pEco -T7-nGST, Eco cloning Kit User Manual

pEco -T7-nGST, Eco cloning Kit User Manual
pEcoTM -T7-nGST, Eco cloning Kit User Manual
(Patent pending)
Cloning PCR products for E Coli expression of N-term GST-tagged protein
Cat#
Contents
Amounts
Application
10 tubes x 50ul/ea
(for 10 rxn)
IC-1004
pEco-T7-nGST vector
built-in EcoTM Cloning
cells
Positive PCR insert
Sequencing primer pair
E Coli expression
of N-term GSTtag protein.
.
1 x 10ul/ea
Forward and reverse
15ul/each, (25ng/ul)
Storage:
EcoTM Cloning Kit is shipped on dry ice. Upon received, stored at -80°C. Once
thawed, must be used, do not re-freeze. Product should be stable for 6 months.
Product Description:
Introduction:
GenTarget’s proprietary fusion in vivo EcoTM cloning technology is a
revolutionized and the easiest PCR cloning method. Simply amplifies your gene
of interest with primer pair that flanked with short homologous arm to the
expression vector ends, then add 1ul of purified PCR into the engineered, Readyto-use Cloning cells, and immediately proceed to transformed.
How it works:
Gentarget’s EcoTM PCR Cloning Kit utilizes an engineered E Coli strain with
enhanced homologous recombination machinery for an In Vivo end-homologous
jointing reaction between PCR product and vector. The vector was pre-processed
with the cloning cell using a proprietary protocol to obtain high cloning efficiency
and low background. It does not need any kinds of In Vitro tube reaction, such as
ligation, Topo jointing or In-fusion reaction, and so on. Let the E Coli do the job
for you In Vivo!
pEco-T7-nGST cloning cells was built-in with a pET based T7 expression vector.
PCR insert will be cloned in-framed with a N-terminal GST-tag.
Key Features:
1. The most cost effective and the easiest PCR cloning method, simply add 1ul of
PCR insert into provided cells for transformation regardless of the insert’s size
and concentration;
2. No need to buy expression vectors. The vector was built-in with cloning cells;
3. No need to buy competent cells. The cloning cells is the competent cells;
4. No need for the tedious bench works for preparing vector backbone;
5. No need for any enzymes or any tube reactions;
6. Precisely directional cloning of PCR products without any extra amino acids
except the affinity tag (His or GST);
7. Flexible to add any cleavage site for removal of N-term His if desired;
8. High efficient (>90% positive rate) and low background;
9. Works fine with any PCR products with or without a 3'-end’s -A overhung (the
extra –A overhang, if exists, will be removed in cloning step);
10. Good for different PCR sizes, from 200bp to 6 kb.
11. Engineered E Coli and mammalian expression vectors for high protein yields;
12. Great for high through-put cloning;
Protocol Outline:
Produce PCR products and clean them
Add 1~2ul of PCR product into provided Cloning cells,
Briefly mixing and immediately proceed to transformation
Pick colonies and miniprep plasmids to verify the positive clones
Protein expression from sequencing verified clones
Detailed protocols:
1. PCR primer design:
The PCR primers, used for generating inserts for EcoTM Cloning must
contains a 20 ~ 25bp homologous sequences corresponding to the built-in
vector. Design your primer pair as follows:
Fwd: 5’- atcggatctggttccgcgtgaattc + 20bp of (5’end gene specific forward sequence)
Rev: 5’- ttgttagcaggttaacacgcgtcta + 20bp of (3’-end gene specific reverse sequence)
Protein cleavage site may be included in forward primer to allow excise the
N-term tag if desired. Its codon sequences must be in frame and set between
the homologous leader and the 20bp gene specific sequence.
An example for PCR primer design:
To design the primer pair for the following gene sequence:
atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgcttacctgttg
ccaacattgggccaacccgaattcttcccaatctttatcttggctgccagcgagatgtcctcaac
aaggagctgatgcagcagaatgggattggttatgtgttaaatgccagcaatacctgtccaaagc
ctgacttttta
Its PCR primer for vector pEco-T7-nGST will be:
Fwd: 5’- atcggatctggttccgcgtgaattcatggcctctgtgaaggaaaa
Rev: 5’- ttgttagcaggttaacacgcgtctaaaagtcaggctttggacagg
In the case of inserting a protein cleavage site, the Fwd primer will be:
Fwd: 5’ atcggatctggttccgcgtgaattcNNNNNNgcctctgtgaaggaaaatcc
(where the NNNNNN is the in-framed codon sequence of cleavage site).
Note: Stop codon is optional to be included in PCR reverse primer since a stop
codon is already built in immediately after the PCR insert.
2. Target amplification by PCR:
Using any PCR amplification protocols that work for you to amply your
targets. To minimize the PCR errors, we recommend using high fidelity
DNA polymerase.
Using any PCR purification column to clean your PCR products. If you do
not obtain a single, discrete band from your PCR, you need gel-purify
your fragment.
Important: if your PCR template can generate background clones (having
Amp resistance), you need treat your PCR product by DPNI or do gel
purification of PCR product.
3. Transformation:
Thaw EcoTM Cloning cells in ice-water. After completely thawed, add
1~2ul purified PCR product (from 20ng to 150ng) into each vial of cells,
brief mixing by taping the tube with your finger. For control vials, add 1ul
positive PCR-insert (provided) as positive control, and add 1ul water to a a
negative control vial cells. Put tubes back on ice, and then proceed for heat
shock at 42oC for 40 seconds (Note: Do not leave DNA-cells mixture on
ice for prolonged period, less than 15min are fine). Put tubes back on ice
for 1 min, add 250ul of SOC medium, incubated at 37oC, shaking for 1hr.
Plating: take 50ul~200ul aliquot, spread out on pre-warmed LB-agar
plates containing100
. And grow colonies at 37oC
incubator for overnight.
Note: usually in the absence of PCR-insert, cells force some background
colonies; the no-insert negative control generates a few colonies. But in
the presence of PCR-insert, greater than 90% colonies are positive. Colony
number varies dependent the quality and quantity of PCR products. The
concentration of purified PCR product can be from 20ng/ul to 150ng/ul
with sizes from 200bp to 10kb. For the simplicity and high through-put
cloning purpose, we recommend simply add 1-2ul of PCR into cloning
cells regardless of the PCR’s concentration and sizes, it will generate
enough colonies (5 ~ 100 colonies in general) for downstream works.
4. Save glycerol stocks for later expression and verification of positive clones:
Pick 2-5 colonies, propagate in LB/Amp, incubate at 37oC overnight;
Isolate the plasmid DNAs using DNA miniprep kit (such as Eco™
Plasmid DNA Miniprep Kit, Cat# DP-100).
Confirm the positive by restriction digestion:
PCR inset can be cut out by two unique sites: EcoRI + HpaI
Run 1.2% agarose, two bands: 3.4 kb backbone + the PCR insert
(or multiple bands when the cut exist within the PCR-insert).
Final sequencing verification:
Use provided sequencing primer pair (Note: sequencing primer
was provided as ready-to-use dilution, use 1ul for each sequencing
reaction with 500ng plasmid in 20ul volume).
Cat #
IC-1004
Vector
pEco-T7-nGST
Forward primer
IC-1004-fwd
5’- catggcctttgcagggct
Reverse primer
IC-1004-rev
5’- tgctagttattgctcagcgg
5. Protein expression:
Transformation: transform the sequencing verified plasmid DNA into any
strain containing a T7 RNA polymerase, such as BL21(DE3) or
BL21(DE3)pLys from which protein are expressed upon IPTG induction.
Transformation uses standard heat-shock protocol, such as add 1ul DNA into
50ul competent cell, set ice (5~15min), heat-shock at 42oC for 30 seconds,
back to ice for 2min, add 250ul SOC, recovery at 37oC, shaking for 1 hour.
Plate 10 to 100ul onto LB plates containing 100ug/ml ampicillin. Grow
colonies at 37oC incubator for overnight;
Propagation: Pick one clone, grow in LB medium with ampicillin at 37oC,
shaking overnight. Add overnight culture into appropriate amount of LB
medium containing 100ug/ml of ampicillin by making 1:40 dilution, keep
medium volume at 20% of flask volume for better aeration, vigorously shake
at 30oC, 300rpm;
Induction: measure growth OD600, at the time when OD600= ~ 0.5, add an
appropriate amount of IPTG, continue grow for 17 ~ 24 hours with vigorously
shaking at 30oC, 300rpm; [Note: for best expression results, use Gentarget’s
auto-induction medium, EcoTM RichMedium (Cat# RM1000) for propagation,
it does not need to add IPTG for induction].
Harvest cells by centrifugation.
QC: Cell pellet was lysed using lysis reagent, [Note: we recommend use
Gentarget’s EcoTM Buster protein extract reagents (Cat# EB-S100 or EBL100)]. Following the lysis protocols, run protein gel for analysis;
Purification: use your favorite protocols and reagent to purify the expression
GST tagged protein by GST-tag affinity column;
Purity and function analysis of the expressed protein using your favorite
protocols.
Vector maps:
The figure below summarizes the vector map of pEco-T7-nGST. The complete
nucleotide sequence is available for downloading from our Website at
RESOURCES page
To make your clone map, simply
paste your gene sequence (not included the flanking sequences of both ends) in
the Red highlighted position (replacing the NNNN..NN). In most case, the pasted
sequence is: “ATG…to...last codon”.
Cloning site for pEco-T7-nGST vector
EcoRI
GST
751
PCR insert
MluI
HpaI
AAATCGGATC TGGTTCCGCG TGAATTCNNN NNNNNNTAGA CGCGTGTTAA
TTTAGCCTAG ACCAAGGCGC ACTTAAGNNN NNNNNNATCT GCGCACAATT
HpaI
CCTGCTAACA AAGCCCGAAA GGAAGCTGAG TTGGCTGCTG CCACCGCTGA
GGACGATTGT TTCGGGCTTT CCTTCGACTC AACCGACGAC GGTGGCGACT
TM
Eco Cloning: pEco-T7-nGST manual, Page 5 of 7
www.gentarget.com GenTarget Inc Copyrights, 2009
Trouble shooting:
Problems
Solution
No colony
Be sure to set up a positive control transformation using
provided positive PCR insert1, which should give you
10~100 colonies;
Spread all transformation mixture on plate;
Background
colonies
Be sure to set up a background control plate in which no
PCR was added into cells, it should generate 0 ~ 5 colonies
or less than 10% compared to plates with insert (Noticed:
in the absence of PCR insert, cells forces vector selfligation resulted in a few background colonies).
Make sure that the PCR’s template do not cause
background colony; If it does, clean PCR products by gelisolation or treated by DPNI;
Plate less transformation mixture on plate;
Be sure to use right amount of antibiotics in LB plate, and
make fresh LB plates if necessary;
Use carbenicillin instead of ampicillin if applicable;
Do not incubate plates longer than 16 hours;
At colony pick, try to avoid the tiny satellite colonies;
Satellite
colonies
Related Products:
Cat#
DP-100
CC03
CC03p
RM1000
EB-S100
EB-L100
Product Name
Eco™ Plasmid DNA
Miniprep Kit
Eco™ E Coli expression
Competent Cells
Eco™ Expression
RichMedium
Eco™ Buster E Coli
protein extraction reagent
Amount
100
miniprep
20
rxn/pack
1000ml/ea
100ml/ea
PCR cloning kit
kit
PCR cloning kit
kit
IC-1003
PCR cloning kit
kit
IC-1005
PCR cloning kit
kit
IC-1006
PCR cloning kit
kit
IC-1001
IC-1002
IC-1007
PCR cloning kit
kit
References:
1.
2.
3.
Oliner et al., 1993, Nucleic Acids Res. 1:5192-97
Aslanidis et al., 1994, Genome Res. 4 :172-177
Kaluz et al. Nucl. Acids Res..1992; 20: 4369-4370
Application
High pure Plamsid DNA isolation
Competent cells for T7 vector protein
expression
Auto-induction, High yield protein
expression medium
Protein extraction from cell pellets
PCR cloning kit with a built-in vector (T7
promoter based) in provided cloning cells
for E Coli expression of N-term His-tagged
protein.
PCR cloning kit with a built-in mammalian
expression vector (with neomycin selection
marker) in provided cloning cells. The vector
containing an engineered super CMV
promoter for high-yield mammalian
expression of N-term His tagged protein
PCR cloning kit with a built-in vector (nonT7 promoter based) in provided cloning
cells for E Coli expression of C-term Histagged protein, specially designed for toxic
proteins.
PCR cloning kit with a built-in Gateway
Entry vector in provided cloning cells for
making your target in Gateway Entry clone
without using BP clonase
PCR cloning kit with a built-in vector (T7
promoter based) in provided cloning cells,
for E Coli expression of C-term His-tagged
protein.
PCR cloning kit with a built-in mammalian
expression vector (with Neomycin selection
marker) in provided cloning cells, for
mammalian expression of C-term Histagged protein.
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement