CapkovaM_Studium membranove_MS_2009
Univerzita Pardubice
Fakulta chemicko-technologická
Studium membránové lokalizace konservovaného hypotetického
lipoproteinu bakterie Francisella tularensis s využitím
molekulárně-biologických metod
Bc. Martina Čapková
Diplomová práce
2009
Prohlašuji:
Tuto práci jsem vypracovala samostatně. Veškeré literární prameny a informace, které jsem v práci využila, jsou uvedeny v seznamu použité literatury.
Byla jsem seznámena s tím, že se na moji práci vztahují práva a povinnosti
vyplývající ze zákona č. 121/2000 Sb., autorský zákon, zejména se skutečností, že
Univerzita Pardubice má právo na uzavření licenční smlouvy o užití této práce jako
školního díla podle § 60 odst. 1 autorského zákona, a s tím, že pokud dojde k užití
této práce mnou nebo bude poskytnuta licence o užití jinému subjektu, je Univerzita
Pardubice oprávněna ode mne požadovat přiměřený příspěvek na úhradu nákladů,
které na vytvoření díla vynaložila, a to podle okolností až do jejich skutečné výše.
Souhlasím s prezenčním zpřístupněním své práce v Univerzitní knihovně.
V Pardubicích dne 4. 5. 2009
Bc. Martina Čapková
Poděkování:
Ráda bych na tomto místě poděkovala Ing. Marcele Šimšové, Ph.D., za vedení mé diplomové práce a cenné rady při jejím zpracování. Dále chci poděkovat také
všem zaměstnancům firmy Apronex s.r.o., kteří mi ochotně pomáhali a poskytli mi
skvělé zázemí, zvláště pak Mgr. Daně Manglové za její obětavou pomoc. Také bych
chtěla poděkovat doc. Zuzaně Bílkové a doc. Lence Hernychové za konzultace.
Děkuji svým rodičům, že mi umožnili studium na vysoké škole a vždy mě
podporovali. Děkuji také svému manželovi za jeho podporu a trpělivost.
Anotace
Nedávno publikované studie ukazují, že proteiny membránového bakteriálního komplexu DsbA-DsbB mají přímý vztah k virulenci mikroba (Inaba and
Ito, 2008). Předkládaná práce je zaměřena na studium topologie jednoho z těchto
lipoproteinů Franciselle tulransis (F. tularensis subtyp tularensis), označovaného
jako lipoprotein FTT1103 (gi 56708183, teoretická Mh 38 721 Da, pI 5.23) s DsbA
doménou. Metodami genového inženýrství byla, pro ověření výsledků predikčních
algoritmů, připravena sada vektorů pro expresi jak fúzních rekombinantních proteinů, tak i volných forem FTT1103.
Expresní vektory byly vytvořeny klonováním genu pro FTT1103 a reportérového genu pro periplazmaticky aktivní enzym alkalickou fosfatázu (PhoA). K určení
lokalizace lipoproteinu v Escherichia coli (E. coli) byla využita právě přirozená enzymatická aktivita PhoA při sekreci proteinů do periplazmatického prostoru díky
přítomnosti funkčního N-koncového signálního peptidu. Připravené vektory byly
použity pro expresi, následnou detekci proteinů a jejich enzymatické aktivity
v modelovém organismu E.coli. Na základě získaných poznatků byl navržen topologický model proteinu FTT1103.
KLÍČOVÁ SLOVA: Francisella tularensis, proteinová topologie, alkalická fosfatáza
Summary
Recently was published, that Francisella tularensis proteins in membrane
compartment have direct relation to the microbe pathogenicity. The referred diploma
thesis is focused on FTT1103 lipoprotein topology study. There was prepared a set of
vectors for expression of phusion recombinant proteins as well as their free variants
by using of genetic engeneering methods to validate data in bioinformatic study. Expression vectors were prepared by “in frame” cloning of FTT1103 gene and reporter
gene for periplasmatically active enzyme alkaline phosphatase (PhoA). Activity of
PhoA due to enzyme secretion into periplasmatic space in the presence of functionally active N-terminal signal sequence was used to determine lipoprotein localization
in Escherichia coli (E. coli). The vectors were used for expression, protein detection
and enzymatic activity prediction in a model organism of E. coli. Based on research
data the topology model was proposed.
KEYWORDS: Francisella tularensis, phusion protein, alkaline phosphatise
Zkratky:
2-DE
Dvoudimenzionální elektroforéza
A
Alanin
A,C,G,T,W
Nukleotidy - adenin, cytosin, guanin, tymin, adenin nebo tymin
ABC
ATP binding cassette transporter (ATP vazebný kazetový přenašeč)
AD
adaptor
BCIP
5-bromo-4-chloro-3-indolylfosfát
bp
Počet párů bází (base pair)
BSA
Hovězí sérový albumin (bovine serum albumin)
C
Cystein
CIAP
Calf Intestinal Alkaline Phosphatase (telecí střevní alkalická fosfatáza)
D
Kyselina asparagová
dNTP
Deoxyribonukleotidtrifosfát
E. coli
Escherichia coli
EDTA
Etylendiamintetraoctová kyselina
ELISA
Enzyme-Linked ImmunoSorbent Assay
F. tularensis
Francisella tularensis
FTT1103
Funkční lipoprotein FTT1103
FTT1103-AD Funkční lipoprotein FTT1103 s připojeným adaptorem
FTT1103∆
Lipoprotein FTT1103 bez signální sekvence
G
Glycin
GAMPx
Goat anti-mouse (kozí sekundární protilátka proti myší primární protilátce)
GARPx
Goat anti-rabbit (kozí sekundární protilátka proti králičí primární protilátce)
h
hodina
HEPES
N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid
His
Histidin
I
Izoleucin
IFN-γ
Interferon γ
IgG, IgM
Protilátky – imunoglobulin G a M
iMALDI
Immunoaffinity Matrix-assisted laser desorption/ionization
kDa
Kilodalton
L
Leucin
LB
Luria-Bertani Broth; Lysogeny Broth
LD pufr
Leading DNA pufr
LP
Lipoprotein
LPS
Lipopolysacharid
LVS
Live Vaccine Strain
MALDI
Matrix-assisted laser desorption/ionization
MHC II
Hlavní histokompatibilní komplex II. třídy
min
minuta
PBS
Phosphate-buffered saline (fosfátový pufr)
PCR
Polymerase-chain reaction (polymerázová řetězová reakce)
PhoA
Alkalická fosfatáza
rpm
Počet otáček za minutu (revolutions per minute)
RT
Laboratorní teplota
S
Serin
SDS
Dodecylsulfát sodný
SDS-PAGE
SDS polyakrylamidová gelová elektroforéza
Sp
Signální peptidáza
T
Treonin
TB
Transformation buffer (transformační pufr)
TBE
Tris/boritan/EDTA
TLR
Toll-like receptor
Tul4
T-lymphocyte-reactive protein
V
Valin
X
Libovolná aminokyselina
Obsah
1.
Úvod..................................................................................................... 11
2.
Teoretická část ..................................................................................... 12
2.1
Francisella tularensis....................................................................... 12
2.1.1 Francisella tularensis – intracelulární patogen ........................... 12
2.1.2 Faktory virulence F. tularensis .................................................... 13
2.1.3 Diagnostika F. tularensis a projevy onemocnění ........................ 15
2.1.4 Dostupné vakcíny proti tularémii ................................................ 18
2.2
Faktory virulence intracelulárních patogenů .................................... 18
2.3
Bakteriální lipoproteiny – struktura, funkce, lokalizace .................. 20
2.4
Metody používané k objasnění lokalizace bakteriálních lipoproteinů .
.......................................................................................................... 22
2.5
fakta
Konservovaný hypotetický lipoprotein FTT1103 – dosud známá
.......................................................................................................... 24
3.
Cíl práce ............................................................................................... 26
4.
Experimentální část.............................................................................. 27
4.1
Chemikálie, materiál a přístrojové vybavení ................................... 27
4.1.1 Chemikálie ................................................................................... 27
4.1.2 Roztoky ........................................................................................ 28
4.1.3 Kity .............................................................................................. 31
4.1.4 Enzymy ........................................................................................ 33
4.1.5 Protilátky...................................................................................... 35
4.1.6 Syntetické oligonukleotidy .......................................................... 35
4.1.7 Gely.............................................................................................. 36
4.1.8 Kultivační média.......................................................................... 37
4.1.9 Plazmidy ...................................................................................... 38
4.1.10 Bakteriální kmeny...................................................................... 38
4.1.11 Použité přístroje a pomůcky ...................................................... 38
4.2
Metody a pracovní postupy .............................................................. 40
4.2.1 Příprava superkompetentních buněk E.coli ................................. 40
4.2.2 Transformace plazmidové DNA do superkompetentních buněk. 41
4.2.3 Izolace plazmidové DNA ............................................................ 41
4.2.4 Manipulace s plazmidovou DNA ................................................ 42
4.2.5 Elektroforéza v agarózovém gelu ................................................ 43
4.2.6 Izolace fragmentů DNA z agarózového gelu............................... 44
4.2.7 Kontrola exprese proteinu............................................................ 45
4.2.8 Elektroforéza v polyakrylamidovém gelu (SDS-PAGE)............. 45
4.2.9 Barvení SDS-PAGE gelu pomocí Coomassie Brilliant Blue ...... 46
4.2.10 Imunochemická detekce proteinů na membráně (Western-blot) 46
4.2.11 Glycerolové bakteriální konzervy.............................................. 47
4.2.12 Příprava sekvenační PCR .......................................................... 47
5.
Výsledky a diskuse .............................................................................. 48
5.1
Příprava expresních vektorů ............................................................. 48
5.2
Exprese a detekce jednotlivých proteinů v E.coli ............................ 57
5.3
Využití
fosfatázové
aktivity
pro
lokalizaci
konservovaného
hypotetického lipoproteinu ..................................................................................... 60
5.4
Diskuse ............................................................................................. 60
6.
Závěr .................................................................................................... 62
7.
Literatura:............................................................................................. 63
1.
Úvod
F. tularensis je jemná pleimorfní Gram-negativní intracelulární bakterie vy-
volávající zoonotické onemocnění tularemie. F. tularensis se vyskytuje ve čtyřech
subtypech: subtyp holarctica, mediasiatica, novicida a tularensis. Pokud není nasazena léčba antibiotiky, je onemocněné hypervirulentní variantou F. tularensis subtyp
tularensis smrtelné až v 60 % případů. Ostatní subtypy jsou méně virulentní.
F. tularensis se vyskytuje prakticky po celé severní polokouli. U subtypů tularensis a
holorctica byl sekvenován a anotován genom (Larsson P. et al. 2005) a charakterizován základní proteom (Hubálek M. et al. 2004). F. tularensis subtyp tularensis je
jedním ze šesti mikroorganismů klasifikovaných The U.S. Centers for Disease Control and Prevention jako biologické agens typu A vojensky a teroristicky zneužitelné
(Dennis a kol., 2001; Ellis a kol., 2002). Vzhledem k nebezpečí, které představuje, se
v dnešní době mnoho výzkumů věnuje podrobnému zkoumání této bakterie.
Předkládaná práce je zaměřena na studium jednoho z lipoproteinů (LP), který
je podle predikčních algoritmů lokalizován v periplazmě nebo vnější membráně bakterie F. tularensis. Tento LP se označuje FTT1103 a pokud by se potvrdila jeho lokalizace ve vnější membráně a vliv na patogenicitu, mohl by být využit při vývoji vakcín, nových diagnostických metod nebo při zlepšování možností léčby.
11
2.
Teoretická část
2.1
Francisella tularensis
2.1.1 Francisella tularensis – intracelulární patogen
Bakterie F.tularensis je Gram-negativní, opouzdřená, nepohyblivá, aerobní
bakterie tyčinkovitého tvaru. Její rozměry jsou 0,4-0,6 µm na šířku a 0,8-1,0 µm na
délku. F. tularensis patří mezi bakterie, které netvoří spóry (Macela a kol., 2006).
F. tularensis je původcem tularémie, nemoci označované také jako zaječí
nemoc. Jde o onemocnění s přírodním výskytem, které se šíří zejména mezi vnímavými hlodavci, jakými jsou divoce žijící hlodavci - králíci a zajíci (odtud označení
zaječí nemoc). Může však dojít k jejímu přenosu i na jiné savce včetně člověka. Přenos probíhá různými způsoby: (1) vzdušnou cestou (kontaminovaným prachem nebo
aerosolem), (2) členovci, kteří sají krev na infikovaných zvířatech (komáři a klíšťata), (3) požitím kontaminované vody apod. Tato bakterie napadá různé typy eukaryotických buněk (profesionální makrofágy i nefagocytující buňky) a může se vyskytovat v různých tkáních (např. uzliny, slezina, plíce). Je také schopná uniknout
z fagolysozomu a množit se v cytoplazmě hostitelské buňky (Thakran a kol., 2007).
Letální infekční dávka F. tularensis subtyp tularensis je pro člověka 10 bakterií aerosolovou cestou (Dennis a kol., 2001; Pávková a kol., 2005).
Bylo prokázáno několik subtypů tohoto mikroorganismu, které se liší ve virulenci. Dva pravděpodobně nejznámější subtypy jsou vysoce virulentní F. tularensis
subtyp
tularensis
(typ
A,
kmen
SchuS4)
a
méně
virulentní
subty-
py F. tularensis subtyp holarctica, mediasiatica, novidica (typ B). F.tularensis subtyp tularensis se vyskytuje v severní Americe a subtyp holarctica v Evropě a Asii.
Právě subtyp holarctica způsobuje epidemie také v České republice. Zatímco nákaza
způsobená subtypem holarctica neléčená antibiotiky je letální asi jen ve 30 %, jde-li
o infekci subtypem tularensis, může být úmrtnost až 60 %. Neléčená nebo nedostatečně léčená infekce vede k selhání dýchání, šoku a smrti. Ve střední Asii se vedle
subtypu holarctica vyskytuje také F. tularensis subtyp mediasiatica, jež svými charakteristikami připomíná F. tularensis subtyp tularensis. V Japonsku se dále vyskytuje F. tularensis subtyp japonica (Macela a kol., 2006; Havlasová a kol., 2005).
12
2.1.2 Faktory virulence F. tularensis
Jedny z klíčových struktur spojených s virulencí se jeví povrchové proteinové
struktury bakterií. Proteiny vnější membrány umožňují F. tularensis vstup do hostitelské buňky, přežívání uvnitř buňky a tím únik před imunitním systémem hostitele.
V současnosti je známo 38 membránových proteinů a stále jsou přidávány další, u
kterých je ověřován vztah k virulenci mikroba. Identifikace povrchových struktur je
důležitá, protože vede k vývoji nových protilátek, diagnostických souprav, vakcín
apod. Zatím však nebyl jednoznačně určen protein či skupina proteinů zodpovědných
za virulenci (Janovská a kol., 2007).
Vedle proteinů mohou být za virulenci F. tularensis zodpovědné i další součásti bakterií, jako je její pouzdro, povrchový lipopolysacharid (LPS) a lipid A nebo
alkyl-pyrofosfoestery (fosfoantigeny). Pouzdro je důležité jako ochrana proti lyzi
zprostředkované sérem, avšak uvnitř hostitelských buněk vede k respiračnímu vzplanutí a usmrcení bakterií. LPS F. tularensis má asi 1000x nižší toxicitu než je tomu u
E.coli a současně má jeho O-řetězec unikátní složení. Lipid A obsažený uvnitř bakterie má vliv na virulenci LPS. Fosfoantigeny jsou silnými induktory růstu T-buněk a
tento růst je patrný především při onemocnění tularemií, nikoli při vakcinaci (Sjödstedt, 2003).
Jedním z proteinů vnější membrány je FopA (Francisella outer membrane
protein), jehož hmotnost je 43-kDa. Tento protein byl testován jako možný kandidát
využitelný při přípravě vakcín. Ukázalo se však, že nevyvolává ochranu ani proti
subtypu A, ale dokonce ani proti kmenu LVS (live vaccine strain – oslabený kmen
používaný k vakcinaci zvířat). Další molekulou lokalizovanou ve vnější membráně
F.tularensis je Tul4 (T-lymphocyte-reactive protein) s molekulovou hmotností
17-kDa. Výzkum ukázal, že jde o integrální membránový LP. Při dalším zkoumání
byly objeveny dva paralogy toho proteinu – Tul4-A (FTT0901) a Tul4-B (FTT0904)
(Huntley a kol., 2006).
Další proteiny pravděpodobně lokalizované ve vnější membráně jsou: LP
asociovaný s peptidoglykanem Pal (peptidoglycan-associated lipoprotein, FTT0842);
ortology proteinu vnější membrány TolC-A (FTT1095c) a TolC-B (FTT1724c);
podjednotka pilinu typu IV PilQ (FTT1156c); protein zodpovědný za rezistenci proti
stříbrným kationtům SilC (FTT1258); antigen na povrchu vnější membrány FtaG
(FTT1573c);
násobitel
infekčnosti
makrofágů
13
Mip (macrophage
infectivity
potentiator, FTT1043); N-koncová část ortologu autotransporterového proteinu
Yersinia YapH-N (FTT0918); C-koncová část ortologu autotransporteru Yersinia
YapH-C (FTT0919); LVS ortolog autotransporteru Yersinia, který je výsledkem
delece C-koncové části YapH-N a N-koncové části YapH-C ve čtecím rámci a jehož
název je YapH-LVS (FTL_0439) (Huntley a kol., 2006).
Pomocí predikčních programů byly objeveny další dva proteiny: protein
z chitinázové rodiny Cht1 (FTT0715) a antigen povrchu vnější membrány SrfA
(FTT0025c). Počítačový program LipoP (http://www.cbs.dtu.dk/services/LipoP/)
umožňující předpovědět lipoproteinový charakter ukázal, že Pal, Mip, YapH-N, YapH-LVS, Tul4-A a Tul4-B by mohly být lipoproteiny. Detailní analýza N-koncových
sekvencí TolC-A a SilC však odhalila, že postrádají sekvenci zvanou „lipobox“ a
proto s velkou pravděpodobností nejde o lipoproteiny (Huntley a kol., 2006).
Podle počítačového programu BLAST
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)
obsahuje F. tularensis kompletní Lol systém, který je nezbytný pro přenos lipoproteinů z vnitřní do vnější membrány (Takeda a kol., 2003). Zatím však není zcela
známo, zda dochází opravdu pomocí tohoto systému k translokaci lipoproteinů přes
periplasmatický prostor nebo nikoli (Huntley a kol., 2006).
Dalšími potenciálními faktory virulence jsou 23-kDa protein (IglC), který je
důležitý pro intracelulární proliferaci; proteiny MglA a MglB, které jsou
pravděpodobně regulátory genové exprese; 17-kDa lipoprotein, který je rozpoznáván
lidskými T-buňkami po vakcinaci kmenem LVS (Sjöstedt, 2003); proteiny IglA a
IglB, u nichž dosud nebyla objasněna jejich funkce a produkt genu iglD. S využitím
bioinformatické analýzy byly navrženi další kandidáti faktorů virulence, kterými jsou
proteáza CplB, důležitá pro správné skládání proteinů do jejich terciární konformace;
RNA označovaná jako host factor 1 (Hfq), vázající protein nutný pro translaci sigma
faktorů stacionární fáze; sigma 54 modulační protein, který je alternativním sigma
faktorem; superoxid dismutáza a peroxidáza/kataláza, pomáhající bakteriím přežít
oxidativní vzplanutí ve fagozomech; alkalická fosfatáza (AcpA), která by mohla
pomáhat F.tularensis unikat z fagolysozomů. Mezi potenciální faktory virulence
patří i tzv. „housekeeping“ proteiny (tj. proteiny nezbytné pro přežívání a proliferaci
bakterií),
mezi
něž
patří
glutamin-syntáza,
serin-hydroxymethyltransferáza
(NP_406411), gama-glutamyltranspeptidáza (NP_462452), thymidylát syntáza
(NP_820530), tzv. putative chorismate mutase (NP_456242), beta podjednotka
14
riboflavin
syntázy
(NP_819678)
a
ABC
transportér
(ATP binding cassette
transporter). Z výše uvedených údajů je patrné, že otázka faktorů virulence F.
tularensis je dosud nedostatečně objasněná (Macela a kol., 2006). V nedávné době
byla prokázána důležitost LP s DsbA doménou (disulfid oxidoreduktáza) jako
klíčového faktoru virulence F. tularensis subtypu holarctica. Tento lipoprotein je
nezbytný pro přežití a replikaci bakterie v hostitelské buňce (Straskova a kol., in
press).
2.1.3 Diagnostika F. tularensis a projevy onemocnění
V minulosti se pro diagnostiku používaly bakterie zachycené z krve při bakteriémii. Izolace se následně prováděla na vnímavých laboratorních hlodavcích. Po
jejich smrti se materiál z typických orgánových lézí kultivoval. Pro kultivaci se používal krevní agar s přídavky glukózy a cysteinu, příp. inokulace testovaného materiálu do žloutkového vaku kuřecího embrya. V dnešní době se však kultivace pro diagnostické účely běžně neprovádí kvůli obtížné izolaci, kultivaci a také reálnému riziku nákazy personálu laboratoře. Pro rychlou a přímou diagnostiku se s výhodou využívají imunofluorescenční metody. Buňkami zprostředkovanou přecitlivělost lze detekovat jak in vitro testem inhibice migrace makrofágů a blastickou transformací
lymfocytů, tak také in vivo kožním alergickým tularinovým testem. Provádí-li se
přímé nátěry z patologického materiálu, mají tyčinky kokobacilární tvar. Pro starší
kultury jsou pak charakteristické puchýřkovité útvary a zduřelé vláknité formy (Bednář a kol., 1996).
Na běžných laboratorních půdách nemůže být F.tularensis kultivována, protože je velice náročná na kultivační podmínky. Pro její růst na živných půdách je
nutná přítomnost železa a sloučenin obsahujících -SH skupiny např. cystein nebo
thioglykolát sodný (Lukáš, Libich, 1962). Kultivace je možná také na krevním agaru,
kde je vedle cysteinu přítomná i glukóza, příp. na půdě z koagulovaných vaječných
žloutků. Mezi nezbytná růstová aditiva pro kultivaci F. tularensis patří kromě již
zmíněného cysteinu i glutamin, histidin a thiamin. Ke kultivaci lze použít také chemicky definované medium s pH mezi 6,2 a 6,4 obsahující mimo jiné vápenatou sůl
kyseliny pantothenové. Oba tyto faktory mají pozitivní vliv na růst bakterií (Chamberlein, 1965). Kolonie vyrůstají po 2 i více dnech. Zpočátku jsou drobné a průsvitné, po čase se mléčně zakalí a začnou mít mukózní konzistenci. Fermentace cukrů je
u F. tularensis velice slabá (Bednář a kol., 1996).
15
Pro diagnostiku se spíše než kultivace používá aglutinační test nebo ELISA.
Tradiční metodou diagnostiky je právě aglutinační test, který však není příliš citlivý a
navíc dochází k případům, kdy izolovaný kmen obsahuje jiné antigeny, než které
jsou používány v komerčních testech (Ellis a kol., 2002). Doba, po kterou může aglutinační test podávat falešně negativní výsledky je i více než 25 dnů. Vzhledem
k tomu, že včasná léčba předchází dalším komplikacím, je jasné, že jsou potřeba
rychlejší a robustnější diagnostické metody. Jedním z přístupů může být ELISA, která využívá navázaný vysoce purifikovaný lipopolysacharidový antigen (LPS antigen)
k detekci IgG a IgM v séru. Ani ELISA však nedokáže s jistotou stanovit IgG a IgM
v séru dřív než za 2-3 týdny. Další nevýhodou metod ELISA a aglutinačního testu je
to, že nejsou schopny od sebe odlišit typy A a B. Rychlejší diagnostika je v dnešní
době možná s využitím PCR (polymerase chain reaction). S pomocí PCR lze stanovit
až 102 CFU/ml bakterií ve fosfátovém pufru (CFU – colony-forming unit). Ve vzorku krve, který obsahuje inhibitory PCR, však takovéto citlivosti nelze dosáhnout.
V lidském séru byla citlivost PCR 103-104 CFU/ml bakterií (při použití více PCR to
bylo až 102 CFU/ml bakterií v lidské krvi). Speciální filtrační papír a spojení s tzv.
„PCR-enzyme immunoassay“ (příp. stanovení pomocí TaqMan 5´nukleázy) zvyšuje
citlivost až na méně než 100 CFU/ml bakterií (Ellis a kol., 2002). Metoda PCR je
dostatečně citlivá pro kožní formu tularémie, avšak nedostatečná pro ostatní formy
jako např. respirační nebo tyfoidní forma. Byl však proveden výzkum, který využíval
stimulaci lymfocytů plné krve (Whole-Blood Lymphocyte Stimulation Test). Měřítkem aktivace lymfocytů je u tohoto testu hladina interferonu γ (IFN-γ). Díky tomu,
že buněčná imunita je rychlejší než humorální, lze již během jednoho týdne od infikování člověka prokázat onemocnění. Tato metoda je zatím stále ve vývoji a běžně
se nepoužívá. Její nevýhodou může být, že se vzorky po odebrání musí zpracovat
během pár hodin, protože jsou velice citlivé k poškození - již za 24 hodin mohou být
výsledky zkreslené (Eliasson a kol., 2008). Další rychlou diagnostickou metodou je
mikroskopické pozorování s využitím fluorescenčně značených protilátek. V tomto
případě je možné získat výsledky již během několika hodin (Dennis a kol., 2001).
ELISA metodou využívající monoklonální protilátky lze detekovat přímo
bakteriální lipopolysacharid. Citlivost tohoto stanovení je 103 CFU/ml bakterií ve
fosfátovém pufru a 104 CFU/ml bakterií v lidském séru. Pro rychlé stanovení
v terénu lze použít ruční imunochromatografický test využívající jak monoklonální,
16
tak i polyklonální protilátky proti LPS antigenu. Citlivost tohoto testu je 106 CFU/ml
ve fosfátovém pufru a 107 CFU/ml v lidském séru. Imunochromatografický test je
sice jednoduchý a rychlý (výsledky jsou k dispozici během 15 minut), avšak díky
nízké citlivosti nelze na základě negativního výsledku jednoznačně vyloučit infekci
F. tularensis (Ellis a kol., 2002).
Nová kvantitativní diagnostická metoda využívající pro detekci F. tularensis
hmotnostní spektrometrii je rychlá, bezpečná, citlivá a specifická. Tato metoda se
nazývá immunoaffinity MALDI (zkráceně označováno iMALDI) a je založena na
detekci IglC peptidu F. tularensis. Protilátky proti peptidu jsou nejprve imobilizovány na afinitní kuličce, následně jsou přidány natrávené „lehké“ a „těžké“ peptidy,
které jsou adsorbovány na kuličku (imunoadsorpce), kuličky se uspořádají na destičku pro MALDI analýzu, je přidán roztok matrix a další postup je již stejný jako u
MALDI. „Těžké“ peptidy jsou izotopicky značené peptidy s hledaným epitopem,
které slouží jako vnitřní standard. Jako „lehké“ peptidy jsou označeny peptidy, které
jsou analyzovány. Metoda iMALDI má oproti mikroaglutinačnímu testu tu výhodu,
že je rychlá (měřitelná hladina protilátek pro mikroaglutinační test je asi za 1 týden
po infekci), a oproti PCR a ELISA není tolik citlivá ke kontaminaci materiálu jinou
DNA/mikroorganismem. Metodou iMALDI se stanovuje IglC v PBS roztoku, ale
stanovení lze provést i z lidské plazmy nebo nosního výtěru (Jiang a kol., 2007).
F. tularensis je intracelulárním parazitem, díky čemuž se jí daří unikat před
imunitním systémem napadeného organismu. Je schopná žít a množit se
v makrofázích a má aparát, který jí umožní únik z fagolysozomů do cytoplazmy. Její
lokalizace v orgánech závisí do určité míry na způsobu infikování, i když přednostně
napadá játra, slezinu, ledviny, plíce a lymfatické uzliny. Počátek onemocnění bývá
provázen bolestmi hlavy, horečkami (38-40 °C), zimnicemi, rýmou a podrážděním
krku (Dennis a kol., 2001). Onemocnění má charakter buď akutní infekce, nebo je
chronické. Při akutní fázi lze pozorovat zvýšenou teplotu a malátnost, při chronické
pak zhnisání a zvětšení mízních uzlin a ztrátu pohyblivosti (Sedlák, Tomšíčková,
2006; Bednář a kol., 1996).
Podle způsobu nakažení lze tularémii rozdělit na několik forem. A to kožní,
způsobenou především členovci, dále pak oční forma, ústní forma po požití kontaminované potravy nebo vody a plicní, která je způsobena vdechnutím kontaminovaného
17
prachu nebo aerosolu. Pravděpodobně nejzávažnější je poslední zmiňovaná forma –
plicní. Projevuje se zánětem plic, kašlem, dušností a bolestí na hrudi. Ústní forma
může mít dvě různé manifestace. Buď připomíná těžkou angínu, nebo tyfus (tyfoidní), kdy jsou časté bolesti břicha, průjmy, zvětšení sleziny, krvácení a vředy
v zažívacím traktu (Sedlák, Tomšíčková, 2006; Bednář a kol., 1996).
2.1.4 Dostupné vakcíny proti tularémii
Z kmene F.tularensis subtyp holarctica byl izolován oslabený kmen „Live
Vaccine Strain“ (LVS), který se používal k vakcinaci. V dnešní době se lidé neočkují
tímto kmenem, protože kmen LVS již není licencován, není znám důvod atenuace a
také hrozí reálné riziko konverze na virulentní kmen. Dále není vyřešen mechanismus navození imunity a hrozí tak nebezpečí infekce imunosuprimovaných jedinců.
Ovšem vzhledem k tomu, že jiná vakcína zatím neexistuje, vakcinace lidí kmenem
LVS se ve speciálních případech provádí. Jde o lidi, kteří jsou v přímém ohrožení
touto bakterií (Janovská a kol., 2007).
Nedávný výzkum odhalil možný cíl vývoje živé oslabené vakcíny. Pokusy
provedené s kmenem F. tularensis subtyp holarctica, který obsahoval nefunkční gen
pro lipoprotein FTT1103 s DsbA doménou, ukázaly, že tento lipoprotein je klíčovým
pro virulenci bakterie F. tulaensis. Tento lipoprotein navozoval u pokusných zvířat
protektivní imunitu, takže byly chráněny před infekcí plně virulentním kmenem typu
B (Straskova a kol., in press). Byly testovány také mutantní kmeny s defektním genem pro lipoprotein FTT1103 s DsbA doménou, které navozovaly protektivní imunitu proti SchuS4. Pokud by se tedy potvrdilo, že lipoprotein FTT1103 je skutečně
zodpovědný za virulenci F. tularensis, znamenalo by to důležitý objev nejen pro vývoj vakcíny proti F. tularensis, ale i pro diagnostiku (Qin a kol., 2009).
2.2
Faktory virulence intracelulárních patogenů
Pro virulenci intracelulárních patogenů je klíčové nejenom adherovat na povrch hostitelských buněk, ale také proniknout do jejich nitra. K přichycení na povrch
hostitelských buněk využívají bakterie molekuly označované jako adheziny. Tyto
molekuly jsou velice variabilní od jednoduchých sacharidů až po složité organely.
Mohou mít vláknitou a ohebnou podobu fimbrií (pili) nebo to mohou být složky buněčné membrány. Tyto molekuly jsou specifické pro jednotlivé druhy bakterií. Velice důležité jsou povrchové struktury bakterií, jako LPS a proteiny vnější membrány u
18
Gram-negativních
bakterií,
nebo
polysacharidy
obsažené
v buněčné
stěně
Gram-pozitivních bakterií. Tyto struktury mohou vedle ochrany proti vnějšímu prostředí sloužit také k adhezi bakterií na hostitelskou buňku (Macela a kol., 2006).
Molekuly, které pomáhají průniku bakterií do hostitelských buněk, se nazývají invaziny (u bakterie Listeria monocytogenes se nazývají internaliny). Některé adheziny mohou plnit zároveň i funkci invazinů, jako např. „fibronectin binding protein“ bakterií Staphylococcus aureus a Streptococcus pyogenes. Mezi invaziny patří i
proteázy a peptidázy, fosfolipázy, kolagenázy, hyaluronidázy apod., které umožňují
průnik bakterií tkáněmi. Invaziny rozrušují membránu vakuol a tím umožňují únik
bakterií z vakuoly do cytoplazmy. Průnik skrze membránu hostitelské buňky může
být zprostředkován také přestavbou cytoskeletu hostitelské buňky, která je indukována GTPázou z rodiny Rho (např. Brucella melitensis, Salmonella enterica). Sekreční systémy jsou pro patogenitu bakterií také důležité, protože s jejich pomocí
bakterie transportuje adheziny a invaziny na svůj povrch a zároveň umožňují sekretovat i regulátory obranných mechanismů hostitelské buňky (Macela a kol., 2006).
Pro patogenitu bakterií jsou nutné proteiny, které zajišťují základní metabolické pochody a umožňují bakteriím přežívat v buňkách hostitelského organismu
Tyto proteiny se označují jako tzv. „house-keeping“ proteiny. Mezi „house-keeping“
proteiny lze zařadit např. glutamin-syntázu nezbytnou pro přežívání bakterií
v makrofázích (Mycobacterium tuberculosis, Salmonella typhimurium), thymidylát-syntázu umožňující intracelulární proliferaci (Salmonella enterica) nebo
γ-glutamyl transpeptidázu indukující apoptózu (Helicobacter pylori) (Bednář a kol.,
1996).
Dalším z faktorů virulence jsou bakteriální toxiny. Tyto toxiny mohou působit buď přímo v hostitelské buňce nebo jejím těsném okolí, nebo mohou být krevním
oběhem zaneseny do jiných částí těla. U Gram-pozitivních bakterií se toxiny do prostředí uvolňují během růstu. Toxiny Gram-negativních bakterií se uvolňují až po
narušení jejich buněčné stěny. Účinky toxinů jsou různé od cytotoxických, jako např.
O-streptolyzin, δ-lyzin nebo listeriolyzin, přes pyrogenní jako např. pyrogenní toxin
bakterie Streptococcus pyogenes nebo mohou způsobovat toxický šok jako je tomu
v případě toxinu toxického šoku Staphylococcus aureus. Jako endotoxin se označuje
lipopolysacharid nebo jeho odštěpená část. Mezi toxiny lze zařadit i superantigeny,
molekuly vázající se nespecificky na T-lymfocyty a MHC II (hlavní histokompati19
bilní komplex II. třídy). Nebezpečí superantigenů spočívá v jejich schopnosti vyvolat
autoimunitní onemocnění (Bednář a kol., 1996; Macela a kol., 2006).
Geny pro faktory virulence jsou často lokalizovány blízko sebe v oblastech
označovaných jako „ostrovy patogenity“.
2.3
Bakteriální lipoproteiny – struktura, funkce, lo-
kalizace
Lipoproteiny se skládají z proteinové a lipidické části. Na N-konci proteinu je
navázána N-acyl diacylglycerylová skupina, která umožňuje ukotvení lipoproteinu
v membráně. Spojení proteinu s diacylglycerylem zajišťuje thioeterová vazba mezi
diacylglycerylem a cysteinovým zbytkem (Obr. 1).
Pro lipoproteiny je charakteristický „lipobox“. Jde o krátkou aminokyselinovou sekvenci na N-konci peptidu, která obsahuje vždy cysteinový zbytek. Tato sekvence je tvořena aminokyselinami [LVI][ASTVI][GAS][C] (Obr. 2). Bakterie používají charakteristický způsob lipidace této oblasti peptidu. Posttranslačně dojde
k navázání N-acyl-diacyl-glycerylové skupiny na thiolovou skupinu cysteinu. Peptid
je následně rozštěpen enzymem signální peptidázou (Sp) a na volnou N-koncovou
skupinu cysteinu je navázán třetí acyl. Tím vzniká triacylovaný lipoprotein. Přítomnost lipidových zbytků umožňuje ukotvení proteinu v membráně. N-konec lipoproteinů obsahuje signální peptid, který je důležitý pro jejich lokalizaci v membráně
bakterií (Obr. 3) (www.mrc-lmb.cam.ac.uk).
Lipidace je také klíčová pro správnou funkci proteinů, která je rozmanitá.
Některé slouží k transportu exopolysacharidů a kapsulárních polysacharidů přes
membránu, jiné jsou aktivátory pro další proteiny (Marczak a kol., 2006). Příkladem
takových lipoproteinů je i FTT1103 (gi 56708183) a Tul4 (32395512), které umožňují aktivovat Toll-like receptory (TLR) (Thakran a kol., 2007). Pro správnou funkci
lipoproteinů je důležitá i jejich sekundární struktura. Jako příklad lze uvést přítomnost sekundární struktury proteinů β-barelu u transportních proteinů, které
v membráně vytváří kanál (Marczak a kol., 2006).
20
Obr. 1 Schematické znázornění struktury lipoproteinu. Na cysteinový
zbytek proteinu je thioeterovou vazbou navázán diacylglyceryl. Třetí acyl je
navázán na N-konci cysteinu (R3). V pozicích R1 a R3 bývá navázán zbytek
kyseliny palmitové, v pozici R2 může být navázán zbytek kyseliny palmitové nebo olejové (www.mrc-lmb.cam.ac.uk; Kamalakkannan a kol., 2004).
Obr. 2 Zastoupení aminokyselinových zbytků v N-terminální proteinové sekvenci „lipobox“. Na ose x jsou uvedeny zkratky jednotlivých aminokyselinových zbytků (L, V, I, A, S, T, G, C); na ose y je procentuelní zastoupení aminokyselinových zbytků. Na první pozici v „lipobox“ bývá nejčastěji leucin, druhá a třetí pozice je variabilnější – na druhé je to často alanin nebo serin, na třetí pak alanin nebo glycin. Poslední pozici vždy zaujímá
cystein (www.mrc-lmb.cam.ac.uk).
Bakteriální lipoproteiny jsou u Gram-negativních bakterií lokalizovány ve
vnitřní či vnější membráně nebo v periplazmě. To, v jaké části membrány bude lipoprotein lokalizován, závisí na mnoha faktorech a jedním z nich je uspořádání a za21
stoupení jednotlivých aminokyselinových zbytků v „lipobox“ sekvenci. Pokud je na
druhém místě kyselina asparagová (CXD), pak bude teoreticky odhadnuta lipoproteinová lokalizace ve vnitřní membráně. Jestliže lipoprotein v této pozici kyselinu
asparagovou postrádá, bude pravděpodobně lokalizován ve vnější membráně. Lipoproteiny mohou obsahovat jednu nebo i více transmembránových oblastí a mohou
tvořit homo- i heterokomplexy (Thakran a kol., 2007; Marczak a kol., 2006).
Obr. 3 Schematické znázornění ukotvení lipoproteinu v membráně.
Hydrofilní část proteinu je orientována do cytoplazmy, periplazmatického
prostoru nebo vnějšího prostředí, zatímco hydrofobní lipidická část představuje kotvu, kterou je celý lipoprotein ukotven v membráně
(www.mrc-lmb.cam.ac.uk).
2.4
Metody používané k objasnění lokalizace bakte-
riálních lipoproteinů
K predikci bakteriálních lipoproteinů lze použít počítačové programy, které
obsahují databáze známých lipoproteinů. Proteinovou sekvenci hledaného lipoproteinu porovnávají s již známými sekvencemi a motivy lipoproteinů v databázi a statistickými výpočty následně určí pravděpodobnou lokalizaci lipoproteinu v bakterii.
Jako příklady programů lze uvést BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi),
PSORT-B (www.psort.org) nebo LipoP (www.cbs.dtu.dk/services/lipoP/). Program
PSORT-B hledá oblasti signálních peptidů, transmembránových α-helixů a motivů
specifických pro určitou lokalizaci. Je schopen zařadit lipoprotein do jedné z pěti
možných lokalizací (cytoplazma, vnitřní membrána, periplazmatický prostor, vnější
membrána a extracelulární prostor) a dokonce je schopen určit, zda protein není lokalizován zároveň ve dvou místech (např. cytoplazma a vnitřní membrána). Předpověď
lokalizace některých lipoproteinů však může být obtížná, pokud jde o proteiny vnitřní membrány se 2 a méně α-helixy, proteiny asociované s vnější membránou bez
22
klasického β-barelu či proteiny sekretované jinak než sekreční drahou typu II (Gardy
a kol., 2003). Program LipoP je schopný predikovat N-koncovou signální sekvenci,
oblast rozeznávanou signálními peptidázami I a II a protein bez signální sekvence.
Při predikci lokalizace využívá oblasti signální sekvence, která může být buď
v n-oblasti, h-oblasti nebo c-oblasti („lipobox“). Tento program je vhodný pro predikci lokalizace lipoproteinů a míst rozeznávaných signálními peptidázami I a II,
dále pak cytoplazmatických a transmembránových proteinů (Juncker a kol., 2003).
K izolaci proteinů jednotlivých buněčných kompartmentů se používá rozdělení v sacharózovém gradientu. Tento gradient se vytvoří postupným vrstvením
55 %, 50 %, 45 %, 40 %, 35 % a 30 % (w/v – hmotnostní procenta) roztoku sacharózy. Sacharóza je nakonec převrstvena homogenizovaným vzorkem obsahujícím analyzované proteiny a lipoproteiny. Následuje dlouhodobá centrifugace, během které
dojde k rozdělení směsi proteinů na jednotlivé frakce podle obsahu proteinů a lipidů.
Přítomnost studovaných proteinů v jednotlivých vrstvách je analyzována SDS-PAGE
s detekcí stříbrem nebo imunochemicky (Huntely a kol., 2006).
Pro separaci jednotlivých bakteriálních proteinů se používá dvoudimenzionální elektroforézu (2-DE). Touto metodou se proteiny nejprve rozdělí podle svého
izoelektrického bodu a následně se dělí podle molekulové hmotnosti (SDS-PAGE).
Proteiny lze detekovat buď stříbrem přímo v polyakrylamidovém gelu nebo imunochemicky metodou Western-blot. Takto získané mapy jsou pro daný kmen charakteristické. Dalším krokem může být analýza proteinů hmotnostní spektrometrií. Nejprve jsou jednotlivé body, odpovídající konkrétním proteinům, z SDS gelu izolovány
a následně upraveny pro vlastní analýzu. Analýza vzorků probíhá metodou hmotnostní spektrometrie MALDI-TOF (matrix-assisted laser desorption/ionization
time-of-fly) a získaná hmotnostní spektra jsou použita pro identifikaci proteinu (Havlasová a kol., 2005).
K analýze proteinů lze použít i fúzi s reportérovým genem. Proteiny kódované reportérovými geny mají specifickou aktivitu, která slouží k jejich průkazu. Jako
příklad
cytoplasmatického
reportérového
genu
lze
uvést
chloramfeni-
kol acetyltransferázu (CAT), která bakterii poskytuje ochranu proti antibiotiku chloramfenikolu. Membránovými reportérovými geny mohou být hybridní protein mannitol permeáza-PhoA nebo b-podjednotka F0 ATPázy. Periplazmatickými reportérovými
geny
jsou
β-laktamáza
(bla),
23
která
rozkládá
penicilin
(http://www.epibio.com/f5_4/f5_4pp.asp) a alkalická fosfatáza (PhoA), která po přidání vhodného substrátu (např. 5-bromo-4-chloro-3-indolylfosfát BCIP) umožňuje
konverzi bezbarvého substrátu na barevný produkt (Prochazkova a kol., 2005; Mierendorf a kol., 1987).
2.5
Konservovaný hypotetický lipoprotein
FTT1103 – dosud známá fakta
Protein FTT1103 je tvořen 365 aminokyselinovými zbytky. Jeho teoretická
molekulová hmotnost je 38,72 kDa a izoelektrický bod 5,11. Podle výsledků
hmotnostní analýzy je jeho reálná molekulová hmotnost 49,82 kDa a izoelektrický
bod 4,45. Při analýze využívající 2-DE se protein FTT1103 vyskytuje v několika
nábojových a hmotnostních variantách. Podle predikčního programu LipoP je
FTT1103 membránový lipoprotein (Janovská a kol., 2007). Obsahující DsbA
doménu. Je vysoce pravděpodobné, že jde o periplazmatický lipoprotein (Qin a kol.,
2009), čemuž by odpovídalo i to, že jeho N-terminální signální peptid je odštěpován
signální peptidázou II (Janovská a kol., 2007). Signální peptidáza I odštěpuje také
N-terminální signální peptid, avšak na rozdíl od signální peptidázy II nepřenáší
protein na lipidovou kotvu. Proteiny štěpené signální peptidázou I jsou buď
sekretované proteiny nebo proteiny ukotvené v membráně další transmembránovou
doménou. Proteiny štěpené signální peptidázou II jsou k membráně vázány lipidovou
kotvou (Gomez a kol., 1999).
FTT1103 obsahuje motiv CXXC, který je součástí „DsbA-like“ struktur. Patří tedy
do skupiny DsbA, podskupiny Com1-like (http://www.ncbi.nlm.nih.gov/sites/;
http://www.ncbi.nlm.nih.gov/protein)
(Obr.
4).
Protein
DsbA
má
disul-
fid oxidoreduktázovou aktivitu, avšak jeho role v patogenezi je nejasná. DsbA/Com1–like doména je důležitá pro správné sbalení proteinů vnější membrány a
sekretovaných proteinů, které mohou sloužit jako toxiny (Strašková a kol., in press).
Lipoprotein FTT1103 spolu s TUL4 a dalšími triacylovanými lipoproteiny jsou
schopny aktivovat Toll-like receptory (TLR), konkrétně heterodimer TLR2/TLR1.
TLR jsou molekuly na povrchu buněk a v endosomálních kompartmentech, které
jsou schopny detekovat produkty bakterií, virů, kvasinek a prvoků. Za stimulaci
TLR2/TLR1 je pravděpodobně zodpovědná právě lipidová složka lipoproteinů
FTT1103 a TUL4. Oba proteiny jsou s největší pravděpodobností triacylovány.
24
Podle nedávných výzkumů tyto dva lipoproteiny hrají jednu z hlavních a důležitých
rolí při vrozené imunitní odpovědi na infekci vyvolanou F. tularensis. Konkrétně
lipoprotein FTT1103 je pravděpodobně zodpovědný za humorální imunitní odpověď.
Díky stimulaci TLR2/TLR1, která vede k produkci cytokinů, lze TUL4 a FTT1103
považovat za faktory virulence F. tularensis (Thakran a kol., 2007).
oblast „lipobox“ (LVAC)
DsbA/Com1-like doména (motiv CMYC
mezi 164. a 167. aminokyselinou)
NH2
COOH
1 19-22
150
164-167
317
365
Obr. 4 Schematické znázornění lipoproteinu FTT1103. Červeně lipobox,
zeleně DsbA/Com1-like doména, motiv CXXC („DsbA-like“ struktura) mezi
aminokyselinami 164 a 167. Čísla udávají pořadí aminokyselinových zbytků
(počítáno od N-konce). Oblast „lipobox“ je charakteristická pro membránové
lipoproteiny, zatímco DsbA je periplazmatický protein (proto je motiv CXXC
typický pro proteiny periplazmy). Písmena L, V, A, C, M, Y označují aminokyseliny – leucin (L), valin (V), alanin (A), cystein (C), metionin (M) a tyrosin
(Y).
Nedávné studie ukazují, že nejenom FTL_1096 izolovaný z kmene LVS
(označení pro FTT1103 subtypu holarctica) je schopen navodit protektivní imunitu.
Stejnou vlastnost má i FTT1103 izolovaný z kmene SchuS4. Lipoprotein FTT1103 je
zodpovědný za únik F. tularensis z fagolysozomu. U mutantních kmenů
s nefunkčním FTT1103, bylo pozorováno, že se z fagolysozomů uvolňuje méně bakterií. Ty bakterie, které se přesto uvolnily, byly imunitním systémem rychle odstraněny a rozšíření bakterií do orgánů bylo minimální. Navíc myši, které byly infikovány tímto mutantním kmenem, byly následně ve většině případů imunní vůči infekci
divokým typem („wild-type“) kmene SchuS4 (Qin a kol., 2009).
25
3.
Cíl práce
Cíle diplomové práce vycházejí z výsledků a požadavků předcházejícího vý-
zkumu. Hlavním cílem bylo, na základě predikčních algoritmů a s využitím nových
přístupů pro studium membránové lokalizace lipoproteinů, potvrdit a určit topologii
jednoho z proteinů FTT1103 mikroba F. tularensis. Metodami genového inženýrství
jsme připravili sérii vektorů jak pro expresi fúzních proteinů, sestávající z FTT1103 a
reportérového enzymu alkalická fosfatáza – PhoA, tak pro expresi volných forem
proteinu FTT1103 v plné délce i s chybějící N-terminální signální sekvencí.
Pro
určení
lokalizace
FTT1103
v komplexu
vnitřní
membrána –
periplazmatický prostor – vnější membrána byla využita přirozená aktivita alkalické
fosfatázy v periplazmatickém prostoru. Pro tento účel jsme sestrojili expresní vektory
s předpokládanou funkční signální sekvencí odvozenou od FTT1103 v porovnání se
signální sekvencí PhoA a zároveň jsme připravili vektory bez signálních sekvencí.
Důkaz funkční signální sekvence a zároveň ověření lokalizace jsme provedli barevnou detekcí růstu bakterií na tuhém kultivačním mediu obohaceném o substrát pro
PhoA.
Kontrolu úrovně exprese proteinů jsme provedli pomocí SDS elektroforézy
v polyakrylamidovém gelu s barvením Coomassie Briliant Blue a zároveň imunochemickým stanovením Western-blot s následnou detekcí proteinů specifickými protilátkami.
26
4. Experimentální část
4.1
Chemikálie, materiál a přístrojové vybavení
4.1.1 Chemikálie
40 % akrylamid/bis 37,5:1 (akrylamid), Amresco, USA
Agaróza pro DNA elektroforézu, Cambrex, USA
Ampicilin, sodná sůl (Amp), Amresco, USA
Azid sodný (NaN3), Penta, ČR
Bakteriologický agar (LB-agar), Amresco, USA
Bromfenolová modř, Sigma, USA
Calf Intestinal Alkaline Phosphatase (CIAP), Fermentas, Litva
Comassie Brilliant Blue R250 (CBB), Serva, Německo
D-glukosa, bezvodá (glukosa), Amresco, USA
Dihydrogenfosforečnan draselný (KH2PO4), Penta, ČR
Dimethylsulfoxid (DMSO), Amresco, USA
Dithiothreitol (DTT), Serva, Německo
DNA polymeráza, Finnzymes, Finsko
dNTPs mix, Fermentas, Litva
Dodecylsulfát sodný (SDS), Amresco, USA
Ethidiumbromid, Amresco, USA
Ethylakohol, absolutní (etanol), Penta, ČR
Ethylendiamin-tetraoctová kyselina (EDTA), Amresco, USA
Glycerin, bezvodý (glycerin), Penta, ČR
Glycin, Serva/Lachema/Penta, Německo/ČR/ČR
Hydrogenfosforečnan sodný, heptahydrát (Na2HPO4 . 7 H2O), Amresco, USA
Hydroxid sodný (NaOH), Amresco, USA
Chlorid draselný (KCl), Penta, ČR
Chlorid sodný (NaCl), Penta, ČR
Isopropylalkohol (isopropanol), Penta, ČR
Isopropyl-β-D-thiogalaktosid (IPTG), Alexis, Švýcarsko
Kanamycin sulfát (Kan), Amresco, USA
27
Koncentrát rychloustalovače, Foma Bohemia spol. s r.o., ČR
Koncentrát vývojky, Foma Bohemia spol. s r.o., ČR
Kyselina boritá (H3BO3), Penta, ČR
Kyselina chlorovodíková (HCl), Penta, ČR
Kyselina kumarová, Sigma, USA
Kyselina octová (CH3COOH), Penta, ČR
LB médium, Amresco, USA
Luminol, Sigma, USA
Methylalkohol (metanol), Penta, ČR
Močovina, Penta, ČR
N-2-Hydroxyethylpiperazin-N'-2-ethanosulfonová kyselina (HEPES),Amresco, USA
N,N,N´,N´-tetrametylethylendiamin (TEMED), Amresco, USA
Octan draselný (CH3COOK), Penta, ČR
Odtučněné mléko, Bohemilk, ČR
Peroxid vodíku (H2O2), Penta, ČR
Persíran amonný (APS), Amresco, USA
Reakční pufr pro DNA polymerázu (HF) , Finnzymes, Finsko
Reakční pufr pro T4 DNA ligázu – 10x koncentrovaný, Fermentas, Litva
Restrikční endonukleázy a jejich pufry, Fermentas, Litva
Roztoky E1-E6 z kitu JETSTAR 2.0, Genomed, Německo
Sacharóza, Amresco, USA
λ DNA, Fermentas, Litva
Standard molekulových hmotností pro SDS PAGE (Prestained Protein Molecular Weight Marker), Fermentas, Litva
Tris(hydroxymethyl)aminomethan (Tris), Amresco, USA
Tris(hydroxymethyl)aminomethan-hydrochlorid (Tris-HCl), Amresco, USA
Tween 20, Pro Pure, Norsko
Všechny použité chemikálie byly v analytické čistotě.
4.1.2 Roztoky
Ampicilin (Amp; 150 mg/ml):
ampicilin …………………………. 7,5 g
destilovaná H2O ………………… 30 ml
28
Destilovanou H2O jsme doplnili do 50 ml, zamíchali a filtrovali přes filtr 0,2
µm Corning. Alikvoty jsme uchovávali při -20 °C.
Blokovací roztok:
sušené odtučněné mléko ………….. 2,5 g
PBS (10x konc.) ………………..… 5 ml
destilovaná H2O …...... doplnit do 50 ml
Blotovací pufr (10x koncentrovaný):
glycin …………………………... 390 mM
Tris …………………………….. 480 mM
SDS ………………………….…… 0,37 % (w/v)
Zásobní roztok jsme uchovávali při 4°C.
Blotovací pufr (1x koncentrovaný):
glycin …………………….…….... 39 mM
Tris ………………………..……... 48 mM
SDS ……………………………….. 0,037 % (w/v)
metanol ………………………..…. 20 % (w/v)
Zásobní roztok jsme uchovávali při 4°C a spotřebovali do 1 týdne.
ECL1:
luminol ……………………...…….. 0,0675 g
DMSO ………………………….… 1,5 ml
kyselina kumarová ………………... 0,0555 g
1,5 M Tris (pH=8) ……………….... 9,99 ml
destilovaná H2O ……... doplnit do 50 ml
ECL2:
H2O2 …………………………..… 91,8 µl
0,1 M Tris-Cl (pH=8,5) ………...… 9,99 ml
destilovaná H2O ……... doplnit do 50 ml
29
Kanamycin (Kan; 60 mg/ml):
kanamycin ………………………… 3 g
destilovaná H2O …………………. 30 ml
Destilovanou H2O jsme doplnili do 50 ml, zamíchali a filtrovali přes filtr 0,2
µm Corning. Alikvoty jsme uchovávali při -20 °C.
Odbarvovací roztok:
metanol ………………………….. 10 % (w/v)
CH3COOH …………………….... 10 % (w/v)
destilovaná H2O ……. doplnit do 100 ml
PBS (10x koncentrovaný):
NaCl ………..….………………... 80 g
KCl ……………………………..… 2 g
Na2HPO4 . 7 H2O …………….… 21,4 g
KH2PO4 ………………….……..… 2 g
destilovaná H2O …... doplnit do 1000 ml
Roztok jsme sterilizovali autoklávováním (121 °C, 20 min) a uchovávali při
4 °C.
Promývací roztok:
PBS
Tween 20 …………………………. 0,05 % (w/v)
Roztok Coomassie Brilliant Blue R-250:
Coomassie Brilliant Blue R-250 ….. 0,25 g
metanol ………………………….. 45 ml
CH3COOH …………………….... 10 ml
destilovaná H2O …..... doplnit do 100 ml
Po rozpuštění jsme roztok přefiltrovali přes filtrační papír.
TB pufr:
HEPES ………………………….. 10 mM
30
MnCl2 …………………………… 55 mM
CaCl2 ……………………………. 15 mM
KCl …………………………….. 250 mM
MnCl2 jsme přidali až po úpravě pH na 6,7 pomocí KOH. Roztok jsme filtrovali přes filtry s velikostí pórů 0,45 µm (4 °C).
TBE pufr (10x koncentrovaný):
Tris ………………………………. 54 g
kyselina boritá ………………...…. 27,5 g
0,5 EDTA (pH=8,0) ……………... 20 ml
destilovaná H2O …... doplnit do 1000 ml
Tris-glycinový elektrodový pufr (10x koncentrovaný):
Tris …………………………..…. 250 mM
glycin ………………………..…..... 2,5 M
SDS …………………………..…... 1 % (w/v)
Vzorkový pufr pro agarózovou elektroforézu (6x koncentrovaný):
bromfenolová modř ………….…… 0,25 % (w/v)
sacharóza …………………..…..… 40 % (w/v)
Alikvoty jsme uchovávali při -20 °C.
Vzorkový pufr pro SDS PAGE (2R – 2x koncentrovaný):
Tris-Cl (pH=6,8) ……….……..... 100 mM
DTT …………………………...... 200 mM
glycerin ………………………….. 20 % (w/v)
SDS ……………………………….. 4 % (w/v)
bromfenolová modř ……………….. 0,2 % (w/v)
Alikvoty jsme uchovávali při -20 °C.
4.1.3 Kity
Jet Quick Gel Extraction Spin Kit (izolace z gelu), Genomed, Německo
JET Star
JET Star (Genomed, Německo):
31
E1 (resuspendace buněk):
Tris ……………………..... 50 mM
EDTA ………………..….. 10 mM
pH upravené pomocí HCl na 8,0
E2 (lyze buněk):
NaOH ………………….. 200 mM
SDS ………………………. 1 % (w/v)
E3 (neutralizace):
octan draselný …………….. 3,1 M
pH upravené pomocí CH3COOH na 5,5
E4 (ekvilibrace kolony):
NaCl ………………….… 600 mM
octan sodný …………….. 100 mM
TritonX-100 ………………. 0,15 %
pH upravené pomocí CH3COOH na 5,0
E5 (promytí kolony):
NaCl ……………………. 800 mM
octan sodný …………….. 100 mM
pH upravené pomocí CH3COOH na 5,0
E6 (eluce DNA):
NaCl ………………….. 1250 mM
Tris …………………….. 100 mM
pH upravené pomocí HCl na 8,5
JET Quick (Genomed, Německo):
L1 (rozpuštění gelu):
NaClO4
octan sodný
32
TBE-rozpouštěcí roztok
L2 (promytí, rekonstituce):
etanol
NaCl
EDTA
Tris-Cl
4.1.4 Enzymy
T4 DNA ligáza a 10x koncentrovaný T4 DNA ligázový pufr, Fermentas,
Litva
RNáza, Fermentas, Litva
DNA Phusion Polymeráza a 5x koncentrovaný Phusion HF pufr, Finnzymes,
Finsko
Název endonukleázy
Rozpoznávaná
sekvence
Doporučený pufr
BamHI
G|GATCC
BamHI pufr; Green
Eco47I (AvaII)
G|GWCC
Red
EcoRI
G|AATTC
MluI
A|CGCGT
Red
NcoI
C|CATGG
1x Tango, 2x Tango
PstI
CTGCA|G
Orange, Red
PvuII
CAG|CTG
Green
SacI
GAGCT|C
SacI pufr; Blue, 1x Tango
SalI
G|TCGAC
Orange
SmaI
CCC|GGG
1x Tango
XbaI
T|CTAGA
1x Tango
XhoI
C|TCGAG
Red, 2x Tango
EcoRI pufr; Orange,
2x Tango
Tab. I Použité restrikční endonukleázy, jimi rozpoznávané sekvence a doporučený pufr. Všechny restrikční endonukleázy byly od
firmy Fermentas (Litva) a jejich restrikční teplota byla 37 °C.
G,T,C,A,W označují nukleotidy – guanin (G), tymin (T), cytosin
(C), adenin (A) a adenin nebo tymin (W).
33
Pufry pro restrikční endonukleázy:
BamHI pufr:
Tris-HCl (pH=8,0 při 37 °C) ….... 10 mM
MgCl2 ……………………………. 5 mM
KCl ……………………………. 100 mM
2-merkaptoetanol ……………….... 1 mM
Triton X-100 ……………………... 0,02 %
BSA ……………………………… 0,1 mg/ml
Blue pufr:
Tris-HCl (pH=7,5 při 37 °C) …… 10 mM
MgCl2 ………………………...… 10 mM
BSA ……………………………… 0,1 mg/ml
EcoRI pufr:
Tris-HCl (pH=7,5 při 37 °C) …… 50 mM
MgCl2 …………………………... 10 mM
NaCl …………………………... 100 mM
Triton X-100 …………………....... 0.02 %
BSA ……………………………… 0,1 mg/ml
Green pufr:
Tris-HCl (pH=7,5 při 37 °C) ….... 10 mM
MgCl2 ………………………..…. 10 mM
NaCl …………………………..... 50 mM
BSA ………………………….…... 0,1 mg/ml
Orange pufr:
Tris-HCl (pH=7,5 při 37 °C) …… 50 mM
MgCl2 …………………………... 10 mM
NaCl ………………………...… 100 mM
BSA ……………………………… 0,1 mg/ml
34
Red pufr:
Tris-HCl (pH=8,5 při 37 °C) …… 10 mM
MgCl2 …………………………... 10 mM
KCl ………………………….… 100 mM
BSA ……………………………… 0,1 mg/ml
SacI pufr:
Bis-Tris Propan-HCl (pH=6,5) …. 10 mM
MgCl2 …………………………... 10 mM
BSA ……………………………… 0,1 mg/ml
Tango pufr:
Tris-acetát (pH=7,9 při 37 °C) …. 33 mM
Acetát hořečnatý ……………….. 10 mM
Acetát draselný …………………. 66 mM
BSA ……………………………… 0,1 mg/ml
4.1.5 Protilátky
Monoklonální myší protilátka proti alkalické fosfatáze anti-PhoA (BAP,
PhoA; klon BAP-77), myší IgG1 izotyp, Sigma, USA
Polyklonální kozí protilátka proti myší IgG protilátce konjugovaná
s křenovou peroxidázou, Southern Biotech, USA
Polyklonální králičí protilátka proti FTT1103, Apronex s.r.o., ČR
Polyklonální kozí protilátka proti králičí IgG protilátce konjugovaná
s křenovou peroxidázou, Southern Biotech, USA
4.1.6 Syntetické oligonukleotidy
Pomocí uměle vytvořeného dvojřetězcového adaptoru jsme do plasmidu
pET28b obsahující FTT1103 vnesli sekvenci rozpoznávanou SalI restrikční endonukleázou (vyznačena tučně).
AD1 – kódující řetězec: 5´-CATGCTGTCGAC-3´
AD2 – komplementární řetězec: 5´-CATGGTCGACAG-3´
35
Uměle vytvořené oligonukleotidy jsme využili jako primery pro amplifikaci
alkalické fosfatázy PhoA, FTT1103 a FTT1103∆-PhoA (Tab. II).
Název primeru Nukleotidová sekvence
FW-PhoA
R-PhoA
FW-FTT1103
R-FTT1103
FWFTT1103∆PhoA
5´ATCTCGAGCGGGTACCTGACTCTGAC3´
5´TACTCGAGGAGCTCGTAACCTTTCAGCCCC
AG3´
5´ATCCATGGACACTAAGAAAAAACTTTTAAA
AGC3´
5´CACTCGAGTCTTGGCTGAGCTAATTGC3´
5´ATTCTAGAATGGACTCAGATAGTTCTAG3´
Restrikční
enzym
XhoI
XhoI, SacI
NcoI
XhoI
XbaI
Tab. II Seznam použitých primerů. Tučně je vyznačena sekvence rozeznávaná
uvedenou restrikční endonukleázou.
Všechny použité oligonukleotidy byly dodány jako jednořetězcové DNA v
lyofilizované formě (GeneriBiotech, ČR). Před použitím jsme je rozpustili dle pokynů výrobce v destilované vodě na výslednou koncentraci 0,1 mM.
4.1.7 Gely
Agarózový gel 0,6 % s ethidiumbromidem:
agaróza …………………………………… 2,4 g
TBE …………………….….. doplnit do 400 ml
ethidiumbromid ……………………….... 20 µl
Agarózový gel 1 % s ethidiumbromidem:
agaróza ……………………………..…….. 4 g
TBE ………………………... doplnit do 400 ml
ethidiumbromid …………………….….... 20 µl
Zaostřovací gel pro SDS-PAGE:
akrylamid (40 %) ........................................ 0,4 ml
Tris (1 M, pH=6,8) …….……………….... 1,25 ml
36
destilovaná H2O …………………………. 3,25 ml
SDS (10 %) ……………………………... 50 µl
APS (10 %) ……………………………... 50 µl
TEMED ………………………………..… 5 µl
Dělicí gel pro SDS-PAGE (12 %):
akrylamid (40 %) ........................................ 1,5 ml
Tris (1,5 M, pH=8,8) …..……………….... 1,25 ml
destilovaná H2O …………………………. 2,20 ml
SDS (10 %) ……………………………... 50 µl
APS (10 %) ……………………………... 50 µl
TEMED ………………………………..… 1,8 µl
Dělicí gel pro SDS-PAGE (10 %):
akrylamid (40 %) ........................................ 1,25 ml
Tris (1,5 M, pH=8,8) …..……………….... 1,25 ml
destilovaná H2O …………………………. 2,45 ml
SDS (10 %) ……………………………... 50 µl
APS (10 %) ……………………………... 50 µl
TEMED ………………………………..… 1,8 µl
4.1.8 Kultivační média
LB-agarová půda (Luria-Bertani):
agar ………………………………… 1,8 g
LB médium ……………………...…. 2 g
destilovaná H2O …....... doplnit do 100 ml
Půdu jsme sterilizovali autoklávováním (121 °C, 20 min).
Tekuté LB médium:
LB médium ………………………. 20 g
destilovaná H2O ….... doplnit do 1000 ml
Médium jsme sterilizovali autoklávováním (121 °C, 20 min)
SOB:
37
Bacto Tryptone …………………………... 2 % (w/v)
kvasničný extrakt ………………………... 0,5 % (w/v)
NaCl ……………………………………. 10 mM
KCl ……………………………………… 2,5 mM
Sterilizovali jsme autoklávováním (121 °C, 20 min) a potom přidali:
MgCl2 ………………………………...… 10 mM
MgSO4 …………………………………. 10 mM
4.1.9 Plazmidy
Plazmid pET28b (5368 bp) obsahuje T7-promotor a T7-terminátor, na N- i
C-konci plazmidu je sekvence kódující histidinovou kotvu (His-Tag), na N-konci je
sekvence pro T7-kotvu (T7-Tag) a nese gen zajišťující rezistenci na antibiotikum
kanamycin.
Plazmid pTZ19R (2862 bp) obsahuje T7-promotor a bla gen, který zajišťuje
rezistenci na antibiotikum ampicilin.
Plazmid pSWFII nese gen pro alkalickou fosfatázu (Ehrman a kol., 1990).
4.1.10 Bakteriální kmeny
Pro transformaci a vytvoření fúzních proteinů jsme používali kmen E.coli
XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZ∆M15 Tn10 (Tetr)].
Kontrolu exprese jednotlivých proteinů jsme prováděli v kmenu E.coli BL21(λDE3)
E. coli B F- dcm ompT hsdS(rB- mB-) gal λ(DE3).
4.1.11 Použité přístroje a pomůcky
Autokláv FN 120, Nüve, Turecko
Autokláv MLS 3750, Sanyo, Belgie
Automatické pipety BioPette, Labnet, USA, Velká Británie
Automatické pipety CAPP autoclavable, CAPP, Německo
Automatické pipety Gilson pipetman, Gilson, USA
Bio-Imaging Systém MiniBis Pro, DNR Bio-imaging systems, Izrael
Blotter TE70XP, Hoefer, USA
Centrifuga 5415R, Eppendorf, Německo
Centrifuga mikro 200, Hettich zentrifugen, Německo
Centrifuga Rotanta 460R, Hettich zentrifugen, Německo
38
Centrifuga Sigma 3-18K, Sigma, Německo
Digitální váhy EW 150-3M, Kern&Sohn GmbH, Německo
Elektroforetická vana s podložkou a těsnícími klíny, Hoefer, USA
Film MEDIX XBU, Foma Bohemia spol. s r.o., ČR
Fólie, GE, Velká Británie
Horizontální elektroforéza HE33, Hoefer, USA
Chladicí box (-4 °C), Caravell, Dánsko
Injekční stříkačka, Hamilton, USA
Jehla, Hamilton, USA
Kazeta na vyvolávání filmů, Japonsko
Kolona DyeExTM 2.0 Spin Column, Qiagen, Německo
Kolona z kitu JETSTART 2.0 , Genomed, Německo
Kývačka Rocker 35A, Labnet, USA, Velká Británie
Magnetické míchadlo MR Hei-Mix S, Heidolph, Německo
Mikrovlnná trouba ZMC 19M, Zanussi, Itálie
Mrazicí box (-20 °C), Liebherr Comfort, Německo
Mrazicí box (-20 °C), Liebherr Premium, Německo
Mrazicí box (-80 °C) Platinum 340, Angelantoni industrie AS Biomedical
Division, Itálie
Nitrocelulózová membrána, PALL Life Sciences BioTrace NT, USA
pH metr pH211 Microporcessor, pH metter HANNA instruments, Itálie
Plynový kahan, Kavalier, ČR
Příslušenství pro vertikální SDS-PAGE elektroforézu (skla, hliníkové destičky, svorky, spacery a hřebeny), Hoefer/Amarsham Biosciences (GE)/GE
Healthcare Bio-Sciences Corp., USA/Velká Británie/Velká Británie
Spektrofotometr Lightwave II, WPA, Nizozemsko
Spektrofotometrické kyvety 302100, Deltalab, Španělsko
Termoblok Digital Dry Bath, Labnet, USA, Velká Británie
Termostat EN 055, Nüve, Turecko
Termostat GallenKamp, GallenKamp, Velká Británie
Třepačka GallneKamp, GallenKamp, Velká Británie
Třepačka OS-10 Orbital Shaker, Biosan, Litva
Třepačka vortex VX100, Labnet, USA
39
UV transluminátor UVT-20M/W, Herolab, Německo
Vertikální elektroforéza SE250, Hoefer, USA
Vodní lázeň-termostatovaná BM 302, Nüve, Turecko
Zdroj elektrického napětí pro agarózovou elektroforézu EC105, Thermo
Electron Corporation, USA
Zdroj elektrického napětí pro agarózovou elektroforézu Power Station 300,
Labnet, USA
Zdroj elektrického napětí pro SDS-PAGE elektroforézu EPS301, GE, Velká
Británie
Zdroj elektrického napětí pro SDS-PAGE elektroforézu Power Station 300,
Labnet, USA
Při práci jsme používali běžný laboratorní plastik a vybavení.
4.2
4.2.1
Metody a pracovní postupy
Příprava superkompetentních buněk E.coli
Na tuhou LB-agarovou půdu jsme nanesli příslušný kmen E.coli a kultivovali
(37 °C, přes noc). Tři kolonie jsme přenesli do 50 ml kompletního SOB a kultivovali
při soustavném třepání (37 °C, přes noc, třepačka Biosan OS-10, 200-250 rpm/min).
Přenesli jsme 5 ml z nočního inokula do 500 ml kompletního SOB a následně kultivovali při soustavném třepání do optické denzity OD600= 0,6 (18-20 °C, třepačka
Gallenkamp 200-250 rpm/min). Po dosažení optické denzity OD600= 0,6 jsme přemístili Erlenmayerovu baňku na 10 min na led. Kulturu jsme rozdělili po 30 ml do 50
ml zkumavek (16 zkumavek) a centrifugovali (2 500g/4 °C/10 min). Supernatant
jsme odstranili, sedimenty resuspendovali ve 20 ml TB roztoku o teplotě 4 °C, nechali inkubovat (4 °C, 10 min) a opět centrifugovali (2 500g/4 °C/7 min). Supernatant jsme opět odstranili a sedimenty resuspendovali ve 4 ml TB roztoku o teplotě
4 °C. Obsah každých 4 zkumavek jsme spojili dohromady a přidali 1,1 ml DMSO
(konečná koncentrace 7 % (v/v)). Suspenzi jsme inkubovali (4 °C, 10 min), rozplnili
do mikrozkumavek po 200 µl a rychle zamrazili ponořením do tekutého dusíku.
Buňky jsme uchovávali při -80 °C.
40
4.2.2
Transformace plazmidové DNA do superkompetentních buněk
Na ledu jsme nechali rozehřát suspenzi superkompetentních buněk
(BL21 λDE3 nebo XL1) a plazmidovou DNA (po rozehřátí nutné důkladně zamíchat). Do předem vychlazené mikrozkumavky jsme nepipetovali 50 µl buněk a 1 µl
plazmidové DNA, příp. 5 µl ligační směsi. Po jemném promíchání jsme nechali buněčnou suspenzi inkubovat (4 °C, 20 min), opět jemně promíchali a vystavili teplotnímu šoku (42 °C, 1 min). K suspenzi jsme okamžitě přidali 1 ml vychlazeného
LB média a nechali inkubovat (37 °C, 1 h). Na tuhou LB-agarovou půdu
s příslušným antibiotikem jsme vyseli 50 µl buněčné suspenze a nechali inkubovat
v závěsné poloze (37 °C, přes noc).
4.2.3
Izolace plazmidové DNA
4.2.3.1 Miniprepace plazmidové DNA
Po úspěšné transformaci (4.2.2) byla jedna kolonie přenesena do 3 ml
LB média s příslušným antibiotikem a za soustavného třepání inkubována
(37 °C, 200-250 rpm/min, přes noc). Do mikrozkumavky jsme přenesli 1,5 kultury,
centrifugovali (13 200 rpm/ laboratorní teplota - RT/1 min), supernatant jsme odstranili a sediment jsme nechali na stole okapat. Sediment jsme pomocí vortexu resuspendovali ve 100 µl roztoku SOL I a inkubovali (RT, 5 min). Buňky jsme lyzovali
150 µl roztoku SOL II, jemně promíchali a inkubovali (4 °C, 5 min). Přidali jsme
150 µl roztoku SOL III, promíchali vortexem a inkubovali (4 °C, 15 min). Lyzované
buňky jsme centrifugovali (13 200 rpm/4 °C/15 min) a následně přenesli 400 µl supernatantu do nové zkumavky. K supernatantu jsme přidali 400 µl isopropanolu, důkladně promíchali pomocí vortexu, inkubovali (4 °C, 2 min) a centrifugovali
(13 200rpm/4 °C/5-15 min). Supernatant jsme vylili a sediment nechali na stole okapat. Zkumavku jsme propláchli 1 ml etanolu (70 %) a po odstranění etanolu jsme
sediment vysušili v termobločku (55-60 °C, cca 5 min). Supernatant jsme rozpustili v
40 µl roztoku TE s pankreatickou RNázou, mírně zamíchali a inkubovali
(70 °C, 30 min). Vzorek plazmidové DNA jsme uchovávali při -20 °C.
4.2.3.2 Midiprepace plazmidové DNA
Po transformaci (4.2.2) jsme několik kolonií přenesli do 50 ml LB média
s příslušným
antibiotikem
a
za
soustavného
třepání
nechali
inkubovat
(37 °C, 200-250 rpm/min, přes noc). Centrifugací (4 000 rpm/4 °C/10 min) jsme od41
dělili buňky, které jsme následně resuspendovali ve 4 ml roztoku E1. Postupně jsme
přidali roztoky E2 a E3 a inkubovali (RT, vždy po 5 min). Vzniklou suspenzi jsme
promíchali a centrifugovali (8 000 rpm/16 °C/10 min), čímž jsme odstranili všechny
nežádoucí příměsi. Supernatant byl přes gázu přenesen na kolonku, kterou jsme předem ekvilibrovali 10 ml roztoku E4. Kolonku jsme promyli 10 ml roztoku E5 a následně eluovali DNA 5 ml roztoku E6 do 15 ml zkumavky. Pro vysrážení DNA jsme
přidali 4-4,5 ml isopropanolu, promíchali a inkubovali (RT, 20 min). Suspenzi jsme
centrifugovali (8 000 rpm/18 °C/15 min). Po odstranění supernatantu jsme zkumavku
propláchli 3-5 ml etanolu (75 %), opět centrifugovali (8 000 rpm/18 °C/5 min) a sediment následně vysušili v termobločku (55-60 °C, cca 15 min). Po úplném odpaření
etanolu jsme sediment resuspendovali v 50 µl destilované vody a uchovávali při
-20 °C.
4.2.4
Manipulace s plazmidovou DNA
4.2.4.1 Příprava dsDNA syntetických oligonukleotidů
Lyofilizované ssDNA oligonukleotidy (GeneriBiotech, ČR) jsme před použitím rozpustili ve sterilní destilované vodě na výslednou koncentraci DNA 0,1mM.
Pro vytvoření dsDNA oligonukleotidů jsme nejprve obě ssDNA zahřáli ve vodní
lázni (70 °C, 5 min), potom smíchali oba ssDNA oligonukleotidy v poměru 1:1 a
vzniklou směs opět zahřáli ve vodní lázni (70 °C, 20 min). Tuto směs jsme nechali
pomalu vychladnout na laboratorní teplotu.
4.2.4.2 Štěpení plazmidové DNA restrikčními endonukleázami
Plazmidovou DNA (5 µg) jsme smíchali s 1-2 µl restrikčního enzymu (Fermentas, Litva) a 3 µl 10x koncentrovaného příslušného reakčního pufru (Fermentas,
Litva). Destilovanou vodou jsme doplnili celkový objem do 30 µl. Směs jsme důkladně promíchali a inkubovali při vhodné teplotě (pro většinu používaných enzymů
37 °C, 1-2 h). Dalším krokem byla agarózová elektroforéza, případně jsme reakční
směs uchovávali při -20 °C.
42
4.2.4.3 Defosforylace 5´-konců lineární plazmidové DNA
K 20 µl reakční směsi (4.2.4.2) jsme přidali 1 µl CIAP (Calf Intestinal Alkaline
Phosphatase; Fermentas, Litva) a inkubovali (37 °C, 30 min). Potom jsme celou směs
aplikovali na agarózovou elektroforézu.
4.2.4.4 Ligace fragmentů DNA
Do mikrozkumavky s 2 µl linearizované plazmidové DNA (může být defosforylovaná) jsme přidali 8 µl inzertu. Poměr inzertu a vektoru by měl být 1:1, případně inzert v mírném nadbytku. Ke směsi jsme dál přidali 2 µl 10x koncentrovaného
T4-ligačního pufru (Fermentas, Litva) a 1-2 µl T4 DNA ligázy (Fermentas, Litva).
Destilovanou vodou jsme směs doplnili do objemu 20 µl a důkladně promíchali. Ligační směs jsme inkubovali přes noc při 4 °C nebo minimálně 2 h při 18 °C.
4.2.4.5 Amplifikace fragmentů plazmidové DNA metodou PCR
Do mikrozkumavky pro amplifikaci DNA metodou PCR jsme pipetovali takové množství templátové DNA, aby její množství bylo 1 pg – 10 ng/50 µl a přidali
jsme 10 µl HF pufru (Phussion pufr, Finnzymes, Finsko). Příslušné primery (GeneriBiotech, ČR) jsme přidali v takovém množství, aby jejich výsledná koncentrace
byla 0,5 µM (tj. 2,5 µl primeru o koncentraci 10 µM). Ke směsi jsme přidali 0,8 µl
dNTP a 0,5 µl DNA polymerázy (Phussion polymeráza, Fermentas, Litva). Destilovanou vodou jsme doplnili do celkového objemu 50 µl. Směs pro PCR jsme připravovali na ledu. V přístroji pro PCR proběhla nejprve úvodní denaturace templátové
DNA (98 °C, 30 s) a potom 30 cyklů, ve kterých se střídaly tyto fáze: denaturační
(98 °C, 10 s), nasedání primerů (45-72 °C dle teploty tání primerů, 30 s) a polymerační fáze (72 °C, 30 s). Následovala ještě finální polymerace (72 °C, 10 min) a potom postupné ochlazení na 4 °C.
4.2.5
Elektroforéza v agarózovém gelu
4.2.5.1 Příprava λ DNA standardu molekulových velikostí
Pro přípravu 1000 µl (případně 250 µl) jsme k 400 µl (100 µl) λ DNA přidali
100 µl (25 µl) pufru orange a 80 µl (20 µl) restrikční endonukleázy PstI (Fermentas,
Litva). Destilovanou vodou jsme směs doplnili do celkového objemu (tj. 420 µl,
43
resp. 105 µl). Restrikční směs jsme důkladně promíchali a nechali štěpit 2 hodiny při
37 °C. Poté jsme restrikční směs obarvili 160 µl (40 µl) bromfenolové modři a rozpipetovali na jednotlivé alikvoty.
4.2.5.2 Příprava gelu, průběh elektroforézy a detekce DNA
Podle velikosti separovaných fragmentů DNA jsme si připravili agarózový
gel o koncentraci 0,6 % (w/v) nebo 1 % (w/v) a přidali do něj ethidiumbromid, tak
aby jeho výsledná koncentrace byla 0,5 µg/ml. Gel jsme zahřáli v mikrovlnné troubě
do úplného rozvaření agarózy. Po tom, co agaróza částečně vychladla, jsme gel nalili
do utěsněné elektroforetické vany a vložili do něj hřeben s potřebným množstvím
jamek. Gel jsme následně nechali tuhnout při laboratorní teplotě. Ze ztuhlého gelu
jsme vyjmuli hřeben, gel přenesli do elektroforetické vany a převrstvili
1x koncentrovaným TBE pufrem. Do jamek jsme napipetovali 5 µl standardu molekulových velikostí λ DNA (štěpený restrikčním enzymem PstI) a vzorky DNA naředěné vzorkovým pufrem LD (leading DNA pufr, 6x koncentrovaný). Přístroj jsme
následně uzavřeli, připojili ke zdroji napětí a nechali procházet napětí 80-100 V. Po
době potřebné k dostatečnému rozdělení fragmentů DNA (cca 1 h), jsme odpojili
zdroj napětí a celý gel jsme přenesli na transluminátor, kde jsme pod UV světlem
pozorovali proužky DNA. Všechny gely byly zaznamenány pomocí přístroje BioImaging Systém MiniBis.
4.2.6
Izolace fragmentů DNA z agarózového gelu
K izolaci fragmentů DNA z agarózového gelu jsme použili kit JETQuick
(Genomed, Německo). Na UV transluminátoru jsme vyřízli pruhy agarózy, které
obsahují námi hledané fragmenty DNA, a přenesli je do předem zvážených mikrozkumavek. Na každých 100 mg gelu jsme přidali 300 µl roztoku L1 a inkubovali
(50 °C, 15 min). Během inkubace jsme směs občas promíchali, aby se agaróza lépe
rozpustila. Do sběrné zkumavky jsme umístili kolonku pro izolaci DNA
z agarózového gelu a přenesli na ni 600 µl vzniklé suspenze. Následovala centrifugace (12 000g/1 min), po které jsme vylili propad a bylo-li to nutné, nanesli jsme zbytek suspenze opět na kolonku a centrifugovali. Poté jsme na kolonku nanesli 500 µl
roztoku L2, centrifugovali (12 000g/1 min) a propad opět vylili. Kolonku jsme centrifugovali ještě jednou „nasucho“ (12 000g/1 min). Poté jsme kolonku přenesli do
44
čisté mikrozkumavky a doprostřed sorpční hmoty jsme napipetovali 50 µl destilované vody předehřáté na 70 °C. Kolonku jsme opět centrifugovali (12 000g/2 min) a
takto izolovanou DNA jsme uchovávali při -20 °C.
4.2.7
Kontrola exprese proteinu
Provedli jsme transformaci (4.2.2) do buněčného kmenu E. coli BL21 λDE3,
druhý den jsme několik kolonií přenesli do 50 µl LB média s příslušným antibiotikem a za soustavného třepání nechali inkubovat (37 °C, 200-250 rpm/min, přes noc).
Odebrali jsme 100-150 µl nočního inokula a přenesli jej do 10 ml LB média
s příslušným antibiotikem. Za soustavného třepání jsme buňky inkubovali (37 °C,
200-250 rpm/min) a průběžně měřili optickou denzitu OD600 (jako slepý vzorek jsme
použili čisté LB medium). Jakmile byla OD600=0,6-0,1, odebrali jsme 1 ml bakterií
do mikrozkumavky a zbytek bakterií jsme indukovali k produkci proteinu přídavkem
IPTG do výsledné koncentrace 1 mM. Spolu s IPTG jsme bakterie inkubovali
(37 °C, 3-4 h) a následně opět odebrali 1 ml bakterií. Pokaždé jsme 1 ml odebraných
bakterií centrifugovali (13 200/1 min) a sediment resuspendovali ve 100 µl pufru
8 M močovina, 50 mM Tris-HCl pH=8, 1 % SDS a přidali jsme vzorkový pufr 2R
(5x koncentrovaný). Všechny vzorky jsme následně analyzovali pomocí elektroforézy v polyakrylamidovém gelu.
4.2.8
Elektroforéza v polyakrylamidovém gelu (SDS-PAGE)
Dle návodu jsme si připravili aparaturu pro přípravu SDS-PAGE. Nejprve
jsme si připravili dělicí gel a potom zaostřovací gel. Hustotu obou gelů jsme volili
podle relativní molekulové hmotnosti proteinů. Ihned po přidání APS a TEMEDu
jsme gel nalili mezi připravená skla a nechali polymerovat. Nejprve jsme nalili gel
dělicí, který jsme převrstvili 1 ml butanolu nasyceného destilovanou vodou. Po
ztuhnutí gelu jsme butanol odstranili a dosušili pomocí filtračního papíru. Následně
jsme si připravili a nalili a gel zaostřovací a ponořili do něho hřebínek odpovídající
potřebnému množství jamek. Když zpolymeroval i gel zaostřovací, přenesli jsme
skla s SDS-PAGE gelem do aparatury pro vertikální elektroforézu, kterou jsme naplnili elektrodovým pufrem a tímto pufrem zalili i jamky. Vzorek proteinu s 2R pufrem
jsme zahřáli (100 °C, 5 min) a následně aplikovali na SDS-PAGE gel. Do první jamky jsme napipetovali 5 µl standardu molekulových hmotností pro SDS-PAGE, do
ostatních jamek 5-20 µl vzorků. Aparaturu jsme připojili ke zdroji napětí a nechali
45
procházet napětí 80 V, dokud vzorek neprošel zaostřovacím gelem. Jakmile vzorek
doputoval do gelu dělicího, zvýšili jsme napětí na 150 V. Elektroforézu jsme nechali
probíhat, dokud čelo nedosáhlo spodního okraje gelu. Potom jsme vyjmuli skla
s SDS-PAGE gelem z aparatury pro vertikální elektroforézu a opatrně odstranili skla
a zaostřovací gel. Dělicí gel jsme barvili pomocí Coomassie Brilliant Blue (CBB)
nebo z něho proteiny přenesli na membránu metodou Western blot.
4.2.9
Barvení SDS-PAGE gelu pomocí Coomassie Brilliant Blue
SDS-PAGE gel jsme ponořili do roztoku Coomassie Brilliant Blue (CBB) a
nechali barvit (10-60 min). Když byl gel dostatečně obarven, odstranili jsme roztok
CBB a gel nechali odbarvovat v odbarvovacím roztoku. Barvení i odbarvování jsme
prováděli na kývačce, abychom umožnili co nejlepší obarvení, případně odbarvení.
Odbarvovací roztok jsme během odbarvování několikrát vyměnili a po dostatečném
odbarvení jsme gel přenesli do destilované vody. V destilované vodě jsme si namočili i celofán, který jsme použili k uzavření gelu do rámu a jeho vysušení.
4.2.10 Imunochemická detekce proteinů na membráně (Western-blot)
Připravili jsme si nitrocelulózovou membránu o rozměrech přibližně o 10 %
větších, než jsou rozměry SDS-PAGE gelu (v našem případě 6x9 cm) a také dva
watman filtrační papíry o stejných rozměrech jako membrána. Po odstranění ochranných papírů z membrány jsme ji ponořili do blotovacího pufru (5 min) a blotovacím
pufrem jsme nasytili také filtrační papíry. Na elektrodu blotovacího přístroje jsme
složili blotovací sendvič v pořadí od anody: filtrační papír, membrána, gel, filtrační
papír. Tlakem jsme opatrně odstranili případné vzduchové bubliny. Blotovací
sendvič jsme uzavřeli víkem s druhou elektrodou a aplikovali konstantní proud
50 mA po dobu 60 min. Po přenosu proteinů lze membránu uchovávat ve fólii při
-20 °C nebo ji rovnou barvit protilátkami proti cílovému proteinu.
Pro detekci proteinu na membráně pomocí protilátek jsme museli nejprve zablokovat
místa
nespecifických
interakcí
pomocí
blokovacího
roztoku
(45 min, RT, na kývačce). Membránu jsme po zablokování promyli roztokem PBS a
inkubovali s odpovídající primární protilátkou (1 h, RT, kývačka). Následně jsme
membránu promyli promývacím roztokem (3x15 min) a inkubovali se sekundární
protilátkou (GAMPx nebo GARPx) naředěnou 20 000x do roztoku 1 % mléka
v promývacím roztoku (45 min, RT, kývačka). Sekundární protilátka je konjugována
46
s křenovou peroxidázou, která umožňuje detekci. Po inkubaci se sekundární protilátkou jsme membránu promyli v promývacím roztoku, který jsme několikrát během
promývání vyměnili (45 min, RT, kývačka). Jakmile jsme membránu dostatečně
promyli, smíchali jsme si v temné komoře 1 ml roztoku ECL1 a 1 ml roztoku ECL2 a
vzniklou směs jsme ihned aplikovali na membránu, kterou jsme předem osušili.
Membránu jsme nechali se substrátem pro křenovou peroxidázu inkubovat 60 s, potom přebytek substrátu vysušili a membránu uložili do fólie. K membráně jsme přiložili film, kazetu uzavřeli a exponovali dle potřeby 10 s-30 min. Potom jsme exponovaný film přenesli do nádobky s vývojkou a nechali jej inkubovat, dokud se neobjevily tmavé proužky. Film jsme následně přenesli do nádobky s rychloustalovačem
a inkubovali (cca 1 min). Aby nedocházelo k poškozování filmu vlivem rychloustalovače, důkladně jsme jej opláchli pod tekoucí vodou. Film jsme nechali oschnout a
potom na něj vyznačili jednotlivé pozice standardu molekulových hmotností a odečetli specifický signál (Sambrook a kol., 1989)
4.2.11 Glycerolové bakteriální konzervy
Několik bakteriálních kolonií, které obsahovaly správnou plazmidovou DNA,
jsme přenesli do 750 µl 40 % glycerolu. Takto vytvořenou konzervu jsme dlouhodobě uchovávali při teplotě -80 °C.
4.2.12 Příprava sekvenační PCR
Pro sekvenaci DNA jsme si na ledu namíchali dvě směsi DNA s primery a
BD kitem. V jedné směsi jsme použili 3 µl primeru pET28b-UP a ve druhé stejný
objem primeru pET28b-TERM. Objem použité midiprepové DNA jsme volili tak,
aby její hmotnost ve výsledné směsi byla cca 100 ng. Přidali jsme 8 µl BD kitu a
destilovanou vodou doplnili do 20 µl. Na PCR cykleru jsme nastavili tyto parametry:
denaturace při 96 °C (30 s), nasedání primerů při 50°C (30 s), polymerace při 60 °C
(4 min) a nechali jsme proběhnout 25 cyklů. PCR směs jsme následně přečistili pomocí kolony DyeExTM 2.0 Spin Column. Kolonu jsme před použitím mírně protřepali, povolili horní uzávěr a spodní uzávěr kolony odlomili. Kolonu jsme přemístili do
sběrné zkumavky a centrifugovali (720 rpm/3 min). Po centrifugaci jsme kolonu
přemístili do čisté zkumavky, doprostřed napipetovali 20 µl PCR směsi a opět centrifugovali (680 rpm/3 min). Takto připravenou směs jsme nechali analyzovat sekvenačním servisním pracovištěm na Mikrobiologickém ústavu AV ČR.
47
5. Výsledky a diskuse
5.1 Příprava expresních vektorů
Výsledky získané predikčním programem LipoP ukazují, že FTT1103 je
membránově lokalizovaný lipoprotein. Motiv DsbA, naznačuje, že by se alespoň
jeho část mohla nacházet v periplazmě. Pro zjištění přesnější lokalizace a topologie
lipoproteinu FTT1103 jsme zvolili strategii vytvoření fúzního proteinu, kdy jsme
fúzovali rekombinantní lipoprotein FTT1103 s reportérovým genem pro alkalickou
fosfatázu PhoA (Prochazkova a kol., 2005; www.sci.sdsu.edu). Gen pro alkalickou
fosfatázu jsme získali z vektoru pSWFII (Ehrmann a kol., 1990). Fúzní proteiny jsme
vytvořili v plazmidu pET28b a následně je pomocí restrikčních endonukleáz přenesli
do vektoru pTZ19R, který jsme použili pro kontrolu exprese rekombinantních proteinů a jejich detekci. Vektor pET28b-FTT1103 s N-terminální signální sekvencí i
bez ní byl připraven firmou Apronex s.r.o. V případě fúzního proteinu FTT1103 bez
signální N-terminální sekvence s PhoA jsme použili odlišnou strategii. Celý fragment
jsme amplifikovali metodou PCR a jako templát jsme použili vektor obsahující
FTT1103 fúzovaný s PhoA. Získané vektory jsou uvedeny v tab. III. Podrobnější
strategie tvorby jednotlivých fúzních proteinů jsou uvedeny v dalším textu. Bakterie
nesoucí plazmid pET28b jsme kultivovali na médiu obsahující kanamycin, ty které
nesly plazmid pTZ19R jsme kultivovali na médiu s ampicilinem.
Alkalická fosfatáza (PhoA) umožňuje defosforylaci 5- a 3- fosfátové skupiny.
Jako substrát pro PhoA může sloužit např. 5-bromo-4-chloro-3-indolylfosfát (BCIP).
Bezbarvý BCIP se působením PhoA přemění na modrý precipitát (Prochazkova a
kol., 2005; Gomez a kol., 2000). Tohoto jevu jsme využili i při přímém určení enzymové aktivity periplazmaticky produkované PhoA a tím i topologie lipoproteinu
FTT1103. Je-li PhoA lokalizována v cytoplazmě, je enzymatická aktivita velmi nízká
a naopak je-li PhoA lokalizována v periplazmě, je její aktivita vysoká (Ehrman a
kol., 1990; Gilmore a kol., 2004). Bakterie obsahující funkční PhoA v přirozené formě nebo ve formě fúzního proteinu FTT1103 s funkční N-terminální signální sekvencí jsou detekovány tmavě modré kolonie (Gomez a kol., 2000). Exprimované
rekombinantní proteiny jsme detekovali také metodou Western-blot a barvením
SDS-PAGE gelu CBB.
48
U všech vytvořených vektorů jsme restrikční analýzou ověřovali správnost
zaklonovaných inzertů. Velikosti fragmentů jsou uvedeny v tab. IV a výsledky štěpení reprezentované elektroforézou v agarosovém gelu jsou na obr. 5.
Název vektoru
Kódované proteiny
Barevné kolonie
pTZ19R-PhoA
PhoA
+
pTZ19R-FTT1103-AD
FTT1103
-
pTZ19R-FTT1103-AD-PhoA
PhoA, FTT1103
+
pTZ19R-FTT1103∆-PhoA
PhoA, FTT1103∆
-
Tab. III Vytvořené fúzní vektory. Název vektoru je používané označení jednotlivých vektorů; kódované proteiny jsou ty, pro něž jsou na vektoru geny; barevné kolonie (+) jsme pozorovali v případě, že PhoA je lokalizována do periplazmatického
prostoru, bezbarvé kolonie (-) jsme pozorovali při lokalizaci PhoA v cytoplazmě.
FTT1103 je protein s N-koncovou signální sekvencí, FTT1103∆ je protein bez
N-koncové signální sekvence a PhoA je alkalická fosfatáza.
Fragmenty po štěpení
restrikční
endonukleáza
správné
špatné
pTZ19R-PhoA
PvuII
2513, 886,875
2513,1013,748
pTZ19R-FTT1103-AD
EcoRI
3310, 657
3453, 514
pTZ19R-FTT1103-AD-PhoA
EcoRI
pTZ19R-FTT1103∆-PhoA
PvuII
vektor
3313, 1409, 331,
300
2513, 1220, 870,
689
2862
2513, 349
Tab. IV Fragmenty DNA při kontrolním štěpení vektorů. Po štěpení vytvořených
vektorů restrikčními endonukleázami jsme na agarózové elektroforéze zaznamenali
správné fragmenty. Pokud bychom zaznamenali špatné fragmenty, znamenalo by to,
že orientace zaklonovaného inzertu je chybná, nebo že inzert není zaklonován vůbec
a na agarózové elektorofréze pozorujeme pouze linearizovaný plazmid.
49
1.
2.
3.
4.
.5.
6.
11497
5077-4507
2838
2560-2443, 2140, 1986,1700
1159, 1093
805
514
Obr. 5 Fotografie agarózového gelu (0,6 %) s vektory, které byly kontrolně štěpeny restrikčními endonukleázami. V jamkách č. 1. a 6. je standard
velikostí molekul λ-DNA, v jamce č. 2. je vektor pTZ19R-PhoA štěpený
enzymem PvuII, v jamce č. 3. je vektor pTZ19R-FTT1103-AD štěpený enzymem EcoRI, v jamce č. 4. je vektor pTZ19R-FTT1103-AD-PhoA štěpený
enzymem EcoRI (fragmenty 331bp a 300 bp nejsou patrné) a v jamce č. 5. je
vektor pTZ19R-FTT1103∆-PhoA štěpený enzymem PvuII. Velikosti standardu molekulových velikostí λ-DNA jsou uvedeny vlevo vedle obrázku,
velikosti fragmentů jsou uvedeny v tab IV.
Strategie vytvoření vektoru pTZ19R-PhoA je znázorněna na obr. 6. Zdrojem
PhoA byl plazmid pSWFII, ze kterého jsme alkalickou fosfatázu vyštěpili pomocí
restrikční endonukleázy BamHI. Plazmid pTZ19R obsahuje pouze jednu sekvenci
rozeznávanou restrikční endonukleázou BamHI a to v multiklonovacím místě.
Vzhledem k tomu, že jsme k vložení PhoA do plazmidu pTZ19R používali pouze
jeden enzym, bylo nutné ověřit, zda má vložená DNA sekvence PhoA správnou orientaci. Tuto kontrolu jsme provedli restrikční analýzou s využitím enzymu PvuII. Po
amplifikaci tohoto vektoru midiprepací jsme opět provedli kontrolní štěpení restrikční endonukleázou PvuII (Obr. 5).
50
BamHI
PhoA
BamHI
BamHI
pSWFII
pTZ19R
1) Štěpení BamHI
2) Izolace fragmentu o
velikosti 1412 bp
1) Linearizace vektoru BamHI
2) Izolace fragment o velikosti
2862 bp
Ligace PhoA s plazminem
pTZ19R štěpeným BamHI
PhoA
pTZ19R-PhoA
Obr. 6 Schematické znázornění klonování vektoru pTZ19R-PhoA.
Vnesením genu pro alkalickou fosfatázu (PhoA) do plazmidu pTZ19R
(4292 bp) pomocí restrikční endonukleázy BamHI vznikl pTZ19R-PhoA.
Dalším
vektorem,
který
jsme
vytvořili,
byl
pTZ19R-FTT1103-AD
(Obr. 7 a 8). Spojení FTT1103 s adaptorem (AD) jsme vytvořili nejprve v plazmidu
pET28b a teprve potom jej celý fragment FTT1103-AD přenesli do plazmidu
pTZ19R. Gen pro funkční lipoprotein FTT1103 jsme získali metodou PCR (Obr. 9)
s využitím primerů FW-FTT1103 a R-FTT1103 uvedených v kap. 4.1.6. Produkt
PCR reakce, stejně jako plazmid pET28b, jsme štěpili restrikčními endonukleázami
NcoI a XhoI. S využitím agarózové elektroforézy jsme následně FTT1103 i pET28b
přečistili a izolovali z gelu (kap. 4.2.5 a kap. 4.2.6). Připravený izolovaný vektor
pET28b-FTT1103 jsme štěpili restrikční endonukleázou NcoI, rozdělili agarózovou
elektroforézou a izolovali z gelu. Abychom do něj mohli vložit dvojřetězcový adaptor, museli jsme jej nejprve vytvořit z lyofilizovaných jednořetězcových alikvotů
(kap.
4.1.6).
Vzniklý
dvojřetězcový
adaptor
jsme
vložili
do
vektoru
pET28b-FTT1103 do místa rozštěpeného restrikční endonukleázou NcoI. Správnost
zaklonování adaptoru jsme ověřili restrikčními endonukleázami SalI a XhoI a sekvenční analýzou (Mikrobiologický ústav AV ČR). Restrikčními endonukleázami SalI
a XhoI jsme z vektoru pET28b-FTT1103-AD vyštěpili FTT1103-AD DNA fragment
51
o velikosti 1105 bp a pomocí agarózové elektroforézy jej izolovali. Plazmid pTZ19R
jsme linearizovali restrikčními endonukleázami SalI a SacI a přečistili a izolovali z
agarózového gelu (kap. 4.2.5 a kap. 4.2.6). Fragment FTT1103-AD jsme do štěpeného plazmidu pTZ19R vnesli s využitím kompatibility přesahujících konců po štěpení
enzymy SacI a XhoI (Obr. 8).
FTT1103
XhoI
pET28b
chromozomální DNA
1) Štěpení NcoI a XhoI
2) Izolace fragmentu o velikosti
5207 bp
A)
1) PCR s využitím primerů pro FTT1103
2) Štěpení produktu PCR enzymy NcoI
a XhoI
3) Izolace fragmentu o velikosti 1098 bp
(1043 bp)
Ligace pTZ19R s FTT1103
štěpeným NcoI a XhoI
B)
5´
NcoI
CATGCTGTCGAC
3´
XhoI
3´
GACAGCTGGTAC
5´
1) Vytvoření dvojřetězcového
adaptoru
2) Ligace s pET28b-FTT1103
štěpeným NcoI
SalI
FTT1103
FTT1103
pET28b-FTT1103
1) Štěpení NcoI
2) Izolace fragmentu 6331 bp
XhoI
pET28b-FTT1103-AD
Obr. 7
Schematické znázornění vytvoření plazmidu A)
pET28b-FTT1103 a B) s vloženým adaptorem (pET28b-FTT1103-AD
6343 bp). FTT1103 připravené metodou PCR jsme pomocí restrikčních endonukleáz NcoI a XhoI vložili do plazmidu pET28b a následně s využitím
restrikční endonukleázy NcoI vložili i dvojřetězcový adaptor.
52
SalI
A:
FTT1103
SalI
pTZ19R
XhoI
pET28b-FTT1103-AD
1) Linearizace pTZ19R
SalI
2) Izolace fragmentu
2862 bp
1) Štěpení SalI a XhoI
2) Izolace fragmentu FTT1103-AD o
velikosti 1097 bp
Ligace FTT1103-AD s pTZ19R štěpeným
SalI a XhoI
FTT1103
pTZ19R-FTT1103-AD
B:
SalI
5´
G
3´
CAGCT
XhoI
TCGAC
3´
5´
C
G
5´
3´
GAGCT
5´
GTCGAG
3´
3´
CAGCTC
5´
TCGAG
C
3´
5´
Obr. 8 A:
Schematické
znázornění
vytvoření
plazmidu
pTZ19R-FTT1103-AD (3967 bp) s využitím komplementarity přesahujících konců fragmentů štěpených XhoI a SalI. Z plazmidu
pET28b-FTT1103-AD jsme pomocí restrikčních endonukleáz SalI a XhoI
vyštěpili DNA úsek FTT1103-AD, který jsme následně vložili do plazmidu pTZ19R štěpeným SalI.
B: Komplementarita přesahujících konců po štěpení restrikčními endonukleázami SalI a XhoI. Po ligaci toto místo nerozpoznávaná ani jeden
z uvedených enzymů.
53
NcoI
DNA sekvence FTT1103
FW-FTT1103
5´
3´ Templátová
DNA
R-FTT1103
XhoI
Obr. 9 Schematické znázornění PCR amplifikace FTT1103. S využitím
primerů FW-FTT1103 a R-FTT1103 jsme provedli PCR amplifikace a zároveň vnesli místa pro rozeznání restrikčními endonukleázami NcoI a XhoI.
Jako templátovou DNA jsme použili chromozomální DNA F.tularensis
SchuS4 (dar z Hradce Králové)
Pro vytvoření vektoru pTZ19R-FTT1103-AD-PhoA jsme využili již připravený vektor pET28b-FTT1103-AD z výroby vektoru pTZ19R-FTT1103-AD
(Obr. 10). Abychom mohli PhoA do vektoru pET28b-FTT1103-AD vložit přes místo
rozeznávané restrikční endonukleázou XhoI a tím vytvořit fúzní protein
FTT1103-PhoA, museli jsme nejprve pomocí metody PCR získat PhoA, jejíž modifikované konce obsahují sekvenci rozeznávanou enzymem XhoI (Obr. 11). K tomu
jsme použili primery FW-PhoA a R-PhoA uvedené v kap. 4.1.6. Produkt PCR reakce
a vektor pET28b-FTT1103-AD jsme štěpili restrikční endonukleázou XhoI a následně přečistili na agarózové elektroforéze. Takto upravenou PhoA jsme vložili do připraveného vektoru a restrikční analýzou určili správné klony (data nejsou uvedena).
Midiprepací jsme získali dostatečné množství čisté DNA a mohli přejít k přenesní
fragmentu pro fúzní protein FTT1103-AD-PhoA z plazmidu pET28b do plazmidu
pTZ19R. Díky tomu, že primer reverse-PhoA obsahoval vedle sekvence rozeznávané
restrikční endonukleázou XhoI i sekvenci rozeznávanou restrikční endonukleázou
SacI, bylo možné celý fragment FTT1103-AD-PhoA přenést do pTZ19R pomocí
restrikčních endonukleáz SacI a SalI. Správné klony jsme opět určili pomocí restrikční analýzy (data nejsou uvedena). Vektor získaný midiprepací jsme kontrolně
štěpili restrikční endonukleázou EcoRI (Obr. 5).
54
FTT1103
PhoA
SalI
XhoI
pET28b-FTT1103-AD
pSWFII
1) PCR s využitím primerů pro
PhoA
2) Štěpení produktu PCR enzymem XhoI
3) Izolace fragmentu o velikosti
1406 bp
1) Linearizace vektoru enzymem XhoI
2) Izolace fragmentu o velikosti 6343 bp
Ligace PhoA a pET28b-FTT1103-AD
štěpeného XhoI
FTT1103
SalI
SalI
XhoI
SacI
pET28b-FTT1103-AD-PhoA
pTZ19R
PhoA
SacI
1) Štěpení SalI a SacI
2) Izolace fragmentu 2839 bp
1) Štěpení SalI a SacI
2) Izolace fragmentu 2735 bp
Ligace FTT1103-AD-PhoA a pTZ19R
štěpeného SalI a SacI
FTT1103
pTZ19R-FTT1103-AD-PhoA
PhoA
Obr. 10
Schematické
znázornění
vytvoření
plazmidu
pTZ19R-FTT1103-AD-PhoA. PhoA získanou PCR metodou jsme štěpili
restrikční endonukleázou XhoI a následně vložili do plazmidu
pET28b-FTT1103-AD.
Z plazmidu
pET28b-FTT1103-AD
jsme
FTT1103-AD-PhoA (5353 bp) vyštěpili restrikčními endonukleázami SalI
a SacI, s jejichž pomocí jsme celý fragment vložili do plazmidu pTZ19R.
55
XhoI
gen pro PhoA
FW-PhoA
5´
3´
R-PhoA
SacI XhoI
Obr. 11 Schematické znázornění amplifikace PhoA s využitím primerů
FW-PhoA a R-PhoA. Místa rozeznávaná restrikčními endonukleázami XhoI
a SacI jsou označena šipkami. Jako templátovou DNA jsme použili plazmid
pSWFII.
Pro vytvoření vektoru pTZ19R-FTT1103∆-PhoA jsme nejprve chtěli použít
stejnou strategii jako u vytváření vektoru pTZ19R-FTT1103-AD-PhoA, avšak tímto
způsobem se nám daný vektor nepodařilo získat. Použili jsme proto metodu PCR,
s jejíž pomocí jsme získali fragment FTT1103∆-PhoA (Obr. 12) a ten jsme následně
vložili přímo do vektoru pTZ19R (Obr. 13). Primery FW-FTT1103∆-PhoA a
R-PhoA, které jsme při PCR použili, jsou uvedeny v kap. 4.1.6. Správné klony získané miniprepací DNA jsme určili restrikční analýzou.
FTT1103∆-PhoA
XbaI
FW-FTT1103∆-PhoA
5´
3´
R-PhoA
SacI
pTZ19RFTT1103
-AD-Pho
XhoI
Obr. 12 - Schematické znázornění amplifikace FTT1103∆-PhoA s využitím
primerů FW-FTT1103∆-PhoA a R-PhoA. Místa rozeznávaná restrikčními
endonukleázami XbaI, XhoI a SacI jsou označena šipkami. Jako templátovou
DNA jsme použili vektor pTZ19R-FTT1103-AD-PhoA.
56
FTT1103
XbaI
SacI
pTZ19R-FTT1103-AD-PhoA
pTZ19R
PhoA
1) PCR s využitím primerů forward-FTT1103∆-PhoA a reverse-PhoA
2) Štěpení produktu PCR enzymy XbaI a SacI
3) Izolace fragmentu 2668 bp
4) Ligace s pTZ19R štěpeným
XbaI a SacI
1) Štěpení XbaI a SacI
2) Izolace fragmentu 2845bp
3) Ligace s FTT1103∆-PhoA
štěpeným XbaI a SacI
Ligace FTT1103∆-PhoA a pTZ19R
štěpeného XbaI a SacI
FTT1103
pTZ19R-FTT1103∆-AD-PhoA
PhoA
Obr. 13 Schematické
znázornění
vytvoření
plazmidu
pTZ19R-FTT1103∆-PhoA (5275 bp). Pomocí PCR jsme získali
FTT1103∆-PhoA z vektoru pTZ19R-FTT1103-AD-PhoA a následně jej
vložili do plazmidu pTZ19R pomocí restrikčních endonukleáz XbaI a SacI.
5.2 Exprese a detekce jednotlivých proteinů v E.coli
Expresi jednotlivých proteinů jsme prováděli v bakteriích obsahující námi vytvořené vektory z plazmidu pTZ19R. Exprese proteinů jsme indukovali přídavkem
IPTG a potom bakterie nechali růst 3 hodiny (kap. 4.2.7). Pro následnou SDS-PAGE
elektroforézu jsme použili 10 % dělicí gel. Proteiny jsme detekovali barvením SDS
gelu pomocí CBB (Obr. 14) a po Western-blot také imunochemicky pomocí protilátek anti-FTT1103 a anti-PhoA (Obr. 15).
Imunochemickou detekcí monoklonální protilátkou anti-PhoA se nám nepodařilo detekovat ani PhoA (48 kDa), ani FTT1103-AD-PhoA (97 kDa), ani
57
FTT1103∆-PhoA (95 kDa). Naproti tomu imunochemická detekce polyklonální protilátkou anti-FTT1103 odhalila možnou kontaminaci bakteriálních linií. Vzhledem
k výsledkům získaným na půdách s BCIP k této kontaminaci pravděpodobně došlo
až během kontroly exprese proteinů. Molekulová hmotnost fúzního proteinu
FTT1103-AD-PhoA je 97 kDa a FTT1103∆-PhoA je 95 kDa. Tyto proteiny se nám
podařilo pomocí anti-FTT detekovat a také na SDS-PAGE gelu barveném CBB lze
pozorovat odpovídající proužky. Teoretická molekulová hmotnost lipoproteinu
FTT1103 je 38,5 kDa, avšak jeho reálná molekulová hmotnost je 49,8 kDa. Imunochemicky jsme detekovali signál odpovídající spíše teoretické molekulové hmotnosti
a na SDS-PAGE gelu obarveném CBB jsme pozorovali produkci proteinu odpovídajícího jak teoretické, tak i reálné molekulové hmotnosti.
A:
B:
1
2
3
4
5
1
170,130
95
72
55
170
130
95
72
43
55
34
2
3
4
5
43
26
34
Obr. 14 SDS-PAGE gely barvené CBB. A: 12 % SDS-PAGE gel; 1.- standard
molekulových hmotností, 2.- PhoA před indukcí, 3.- PhoA po indukci, 4.FTT1103-AD před indukcí, 5.- FTT1103-AD po indukci. B: 10 % SDS-PAGE
gel; 1.- standard molekulových hmotností, 2.- FTT1103-AD-PhoA před indukcí,
3.- FTT1103-AD-PhoA po indukci, 4.- FTT1103∆-PhoA před indukcí,
5.- FTT1103∆-PhoA po indukci. Šipkami jsou vyznačeny jednotlivé molekulové
hmotnosti.
58
A:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
170
130
95
72
95 kDa a 97 kDa
55
43
48 kDa
34
38 kDa
26
B:
1
2
3
4
5
6
7
8
170,130
95
72
9
10
95 kDa a 97 kDa
55
48 kDa
43
38 kDa
34
26
Obr. 15
Imunochemická detekce exprimovaných proteinů
v bakteriálních lyzátech pomocí polyklonální králičí protilátky anti-FTT1103entire. 1.- standard molekulových hmotností, 2.- PhoA před
indukcí, 3.- PhoA po indukci, 4.- FTT1103-AD před indukcí,
5.- FTT1103-AD po indukci, 6.- FTT1103-AD-PhoA před indukcí,
7.- FTT1103-AD-PhoA po indukci, 8.- FTT1103∆-PhoA před indukcí,
9.- FTT1103∆-PhoA po indukci, 10.- FTT1103 pozitivní kontrola. Šipkami
jsou vyznačeny jednotlivé molekulové hmotnosti exprimovaných proteinů.
A: detekce primární protilátkou anti-FTT1103 a sekundární protilátkou
GARPx. B: Detekce primární protilátkou anti-PhoA a sekundární protilátkou GAMPx.
59
5.3 Využití fosfatázové aktivity pro lokalizaci konservovaného hypotetického lipoproteinu
Bakterie nesoucí vytvořené vektory jsme kultivovali přes noc při 37 °C na tuhých půdách, které obsahovaly 40 µg/ml BCIP, substrát pro PhoA. Bakterie
s vektorem nesoucím gen pro FTT1103-AD-PhoA rostly v modrých koloniích, což
indukuje přítomnost signálního peptidu pocházející z FTT1103 stejně jako kolonie
bakterií
transformovaných
vektorem
s PhoA.
Bakterie
obsahující
vektory
pTZ19-FTT1103-AD a pTZ19R-FTT1103∆-PhoA vykazovaly růst v bílých koloniích (Obr. 16).
FTT1103∆-PhoA
FTT1103-AD
FTT1103-AD-PhoA
PhoA
Obr. 16 Aktivita PhoA na půdě s 40 µg/ml BCIP. Modré zbarvení kolonií
signalizuje přítomnost enzymaticky aktivní PhoA v periplazmatickém prostoru, bílé kolonie nenesou reportérový gen pro PhoA nebo neobsahují gen
pro FTT1103 včetně N-terminální signální sekvence.
5.4 Diskuse
Vzhledem k rozdílným aktivitám PhoA fúzované s FTT1103 se signální sekvencí a bez této sekvence je zřejmé, že signální sekvence lipoproteinu je důležitá pro
transport do periplazmatického prostoru. FTT1103 by tedy mohl být sekretovaný
60
protein, nebo je lokalizován do periplazmy, či vnější membrány a jeho C-konec
s navázanou PhoA směřuje do periplazmy (www.sci.sdsu.edu; Prochazkova a kol.,
2005; Gilmore a kol., 2004). Poslední zmíněná možnost, tedy lokalizace lipoproteinu
ve vnější membráně s C-koncem orientovaným do periplazmatického prostoru, odpovídá jak výsledkům predikčního programu LipoP (Janovská a kol., 2007), tak i
možnosti periplazmatické lokalizace na základě podobnosti s DsbA (Qin a kol.,
2009). Podle predikčního programu LipoP je FTT1103 membránový lipoprotein,
avšak podobnost s DsbA proteinem jej předurčuje k lokalizaci v periplazmě. My
jsme potvrdili, že C-konec lipoproteinu FTT1103 je skutečně lokalizován
v periplazmě. Možná topologie lipoproteinu FTT1103 je znázorněna na obr. 17.
Vnější membrána
Lipidová kotva
N-konec
C-konec
Periplazmatický prostor
DsbA motiv
Vnitřní membrána
Obr. 17 Model lipoproteinu FTT1103. C-konec a DsbA motiv jsou lokalizovány do periplazmatického prostoru. Na N-konec v místě „lipobox“ je navázána lipidová kotva, která zajišťuje interakci s vnější membránou.
Pozorovali jsme, že bakterie, které nesly vektor s fúzovanými geny pro
FTT1103 a PhoA získávaly modré zbarvení daleko rychleji než bakterie, které obsahovaly vektor se samotnou PhoA. Je možné, že signální peptid FTT1103 umožňuje
rychlejší transport proteinu do periplazmatického prostoru resp. vnější membrány.
V této práci se nám podařilo prokázat orientaci C-konce lipoproteinu
FTT1103 do periplazmatického prostoru. Další studium tohoto lipoproteinu by se
mohlo zaměřit na potvrzení nebo vyvrácení hypotézy o jeho lokalizaci ve vnější
membráně.
61
6. Závěr
1. Z vektoru pSWFII jsme vyštěpili gen pro PhoA, vnesli jej do plazmidu
pTZ19R a restrikční analýzou ověřili jeho zaklonování.
2. Na základě známé sekvence genů pro FTT1103 a PhoA jsme navrhli primery pro jejich amplifikaci a vnesení sekvencí rozeznávaných vhodnými
restrikčními endonukleázami využitelnými při jejich zabudování do vektorů pET28b a pTZ19R.
3. Gen pro FTT1103 jsme zaklonovali do vektoru pET28b, kde jsme k němu
přidali dvojřetězcový adaptor. Správné klony jsme ověřovali pomocí restrikční analýzy a sekvenování. Do vytvořeného vektoru jsme zaklonovali
PhoA získanou PCR metodou a správné zaklonování ověřili restrikční
analýzou.
4. Geny pro FTT1103-AD a FTT1103-AD-PhoA jsme přenesli do plazmidu
pTZ19R a jejich správné zaklonování ověřili restrikční analýzou.
5. Navrhli jsme si primer FW-FTT1103∆, který jsme spolu s primerem
R-PhoA použili pro amplifikaci FTT1103∆-PhoA. Získaný fragment jsme
vnesli do plazmidu pTZ19R a správné zaklonování jsme ověřili restrikční
analýzou.
6. Na pevných kultivačních mediích s BCIP jsme ověřili enzymovou aktivitu
PhoA fúzovanou s FTT1103.
7. Ověřili jsme expresi proteinů, které jsme detekovali barvením SDS-PAGE
gelu CBB a imunochemicky pomocí primárních protilátek anti-FTT1103
a anti-PhoA a sekundárních protilátek konjugovaných s křenovou peroxidázou.
8. Ze získaných výsledků jsme navrhli možný model topologie lipoproteinu
FTT1103.
62
7. Literatura:
Bednář, M., Fraňková, V., Schindler,J., Souček, A., Vávra, J.: Lékařská mikrobiologie. Praha: Nakladatelství Marvil, 1996: 255-256
Dennis, D.T., Inglesby, T.V., Henderson, D.A., et al.:Tularemia as a Biological
Weapon:
Medical
and
Public
Health
Management.
JAMA,
2001;
285(21):2763-2773.
Ehrman, M., Boyd, D., Beckwith, J.: Genetic analysis of membrane protein topology
by a sandwich gene fusion approach. Proc. Natl. Acad. Sci. USA, 1990 Oct;
Vol. 87,7574-7578.
Eliasson, H., Olcén, P., Sjöstedt, A., Jurstrand, M., Bäck, E., Andersson, S.: Kinetics
of the Immune Response Associated with Tularemia: Comparison
of an Enzyme-Linked Immunosorbent Assay, a Tube Agglutination
Test, and a Novel Whole-Blood Lymphocyte Stimulation Test. Clin. Vaccine Immunol., 2008; 15(8):1238-1243.
Ellis, J., Oyston, P.C.F., Green, M., Tittball, R.W.: Tularemia. Clin. Microbil. Rev.
2002 Oct; 15(4):631-646.
Gardy, J.L., Spencer, C., Wang, K., Ester, M., Tusnády, G.E., Simon, I., Hua, S.,
deFays, K., Lambert, Ch., Nakai, K., Brinkman, F.S.L.: PSORT-B: improving protein subcellular localization prediction for Gram-negative bakteria. Nucleic Acid
Research, 2003; 31(13):3613-3617.
Gilmore, R.D. Jr, Bacon, R.M., Sviat, S.L., Petersen, J.M., Bearden, S.W.: Identification of Francisella tularensis genes encoding exported membrane-associated proteins using TnphoA mutagenesis of a genomic library. Microbial Pathogenesis, 2004;
37:205-213.
63
Gomez, M., Johnson, S., Gennaro, M.L.: Identification of Secreted Proteins of Mycobacterium tuberculosis by a Bioinformatic Approach. Infect. Immun., 2000;
68(4):2323-2327.
Havlasová, J., Hernychová, L., Brychta, M., Hubálek, M., Lenco, J., Larsson, P.,
Lundqvist, M., Forsman, M., Kročová, Z., Stulík, J., Macela, A.: Proteomics analysis
of anti-Francisella tularensis LVS antipody response in murine model of tularemia.
Proteomics, 2005; 5:2090-2103
Hubálek, M., Hernychová, L., Brychta, M., Lenco, J., Zechovská, J., Stulík, J.: Comparative proteome analysis of cellular proteins extracted from highly virulent Francisella tularensis ssp. tularensis and less virulent F. tularensis ssp. holarctica and F.
tularensis ssp. mediaasiatica. Proteomics, 2004; 4(10):3048-3060.
Huntley, J.F., Conley, P.G., Hagman, K.E., Norgard, M.V.: Charakterization of
Francisella tularensis outer membrane proteins. J. Bacteriol., 2006; Vol. 189, No. 2:
561-574
Chamberlein, R.E.: Evaluation of Live Tularemia Vaccine Prepared in a Chemically
Defined Meduim. Appl. Microbiol., 1965; 13(2):232-235.
Janovská, A., Pávková, I., Hubálek, M.,m Lenčo, J., Macela,, A., Stulík, J.: Identification of immunoreactive antigens in membrane proteins enriched fiction from
Francisella tularensis LVS. Immunology Letters, 2007; 108:151-159
Jiang, J., Parker, C.E., Fuller, J.R., Kawula, T.H., Borchers, Ch.H.: An immunoaffinity tandem mass spektrometry (iMALDI) assai for detection of Francisella tularensis. Analytica Chimica Acta, 2007; 605:70-79.
Juncker, A.S., Willenbrock, H., von Heijne, G., Brunak, S., Nielsen, H., Krogh, A.:
Prediction of lipoprotein signal peptides in Gram-negative bakteria. Protein Science,
2003; 12:1652-1662.
64
Kamalakkannan, S., Murugan, V., Jagannadham, M.V., Nagaraj, R., Sankaran, K.:
Bacterial lipid modification of proteins for novel engeneering applications. Protein
Engeneering, Design & Selection, 2004; 17(10):721-729.
Larsson, P., Oyston, P.C., Chain, P., Chu, M.C., Duffield, M., Fuxelius, H.H., Garcia, E., Hälltorp, G., Johansson, D., Isherwood, K.E., Karp, P.D., Larsson, E., Liu,
Y., Michell, S., Prior, J., Prior, R., Malfatti, S., Sjöstedt, A., Svensson, K., Thompson, N., Vergez, L., Wagg, J.K., Wren, B.W., Lindler, L.E., Andersson, S.G., Forsman, M., Titball, R.W.: The komplete genome sequence of Francisella tularensis,
the causative agent of tularemia. Nat. Genet., 2005; 37(2):153-159.
Lukáš, B., Libich, J.: Modifikace jednoduché krevní agarové plotny pro kultivaci
Pasteurella tularensis. Čs. epidemiol. mikrobiol. imunol., XI, 1962: 290-297. (cit.
Macela, A., Stulík., J., Trebichavský, I., Kroča, M., Janovská, S.: Infekční choroby a
intracelulární parazitismus bakterií. Grada Publishing, a.s., 2006: 113)
Macela, A., Stulík., J., Trebichavský, I., Kroča, M., Janovská, S.: Infekční choroby a
intracelulární parazitismus bakterií. Praha: Nakladatelství Grada Publishing, a.s.,
2006: 113. ISBN 80-247-0664-4
Marczak, M., Mazur, A., Król, J.E., Gruszeki, W.I., Skorupska, A.: Lipoprotein PssN
of Rhizobium leguminosarum bv. triforii: Subcellular Localization and Possible Involvement in Exopolysacharide Export. J. Bacteriol., 2006 Oct; 188(19):6943-6952.
Mierendorf, R.C., Percy, C., Young, R.A.: Gene Isolation by Screening λgt11 Libraries with Antibodies. Methods Enzymol., 1987; 152:458-469.
Pávková, I., Hubálek, M., Zechovská, J., Lenčo, J., Stulík, J.: Francisella tularensis
live valine strain: Proteomic analysis of membrane enriched fiction. Proteomics
2005; 5:2460-2467.
65
Prochazkova, K., Osicka, R., Linhartova, I., Halada, P., Sulc, M., Sebo, P.: The Neisseria meningitis Outer Membrane Lipoprotein FrpD Binds the RTX Protein FrpC. J
Biol Chem., 2005 Feb 4; 280(5):3251-3258.
Qin, A., Scott, D.W., Thompson, J.A., Mann, B.J.: Identification of an Essential
Francisella tularensis subsp. Tularensis Virulence Factor. Infect. Immun, 2009;
77(1):152-161.
Sambrook, J., Fritsch, E.F., Maniatis, T.: Molecular cloning (A laboratory manual),
1989, 2.vydání
Sedlák, K., Tomšíčková, M.: Nebezpečné infekce zvířat a člověka. Praha: Nakladatelství Scientia, 2006. 167 s., ISBN 80-86960-07-2.
Sjödstedt, A.: Virulence determinants and protective antigens of Francisella tularensis. Current Opinion in Microbiology, 2003; 6:66-71.
Straskova, A., Pavkova, I., Forslund, A.-L., Kuoppa, K., Noppa, L., Kroca, M., Fučíková, A., Krocova, Z., Forsberg, Å, Stulik, J.: A dsbA mutant of Francisella tularensis is high attenuated in vivo and induces protective imunity. In press.
Takeda, K., Miyatake, H., Yokota, N., Matsuyama, S., Tokuda, H., Miki, K.: Crystal
structures of bacteriel lipoprotein localization factors, LolA and LolB. EMBO J.,
2003; 22(13):3199-3209.
Thakran, S., Li, H., Lavine, Ch.L., Miller, M.A., Bina, J.E., Bina, X.R., Re, F.: Identification of Francisella tularensis lipoproteins that stimulate the Toll-like receptor
(TLR) 2/TLR1 heterodimer. J Biol Chem., 2008 Feb 15;283(7):3751-3760. Epub
2007 Dec 13.
66
Internetové odkazy:
http://blast.ncbi.nlm.nih.gov/Blast.cgi - predikční program BLAST
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=retrieve&dopt=full_report
&list_uids=3191250&log$=databasead&logdbfrom=protein – FTT1103; 20.3.2008
10:06
http://www.ncbi.nlm.nih.gov/protein/56708183?ordinalpos=1&itool=EntrezSystem2.
PEntrez.Sequence.Sequence_ResultsPanel.Sequence_RVDocSum
–
FTT1103;
1.5.2009 13:53
http://www.cbs.dtu.dk/services/LipoP/ - predikční program LipoP
http://www.epibio.com/f5_4/f5_4pp.asp - Efficient Fractionation of Periplasmic,
Cytoplasmic, and Membrane Proteins From Escherichia coli Using the Epicentre
PeriPrepsTM Periplasting Kit; 24.10.2007 9:07
http://www.mrc-lmb.cam.ac.uk/genomes/dolop - 3.3.2009 20:01
http://www.psort.org – predikční program PSORT-B
http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/regulation/fusion.html 24.10.2007
67
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement