SeqCap EZ Library SR User`s Guide

Add to My manuals
55 Pages

advertisement

SeqCap EZ Library SR User`s Guide | Manualzz

SeqCap EZ Library SR

User’s Guide

Version 5.1

For life science research only.

Not for use in diagnostic procedures.

Copyright

© 2015 Roche NimbleGen, Inc. All Rights Reserved.

Editions

Version 1.0, December 2010 (SeqCap EZ Choice SR 06264808001); Version 2.2, December 2010 (SeqCap EZ Exome SR 05836611001);

Version 3.0, November 2011; Version 4.0, January 2013; Version 4.1, May 2013; Version 4.2, December 2013; Version 4.3, October 2014;

Version 5.0, December 2014; Version 5.1, September 2015.

Restrictions and Liabilities

This document is provided “as is” and Roche NimbleGen, Inc. (“Roche NimbleGen”) assumes no responsibility for any typographical, technical, or other inaccuracies in this document. Roche NimbleGen reserves the right to periodically change information that is contained in this document; however, Roche NimbleGen makes no commitment to provide any such changes, updates, enhancements, or other additions to this document to you in a timely manner or at all.

OTHER THAN THE LIMITED WARRANTY CONTAINED IN THIS USER GUIDE, ROCHE NIMBLEGEN MAKES NO REPRESENTATIONS,

WARRANTIES, CONDITIONS OR COVENANTS, EITHER EXPRESS OR IMPLIED (INCLUDING WITHOUT LIMITATION, ANY EXPRESS OR

IMPLIED WARRANTIES OR CONDITIONS OF FITNESS FOR A PARTICULAR PURPOSE, NON-INFRINGEMENT, MERCHANTABILITY,

DURABILITY, TITLE, OR RELATED TO THE PERFORMANCE OR NON-PERFORMANCE OF ANY PRODUCT REFERENCED HEREIN OR

PERFORMANCE OF ANY SERVICES REFERENCED HEREIN).

This document might contain references to third party sources of information, hardware or software, products, or services and/or third party web sites (collectively the “Third-Party Information”). Roche NimbleGen does not control, and is not responsible for, any Third-Party

Information, including, without limitation the content, accuracy, copyright compliance, compatibility, performance, trustworthiness, legality, decency, links, or any other aspect of Third-Party Information. The inclusion of Third-Party Information in this document does not imply endorsement by Roche NimbleGen of the Third-Party Information or the third party in any way.

Roche NimbleGen does not in any way guarantee or represent that you will obtain satisfactory results from using NimbleGen products as described herein. The only warranties provided to you are included in the Limited Warranty enclosed with this guide. You assume all risk in connection with your use of NimbleGen products.

Roche NimbleGen is not responsible nor will be liable in any way for your use of any software or equipment that is not supplied by Roche

NimbleGen in connection with your use of NimbleGen products.

Conditions of Use

NimbleGen products are intended for life science research only and are not for use in diagnostic procedures. You are responsible for understanding and performing the protocols described within. Roche NimbleGen does not guarantee any results you may achieve. These protocols are provided as Roche NimbleGen’s recommendations based on its use and experience with NimbleGen products.

Use Restrictions

For patent license limitations for individual products please refer to:

www.technical-support.roche.com

.

SeqCap EZ Library SR User’s Guide, v5.1

2

Table of Contents

Table of Contents ................................................................................................................................................. 3

Preface.................................................................................................................................................................... 5

Intended Use ........................................................................................................................................................................................................... 5

SeqCap EZ Probe Pool ................................................................................................................................................................................... 5

Contact Information .............................................................................................................................................................................................. 5

Technical Support............................................................................................................................................................................................ 5

Manufacturer and Distribution ................................................................................................................................................................... 5

Conventions Used in This Manual ................................................................................................................................................................... 5

Symbols ............................................................................................................................................................................................................... 5

Text ....................................................................................................................................................................................................................... 6

Chapter 1. Before You Begin ............................................................................................................................. 7

Workflow .................................................................................................................................................................................................................. 7

Prepare the Following Reagents and Equipment ....................................................................................................................................... 8

What’s New in v5.1? ............................................................................................................................................................................................. 9

What’s New in v5.0? ............................................................................................................................................................................................. 9

Terminology ............................................................................................................................................................................................................. 9

Components Supplied ....................................................................................................................................................................................... 10

Protocol Information & Safety ......................................................................................................................................................................... 10

Required Equipment, Labware & Consumables ....................................................................................................................................... 10

Laboratory Equipment .................................................................................................................................................................................. 10

Consumables Available from Roche Diagnostics ............................................................................................................................... 11

Consumables Purchased from Other Vendors .................................................................................................................................... 11

Custom Oligonucleotides Purchased from IDT or Another Vendor .............................................................................................. 12

Chapter 2. Store the SeqCap EZ Reagents ................................................................................................... 13

Step 1. Aliquot the SeqCap EZ Probe Pool ................................................................................................................................................. 13

Step 2. Store the Frozen Reagents ................................................................................................................................................................ 14

Step 3. Store the Refrigerated Reagents ..................................................................................................................................................... 14

Chapter 3. Prepare the Sample Library ......................................................................................................... 15

References ............................................................................................................................................................................................................. 15

Sample Requirements ........................................................................................................................................................................................ 15

Step 1. Resuspend the Index Adapters ........................................................................................................................................................ 15

Step 2. Prepare the Sample Library ............................................................................................................................................................... 16

Chapter 4. Amplify the Sample Library Using LM-PCR .............................................................................. 21

References ............................................................................................................................................................................................................. 21

Sample Requirements ........................................................................................................................................................................................ 21

Step 1. Resuspend the SeqCap Pre-LM-PCR Oligos .............................................................................................................................. 21

Step 2. Prepare the Pre-Capture LM-PCR Master Mix ........................................................................................................................... 21

Step 3. Perform the Pre-Capture PCR Amplification ............................................................................................................................... 22

Step 4. Purify the Amplified Sample Library using Agencourt AMPure XP Beads ....................................................................... 22

Step 5. Check the Quality of the Amplified Sample Library .................................................................................................................. 23

Chapter 5. Hybridize the Sample and SeqCap EZ Probe Pool .................................................................. 25

Step 1. Prepare for Hybridization ................................................................................................................................................................... 25

Step 2. Resuspend the SeqCap HE Universal and SeqCap HE Index Oligos .................................................................................. 25

Step 3. Prepare the Multiplex DNA Sample Library Pool ....................................................................................................................... 26

Step 4. Prepare the Multiplex Hybridization Enhancing Oligo Pool ................................................................................................... 26

Step 5. Prepare the Hybridization Sample ................................................................................................................................................... 27

Chapter 6. Wash and Recover Captured Multiplex DNA Sample ............................................................ 29

Step 1. Prepare Sequence Capture and Bead Wash Buffers ................................................................................................................ 29

Step 2. Prepare the Capture Beads ............................................................................................................................................................... 30

SeqCap EZ Library SR User’s Guide, v5.1

3

Table of Contents

Step 3. Bind DNA to the Capture Beads ..................................................................................................................................................... 30

Step 4. Wash the Capture Beads Plus Bound DNA ................................................................................................................................. 30

Chapter 7. Amplify Captured Multiplex DNA Sample Using LM-PCR ............................................................ 32

References ............................................................................................................................................................................................................. 32

Step 1. Resuspend the Post-LM-PCR Oligos ............................................................................................................................................. 32

Step 2. Prepare the Post-Capture LM-PCR Master Mix ......................................................................................................................... 32

Step 3. Perform the Post-Capture PCR Amplification ............................................................................................................................. 33

Step 4. Purify the Amplified Captured Multiplex DNA Sample using Agencourt AMPure XP Beads..................................... 34

Step 5. Determine the Concentration, Size Distribution, and Quality of the Amplified Captured Multiplex DNA Sample35

Chapter 8. Measure Enrichment Using qPCR ................................................................................................... 36

References ............................................................................................................................................................................................................. 36

Step 1. Perform the qPCR Assay .................................................................................................................................................................... 36

Step 2. Analyze Data .......................................................................................................................................................................................... 39

Example: NSC-0268 assay .......................................................................................................................................................................... 40

Interpreting qPCR Results – SeqCap EZ Probe Pool Captures....................................................................................................... 40

Appendix A. Hybridize Using 96-Well Plates and a Liquid Handler System .......................................... 41

Step 1. Prepare for Hybridization ................................................................................................................................................................... 41

Step 2. Resuspend the SeqCap HE Universal and SeqCap HE Index Oligos .................................................................................. 41

Step 3. Prepare the Multiplex DNA Sample Library Pool ....................................................................................................................... 41

Step 4. Prepare the Multiplex Hybridization Enhancing Oligo Pool ................................................................................................... 42

Step 5. Prepare the Hybridization Sample ................................................................................................................................................... 42

Appendix B. Wash and Recover Using 96-Well Plates and a Liquid Handler System ......................... 45

Additional Equipment, Labware & Consumables ..................................................................................................................................... 45

Step 1. Prepare Buffers...................................................................................................................................................................................... 46

Step 2. Prepare the Capture Beads ............................................................................................................................................................... 46

Step 3. Bind DNA to the Capture Beads ..................................................................................................................................................... 47

Step 4. Wash the Capture Beads Plus Bound DNA ................................................................................................................................. 47

Appendix C. Post-Capture Multiplexing for Sequencing ........................................................................... 49

Appendix D. Purify the Amplified Captured DNA using Qiagen QIAquick PCR Purification Kit ........ 50

References ............................................................................................................................................................................................................. 50

Appendix E. Troubleshooting ........................................................................................................................... 51

Appendix F. Limited Warranty .......................................................................................................................... 54

SeqCap EZ Library SR User’s Guide, v5.1

4

Preface

Preface

Intended Use

For life science research only. Not for use in diagnostic procedures.

SeqCap EZ Probe Pool

SeqCap EZ probe pool is a solution-based capture method that enables enrichment of the whole exome or customer regions of interest in a single tube. Throughout this document, ‘SeqCap EZ probe pool’ refers to both the SeqCap EZ

Library and SeqCap EZ Enrichment Kits.

Contact Information

Technical Support

If you have questions, contact your local Roche Technical Support. Go to

www.nimblegen.com/contact

for contact information.

Manufacturer and Distribution

Manufacturer

Distribution

Distribution in USA

Roche NimbleGen, Inc.

Madison, WI USA

Roche Diagnostics GmbH

Mannheim, Germany

Roche Diagnostics Corporation

Indianapolis, IN USA

Conventions Used in This Manual

Symbols

Symbol Description

Important Note: Information critical to the success of the procedure or use of the product. Failure to follow these instructions could result in compromised data.

Information Note: Designates a note that provides additional information concerning the current topic or procedure.

SeqCap EZ Library SR User’s Guide, v5.1

5

Preface

Text

Conventions

Numbered listing

Italic type, blue

Italic type

Bold type

Description

Indicates steps in a procedure that must be performed in the order listed.

Identifies a resource in a different area of this manual or on a web site.

Identifies the names of dialog boxes, windows, tabs, panels, views, or message boxes in the software.

Identifies names of menus and controls (buttons, checkboxes, etc.) in the software.

SeqCap EZ Library SR User’s Guide, v5.1

6

Chapter 1. Before You Begin

Chapter 1. Before You Begin

This User’s Guide describes the process for enrichment of individual or multiplexed genomic DNA (gDNA) sample libraries using SeqCap EZ Libraries, and the amplification of these sample libraries by ligation-mediated PCR (LM-

PCR) (

Figure 1

). Specifically, this User’s Guide provides a protocol for the workflow outlined below. The output of

this protocol consists of enriched gDNA fragments that can be sequenced directly using an Illumina sequencing instrument.

Workflow

The SeqCap EZ protocol involves:

1.

Preparation of the gDNA sample library using the KAPA Library Preparation Kits.

2.

Amplification of the DNA sample library using the KAPA HiFi HotStart ReadyMix.

3.

Capturing target regions by hybridizing the gDNA sample library with the SeqCap EZ probe pool.

4.

Recovery of captured sample using the SeqCap Hybridization and Wash Kit.

5.

Further amplification of the captured DNA sample using the KAPA HiFi HotStart ReadyMix.

6.

Sequencing the captured and amplified DNA sample using an Illumina sequencing instrument.

Figure 1

lists the steps in the workflow for SeqCap EZ Libraries.

The corresponding estimated time for each step is based on processing one capture reaction. When applicable,

incubation times are indicated between processing times in

Figure 1

.

SeqCap EZ Library SR User’s Guide, v5.1

7

Chapter 1. Before You Begin

Step

Library Preparation

(KAPA Library Preparation Kit Illumina)

Processing Time

5.5 h

Amplify Sample Library Using LM-PCR

Mix Amplified Sample Libraries

(Multiplex Sample Capture, only)

Hybridize Sample and SeqCap EZ Probe Pool

Wash and Recover Captured DNA

1.5 h

0.5 h

0.5 h

16 - 20 h incubation

2 h

2.5 h

Amplify Captured DNA Using LM-PCR

Measure Enrichment Using qPCR

2 h

Proceed to Sequencing Using Illumina Sequencing Instrument and Associated Reagents

Figure 1: Workflow for SeqCap EZ experiments using Illumina sequencing instruments.

Prepare the Following Reagents and Equipment

Thermocyclers should be programmed with the required thermocycler programs: o

Pre-Capture LM-PCR program (

Chapter 4

, Step 3.2)

o

Post-Capture LM-PCR program (

Chapter 7

, Step 3.2)

It is recommended to use a thermocycler with a heated lid, which tracks +10°C above the incubation temperature.

The following reagents should be prepared as described before beginning the protocol: o

Aliquot SeqCap EZ Probe Pool (

Chapter 2

, Step 1)

o

Resuspend Index Adapters (

Chapter 3

, Step 1)

o

Resuspend Pre-LM-PCR Oligos (

Chapter 4

, Step 1)

o

Resuspend SeqCap HE Universal and SeqCap HE Index Oligos (

Chapter 5

, Step 2)

o

Resuspend Post-LM-PCR Oligos (

Chapter 7

, Step 1)

SeqCap EZ Library SR User’s Guide, v5.1

8

Chapter 1. Before You Begin

What’s New in v5.1?

The ‘Components Supplied’ list has been updated for the launch of the SeqCap EZ MedExome Enrichment Kit and SeqCap EZ MedExome Plus Enrichment Kit (see

www.nimblegen.com/products/

for additional details).

What’s New in v5.0?

The recommended amount of input DNA into the KAPA library preparation step(s) has been reduced from

1 µg to 100 ng (

Chapter 3

).

The length of the hybridization of the amplified sample library with the SeqCap EZ probe pool has been reduced

from 64 - 72 hours to 16 - 20 hours (

Chapter 5

).

The instructions in

Chapter 3

have been updated to state that the KAPA Library Preparation Kit Technical Data

Sheet, KR0935 – v2.14 (or later) should be utilized for generating DNA sample libraries.

The SeqCap EZ Library SR User’s Guide now includes detailed steps for how to generate a DNA sample library using the KAPA Library Preparation Kit (Illumina series), from Kapa Biosystems.

The SeqCap EZ Pure Capture Bead Kit, SeqCap EZ Purification Beads, and SeqCap EZ Hybridization and Wash

Kit have been renamed to SeqCap Pure Capture Bead Kit, Agencourt AMPure XP Beads, and SeqCap

Hybridization and Wash Kit, respectively.

Note: This User’s Guide can be used with any SeqCap EZ probe pool.

To verify you are using the most up-to-date version of this User’s Guide to process your captures, go to

www.nimblegen.com/lit

.

Terminology

LM-PCR: Ligation Mediated PCR. In the context of this document, PCR using primers complementary to the sequencing adapters.

Sequence Capture (or Capture):

The process of enriching targeted regions from genomic DNA. In the context of this document, the hybridization of the amplified sample library and SeqCap EZ probe pool, and subsequent washing steps.

SeqCap EZ probe pool: The complete set of biotinylated long oligonucleotide probes provided by Roche

NimbleGen to perform sequence capture (SeqCap EZ Human Exome, SeqCap EZ MedExome, SeqCap EZ Choice, or SeqCap EZ Developer).

Sample Library: The initial shotgun library generated from genomic DNA by fragmentation and ligation of sequencing-platform-specific linkers. In the context of this document, the sample library before amplification by

LM-PCR and before capture.

Amplified Sample Library: The sample library after amplification by LM-PCR but before capture.

Captured Multiplex DNA Sample: The enriched DNA population from the amplified sample library after the multiplex capture process but before another round of LM-PCR.

Amplified, Captured Multiplex DNA Sample: The captured DNA after LM-PCR amplification.

SeqCap EZ Library SR User’s Guide, v5.1

9

Chapter 1. Before You Begin

Components Supplied

Component

SeqCap EZ MedExome Enrichment Kit

SeqCap EZ MedExome Plus Enrichment Kit

SeqCap EZ Choice Library

SeqCap EZ Choice XL Library

SeqCap EZ Developer Library

SeqCap EZ Human Exome Library v3.0

SeqCap EZ Human Exome Library v2.0

SeqCap EZ Exome Plus Library

Description

Available in 4, 48, or 384 reaction packs

Available in 48 reaction packs

Available in 4, 12, 24, 48, 96, 384 or 960 reaction packs

Available in 4 or 48 reaction packs

Available in 4 or 48 reaction packs

Available in 12, 48 or 96 reaction packs

SeqCap EZ Designs Available in various reaction packs

Product CD/DVD

Design and annotation (bed 1 ) files and user documentation are included.

1 View .bed files using Roche NimbleGen SignalMap software (available at

UCSC Genome browser).

www.nimblegen.com/products/software

or the Internet-based

Protocol Information & Safety

Wear gloves and take precautions to avoid sample contamination.

Perform all centrifugations at room temperature (+15 to +25°C) unless indicated otherwise.

Required Equipment, Labware & Consumables

You assume full responsibility when using the equipment, labware, and consumables described below. These protocols are designed for use with the specified equipment, labware, and consumables.

Laboratory Equipment

Equipment

DNA Vacuum Concentrator

(1.5 ml tubes)

Covaris Ultra Sonicator

(optional)

DynaMag-2 Magnet

(16 x 1.5 ml tube holder)

DynaMag-96 Side Magnet

(optional)

Heat block

Water bath

Microcentrifuge

(16,000 x g capability)

Spectrophotometer

Bioanalyzer 2100

LightCycler

®

480 Instrument II

Thermocycler (capable of maintaining +47°C for

16 - 20 hours; programmable heated lid required)

Vortex mixer

Supplier

Multiple Vendors

Covaris

Life Technologies

Life Technologies

Multiple Vendors

Multiple Vendors

Multiple Vendors

NanoDrop

Agilent

Roche Diagnostics

Multiple Vendors

Multiple Vendors

Catalog No.

Multiple models

(e.g. S220, E220)

12321D

12331D

ND-1000

05 015 243 001 (384-well)

-or-

05 015 278 001 (96-well)

SeqCap EZ Library SR User’s Guide, v5.1

10

Chapter 1. Before You Begin

Consumables Available from Roche Diagnostics

The package sizes listed provide sufficient material to perform a minimum of 24 Sequence Capture experiments.

Component

LightCycler

®

480 Multiwell Plate 384 (with sealing foils)

LightCycler

®

480 SYBR Green I Master (2X Mix)

Water. PCR Grade

KAPA Library Preparation Kit Illumina

KAPA Library Preparation Kit Illumina

KAPA HTP Lib Preparation Kit Illumina

SeqCap Adapter Kit A 96

Package Size/Contents

5 x 10 plates

5 x 1 ml

4 x 25 ml

10 reactions

50 reactions

96 reactions

96 reactions

Catalog No.

04 729 749 001

04 707 516 001

03 315 843 001

07 137 923 001

07 137 974 001

07 138 008 001

07 141 530 001

SeqCap Adapter Kit B 96

SeqCap Hybridization and Wash Kit

1

SeqCap EZ Accessory Kit v2

1

96 reactions

24 reactions

24 reactions

07 141 548 001

05 634 261 001

07 145 594 001

SeqCap EZ Accessory Kit v2

SeqCap HE-Oligo Kit A

1

96 reactions

96 reactions

06 776 345 001

06 777 287 001

SeqCap HE-Oligo Kit B 96 reactions 06 777 317 001

SeqCap Pure Capture Bead Kit

2

24 reactions 06 977 952 001

1 These items can be ordered together in the SeqCap EZ Reagent Kit v2, 24 reactions

2

(Cat. No. 06 953 212 001)

2 These items can be ordered together in the SeqCap EZ Reagent Kit Plus v2, 24 reactions (Cat. No. 06 953 247 001

)

Use nuclease-free, PCR-grade water for all described protocol steps. Working with a

liquid handler system may require a considerably greater excess volume (

Appendix B)

.

Consumables Purchased from Other Vendors

Component

Agilent DNA 1000 Kit

Supplier

Agilent

Agencourt AMPure XP Beads

Ethanol, 200 proof (absolute), for molecular biology

TE Buffer, 1 X Solution pH 8.0, Low EDTA microTUBE AFA Fiber Pre-Slit Snap-Cap 6x16mm (25)

Elution buffer (10 mM Tris-HCl, pH 8.0)

Tubes:

0.2 ml PCR tubes

1.5 ml microcentrifuge tubes

Beckman Coulter

Sigma-Aldrich

USB Corporation

Covaris, Inc.

Multiple Vendors

Multiple Vendors

Package Size

1 kit

5 ml

60 ml

450 ml

500 ml

Catalog No.

5067-1504

A63880

A63881

A63882

E7023-500ML

100 ml 75793

1 package of 25 tubes 520045

SeqCap EZ Library SR User’s Guide, v5.1

11

Chapter 1. Before You Begin

Custom Oligonucleotides Purchased from IDT or Another Vendor

Component Concentration Sequence

qPCR NSC-0237, forward, Oligo qPCR NSC-0237, reverse, Oligo qPCR NSC-0247, forward, Oligo qPCR NSC-0247, reverse, Oligo

2 µM

2 µM

2 µM

2 µM

5' - CGC ATT CCT CAT CCC AGT ATG - 3'

5' - AAA GGA CTT GGT GCA GAG TTC AG - 3'

5' - CCC ACC GCC TTC GAC AT - 3'

5' - CCT GCT TAC TGT GGG CTC TTG - 3' qPCR NSC-0268, forward, Oligo qPCR NSC-0268, reverse, Oligo

2 µM

2 µM

5' - CTC GCT TAA CCA GAC TCA TCT ACT GT - 3'

5' - ACT TGG CTC AGC TGT ATG AAG GT - 3' qPCR NSC-0272, forward, Oligo qPCR NSC-0272, reverse, Oligo

2 µM

2 µM

5' - CAG CCC CAG CTC AGG TAC AG - 3'

5' – ATG ATG CGA GTG CTG ATG ATG - 3'

Note: The qPCR oligonucleotides can be resuspended in PCR-grade water or TE buffer.

Note(s)

These oligos are used in qPCR analysis of enrichment.

SeqCap EZ Library SR User’s Guide, v5.1

12

Chapter 2. Store the SeqCap EZ Reagents

Chapter 2. Store the SeqCap EZ Reagents

Chapter 2 describes the storage conditions for the following kits:

SeqCap EZ Library Kit or SeqCap EZ MedExome Enrichment Kit

SeqCap EZ Accessory Kit v2

SeqCap Hybridization and Wash Kit

SeqCap Adapter Kit (A and/or B)

SeqCap HE-Oligo Kits (A and/or B)

SeqCap Pure Capture Bead Kit

Step 1. Aliquot the SeqCap EZ Probe Pool

Upon receipt of the SeqCap EZ Library Kit or SeqCap EZ MedExome Enrichment Kit, undertake the following steps to ensure the highest performance of the SeqCap EZ probe pool to avoid multiple freeze/thaw cycles or potential accidental contamination:

1.

If frozen, thaw the tube of SeqCap EZ probe pool on ice.

2.

Vortex the SeqCap EZ probe pool for 3 seconds.

3.

Centrifuge the tube of SeqCap EZ probe pool at 10,000 x g for 30 seconds to ensure that the liquid is at the bottom of the tube before opening the tube.

4.

Aliquot the SeqCap EZ probe pool into single-use aliquots (4.5 µl/aliquot) in 0.2 ml PCR tubes (or 96-well plates

if following the higher throughput protocol described in

Appendix A

) and store at -15 to -25°C until use. The

presence of some residual volume after dispensing all single-use aliquots is normal.

5.

When ready to perform the experiment, thaw the required number of single-use SeqCap EZ probe pool aliquots on ice.

The SeqCap EZ probe pool should not undergo multiple freeze/thaw cycles. To help ensure the highest performance of the SeqCap EZ probe pool, Roche NimbleGen recommends aliquoting the SeqCap EZ probe pool into single-use volumes to prevent damage from successive freeze/thaw cycles.

SeqCap EZ Library SR User’s Guide, v5.1

13

Chapter 2. Store the SeqCap EZ Reagents

Step 2. Store the Frozen Reagents

Upon receipt, undertake the following steps to ensure the highest performance of the SeqCap EZ Accessory Kit v2,

SeqCap Hybridization and Wash Kit, SeqCap Adapter Kits A and B, and SeqCap HE-Oligo Kits:

1.

Store the kits at -15 to -25°C until use.

Step 3. Store the Refrigerated Reagents

Upon receipt, undertake the following steps to ensure the highest performance of the SeqCap Pure Capture Bead Kit:

1.

Store the SeqCap Pure Capture Bead kit at +2 to +8°C until use.

The SeqCap Pure Capture Bead Kit must not be frozen.

SeqCap EZ Library SR User’s Guide, v5.1

14

Chapter 3. Prepare the Sample Library

Chapter 3. Prepare the Sample Library

Chapter 3 describes the sample library preparation method and how to assess the quality of the sample library before amplification using LM-PCR.

KAPA Library Preparation Kit

SeqCap Adapter Kit (A and/or B)

SeqCap EZ Accessory Kit v2

Agencourt Ampure XP Beads (warmed to room temperature prior to use)

Ensure that the following are available:

Additional PCR-grade water for sample library preparation

Freshly-prepared 80% ethanol: 1.6 ml per DNA sample

Elution buffer (10 mM Tris-HCl, pH 8.0): 125 µl per DNA sample

If the sample library preparation protocol is split across two days, freshly prepare the required amount of 80% ethanol daily.

References

KAPA Library Preparation Kit Technical Data Sheet, KR0935 – v2.14 (or later) (hard-copy included in the

KAPA Library Preparation Kit or contact Kapa Biosystems Technical Support to obtain pdf, at

[email protected]

).

Covaris Focused-ultrasonicator User’s Guide

Sample Requirements

Roche NimbleGen recommends starting with 100 ng of input gDNA for sample library preparation; however, up to

1 µg of input gDNA has been validated and is supported for use in sample library preparation if desired

(see

Appendix E

).

Step 1. Resuspend the Index Adapters

Resuspension of the Index Adapters must be performed on ice. Care should be taken when opening tubes to avoid loss of the lyophilized pellet.

1.

Spin the lyophilized index adapters, contained in the SeqCap Adapter Kit A and/or B, briefly to allow the contents to pellet at the bottom of the tube.

2.

Add 50 µl cold, PCR-grade water to each of the 12 tubes labeled ‘SeqCap Index Adapter’ in the SeqCap Adapter

Kit A and/or B. Keep adapters on ice.

3.

Briefly vortex the index adapters plus PCR-grade water and spin down the resuspended index adapter tubes.

4.

The resuspended index adapter tubes should be stored at -15 to -25°C.

SeqCap EZ Library SR User’s Guide, v5.1

15

Chapter 3. Prepare the Sample Library

Step 2. Prepare the Sample Library

Instructions for preparing an individual sample library are included here in Step 2, based on v2.14 of the KAPA Library Preparation Kit Technical Data Sheet. When assembling a master mix for processing multiple samples, prepare an excess volume of

~5% to allow for complete pipetting (liquid handling systems may require an excess of

~20%). The KAPA Technical Data Sheet includes several specific scaling examples.

Prior to executing the sample library preparation, please carefully read the entire

Technical Data Sheet (v2.14 or later). Ensure you are using the most recent version of the protocol, and contact

[email protected]

for technical assistance related to the library construction.

For guidelines on preparing sample libraries using amounts of input DNA other than

100 ng, or for using low quality DNA extracted from formalin-fixed paraffin-embedded

(FFPE) tissues, see

Appendix E

, or contact your local Roche Technical Support (go to

www.nimblegen.com/contact

for contact information).

1.

Pipette 100 ng of the gDNA sample of interest into a 1.5 ml tube.

2.

Adjust the volume to a total of 52.5 µl using 1x TE (low EDTA) and transfer to a Covaris microTUBE for fragmentation.

3.

Fragment the gDNA so that the average DNA fragment size is 180 – 220 bp.

4.

Following fragmentation, proceed with the End Repair Reaction Setup:

a.

Transfer 50 µl of the fragmented DNA to a 0.2 ml PCR tube.

b.

To each 50 µl fragmented sample add 20 µl of End Repair Master Mix, resulting in a total volume of 70 µl.

End Repair Master Mix

PCR-grade water

10X KAPA End Repair Buffer

KAPA End Repair Enzyme Mix

Total

Per Individual

Sample Library

8 µl

7 µl

5 µl

20 µl c.

Mix the End Repair reaction by pipetting up and down.

d.

Incubate the reaction at +20°C for 30 minutes.

e.

Following the 30 minute incubation, proceed immediately to the next step.

5.

Perform the End Repair Cleanup:

a.

To each 70 µl End Repair Reaction, add 120 µl of room temperature Agencourt AMPure XP beads, resulting in a total volume of 190 µl.

End Repair Cleanup

End Repair Reaction

Agencourt AMPure XP beads

Total

Per Individual

Sample Library

70 µl

120 µl

190 µl

SeqCap EZ Library SR User’s Guide, v5.1

16

Chapter 3. Prepare the Sample Library

b.

Mix thoroughly by pipetting up and down multiple times.

c.

Incubate the tube at room temperature for 15 minutes to allow the DNA to bind to the beads.

d.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

e.

Carefully remove and discard the supernatant.

f.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

g.

Incubate the tube at room temperature for ≥30 seconds.

h.

Carefully remove and discard the ethanol.

i.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

j.

Incubate the tube at room temperature for ≥30 seconds.

k.

Carefully remove and discard the ethanol. Try to remove all residual ethanol without disturbing the beads.

l.

Allow the beads to dry at room temperature, sufficiently for all the ethanol to evaporate.

Caution: Over-drying the beads may result in dramatic yield loss.

m.

Remove the tube from the magnet.

6.

Perform the A-Tailing Reaction Setup:

a.

To each tube of DNA plus beads add 50 µl of the A-Tailing Master Mix, resulting in a total volume of 50 µl.

A-Tailing Master Mix

PCR-grade water

10X KAPA A-Tailing Buffer

KAPA A-Tailing Enzyme

Total

Per Individual

Sample Library

42 µl

5 µl

3 µl

50 µl b.

Thoroughly resuspend the beads by pipetting up and down multiple times.

c.

Incubate the A-Tailing reaction at +30°C for 30 minutes.

d.

After incubation, proceed immediately to the next step.

7.

Perform the A-Tailing Cleanup:

a.

To each 50 µl A-Tailing Reaction add 90 µl of thawed, room temperature PEG/NaCl SPRI Solution, resulting in a total volume of 140 µl.

A-Tailing Cleanup

A-Tailing Reaction

PEG/NaCl SPRI Solution

Total

Per Individual

Sample Library

50 µl

90 µl

140 µl b.

Mix thoroughly by pipetting up and down multiple times.

c.

Incubate the tube at room temperature for 15 minutes to allow the DNA to bind to the beads.

d.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

SeqCap EZ Library SR User’s Guide, v5.1

17

Chapter 3. Prepare the Sample Library

e.

Carefully remove and discard the supernatant.

f.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

g.

Incubate the tube at room temperature for ≥30 seconds.

h.

Carefully remove and discard the ethanol.

i.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

j.

Incubate the tube at room temperature for ≥30 seconds.

k.

Carefully remove and discard the ethanol. Try to remove all residual ethanol without disturbing the beads.

l.

Allow the beads to dry at room temperature, sufficiently for all the ethanol to evaporate.

Caution: Over-drying the beads may result in dramatic yield loss.

m.

Remove the tube from the magnet.

8.

Proceed with the Adapter Ligation Reaction Setup:

a.

To each tube of beads add 47 µl of the Ligation Master Mix, resulting in a total volume of 47 µl.

Ligation Master Mix

PCR-grade water

5X KAPA Ligation Buffer

KAPA T4 DNA Ligase

Total

Per Individual

Sample Library

32 µl

10 µl

5 µl

47 µl b.

Thoroughly resuspend the beads by pipetting up and down multiple times.

c.

Add 3 µl of the SeqCap Library Adapter (with the desired Index) to the tube containing the Ligation Master

Mix plus DNA and beads.

Ensure that you record the index used for each sample.

d.

Pipette up and down 10 times to mix.

e.

Incubate the Ligation reaction at +20°C for 15 minutes.

f.

Following the incubation, proceed immediately to the next step.

9.

Perform the First Post Ligation Cleanup as follows:

a.

To each 50 µl Ligation Reaction add 50 µl of thawed, room temperature PEG/NaCl SPRI Solution, resulting in a total volume of 100 µl.

First Post Ligation Cleanup

Ligation Reaction

PEG/NaCl SPRI Solution

Total

Per Individual

Sample Library

50 µl

50 µl

100 µl b.

Mix thoroughly by pipetting up and down multiple times.

c.

Incubate the tube at room temperature for 15 minutes to allow the DNA to bind to the beads.

SeqCap EZ Library SR User’s Guide, v5.1

18

Chapter 3. Prepare the Sample Library

d.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

e.

Carefully remove and discard the supernatant.

f.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

g.

Incubate the tube at room temperature for ≥30 seconds.

h.

Carefully remove and discard the ethanol.

i.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

j.

Incubate the tube at room temperature for ≥30 seconds.

k.

Carefully remove and discard the ethanol. Try to remove all residual ethanol without disturbing the beads.

l.

Allow the beads to dry at room temperature, sufficiently for all the ethanol to evaporate.

Caution: Over-drying the beads may result in dramatic yield loss.

m.

Remove the tube from the magnet.

n.

Thoroughly resuspend the beads in 100 µl of elution buffer (10mM Tris-HCl, pH 8.0 or PCR-grade water).

In this and subsequent steps, use buffer rather than PCR-grade water if the eluted sample will be stored for an extended period of time (>24 hours).

o.

Incubate the tube at room temperature for 2 minutes to allow the DNA to elute off the beads.

p.

Proceed immediately to the next step.

10.

Perform the Dual-SPRI Size Selection:

a.

To each tube containing 100 µl resuspended DNA with beads add 60 µl of thawed, room temperature

PEG/NaCl SPRI Solution, resulting in a total volume of 160 µl.

Dual-SPRI Size Selection

Resuspended DNA with beads

PEG/NaCl SPRI Solution

Total

Per Individual

Sample Library

100 µl

60 µl

160 µl b.

Mix thoroughly by pipetting up and down multiple times.

c.

Incubate the tube at room temperature for 15 minutes to allow library fragments larger than ~450 bp to bind to the beads.

d.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

e.

Carefully transfer 155µl of the supernatant containing library fragments smaller than ~450 bp to a new tube.

Do NOT discard the supernatant at this step. It is also critical to not transfer any beads with the supernatant.

f.

To the 155 µl supernatant add 20 µl of room temperature Agencourt AMPure XP beads.

g.

Thoroughly resuspend the beads by pipetting up and down multiple times.

SeqCap EZ Library SR User’s Guide, v5.1

19

Chapter 3. Prepare the Sample Library

h.

Incubate the tube at room temperature for 15 minutes to allow library fragments larger than ~250 bp to bind to the beads.

i.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

j.

Carefully remove and discard the supernatant.

k.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

l.

Incubate the tube at room temperature for ≥30 seconds.

m.

Carefully remove and discard the ethanol.

n.

Keeping the tube on the magnet, add 200 µl of freshly-prepared 80% ethanol.

o.

Incubate the tube at room temperature for ≥30 seconds.

p.

Carefully remove and discard the ethanol. Try to remove all residual ethanol without disturbing the beads.

q.

Allow the beads to dry at room temperature, sufficiently for all the ethanol to evaporate.

Caution: Over-drying the beads may result in dramatic yield loss.

r.

Remove the tube from the magnet.

s.

Thoroughly resuspend the beads in 25 µl of elution buffer (10 mM Tris-HCl, pH 8.0 or PCR-grade water).

t.

Incubate the tube at room temperature for 2 minutes to allow the DNA to elute off the beads.

u.

Place the tube on a magnet to capture the beads. Incubate until the liquid is clear.

v.

Transfer the clear supernatant to a new tube and proceed with the amplification of the sample library as

detailed in

Chapter 4

.

SeqCap EZ Library SR User’s Guide, v5.1

20

Chapter 4. Amplify the Sample Library Using LM-PCR

Chapter 4. Amplify the Sample Library Using LM-

PCR

This chapter describes how to amplify the sample library (prepared in

Chapter 3

) using LM-PCR in preparation for

hybridization to the SeqCap EZ probe pool. This chapter requires the use of the components from the following kits:

SeqCap EZ Accessory Kit v2

SeqCap Adapter Kit A and/or B

SeqCap Pure Capture Bead Kit

Ensure that the following is available:

Freshly-prepared 80% ethanol: 0.4 ml per DNA sample

References

Thermocycler Manual

Agilent DNA 1000 Kit Guide

Sample Requirements

For each sample library to be captured, 20 µl of the sample library from

Chapter 3

is amplified via Pre-Capture LM-PCR.

Step 1. Resuspend the SeqCap Pre-LM-PCR Oligos

1.

Briefly spin the lyophilized ‘Pre-LM-PCR Oligos 1 & 2’, contained in the SeqCap Adapter Kit A and/or B, to allow the contents to pellet at the bottom of the tube. Please note that both oligos are contained within a single tube.

2.

Add 550 µl PCR-grade water to the tube of centrifuged oligos.

3.

Briefly vortex the resuspended oligos.

4.

Spin down the tube to collect contents.

5.

The resuspended oligo tube should be stored at -15 to -25°C.

Step 2. Prepare the Pre-Capture LM-PCR Master Mix

The Pre-Capture LM-PCR Master Mix is temperature sensitive. Thawing of components and preparation of LM-PCR reactions must be performed on ice.

We recommend the inclusion of negative (water) and positive (previously amplified library) controls in the Pre-Capture LM-PCR step.

Instructions for preparing an individual PCR reaction are shown here. When assembling a master mix for processing multiple samples, prepare an excess volume of ~5% to allow for complete pipetting (liquid handling systems may require an excess of ~20%).

SeqCap EZ Library SR User’s Guide, v5.1

21

Chapter 4. Amplify the Sample Library Using LM-PCR

1.

To each PCR tube/well add 30 µl of Pre-Capture LM-PCR Master Mix, resulting in a total volume of 30 µl per tube.

Pre-Capture LM-PCR Master Mix

KAPA HiFi HotStart ReadyMix (2x)

Pre LM-PCR Oligos 1 & 2, 5 µM*

Per Individual

Sample Library or Negative Control

25 µl

5 µl

Total 30 µl

* Note: The pre-capture LM-PCR Oligos are contained within the SeqCap

Adapter Kit A and/or B, and the KAPA HiFi HotStart ReadyMix is contained within the SeqCap EZ Accessory Kit v2.

2.

Add the 20 µl of sample library (or PCR-grade water for negative control) to the PCR tube or each well of the

96-well plate containing the LM-PCR Master Mix.

3.

Mix well by pipetting up and down five times. Do not vortex.

Step 3. Perform the Pre-Capture PCR Amplification

1.

Place the PCR tube (or 96-well PCR plate) in the thermocycler.

It is recommended to set the heated lid of the thermocycler to track +10°C above the incubation temperature during amplification steps.

2.

Amplify the sample library using the following Pre-Capture LM-PCR program:

Step 1: 45 seconds at +98°C

Step 2: 15 seconds at +98°C

Step 3: 30 seconds at +60°C

Step 4: 30 seconds at +72°C

Step 5: Go to Step 2, repeat eight times (for a total of nine cycles)

Step 6: 1 minute at +72°C

Step 7: Hold @ +4°C

3.

Store the reaction at +2 to +8°C until ready for cleanup, up to 72 hours.

Step 4. Purify the Amplified Sample Library using Agencourt AMPure XP

Beads

Alternatively, samples can be purified using the Qiagen QIAquick PCR Purification Kit.

If this purification method is chosen instead of the Agencourt AMPure XP Beads, follow

the protocol detailed in

Appendix D

.

1.

Allow the Agencourt AMPure XP Beads, contained in the SeqCap Pure Capture Bead Kit, to warm to room temperature for at least 30 minutes before use.

2.

Each amplified sample library (approximately 50 µl) can remain in the 0.2 ml PCR tube if using the DynaMag-

96 Side Magnet or transfer the amplified sample library to a 1.5 ml tube (for use with a DynaMag-2 Magnet).

Process the negative control in exactly the same way as the amplified sample library.

SeqCap EZ Library SR User’s Guide, v5.1

22

Chapter 4. Amplify the Sample Library Using LM-PCR

3.

Vortex the Agencourt AMPure XP Beads for 10 seconds before use to ensure a homogenous mixture of beads.

4.

Add 90 µl Agencourt AMPure XP Beads to the 50 µl amplified sample library.

5.

Vortex briefly.

6.

Incubate at room temperature for 15 minutes to allow the DNA to bind to the beads.

7.

Place the tube containing the bead bound DNA in a magnetic particle collector.

8.

Allow the solution to clear.

9.

Once clear, remove and discard the supernatant being careful not to disturb the beads.

10.

Add 200 µl freshly-prepared 80% ethanol to the tube containing the beads plus DNA. The tube should be left in the magnetic particle collector during this step.

11.

Incubate at room temperature for 30 seconds.

12.

Remove and discard the 80% ethanol and repeat Steps 4.9-4.11 for a total of two washes with 80% ethanol.

13.

Following the second wash, remove and discard all of the 80% ethanol.

14.

Allow the beads to dry at room temperature with the tube lid open for 15 minutes (or until dry).

Over drying of the beads can result in yield loss.

15.

Remove the tube from the magnetic particle collector.

16.

Resuspend the DNA using 52 µl of PCR-grade water.

It is critical that the amplified sample library is eluted with PCR-grade water and not buffer EB or 1X TE.

17.

Pipet up and down ten times to mix to ensure that all of the beads are resuspended.

18.

Incubate at room temperature for 2 minutes.

19.

Place the tube back in the magnetic particle collector and allow the solution to clear.

20.

Remove 50 µl of the supernatant that now contains the amplified sample library and transfer into a new 1.5 ml tube.

Step 5. Check the Quality of the Amplified Sample Library

1.

Measure the A260/A280 ratio of the amplified sample library to quantify the DNA concentration using a

NanoDrop spectrophotometer and determine the DNA quality.

When working with samples that will be pooled for hybridization (i.e. multiplex

Sequence Capture), accurate quantitation is essential. Alternative quantitation methods, such as those that are fluorometry-based, should be used in place of, or in addition to, the NanoDrop spectrophotometer. Slight differences in the mass of each sample combined to form the ‘Multiplex DNA Sample Library Pool’ will result in variations in the total number of sequencing reads obtained for each sample in the library pool.

SeqCap EZ Library SR User’s Guide, v5.1

23

Chapter 4. Amplify the Sample Library Using LM-PCR

The A

260

/A

280

ratio should be 1.7 - 2.0.

The sample library yield should be >1.0 µg.

The negative control yield should be negligible. If this is not the case, the measurement may be high due to the presence of unincorporated primers carried over from the LM-PCR reaction and not an indication of possible contamination between amplified sample libraries.

2.

Run 1 µl of each amplified sample library (and any negative controls) on an Agilent Bioanalyzer DNA 1000 chip. Run the chip according to manufacturer’s instructions.

The Bioanalyzer should indicate that average fragment size falls between 150 - 500 bp (

Figure 2

). The

negative control should not show any significant signal within this size range, which could indicate contamination between amplified sample libraries. A sharp peak may be visible below 150 bp. This peak, which consists of unincorporated primers carried over from previous steps or the LM-PCR reaction, will not interfere with the capture process.

The negative control should not show any signal above baseline within the 150 - 400 bp size range, which could indicate contamination between amplified sample libraries, but it may exhibit sharp peaks visible below 150 bp. If the negative control reaction shows a positive signal by the NanoDrop spectrophotometer, but the Bioanalyzer trace indicates only the presence of a sharp peak below 150 bp in size, then the negative control should not be considered contaminated.

3.

If the amplified sample library meets these requirements, proceed to

Chapter 5

. If the amplified sample library

does not meet these requirements, reconstruct the library.

Figure 2: Example of an amplified sample library analyzed using an Agilent Bioanalyzer DNA 1000 chip.

SeqCap EZ Library SR User’s Guide, v5.1

24

Chapter 5. Hybridize the Sample and SeqCap EZ Probe Pool

Chapter 5. Hybridize the Sample and SeqCap EZ

Probe Pool

Chapter 5 describes the Roche NimbleGen protocol for hybridization of the amplified sample libraries and the

SeqCap EZ probe pool. This chapter requires the use of components from the following kits:

SeqCap EZ probe pool (refers to either SeqCap EZ Library or SeqCap EZ Enrichment Kit)

SeqCap Hybridization and Wash Kit

SeqCap EZ Accessory Kit v2

SeqCap HE Oligo Kit

The hybridization protocol requires a thermocycler capable of maintaining +47°C for

16 - 20 hours. A programmable heated lid is required.

Note: Instructions for using SeqCap HE-Oligo Kits A & B with automated liquid

handling instruments for setting up hybridizations is described in

Appendix A

.

Note: In this chapter we use the term ‘Multiplex DNA Sample Library Pool’, however a single DNA sample library may be captured using the same instructions. It is not required to capture more than one library at a time.

Step 1. Prepare for Hybridization

1.

Turn on a heat block to +95°C and let it equilibrate to the set temperature.

2.

Remove the appropriate number of 4.5 µl SeqCap EZ probe pool aliquots (one per hybridization) from the

-15 to -25°C freezer and allow them to thaw on ice.

Step 2. Resuspend the SeqCap HE Universal and SeqCap HE Index

Oligos

1.

Briefly spin the lyophilized oligo tubes, contained in the SeqCap HE-Oligo Kits A and/or B, to allow the contents to pellet to the bottom of the tube.

2.

Add 120 µl PCR-grade water to the SeqCap HE Universal Oligo tube (1,000 µM final concentration).

3.

Add 10 µl PCR-grade water to each SeqCap HE Index Oligo tube (1,000 µM final concentration).

4.

Vortex the primers plus PCR-grade water for five seconds and spin down the resuspended oligo tube.

5.

The resuspended oligo tube should be stored at -15 to -25°C.

To prevent damage to the Hybridization Enhancing (HE) oligos due to multiple freeze/thaw cycles, once resuspended the oligos can be aliquoted into smaller volumes to minimize the number of freeze/thaw cycles.

SeqCap EZ Library SR User’s Guide, v5.1

25

Chapter 5. Hybridize the Sample and SeqCap EZ Probe Pool

Step 3. Prepare the Multiplex DNA Sample Library Pool

1.

Thaw on ice each of the uniquely indexed amplified DNA sample libraries that will be included in the multiplex

capture experiment (generated in

Chapter 4

).

2.

Mix together equal amounts (by mass) of each of these amplified DNA sample libraries to obtain a single pool with a combined mass of at least 1.25 µg. This mixture will subsequently be referred to as the ‘Multiplex DNA

Sample Library Pool’. One µg of the multiplex DNA sample library pool will be used in the sequence capture

hybridization step, and 60 ng will be used for measurement of enrichment using qPCR (

Chapter 8

).

To obtain equal numbers of sequencing reads from each component libraries in the

Multiplex DNA Sample Library Pool upon completion of the experiment, it is very important to combine identical amounts of each independently amplified DNA sample library at this step. Accurate quantification and pipetting are critical.

Note: Store remaining 250 ng of Multiplex DNA Sample Library Pool at -15 to -25°C

until use in measurement of enrichment using qPCR (

Chapter 8

).

Step 4. Prepare the Multiplex Hybridization Enhancing Oligo Pool

1.

Thaw on ice the resuspended SeqCap HE Universal Oligo (1,000 µM) and each resuspended SeqCap HE Index oligo (1,000 µM) that matches a DNA Adapter Index included in the Multiplex DNA Sample Library Pool from

Step 2 of this section.

2.

Mix together the HE oligos so that the resulting Multiplex Hybridization Enhancing Oligo Pool contains, by mass, 50% SeqCap HE Universal Oligo and 50% of a mixture of the appropriate SeqCap HE Index oligos. The total combined mass of the Multiplex Hybridization Enhancing Oligo Pool should be 2,000 pmol, which is the amount required for a single Sequence Capture experiment.

Example: If a Multiplex DNA Sample Library Pool contains four DNA sample libraries prepared with SeqCap

Adapter Indexes 2, 4, 6, and 8, respectively, then the Multiplex Hybridization Enhancing Oligo Pool would contain the following:

Component

SeqCap HE Universal Oligo

SeqCap HE Index 2 Oligo

SeqCap HE Index 4 Oligo

SeqCap HE Index 6 Oligo

SeqCap HE Index 8 Oligo

Total

Amount

1,000 pmol (1 µl of 1,000 µM)

250 pmol (0.25 µl of 1,000 µM)

250 pmol (0.25 µl of 1,000 µM)

250 pmol (0.25 µl of 1,000 µM)

250 pmol (0.25 µl of 1,000 µM)

2,000 pmol (2 µl of 1,000 µM)

Due to the difficulty of accurately pipetting small volumes, it is recommended to either prepare a larger volume of the Multiplex Hybridization Enhancing Oligo

Pool using the 1,000 µM stocks or dilute the 1,000 µM stocks and then pool.

These pools can be dispensed into individual single-use aliquots that can be stored at -15 to -25°C until needed.

SeqCap EZ Library SR User’s Guide, v5.1

26

Chapter 5. Hybridize the Sample and SeqCap EZ Probe Pool

For optimal results, it is important that the individual SeqCap HE oligos contained in a Multiplex Hybridization Enhancing Oligo Pool are precisely matched with the adapter indexes present in the Multiplex DNA Sample Library Pool in a multiplexed Sequence Capture experiment.

Step 5. Prepare the Hybridization Sample

Note: When working with non-human gDNA, consider using the SeqCap EZ Developer

Reagent (catalog number 06684335001) in place of COT Human DNA. When using the

SeqCap EZ Developer Reagent, add 10 µl of this reagent to each hybridization instead of

COT Human DNA.

1.

Add 5 µl of COT Human DNA (1 mg/ml), contained in the SeqCap EZ Accessory Kit v2, to a new 1.5 ml tube.

2.

Add 1 µg of Multiplex DNA Sample Library to the 1.5 ml tube containing 5 µl of COT Human DNA.

3.

Add 2,000 pmol (or 2 µl) of the Multiplex Hybridization Enhancing Oligo Pool (1 µl of 1,000 pmol SeqCap HE

Universal Oligo and 1 µl of the 1,000 pmol SeqCap HE Index Oligo pool) to the Multiplex DNA Sample Library

Pool plus COT Human DNA.

The tube should now contain the following components:

Component

COT Human DNA

Multiplex DNA Sample Library Pool

SeqCap HE Universal Oligo

SeqCap HE Index Oligo pool

Amount

5 µg

1 µg

1,000 pmol

1,000 pmol

Volume

5 µl

~ 50 µl

1 µl

1 µl

Total varies

4.

Close the tube’s lid and make a hole in the top of the tube’s cap with an 18 - 20 gauge or smaller needle.

The closed lid with a hole in the top of the tube’s cap is a precaution to suppress contamination in the DNA vacuum concentrator.

5.

Dry the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool in a DNA vacuum concentrator on high heat (+60°C).

Denaturation of the DNA with high heat is not problematic because the hybridization utilizes single-stranded DNA.

6.

To each dried-down Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization

Enhancing Oligo Pool, add:

7.5 µl of 2X Hybridization Buffer (vial 5)

3 µl of Hybridization Component A (vial 6)

SeqCap EZ Library SR User’s Guide, v5.1

27

Chapter 5. Hybridize the Sample and SeqCap EZ Probe Pool

The tube should now contain the following components:

Component

COT Human DNA

Multiplex DNA Sample Library Pool

Multiplex Hybridization Enhancing Oligo Pool

2X Hybridization Buffer (vial 5)

Solution Capture

5 µg

1 µg

2,000 pmol*

7.5 µl

Hybridization Component A (vial 6) 3 µl

Total 10.5 µl

*Composed of 50% (1,000 pmol) SeqCap HE Universal Oligo and 50% (1,000 pmol) of a mixture of the appropriate SeqCap HE Index oligos.

7.

Cover the hole in the tube’s cap with a sticker or small piece of laboratory tape.

8.

Vortex the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool plus Hybridization Cocktail (2X Hybridization Buffer + Hybridization Component A) for 10 seconds.

9.

Centrifuge at maximum speed for 10 seconds.

10.

Place the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool/Hybridization Cocktail in a +95°C heat block for 10 minutes to denature the DNA.

11.

Centrifuge the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing

Oligo Pool/Hybridization Cocktail at maximum speed for 10 seconds at room temperature.

12.

Transfer the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing

Oligo Pool/Hybridization Cocktail to the 4.5 µl aliquot of SeqCap EZ probe pool in a 0.2 ml PCR tube prepared

in

Chapter 2

(the entire volume can also be transferred to one well of a 96-well PCR plate).

13.

Vortex for 3 seconds.

14.

Centrifuge at maximum speed for 10 seconds.

The hybridization sample should now contain the following components:

Component

COT Human DNA

Multiplex DNA Sample Library Pool

Multiplex Hybridization Enhancing Oligo Pool

2X Hybridization Buffer (vial 5)

Hybridization Component A (vial 6)

SeqCap EZ probe pool

Solution Capture

5 µg

1 µg

2,000 pmol*

7.5 µl

3 µl

4.5 µl

Total 15 µl

*Composed of 50% (1,000 pmol) SeqCap HE Universal Oligo and 50% (1,000 pmol) of a mixture of the appropriate SeqCap HE Index oligos.

15.

Incubate in a thermocycler at +47°C for 16 - 20 hours. The thermocycler’s heated lid should be turned on and set to maintain +57°C (10°C above the hybridization temperature).

SeqCap EZ Library SR User’s Guide, v5.1

28

Chapter 6. Wash and Recover Captured Multiplex DNA Sample

Chapter 6. Wash and Recover Captured Multiplex

DNA Sample

Chapter 6 describes the process for the washing and recovery of the captured multiplex DNA sample from the

hybridization of the Multiplex DNA Sample Library Pool and SeqCap EZ probe pool. (Refer to

Appendix C

for

instructions for increased throughput applications.) This chapter requires the use of components from the following kits:

SeqCap Hybridization and Wash Kit

SeqCap Pure Capture Bead Kit

Ensure that the following is available:

Additional PCR-grade water for buffer preparation and elution

It is extremely important that the water bath temperature be closely monitored and remains at +47°C. Because the displayed temperatures on many water baths are often imprecise, Roche NimbleGen recommends that you place an external, calibrated thermometer in the water bath.

Equilibrate buffers at +47°C for at least 2 hours before washing the captured Multiplex

DNA sample.

Step 1. Prepare Sequence Capture and Bead Wash Buffers

Volumes for an individual capture are shown here. When preparing 1X buffers for processing multiple reactions, prepare an excess volume of ~5% to allow for complete pipetting (liquid handling systems may require an excess of ~20%).

1.

Dilute 10X Wash Buffers (I, II, III and Stringent) and 2.5X Bead Wash Buffer, contained in the SeqCap

Hybridization and Wash Kit, to create 1X working solutions. Volumes listed below are sufficient for one capture.

Concentrated Buffer

10X Stringent Wash Buffer (vial 4)

10X Wash Buffer I (vial 1)

10X Wash Buffer II (vial 2)

10X Wash Buffer III (vial 3)

Volume of

Concentrated Buffer

40 µl

30 µl

20 µl

20 µl

Volume of

PCR-grade Water

360 μl

270 μl

180 μl

180 μl

Total Volume of 1X Buffer*

400 μl

300 μl

200 μl

200 μl

2.5X Bead Wash Buffer (vial 7) 200 µl 300 μl

500 μl

*Store working solutions at room temperature (+15 to +25°C) for up to 2 weeks. The volumes in this table are calculated for a single experiment; scale up accordingly if multiple samples will be processed.

2.

Preheat the following wash buffers to +47°C in a water bath:

400 μl of 1X Stringent Wash Buffer

100 μl of 1X Wash Buffer I.

SeqCap EZ Library SR User’s Guide, v5.1

29

Chapter 6. Wash and Recover Captured Multiplex DNA Sample

Step 2. Prepare the Capture Beads

1.

Allow the Capture Beads, contained in the SeqCap Pure Capture Bead Kit, to warm to room temperature for 30 minutes prior to use.

2.

Mix the beads thoroughly by vortexing for 15 seconds.

3.

Aliquot 100 µl of beads for each capture into a single 1.5 ml tube (i.e. for one capture use 100 µl beads and for four captures use 400 µl beads, etc.). Enough beads for six captures can be prepared in a single tube.

4.

Place the tube in a DynaMag-2 device. When the liquid becomes clear (should take less than 5 minutes), remove and discard the liquid being careful to leave all of the beads in the tube. Any remaining traces of liquid will be removed with subsequent wash steps.

5.

While the tube is in the DynaMag-2 device, add twice the initial volume of beads of 1X Bead Wash Buffer

(i.e. for one capture use 200 µl of buffer and for four captures use 800 µl buffer, etc.).

6.

Remove the tube from the DynaMag-2 device and vortex for 10 seconds.

7.

Place the tube back in the DynaMag-2 device to bind the beads.

8.

Once clear, remove and discard the liquid.

9.

Repeat Steps 2.5 - 2.8 for a total of two washes.

10.

After removing the buffer following the second wash, resuspend by vortexing the beads in 1x the original volume using the 1X Bead Wash Buffer (i.e. for one capture use 100 µl buffer and for four captures use 400 µl buffer, etc.).

11.

Aliquot 100 µl of resuspended beads into new 0.2 ml tubes (i.e. one tube for each capture).

12.

Place the tube in the DynaMag-2 device to bind the beads. Once clear, remove and discard the liquid.

13.

The Capture Beads are now ready to bind the captured DNA. Proceed immediately to the next step.

Do not allow the Capture Beads to dry out. Small amounts of residual Bead Wash

Buffer will not interfere with binding of DNA to the Capture Beads.

Step 3. Bind DNA to the Capture Beads

1.

Transfer the hybridization samples to the Capture Beads prepared in the previous step.

2.

Mix thoroughly by pipetting up and down ten times.

3.

Bind the captured sample to the beads by placing the tubes containing the beads and DNA in a thermocycler set to +47°C for 45 minutes (heated lid set to +57°C). Mix the samples by vortexing for 3 seconds at 15 minute intervals to ensure that the beads remain in suspension. It is helpful to have a vortex mixer located close to the thermocycler for this step.

Step 4. Wash the Capture Beads Plus Bound DNA

1.

After the 45-minute incubation, add 100 µl of 1X Wash Buffer I heated to +47°C to the 15 µl of Capture Beads

Plus Bound DNA.

2.

Mix by vortexing for 10 seconds.

3.

Transfer the entire content of each 0.2 ml tube to a 1.5 ml tube.

SeqCap EZ Library SR User’s Guide, v5.1

30

Chapter 6. Wash and Recover Captured Multiplex DNA Sample

4.

Place the tubes in the DynaMag-2 device to bind the beads.

5.

Remove and discard the liquid once clear.

6.

Remove the tubes from the DynaMag-2 device and add 200 µl of 1X Stringent Wash Buffer heated to +47°C.

7.

Pipette up and down ten times to mix. Work quickly so that the temperature does not drop much below +47°C.

8.

Incubate at +47°C for 5 minutes.

9.

Repeat Steps 4.4 - 4.8 for a total of two washes using 1X Stringent Wash Buffer heated to +47°C.

10.

Place the tubes in the DynaMag-2 device to bind the beads.

11.

Remove and discard the liquid once clear.

12.

Add 200 µl of room temperature 1X Wash Buffer I and mix by vortexing for 2 minutes. If liquid has collected in the tube’s cap, tap the tube gently to collect the liquid into the tube’s bottom before continuing to the next step.

13.

Place the tubes in the DynaMag-2 device to bind the beads.

14.

Remove and discard the liquid once clear.

15.

Add 200 µl of room temperature 1X Wash Buffer II.

16.

Mix by vortexing for 1 minute.

17.

Place the tubes in the DynaMag-2 device to bind the beads.

18.

Remove and discard the liquid once clear.

19.

Add 200 µl of room temperature 1X Wash Buffer III.

20.

Mix by vortexing for 30 seconds.

21.

Place the tubes in the DynaMag-2 device to bind the beads.

22.

Remove and discard the liquid once clear.

23.

Remove the tubes from the DynaMag-2 device.

24.

Add 50 µl PCR-grade water to each tube of bead-bound captured sample.

25.

Store the beads plus captured samples at -15 to -25°C or proceed to

Chapter 7

.

There is no need to elute DNA off the beads. The beads plus captured DNA will be

used as template in the LM-PCR as described in

Chapter 7

.

SeqCap EZ Library SR User’s Guide, v5.1

31

Chapter 7. Amplify Captured Multiplex DNA Sample Using LM-PCR

Chapter 7. Amplify Captured Multiplex DNA Sample

Using LM-PCR

Chapter 7 describes the amplification of captured Multiplex DNA sample, bound to the Capture Beads, using LM-

PCR. A total of two reactions are performed per sample, and subsequently combined, to minimize PCR bias. This chapter requires the use of components from the following kits:

SeqCap EZ Accessory Kit v2

SeqCap Pure Capture Bead Kit

In addition, ensure that the following are available:

Additional PCR-grade water for 80% ethanol preparation and elution

Freshly-prepared 80% ethanol: 0.4 ml per DNA sample

References

Thermocycler Manual

Agilent DNA 1000 Kit Guide

Step 1. Resuspend the Post-LM-PCR Oligos

1.

Briefly spin the lyophilized ‘Post-LM-PCR Oligos 1 & 2’ oligos, contained in the SeqCap EZ Accessory Kit v2, to allow the contents to pellet at the bottom of the tube. Please note that both oligos are contained within a single tube.

2.

Add 480 µl PCR-grade water to the tube of centrifuged oligos.

3.

Briefly vortex the resuspended oligos.

4.

Spin down the tube to collect the contents.

5.

The resuspended oligo tube should be stored at -15 to -25°C.

Step 2. Prepare the Post-Capture LM-PCR Master Mix

The Post-Capture LM-PCR Master Mix and the individual PCR tubes must be prepared on ice.

Instructions for preparing individual PCR reactions are shown here. When assembling a master mix for processing multiple samples, prepare an excess volume of ~5% to allow for complete pipetting (liquid handling systems may require an excess of ~20%). Note that each captured DNA sample requires two PCR reactions.

SeqCap EZ Library SR User’s Guide, v5.1

32

Chapter 7. Amplify Captured Multiplex DNA Sample Using LM-PCR

1.

To each PCR tube/well (one pair per captured DNA sample) add 30 µl of Post-Capture LM-PCR Master Mix, resulting in a total volume of 30 µl per tube, or 60 µl per DNA sample.

Post-Capture LM-PCR Master Mix

KAPA HiFi HotStart ReadyMix

Per Individual PCR Reaction

(Two Reactions

Per DNA Sample)

25 µl

Post-LM-PCR Oligos 1 & 2, 5 µM* 5 µl

Total 30 µl

* Note: The post-capture LM-PCR Oligos and the KAPA HiFi HotStart ReadyMix are contained within the SeqCap EZ Accessory Kit v2.

Two LM-PCR reactions will be performed for each captured multiplex DNA sample. The total volume of the PCR Master Mix is 60 µl that will be distributed in two tubes (30 µl each).

2.

Vortex the bead-bound captured DNA to ensure a homogenous mixture of beads.

3.

Aliquot 20 µl of bead-bound captured DNA as template into each of the two PCR tubes/wells.

4.

Mix well by pipetting up and down.

5.

Add 20 µl of PCR-grade water to the negative control.

6.

Mix well by pipetting up and down five times.

7.

Store the remaining bead bound captured DNA at -15 to -25°C.

Step 3. Perform the Post-Capture PCR Amplification

1.

Place the PCR tube (or 96-well PCR plate) in the thermocycler.

It is recommended to set the heated lid of the thermocycler to track +10°C above the incubation temperature during amplification steps.

2.

Amplify the captured DNA using the following Post-Capture LM-PCR program:

Step 1: 45 seconds @ +98°C

Step 2: 15 seconds @ +98°C

Step 3: 30 seconds @ +60°C

Step 4: 30 seconds @ +72°C

Step 5: Go to Step 2, repeat 13 times (for a total of 14 cycles)

Step 6: 1 minutes @ +72°C

Step 7: Hold @ +4°C

3.

Store reactions at +2 to +8°C until ready for purification, up to 72 hours.

SeqCap EZ Library SR User’s Guide, v5.1

33

Chapter 7. Amplify Captured Multiplex DNA Sample Using LM-PCR

Step 4. Purify the Amplified Captured Multiplex DNA Sample using

Agencourt AMPure XP Beads

Alternatively, samples can be purified using the Qiagen QIAquick PCR Purification Kit.

If this purification method is chosen instead of the Agencourt AMPure XP Beads, follow

the protocol detailed in Appendix D.

1.

Allow the Agencourt AMPure XP Beads, contained in the SeqCap Pure Capture Bead Kit,to warm to room temperature for at least 30 minutes before use.

2.

Pool the like amplified captured Multiplex DNA Sample Libraries into a 1.5 ml microcentrifuge tube

(approximately 100 µl). Process the negative control in exactly the same way as the amplified sample library.

3.

Vortex the beads for 10 seconds before use to ensure a homogenous mixture of beads.

4.

Add 180 µl Agencourt AMPure XP Beads to the 100 µl pooled amplified captured Multiplex DNA Sample library.

5.

Vortex briefly.

6.

Incubate at room temperature for 15 minutes to allow the DNA to bind to the beads.

7.

Place the tube containing the bead bound DNA in a magnetic particle collector.

8.

Allow the solution to clear.

9.

Once clear, remove and discard the supernatant being careful not to disturb the beads.

10.

Add 200 µl freshly-prepared 80% ethanol to the tube containing the beads plus DNA. The tube should be left in the magnetic particle collector during this step.

11.

Incubate at room temperature for 30 seconds.

12.

Remove and discard the 80% ethanol, and repeat Steps 4.9-4.11 for a total of two washes with 80% ethanol.

13.

Following the second wash, remove and discard all of the 80% ethanol.

14.

Allow the beads to dry at room temperature with the tube lid open for 30 minutes (or until dry).

Over drying of the beads can result in yield loss.

15.

Remove the tube from the magnetic particle collector.

16.

Resuspend the DNA using 52 µl of PCR-grade water.

17.

Pipet up and down ten times to mix to ensure that all of the beads are resuspended.

18.

Incubate at room temperature for 2 minutes.

19.

Place the tube back in the magnetic particle collector and allow the solution to clear.

20.

Remove 50 µl of the supernatant that now contains the amplified captured Multiplex DNA Sample Library Pool and transfer into a new 1.5 ml tube.

SeqCap EZ Library SR User’s Guide, v5.1

34

Chapter 7. Amplify Captured Multiplex DNA Sample Using LM-PCR

Step 5. Determine the Concentration, Size Distribution, and Quality of the Amplified Captured Multiplex DNA Sample

1.

Quantify the DNA concentration and measure the A260/A280 ratio of the amplified captured multiplex DNA and negative control using a NanoDrop spectrophotometer.

The A

260

/A

280

ratio should be 1.7 - 2.0.

The LM-PCR yield should be ≥500 ng.

The negative control should not show significant amplification, which could be indicative of contamination.

2.

Run 1 µl of the amplified captured multiplex DNA sample and negative control using an Agilent Bioanalyzer

DNA 1000 chip. Run the chip according to manufacturer’s instructions. Amplified captured multiplex DNA should exhibit the following characteristics:

The average fragment length should be between 150 - 500 bp.

Figure 3: Example of successfully amplified captured multiplex DNA analyzed using an Agilent Bioanalyzer

DNA 1000 chip.

3.

If the amplified captured multiplex DNA meets the requirements, proceed to

Chapter 8

.

If the amplified captured multiplex DNA does not meet the A260/A280 ratio requirement, purify again using the Agencourt AMPure XP Beads (or alternatively, a second Qiagen QIAquick PCR Purification column).

If the results of the qPCR assays in

Chapter 8

indicate the enrichment was successful, the amplified captured

multiplex DNA is ready for sequencing.

SeqCap EZ Library SR User’s Guide, v5.1

35

Chapter 8. Measure Enrichment Using qPCR

Chapter 8. Measure Enrichment Using qPCR

Chapter 8 describes the qPCR assays employed as internal quality controls for NimbleGen SeqCap experiments performed with human total gDNA. These assays estimate the relative fold enrichment by measuring the relative abundance of control targets in the pre- and post-capture LM-PCR reactions. The genomic loci recognized by these assays are included as capture targets in every SeqCap EZ probe pool and provide an inexpensive way to determine whether the capture was successful prior to sequencing.

This chapter requires the use of the following reagents:

LightCycler® 480 SYBR Green I Master (2x Mix)

Additional PCR-grade water

Custom Oligonucleotides:

Component

qPCR NSC-0237, forward, Oligo qPCR NSC-0237, reverse, Oligo qPCR NSC-0247, forward, Oligo qPCR NSC-0247, reverse, Oligo qPCR NSC-0268, forward, Oligo qPCR NSC-0268, reverse, Oligo qPCR NSC-0272, forward, Oligo

Concentration Sequence

2 µM

2 µM

2 µM

2 µM

2 µM

2 µM

2 µM

5' - CGC ATT CCT CAT CCC AGT ATG - 3'

5' - AAA GGA CTT GGT GCA GAG TTC AG - 3'

5' - CCC ACC GCC TTC GAC AT - 3'

5' - CCT GCT TAC TGT GGG CTC TTG - 3'

5' - CTC GCT TAA CCA GAC TCA TCT ACT GT - 3'

5' - ACT TGG CTC AGC TGT ATG AAG GT - 3'

5' - CAG CCC CAG CTC AGG TAC AG - 3' qPCR NSC-0272, reverse, Oligo 2 µM 5' – ATG ATG CGA GTG CTG ATG ATG - 3'

Note: The qPCR oligonucleotides can be resuspended in PCR-grade water or TE buffer.

References

LightCycler® 480 User’s Guide

Step 1. Perform the qPCR Assay

1.

Determine the number of DNA samples to be analyzed:

A ‘DNA sample’ in this chapter is defined as one amplified sample library (

Chapter 4

) and the

corresponding amplified captured multiplex DNA (

Chapter 7

).

If samples are multiplexed pre-capture, you only need one representative precapture amplified sample library for the corresponding amplified captured multiplex DNA sample.

Instructions for preparing an individual PCR reaction are shown here. When assembling a master mix for processing multiple samples, prepare an excess volume of ~5% to allow for complete pipetting (liquid handling systems may require an excess of ~20%).

SeqCap EZ Library SR User’s Guide, v5.1

36

Chapter 8. Measure Enrichment Using qPCR

Assuming the standard set of four NimbleGen SeqCap EZ (NSC) control locus qPCR assays will be used and qPCR assays will be performed in triplicate, each DNA sample will require 24 individual qPCR reactions for analysis.

One negative control (i.e. no-template-control, NTC) should always be included to monitor for contamination in qPCR assay primers, other qPCR reagents, and the entire qPCR process.

One positive control template, ideally consisting of the original genomic DNA starting material, should always be included to verify assay function.

The negative and positive controls will each require twelve additional qPCR reactions (refer to

Figure 4

).

Original DNA sample

Amplified Sample Library

4 qPCR assays in triplicate:

Amplified Captured DNA

4 qPCR assays in triplicate:

NSC

Assay 1

NSC

Assay 2

NSC

Assay 3

NSC

Assay 4

NSC

Assay 1

NSC

Assay 2

NSC

Assay 3

Positive Control (genomic DNA)

NSC

Assay 4

Negative Control (PCR-grade

4 qPCR assays in triplicate: 4 qPCR assays in triplicate:

NSC

Assay 1

NSC

Assay 2

NSC

Assay 3

NSC

Assay 4

NSC

Assay 1

NSC

Assay 2

NSC

Assay 3

NSC

Assay 4

Figure 4: qPCR experimental overview.

2.

Dilute the following samples to a concentration of 5 ng/µl in 100 µl of PCR-grade water:

Genomic DNA (positive control template)

Amplified sample library (one representative per multiplexed capture experiment)

Each amplified captured multiplex DNA sample

3.

Make a master mix for each of the four NSC assays:

qPCR Master Mix

PCR-grade water

NSC Assay forward primer (2 µM)

Per Reaction

5.9 µl

0.3 µl

NSC Assay reverse primer (2 µM)

SYBR Green Master Mix (2x)

0.3 µl

7.5 µl

Total 14 µl

Master Mix example: For an experiment that contains a single captured sample, the following numbers of reactions are required (scale-up captured and non-captured reaction numbers based on the number of samples in your particular experiment):

3 replicate reactions per NSC Assay (12 total reactions) – captured sample

3 replicate reactions per NSC Assay (12 total reactions) – non-captured sample

3 replicate reactions per NSC Assay (12 total reactions) – positive control

3 replicate reactions per NSC Assay (12 total reactions) – negative control

SeqCap EZ Library SR User’s Guide, v5.1

37

Chapter 8. Measure Enrichment Using qPCR

The template is defined as amplified sample library, amplified captured multiplex

DNA, positive control genomic DNA, or negative control PCR-grade water, templates. The final concentration of templates in the reaction should be

0.333 ng/µl, except for the negative control PCR-grade water template.

4.

Aliquot 14 µl of each master mix to the appropriate well into a LightCycler® 480 Multiwell Plate 384 and add 1 µl of the appropriate sample:

qPCR Reaction

NSC qPCR Master Mix

Template (pre- or post-capture library, gDNA control, or H2O)

Total

5.

Seal the plate with a plate seal.

Per Reaction

14 µl

1 µl

15 µl

6.

Centrifuge the 384-well plate in a plate centrifuge at 6,000 x g for 10 seconds to collect the reagents at the bottom of the wells.

7.

Program the qPCR instrument using the conditions specified in

Table 1

.

These conditions are optimized for use with the LightCycler® 480 Instrument II and

LightCycler® 480 SYBR Green I 2X Master Mix. The use of a different thermocycler or reagents could require altering these conditions to achieve optimal results.

Program Name

Pre-incubation

Amplification

Melting Curve

Cycles

1

40

1

Analysis Mode

None

Quantification

Melting Curves

Target

(°C)

95

95

60

95

65

95

40

Hold

(hh:mm:ss)

00:10:00

00:00:10

00:01:00

00:00:10

00:01:00

---

00:00:10

Ramp Rate

(°C/s)

4.8

4.8

2.5

4.8

2.5

---

2

Acquisitions

(per °C)

---

---

---

---

---

5

---

Acquisition

Mode

None

None

Single

None

None

Continuous

None Cooling 1 None

Table 1: qPCR instrument cycling conditions.

8.

Following the completion of the qPCR program, run the Absolute Quantification Analysis Module within the

LightCycler® 480 Software using the 2nd Derivative Maximum Method.

9.

Perform a melting curve (dissociation) analysis to verify that nonspecific amplification products, primer dimers, and other artifacts are not contributing to the Cp values for any samples.

10.

Copy or export the Cp values to a spreadsheet program for further analysis.

SeqCap EZ Library SR User’s Guide, v5.1

38

Chapter 8. Measure Enrichment Using qPCR

Cp (crossing point) values reported by the LightCycler® 480 Instrument II and software are analogous to the C t

(crossing threshold) values reported by other instruments and represent the cycle at which fluorescence signal in a reaction well

rises above background fluorescence signals in that well (

Figure 5

). The Cp value

measured for a sample is dependent on the initial concentration of template DNA in the reaction. Lower Cp values correspond to higher initial template concentrations.

Figure 5: Example of sequence capture qPCR data for two NSC assays generated using the LightCycler® 480 Instrument II.

In a successful experiment, the Cp values from qPCR of amplified captured multiplex DNA templates (CAP) will be significantly lower than Cp values from amplified sample library templates (NON) for all assays.

Step 2. Analyze Data

1.

Calculate the average Cp values for all replicate reactions.

2.

Confirm that the negative control reactions did not produce significant fluorescent signals, which might indicate a problem with PCR contamination. Contamination could result in difficulty interpreting experimental results.

3.

For each different sample and NSC assay combination, subtract the average Cp value measured for the amplified captured multiplex DNA template from the average Cp value measured for the corresponding amplified sample library template. This value is the ∆Cp. A successfully enriched amplified captured multiplex DNA sample should generate a lower Cp value then its corresponding amplified sample library. Thus the ∆Cp calculated from an NSC assay should be positive if the capture process enriched the corresponding locus.

4.

Calculate the fold enrichment for a NSC control locus by raising the PCR Efficiency (E) for that assay to the power of the ∆Cp measured for the corresponding control locus, or

E

∆ Cp

.

When PCR assays operate at 100% theoretical efficiency (i.e. a perfect doubling of target sequences in every cycle), E = 2. The E values for the NSC assays listed in the table (below) were measured by Roche NimbleGen. However, because multiple parameters (PCR instrument, reagent lots, etc.) can affect the efficiency of a PCR assay, it is recommended to determine E values empirically in your own laboratory for each different NSC assay.

SeqCap EZ Library SR User’s Guide, v5.1

39

Chapter 8. Measure Enrichment Using qPCR

NSC qPCR

Assay Name

NSC-0237

NSC-0247

NSC-0268

NSC-0272

Primer Sequences ( 5 ′

→ 3′ )

F: CGCATTCCTCATCCCAGTATG

R: AAAGGACTTGGTGCAGAGTTCAG

F: CCCACCGCCTTCGACAT

R: CCTGCTTACTGTGGGCTCTTG

F: CTCGCTTAACCAGACTCATCTACTGT

R: ACTTGGCTCAGCTGTATGAAGGT

F: CAGCCCCAGCTCAGGTACAG

R: ATGATGCGAGTGCTGATGATG

T m

( °C )

81.15

81.03

78.99

82.23

Product

Length

80 bp

74 bp

75 bp

71 bp

qPCR Efficiency (E)

1.84

1.80

1.78

1.93

Example: NSC-0268 assay

(assuming E = 1.78)

Replicate Cp values for qPCR of amplified sample library = 28.3, 28.5, 28.4

Replicate Cp values for qPCR of amplified captured multiplex DNA = 17.5, 17.3, 17.7

Average Cp amplified sample library

= 28.4

Average Cp amplified captured multiplex DNA

= 17.5

∆Cp = 10.9

Fold enrichment (E

Cp) = (1.78)10.9 = 537

Interpreting qPCR Results – SeqCap EZ Probe Pool Captures

Theoretical maximum average fold enrichment : Varies significantly for each SeqCap EZ experiment based on target size, from 75-fold for a 40 Mb target to 12,000-fold for a 250 kb target. Actual average fold enrichment values are typically lower than this, and different targets of the same cumulative size can enrich to different levels depending on variation in the sequence makeup of the region(s) targeted for capture and other factors. For example, if 50% of a genome were targeted for capture, an ideal result should yield no better than a two-fold average enrichment for the targeted loci.

Correlation of fold enrichment determined by qPCR and sequencing data : Probes targeting the NSC control loci were designed using different criteria than the SeqCap EZ probes, and so their reported qPCR values should not be interpreted as a literal estimate of the expected enrichment of other targeted loci.

Rather, the NSC control assays are primarily intended as a screen for potentially poor enrichment results so that unproductive sequencing may be avoided.

Negative Control : Average Cp values for negative control (PCR-grade water) assays should be negligible, or they may indicate the presence of cross-contamination among wells or reagent contamination. If this is observed, the qPCR experiment should be repeated.

Positive Control : Average Cp values for positive control (genomic DNA) assays should be similar (within approximately 1 Cp) to the average Cp values obtained for the qPCR of amplified sample library.

Recommendation : Based on experiments conducted at Roche NimbleGen, we recommend not sequencing the captured DNA from any SeqCap EZ experiment with calculated average fold enrichment values less than tenfold because of the potential that this indicates a failed enrichment. We recommend such experiments be repeated from the beginning. Thus, the definition of a ‘successful’ NimbleGen Sequence

Capture experiment, as estimated by fold enrichment values for control loci, might differ substantially with different sized capture targets or different downstream applications for the captured DNA.

SeqCap EZ Library SR User’s Guide, v5.1

40

Appendix A. Hybridize Using 96-Well Plates and a Liquid Handler System

Appendix A. Hybridize Using 96-Well Plates and a

Liquid Handler System

This appendix describes a procedure for using the SeqCap HE-Oligo Kits A and B with liquid handling instruments

for setting up Hybridizations. This appendix can be used in place of

Chapter 5

, when working with a liquid handling

instrument. Appendix A requires the use of components from the following kits:

SeqCap EZ Library or SeqCap EZ MedExome Enrichment Kit

SeqCap Hybridization and Wash Kit

SeqCap EZ Accessory Kit v2

SeqCap HE Oligo Kit

Proper automation equipment maintenance and protocol setup are essential to obtaining high-quality and reproducible results.

Ensure that the following is available:

Additional PCR-grade water (~2.4 ml total per SeqCap HE Oligo Kit, which comes with 2 x 1 ml)

Step 1. Prepare for Hybridization

1.

Turn on a heat block to +95°C and let it equilibrate to the set temperature.

2.

Remove the appropriate number of 4.5 µl SeqCap EZ probe pool aliquots (one per hybridization) from the -15 to -

25°C freezer and allow them to thaw on ice.

Step 2. Resuspend the SeqCap HE Universal and SeqCap HE Index

Oligos

1.

Spin the lyophilized oligo tubes, contained in the SeqCap HE-Oligo Kit A and/or B, briefly to allow the contents to pellet to the bottom of the tube.

2.

Add 1,200 µl PCR-grade water to SeqCap HE Universal Oligo tube (100 µM final concentration).

3.

Add 100 µl PCR-grade water to each SeqCap HE Index Oligo tube (100 µM final concentration).

4.

Vortex the primers plus PCR-grade water for 5 seconds and spin down the resuspended oligo tubes.

5.

The resuspended oligo tube should be stored at -20°C.

Step 3. Prepare the Multiplex DNA Sample Library Pool

1.

Thaw on ice each of the uniquely-indexed amplified DNA sample libraries that will be included in the multiplex

capture experiment (generated in

Chapter 4

).

2.

Mix together equal amounts (by mass) of each of these amplified DNA sample libraries to obtain a single pool with a combined mass of at least 1.1 µg. This mixture will subsequently be referred to as the ‘Multiplex DNA

Sample Library Pool’. One µg of the multiplex DNA sample library pool will be used in the sequence capture

hybridization step, and 60 ng will be used for measurement of enrichment using qPCR (

Chapter 8

).

SeqCap EZ Library SR User’s Guide, v5.1

41

Appendix A. Hybridize Using 96-Well Plates and a Liquid Handler System

To obtain equal numbers of sequencing reads from each component libraries in the

Multiplex DNA Sample Library Pool upon completion of the experiment, it is very important to combine identical amounts of each independently amplified DNA sample library at this step. Accurate quantification and pipetting are critical.

Note: Store remaining Multiplex DNA Sample Library Pool at -15 to -25°C until use

in measurement of enrichment using qPCR (

Chapter 8

).

Step 4. Prepare the Multiplex Hybridization Enhancing Oligo Pool

1.

Thaw on ice the resuspended SeqCap HE Universal Oligo (100 µM) and each resuspended SeqCap HE Index oligo (100 µM) that matches a DNA Adapter Index included in the Multiplex DNA Sample Library Pool from

Step 2 of this section.

2.

Mix together the HE oligos so that the resulting Multiplex Hybridization Enhancing Oligo Pool contains, by mass, 50% HE Universal Oligo and 50% of a mixture of the appropriate SeqCap HE Index oligos. The total combined mass of the Multiplex Hybridization Enhancing Oligo Pool should be 2,000 pmol, which is the amount required for a single Sequence Capture experiment.

Example: If a Multiplex DNA Sample Library Pool contains four DNA sample libraries prepared with SeqCap

Adapter Indexes 2, 4, 6, and 8, respectively, then the Multiplex Hybridization Enhancing Oligo Pool would contain the following:

Component

SeqCap HE Universal Oligo

SeqCap HE Index 2 Oligo

SeqCap HE Index 4 Oligo

SeqCap HE Index 6 Oligo

SeqCap HE Index 8 Oligo

Total

Amount

1,000 pmol (10 µl of 100 µM)

250 pmol (2.5 µl of 100 µM)

250 pmol (2.5 µl of 100 µM)

250 pmol (2.5 µl of 100 µM)

250 pmol (2.5 µl of 100 µM)

2,000 pmol (20 µl of 100 µM)

For optimal results, it is important that the individual SeqCap HE oligos contained in a Multiplex Hybridization Enhancing Oligo Pool are precisely matched with the adapter indexes present in the Multiplex DNA Sample Library Pool in a multiplexed Sequence Capture experiment.

Step 5. Prepare the Hybridization Sample

1.

Add 5 µl of COT Human DNA (1 mg/ml), contained in the SeqCap EZ Accessory Kit v2, to a new 1.5 ml tube.

2.

Add 1 µg of Multiplex DNA Sample Library to the 1.5 ml tube containing 5 µl of COT Human DNA.

3.

Add 2,000 pmol of Multiplex Hybridization Enhancing Oligo Pool (1,000 pmol HE Universal Oligo and

1,000 pmol HE Index Oligo pool) to the Multiplex DNA Sample Library Pool plus COT Human DNA.

4.

Close the tube’s lid and make a hole in the top of the tube’s cap with an 18 - 20 gauge or smaller needle.

The closed lid with a hole in the top of the tube’s cap is a precaution to suppress contamination in the DNA vacuum concentrator.

SeqCap EZ Library SR User’s Guide, v5.1

42

Appendix A. Hybridize Using 96-Well Plates and a Liquid Handler System

5.

Dry the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool in a DNA vacuum concentrator on high heat (60°C).

Denaturation of the DNA with high heat is not problematic because the hybridization utilizes single-stranded DNA.

6.

To each dried-down Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization

Enhancing Oligo Pool, add:

7.5 µl of 2X Hybridization Buffer (vial 5)

3 µl of Hybridization Component A (vial 6)

The tube with the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing

Oligo Pool should now contain the following components:

Component

COT Human DNA

Multiplex DNA Sample Library Pool

Multiplex Hybridization Enhancing Oligo Pool

2X Hybridization Buffer (vial 5)

Solution Capture

5 µg

1 µg

2,000 pmol*

7.5 µl

Hybridization Component A (vial 6) 3 µl

Total 10.5 µl

*Composed of 50% (1,000 pmol) SeqCap HE Universal Oligo and 50% (1,000 pmol) of a mixture of the appropriate SeqCap HE Index oligos.

7.

Cover the hole in the tube’s cap with a sticker or small piece of laboratory tape.

8.

Vortex the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool plus Hybridization Cocktail (2X Hybridization Buffer + Hybridization Component A) for 10 seconds and centrifuge at maximum speed for 10 seconds.

9.

Place the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing Oligo

Pool/Hybridization Cocktail in a +95°C heat block for 10 minutes to denature the DNA.

10.

Centrifuge the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing

Oligo Pool/Hybridization Cocktail at maximum speed for 10 seconds at room temperature.

11.

Transfer the Multiplex DNA Sample Library Pool/COT Human DNA/Multiplex Hybridization Enhancing

Oligo Pool/Hybridization Cocktail to the 4.5 µl aliquot of EZ Library in a 0.2 ml PCR tube prepared in

Chapter 2

(entire volume can also be transferred to a 96-well PCR plate).

12.

Vortex for 3 seconds and centrifuge at maximum speed for 10 seconds.

SeqCap EZ Library SR User’s Guide, v5.1

43

Appendix A. Hybridize Using 96-Well Plates and a Liquid Handler System

The hybridization sample should now contain the following components:

Component

COT Human DNA

Multiplex DNA Sample Library Pool

Multiplex Hybridization Enhancing Oligo Pool

2X Hybridization Buffer (vial 5)

Hybridization Component A (vial 6)

EZ Library

Solution Capture

5 µg

1 µg

2,000 pmol*

7.5 µl

3 µl

4.5 µl

Total 15 µl

*Composed of 50% (1,000 pmol) SeqCap HE Universal Oligo and 50% (1,000 pmol) of a mixture of the appropriate SeqCap HE Index oligos.

Incubate in a thermocycler at +47°C for 16 - 20 hours. The thermocycler’s heated lid should be turned on and set to maintain +57°C (10°C above the hybridization temperature).

SeqCap EZ Library SR User’s Guide, v5.1

44

Appendix B. Wash and Recover Using 96-Well Plates and a Liquid Handler System

Appendix B. Wash and Recover Using 96-Well

Plates and a Liquid Handler System

This appendix describes a procedure for an increased throughput method for SeqCap EZ probe pool washing and

recovery of captured DNA. This appendix can be substituted for

Chapter 6

of the protocol to process captured DNA

in a 96-well plate format and to adapt the protocol onto a liquid handling instrument. Appendix B requires the use of components from the following kits:

SeqCap Hybridization and Wash Kit

SeqCap Pure Capture Bead Kit

Proper automation equipment maintenance and protocol setup are essential to obtaining high-quality and reproducible results.

Ensure that the following is available:

Additional PCR-grade water: ~215 ml per 96-well plate

Additional Equipment, Labware & Consumables

Equipment Supplier Item Number

MagnaBot II Magnetic Separation Device Promega

Multichannel Pipettors

(20 µl and 200 µl)

Multiple vendors

96-well PCR Plate (1/2 skirt)

V8351

Multiple Vendors

Note: Full skirt 96-well PCR plates will not work with the MagnaBot II Magnetic

Separation Device.

15 ml and 50 ml Conical Tubes

Multiple vendors

Equilibrate 1X Stringent Wash Buffer and 1X Wash Buffer I at +47°C for at least 2 hours before washing the captured Multiplex DNA sample.

SeqCap EZ Library SR User’s Guide, v5.1

45

Appendix B. Wash and Recover Using 96-Well Plates and a Liquid Handler System

Step 1. Prepare Buffers

1.

Prepare a 1X working solution for each of the Sequence Capture Wash Buffers (enough of each buffer for a full

96-well plate) each in a separate 50 ml conical tube.

Component

10X Stringent Wash Buffer

PCR-grade water

Volume

4 ml

36 ml

Total 40 ml

Preheat 1X Stringent Wash Buffer to +47°C in a water bath.

Component

10X Wash Buffer I

PCR-grade water

Volume

3 ml

27 ml

Total 30 ml

Remove 10 ml of 1X Wash Buffer I to a separate 15 ml conical tube and preheat to +47°C in a water bath. Store remaining 1X Wash Buffer at room temperature

Component

10X Wash Buffer II

Volume

2 ml

PCR-grade water 18 ml

Total 20 ml

Store 1X Wash Buffer II at room temperature after preparation.

Component

10X Wash Buffer III

Volume

2 ml

PCR-grade water 18 ml

Total 20 ml

Store 1X Wash Buffer III at room temperature after preparation.

Component

2.5X Bead Wash Buffer

PCR-grade water

Volume

20 ml

30 ml

Total 50 ml

Store 1X Bead Wash Buffer at room temperature after preparation.

Step 2. Prepare the Capture Beads

1.

Warm the Capture Beads to room temperature for 30 minutes prior to use.

2.

Vortex the Capture Beads for 15 seconds to resuspend.

3.

For each capture reaction, aliquot 100 µl of beads into a well of a 96-well PCR plate.

4.

Place the PCR plate onto the MagnaBot II magnetic separation device.

5.

Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove supernatant and discard to waste.

6.

Remove the PCR plate from the MagnaBot II device.

SeqCap EZ Library SR User’s Guide, v5.1

46

Appendix B. Wash and Recover Using 96-Well Plates and a Liquid Handler System

7.

Add 200 µl of 1X Bead Wash Buffer to each well of the 96-well PCR plate and mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

8.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

9.

Remove the PCR plate from the MagnaBot II device.

10.

Repeat Steps 2.7 - 2.9 for a total of two washes.

11.

Add 100 µl of 1X Bead Wash Buffer to each well of the 96-well PCR plate and mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

12.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

Step 3. Bind DNA to the Capture Beads

1.

Transfer each hybridization sample (approximately 15 µl) to a well of the 96-well PCR plate containing the prepared Capture Beads.

2.

Mix thoroughly by pipetting up and down ten times.

3.

Bind the captured sample to the beads by placing the 96-well plate containing the beads and DNA in a thermocycler set to +47°C for 45 minutes. Mix the samples by vortexing at 15-minute intervals to ensure that the beads remain in suspension.

Step 4. Wash the Capture Beads Plus Bound DNA

1.

After the 45-minute incubation at +47°C, place the 96-well PCR plate onto the MagnaBot II device. Wait for

1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant to waste.

2.

Add 100 µl of preheated (+47°C) 1X Wash Buffer I to each well of the 96-well PCR plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

Alternatively, it is acceptable to add 100 µl of preheated (+47°C) 1X Wash Buffer I to each well of the 96-well PCR plate prior to Step 4.1 if there is sufficient room in the individual PCR wells to accommodate the additional volume of the buffer.

3.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

4.

Add 200 µl of 1X Stringent Wash Buffer heated to +47°C to each well of the 96-well plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

5.

Place the PCR plate into a thermocycler and incubate for five minutes at +47°C.

6.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

7.

Repeat Steps 4.4 - 4.6 for a total of two washes with the 1X Stringent Wash Buffer heated to +47°C.

8.

Add 200 µl of room temperature 1X Wash Buffer I to each well of the 96-well PCR plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

SeqCap EZ Library SR User’s Guide, v5.1

47

Appendix B. Wash and Recover Using 96-Well Plates and a Liquid Handler System

9.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

10.

Add 200 µl of room temperature 1X Wash Buffer II to each well of the 96-well PCR plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

11.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

12.

Add 200 µl of room temperature 1X Wash Buffer III to each well of the 96-well PCR plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

13.

Place the PCR plate onto the MagnaBot II device. Wait for 1 minute to capture the Capture Beads to the side of the tubes. Remove the supernatant and discard to waste.

14.

Remove the plate from the MagnaBot II device and add 50 µl of PCR-grade water to each well of the 96-well

PCR plate. Mix by pipetting up and down to thoroughly resuspend the Capture Beads into solution.

15.

Store the beads plus captured samples at -15 to -25°C or proceed to

Chapter 7

.

There is no need to elute DNA off the beads. The beads plus captured DNA will be

used as template in the LM-PCR as described in

Chapter 7

.

SeqCap EZ Library SR User’s Guide, v5.1

48

Appendix C. Post-Capture Multiplexing for Sequencing

Appendix C. Post-Capture Multiplexing for

Sequencing

This appendix provides a recommended workflow for pooling Amplified Captured DNA Sample Libraries immediately prior to sequencing. Each DNA Sample Library contains a different DNA Adapter Index and is

captured independently (

Figure 6

). Following the Post-Capture LM-PCR amplification step, the different Amplified

Captured libraries are quantitated and pooled so that the pool contains equivalent amounts (by mass) of each library. To determine the appropriate number of libraries to pool, consider the capture target size, the capture specificity (i.e. ‘on-target read rate’) for the design, and your desired coverage depth.

I. Prepare the DNA Sample Library

Sample Library

Constructed with

Adapter Index 2

Sample Library

Constructed with

Adapter Index 4

Sample Library

Constructed with

Adapter Index 5

Etc.

II. Amplify Pre-Capture Sample Library Using LM-PCR

III. Hybridize Amplified Sample and EZ Probe Libraries

Hybridization sample includes 1,000 pmol of

SeqCap HE Universal

Oligo + 1,000 pmol of

SeqCap HE Index 2 Oligo

Hybridization sample includes 1,000 pmol of

SeqCap HE Universal

Oligo + 1,000 pmol of

SeqCap HE Index 4 Oligo

Hybridization sample includes 1,000 pmol of

SeqCap HE Universal

Oligo + 1,000 pmol of

SeqCap HE Index 5 Oligo

IV. Amplify Post-Capture Sample Library Using LM-PCR

Etc.

V. Quantitate and pool an equal mass of each Amplified, Captured Library*

(qPCR to estimate enrichment is recommended here, prior to pooling)

* Pooling unequal amounts of

Amplified, Captured Libraries will result in skewed ratios of sequence reads representing the component indexes following step VI.

VI. Proceed to sequencing of the pooled, indexed, Amplified Capture Libraries

Figure 6: Post-capture multiplexing workflow.

SeqCap EZ Library SR User’s Guide, v5.1

49

Appendix D. Purify the Amplified Captured DNA using Qiagen QIAquick PCR Purification Kit

Appendix D. Purify the Amplified Captured DNA using Qiagen QIAquick PCR Purification Kit

This appendix provides a instructions for the use of Qiagen QIAquick PCR Purification Kit in place of Agencourt

AMPure XP Beads (

Chapter 4

and

Chapter 7)

for the purification of the PCR products resulting prior to and after hybridization. It follows the protocol detailed in the Qiagen QIAquick PCR Purification Kit guide with the following exception: elute the pre-capture amplified, bisulfite-converted sample library DNA using PCR-grade water instead of

Qiagen buffer EB.

References

Microcentrifuge Manual

Qiagen QIAquick PCR Purification Kit Protocol

Post-Capture LM-PCR: Pool the two reactions from each amplified, captured bisulfiteconverted DNA sample into a single 1.5 ml microcentrifuge tube (approximately

200 µl). Process the negative control in exactly the same way as the amplified captured

DNA.

1.

Follow the instructions provided with Qiagen QIAquick PCR Purification Kit with the following modifications.

2.

To each tube of amplified DNA add 5x volume (250 µl following pre-capture LM-PCR amplification or 500 µl following post-capture LM-PCR amplification) of Qiagen buffer PB. Mix well.

3.

Pipette 750 µl of the amplified DNA in PB into a QIAquick PCR Purification column.

4.

Centrifuge at 16,000 x g for 1 minute. Discard the flow-through.

5.

Add 750 µl of buffer PE to the column. Centrifuge at 16,000 x g for 1 minute.

6.

Discard the flow-through and place the column back in the same tube. Centrifuge the column for an additional minute.

7.

Add 50 µl of PCR-grade water (following Pre-capture LM-PCR amplification) or 50 µl of buffer EB (following

Post-capture LM-PCR amplification) directly to the column matrix. Transfer the column to a 1.5 ml microcentrifuge tube.

It is critical that the Pre-Capture amplified sample library is eluted with PCR-grade water and not buffer EB or 1X TE.

8.

Let the column stand for 1 minute.

9.

Centrifuge at 16,000 x g for 1 minute to elute the DNA.

Post-capture LM-PCR: Due to the presence of the Capture Beads, the Qiagen

QIAquick column might appear brown in color. The Capture Beads will not interfere with the action of the Qiagen QIAquick PCR Purification Kit column or buffers.

SeqCap EZ Library SR User’s Guide, v5.1

50

Appendix E. Troubleshooting

Appendix E. Troubleshooting

This appendix provides guidance for interpreting unexpected results and recommendations for implementing corrective action if problems occur. For technical questions, contact your local Roche Technical Support. Go to

www.nimblegen.com/contact

for contact information.

Cause(s) / Recommendation(s) Observation

Sample Library Preparation

Less than 100 ng of input DNA is available for library preparation.

More than 100 ng of input DNA is available for library preparation.

DNA extracted from formalin-fixed paraffin-embedded (FFPE) tissue is available for library preparation.

Libraries generated using <100 ng of input gDNA can produce high quality capture results; however, several adjustments documented in the KAPA Library Preparation Kit’s technical data sheet, and summarized below, will increase the probability of success.

Adjust the adapter concentration to preserve the adapter:insert molar ratio in order to maintain high ligation efficiency. For example, if starting with 10 ng of input DNA, use 5 µl of 0.1 µM adapter during adapter ligation reaction.

Perform two SPRI bead cleanups after adapter ligation instead of one SPRI bead cleanup + dual-SPRI size selection. This will reduce sample loss associated with size selection, but may yield a broader fragment size distribution that must be accounted for in subsequent steps (e.g. calculating average fragment size to determine library molar concentration).

Increase the number of PCR cycles during pre-capture LM-PCR by

1 – 3 cycles, depending on starting gDNA amount. For example, if starting with 10 ng of input DNA, set the pre-capture LM-PCR program to run for 12 cycles. Performance of these cycle number recommendations may vary for your particular sample.

Increase primer concentration during pre-capture LM-PCR to a

2 µM effective concentration in the final reaction volume to mitigate the probability of primer depletion artifacts (i.e. when primers are depleted before thermocycling is completed).

Note: There is a possibility that these steps will not lead to success with lower input amounts. For the most current guidance on working with lower input amounts, please contact Roche Technical Support.

The SeqCap EZ workflow has been validated for gDNA input amounts up to 1 µg. When working with 1 µg of input gDNA, use 5 µl of resuspended Index Adapter in the Adapter Ligation Reaction

(

Chapter 3

) and adjust the total number of Pre-capture LM-PCR cycles

(

Chapter 4

) to 7, which may lower the chance of amplification bias and

the rate of PCR duplicates in the experiment.

DNA extracted from FFPE tissue is highly variable in quality due to chemical damage and fragmentation, and often is available only in small amounts. To increase probability for success, follow recommendations for library construction using less than 100 ng of input DNA, perform DNA fragmentation using the Covaris instrument even when the DNA sample already appears to be degraded to a low molecular weight. This can help to remove chemically-damaged termini that will interfere with adapter ligation.

Note: There is a possibility that these steps will not lead to success with DNA extracted from FFPE samples. For the most current guidance on working with FFPE samples, please contact Roche Technical

Support.

SeqCap EZ Library SR User’s Guide, v5.1

51

Appendix E. Troubleshooting

Observation

Amplified Sample Library (Pre-Capture LM-PCR Product)

Yield is <1 µg (yield should be ≥1 µg).

Cause(s) / Recommendation(s)

Possible error occurred during library preparation or damaged reagents were used.

Use an evaluated sample library as a positive control for LM-PCR reagents.

Repeat library preparation if necessary.

Poor fragmentation occurred. Repeat library preparation. Consider implementing the gel-cut size selection option.

Fragment distribution (analyzed using a Agilent DNA 1000 chip) shows that the average amplified fragment size is not within the size range of 150 - 500 bp.

Fragment distribution (analyzed using a Agilent DNA 1000 chip) is bimodal, with a larger set of fragments observed in addition to, or instead of, the expected set of fragments.

A

260

/A

280

is <1.7 (ratio should be 1.7 - 2.0).

The negative control yield measured by the NanoDrop spectrophotometer is non-negligible.

The Agilent Bioanalyzer DNA 1000 chip indicates one or more visible sharp peaks that are <150 bp in size.

The Agilent Bioanalyzer DNA 1000 chip indicates that the average amplified material is 150 - 500 bp in size in the negative control for sample library amplification.

Hybridizing the Sample Library and SeqCap EZ Probe Pool

Non-standard hybridization times.

See the section entitled “Amplified captured multiplex DNA (Post-

Capture LM-PCR Product)” in this appendix.

Inefficient sample cleanup was performed. Repeat cleanup.

The measurement may be high due to the presence of oligonucleotides carried over from previous steps/LM-PCR. This carryover will be apparent as one or more sharp peaks visible less than 150 bp in size when examining the data from the Agilent Bioanalyzer DNA 1000 chip.

This carryover is not a sign of contamination and will not interfere with the capture process.

These peaks, which represent oligonucleotides carried over from previous steps/LM-PCR, may be especially prominent when the library preparation procedure omits the optional gel-cut step. This carryover will not interfere with the capture process but could lead to overestimation of the amplified library yield when interpreting the data from NanoDrop spectrophotometer.

This material could represent cross-contamination between amplified sample libraries. Test reagents for contamination and replace if necessary. Repeat library construction using fresh genomic DNA.

NimbleGen SeqCap EZ experiments can safely incubate during the hybridization step for up to 3 days (72 hours).

SeqCap EZ Library SR User’s Guide, v5.1

52

Appendix E. Troubleshooting

Observation Cause(s) / Recommendation(s)

Amplified captured multiplex DNA (Post-Capture LM-PCR Product)

Yield is <500 ng (yield should be ≥500 ng).

Incorrect hybridization or wash temperatures was used. Make sure the correct hybridization and wash temperatures were used. If temperatures were not correct, repeat the experiment from hybridization.

PCR reagents are damaged. Verify that the positive control worked. If the positive control did not work, repeat hybridization and re-amplify using fresh PCR reagents.

Note: Experiments designed to capture less genomic DNA (i.e. a smaller cumulative target size) may be successful even though they can generate lower LM-PCR yields than experiments designed to capture larger targets. Target size and enrichment qPCR results

(

Chapter 8

) should be taken into consideration when evaluating low

Post-Capture LM-PCR yield.

Poor fragmentation occurred. Repeat library preparation. Consider implementing the gel-cut size selection option.

Fragment distribution (analyzed using a Agilent DNA 1000 chip) shows that the average amplified fragment size is not within the size range of 150 - 500 bp.

Fragment distribution (analyzed using a Agilent DNA 1000 chip) is bimodal, with a larger set of fragments observed in addition to (Fig B), or instead of (Fig C), the expected set of fragments (Fig A):

A.

B.

Primer depletion due to over-amplification of sample library relative to the amount of primers available in the reaction results in single stranded amplification products. These products can anneal to each other via adapter homology on both ends of the fragments to form heteroduplexes, and migrate as apparently much larger products on an

Agilent DNA 1000 chip than their actual length in base pairs. The artifact can be resolved by increasing primer concentration or reducing cycle number in the LM-PCR reaction, however the products themselves are perfectly acceptable for use in sequence capture and sequencing, and this artifact will not affect capture performance. Care should be taken to quantify the area under both peaks if quantification will be performed using the Bioanalyzer image.

The Agilent DNA 1000 chip traces shown in Figs A, B, and C (left) show the result of amplification of the same captured gDNA sample library following post-capture LM-PCR amplification for 16, 18, or 22-cycles, respectively. The same artifact can appear in pre-capture LM-PCR amplification.

C.

A

260

/A

280

is <1.7 (ratio should be 1.7 to 2.0).

Measurement of Enrichment Using qPCR

Standard deviation of triplicate qPCR reactions is >0.5.

Average Cp values for negative control assays are not negligible.

One or more calculated NSC control locus fold enrichment values, or the average of all four, are less than the

recommended value of tenfold (

Chapter 8

).

Inefficient sample cleanup was performed. Repeat cleanup.

Pipetting error may have occurred. Repeat qPCR assays.

Possible cross contamination across wells or reagent contamination occurred. Repeat qPCR assays.

Low qPCR values often correlate with low capture specificity, or a reduced ‘on target’ rate, for captured fragments. Repeat qPCR assays. If the result is confirmed, repeat the experiment from the beginning.

The Illumina sequencing workflow is not supported by Roche NimbleGen Technical

Support.

SeqCap EZ Library SR User’s Guide, v5.1

53

Appendix F. Limited Warranty

Appendix F. Limited Warranty

ROCHE NIMBLEGEN, INC.

NIMBLEGEN PRODUCTS

1. Limited Warranty

A. Products: Roche NimbleGen, Inc. (“Roche NimbleGen”) warrants that its Products conform to its published specifications and are free from defects in material or workmanship. Customer’s sole and exclusive remedy (and Roche NimbleGen’s sole and exclusive liability) under this limited warranty shall be to either (a) replace the defective Products, or (b) provide Customer with a refund, as solely determined by

Roche NimbleGen.

B. Under no circumstances shall Roche NimbleGen’s liability to Customer exceed the amount paid by Customer for the Services and

Products to Roche NimbleGen. Roche NimbleGen will bear all reasonable shipping costs if service is re-performed at Roche NimbleGen or the Products are replaced. This warranty does not apply to any defect or nonconformance caused by (i) the failure by Customer to provide a suitable storage, use, or operating environment for the Materials or Customer’s submission of substandard quality Materials or contaminated or degraded Materials to Roche NimbleGen, (ii) Customer’s use of non-recommended reagents, (iii) Customer’s use of the

Products, Materials or Data for a purpose or in a manner other than that for which they were designed, (iv) the failure by Customer to follow Roche NimbleGen’s published protocols; or (v) as a result of any other abuse, misuse or neglect of the Products, Materials or Data by Customer. This warranty applies only to Customer and not to third parties.

C. TO THE FULLEST EXTENT PERMITTED BY APPLICABLE LAW, ROCHE NIMBLEGEN DISCLAIMS ALL OTHER REPRESENTATIONS, AND

WARRANTIES, EXPRESS OR IMPLIED, WITH RESPECT TO THE PRODUCTS, SERVICES AND DATA, INCLUDING BUT NOT LIMITED TO, ANY

IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE OR NON-INFRINGEMENT. CUSTOMER’S SOLE

REMEDY FOR BREACH OF WARRANTY IS STATED ABOVE.

D. Any action by Customer against Roche NimbleGen for Roche NimbleGen’s breach of this warranty must be commenced within

12 months following the date of such breach. Notwithstanding such 12-month period, within twenty (20) days of the delivery of Data and/or

Products to Customer, Customer must notify Roche NimbleGen in writing of any nonconformity of the Services and Products, describing the nonconformity in detail; otherwise all Services and Products shall be conclusively deemed accepted without qualification.

2. FURTHER LIABILITY LIMITATION

TO THE FULLEST EXTENT PERMITTED UNDER APPLICABLE LAW, ROCHE NIMBLEGEN SHALL NOT HAVE ANY LIABILITY FOR

INCIDENTAL, COMPENSATORY, PUNITIVE, CONSEQUENTIAL, INDIRECT, SPECIAL OR OTHER SIMILAR DAMAGES, HOWEVER CAUSED

AND REGARDLESS OF FORM OF ACTION WHETHER IN CONTRACT, TORT (INCLUDING NEGLIGENCE), STRICT PRODUCT LIABILITY OR

OTHERWISE, EVEN IF ROCHE NIMBLEGEN HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. CUSTOMER UNDERSTANDS

THAT ANY RISKS OF LOSS HEREUNDER ARE REFLECTED IN THE PRICE OF THE SERVICES AND PRODUCTS AND THAT THESE TERMS

WOULD HAVE BEEN DIFFERENT IF THERE HAD BEEN A DIFFERENT ALLOCATION OF RISK.

If you have any questions concerning service of this product, please contact your local Roche Technical Support. Go to

www.nimblegen.com/contact

for contact information.

Evidence of original purchase is required. It is important to save your sales receipt or packaging slip to verify purchase.

SeqCap EZ Library SR User’s Guide, v5.1

54

Published by:

Roche NimbleGen, Inc

500 S. Rosa Road

Madison, WI 53719

USA

www.nimblegen.com

© 2015 Roche NimbleGen, Inc. All rights reserved.

06588786001  09/15

NIMBLEGEN and SEQCAP are trademarks of Roche.

SYBR is a registered trademark of Life Technologies Corporation.

AMPure, Beckman, and Beckman Coulter are trademarks or registered trademarks of

Beckman Coulter, Inc.

All other product names and trademarks are the property of their respective owners.

For life science research only.

Not for use in diagnostic procedures.

advertisement

Related manuals

advertisement

Table of contents