fundamental part of our
strategy in characterizing the synthesis and importance of B12 in Salmonella. I
have not been able to clone eut using standard techniques, suggesting that
minor variations in its expression levels may have dramatic effects on the wellbeing of the cell. Instead, I have chosen to amplify portions of the operon from
the genome and to sequence these PCR products directly.
Sequencing Strategy
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Direct PCR sequencing has the advantage of blending Taq polymeraseinduced errors into the background. However, linearized double-stranded template yields short, dirty "reads" with many premature stops. The technique is usually avoided in favor of sequencing cloned amplified DNA. Such inserts often
contain polymerization mutations. Two and sometimes three independent clones
must be sequenced to determine the primary structure with confidence. This,
together with the overhead of plasmid preparation, increases the time required.
Recently, a fast and efficient method for DNA strand separation based on
magnetic bead technology became commercially available (Dynal; 5
Delaware Drive, Lake Success, NY 11042; 800 638-9416). This allows exceptionally
clean direct PCR sequencing using single-stranded templates. In addition, by
optimizing for long amplification products, less time is spent preparing DNA.
INDEX
122
SETTING UP
Mispriming & Parasites
INDEX
123
RAPIDCYCLIST
NEWSLETTER
I have also had excellent success using cells scraped form a plate in place of
genomic DNA. In this case, I either simply touch the cells directly to the reaction
mix, or resuspend them in 50 uL TE (10 mM Tris, pH 8.3; 1 mM EDTA), heat 2' at 95°,
spin down and use the supernatant, diluted zero to 100-fold. The remainder can
be frozen for future use.
ARTICLES
I usually use reamplified template DNA for sequencing. I first prepare a starter
by amplification of genomic DNA (either purified, crude or encapsulated in
cells). Subsequent template preparations are reamplified from a 1:100 dilution of
the starter. This is especially important when genomic DNA (prepared according
to Ausubel, F.A. et al. (eds), 1990, Current Protocols in Molecular Biology, Greene
Publishing and Wiley-Interscience, New York, pp. 2.4.1 - 2.4.2) is used in the primary reaction.
WARRANTY
AND UPGRADES
Reamplification
SERVICE AND
MAINTENANCE
Best results always correlate with well designed primers (20-30 nucleotides
with approximately 50% G+C content; no 3' terminal complementarities; no internal palindromes; no runs of G or C near 3' end). Primers should be "balanced " in
the sense that overall lengths and compositions are about the same. I often
include 5' tails for special purposes and find little, if any detrimental effect if the
3' end is at least 20 bases long. Trailing sequences can be amazingly long.
TROUBLE
SHOOTING
Primer Design
PROGRAMMING
I eliminate primer dimer formation and false priming prior to the first denaturation step by including TaqStart antibody (Clonetech, Catalog #5400-x; 4030
Fabian Way, Palo Alto, CA 94303-4607; 800 662-2566). This temporarily inactivates
the polymerase, which reactivates as increasing temperature denatures the antibody. To use the reagent, combine 1 volume Taq polymerase (5 units/ml), 1 volume of TaqStart (7 uM) and 10.5 volumes of enzyme dilution buffer (2.5 mg/ml
bovine serum albumin [BSA] in 10 mM Tris pH 8.3). This is then used as normal Taq
polymerase stock at 0.4 units/ul.
SAMPLE
HANDLING
I routinely amplify product in the range 3-5 Kb. A major problem when generating molecules of this size is the tendency of non-specific smaller products to
deplete reactants. Such parasites arise through false priming events and
become favored, as efficiency per cycle is inversely correlated with product size.
The short dwell times used by the Air Thermo-Cycler during annealing discourage
false priming. Nevertheless, single primer controls should always be run to verify
that a given product is dependent on both primers.
SETTING UP
More Tricks for Large Products
SAMPLE
HANDLING
Purified genomic DNA should never be preboiled. Too many nicks are introduced and long products are more difficult to amplify. Preceding a primary
genomic amplification with a 30 sec hold at 94° and following PCR with a 5 min
hold at 72° improves yield. When characterizing a new primer pair, I always optimize according to the simple "3 x 3" scheme of Rasmussen (Rapid Cyclist vol .1,
no. 1, 1-5, 1992). This takes only a couple of hours and pays great dividends.
PROGRAMMING
PCR Reaction for a Typical Analytical Amplification
Use 10 - 15 uL of the following in a single capillary. For a preparative run, scale
by 5 and load into 6 capillaries.
TROUBLE
SHOOTING
A Typical Amplification Program
SERVICE AND
MAINTENANCE
For products longer than 1 kb,
assume an elongation rate of 20
bases/sec for the elongation time. The
annealing temperature can vary from
40° to 65°, and is determined empirically
in a "3 x 3" optimization. For products
longer than 3 kb, a denaturation time of
5 sec frequently improves the yield. If
primers are poorly balanced or imperfectly match their sites, a ramp constant
"S" of 6 will sometimes help.
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
For single product preparative runs,
use Wizard PCR Prep (Promega; 2800
Woods Hollow Road, Madison, WI 537115399; 800 356-9526) for rapid cleanup.
Elute with H2O and store at -20°. When
more than one band is present, excise
the correct one and purify with
GeneClean (Bio 101; PO Box 2284, La
Jolla, CA 92038-2284; 800 424-6101).
Again, elute with H2O and store frozen.
INDEX
124
8
2
2
2
2
2
2
uL water
uL 10X PCR Reaction Buffer
uL 4 dNTP's, each at 2 mM
uL primer 1 at 5 uM
uL primer 2 at 5 uM
uL DNA, diluted 1:100
ul Taq + TaqStart (see above)
Total = 20 uL
10X PCR Reaction Buffer: 500 mM Tris, pH 8.3,
2.5 mg/ml BSA, 5% Ficoll and 10 mM Cresol
Red. MgCl2 added to 10, 20 or 30 mM.
1. Hold 30 sec at 94°
2. Cycle parameters
(as they occur on Air Thermo-Cycler screen):
D94 A50 E72 C30 S9
d0 a0 e1'0"
3. Hold 5 min at 72°
DynaBeads or "Beads" - DynaBeads M-280 Dynal
HBWB - high-salt "Binding & Wash Buffer"
10 mM
Tris, pH 7.5
1
mM
Na2 EDTA
3
M
NaCl
PROGRAMMING
"Acetate Solution" - Potassium acetate, pH 4.8
(5 M acetate, 3 M K)
294
g
KCH3CO2
115
ml
HCH3CO2
H2O to 1 liter (no need to check pH)
SAMPLE
HANDLING
There are several methods for
preparing single-stranded DNA from
PCR products, such as asymmetric
amplification, exonuclease digestion
and magnetic separation. I prefer
the last as it is fast and the magnetic
beads lend themselves to a number
of other techniques. It requires that
one and only one of the two PCR
primers be biotinylated. Generally,
there is little additional cost for this
service.
SETTING UP
Magnetic Strand Separation & Purification of Both DNA Strands
TE
Tris, pH 7.4
Na2EDTA
INDEX
125
RAPIDCYCLIST
NEWSLETTER
3. Denature DNA:
load tube "C" with 30 uL 3 M acetate solution
resuspend beads in 15 uL 0.2 N NaOH
incubate 15 min x RT with occasional resuspension
magnetically separate, add supernatant to tube "C"
ARTICLES
2. Bind DNA
add 5 -20 uL PCR product to bead pellet mix by flicking
incubate 15 min RT with occasional resuspension
magnetically separate, discard supernatant
resuspend beads in 40 uL HBWB
magnetically separate, discard supernatant
WARRANTY
AND UPGRADES
1. Wash the beads:
vortex bead stock
add 10 uL beads to 20 uL HBWB in tube "W" vortex
magnetically separate, discard supernatant
resuspend beads in 30 uL HBWB
SERVICE AND
MAINTENANCE
The protocol yields two DNA
strands, separated and purified in a Glycogen Solution - 20 mg/ml
manner suitable for direct sequencBoehringer Mannheim, Catalog # 901-393
ing. The "W" strand is biotinylated and
the "C" is its complement. Preparation
of the "W" strand is a modification of the Dynal protocol which conserves beads
with no apparent sacrifice in yield. The method for preparing "C" strand is new .
Typically, 5 uL of either strand preparation is used in a single sequencing reaction.
TROUBLE
SHOOTING
10 mM
1
mM
SETTING UP
SAMPLE
HANDLING
4. More strand separation - repeat 3x
resuspend beads in 50 uL 0.2 N NaOH
magnetically separate, add supernatant to tube "C"
resuspend beads in 40 uL HBWB
magnetically separate, discard supernatant
resuspend beads in 50 uL TE
magnetically separate, discard supernatant
PROGRAMMING
5. "W" strand cleanup
resuspend beads in 25 uL H2O
store at -20 °
TROUBLE
SHOOTING
6. "C" strand cleanup
add 1 uL glycogen to tube "C" and mix well
add 500 uL 95% ethanol - mix well
30 min x ice
microfuge 10 min
wash once with 400 uL 70% ethanol
draw off ethanol in vacuum jar; avoid fully drying pellet
resuspend in 25 uL H2O
store at -20°
SERVICE AND
MAINTENANCE
Sequencing Reactions
WARRANTY
AND UPGRADES
This is a synopsis of my current sequencing methods. I use "Sequenase Version
2 with Pyrophosphatase" (USB, Catalog # 70175) and the "Manganese Reagent"
Sequenase Kit (USB, Catalog # 70130), which employs extensions and slight modification of commonly used dideoxy technology.
RAPIDCYCLIST
NEWSLETTER
ARTICLES
This protocol will yield sufficient material for fully redundant loading of 1.5 uL
samples on two gels. "Mix" quantities are given for a single primer/template pair.
Multiply amounts by the number of such sequences plus one. Wherever temperature blocks are called for, each cavity used is filled with water.
1. Annealing - combine in a small Eppendorf vial:
7 uL DNA at 0.1 - 1 ug/mL
1 uL primer at 5 uM
1 uL 10X MOPS: included in kit
1 uL 10X Mn Solution: included in kit
Total = 10 uL
2 min at 65° - temp. block
30 min at 42° - small oven or temp. block
INDEX
126
"Manganese Reagent" Kit
USB, "Mn2+ Reagent Kit for DNA Sequencing",
catalog # 0130
"Enzymes"
USB,
"Sequenase
Version
2
with
Pyrophosphatase", catalog # 70175
SAMPLE
HANDLING
0 -5 min at room temperature
(Shorter times allow reads closer
to template. 5 min is the norm.)
SETTING UP
2. Extension - add:
5.5
uL
EMix
Total = 15.5 uL
EMix
"Mini Trays"
InterMountain Scientific, 1610 S. Main,Suite H,
Bountiful, UT 84010, (801) 298-7884;
"Micro Well Mini Tray", cat. #438733.
SERVICE AND
MAINTENANCE
TdT Mix
3.4 uL H2O
0.3 uL 4 dNTP's, each at 2 mM
(Pharmacia, "Ultrapure dNTP Set", cat. # 272035)
0.3 uL terminal deoxynucleotidyl transferase
@20 u/uL (BRL, cat. # 8008SB)
TROUBLE
SHOOTING
3. Termination - add to each
well of appropriate row:
3.5 uL extension reaction
Total in each well = 6 uL
10 min at 42° - small oven or
temp. block
1.6 uL H2O
1.0 uL 0.1 M DTT: included in kit
0.4 uL Sequence Labeling Mix ( incl. in kit),
diluted 1:5 with H2O
0.5 uL labeled dATP (32P, 33P, or 35S)
2.0 uL enzymes
Total = 5.5 uL
PROGRAMMING
During this time, add 2.5 uL termination mixes to a preheated
(37 ° C) mini tray. Distribute
each mix to its own column, filling as many wells as there are
reactions.
Each row corresponds to one primer/template
pair and can be color coded
on the reverse side of the tray.
Total = 4.0 uL
WARRANTY
AND UPGRADES
4. TdT Extension - optional; used
to resolve premature stops.
Add to each well:
1 uL TdT Mix
Total in each well = 7 uL
RAPIDCYCLIST
NEWSLETTER
INDEX
127
ARTICLES
5. Electrophoresis: place tray in vacuum jar, evacuate 15 min.
add to each well:
4 uL stop solution: included in kit
Total = ~6 uL
3 min at 75° - place covered tray under slug of 75° temperature block load
1.5 ul sample per well
SETTING UP
SAMPLE
HANDLING
Rapid PCR Fingerprinting of Bacterial
Genomes with REP Primers in Capillary Tubes
Using the Air Thermo-Cycler.
PROGRAMMING
Ricardo Dewey 1,2,
Oscar Grau 1,3
Antonio Lagares 1*
1
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
DNA fingerprinting of genomes using PCR methods
has been intensively used during the last years to characterize genomic diversity and to search for specific DNA
markers (1-9). Different DNA banding patterns have been
obtained using primers with length ranging from 8 to 25
nucleotides containing either arbitrary (2, 3, 5, 8, 9) or
specific sequences (4, 6). In particular, the use of bacterial Repetitive Extragenic Palindromic sequences (REP)
and Enterobacterial Repetitive Intergeneric Consensus
(ERIC) have been proved to be practical and appropriate to fingerprint a number of different bacterial species
(4, 6). Although REP and ERIC primers do not lead to
amplification patterns as complex as those obtained with
the random primed DAF (1), visualization of amplified
DNA fragments can be easily achieved by agarose gel
electrophoresis/ethidium bromide staining. Thus, classic
REP and ERIC PCR amplifications may be efficiently used
to characterize Gram-negative and Gram-positive bacterial genomes in a 10 hours experimental procedure.
Here, we report a simple, rapid and reproducible protocol to perform REP DNA amplifications in 2 h using capillary tubes in air thermo-cyclers.
INDEX
128
Rm41
RMl-74
(-)
M
USDA1029
Introduction
Rm2011
TROUBLE
SHOOTING
Instituto de Bioquímica y Biología Molecular (IBBM), Facultad de Ciencias
Exactas, Universidad Nacional de La Plata, Argentina.
2
Instituto de Microbiología y Zoologia Agrícola (IMYZA), CICA, INTA Castelar,
Argentina.
3
CICA, INTA Castelar, Argentina.
*
Corresponding Author
1
2
3
4
5
Figure 1. amplification
patterns of four distinct R.
meliloti strains using whole
bacteria as the source of
DNA
in
the
Air
Thermo-Cycler
(ATC).
Lane 1, Rm 2011; lane 2,
Rm 1029; lane 3, Rm 41;
lane 4, Rm 1-74 and lane
5, control without template. Molecular weight
marker: lambda/HindIII.
SETTING UP
Methods
Rm2011 USDA1029 Rm41
M 1 2 3
4 5 6
7 8 9
Rm1-74
10 11 12
(-)
13 14 15
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
INDEX
129
RAPIDCYCLIST
NEWSLETTER
Figure 2. REP amplification patterns using metal
block (MBTC) and capilary air thermo cyclers
(ATC). Lane 1, Rm 2011 MBTC: lane 2 Rm 2011
MBTC/BSA; lane 3 RM 201 ATC/BSA; lane 4, Rm
1029 MBTC; lane 5 Rm 1029 MBTC/BSA; lane 6 Rm
1029 ATC/BSA; lane 7, Rm 41 MBTC; lane 8 Rm 41
MBTC/BSA; lane 9 Rm 41 ATC/BSA; lane 10, Rm 174 MBTC; lane 11 Rm 1-74 MBTC/BSA; lane 12 Rm
1-74 ATC/BSA; lanes 13, 14 and 15, controls without template for MBTC, MBTC/BSA and ATC/BSA,
respectively. Molecular weight marker: pUC
9/HaeIII.
ARTICLES
We set up the experimental conditions using 4 strains of the soil bacteria Rhizobium meliloti, Rm 2011 (Dr.
J. Dénarie, Toulouse, France), Rm
USDA 1029, Rm 41 (Dr. A. Kondorosi,
Paris, France) and Rm 1-74 (Dr. A.
Pühler, Bielefeld, Germany). The rapid
transfer of heat in the capillary sample container allowed the shortness
of amplification cycles from the
required 600 sec. in metal block thermo-cyclers (MBTC), to 140 sec. in the
ATC. Thus, the whole protocol could
be carried out in less than 2h using
either 1 µl of intact bacterial cells or
purified DNA as template. The
obtained DNA amplification patterns
were all different among the strains
(Fig 1) and allowed us to identify any
of them in subsequent screenings. To
validate this protocol designed for
the ATC, we compared REP amplifications in MBTC with those obtained
with the conditions here described.
Figure 2 shows that DNA amplification products were comparable and
tended to parallel each other when
BSA was present in the reaction indi-
PROGRAMMING
Results
SAMPLE
HANDLING
The amplification mixture composition was as follows: 50 mM Tris, pH 8.3; 500
µg/ml BSA; 3mM MgCl2 (1x high magnesium buffer-Idaho Tech.); 200 µM dNTPs;
1U Taq DNA polymerase (Promega Corp.); 15 µM of each REP primers; and 1 µl of
bacterial cells from a fresh isolated colony as the source of DNA template in a
final volume of 25 µl. The cycling conditions were as follows: 95°C for 5 min; 30
cycles at 94°C for 10 sec., 40°C for 10 sec. and 65°C for 2 min.; 1 final step at 65°C
for 4 min. All PCR amplifications were carried out using an Idaho 1605 Air ThermoCycler (ATC) in 25 µl capillary tubes. Ten µl of each sample were electrophoresed
in 0.8-1.5% agarose gels added with 150 µg/l ethidium bromide.
SETTING UP
SAMPLE
HANDLING
cating that BSA has additional effects other than the enzyme protection in the
capillary system. Moreover, the presence of BSA allowed the amplification of
DNA from the strain Rm 1-74. Total DNA preparation from these rhizobia was systematically contaminated by a yet unknown pigment which strongly inhibited
conventional PCR amplifications.
PROGRAMMING
The system here described for the characterization of bacterial genomes is
fast, reproducible, strain specific, and suitable for amplification of samples containing natural PCR inhibitors not removed during the cell heating or template
DNA preparations. The high number of individual isolates in strain collections represent a limiting factor during the selection of molecular characterization methods. The possibility to obtain reproducible DNA fingerprints in a short time represents a valuable alternative for programs of germoplasm characterization.
TROUBLE
SHOOTING
References
1. Bassam B. J., G. Caetano Anollés, and P. Gresshoff. 1992. DNA amplification fingerprinting of bacteria. Appl. Microbiol. Biotechnol. 38:70-76.
SERVICE AND
MAINTENANCE
2. Caetano Anollés, G. 1993. Amplifying DNA with arbitrary oligonucleotides
primers. PCR Methods and Applications 3:85-94.
3. Caetano Anollés, G., Bassam B. J., and P. Gresshoff. 1991. DNA amplification fingerprinting using very short arbitrary oligonucleotide primers.
Bio/Technology 9:553-557.
WARRANTY
AND UPGRADES
4. DeBruijn F. J. 1992. Use of repetitive (Repetitive Extragenic Palindromic and
Enterobacterial Repetitive Intergeneric Consensus) sequences and the polymerase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates
and other soil bacteria. Appl. Environ. Microbiol. 58:2180-2187.
5. Scroch, P., and J. Nienhuis. 1992. A RAPD protocol for the Air Thermo-Cycler.
The Rapid Cyclist 1:9-10.
ARTICLES
6. Versalovic J., Koeuth T., and J. R. Lupski. 1991. Distribution of repetitive DNA
sequences in eubacteria and application to fingerprinting of bacterial genomes.
Nucleic Acids Res. 19:6823-6831.
RAPIDCYCLIST
NEWSLETTER
7. Waugh R., W. Powell. 1992. Using RAPD markers for crop improvement.
TIBTECH 10:186-191.
8. Williams, J. G. K., Kubelik A. R., Livak K. J., Rafalski J. A., and S. V. Tingey.
1990. DNA polimorphisms amplified by arbitrary primers are useful as genetic
markers. Nucleic Acids Res. 18:6531-6535.
9. Welsh J., and M. McClelland. 1990. Fingerprinting genomes using PCR with
arbitrary primers. Nucleic Acids Res. 18:7213-7218.
INDEX
130
PROGRAMMING
TROUBLE
SHOOTING
M.G. Johnson
Food Science Department
University of Arkansas
SAMPLE
HANDLING
Rong-fu Wang*
Wei-wen Cao
Carl E. Cerniglia
Microbiology Division
National Center for Toxicological Research
SETTING UP
Comparison of Different PCR
Cycler Machines for Rapid and
Sensitive Detection of Pathogens
*
Corresponding Author
Abstract
RAPIDCYCLIST
NEWSLETTER
INDEX
131
ARTICLES
Rapid and specific methods for detection and identification of pathogens
are essential for food safety and clinical diagnosis of human and animal diseases.
Antibody-based test methods are the most often used technique. However, PCR
based methods should be faster and more specific. A traditional PCR protocol
takes about 5 hours in Perkin Elmer Cycler 480. Previously, we reported a protocol
for the PHC-2 cycler machine (Techne Inc., Princeton, NJ), which shortened
detection time to 3 hours (2,3,4,5). In this article, we report the results of comparison of different PCR cycler machines for the rapid and sensitive detection of
pathogens.
WARRANTY
AND UPGRADES
Introduction
SERVICE AND
MAINTENANCE
In order to find a rapid PCR method to detect bacterial pathogens, we compared different PCR cycler machines. The total cycle time to complete the PCR
amplifications were: 5 hours in the BioOven (BioTherm Co.) PCR cycler; 1.5 hours
in the MiniCycler (MJ Research, Inc.), 2.5 hours in the Perkin Elmer Cycler 480; 3
hours in the PHC-2 Cycler (Techne Inc.), but only 30 minutes in the 1605 Air
Thermo-Cycler (Idaho Technology). Using the 1605 Air Thermo-Cycler with our
rapid and simple sample preparation method, the total detection and identification time was 1.5 - 2 hours including 30 minutes for the PCR cycles and 40 minutes for electrophoresis. Eight bacterial species have been tested with this protocol in the 1605 Air Thermo-Cycler, all of them gave good results.
SETTING UP
Materials and Methods
SAMPLE
HANDLING
The bacterial cells were collected
from liquid cultures by centrifugation.
The cells were washed twice with
phosphate buffered saline (PBS), distilled water (dH2O), and resuspended
in dH2O at 107 cells per µl. Just before
the PCR assay, the samples were
diluted to the desired cell concentration of 105 CFU in 50 to 100 µl of 1%
Triton X-100. The cells were then heated at 100°C for 5 minutes, immediately cooled in ice water, and tested
by PCR without isolation of the DNA.
Two µl of above sample were added
to 23 µl of a PCR mixture.
PROGRAMMING
TROUBLE
SHOOTING
SERVICE AND
MAINTENANCE
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
For the BioOven, MiniCycler,
Perkin Elmer Cycle 480, and PHC-2,
the PCR mixture contained 50 mM
Tris-HCl (pH 8.5), 50 mM NaCl, 1 mM
MgCl2, and 2 mM dithiothreitol, 0.1%
Triton X-100, 0.22 mM of each dATP,
dTTP, dCTP, dGTP, 0.28 µM of each Figure 1. PCR results in different thermal cycler
primer, and 0.9 U of Taq polymerase machines. PCR primers are specific for
(Promega, Madison, WI). The pro- Mycoplasma gallisepticum (unpublished data).
gram consisted of one cycle of 3 min- The PCR product is 138 base pair DNA fragment.
3% agarose gel was used for the electrophoresis.
utes at 94°C, then 40 cycles of 20 sec- Lane m: molecular size marker. Lane 1:
onds at 94°C, 20 seconds at 55°C, 40 Mycoplasma gallisepticum strain K23. Lane 2: M.
seconds at 72°C, and finally one gallisepticum strain K730. Lane 3: Mycoplasma
cycle of 3 minutes at 72°C. For the synoviae strain FMT. Lane 4: H2O for control. Panel
a: The MiniCycler was used with a total cycle time
1605 Air Thermo-Cycler (Idaho of 1.5 hours. Panel b: The BioOven was used with
Technology), the PCR mixture con- a total cycle time of 5 hours. Panel c: The PHC-2
tained 50 mM Tris-HCl (pH 8.5), 20 mM Cycler was used with a total cycle time of 2.8
KCl, 3 mM MgCl2, 0.05% bovine serum hours. Panel d: The 1605 Air Thermo-Cycler was
used with a total cycle time of 30 minutes.
albumin (BSA, No. A-4378, SIGMA,
Chemical Co., St. Louis, MO), 0.25 mM
of each dATP, dTTP, dCTP, dGTP, 0.25 µM of each primer, and 0.9 U of Taq polymerase. The program consisted of one cycle of 15 seconds at 94°C, then 30
cycles of (5 seconds at 94°C, 5 seconds at 55°C, 15 seconds at 74°C), and finally one cycle of 2 minutes at 74°C, 2 seconds at 45°C. The fastest transition speed
(S-9 on the 1605 Air Thermo-Cycler and 2.0 on the Rapidcycler) was chosen.
INDEX
132
SETTING UP
SAMPLE
HANDLING
For the MiniCycler, Perkin Elmer
Cycler 480, and PHC-2, the PCR reaction has to be covered with 50 µl of
mineral oil, but for the BioOven and
the Air Thermo-Cycler, no oil was
needed.
PROGRAMMING
The PCR products (6 - 10 µl each )
were separated by gel electrophoresis in a 2 - 3% agarose gel containing
ethidium bromide (1 µg/ml).
Results and Discussion
TROUBLE
SHOOTING
We have already used this protocol and the 1605 Air Thermo-Cycler to detect
many other bacteria, such as Clostridium perfringens, C. Clostridiiforme, C. leptum, Bacteroides distasonis, B. thetaiotaomicron, B. vulgatus, and
Bifidobacterium. Figure 2 shows the results. Different primers were used for different bacterial species, but the same program and same 1605 Air Thermo-Cycler
INDEX
133
RAPIDCYCLIST
NEWSLETTER
High concentrations of BSA were essential for the PCR assay in the 1605 Air
Thermo-Cycler, BSA is thought to prevent denaturation of the Taq polymerase on
the large internal surface area of the glass capillary tubes (6).
ARTICLES
Cycle times were 50 seconds in
Air Thermo-Cycler, 2 minutes 5 seconds in MiniCycler, 4 minutes in PHC2, and 7 minutes 10 seconds in BioOven. The total cycle times were 30 minutes in
1605 Air Thermo-Cycler, 1.5 hours in the MiniCycler, 2.5 hours in the Perkin Elmer
Cycler 480 (data not shown), 2.8 hours in the PHC-2, and 5 hours in the BioOven.
WARRANTY
AND UPGRADES
Figure 2. PCR results for different bacterial species
in the 1605 Air Thermo-Cycler. 105 cells of each
bacterial species was used for this test. 2%
agarose gel was used for the electrophoresis.
Lane m: molecular size marker. Lane 1:
Clostridium perfringens. The product is 280 bp.
Lane 2: C. leptum. The product is 257 bp. Lane 3:
C. clostridiiforme. The product is 255 bp. Lane 4:
Bacteroides distanonis. The product is 273 bp.
Lane5: B. thetaiotaomicron. The product is 423
bp. Lane 6: B. vulgatus. The product is 287 bp.
Lane 7: Bifidoacterium sp. The product is 190 bp.
SERVICE AND
MAINTENANCE
Figure 1 shows the PCR results
using the four different PCR cycler
machines. Only the two Mycoplasma
gallisepticum strains gave 138 bp
PCR products (lanes 1 and 2). M. synoviae and H2O (lanes 3 and 4) were
negative. The most intense bands
were in panel d (Air Thermo-Cycler)
and panel c (PHC-2) compared with
less intense bands in panel a
(MiniCycler) and panel b (BioOven).
SETTING UP
were used. All of them gave good
results.
SAMPLE
HANDLING
We directly used the bacterial
cells lysed in 1% Triton X-100 for DNA
template of the PCR, so the final concentration of the Triton X-100 in the
reaction tubes was about 0.1%. This
concentration of Triton X-100 did not
interfere with the PCR assay (data not
shown).
PROGRAMMING
TROUBLE
SHOOTING
In general, the optimal annealing
temperature used in the 1605 Air
Thermo Cycler was 5°C lower than
the other machines and gave better
sensitivity and better specificity
(Figure 3).
SERVICE AND
MAINTENANCE
In conclusion, the 1605 Air
Thermo-Cycler is the fastest and most
sensitive PCR machine for the detection and identification of microbial
pathogens.
WARRANTY
AND UPGRADES
RAPIDCYCLIST
NEWSLETTER
ARTICLES
Figure 3. Comparison of the results of 5 PCR
methods for 5 different bacterial species in the
1605 Air Thermo-Cycler (Idaho Technology) and
the Cycler 480 (Perkin Elmer). Panel A: the 1605
Air Thermo-Cycler (25 µl tube, one cycle of 94°C
for 15 sec, 30 cycles of 94°C for 3 sec, 50°C for 10
sec, 74°C for 15 sec and finally one cycle of 74°C
for 2 min and 45°C for 2 sec). Panel B: the Cycler
480 (one cycle of 3 min at 95°C , then 35 cycles
of 20 sec at 94°C, 20 sec at 55°C, 40 sec at 72 °C.
and finally one cycle of 3 min at 72°C and 2 sec
at 20°C). Line m, molecular marker. Lane 1:
Escherichia coli, the primer set is CACACGCTGACGCTGACCA;
with
GACCTCGGTTTAGTTCACAGA, PCR product is 585 bp. Lane 2:
Eubacterium limosum, the primer set is
GGCTTGCTGGACAAATACTG;
with
CTAGGCTCGTCAGAAGGATG, the PCR product is 274
bp. Lane 3: Vibrio vulnificus, the primer set is
CTCACTGGGGCAGTGGCT; with CCAGCCGTTAACCGAACCA, the PCR product is 383 bp.
Lane 4: Listeria monocytogenes, the primer set is
CGGAGGTTCCGCAAAAGATG; with CCTCCAGAGTGATCGATGTT, the PCR product is 234 bp.
Lane 5: Staphylococcus aureus, the primer set is
GCGATTGATGGTGATACGGTT; with CAAGCCTTGACGAACTAAAGC, the product is 276 bp.
INDEX
134
SETTING UP
References
3. Wang, R F, W W Cao, and M G Johnson. 1992. 16S rRNA-based PCR method
to detect L. monocytogenes cells added to foods. Appl. Environ. Microbiol.
58:2827-2831.
6. Wittwer, C T, and D J Garling. 1991. Rapid cycle DNA amplification: time
and temperature optimization. BioTechniques 10:76-83.
SERVICE AND
MAINTENANCE
5. Wang, R F, M F Slavik, and Wei-Wen Cao. 1992. A rapid PCR method for
direct detection of low numbers of Campylobacter jejuni. J. Rap. Met. & Auto.
Microbiol. 1:101-108.
TROUBLE
SHOOTING
4. Wang, R F, W W Cao and M G Johnson. 1992. Development of cell surface
protein associated gene probe specific for Listeria monocytogenes and detection of bacteria in food by PCR. Mol. Cel. Probes 6:119-129.
PROGRAMMING
2. Wang, R F, W W Cao, H Wang, and M G Johnson. 1993. A 16S rRNA-based
DNA probe and PCR method specific for Listeria ivanovii. FEMS Microbiol. Letters
106:85-92.
SAMPLE
HANDLING
1. Sambrook, J, E F Fritch and T Maniatis. 1989. In vitro amplification of DNA by
the polymerase chain reaction, p. 14.1 - 35. In Molecular Cloning: A Laboratory
Manual, 2nd Ed. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY.
WARRANTY
AND UPGRADES
ARTICLES
RAPIDCYCLIST
NEWSLETTER
INDEX
135
SETTING UP
New From Idaho Technology
SAMPLE
HANDLING
Kirk Ririe
Idaho Technology Inc.
Introducing the 1002 Rapidcycler
PROGRAMMING
In March of 1995, we began shipping a new version of our capillary based
temperature cycling system, the Rapidcycler. This system offers numerous advantages over the previous model.
Improved Temperature Control.
TROUBLE
SHOOTING
The Rapidcycler is able to run a broader range of temperature cycle protocols including two-temperature cycling. It is also less likely to overshoot elongation temperatures.
SERVICE AND
MAINTENANCE
The temperature ramp rate between the annealing and elongation temperatures is now entered in degrees per second and is linear within and between
runs.
Quiet Operation
WARRANTY
AND UPGRADES
The actuator used to control air flow through the Rapidcycler is a soft shift
solenoid as opposed to the AC solenoid used in the 1605. This offers two advantages. Besides being much quieter, the new actuator allows intermediate door
settings hence variable airflow. This is in contrast to the solenoid in the 1605 which
had just two settings, open and closed. The new actuator allows the control software to more effectively dampen the temperature oscillations that tend to occur
when driving rapid temperature changes.
ARTICLES
RAPIDCYCLIST
NEWSLETTER
Improved Programming
The Rapidcycler user interface is a significant improvement over the 1605. The
readout size has been increased so that everything is printed in clear English
instead of abbreviations. The three user modes, Cycle, Hold and Link, are now
accessible by a single button from the keypad.
Maneuvering around programming screens has been simplified by the addition of cursor keys. There are now 99 Cycle programs, 99 Hold programs, and 99
Link programs available. Many of them come preprogrammed for the more
commonly used reaction profiles.
INDEX
136
SETTING UP
New Optimizer Kit
WARRANTY
AND UPGRADES
ARTICLES
Idaho Technology Inc., together with
the University of Utah has received generous funding from the National Institutes of
Health STTR program and from the University
of Utah. This joint research project is an
effort to develop a system to continuously monitor the progress of an amplification reaction. The use of capillary tubes lends itself to fluorescent analysis of reaction product during the course of a reaction. By combining a fluorimeter and
thermal cycler into a single mechanism it is possible to essentially "watch" a reaction occur. It is hoped that this research will lead to extremely rapid detection systems as well as becoming a general purpose window into reaction mechanics.
SERVICE AND
MAINTENANCE
Research in Progress at IT
TROUBLE
SHOOTING
We now ship a Blazer butane torch with
the Rapidcycler. The torch is fast igniting,
light-weight, and burns very hot. It is a good
general purpose lab torch and is ideal for
sealing glass capillaries. We recommend
that everyone using glass capillaries keep
one handy. They are available either directly from us or from some sporting-goods outlets.
PROGRAMMING
Blazer mini-torch
SAMPLE
HANDLING
The Optimizer kit has been modified to allow more flexibility and to reduce
waste. There are now four base buffers available ranging in Mg++ concentration
from 10 mM to 40 mM . Either of two gel loading additives (Ficoll/tartrazine or
sucrose/cresol red) can be added along with dNTPs and other reaction constituents into a master mix which will keep for months in a refrigerator.
RAPIDCYCLIST
NEWSLETTER
INDEX
137
SETTING UP
E
M
Microcentrifuge tubes
oil overlays..................................13
protocols.....................................10
reaction optimization...........12-13
real vs. set temperatures .....13-14
SERVICE AND
MAINTENANCE
Cycle Mode
criteria .........................................24
editing programs ..................23-25
parameters.................................23
running a program...............24-25
table of programs ................29-33
TROUBLE
SHOOTING
Link Mode
editing Programs .......................27
parameters.................................27
running a program ....................28
table of programs ................29-33
Capillary tubes
dispensing from ...........4-6, 15-20
module ............................7, 18-20
sealing .............................6, 16-20
PROGRAMMING
C
SAMPLE
HANDLING
Index
P
Program Memory..............................28
S
H
Setting Up the RapidCycler ..............3
T
Thermal fuse replacement.........40-41
L
Light bulb replacement..............38-39
W
Warranty information .......................46
INDEX
138
RAPIDCYCLIST
NEWSLETTER
Troubleshooting
reaction problems .....................37
slow cooling ...............................35
slow heating...............................36
ARTICLES
Hold Mode
criteria .........................................26
editing programs ..................25-26
parameters.................................25
running a program...............26-27
table of programs ................29-33
WARRANTY
AND UPGRADES
Editing Numbers ...............................22
Electric fuse replacement ...............40
Idaho Technology Inc.
390 Wakara Way, Salt Lake City, Utah 84108
1-800-735-6544 • ph. (801) 736-6354 • fax (801) 588-0507
[email protected] / www.idahotech.com
Revised: March 2000
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement