Quality Assurance Project Plan

Quality Assurance Project Plan
QUALITYASSURANCEPROJECTPLAN
eDNAMONITORINGOFBIGHEADANDSILVERCARPS
Preparedfor:
U.S.FishandWildlifeService
USFWSMidwestRegion
Bloomington,MN
2015
REVIEWCERTIFICATIONSHEETS
FOR
FinalQualityAssuranceProjectPlan
forthe
eDNAMonitoringofBigheadandSilverCarp
Approvedby:
Digitally signed by AARON WOLDT
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife
Service, cn=AARON WOLDT, 0.9.2342.19200300.100.1.1=14001000741825
Date: 2015.06.24 12:33:14 -05'00'
AaronWoldt,DeputyAssistantRegionalDirector,Fisheries,USFWSMidwestRegion
KellyBaerwaldt,AsianCarp/eDNAProgramCoordinator,USFWS
MidwestRegion
Digitally signed by EMY MONROE
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife Service,
cn=EMY MONROE, 0.9.2342.19200300.100.1.1=14001002848126
EmyMonroe,ProjectLeader,WGL
AARON WOLDT
Kelly Baerwaldt
Digitally signed by Kelly Baerwaldt
DN: cn=Kelly Baerwaldt, o=USFWS, ou, [email protected], c=US
Date: 2015.06.10 12:25:26 -05'00'
EMY MONROE
Date: 2015.06.22 09:10:03 -05'00'
MAREN TUTTLE-LAU
Digitally signed by MAREN TUTTLE-LAU
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife Service,
cn=MAREN TUTTLE-LAU, 0.9.2342.19200300.100.1.1=14001001293609
Date: 2015.06.19 07:23:17 -05'00'
MarenTuttle‐Lau,eDNAProcessingQASpecialist,WGL
NIKOLAS GRUENEIS
Digitally signed by NIKOLAS GRUENEIS
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife
Service, cn=NIKOLAS GRUENEIS, 0.9.2342.19200300.100.1.1=14001000999945
Date: 2015.06.18 15:41:00 -05'00'
NikolasGrueneis,DNADocumentation&ReportingSpecialist,WGL
MarkHoley,ProjectLeader,GreenBayFWCO
MARK HOLEY
Digitally signed by MARK HOLEY
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife
Service, cn=MARK HOLEY, 0.9.2342.19200300.100.1.1=14001000763324
Date: 2015.06.25 08:00:48 -05'00'
MARK BROUDER
Digitally signed by MARK BROUDER
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife
Service, cn=MARK BROUDER, 0.9.2342.19200300.100.1.1=14001000690902
Date: 2015.06.18 07:04:04 -05'00'
MarkBrouder,ProjectLeader,AshlandFWCO
SCOTT YESS
Digitally signed by SCOTT YESS
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife Service, cn=SCOTT YESS,
0.9.2342.19200300.100.1.1=14001000655627
Date: 2015.06.17 11:49:36 -05'00'
ScottYess,ActingProjectLeader,LaCrosseFWCO
[email protected]
Digitally signed by [email protected]
DN: [email protected]
Date: 2015.06.15 07:46:41 -04'00'
ScottKoproski,ProjectLeader,AlpenaFWCO
SAMUEL FINNEY
Digitally signed by SAMUEL FINNEY
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and
Wildlife Service, cn=SAMUEL FINNEY, 0.9.2342.19200300.100.1.1=14001000716290
Date: 2015.06.12 07:56:21 -05'00'
RobSimmonds,ProjectLeader,Carterville,FWCO
JEFF FINLEY
Digitally signed by JEFF FINLEY
DN: c=US, o=U.S. Government, ou=Department of the Interior, ou=U.S. Fish and Wildlife Service, cn=JEFF FINLEY, 0.9.2342.19200300.100.1.1=14001000747382
Date: 2015.06.11 14:24:00 -05'00'
WyattDoyle,ActingProjectLeader,Columbia,FWCO
Date
TABLEOFCONTENTS
SectionNo.
1. 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2. PageNo.
PROJECTDESCRIPTIONANDPERSONNELREQUIREMENTS
1‐6 Background.........................................................................................................................................................1‐6 GeneralRequirement......................................................................................................................................1‐2 ProjectHistory...................................................................................................................................................1‐2 Objective..............................................................................................................................................................1‐2 ProjectPersonnel.............................................................................................................................................1‐3 Reporting:............................................................................................................................................................1‐6 Casenumberassignmentandmanagement:........................................................................................1‐6 QAPPmaintenanceandmodifcations......................................................................................................1‐7 eDNASecurityPlan(s)....................................................................................................................................1‐8 SAMPLECOLLECTION
2‐1 2.1 Pre‐TripPlanningandSiteSelection.......................................................................................................2‐1 2.1.1 Purpose
2‐1 2.1.2 Pre‐tripPlanningProcedure
2‐1 2.1.3 Fieldequipmentlist(proceduresareinsection2.2;tobeprovidedbysampling
office/agency)
2‐2 2.1.4 LoticSystemSiteSelectionProcedure(inthefield)
2‐4 2.1.5 LenticSystemSiteSelectionProcedure(inthefield)
2‐5 2.1.6 eDNATrailerPreparationandFieldConsiderations
2‐5 2.2 EquipmentPreparation.................................................................................................................................2‐5 2.2.1 Purpose
2‐5 2.2.2 EquipmentProcedureforCoolers
2‐6 2.2.3 BoatandFieldEquipment
2‐6 2.2.4 BoatandEquipmentDecontaminationProcedure
2‐7 2.3 MotorizedSampleCollectionProcedure................................................................................................2‐8 2.3.1 Purpose
2‐8 2.3.2 WaterCollectionProcedure
2‐9 2.4 WadingandNon‐motorizedSampleCollectionProcedure..........................................................2‐10 2.4.1Purpose
2‐10 2.4.2WadingWaterCollectionProcedure
2‐11 2.4.3Non‐motorizedWaterCollectionProcedure....................................................................................2‐12 3. SAMPLEPROCESSING(FILTERINGorCENTRIFUGING)
3‐1 3.1 Purpose.................................................................................................................................................................3‐1 3.2 CentrifugingProcedure.................................................................................................................................3‐1 3.3.1LaboratoryPreparation
3‐2 3.3.2SamplePreparation
3‐2 3.3.3CentrifugingtheSamples
3‐2 i
4. 4.1 4.2 4.3 4.4 5. SAMPLESHIPMENT
4‐1 Purpose.................................................................................................................................................................4‐1 ShippingProcedureforsamplesondryice...........................................................................................4‐1 ShippingProcedureforsamplespreservedwith70%isopropyl................................................4‐2 WGLcontacts.....................................................................................................................................................4‐3 DNAASSAYS
5‐1 5.1 GeneralQualityAssuranceandChain‐of‐CustodyConsiderations..............................................5‐1 5.2 QualityControlforSampleCustodianProcedureandStorage.....................................................5‐4 5.3 PhysicalSeparationofPre‐PCRandPost‐PCRAssayStages..........................................................5‐4 5.3.1 TheeDNAExtractionRoom
5‐4 5.3.2 Pre‐PCRRoom
5‐4 5.3.3 PCRProductAnalysisRoom
5‐4 5.4 ReceiptofTubes...............................................................................................................................................5‐5 5.4.1 Source
5‐5 5.5 DNAExtractionfromTubes.........................................................................................................................5‐5 5.5.1 Source
5‐5 5.5.2 DNAExtractionQualityAssuranceandChain‐of‐custody
5‐5 5.5.3 Alcoholevaporationfromcentrifugedsamplesprocedure
5‐6 5.5.4 Centrifugedsamplesshippedondryiceprocedure
5‐7 5.6 PCRAmplificationofeDNASamples......................................................................................................5‐11 5.6.1 Purpose
5‐11 5.6.2 Source
5‐11 5.6.3 PCRQualityAssuranceandChain‐of‐custody
5‐11 5.6.4 Procedure
5‐12 5.6.5 Standardcurvematerial,preparationandstorage
5‐15 5.6.6 InternalPositiveControl(forindicatinginhibition)
5‐15 5.7 Presumptivepositivedetermination,confirmationpositivedeterminationanddata
management........................................................................................................................................................5‐17 5.7.1 Purpose
5‐17 5.7.2 Source
5‐17 5.7.3 PresumptiveCallDocumentationandStorageAssurance
5‐17 5.7.4 ConfirmationofPresumptivePositiveSamples
5‐18 5.8 CommunicationofeDNAAssayResultsandfielddatafromWGLtoUSFWSMidwestRegion
Leadership............................................................................................................................................................5‐19 5.8.1 Purpose
5‐19 5.8.2 Source
5‐19 5.8.3 QualityControl
5‐19 5.8.4 GeneralProcedure(fordetailsseeAppendixEforSOP)
5‐19 6. 6.1 INTERNALQUALITYCONTROLCHECKS
LaboratoryQualityControlEvaluationCriteria..................................................................................6‐1 ii
6‐1 7. SPECIFICROUTINEPROCEDURESTOASSESSDATAPRECISION,
ACCURACY,ANDCOMPLETENESS
7.1 7‐1 FieldMethodsandLaboratoryData.........................................................................................................7‐1 8. CORRECTIVEACTIONS
8‐1 9. PREVENTATIVEMAINTENANCEPROCEDURES
9‐1 9.1 9.2 10. FieldEquipment/Instruments....................................................................................................................9‐1 LaboratoryInstruments................................................................................................................................9‐1 PERFORMANCEANDSYSTEMAUDITS
10‐1 10.1 FieldAudits.......................................................................................................................................................10‐1 10.2 LaboratoryAudits..........................................................................................................................................10‐1 11.
EXHIBITS
11‐1 iii
LISTOFEXHIBITS
1
FieldCollectionSummary
11‐2
2
FieldSampleDatasheet
11‐4
3
Chain‐of‐Custody(COC)Record
11‐5
4
SampleReceiptChecklist,internallabCOC
11‐6
5
ExcelLogFileforLabCases
11‐7
6
ExcelLogFileofaSingleCase
11‐8
7
‐20FreezerTemperatureLog
11‐9
8
CoolerStorageTemperatureLog
11‐10
9
‐80FreezerTemperatureLogandSampleLog
11‐11
10
AmbientStorageSampleLog
11‐12
11
PCRLog
11‐13
12‐14
LabDataSheets
11‐14
15
QAPPComplianceCertificationStatement
11‐22
16
QualityControlAuditChecklistsforFieldSamplingandProcessing
11‐23
LISTOFAPPENDICES
A
RolesandResponsibilitiesandAnnualStaffAssignments
B
ResultsCommunicationSOP
C
DataManagementandDatabaseInstructionManual
D
SampleBottleManagementPlan
E
MethodsforEliminationandReductionofeDNAonBoatsandEquipment
F
MobileeDNATrailerMaintenanceandUseManual
G
eDNASecurityPlanforCo‐LocatedLaCrosseFWCOandWGL
H
OriginalmethodsfrompreviousversionsofQAPP
I
InternalWhitneyGeneticsLabReport:ValidationofIBIScientificandQiagen
DNAextractionkitsforuseintheearlydetectionandmonitoringofinvasive
carpusingenvironmentalDNA
iv
J
InternalWhitneyGeneticsLabReport:HemTinternalpositivecontrolfor
determininginhibitionineDNAmonitoringsamples
K
InternalWhitneyGeneticsLabReport:ValidationofcentrifugationforeDNA
samplecollectionandprocessing
ACRONYMS/ABBREVIATIONS
COC
Chain‐of‐custody
CSO
combinedseweroverflow
DI
deionized(water)
DNA
Deoxyribonucleicacid
dNTP
deoxyribonucleotidetriphosphates,alsoknownsimplyasnucleotides
eDNA
environmentalDeoxyribonucleicacid
FWCO
FishandWildlifeConservationOffice
GL
GreatLakes
GPS
GlobalPositioningSystem
LDB
leftdescendingbank
MRWG
MonitoringandResponseWorkGroup
MSDS
MaterialSafetyDataSheets
PCR
polymerasechainreaction
QAPP
QualityAssuranceProjectPlan
RDB
rightdescendingbank
Taq
Thermusaquaticus
USACE
UnitedStatesArmyCorpsofEngineers
USFWS
UnitedStatesFishandWildlifeService
UV
Ultravioletlight
WGL
WhitneyGeneticsLab
v
SECTION1
1.
PROJECTDESCRIPTIONANDPERSONNELREQUIREMENTS
1.1
Background
Invasiveaquaticnuisancespeciesposeamajorthreattoaquaticecosystemsworldwide.WithinIllinois,
themanmadeChicagoSanitary&ShipCanal(CSSC),constructedintheearly1900s,providedan
unnaturalportalforinvasivespeciesdispersalbetweenthegeologicallyseparatedMississippiRiverand
GreatLakesdrainagebasins.In2002,inanefforttocurtailthespreadofinvasivespeciesbetweenthe
twobasins,theU.S.ArmyCorpsofEngineers(USACE),constructedadispersalbarriersystemwithinthe
CSSC.Theprimaryobjectiveofthebarriersystemwheninitiatedwastostopthedispersaloftheinvasive
RoundGobyintotheMississippiRiverbasin;however,oncetheprojectwascompleted,itwasfoundthat
theRoundGobyhadalreadysurpassedthebarrier.Sincethen,anewthreattotheGreatLakesfromthe
MississippiRiverbasinhasbecometheprimaryobjectiveofthedispersalbarriersystem.InvasiveAsian
carps,includingBigheadCarp(Hypophthalmichthysnobilis)andSilverCarp(H.molitrix)havebeen
steadilydispersingupstreamthroughtheMississippi,Illinois,andDesPlainesrivers.Theirpotential
dispersalthroughthedispersalbarriersystemwithintheCSSCposesapotentialthreattotheGreatLakes
ecosystem.
Inthepast,traditionalfisherytechniqueswereusedtodetecttheleadingedgeoftheAsiancarp
population;however,thismethodwassomewhatineffectiveattargetingthesespeciesatlowdensities.
TheUniversityofNotreDame,withfundingfromtheUSACE,developedamethodthatdetected
“environmental”DNA(eDNA)leftbehindintheaquaticsystembythetargetedspecies.Environmental
DNAentersthesystemthroughavarietyofmechanisms,someofwhichincludesloughingofexternal
epidermalcellsintothewater,sloughingofinternalepidermalcellsintofecesandintothewater,andas
tissueresiduesfollowinginjuryorpredation.ThedetectionofeDNAinwatersamplesisbasedonwhole
DNAextractionfromparticulateorganicandinorganicmatterfoundinthewaterandpolymerasechain
reaction(PCR)assaysforspecies‐specificmitochondrialDNAmarkers.
UseofthismethodistoprovidedetectionofAsiancarpatlowdensitiesandtoserveasanearlydetection
systemofthespreadofAsiancarpintopreviouslyuninhabitedareas.TheoriginalQualityAssurance
ProjectPlan(QAPP)detailingtheeDNAmonitoringprocess,includingmethodologiesandquality
controls,wasrequestedfromtheU.S.ArmyEngineerResearchandDevelopmentCenter(ERDC)asthe
USACEassumedeDNAmonitoringresponsibilityfromtheUniversityofNotreDame.ThismodifiedQAPP
willbefollowedbytheU.S.FishandWildlifeService(USFWS)officesresponsibleforfieldsamplingand
labprocessingofeDNAsamples.FishandWildlifeConservationoffices(FWCO)willhandlefield
samplingandtheWhitneyGeneticsLab(WGL)attheLaCrosseFishHealthCenterwillprocesseDNA
samplessincetheUSFWSassumedresponsibilityformonitoringAsiancarpintheChicagoArea
WaterwaySystem(CAWS)andotherwaterbodiesin2013.
ThisversionoftheQAPPhasbeenmodifiedtobeageneralguidetofieldandlaboratorymethodsthat
shouldbeemployedduringeDNAmonitoringprograms.Specificsamplingplansandschedulesfor
vi
particularwaterbodieswillbedevelopedbyregionalsamplingagenciesandtheirpartners,aswellas
overseeinggoverningbodies(suchastheAsianCarpRegionalCoordinatingCommitteeandGreatLakes
FisheryCommission).Theseplansareavailableonlineonvariousagencywebsitesandwillnotbe
includedinthisdocument.
1.2
GeneralRequirement
USFWSMidwestRegionrequiresaQualityAssuranceProjectPlan(QAPP)foreDNAmonitoring.Full‐
scaleeDNAmonitoringcommencedinSeptember2010bytheUSACE,andbasedonconsultationwith
expertsinprocessingoflitigableDNAevidence(whichappliestoeDNAmonitoring),afinal,
comprehensiveQAPPwasnotinplacewithinthattimeframe.InsteadaprovisionalQAPPwasused
duringthefirstyearofeDNAmonitoring,tobefollowedlaterbyafinalizedversionunderadifferent
scopeofwork.TheUSFWSwillcontinuetomaintainandupdateaQAPPforuseineDNAmonitoring
programsthatallowsforinclusionofanybeneficialtechnicalorstrategicmodificationsthatbecome
apparentfrompastmonitoringevents,researchconductedbytheeDNAcalibrationresearchteam,or
researchpublishedintheliteratureandvettedbytheeDNAcalibrationteamorotherUSFWSgenetics
laboratories.
1.3
ProjectHistory
TheUniversityofNotreDame,DepartmentofBiologicalSciences,CenterforAquaticConservation,
preparedaStandardOperatingProcedure(SOP)in2010.TheSOPprovideddetailsregardingeDNA
monitoringprotocolandwasgiventoUSACEinMay2010incompliancewithCooperativeEcosystem
StudyUnitagreement#W912HZ‐08‐2‐0014,modificationP00007.On15and16December2009,a
technicalandqualitysystemsauditoftheCenterforAquaticConservationLodgeLaboratoryatthe
UniversityofNotreDamewasconductedbytheUSEnvironmentalProtectionAgency.Thelaboratory
auditreportdated5February2010wasprovidedtoUSACEinadditiontotheeDNAmonitoringprotocol.
ThesedocumentsservedasthebasisfortheQAPPfollowedbyERDC.Additionally,USACEsubmittedthe
eDNAmethodologyforanIndependentExternalPeerReview(IEPR),whichisarequirementtoexamine
decisiondocumentsandsupportingworkproductswheretherearepublicsafetyconcerns,significant
controversy,ahighlevelofcomplexity,orsignificanteconomic,environmentalandsocialeffectstothe
nation.Releasedfallof2011,theeDNAIEPRreport,conductedbyobjectivepanelistswithtechnical
expertiseingeneticsandpopulationecology,confirmedeDNAsamplingandtestingmethodologyis
soundfordetectingSilverandBigheadcarpDNAbutcannotindicatethesourceofAsiancarpDNA
(informationonthesize,gender,ageandnumberofindividualspresentandcannotdistinguishbetween
pureSilverorBigheadcarpandtheirhybrids).In2013,theWGLreceivedtheQAPPandmadechanges
sothatitwouldbeapplicabletothenewfieldsampleprocessingandeDNAprocessingpersonneland
theirspecificlocations.ItwasalsomodifiedaccordingtoresultsoftheeDNACalibrationStudies(ECALS)
andlabvalidationscarriedoutbytheinteragencyECALSteam.Annualmodifications(seesection1.8)to
theQAPPwillbeapprovedbyregionalfieldstaff,theUSFWSeDNAteam,andleadershipofUSFWS
MidwestRegion.Changestosampleanalysiswillundergopeer‐reviewbyexternalexpertsandvalidation
inspecificallydesignedstudiescarriedoutinatleastthreedifferentlaboratories.
1.4
Objective
TheobjectiveofthisQAPPistoprovidedetailedproceduresforAsiancarpeDNAsamplecollection,
sampleprocessing(includingfiltering,centrifuging,DNAextraction,PCR,biomarkeranalysis,DNA
sequencing),datareporting,andqualitycontrol/qualityassuranceprocedurestoensurethatdataareas
technicallydefensible,consistent,andusableaspossible.Thespecificgoalsandobjectivesofsampling
plansforparticularbodiesofwaterarecurrentlydirectedbytheappropriategoverningbody.For
example,theChicagoAreaWaterwaysamplingplanhasbeenissuedbytheAsianCarpRegional
1‐2
CoordinatingCommittee’sMonitoringandResponseWorkgroupintheMonitoringandResponsePlan.
TheGreatLakes,OhioRiver,andUpperMississippiRiverplanswillbeorhavebeenissuedbyUSFWS
MidwestRegioninconjuctionwithstateandotherpartners.
UseofthisQAPPforallaspectsofeDNAmonitoringfortheearlydetectionofSilverandBigheadcarpis
stronglyencouragedifresourceagencieswouldliketocompareresultstoFWSresults.Anysamples
processedthatdonotfollowthisprotocolcannotbedirectlycomparedtoFWSmonitoringresults.
1.5
ProjectPersonnel
TheeDNAmonitoringprojectinUSFWSMidwestRegionhasformedaneTeam,withmembersofthe
RegionalOffice,allfieldstationsandtheWhitneyGeneticsLab.Anofficialdocumentdefiningrolesand
responsibilitiesisattachedinAppendixA,andthenamesandcontactnumbersshouldbeupdated
annually.
TheeDNAmonitoringprogramofUSFWSMidwestRegionmusthavepersonnelappointedtothe
followingpositions,anditishighlyrecommendedforotheragenciesinterestedineDNAmonitoring:
Fieldsamplingpointofcontactforeachfieldstationresponsibleforsamplingandfieldprocessing.For
eachsamplingtrip,specificpersonnelwilldifferforeachroleaslistedintheQAPP,buteachrolewillbe
filledoneachsamplingtrip










eDNAProjectCoordinator
FieldOperationsManager
SamplingLeader
SamplingQualityAssuranceSpecialist
SampleProcessingLeader
SampleProcessingQualityAssuranceSpecialist
DNAProcessingLeader
DNAProcessingQualityAssuranceSpecialist
DataDocumentation&ReportingSpecialist
SupportingAgencycontacts
Theminimalresponsibilitiesoftheabovepositionsaredetailedbelow.Specificpersonnelassignedtothe
projectarelistedinAppendixA.
SamplingandSampleProcessingrolesmayNOTbefilledbythesamepersonandmusteachbefilledon
everysamplingtrip.
Priortoeachtrip,theeDNAProgramCoordinatorandtheeDNAProcessingLeaderneedthenameand
mobilephonenumberforthefieldsamplingandsampleprocessingleaders.Aftereachtrip,abrief
summaryreport(Exhibit16)coveringqualityassuranceissuesandanychangesinpersonnelroles
shouldbeprovidedtotheeDNAProgramCoordinator.
TheserolesassumeallstaffareUSFWSMidwestRegionStaffwhohavetheminimumrequirementsand
havebeentrainedintheQAPPmethods.Ifotheragencypersonnelareassistinginthefieldorlab,they
musthavereadandunderstoodtheQAPPandhaveExhibit15andtheirCVonfilewiththeleadFWS
office.Whenpersonnelfromotheragenciesorvolunteersdonotmeettheminimumrequirementsor
haveequivalentrequirements(e.g.stateboatoperatortraining),thismustbedocumentedonExhibit16
asadeviationfromtheQAPPandabriefexplanationprovidedthatexplainsthesituation.
1‐3
eDNAProjectCoordinator:USFWSMidwestRegionalOfficestaffspecialistresponsiblefor
development,coordinationandimplementationoftheUSFWSeDNAmonitoringprogramforAsiancarps.
Assumesprincipalresponsibilitiesforinitiating,leading,facilitating,integrating,coordinating,and
communicatingnecessarymonitoringworkandactivitiesusingeDNAoftheMidwestRegion’sFisheries
Programthroughthecooperativeconservationcommunity.Providesguidanceforimplementingand
utilizingeDNAactivitiesatthefieldlevel.Providestechnicalleadershiptoplan,conductandleadother
biologistsaswellascoordinateactivitiestoidentifyandcoordinatesurveillanceareasinwaterbodiesfor
theearlydetectionofAsiancarpeDNA.Ensuresthebestscientificpracticesareusedduringthe
developmentandimplementationofmanagementplanstomonitor,control,anderadicateAsiancarp.
ImplementsandcoordinatestheeDNAcollectionprogram;eDNAprocessingandinterpretationofdata;
collectionanddisseminationofresearchinformationfrominstitutionsandresearchagenciesonfindings
andnewdevelopmentsineDNAcollectionandinterpretationofdataandthedevelopmentand
implementationofAsiancarpmanagementplans.ResponsiblefortheoverallQAPPandits
implementationatthefieldandlablevels.ResponsibleforcommunicationbetweenthelabandRegional
office.IntegrationwithinteragencyECALSteamandotherrelevantentities.
FieldOperationsManager:ServeasleadbiologisttoimplementtheeDNAmonitoringprogramforthe
watershedsassignedtotheirrespectivefieldoffice.UnderthesupervisionoftheProjectLeader,
developsandimplementseDNAsamplingplansforwatersassignedandservesasapointofcontact,with
theirProjectLeader,forpartnerstocoordinatealleDNAfieldactivities.
SamplingLeader:ResponsibleforobtainingwatersamplesforeDNAmonitoringandprovidingthoseto
sampleprocessingteam.ResponsibleforreportingresultstoSampleProcessingandDNAProcessing
TeamLeaders,theeDNAProgramCoordinator,aswellasotherdesignatedUSFWSpersonnel.
SamplingQualityAssuranceSpecialist:Responsibleforknowingallqualityassurance/qualitycontrol
(QA/QC)measuresforeDNAsamplingefforts.AdvisesSamplingLeaderonanypotentialQA/QC
problems.Reviewsprocedures,fieldlogs,datacollectionmethodology;ensuresthatallagencies
participatinginsamplingareconformingtoprocedures,anddocumentsthisaftereachsamplingtrip
(Exhibit16).Recommendscorrectiveactionsfornon‐conformities.
SampleProcessingLeader:Responsibleforfiltering/centrifugingwatersamplesforeDNAmonitoring
andprovidingthoseprocessedsamplestoeDNAProcessingteam.Responsibleforreportingresultsto
SamplingandDNAProcessingTeamLeaders,theeDNAProgramCoordinator,aswellasotherdesignated
USFWSpersonnel.
SampleProcessingQualityAssuranceSpecialist:ResponsibleforknowingallQA/QCmeasuresfor
filtering/centrifugingefforts.AdvisesSampleProcessingLeaderonanypotentialQA/QCproblems.
Reviewsprocedures,laboratorylogs,anddocumentationforprocessing;ensuresallpersonnelare
conformingtoprocedures,anddocumentsthisaftereachsamplingtrip(Exhibit16).Recommends
correctiveactionsfornon‐conformities.
DNAProcessingLeader:ResponsibleforprocessingeDNAsamplesthroughDNAextraction,PCR,and
sequencing.ResponsibleforreportingresultstoeDNAProgramCoordinator,aswellasotherdesignated
USFWSpersonnel.
DNAProcessingQualityAssuranceSpecialist:ResponsibleforknowingallQA/QCmeasuresforeDNA
processingefforts.AdviseseDNAProcessingLeaderonanypotentialQA/QCproblems.Reviews
procedures,laboratorylogs,anddocumentationforDNAprocessing;ensuresallpersonnelare
conformingtoprocedures.Recommendscorrectiveactionsfornon‐conformities.
1‐4
DataDocumentation&ReportingSpecialist:AssistsDNAProcessingLeaderinmaintaininglaboratory
databaseforeDNAsampleprocessing.Performsdatacompletenessanddataverificationchecks,and
ensuresthatalldataaredocumentedcompletely.
AssignedProjectLeadersandSpecialists:Othersservingontheprojectmayincluderesearchers,
technicians,andbudgetarypersonnel.Samplingmayemploypersonnelfromotheragenciesin
coordinatedefforts.Allpersonnelmustmeetaminimumstandardfortrainingand/orexperiencebefore
independentlyconductinganyportionoftheeDNAmonitoringprotocol.Eachstation’sleadeDNA
personnelwillattendanannualQAPPreviewtraining(trainthetrainer).TheseleadeDNAstaffwillthen
trainanyotherstaffassistingwitheDNAwork.ThesupportingagencycontactsaregiveninAppendixA.
Minimumpersonneltrainingrequirementsaregivenbelow.
PersonnelTrainingRequirements
Minimumtrainingand/orexperiencerequirementsforthedifferentmajorcomponentsoftheeDNA
monitoringprotocolaredetailedbelow.
BoatOperator:
 MustmeetUSFWSboatoperatorrequirementsasaminimum.
Sampling:
 ABA/BSdegreeoritsequivalentinbiologyorrelatedfieldofstudy,or
 Atleast2yearsofspecializedpostsecondarytrainingoranassociatedegreeinappliedscienceor
science‐relatedtechnology,or
 Ahighschooldiplomaoritsequivalentandaminimumof2yearsprofessionalexperiencein
biology‐relatedfield.
 Firstaidand/orboatingsafetycourse.
 Minimum1yearexperienceincollectingfieldsamplesforbiologicalanalyses.
SampleProcessing:
 ABA/BSdegreeoritsequivalentinbiologyorrelatedfieldofstudy,or
 Atleast2yearsofspecializedpostsecondarytrainingoranassociatedegreeinappliedscienceor
science‐relatedtechnology,or
 Ahighschooldiplomaoritsequivalentandaminimumof2yearsprofessionalexperiencein
biology‐relatedfield.
 Firstaidtraining.
 Facility‐specificsafetytraining.
 Minimumonesemestercollegelevellaboratoryexperience,pluseDNA‐specifictraining.
DNAProcessing:
 AminimumBA/BSdegreeoritsequivalentinbiologyorrelatedareaandsuccessfulcompletionof
collegecoursework(graduateorundergraduatelevel)coveringthesubjectareasofbiochemistry,
genetics,andmolecularbiology(moleculargenetics,recombinantDNAtechnology)orother
subjectsthatprovideabasicunderstandingofthefoundationofDNAanalysis,aswellascourse
workand/ortraininginPCRamplificationasitappliestoeDNAanalysis.
 Aminimumof6monthsofgeneralDNAlaboratoryexperience,includingexperiencewithDNA
extractionandPCR.Additionally,2weeksoftrainingonAsiancarpeDNAprotocols.
 SuccessfulcompletionofaqualifyingtestdemonstratingeffectiveexecutionofeDNA‐typeassays
beforebeginningindependentworkontheproject.
1‐5
1.6

Reporting:
Allagencies,needtosubmitresumes(CurriculumVitaes)forproposedstafftotheeDNAProgram
Coordinator,tobereviewedandapprovedbytheeDNAProgramCoordinator.Asnewpersonnel
areacquiredandtrained,theirresumesmustbefiledwiththeeDNAProgramCoordinator.Those
documentswillbekeptwiththeprojectfile.Thispaperworkshouldbeupdatedeachtimethe
QAPPisupdated.

Foreachsamplingevent,apre‐tripsummaryofthesamplingsites,dates,personnelroles,and
contactinformationshouldbesuppliedtotheeDNAProgramCoordinator,otherUSFWS
personnelasneeded,andpartneragenciesasappropriate.

Specificstaffmembernamesconductingthevariousactivitiesmustbedocumentedonallofficial
datasheets(e.g.,onthefieldsamplinglog).

Pre‐tripcommunicationswitheDNAProgramCoordinatormaybeviaemailortext.

Uponcompletionofallsamplingevents,thetripcompletionreport(Exhibit16)mustbefilledout
andfiledwiththeeDNAProgramCoordinator.Thisformincludesareastoclearlylistcase
numbers,samplenumbers,samplinglocations,personnel,andensuresthattheSamplingand
SampleProcessingQualityAssuranceLeadsconfirmadherencetotheQAPP.

ThelabwillfileweeklyreportswiththeeDNAProgramCoordinatorthatcontainup‐to‐date
informationontheprogressofsampleswithineachcase.

ThelabwillupdatetheeDNAProgramCoordinatorwithinformationregardingpresumptive
positivesamplessothattimelyhandlingoffinalresultscanbemappedandcommunicated
internallyandwithotherofficesandpartnersasneeded.

Thelabwillfilefinalreportsforeachcasethatcontainsalloftheprocessinginformationandfinal
positiveandnegativeresultswiththeeDNAProgramCoordinator.

TheeDNAProgramCoordinatorwilltrackeDNAsamplingeventsandprocessinginamastercase
filethatwillbesharedwithUSFWSpersonnelandpartneragencies.
1.7
Casenumberassignmentandmanagement:
AlleDNAfieldandlabdatawillbecollatedandhousedinageo‐referenceddatabasemaintainedatthe
RegionalOffice.ThedatabaseisorganizedaroundauniquereferenceIDforeachindividualsample,thus
auniqueidentifierisrequiredforeacheDNAsample.





Eachsamplingeventiscenteredaroundaspecificwaterbody,andwillbeassignedacasenumber
consistingofa5‐digitinteger(00000).SampleIDnumberswithincaseswillbeinconsecutive
numericalorder,andwillconsistofa3‐digitinteger(000).Eachsamplewillbeidentifiedbythe
8‐digitnumberconsistingofthecaseandsampleIDnumber,withoutspacesorpunctuation
(00000000).
WGLwillcreateamastercaselisteachseasonandassigncasenumbersasneededtoeachFWCO.
FWCOswillassigncasenumberstosamplingeventssothatthelabremainsblindforsample
processing.
AtableofcasenumberswillbeprovidedbyWGLtotheeDNAProjectCoordinatorsothatcase
numberswillneverberepeatedamongsamplingyears.
SamplingprioritywillbefinalizedbytheeDNAProjectCoordinatorandappropriateFWSand
partnerpersonnel.
Labprocessingpriority(whichmaydifferfromsamplingpriority)willbefinalizedbytheeDNA
ProjectCoordinatorandappropriateUSFWSandpartnerpersonnel.
1‐6
1.8
QAPPmaintenanceandmodifcations
EarlydetectionofaquaticspeciesbyeDNAisanewtechniquethatissimultaneouslyundergoing
extensivedevelopmentontheresearchfrontasitisappliedonthegroundinmonitoringefforts.This
resultsinrapidadvancementofthetechniquethatshouldbeappliedtomonitoringeffortstonotonly
improveuseofthetoolinmanagementapplications,butalsotoimproveefficiency.





TheUSFWSworkscloselywithcollaboratingagenciessuchastheUSGSandtheUSACEtokeepup
withcurrentresearchsothattheeDNAmonitoringprogramcanbeupdatedregularly.
TheQAPPwillbeupdatedannuallytoreflectadvancementsineDNAresearchaswellasto
improveefficiencyinfieldandlabeffortsbasedonlessonslearnedfromthepreviousyearof
implementation.
AnnualupdatestotheQAPPmaybeimplementedbytwomechanisms.
o Changestofieldmethodsandanti‐contaminationmeasuresbytheeTeam.In2014USFWS
FWCOs,WGL,andtheMidwestRegionalOfficeformedaneDNAteam(eTeam,see
AppendixA)toworkonmaintainingtheQAPP.
 Thesechangesaresuggestedbyfieldstaff,andreviewedbytheeTeam,andupon
approval,implementedintotheQAPP.Ingeneral,thesechangesareto
accommodateamore‐widelyimplementedmonitoringprogramspatiallytoinclude
amuchgreaterareathantheCAWS.Italsoaccommodatesimplementationby
severaldifferentFWCOoffices,insteadofafairlylimitedcrewusedintheCAWS.
 Noneofthesechangesreducethelevelorrigorousnessofqualitycontrolmeasures
sothattheQAPPmaintainsthehighlevelofqualitycontrolthatwasapprovedby
severalexternalreviews.
o Changestolabmethodsasrecommendedbycollaboratingresearchagenciessuchasthe
USGSorUSACEorlabstaff.Newtechniquesandproductsmustbevalidatedthrough
rigorousstudiesconductedinatleasttwolabs,preferablythreelabs.
o Again,thesechangesincorporatethesamelevelofrigorousqualitycontrolastheoriginal
QAPP.
OtheragenciesthatwouldliketocontractwithotherlabsforeDNAmonitoringmaywanttouse
theQAPPareencouragedtodoso.Howeveritislikelythatpartneringwithotherlabswillleadto
proceduresthatarenotcoveredintheQAPP.Inthiscase,itisuptoeachagencytodecideontheir
ownrequirementsneededforeDNAsamplingandlabprocessing.
o TheUSFWSrecommendsamimimumoffollowingcloselysections1‐4,6‐10toensure
rigorousqualitycontrolandsampleintegrity.
o Useofotherlabsshouldbecarefullyreveiwedbythecontractingagencystaffandeach
agencyshouldensurethatlabsarevalidatedandcanprocesssampleswithatleastthe
samelevelofqualitycontrolandinlabsituationsthatminimizecontaminationinhighly
sensitivePCRapplications.
 ItislikelythatotherlabswilluseassayswithdifferentPCRmarkersandeven
differentPCRtechniquessuchasdigitalPCR.Itisuptothemanagementagency
contractingtheworktoensurethattheseassayshavebeenrigorouslytestedand
validatedforuseinsensitiveeDNAmonitoringprograms.Atamimimum,theassay
methodsshouldbepublishedorvalidatedinarigorous,round‐robinlabstudy.
ListofupdatestoQAPP
o 2013
 Section2.1.5addedguidanceforexpandingsamplingintoGreatLakestributaries.
 Section2.1.6addedforeDNAprocessingtrailermaintenanceandcleaning.
 Section2.4addedguidanceforwadingandnon‐motorizedsamplingprocedures.
1‐7




Section3.3addeddetailedproceduresforcentrifugingsamplesasanalternativeto
filtering.Filteringwastheonlymethodallowedwhenobjectiveswereearly
detectionandsurveillanceforAsiancarp.Centrifugationwasallowedinspecial
caseswhenapprovedbyRegion3ROstaff.
Section5.5.5addedextractionproceduresforusingtheQiagenDNeasyBloodand
Tissuekit.Allofficial2013monitoringsampleswereprocessedwiththeQiagenkit.
TheoriginalPowerwaterkitmethodsweremovedtoappendixHin2015.
 Ablind,round‐robinvalidationstudywasconductedinthreelaboratoriesto
ensuretheQiagenkitsperformedaswellasorbetterthanthePowerWater
ktis(Amberg,J.J.,S.G.McCalla,E.Monroe,R.Lance,K.Baerwaldt,andM.P.
Gaikowski.2015.ImprovingEfficiencyandReliabilityofEnvironmentalDNA
AnalysisforSilverCarp.Accepted.JournalofGreatLakesResearch.
doi:10.1016/j.jglr.2015.02.009.).
AllexhibitswereupdatedwithcustomizationforWhitneyGeneticsLab
AppendicesA‐GwereaddedorupdatedtofunctionwithintheUSFishandWildlife
Service.
o 2014
 Section5.6,5.7and5.8wereupdatedwithnewqPCRmarkers,newmethodsfor
determiningpresumptivepositiveandconfirmedpositiveresults,andprotocolsfor
datareportingandmanagement.Markerspublishedin:Farrington,H.L.,C.E.
Edwards,X.Guan,M.R.Carr,andR.F.Lance.2015.MitochondrialGenome
SequencingandDevelopmentofGeneticMarkersfortheDetectionofDNAof
InvasiveBigheadandSilverCarp(HypophthalmichthysnobilisandH.molitrix)in
EnvironmentalWaterSamplesfromtheUnitedStates.PLoSONE10(2):e0117803.
doi:10.1371/journal.pone.0117803.Ablind,round‐robinvalidationstudywas
conductedinthreelaboratoriestodocumentmarkerperformance.Finalreportand
publicationtofollow.All2014sampleswerescreenedwiththesenewmarkers.
 OriginalsectionsregardingamplificationwitholdcPCRmarkers,andmethodsfor
determingingresultsweremovedtoappendixG.
o 2015
 Section1.5hadanadditionalroleaddedforfieldstations,FieldOperationsManager.
 Section3.3CentrifugationwasapprovedforuseinalleDNAapplicationsbasedon
resultsofWGLstudy,Validationofcentrifugationvs.filteringforeDNAsample
collection(AppendixK).ReportfiledwithRegionalOffice.Filteringmethodswere
movedtoappendixH.Referencestobottlesinothersectionswereeithermovedto
AppendixHorchangedtoreflectcentrifugingmaterialsandmethods.
 Section5.6‐8wereenhancedwiththeadditionofmethodsusinganinternalpositive
controltoassessandmeasureinhibitionofPCRs.
 Section5.6.5addeddetailsregardingquantitativePCRstandardcontrolmaterials
andmethods.
1.9

eDNASecurityPlan(s)
AdetailedeDNAsecurityplanfortheMidwestFisheriesCenterhasbeendevelopedduetotheco‐
locationoftheLaCrosseFWCOandtheWGL.StaffintheFWCOoftenworkinAsiancarp
contaminatedwatersandconductfieldworkwhereAsianCarparedirectlyhandled.Thus,this
planincludesdetailedproceduresfordecontaminatingfieldequipmentaswellasboats,trailers,
andtrucksusedforallfieldworkincludingeDNAsamplecollection.Itisastand‐alonedocument
includedasAppendixG.
1‐8

ADNAsecurityplanforeachfieldorlabstationinvolvedineDNAsamplingorprocessingshould
bedevelopedusingtheMidwestFisheriesCentereDNAsecurityplanasamodel,butadaptedfor
eachstation’suniquesituation.Thisplanshouldbekeptonfileattheregionaloffice.The
documentsshouldbesignedbyallpersonnelatthefieldorlabstationandapprovedbytheeDNA
ProjectCoordinator(s).
1‐9
SECTION2
2.
SAMPLECOLLECTION
Priortoanyfieldsamplingwork,allfieldemployeesmustreviewthisQAPPandacknowledgethe
proceduresandprocessestobefollowedforeverysampleandeveryevent.Fieldemployeeswill
acknowledgetheirunderstandingandintenttocomplybysigningthecertificationformgivenasExhibit
15.Fieldemployeeswillalsoreviewthesamplingsafetyplan(separatestation‐specificdocument)and
participateinasafetybriefing.
Priortoanysampleprocessingoranalysiswork,alllaboratoryemployeesmustreviewthisQAPPand
acknowledgetheproceduresandprocessestobefollowedforeverysampleandeveryevent.Laboratory
employeeswillacknowledgetheirunderstandingandintenttocomplybysigningthecertificationform
givenasExhibit15.Laboratoryemployeeswillalsoreviewthelaboratorysafetyplan(separatestation‐
specificdocument)andparticipateinasafetybriefing.
2.1 Pre‐TripPlanningandSiteSelection
Refertotheinternetforannualmonitoringplansissuedbytheagencyresponsibleforeachparticular
bodyofwater.Forexample,theCAWSmonitoringplancanbefoundatwww.asiancarp.us.
2.1.1 Purpose
Accurateplanningofageneralcollectionsiteisnecessarytoeffectivelymanagethetimeofcrews
collectingsamples,aswellastoensurecompleteandcorrectsamplingproceduresareused.
2.1.2 Pre‐tripPlanningProcedure
Refertotheannualmonitoringplanstoproperlyplanforsampling.Thesamplingagencyshoulduse
interactiveaerialimagerysoftware(i.e.,GoogleEarth)toscopeoutreachestobesampled,placementof
samples,anduniquefeaturesthatshouldbetargetedduringsampling.
(1) Aerialmapsshouldbedetailedenoughtoshowuniquefeatures(e.g.,bargeslips,factory,bridge
pilingsetc.)thatcanbeidentifiedinthefieldandusedasmarkersforlocationwhensampling.The
recommendedminimumscaleis1’:500’,ifthatisnotavailable,usethebestscalepossible.
(2) Aerialmapsshouldbemarkedwithsamplelocationsandshouldensurespatialcoverageandoverall
representativenessofthesamplearea.
(3) Targetspecificareas(backwaters,islandsidechannels,pooledareas,belowandaroundstructures,
confluenceoftributaries)aswellasintegratingtransectplotsinthesamplingplan.
(4) Printmap(s)withdetailedsampleplan.
 Locateaccesspointsforboatlaunchandacquirepermissiontouseifnecessary.Ifsampling
aroundlocks,orifsamplingwillrequirelockage,notifytheLockmasteratleast1daybefore
sampling.
(5) Coordinatesampleplanwithsamplingcrew,eDNAProgramCoordinator,oranypartneragency.
 Samplingcrewshouldcomprisethreepeopleataminimum:oneboatoperator,oneleadsampler,
andonesamplingassistant.
2‐1
 Processingcrewsshouldconsistoftwopeople.Allcrewmembersmusthavetheirresume(CV)
onfilewiththeUSFWS(section1.6),priortothesamplingevent.
 AllparticipantsmusthavereadthisQAPPandmusthaveasignedcertificationstatement(Exhibit
15)onfilewiththeUSFWS,priortothesamplingevent.Allparticipants,includingpartneragency
employeesandanyvolunteers,involvedinthesamplingmustmeettheminimumqualifications
givenfortheirroleinSection1.3ofthisdocument.
 Afieldequipmentchecklistanddatasheets(Exhibits1&2)shouldbeprintedpriortoeach
samplingtriponRite‐in‐the‐Rain®paperorotherwaterproofpaper.Datasheetsmaybeprinted
onfrontandback.
 Checkriverstageandweatherforecast.
 Filepre‐tripplanwithsamplingsites,launches,personnelindesignatedQAPProles,andfield
contactinformationwitheDNAProjectCoordinatorandotherappropriateFWSandpartner
contacts.Thiscanbedoneviaemailortext.
 Priortoeachtrip,theeDNAProgramCoordinatorandtheeDNAProcessingLeaderneedthename
andmobilephonenumberforthefieldsamplingandsampleprocessingleaders
(6) Intheeventofasignificantrainfallevent(morethan1.5inchesina24‐hrperiod),theField
OperationsManagermustassessthesituationanddetermineifsamplingshouldbepursued.The
firstconsiderationiscrewsafety.Onceitisdeterminedthatsamplingcanoccursafely,sampling
maybepursued.However,becauseeffectsofhighrainfalleventswilldifferamongsystems,itis
importantforexperiencedfieldstafftoweighinonthediscussionstoavoidunnecessarytravelif
thehighwaterwouldpreventsampling.Ifitisdeemedsafeforsamplingtooccur,thesampling
crewandeDNAProgramCoordinatorneedtodiscusstheaffectsofhighwaterontheabilityto
detecteDNA.Insomecases,therisinglimbofahydrographmaystimulatespawningofthetarget
species,thusitmaybeadvantageoustosample.Inothercases,increasedrun‐offcoulddilutethe
signal,andthusdecreasethechangesofdetectingtargetDNA.Thiscallmustbemadeonacase‐by‐
casebasis.IntheCAWS,samplingshouldbeavoidedwithin3daysofacombinedseweroverflow
(CSO)event,duetoadversehealtheffectsfromrawsewageintheCAWS.Weatherdataandriver
stagefortheareatobesampledcanbecheckedat:http://waterdata.usgs.gov/nwis.Theoccurrence
ofaCSOeventcanbeverifiedbycontactingtheFWCOcontactforthatparticularsamplingevent
listedinAppendixA
(7) Ingeneralsamplingshouldbeavoidedinwaterthathasobviousdisturbancefromthesampling
vesselthatincreasestheturbidityandsuspendedsedimentsinthewater.Ifpossible,thoseareas
shouldbeavoidedforsamplingandcareshouldbetakentopreventsedimentdisturbancesasmuch
aspossible.ThisisbecauseeDNAcanbestoredinsedimentsforlongtimeperiods,whichconfounds
earlydetectionmonitoringgoals.
2.1.3 Fieldequipmentlist(proceduresareinsection2.2;tobeprovidedbysampling
office/agency)
(1) Waterbody‐appropriatevessel.Ifpossible,vesselandassociatedequipmentshouldbededicated
toeDNAcollectionstominimizeriskofDNAcontaminationofsamplesfromothersources.If
boatdedicationisnotpossible,oreDNAcollectionoccurredinknowncarppositivewaters,
proceduresfordecontaminatingboatsandequipmentareincludedinSection2.2.4.These
procedureswillalsoworkforconvertingapreviouscarpsamplingboattoadedicatedeDNA
samplecollectionvessel.
a. eDNA‐onlydedicatedpersonalflotationdevices(PFD)foreachcrewmember,usingthe
typeofdeviceslistedinthesafetyplan.MinimumPFDrequirementsareTypeIwithinthe
2‐2
SafetyZoneneartheexistingelectricbarrier(ontheChicagoSanitaryandShipCanal)or
TypeIIforotherareas.NOTE:Insomecases,eDNAsamplingmayoccurinAsiancarp‐
infestedwaters,avoidusingcleaneDNAdedicatedfieldgearforthesetripstoprevent
contaminationforlateruseinnon‐infestedwaters.
b. ItmaybenecessarytosampleeDNAincarp‐infestedwaters.Inthiscase,crewsshould
carefullyconsiderwhichpersonalprotectivegearshouldbeused.Itmaybeprudentto
avoidexposingcleaneDNAgeartocarp‐infestedwatersandinsteadother“relatively”
cleangearshouldbeusedinstead.Ifthereisuncertaintyorquestions,calltheeDNA
ProgramCooridnator.
(2) Ifcentrifuging:enough100‐qtcoolerscapableofholding550‐mlcentrifugetubesperplanned
fieldsample.SeeAppendixDfortubehandlingplan. (3) Ifcentrifuging:Sterile,chemical‐freepolypropylene50‐mlcentrifugetubes,thatareratedto
withstand6000xg,labeledbysamplingagency.Tubeswillnotbere‐used,butWGLwillreturn
shippingcontainerstobere‐usedbysamplingagenciesifrequested.
(4) 3‐gallonsprayer(lowpressurehandsprayerforsprayingdownboatsinthefield),hotwater
pressuresprayer(fordecontaminatingboatswherewaterandelectricalhookupsareavailable)
orcoldwaterhighpressuresprayerwithlowpressuredetergentinjection(maybeportablefor
useinthefield).Carwashingbrushesormopsmaybeusedinlieuoflowpressurehandsprayer
forchemicaldecontaminantapplications.
(5) Habitatmeasurementequipment(GlobalPositioningSystem[GPS],DigitalDepthSounder).
(6) FieldCollectionSummarysheets(Exhibit1)andFieldDatasheets(Exhibit2).
(7) Chain‐of‐custodyform(Exhibit3).
(8) Sharpie®permanentmarkerinblack.
(9) Powderlessnitrileorlatexgloves.
(10) Iceforcoolerswithsamples.
(11) Drinkingwaterforcrew.
(12) Safetyplan–theUSFWSplanrepresentsminimumrequirements;agency‐specificalternative
plansareallowableaslongasallhazardsareaddressedandminimumrequirementsaremet.
(13) Bleach(anycommerciallyavailablebrandorstrength),detergentforusewithcoldwater
pressuresprayer,orVirkonAquatic:decontaminationchemicalswillonlydecontaminateclean
surfaces,thuscleananysolidsurfacewelltocompletelyremoveanyfilmorbiologicalbuildup
beforeapplicationofdecontaminatingagents.Ifusingcoldwaterpressuresprayertoapply
detergentinlieuofhotwaterpressuresprayerorbleach/Virkon,surfacesmustbepre‐cleaned
beforeapplicationofthedetergent(3‐5mincontacttime)witha10‐secondhighpressurerinse.
a. Bleachmaybemixedintwostrengths:10%solutionsrequire10‐minutecontacttime
but20%solutionsrequire5‐10secondcontacttime.
b. Theoxidativefeatureofbleachdeterioriateswithexposuretoorganicmaterialandover
time,sobleachsolutionsmustbemadefreshdailyinordertodecontaminateDNA.
c. Virkonmustbeappliedina2%solutionforDNAdecontaminationorreductionmethods.
Equipmentmustbefullysubmersedina2%Virkonsolutionfor30minutesforcomplete
decontamination.A2%Virkonsprayorswabapplicationfora10‐minutecontactwill
reduceDNAtonegligiblelevels.Virkonmixedinsolutionisgoodforoneweek.
2‐3
(14) Watersources:waterusedtomixbleachorVirkonsolutionscanbeanysourceofpotablewater,
itdoesnothavetobeDIwater.Tapwatermaybeusedtowipedownsurfacesortorinse
equipmentsuchasfilterfunnelsafterableachsoak.DIwaterisonlyrequiredwhenthewater
usedwillcomeintocontactwithafilterthatwillbeprocessedinthelab.
(15) Garbagebags
2.1.4 LoticSystemSiteSelectionProcedure(inthefield)
SpecificeDNAmonitoringplansthatexplicitlyexplainwhereandhowmanyeDNAsampleswillbe
collectedforparticularwaterbodieswillbecreatedeachyearbythesamplingofficeoragencyin
coordinationwithstatepartnersandotheragencies.Theseplanswillcontainspecificsamplinglocations,
numbersofsamples,temporalandspatialsamplingdetails.Theseplansareoutsidethescopeofthis
document,however,therearesomecriticalconsiderationsthatshouldbefollowed.
(1) Inloticsystems,samplingshouldoccurinadownstreamtoupstreamdirectiontominimizethe
potentialforsurfacewaterdisturbancecausedbythevesselswakewithinthesamplereach.The
onlyexceptionwheresamplingmayoccurinanupstreamtodownstreamdirectionwouldbeifthe
nearestboatlaunchisupstreamofthereachtobesampledorifitisnotfeasibletosampleasystem
inanupstreamdirection(forexamplebykayak).SampledirectionshouldbenotedontheField
CollectionSummarydatasheet(Exhibit1).
(2) Samplesshouldbecollectedintwoways–transectandtargetedsampling.
(a)Transect:LocationoftransectswillbedeterminedbytheUSFWSpriortothestartofasampling
event.Thefirsttransectwillbesetacrossthedownstreamendofthereachtobesampledwith
subsequenttransectsset500mapartheadingupstream(seeexceptiontoprotocolabove(1)).
Transectswillrunperpendiculartoflow,andthreesampleswillbecollectedalongeachtransect
usingthefollowingscheme:onecollectedneartheleftdescendingbank(LDB),oneinmid‐channel
(MC),andoneneartherightdescendingbank(RDB).Wheresamplesarecollectedshouldbe
recordedinthe“Habitat”columnoftheSamplingdatasheet(Exhibit2).Samplesshouldbe
collectedontheupstreamsideoftheboatoroffthebow.

Whencollectingsamplesnearthebank,beobservantofwake‐disturbedsurfaces.To
compensateforthewakecreatedbyapassingboat,samplesmayneedtobecollected
2–3ftoffthebanktoobtaindisplacedsurfacefilm.
(b)TargetedsamplingiscollectingsamplesinthemostprobableplacesofeDNAaccumulation,such
as(butnotlimitedto):










Backwaterareas
Islandsidechannels
Confluencesoftributarywaters
Effluentareas
Eddiesorpooledareas
Nearstructuresthatcreateslack‐water(e.g.,sunkenbarges)
Bays
BelowLockandDamstructures
Winddrivenscumlines
Otherareaswhereorganicmaterialhasaccumulatedonthewatersurface
2‐4
Avoidtakingsamplesfromdirectlyinthemiddleofsuchareasandtargettheperimeterto
lessenthelikelihoodofoverwhelmingthesamplefilter.Avoidsamplingunderor
downstreamofbirdrookeriesorstormseweroutflowssincethesehavebeenshowntobe
vectorsofeDNAfromsourcesotherthanalivefish.
2.1.5 LenticSystemSiteSelectionProcedure(inthefield)
(1) Lakeandbaysampleswillbeselectedusingablockedrandomsamplingdesignincludingtargeted
collectionswithineachblock.Thesamplingstrategywillincorporatepotentialfocusareasbasedon
introductionvectorprobability,attraction(foodandhabitat)andproximitytotheCAWS.
(2) Oncefocusareashavebeenidentifiedandboundariesdefined,eachhotspotwillbedividedinto8
equalsizedblocks.Blocksizewillbedependentonthehotspotboundaries,concentratingaround
highestproductivityarea.Thesewillthenbenumberedand4ofthe8randomlychosenfor
sampling.
(3) Whenusingthefilteringmethod,25watersamples(2L)willbecollected(100total)foreachblock.
Usingthecentrifugemethod125watersamples(50mlcentrifugetubes)willbecollectedforeach
block.Watercollectionwillfollowaprobabilisticsamplingdesigntargetingareasthroughoutthe
entireblockwhereeDNAwillaccumulate.
(4) Targetedareasincludebackwaters,islandsidechannels,pooledareas,belowandaround
structures,confluencesoftributariesaswellasanyareaswherefloatingdebrisaccumulates.
Juvenileandage‐0Asiancarpprefershallow,productiveareaslikethoseadjacenttoandwithin
wetlands.Areastobeconsideredforsamplecollectionincludethosewithlocallyhighproductivity,
suchassewagesystemeffluents.
2.1.6 eDNATrailerPreparationandFieldConsiderations
RoutinetrailermaintenanceiscoveredinAppendixF.Priortodeparturethetrailershouldbecleaned,
decontaminatedandthenstockedwithallsuppliesneededforfieldsamplingandlabprocessing.
(1) Decontaminatesurfacesandfloorswitha10%bleachsolution,allowittosoakfor10minutes,
thenrinsetopreventbuild‐upofbleachsalts.
(2) Ensureallsuppliesneededforthefieldandsampleprocessingarestockedandsecurefortravel.
(3) UVlightscanbeusedfor30minutesatthebeginningofeachday.
Uponarrivalatthesampleprocessingsite,selectanareatoparkthetrailerthathaslimitedriskfor
contaminationfromotheractivitieson‐goinginthearea.Forexample,avoidparkingnexttoboat
washingstationswherecommercialcarpfishingboatswillbesprayedclean.
2.2
EquipmentPreparation
2.2.1 Purpose
InordertoperformlaboratorymolecularanalysestodetecteDNA,vesselsandequipmentmustbe
decontaminatedinaccordancewiththefollowingprotocolstoeliminateintroductionofoutsideDNA
sourcesinthesamplingregime.Bleachwillonlydecontaminatecleansurfaces,sobesuretocleanany
solidsurfacewelltocompletelyremoveanyfilmorbiologicalbuildupsothebleachcandestroyany
DNA.
2‐5
Cautions:Precautionsshouldbemadetoavoiddirectskincontactwithbleach;bleachsolutionmayalso
stainclothingorothermaterials.Beawareofpollutantsintheaquaticenvironmentandrelatedhealth
hazards.
Waterusedforbleachsolutionsmaybeanysourceofclean,potablewater.Waterusedtorinse
equipment,suchasthefilteringfunnelsorsamplecontainerinterior,thatcomesintocontactwiththe
actualeDNAsampleshouldbeDIwatertoavoidintroducinganyinhibitorstothesamples.
2.2.2 EquipmentProcedureforCoolers
(1) A10%bleachsolutionwithwaterwillbepreparedina3‐gallonlow‐pressuresprayerthatis
dedicatedtotheproject.Thebleachsolutionmustbepreparedimmediatelypriortouse,andeach
timedecontaminationactivitieswillbeoccurring.
(2) Removemudandotherbiologicalresiduesfromsurfacesbyrinsingandscrubbing.Equipment
surfacesmustbefreeofdebrisandothermaterialbeforedecontaminating.
(3) Sampletransportcoolerswillbedecontaminatedwithfreshlymade10%bleachsolutioninthelow
pressuresprayer.Usethelow‐pressuresprayertothoroughlycovertheinsideandoutsidesurfaces.
Allow10minofcontacttimebeforerinsingwithwater.Coolersmaybelefttoairdry,ordriedusing
cleanpapertowelswhilewearingcleangloves.
(4) Purchasesterile,chemical‐freedisposable50‐mlpolypropylenetubeswithmaximumRCFofatleast
6,000xg.Evensteriletubescanstillhavetracesofthechemicalusedtofreetheplastictubesfrom
themetalformsduringproduction.Somemanufacturerssellsteriletubesthatdonothavethis
residualchemicalinthem,andtheseshouldbeusedtoavoidintroducingPCR‐inhibitorsfromthe
sampletube.
(5) Samplelabelscanbeprintedbythesamplingagency.Samplecontainerswillbelabeledwithan
uniquebarcodeIDoragencygeneratedcode(Section1.7forcaseandsamplenumbering)thatdoes
notindicatelocation(toallowblindprocessing).LabelswillbeprintedonRite‐N‐Rain®orsome
typeofwaterprooflabelsandaffixedtotheoutsideofthesampletubes.
(6) Oncetubeshavebeenlabeled,theywillbeplacedinthesterilizedsamplecoolersinnumerical
order.Samplecontainerswillbestoredinthesterilizedcoolersuntiluse,andwillbetransported
onlyinthecoolers.AlthoughthesampleIDnumberofthesamplesisnotrelevantexceptfor
identificationpurposes,collectinginconsecutiveorderwillaidindeterminingwheresampleswere
takenincaseofarecordingerror.
(7) Aminimumof10%ofthenumberofsamplescollectedshouldbefieldblanks.Forofficesworking
withtheWGL,allfieldblanksmustbefilledbyWGL.Forotheragencies,blanksmaybefilledwith
anycity‐providedtapwater(Ifwatersourceisawelloryouareunsureofthesource,usedistilled
ordeionizedwater).Note,ifthesamplingdesignforyourparticularbodyofwaterrequiresa
specificsamplesizeinordertomeetaprecisedetectionprobability,thencontainersforcontrol
samplestomeetthe10%willbeaddedtothetotalnumberofsamplecontainersdictatedbyyour
samplingplan.
2.2.3 BoatandFieldEquipment
Thissectionappliestoallmotorizedorhand‐poweredboats,paddles,andanyassociatedfieldequipment
usedtocollecteDNA.
2‐6
(1)
(2)
AsetoffieldequipmentusedbystaffcollectingeDNAsuchaspersonalflotationdevices,raingear,
hats,sunglasses,etc.,shouldbededicatedforeDNAfieldworkonly,toavoidcontaminationrisks.
Thisisespeciallyimportantifthesamestaffareinvolvedinfieldworkinriverswithwell‐
establishedpopulationsofAsianCarp,orifstaffconductfieldworkwheretheycomeintodirect
contactwithAsianCarp.Thisdedicatedgearshouldbestoredandtransportedindesignated
containers(suchastotes)sothatcontaminationfromtrucksorboatscontaminatedwithCarp
DNAisavoided.Afterthetrip,gearandtransportcontainersshouldbedecontaminatedaccording
tosection2.2.4.
Itispreferabletohavedesignatedvessels,trailers,andtruckssetasideforeDNAworkifpossible.
Evenifthereisdesignatedequipment,becauseeDNAcanbemovedamongsitesonvessels,boats
andequipmentmustbedecontaminatedpriortosampling,andbetweensamplingsites.If
completedecontaminationcannotbeperformedbetweencaseswhileinthefield,choosethemost
preferredmethodofDNAreductionavailableinbetweencases(AppendixE).Uponreturntothe
fieldstationoffice,acompleteDNAcontaminationforallassociatedequipmentmustbe
performedbeforereturningtothefield.
2.2.4 BoatandEquipmentDecontaminationProcedure
Followsteps1‐12fordecontaminationorreductionofDNAonequipmentsurfacesbeforeandbetween
collectionsofeDNAsamplesfromanysite.RefertoAppendixEforalistofrecommended
decontaminants.Usepersonalprotectiveequipment(PPE)andreadMSDSbeforeusewithanyproduct.
Followequipmentsafetyinstructionsandreadequipmentmanualbeforeusinganindustrialhotwater
pressurewasher:
(1)
(2)
(3)
(4)
PutonappropriatePPE.DecontaminationPPEshouldbedesignated,storedseparatelyand
decontaminatedaftereachusetopreventreintroductionofDNAtoequipment,andtransferof
splashedDNAaroundyourfacility.
Removeequipmentfromboats,trucks,etc.andlaythemoutseparatelysothatallsurfacesof
equipmentwillbeexposedtotreatment.Treatonesideandthenflipifnecessary.
Removeanyenvironmentaldebrissuchasplantmaterial,mud,orfishslimewithbrushesor
gloves.Ifpossible,performthisstepatthesamplingsitetoleaveasmuchDNAmaterialbehindas
possible.Bucketsandbrushesorawaterpumpcanhelprinseboatsurfacesofbloodandslime
beforeleavingthewater.
Rinsesurfaceswiththehighestpressurewateravailableforthelocation.Surfacesmustbeclean
fordecontaminant/DNAreducerstowork.
Chooseadecontaminationmethodthatisappropriatefortheequipment,locationandservicesavailable
(Proceedtosteps5,6,7or8).IfequipmenthasbeenexposedtoAsiancarpDNAuseonehighpressure
sprayermethodinconjunctionwithonechemicalmethod(steps5or6and7or8)fordecontamination:
(5)
(6)
(7)
Useanindustrialhotwaterpressurewashersetat212Ftodecontaminateappropriatesurfaces.
Minimumexposuretimefordecontaminationis10seconds.
Applydetergentatlowpressuretosaturatesurfaceswithanindustrialcoldwaterpressure
sprayerwithdetergentinjector.Wait3to5minutes,thenrinseathighpressurefor10seconds.
Mixa10%solutionofhouseholdbleach(5‐8%sodiumhypochloritebeforemixing)intapwaterin
ahandpressuresprayer(lowpressuresaturation)orlargetub(immersionbath).Sprayorswab
tosaturateatlowpressureorimmerseallappropriatesurfaces.Exposuretimeforcomplete
2‐7
(8)
decontaminationis10minutes.Rinsewithfreshwaterandallowsurfacestodry.Mixedsolution
goodforoneday.
a. Asanalternativetostep6forsmalleritems,preparea20%bleachsolutioninasmalltub
andcompletelyimmerseitemsfor10seconds.Rinseandallowsurfacestodry.
Immersesmallerequipmentina2%Virkonbathfor30minutes.Metalsshouldbeimmersedno
longerthan10minutes.Forlargerequipment,preparea2%Virkonsolutioninalow‐pressure
sprayerorswabandsaturatesurfaces.Minimumexposuretimeis10minutes.Rinsewithfresh
waterandallowsurfacestodry.Caution:Donotaerosolizethisproduct.Useatthelargestdroplet
settingtoavoidrespiratoryexposure.Mixedsolutiongoodforoneweek.
Inabsenceofavailabilityofmethodsfordecontaminationpreviouslymentionedinthisdocument,rinse
equipmentwithcopiousamountsofwateratthehighestpressureavailableandallowtodry.Exposure
tothesunorUVradiationandheatwillhelpreduceresidualDNA.Followcompletedecontamination
proceduresbeginningatstep1uponreturntofieldstationofficeoratfirstavailability.
Uponcompletionofmethodsabove,followsteps10‐12tocompleteeDNAclean‐up:
(9)
(10)
(11)
(12)
UseDNAAwayandpapertowelstodecontaminatepens,hats,notebooksurfaces,electronic
equipmentsurfaces,truckinteriorandothernon‐saturableequipment.
Containanyequipmentthatwasnottreatedinbagsortotesforlaterdecontamination.
Washhands,launderorchangesoiledclothing.
RemovePPEanddecontaminatebeforestoringseparatelyfornextuse.
2.3 MotorizedSampleCollectionProcedure
2.3.1
Purpose
InordertoperformlaboratorymolecularanalysestodetecteDNA,samplesmustfirstbecollectedfrom
theappropriateaquaticenvironmentinaccordancewiththefollowingprotocols.Eachmorningpriorto
sampling,collectionstaffandfilteringstaffpriortodepartingwillhaveamorningbriefingthatwill
discusswhereandhowthesamplingisoccurring.AtthistimeafloatplanandGARmodelwillbefiled
withtheboatoperatorandcollectioncrewandprocessinglead.Oncethemeetingiscompletethe
processingleadwillemailthosedocumentstotheleadagency’smainofficeprojectleaderandanyother
necessarypersonnel.
Cautions:Lifejacketsmustbewornatalltimesintransportvessels(boats).Additionally,disposable
powder‐freelatexornitrileglovesmustbewornwhencollectingwatersamplesandmeasuringwater
depthandtemperature.Beawareofpollutantsintheaquaticenvironmentandrelatedhealthhazards.
FieldcrewsshouldhaveseparateanddesignatedfieldgearandouterwearthatisforeDNAsampling
only.ThisgearshouldbestoredseparatelyfromotherfieldgearthatmaycomeincontactwithAsian
carpbiologicalmaterial.GearshouldbetransportedinacleaneDNAgearboxsothatitisnot
contaminatedinvehicles,boats,ortrailers.FollowBoatandEquipmentDecontaminationProcedures
(abovesection2.2.3)betweensamplingsites.
Gear(suchasPFDsandhats)shouldbedecontaminatedbetweensamplingeventsaccordingtosection
2.2.3.However,ifanygeariscompromisedduringsampling(accidentallyfallingin,oraspill,etc.)and
stafffeelthatitmaycontributetocontaminationofthesamples,thegearshouldbedecontaminatedas
soonaspossibleattheendoftheworkday,orreplacedwithnewgearassoonaspossible.
2‐8
2.3.2 WaterCollectionProcedure
(1) Priortolaunch,crewmemberswillhavereviewedthisQAPP,willhavesignedtheQAPP
certificationform(Exhibit15),andwillunderstandtheirassignedrolesinthesamplecollection
procedure.AllsampleridentificationinformationandotherfielddatawillberecordedontheField
CollectionSummary(Exhibit1).
(2) Thetransportvesselwillbelaunchedfromanappropriateareathatallowsaccesstothereachesto
besampled.
(3) Samplingwillcommenceatthefirsttransectlocatedatthedownstreamendofthereachtobe
sampledandwillproceedinanupstreamdirection.Theonlyexceptiontothisprotocoliswhenthe
boatlaunchislocatedupstreamofthesamplingreach.Thensamplingwillcommenceatthefirst
transectlocatedattheupstreamendofthereachtobesampledandwillproceedinandownstream
direction.ThedirectiontraveledforsamplingshouldberecordedontheFieldCollectionSummary
(Exhibit1).
(4)Itisimperativetoavoiddisturbingsediments,andavoidcollectingsampleswherethesediments
havebeenstirredup.Ifsedimentsareaccidentallydisturbedbytheboatmotor,itisrequiredthat
thedriver,re‐positiontheboatinanewareawithoutdisturbingsediments.Thedatarecordermust
makeanoteonthedatasheetandrecordactualGPScoordinateswherethesamplewastaken.
(Sedimentsaddtotheinhibitionloadofthesampleandcouldincreasetherateoffalsenegative
resultsforbothfilteredorcentrifugedsamples).
(5) Whenarrivingatasamplelocation(withineitheratransectortargetedarea),theleadsamplerand
samplingassistantwillputonnewgloves(powderlesslatexornitrile).REMINDER–Glovesmust
bechangedbeforeeachnewtransectistakentopreventcrosscontamination.Thesame
glovesmaybewornwhencollectingblanksamplesintandemwitharegularsampleina
transect.
(6) Goinginconsecutivenumericalorderbasedonthetubelabels,theleadsamplerwillremovea
labeledsampletubefromthesamplecooler.
(7) Justpriortocollectingthesample,theleadsamplerwillunscrewandremovethelid(s)fromthe
samplecontainers.Donotunderanycircumstancestouchtheinteriorofasamplecontainer,even
withacleanglove.Lidsshouldbeheldinhandandkeptclean,orplacedinacontainerdesignated
forholdinglidswhilewateriscollected.Toremovelidsfromholdingcontainer,dumpthemintoa
cleanglovedhand,donotreachintothecontainertoremovethelids.
(8) Theleadsamplerwillthenreachovertheupstreamsideorthebowofthetransportvesselwiththe
samplecontainerandfillthetubebyskimmingthesurfaceofthefieldwater.Thesamplecontainer
mustnotbesubmergedordippedbeyondtheupper2inchesofthesurfacewaterforsample
collection,sincetheintentofthesamplingistocollectfloatingorganicmatterthatisonthewater
surface.Avoidcollectinglargeorganicdebrissuchastwigs,leaves,seeds,etc.,becausetheycause
problemsinextraction.Asmallamountofduckweedisfine.Toavoidcontamination,theindividual
collectingthesampleshouldavoidtouchinganyothersurfaceswiththecleangloves(i.e.the
gunwhale)andshouldonlyhandlethesamplecontainerandcap.
Note:Centrifugesamplesforearlydetectionandmonitoringarecomprisedof5replicate50‐mL
tubes,whichmaybecollectedintwoways:1)tominimizevariationamongoffices,asampling
devicemaybeusetocollectall5tubesatonce,aslongasthereisacleanplacetostorefivecaps
2‐9
whilesamplingisoccurring.2)tocollectsamplesacrossalargeraccumulationzone,tubesmaybe
collectedoneatatimeacrossalargersampleareawithintheaccumulationareaoralongatransect,
orspacedaroundablock,toincreasedetectionprobability.Thisoptionshouldbecoveredinthe
specificsiteplan,wherespecificguidanceonthemethodsshouldbeexplicitforfieldcrews.
Centrifugesamplesmayalsobecollectedinalreadycarp‐infestedwaterstodetectorconfirm
spawningevents,ortofindareaswherecarpcongregatetobeusedincontrolefforts.Inthese
applications,samplesareasingle50‐mltube.
(9) Oncethesamplecontainerisfilled,theleadsamplerwillscrewthelidbackonuntilitistight.The
closedcontainerwillthenbereturnedtothesamplecoolerfromwhichitwasremoved.Tubesmay
befilledalltheway,thereisnoreasontomeasurewater,andaslongasalltubesarefilledthesame,
theywillbesafetouseinthecentrifuge.
(10) Whiletheleadsampleriscollectingthewatersample,thesamplingassistantwilltakeandrecord
habitatmeasurements:watertemperature,depth,GPScoordinatesinDecimalDegrees,timeof
sample,location(e.g.,left‐bankdecending(LBD),center,right‐bankdecending(RBD),andrecord
theinformationonthedatasheetnexttotheappropriatesampleID.BesuretosavetheGPS
coordinateswiththeway‐pointfeatureofyourdeviceandtonotethewaypointIDonthefield
datasheet.
(11) Iftheleadsamplerpullsafieldblank(waterfilledpriortotrip)fromthecooler,thesamplerwill
unscrewthelidandremovetoexposethecontainercontentstotheatmospherefor5sec,resealthe
container,fullysubmergethecontainerinthefieldwater,andreturnthecontainertothesample
coolerfromwhichitwasremoved.Theleadsamplershouldrelaytosamplingassistantresponsible
fordatarecordingthatthesamplewasablank,sothatitcanberecordedonthedatasheetnextto
theappropriateID.BLANKSARETAKENINTANDEMWITHTHENEXTACTUALSAMPLEANDDO
NOTREPLACEASAMPLEINTHATLOCATION.Ifablankhasbeenpulled,theboatwillremainatthe
samelocationandanactualsamplewillbetaken.
(12) Steps1through10willberepeatedateachsamplinglocationuntilsamplinghasbeencompletedfor
thetargetedreach.
(13) Onceacoolerisfull,addicetocompletelycoverallcontainers.Replaceiceasitmelts,removing
excesswateronlyasneeded,sinceicewaterwillprovidebettercoolingthanicealone.
(14) Chain‐of‐custody(COC)forms(Exhibit3)willbecompletedforeverysampleandeverycooler.All
samples,includingblanks,willbeloggedontoCOCforms.Theformswillbecollectedandsigned
wheneverthecoolersaretransferredbetweenparties.Ifyoumustsplitsamplesintodifferent
configurationsthanlistedontheoriginalCOC,makeanentryforthosesamplesontheoriginalCOC
andcreateanewCOCforanynewtransferorshippingcontainers.Besurethateachcontainerhas
itsownCOCthathasrecordsforexactlyandonlythesamplescontainedwithin.
2.4
WadingandNon‐motorizedSampleCollectionProcedure
2.4.1Purpose
CollectionofwatersamplesforeDNAanalysismaybeconductedinareasnotaccessiblebymotorized
watercraftandalternativemeansmustbeemployed.InordertoprovideaccurateandcreditableeDNA
results,watercraftandequipmentmustbedecontaminatedinaccordancefollowingsection2.2.3
protocolstoeliminateintroductionofoutsideDNA.
2‐10
Cautions:Precautionsshouldbemadetoavoiddirectskincontactwithbleachsolutionwhichmayalso
stainclothingorothermaterials.Beawareofpollutantsintheaquaticenvironmentandrelatedhealth
hazards.Whencanoeingorkayakingtwopeoplemustbetogethereitherinseparatekayaksorinone
canoewithPFD’swornatalltimesandafloatplanandGARmodelonfilewithsamplelead,processing
lead,samplequalityleadandprocessingqualityleadandsamplingagency’smainoffice.IfwadingPFD’s
mustbeworn.
2.4.2WadingWaterCollectionProcedure
(1) Collectionofwatersampleswhilewadingshouldcommenceatthemostdownstreamaccessible
samplingsiteandproceedupstream.Carefullyapproacheachsamplingsiteslowlytoavoid
disruptingsedimentsandaccumulationareas.Whentakingthesamplethecollector’sposition
shouldalwaysbedowncurrentofthetargetedarea.
(2) Whenthereisnoaccesstothedownstreammostsiteexceptfromanupstreamlocationfieldcrew
mayenteratthatpointandproceeddownstreamcarefully.Samplingwillcommenceatthe
downstreammostsiteofthereachtobesampledandproceedupstream.Theentiresampling
route,includingdirection,shouldberecordedontheFieldCollectionSummary(Exhibit1).When
travelingdownstreamstayoutofthewaterasmuchaspossibleandavoiddisturbinganyareasof
accumulationorsamplingsites.
(3) Thesamplecollectorwillputoncleangloves,removethefirstcontainerfromthecoolerandwade
toanareaofaccumulationtocollectthefirstsample.Afterthesampleistaken,thecollectorwill
returntoshoreandreplacethesealedcontainertothecooler.Donotunderanycircumstances
touchtheinteriorofasamplecontainer,evenwithacleanglove.Ifyoucannotgraspthecontainer
withonehand,usebothhandstoholdthecontainer.Sincethelidshouldnotbesetdown,either
handthelidtothesamplingassistantorholdthelidwiththeinsidetowardthecontaineralong
sidethecontainerasyoucollectthesample,keepingthelidoutofthewater.
(4) Whenapproachinganaccumulationareamovingdownstreammakea“J”likeapproachtodisturb
thewaterandsedimentaslittleaspossible.Ifapproachinganaccumulationareamovingup
streammakean“L”likeapproachtonotdisturbsedimentalongthebank.
(5) Changeglovesandremovethenextsamplenumbergoinginconsecutiveorderandproceedtothe
nextaccumulationarearepeatingsteps1and2.
(6) Ifsamplinginaremotelocationabackpackcontainermaybeused.Thebackpackshouldbeeither
ahardplasticpack/trapper’sbasketoraframepackwithahardplasticstoragecontainer
attached.Anybackpackcontainersusedmustbeabletowithstandthebleachdecontamination
protocolsandnotabsorb/retainwater.Cleansamplingcontainershouldbeplacedinalarge
plasticbag(i.e.,heavydutygarbagebag)andclosedpriortoloadingintothebackpack.Another
plasticbagplacedinthebackpackwillbeforfullwatersamples.Thepersonwearingtheback
packwillserveasthedatarecorderifathirdpersonisnotavailable.Thecollectorwillputonnew
glovespriortoopeningandremovingasamplecontainerfromthecleanbag.Ensurethecleanbag
issealedafterremovingacontainer.Aftercollection,placethecontainerinthebagdesignatedfor
watersamples,sealthebag,andremovecontaminatedgloves.Theboxofcleanglovesshouldbe
sealedinaplasticbag/containerbetweenuses.Placeusedglovesinaseparatewastebag.Place
watersamplesoniceassoonaspossibleandwithintwohoursorlessofcollection.
Note:Centrifugesamplesarecomprisedof5replicate50‐mLtubes,whichmaybecollectedintwo
ways:1)tominimizevariationamongoffices,asamplingdevicemaybeusetocollectall5tubes
atonce,aslongasthereisacleanplacetostorefivecapswhilesamplingisoccurring.2)tocollect
samplesacrossalargeraccumulationzone,tubesmaybecollectedoneatatimeacrossalarger
2‐11
sampleareawithintheaccumulationareaoralongatransect,orspacedaroundablock,to
increasedetectionprobability.Thisoptionshouldbecoveredinthespecificsiteplan,where
specificguidanceonthemethodsshouldbeexplicitforfieldcrews.
2.4.3Non‐motorizedWaterCollectionProcedure
(1) Kayaking/Canoeingwillcommenceatthemostupstreamsite(collectingsamplesinanupstream
todownstreamfashion).Asyouaremovingdownriver,trytomaintainareasonabledistance
fromtheshorelinetoreducewaveactiontotheshorelineandaccumulationareas.
(2) Cleansamplingcontainers(uptoseven)canbeplacedeitherlooselywithintheboatorinaplastic
trashbagdependingontypeanddesignofcraft.Samplenumbersofcontainersshouldbein
consecutiveorderandcollectedinorder.
(3) Whenapproachinganaccumulationareamovingdownstreamkayak#1willmakea“J”like
approachnottodisturbthewaterandsedimentaslittleaspossible.Afterthesampleiscollected
andkayak#1hasmovedfromthecollectionspotkayak#2willmoveintothespottorecord
depth,watertemperatureandGPScoordinates.Donotunderanycircumstancestouchthe
interiorofasamplecontainer,evenwithacleanglove.Ifyoucannotgraspthecontainerwithone
hand,usebothhandstoholdthecontainer.Sincethelidshouldnotbesetdown,eitherhandthe
lidtothesamplingassistantorholdthelidwiththeinsidetowardthecontaineralongsidethe
containerasyoucollectthesample,keepingthelidoutofthewater.
(4) After5‐7containershavebeencollectedkayak#1willswitchroleswithKayak#2(i.e.,kayak#2is
thecollectorandkayak#1isthedatarecorder).TheeDNAtrailerorafilterstaffmemberwill
meetthekayakersatalocationdownstreamthatisaccessibletoplacecollectedwatersamples
intoacoolerwithice.
(5) Atthistimethekayakerswilltakethelastofthecontainersinthecoolerandcontinuecollecting
withinthecollectionreachrepeatingstepsfourandfiveasneededuntilalllocationsaresampled.
(6) Ifsamplinglocationisinslowornocurrentareas(e.g.,impoundments,shallowchannels,etc.)
samplingcollectionprotocolsshouldfollowthelenticproceduresinsection2.4.2.Craftmay
proceedupstreamandalsoshouldcollectfromdownwindtoupwindifpossibleandapproachall
accumulationsiteswithminimaltonodisturbance.
2‐12
SECTION3
3. SAMPLEPROCESSING(FILTERINGorCENTRIFUGING)
3.1
Purpose
InordertoisolateeDNAfromwatersamplescollectedinthefield,particulatemattermustbe
concentrated.Itcanbefilteredfromthesampleusingavacuumfiltrationsystem,orconcentratedby
centrifugation.AsofMarch2015,centrifugingwillbeusedbytheUSFWS.Filteringmethodshavebeen
movedtoappendixH.
Centrifugationofwatersamplescollectsmatteratthebottomofthetubes,whichcanbecollectedon
sterilecottonswabsandeDNAcanbeextractedfromtheswab.Validationofthismethodhasshownthat
amaximumoffivetubescanbeswabbedwithasingleswab.
Cautions:Wearpowder‐freelatexornitrilegloveswhenhandlingsamples(aglovechangeisrequired
foreachsample).Becarefultoavoidunintentionalpuncturesofgloveswhenusingforceps.Punctured
glovesmustbechangedimmediately.Becarefulnottotouchcommonlyuseditemsinthelaboratory
whenwearingsamplegloves(i.e.,writingutensils,stationarylabequipment).Ifindoubt,changeyour
gloves!
3.2
CentrifugingProcedure
Watersamplescollectedinthefieldneedtobecentrifugedwithin12–16hoursafterthelastfieldsample
iscollected.
Equipmentneeded:
• Sterile,chemical‐freecentrifugetubes(MidwestScientific#TP91050)madeofpolypropylenethat
canwithstand6000xgwithcapsandlabels(recommendedAverylaserwhiteweatherproof
addresslabels#5520).
• Papertowels
• 95%ethanolor70%isopropylalcohol(mixpriortotripwithpurchasedmoleculargradewater)
• Areuseablebottle‐topre‐pipettorfordispensingalcohol
• Blackpermanentmarkers(e.g.,Sharpie®)
• Powderlesslatexornitrilegloves
• Refrigeratedcentrifuge(s)withrotorsandadaptorsfor50‐mltubes(Fisheritem#listedfor:
SorvallLegendXTRcentrifuge;rotorGS25F7087Gitem#75‐033‐607;750mlroundbucket
GS25F7087Gitem#75‐003‐608;50‐mltubeadaptorsitem#75‐003‐638)
• Bleach
• 10%bleachbathfordecontaminatingplasticcentrifugetubeadaptors*BleachdestroysDNA,so
takecaretoavoidcontaminatingsampleswithdrippingbleach.
• 20%bleachbathfordecontaminatingcentrifugetubesbeforeprocessing*BleachdestroysDNA,so
takecaretoavoidcontaminatingsampleswithdrippingbleach.
• • Rinsebathofwatertorinsecontainersbeforeprocessing
• Dedicatedlabequipmentcleaningsink
• Wastewaterdisposallocationsuchasnonspecified‐usesink
• Cleanbenchpaperorcleanpapertowels
• Dedicatedwaterbottles:oneforDIwater;oneforbleachsolution
3‐1
• Washbinforcentrifugeadaptorsandbuckets,suchasadedicated10qtplastictub
3.3.1LaboratoryPreparation
(1)Handsmustbewashedthoroughlypriortostarting.Adedicatedplasticwashbottlewith10%bleach
solutionshouldbepreparedforwipingdownlabtablesandothersurfacespriortoprocessing
samples.Allequipmentmustbesterilizedandallsuppliescollectedpriortostarting.
(2)Eachworkstationmustberinsedwithbleachsolutionandthesurfacecoveredwithoneormoreclean
papertowelsorbenchpaperpriortobeginningthecentrifugingprocess.Papermustbeswitched
betweeneachbatchofsamplingsites.Newpowder‐freelatexornitrileglovesmustbewornfor
processingeachbatch.Priortocentrifugingsamples,eachworkstationshouldhavepre‐printed
labelsoroneblack,waterproofpermanentmarkerforlabelingsampletubes,awastewatercontainer
(withlid),andadedicatedwashbottlewith10%bleachsolution,andadedicatedalcoholbottlewith
95%ethanolor70%isopropanol.Atleasta10‐qtplastictub(e.g.,Rubbermaid®plasticstoragebin)
shouldbefilledwith20%bleachsolutionforthesterilizationbathinsidethelab.
(3)Ateachworkstationarefrigeratedcentrifugesetat4⁰C.Ifinmobiletrailer,checkhorizontal
alignment,trailershouldbeaslevelaspossible.
(4)Adecontaminationstationwitha20%bleachbathtodecontaminateracksandtubespriorto
processing.
(5)Centrifugetuberacksshouldbeavailablefororganizingandworkingwithsampletubes.Onesetof
rackscanbeusedwithsamplespriortodecontamination,andasecondsetofracksshouldbe
decontaminatedbydippinginthe20%bleachbathandrinsingwithtapwater.Takecaretoplace
onlydecontaminatedtubesinthecleanracks.Besuretubesaredriedwellaftertheirsanitizingdip
toavoidanycontaminationofthesamplesduringprocessing.
3.3.2SamplePreparation
Newpowder‐freelatexornitrileglovesmustbewornpriortohandlingeachsampleset.
Processtubesinsetsofreplicates,untilafullcentrifugebatchisprepared.
Acentrifugeequipmentcontrolcomprisedof50mloftapwatershouldbeincludedwitheach
batchoftubesineachcentrifuge.Itshouldbelabledwiththerangeofsamplenumbersincluded
inthebatch.Forexample,centrifugeequipmentcontrolsamplenumber1000001‐1000005was
includedinthecentrifugewithfieldsamples1through5fromcasenumber10000.This
equipmentcontrolisinadditiontothefieldcontrol,andshouldbemadebythesamplingofficeor
agencywhileprocessingsamplesinthetrailer.
3.3.3CentrifugingtheSamples
(1) 50‐mltubesshouldberemovedfromthetransportcoolerandcapscheckedandtightened.Sample
containersshouldbesubmergedtothebottomofthecapinthe20%bleachfor10secondsandthen
completelydriedbeforebeingmovedintotheprocessingarea.*Itisimperativethatbleachnotbe
allowedunderthecapsortocomeincontactwiththesample,sincebleachdestroysDNA.
(2) Placethe50mltubesthathavebeencleanedanddriedintherefrigeratedcentrifugesetat4⁰C.
Tubesmustbeevenlydistributedwithinthecentrifugetomaintaintherotorbalance.NOTE:Always
followthemanufacturer’sguidelinesforcentrifugeoperation.Remembertoincludeoneequipment
controltubewitheachfullcentrifuge.Itisalsoimportanttokeepreplicatetubesforeachsample
3‐2
(3)
(4)
(5)
(6)
(7)
(8)
(9)
togetherinbatches.Donotsplitasamplebetweenbatches,otherwiseitistoodifficulttotrace
equipmentcontrolresultsthroughthelab.
Once50mltubesareinposition,closeandsecurecentrifugelid.Setcentrifugetospinthesamples
for30minatmaxspeed(~4500‐5000xg)andbegincentrifugingthesamples.Duringthisperiod
theothertubesmaybedecontaminatedandplacedonasterilizedsurfaceorrack.DONOTPLACE
DECONTAMINATEDTUBESONANYSURFACEORRACKTHATHASNOTBEENSTERILIZED.
OncesampleshavebeencentrifugedtheeDNAwillbeonthebottomofthetube.Wearinganewpair
ofglovesforeachsetoftubescomprisingonesample,carefullyremovecapandGENTLYpouroff
waterintoawastewatercontainer.Acarboyisusefultopreventsplashing,oraplainbucketwith
bleachinthebottomwillalsowork.Changeglovesaftereachsampleset.
Add~5mlof95%ethanolor70%isopropanoltothetubetostabilizetheeDNA.Replacecapand
swirlalchololaroundtubecoveringtheentireinternalwall.Centrifugethesampleswithalcoholfor
10minutes(ormoreasneededifpelletistooloose)atmaxspeed(~4500‐5000xg).
Decantexcessalcoholuntilthelevelofthealcoholiswithintheconicalendofthetube.Placetubes
backintoasterilizedrack,keepingsamplesorganizedbysamplenumberandensurecontrol
samplesarelabeledsothattheycanbepairedwiththeirprocessingbatches.Changegloves
betweensamplesets.
Whenracksarefull,puttheminplasticbagssothatthetubesaresecuredintherack.Tapebags
closedandsignacrossthetapewhereitoverlaps.Placeinboxtobeshipped.NOTE:Ifastabilizing
solution(i.e.,ethanol)isnotusedeDNAsamplesmustbefrozen(traditionalcommercialfreezeror
−20°Cfreezer)orplacedincoldstorage.Toconservedryice,samplesmaybeplacedinacooler
filledwithiceduringtheworkingday.Attheendoftheday,quicklytransferallsamplesintoadry
icecoolerforlong‐termstorage.Besuretomonitortemperaturetwiceadayandreplenishdryice
asneeded.
Priortocentrifugingthenextbatchof50mlsamplesremovethe50mltubeadaptorinsertsand
examineforanywaterordebris.Ifanythingisfound,placein10%bleachbathfor10minutes,
rinsewelltoremoveallresidualbleach,drywithnewpapertowels,andreplace.Ifadaptorinserts
arecleananddryonlyperformthisstepduringdailylabcleanup.(Itmaybehelpfultohavetwofull
setsofinsertssothatprocessingcanproceedwhileanydirtyinsertsarebeingcleaned).
OnthefielddatasheetnexttotheappropriatesampleID,recordthetimeofcentrifugecompletion
andtheinitialsofthepersonthatprocessedthesample.
Steps1–9shouldberepeateduntilallsampleshavebeenprocessed.
Asalways,glovesmustbechangedandtheworkstationsterilizedbetweenbatches.
Whenthewastewatercollectioncarboyisfull,itshouldbedisposedofinasinkseparatefromtheone
usedtobleachequipment.Ifasecondsinkisnotavailable,disposeofthewastewaterinanydrainthatis
connectedtoasewagetreatmentfacilityorsystem.
Ifasampleisaccidentallyspoiledduringthecentrifugingprocess(e.g.,thepelletwaslostduring
decanting,bleachwassquirtedintoatube,orcross‐contaminationissuspected),itshouldimmediately
bethrownaway.RecordonthecorrespondingdatasheettheappropriatesampleIDaswellasthereason
fortheruinedsample.
IfanydeviationsfromthisQAPPoccurredduringwatersamplecollectioninthefieldorduring
processingofsamples,clearlydescribethedeviationsonExhibit16.Ifdeviationswillaffectlab
processing,theeDNAProgramCoordinatorwillcontacttheeDNAProcessingLeader.
3‐3
EveniftherewerenodeviationsfromtheQAPP,Exhibit16formsshouldbesenttotheeDNA
ProjectCoordinatorfollowingasamplingeventtosatisfyreportingrequirementsinsection1.6.Besure
tonoteanychangesinpersonnelfromthepre‐tripplanonExhibit16whenthereportisfiled.
3‐4
SECTION4
4. SAMPLESHIPMENT
4.1
Purpose
Samplesmustbemaintainedaccordinglydependingonsampletype.Non‐preservedcentrifugesamples
mustbeonondryiceorina‐80freezeruntiltheycanbeshippedtotheDNAprocessinglab(WGLlabin
Onalaska,WI)assoonaspossible.Temperatureshouldberecordedtwiceadayduringsamplestorage
andimmediatelypriortosealingtheshippingcontainer(Exhibit7).Ifsampleswerecentrifuged,samples
donotneedtobecooled.Allsamplesshouldbeshippedassoonaslogisticsinthefieldallow.Thereisno
longera24‐hourmaximumtimelimitonshipping,butthatdoesnotmeanthatseveralcasesmaybe
saveduptobedeliveredorshippedatonetime.Sincethelabhastoopenandaccountforeachindividual
sampleandequipmentcontrol,samplesshouldbeshippedinnomorethan400totalsamples(unlessa
singlecaseislargerthanthis,thenshipbycase).TheProcessingLeaderisresponsibleforensuringthat
samplesareproperlypackedandshippedaccordingtotheprocedurebelow.
TherewillbenoairshipmentsacceptedonFridaysatWGL.Experienceinthepastwiththerare
failureofFedExtodeliveronFridayhasresultedinlossofsamples.Ifsamplescannotbeshipped
byWednesday,thentheymustbeheld,withtemperaturesrecorded,bythesamplingagency
(accordingtostep3.3.3(7))untilthefollowingweek.Ifshippingflammablesamplesbyground,
WGLwillacceptFridaydeliveries.
Pleasenote:theCOCformsareasimportantasthesamplesthemselves.IfCOCformsarenotfilled
outproperly,thensampleintegrityislostandthesampleswillnotbeprocessedbecausetheir
custodycannotbeaccountedfor.Therefore,pleasebesuretoaccuratelyandcompletelyfilloutthe
COCforms.Ifyouhavequestions,donothesitatetocalltheeDNAProgramCoordinatorortheeDNA
laboratory.
Cautions:Wearglovesandusecautionwhenworkingwithdryice.
4.2
ShippingProcedureforsamplesondryice
(1) Centrifugetubesmustbeshippedorganizedinracks,securedinplasticbagsthatwillkeeptubesin
theracks,andshippedincontainersthatwillholdthetubesandpreventdamagetothetubes.
Besuretubesaresecurelyclosedtopreventleaking.Ifnecessary,twistcapscounter‐clockwiseto
properlyseatthethreadsindicatedwitha“click”.Tighten.Iftubeshavebeenchilled,lidsmay
becomeloose,sodouble‐andtriple‐checkbeforepacking.Placetubesbackintotherackin
numericalorder.Placetherackoftubesbackintoaplasticbag,sealorwrapittighttokeeptubes
fromfallingout,tapeitclosed,staplingorsigningacrossthetape.Packracksoftubesintoboxes,
usingpackingmaterialtokeepthemfromshifting.
(2) FilloutaCOCformforeachshippingcontainerwherethemostrecentlistinglistsexactlyandonly
thesamplesshippedinthatparticularcontainer(equipmentcontrolsareseparatesamplesfromthe
fieldsamples,sotheymustbeaccountedforonCOCformsinthecontainersinwhichtheyare
shipped).Theindividualemployeepackingandsealingthecontainersshouldlisttheirnameinthe
“from”line,besuretoincludeagencyandprintclearly.Thecontainershouldbepackedand
releasedonthesamedate.SignandplaceCOCforms(Exhibit3)inaclean1‐galresealablebag,
placeevidencetapeacrosstheseal,andplacethebagontopofthecoolerbeforeclosingthe
corrugatedshippingboxandsealingwithpackingtape.EachboxMUSThaveaseparatesigned
COCformincludedtodocumentthespecificsamplesincludedtherein.Ifyoumustsplitsamples
4‐1
intodifferentconfigurationsthanlistedontheoriginalCOC,makeanewentryforthosesamples
goingintoonecontainerontheoriginalCOCandcreateanewCOCforanynewshippingcontainers.
(3) FilloutaFederalExpress(FedEx)airbillshippinglabelwithappropriateinformation.Besureto
affixadryicewarninglabel(canbepurchasedinrollsfromFedEx,orprintedfromtheinternet)
withtheamountofdryiceineachcooleronthecardboardshippingcontainer.Onthelabelbesure
todesignateFedExOvernightExpress(deliveryisusuallythefollowingdaybetween8and10AM)
aswellastoidentifytheweightofthedryiceinthepackage.Whenready,dropoffatFedExorcall
FedEx(1‐800‐463‐3339)forpickup.Besuretotelltheoperatorthatthepackagecontainsdryice
andaskforanapproximatepickuptime.Besuretorecordtrackingnumbersforallboxesbeing
shipped.
(4) Itemswillbeshippedtothefollowingaddress:
WhitneyGeneticsLab
555LesterAvenue
Onalaska,WI54650
608‐783‐8444
4.3
ShippingProcedureforsamplespreservedwith70%isopropyl
(1) Centrifugetubesmustbeshippedorganizedinracks,securedinplasticbagsthatwillkeeptubesin
theracks,andshippedincontainersthatwillholdthetubesandpreventdamagetothetubes,as
wellasmeetingregulationsforshipping“smallquantities”offlammableliquidsaccordingto49CFR
173.4.Note,thesesamplesmayonlybeshippedground,andifusingFedEx,youmustcallforpick‐
up,theywillNOTacceptdrop‐offsatanyoffice.
(2) Besuretubesaresecurelyclosedtopreventleaking.Ifnecessary,twistcapscounter‐clockwiseto
properlyseatthethreadsindicatedwitha“click”.Tighten.Useasinglepieceoftapetosecurethe
lidtothetube.Placetubesbackintotherackinnumericalorder.Placetherackoftubesbackinto
aplasticbag,sealorwrapittighttokeeptubesfromfallingout,tapeitclosed,signingacrossthe
tape.
(3) Constructshippingbox,double‐tapingallseams.Boxmustmeetfederalguidelines,twooptionscan
bepurchasedfromUline:model#S‐4798(holds120samplesor600tubes)ormodel#S16458
(holds90samplesor450tubes).
(4) Usetwosectionsofabsorbentmaterial(BLU‐102fromnewpig.com)andmakeacrossoverthebox.
Pushthecenterofthecrossintothebottomofthebox,makingsuretopressthemattingintothe
bottomcorners.
(5) Ontopofthematting,placea24x24x48gussetedbag.
(6) Placeracksina3x2configuration(3layershigh)fora22x18x16box.Theyonlyfitlikethisoneway.
18racksintotal.A22x22x22boxwillbeabletoaddanotherlayer,for4layersof3x2racks.Add
moremattingorusesparezipbagstofillinthesidespaceleftbythelargerbox.
(7) Twisttieshutthe24x24x48gussetedbagtofullyencloseallthetuberacks.Usetampertapetolay
thetwistknotasflataspossible.Youcantuckmostofitintothespacecreatedwheretworacks
meet.
4‐2
(8) Foldtagendsofmattingontoeachothertofullyenclosethetopoftheboxwithmatting.
(9) Placea20x20dividerontopofeverythingtomakeaflatsurface.
(10) FilloutaCOCformforeachshippingcontainerwherethemostrecentlistinglistsexactlyandonly
thesamplesshippedinthatparticularcontainer(equipmentcontrolsareseparatesamplesfromthe
fieldsamples,sotheymustbeaccountedforonCOCformsinthecontainersinwhichtheyare
shipped).Theindividualemployeepackingandsealingthecontainersshouldlisttheirnameinthe
“from”line,besuretoincludeagencyandprintclearly.Thecontainershouldbepackedand
releasedonthesamedate.SignandplaceCOCforms(Exhibit3)inaclean1‐galresealablebag,
placeevidencetapeacrosstheseal,andplacethebagontopofthedividerbeforeclosingthe
corrugatedshippingboxandsealingwithpackingtape.EachboxMUSThaveaseparatesigned
COCformincludedtodocumentthespecificsamplesincludedtherein.Ifyoumustsplitsamples
intodifferentconfigurationsthanlistedontheoriginalCOC,makeanewentryforthosesamples
goingintoonecontainerontheoriginalCOCandcreateanewCOCforanynewshippingcontainers.
(11) Finally,doubletapethetopseamstoclosethebox.Clearlywrite“Thispackageconformsto49CFR
173.4fordomestichighwayorrailtransportonly”ononesideofthebox.Besuretodrawarrows
onallsidesofthebox,indicatingwhichsideisthetopofthebox.
(12) FilloutaFederalExpress(FedEx)GROUNDshippinglabelwithappropriateinformationand
requestapick‐up.FedExwillonlyshipflammablesifyourequestapickup,youwillnotbeallowed
todropboxesoffatFedEx.
(13) Itemswillbeshippedtothefollowingaddress:
WhitneyGeneticsLab
555LesterAvenue
Onalaska,WI54650
608‐783‐8444
4.4
WGLcontacts
(1) Onceitemshavebeenshipped,atleastonepersonatWGLmustbecontactedandnotifiedof
approximatedeliverydateandtime.Atleastoneofthefollowingpersonnelshouldbecontactedvia
telephoneandemailregardingshipment,continuecallingdownthelistuntilyouspeakwitha
humanonthephone.Followingshipment,emailapproximatedeliverytime,dateandtracking
numberstothepersonyoutalkedwithandthepersonwhowillbereceivingthedeliveryatWGL:
EmyMonroe
Phone:608‐783‐8402
Email:[email protected]
MarenTuttle‐Lau
Phone:608‐783‐8403
Email:maren_tuttle‐[email protected]
NickGrueneis Phone:608‐783‐8404
Email:[email protected]
4‐3
NickBerndt Phone:608‐783‐8419
Email:[email protected]
KyleVonRuden
Phone:608‐783‐8411
Email:[email protected]
(2) UponreceiptofthesamplesatWGL,ifthesampleswereshippedwithdryice,theinside
temperatureofallthecoolersmustbetakenandrecorded.Samplesshippedwithdryicethathave
remainedatroomtemperature(approximately20°C)formorethan24hourswillbediscarded,and
thesamplenamesandreason(s)fordiscardingwillbenotedinthelaboratorylog.Samplesthatare
shippedatambienttemperaturedonotneedatemperaturerecordeduponreceipt.
(3) PersonnelreceivingtheshipmentmustimmediatelysigntheCOCform,scanitandemailitbackto
thesenderoftheCOCandthatstation’sFieldOperationsManager.MakesuretocctheData
ReportingSpecialist,theeDNAProcessingCoordinatorandtheeDNAProjectCoordinatorsothat
properdocumentationcanberecorded.Receivingpersonnelshouldalsocallthesenderand
samplingleaderiftheydonothaveemailaccessinthefield.
4‐2
5.
5.1

SECTION5
DNAASSAYS
GeneralQualityAssuranceandChain‐of‐CustodyConsiderations
AnychangetodescribedDNAhandling,storage,orprocessingproceduresmustnotresultin
reductionofeDNAsensitivityrelativetocurrentvaluesandmustbeclearedwiththeeDNA
ProcessingLeader.Theoriginalprotocolproducedthefollowingresultsatdifferentconcentrations
ofpurifiedDNAamplicons1insterilewater:
Species
PurifiedDNAamplicon
(copies/μlwater)
PurifiedDNA
amplicon
(ng/μlwater)
BigheadCarp
207
3.30x10‐8
SilverCarp
7
7.25x10‐10
NewmarkersdevelopedandthentestedandverifiedviatheMarkerValidationStudywerefoundtobe
moresensitivethantheoriginalmarkers:
Marker(species)
ACTM1(both,cannotdifferentiate)
ACTM3(both,cannotdifferentiate)
SCTM4(Silver)
SCTM5(Silver)
BHTM1(Bighead)
BHTM2(Bighead)
Copies/μlwater
3
3
3
3
3
3
Markerlength(bp)
145
133
168
98
144
96
Thenewmarkersarelocatedthroughoutthemitochondrial(mt)DNAloop(figure1),andasuiteof
markerswillbeusedtodetectandconfirmthepresenceofcarpDNAinthewatersamples,ratherthana
singlelocusperspecies.Eachpairofmarkerscanbeanalyzedinduplex,orasinglereaction,andwhen
positiveformarkers,indicate2lociwithinthemtgenomearepresent.Theinitialscreeningreactionwill
detectthepresenceoftwolociwithinthecytochromeoxidase1(COI)geneinthemtDNAofbothSilver
andBigheadcarp.Thislocusisparticularlypowerful,asitisusedastheuniversalbarcodeoflife,a
regionofmtDNAusedtoidentifyspecimenstospeciesfortheentireanimalkingdom.Inordertobe
deemedpresumptivepositive,bothoftheCOIlocimustbedetectedinatleastonereplicatereaction,but
theydonothavetobethesamereplicate.Theconfirmationofeachspecieswillthenbedemonstratedby
detectingatleastoneadditionallocusonthemtDNAgenome.ForSilvercarp,twomarkersareinthe
ND2andND6genesubunits,andforBigheadcarpintheND2andND4genesubunits.Thepresenceof
oneortheotherlocusinatleastonereplicatewillconfirmthepresenceofeitherSilverorBigheadcarp
DNAinthesample.
1AsreportedinJerdeetal.,2012.ResponsetoCaseyetal.’ssensitivityofdetectingenvironmentalDNAcomment.
ConservationLetters0:1‐2.
5‐1
Detectingatleastthreedifferentlociwithinthemtgenomeprovidesconfidenceinthedetectionofcarp
DNAinthewatersample,andsequencingisnotrequiredsincetheentireamplicon(markerlengthin
tableabove)isrequiredtomatchtheprimersandprobeindicatinghighspecificity.
Figure1.MapofentireAsiancarpmitochondrialgenomewhichwasdeterminedatERDCwith33
bigheadcarpand29silvercarpcollectedfromacrosstheUnitedStates(Farringtonetal.inreview2).
Markerlocationsareindicatedwitharrows.Theoriginalmarkersarelocatedwithinthecontrolregion
(Dloop).TheACTM1and3markersareoneitherendoftheCOIgene.BigheadmarkersBHTM1and2
areintheND4andND6regions,andSilvermarkersSCTM4and5areintheND6andND2regions,
respectively.

EachstageofeDNAgeneticprocessingprocedures(eDNAsampleextraction,PCRsetup,andpost‐
PCRprocesses)shouldbeperformedinaseparateroominordertominimizetheriskofsample
cross‐contamination.Ifseparateroomsarenotavailable,extractionsandPCRsetupcanbe
combinedinoneroom,ONLYifPCRsaresetupinaPCRhoodwithahepafilterandUVlight.All
post‐PCRprocessingmustbeinaseparateroom.

Everyeffortshouldbemadetoensurethatequipment,workareas,andsolutionsarefreefromDNA
contamination.Allsurfacesshouldbewipedcleanwith10%bleachsolution(orcommercialDNA
eliminatingsolutionsuchasDNAAway)beforeandafteruse.IfequippedwithUVlamps,cleanlab
roomsorPCRhoodsshouldbeirradiatedwithUVlight30minutesatthebeginningandendofthe
workday.

Non‐sterile,non‐PCRreadymicrocentrifugetubes(MCT)andglasswareusedinthelabmustbe
autoclavedat121˚Cfor20minbeforebeingused.Anyre‐useditemsmustbesoakedinafreshly
5‐2
made10%bleachsolutionfor10minutesfollowedbyathoroughrinse.(Sterile,certifiedDNA‐free
MCTdonotneedtobeautoclavedpriortouse).
2Farrington,H.L.,C.E.Edwards,X.Guan,M.R.Carr,andR.F.Lance.2015.MitochondrialGenomeSequencingandDevelopment
ofGeneticMarkersfortheDetectionofDNAofInvasiveBigheadandSilverCarp(HypophthalmichthysnobilisandH.molitrix)
inEnvironmentalWaterSamplesfromtheUnitedStates.PLoSONE10(2):e0117803.doi:10.1371/journal.pone.0117803

Goodhousekeepingpolicyshouldbepracticedatalltimes.Reagentsthathavepassedexpiration
datesshouldnotbeused,norshouldanyreagentsthathavebeenkeptatincorrectstorage
temperaturesforasignificantlengthoftime.Allreagents,reactiontubes,etc.,mustbeclearly
labeled.Recordsofbatchnumbersofallreagentsusedinindividualassaysshouldbemade
wheneverreagentsaresignedoutfromthedesignatedfreezer.Thetemperaturesofcoldstorage
unitsmustbemonitoredonceaday,usingtheformsgiveninExhibits7‐8.

Positiveand/ornegativereactionsshouldbeusedtotestallnewbatchesofcriticalcomponents
priortoorconcurrentwiththeirapplicationtoeDNAsamples.

StandardsteriletechniquesshouldbeusedintheDNAlaboratorytopreventtheunintended
transferofDNAbetweensurfaces,andtopreventcross‐contaminationbetweensamples.
Contaminationcanadverselyaffecttheoutcomeofacase;therefore,itisessentialthatthe
laboratoryhaveproceduresinplacetolimit,recognize,andaddresscontamination.

Gloves(e.g.,powder‐freenitrileorlatex)mustbewornthroughoutsampleprocessing.Ata
minimum,glovesshouldbechangedatthecompletionofeachstepoftheprocess.Ifglovesbecome
contaminatedorifcontaminationissuspected,discardthemandreplacethemwithnewones.For
example,glovesshouldnotbewornwhenusingorhandlingkeyboards,notebooks,pens,
telephones,etc.andmustbereplacedimmediatelybeforerecommencingbenchwork.

Centrifugetubesbeforeopeningthereagents.Uncapandclosetubescarefullytopreventaerosol
contamination.

Ensurethatcentrifugesarealwaysbalancedwhencentrifugingsamples.

Ensurethatallequipment,includingpaper,pens,andlabcoats,arededicatedforuseonlyinthat
particularlaboratory(e.g.,laboratorycoatforeachstageofprocedurerooms.Workbooksthathave
beenincontaminatedareasshallnotbetakenintocleanPCRareas.AProjectLabBookshouldbe
keptinaroomseparatefromtheDNAExtractionRoomandDNAPCRRoom.Eachroom(Extraction,
PCR,Post‐PCR)shouldhavenote‐takingmaterials(e.g.,loose‐leafpaper,networkedtabletPCs)that
canbetransportedorviewedforconsolidationintheProjectLabBook.Othersolutionsfor
preventingcontaminationofsensitiveareasvialabnotesmaybeusedfollowingapprovalbythe
eDNAProcessingLeader.AnychangesshouldbeincorporatedintoarevisedQAPP.Laboratory
notes/notebooksshould:
o Bewrittenorprintedontamper‐proofpaper(e.g.,doesnotexactlyphotocopy).
o Havelabbookidentification,withconsecutivenumbering,dates,andsignatures(ofthe
note‐taker)oneachpage.
o Bemadeusingpermanentink.Specialpensmayberequiredforcertainpapertypes.
o Haveanychangestonotebooksbedatedandinitialedbythepersonwhomadethechange.
Anyincorrectinformationshouldhaveasinglelinedrawnthroughitandnotbecompletely
obscured.
5‐3
o Containalldataimages(e.g.,gelphotographs,denaturingcurves,DNAsequence
electropherograms).Imagesshouldbepermanentlyaffixedtothenotebookandsigned
acrossboththeedgeoftheinsertandthepage.
o Bekeptinalockeddrawerorcabinetwithrestrictedaccesswhennotinuse.

Alogofallbatchesofcriticalcomponentsshouldbekept.Thislogshouldincludematerialsafety
datasheets(MSDS)andproductinformationsheets.Datesofreceipt,opening,testing,anddisposal
foreachcomponentshouldberecordedinthelog.
5.2






5.3
QualityControlforSampleCustodianProcedureandStorage
Aninternallogbookshouldbekeptforallsamples.Tamper‐proofpapershouldbeused.Thelog
bookshouldbekeptinalockeddrawerorcabinetwhennotinuse.
Separatefreezersshouldbedesignatedforstorageof(a)concentratedwatersamples,(b)DNA
extracts,(c)PCRandsequencingproduct,and(d)PCR,cloning,andsequencingkitcomponents.A
dedicatedrefrigeratorshouldalsobemaintainedforanyPCR,gelelectrophoresis,cloning,and
sequencingkitcomponentsthatrequire4˚Cstorage.
Mapsorotherdesignationsofthelocationofsampleswithinfreezersshouldbemaintained.
Allitemsinfreezersshouldhaveindelibleinkidentifications.
Allfreezersshouldhavenon‐universallocksormarinebracketsattachedthatcanbeusedwith
keyedlocks,orbehousedinasecurefacility.
Allsamplesplacedintoorremovedfromfreezersshouldbesignedforonfreezerlogorambient
storagelog(seeExhibits7,8,and9).
PhysicalSeparationofPre‐PCRandPost‐PCRAssayStages
5.3.1 TheeDNAExtractionRoom



ExtractionofDNAmustbeperformedwherePCRproductsandstocksofclonedmaterialarenot
handled.
APCRhoodwithabuilt‐inultraviolet(UV)lightandHEPAfiltermaybeusedtofurtherisolate
DNAextractionkitsolutionsandelutesfromambientDNA.
Acompleteseparatesetofnecessarylaboratoryequipment,consumables,andlaboratorycoats
shouldbededicatedforuseinDNAextraction.
5.3.2 Pre‐PCRRoom




Topreventcarry‐overofamplifiedDNAsequences,PCRreactionsshouldbesetupinaseparate
roomfromthatusedforpost‐PCRmanipulations.
Acompletelyseparatesetofnecessarylaboratoryequipment,consumables,andlaboratorycoats
shouldbededicatedforthespecificuseofpre‐PCRmanipulations.
ReagentsandsuppliesshouldbetakendirectlyfromcleanstorageintothePCRareaandshould
neverbetakenorsharedwithareasinwhichpost‐PCRanalysesarebeingperformed.Equipment
suchaspipettesshouldneverbetakentothepost‐PCRareaafterusewithamplifiedmaterial.
Asign‐inlogsystemshouldbeimplementedforuseofthethermalcyclers(PCRmachines),
includingtherunname,plateorientation,andthenumberofthermalcyclerheads.
5.3.3 PCRProductAnalysisRoom
Thisisthepost‐PCRRoomwherepost‐PCRmanipulationsareperformed,includingagarosegel
electrophoresisofproductsandsequencingofpresumptivepositives.
5‐4


Thisroomisacontaminatedarea;therefore,noreagents,equipment,laboratorycoats,etc.from
thisroomshouldbeusedinanyoftheotherlabareas.
AbiologicalorPCR‐typehoodmaybeusedforsettingupcloningorsequencingreactions.
5.4 ReceiptofTubes
5.4.1 Source
WatersampleshavebeentakeninthefieldaccordingtoSection2andcentrifugedaccordingtoSection3.
SampleshavebeenshippedtoWGLandpersonnelassignedtotheWGLeDNATeamhavereceived
packagesfromtheovernightservice.NOTE:alcohol‐preservedcentrifugedsamplesareshippedat
ambienttemperature.
(1)
UponreceiptofsamplesfromtheeDNAsamplefilteringteam,theshippedbox(es)shouldbe
openedandifshipmentwasondryice,thetemperatureinsideeachboxrecorded.Thegeneral
conditionofthebox(es)shouldalsoberecorded.
(2)
Ifsampleswereshippedondryiceonly:measuretemperatureuponopeningthebox,either(a)
placeaglassthermometerinsidetheStyrofoamcontainer,replacelid,andleavethethermometer
inplaceforatleast2minbeforeremovingitandimmediatelyrecordingtemperatureor(b)
immediatelyaimaninfraredlaserthermometeratthesamplesandpresstheMEASUREbuttonto
recordthetemperatureinsidethecooler.
(3)
Placeallsamplesinsamplestoragefreezer(–80°C)andlogsamplesonfreezersheet(Exhibit8).If
centrifugedsamplesaretobeprocessedwithinaweek,itispermissibletoplacetubesinambient
samplestorage(shelves)andlogsamplesonbench‐toplogsheet(Exhibit9).
(4)
SignanddatetheCOCformsthataccompaniedthesamples.Placetheminadesignatedfile;acopy
shouldalsobeprovidedtosamplingagency.Iftheformswereinsidesealedbags,slitthebagto
removetheCOCforms.Noteanyconditionissues(brokentapeorseals,damagedcontainersor
containers,etc.)withthesamplesontheCOCforms.Noteanysamplesthatmustbediscardeddue
toconditionissuesandthereasonfordiscard.
(5)
Entersampledataintointernalsamplelogbook(orLIMS),includingnotinganysamplesthatare
beingdiscardedandthatshouldnotbeanalyzed,andcreatenewWGLCOCformforsamples.Note
anyobservationsaboutsamplessuchasconditionissues.StoreCOCformsinasecurearea.
(6)
AlertSamplingandProcessingLeadersthatsampleshavebeenreceived.Usee‐mailaddresses
withreturn/receiptrequestedanddirectlycontactviatelephone;teamcontactsarelistedin
AppendixA.Thisreportingmustbedonewithin1hourofcompletingsamplecheck‐in.Besureto
scanandsendCOCsaccordingto4.2(10).
5.5
DNAExtractionfromTubes
5.5.1 Source
TubesfromeDNAsamplinghavebeenreceivedbyWGLeDNATeamandlogged.Centrifugedsample
tubesmaybeinambientstorageoriftheyarenotpreservedwithalcoholindesignated‐80°Cfreezer.
5.5.2 DNAExtractionQualityAssuranceandChain‐of‐custody
Atthisstage,acriticalcomponentofqualitycontrolshouldbetocorrectlylabelallsampleextraction
processingtubessothatthereisnoquestionabouttheoriginofsamples.
5‐5
(1) BenchareasinDNAextractionlaboratoryandPCR‐typehood(ifused)shouldbewipedbeforeand
afterusewith10%bleach.Validated,commerciallyavailablesterilizationreagents,suchas
LookOut®DNAErase®,maybepreferred.ExtractionroomsshouldbeirradiatedwithUVlightsfor
30minutespriortouse.
(2) Afteranitemorsurfaceiscleanedwithbleach,itmustberinsedwithpurifiedwateroralcoholto
preventthebuild‐upofsodiumhypochloritecrystals.Instrumentsorequipmentcleanedwith
bleachmustberinsedtoavoidcorrosion.
(3) Itiscommonpracticeformoisturebarrierpapertowelstobeplacedonthebenchtopwhile
processingsamplestoactasabarrier.Thepaperbarriersmustbechangedandthebenchtop
cleanedbetweensamplebatches.
(4) Centrifuges,thermalcycler,tuberacks,pipettes,andanyotherequipmentusedfortheextraction
processshouldbecleanedbeforeandaftereachuse.
(5) Instrumentssuchasforcepsandscissorsshouldbecleanedjustpriortouse.Steriledisposable
equipmentshouldbeopenedjustpriortosampleprocessinganddiscardedafteroneuse.
(6) Whenusingpipettors,usefilteredtipsandneverallowtheliquidinapipettetiptoriseuptothe
barrier.
 Donotrestthepipetteonadirtysurface.
 Avoidcross‐contaminationbychangingpipettetipsaftereachuse.
 Watchthatthetip,andonlythetip,isallowedtogointoabottleofreagent,neverthepipette
itself.
(7) Recordallsolutionbatch/lotnumbersusedforreactionsinlabnotes.
(8) Alwaysmixtubesbyvortexorfingerflicking,andthenbrieflyspindowntubesbeforeopening.
(9) NodeviationstotheDNAextractionprotocolareallowedwithoutwrittenapprovalbytheeDNA
ProcessingLeader.Anyerrorsinprocessingshouldbenotedinthelaboratorylog.Samplesaffected
byerrorsintheextractionprotocolshouldbeclearlyidentified.
5.5.3 Alcoholevaporationfromcentrifugedsamplesprocedure
(1) Centrifugedsamplesmayneedtobere‐spuntore‐concentratesampleatthebottomofthetube
aftershipping.Swirlliquidtore‐captureanyobservabledebrisfromthesideofthetubewall.
(2) Centrifugeatmaxspeedfor5minutes.Thisentireprocedurecanbedoneinadvance,andsamples
storedat‐80untilreadyforprocessing.
(3) Centrifugedsamplespreservedwithalcoholmusthavethealcoholevaporatedawaybefore
extractingthesamples.Preparelaminarflowhoodbywipingdowntheworksurfacewith10%
bleachorDNAawayand/orusetheUVlampfor15mintues.
(4) Removesamplesfromfreezerorambientstorage;noteonfreezer/storageandsamplelog(see
Exhibits7‐9).
(5) Movesamplesintuberackstothelaminarflowhood.Carefullyremovetubelidsandplaceinthe
sameorderasthesamplesnexttoeachrack.Turnontheairflowandleavethesamplestodryuntil
alltracesofethanolorisopropanolsmellaregone,becausethesearebothPCRinhibitors.Donotlet
5‐6
samplessitatroomtemperaturelongerthanovernight,andneveroveraweekend.Ifworkingin
advance,evaporatedsamplesshouldbestoredat‐80untilextraction.
(6) Includeahoodnegativecontrolsampleforeachextractionbatchsetouttodry.ForWGLextraction
batchesof48,thisequals45fieldsamples,anextractionpositiveandnegative,andonehood
negativecontrol.Makeanegativehoodcontrolbyplacinganempty,sterilecentrifugetubeinthe
rackswiththelidremovedalongsidethefieldsamples.
(7) PositiveandnegativeextractioncontrolsshouldbeaddedtoeacheDNAextractionprocedurebatch.
•Beforeproceedingwithextraction,apositivecontrolswabispreparedbypipetting300µlof
SilverandBigheadcarpcelllinesortissueslurrydirectlyontoasterileswabsin1.5‐mlMCT.
Alternativespecies(e.g.sturgeonorbluegill)maybeusedasthepositivecontroltoreduceriskof
samplecontaminationfromcarptissue.AlternativespeciesmusthavePCRprimersthat(1)do
notcross‐reactwithcarpDNA.Abatchofextractionpositivescanbepreparedaheadoftimeand
frozenat‐20°C.
•Additionally,anextractionnegativecontrolsampleshouldbepreparedbypipetting300ulof
sterilelabDIwaterontoasterileswabina1.5‐mlMCT.Abatchofextractionblankscanbe
preparedinadvanceandkeptfrozenat−20°C
•Foreveryextractionbatchoffiltersamplesorcentrifugedsamplesprocessed,conductDNA
extraction(below)ononefrozen,sterileextractionnegativecontrolandonepreparedpositive
control.
(8) Forallsamplesandcooler,equipment,andextractioncontrols,followtheDNAextractionprotocol
detailedbelow.
Cautions:AswithallcomponentsofeDNAprocessing,qualitycontrolandsterilizationproceduresmust
becarefullyfollowedinordertoavoidcontaminationofdownstreamprocedures.
5.5.4 Centrifugedsamplesshippedondryiceprocedure
Centrifugedsamplesmayneedtobere‐spuntore‐concentratesampleatthebottomofthetubeafter
shipping.Thaw5samplesoftubes,andworkquicklytoavoidDNAdecomposition.Whenthatsetof5
samplesisfinished,placethembackintothefreezerandtakeoutthenextfivesamples.Sincesamplesare
beingplacedbackintothefreezer,donotworryaboutenteringthisactionintothefreezerlog.Onlyfill
outthefreezerlogwhensamplesareremovedtoextraction.
(1) Swirlwatertore‐captureanyobservabledebrisfromthesideofthetubewall.Consolidatepellets
intoasingletube,rinsesideswithadditionalwaterifneeded,usingasquirtbottle,andtakingcare
toavoidcontaminatingthetip.Besuretochangeglovesbetweensamples.
(2) Centrifugeatmaxspeedfor5minutes.Decantasmuchofthewateraspossiblesothattheentire
samplecanbeextracted,includingtheremnantwater.
(3) Thisentireprocedurecanbedoneinadvance,andsamplesstoredat‐80untilreadyforprocessing.
(4) Removesamplesfromfreezer,noteonfreezerlog(seeExhibits7‐9).
(5) Samplesfrozenwithwatercanbedirectlyextracted.
(6) PositiveandnegativeextractioncontrolsshouldbeaddedtoeacheDNAextractionprocedurebatch.
 Beforeproceedingwithextraction,apositivecontrolswabispreparedbypipetting200µlof
SilverandBigheadcarpcelllinesortissueslurrydirectlyontoasterileswabsin1.5‐mlMCT.
Alternativespecies(e.g.sturgeonorbluegill)maybeusedasthepositivecontroltoreducerisk
5‐7
ofsamplecontaminationfromcarptissue.AlternativespeciesmusthavePCRprimersthat(1)
donotcross‐reactwithcarpDNA.Abatchofextractionpositivescanbepreparedaheadof
timeandfrozenat‐20°C.
 Additionally,anextractionnegativecontrolsampleshouldbepreparedbypipetting200ulof
sterilelabDIwaterontoasterileswabina1.5‐mlMCT.Abatchofextractionblankscanbe
preparedinadvanceandkeptfrozenat−20°C
 Foreveryextractionbatchoffiltersamplesorcentrifugedsamplesprocessed,conductDNA
extraction(below)ononefrozen,sterileextractionnegativecontrolandonepreparedpositive
control.
(7) Forallsamplesandcooler,equipment,andextractioncontrols,followtheDNAextractionprotocol
detailedbelow.
Cautions:AswithallcomponentsofeDNAprocessing,qualitycontrolandsterilizationprocedures
mustbecarefullyfollowedinordertoavoidcontaminationofdownstreamprocedures.
5‐8
5.5.5QiagenDNeasyKit(orequivalentkit)Procedureforcentrifugedsamples
(1)Obtainonelyseandspinkitpersampletobeextracted,openpackagesandorganizetubesinrack.
Labelbothcapsofeachsample.Youwillhavetimetolabeltherest(3lab‐supplied1.5‐mLMCT,
1Qiagenspintube,and3Qiagencollectiontubes)duringthe1‐hourincubation.Besureyouhave
addedpositiveandnegativeextractioncontrolstoeacheDNAextractionprocedurebatch.
(2)Add370µLATLtothetopofeachbaskettube.
(3)Add30µLproteinaseKtototheATL.
(4)RemovesterileswabsfrompackandplaceoneswabintoeachtubeofATL/proteinaseKmix.
(5)Movedriedsamplesincentrifugetubestotheextractionroom.Usethemoistenedswabtoswabthe
bottomofeachtubeincludedinthefieldsample(e.g.ifthereare5tubespersample,swabthe
bottomofall5tubeswiththemoistenedswab).Iftheswabbecomescoveredwithdebris,rinse
swabinATLsolutionforthatsampleintheextractiontubeandproceedswabbingtherestofthe
replicates.BEcarefultoavoidcross‐contaminationatthisstep.
(6)PlacetheswabbackintotheATLmixture,breakthewoodenstickandclosethetube.
(7)Incubateat55°Cfor1hour.Labeltherestofthetubesandprintfinalarchivelabelsforfiltersand
extracts.
(8)Removefromincubatorandcentrifugeat≥18,000xgfor1minute.Removetheassemblyandkeep
theswabonlyuntilthecaseisclosed.Archivetubewithswabat‐80°C,untilthecaseisclosed,
thendispose.
(9)Add400µLBufferAL.
(10)Add400µLethanol(96–100%,moleculargrade).Mixthoroughlybyvortexing.Ifliquidcollects
aroundthecap,spinbrieflybeforeopeningtoreducecontaminationrisk.
(11)TransferabouthalfofthemixturebypipetintoaDNeasyMinispincolumnplacedina2mL
collectiontube.Centrifugeat≥6000xgfor1minute.Discardflow‐throughandcollectiontube.
(12)Transfertheremainingmixturebypipetontothesamespincolumnandplaceinanew2mL
collectiontube.Centrifugeagainat≥6000xgfor1minute.Discardflow‐throughandcollection
tube.
(13)Placespincolumninanew2mLcollectiontube.Add500µLBufferAW1.Centrifugeat6000xg
for1minute.Discardflow‐throughandcollectiontube.(14)Placespincolumninanew2mL
collectiontube.
(14)Add500µLBufferAW2.Centrifugeat18,000xgfor3minutes.Discardflow‐throughand
collectiontube.
(15)Transferthespincolumntoanew1.5mLor2mLMCT.
(16)Add200µLBufferAEtothecenterofthespincolumnmembrane.Incubatefor1minuteatroom
temperature(15‐25°C).Centrifugeat≥6000xgfor1minute.(17)Discardthespincolumnand
storetheelutedDNAsamplesat−20°C.IfDNAistobeimmediatelyusedforPCR,keeponice.
(Filtersmaybediscarded).
Amberg,J.J.,S.G.McCalla,E.Monroe,R.Lance,K.Baerwaldt,andM.P.Gaikowski.2015.ImprovingEfficiencyandReliability
ofEnvironmentalDNAAnalysisforSilverCarp.Accepted.JournalofGreatLakesResearch.doi:10.1016/j.jglr.2015.02.009.
5‐9
5.5.6IBIScientificgMAXKitProcedureforcentrifugedsamples
(1)ObtainoneQiagenlyseandspinkitpersampletobeextracted,openpackagesandorganizetubes
inrack.Labelbothcapsofeachsample.Youwillhavetimetolabeltherest(1lab‐supplied1.5‐mL
MCT,1GDspincolumn,and3IBIcollectiontubes)duringthe30minuteincubation.Besureyou
haveaddedpositiveandnegativeextractioncontrolstoeacheDNAextractionprocedurebatch.
(2)Add350µLGSBtoeachlyseandspinbaskettube.IfprecipitatehasformedinGSBbuffer,dissolve
byincubatingat60⁰Cfor10minutes.
(3)Add35µLproteinaseKtotheGSB.
(4)Movedriedsamplesin50mlcentrifugetubestotheextractionroom.Makesureeachtubeisdry.
(5)Removeasterileswabfrompack,anddipitintoanumberedtubeofGSB/proteinaseKmix.Usethe
moistenedswabtoswabthebottomofeachtubeincludedinthefieldsample(e.g.thereis5tubes
persample,swabthebottomofall5tubeswiththemoistenedswab).Iftheswabbecomes
coveredwithdebris,rinseswabintubeofGSB/proteinaseKsolutionforthatsample,andproceed
swabbingtherestofthereplicates.Becarefultoavoidcross‐contaminationatthisstep.
(6)PlacetheswabbackintotheGSBmixture,breakthewoodenstickasclosetotheswabaspossible,
andclosethetube.Changeglovesbetweensamples.
(7)Incubateat60°Cfor30minutes.Labeltherestofthetubes,placeGDspincolumnsinyourtube
rack(sameamountasyoursamplesize),andprintfinalarchivelabelsforswabsandextracts.
AlsoduringthistimeplacetheElutionBufferintothe60°Cbeadbath.
(8)Removelyseandspintubefromincubatorandcentrifugeat≥16,000xgfor1minute.Removethe
assemblyandkeeptheswabonlyuntilthecaseisclosed.Archivetubewithswabat‐80°C,until
thecaseisclosed,thendispose.
(9)Add500µLethanol(96–100%,moleculargrade)totheflowthroughofthelyseandspintube.Mix
thoroughlybyvortexing.Ifliquidcollectsaroundthecap,spinbrieflybeforeopeningtoreduce
contaminationrisk.
(10)TransferabouthalfofthemixturebypipetintoaGDspincolumnplacedina2mLcollectiontube.
Centrifugeat≥6000xgfor1minute.Discardflow‐throughandcollectiontube.
(11)Transfertheremainingmixturebypipetontothesamespincolumnandplaceinanew2mL
collectiontube.Centrifugeagainat≥6000xgfor1minute.Discardflow‐throughandcollection
tube.
(12)PlaceGDspincolumninanew2mlcollectiontube.Add400µLBufferW1.Centrifugeat6000xg
for30seconds.Discardflow‐throughandcollectiontube.(13)Placespincolumninanew2mL
collectiontube.Add600µLWashBuffer.Centrifugeat18,000xgfor3minutes.Discardflow‐
throughandcollectiontube.
(14)Transferthespincolumntoanew1.5mLMCT.
(15)Add200µLofthepr‐heatedElutionbuffertothecenterofthespincolumnmembrane.Incubate
for1minuteatroomtemperature(15‐25°C).Centrifugeat≥18000xgfor30seconds.
(16)DiscardthespincolumnandstoretheelutedDNAsamplesat−20°C.IfDNAistobeimmediately
usedforPCR,keepin4⁰refridgerator.(Swabsmaybediscarded)
5‐10
5.6
PCRAmplificationofeDNASamples
5.6.1 Purpose
InordertodetermineiftheDNAofaspecificspeciesispresentintheconcentratedwatersamplestaken
inthefield,thetotalDNAextractedfromthefilteredsamplesmustbeamplifiedusingspecies‐specific
primers.Newin2014,real‐timePCRmarkerswillbeusedfordetectingpresumptivepositivesamplesas
wellasconfirmingSilverorBigheadcarpDNA.AllsampleswillbefirstassayedwithtwogeneralAsian
carpmarkersthatdetecttwolociwithinthecytochromeoxidaseIgeneofbothSilverandBigheadcarp
mitochondria(ACTM1andACTM3).AnysamplethathasatleastonereplicatePCRpositiveforbothloci
willbeconsideredpresumptivepositive.
5.6.2 Source
eDNAsampleshavebeenreceivedbyWGLeDNATeamandDNAhasbeenextracted.DNAelutesfrom
samplesshouldeitherbelocatedindesignated−20°CfreezerorcarriedfromtheDNAextractionroomto
PCRroom.BesuretheroomisirradiatedwithUVlightfor30minutespriortouse.Ensure
thermalcyclersareavailablebeforemixingthemastermix.MastermixwithorwithouttemplateDNA
cannotsitlongerthanittakestopreparethesamplesforcycling.
5.6.3 PCRQualityAssuranceandChain‐of‐custody
ThisstageofDNAprocessingisparticularlysusceptibletocontaminationand,subsequently,inaccurate
results.CarefullyfollowqualitycontrolandCOCstepslistedbelow:
(1) PCR‐typehoodbenchshouldbewipedbeforeandafterusewith10%bleach.Validated
commerciallyavailablesterilizationreagentsuchasLookOut®DNAErase®maybepreferred.PCR
roomshouldbesterilizedusingabuilt‐inUVlightsifavailable.
(2) Afteranitemorsurfaceiscleanedwithbleach,itmustberinsedwithpurifiedwateroralcoholto
preventthebuild‐upofsodiumhypochloritecrystals.Instrumentsorequipmentcleanedwith
bleachshouldberinsedtoavoidcorrosion.
(3) Centrifuges,thermalcycler,tuberacks,pipettes,andanyotherequipmentusedforPCR
amplificationshouldbecleanedbeforeandaftereachuse.
(4) Useautoclaved,filtered,orcommerciallysterilemoleculargradewaterpriortouseforsettingup
PCRreactions.
(5) Aerosol‐resistantpipettetipsshouldbeused.Placethesteriletiponthepipetteimmediatelyprior
touse.Ifthepipetteissetdownwiththetipon,discardthetip.Anewpipettetipmustbeusedfor
theadditionofeachreagenttoasampletube.
(6) UseautoclavedsampletubesforPCRmastermix.
(7) Closeeachtubeimmediatelyafterlabelingandaftertheadditionofsampleorreagentstoprevent
cross‐contamination.
(8) BesuretoonlytouchthetipoftheMCTcaporuseatubeopener,cleanKimwipe®,orothersuitable
barriertoopenMCT.
(9) Recordallsolutionbatchnumbersusedforreactionsinlabnotes.
5‐11
(10) PCRreagentsshouldbealiquoted(aportionoftheoriginalstock)toavoidexcessivefreeze‐thawing
andtoprotectstockreagentsifcontaminationoccurs.
(11) Lightlyvortex(quicktouch,becausevigorousvortexingcandamageTaq)tomixsampleandquick‐
spin/centrifugetubesbeforeopeningthereagentstoavoidsplashesordripsfromcapwhen
opening.Uncapandclosetubescarefullytopreventaerosolcontamination.
(12) AnyrevisionstotheDNAamplificationprotocolmustbeapprovedbytheeDNAProjectLeaderand
documentedinwriting.
Cautions:Wearpowder‐freelatexornitrileglovesthroughouttheDNAamplificationandgel
electrophoresisprocedures.Ethidiumbromide,usedinDNAgelelectrophoresistovisualizeDNA,isa
knownmutagenthataffectsbiologicalprocesses.
Noteforexhibit13:PlatemapshavebeenincludedforscenariosmostprocessedatWGL.384‐wellplate
sheetswithinhibitorPCRcomponentsareincludedforinitialscreeningofeachcase,but96‐wellplate
sheetsarealsoincludedforprocessinganyequipmentcontrolsforconfirmedpositivesamples.Likewise,
96‐wellsheetsareincludedforconfirmationassaysusingsilverandbigheadPCRcomponents,butif
needed,384‐wellsheetsmaybeusedinstead.
5.6.4 Procedure
(1) IfDNAsamples(extractionelutes)areremovedfromfreezer,noteonfreezer/ambientlog(see
Exhibits7‐9).Alsonoteonsamplelog(Exhibit6).
(2) Usepreprintedplatemap(Exhibits12‐13)orbuildplatemapinLIMStodeterminewhichsamples
willbepipettedintowhichwells.Clearlymarkplateidentificationonbottomedgeskirtofplate.
Writeplateidentificationinformation(ddMONyy_initials_ASSAY_case(sample#‐sample#)_Plate#)in
labnotes.
(3) MakesuresamplemapforeachplateisenteredintotheLIMSorattachedtolabnotesanda
signatureiswrittenacrossthemapandlabbookpage.
(4) FollowDNAamplificationprotocoldetailedbelow.
(5) Primersfortwoloci(ACTM1andACTM3)withinthecytochromeoxidaseIgeneofthe
mitochondrialgenomewilldetecteitherHypophthalmichthysmolitrix(SilverCarp)orH.nobilis
(BigheadCarp),orbothtoscreeneDNAsamplesanddetectDNApresentintheeDNAsamplesby
PCR.ThePCRprogramsusedtoamplifytheextractedDNAarethesameforallthreepairsofduplex
real‐timemarkers.ThePCRprotocolhasbeenoptimizedtoutilizeTaqManEnvironmentalMaster
Mix2.0(LifeTechnologies,Carlsbad,CA)intheeDNAscreening.Ifotherbrandsofreal‐timePCR
mastermixesareused,optimizationoftherecipeandthermalprofilesmustbeexecuted.Eight
reactionsaresetupforeachsample,inadditiontonegative(DNAblank)andpositive(DNA
extractedfromcelllinesortissue)controlsforeachmastermix.ThePCRreactionsarepreparedas
follows:
(6) Wipelabbenchareawith10%bleach,75%Ethanol,orcommercialDNAsterilizationwipes.Also
wipedownworkareainPCRhood.Usebuilt‐inUVlampstoradiatecleanroomfor30minpriorto
PCRset‐up.
(7) ElectronicpipettorsshouldbewipeddownwithoneofthesolutionsorwipeslistedinStep1.
(8) Inthecleanreagentroom,obtainallPCRmastermixreagents(usingonlythosethathavenot
expiredandthathavebeentestedandfoundviable).
a. TaqManEnvironmentalMasterMix2.0
b. Onetubewithtwoforwardandtworeverseprimersat10μMworkingdilution.
c. OnetubewithaFAM‐labeledprobeforACTM1andoneHEX‐labeled(oranother
appropriatefluorophoreforyourinstrument)probeforACTM3dilutedto2.5µM.(we
5‐12
preferdouble‐quenchedprobesthatincludeaZENquencherlocatedabout9basepairs
fromtheflourophoreaswellasanIowaBlackholeQuencheronthe3’endoftheprobe,
butregularTAMRA‐quenchedprobesmayalsobeused).
d. Sterilemoleculargradewater(commerciallysterileorMilliporefiltered,autoclaved)
(9) Allowreagentstothaw.DonotvortexprimersorTaqtooviolently.Brieflyspindowntubesto
minimizeaersolization.
(10)Recordinlabnotebookthelotnumberofallreagentsused.
(11)PreparePCRmastermixesincleanreagentroom.Themastermixvolumecanbeadjustedaccording
tothenumberofsamplestobeprocessed.Inordertomakesurethatmastermixdoesnotrunout
priortosupplyingallthedesiredreactions(thismayoccurasaresultofminorerrorsorvariations
inpipettingvolumes),itisgenerallyhelpfultomakemorethanenoughmastermixthanisneeded
forthedesirednumberofreactions.Forexample,makeenoughmastermixfor100reactionswhen
actuallypreparingfor96reactions.NOTE:Ifpositiveextractioncontrolsconsistofadifferent
speciesofDNA,besuretomakeasmallseparatemastermixforthosesamplesanduseprimers
specifictothecontentofthecontrolsample.Negativeextractioncontrolsshouldbeamplifiedwith
theAsiancarpmastermix.
EachInitialPCR1Xreactionshouldcontain:
10.0μLTaqManEnvironmentalMasterMix2.0
1.0μLprimermix(10µMeach,workingdilution)
1.0μLprobemix(2.5µMeach,workingdilution)
5.0μLsterilewater(*7.0μLinstandardcurvemix)
3.0μLsampleextractastemplate(*1.0μLgblocktemplateinstandards)
NOTE:TheTaqManEnvironmentalMasterMixisveryviscous,andrequirescarefulpipettingto
ensureaccuracy.Themaximumsizepipetallowedisthe1000‐μlpipet,andanewtipshouldbeused
foreachaliquotremoved.Thetipmustbeleftinthemixforafewsecondsafteraspirationtoensure
completeaspirationofthedesiredvolume,andupondispensing,apauseisrequiredtoallowthemix
topoolinthetipbeforethefinalplungetodispensethelastdropofmix.Ifthismixispipettedtoo
quickly,therewillbetoolittlevolumetofilltherequiredwells.
(12) Mixmastermixwellbyslowlyinvertingthetube17times.Avoidshakingorinvertingtooquickly
topreventcreatingbubbles.MovepreparedmixfromreagentroomintoPCRroom.
(13) RemoveDNAextractsfromfreezerorfridge(filloutlogsasneeded),vortex(quicktouch)and
quick‐spindowntheextracttubes.TakethemintothePCRroom.Placethe96‐wellPCRplateonto
acleansurface,positionedfromlefttoright.
(14) NOTE:WGLnowhasautomatedliquidhandlingrobotsthatwillfillplatesforcycling.Iftheseare
unavailable,detaileddirectionsforloadingplatesfollows.Fillallplatewellswith17µlPCRmix.To
avoidcreatingbubbles,whichinterfereswithdatacollection,placethepipettetipgentlyinthevery
bottomofthewells.Fillwellsfromthebottomup.Donotdispenseairintothemix.
(15) Carefullypipette3µLofeachextract(or1μLgblockinstandards)tobescreenedontothesideof
eachwellofacolumn,changingthepipettetipbetweeneachsample.Again,placementofthetipis
importanttoavoidcreatingbubbles,sosetthetipagainstthesideofthewell,abovethelevelof
mastermix,andthendepositthealiquotoftemplate.
(16) Eachcolumnofeightwellsshouldbefilledwiththesamesample(i.e.,eightreplicatespersample
tobetested).Thefirst10columnsofthePCRplatecantest10differentsamples.Usethe11th12th
columnsforPCRnegativeandpositivecontrolsandstandardcurvedilutions.Pipette3µLofwater
intowellsGandHtoserveasPCRnegativesamples.Five‐point,five‐foldstandardcurveswith10,
50,250,1250,and6250copies/μLwillbeused.ThehigheststandardshouldbeplacedinwellB
5‐13
(17)
(18)
followedbythenextloweststandardsthroughwellE.PlaceamixedsampleofbothSilverand
BigheadcarpcellextractintowellAtoserveasPCRpositivesamples.
Extractionnegativeswillberunastheywereextractedwithinthesamplebatch.
Extractionpositiveswillberemovedandrunonseparateplateswithabluegillmarkerassay
(Takaharaetal.2013).Extractionpositivesshouldberunwithinthesamedayasthe
correspondingsamplebatch.
3TakaharaT.,T.Minamoto,andH.Yamanaka,H.Doi,andZ.Kawabata.2012.Estimationoffishbiomassusing
environmentalDNA.PLoSONE7:e35868.
a. EachBluegillPCR1Xreactionshouldcontain:
13.4μLTaqManEnvironmentalMasterMix2.0
1.8μLforwardprimer(10µMeach,workingdilution)
1.8μLreverseprimer(10µMeach,workingdilution)
1.0μLprobe(2.5µM,workingdilution)
2.0µlofextractionpositiveextractastemplate.
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
Anewtipshouldbeusedforeachtemplateorstandarddeliveredineachwell.Carefullyobserve
thevolumeofliquidinthepipettetipisaccurate.Alltemplatesorstandardmaterialisdeliveredon
thesideofthewell,asdescribedin(15).
BeforethePCRplateissealed,checkeverywellforbubbles.Bubblesdisrupttheaccuracyofthe
cameradetectingfluoruophoresandneedtoberemovedbeforetheplateissealedandputintothe
machine.Toremovebubbles,removethestrawfromanisopropanolbottleandusethefumesfrom
thealcoholtobreakthesurfacetensionofthebubble.Ifabubbleistrappedinthebottomofthe
well,sealtheplateandspinforanextendedperiodoftime.Usecaretoavoidtouchingtiptoany
surfaceoftheplateorwells.
PlacePCRfilmoverthePCRplateanduseanautomaticplatesealertoensuretheedgesofallwells
aresealed.SpindowntheplateintheplatespinnertoensureallDNAisdowninthemastermix.
WGLhasaBioRadbrandplatesealer.Usethesealguardtokeepthesealfromshifting.Turnon
thesealerandensureitisuptotemp.Seal96wellplatesat180⁰Cfor3secondsand384well
platesat167⁰Cfor3seconds.Inspectthesealtoensureitisnotloose,andallwellsaresealed.If
necessarytoobtainreliableseals,temperatureandtimemaybeadjusted.
Ifyoudonothaveaplatesealer,useaplaterollerorpaddletoensureagoodseal.Itisimperative
tohaveagoodsealtopreventevaporationwhichwillpreventdatacollection,andpotentially
contaminatethelabwithamplifiedDNA.
PlacethePCRplateinthethermalcycler,closeandsecurelid,andselecttheappropriatePCR
thermalprogram.ThethermalprogramsfortheACTM1&3duplexreactionis:
Initialdenaturationat95°Cfor10min
Followedby40cyclesof:
95°Cfor15sec
60°C1min
RecordtheplateID,thermalcyclerunitorhead,plateorientation,andruntimesforthePCRplate
inthePCRlog(Exhibit10).
PlacecycledPCRplatesandproductintrashcanwithoutopeningtheseal.Removeplates
promptly.
UndernocircumstancesshouldyouopenoruncoverPCRplatesthathavebeencycledinthePCR
room.
5‐14
5.6.5Standardcurvematerial,preparationandstorage
TheuseofstandardcurvesinquantitativePCRapplicationsallowsforcalculationoftheinitialstarting
copynumberoftargetDNAinthealiquotoftemplateusedineachreaction.Standardcurvematerials
willbesyntheticstrandsofDNApurchasedfromareliableproductioncompany.WGLwillpurchase
G‐blockproductfromIntegratedDNATechnologies,butothersuitablevendorsareallowed.Toget
reproducibleandhighqualitystandardcurvedata,itisimportanttostorematerialsproperly,andmake
serialdilutionsfresheachweek.Storinglongerproducesinaccurateresults.
(1) gblockstandardcurves
a. gblockispurchasedsothatitcontainsall6qPCRmarkertargets.
(2) gblockishydratedwithTEbuffertomakeainitialdilutionthatis1.00E+10copiespermicroliter.
(anexcelstockdilutioncalculatorspreadsheetisontheshareddriveatWGL).
a. VolumeTEtoadd=fmoles*0.0000000000000001*6.022E+23/1.00E+10
i. Mixwell.Donotfreezethisstock.
(3) Useinitialstocktomake10Xfreezerstockinseveralaliquots.Usescrew‐captubeswitho‐ringsto
preventevaporationinthefreezer.
a. Add1.0µllofinitialstockto31.0µl100ng/µlyeasttRNAinwater.This10Xstockhas
312,500copies/µl.
(4) Serialdilutionsforuseinassaysshouldbemadefreshweeklywiththe10Xstockand100ng/µl
tRNAasadiluent.Theymaybestoredfrozenandthawedasneededthroughouttheweek.
a. Anewpipettipisrequiredforeachdilutionforaccurateresults.
b. Aftereachaddition,usethepipettetomixaminimumof17times.
c. Currently,a5XcurveisusedatWGL.
i. 30µlworkingstockinto270µltRNA.Mix17times=31,250copies
ii. 60µlof31,250mixinto240µltRNA,mix17times=6250copies.
iii. 60µlof6250mixinto240µltRNA,mix17times=1250copies
iv. 60µlof1250mixinto240µltRNA,mix17times=250copies
v. 60µlof250mixinto240µltRNA,mix17times=50copies
vi. 60µlof31,250mixinto240µltRNA,mix17times=10copies
5.6.6InternalPositiveControl(forindicatinginhibition)
TheuseofinternalpositivecontrolsinqPCRisthemostcommonlyusedmethodtodetectinhibitionin
laboratoriesspanningfromclinicaldiagnosticsettings,forensicsettingstoenvironmentalresearch.WGL
willuseanovelmousegene,HemT,whichencodesforahematopoieticcell‐specifictranscript.Known
numbersoftheHemTwillbespikedintoeachwelloftheplatecontainingfieldsamples,whichwillthen
bequantifiedusingstandardcurvesforthattarget.Iffewercopiesofthespikearemeasuredinasample,
inhibitionisassumed,andtheextractwillbecleanedupwithaPCRclean‐upkit(OneStepInhibitor
RemovalkitbyZymoResearch,Irvine,CA),andre‐amplified.Sampleswillthencontinuethroughthe
eDNAworkflow.Thismethodwillnotdeterminewhatparticularinhibitormaybepresent,andwillonly
testforinhibitionduetoblockageoftaqactivity.
(1) AtWGL,allprimers,probes,andthetargetultramerwillbepurchasedfromIntegratedDNA
Technologies,butotherprovidersmaybeused.
a. HemTForwardPrimer=5’TCTGAGTGTCCCTCGAATCT3’
b. HemTReversePrimer=5’GCAGTCCTTGAGAACATAGAGC3’
c. HemTProbe=5’Cy5/ZENTGACAGTCTCCTTTCGTGTGAACATTCG3’IBQ
5‐15
d. HemTUltramer=5’CTACATAAGTAACACCTTCTCATGTCCAAAGCTCTCTGAGTGTCC
CTCGAATCTCAGACGCTGTATGACAGTCTCCTTTCGTGTGAACATTCGGCTGCTCTA
TGTTCTCAAGGACTGCAC3’
(2) HemTprimersshouldbehydrated,dilutedto5.0µM,andstoredinsmallaliquotsinthereagent
roomfreezer.
(3) TheHemTprobeshouldbedilutedto2.5µMandstoredinsmallaliquotsinthereagentroom
freezer.
(4) HemTstandardcurveswillberunoneachplate,withtheACTM1and3markers,butthiswillbea
10Xcurve.Thetablebelowindicatesstandardcurvedilutionstobeused.SeeExhibt13,page1
forthePCRdatasheet.
(5)
(6)
(7)
(8)
Standarddilutioncopy
Standarddilutioncopynumberof
numberofHemTIPC
ACTM1andACTM3gBlock
5
10 6250
4
10 1250
250
103
102
50
1
10
10 ThePCRcocktailrecipefortheACTM1and3assayhasbeenadjustedtoaccountforthespike.All
unknownfieldsamplesandthePCRnegativeandPCRnotemplatecontrolsampleswillbemade
frommastermixesincluding100copiesofHemTperreaction.Therecipeperreactionfollows:
a.
TaqManEnvironmentalMasterMix2.0=10.0µL
b.
HemTPrimerMix(5.0µM)=1.0µL
c.
HemTProbe(2.5µM)=0.75µL
d.
ACTM1/3PrimerMix(10µM)=1.0µL
e.
ACTM1/3Probe(2.5µM)=1.0µL
f.
IPCspiketemplate(102)=1.0µL
g.
ddH2O=2.25µL
3.0µLoftemplateisaddedtoeachreaction.
ThePCRcocktailrecipeforthestandardcurvesamplesdiffersbecsauseitdoesnotincludetheIPC
spikedsample.Only1.0µLofeachG‐blockstandarddilutionisusedinthesereactions.
a.
TaqManEnvironmentalMasterMix2.0=10.0µL
b.
HemTPrimerMix(5.0µM)=1.0µL
c.
HemTProbe(2.5µM)=0.75µL
d.
ACTM1/3PrimerMix(10µM)=1.0µL
e.
ACTM1/3Probe(2.5µM)=1.0µL
f.
ddH2O=4.25µL
Analysisofresults
a. ThestandardcurveoftheIPCmustmeetefficiencyof80‐100%andR2>0.95.
b. ThedifferencebetweentheminimumandmaximumCqvaluesofthePCRnegatives,PCR
notemplatecontrols,andthe102standarddilutionswillbeusedtodefinetheexpectedCq
fortheIPCinthesamples.
c. InhibitionwillbedefinedasanyfieldsamplewithaCqfortheIPCthatisgreaterthanthe
referenceCqaveragebymorethantherangeofCqsusedinthereferencecalculation,orat
least1cycleiftherangeislessthanone.
d. Theentireremainingextractofsamplesdeterminedtobeinhibitedwillbecleanedupwith
thePCRinhibitorcleanupkitaccordingtothemanufacturersdirectionsandre‐assayed
withtheACTM1and3markers.
5‐16
5.7
e. Uninhibitedresultswillenterthenormalworkflow,negativeresultsreported,and
presumptivepositiveresultsscreenedwiththeconfirmationassays.
Presumptivepositivedetermination,confirmationpositivedeterminationanddata
management
5.7.1 Purpose
Oncereal‐timedatahasbeencollected,theresultsmustbedocumented,interpreted(i.e.,scored),and
archived.
5.7.2 Source
Followingcycling,datafilescanbeexportedfromthecyclers,analyzedwithR‐statisticalpackagecode,
andresultsconfirmedbyvisualexaminationofthetracedata.Followingdataprocessing,samples
determinedaspresumptivepositivemustbeassayedwithtwoadditionalreactions,oneeachforSilver
andBigheadconfirmation.
5.7.3 PresumptiveCallDocumentationandStorageAssurance
(1) Assayqualitymustbeassessedbeforedataisaccepted.Datamustbeexportedasa*.txtfileand
savedintoafoldernamedwiththecasenumber.Filenamesmustbecarefullyenteredwithoutany
mistakesinspacingorcoding.Filenameswillfollowthisformat:
ddMONyy_initials_ASSAY_case#(sample#‐sample#)_Plate#_cyclerSN.Thereshouldnotbeany
spaces.Samplerangeshouldbeintegersseparatedwithadash.Platenumbersaredesignatedas
P1,P2,P3……andnoplatenumbersshouldberepeatedwithinananalysisday.Therfore,ifthereare
3roundsofPCR,platenumbersshouldgofrom1to24.Datesmustbeasdepictedwithatwo‐digit
day,threeletterCAPmonth,andtwodigityear.Initialsarenotcasesensitive,butassayMUSTBE
CAPS.
(2) Oncetextfilesareinthefolder,theprogramRshouldbeusedanalyzethedata.Outputwillinclude
thefollowing:
a. Summarystatistics(StandardCurves.csv)onassayqualityincludingtheefficiency(E)andR2of
theduplicatestandardcurvesoneachplate.Minimumrequirementsforacceptingthedataare
E=80‐120%andR2≥0.95.Ifnecessary,errantstandardcurvepointsmaybedroppedto
recovercurvestatisitcs,buttheremustbeatleastone3‐pointcurveremaining.Thisis
acceptable,sincethestandardcurvesareforassessingassayperformanceonly,andnotfor
quantificationofstartingcopynumber.Ifthestandardcurvesfail,theplatemustbere‐
amplified.
b. Summarydataforthetotalnumberofnegativecontrolsthatwerecleanandthetotalnumber
ofpositivecontrolsthatwerepositive,sortedintoextractionvsPCRcontrols(AnalysisLog.txt).
Ifthereareanyissues,thesamplesandcontrolsmustbere‐processedatthestepoffailure.
Forexample,ifanextractionpositivefailstoamplify,allofthesamplesandcontrolsmustbe
re‐extractedalongwithtwonewextractioncontrolsandthenre‐amplified.IfPCRcontrolsfail,
theplatemustbere‐amplified.Iftheproblemisresolvedwiththere‐do,there‐rundata
shouldbeused.Iftheproblemstillpersists,thenthedatashouldberejectedandnotreported.
Documentfailedanalysesonthedatasheetsandinthecaselogfile.
5‐17
i. Rerundatashouldbeexportedasatxtfilewiththesamenamingconvention,butsaved
withinafoldernestedwithinthefolderwithcaseresults.Thefolderwithre‐rundat
mustbenamed“reruns”,alllowercaseoneword.
c. Alistofsamplesthathadcyclethresholdslessthanorequalto15cyclesthatwerechangedto
negative.
d. Alistofpresumptivepositivesamples(Presumptives.csv).
e. Atableofdataincludingthenumberofoctetspositivepersampleandtheaverageand
standarddeviationcopynumberforpositivesamples(DataSummary1.csv).
(3) EnterthequalitycontrolsummarydataintothedatabaseinanExcelfileandonthedatasheetin
thelaboratorynotebook,orinLIMS.
a. NotifytheeDNAProcessingLeaderimmediatelyofanycaseswithpresumptivepositive
results.
(4) AllreportswillreviewedbytheeDNAProcessingLeaderbeforebeingreported.
(5) Apapercopyofthereportshouldbeheldinthefilesfor5years.
(6) Electroniccopiesofallreportsshouldbeheldfor5yearsorlonger,asspacepermits.
(7) AnysubstantiverevisionstotheDNAamplificationprotocolmustbeapprovedbytheeDNA
ProcessingLeaderandapprovedbytheeDNACoordinator.Anysuchchangesmustbeincorporated
intoarevisedQAPP.
5.7.4 ConfirmationofPresumptivePositiveSamples
(1) Repeatsection5.6.4foronlythepresumptivepositivesampleswiththeSCTMmarkersandwiththe
BHTMmarkers.Recipesforthemastermixarethesame,exceptsubstitutetheappropriateprimers
andprobes.ThePCRprogramisthesameaswell.BesuretousesilvercarppositivesfortheSCTM
markerandbigheadpositivesfortheBHTMmarkerassay.
(2) Repeatsection5.7.3.toassessassayqualitybeforeacceptingdata.
(3) Allequipmentcontrolsforconfirmedpositivesamplesmustbeextractedwiththesamemethodas
thesamples,andassayedwithACTM1and3,andasinsection5.6.4.Ifanyequipmentcontrolstest
positive,theresultforthatsamplewillnotbeincluded.
(4) Finalconfirmedresultsareintheoutputfile:DataSummary2.csv.Thisfileisformattedsothatif
sortedbysampleID,theresultsmaybecopiedandpastedintothecaselogfile.Besuretoproof
alignmentofthepastebycheckingsampleIDnumbersrandomlythefulllengthofthecase.
(5) NotifytheeDNAProcessingLeaderimmediatelyofanycaseswithconfirmedpositiveresults.
(6) Ensurethatallrawdata,outputfilesfromthethermocyclersanddataanalysisareinthecasefolder
ontheLIMScomputer.
5‐18
5.8
CommunicationofeDNAAssayResultsandfielddatafromWGLtoUSFWSMidwestRegion
Leadership
5.8.1 Purpose
ToconveytoSerivedesignatedpersonneltheprogressandresultsofeDNAassays.
5.8.2 Source
WGLkeepsarecordofeachsamplesprogressthroughtheeDNAassayprocedure.Theserecordsare
summarizedforeachbatchforreportingtotheeDNACoordinatorinUSFWSMidwestRegion.
Eachfieldsamplingagencykeepsarecordoffielddata.Theserecordsaresummarizedandreportedto
theeDNACoordinatorinUSFWSMidwestRegionviatheeDNAdatabase.
TheeDNACoordinatorinUSFWSMidwestRegioncollatesfieldandlabdataforreportingresultsto
partnersandthepublic.
5.8.3 QualityControl
TheWGLeDNAProcessingLeaderwillprovideupdatesandreportstotheUSFWSMidwestRegioneDNA
Coordinator.Atthistime,EmyMonroeistheWGLeDNAProcessingLeaderandKellyBaerwaldtisthe
USFWSMidwestRegioneDNACoordinator.Anypermanentortemporarychangestoeitherposition
shouldbecommunicatedimmediatelytotheassignedUSFWSseniorexecutive.Anypermanentchanges
shouldbeincorporatedintoarevisedQAPP.
AnyrevisionstothereportingproceduresmustbeapprovedbytheeDNAProcessingLeaderand
approvedbytheassignedUSFWSseniorexecutive.Anysuchchangesshouldbeincorporatedintoa
revisedQAPP.
5.8.4 GeneralProcedure(fordetailsseeAppendixEforSOP)
TheUSFWSeDNAProcessingLeadershould,oneveryFridayduringtheperiodoverwhichtheWGL
eDNATeamisprocessingsamples,provideupdatesonallsamplebatchestotheUSFWSeDNA
Coordinator.Reportsshouldbeorganizedbycaseandshouldconsistofspreadsheetsshowingthestage
ofprocessingforeachsample.Additionally,followingapprovalbytheeDNAProcessingLeader,theWGL
PRRshouldconveyfinalresultsforeachcase(allsamplesconfirmedaspositiveornegativeforACeDNA)
within24hoursofcompletionofprocessingforthelastsamplewithinacase.
TheUSFWSeDNACoordinatormayrequestupdatesfromtheeDNAprocessingleaderatanypoint.The
WGLeDNAProcessingLeaderisexpectedtorespondassoonaspossibleduringnormalworkinghours.
5‐19
SECTION6
6.
INTERNALQUALITYCONTROLCHECKS
Detailsonqualitycontrolarefoundwithineachofthevariousprotocolsections.Insummary,however,
qualitycontrolrelativetosamplecontaminationiscoveredbythetransport(orcooler),equipment,DNA
extraction,PCR,andsequencingblanksornegativecontrols.Qualitycontrolforefficacyofmethodology,
solutions,etc.iscoveredbypositivecontrolsforeachsamplehandlingstep(extraction,PCR,and
sequencing)oftheeDNAprotocol.Furthermore,eachnewsolutionorkittobeusedineDNAprocessing
willbetestedwithpositiveandnegativecontrolsbeforeorduringthefirstuse.
TheWGLeDNAprocessingfacilityandprotocolswasreviewedbyanERDCauditshortlyaftercompletion
ofthetransitionplanandfulldeploymentofAsiancarpeDNAdedicatedequipment.
6.1
LaboratoryQualityControlEvaluationCriteria
Qualitycontrolismeasuredintwoways:




Iftransport,filtering,centrifuge,hood,extraction,PCR,andDNAsequencingnegativecontrols
showproduct(e.g.,bandsinPCRorDNAsequence),theassociatedpositivedataarenegatedand,
whenpossible,samplesarereprocessed.ContaminationofDNAextractwillrequirethatany
positivesamplesberemovedfromconsideration.Ifallothersamplesarenegative,contamination
wasonlyanissueinthecontrols,andnegativeresultsmaybereported.
Positivecontrolsarecurrentlyemployedforextraction,PCR,andsequencing.Ifthepositive
controlsfailtobehaveasexpected,anysampleshowinganapparentlackofresultswillbererun
atthesametimeorfollowingrerunningofthepositivecontrols.Thiswillbedoneuntilallpositive
controlsproducetheexpectedresults.
Weincorporatetwotypesofpositivecontrolsduringsequencing.OnepositivecontrolPCR
productsfrompositivecontrolreactionsandonesequencingreactionperplatewithastandard
DNAsequencingtemplate(pGem)providedbythemanufacturer.Iflessthanafullplateare
sequenced,onepGEMperbatchofsequencingmastermixmade,andaminimumofoneperplate
eDNAsamplesthataresequenced.Inthecasethatanyofthesefail,anysamplesthatfailto
producesequencedatathatwererunatthesametimewillbererunatthesametimeaspositive
controlsarererun.
Incaseswherefewerthan16eDNAsamplesaresequenced,bothtypesofpositivesequence
controlsarestillrun.
6‐1
SECTION7
7. SPECIFICROUTINEPROCEDURESTOASSESSDATAPRECISION,ACCURACY,ANDCOMPLETENESS
7.1
FieldMethodsandLaboratoryData
UseofquantitativePCRtechniquesprovidesregularandon‐goingassessmentofaccuracyandprecision
oflaboratoryanalyses.Theintegrityofeachplateanalyzedisconfirmedwhenthestandardcurvespass
minimumrequirementsin5.7.3.2a.Eachstandardcurverepresentsa5‐folddilutionofcarpDNAdown
to10copies.
Thus,thefollowing3monthassaynolongerneedstobeexecutedtodocumentqualityofdataproduced
inthelab.
7‐1
SECTION8
8.
CORRECTIVEACTIONS
Correctiveactionsmayberequiredfortwoclassesofproblems:analytical/equipmentproblemsand
noncomplianceproblems.Analyticalandequipment‐relatedproblemsmaydevelopduringsamplingand
samplehandling,samplepreparation,laboratoryinstrumentalanalysis,anddatareview.Noncompliance
issuesarisewheneDNAsampling,processingorlabprocedureexecutiondeviatesfromprocedures
describedintheQAPP.
Inthecaseofanalytical/equipmentproblemsordeviationsfromsetprocedures(asoutlinedinQAPP),
theresponsibleleadwilldetermineiftheproblemordeviationwillimpacttheaccuracyoftheresulting
data.Ifitisdeterminedthattheproblemordeviationdoesimpactdataaccuracy,twocoursesofaction
maybefollowed:
(1) Ifpossible,theprocedureisrepeateduntilitisperformedwithoutanyproblemordeviation,or
(2) Thesampleorsamplesareremovedandnotprocessedanyfurther.
Ineithercase,acorrectiveactionreportmustbecompleted(Exhibit16).Carefulnotesofanycorrective
actionsandwhatincidentledtothem,aswellastheresolutionorpreventativemeasure(s)identifiedwill
becarefullynotedinthecorrectiveactionreport,whichmustbeprovidedelectronicallytoallLeaders
(ProjectLeader,SamplingLeader,etc)asanafteractionreport.Thepapercopyofthecorrectiveaction
reportwillbemaintainedintheprojectfileasalong‐termrecord.
Inthecasethattheresponsibleleaddeterminesthatdataaccuracyisnotaffectedbythe
analytical/equipmentproblemordeviationfromprocedure,thesampleorsamplesmaycontinuetobe
processed.Theresponsibleleadwillmakecarefulnoteoftheincidentinprojectrecordsandincludethe
rationaleforcontinuingprocessing.
8‐1
SECTION9
9.
9.1
PREVENTATIVEMAINTENANCEPROCEDURES
FieldEquipment/Instruments
Hand‐heldorconsoleinstalledsonar:Batterieswillbechangedatleastonceamonthinhand‐heldunits
(ifnotrequiredsooner)toensureaccuratereadingsoftheinstrument.Inaddition,readingaccuracy
shouldbecheckedpriortosamplingseasonforallunits.Depthreadingsmaybecheckedbyfillinga
containerofaknowndepthwithwaterandsubmergingtheinstrumentation.Temperaturereadingsof
thesonarmaybecheckedagainstathermometer.Theserecordsshouldbekeptininkinabound
notebook,wheretheoriginalsarekeptonsiteinasecurelocationandcopiesaresenttotheeDNA
Coordinatorattheendofeachsamplingseason.
GPSequipment:Batterieswillbechangedatleastonceamonth(ifnotrequiredsooner)toensure
accuratereadingsoftheinstrument.Inaddition,coordinateaccuracywillbecheckedagainstknown
benchmarks.
DIequipmentintheTrailer:Keepaboundhard‐copynotebookinthetrailertorecordthetotaldissolved
solidspresenteachdaythetrailerisused.Itshouldreadzero.
Centrifuges:Annualserviceisagoodideaiftheyareheavilyused.
Iffiltering:
Plastic2Lsamplebottles:Afterbleachingandautoclaving,bottleswillbeinspectedfordentsand/or
warpingofthematerial.Anybottlefailinginspectionwillbedisposedofandreplaced.
Forceps:Forcepswillbeinspectedmonthly,andthoseexhibitinglargeamountsofrustwillbedisposed
ofandreplaced.
Carboys:Carboyswillbeinspectedmonthlyforcracksintheglassthatcouldposeasafetyhazardto
filteringpersonnel.Anycarboyfailinginspectionwillbedisposedofandreplaced.
Plastictubing:Plastictubingusedtoconnectthecarboytothemanifoldwillbeinspectedmonthlyfor
cracksintheplastic.Anyplastictubingfailinginspectionwillbedisposedofandreplaced.
Allotherlaboratoryequipmentwillbeinspectedmonthlyandundergopropermaintenancetomaintain
theiridealworkingcondition.Anyequipmentnotperformingaccuratelyortoestablishedstandardswill
bedisposedofandreplaced.
9.2
LaboratoryInstruments
Pipettes:Annuallyallpipetteswillbeinspected,calibrated,andcertified.Anypipettefailinginspection
andcertificationwillbedisposedofandreplaced.
Anythermal‐cyclerheadthatfailsthemanufacturersself‐testuponinstrumentstartupwillberemoved
andreplacedwiththemanufacturer’scertifiedreplacementpart.
Equipmentmaintenancecontracts,withannualmaintenancecheck‐ups,willbeusedforanyappropriate
equipment(i.e.,DNAsequencer).
9‐1
SECTION10
10. PERFORMANCEANDSYSTEMAUDITS
10.1 FieldAudits
Internalauditsoffieldcrewperformanceandqualitycontrolsforsamplingandfilteringwill
bemadesemi‐annuallybytheFWCOfieldstafftomakesurethatallproceduresinthesample
collectionportionsoftheQAPParebeingfollowed.Onsamplingtripswheremorethantwo
FWCOofficesareontheteam,thevisitingFWCOeDNAleaderwillserveasthesampling
auditor.AbriefreportwillbemadetotheeDNAProgramCoordinatorofauditfindings,
includingasignedchecklistofauditedprocedures(Exhibit16).Iftherearenotripswith
coordinatingoffices,thentherepresentativeontheeTeamforUSFWSMidwestRegionmay
serveastheauditorfortheiroffice.
10.2 LaboratoryAudits
InternalauditsofWGLlaboratoryperformanceandqualitycontrolswillbemadesemi‐
annuallybytheDNAProcessingLeadtomakesurethatallproceduresintheDNAprocessing
portionsoftheQAPParebeingfollowed.AbriefreportwillbemadetotheeDNAProgram
Coordinatorofauditfindings,includingasignedchecklistofauditedprocedures.Participation
invalidationstudiesbythelabmaysufficeasinternalaudits,andreportsofsuchstudiesmay
besubstitutedandfiledwiththeeDNAProgramCoordinator.Every2yearsanexternal
reviewofWGLeDNAprocessingwillbeundertaken.Thereviewpanelorconsultant(s)willbe
selectedbytheProjectLead.TheDNAProcessingLeadmayassisttheProgramCoordinatorin
identifyingoneormorepotentialreviewers.
10‐1
SECTION11
EXHIBITS
11‐1
Exhibit1page1
FieldCollectionSummary
CaseNumber______________________________
SampleDate__________
SamplingLead____________________________________SamplingQA/QC_______________________________________DataRecorder__________________________________
Location_______________________________________________________________________________
PrepList(InitialandDate)
Samples(range)_____________________________________Blanks(CI)_____________________
Centrifugetubes
_____________
BoatRamp(lat,long)__________________________________________________________________
Coolersbleached
_____________
WaterCollectionPersonnel Tubesloaded _____________
BoatOperator _______________________________________________________________________
Blanksloaded _____________
OtherPersonnel
______________________________________________________________
Boatcleaned _____________
Boatcleaned _____________
WaterProcessingPersonnel
FWSLead
_______________________________________________FWSQA/QC____________________________________________________________
OtherPersonnel
____________________________________________
TimeFrame Start___________End______________
TubesIced
ReturntoLab/FilteringTrailer_____________
_______________ Other
Notes:_________________________________________________________________________________________________________________________________________________________________________
________________________________________________________________________________________________________________________________________________________________________________
MapAttached
11‐2
FieldCollectionSupplyList
Exhibit1page2
Coolers
___Labeledcontainers
___Fieldblanks
Clipboard
___pencils/pens
___Datasheets
___GPS
___ExtrabatteriesforGPS
___Maps
Drybag
___Gloves
___Depth/tempdevice
___WetWipes
___Sunblock
Drinkingwater
Others
___bleach
___mop
___bucket
___camera
___Ipass
___Lifejackets
___Filedfloatplan
___sunglasses
11‐3
FieldCollectionDataSheet Exhibit2
CASENUMBER________________________DATE____________________NAME_________________STARTTIME____________Volume:2Lor5x50mlSHEET___of____
SampleID
Wind
Direction
Way‐
point
Latitude
(dec.degrees)
Longitude
(dec.degrees)
Temp
(C/F)
Depth
(m/ft)
Notes/comments:
11‐4
Blank(B)
Habitat
(LDB/MC/RDB
/BAY/TRB)
Collecttime
Processing
time
Processor
Initials
Chain‐of‐custodyForm
USFish&WildlifeService
CHAIN‐OF‐CUSTODYRECORD
Dateandtimeofcollection:
Collectedby(firstandlastnames):
Notes:
CaseNumber:
Allcontrolsamplesmustalsobelistedandaccountedfor.
SampleNumbers
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
SampleNumbers.
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
SampleNumbers
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
From:(Printname,Agency)
Releasesignature:
Release
Date:
To:(Printname,Agency)
Receiptsignature:
Receipt
Date:
SampleNumbers
SampleNumbers
SampleNumbers
11‐5
Deliveredvia:
FedEx
InPerson
Other:
Deliveredvia:
FedEx
InPerson
Other:
Deliveredvia:
FedEx
InPerson
Other:
Deliveredvia:
FedEx
InPerson
Other:
Deliveredvia:
FedEx
InPerson
Other:
Deliveredvia:
FedEx
InPerson
Other:
Exhibit4
USFWSWGLSampleReceiptChecklist
CaseNumber:
Other:
ReceiptDate:
Rec’dby:
Weresamplesshipped?Yes,FEDEX/UPS/Other
No,Courierpickup/handdelivered
Comments:
Coolertempuponarrival________⁰C/NA
Chain‐of‐custody(COC)present?Yes/no
Complete?Yes/no
Custodysealspresentoncooler?Yes/no
Samples?Yes/no
Weresamplecontainersintact?Yes/no
SamplesandCOCmatch?Yes/no
Ifanyproblems,wasprojectmanager
notified?
Yes/no
Bywhom?_______________________
Appropriatesamplecontainers?
Yes/no
Date/timeofcollectiononCOCYes/no
LocationandIDofsamplestorage:
Freezer_______________________
Refrigerator____________________
Temperaturelogupdatedforstorage?
Yes/no
11‐6
Exhibit5
ScreencaptureofExcellogfile.Firstworksheetinworkbookoutlineslogforallsamplingeventsorcaseswhichcorrespondtosamplesfromaparticular
system.SubsequentworksheetsarecreatedforeachcaseandallowforsampletrackingthroughtheeDNAlab.ThiswillbeuseduntilaLaboratory
InformationSystem(LIMS)isadopted.“REF”incellsisduetoformulaealreadyenteredintotheform,whichwillworkoncedataareentered.
11‐7
Exhibit6
ScreencaptureofExcellogfilewiththefirstcasesamplelogopen.Samplesaretrackedbydateandprocessstepthroughthelab.Corresponsingquality
controlresultsbyextractionbatchandPCRbatcharereportedwithsampleresults.Qualitycontrolcolumnscontinuetoright,toincludeallmarkers
testedthroughconfirmation.
11‐8
Exhibit7
Exampleof‐20freezertemperaturelog.
Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Freezer Temperature Log
Month: ______ Year: ______ Freezer ID: __________ Freezer Location: __________ Maintenance Displayed Temp Date Initials (Y/N) Temperature should be between ‐23 and ‐17 °C for recording. 11‐9
Exhibit8
Dailylogforcoldstoragecoolers,usedinprocessingtrailerstokeepsamplescolduntilshipmenttoWGL.
Cooler Temperature Log
Case#s: ____________________________________________ Sample Time Displayed IDs Date (am/pm) Temp Initials 11‐10
Exhibit9
Exampleof‐80freezertemperatureandsamplestoragelog.Allcoldstorageappliancesthatstoresamples
afterreceiptbutbeforeextraction,orstorearchivedextractshaveatemperaturelogandasamplelog.The
temperaturelogisfilledoutdailyandthesamplelogeachtimesamplesareremovedorstored.
Ultra Low Freezer Temperature Log
Month: ______ Year: _____ Freezer ID: __________ Freezer Location: __________ Temp in range Maintenance Day Date Initials (Y/N) (Y/N) 1 2 3 4 5 6 7 8 9 10 ‐80°CSampleLog
FreezerIDandLocation:_____________________
Case#andsample
Line
Samplenumberrange,stateactiontaken(ex:extraction).
numbersCHECKED
DateandInitialCHECKEDOUT.
Number
IN
11‐11
Exhibit10
Exampleofambienttemperature(alcohol‐preservedcentrifugesamplesonly)samplestoragelog.The
samplelogisfilledouteachtimesamplesareremovedorstored.
Bench‐topShelvingLog
Room_____________________
Case#andsample
Line
Samplenumberrange,stateactiontaken(ex:extraction).
numbersCHECKED
Number
DateandInitialCHECKEDOUT.
IN
11‐12
Exhibit11
Thermocyclelog
PCR Log
Month: ______ Year: ______ Machine ID: __________ Machine Location: __________ PCR Plate PCR Machine Orientation Program ID Plate ID Run Finish Time Date/Initials 11‐13
Run Start Time Exhibit12
“copy”watermarkisgreyonoriginal.
Extraction data sheet: to be filled out and taped into Extraction room data book Analyst_________Room#_________ Date________________ Sample batch_______________ Reagents used: note lot ID and expiration date for kit components Reagent/tubes Lot # Expiration date GSB buffer Proteinase K Ethanol W1 buffer Wash buffer Elution buffer (at 60°C) Spin filter Start time__________________ Tube
Tube Sample ID Sample ID ID ID 1 25 2 26 3 27 4 28 5 29 6 30 7 31 8 32 9 33 10 34 11 35 12 36 13 37 14 38 15 39 16 40 17 41 18 42 19 43 20 44 21 45 22 46 23 47 Extraction Negative 24 48 Extraction Positive Write notes for any deviations from QAPP or lab blunders on facing page of notebook.____________________________________________________________________________________
____________________________________________________________________________________________ Finish time:_____________ 11‐14
Exhibit13page1
“copy”watermarkisgreyonoriginal.
384‐wellPlateAsiancarpgeneralqPCRdatasheet
11‐15
Exhibit13page2
“copy”watermarkisgreyonoriginal.
384‐wellPlateAsiancarpgeneralqPCRdatasheet,page2
11‐16
Exhibit13pg3
“copy”watermarkisgreyonoriginal.
96‐wellPlateAsiancarpgeneralqPCRdatasheet,page1
11‐17
Exhibit13pg4
“copy”watermarkisgreyonoriginal.
96‐wellSilvercarpqPCRplateforconfirmationofpresumptivepositivesamples
11‐18
Exhibit13pg5
“copy”watermarkisgreyonoriginal.
96‐wellBigheadcarpqPCRplateforconfirmationofpresumptivepositivesamples
11‐19
Exhibit14pg1
“copy”watermarkisgreyonoriginal.
384‐wellBluegillqPCRplateforpositiveextractioncontrols
11‐20
Exhibit14pg2
“copy”watermarkisgreyonoriginal.
96‐wellBluegillqPCRplateforpositiveextractioncontrols
11‐21
Exhibit15
QualityAssuranceProjectPlanCertificationStatement
I,theundersigned,certifythatIhavereadandthatIunderstandtheQualityAssuranceProjectPlan(QAPP)
fortheeDNAmonitoringofInvasiveAsianCarp.IfurthercertifythatIwillfollowtheprocedureslistedin
thisQAPP.
Signed:
____________________________________________________________________________________________________________________________
Name Agency
Date
11‐22
Exhibit16
QualityControlAuditChecklistforFieldSamplingandWaterProcessing:
ThismustbefilledoutaftereachtripandsenttotheeDNAProgramCoordinatoralongwithyour
posttripreporthighlightinganydifferencesbetweenactualexecutedworkandthepre‐tripfield
plan.
I,______________________________________________________________,observedsamplingprocessingforcase#
SamplingQualityLead
________________________collectedon____________________________________,fromthefollowing
locations:___________________________________________________________________________________________________,bythe
followingpersonnel___________________________________________________________________________________________.
Duringthistime,IcomparedtheactionsofthecrewtotheQAPPandwitnessedadherencetotheQAPPin
thefollowing:AcheckindicatescompliancewiththeQAPP.AnXindicatestheQAPPwasnotfollowedanda
shortexplanationfollows.Ifmorespaceisneeded,attachawrittenreport.
ContaminationPrevention:
Boatandequipmentpreparation________
Samplecollectionandnavigation________
I,______________________________________________________________,observedsamplingprocessingforcase#
ProcessingQualityLead
_______________________collectedon____________________________________,fromthefollowing
locations:____________________________________________________________________________________________________,bythe
followingpersonnel___________________________________________________________________________________________.
Duringthistime,IcomparedtheactionsofthecrewtotheQAPPandwitnessedadherencetotheQAPPin
thefollowing:AcheckindicatescompliancewiththeQAPP.AnXindicatestheQAPPwasnotfollowedanda
shortexplanationfollows.Ifmorespaceisneeded,attachawrittenreport.
ContaminationPrevention:
Sampleprocessingequipment___________
Sampleprocessingprocedures___________
Explanationfordeviation(s)fromtheQAPP:______________________________________________________________
_________________________________________________________________________________________________________________
_________________________________________________________________________________________________________________
__________________________________________________________________________________________________________________
________________________________________________________________________________________________________________
11‐23
AppendixA
RolesandResponsibilities
And
AnnualStaffAssignments
A‐1
AsofSeptember2014,thefollowingstaffareassignedtotheeDNAmonitoringproject.
eDNAProgramCoordinator:KellyBaerwaldt,USFWS,309‐429‐1442
eDNAProcessingLeader:EmyMonroe,WGL,608‐783‐8402
DNAProcessingQualityAssuranceSpecialist:MarenTuttle‐Lau,WGL,608‐783‐8403
DataDocumentation&ReportingSpecialist:NikolasGreuneis,WGL,608‐783‐8404
FishandWildlifeConservationOfficePointsofContact:
LaCrosse:AnnRunstrom,608‐783‐8433
Columbia:PattyHerman,573‐234‐2132x170
Carterville:SamFinney,618‐997‐6869x17
GreenBay:MarkHoley,920‐866‐1760
Ashland:MarkBrouder,715‐682‐6185x11
Alpena:ScottKoproski,989‐356‐3052x1023
A‐2
USFWS Midwest and Northeast Region
eDNA Roles and Responsibilities
September 2014
ROLES
Regional Office
Region 3 Deputy RD/National Asian Carp Lead: Charlie Wooley
Fisheries ARD: Todd Turner
Deputy ARD/FWS National Asian Carp Plan Coordinator: Aaron Woldt
R3 AIS Coordinator: Mike Hoff
R5 AIS Coordinator: Sandra Keppner
R3 Asian Carp/eDNA Coordinator: Kelly Baerwaldt
R3 FWCO Program Supervisor: Maureen Gallagher
Midwest Fisheries Center
Center Director: (acting) Maureen Gallagher (FWCO Supervisor) and Kurt Schilling (hatchery Program
Supervisor)
Whitney Genetics Lab
Supervisory Molecular Geneticist: (acting) Emy Monroe, Molecular Geneticist
Fish and Wildlife Conservation Offices
Project Leaders: Mark Holey, Mark Brouder, Wyatt Doyle (Assistant PL Columbia), Scott Koproski, Rob
Simmonds, Scott Yess (Section Chief La Crosse), Kofi Fynn-Aikins
eDNA Point Of Contact’s: Alpena: Chris Olds; Green Bay: Tim Strakosh; Ashland: Mark Brouder (or designee);
Carterville: Jeff Stewart; Columbia: Patty Herman; LaCrosse: Nick Bloomfield; Lower Great Lakes (Region 5):
Sandy Keppner
RESPONSIBILITIES
Deputy ARD/National Asian Carp Plan Coordinator:
Regional oversight of all Asian carp and eDNA activities. Senior level authority on all decisions on eDNA
sampling program.
Region 3/5 Aquatic Invasive Species Coordinators:
National Aquatic Invasive Species Subject Matter Expert on development and implementation of processes and
strategies for aquatic invasive species (AIS) management, providing regional project leadership on DOI initiatives
addressing AIS management. Provides technical assistance for development and application of new scientifically
based concepts and improved technology in AIS prevention and control. Leads interagency and interregional
efforts to develop and implement programs for early detection and rapid response processes.
Region 3 Asian Carp/eDNA Coordinator:
Regional Office staff specialist responsible for development, coordination and implementation of the Midwest
Region’s eDNA monitoring program for Asian carps. Reports to the Deputy Assistant Regional Director. Assumes
principal responsibility for initiating, leading, facilitating, integrating, coordinating, and communicating necessary
monitoring work and activities using eDNA of the Midwest Region’s Fisheries eDNA Program through the
cooperative conservation community. Provides guidance for implementing and utilizing eDNA activities at the
A‐3
field level. Provides technical leadership to plan, conduct and lead other biologists as well as coordinate activities
to identify and coordinate selection of surveillance areas in water bodies for the early detection of Asian carp
eDNA. Ensures the best scientific practices are used during the development and implementation of management
plans to monitor, control, and eradicate Asian carp. Implements and coordinates the Regional eDNA collection
program; eDNA processing and interpretation of data; collection and dissemination of research information from
institutions and research agencies on findings and new developments in eDNA collection and interpretation of data
and the development of Asian carp management plans. Responsible for the QAPP and coordinating its
implementation with the FWCOs and lab, as well as ensures that field offices and laboratory staff receive proper
training to adhere to the procedures identified within. Responsible for communication between the lab field offices,
and Regional office. Integration with interagency ECALS team and other relevant entities (Academia, etc).
Responsible for external communication with partners regarding eDNA programmatic changes (eg. Marker
development, extraction techniques), collections, and results. Regularly communicates with the FWCO Program
Supervisor, Supervisory Molecular Geneticist, and Center Director to ensure a high level of quality and scientific
rigor with respect to field operations.
Region 3 FWCO Program Supervisor:
Responsible for the implementation and delivery of the FWS fisheries program through the Fish and Wildlife
Conservation field offices of the Midwest region. Direct supervisor of the Project Leaders of FWCOs and
Midwest Fisheries Center. Responsible for developing overall program direction and budget needs for FWCOs. In
addition to managing the assigned field stations, serves the role of coordinating and integrating their operations
with other Fishery Program operations, and ensuring cooperative and productive partnerships with the Upper
Midwest and Great Lakes, Eastern Tallgrass Prairie and Big Rivers, Plains and Prairie Potholes, and Ozark Plateau
Landscape Conservation Cooperatives and between the Midwest and Northeast Regions.
Midwest Fisheries Center Director: Description of duties to be provided when position is filled.
Supervisory Molecular Geneticist, Whitney Genetics Lab:
Responsible for planning and implementing operations of the Whitney Genetics Lab (WGL) and provides lab
services to federal and state entities nationwide. Reports to the (Acting) Midwest Fisheries Center Director.
Supervises a WGL staff of fish biologists and technicians performing a variety of procedures in support of early
detection and monitoring of aquatic species and in meeting fisheries management objectives. Responsible for all
processing of eDNA samples and reporting of results to eDNA coordinator and supervisor. Primary author and
editor of all processing related portions of the QAPP. Regularly communicates with the Region 3 Asian
Carp/eDNA Coordinator to ensure a high level of quality and scientific rigor.
FWCO Project Leaders
Responsible for overseeing the delivery implementation of the eDNA program at FWS aquatic conservation,
management, and aquatic invasive species programs within the field level which includes: collection, processing
(filtering or centrifuging), and shipping samples waters assigned to their station. Responsible for and supervises all
aspects of administration of the Aquatic Nuisance Species Act in the states or geographic area of responsibility
assigned to the respective office. Will report any eDNA related issues/questions to Asian carp/eDNA coordinator
and/or National Asian Carp coordinator.
eDNA POC’s
Serve as lead biologist to implement the eDNA program for the watersheds assigned to their respective field office.
Under the supervision of the project leader, develops and implements eDNA sampling plans for waters assigned
and serves as a point of contact, with their PL, for partners to coordinate eDNA activities. Serves as the
representative of their respective office on the eTeam.
*************************************************************************************
A‐4
STRUCTURE AND FUNCTION OF THE eTEAM (eDNA Team)
Purpose:
1. Review and refine the QAPP as needed.
2. Facilitate communication among FWCO field staff responsible for eDNA sampling in a structured forum,
in order to improve scientific quality of sampling.
3. Provide a forum for FWCO field staff to communicate with RO staff responsible for Asian carp
surveillance activities.
Members:
eDNA Coordinator (Kelly Baerwaldt) - chair
Whitney Genetics Lab Leader (Emy Monroe)
FWCO eDNA POC’s (Alpena: Chris Olds; Green Bay: Tim Strakosh; Ashland: Mark Brouder; Carterville:
Jeff Stewart; Columbia: Patty Herman; LaCrosse: Nick Bloomfield; Lower Great Lakes: Sandy Keppner)
Asian Carp Coordinator (Aaron Woldt)
Regional FWCO Program Supervisor (Maureen Gallagher)
Goal of eTeam: Improve scientific rigor through improved field-level communication and cross-FWCO education.
Facilitate communication regarding the field implementation and execution of the QAPP for eDNA between the
FWCOs and the RO leadership.
Responsible for reviewing and recommending changes to the field sampling portions of the QAPP for eDNA.
Responsible for keeping respective Project Leaders apprised of team progress. Responsible for developing site
specific sampling plans in coordination with state partners. Responsible for developing, standardizing, and
executing training of field staff. Will meet regularly or as needed to discuss field issues, recommended resolutions,
and lessons learned regarding field sampling of eDNA.
eTeam will be chaired by the Regional Asian Carp Coordinator. All recommendations from the team will be
communicated to the FWS National Asian Carp Coordinator for decision.
A‐5
AppendixB
InternalCommunicationofResultsSOP
B‐1
StandardOperatingProcedure:
NotificationofU.S.FishandWildlifeServiceeDNAResults
ThisStandardOperatingProcedure(SOP)isintendedtoguideU.S.FishandWildlifeService(Service)
employeesinvolvedinthesamplingandanalysisofenvironmentalDNA(eDNA)astheydisseminate
the resultsofearlydetectionandmonitoringforBigheadandSilvercarpgeneticsurveillance.
Includedisa flowchart(Figure1)depictinghowinformationwillbetransmittedthroughthe
MidwestRegion,aswell asspecificguidancerelatingtotheformatandtypesofinformationthatwill
becrucialtoincludeas eDNAresultsarecommunicated.FurtherguidanceregardingServiceeDNA
samplingcanbefoundintheAsianCarpRegionalCoordinating Committee’sMonitoringand
ResponsePlanandotherregionallyspecificplans. AlleDNAsamplingshouldbecompletedin
accordancewiththeQuality Assurance Project Plan; eDNA Monitoring of Bighead and Silver Carp.
Figure1:TheflowofinformationfromtheWhitneyGeneticsLab(WGL)/FishHealthCenter(FHC) withinthe
ServicetotheRegionalDirector(RD),andthenfromtheRDexternallytoouraffected partner.Numericorderof
theprimaryflowofresultsinformationnotedateachstep.
B‐2
DatasharingfromFWCO’sandServiceWhitneyGeneticsLaboratory(WGL)







Oncesampleprocessingiscompleteandpositivesidentified,resultswillbecommunicated
throughtheflowchart(Figure1)withinRegion3(R3)FisheriestotheAssistantRegional
Director(ARD)level.ReportinginternallytotheeDNACoordinatorlevelastheresultsare
determinedbytheWhitneyGeneticsLab(WGL)willhelpstreamlinetheprocessandallow
timefortheeDNACoordinatortopreparefordisseminatingtheresultsupandouttothe
affectedpartner
AlleDNAresultsinformationistobekeptconfidential,beingtransmittedasshownintheflow
chart(figure1).Anypotentialcommunicationwithpartnergroupsorotherentitiesoutside
the Servicewillnotoccurpriortoinformingtheaffectedpartner.Forfurtherinformationon
the disseminationofresultstoothers,seethe“PostAnalysisCoordination”Sectionbelow.
eDNAresultsinformationwillbeformattedasdescribedintheResultsProcedureSection
(below) bytheeDNACoordinatorandpreparedasabriefingfortheFisheriesDeputyAssistant
RegionalDirector(DARD),andARD.
Oncebriefed,theR3FisheriesARDwillbrieftheR3RegionalDirector(RD),orDeputy
RegionalDirector(DRD),whichwillallowtheRDorDRDtoprovideinputanddisseminate
theresultsasappropriatetoaffectedpartnerandpartnergroup(s)asoutlinedinthePost
AnalysisCoordinationSection(below).
ThecommunicationandbriefingprocessfromeDNACoordinatortoRDand/orDRDshould
occurquickly.ThiswillallowR3todisseminateresultspromptlyandmaintainour
responsivenesstoaffectedpartnerandpartnergroup(s).
Whencommunicationsaremadewhichtransmitresultsordatafromonesteptothenextin
the flowchart(Figure1),thepersonsendingitmustconfirmreceiptoftheinformationvia
email responsetoensurethemessagewasreceivedandmaintainarecordoftheexchange.
CommunicationofresultsbeyondtheeDNACoordinatorwillonlybemadeonceallsamples
fromthesamplingeventarefullyanalyzed.
ResultsProcedure:





ThesamplingeventdatawillbepackagedtogetherbytheeDNACoordinatorina
uniform templatetobeusedtoinformtheaffectedpartner.Samplingeventsaredefined
bythe geographicboundariessampledorbythenumberofsamplestaken.
DataandmapsrelatedtothesamplingeventwillbeprovidedtotheeDNACoordinatorfrom
each respectiveFishandWildlifeConservationOffice(FWCO)upontheircompletion.
Theanalysisresultsassociatedwitheachsamplingeventwillbeprovidedtothe
eDNA CoordinatorbytheWGLonceprocessingatthelabiscompleted.
TheeDNACoordinator,aspartofgatheringthisinformation,willcomparethedatasets
provided bytheWGLandtheFWCOtoensurethedatamatcheseachother,i.e.labelingand
unique identifiersmatch,andcombinethemtocreatethefinaldatapackagetobesenttothe
affected partner.
Thedatapackagetobesenttotheaffectedpartnerwillinclude:
o Geo‐referencedmapindicatingallsiteseDNAsamplesweretaken,highlightingthose
sightsthatweredeterminedtobepositiveforeDNA(ExampleincludedasAppendixA).
B‐3
o
o
o
Thismapwillbeformattedasa.jpegfileindicatingpositiveresultsasredtriangles(silver
carp),bluesquares(bigheadcarp)andnegativeresultsatyellowcircles.
DigitalExcelfilewitheachsampleuniquelyidentified. Datacolumnswillinclude:
SampleID,LatitudeandLongitudeindecimaldegrees,DateofCollection,WaterBody
Name,SilverCarpResults,andBigheadCarpResults.
AtransmissionmemofromR3FisheriesARDtotheaffectedpartnerrelatingasummary
oftheinformationthathasbeencollectedandourproposednextsteps(Memotemplate
attachedasAppendixB).Thismemowillbesentviaemailfortimelinessaswellasin
hardcopy.
ApressreleasetemplatewitheDNAspecificlanguagewillalsobeincludedinthe
transmissiontoassisttheaffectedpartnerasneeded(AppendixC).
PostAnalysisCoordination
 ThedatapackageofresultswillbeemailedfromtheDeputyRegionalDirector(delegatedto






AssistantRegionalDirectororDeputyAssistantRegionalDirectorasappropriate)directlyto
theaffectedpartnerpointofcontact(asdeterminedbytheaffectedpartner).TheDeputy
AssistantRegionalDirectorwillfollowupwithsecondarycommunicationviatelephone
and/oremailtotheaffectedpartnerpointofcontacttoensurethedatawasreceived.
Followingtransmissionofthedatapackagetotheaffectedpartnerwewillbepreparedto
work withthem,toassistininterpretingtheresultsorsupportingfurthersamplingif
possible, understandingthatinsomecasestheaffectedpartnermaynotdecidetocarryout
followup investigation.Wewillalsoassistasrequestedinapartnerledpressreleasesharing
theresults withthegeneralpublic.
Whennotifyingtheaffectedpartner,thedatapackagewillalsobetransmittedviaemailtoour
websitemanagerandExternalAffairsOffice.TheServiceExternalAffairsteamwillbe
preparedtoassisttheaffectedpartnerwithoutreachorpressreleasematerialsuponrequest.
Thistransmissionwillstarta5businessdaywaitingperiodattheendofwhichtheresultswill
bepostedtoaServicewebsite.However,uponwrittenrequestfromanaffectedpartner,the
Servicewillextendthetimeframeforuptoanadditional5businessdays.Therequestwill
specifythereason(s)fortheextension(e.g.newgeographicareaofeDNAdetection,high
numberofpositiveresults,etc.),thenameandpositionoftherequestingofficial,andthe
numberofadditionaldaysrequested.SeeappendixDforfurtherinformationregardingService
ExternalAffairsroleineDNAresultsnotificationprocess.
Thewebsitemanagerwillreviewthematerialsandformatthemasneededtopreparethem
for postingontheFWSpublicwebsite: www.fws.gov/midwest/fisheries/eDNA.html
Theresultswillbepostedconcurrentwithanypressreleasesissuedbyaffectedpartner,OR
by3 PMCSTonthethirdbusinessdayafterdeliveryofthedatapackagetotheaffected
partner, whichevercomesfirst. Thisistoensuretransparencyinthesystemandtonot
restrict informationsharing.
Immediatelyuponpostingtheresultsonline,thewebsitemanagerwillinformthe
ARD/DARD, whowilltheninformtheaffectedpartnerviaconfirmedemail.
Inaddition,PartnerGroups,TribalEntitiesandCongressionalMemberOfficeswillbenotified
on acasedependentbasis.
o PartnerGroups–Groups,suchastheAsianCarpRegionalCoordinatingCommittee,the
B‐4
o
o
CouncilofGreatLakesFisheriesAgencies,theAffectedGreatLakesFisheryCommission
LakeCommittee,theMississippiRiverInterstateCooperativeResourceAssociation,etc.
willbenotifiedviaemailand/orphonecallfromtheDRD(delegatedtoARDas
appropriate)totheirchairpersonuponissuanceofapressreleasebytheaffectedpartner.
TribalEntities–NotificationswillbemadetoeachTribe’sleadershiprespectivelyasan
affectedpartnerwhensamplinghastakenplacewithinorindirectproximitytotribal
lands.Inthiscase,theywillreceivethesamedatapackageviaemailasanyotheraffected
partner(SeeResultsProceduresection).Ifthesamplesweretakenintreatywaters,but
notinproximitytotriballands,theirleadershipwillbenotifiedviaemailand/orphonecall
fromtheDRD(delegatedtoARDasappropriate)eitheruponissuanceofapress releaseby
theaffectedpartnerorwhentheresultsarepostedontheFWSwebsite.
Congressional Member Offices – Congressional Office contacts will be notified upon
issuanceofapressreleasebytheaffectedpartnerontheirbehalf.Notificationwillbe
madeviaemailand/orphonecallfromDRD(delegatedtoARDasappropriate).
B‐5
AppendixA:
Examplegeo‐referencedmapofnegativeresults,althoughnoneoccuronthisexample,positive
SilvercarpresultsshouldbehighlightedasredtrianglesandpositiveBigheadcarpresults should
behighlightedasbluesquares.
B‐6
AppendixB:
Dear(InsertnameofPartner),
EnclosedwiththisletteryouwillfindtheU.S.FishandWildlifeService(Service)Whitney
GeneticsLabresultsrelatingtotherecentEnvironmentalDNA(eDNA)samplingwhich occurredin
(EnterNameofSamplingLocationorWaterBody). Theseresultsarepresented geographicallyto
provideanoverviewofthelocationswhereeachindividualsamplewas collected,aswellas
indicatingthosethatwerefoundtobepositiveforAsianCarpeDNA (includeifpositivesarefound).
Additionally,thereisatableprovidedwhichidentifieseach individualsamplecollectedbyunique
identifieranditscorrespondingdata.
IfoneormoresampleswerepositiveforAsiancarpeDNA,usethisparagraph:
Of the X samples taken, positive results were found in X samples. Of those, X were positive for
silvercarpand/orXwerepositiveforbigheadcarp.Workingwithyouasourpartner,we would
recommendthat…
IfnosampleswerepositiveforAsiancarpeDNA,usethisparagraph:
Afterreviewingthedata,youwillseethatnoneofthewatersamplescollectedinthiseffort were
foundtobepositiveforAsiancarpeDNA.Wewillkeepyouappraisedasfurther informationis
collectedthroughfuturesamplingefforts.
Pleasebeawarethattheseresultswillbepostedonourpublicwebsitenolaterthan(Enter
approximatetime(noon)anddateofpostingifnopressreleaseifissued),3businessdaysafter the
transmissionofthismessage.Uponyourrequest,wewillworkwithyoutointerpretthese results
andissueapressrelease.
Includeifmorethanoneaffectedpartner:
Thisinformationhasalsobeensentto(Enternamesofotheraffectedpartner)asaffected partners.
PleaseworktogetherwiththeServiceandtheotheraffectedpartnerstocoordinate nextstepsin
respondingtotheseresultsandprovidinginformationtothepublictoensurea clearandconsistent
message.
PleasecontacteDNACoordinatorXXXXat(Phoneandemail)ifyouhaveanyquestions.
B‐7
AppendixC:
FOR IMMEDIATE RELEASE Month XX, XXXX Contact(s): Name of Agency, Contact Name, Phone Number Name of Partner Agency, Contact Name, Phone Number MAIN TITLE Subtitle Analysis of water samples taken from [insert water body] on [insert date] have tested positive for the presence of Asian
carp environmental DNA, also known as eDNA. Out of [insert total number of water samples] water samples collected
by the [insert agency], [insert number] have traces of genetic material from [insert Asian carp species, e.g. bighead
and/or silver].
The eDNA samples were collected as part of an extensive monitoring effort in [insert all water bodies sampled]. The
samples were processed by the U.S. Fish and Wildlife Service’s Whitney Genetics Lab in La Crosse, Wisconsin.
[Insert agency VIP quote explaining what the positive eDNA findings mean]
In response to the positive findings [insert next steps].
eDNA can be left in the environment in the form of scales, cells, feces or mucus. At present, eDNA evidence cannot
verify whether live Asian carp are present, whether the DNA may have come from a dead fish, or whether water
containing Asian carp DNA may have been transported from other sources such as bilge water, storm sewers or fisheating birds. The U.S. Fish and Wildlife Service, U.S. Army Corps of Engineers and the U.S. Geological Survey are
leading a multi year Asian Carp Environmental DNA Calibration Study (ECALS), funded through the Great Lakes
Restoration Initiative, to improve the understanding and interpretation of Asian carp eDNA results.
For more information on ECALS, please visit www.asiancarp.us/ecals.
eDNA results from this sampling event can be viewed at: www.fws.gov/midwest/fisheries/eDNA.html
For more information on the science of eDNA in the fight against Asian carp, watch the video at:
http://youtu.be/xXwply6ahQ8 .
[Insert agency boiler plate]
B‐8
Appendix D. U.S. Fish and Wildlife Service External Affairs Flow Chart Thisplanisavailableon:http://www.fws.gov/midwest/fisheries/eDNA.html
B‐9
AppendixC
DataManagement
C‐10
1.Purpose
InordertokeepaccuraterecordsofeDNAsamplecollections,personnelassociatedwith
samplingandprocessingofcollections,anddataassociatedwithaspecificcollectionsample,
datasheetsassociatedwithsamplecollectionsmustbekeptinaccordancewiththefollowing
protocolsforquickreferenceandtopreventloss.Thisappendixdescribesproceduresfor
datareportinganddatamanagementspecifictoUSFWS.
2.Datamanagement
(1) FielddataanddatasheetsaretheresponsibilityoftheFWCO.
a. FWCOstaffareresponsibleforenteringfielddata,proofingdataand
maintainingdataattheirlocation.Hardcopyandelectronicdatashouldbe
backedupregularly.
b. FielddatasheetsshouldbescannedandsavedinaPDFwithallofthedata
sheetsforaparticularlocation/caseinonedocument.Thefilenameshould
includesamplingdatesandlocationinformation,andshouldbesavedonthe
station’sshareddriveaswellasattachedtothedatabasedescribedin#3.
c. OriginalCOCformsaresenttoWGLwiththesamples.FWCOswillreceivea
scannedCOCthatshouldbeprintedandfiledinaprojectbinderandthe
electroniccopysavedwithelectronicfielddataandscanneddatasheets.
i. TheoriginalCOCformsarekeptinaprojectbinderatWGL,andwillbe
giventotheeDNAProjectCoordinatorattheendofeachsamplingyear.
(2) LabdataanddatasheetsaretheresponsibilityofWGL.
a. WGLwillmaintainhardcopiesoflaboratorynotebooksandtheelectronic
projectdatafilecatalogingeachcaseinanexcelfile.Gelphotosareprintedand
placedintolabnotebooks,andelectronicfilesoftheimagesarealsosavedon
thelabnetwork,whichisbackedup.Labnotebookswillbestoredina
fireprooffilecabinet.Sequencedatawillbesavedelectronicallyonthe
station’sserver.
b. WGLwillscandatanotebooksintoPDFsbycasesandthesewillbesavedon
thelabnetworkedcomputerwithaback‐upaswellasonthestation’sshared
drivewhichisalsobackedupbyITstaff.
c. EventuallyanelectronicLaboratoryInformationManagementSystemwillbe
utilizedtotrackcasesandsamplesthroughthelabworkflow.TheLIMSwillbe
backedupaminimumof4timesonseparateharddrives.
i. Finalreportswillbegeneratedaseachcaseiscompleted,senttothe
eDNAProgramCoordinatoraswellassavedelectronicallyinthelab
networkandonthestation’sshareddrive.
ii. ThePDFsofthescannedfieldCOCaswellasthegelimagesand
sequencingresultswillbemaintainedinelectroniccopyonsitewith
back‐up.
(3) Collatedfieldandlabdataingeo‐referenceddatabasemanagedattheRegionalOffice
a. FWCOsareresponsibleforenteringandproofingfielddata.Ifpossible,FWCOs
shouldhavedatauploadedintothedatabasewithin5businessdaysafter
collection.Ifotherfieldworkpreventsuploadingtothedatabase,FWCOsmay
C‐11
emailtheproofedexcelfiletotheeDNAProgramCoordinatorwithin5
buisnessdays,andtheCoordinatorwilluploadthedatatothedatabase.
b. WGLisresponsibleforfilingfinalcasereportsofresultswiththeeDNA
ProgramCoordinatorwithin24hoursofresultconfirmation.
c. USFWSMidwestRegionwillmaintainadatabasecompletewithfieldandlab
dataaswellaselectroniccopiesofreportsprovidedtopartneragenciesand
thepublic.
C‐12
FisheriesSamplingSiteDataManagementPlan
DevelopedbyGabeDeAlessioandR3FisheriesProgram UpdatedJune27,2014
Purpose: TheFisheriesSamplingdataiscollectedbymultiplefieldstationsandneedstobe
reported andconsolidatedintoasinglelocationforarchivingandcentralizingmapping
needs. UsingArcGIS Server(SDE)willcreateasimplifiedworkflowandrepositoryforthe
data.
UserDescriptions:
FisheriesFieldUsers–theseusersareresponsibleforcollectingthesamples,quality
controlofthedata, andinputtingthesamplingdataintothesystem. Theywillhaveediting
permissionforthe eDNA_SAMPLEtableandreadpermissiontothe
eDNA_SAMPLE_RESULTSfeatureclass. Thisdesignationwillincludeoneemployeefrom
eachFWCOaslistedbelow:
AlpenaFWCO–ChrisOlds
AshlandFWCO–MarkBrouder
CartervilleFWCO–JeffStewart/SamFinney
ColumbiaFWCO–PattyHerman LaCrosseFWCO–AnnRunstrom/NickBloomfield
GreenBayFWCO–TimStrakosh
LowerGreatLakesFWCO–SandraKeppner/ScottSanders
C‐13
FisheriesDataSteward–Thisperson(andtheirbackup)willworkwithROGISStaff(see
below)andbe responsibleforupdatingtheeDNA_RESULTSdataandjoiningthe
eDNA_RESULTStabletothe eDNA_SAMPLE_RESULTSfeatureclass. Thispersonandtheir
backupwillhaveeditingpermissionforthe RESULTStable,theeDNA_SAMPLEfeatureclass,
andtheeDNA_SAMPLE_RESULTSfeatureclass. Also, theDataStewardwillbetheprimary
contactforfieldstationsonassistancewithtraining, troubleshooting,datareviewand
managementasneeded,anddaytodayoperations.
Primary–KellyBaerwaldt/BrianElkington
Backup–KarlaBartelt
eDNACoordinator‐ ThispersonwillworkwiththeWhitneyGeneticsLab(WGL)to
receiveresultsand transmitthemtotheFisheriesDataSteward. TheeDNACoordinator
willalsoassistinCoordinatingFWCOeDNAsamplingfortheRegion. Thispersonwillnot
haveaccesstotheSDEinitiallybutmaybe addedasaPrimaryFisheriesDataStewardinthe
futuredependentonworkflowandoverallefficiency ofthesystem.
Primary–KellyBaerwaldt
ROGIS–Responsibleforinitialdataloading,managinguserpermissionsandserverside
issues. TheRO GISstaffwilladvisetheFisheriesDataStewardondatabasecreationand
editing(includingdesign, implementationandtraining)butisnotresponsiblefordayto
dayupdatingofthedatabase. Oncein productionmode,theROstaffwillassistFieldUsers
onlyiftheFisheriesDataStewardisunableto resolvetheissue.
Primary–GabeDeAlessio
C‐14
WorkflowOverview:
Sampledataiscollectedbyfieldstations. Thedataarecollectedandrecordedasoutlinedin
theQuality AssuranceProjectPlan(QAPP),withtheadditionoftheRegionalUnique
Identifier.Whilethephysical samplesaresenttotheWhitneyGeneticsLab(WGL)for
analysis,theFisheriesFieldUsersare responsiblefordigitizingtheirrawdata,ensuring
dataaccuracy,andloadingthatdataintotheeDNA_SAMPLEfeatureclassintheArcGIS
Server(SDE)usinganexcelfiletemplateprovidedbythe FisheriesDataSteward. Alldata
willbeerrorcheckedpriortoloading(Seedatauploadinstructions below)andwillbe
loadednomorethan2weekspostsamplingeventbytheFisheriesFieldUsersto ensureit
isenteredpriortowhenresultsarriveattheROfromtheWGL.
UponreceivingtheresultsdatafromtheWGL,viatheeDNACoordinator,theFisheriesData
Steward(or theirbackup)willloadtheresultsdataintotheeDNA_RESULTStable. Oncethe
dataisloaded,the FisheriesDataStewardwillproducethenecessarymapstobeusedto
informtheaffectedpartner.
Concurrentwithwebsiteposting,theFisheriesDataStewardwilljointheeDNA_RESULTS
tablewiththe eDNA_SAMPLEfeatureclass. Thisjoinwilladdtheresultsandsamplingdata
tothe eDNA_SAMPLE_RESULTSfeatureclass(readonlyforFisheriesFieldUsers)anddelete
theresultsand samplingdatafromtheeDNA_RESULTStableandeDNA_SAMPLEfeature
class. The eDNA_SAMPLE_RESULTSfeatureclasswillbeconsideredthelongtermdata
archiveforfuturereference asneeded.
C‐15
Figure1.WorkflowofeDNAsamplingandresultsdataintotheRegionalArcGISServer(SDE). The
samplingdataisenteredbyFWCOstaffintotheeDNA_SAMPLEpointfeatureclass,whichcontains
all appropriateandstandardizeddatafields(guidanceprovidedintheQualityAssuranceProject
Plan (QAPP)). CorrespondingresultsdataisenteredintoaseparateeDNA_RESULTStableonce
received fromFHCandultimatelyjoinedwiththesamplingdatatocreatethe
eDNA_SAMPLE_RESULTSpoint featureclass,alongtermRegionaleDNAdataarchive.
C‐16
Table1.FielddescriptionsfortheeDNA_Samplepointfeatureclass.
Field Name RUID Alias Regional Unique ID Type
Long Integer Length
n/a (8) FWCO_ID Sampling Station ID code Text 3 STATE State Text 2 BASIN Basin Text 4 Description
Composite number that has a 5‐digit “case” number (a series of unique numbers assigned by the WGL to each FWCO at the start of the sampling year and provided for each individual planned sampling event followed by a 3 digit sample ID number assigned by the FWCO numerically as they take samples in the field (no punctuation, #######) Alpena FWCO – ALP Ashland FWCO – ASH Carterville FWCO – CAR Columbia FWCO – COL Green Bay FWCO – GRB LaCrosse FWCO ‐ LAX Two letter state code in which samples were taken. LH = Lake Huron LM = Lake Michigan LE = Lake Erie LS = Lake Superior LO = Lake Ontario CAWS = Chicago Area Waterway System UMR=Upper Miss River OHR=Ohio river WATERBODY DATE_COLL Waterbody Collection Date Text
Date WIND_DIR Wind Direction Text 20 Double n/a LATITUDE 100
C‐17
‐Other designations to be added as needed by Fisheries Data Steward Waterbody name Date of collection (MMDDYYYY) Abbreviated wind direction, “Calm”, “Variable”, or shorthand (NE, NW, SE, SW, N, S, E, W) and wind speed if available.
WGS 84 Decimal Degrees, 5 decimals
LONGITUDE Double n/a TEMP_F Double n/a DEPTH Double n/a Text
Text
Text 5
5
30 DOUBLE_SAMPLE BLANK HABITAT COLLECT_TIME Collection Time Long Integer 4 FILTER_TIME Filter Time Long Integer 4 PROCESSOR Text 3 COMMENTS Text 255 WGS 84 Decimal Degrees, 5 decimals
Temperature in degrees Fahrenheit (1 decimal) Depth where sample was taken in Feet (1 decimal) Yes/No
Yes/No
Habitat type where sample was taken, i.e. LDB, RDB, MC, Bay, Lake, Confluence, etc. Time stamp in military time, no punctuation Time stamp in military time, no punctuation Initials of person who filtered the sample
General notes, issues, or observations while sampling
Table2.FielddescriptionsforeDNA_Resultstable.
Field Name RUID BIGHEAD SILVER MARKER_NAME Alias Regional Unique ID Type
Long Integer Length
n/a (8) Text
Text
Text 5
5
25 C‐18
Description
Composite number that has a 5‐digit “case” number (a series of unique numbers assigned by the WGL to each FWCO at the start of the sampling year and provided for each individual planned sampling event followed by a 3 digit sample ID number assigned by the FWCO numerically as they take samples in the field (no punctuation, #######) Yes/No
Yes/No
Name of the specific markers used at the Whitney Genetics Lab to test the sample SystemRequirements:
ArcGIS10.1,SP1. Thisisavailablefrom“FWSAppstoGo”anddoesn’trequire
elevated privilegestoinstall. ContactITwithanyproblems.
SQLServer2008NativeClient–ThisallowsArcGIStoconnecttoArcGISServer(SQL
Server).
LookinProgramFilestoseeifit’sinstalled(screenshotbelow). Ifnot,contactIT
(x5115)togetit installedpriortoconnecting.
C‐19
EstablishingaConnectiontotheRegion3ArcGISServer:
GotoArcCatalog. ScrolldownintheTableofContentstoDatabase
Connections ClickAddDatabaseConnection.
Setupasfollowing,replacingtheUserNamewithyourActiveDirectoryShortName.
(Generally IFW\firstinitiallastname)
SetthePasswordto“a”(itcannotbeleftblank). Notethatthesoftwareisactuallypassing
your WindowsLoginpassword,the“a”isjustaplaceholder.
ClickOK. Youshouldbeabletoopentheconnectionandseethevariousdatasets.
C‐20
Troubleshooting‐ iftheconnectionfails,itislikelyoneofthefollowing:
1) Doublecheckyourshortnameandbesurealltheparametersarecorrect.
2) Youhavenotbeengrantedpermissiontothedatabaseyet. ContacttheROGIS
Staff(Gabe).
3) The SQL Server 2008 Native Client is not installed (see System
Requirements). Oncethedatabaseconnectionismade,youshouldbeable
to see the many datasets. Right click on the connection and choose
RENAME. ChangethenametoFWSVector.
Lastly,wewanttoconnecttotheworkingversionofthedatabase. RightClickonthe
newlynamed FWSVectorandchooseGeodatabaseConnectionProperties.
C‐21
SelecttheTransactionalversiontoMappingandclickOK.
C‐22
FieldUserInstructions:
ThissectionwillguideyouthroughtheinitialArcMapsetupanddataloadingprocess.
Someofthese stepscanbedoneonceaslongasyousaveandreusetheArcMapproject
forfuturedataloads.
1) Createanemptygeodatabasetostoretemporarydata.
InArcCatalog,selectalocation(suggestedlocation> C:\TEMP)and
right click and choose New > File Geodatabase Renamethegeodatabase:Sample_Temp_Data.gdb
C‐23
2) BesureyourdataisloadedintothefielddataMSExceleDNA_SAMPLEdatasheet.
3) OpennewArcMapproject.
RightclickonLayers>DataFrameProperties.
4) ChoosetheCoordinateSystemtab
SelectGeographicCoordinateSystems>
World>WGS1984.
5) ClickOK. ThissetsyourArcMap
projectto thecoordinatesystem
yourXYdataisin(Decimal
Degrees‐Lat/Long).
C‐24
6) Next,addabasemaptoyourworkarea. Ifyouhavealocalcopyofa
topographicoraerial, browsetothatandadd.
Ifnot,youcanusetheAddDataDropdowntochooseAddDatafromArcGISOnlineand
type “Image”tolocateaworldwideimageset. (Notethatslowinternetspeedsmaybe
veryslowto workwith‘live’data.)
7) UseAddDatatobringtheeDNA_SAMPLEdatasheetintotheTableofContents.
C‐25
8) RightClickonthetableandchoose,DisplayXYData.
C‐26
9) LatitudeandLongitudewillautopopulate. ClickOK.
YouwillgetawarningmessageregardinganObjectIDfield,Click
OK.
10) FieldusersshouldQualityCheckthedatanow. Reviewbothpositionalaccuracyaswellas
verifyingalltherequiredattributesarepresentandcorrect.
11) OncefieldQCiscomplete,rightclickontheEventslayerandchooseData>ExportData
C‐27
12) BrowsetoyourSample_Temp_Data.gdbandnamethedataSampleX ClickOK.
Whenaskedifyouwanttoaddthedatatothemap,clickYes.
13) AddtheeDNA_SAMPLEpointfeatureclassfromtheSDEserver.
ClickAddData,thenbrowsetoDatabaseConnections>FWSVector.sde>eDNA_SAMPLE ClickAdd
14) Confirmthetableofcontentslookslikethefollowing,showingtheGIS.Mappingversionofthe
eDNA_SAMPLEpointfeatureclass.
C‐28
17)MakesuretheEditorToolbarisopen. Ifitisnot,gotoCustomize>Toolbars>Editor Dockthe
toolbarwhereyouprefer.
18) ClickEditor>StartEditing.
ChoosetheFWSVector.GIS.eDNA_SAMPLElayer.
ClickOK.
19) RightclickontheSampleXlayer. ChooseSelection>SelectAll.
C‐29
20) OntheMainMenu,chooseEdit>Copy. (orCtrl+C)
21) NextchooseEdit>Paste.(orCtrl+V)
BesureyourtargetdatasetistheeDNA_SAMPLEpointfeatureclass.
C‐30
ClickOK.
22) TurnofftheSampleXandEventpointdataintableofcontent.
Zoomtothenewlyaddeddata,andreviewthattheattributespastedcorrectly.
23) OntheEditorToolbar,SaveeditsandStopEditing.
24) YoucanrightclickandRemovetheSampleX,EventdataandtheExceleDNA_SAMPLEtable. Your
projectisreadyforthenextdataloading.
25) GotoFile>SavetosavetheArcMapprojectforreuselater. Notethatyouwillnowstarton step9
andskipsteps15–17infuturedataloadsifyouusethis.mxd.
FisheriesDataStewardInstructions:
FisherieseDNADataStewardGuide
DescribesthestepsfortheeDNADataStewardtoreceivetheresultsdataandlinkitwiththefield‐
providedsampledatatocreatemaps.
1) ReviewdatafromtheFishHealthCenter.ThedatawillcomeinExcelform.Makesurethefields
arefilledoutcorrectlyandmatchtherequiredpropertiesassetforthintheDataStandards
document.
2) Convertthe.XLSdatato.CSVformat.(DuetoExcelandArcGISnotcommunicatingLongInteger
valuescorrectly,thisstepisnecessarytoloadtheRUIDsproperly.)
3) ConnecttoArcCatalogviatheMappingVersion.RightclickonthetheeDNA_Resultstableand
chooseLoadDatatoopentheSimpleDataLoaderwizard.
C‐31
4) ClickNextthroughtheSimpleDataLoaderintroductionscreen(youcanchecktheboxtodisableit
forfutureruns.)
5) Clickonthefoldericonandbrowsetothe.CSVfilethatwascreatedinStep2.
ClickAddtomovethe.CSVtotheList.
ClickNext.
C‐32
6) Wearen’tdealingwithSubtypes,ClickNext.
C‐33
7) Makesurethateachofthe4RESULTS
SourceField”correctlyalignwiththeir
“TargetField”.
“Matching
respective
8) Assumingyouaren’tdealingwithquerying
loading,clickNext.
datawhile
9) ReviewtheSummaryandclickFinishtoloadthe
data.
WorkingwiththeeDNAdatainArcMap.
Toproducethereviewermaps,thesample(XYlocation)datamustbejoinedwiththeresultsdata.Thisis
doneinArcMapandthenthemapiscreatedbyaddingabasemap,collateraldataandwhatever
cartographicelementsarerequired.
10)OpenArcMap.
ClickAddData.
Browsetoandhighlightthe
eDNA_Results(table)andeDNA_Sample
featureclass).
ClickAdd.
11)Youwillseeboththepointdataandthe
intheSourceviewoftheTableof
OntheeDNA_Sampledata,rightclickandchooseJoinsandRelates,Join.
C‐34
(point
tableadded
Contents.
12)IntheJoinDatawizard,choosethe“Regional
UniqueID”fieldfor#1.
For#2,theeDNA_Resultsshouldautopopulate,if
selectitfromthedropdownorbrowsetoit(ifit’s
alreadyinyourmap.)
Besure#3istheRUIDfield(thisisderivedfrom
eDNA_Resultstablein#2.)
YoudonothavetoValidateJoin.
ClickOK.
Ifyougetthe“MessagefromJoin”,choosethe
“PerformJoinNowWithoutIndex”option.
not
not
the
13)ToconfirmyourJoinwassuccessful,rightclickon
eDNA_SamplepointfeatureclassintheTableof
Contents,andOpenAttributeTable.
C‐35
the
14)Scrolltothefarrightoftheattributetable.RightclickontheRUIDfield,andchoose“Sort
Descending”.Thisforcethesuccessfullyjoineddatatothetopoftheattributetable.
15)Nowit’stimetomakeyourReviewMaps.
C‐36
AppendixD
CentrifugeTubeManagementPlan
D‐1
Newin2015,sampleswillnowbecollectedin50‐mlcentrifugetubesandconcentratedinthefieldvia
centrifugation.Eventhoughtubescomesterileandreadytouse,theRegionalOfficehasdecidedthat
WGLwillserveasthesinglepreparationfacilityforcreatingfieldblanksusedintheAsiancarpeDNA
monitoringprogram.
WGLwillfillnew,sterilecentrifugetubes,packagetheminrackstobesecuredinacleanplasticsleeve,
andtheneitherdeliverorshipthemtofieldofficesasneeded.
fieldblankfieldblankCooler(field)blanks:
(1) PlasticbagsfittoracksoffilledtubeswillbepurchasedbyWGL
(2) Filledtubeswillbesecurelyclosed,andplacedinthebag.
(3) Bagswillbetwistedclosedwithwireclosuresortape.
(4) Filledtubeswillbedistributedattheannualfieldtrainingmeetingsothateachfieldstation
willstartouttheseasonwiththetotalestimatednumberoffieldblanksneededforthe
samplingseason.
(5) Fieldstationscanstorethesepreparedfieldblanksaslongasneeded,ideallyinthefield
trailers.Bagsshouldbere‐sealedafterremovalofblankstokeepcontaminationrisklow.
(6) FieldstationswillpreparecoolersaccordingtotheQAPP,inascleanofanareaaspossibleat
thestation.
a. Anytimeboxesareopened,staffshouldbeincleanclothesanduseanewpairofclean
glovesforactuallyhandlingthetubes.Forexample,youmayopentheboxwithun‐
glovedhands.Then,putonglovestoopenthebagandtouchthetubes.
(7) Oncecleancoolersareready,boxesmaybeopened,tubeslabeled,andplacedintoclean
coolers.
(8) Afteruse,fieldstaffshouldreturntherackstoWGL,butdisposeofallusedtubes
Anoteonlabels:We’vefoundsomegreatlabelsthatwithstandallsortsofabuseandareavailableon
GSA.Averylaserwhiteweatherproofaddresslabels#5520.
D‐2
AppendixE
MethodsforEliminationandReductionofeDNAonBoatsandEquipment
E‐1
RecommendedmethodsforreductionofresidualorenvironmentalDNAonboatsandotherequipmentassociatedwithenvironmentalconservationworkinthefield.
ForboatsandequipmentthathavebeenpreviouslyexposedtocarpDNA,chooseonehighpressuresprayermethodinconjunctionwithonechemicalmethodtoreduce
DNAlevelstonegligibleorbelowLOD.ReadMSDSandUsepersonalprotectiveequipment(PPE).Readjobhazardassessment(JHA)forapplicablemethods.
Method
[email protected]
ColdWaterHighPressureSprayer
withLowPressureDetergent
Application
10%HouseholdBleachLow
PressureSaturation
20%HouseholdBleach
ImmersionBath
2%VirkonImmersionBath
2%VirkonLowPressure
Saturation
ActiveIngredient
ContactTime
Advantages
10sec
Pressure,HeatandWater
Environmentalsafety
Disadvantages
Needelectricalandwater
hookups
Canmeltortearmaterials
Detergent,Pressureand
Water
3‐5minDetergent
contact/10sechigh
pressurerinse
Sodiumhypochlorite
(5‐8%beforemixing)
Potassium
Peroxymonosulfateand
SodiumChloride
Needwaterhookups
Cantearmaterials
Nohookups
necessary–canuse
offstation
10min
Sodiumhypochlorite
(5‐8%beforemixing)
Potassium
Peroxymonosulfateand
SodiumChloride
Environmentalsafety
Nohookups
necessary–canuse
offstation
10sec
Lasts1weekin
solution
30min
Environmentalsafety
Lasts1weekin
solution
10min
Environmentalsafety
E‐2
Notpreferredforenvironmental
safety
Singledayuseinsolution
Notpreferredforenvironmental
safety
Singledayuseinsolution
Cautions
UsePPE–needpropersafety
training,cancauseburns,
cuts,airembolisms
UsePPE–needpropersafety
training,cancausecuts,air
embolisms
UsePPEandavoidbreathing
fumes
UsePPEandavoidbreathing
fumes
Corrosivetometalswhen
exposedlongerthan10min
UsePPE–wearadustmask
whenmixingpowder
Notquiteaseffectiveasbleachin
laboratorystudy;equalorbetter
thanbleachinfield(boat)
equipmentstudy
UsePPE–wearadustmask
whenmixingpowder.DoNot
Aerosolize!Usealow
pressuredispenser(hose
attachmentsprayeratlargest
dropletsetting)
E‐3
AppendixF
MobileeDNATrailerMaintenanceandUseManual
F‐1
MobileeDNATrailerMaintenanceandUseManual
Purpose
Inordertoprocesswatersamplescollectedinthefield,asterileworkenvironmentisrequiredto
filter/centrifugewaterwhilepreventinganyfieldcontamination.TheeDNAtrailerisdesignedtobe
mobilewhilemaintainingthehighestlevelofqualityassuranceandqualitycontrolthatwouldbefound
inanylabenvironment.
Thisisdoneinpartbykeepingalldryconsumableequipment(filters,papertowel,gloves)inlocked
cabinetswithinthedrylabarea.Allequipmentthatrequiresdecontaminationbetweenuses(filter
funnels,carboys,filtermanifolds)arestoredundertheworkbenchinthewetlab.
TheeDNAtrailerisequippedwithtwosinks,bothofwhichareinthewetlab.Theaftsinkshouldbe
consideredcontaminatedandtheforwardsinkshouldbeconsideredclean(non‐contaminated).The
forwardsinkhastwofaucets;onefordeionized(DI)waterandoneforregulartapwater.
PlacementoftheeDNATrailerisimportantinoptimizingitscapabilitiesandimprovingtheefficiencyof
sampleprocessing.TheeDNAtrailershouldbesetupnearanaccesspointtothebodyofwaterbeing
sampled,preferablyupriverofwherecollectionsbegin.
Cautions:
 ParkeDNAtraileronlevelhardsurfacetopreventgettingstuckandtokeepfiltering/centrifuging
equipmentfunctioningproperly.
 ParkeDNAtrailersoexhaustfromgeneratorisblownawayfromeDNAtrailer(ifpossible).
 IfeDNAtrailerisequippedwithadryicecooler,turnonceilingfanindrylabtoremoveany
carbondioxidegasoncetrailerissetupandrunning,.
 Whentheultra‐violet(UV)systemisinoperation,nostaffshouldbeinthewetlab.
IfeDNAtrailerwillbesetupatthesameplaceforanextendedperiodoftime,disconnectfromtow
vehicle.IfeDNAtrailerwillbelocatedataparticularsitefortheday,itisacceptabletoleaveitconnected
totowvehicleprovidedstaffstillgothroughthelevelingprocedures(seesetupproceduressection).
ToolsNeeded:




Levelingjacksocket
Level
Wheelchocks
Fourblocksofwood(2x4‐12”long)tobeplacedunderlevelingjacks.
eDNATrailerSetUpProcedure
1. ParkeDNAtraileronflathardsurface.Ifusingexternalwatersource,ensurethereisenough
waterhosetoreachwaterconnection.
2. Placewheelchocksinfrontofandbehindtrailertires.
3. LevelingtheeDNAtrailer.
a. UsethepowerjackontongueofeDNAtrailertovisuallyleveltrailer.
F‐2
b. Usingalevelingjacksocket,lowerthefourlevelingjackstotheground.Placeblocksof
woodunderlevelingjackpads.(levelingjacksarelocatedatthefourcornersofthetrailer).
c. EntertheeDNAtrailerandplacelevelonwetlabcountertoptoidentifyifeDNAtrailer
needsanyfurtherleveling(accomplishedbyputtingweightdownwithlevelingjacks
locatedonallfourcornersofthetrailer).
d. Thefourlevelingjacksareusedformakingfineadjustments.Thebulkoftheleveling
procedureshouldbeaccomplishedwiththepowerjacklocatedonthetongueoftheeDNA
trailer.
4. Connectingpowersource(ensurealloperatingsystemswitchesareintheoffposition).
a. Operatingfromshorepower.
i. Makesuretouse220v,witha30ampminimumservice,butitcannotexceeda50
ampservice.Ifthepropershorepowerrequirementsarenotavailableuseon‐board
generator.
ii. FirstconnecttheextensioncordtotheeDNAtrailer,thenplugintothepower
source.
iii. Oncetheshorepowerisproperlyconnect,switchesforoperatingsystemscanbe
turnedon.
b. Operatinggenerator(ensurealloperatingsystemswitchesareintheoffposition).
i. Tostartgenerator,holddowngeneratorstarterintheprimingpositionfor30‐60
seconds.
ii. Pushgeneratorstarterswitchtotheonpositionuntilgeneratorstarts.
iii. Oncethegeneratorisrunning,switchesfortheoperatingsystemscanbeturnedon. 5. Connectingwatersource(fillinternalwatertankbeforeheadingintofield).
a. Ifusingexternalwatersource,connecthosetoeDNAtrailerandwatersource.Oncethe
connectionismade,turnonthewatersourcetopressurizethewaterlinetothetrailer.
b. Ifusinginternalwatersource,turnonwaterpump.
OperatingSystems
1. Supplies
a. Allconsumables(gloves,filters,papertowels)arestoredinthedrylab.
b. Allfilteringequipmentisstoredinwetlabinsidecabinets.
i. Filtermanifolds,carboys,forceps,tubing,funnelsaretobekeptinthewetlabatall
times.
2. Lighting
a. Lightswitchesforwetlabarelocatedinwetlab.
b. Theultravioletlight(UV)on/offswitchislocatedindrylabwithaflip‐upplasticlidto
preventaccidentaluse.
i. WhenUVsystemison,awarningindicatorlightinwetlabwillalertanyone
workinginwetlabthatUVsystemisinon.
F‐3
3. HVAC
a. Heating/Cooling:Adjustthermostattodesiredtemperatureforworkingconditions
b. DryLabCeilingFan:Setthermostattoturnonthefan.
CAUTION:DRYLABCEILINGFANSHOULDALWAYSBEONWHENDRYICEISKEPTINDRYICECOOLER.
4. VacuumSystem
CAUTION:DONOTLETVACUUMPUMPRUNMORETHAN60SECONDSWITHOUTanOPENVALVE.
a. Vacuumpumpsarelocatedinacabinetindrylab.
b. Toturnonvacuumpump,locatetheswitchinthewetlabandmoveto“on”position.
i. Eachpumpissettooperateeachfilterlineoneachsideoftrailer.
ii. Twoshutoffvalveslocatednexttoforwardsinkcontrolswhichvacuumlinesare
activated.
iii. Oncefilteringiscomplete,openseveralvalvesandallowthevacuumpumpto
operatewithoutpressureforatleast5minutesbeforeshuttingoff.
5. DI/waterheater(ifusinginternalwatersourceturnonwaterpump).
a. Waterheater
i. On/offswitchlocatedindrylabnexttothermostat.
ii. Waterheatershouldbeturnedononcefilteringbeginstoensurewaterishot.
iii. Whenredindicatorlightturnsoffwaterishot.
iv. Frontsinklefthandleproduceshotwater.
b. DIsystem
i. FrontsinkrighthandleproducesDIwater.
ii. DIwatershouldbetestedusingTDSmetertoensurewaterqualityismet.
iii. WhenDIwaterTDSisabove15ppmchangeresinintank1andtank2.
6. Refrigerator
a. Runsoffpropane/electric
LaboratoryDecontamination
Aftertrailerhasbeenleveledandsetup,decontaminatetheinteriorofthetraileratthebeginningofeach
day:
1.
2.
3.
4.
5.
6.
7.
Mixupa10%bleachsolutioninbleachbathcontainer.
Wipedownallcountersandcabinetswithbleachsolution.
Wipedownallcountersandcabinetswithtapwatertoremovebleachresidue.
Sweepthefloortoremoveanydebrisbroughtinonbootsorcoolers.
Mopfloorwith10%bleachsolutionandrinsewithwatertoremoveanybleachresidue.
Lockbackdooranddividingdoorofthewet/drylab.TurnontheUVlightsfor30minutes.
AfterUVlightshavebeenturnedoff,unlocktrailerdoorsandbeginsettingupthewetlabfor
filtering/centrifuging.
F‐4
Filtering/CentrifugingProcedures
SeeQAPP2014
eDNATrailerShutdownProcedure
Centrifuging:
1. Storecentrifugingequipmentincurbsidecabinets.
2. Wipeoutcentrifugeswithdrypapertowel.
3. Securecentrifugesfortravelling.
Filtering:
1. Oncethelastsampleisfiltered,disconnectallcarboysfromvacuumline.Completelyopenfouror
morevalvesandletvacuumpumprunfor5ormoreminutes.Doingsowillremoveanymoisture
invacuumline,preventinglongtermdamagetovacuumpump.
2. Storefilteringequipmentincurbsidecabinets.
TowingPreparations
1. RemovegarbagefrominsideeDNAtrailerandplaceinnearestreceptacle.
2. Thoroughlywipedownallcountertopswithwater.(Anybleachresiduewilldiscolorandrust
countertop).
3. Shutdownalloperatingsystems.
a. Turnoff
i. Vacuumpumps
ii. Lighting
iii. Waterpump
iv. Waterheater
v. HVAC/refrigerator
vi. Ceilingfan(makesureroofventisclosed)
4. Disconnectwatersource.
5. Disconnectpowersource.
a. Ifrunninggenerator,allowgeneratortorunwithoutloadfor5minutesbeforeshutting
down.
6. Raiselevelingjacks
7. ConnecteDNAtrailertotruck(ifneeded).
a. Connect/checksafetychains.
b. Raisepowerjackhighenoughtoavoidrubbingground.
c. Connect/checktrailerlightsandensuretheyarefunctioningproperly.
8. Removetirechocks.
9. TakefinalwalkinandaroundeDNAtrailer.
a. EnsureeDNAtrailerisreadyfortraveling.
i. Secureallequipment
ii. Closeallwindowsandcabinetdoors.
iii. Lockalldoorsincludinglabdividingdoor.
F‐5
iv.
v.
Putcapsonholdingtanks.
Raisesteps.
TrailerMaintenance
1. Beforedepartingoneachtripchecktirepressureandtreadwear.
2. Checkhourmeterongeneratorandserviceasprescribedinowner’smanual.
3. Checkpropanecylinderstoensuretheyarestillproperlysecuredandinspectpropanelinesfor
cracking.
4. EnsureDIsystemisworkingproperly,ifnecessary,replaceresin.
5. PeriodicallycheckMSDSsheets,medkits,andfireextinguisherstoensuretheyareallupdate
a. Onesafetyitemtokeepinthetraileriskittylittertoplaceonanydieselspilledonthe
ground.
F‐6
AppendixG
eDNASecurityPlanforCo‐LocatedLaCrosseFWCOandWGL
G‐1
StandardOperatingProcedureforMinimizingRiskofInvasiveCarpDNA
ContaminationwithintheMidwestFisheriesCenter
eDNASecurityTeam:NicholasBloomfield,KenPhillips,JenBailey,MarkSteingraeber
ProjectLeaders:ScottYess,TerrenceOtt,EmyMonroe
SafetyOfficers:MarkSteingraeber,NikolasGrueneis,TerrenceOtt
EffectiveDate:April20,2014
ReviewDate(annually):April2015
Purpose:ThesharedlocationofthreeU.S.FishandWildlifeService(USFWS)Offices,LaCrosseFishand
WildlifeConservationOffice(LFWCO),LaCrosseFishHealthCenter(LFHC),andWhitneyGenetics
Laboratory(WGL)presentsauniquechallengetotheUSFWSEnvironmentalDNA(eDNA)Monitoring
Program.eDNAsampleprocessingisasensitiveprocess,inherentlysusceptibletocontaminationfrom
outsidesources.ProcessingofeDNAsamplesrequiresstrictadherencetolaboratoryhygieneandspecific
protocolsforreductionofriskfactorsthatcouldcausecontaminationofsamples.Sampleanalysisforthe
entireeDNAmonitoringprogram,currentlyincludingsamplesfromtheGreatLakesandMississippi
Riverbasins,isperformedattheWhitneyGeneticsLaboratory.Laboratorystaffminimizesriskby
followingproceduresdesignedtoreduceintroductionofDNAtothelaboratorythatmaybeonsurfaces
ofsamplepackages,samplebottles,clothingandfootwear.Tocompoundriskfactors,amissionoftheco‐
locatedLFWCOistomonitorinvasivecarppopulationsdirectly,whichincludescollectionofinvasive
carpandinvasivecarptissuesamples,aswellascollectingwatersamplesforeDNAanalysisatWGL.
Cross‐contaminationbetweeneDNAsamplesandgearandcarpsamplinggearcouldbeverylikelyif
protocolswerenotinplacetohelpstaffaddresscontaminationchallenges.Theco‐locatedLaCrosseFish
HealthCenteroccasionallyreceiveswholecarpsand/orcarptissuesamplesfordiagnosticfishhealth
cases,andmaintainsseveralinvasivecarptissuecelllinesforresearchpurposesaspartofitsmission.
MidwestFisheriesCenterstaff,collaborators,volunteers,andassociatedsamplecontainers,laboratory
andfieldequipmenthavealargepotentialforactingasvectorsofcontaminationbycarryinginvasive
carpDNAtoandwithintheco‐locatedfieldstationandindirectlytoWGL.Duetotheuniquechallenges
thatco‐locationoftheseofficespresents,stringentprotocolsmustbefollowedtopreventcontamination
ofwatersamplesduringcollection,samplereceipt,movementthroughthebuildingandsharedspaces,
andsampleprocessing.Followingtheseisolationanddecontaminationprotocolswillreduce
unintentionaltransferofinvasivecarpDNAtofacilities,samplinggear,eDNAwatersamplesandsample
containers,fieldandlabpersonnel,andothersurfaces.
Scope:Thisdocumentidentifieshighriskzonesformovementofpersonnel,collaborators,volunteers,
visitorsandfishortissuesamplesthroughoutthefacility,setsupcommunicationpracticesforpersonnel
tohelpcontainknowncontaminationriskssothattheymaybeisolatedandeliminated,andprovides
directionsfortheisolationanddecontaminationoffieldandlaboratoryequipment,samples,and
packages.
Responsibilities:USFWSemployees,collaboratorsandvolunteersareresponsibleforfollowing
proceduresoutlinedinthisdocumentandreviewingupdatestothisdocumentannually.Visitorswillbe
notifiedofproceduresapplyingtothespecificactivitiesoftheirvisit.
Definitions:
Invasivecarp=silverandbigheadcarp.
Establishedinvasivecarppopulations=waterswheresilvercarpareobservedjumping,oracommercial
harvestisoccurring.
G‐2
RiskZones:Thefacilityisdividedintozonesofcontaminationriskforpersonnelorequipment
dependentontheactivitiesthatmaytakeplacewithin(Figure1).




ZoneAistheareaofhighestcontaminationrisk.Thisareaincludesthegatedoutdoorareadirectly
infrontofthethreesouthgaragebaysborderedbyfencestothesouthandeast,andapathfrom
theentrygatetothisarea.Directcontactboats,vehicles,samplinggear,andnetsmaybestoredin
thisarea.Thiszonewillalsoserveasthedecontaminationareaforalltraditionalsamplinggear
andequipment.
ZoneBistheareawithamoderateorperiodicriskofcontaminationpresent.Areaswith
continuousmoderateriskincludethevirologylaboratory,thethreeLFWCOgaragebays,the
fisherieslaboratory,andthewoodshop.Invasivecarptissuecellsareculturedinthevirology
laboratoryandpresentacontinuousrisk.Aseptictechniquesareappliedtomethodsinalltissue
cellcultureprocedures,whichwillminimizeriskforescapeofDNAfromthislaboratory.In
additiontothesepractices,10%bleachorDNAawaywillbeappliedasneededtoequipmentand
laboratorysurfaceswhenworkingwithinvasivecarptissuecells.Predominatelydecontaminated
equipmentandgearwillbehousedinthegaragearea,fisherieslaboratory,andthewoodshop,
althoughinspecialcircumstancesdirectcontactgear,directcontactequipment,andinvasivecarp
ortheirpartsmaybepresent.Specificprotocolsareinplacetoreducecontaminationthreatsfrom
thesesources.Areaswithperiodicriskofcontaminationarethefrontdoorandreceptionarea
wherefishand/ortissuesamplesmayarriveforfishhealthdiagnosticcasesorresearchpurposes.
InthiscasediagnosticianswillremovesamplepackagestotheLFHChistologylaboratoryfor
processing.Specificprotocolsareinplacetocontaincontaminationthreatsandtocommunicate
riskstobuildingstaff.Intherarecasethatapartnerormemberofthepublicinpossessionofan
invasivecarpbringscarcass(es)intothebuildingthroughthefrontentranceforreporting,Center
staffwillcontaintheriskandnotifybuildingpersonnelofthespecificcontaminationpotential
associatedwitheachindividualcase.
ZoneCistheareawithalowcontaminationrisk.ThisareaincludestheinterioroftheLFWCO,
LFHC,theofficeandhallwayspaceofWGL,thenorthgaragebay,andtheremainderofthegated
parkinglotasidefromZoneA.Predominatelyonlydecontaminatedpersonnel,equipment,and
gearwillbehousedinthiszone.Underspecialcircumstances,contaminateddatasheets,
personnel,andinvasivecarportheirpartsmaybepresent.Specificprotocolsareinplaceto
reducecontaminationthreatsfromthesesources.
ZoneDistheareawherethereisaverysmallriskofoutsidecontamination.Thisareaincludesthe
laboratoriesofWGL.PersonnelandequipmententeringZoneDmustadheretostrictprotocols
priortoanduponentryorexittoreducethepotentialofoutsidecontaminationintothe
laboratory.
G‐3
B
B
B
Figure1.ZonemapoftheMidwestFisheriesCenterFacility.Zonesindicatethelikelihoodofinvasivecarp
DNAbeingpresent,fromA(red)thehighesttoD(blue)thelowest.
Movementofsamples,equipmentandpeople:Eachofficehasoutlinedspecificproceduresto
minimizecontaminationthreatsfortasksthatoccurwithinrespectiveprogramsandmaynotcarryover
totheotherco‐locatedoffices(seeproceduredetailsbelow).However,manytimestasksandgroup
projectsaresharedoroverlapbetweenoffices,sostaff,volunteers,andcollaboratorsmusthave
proceduresinplacethatencompassawidevarietyoftasksandprojectsthatfallintograyorshared
G‐4
areas.Allparticipantsmustbeawareofdecontaminationorriskminimizationproceduresthatapplyto
dailydutiesaswellassharedoroverlappingduties.Allstaff,collaboratorsandvolunteersare
responsibleforknowingRiskZonesandproceduresthatapplytoenteringeachriskzone.Staffisalso
responsibleformakingcollaborators,volunteersandvisitorsawareofproceduresthatapplytothemand
theircorrespondingactivities.Ifstafforvolunteersfromoneofficewillbeworkingintheworkspaceof
anotheroffice,orcollaboratingwithanotheroffice,theymustbefamiliarwithSOP’spertainingtothe
worktheyareperforming.Samplesandequipmentmustbehandledaccordingtoprotocols,nomatter
whoreceivessamplesorpackages,orwhichstaffmemberisusingtheequipment.Muchoftheequipment
inusefortheCenterisshared.Beawareofprocedurestofollowwhenborrowingorusingshared
equipment.
DecontaminationGearandPPE:Therewillbetwoseparatedecontaminationzones,withdedicated
equipmenttoremainineachzone.Onezonewillbeformediumtolowriskgear,andoneforhighrisk
gear.Cleansetsofpersonalprotectiveequipment(PPE)willbestoredincabinetsineachzone(or
nearby)thatincludebootcovers,Tyveksuits,labcoats,anddecontaminationchemicals(Virkon,etc).
ThisPPEshouldbewornwhiledecontaminatinggear,andthenremovedbeforereentryintolowrisk
areas.InZoneCofthegarage,a“clean”coldwaterpressurewasherwithattachmentsfordegreasing
detergentwillbeinstalledforusebyCenterstafftodecontaminatemediumtolowriskfieldequipment
andgearsuchaseDNAboatsandequipmentandboatsandequipmentusedinWildFishHealthSurvey
samplecollectionswhereinvasivecarppopulationsarenotestablished.Aduplicatesetof
decontaminationequipmentandPPEforusewithhighlycontaminatedboats,equipment,etcwillbekept
nearthehotZoneA.Donotusethisequipmentforlow‐contaminationequipment.Thisequipmentand
associatedPPEwillstayinZoneA.Keep“clean”and“dirty”equipmentseparateanddonotmoveoutside
oftheirappropriateRiskZones.BootcoversandTyveksuitswillbekeptatentrancesandtransition
areasforuseasneededtopreventtransferofDNAonsurfaces,boots,andemployees.
Communications:SpecificcommunicationsprotocolsforcertaintasksareoutlinedinSOP’s(below),but
manycommunicationsareessentialformaintainingtheintegrityofRiskZones,samples,packages,and
sharedspaces.PleaseinformCenterstaffofriskstheymaybecomeinvolvedintomakesuretheyare
awareandfollowappropriateprocedurestominimizerisk.InformProjectLeadersandtheeDNAand
BiosecurityTeammembers(NicholasBloomfield,KenPhillips,JenBailey,MarkSteingraeber)ofknown
orunusualrisksthatarenotcoveredinProcedureslistedbelow.Informstaffmemberswhowillbe
workingwithequipment,samples,orinareasthatmaybecomeaffectedofanyprocedurestheymay
followtoreduceDNAcontaminationandpreventspreadthroughoutthebuilding.Ifthismayalsoinclude
asafetyrisk,informSafetyOfficers(NickGrueneis,MarkSteingraeber,TerryOtt)aswell.
LaCrosseFishHealthCenterStandardOperatingProcedures:TheLaCrosseFishHealthCenter
(FHC)followsguidelinesestablishedintheAmericanFisheriesSocietyFishHealthSectionBluebook,
Section3:QualityAssurance/QualityControl,whichestablishesproceduresforhandlingsamples.The
sectionprovidesbasicguidancetopreventcontaminationinthelaboratoryandbetweensamples.
Althoughnottypical,theLaCrosseFHCoccasionallyreceiveswholeinvasivecarpsand/ortissuesamples
frominvasivecarpsasdiagnosticcases.TheLaCrosseFHCalsomaintainsseveralinvasivecarptissue
celllinesforresearchpurposes.TominimizethespreadwithintheMidwestFisheriesCenterbuildingof
DNAfrominvasivecarps,theLaCrosseFHChasadoptedadditionalproceduresforhandlinginvasive
G‐5
carps,tissuesamplesfrominvasivecarps,andinvasivecarptissuecultures.Procedurestobefollowedin
additiontothosedescribedinSection3oftheAFS‐FHSBluebookare:
1. LaCrosseFHCstaffwillprovidenotificationtoWhitneyGeneticslaboratorystaffthatinvasive
carpsand/ortissuesarebeingworkedwith.WGLstaffwilltakeappropriateprecautions.
2. AnywholeinvasivecarpsortissuesamplesfrominvasivecarpsreceivedattheLaCrosseFHCwill
beinasealedcontainer.Theexternalsurfaceofthecontainerwillbecoatedwithanappropriate
decontaminant(10%bleachorDNAaway)foraminimumof10minutespriortoopening.
Isopropanolandquaternaryammoniumproducts(LysolProfessional,Extra)arenotacceptable
decontaminantsforeliminatingDNA).
3. Wholeinvasivecarpswillbedissected/processedwithintheHistologyLaboratory(Room10)at
theLaCrosseFHC.Processedtissuesampleswillbedistributedtotheappropriatelaboratory(s)
forpathogenscreening.
4. LaCrosseFHCstaffwilldonappropriatePPEwhenworkingwithinvasivecarps,invasivecarp
tissues,orinvasivecarptissuecellculture.AppropriatePPEwillberaingear,Tyvek,orother
designatedclothing,andbootswhendissectinginvasivecarpsorprocessingtissuesfrominvasive
carps.LaboratorycoatsareconsideredminimumPPEandareonlyallowedfortissuecellculture
work,orotherlaboratoryworkinvolvingprocessedsamples(histopathologysamples,bacterial
isolates,etc.).LaboratorycoatsandotherPPEthatmaybecontaminatedwithinvasivecarpDNA
shouldnotleavethelaboratoryuntiltheyhavebeenwashed,decontaminatedordisposedof.
5. Immediatelyfollowingcompletionofworkinvolvinginvasivecarpsortheirtissues,LaCrosse
FHCstaffshalltreatalllaboratorysurfaces,equipmentandtoolswithanappropriate
decontaminant(10%bleachorDNAaway)foraminimumof10minutes.
6. PPEshallberemovedandplacedinappropriatelocationsfordisposalorcleaning.Employees
shallthoroughlywashtheirhandswithsoapandwater.
7. AnyLaCrosseFHCemployeethatworkeddirectlywithinvasivecarpsand/ortissuesfrom
invasivecarps,ormayhavepotentiallybeenexposedtoinvasivecarpDNA,shallnotenterZoneD
untilthefollowingday.
LaCrosseFishandWildlifeConservationOfficeStandardOperatingProcedures:Thefollowing
proceduresarespecifictoLaCrosseFishandWildlifeConservationOfficeprogramsandprojects.
SeparationofFieldEquipment:Toreducethethreatofcontamination,fieldcrewswillmaintaintwo
separatesetsofpersonalfieldsamplinggearincludingataminimumPFD’sandraingear:1)eDNA
samplinggearand2)Anyothertraditionalfieldapplications.EquipmentusedforeDNAsamplingversus
traditionalsamplingwillalsobemaintainedseparately:1)Onevehicleandoneboatwiththenecessary
associatedequipment(oars,fueltanks,toolbox,etc.)willbededicatedtoeDNAsamplingand2)
Remainingboats,vehicles,andothergearwillbedesignatedforanyotheruse.AlleDNAfieldequipment
(boat,vehicle,PFD’s,raingear,etc.)andsupplies(gloves,filters,centrifugetubes,etc.)willbehousedata
separatestoragelocation.Contaminatedtraditionalsamplingequipmentwillbepredominatelystagedor
storedinZoneA.Equipmentthathasbeendecontaminatedanddecontaminationsupplieswillbehoused
inZoneB.
DecontaminationEquipmentList:
G‐6
ThisdecontaminationequipmentwillbemaintainedseparatelybetweeneDNAsamplingand
traditionalsampling










Brushes
Waterpumpand/orbuckets
DNAAwayorequivalent
PaperTowels
GardenHose
GardenSprayer
Pressurewasherwithsteamoption
VirkonAquatic
>30gallondecontaminationtubs
PersonalProtectiveEquipment(PPE)
DecontaminationProcedures:
ProcedureA‐DecontaminationofeDNAsamplinggearandequipment:Thisprocedurerefersto
actionstakenpriortoleavinganduponreturningtothestationforcollectionofeDNAsamplesinthe
field.EquipmentdesignatedforeDNAgearandequipmentdecontaminationwillbeusedtoperformany
functionsrelatedtoeDNAsampling.ThisequipmentwillbehousedinZoneCofthegarage.This
proceduredoesnotprecludeadditionalprotocolsoutlinedintheQualityAssuranceProjectPlan(QAPP)
performedpriortoeDNAsampling.DuetothesensitivityofeDNAsampling,thismustbedonebefore
andaftereacheDNAsamplingtrip.
1. Priortoleavingonacollectiontrip,useDNAAwayorequivalenttodecontaminateanypersonal
itemsthatwillbeusedonthetrip(watches,sunglasses,etc.)
2. ParktruckandboatinZoneC.
3. Usepressurewashertorinsetruck(includingfloormats),boat,andanyassociatedequipment
capableofwithstandingahighpressurerinse(oars,fueltanks,toolbox,totes,etc.).Thiscould
includePFD’s,raingear,orbootsiftheywereheavilysoiled.
4. Fillapumpsprayerwith2%VirkonAquatic.
5. Sprayallsurfacesoftruck,boat,andotherequipmentuntilallsurfacesarecompletelysoaked.
Thesesurfacesmustbecoatedforatleast20minutes.Rinsewhencomplete.
6. Mixabatchof2%VirkonAquaticaccordingtorecommendationsinthedecontaminationtub.
7. DipPFD’s,raingear,boots,floormats,oars,oranyequipmentcapableofwithstandinga
prolongedsubmergencewithoutdamage.Allowtosoakfor20minutes.
8. AllowequipmenttoairdryonthedesignateddryingrackspriortoreturningalleDNAequipment
totheoff‐sitefacility.
ProcedureB‐MinimizeInvasiveCarpResidueTransporttoStation:Thisprocedurerefersto
returningfromsamplingthathasoccurredinwaterswithanyreportedinvasivecarpobservations.
1. Priortoreturningtothestation,usewaterpump,buckets,andbrushestoremoveasmuchblood,
slime,scales,sediments,etc.fromtheboat,equipment,andgearaspossible.
ProcedureC‐StorageorDecontaminationofTraditionalSamplingGearandEquipment:This
procedurereferstoreturningfromsamplingthathasoccurredinwaterwithanyobservedinvasivecarp.
G‐7
Equipmentdesignatedfortraditionalsamplinggearandequipmentdecontaminationwillbeusedto
performanyfunctions.ThisequipmentwillbehousedinZoneBofthegarage.Boats,vehicles,gearand
non‐enclosedequipmentthatwillbestoredinsidethefacilitywillbedecontaminated.Note:Gearand
equipmentfromnon‐invasivecarpinfestedwatersarestillsubjecttodisinfectionstandardspriorto
enteringadifferentbodyofwater.
1. ParkvehicleandboatinZoneA.TheseandanygearorequipmentmayremaininZoneAwithout
decontamination.
2. Personnelwearingdirectcontactclothesorshoes/bootsshouldnotproceedbeyondZoneB.
3. Gill/trammelnetswillbelaidouttodrywithinZoneA.Afterdrying,thesewillbestoredinZoneA
orenclosedwithlidsifstoringinZoneB.PriortoentrytoZoneB,theoutsideofthecontainerwill
bedecontaminatedinstep6ofthisprocedure.Fyke/mini‐fykenetswillbedecontaminatedinstep
6ofthisprocedurepriortostorageinZoneB.
4. Usehotpressurewashertorinsetruck(includingfloormats),boat,andanyassociatedequipment
capableofwithstandingahighpressuresteamrinse(oars,fueltanks,toolbox,totes,etc.).This
couldincludePFD’s,raingear,orbootsiftheywereheavilysoiled.
5. Mixabatchof2%VirkonAquaticaccordingtorecommendationsinthedecontaminationtub.
6. DipPFD’s,raingear,boots,floormats,oars,oranyequipmentcapableofwithstandinga
prolongedsubmergencewithoutdamage.Allowtosoakfor20minutes.Rinsewhencomplete.
7. Allowequipmenttoairdryonthedesignateddryingracks.
8. DecontaminatecleaningsuppliesintubandreplaceinZoneB
9. DatasheetsandclipboardswillbekeptinanenclosedcontainerwithinFWCOofficeswhennotin
useorintheFWCOlab.Afterhandlingsheetsfordataentryorverification,replaceintoenclosed
container,cleanworkareawithDNAAwayorequivalent,andwashhands.
ProcedureD‐NetMending:Thisprocedurereferstomendinggillnets,trammelnets,andfyke/mini‐
fykenetsthathavebeenusedinwaterswithanyknowninvasivecarpobservations.
1. Priortohandlingnets,personnelwilldonappropriatePPE(raingear,Tyvex,ordesignated
clothingandboots).
2. Whenpossible,mendingwilltakeplaceinZoneA.Whennecessary,mendingwilltakeplacewithin
thewoodshopsectionofZoneB.WhenworkinginZoneB,areawillbesectionedoffandlabeledas
aDNAhotzone.
3. NetswillbedecontaminatedviaProcedureC‐8inthesoutherngaragesectionofZoneB.
4. PriortoenteringZoneC,anyPPEwillberemovedandstoredwithinthelabeledhotzoneand
handswillbewashed.
5. Uponcompletionofnetmending,PPEandnetmendingtoolswillbedecontaminatedvia
ProcedureC‐8.
6. Removeanysolids(leaves,scales,algae,etc.)thathaveaccumulatedonthefloor.
7. Prepareasolutionofdecontaminateandmopfloor.
ProcedureE‐ReduceTransportofDNAContaminationbetweenZones:Thisprocedurerefersto
movementofpersonnel,gear,andequipmentthroughoutthefacility.Specificprotocolsmustbefollowed
toreducethelikelihoodofspreadinginvasivecarpDNAintozonesoflowerriskandultimatelyWGL.
1. PersonnelworkingwithdirectcontactcontaminatedgearinZoneAorBwillwearappropriate
PPE.PPEwillberemovedandhandswashedpriortore‐entryintoZoneC.
2. PersonnelenteringZoneDfromZoneCwillatminimumwashhandspriortoentry.
G‐8
3. ItisrecommendedthatpersonnelworkinginZoneDdonotenterZoneAorB.Ifitisnecessary,
theywillwearPPEtocoverfootwearandclothingpriortoenteringZoneAorBandremoveupon
exit.
4. Anypotentiallycontaminatedgearwillbedecontaminatedviaproceduresaboveorenclosedprior
toentrytoZoneCorD.
G‐9
WhitneyGeneticsLaboratoryStandardOperatingProcedures:Mostoftheproceduresperformedat
WhitneyGeneticsLaboratoryarespecificallyforeDNAmonitoringofinvasivecarpsandareincorporated
intotheQualityAssuranceProjectPlan(QAPP).Occasionally,dutiesareperformedeitherinadditionto
orinsupportoftheQAPP,orforprogramsnotrelatedtotheQAPPsuchasflowcytometricanalysisof
grassandblackcarpsamples.SamplesarealsooccasionallyprocessedatWhitneyGeneticsLaboratoryin
supportofresearchanddevelopmentoftheQAPP,orforotherUSFWSprograms.Thefollowing
procedureswillbefollowedinadditiontoQAPPprocedureswhileinsupportoftheeDNAprogram,
performingresearch,orduringdevelopmentofnewprograms.
1. Anystaff,collaborators,volunteers,orvisitorstotheWGLwhoarewearingclothingorfootwear
thathasbeenexposedtoanywaterwhereinvasivecarpareknowntoexistmustwearTyveksuits,
labcoats,glovesorbootcoversasappropriatebeforeenteringthelab.Theseareprovidedatthe
twomainentrancesatWGL.AnyWGLstafforassociatedmemberwhoisleavingthelaboratory
foranareaofknowncontaminationshouldbringPPEwiththemtominimizeriskofbecoming
contaminatedwhileoutsidethelab.Disposeofcontaminatedgearbeforere‐entrytothelab.
Changefootwearifpossible.
2. Whenreceivingsamples,equipment,orpackagesthatmaybecontaminatedwithinvasivecarp
DNA,wearappropriatePPEtohelpcontaincontaminationanddisposeofPPE,gloves,andboot
coversaftereachuse.Stayinreceivingroomanddon’tremovesamplesorassociatedequipment
toanotherroomuntilallsurfaceshavebeendecontaminated.
3. Spraysurfacesofcontainersorequipmentwith10%bleach(10minexposure)orDNAAwayand
wipesurfaceswithpapertowels.Removetostorageortoworkareawithinthereceivingroomfor
processing.
4. Whenworkingwithtissuesamplesfromgrasscarporblackcarp(i.e.,notsilvercarporbighead
carp)usebenchpapertodefineworkingspaceandkeepassociatedlaboratoryinstruments,etc,
confinedtoworkspace.Aftertaskiscomplete,decontaminateinstrumentswith10%bleach(10
min)orDNAAwayandwipeentireareawitheitherdecontaminant.Containcontaminatedwaste
productsinasealedwastebagandremovetotrashbin.
5. DecontaminatesurfacesofanysamplecontainerssavedforstorageinWGLbeforeremovingto
storageorothersampleprocessingrooms.
6. Directworkwithinvasivecarptissuecellsisimportantforpreparationofextractioncontrol
samplesfortheeDNAmonitoringprogramandsometimesforotherpurposes.Ifatallpossible,
performthisworkinborrowedlaboratoryspacefromLFHCoranotherappropriatespace.Wear
protectivegeartocontainDNAcontaminationduringsampleprocessing,use10%bleachorDNA
Awaybefore,during,andafterprocessingprocedures,anddisposeofcontaminatedPPE.Follow
allproceduresoutlinedforthelaboratoryspaceyouareworkingin.
Inadditiontostep‐by‐stepprocedures,itispertinentforallWGLemployeestofollowimmaculate
laboratoryhygienepractices:


Dedicatefootweartolaboratoryspace.ThisfootwearshouldnotbeworninRiskZonesAorBand
shouldbewornonlyinRiskZoneDifpossible.IfyoumustenterRiskZoneCduringtimesof
knowncontamination,wearbootcoverswhileworkinginthatareaanddisposeoflater.
Clothingorattireshouldnothavebeenexposedtoanypotentialcontaminationriskswithout
launderingbeforeenteringWGL.Thisappliestohats,jackets,boots,shoesandregularclothing.
Anyattirethathasbeenworninareasofpotentialriskmustbelaunderedusingdetergentor
decontaminatedwithDNAAwaybeforereturningtothelab.Ifyouhavebeensamplingforthe
G‐10


eDNAprogram,volunteeringwithotherprograms,recreatinginareasofknowncontamination,or
performingresearchdutiesdonotreturntothelabwearingthesameclothes.
Washhandswithcopiousamountsofsoapandwaterifyouhavebeenexposedtoinvasivecarp
DNA.
Beawareofanypotentialrisksthatmaynotbecoveredintheseprotocolsandinformteammates
ofanyconcerns.
G‐11
AppendixH
OriginalMethodsfrompreviousversionsofQAPP
H‐1
**Old2.2
EquipmentProcedureforCoolersandSampleBottles
(1) A10%bleachsolutionwithwaterwillbepreparedina3‐gallonlow‐pressuresprayerthatis
dedicatedtotheproject.Thebleachsolutionmustbepreparedimmediatelypriortouse,andeach
timedecontaminationactivitieswillbeoccurring.
(2) Removemudandotherbiologicalresiduesfromsurfacesbyrinsingandscrubbing.Equipment
surfacesmustbefreeofdebrisandothermaterialbeforedecontaminating.
(3) Sampletransportcoolerswillbedecontaminatedwithfreshlymade10%bleachsolutioninthelow
pressuresprayer.Usethelow‐pressuresprayertothoroughlycovertheinsideandoutsidesurfaces.
Allow10minofcontacttimebeforerinsingwithwater.Coolersmaybelefttoairdry,ordriedusing
cleanpapertowelswhilewearingcleangloves.
(4) Iffiltering:Sterilizeddisposable2Lbottlesmaybeusedforsamplecollectionor2Lautoclavable
reusablebottlessterilizedinthefollowingwaymaybeused:
(a)NEW2Lbottlesmaybeusedstraightfromthemanufacturer.Forsubsequentsamplingevents,
sendbottlestotheWGLforcleaning,andWGLwillreturncleanbottles(refertoAppendixD).For
samplingagenciesnotworkingwiththeWGL,followproceduresb‐ctoproperlydecontaminate
bottlesbetweenuses
(b)Ifthereisnoautoclaveavailable,usea10%bleachbathtodecontaminatesamplebottles.
1. Inanareafreeofcarp‐contaminationpreparea10%bleachsolutionandsoakbottlesandcaps
foraminimumof10minutes.Itisimportanttoensurethattherearenoairbubblesinside
bottlesorcaps,whichmayrequiretwo10‐minutesoaks,onewiththebottleuprightoneach
endoftheclosedbottle.
2. Rinseeachbottlebypartiallyfillingwithwaterandshakingvigorouslysothatallareasofthe
bottlearerinsed,repeataminimumofthreetimesperbottle,butbesuretorinseuntilthere
arenotracesofbleach.
3. Airdry,cap,andplaceinsanitizedcoolers.NOTE:Itisessentialtorinsewellsinceresidual
bleachwoulddestroyanyDNAcollectedandisaPCRinhibitor.
(c)Ifyouhaveaccesstoanautoclave,bottlesneedtoberinsedwellwithcleantapwaterand
autoclaved.
1. Rinsebottlesbypartiallyfillingwithcleanwater,shakingvigorouslywiththecaplooselyheld
overtheopening.Emptyandrepeataminimumoftwotimes.
2. Placethethreadedcapsonthebottlesandlightlyscrewoncap(capwillnotbeabletocome
off,butwillstillbeabletomove).
3. Placeintoautoclaveandsetcyclefor1hourat121°C(15psigor1bar).
4. Oncetheautoclavecycleiscomplete,carefullyremovebottlesandallowthemtocooltoroom
temperaturebeforefullytighteningcaps.Ifcapsaretightenedbeforeallowingthebottlesto
cool,thebottleswillwarpandcollapse.
Ifcentrifuging:purchasesterile,chemical‐freedisposable50‐mlpolypropylenetubeswith
maximumRCFofatleast6,000xg.Evensteriletubescanstillhavetracesofthechemicalusedto
freetheplastictubesfromthemetalformsduringproduction.Somemanufacturerssellsterile
tubesthatdonothavethisresidualchemicalinthem,andtheseshouldbeusedtoavoid
introducingPCR‐inhibitorsfromthesampletube.
H‐2
(5) Onceall2Lbottleshavebeensanitized,samplelabelscanbeprintedbythesamplingagency.
SamplecontainerswillbelabeledwithanuniquebarcodeIDoragencygeneratedcode(Section1.7
forcaseandsamplenumbering)thatdoesnotindicatelocation(toallowblindprocessing).Labels
willbeprintedonRite‐N‐Rain®orsometypeofwaterprooflabelsandaffixedtotheoutsideofthe
samplebottles/tubes.
(6) Oncebottles/tubeshavebeenlabeled,theywillbeplacedinthesterilizedsamplecoolersin
numericalorder.Samplecontainerswillbestoredinthesterilizedcoolersuntiluse,andwillbe
transportedonlyinthecoolers.AlthoughthesampleIDnumberofthesamplesisnotrelevant
exceptforidentificationpurposes,collectinginconsecutiveorderwillaidindeterminingwhere
samplesweretakenincaseofarecordingerror.
(7) Aminimumof10%ofthetotalnumberofsamplescollectedshouldbefieldblanks.Foroffices
workingwiththeWGL,allfieldblanksmustbefilledbyWGL.Forotheragencies,blanksmaybe
filledwithanycity‐providedtapwater(Ifwatersourceisawelloryouareunsureofthesource,use
distilledordeionizedwater).Iffiltering,aminimumofoneblankpercoolerisrequired,butmore
maybeincluded.Ifcentrifuging,collectblankstomeet10%oftotalnumberofsamplescollected.
Note,ifthesamplingdesignforyourparticularbodyofwaterrequiresaspecificsamplesizein
ordertomeetaprecisedetectionprobability,thencontainersforcontrolsamplestomeetthe10%
minimumwillhavetobeaddedtothetotalnumberofsamplecontainersdictatedbyyoursampling
plan.
**Old3.2
FilteringProcedure
Watersamplescollectedinthefieldneedtobefilteredwithin12–16hoursafterthelastfieldsampleis
collected.
Equipmentneeded:
















Manifolds(Millipore3‐placestainlesssteelHyrrosolManifold,item#XX2504735)
Magnetic500‐mlfilterfunnels(Pallitem#4238;VWRitem#28150‐496)
Glassfiberfilters,1.5micron,5.5cmdiameterglassfiberfilterpaper(Type934‐AH;Fisheritem
#1827‐055)
Forceps(microforceps)–atleasttwopair,labeledwithdifferentcolorsorotheridentifier
Carboy(3.5galorlarger),forwastewatergeneratedduringfiltering
Rubbervacuumtubing(14‐176‐24,1.25in.innerdiameter),doubleholestopper(Fisheritem
#14‐140P)thatfitscarboyopening,andglassconnectorsorplasticconnectors(Fisheritem
#509557177)forconnectingmanifoldtocarboyandmanifoldtovacuumline
Vaccumtrapflasktoprotectvacuumpumps(plasticisfine),singleholestoppertofitflaskand
tubingtofitflaskvent
Sterileconicaltubes(50mL)withcapsandlabels
Sterileconicaltubes(15mL)withcapsandlabels
Papertowels
Blackpermanentmarkers(e.g.,Sharpie®)
Powderlesslatexornitrilegloves
Vacuumsystemcapableof−75kPavacuum
Bleach
10%Bleachbathtosanitizefilterfunnels(useanyclean,potablewatersourcetomixbath)
Dedicatedlabequipmentcleaningsink
H‐3






Wastewaterdisposallocationsuchasnonspecified‐usesink
Sterilebenchpaper
Dedicatedwaterbottles,oneforbleachsolution,oneforDIwater
DIwaterforequipmentblanksonly
Washbinformanifolds,suchasadedicated10qtplastictub
Plasticsealablebags(e.g.Ziplock®)
3.2.1 LaboratoryPreparation
(1) Washhandsthoroughlypriortostarting.Prepareadedicatedplasticwashbottlewith10%bleach
solutionforwipingdownlabtablesandmanifoldsurfacespriortoprocessingsamples.Sanitizeall
equipment,infreshlymade10%bleachsolution,priortostarting.Collectallsupplies.
(2) Rinsedowneachworkstationwithbleachsolutionpriortobeginningthefiltrationprocess.Cover
eachworkstationsurfacewithsterilebenchpaperorcleanpapertowels.Benchpapermustbe
changedbetweensamples.
(3) Putonnewpowder‐freelatexornitrilegloves.Priortofilteringasample,eachworkstationshould
haveoneblackwaterproofpermanentmarkerforlabelingsampletubes(orpre‐printedlabels),one
sterile50‐mLandonesterile15‐mLplasticconicaltube,sterilefilterpaper,onesetofsterileforceps
forplacingfilterpaperonfilterapparatus,onesetofforcepsforhandlingusedfilterpaper,
dedicatedwashbottlewithfreshlymade10%bleachsolution.
(4) Ateachworkstation,connecta3‐placestainlesssteelfilterfunnelmanifoldtoalargecarboybottle
usingrubbervacuumtubing,two‐holestopper,andplastictubingconnector.Connectcarboybottle
toatrapflask,andthetrapflasktothevacuumlinewithsecondpieceofrubbertubing.Glass
connectorsmaybeusedinsteadifavailable.Note,atrapflaskshouldbebetweenthecarboyand
vaccumtoprotectthepumpfromdamageshouldthecarboygettoofull.
(5)Samplecontainersshouldbedriedtoremoveallexternalwatersothatnothingwilldripwhenthe
sampleisbeingfilteredortheycanalsothoroughlyrinsedanddriedcompletelybeforebeing
broughtintothetrailer.Ensurethereisnowatertrappedinthegroovesbetweenthecapsand
bottlesbytippingbottlesanddryingawayanywaterdrippingout.
3.2.2 SamplePreparation
(1) Putonnewpowder‐freelatexornitrileglovespriortohandlingeachsample.
(2) Removefirstsamplefromcoolerofcleanedsamplebottlesandmakesureitisdry.
(3) Labelonesterile15‐mLconicaltubeandonesterile50‐mLconicaltubewithsamplenumber;
indicatethatthefiltertobestoredinthe15‐mLtubeistheequipmentcontrolbylabelingthistube
witha“C”.Ensureglovesthatcomeintocontactwithlabelingmarkerarenotusedagainfor
handlingothersamples.Alternatively,labelsmaybepreprintedandusedforeachtube.
3.2.3 FilteringtheEquipmentControl
(1) Putonnewpowder‐freelatexornitrileexamglovespriortoprocessingeachnewsample.
(2) Placebottomportionofsterile(section3.2.6)magneticfilterfunnelequippedwithrubberstopper
onmanifoldandopenvacuumline.
H‐4
(3) Takedesignatedforcepsforhandlingcleanfilterpaper,removeonefilterandplaceonbottom
portionofsterilemagneticfilterfunnel.Oncethefilterpaperispositionedonthemagneticfilter
funnel,attachtheupperportionofthemagneticfilterfunnel(i.e.,thefunnel)tothebottomportion.
(4) Asterileandcleanmagneticfilterfunnelmustbeusedforeachsample.Thecleaningprocessis
describedundertheEquipmentandWorkAreaCleaningsection3.2.5.
(5) Oncethemagneticfilterfunneltopissecuredtothebottomportion,pour500mLofDIwaterthe
magneticfilterfunneltopasacontrol.InordertocaptureanypotentialcontaminantDNAinthe
funnel,besuretopourtheDIwaterquicklysoastoimmersealltheinternalsurfacesofthe
magneticfilterfunneltopwithDIwater.OncetheDIwaterhasbeenpouredintothefilterfunnel
top,turnthevacuumontodrawthewaterdownquicklyandfilterthematerialasquicklyas
possible.Repeatwith500mL.
(6) OncetheDIwaterhasbeenfilteredthroughthefunnel,removethefilterfunneltop,placeitonclean
benchpaperdedicatedforthatsample.Taketheforcepsdesignatedforthatsample’susedfilter
paperandgrasptheedgeofthefilterpaper.Rollorfoldthefilterpaperuntilitisofasizetofitinto
the15mLconicaltubelabeledasacontrolfortheappropriatesampleID.
(7) Placethecontrolfilterpaperintothe15mLtube,screwontop,andplacetubewithcontrolsample
filterpaperintocoldstorage.Ifworkisatalaboratory,usea−20°Cnon‐frost‐freefreezer,ifworkis
inamobiletrailer,placetubesintoacoolerfilledwithiceduringtheworkday.Ifusingacooler,be
suretouseacleansealablebagdesignatedforcontrolsamplesonlytokeepequipmentcontrol
samplesseparatedfromfieldsamplestoavoidanycontaminationwhileincoldstorage.Sealthe
plasticbagaftereachnewsampleisadded.Attheendoftheday,transferallofthetubestoa
coolerlinedwithdryice(replacedasneededtokeepsamplesfrozen).Thefreezerorcoolershould
besecured(i.e.,locked)ifsamplesareleftforanyperiodoftimeunattended.
3.2.4 FilteringtheSample
(3) Takedesignatedforcepsforhandlingcleanfilters,removeonefilterandplaceonbottomportionof
sterilemagneticfilterfunnel.Oncethefilterpaperispositionedonthemagneticfilterfunnel,attach
theupperportionofthemagneticfilterfunnel(i.e.,thefunnel)tothebottomportion.Avoid
touchingthefunnelbasewithcleanforceps.Ifforcepsaccidentallytouchthebase,getanewpairof
forcepsforhandlingcleanfilterpaper.Thesedesignatedcleanforcepsandtheboxoffiltersmust
bekeptinalocationfarenoughawayfromthefilteringareatopreventthemfrombecoming
contaminatedduringfiltering.Ifatanytimewaterisspilledorsplashednearthefiltersorforceps,
getanewboxoffiltersandanewpairofforceps.
(4) Takethesamplebottleandgentlyshaketodistributethecontentswithinthesampleevenly.
(5) Oncethemagneticfilterfunneltopissecuredtothebottomportion,turnonthevacuumandthen
pourapproximatelyone‐thirdofthesampleintothemagneticfilterfunneltop.
(6) Oncetheone‐thirdportionofthesamplehasbeenfilteredthroughthefunnel,continuefilteringuntil
thefilterisnearlydry.Removethefilterfunneltop.Taketheforcepsdesignatedforusedfilterpaper
andgrasptheedgeofthefilterpaper.Neatlyfoldthefilterpaperoncetofitintothe50mLconical
tubelabeledfortheappropriatesampleID.
H‐5
(7) Repeatsteps1–4atleasttwomoretimesoruntiltheentiresamplehasbeenfiltered.Afterallthe
samplehasbeenfiltered,DIwaterfromawashbottlemaybeusedtorinseanyparticulates
attachedtothesidesofthemagneticfilterfunnelontothefilterpaper.NOTE:sincethiswateris
touchingtheDNAsampleDIwaterisbetterthantapwater.
(8) Placethetubewithfieldsamplefilterpapersintocoldstorage.Ifworkisatalaboratory,usea
−20°Cnon‐frost‐freefreezer,ifworkisinamobiletrailer,placetubesintoacoolerfilledwithice
duringtheworkday.Useasealableplasticbagdesignatedforfieldsamplesonly,tokeepthe
sampletubesorganizedandseparatedfromequipmentcontrolsamples.Sealtheplasticbagafter
eachnewsampleisadded.Attheendoftheday,transferallofthetubestoacoolerlinedwithdry
ice(replacedasneededtokeepsamplesfrozen).Thefreezerorcoolershouldbesecured(i.e.,
locked)ifsamplesareleftforanyperiodoftimeunattended.
(9) Thenumberoffiltersusedtoprocessthesampleisuptothediscretionofpersonnelprocessingthe
sample,howeverintheDNAlab,filtersmustbeextractedoneatatime.Therefore,ifthewater
sampleexhibitsanexcessivelyslowfiltrationrate,multiplefiltersshouldbeused.Alsouptothe
discretionofthepersonnelprocessingthesampleistheamountofsamplewatertorunthrougha
singlefilter.Ageneralruleistorunone‐thirdofa2Lsamplethroughasinglefilter;however,ifthe
samplewaterisextremelyturbid,forexample,lesswatershouldbeputthroughafilter.Attheother
endofthespectrum,ifthesamplewaterisextremelyclear,morethanone‐thirdofa2Lsamplemay
berunthroughasinglefilter.Donotplacemorethan10filtersintoasingle50‐mLtube.Ifmore
than10filtersaregenerated,useadditional50‐mLtubes,makingsuretheyareclearlylabeledwith
thesampleIDandmakeanoteonthedatasheet.
(10) Onthefielddatasheet(Exhibit2)nexttotheappropriatesampleID,markthetime(useAMPMor
militarytimeforclarity)offiltercompletionandtheinitialsofthepersonthatprocessedthe
sample.
(11) Changeglovesandsterilizetheworkstationbetweensamples.Repeatsteps1–8untilallsamples
havebeenprocessed.
(12) Whenfiltering,ifthewatercollectioncarboybecomesfull,disconnectthecarboyfromthevacuum
andmanifoldanddispensewaterinasinkseparatefromtheoneusedtocleanequipment.Once
emptied,reconnectthecarboytothevacuumandmanifoldandproceedwiththefilteringprocess.
CAUTION:Besuretoopenmanifoldvalveandturnoffthevacuumairsupplywhen
disconnectingandconnectingthecarboysoastopreventexplosionoftheglass.
(13) Ifsampleisaccidentallyspoiledduringthefilteringprocess(e.g.,bleachwasusedtorinsefilter
funnelinsteadofDIwater,forcepsfromprevioussampleused,etc.),immediatelythrowaway
ruinedsamples.Ifportionsofthesamplearestillviable,placein50mLconicaltube.Ontheoutside
ofthesampletube,labelwiththeamountoftheviablesample(e.g.,2/3sample).Ondatasheet,label
withthesameinformation(e.g.,2/3sample)nexttoappropriatesampleID.Notethereasonforthe
ruinedordiminishedsample.
3.2.5 EquipmentandWorkAreaCleaningAfterFilteringEachSample
(1) Filla500mLglassbeakerwith10%bleachsolution.Forcepsdesignatedforusedfilterpapermust
beswitchedoutforeachsample.Usedforcepswillbeplacedinbeakerwith10%bleachsolutionfor
H‐6
aminimumof10minforsterilization.Oncesterilized,removeforcepsfrombleachsolutionand
rinsethoroughlybeforeuse.
(2) Fillatleasta10‐qtplastictub(e.g.,Rubbermaid®plasticstoragebin)with10%bleachsolution.
Onceasamplehasbeenprocessed,thefilteringapparatusmustbedismantled(i.e.,themagnetic
filterfunnelshouldbeseparatedintotheupperandlowerparts),rinsedtoremoveanyparticles
and/orfilm,andplacedintheplastictubwiththe10%bleachsolutionforaminimumof10minfor
sterilization.Ensuretherearenoairbubblespreventingthebleachsolutionfromfullycontacting
theentirefiltercupinterior.Oncesterilized,removethetwopartsofthemagneticfilterfunneland
thoroughlyrinsebeforeuse.Rinsingshouldcontinueuntilallresiduesandscentofbleachcanno
longerbedetected.
(3) Inbetweeneachsample,disposeofbenchpaper.Wipedownsurfacewith10%bleachsolution
usingwashbottleandpapertowels.CHANGEGLOVES!Coverworkstationwithnewbenchpaper.
IfanydeviationsfromthisQAPPoccurredduringwatersamplecollectioninthefieldorduring
processingofsamples,clearlydescribethedeviationsonExhibit16.Eveniftherewerenodeviations
fromtheQAPP,Exhibit16formsshouldbesenttotheeDNAProjectCoordinatorfollowingasampling
eventtosatisfyreportingrequirementsinsection1.6.Besuretonoteanychangesinpersonnelfromthe
pre‐tripplanonExhibit16whenthereportisfiled.
H‐7
**Old4.2ShippingFilters
(1) Iffilters:Corrugatedboxes(minimumouterdimensions12"X12"X12")withstyrofoamcooler
insertswillbepreparedforshipment.Thenumberofboxestopreparedependsuponthenumberof
samplescollected(e.g.,a120‐samplecollectionwillrequiremoreboxesforshippingthana50‐
samplecollection).Filteringequipmentcontrolsshouldbeplacedintoseparateplasticbagsduring
shipping,butcentrigugeequipmentcontrolscanbemixedinwithsamples.
Ifcentrifugetubes:Anyshippingcontainersthatwillholdthetubesandpreventdamagetothe
tubeswillwork.
(2) Forfiltersornon‐preservedcentrifugesamples:Thebottomofthecoolerswillbelinedwithsolid
blocksofdryice(approximately1–2inchthickness).Oven‐mitttypeglovesmustbewornby
personnelthatarehandlingdryicetoprotecthands.Ifblockdryiceisnotavailable,pelletsmaybe
used,butavoidpowderorflake.
(3) Forfilteredsamples:Removethe15mLconicaltubeswithcontrolfilterpaperfromsecure(i.e.,
locked)−20°Cfreezerandplaceinclean1‐galresealablebag(e.g.,Ziploc®).Multiplebagsmaybe
usediftheentiresampledoesnotfitinonebag.Sealovertheopeningofallbagsusedwithtamper‐
evidenttape(e.g.,EvidenceTape–NC9709516).Theindividualpackingthesamplesshouldsignthe
tape.Besuretoremoveasmuchairaspossiblefromallresealablebagsusedbeforesealing.
Besurebagsaresecuredsothattheyaretamper‐evident.Thereareseveralwaystodothis,here
aretwo:1)Closeandsealbags,removingasmuchairaspossible.Wraptamper‐evidenttapeor
cleartapearoundthebagintwoperpidiculardirectionssothatthebagcannotslideoutofthetape.
Ifyoudon’tusetamperevidenttape,besuretosignacrosswherethetapemeetsitselfwitha
permanentmarker.2)Closeandsealbags,removingasmuchairaspossible.Placetamperevident
tapeparalleltothebagseal,securingwiththree(3)staples.Thisoptiondoesnotallowforclear
tapewithasignature.
Whenambienttemperatureisabove60⁰F,moredryiceisneededforshippingthanwhenitis
cooler.Ifpossibleusebothblockandpelletdryicetoensuresampleintegritywhenshippingduring
warmweather.Placea~10‐lbblockofdryiceonthebottomofcooler.Placeabagofsampleson
theblock,layerapproximately1in.ofdryicepelletsontopofbagbeforeplacinganotherbaginthe
cooler.Repeatuntilonly2inchesofspaceisleftatthetopofcoolerandfillthespacewithdryice
pellets.Ifpelletsarenotavailable,useaminimumof20poundsofblockdryice.Leavethebottom
blockwhole,butbreakuptheotherblockanddistributeamongthebagsofsamples.Beforeclosing
thestyrofoamcooler,recordtheinsidetemperatureonthedatasheet(Exhibit2).Placethe
styrofoamlidontopofthesamplecontentsandsealwithtamper‐evidenttape,ensuringthetape
crossesthelidandbodyofthecooler.Iftamper‐evidenttapeisnotavailable,usepackingtapeand
signacrosswherethetapeoverlapsaswellasacrosswerethelidmeetsthebodyofthecooler.
**Old5.5*QiagenDNeasyKit(orequivalentkit)Procedureforfilters
(1)Removesamplesthathavebeendesignatedtobeextractedfromfreezer.
(2)Obtainonelyseandspinkitperfiltertobeextracted,openpackagesandorganizetubesinrack.
Labelbothcapsofeachtubeperfilter(onetubeperfilter).Youwillhavetimetolabeltherest(3
more1.5mLlabsuppliedMCT,onespinfiltertube,3Qiagencollectiontubes)duringthe1‐hour
incubation.BesureyouhaveaddedpositiveandnegativeextractioncontrolstoeacheDNAextraction
procedurebatch.
H‐8
(3)Add350µLATLtothetopofeachbaskettube.
(4)Add25µLproteaseKtotheATLineachtube.
(5)Removetheappropriatefiltersample,carefullytearofftheedgeofthefiltersothatitfitsintothetop
ofthebaskettube.OnlyonefiltercanbeextractedperMCT.Ifmorethantwoextractionsarerequired
foronesample,combineproductsintoasingletubeonceextractionshavebeencompleted(during
step17).BesuretopushthefilterdownintotheATL/proteinaseKmixture(useacleanpipettip),do
nottapthelysebasketsonthecounterorelsethebufferwillleakthrough.
(6)Placethebaskettubeintothecollectiontubeandincubateat55°Cfor1hour.Duringincubation,
labeltwomoreMCTs,andaspin‐columnassemblyforeachsample,andsetupthreeadditional
collectiontubespersample.Printlabelsforarchivedextracts.
(7)Removefromincubatorandcentrifugeat≥16,000xgfor1minute.Removetheassembly,archving
thefilteronlyuntilthecaseisclosed.Archivetubeandfilterat‐80°C,untilresultsarefinalized,then
dispose.
(8)Add375µLBufferAL.
(9)Add375µLethanol(96–100%moleculargrade).Mixthoroughlybyvortexing.Ifliquidgathers
aroundthelid,brieflyspintoreducecontamination.
(10)TransferabouthalfofthemixturebypipetintoaDNeasyMinispincolumnplacedina2mL
collectiontube.Centrifugeat≥6000xgfor1minute.Discardflow‐throughandcollectiontube.
(11)Transfertheremainingmixturebypipetontothesamespincolumnandplaceinanew2mL
collectiontube.Centrifugeagainat≥6000xgfor1minute.Discardflow‐throughandcollection
tube.
(12)Placespincolumninanew2mLcollectiontube.Add500µLBufferAW1.Centrifugeat≥6000xg
for1minute.Discardflow‐throughandcollectiontube.
(13)Placespincolumninanew2mLcollectiontube.Add500µLBufferAW2.Centrifugeat18,000xg
for3minutes.Discardflow‐throughandcollectiontube.Becarefultoavoidsloshingtheethanolin
thecollectiontubeupontothefiltercolumn.Itisimportanttopreventethanolfromtouchingthe
filterbecauseethanolisaPCRinhibitor.
(14)Transferthespincolumntoanew1.5mLor2mLMCT.
(15)Ifthereare8orfewerfilterspersample,elutetheDNAbyadding200µLBufferAEtothecenterof
thespincolumnmembrane.Incubatefor1minuteatroomtemperature(15‐25°C).Centrifugeat≥
6000xgfor1minute.Iftherearemorethan8filters,elutewithonly100µLBufferAEsothatallof
thereplicatescanbepooledintooneextractiontube.
(16)Discardthespincolumn,combinemultipleextractionsforasinglesampleifnecessary.Storethe
elutedDNAsamplesat−20°C.IfDNAistobeimmediatelyusedforPCR,keeponice.
**Old5.6
OriginalPCRProcedure(used2009‐2013)
(1) IfDNAsamples(extractionelutes)areremovedfromfreezer,noteonfreezer/ambientlog(see
Exhibits7‐9).Alsonoteonsamplelog(Exhibit6).
(2) Usepreprinted96‐wellplatemap(Exhibits12‐13)orbuildplatemapinLIMStodetermine
whichsampleswillbepipettedintowhichwells.Clearlymarkplateidentificationonbottom
edgeskirtofplate.Writeplateidentificationinformation(e.g.FY_case#_sample
H‐9
numbers_species_initials_date)inlabnotesLegiblelabelsforusewhileworkingmustbe
completetoallowforeasydown‐streamprocessinginthesequencinglab.
(3) MakesuresamplemapforeachplateisenteredintotheLIMSorattachedtolabnotesanda
signatureiswrittenacrossthemapandlabbookpage.
(4) FollowDNAamplificationprotocoldetailedbelow.
PrimersspecifictoeitherHypophthalmichthysmolitrix(SilverCarp)orH.nobilis(BigheadCarp)are
usedtoscreeneDNAsamplesandamplifyuniqueDNAsequencesineachspeciespotentiallypresent
intheeDNAsamplesbyPCR.ThePCRprogramsusedtoamplifytheextractedDNAarespecifictothe
primersetused.ThePCRprotocolhasbeenoptimizedtoutilizePlatinum®TaqDNApolymerase
(InvitrogenCorporation,Carlsbad,CA)intheeDNAscreening.IfotherbrandsofTaqareused,
optimizationoftherecipeandthermalprofilesmustbeexecuted.Eightreactionsaresetupforeach
sample,inadditiontonegative(DNAblank)andpositive(DNAextractedfromtissue2)controlsfor
eachmastermix.ThePCRreactionsarepreparedasfollows:
(1)
Wipelabbenchareawith10%bleach,75%Ethanol,orcommercialDNAsterilizationwipes.Also
wipedownworkareawithPCRhood.Usebuilt‐inUVlampstoradiatecleanroomfor30minprior
toPCRset‐up.
(2)
ElectronicpipettorsshouldbewipeddownwithoneofthesolutionsorwipeslistedinStep1.



 Inthecleanreagentroom,obtainallPCRmastermixreagents(usingonlythosethat
havenotexpiredandthathavebeentestedandfoundviable).
 10XPCRbuffer(comesinTaqkit)
 10mMequallymixeddNTPsolution(2.5mMpernucleotide)
50mMMg2+solution(concentrationinPlatinumTaqkit;usewhatcomeswithyourbrand)
 Species‐appropriateforwardprimer
Species‐appropriatereverseprimer
TaqDNApolymerase(weusePlatinum,butanyhot‐startTaqcanbeused)
 Sterilemoleculargradewater(commerciallysterileorMilliporefiltered,
autoclaved)
Allowreagentstothaw.DonotvortexprimersorTaqtooviolently.
(3)
Recordinlabnotebookthelotnumberofallreagentsused.
PreparePCRmastermixesincleanreagentroom.Themastermixvolumecanbeadjusted
accordingtothenumberofsamplestobeprocessed.Inordertomakesurethatmastermixdoes
notrunoutpriortosupplyingallthedesiredreactions(thismayoccurasaresultofminorerrors
orvariationsinpipettingvolumes),itisgenerallyhelpfultomakemorethanenoughmastermix
thanisneededforthedesirednumberofreactions.Forexample,makeenoughmastermixfor100
reactionswhenactuallypreparingfor96reactions.NOTE:Ifpositiveextractioncontrolsconsistof
adifferentspeciesofDNA,besuretomakeasmallseparatemastermixforthosesamplesanduse
primersspecifictothecontentofthecontrolsample.Negativeextractioncontrolsshouldbe
amplifiedwiththeSilverorBigheadCarpmastermix.
(4)
2
Extract from tissue using commercial DNA extraction kit (e.g., Qiagen DNeasy Blood & Tissue Kit), and manufacturer protocol. Run test PCR before relying on any DNA extract for eDNA assay positive controls. H‐10
(a) EachInitialPCR1Xreactionshouldcontain:
 2.5μL10XPCRbuffer
 0.5μLdNTP(10mMmixeddNTP)
 0.75μLMg2+solution(50mM)
 0.5μLforwardprimer(10µMworkingdilution)
 0.5μLreverseprimer(10µMworkingdilution)
 0.25μLPlatinum®Taqpolymerase(=1.25U)
 19.0μLsterilewater.
MovepreparedmixfromreagentroomintoPCRroom.
(5)
RemoveDNAextractsfromfreezerorfridge(filloutlogsasneeded),vortex(quicktouch)and
quick‐spindowntheextracttubes.TakethemintothePCRroom.Placethe96‐wellPCRplateonto
acleansurface,positionedfromlefttoright.
(6)
Filltheplatewellswith24µlPCRmix.Carefullypipette1µLofeachsampletobescreenedinto
eachwellofacolumn,changingthepipettetipbetweeneachsample.Eachcolumnofeightwells
shouldbefilledwiththesamesample(i.e.,eightreplicatespersampletobetested).Thefirst11
columnsofthePCRplatecantest11differentsamplesforonetargetspecies.Intothe12thcolumn,
pipette1µLofsterilewaterintothebottomthreewells(F,G,H)andpipette1µLofeachofthe
targetspeciespositivecontrolDNAintoeachofthetopfourwells(A,B,C,D).Leavetheintervening
well(E)empty.
(7)
PlacethepositivecontrolDNAbackintotheappropriate−20°Cfreezerandchangegloves
immediatelyinordertoreduceriskofcontamination.
(8)
PlacePCRfilmoverthePCRplateandpressfirmly(oruseanautomaticplatesealer)toensurethe
edgesofallwellsaresealed.Gentlytapafewtimesonthelabbenchtoensurethoroughmixingof
eachreaction.SpindowntheplateintheplatespinnertoensureallDNAisdowninthemastermix.
(9)
Placethe96‐wellPCRplateinthethermalcycler,closeandsecurelid,andselecttheappropriate
PCRthermalprogram(thermalcycleprogramsforSilverCarpandBigheadCarputilizedifferent
annealingtemperatures).ThethermalprogramsforthecurrenteDNAmarkers(Jerdeetal.2011)
bothconsistof:
 Initialdenaturationat94°Cfor10min
Followedby45cyclesof:
 94°Cfor1min,
 50°CforSilverCarpprogramor52°CforBigheadCarpfor1min
 72°Cfor1.5min.
Followedby:


finalextensionat72°Cfor7min
4°Choldtemperatureuntilplateremovedfromthermalcycler.
(10) RecordtheplateID,thermalcyclerunitorhead,plateorientation,andruntimesforthePCRplate
inthePCRlog(Exhibit10).
H‐11
(11) PlacecycledPCRplatesandproductindesignated20°Cfreezerforlong‐term(morethan
overnight)storage,inthedesignated4°Crefrigeratorforshort‐ormid‐termstorage(1–12hours).
Ifyouleaveforthenight,thethermalcyclersaresettoholdat4⁰Cforever.Removeplates
promptlyinthemorning.
(12) UndernocircumstancesshouldyouopenoruncoverPCRplatesthathavebeencycledinthePCR
room.Onlyopencycledplatesinthepost‐PCRrooms.
5.7 GelElectrophoresisofeDNAPCRAssays(originalmethodused2009‐2013)
5.7.1 Purpose
Onceamplified,theDNAsamplesshouldthenbesubjectedtogelelectrophoresisinordertovisualizethe
amplifiedDNA.ThismethodisusefulindeterminingthepresenceofDNAfromthetargetspeciesin
differentaquaticenvironments.
5.7.2 Source
PCRproductfollowingamplificationcanbetakeneitherfromcoldstorage(see#11above)ordirectly
fromthethermalcycler.
5.7.3 GelElectrophoresisAssuranceandChain‐of‐custody
ThisstageofDNAprocessingisparticularlysusceptibletopipettingerror.Itisalsohighlysusceptibleto
mislabelingand,consequently,confoundingofsampleresults.
Draworotherwiseproduceamapofwhichsamplewillbeelectrophoresedonwhichgelandinwhich
laneoftheselectgel.
Carefullypipettesamplessoastoavoid:
Injectingsamplestoincorrectwells.
PiercingthebottomofsamplewellsandlosingPCRproduct.
Spilloverfromadjacentwells.
Recordallsolutionbatchnumbersorname/dateidentificationforstocksolutions.Recordprecastgel
batchidentificationnumberifappropriate.
Centrifugeplates,striptubes,etc.beforeremovingfilmorcapsinordertopreventaerosolcross‐
contamination.
AnyrevisionstotheDNAamplificationprotocolmustbeapprovedbytheeDNAProjectLeader(and
documented)andincorporatedintoarevisedQAPP.
5.7.4 OptionAProcedure
Prepare2%agarosegelswithSB(sodiumhydroxideandboricacid)bufferandallowthegelto
polymerizeforaminimumof25–30minpriortoloadingsamples.Gelscanbepreparedatanytimeprior
toPCRorimmediatelyafterPCR.However,onceyoubeginloadingagelfinishloadingandrunthegel
immediately.
H‐12
TopreparePCRsamplesforgelelectrophoresis,transfer10µlfromeachwellofthe96‐wellplatetonew
wellsinanidenticallylabeled96‐wellplate.Add2µlofloadingdye(seerecipebelow)toeachwellwith
PCRproduct(loadingdye=500µl6Xloadingdye,500µlDMSO,1µlSYBRGreenI)
Placethe2%agarosegelintheelectrophoresischamberthatcontainsSBBufferandremovethegel
combs.Inthefirstwellofeachrowontheagarosegel,load100bpDNAladder/loadingdyemix.Next,
load10μLofeachsamplemixture(i.e.,eachPCRreactionandloadingdye),andnegativecontrolsintothe
remainingwells.Besure10µlofapositivecontrolPCRproductisinthelastlaneofeachrow.Run
electrophoresisat~250Vfor~45mindependingonmigrationtimesthroughthegel.Timesandvoltages
requiredtoruneachgelareapproximate(differentbuffersandhighercontentagarosegelswillrequire
differentruntimesandvoltages,usewhatworksinyourlab).
Besuretoannotatethegelloadingmapinthenotebookasyouobservethegelinthegeldoc.Interpret
positivesamplesandnotesuccessfulpositiveandnegativecontrolsoneachgel.Afterdocumentation
(5.8),disposeofgelinthegarbage.
5.7.5 OptionBProcedure
Pre‐cast2%E‐Gel®48gels(Invitrogen)areusedwiththeE‐Base™system(Invitrogen).
OpenE‐gelsandloadintothebases.
Removegelfromthepouch.Removecombfromthegel.
SlidegelintothetwoelectrodeconnectionsontheMotherE‐Base™orDaughterE‐Base™.Ifgelis
properlyinserted,afaninthebasebeginstorun,aredlightilluminates,anddigitaldisplayshows20
min.
Loadeachgelwithin30minofremovinggelfromthepouchandrunwithin15minofloading.
SelectingProgramonE‐Base™
ConnecttheDaughterE‐Base™toaMotherE‐Base™oranotherDaughterE‐Base™ifrunningmultiplegels.
SelectprogramEGbypressingandreleasingthepwr/prg(power/program)buttononthebase.
LoadingE‐Gel®48Gels
Load15μLPCRproductintoeachwellofanE‐Gel®48gel.Keepallsamplevolumesuniform.Loadwitha
multichannelpipettor.
LoadappropriateDNAladder(distinctbandsbetween0‐500bp)intofarleftwell(labeledM)and
positivecontrolPCRproductintothefarrightmarkerwell.Ensurethemarkersaltconcentrationis
similartothatofadjacentsamples(2%geluses100bpDNALadder).
Load15μLofsamplebuffercontainingthesamesaltconcentrationasthesample,orsterilewater,into
anyemptywells.
RunConditions
H‐13
Tobeginelectrophoresis,pressandreleasethepwr/prgbuttonontheMotherE‐Base™andDaughterE‐
Base™.Theredlightchangestogreen.
Attheendoftherun(signaledwithaflashingredlightandrapidbeeping),pressandreleasethepwr/prg
buttononthebasetostopthebeepingandflashingredlight.
Removegelcassettefromthebaseandanalyzeresults.
Note:ifagelisremovedbeforearuniscomplete,agelmustbereplacedandtheunitallowedtorunout
untilthetimercountsdowntozero.Thereisnooptiontoresetthebase.
5.8
eDNAGelDocumentationandStorage(originalmethodused2009‐2013)
5.8.1 Purpose
OnceeDNAgelshavebeenvisualized,theresultsmustbedocumented,interpreted(i.e.,scored),and
recorded.Insomecases,verylightbandsmaybevisible,makingscoringdifficult.Documentation,
labelingandsavingforsequenceconfirmation,andstoragearecriticalforlaterqualitycontrolreview.
5.8.2 Source
Followingelectrophoresis,agarosegelsshouldbeimmediatelydocumented.Followingdocumentation,
PCRproductsrequiringsequencingmustbelabeledandorganizedforsequencing.
5.8.3 GelDocumentationandStorageAssuranceandChain‐of‐custody
Becauseofthedifficultnatureofscoringsomeresults,carefulrecordsmustbekeptofallgelsandresults.
Theseresultsmustbemaintainedsoastominimizetheriskoftamperingordataloss.
Gelimagequalitymustbeassessedatthetimeimagesareobtained.Imagesshouldexhibitallbandson
gelsasclearlyaspossible,ifthisisnotpossible,itmustbenotedonthegeldatasheet(Exhibit14).Allgel
digitalimagefilesshouldbesavedandshouldbearchivedattheendofeachworkingday.Allgelimage
dataarereferencedtothesamplescasenumbertomakesuretheconsistencyofthesamplecustody.
GelscoredatashouldbeenteredandstoredintheappropriatedatabaseinanExcelfileandonthedata
sheetinthelaboratorynotebook,orinLIMS.
AllreportsshouldreviewedbytheeDNAProcessingLeaderbeforebeingreported.
Apapercopyofthereportshouldbeheldinthefilesfor5years.
Electroniccopiesofallreportsshouldbeheldfor5yearsorlonger,asspacepermits.
AnysubstantiverevisionstotheDNAamplificationprotocolmustbeapprovedbytheeDNAProcessing
LeaderandapprovedbytheeDNACoordinator.Anysuchchangesmustbeincorporatedintoarevised
QAPP.
5.8.4 Procedure
Afterelectrophoresisiscomplete,removecastingtraywithgelfromtheelectrophoresischamberand
placethegelontothegelscanner(BioRadMolecularimagerFX),selectDNAethidiumbromidestaingel,
setupscanningarea,andthenselect100micrometertostartscanningthegel.
H‐14
Alternatively,placethegelonaUVtransilluminatorequippedwithadigitalcamera,suchastheAlphared
Imager(CellBiosciences,Inc.),andcaptureadigitalphotographofthegel.
Afterthegelscanningisdone,properlylabelfilenameandsavethefileontheharddriveimmediately.
IfnotusingLIMS,printoutapictureofthegelimageandinsertintolabbook.Acopyshouldbekeptwith
theProjectLabBook.Besuretosignacrosstheprintoutandthelabbookpage.
5.9
GelInterpretation(originalmethodused2009‐2013)
5.9.1 Purpose
Onceagelisvisualized,thequalityoftheresultsandpresenceofpotentialpositivebandsmustbe
assessedinordertodeterminewhichsamplesneedtobefurtherassayed.
5.9.2 Source
Immediatelyfollowingthecessationofelectrophoresis,theagarosegelcontainingtheeDNAPCR
productsshouldhavebeenvisualizedoneithertheUV‐basedimagerorthelaser‐basedimager.Inboth
cases,thegelimageshouldbecaptured(savedtoharddisk)immediatelyandthenprinted.
5.9.3 GelInterpretationQualityAssuranceandChain‐of‐custody
Thepositivecontrolsshouldhavebrightbandsattheappropriatemigrationdistance(numberofbase
pairs),indicatingapositivereaction.
Nobandsatthetargetedsizes(~200bpsilver,~300bpbighead)shouldbeobservedinthenegative
controls.
IfanyoftheinitialPCRreactionsarepositive(i.e.,avisiblebandattheappropriatemigrationdistance),
theinitialsampleisdesignateda“presumptivepositive”.
Recordthenumberofpresumptivepositivereactionsforeachsamplebothinthegelelectrophoresislab
notebookandintheexcelfileonthelabcomputer.
Presumptivepositiveresultswillinitiateaseriesofresultsconfirmationmechanisms(seebelow).These
mechanismsincludescreeningthetransportandequipmentcontrols,andDNAsequencing.
Oncepresumptivepositivesaredocumented:
FillinthequalitycontrolresultsintheeDNAsamplelog(Exhibit6).
NotifiytheeDNAProcessingleader.
ColorintheplatesealabovethewellscontainingpresumptivepositivesamplesonthePCRproductplate.
Moveallplatesrequiringsequenceconfirmationintothefreezerinthesequencingroom.Plateswithout
positivescanbediscarded.
5.10 ConfirmationofPositiveResults(originalmethodused2009‐2013)
5.10.1Purpose
H‐15
TheseconfirmationmechanismsareinitiatedifasamplereturnsasapositiveforthePCRtest(any
numberoftheeightreactions,e.g.,oneofeightuptoeightoftheeightPCRreactions).
5.10.2Source
PositiveresultsforAsiancarpeDNArequirethatthosepositivesamplesbefurtherassayed.Theoriginal
DNAelutesfromsamplesshouldbelocatedindesignated−20°Cfreezer.
5.10.3GelInterpretationAssuranceandChain‐of‐custody
Presumptivepositiveassays(PCRreactions)arevalidatedthroughDNAsequencingandtestingof
additionalcontrolsamples.
AnyrevisionstotheDNAQA/QCamplificationprotocolmustbeapprovedbytheeDNAProcessing
LeaderandapprovedbytheassignedUSFWSseniorexecutive.Anysuchchangesshouldbeincorporated
intoarevisedQAPP.
5.10.4Procedure
ConductPCRassaysofthepairedequipmentcontrolforeachpresumptivepositive.DNAextraction,
amplification,documentation,andinterpretationfollowingprotocolsdetailedabove(Sections5.6–5.9).
Ensurethatthetransportblanks(see2.2.2(6)and2.3.2(10))havebeentestedforthatsamplegroup
(i.e.,fromthesamecoolerinwhichthepresumptivepositivesamplewastransported).
Forallpresumptivepositivesamples,bidirectionalsequencingconfirmationisperformed.Thisisdoneby
usingacommerciallyavailablegelextractionkit(e.g.,QiagenQiaquickGelExtractionkit)perthe
manufacturer’srecommendationsonthepositivePCRreactions,orE‐Gel®CloneWellAgaroseGels
(Invitrogen)permanufacturer’srecommendation.
Iftheequipmentcontrolandtransportblankstestnegative,thesampleisdesignateda“confirmed
positive.”
Thefollowingsequencingreactioncanbedoneeitherbycloning(TATOPOcloningkitusedfor
sequencingpermanufacturer’srecommendation)thensequencing,orbyadirectSangersequencing
method(ABIBigDye®Terminatorv3.1orv1.1CycleSequencingKit)modifiedbyWGL.BigDye
TerminatorReactionMasterMixfor1Xreaction:
1µLBigDyeterminatormix,
4µL5Xreactionbuffer,
0.8µLeitherSC/BHforwardprimer,and
10.2µLofwater.
Add16µLofmastermixtothe4µLofpurifiedDNA.Totalreactionsizeis20µL.
Thepositivecontrolreactionofsequencingwasdonepermanufacturer’srecommendation.
ForeachpGEMcontrolPCRmastermix:
H‐16
1µLBigDyeterminatormix,
4µL5Xreactionbuffer,
2µLm13primer,
8µLwater,and
2µLpGEM.
Add20µLtoeachcontrolwell.
PlacethePCRplateonthethermalcyclerandbegintemperaturecyclingprotocol.Programthethermal
cyclerasfollows:25cyclesof[96°Cfor10sec,50°Cfor10sec,60°Cfor4min],thenrampto4°C.
Option1:TocleantheBigDyereactionwithEDTAprecipitation:
Spinplateafterremovingfromthermalcycler(justtomakesurethateverythingisatthebottomofthe
well).
Add5µLof125mMEDTAtoeachwell.
Add60µLof100%EtOH.
Sealtheplateandmixbyinvertingfourtimes.
Incubateatroomtemperature(RT)for15min.
Spinplateat3000xgfor30min(at4°C)orat2000xgfor45min.Proceedtonextstepimmediately.
Inverttheplateandspinat185xgfor1min(timefromwhenrotorstarts).
Add60µLof60%EtOH.
Spinat1650xgfor15minat4°C.
Invertplateandspinat185xgfor1min.
Resuspendsamplesin20µLHi‐Dye.
Option2:TocleantheBigDyereactionwithSephadexinCentri‐SEPspincolumnsorMillipore
plates,usecolumnsfor1‐16samplesandplatesfor17ormore.
Centri‐SEPcolumnprocedure
Materialslist:
Spincolumns(preloadedwithdrysephadex,caps,andbottomcaps),onepersample
H‐17
Pipetsandtips
CentrifugewithMCTrotor
Reagentgradewater
Labeled1.5‐mLMCTandtuberack
Vortexer
ColumnHydration
Tapcolumnoncountertosettlesephadexgelintothebottom.
Removecapandadd800µlsterileddH2O.Replacecap,invert,andmixwellonvortexer,ensuringallgel
ishydrated.Invertagain,vortexandplaceinrack.
Letsit30minutesatroomtempinatuberack.
Whilecolumnssit,label1.5mlMCTwithsamplenamesforcollectingcleanedproduct.
Removeexcesswater
Checkeachtubeforbubbles,iftherearebubblesinthegel,invertthetubesandvortexsoalltheslurry
movestowardthecap.
Invertandgentlyplaceintuberack,allowinggeltosettle.
Removecaps,thenbottom,andplacecolumnincollectiontubetodrain.
Allowtodrainuntilabout200‐250µlwaterhasdrained.Ifneeded,gentlyapplypressurewithagloved
fingertogetthewaterdraining.
Discardfluid,replacecolumnincollectiontube.
Placecolumnsintocentrifuge,makingsuretheindicatortabsareup.
Spinat750xg(rcf)for2min
Discardthecollectiontube,blotanywateroffthebottomofcolumnsandplacecolumnintolabeled
samplecollectiontube.
Sampleprocessing
Holdthecolumnuptoeyelevel,andcarefullyplaceallofthecyclesequencingproductontothecenterof
thepackedcolumn,beingcarefultonotdisturbthecolumn.Don’ttouchthesideofthecolumnwiththe
productorthepipettip.
Placecollectiontubeintocentrifugewithcapsopenandfacinginwardandtheindicatortabofthecolumn
facingup.
Spinat750xg(rcf)for2min.Discardspincolumn.
H‐18
Ifyouhavemorethan32samples,youmustdryfiltratesinthespinvacat~60*for~45minutes.Once
dry,youmayfreezeforuptotwoweeksorgodirectlytoanalyzingonthesequencer.Ifyouhave32
samplesorless,youmayrunthosedirectlyonthesequencerintheelutionwater.
Milliporeplatesephadexprocedure
Materialslist:
Milliporefilterplatewithcentrifugealignmentframe
Plain96‐wellplatetocatchwastewater(canreusethesameone)
Sequencingplate(withbarcode)
SephadexG50‐fine
Milliporecolumnloaderandtray
Centrifugewithplaterotor
Reagentgradewater
Preparesephadexplate:
Pourdrysephadexintotheblackmetalloadingplatewhichisintheplasticcatchmenttray.
Usetheclearsqueegeetoleveleachwellyouneedforcleanup(tapeoffunusedwells).
Scrapeexcesspowderintothecatchmenttraysoyoudon’twastetoomuchsephadex.
Invertamultiscreenplateoverthemetaltrayandholdthemtogetherwhileyouinvertthetraytofillthe
wellswithsephadex.Makesureyouarefillingthewellsyouwishtouse!Tapgentlytomakesureallof
thesephadexmovesintothefilterplate.
Pourexcesssephadexfromthetraybackintothesephadexcontainerandcaptightly.
Add300µlofwatertoeachwelloftheplateandletsit3hoursatroomtemp.(theseplatescanbe
preparedaheadoftime,wrappedtightlyinplasticwrap,placedinaTupperwarewithamoisttoweland
refrigeratedfortwoweeks.)
Removeexcesswaterandpackcolumnspriortouse:
Placethefilterplateoveraplain96‐wellplasticplate,andloadintotheplaterotor.Don’tusetheinterior
lidbecauseitdoesnotfitoverstackedplates.
Centrifugeat910xg(rcf)for5min.
Dumpthewastewaterintothesinkandrinsecatchmentplate(setasideforanotheruse).
Cleansequencingreactionswiththecolumns.
H‐19
Usethemultichannelpipettocarefullyaddreactionstothecenterofeachcolumn.
Placethefilterplateovera96‐wellsequencerplatemakingsurewellsA1arealigned.
Centrifugeat910xg(rcf)for5minutes.
Dryfiltratesinthespinvacat~60⁰Cfor~20minutes.Youmaysealplateandfreezeforuptotwoweeks
orgodirectlytoanalyzingonthesequencer.Ifyouhave32samplesorless,youmayrunthosedirectlyon
thesequencerintheelutionwater.
Oncesamplesaredry,add15µlHiDitoeachsample.SamplesinHi‐Dyecanbestoredat4°Covernight,
butmaynotbeleftanylongerthan12hours.
Tosequence:
DenaturesampleswithHiDifor5minat95°Cinthermocycler(donotdenaturesamplesrunwet)
Placeimmediatelyonice
Loadintosequencerplateandontosequencer.
ResultingsequencingreactionsthataresuccessfularescreenedinGenBank
(http://www.ncbi.nlm.nih.gov/blast)usingtheBLAST(BasicLocalAlignmentSearchTool)algorithm.If
theresultingsequenceisapositivematchtothetargetedspeciesofAsiancarp,thesampleisdesignateda
“confirmedpositive–sequenced”.
References:UserManual,“BigDye®Terminatorv3.1CycleSequencingKit”
http://www.ibt.lt/sc/files/BDTv3.1_Protocol_04337035.pdf
“TOPOTACloning®KitforSequencing”http://tools.invitrogen.com/content/sfs/manuals/topotaseq_man.pdf
“QIAquickGelPurificationKit”
http://molecool.wustl.edu/krolllab/Kroll_Lab_Protocols/Molecular%20Biology%20protocols/Cloning%20protocols%20fold
er/Gel%20extraction‐Qiagen.pdf
H‐20
**OLD5.5.4 PowerWaterProcedureforfilters
(9) Removesamplesfromfreezeriffilters,noteonfreezerandsamplelogs(seeExhibits7‐9).
(10) BesureyouhaveaddedpositiveandnegativeextractioncontrolstoeacheDNAextraction
procedurebatch.
(b) Beforeproceedingwithextraction,apositivecontrolfilterispreparedbypipetting300µlofa
mixedslurryofhomogenizedSilverandBigheadcarptissueorcellsdirectlyontoasterilefilter
paper.Alternativespecies(e.g.–sturgeon)maybeusedasthepositivecontroltoreduceriskof
samplecontaminationfromcarptissue.AlternativespeciesmusthavePCRprimersthat(1)do
notcross‐reactwithcarpDNAand(2)canberunonthesamethermocyclersettingsascarp
samples.
(c) Additionally,anextractionnegativecontrolsampleshouldbepreparedbyplacinganewfilter
paperinanewsterile1.5mLmicrocentrifugetube(MCT)andpipetting300µlofsterilelabDI
waterdirectlyontothefilter.Abatchofextractionblankscanbepreparedinadvanceandkept
frozenat−20°C.
(d) Foreveryextractionbatchoffiltersamplesprocessed,conductDNAextraction(below)onone
frozen,sterileextractionnegativecontrolfilterandonepreparedpositivecontrolfilter.
(11) Forallsamplesandcooler,equipment,andextractioncontrols,followtheDNAextractionprotocol
detailedbelow.Foreachfilter,youwillneedonespincolumnand41.5/1.7mllabsuppliedMCT
and5Powerwatercollectiontubes.
ThisDNAextractionutilizesthePowerWaterDNAIsolationKit(MoBioLaboratories,MoBioInc.)
andtheprotocolisadaptedfromthemanufacturer’sprotocol
(http://www.mobio.com/images/custom/file/14900.pdf).
(a)PlaceSolutionPW1ina55°Cwaterbathfor5–10mintodissolveanyprecipitatesthathave
formedatroomtemperature.RemoveSolutionPW1fromthewaterbathimmediatelypriorto
use.
(b)Removetheappropriatefiltersamplefrom−20°Cfreezerandtransferthe ilter(s)toalabeled
5mLPowerWaterBeadTube.IfDNAwillbeextractedfrommultiplefiltersamples,continueto
removeeachfiltersamplefrom−20°Cfreezerimmediatelypriortofiltertransfer.Each
PowerWaterBeadTubewillholduptotwofilterspersample.Ifanyfilteredwatersamples
requiredmorethantwopiecesoffilterpaper,splitthefiltersintotwoperPowerWaterBead
Tube.
Note: Changeglovesbetweenthetransfersofeachsampletoavoidcross‐contaminationof
samples.
(c)Add1mLofSolutionPW1tothePowerWaterBeadTubeandsecurethecaptightly.Mountthe
tubeonavortexadaptor(MoBioInc.)andvortexonhighfor5–10min,oruntilthecontentsof
thebeadtubeappearliquefied.Timescanvarydependingonthenumberoffilterpapersbeing
extracted.Abeadbeatercanbeusedonalargebatchofbeadtubesifavailable.
(d)Centrifugethetubesat4,000xgfor8minatroomtemperature.Ensurecentrifugeisbalanced
beforecentrifuging.Transfer650‐800µlsupernatantusinga1mLpipettetoalabeled1.7mL
labsuppliedMCT.
H‐21
(e)Centrifugetubesat13,000xgfor1minandcarefullytransfer650µlofthesupernatantwitha
pipetteintoanewlabeled1.7mLlabsuppliedMCT.Besuretoavoidanybeadsorfilterdebris.
(f) Add200μLofSolutionPW2,vortexbriefly,andincubateat4°Cfor5min.Itshouldappear
cloudy.
(g)Centrifugethetubesat13,000xgfor1minandcarefullytransfer650µlofthesupernatant
withapipetteintoanewlabeledlab‐supplied1.7mLMCT.
(h)Add650μLofSolutionPW3andvortexbriefly.Load650μLofsupernatantontoaspinfilter,
placespinfilterintoaMoBio2mLtubeandcentrifugeat13,000xgfor1min.Discardtheflow
throughandcollectiontube.PlacespinfilterintoanewMoBio2mLtubeandloadanother650
µl,centrifugeandrepeatuntilallthesupernatanthasbeenpassthroughthespinfilter.
(i) PlacethespinfilterbasketintoanewlabeledMoBio2mLcollectiontubeandadd600μLof
SolutionPW4.
(j) Centrifugethetubesat13,000xgfor1minanddiscardflowthrough.Placespinfilterina
new,labeledMoBio2mLtube.
(k)Add550μLofSolutionPW5andcentrifugeat13,000xgfor1min.Discardflowthrough,place
spinfilterintoanewMoBio2mLlabeledtubeandcentrifugeagainat13,000for2min.Be
surealltracesofEtOHaregone.
(l) Placethespinfilterintoanewlabeled1.7mLlabsuppliedMCTlabeledwiththesample
identificationnumber.
(m)Add100μLofsterilewater(autoclaved,de‐ionized)tothecenterofthewhitefilter
membrane,letitsitfor1‐2minutes,thencentrifugeat13,000xgfor1min.
(n)DiscardthespinfilterandstoretheelutedDNAsamplesat−20°C.Ifmorethanoneextraction
tubewasrequiredforasinglesample,combineallreplicatesintoonefinalextractiontube.
DNAextractionelutesshouldbeplacedintoadesignatedfreezerforovernightorlongerstorage,or,if
usedforPCRwithin1‐4hours,storedintherefrigerator.Makenoteofsampleadditiontofreezerlogif
necessary(seeExhibit7).Notecompletionofextractiononsamplelog.
H‐22
OLDAppendixD:SampleBottleManagementPlan
TheWGLstudytestingusedsamplingdemonstratedthatsamplebottlescanbereusedforeDNA
sampling,butrecommendationswereforimplementationofadecontaminationspecialisttooverseeand
confirmthatdecontaminationwasconductedaccordingtotheQAPP.TheRegionalOfficehasdecided
thatWGLwillserveasthesingledecontaminationfacilityfortheAsiancarpeDNAmonitoringprogram.
WGLwillcleanandpreparebottlesaccordingtotheQAPPandstoretheminthelabinacleanroom.WGL
willpackagebottlesaccordingtothefollowingprocedure,andsendthemasneededtothefieldoffices.
Emptybottlesforfieldsamples:
(1) NewcardboardboxesandplasticlinerswillbepurchasedbyWGL.Boxeswillbeassembled
asneededandlinedwiththeplasticbags.
(2) Cleanedandautoclavedbottleswillbesecurelyclosedandplacedinthebag.
(3) Bagswillbesealedwithtamperevidenttape,boxessealedandshippedtofieldstations.
Water‐filledfieldblanksmayneedtobesentseparately,butalleffortswillbemadetoget
fieldblanksdistributedattheannualtrainingmeetingeachspring(ifitisheldinLaCrosse).
(4) Fieldstationswillreceiveboxes,storesealeduntiltheyarereadyforlabeling.
(5) FieldstationswillpreparecoolersaccordingtotheQAPP,inascleanofanareaaspossibleat
thestation.
a. Anytimeboxesareopened,staffshouldbeincleanclothesanduseanewpairofclean
glovesforactuallyhandlingthebottles.Forexample,youmayopentheboxwithun‐
glovedhands.Then,putonglovestoopenthebagandtouchthebottles.
(6) Oncecleancoolersareready,boxesmaybeopened,bottleslabeled,andplacedintoclean
coolers.
(7) Afteruse,fieldstaffcanusethesamebagandboxtoreturnthebottlestoWGL.
Cooler(field)blanks:
(9) PlasticbagsfittoholdonecontainerwillbepurchasedbyWGL
(10) CleanedbottleswillbefilledwithreverseosmosistapwateratWGLandautoclaved.
(11) Aftercooling,bottleswillbesecurelyclosed,andplacedinthebag.
(12) Bagswillbetwistedclosedwithwireclosures.
(13) FilledbottleswillbedistributedattheannualfieldtrainingmeetingheldatWGLsothat
eachfieldstationwillstartouttheseasonwiththetotalestimatednumberoffieldblanks
neededforthesamplingseason.
(14) Fieldstationscanstorethesepreparedfieldblanksaslongasneeded,becauseaseach
bottleiswrappedindividually.
(15) FieldstationswillpreparecoolersaccordingtotheQAPP,inascleanofanareaaspossible
atthestation.
a. Anytimeboxesareopened,staffshouldbeincleanclothesanduseanewpairofclean
glovesforactuallyhandlingthebottles.Forexample,youmayopentheboxwithun‐
glovedhands.Then,putonglovestoopenthebagandtouchthebottles.
(16) Oncecleancoolersareready,boxesmaybeopened,bottleslabeled,andplacedintoclean
coolers.
(17) Afteruse,fieldstaffcanusethesamebagandboxtoreturnthebottlestoWGL.
WGLwillhavedesignatedshelvesinthegarageforboxesofdirtybottles.
Anoteonlabels:We’vefoundsomegreatlabelsthatwithstandallsortsofabuseandareavailableon
GSA.Averylaserwhiteweatherproofaddresslabels#5520.
H‐23
AppendixI
InternalReportbyWhitneyGeneticsLab
I‐1
ValidationofIBIScientificandQiagenDNAextractionkitsforuseintheearly
detectionandmonitoringofinvasivecarpusingenvironmentalDNA
Kyle M.Von Ruden, Nicholas M. Berndt , Emy M. Monroe: US Fish and Wildlife Service, Whitney Genetics
Laboratory
Introduction
EnvironmentalDNA(eDNA)hasbecomeincreasinglyusedasasurveillancetooltomonitorforthe
geneticpresenceofaquaticinvasivespeciesorthreatenedandendangeredspecies(Jerde2011).
EnvironmentalsamplesgenerallyhavelowlevelsofthetargetspeciesDNA(Dejeanetal.2011),thusitis
criticaltohaveminimallossofDNAduringprocessinginthelab.
OnceaneDNAwatersampleiscollected,theorganicmatteristypicallyconcentratedbyfilteringor
centrifugation.ExtractionoftotalDNAfromfiltersorpelletisthefirststepinworkflow.Detectionof
targetDNAinthesampledependsonthequantityandqualityofDNAwhichisextractedfromthefield
sample.CommerciallyavailableextractionkitsmayvaryinthequantityandqualityoftargetDNAcopies
availableattheendofextraction,soitiscriticaltobeabletomaximizebothaspectsofextraction.
Extractionisatime‐consumingstepinthelab,especiallywhentherearethousandsofeDNAsamplesto
beprocessed,andthisstepisoftenthe“bottleneck”inprocessing.Inadditiontolabortime,other
considerationsinchoiceofextractionkitsarecostandtheabilitytopurchaseindividualreagentsor
piecesofeachkitasneededtoavoidwasteofkitcomponents.CurrentprotocolsusedintheWhitney
GeneticsLabfortheprocessingofeDNAsamplesintheearlydetectionandsurveillanceofbigheaded
carpsisoutlinedingreatdetailintheQualityAssuranceProjectPlan(QAPP).Originally,theQAPPcalled
foruseofMoBioPowerWaterkitsforextraction,butin2013afterarigourouscomparisonstudy
conductedwithtwootherlabs,QiagenDNeasyBloodandTissuekitswereapprovedforextraction
(Ambergetal.inpress).ThepatentonQiagenkitsrecentlyexpired,andIBIScientificcreateda“copycat”
kitcalledthegMAxminikit,whichusesthesamechemicalbuffersandDNA‐bindingmembranesinaspin
kitastheQiagenversion.TheIBIkitislesscostlyat2.1centspersamplecomparedto2.7centsper
sample,andIBIwillsellthespincolumnsseparatelyunlikeQiagen.Thisishelpfultoreducereagent
wastebecausethereareoftenleft‐overreagentsthatcan’tbeusedbecausethespincolumnsareusedup
first.
TheobjectiveofthisstudywastodeterminewhethertheIBIkitisasgoodasorbetterthantheQiagenkit
bycomparingcopiesoftargetDNAfoundinthreedifferenttypesofsamples.Inordertoavoid
unnecessarycontaminationoftheeDNAlabwithAsiancarpDNA,bluegillDNAwasassayedwithreal‐
timequantitativemarkers(qPCR)(Takaharaetal.2003)afterextraction.
Methods
Threesetsof25samples(24fortheMississippiRiverset)werecollectedorcreated,filteredaccordingto
theQAPP,andthenhalfofthetotalnumberoffilterswereextractedwitheachkit.Tohomogenize
samplesbetweenfilters,each2Lsamplewasinvertedmultipletimesandsplitinto500mlperfiltertwo
timescreatingatotalofonefilterperkitpersample.Threedifferentsampletypesconsistedfield‐
collectedwater,aquariumwater,andtapwaterspikedwithbluegillcellscollectedfromthevirologylab
atthecenter.FieldwaterwastakenfromabackwateroftheMississippiRiver,theaquariumwatercame
fromaholdingtankofbluegillsandlargemouthbass,andtapwaterwasspikedwith1mlofcultured
bluegillcellline.Bluegillwaschosenasasurrogatetoinvasivecarpbecausetheyareactiveinwinter,
I‐2
don’tcarrycontaminationconcerns,arelocallyavailable,andcanbedetectedwithahigh‐qualityqPCR
assay(Takaharaetal2003).
Oncesampleswerefiltered,eachsetof25wasextractedfollowingthemanufacturerer’sprotocolfor
theirrespectivekit.ExtractswerethenanalyzedineightreplicateqPCRreactionsfollowingmethodsin
theQAPP.PlateswereloadedonanEppendorfepMotion5075andcycledonBio‐RadCFX384Touch™
Real‐TimePCRDetectionSystems.Resultswerebasedoffaveragestartingquantities(SQ)ofDNAcopy
numbersandextractionkitswerecomparedtoeachotherbysampleusingaPairedT‐test.
Results
TheaverageamountofDNAmeasuredineightreplicateqPCRSfromeachextractispresentedin(Figure
1;fieldsamplestoppanel,aquariumsampleslowerpanel).Extractionsusingbothkitsforthecellline
sampleswereoverwhelmedwithDNAandarenotshown.Pairedt‐testscomparingthetotalcopiesof
bluegillDNAineachsampletypeindicatethattherewasasignificantdifferencebetweenthetwokits(p=
0.0003field,andp=0.0004aquarium)andin22ofthe24comparisons,theIBIkitextractedmoretarget
DNAcopiesthantheQiagenkit.
Discussion
TheIBIgMAxkitextractedsignificantlymoretargetDNAthantheQiagenkit.Thefieldsampleshad
loweroverallcopiesforbothkits,butthiswasexpectedbecausedilutedenvironmentalsamplestypically
yieldlesstargetDNA.TheaquariumsamplesyieldedhighamountsofnaturallysloughedDNA,andIBI
performedbetterthanQiagenhereaswell.
ResultsforourcellspikedsamplesappearedtooverloadeachkitwithQiagenbeingmaxedat5x106cells
andIBIat1x107cells(www.ibisci.com,www.qiagen.com).YieldandqualityofDNAcanbeaffectedwhen
overloadinganextractioncolumnwithcells.Thus,theseresultswerenotconsideredinouranalysis.
ExtractiontimeusingtheIBIkitwasapproximatelyonehourlessandeachfiltercostapproximately
$0.60lesstoextract.ThistimesavingsaddsuptohoursduringtheweekthatcannowbeusedbyWGL
stafftomovemonitoringcasesalongmorequickly,significantlyreducingturnaroundtimeforreporting
results.FurtherefficiencycanberealizedbycompletelyusingallkitreagentsbecaueIBIwillsellthespin
columnsseparately,butQiagenwillnot.BecausetheIBIkitisadvertisedasareplicaoftheQiagenkit,
switchingfromonekittotheotherdoesnotrequirealargechangeinprotocolinthelab,thusitcanbe
seamlesslyintegratedintoournormalworkflowandaddedasanextractionoptionintheQAPP.Sincethe
IBIkitperformedatleastaswellastheQiagenkit,datageneratedbythelabwillremainofthehighest
quality.
OurresultsshowthatIBIScientificgMAxMiniKitextractsmorecopiesofthetargetDNAcomparedto
Qiagen’sDNeasy®Blood&TissueKit.WhenconsideringotheraspectsofextractingDNAsamplesina
highthrough‐putfacility,theIBIkitalsoappearstobemoreefficientandcostfriendly.Basedonthis
study,werecommendusingIBIScientificgMAXMiniKitforextractionofeDNAsamplesinWGL.
I‐3
8000
Field samples
7000
Sq Copy Number
6000
IBI
Qiagen
5000
4000
3000
2000
1000
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
9000000
8000000
Aquarium samples
Sq Copy Number
7000000
6000000
5000000
4000000
3000000
2000000
1000000
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
Figure1.AveragecopiesofbluegillDNAperoctetforeachsampleusingIBIandQiagenextractionkits.Samplenumberisonthe
x‐axis,andSqcopynumberisontheyaxis.IBIextractionkitislabeledinred,andQiagenispurple.
References
Amberg,J,McCallaS,MonroeE,LanceR,BaerwaldtK,andGaikowskiM.Inpress.Improvingefficiency
andreliabilityofenvironmentalDNAextractionmethodsandanalysisforbigheadedcarps.Journal
ofGreatLakesResearch.
DejeanT,ValentiniA,DuparcA,Pellier‐CuitS,PompanonF,etal.(2011)PersistenceofEnvironmental
DNAinFreshwaterEcosystems.PLoSONE6(8):e23398.doi:10.1371/journal.pone.0023398
IBIScientificgMaxMiniKitInstructionManual(2013)http://www.ibisci.com/wp‐
content/uploads/2014/12/IB47280‐IB47281‐IB47282‐Protocol.pdf
I‐4
JerdeCL,MahonAR,ChaddertonWL,LodgeDM(2011)“Sight‐unseen”detectionofrareaquaticspecies
usingenvironmentalDNA.ConsLett4:150–157
QiagenDNeasyBlood&TissueHandbook(2006)http://www.qiagen.com/us/resources/
resourcedetail?id=6b09dfb8‐6319‐464d‐996c‐79e8c7045a50&lang=en
TakaharaT,MinamotoT,andDoiH.2003.UsingenvironmentalDNAtoestimatethedistributionofan
invasivefishspeciesinponds.PLoSONE8:e56584.doi:10.1371/journal.pone.0056584
USFishandWildlifeService.2014.QualityAssuranceProjectPlan.
http://www.fws.gov/midwest/fisheries/eDNA/QAPP‐2014.pdf
I‐5
AppendixJ
InternalReportWhitneyGeneticsLab
J‐1
HemTinternalpositivecontrolfordetermininginhibitionineDNAmonitoringsamples
KyleM.VonRuden,MarenT.Tuttle‐Lau,NicholasM.Berndt,NikolasS.GrueneisandEmyM.Monroe
USFishandWildlifeService,WhitneyGeneticsLaboratory
Introduction
QuantitativePCR(qPCR)isusedtodetectandquantityverysmallamountsofgeneticmaterialinawater
sample.GeneticmaterialinanenvironmentalsampleiscalledenvironmentalDNAoreDNA,andthe
abilitytodetectthepresenceofthegeneticmaterialisofinteresttoresourcemanagers.However,
surfacewatersarelikelytocontainseveralknowninhibitorssuchashumicandtannicacidsandalgal
cellswhichcanpreventtheamplificationoftargetDNAinasamplebyblockingtheactionofDNAtaq
polymerase,andthuscreatefalsenegativeresults.InordertoovercomethispotentialproblemofPCR
inhibitors,WGLtestedandwilladoptanInternalPositiveControl(IPC)forthe2015monitoringseason.
OneprocedureusedtoaccountforthepresenceofinhibitionistoamplifysyntheticDNAorareference
geneatthesametimeasthetargetgeneandcomparethecopynumber(Nolanetal.2006,Randalletal.
2010).Thisprocedureisthemostcommonlyusedmethodtodetectinhibitioninlaboratoriesspanning
fromclinicaldiagnosticsettings,forensicsettingstoenvironmentalresearch(Hoorfaretal.2004,
KontanisandReed2006).
TheUSGeologicalSurveyColumbiaEnvironmentalResearchCenter(USGS‐CERC)developedanIPC
(Table1)madeupofanovelmousegene,HemT,whichencodesforahematopoieticcell‐specific
transcript(Xueetal.1999).KnownnumbersoftheHemTwillbespikedintoeachwelloftheplate
containingfieldsamples,whichwillthenbequantifiedusingstandardcurvesforthattarget.Iffewer
copiesofthespikearemeasuredinasample,inhibitionisassumed,andtheextractwillbecleanedup
withaPCRclean‐upkit(OneStepInhibitorRemovalkitbyZymoResearch,Irvine,CA),andre‐amplified
(Turneretal.2015).SampleswillthencontinuethroughtheeDNAworkflow.Thismethodwillnot
determinewhatparticularinhibitormaybepresent,andwillonlytestforinhibitionduetoblockageof
taqactivity.Theobjectiveofourstudywastore‐analyzethreecasesfromthe2014samplingseasonto
developthemethodologyoftheIPCanddeterminehowtopreciselydefineinhibition,howtoovercome
inhibition,anddevelopdataprocessingpipelinesfortheupcoming2015eDNAseason.
Table1.SequencesfortheHemTprimers,probe,andultramerusedtoaccessinhibition.
Product
HemTForwardPrimer
HemTReversePrimer
HemTProbe
HemTUltramer
Sequence5’‐3’
TCTGAGTGTCCCTCGAATCT
GCAGTCCTTGAGAACATAGAGC
TGACAGTCTCCTTTCGTGTGAACATTCG
CTACATAAGTAACACCTTCTCATGTCCAAAGCT
CTCTGAGTGTCCCTCGAATCTCAGACGCTGTAT
GACAGTCTCCTTTCGTGTGAACATTCGGCTGCT
CTATGTTCTCAAGGACTGCAC
Methods
Preliminarytests‐AnIPCprotocolwasobtainedfromCERCforfurthermethoddevelopmentatWGL.
First,wehadtodetermineiftheadditionoftheIPCtargetandprimersandprobesreducedtheefficiency
oftheACTM1and3carpmarkers.ThiswasdonebyaddingtheIPCcomponentstofourreplicate
standardcurvesandcomparingqPCRperformancetoseveralstandardcurveresultsfromthe2014eDNA
J‐2
monitoringseason(Table2).TheACTM1and3markersperformedequaltoresultsinthe2014
monitoringseason(Table3).Afterthisinitialtest,12replicatestandardcurveswiththeIPCandACTM1
and3werealsotestedtoconfirmrepeatabilityandaccuracyoftheIPCwhencompetingwithACTM1and
3standards(Table3).
2014monitoringseasonre‐runs‐Threecases(10089,10103,and10104)fromthe2014monitoring
seasonweretestedtocomparedetectionresultswiththeIPC.Becausestandardcurvewellshavevaried
amountsoftheHemTtarget,andtherestoftheplatehas100copiesoftheHemTtarget,eachplateis
madewithtwomastermixes.Themastermixforallunknownfieldsamplesplusthe4negativecontrol
sampleshad102(100)copiesoftheHemTtargetineachreaction,whereasthemixforstandardsamples
didnothaveanytargetHemTincluded,sothattheproperdilutioncouldbeusedtocreatethestandard
curve.Sampleswereruninreplicatesofeightwith2replicatestandardcurvesperplateaccordingthe
QAPP.AllreactionsweresetupforqPCRonanEppendorfepMotion5075andanalyzedusingBio‐Rad
CFX384Touch™Real‐TimePCRDetectionSystems.
Each20µlqPCRreactionforthestandardsconsistedof10.0µlofTaqman®EnvironmentalMasterMix,
1.0µlofHemTforwardandreverseprimermixat5.0µM,and0.75µlofHemTprobeat2.5µM,1.0µlofAC
TM1/3forwardandreverseprimermixat10µM,1.0µlofACTM1/3Probeat2.5µM,4.25µlofwater
alongwith1.0µloftheappropriategBlockstandarddilutionand1.0µloftheappropriateHemTstandard
dilution.Cyclingconditionswereasfollows:95°Cfor10min,followedby40cyclesof(95°Cfor15sec,
60°Cfor1min,followedbyaplateread).
Table2.PairedHemTIPCandgBlockstandardsruninduplicateoneveryplate.
StandarddilutioncopynumberofACTM1
StandarddilutioncopynumberofHemTIPC
andACTM3gBlock
5
10 6250
104
1250
103
250
2
10 50
101
10
Results
Preliminarytests‐Boththepairedstandardtestsoffourandtwelvereplicatestandardcurvesresultedin
R2andEfficienciesthatperformedwithintheWGLreportingrangewithoutanystandardpointsbeing
removed(Table3andFigure1),indicatingthatthereactionshadenoughreagentstoamplifyallthree
targetswithoutnegativelyaffectingefficiencyofthereactions.Onetargetfailedtoamplifyinthelowest
ACTM1standard(10copies),buttherestofthestandardsallowedforgenerationofstandardcurves
withR2andefficiencyvalueswithinWGLlimits.TheLimitofDetection(LOD)forACTM1and3
remainedat10copies,whichisimportantwhendetectinglowcopynumbersineDNAsamples.
Table3.Comparisonsofmeanefficiencies,R2andslopesfromthe2014monitoringseasonand
preliminarytestsoftheHemTIPCspike.
FAM
HEX
2
Efficiency
R
Slope Efficiency
R2
Slope
93.9
0.99
‐3.49
96.4
0.98
‐3.43
2014*season
(7.62)
(0.01)
(0.21)
(9.08)
(0.01)
(0.24)
J‐3
Fourreplicate
standardcurves
Twelvereplicate
standardcurves
91.9
(14.4)
100.6
(11.06)
0.98
(0.01)
0.97
(0.01)
‐3.53
(0.36)
‐3.31
(0.26)
100.6
(12.5)
103.4
(19.9)
0.98
(0.01)
0.95
(0.01)
‐3.31
(0.28)
‐3.24
(0.43)
*meanvaluesfrom6standardcurvesoffof3platesfrom6casesanalyzedinJuly2014toJanuary2015.
Figure1.CFXManagerSoftwarescreencaptureofthetwelvereplicatestandardcurvepreliminarytest(Leftpanel).ACTM1isrepresented
bythebluelines(FAM),ACTM3representedbythegreenlines(HEX)andtheIPCspikeisrepresentedbythepurpleline(Cy5).
Rightpanelshowsstandardcurveswithdataoneachcurveinthelowerbox.
2014monitoringseasonre‐runs‐Case10089waschosenforreanalysisbecauseithadthehighest
averagenumberoffilters(10)persamplefromthe2014monitoringseason.AnuninhibitedaverageCq,
orthereferenceCq,wascalculatedforeachplateusingthemeanCqfortheduplicate102copystandard
wellsandthefourNegative/NTCwellswiththe102copiesoftheIPC.ThisreferenceCqwasusedto
determinethethresholdforinhibitioninallotherunknownsamples.Initially,inhibitionwasdefinedas
anysamplewithaCq2cyclesormoreabovethereferenceCq.Thisresultedinzerosamplesbeing
inhibitedforcase10089.Afterfurtherreviewofliterature(Hartmanetal.2005,Turneretal.2015)we
changedhowpotentialinhibitionwouldbedetermined.Inhibitionisnowdefinedasanysinglereplicate
oftheeightreplicatePCRsrunperfieldsamplewhichhasaCqgreaterthanthereferenceCqbymore
thantherangeofCqsusedinthereferencecalculation,oratleast1cycleiftherangeislessthanone.Any
samplewellthathadnoCqfortheIPCisconsideredcompletelyinhibited.Usingtheseguidelines,10
samplesweredeterminedasinhibited,andwerere‐analyzedafterusingaOneStepTMPCRInhibitor
RemovalKitbyZymoResearch(Turneretal.2015).Afterclean‐up,nineofthesampleswerenolonger
inhibited,whiletheothersamplehadonlyonereplicateofitseightthatstillshowedsignsofinhibition.
TherewerenofurtherpresumptivepositivesforAsianCarponcethesampleswerepurified.
Case10103consistedof37samplesandwasfoundtohavefoursamplespositiveforeitherbigheador
silvercarp,aswellasnineinhibitedsamples(Figure2).Ofthosenineinhibitedsamples,eightwerere‐
amplifiedusinga1:1dilution.Fourofthesesampleswereclearedofinhibitionafterthedilutionandone
ofthesampleswasthenalsoconfirmedpositiveforsilvercarp.Furtherdilutionsof2:1and3:1finally
alleviatedinhibitioninallbutoneoftheremainingsamples,andnofurthercarpDNAwasdetected.One
sampleremainedmildlyinhibited,butnofurtherstepsweretakentotryandeliminateinhibitioninthat
J‐4
particularsample,becauseinthefuture,allinhibitedsampleswillbecleanedwithOneStepInhibitor
Removalkitstoexpediteprocessingandallowforrapidconfirmationandcasecompletion.
Figure2.IPCstandardcurveshowingthepointofinhibitionbasedonourguidelinesforreferenceCqincase10103.SampleswithCq
greaterthanthispointareconsideredinhibitedandwillbere‐amplifiedafterclean‐upwithaPCRcleanupspinkit.
Case10104consistedof31samplesandwasalsore‐analyzedwiththeIPC.Noneofthesesampleswere
inhibited,thusallsamplesremainednegativeforsilverandbigheadcarp(datanotshown).
Conclusion
OurresultsshowtheadditionoftheHemTIPCprimers,probe,andtemplatehavenonegativeeffectson
theperformanceofourpreviouslyvalidatedAsianCarpMarkersandalsotheHemTIPCcanbeusedto
indicateinhibitionintheactivityoftaqpolymerase.Basedontheseresultswerecommendamendingthe
QAPPforthe2015eDNAmonitoringofAsianCarpatWGLtoincludetheHemTInternalPositiveControl
inallcasesinanefforttoquantifytherateofinhibition,andthenremoveinhibitorswithasimpleclean
upkit,whichwilleliminatethissourceoffalsenegativeresults.
Tothisend,WGLhasincorporatedtheHemTIPCintheinitialassayscreeningallsamplesfortheACTM1
&3markers.SamplesshowntobeinhibitedwillbecleanedwiththePCRinhibitorcleanupkit(see
above),andthenre‐assayedwiththeACTM1&3markers.Presumptivepositivesampleswillbemoved
throughtheconfirmationassays,usingthenowinhibitor‐freeextract.Thetotalnumberofinhibited
sampleswillbetrackedbycasesothattrendsatparticularsitesoratparticulartimesofyearcanbe
monitored.
References
Hartman,LJ,SRCoyne,DANorwood.2005.DevelopmentofanovelinternalpositivecontrolforTaqman®
basedassays.MolecularandCellularProbes19:51‐59.
J‐5
Hoorfar,J,BMalorny,A.Abdulmawjood,NCook.MWagnerandPFach.2004.Practicalconsiderationin
designofinternalamplificationcontrolfordiagnosticPCRassays.JournalofClinicalMicrobiology
42:51863‐1868.
Kontanis,EJandFAReed.Evaluationofreal‐timePCRamplificationefficienciestodetectPCRinhibitors.
JournalofForensicSciences51:4795‐804.
Nolan,T,REHands,WOgunkoladeandSABustin.2006.SPUD:AquantitativePCRassayforthedetectionof
inhibitorsinnucleicacidpreparations.AnalyticalBiochemistry351:308‐310.
Randall,L,FLemma,JRodgers,AVidalandFClifton‐Hadley.2009.Developmentandevaluationofinternal
amplificationcontrolsofuseinreal‐timeduplexPCRassayfordetectionofCamplylobactercoliand
Camplylobacterjejuni.JournalofMedicalMicrobiology59:2172‐178.
Turner,CR,KLUy,andRCEverhart.2015.FishenvironmentalDNAismoreconcentratedinaquatic
sedimentsthansurfacewater.BiologicalConservation183:93‐102.
Xue,H,DO’Neill,JMorrow,andABank.1999.Anovelmousegene,HemT,encodinganhematopoietic
cell‐specifictranscript.Gene231:49‐58.
J‐6
AppendixK
InternalReportWhitneyGeneticsLab
K‐1
ValidationofcentrifugationforeDNAsamplecollectionandprocessing
EmyMonroe,WhitneyGeneticsLaboratory,U.S.Fish&WildlifeService
RichardLance,EnvironmentalLaboratory,U.S.ArmyCorpsofEngineersResearch&DevelopmentCenter
ChrisRees,UpperMidwestEnvironmentalScienceCenter,U.S.GeologicalSurvey
TimStrakosh,GreenBayFishandWildlifeConservationOffice,U.S.Fish&WildlifeService
Introduction
EnvironmentalDNA(eDNA)hasbeenappliedasanearlydetectionandsurveillancetoolforAsiancarps
intributariesoftheGreatLakesandtheUpperMississippiandOhioRiversbyresourceagencies.The
currentprotocolinuse,theQualityAssuranceProjectPlan(QAPP),wasinitiallydevelopedbytheU.S.
ArmyCorpsofEngineers,basedonthemethodsofJerdeetal.(2011).TheQAPPrequires2‐Lwater
samplesbecollectedandthenfilteredwithin16hours,whichisproblematicforsomesurfacewatersthat
containlargeamountsoffilter‐cloggingparticulatematter(e.g.,tributariesofLakeErie).Various
methodsofsamplecollectionforeDNAanalysisarefoundintheliteratureincludingsmallervolumegrab
samples(i.e.,15and50mL)thatareconcentratedbycentrifugation(Ficetolaetal.2008,Dejeanetal.
2011,Minamotoetal.2012,Footeetal.2012,andThomsenetal.2012)andlargervolumesthatare
filtered,suchasthoseoutlinedintheQAPP.Bothcentrifugationandfiltrationmethodshavebeenfield
validatedandweresuccessfulatidentifyingorganismalDNAatlowlevelsintheirrespectivestudies.It
maybemoretimeandcost‐effectivefortheQAPPtoallowtheuseofsmallerwatervolumesthat
concentrateDNAbycentrifugation.Priortoimplementationofcentrifugationmethodologyforearly
detectionandmonitoringprograms,astudymustbeconductedtodetermineifthetechniquesyield
comparabledetectionratesofeDNAsamplescollectedinthesamelocationatthesametime.
ProjectOverview
ThecurrentQAPPrequirescollectionofa2‐Lwatersamplewhichmustbefilteredwithin16hoursto
avoidDNAdegradation.WhilethistechniquemaybeusefultoconcentrateDNAfromthewatersample,
italsoconcentratessuspendedmaterials,resultingintheneedforseveralfiltersforasinglesample.For
example,intheChicagoAreaWaterways(CAWS),onaverageone2‐Lsamplerequires4filters(Whitney
GeneticsLab(WGL)caselog2013and2014);howeverintheMaumeeandSanduskyBaysofLakeErie,
one2‐Lsamplerequiredupwardsof20‐45filters(C.Olds,pers.comm.),andthemaximumfor2014fora
single2Lwatersamplewas65filters(WGLcaselog2014).Additionally,onecaseof200samplesin2014
averaged10filterspersample.Thetotalnumberoffiltersprocessedin2014atWGLwasover23000,but
totalsamplesreportedwasonly6330(WGLcaselog2014).Thislargenumberoffilterspersample
pushedsampleprocessingupagainstthe16‐hrtimelimitforfieldstaff,cost$2.70perfiltertoextractin
thelab,andincreasedthetimenecessaryforlaboratorypersonneltoextractasinglecaseofsamples.
AccordingtotheQAPP,theextractionkits(QiagenDNeasy)canonlyhandleonefilterperextraction
resultinginalargenumberofextractionsinthelaboratory.Filteringwateralsocreatesmultiple
opportunitiesforcontaminationamongsamplestooccur.The2‐Lsamplecontainersarechallengingfor
fieldstafftostore,move,andrapidlycoolduetosizeandweight.Largecoolersarerequiredtomoveand
storesampleswithsufficienticetopreventDNAdegradation.Boatsizeandnumberofsamplecoolers
limitthenumberofsamplesthatcanbetakenpertrip.
Theabilitytocollectsmallervolumesofwaterwouldincreasefieldsamplingefficiency,becauseall
samplingcontainersneededforacollectioneventcouldbecarriedinaboatatonetime.Thesmaller
volumeswouldalsorequirelessicetorapidlycoolandpreventfurtherDNAdegradation.Theuseof
sterilecentrifugetubesandcentrifugationreducescontaminationrisksinceexposureislimitedtowater
K‐2
decantingafterpelletcentrifugation.CentrifugedsamplesalsoreducepotentialDNAdegradationorloss
duringshippingbecausetheyarepreservedin95%ethanolor70%isopropyl,whichwilllastindefinitely,
unlikethefilterswhichareshippedindryice.Laboratorytimeandcostsavingsarealsoaresultbecause
theentirepelletfromonetofivecentrifugetubescanbecollectedonasinglesterilebuccalswaband
processedinasingleextraction.
Preliminarystudiesandresults
Preliminarystudiescomparingcentrifugationandfiltrationhavebeenconductedbyfederallabsaspart
oftheenvironmentalDNAcalibrationstudy(ECALS(http://www.asiancarp.us/ecals.htm)labs),but
contaminationinthetrialsprecludedanyinterpretationofthedata(ACRCC2014).WGLconductedtwo
preliminarystudiestoexaminethefeasibilityofusingthecentrifugtionmethodtoconcentrateeDNAin
watersamples.ThefirststudyconductedbyECALSlaboratoriesoccurredsimultaneouslywithvalidation
ofanalternateextractionmethodin2013.Forthisstudy,sampleswerecollectedfromtheBlackRiver
(LaCrosseCounty,WI)andspikedwithaslurryofsilvercarpslimeandfeceswithaknownamountof
DNA(Ambergetal.inpress).Two‐literwatersampleswerecollectedandspikedwith0,200,750,1000,
and2000ngofDNA(5treatmentclasses)andimmediatelyextracted.Atthesametime,10replicatesof
thesesametreatmentswerebeingfilteredforuseintheUpperMidwestEnvironmentalSciencesCenter
(UMESC)bridgingstudy(Ambergetal.inpress)testingthetwoextractionkits.Each2‐Lsamplefrom
thefivetreatmentswasmixedbyinversion,andtwenty50‐mlsterilecentrifugetubeswerefilled.The
sampleswerethencentrifugedat~4500rcf(maxspeedonSorvallLegendSTR)at4⁰Cfor30minutes.
Waterwascarefullydecanted;makingsurethepelletremainedintactinthebottomofthetube,andthe
pelletwascoveredwith5‐15mlofisopropanol,andspunagainat~4500rcffor5minutesat4⁰C.Excess
isopropanolwasdecantedcarefullytoremoveasmuchliquidaspossiblewithoutdisturbingthepellet.
Sampleswerestoredatroomtemperatureonopenshelvesuntilprocessing.Thedaybeforeextracting,
sampleswerepreparedbyevaporatingallresidualisopropanolinalaminarflowhood.Sampleswere
placedincentrifugetuberacks,movedintoasterilehoodarea,hadcapsremoved,andwerelefttodry.
Eachbatchoftubesincludedahoodnegativecontroltotestforcontaminationduringthedryingprocess.
SampleswerethenmovedintotheextractionroomwheretheywereextractedwiththeQiagenDNeasy
BloodandTissueKitpertheQAPP.EachsamplewasprocessedaccordingtoAmbergetal.(inpress)for
bothconventional(cPCR)markers(Jerdeetal.2011)andquantitativePCRmarkers(qPCR;Merkesetal.
2014).Resultsfromthecentrifugedsampleswerecomparedto10replicatefilteredsamplesruninWGL
intheAmbergetal(inpress)study.Overall,thecentrifugedsampleshadcomparableresultstothe
filteredsamplesinbothassays(Tables1and2).Althoughtheseresultsseemedpromising,itis
importanttonotethe20centrifugedsamplesarepseudoreplicatesfromone2‐Lspikedsample.Thus,
furtherconfirmationwasrequired.
Thesecondpreliminarystudywasexecutedinfallof2013,when120pairedsamples(N=240)were
collectedinfoursites(60samplespersite)intheChicagoAreaWaterwaySystem(CAWS).Filtered
samples(N=120)werecollectedaspartoftheformalearlydetectionandmonitoringprogram(MWRG
Plan2013,http://www.asiancarp.us/documents/MRP2014.pdf),butanadditionalfive50‐mlsamples
(centrifuged)werecollectedside‐by‐side(N=120)witheach2‐Lsample(filtered).Thesewere
extractedwiththeQiagenDNeasykitaccordingtotheQAPP.SinceeDNAofAsiancarpisnotconsistently
detectedintheCAWS,markersfordetectingeDNAofbluegill(Takaharaetal.2003)andcommoncarp
(Barnesetal.2014)wereusedtocomparedetectionofDNAbetweenthetwoprocessingmethodswithin
eachsite.ItshouldbenotedthatTakahara’sbluegillmarkerwillalsodetectotherLepomisspecies,butit
shoulddosoequallyinbothsampletypes.Resultsfromthissecondpreliminarystudybasedonfield
samplesindicatedthattheprocessesdonotdiffer(PairedChi‐squaretestbysamplesite,p=0.435bluegill
andp=0.947commoncarp)(Figure1).
K‐3
BothpreliminarystudiesindicatedequalratesofDNAdetectionbetweenthetwomethodstoprocess
fieldsamples,butneitherstudyusedearlydetectionmarkersforAsiancarpinfieldsamples.Thusthe
goalofthisstudywastocompareresultsofbigheadedcarpeDNAamplificationfrom2‐Lwatersamples
thatwerefilteredand50‐mlsamplesthatwerecentrifugedfromsurfacewaterscontainingknown
abundancesofbigheadedcarps.ThisstudyusedsamplesfromtheIllinoisRiverinareasthathavelow,
medium,orhighlevelsofAsiancarp(detailsbelow).Fieldworkforthestudywascarriedoutbythe
GreenBayFishandWildlifeConservationOffice(FWCO)withassistancefromtheCarterville,Columbia,
Alpena,andLaCrosseFWCOs.LaboratoryanalyseswerecarriedoutattheU.S.ArmyCorpsofEngineers
EngineeringResearchandDevelopmentCenter(ERDC),theU.S.FishandWildlifeWhitneyGeneticsLab
(WGL),andtheU.S.GeologicalSurveyUpperMidwestEnvironmentalSciencesCenter(UMESC).
Methods
Pairedwatersampleswerecollectedandprocessedbycentrifugingandfilteringfromthreereacheswith
low,medium,andhighcarpdensities(Figure2,Table3).Eachreachwassampledina2.5‐kmlong
sectionencompassingtheareaofinterest.Watersampleswithineachselectedsectionweretakenat23
sitesfollowingaprobabilisticsamplingdesigntargetingareaswhereeDNAhadthehighestprobabilityof
accumulation(QAPP).Attheselectedsite,surfacewater(<4cm)wascollectedinasterilizedcontainer
approximately10Linvolume.Thesurfacewaterwashomogenizedanddistributedintothree2‐Lbottles
andfifteen50‐mltubesdesignatedforthatsite.Each2‐Lbottleandsetoffive50‐mltubesisareplicate
(n=3)forthatsite.Anew10‐LcontainerwasusedforeacheDNAaccumulationsiteandnotreused
duringthisstudy.Twoofthe23samplingsiteswererandomlyselectedforcoolerblanksfilledwithDI
water(i.e.,three2‐Lbottlesandfifteen50‐mlcentrifugetubespersite).Thenegativecontrolsdidnot
replacethecollectionofwatersamplesatthesite,butservedasnegativecontrols.Allsampleswere
filteredorcentrifugedaccordingtotheQAPPinmobileeDNAtrailersandsenttothelaboratories.One
setwasshippeddirectlytoERDC,andtheothertwowerehand‐deliveredtoWGLpersonnelwhothen
distributedthefinalsettoUMESCforanalysis.ThreestudyreachesintheIllinoisRiver(Figure2)were
identifiedbasedonAsiancarpdensities(Table3):BrandonRoadPool(low),MarseillesPool(medium),
andLaGrangePool(high;Figure2;seealsoBaerwaldtetal.2014).Sampleswerecollectedwithina2.5
kmstretchimmediatelybelowtheupstreambarrier(lockanddamstructure)withineachreach(Figure
3).
AllpreparationactivitiesfollowedthosespecifiedintheQAPPandotherguidingdocuments/protocols
(e.g.,eDNATrailerSOP).Watersampleswithineachrandomlyselectedsectionweretakenat23sites
followingaprobabilisticsamplingapproachdescribedabove.Targetedareasincludedbackwaters,island
sidechannels,pooledareas,belowandaroundstructures,confluencesoftributaries,andanyareas
wherefloatingdebrisaccumulates.ActualsamplecollectionlocationsweredeterminedbytheCollection
CrewLeaderfrominsituobservationsofwinddirection,accumulationareas,andwaterlevels.NoeDNA
samplingoccurredwithin5daysafterasignificantrainfallevent(morethan1.5inchesina24‐hrperiod)
orontherisinglimbofahydrographoftheriverasitexceededfloodstage.
SampleswerecollectedaccordingtotheQAPP,andatotalof2252‐Lsamplesand112550‐mlsamples
werecollected.AllsampleswereprocessedaccordingtotheQAPP,includingcentrifugesamples(QAPP
alreadycontainsmethodforcentrifugationwhichisallowedforresearchpurposes),andDNAwas
extractedusingtheQiagenDNeasykits.Atthetimethisstudywasplanned,theQAPPusedconventional
PCRmarkersfromJerdeetal.(2011);however,aftersampleshadbeencollectedinSpringof2014but
beforetheywereanalyzed(JuneatERDCandwinteratUMESCandWGL),newqPCRmarkershadbeen
validatedandthusadaptedintheQAPP(Farringtonetal.2015),andthesenewmarkerswereusedto
analyzesamples.Thevalidationstudyprovidedlimitsofdetection(3‐9copies)andlimitsof
K‐4
quantification(10copies)forthesenewmarkers,thereforeasampleisdetectedaspositiveforamarker
ifstartingcopiesoftemplateDNAarebetween3‐9,andasamplecanbedetectedaspositive,andstarting
copiesoftemplateDNAcanbereportedasanumericalvaluefor10copiesorgreater.
Datafromeachlabwasreportedintwoways:samplesconfirmedpositiveforBighead,Silver,orboth
species,andcopynumber.Theoverallprobabilityofdetectionforpositivesampleswascalculatedfor
eachreachbyeachprocessingmethodtoassessdetectionrate.Thedetectionrateforbothfiltrationand
centrifugationwasthenusedtocalculatethenumberofsamplesneededtoachieveaspecifieddetection
probabilityusingequationsmodifiedforbinomialvariables(McArdle1990,Reed1996,andKery2002).
AlleDNAsampleswereassumedtobecomparableandindependent,thereforetheprobabilityofnot
detectingAsiancarpsinNeDNAsamplesis
Probability
unsuccessfulsamples
1
whereαistheprobabilityofmakingaTypeIerrorunderthehypothesisthattheeDNAisactually
present(i.e.,concludingtheeDNAisabsentwhenitisactuallypresent),pisprobabilityofdetection,and
NisthetotalnumberofeDNAsamples.SolvingforNgivesthenumberofsamplesrequiredatadesired
TypeIerrorrate.
⁄
1
Asmoresamplesarecollected,theprobabilityofdetectingpresenceofAsiancarpeDNA(p*)increases
andcanbecalculatedas
∗
1
1
Samplesthathaddetectionswithanyofthe6markerswereusedtotestfordifferencesincopynumber
betweenthetwoprocessingmethodsusingapermutationalmultivariateanalysisofvariance
(PERMANOVA)basedonEuclideandistancematrixinPrimerV6(Andersonetal.2008).The
PERMANOVAisanon‐parametricmultivariateapproachwhichdoesnotmakeanyassumptionof
distribution,isinsensitivetocorrelationamongresponsevariablesandzeros,andallowstheuseofcopy
numbersfromallthemarkersinonetest(Anderson2001).Specificcontrastswereusedtotestforthe
differencebetweencentrifugingandfiltrationwithineachofthereachesusingTypeIIIsumofsquares
and9999permutations.
Results
SamplesweresuccessfullycollectedandtwosetsshippedtoWGLandthethirdtoERDC.Sampleswere
checkedin,andhelduntilprocessing(WGLheldbothUMESCandWGLsamplesuntilprocessing).Filters
werestoredat‐80°Candcentrifugedsamplespreservedwithisopropylwereheldatambientlab
temperature.AtWGLthisambientstoragewasinopenshelves.SampleswereprocessedatERDCin
June.SampleswereprocessedatWGLinDecemberandatUMESC,inJanuary.AllWGLsamplespassed
qualitycontrolchecks,andthusareincludedinanalysis.However,thereweresomecontrolsamples
(centrifugecontrol13,hoodcontrol7,andextractionnegative7)thatatfirstappearedtobe
contaminatedinthesetanalyzedatERDC.Uponcloserinspection,onlythecentrifugecontrolwas
presumptivepositivewithoneof8reactionsamplifyingbothACTMmarkers,butitwasoverallnegative
sincetheconfirmationmarkersforbothspeciesfailedtodetect.Theothertwocontrolsampleshadjust
oneoftheACTMmarkersdetected,sotheywerenotpresumptivelypositive,thusallofERDCsdatawere
usedinthefinalanalysis.Unfortunately,UMESCdatahadtobediscardedfromanalysisfortworeasons.
1)Centrifugedsamples1‐25completelyfailedamplificationcomparedtoWGLandERDC.Tofurther
K‐5
investigatepotentialreasonsforthisfailure,10µlofeachextractwaselectrophoresedin2%agarosegels
with5WGLsamplesfromthesamesamplesetforcomparison.TheUMESCextractsdidnothaveas
muchDNA(muchfainterstreaks)oraswidearangeofDNAlengths(alllessthan100basepairs)
comparedtoWGLextracts(datanotshown).Thelackoflargestrandsindicatessamplesmayhave
degradedduringstorageatroomtemperatureexposedtolablights,orthattheextractionkitreagents
failed.Kitfailureispossible,sinceitwasnotedbythetechnicianthatsomeofthebuffershadcrystallized
andwereusedwithoutre‐dissolvingthebuffer.2)Filteredsamples51‐75fromthehigh‐abundancecarp
reachoftheriveralsocompletelyfailedamplification.Again,extractswereelectrophoresedand
comparedto5extractsfromWGLsamplesfromthesamesetofsamples.Thegelrevealedordersof
magnitudelessDNAthanthoseextractedbyWGLandDNAalllessthan100basepairs(datanotshown),
whichindicatesfailureofextractionkitssincethefilterswerestoredinthedarkinultra‐coldfreezers
untiltheywereprocessed.Thus,resultswillonlybebasedontworeplicates(WGL&ERDC)insteadof
three.
Overall,resultsbetweenERDCandWGLhadsimilarratesofdetectionforbothspeciesinallthree
reaches(Table4).Meancopynumbers(8replicatereactionsx25samples)variedbetweenlabs,but
weresimilaramongreachesforeachprocessingmethod.MeancopynumbersalsoreflectedtheAsian
carpdensityfromtheirrespectivereaches(i.e.,highdensityreachhadhighercopynumber),andforthe
mostpart,centrifugedsampleshadhighercopiesthanfilteredsamples(Table5).Detectionprobability
wascalculatedbyreachforeachmethodusingtheresultsfrombothlabsforeachindividualsite.For
exampleifWGL(+)andERDC(‐,)thenthesitewasconsidered(+).Detectionprobabilitiesweresimilar
forthemediumandhighreaches,butcentrifuginghada26%detectionratecomparedto0%for
filtrationinthelowdensityreach(Table6).Thetotallengthofthestudyreachwas2.50kmwithan
averagewidthof0.12kmandatotalareaof0.30km2.Therefore,usingcentrifugationa95%detection
probabilitywouldrequire10samples(i.e.,10setsoffive50mltubes)tobecollectedper2.5kmreachor
4samplesperriverkm.Toachievea99%detectionprobabilityattotalof15samplesper2.5kmor6
samplesperriverkmwouldbecollected.
Forthestatisticalanalyses,thecopynumberswereaveragedforthereplicatesamplesbetweenthetwo
labs.Therefore,everysitehadanaveragecopynumberforeachofthesixmarkers.Theaveragecopy
numberswerethenlog10transformed,andadissimilaritymatrixwasthengeneratedbasedonEuclidean
distanceforthePERMANOVA.ResultsfromthePERMANOVAshowedsignificantdifferencesbetween
centrifugingandfiltrationforallthreereaches(P<0.001;Table7).Centrifuginghadsignificantlyhigher
copynumbersthanfiltrationforhighandlowdensityreaches,butfiltrationhadsignificantlyhigher
numbersinthemediumdensityreach(Tables5and7).Reasonsforhighernumbersinthefiltered
samplesfromthemediumreachcouldberelatedtodifferencesininhibitorsbetweenreaches,orother
confoundingenvironmentalvariables,butthatisbeyondthescopeofthisstudy.However,astatistical
differenceinthemediumreachwherefilteringproducedhighercopynumbersisnotasrelevantina
detectionprogram,sincetheoveralldetectionrateisadifferenceof96%versus100%,andbothmethods
wouldprovidepositiveresultsforthisparticularreach.Sinceearlydetectionprogramsfocuson
detectioninlow‐densityreaches,itisimportantthatthecentrifugationmethodwasabletodetectDNA
whenthefilteringmethodwasnot.
ConclusionsandRecommendations
ThisstudystronglysupportstheuseofcentrifugingasamethodtoprocesseDNAfield‐collectedsamples
inearlydetectionandmonitoringprograms,mostnotablyduetoitsperformanceinthelow‐abundance
carpreachesoftheIllinoisRiverwherecentrifugedsampleswereabletodetectcarpDNA,butfiltered
sampleswerenot.Onepotentialexplanationforwhycentrifugingoutperformedfilteringisthatsmaller
K‐6
volumesofwaterwillhavesmalleramountsofinhibitors(Gibsonetal.2012),whichwouldimprove
detectionoverheavilyinhibitedfilteredsamples.Thisstudyalsoconfirmscentrifugationasamethodfor
processingeDNAsamplesinotherapplications,suchasconfirmationofspawningeventsordetectionof
over‐winteringhabitats.Thereareseveralbenefitstocentrifugingoverfiltering,butthemostimportant
ispreventingcontaminationinthefield.Thereducedhandlinginthefieldcreatesfarfewerchancesfor
cross‐samplecontamination,andsingle‐use,steriletubeseliminatecontaminationbetweensampling
events.Inotheragencies,fieldstaffcouldfillbothfieldblanksandcentrifugecontrolsamplesinthelab
orprocessingtrailer,butWGLwillfillallfieldblanksanddistributeasneeded.Inaddition,thereare
largeimprovementsinefficiencyinthefieldandlabwhichwillallowforthecollectionandprocessingof
manymoresampleswithinthesamplingseason.Thus,basedonthesameoutcomeinthreedifferent
studiescomparingcentrifugationtofiltrationasawaterprocessingmethod,werecommendthat
centrifugationbeapprovedforuseintheearlydetectionandsurveillanceofbigheadedcarps,specifically
intheQualityAssuranceProjectPlan.
K‐7
TablesandFigures
Table1.QiagenextractionkitconventionalPCRresultsoftwenty50‐mLsamplesprocessedbycentrifugationfromone2‐L
samplecontainer,comparedtoten2‐Lreplicatesprocessedbyfiltration.
*CentrifugedNumber
Centrifuged
*FilteredNumber
Filtered
QuantityofDNA(ng)
positivebandscounted
Numbersamples
positivebands
Numbersamples
(80)
positive(20)
counted(20)
positive(10)
(0)
0
0
0
0
(200)
32
14
16
9
(750)
67
20
20
10
(2000)
77
20
20
10
(4000)
77
20
20
10
ExtractionNegative
Na
0
0
0
ExtractionPositive
Na
All+
All+
All+
PCRNegative
Na
0
0
0
PCRPositive
Na
All+
All+
All+
*Forcentrifugedsamples,oneswabrepresentsonesampleforatotalof20samplespertreatment.FourreplicatereactionsforcPCRforcentrifugedsamples,
tworeplicatePCRsforfilteredsamples.
Table2.QiagenextractionkitquantitativePCRresultsoftwenty50‐mLsamplesprocessedbycentrifugationtakenfromone
2‐Lsamplecontainer,comparedtoten2‐Lreplicatesprocessedbyfiltration.
*Filtered
Number
Filtered
*Centrifuged
positive
Number
Numberpositive
Centrifuged
curves
CentrifugedAve
samples FilteredAveCq
curvescounted Numbersamples
counted
Cqvalue1
positive
value1
QuantityofDNA(ng)
(SE)
(SE)
(40)
positive(20)
(20)
(10)
(0)
0
0
0(0)
0
0
0(0)
(200)
25
15
36.83(0.21)
19
10
23.50(0.20)
(750)
40
20
35.58(0.18)
19
10
29.44(0.23)
(2000)
38
20
34.03(0.22)
20
10
27.71(0.11)
(4000)
36
20
31.84(0.20)
20
10
27.28(0.13)
ExtNegative
Na
0
0
0
0
0
ExtPositive
na
All+
33.18(0.31)
All+
All+
36.29(0.15)
*Forcentrifugedsamples,oneswabrepresentsonesampleforatotalof20samplespertreatment.Tworeplicatereactionsforfilteredsamplesand4
replicatereactionsforcentrifugedsamples.
1Cqvaluecalculatedonpositivesamples,zeroreadingswerenotincludedinsummarynumbers.
Table3.CatchperuniteffortofbigheadandsilvercarpinselectedpoolsoftheIllinoisWaterwayin2013.Datawereacquired
fromtheIDNR,SIU,andINHSfromprojectsoutlinedintheMonitoringandResponsePlanforAsianCarpintheUpperIllinois
RiverandChicagoAreaWaterwaySystem(2013).Allofthesitesusedwithineachprojectwerefixedandchosenasalikely
areaofinhabitationbyAsiancarpwithinthatpool.
Pool
Electrofishing(fish/hr)
GillNetting(fish/100yds)
HoopNetting(fish/set)
Bighead
Silver
Bighead
Silver
Bighead
Silver
BrandonRoad
0
0
0
0
0
0
Marseilles
0
1.73
5.88
0.38
0.87
0.07
0.04
0.96
LaGrange
0
16.78 46.53
1.07*
3.47*
0.71
na
*2012data.
K‐8
Table4.ConfirmeddetectionsforBigheadandSilvercarpDNAinwatersamplescollectedfromriverreacheswithvarying
Asiancarpdensitiesandprocessedinthefieldwithfilteringandcentrifuging.
Filteredwater(2‐Lbottles)
Centrifugedwater(50‐mltubes)
AsianCarp
Density
Processing
Lab
High
Silver
Positive
Bighead
Positive
Both
Positive
Silver
Positive
Bighead
Positive
BothPositive
23
19
23
19
23
19
23
23
23
23
23
23
ERDC
WGL
Medium
ERDC
WGL
Low
23
23
ERDC
WGL
0
0
21
21
0
0
Samples*perLab:
21
21
18
19
0
0
2
1
9
14
8
12
1
3
1
0
69
69
*totalsamplenumberlesscoolerblanks
Table5.Meancopynumberfor25samples(from8replicatereactions)foreachofsixAsiancarpqPCRmarkersamplifiedin
watersamplescollectedfromriverreacheswithvaryingAsiancarpdensitiesandprocessedinthefieldwithfilteringand
centrifuging.Limitofdetectionis3‐9copies,limitofquantification(LOQ)is10copies.Sampleswithcopynumbersabovethe
LOQarereported,butthosethatdetectedbutwerebelowtheLOQare
designated(+).
Fish
Density
High
ACTM1
Lab
ERDC
WGL
SCTM5
Cent.
Filter
Cent.
Filter
Cent.
Filter
Cent.
Filter
Cent.
128
272
58
165
64
17
168
24
70
163
243
156
510
12
22
46
32
357
295
644
17
39
+
21
32
33
654
93
16
54
Low
SCTM4
Filter
33
WGL
BHTM2
Cent.
234
ERDC
BHTM1
Filter
Medium
ACTM3
17
27
43
54
10
+
+
+
+
22
23
+
16
+
43
21
ERDC
0
20
+
21
0
50
0
107
0
11
0
+
WGL
+
23
+
25
0
27
0
55
0
17
0
24
Table6.Detectionprobabilitiesforcentrifugingandfiltrationprocessingmethodswerecalculatedforeachofthereaches.A
sitewasconsidered(+)forAsiancarpeDNAifeitherorbothWGLorEDRChadaconfirmed(+)forthatsite.
AsianCarpDensity
Filteredwater(2‐Lbottles)
Centrifugedwater(50‐mltubes)
High
100%
100%
Medium
100%
96%
Low
0%
26%
K‐9
Table7.PERMANOVAresultstablecontrastingthedifferencesofcentrifugingandfiltrationindifferentreachesofdensityof
AsiancarpbasedonaveragecopynumberfromWGLandEDRCforsixmarkersateachsite.Tablereportsdegreesoffreedom
(df),Sum‐of‐squares(SS),Meansquare(MS),theF‐statistic(Pseudo‐F),andthe
p‐value(P).
PERMANOVA
Source
df
SS
MS
Pseudo‐F
P(perm)
Overall
5
2486.3
497.25
122.44
0.0001
Low
1
26.359
26.359
7.7438
0.0001
Medium
1
85.825
85.825
24.404
0.0001
High
1
118.9
118.9
22.593
0.0001
Res
132
536.07
Total
137
3022.3 K‐10
4.0612 60
NumberofBluegilldetections
50
40
30
20
10
0
Numberofcommoncarpdetections
60
50
40
30
20
10
0
LakeCalumet
CalumetRiver
Site
ChicagoRiver
Figure1.Detectionofbluegill(top)andcommoncarp(bottom)eDNAinfoursitesintheChicagoAreaWaterwaySystem.
DetectionofeDNAincentrifugedsamplesinblue,filteredsamplesinred.Duetoacombinedsewageoverflow(CSO),there
wereonly20samplescollectedintheChicagoRiverinsteadof60.
K‐11
Figure2.MapoftheIllinoisWaterway.Highlightedpoolsindicatesitesselectedashigh(red),medium(yellow),orlow
(green)concentrationsofAsiancarp.BrandonRoadpool(green),Marseillespool(yellow),andLaGrangepool(red)were
selectedbasedonsamplingdatafromtheMonitoringandResponseWorkgroupFishSurveys.Note:figuremisspells
‘Marsailles’.
K‐12
Figure 3. Study reaches in the Illinois River. Each polygon encompasses a study reach 2.5 river km below the upstream lock in the high (red), medium (orange), and low (green) bigheaded carp density pools. K‐13
Acknowledgements
WewouldliketothankallofthefieldstaffateachoftheFWCOsfortheirworkinthefield.Wethank
ChrisMerkes(USGS),XinGuan(ACE),andWGLstaffMarenTuttle‐Lau,KyleVonRuden,Nikolas
Grueneis,andNicholasBerndtwhoassistedinDNAextractions,qPCRdatacollectionandsorting.We
appreciatecommentsfromthreereviewers.
K‐14
References
AsianCarpRegionalCoordinatingCommittee(ACRCC).2014.EnvironmentalDNACalibrationStudy,
InterimTechnicalReviewReport.KellyBaerwaldt,editor.234pages.Availableat
http://www.asiancarp.us/
Amberg,J.J.,S.G.McCalla,E.Monroe,R.Lance,K.Baerwaldt,andM.P.Gaikowski.Inpress.Improving
efficiencyandreliabilityofenvironmentalDNAextractionmethodsandanalysisforsilvercarp.
JournalofGreatLakesResearch.
Anderson,M.J.2001.Anewmethodfornon‐parametricmultivariateanalysisofvariance.Austral
Ecology26:32‐46.
Anderson,M.J.,R.N.Gorley,andK.R.Clarke.2008.PERMANOVA+forPRIMER:Guidetosoftwareand
statisticalmethods.PRIMER‐E:Plymouth,UK.
Baerwaldt,K.,A.Benson,andK.Irons.2013.AsianCarpDistributioninNorthAmerica.Reporttothe
AsianCarpRegionalCoordinatingCommittee,April2013.(updatedApril2014
http://www.asiancarp.us/documents/ACDistribution.pdf)
Barnes,M.A.,C.R.Turner,C.L.Jerde,M.A.Renshaw,W.L.Chadderton,andD.M.Lodge.2014.
EnvironmentalconditionsinfluenceeDNApersistenceinaquaticsystems.EnvironmentalScience
andTechnology48:1819‐1827.
Dejean,T.,A.Valentini,A.Duparc,S.Pellier‐Cuit,F.Pompanon,P.Taberlet,andC.Miaud.2011.
PersistenceofeDNAinfreshwaterecosystems.PLoSONE6:e23398.
Farrington,H.L.,C.E.Edwards,X.Guan,M.R.Carr,K.Baerwaldt,andR.FLance.2015.Mitochondrial
genomesequencinganddevelopmentofgeneticmarkersforthedetectionofDNAofinvasive
bigheadandsilvercarp(HypophthalmichthysnobilisandH.molitrix)inenvironmentalwater
samplesfromtheUnitedStates.PLoSONEDOI:10.1371/journal.pone.0117803.
Ficetola,G.F.,C.Miaud,F.Pompanon,andP.Taberlet.2008.Speciesdetectionusingenvironmental
DNAfromwatersamples.BiologyLetters4:423‐425.
Foote,A.,P.Thomsen,S.Sveegaard,M.Wahlberg,J.Kielgast,L.Kyhn,A.Salling,A.Galatius,L.Orlando,
andM.Gilbert.2012.InvestigatingthepotentialuseofeDNAforgeneticmonitoringofmarine
mammals.PLoSONE7:e41781.
Gibson,K.E.,Schwab,K.J.,Spencer,S.K.andM.A.Borchardt.2012.Measuringandmitigatinginhibition
duringquantitativerealtimePCRanalysisofviralnucleicacidextractsfromlargevolume
environmentalwatersamples.WaterResearch,46,4281–91.
Kery,M.2002.Inferringtheabsenceofaspecies‐acasestudyofsnakes.JournalofWildlife
Management66:330‐338.
McArdle,B.H.1990.Whenarerarespeciesnotthere?Oikos57:276‐277.
Merkes,C.M.,S.G.McCalla,N.R.Jensen,M.P.Gaikowski,andJ.J.Amberg.2014.PersistenceofDNAin
carcasses,slime,andavianfecesmayaffectinterpretationofenvironmentalDNA.PLoSOne
9:e113346.doi:10.1371/journal.pone.0113346.
K‐15
Minamoto,T.,H.Yamanaka,T.Takahara,M.Honjo,andZ.Kawabata.2012.Surveillanceoffishspecies
compositionusingeDNA.Limnology13:193‐197.
MWRG(MonitoringandResponseWorkgroup).2013.MonitoringandresponseplanforAsiancarpin
theUpperIllinoisRiverandChicagoAreaWaterwaySystem.MonitoringandResponse
Workgroup,AsianCarpRegionalCoordinatingCommittee,CouncilonEnvironmentalQuality,
Washington.May2013,141pp.
Reed,J.M.1996.Usingstatisticalprobabilitytoincreaseconfidenceofinferringspeciesextinction.
ConservationBiology10:1283‐1285.
Takahara,T.,T.Minamoto,andH.Doi.2003.UsingenvironmentalDNAtoestimatethedistributionof
aninvasivefishspeciesinponds.PLoSONE8:e56584.doi:10.1371/journal.pone.0056584
Thomsen,P.F.,J.Kielgast,L.Iversen,C.Wiuf,M.Rasmussen,M.Gilbert,L.OrlandoandE.Willerslev.
2012.MonitoringendangeredfreshwaterbiodiversityusingeDNA.MolecularEcology21:2565‐
2573.
U.S.ArmyCorpsofEngineers.2012.QualityAssuranceProjectPlan.
http://www.asiancarp.us/documents/USACE‐eDNA‐QAPP.pdf.
U.S.FishandWildlifeService.2014.QualityAssuranceProjectPlan.
http://www.fws.gov/midwest/fisheries/eDNA/QAPP‐2014.pdf
K‐16
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement