HAEMOPHILUS SOMNUS IMMUNOGENIC PROTEINS

Europaisches Patentamt
(19)
European Patent Office
Office europeen
brevets
peen des brevets
EP
0 635
055
B1
E U R O P E A N PATENT S P E C I F I C A T I O N
(12)
(45) Date of publication and mention
of the grant of the patent:
23.12.1998 Bulletin 1998/52
(51) intci.6: C12N 15/31, C07K 1 4 / 1 9 5 ,
C12P 21/02, A 6 1 K 3 9 / 1 0 2 ,
C12N 1/21
(21) Application number: 93907710.3
(86) International application number:
PCT/CA93/00135
(22) Date of filing: 05.04.1993
(87) International publication number:
WO 93/21323 (28.10.1993 Gazette 1993/26)
(54) HAEMOPHILUS SOMNUS IMMUNOGENIC PROTEINS
HAEMOPHILUS SOMNUS IMMUNOGENE PROTEINE
PROTEINES IMMUNOGENES DERIVEES DE HAEMOPHILUS SOMNUS
(84) Designated Contracting States:
DE FR GB
(30) Priority: 09.04.1992
04.06.1992
04.06.1992
29.03.1993
29.03.1993
29.03.1993
US
US
US
US
US
US
865050
893424
893426
38287
38288
38719
(43) Date of publication of application:
25.01.1995 Bulletin 1995/04
(73) Proprietor: The University of Saskatchewan
Saskatoon, Saskatchewan S7N 0W0 (CA)
(72) Inventors:
• POTTER, Andrew, A.
Saskatoon, Saskatchewan S7H 3S5 (CA)
• PONTAROLLO, Reno, A.
Saskatoon, Saskatchevan S7N 1H6 (CA)
• PFEIFFER, Cheryl, G.
Vancouver, B.C., V6E 1S8. (CA)
• THEISEN, Michael
DK-1957 Frederiks Ber GC (DK)
• HARLAND, Richard, J.
Saskatoon, Saskatchewan S7H 2M5 (CA)
• RIOUX, Clement
Saskatoon, Saskatchewan S7K 3J5 (CA)
DO
lO
o
LO
CO
CO
o
a.
LU
(56) References cited:
• ABSTRACTS OF THE GENERAL MEETING OF
THE AMERICAN SOCIETY OF MICROBIOLOGY
vol. 92, no. 0, 8 April 1992, page 88 M. THEISEN
ET AL 'Cloning and characterization of IppB,
agene encoding an Antigenic 40-kilodalton
lipoprotein of Haemophilus somnus'
• INFECTION AND IMMUNITY, vol. 60, no. 3, March
1992, WASHINGTON US pages 826 - 831 M.
THEISEN ET AL 'Molecular cloning , nucleotide
sequence , and characterization of a
40,000-molecular-weight Lipoprotein of
Haemophilus somnus' cited in the application
• INFECTION AND IMMUNITY, vol. 56, no. 10,
October 1988, WASHINGTON US pages 2736 2742 L. B. CORBEIL ET AL 'Cloning and
Expression of genes encoding
Haemophilussomnus Antigens'
• INFECTION AND IMMUNITY, vol. 59, no. 12,
December 1991, WASHINGTON US pages 4295 4301 L. B. CORBEIL ET AL 'Characterization of
Immunodominant Surface Antigens of
Haemophilus somnus'
• INFECTION AND IMMUNITY, vol. 61, no. 5, May
1993, WASHINGTON US pages 1793 - 1798 M.
THEISEN ET AL 'Molecular cloning, Nucleotide
sequence, and characterization of IppB,
encoding an Antigenic 40-Kilodalton
Lipoprotein of Haemophilus somnus'
(74) Representative: Silveston, Judith et al
ABEL & IMRAY
Northumberland House
303-306 High Holborn
London, WC1V7LH (GB)
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give
notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in
a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art.
99(1) European Patent Convention).
Printed byJouve, 75001 PARIS(FR)
EP 0 635 055 B1
Description
Technical Field
5
The present invention relates generally to bacterial antigens. More particularly, the present invention pertains to
proteins derived from Haemophilus, somnus and the use of the same in vaccine compositions.
Background
10
is
20
25
30
35
40
45
so
55
Haemophilus somnus is a Gram negative bacterium which is related to several Actinobacillus species and appears
to be identical to Histophilus ovis and Haemophilus agni (Philbey et ai, Aust. Vet. J. (1 991 ) 88:387-390. H. somnus
causes a number of disease syndromes in animals. The bacterium is commonly associated with thromboembolic meningoencephalitis (HEME), septicemia, arthritis, and pneumonia (Corbeil, L.B., Can. J. Vet. Res. (1990) 54:S57-S62;
Harris, F.W., and Janzen, E.D., Can. Vet. J. (1990) 30:816-822; Humphrey, J.D., and Stephens, L.R., Vet. Bull. (1983)
53:987-1004). These diseases can cause significant economic losses to the farm industry. Currently available vaccines
are either based on killed whole cells or on outer membrane protein (OMP) preparations. (See, e.g. U.S. Patent Nos.
4,981,685 and 4,877,613). However, whole cell bacterins and surface protein extracts often contain immunosuppressive components which can render animals more susceptible to infection. Furthermore, an OMP enriched vaccine has
only been shown to offer significant protection against H. somnus induced disease in an experimental challenge model
(Harland, R.J., etai, Res. Work. Anim. Dis. 71st (1990) 29:6). Subunit vaccines, i.e. vaccines including select proteins
separated from the whole bacterium, afford a method for overcoming the problems inherent in the use of the abovedescribed vaccines.
Iron is an essential nutrient for bacterial growth and the ability to acquire iron from a host's iron-limiting environment
is necessary to establish and maintain an infection. A correlation between virulence and the ability to scavenge iron
from the host has been shown (Archibald, F.S., and DeVoe, I.W., FEMS Microbiol. Lett. (1979) 6:159-162; Archibald,
F.S., and DeVoe, I.W., Infect. Immun. (1980) 27:322-334; Herrington, D.A., and Sparling, FP, Infect. Immun. (1985)
48:248-251; Weinberg, E.D., Microbiol. Rev. (1978)42:45-66).
Bacteria can scavenge iron from a number of sources. Iron-containing compounds, such as free heme, haemoglobin, myoglobin, transferrin, lactoferrin, catalase, cytochromes, haem-haemopexin, haem-albumin, haemoglobinhaptoglobulin, and the like, can provide iron, depending on the bacterium in question. A limited number of Gramnegative bacteria, including Haemophilus species, can utilize haemin as a source of iron.
Bacteria have evolved a number of mechanisms to capture needed iron. Acquisition of iron from host iron sources
may be facilitated by the production of haemolysins and cytolysins which lyse host cells and release intracellular iron
complexes. Iron can then be captured by a variety of methods. For example, E. coli uses siderophores to chelate
external iron which is then bound to a cognate receptor for subsequent internalization. Cross, J.G., Microbiol. Rev.
(1989) 53:517-530; Nellands, J.B., Annu. Rev. Microbiol. (1982) 36:285-309. Unlike E. coli, H. influenzae appears to
capture iron by a siderophore-independent receptor mediated process. Schryvers, A.B., J. Med. Microbiol. (1989) 29:
121-130; Lee, B.C., Infect. Immun. (1992) 60:810-816. Both haemin-binding proteins and haemolysins have been
shown in Plesiomonas shigelloides (Daskaleros, PA., et al., Infect. Immun. (1991) 59:2706-2711). Similarly, H. influenzae has been shown to possess haemin-binding proteins (Lee, B.C., Infect. Immun. (1992) 60:810-816 and Hanson,
M.S. and Hansen, E.J., Mol. Microbiol. (1991) 5:267-278). A transferrin-binding protein has been isolated from H.
somnus (WO90/1 2591).
Haemolysins and cytolysins have been shown in a number of other bacteria. A. pleuropneumoniae strains produce
several cytolysins. See, e.g. Rycroft, A.N., et al., J. Gen. Microbiol. (1991) 137:561-568 (describing a 120 kDacytolysin
from A. pleuropneumoniae); Chang, Y.F, et al., DNA (1989) 8:635-647 (describing a cytolysin isolated from A. pleuropneumoniae serotype 5); Kamp, E.M., et al., Abstr. CRWAD (1990) 1990:270 (describing the presence of 103, 105
and 120 kDa cytolysins in A. pleuronneumoniae strains) and Welch, R.A., Mol. Microbiol. (1991) 5:521 -528 (reviewing
cytolysins of gram negative bacteria including cytolysins from A. pleuronneumoniae). One of these cytolysins appears
to be homologous to the alpha-hemolysin of E coli and another to the leukotoxin of Pasteurella haemolytica. Welch,
R.A., Mol. Microbiol. (1991) 5:521-528. These proteins have a molecular mass of approximately 105,000 kDa and are
protective in mouse and pig animal models against challenge with the homologous serotype. However, cross-serotype
protection is limited at best (Higgins, R., etal., Can. J. Vet. (1985)26:86-89; Maclnnes, J. I., etal., Infect. Immun. (1987)
55: 1626-1 634. The genes for two of these proteins have been cloned and expressed in E coli and their nucleotide
sequence determined. Chang, Y.F, et al., J. Bacteriol. (1991) 173:5151-5158 (describing the nucleotide sequence for
an A. pleuronneumoniae serotype 5 cytolysin); and Frey, J., et al., Infect. Immun. (1991)59:3026-3032 (describing the
nucleotide sequence for an A. pleuropneumoniae serotype 1 cytolysin). However, haemin-binding proteins and haemolysins from H. somnus have not heretofore been isolated.
The outer membrane of H. somnus includes a 40 kDa protein (as determined by SDS-PAGE) which reacts with
2
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
convalescent serum (Corbeil, L.B., etal., infect. Immun. (1987)55:1381-1386; Goglolewski, Ft. P., etal., Infect. Immun.
(1988) 56:2307-2316). Additionally, antibodies directed against a 40 kDa OMP have been shown to prevent infection
in vitro in a neutralization experiment (Gogolewski et al., supra) and a seroreactive protein of 40 kDa is present in all
H. somnus isolates that have been tested (Corbeil etal, 1987).
A 39 kDa OMP, antigenically distinct from the 40 kDa OMP described above, has also been identified. This protein
reacts with convalescent-phase serum and is conserved among all H. somnus isolates tested.
An increasing number of bacterial antigens have now been identified as lipoproteins (Anderson, B.E., et al., J.
Bacteriol. (1988) 170:4493-4500; Bricker, T.M., etal., Infect. Immun. (1988) 56:295-301; Hanson, M.S., and Hansen,
E.J., Mol. Microbiol. (1991) 5:267-278; Hubbard, C.L., etal., Infect. Immun. (1991) 59:1521-1528; Nelson, M.B., etal.,
Infect. Immun. (1988) 56:128-134; Thirkell, D., etal., Infect. Immun. (1991) 59:781-784). These lipoproteins are generally localized in the envelope of the cell and are therefore exposed to the host's immune system. It has been shown
that the murein lipoprotein from the outer membrane of Escherichia coli acts as a potent activator of murine lymphocytes, inducing both proliferation and immunoglobulin secretion (Bessler, W., etal. Z. Immun. (1977) 153:11-22;
Melchers, F, etal. J. Exp. Med. (1975 142:473-482). The active lipoprotein portion of the protein has been shown to
reside in the N-terminal fatty acid containing region of the protein. Recent studies using synthetic lipopeptides based
on this protein show that even short peptides, containing two to five amino acids covalently linked to palmitate, are
able to activate murine lymphocytes (Bessler, W.G., et al. J. Immunol. (1985) 135:1900-1905).
A lipoprotein from H. somnus has been positively identified. This protein, termed "LppA", is an OMP with an apparent molecular mass of 40 kDa, as determined by gel electrophoresis. The nucleotide sequence for LppA has been
determined (Theisen, M., et al., Infect. Immun. (1 992) 60:826-831 ). However, the protective capability of this protein
has not previously been studied.
A second lipoprotein, termed "LppB", from Haemophilus somnus is known. It is reported that a genomic library of
Haemophilus somnus in E.coli was screened with bovine hyperimmune sera and a clone was found which encoded a
strongly seroreactive 40 kDa protein (Theisen, M. et al Abstr. Gen. Meeting. Am. Soc. Microbiol. (92nd meeting), New
Orleans, May 1992). It is also reported that the entire DNA insert was sequenced and it was found that the larger of
two open reading frames encoded the seroreactive protein. This protein is said to be an LppB lipoprotein.
The present invention is based on the discovery of immunogenic proteins from H. somnus and the isolation of the
various genes coding therefor. These proteins, may be the native protein, immunogenic fragments thereof, analogs
thereof, or chimeric proteins including the same. Novel subunit vaccines to provide protection from H. somnus infection
in vertebrate subjects comprise the LppB protein, fragments or analogs thereof, and/or chimeric proteins comprising
the same, either alone or in combination with other immunogenic H. somnus proteins or with other antigens.
The present invention provides a vaccine composition comprising a pharmaceutical^ acceptable vehicle and a
recombinant immunogenic Haemophilus somnus protein, capable of eliciting a protective immune response against
Haemophilus somnus, which protein may be lipidated or non-lipidated and comprises
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
As described in greater detail below, the protein may be non-lipidated or lipidated by a lipid moiety not normally
found in association with the protein or lipidated by a lipid moiety usually found in association with the protein.
The immunogenic protein of the vaccine compositions of the present invention may be a fusion protein, that is a
protein in which the amino acid sequence of (a), (b), (c) or (d) above is fused to a non-Haemophilus somnus amino
acid sequence. Examples of such proteins are discussed herein.
The vaccine compositions may comprise more than one immunogenic protein as described above and may in
addition to an LppB protein comprise a Haemophilus somnus protein other than an LppB protein. Other Haemophilus
somnus proteins, immunogenic fragments thereof, analogs thereof and chimeric proteins including the same are described herein.
The present invention also provides a method of producing a vaccine composition, said method comprising:
(1 ) culturing a transformed host cell, the host cell having been transformed with a recombinant vector, under conditions whereby the protein encoded by the coding sequence present in said recombinant vector is expressed, the
recombinant vector comprising:
(i) a nucleotide sequence comprising a coding sequence for an immunogenic Haemophilus somnus protein
capable of eliciting a protective immune response against Haemophilus somnus, which protein comprises
3
EP 0 635 055 B1
(a) an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
(b) an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
(c) an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
(d) a fragment of an amino acid sequence according to (a), (b) or (c);
and
5
10
is
20
25
30
35
40
45
so
55
(ii) control sequences that are operably linked to said nucleotide sequence whereby said coding sequence
can be transcribed and translated in a host cell, and at least one of said control sequences is heterologous to
said coding sequence; and
(2) admixing the expressed protein with a pharmaceutical^ acceptable vehicle.
The method according to the invention may also comprise the step of transforming a host cell with the recombinant
vector to obtain the transformed host cell.
The present invention further provides use of a recombinant immunogenic Haemophilus somnus protein in the
manufacture of a vaccine for treating or preventing Haemophilus somnus infection in a vertebrate subject, the protein
being capable of eliciting a protective immune response against Haemophilus somnus, being lipidated or non-lipidated
and comprising
(a) an amino acid sequence shown at positions 1 to 279, inclusive,
of Figure 9; or
(b) an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
(c) an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
(d) a fragment of an amino acid sequence according to (a), (b) or (c).
Especially provided is the use of such a protein in the manufacture of a vaccine for the treatment of or prevention
of thromboembolic meningoencephalitis, septicemia, arthritis, pneumonia, myocarditis, pericarditis, spontaneous abortion, infertility and/or mastitis caused by infection with Haemophilus somnus.
A further aspect of the present invention is a recombinant carrier virus capable of expressing an immunogenic
Haemophilus somnus protein, capable of eliciting a protective immune response against Haemophilus somnus, which
protein comprises
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
In accordance with the invention there is provided a vaccine composition comprising a pharmaceutical^ acceptable
vehicle and a recombinant carrier virus as described above. The carrier virus may be a pox virus, advantageously the
vaccina virus, an adenovirus or a herpes virus.
Also provided by the invention is a pharmaceutical preparation suitable for nucleic acid immunization, which preparation comprises a nucleic acid sequence encoding an immunogenic Haemophilus somnus protein, capable of eliciting
a protective immune response against Haemophilus somnus, which protein comprises
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c),
Such a nucleic acid sequence may be in a form suitable for administration directly to the vertebrate subject or in
a form suitable for introduction into cells belonging to the vertebrate subject by gene transfer.
Figure 1 shows the location of the Wyand hmb gene on the plasmids pRAP117, pRAP401 and pRAP501 .
Figure 2 depicts the nucleotide sequence of plasmid pRAP501 . Also shown are the deduced amino acid sequences
of the various open reading frames (ORFs), including ORF1 which encodes the H. somnus haemin-binding protein.
Figure 3 shows the ORFs in pRAP501 , as deduced from the sequence shown in Figure 2.
Figure 4 depicts the deduced amino acid sequence for the H. somnus haemin-binding protein.
Figure 5 shows the nucleotide sequence contained in plasmid pGCH5. The sequence includes the IktA gene from
Pasteurella haemolytica fused with a truncated hmb gene.
4
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
Figure 6 depicts the nucleotide sequence contained in plasmid pGCH4. The sequence includes the Iktk gene from
P. haemolytica fused with a truncated hmb gene.
Figure 7 depicts the nucleotide sequence and deduced amino acid sequence of the H. somnus Ippk region. The
sequence of the antisense strand is shown with numbering starting from the 5'-end Shine-Dalgarno (SD) sequence.
The transcriptional start of the Ippk gene is indicated by 1.
Figure 8 shows the structure and properties of plasmids described in Example 1. The top line shows a partial
restriction map of plasmid pMS22 with relevant sites shown. The arrow indicates the location and direction of transcription of the Ippk gene. The shaded bars beneath the arrow illustrate the DNA cloned in each of the indicated
plasmids. Plasmid names indicated with a slash denote fragments cloned in both orientations. The lower two sets of
lines show the DNA remaining in the deletion plasmids used for determining the nucleotide sequence of the Ippk gene.
The far right column indicates the ability of the various plasmids to direct the synthesis of LppA in JM105.
Figure 9 shows the nucleotide sequence and deduced amino acid sequence of the gene encoding H. somnus
LppB. The preprotein is encoded by nucleotide positions 872 through 1708 (amino acid residues 1 through 279). The
mature protein is encoded by nucleotide positions 920 through 1708 (amino acid residues 17 through 279).
Figure 10 depicts the nucleotide sequence and predicted amino acid sequence of the gene encoding H. somnus
LppC. The preprotein spans nucleotide positions 108 through 1850 (amino acid residues 1 through 581), with the
spanning positions 171 through 1850 (amino acids 22 through 581).
Figure 11 depicts the nucleotide sequence and predicted amino acid sequence contained in plasmid pCRR28.
The sequence includes the Iktk gene from P. haemolytica fused with the IppB gene.
Detailed Description
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular
biology, microbiology, virology, recombinant DNA technology, and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A
Laboratory Manual, Second Edition (1989); DNA Cloning, Vols. I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis{M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames&S.J. Higgins eds. 1984); Animal Cell Culture (R.
K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular
Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); and
Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., 1986, Blackwell Scientific Publications).
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
A. Definitions
In describing the present invention, the following terms will be employed, and are intended to be defined as indicated
below.
The term "H. somnus haemin-binding protein" or a nucleotide sequence encoding the same, intends a protein or
a nucleotide sequence, respectively, which is derived from the haemin-binding {hmb) gene from H. somnus and found
in plasmid pRAP117 (ATCC Accession No. 68952) and depicted as ORF1 in Figure 2.
The term "H. somnus haemolysin" or a nucleotide sequence encoding the same, intends a protein or a nucleotide
sequence, respectively, which is derived from the haemolysin (hly) gene found in plasmid pAA504.
The term "LppA" or a nucleotide sequence encoding the same, intends a protein or a nucleotide sequence, respectively, derived from a contiguous sequence falling within positions 1 through 247, inclusive, of Figure 7.
The term "LppB" or a nucleotide sequence encoding the same, intends a protein or a nucleotide sequence, respectively, derived from a contiguous sequence falling within positions 1 through 279, inclusive, of Figure 9.
The term "LppC" or a nucleotide sequence encoding the same, intends a protein or a nucleotide sequence, respectively, derived from a contiguous sequence falling within positions 1 through 581 , inclusive, of Figure 10.
The derived protein or nucleotide sequences need not be physically derived from the genes described above, but
may be generated in any manner, including for example, chemical synthesis, isolation (either from H. somnus or any
other organism expressing the proteins) or by recombinant production, based on the information provided herein.
Furthermore, the terms intend proteins having amino acid sequences substantially homologous to contiguous amino
acid sequences encoded by the genes. Thus, the terms include both full-length, truncated and partial sequences, as
well as analogs and precursor forms of the proteins. Representative truncated sequences derived from the hmb gene
are present as fusions with a truncated P. haemolytica leukotoxin gene in plasmids pGCH5 and pGCH4 and are shown
in Figures 5 and 6. Precursor forms of several of the proteins are described further below. The terms also include
proteins in neutral form or in the form of basic or acid addition salts depending on the mode of preparation. Such acid
5
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
addition salts may involve free amino groups and basic salts may be formed with free carboxyls. Pharmaceutical^
acceptable basic and acid addition salts are discussed further below. In addition, the proteins may be modified by
combination with other biological materials such as lipids (both those occurring naturally with the molecule or other
lipids that do not destroy activity) and saccharides, or by side chain modification, such as acetylation of amino groups,
phosphorylation of hydroxyl side chains, oxidation of sulfhydryl groups, glycosylation of amino acid residues, as well
as other modifications of the encoded primary sequence. A protein derived from the hmb gene or the Wygene need
not necessarily display haemin-binding or haemolytic activity, respectively.
An "isolated" protein sequence is a protein sequence which is separate and discrete from a whole organism (live
or killed) with which the protein is normally associated in nature. Thus, a protein contained in a cell free extract would
constitute an "isolated" protein, as would a protein synthetically or recombinantly produced. An "isolated" nucleotide
sequence is a nucleotide sequence separate and discrete from the whole organism with which the sequence is found
in nature; or a sequence devoid, in whole or part, of sequences normally associated with it in nature; or a sequence,
as it exists in nature, but having heterologous sequences (as defined below) in association therewith.
The term "epitope" refers to the site on an antigen or hapten to which specific B cells and T cells respond. The
term is also used interchangeably with "antigenic determinant" or "antigenic determinant site."
An "immunological response" to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest. Usually, such a response includes but is
not limited to one or more of the following effects; the production of antibodies, B cells, helper T cells, suppressor T
cells, and/or cytotoxic T cells and/or yST cells, directed specifically to an antigen or antigens included in the composition
or vaccine of interest.
The terms "immunogenic" protein or polypeptide refer to an amino acid sequence which elicits an immunological
response as described above. An "immunogenic" protein or polypeptide, as used herein, includes the full-length sequence of the H. somnus protein in question, analogs thereof, or immunogenic fragments thereof. By "immunogenic
fragment" is meant a fragment of a polypeptide which includes one or more epitopes and thus elicits the immunological
response described above. Such fragments can be identified by, e.g., concurrently synthesizing large numbers of
peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides
with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described
in, e.g., U.S. Patent No. 4,708,871; Geysen, H.M. etal. (1984) Proc. Natl. Acad. Sci. USA 81.: 3998-4002; Geysen, H.
M. etal. (1986) Molec. Immunol. 23:709-715, all incorporated herein by reference in their entireties. Studies with some
bacterial lipoproteins have shown that the portion of the molecule responsible for biological activity resides in the Nterminal fatty acid containing region. Short peptides, including two to five amino acids covalently linked to palmitate,
have been shown to possess biological activity (Bessler, W.G., etal. J. Immunol. (1 985) 135: 1900-1 905). Accordingly,
immunogenic fragments, for purposes of the present invention, will usually be at least about 2 amino acids in length,
more preferably about 5 amino acids in length, and most preferably at least about 10 to 15 amino acids in length. There
is no critical upper limit to the length of the fragment, which could comprise nearly the full-length of the protein sequence,
or even a fusion protein comprising two or more epitopes of the H. somnus proteins.
The terms "polypeptide" and "protein" are used interchangeably and in their broadest sense, i.e.., any polymer of
amino acids (dipeptide or greater) linked through peptide bonds. Thus, the term "polypeptide" includes proteins (having
both the full-length sequence or fragments thereof), oligopeptides, analogs, muteins, fusion proteins and the like.
"Recombinant" polypeptides refer to polypeptides produced by recombinant DNA techniques; i.e., produced from
cells transformed by an exogenous DNA construct encoding the desired polypeptide. "Synthetic" polypeptides are
those prepared by chemical synthesis.
A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of
DNA replication in vitro or in vivo; i.e.., capable of replication under its own control.
A "vector" is a replicon, such as a plasmid, phage, or cosmid, to which another DNA segment may be attached so
as to bring about the replication of the attached segment.
A DNA "coding sequence" or a "nucleotide sequence encoding" a particular protein, is a DNA sequence which is
transcribed and translated into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory
sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a
translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic
sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and
even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.
DNA "control sequences" refers collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, which collectively
provide for the transcription and translation of a coding sequence in a host cell. Not all of these control sequences
need always be present in a recombinant vector so long as the desired gene is capable of being transcribed and
translated.
"Operably linked" refers to an arrangement of elements wherein the components so described are configured so
6
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
as to perform their usual function. Thus, control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter
sequence can still be considered "operably linked" to the coding sequence. Similarly, a coding sequence is "operably
linked to" another coding sequence (i.e., in the case of a chimeric protein) when RNA polymerase will transcribe the
two coding sequences intomRNA, which is then translated into the polypeptides encoded by the two coding sequences.
The coding sequences need not be contiguous to one another so long as the transcribed sequence is ultimately processed to produce the desired protein.
A control sequence "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the
promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide
encoded by the coding sequence.
A "host cell" is a cell which has been transformed, or is capable of transformation, by an exogenous DNA sequence.
A cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell
membrane. Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the
genome of the cell. In procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal
element, such as a plasmid. With respect to eucaryotic cells, a stably transformed cell is one in which the exogenous
DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eucaryotic cell to establish cell lines or clones comprised of
a population of daughter cell containing the exogenous DNA.
Two DNA or polypeptide sequences are "substantially homologous" when at least about 80% (preferably at least
about 90%, and most preferably at least about 95%) of the nucleotides or amino acids match over a defined length of
the molecule. For the purposes of the present invention, at least 90 % homology is required between two polypeptides
for them to be considered "substantially homologous" to one another. As used herein, substantially homologous also
refers to sequences showing identity to the specified DNA or polypeptide sequence. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as
defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g.,
Sambrook et al., supra; DNA Cloning, vols I & II, supra; Nucleic Acid Hybridization, supa.
The term "functionally equivalent" intends that the amino acid sequence of the subject peptide is one that will elicit
an immunological response, as defined above, equivalent to the response elicited by an H. somnus haemolysin, haemin-binding protein, LppA, LppB or LppC antigenic peptide having identity with either the entire coding sequence for
the various native proteins, or an immunogenic portion thereof.
A "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA
molecule that is not found in association with the other molecule in nature. Thus, when the heterologous region encodes
a bacterial gene, the gene will usually be flanked by DNA that does not flank the bacterial gene in the genome of the
source bacteria. Another example of the heterologous coding sequence is a construct where the coding sequence
itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation
or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.
The term "treatment" as used herein refers to either (i) the prevention of infection or reinfection (prophylaxis), or
(ii) the reduction or elimination of symptoms of the disease of interest (therapy). Hence, the vaccines and pharmaceutical compositions according to the invention may be used for prophylaxis or therapy.
By "vertebrate subject" is meant any member of the subphylum chordata, including, without limitation, mammals
such as cattle, sheep, pigs, goats, horses, and man; domestic animals such as dogs and cats; and birds, including
domestic, wild and game birds such as cocks and hens including chickens, turkeys and other gallinaceous birds. The
term does not denote a particular age. Thus, both adult and newborn animals are intended to be covered.
B. General Methods
so
55
Central to the present invention is the discovery of several unique, immunogenic, outer membrane H. somnus
proteins and in particular the LppB proteins. The genes for these proteins (termed "hmb," "hly," "Ippk," 7ppB"and
"IppC" herein) have been isolated and characterized. The hmb and various Ipp genes have been sequenced. The
protein products from the hmb and hly genes bind haemin and display haemolytic activity, respectively, in assays
described below.
As shown in Figure 1, the hmb gene is located on a 3 kb Xbal fragment derived from plasmid pRAP117 (ATCC
Accession No. 68952). Western blot analysis of a clone including this fragment detects a protein with an apparent
molecular mass of 50 kDa that comigrates with an iron-regulated H. somnus protein. The hly gene is present in plasmid
pAA504 (ATCC Accession No. 68953), as confirmed by probing this plasmid with an 8 kb Hindlll fragment from plasmid
pRAP117. The Wygene is located on the distal end of this fragment (see Figure 1).
7
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
The hmb gene is shown as ORF1 in Figure 2. The gene encodes a haemin-binding protein having 178 amino
acids. The deduced amino acid sequence for the H. somnus haemin-binding protein is shown in Figure 4.
LppA appears to correspond to the major H. somnus 40 kDa OMR The gene encoding LppA, Ippk, has been
cloned and the nucleotide sequence determined. LppA is specified by a single transcript approximately 1300 nucleotides in length. The start point is located at position 757 of Figure 7, suggesting that transcription terminates beyond
the 3'-end of the cloned DNA. One open reading frame (ORF) is present, starting at an ATG codon at position 791 and
running through position 1531 of Figure 7 (amino acid residues 1 through 247). This region appears to encode the
preprotein. The calculated molecular weight based on the sequence is 27,072. This reading frame has been confirmed
by sequencing the fusion joint of two independent Ippk. Jnphok gene fusions. Thus, although the predicted molecular
weight is less than expected, the ORF indeed encodes the LppA protein. The anomalous molecular weight is likely
due to the lipid nature of the molecule. The region downstream of the Ippk gene does not contain ORFs of any significant
length. Also, the LppA protein is the only polypeptide specified by the H. somnus insert in E. coli minicells. Therefore,
it is likely that Ippk is transcribed as a single cistron.
No significant homology between the complete LppA amino acid sequence and sequences compiled in Genbank
have been found.
LppA appears to include a signal sequence. The 21 N-terminal amino acids show strong sequence homology to
the signal peptide of other secreted proteins, and the sequence, Leu-Leu-Ala-Ala-Cys, at the putative cleavage site,
is identical to the consensus cleavage sequence of lipoproteins from Gram-negative bacteria. Thus the mature protein
spans positions 854 through 1531 (amino acid residues 22 through 247), inclusive, of Figure 7. The ORF thus encodes
a preprotein having 247 amino acid residues and a mature polypeptide having 226 amino acid residues.
The presence of the lipid moiety on the protein was shown by incorporation of radioactive palmitic acid into the
natural H. somnus protein. Palmitic acid was also incorporated into the protein when it was recombinantly produced
in E. coli. Synthesis of the mature LppA lipoprotein was inhibited by globomycin, showing that cleavage of the signal
peptide is mediated by signal peptidase II in both organisms. Using site-directed mutagenesis, the Cys residue at the
cleavage site was changed to glycine. Radiolabeled palmitate was not incorporated into the mutated protein, showing
that lipid modification occurs at the Cys-22 residue.
Lipoprotein, LppB, has been cloned and studied. The gene, IppB, also encodes a 40 kDa H. somnus outer membrane lipoprotein. This lipoprotein is antigenically distinct from LppA and plasmids harboring the IppB gene do not
hybridize to plasmids encoding LppA. Lipid moieties on the molecule were detected as described above. Figure 9
depicts a chromosomal fragment which includes IppB. The ORF encoding LppB begins at position 872 and ends with
the TAA codon at position 1709. A putative ribosome binding site, GGAG, is located upstream and a seven base pair
A/T rich spacer precedes the ATG start codon. The IppB gene encodes a preprotein having 279 amino acids. The first
16 amino acids of LppB appear to specify a signal sequence. Amino acid residues 1 to 13 are followed by a lipoprotein
box, Leu-Ala-Ala-Cys. This region strongly resembles signal peptides of other procaryotic lipoproteins, including LppA
described above. The mature lipoprotein spans positions 920 through 1708 (amino acid residues 17 through 279) of
Figure 9. The calculated molecular mass of LppB is 31 307 Daltons. Again, the discrepancy in size is probably due to
the lipid nature of the protein.
LppB binds both Congo red and hemin on agar plates. LppA, on the other hand, binds neither of these proteins.
It is known that some pathogenic bacteria can adsorb the aromatic dye Congo red and that this ability is strongly
correlated with virulence (Daskaleros & Payne Infect. Immun. (1985) 48:165-168; Maurelli etal. Infect. Immun. (1984)
43:397-401). The molecular basis for this adsorption is unclear, although in E. coli and S. flexneri, Congo red binding
has been associated with the presence of a large virulence plasmid (Maurelli etal. 1984). It has also been suggested
that the ability of certain species to bind Congo red is related to their ability to sequester iron and that Congo red binding
and hemin adsorption is correlated (Prpic et al. 1983). The ability of LppB to bind Congo red and hemin can be used
as a selection technique in recombinant production.
The gene encoding a third H. somnus lipoprotein, LppC, has also been cloned. LppC is a 60 kDa lipoprotein, as
determined by gel electrophoresis. The nucleotide sequence and predicted amino acid sequence of LppC is shown in
Figure 10. An ORF beginning at position 108 and ending at position 1850 codes for a protein with a calculated molecular
weight of 63,336 Daltons. As with LppA and LppB, the preprotein includes atypical procaryotic signal sequence. The
signal sequence includes the first 21 amino acids and thus the DNA coding for the mature protein begins at nucleotide
position 171. The lipid nature of this protein was confirmed as with LppA and LppB. Like LppB, LppC is able to bind
both Congo red and hemin.
As explained above, the LppA, LppB and LppC proteins are normally found in association with lipid moieties. It is
likely that the fatty acid moiety present is a palmitic acid derivative. The antigens of the present invention, even though
carrying epitopes derived from the LppB lipoprotein, do not require the presence of the lipid moiety. Furthermore, if the
lipid is present, it need not be a lipid commonly associated with the lipoprotein, so long as the appropriate immunologic
response is elicited. In any event, suitable fatty acids, such as but not limited to, palmitic acid or palmitic acid analogs,
can be conveniently added to the desired amino acid sequence during synthesis, using standard techniques. For
8
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
example, palmitoyl bound to S-glyceryl-L-Cys (Pam3-Cys) is commercially available (e.g. through Boehringer Mannheim, Dorval, Quebec) and can easily be incorporated into an amino acid sequence during synthesis. See, e.g. Deres,
K., et al. Nature (1989) 342:561. This is a particularly convenient method for production when relatively short amino
acid sequences are used. Similarly, recombinant systems can be used which will process the expressed proteins by
adding suitable fatty acids. Representative systems for recombinant production are discussed further below.
An H. somnus LppB protein, analogues thereof, immunogenic fragments thereof or chimeric proteins including the
same, can be provided in subunit vaccine compositions and thus problems inherent in prior vaccine compositions,
such as localized and systemic side reactions, as well as immunosuppressive effects, are avoided. In addition to use
in vaccine compositions, the proteins or antibodies thereto can be used as diagnostic reagents to detect the presence
of H. somnus infection in a subject. Similarly, the gene encoding the protein can be cloned and used to design probes
for the detection of H. somnus in tissue samples as well as for the detection of homologous genes in other bacterial
strains.
It will sometimes be preferable to have more than one epitope of one or more of the proteins in the vaccine compositions of the present invention. In its simplest form, this can be achieved by employing a polypeptide comprising
the full-length sequence of the LppB protein (encompassing more than one epitope), or by employing a combination
of polypeptides comprising the sequences of two or more of the described proteins. Thus, the vaccine compositions
could comprise, for example various combinations such as one of the LppB proteins and one or more of the other H.
somnus proteins, or a combination of all of the described proteins.
Furthermore, the vaccine compositions of the present invention can include fusion proteins (included in the word
"protein" above) comprising fragments of one or more of the H. somnus antigens fused to, i.e.., a bacterial, fungal,
viral or protozoal antigen. For example, chimeric proteins comprising truncated haemin-binding proteins fused to the
P. haemolytica leukotoxin gene have been constructed and the sequences are depicted in Figures 5 and 6. The chimera
in Figure 5 includes a gene coding for a haemin-binding protein lacking the first two amino acid residues of the native
product, fused to a truncated leukotoxin molecule, encoded by the IktA gene of P. haemolytica (available from ATCC
Accession No. 68283). The construct depicted in Figure 6 includes a deletion of the first 32 amino acid residues of the
H. somnus haemin-binding protein, also fused with the IktA gene of P. haemolytica. Similarly, chimeric constructs of
IppB, fused to the P. haemolytica IktA gene have also been produced and the sequence is depicted in Figure 11 . Such
chimeric proteins can be produced using recombinant techniques described herein and, e.g., in U.S. Patent No.
4,366,246; Hughes, H.P.A. etal. (1992) Infect. Immun. 60:565-570; PCT Publication No. WO 88/00971 (published 11
February 1988); and allowed U.S. Patent Application Serial No. 07/571 ,301 .
The vaccine compositions can be used to treat or prevent a wide variety of H. somnus infections in animals. Such
infections include thromboembolic meningoencephalitis (ITEME), septicemia, arthritis, and pneumonia (Corbelll, L.B.,
Can. J. Vet. Res. (1990)54:557-562; Harris, F.W., and Janzen, E.D., Can. Vet. J. (1990)30:816-822; Humphrey, J.D.,
and Stephens, L.R., Vet. Bull. (1983) 53:987-1004), as well as myocarditis, pericarditis, spontaneous abortion, infertility
and mastitis. Other antigens can also be included in the vaccine compositions, such as the P. haemolytica leukotoxin
described further below. Thus, the compositions will also serve to prevent diseases caused by these organisms, i.e.,
respiratory diseases caused by P. haemolytica, symptoms of shipping fever and bovine respiratory disease in feedlot
cattle, among others.
Production of the H. somnus Proteins
The above described proteins and active fragments, analogs and chimeric proteins derived from the same, can
be produced by a variety of methods. Specifically, the proteins can be isolated directly from H. somnus from outer
membrane preparations, using standard purification techniques. See, e.g. Theisen, M. and Potter, A. Infect. Immun.
(1 992), in press. Alternatively, the proteins can be recombinantly produced as described herein. The proteins can also
be synthesized, based on the determined amino acid sequences, using techniques well known in the art.
For example, the proteins can be isolated from bacteria which express the same. This is generally accomplished
by first preparing a crude extract which lacks cellular components and several extraneous proteins. The desired proteins
can then be further purified i.e. by column chromatography, HPLC, immunoadsorbent techniques or other conventional
methods well known in the art.
The H. somnus proteins can be conveniently produced as recombinant polypeptides. As explained above, these
recombinant products can take the form of partial protein sequences, full-length sequences, or even fusion proteins
(e.g., with an appropriate leader for the recombinant host, or with another subunit antigen sequence for H. somnus or
another pathogen).
The hmb and hly genes can be isolated based on the ability of the protein products to bind haemin and display
haemolytic activity, respectively. Thus, gene libraries can be constructed and the resulting clones used to transform
an appropriate host cell. Colonies can be pooled and screened for clones having these properties. Colonies can also
be screened using polyclonal serum or monoclonal antibodies to the desired antigen, for the identification of the IppA,
9
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
IppB and IppC genes.
Alternatively, once the amino acid sequences are determined, oligonucleotide probes which contain the codons
for a portion of the determined amino acid sequences can be prepared and used to screen DNA libraries for genes
encoding the subject proteins. The basic strategies for preparing oligonucleotide probes and DNA libraries, as well as
their screening by nucleic acid hybridization, are well known to those of ordinary skill in the art. See, e.g., DNA Cloning:
Vol. I, supra; Nucleic Acid Hybridization, supra; Oligonucleotide Synthesis, supra; T. Maniatis et al., supra. Once a
clone from the screened library has been identified by positive hybridization, it can be confirmed by restriction enzyme
analysis and DNA sequencing that the particular library insert contains the desired H. somnus gene or a homolog
thereof.
Alternatively, DNA sequences encoding the proteins of interest can be prepared synthetically rather than cloned.
The DNA sequences can be designed with the appropriate codons for the particular amino acid sequence. In general,
one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete
coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair etal. (1984) Science 223:1299; Jay etal. (1984)
J. Biol. Chem. 259:6311.
Once coding sequences for the desired proteins have been prepared or isolated, they can be cloned into any
suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an
appropriate cloning vector is a matter of choice. Examples of recombinant DNA vectors for cloning and host cells which
they can transform include the bacteriophage X(E coli), pBR322 (E. coli), pACYCI 77 (E. coli), pKT230 (gram-negative
bacteria), pGV1106 (gram-negative bacteria), pLAFRI (gram-negative bacteria), pME290 (non-E coli gram-negative
bacteria), pHV14 (E coli and Bacillus subtilis), pBD9 (Bacillus), plJ61 (Streptomyces), pUC6 (Streptomyces), Ylp5
(Saccharomyces), YCp1 9 (Saccharomyces) and bovine papilloma virus (mammalian cells). See, generally, DNA Cloning:Vo\s. I &II, supra; J. Maniatis etal., supra; B. Perbal, supra.
The gene can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and,
optionally, an operator (collectively referred to herein as "control" elements), so that the DNA sequence encoding the
desired protein is transcribed into RNA in the host cell transformed by a vector containing this expression construction.
The coding sequence may or may not contain a signal peptide or leader sequence. If signal sequences are included,
they can either be the native sequences or heterologous sequences. Leader sequences can be removed by the host
in post-translational processing. See, e.g., U.S. Patent Nos. 4,431,739; 4,425,437; 4,338,397.
Other regulatory sequences may also be desirable which allowfor regulation of expression of the protein sequences
relative to the growth of the host cell. Regulatory sequences are known to those of skill in the art, and examples include
those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus,
including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector,
for example, enhancer sequences.
The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion
into a vector, such as the cloning vectors described above. Alternatively, the coding sequence can be cloned directly
into an expression vector which already contains the control sequences and an appropriate restriction site.
In some cases it may be necessary to modify the coding sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the proper reading frame. It may also be desirable to produce
mutants or analogs of the H. somnus protein of interest. Mutants or analogs may be prepared by the deletion of a
portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are
described in, e.g., Sambrook etal., supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra.
The expression vector is then used to transform an appropriate host cell. A number of mammalian cell lines are
known in the art and include immortalized cell lines available from the American Type Culture Collection (ATCC), such
as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney
cells (COS), human hepatocellular carcinoma cells [e.g., Hep G2), Madin-Darby bovine kidney ("MDBK") cells, as well
as others. Similarly, bacterial hosts such as E coli, Bacillus subtilis, and Streptococcus spp., will find use with the
present expression constructs. Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae,
Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for use with baculovirus
expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster,
Spodoptera frugiperda, and Trichoplusia ni.
Depending on the expression system and host selected, the proteins are produced by culturing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. The
protein is then isolated from the host cells and purified. If the expression system secretes the protein into the growth
media, the protein can be purified directly from the media. If the protein is not secreted, it is isolated from cell lysates.
The selection of the appropriate growth conditions and recovery methods are within the skill of the art.
10
EP 0 635 055 B1
5
10
15
20
25
30
35
40
45
so
55
The proteins may also be produced by chemical synthesis such as solid phase peptide synthesis, using known
amino acid sequences or amino acid sequences derived from the DNA sequence of the genes of interest. Such methods
are known to those skilled in the art. Chemical synthesis of peptides may be preferable if a small fragment of the antigen
in question is capable of raising an immunological response in the subject of interest.
The proteins or their fragments can be used to produce antibodies, both polyclonal and monoclonal. If polyclonal
antibodies are desired, a selected mammal, (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an antigen of the
present invention, or its fragment, or a mutated antigen. Serum from the immunized animal is collected and treated
according to known procedures. If serum containing polyclonal antibodies is used, the polyclonal antibodies can be
purified by immunoaffinity chromatography, using known procedures.
Monoclonal antibodies to the proteins, and to the fragments thereof, can also be readily produced by one skilled
in the art. The general methodology for making monoclonal antibodies by using hybridoma technology is well known.
Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct
transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., M. Schreier
etal., Hybridoma Techniques (1980); Hammerling etal., Monoclonal Antibodies and T-cell Hybridomas (1981); Kennett
et al., Monoclonal Antibodies (1980); see also U.S. Patent Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887;
4,452,570; 4,466,917; 4,472,500, 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against the
antigen of interest, or fragment thereof, can be screened for various properties; i.e.., for isotype, epitope, affinity, etc.
Monoclonal antibodies are useful in purification, using immunoaffinity techniques, of the individual antigens which they
are directed against.
Vaccine Formulations and Administration
The H. somnus proteins can be formulated into vaccine compositions, either alone or in combination with other
antigens, for use in immunizing subjects as described below. Methods of preparing such formulations are described
in, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, 15th edition, 1975.
Typically, the vaccines of the present invention are prepared as injectables, either as liquid solutions or suspensions.
Solid forms suitable for solution in or suspension in liquid vehicles prior to injection may also be prepared. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles. The active immunogenic
ingredient is generally mixed with a compatible pharmaceutical vehicle, such as, for example, water, saline, dextrose,
glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the vehicle may contain minor amounts
of auxiliary substances such as wetting or emulsifying agents and pH buffering agents.
Adjuvants which enhance the effectiveness of the vaccine may also be added to the formulation. Adjuvants may
include for example, muramyl dipeptides, avridine, aluminum hydroxide, oils, saponins, cytokines, and other substances known in the art.
The protein may be linked to a carrier in order to increase the immunogenicity thereof. Suitable carriers include
large, slowly metabolized macromolecules such as proteins, including serum albumins, keyhole limpet hemocyanin,
immunoglobulin molecules, thyroglobulin, ovalbumin, and other proteins well known to those skilled in the art; polysaccharides, such as sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine, and the like; amino acid copolymers; and inactive virus particles.
The protein substrates may be used in their native form or their functional group content may be modified by, for
example, succinylation of lysine residues or reaction with Cys-thiolactone. A sulfhydryl group may also be incorporated
into the carrier (or antigen) by, for example, reaction of amino functions with 2-iminothiolane or the N-hydroxysuccinimide ester of 3-(4-dithiopyridyl propionate. Suitable carriers may also be modified to incorporate spacer arms (such
as hexamethylene diamine or other bifunctional molecules of similar size) for attachment of peptides.
Other suitable carriers for the proteins include VP6 polypeptides of rotaviruses, or functional fragments thereof,
as disclosed in U.S. Patent No. 5,071 ,651 , incorporated herein by reference. Also useful is a fusion product of a viral
protein and the subject immunogens made by methods disclosed in U.S. Patent No. 4,722,840. Still other suitable
carriers include cells, such as lymphocytes, since presentation in this form mimics the natural mode of presentation in
the subject, which gives rise to the immunized state. Alternatively, the proteins of the present invention may be coupled
to erythrocytes, preferably the subject's own erythrocytes. Methods of coupling peptides to proteins or cells are known
to those of skill in the art.
Furthermore, the proteins (or complexes thereof) may be formulated into vaccine compositions in either neutral
or salt forms. Pharmaceutical^ acceptable salts include the acid addition salts (formed with the free amino groups of
the active polypeptides) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric
acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from free carboxyl groups
may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric
hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and
the like.
11
EP 0 635 055 B1
5
10
is
20
25
30
35
40
45
so
55
Injectable vaccine formulations will contain a "therapeutically effective amount" of the active ingredient, that is, an
amount capable of eliciting an immune response in a subject to which the composition is administered. The exact
amount is readily determined by one skilled in the art. The active ingredient will typically range from about 1% to about
95% (w/w) of the composition, or even higher or lower if appropriate. With the present vaccine formulations, 50 to 500
u.g of active ingredient per ml of injected solution should be adequate to raise an immunological response when a dose
of 1 to 3 ml per animal is administered. To immunize a subject, the vaccine is generally administered parenterally
usually by intramuscular injection. Other modes of administration, however, such as subcutaneous, intraperitoneal and
intravenous injection, are also acceptable. The quantity to be administered depends on the animal to be treated, the
capacity of the animal's immune system to synthesize antibodies, and the degree of protection desired. Effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response
curves. The subject is immunized by administration of the vaccine in at least one dose, and preferably two doses.
Moreover, the animal may be administered as many doses as is required to maintain a state of immunity to H. somnus
infection.
Additional vaccine formulations which are suitable for other modes of administration include suppositories and, in
some cases, aerosol, intranasal, oral formulations, and sustained release formulations. For suppositories, the vehicle
composition will include traditional binders and carriers, such as, polyalkaline glycols, or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w),
preferably about 1% to about 2%. Oral vehicles include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium, stearate, sodium saccharin cellulose, magnesium carbonate,
and the like. These oral vaccine compositions may be taken in the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders, and contain from about 10% to about 95% of the active ingredient,
preferably about 25% to about 70%.
Intranasal formulations will usually include vehicles that neither cause irritation to the nasal mucosa nor significantly
disturb ciliary function. Diluents such as water, aqueous saline or other known substances can be employed with the
subject invention. The nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and
benzalkonium chloride. A surfactant maybe present to enhance absorption of the subject proteins by the nasal mucosa.
Controlled or sustained release formulations are made by incorporating the protein into carriers or vehicles such
as liposomes, nonresorbable impermeable polymers such as ethylenevinyl acetate copolymers and Hytrel® copolymers, swellable polymers such as hydrogels, or resorbable polymers such as collagen and certain polyacids or polyesters such as those used to make resorbable sutures. The proteins can also be delivered using implanted mini-pumps,
well known in the art.
The proteins can also be administered via a carrier virus which expresses the same. Carrier viruses which will find
use with the instant invention include but are not limited to the vaccinia and other pox viruses, adenovirus, and herpes
virus. By way of example, vaccinia virus recombinants expressing the proteins can be constructed as follows. The DNA
encoding the particular protein is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter
and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used
to transfect cells which are simultaneously infected with vaccinia. Homologous recombination serves to insert the
vaccinia promoter plus the gene encoding the instant protein into the viral genome. The resulting TKrecombinant can
be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral-plaques resistant thereto.
An alternative route of administration involves gene therapy or nucleic acid immunization. Thus, nucleotide sequences (and accompanying regulatory elements) encoding the subject proteins can be administered directly to a
subject for in vivo translation thereof. Alternatively, gene transfer can be accomplished, by transfecting the subject's
cells or tissues ex vivo and reintroducing the transformed material into the host. DNA can'be directly introduced into
the host organism, i.e., by injection (see International Publication No. WO/90/11092; and Wolff etal., Science (1990)
247:1465-1468). Liposome-mediated gene transfer can also be accomplished using known methods. See, e.g., Hazinski etal., Am. J. Respir. Cell Mol. Biol. (1991) 4:206-209; Brigham etal., Am. J. Med. Sci. (1989) 298:278-281;
Canonico etal., Clin. Res. (1991) 39:21 9A; and Nabel etal., Science (1990) 249:1285-1288. Targeting agents, such
as antibodies directed against surface antigens expressed on specific cell types, can be covalently conjugated to the
liposomal surface so that the nucleic acid can be delivered to specific tissues and cells susceptible to H. somnus
infection.
Below are examples of specific embodiments for carrying out the present invention. The examples are offered for
illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
Example 6 describes the cloning and characterization of LppB. Example 9 describes the construction of leukotoxinLppB fusion proteins and Example 10 relates to their protective capacity. Example 8 is a comparative Example relating
to the protective capacity of LppB, LppB+LppA and LppA. Examples 1 to 5 and 7 relate to other H. somnus proteins
that may be included with LppB proteins in vaccine compositions according to the present invention.
12
EP 0 635 055 B1
Deposits of Strains Useful in Practicing the Invention
5
15
A deposit of biologically pure cultures of the following strains was made with the American Type Culture Collection,
12301 Parklawn Drive, Rockville, Maryland, under the provisions of the Budapest Treaty. The accession number indicated was assigned after successful viability testing, and the requisite fees were paid. The designated deposits will be
maintained for a period of thirty (30) years from the date of deposit, or for five (5) years after the last request for the
deposit, whichever is longer. Should a culture become nonviable or be inadvertently destroyed, or, in the case of
plasmid-containing strains, lose its plasmid, it will be replaced with a viable culture(s) of the same taxonomic description.
Strain
Deposit Date
ATCC No.
pRAP117 in E. co// J M105
pAA504 in E. co//MC1061
April 7, 1992
April 7, 1992
68952
68953
C. Experimental
Materials and Methods
20
25
30
35
40
45
so
Enzymes were purchased from commercial sources, and used according to the manufacturers' directions. Radionucleotides and nitrocellulose filters were also purchased from commercial sources.
In the isolation of DNA fragments, except where noted, all DNA manipulations were done according to standard
procedures. See Sambrook etal., supra. Restriction enzymes, T4 DNA ligase, E. coli, DNA polymerase I, Klenow
fragment, and other biological reagents can be purchased from commercial suppliers and used according to the manufacturers' directions. Double stranded DNA fragments were separated on agarose gels.
Bacterial strains, plasmids and growth condition.
Plasmid pHC79 was used to construct the cosmid library and is commercially available from Boeringer-Mannheim.
E. coli strain MC1061 is readily available.
E. co//DH5<x((|>80, /acZAM15, endM , recM , hsdRM (rk,mk+),supEAA, fftM, ,gyrA96, re/A1 A(/acZYA-argF),U169)
/'lacfrproAB+lacZA M15, Tn5(IKmR) ; and JM105 [endA-\, thi, rpsL, sbcB15, hsdRA, Alac-proAB), /F'fraD36, proAB+,
/ac|qZAM15)] are available commercially (i.e. Stratogene) and CC118 (aroD-\2>§, A{ara,leu)7697, AlacXIA, phoAA20,
gaE, galK, thi, rpsE, rpoB, argEam, recA~\) from C. Manoil, Harvard University (Manoil, C, and Beckwith, J. Proc. Natl.
Acad. Sci. USA (1985) 82:8129-8133).
E. coli strains were grown in Luria broth (LB) or M9 (Miller, J.H., Experiments in Molecular Genetics, (1972) Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York). Ampicillin was used at 100 u.g/ml and kanamycin at 25 u.g/
ml unless otherwise indicated.
H. somnus strain HS25 has been used in challenge experiments to induce experimental Haemophilosis in calves
(Harland, R.J., etal. Conf. Res. Work. Anim.. Dis. 71st (1990) 29:6). Growth conditions for strain HS25, the plasmid
pGH433, and the construction of the genomic library have been described (Theisen, M., and Potter, A.A. J. Bacteriol.
(1992) 174:17-23). For iron-restricted growth, Brain Heart Infusion broth (BHI-TT) (Difco Laboratories) containing 0.1%
Tris base and 0.001 % thiamine monophosphate was supplemented with the iron chelator 2,2-dipyridyl (Sigma Chemical
Co., St. Louis, Mo) to a final concentration of 100 uM Iron-replete bacteria were grown in BHI-TT containing 50 u.M
Fe(N03)3.
DNA techniques.
Restriction enzymes, Klenow fragment of E. co//DNA polymerase I, T4 DNA ligase, and exonuclease III were used
as recommended by the suppliers. DNA sequencing was accomplished by the chain termination method, essentially
as described by Messing, 1983 (Manoil, C, and Beckwith, J., Science (1986) 233:1403-1408). Primer extension was
performed as previously described (Theisen, M., etal. Infect. Immun. (1992) 60:826-831).
Screening of H. somnus genomic library.
55
Recombinant plasmids were transformed into E. coli strain JM105 and plated on LB agar plates containing 0.05%
Congo red (for LppB and LppC). After two days of incubation at 37°C approximately 0.5% of the colonies turned dark
red. Congo red binding colonies were picked and purified to single colonies on identical plates. One of each was then
tested for the expression of H. somnus antigens by the colony blot method (French, B.T., etal. Anal. Biochem. (1986)
13
EP 0 635 055 B1
156:417-423). LppA was screened by the colony blot method (French, B.T., et al. Anal. Biochem. (1986).
Transposon Tnphok mutagenesis.
5
10
15
20
25
Fusions of Ippk to Tnphok were created with Xv.Tnphok (Gutierrez, C, etal. J. Mol. Biol. (1987)J95:289-297). In
this system, alkaline phosphatase (AP) activity is only obtained if Tnphok transposes onto a DNA sequence in such
a way that AP is fused in frame and downstream of an expressed coding sequence containing appropriate membrane
insertional sequences (Hoffman, C.S., and Wright, A. Proc. Natl. Acad. Sci USA (1985) 82:5107-51 11 ; Manoil, C, and
Beckwith, J. Proc. Natl. Acad. Sci. USA (1985) 82:8129-8133; Manoil, C, and Beckwith, J. Science (1986) 233:
1403-1408). Plasmid pMS22 was transformed into strain CC118. The resulting strain was infected with X.. Tnphok and
grown for 15 hours at 30°C. Aliquots were plated on LB agar supplemented with 300 u.g/ml kanamycin, 100 u.g/ml
ampicillin, and 40 u.g/ml 5-bromo-4-chloro-3-indoyl phosphate (BCIP). The plates were incubated at 30°C for 2-3 days,
and plasmid DNA was extracted from five pools of blue colonies and used to transform CC118 cells. Individual AP+
(blue) colonies were isolated at 37°C and their plasmid DNA analyzed by restriction mapping.
PAGE and Immunoblotting.
SDS-PAGE of H. somnusand E. co//proteins was performed in the Laemmli system (Laemmli, U.K., Nature (1 970)
227:680-685) or by using the Tricine-SDS polyacrylamide gels with a 16.5%T, 6% C separating gel (Schagger, H., and
von Jagow, G. Anal. Biochem. (1987) 166:368-379). Transfer of proteins onto nitrocellulose membranes was performed
as recommended by the manufacturer. Blots were incubated with bovine serum diluted 1:500 with TBS-1 % BSA (1 OmM
Tris-CI pH 7.5, 140 mM NaCI) for two hours. The antisera used was bovine hyperimmune serum against live H. somnus
HS25 (Theisen & Potter, 1992) and rabbit serum against H. somnus OMPs. After three washes in TBS containing 0.5%
Tween 20, seroreactive proteins were detected with goat antibovine-IgG coupled to alkaline phosphatase (Kirkegaard
and Perry) at 1:5000 in TBS-1% BSA. Alkaline phosphatase activity was visualized using the NBT/BCIP system as
described by the supplier (Promega). Prestained or non-stained protein standards were obtained from BioRad.
Hybridization techniques.
30
35
40
Northern (RNA) blotting was performed as described by Maniatis. RNA was extracted from H. somnus and E. coli
by standard techniques (Theisen, M. and Potter, A.A. J. Bacteriol. (1992) 60:826-831) and electrophoresed through
1.5% agarose gels containing formaldehyde. Three micrograms of RNA was used per lane. The RNA was blotted to
nitrocellulose membrane and hybridized to DNA probes labelled at the 5'-end. After hybridization, blots were washed
twice in O.lxSSC, 0.5% SDS for two hours.
Analysis of plasmid encoded proteins.
Minicells were isolated from cultures of BD1854 containing the appropriate plasmids by centrifugation on a 5% 25% sucrose gradient, labelled with [35S]methionine, and subjected to SDS-PAGE. The proteins were electroblotted
on to nitrocellulose membrane and antigen was detected using hyperimmune serum against HS25. The position of the
labelled polypeptides was then determined by autoradiography of the western blot.
Labeling of proteins with [3H1palmitate.
45
so
55
E. coli strain DH5aF'IQ harboring the specified plasmids was grown in M63 medium supplemented with glycerol
(0.5% w/v) and casamino acids (2% w/v). H. somnus strain HS25 was grown in BHI-TT medium. To exponentially
growing cells (4x1 08 cells/ml), [3H]palmitate (5 mCi/ml) was added to a final concentration of 50 u.Ci/ml, and incubation
was continued for two hours. Labeling was terminated by precipitation with trichloroacetic acid (10% w/v) for 30 min
on ice. When indicated, globomycin (Sankyo Co. Tokyo, Japan) (10 mg/ml in dimethyl sulfoxide) was added at 100 u.g/
ml, 5 min prior to the addition of palmitate. Proteins were pelleted by centrifugation at 15000xg for 20 min, and the
pellets were washed twice with methanol to remove lipids. The dried pellets were resuspended in sample buffer and
analyzed by Tricine-SDS PAGE, the radiolabeled protein bands in the dried gel were detected by fluorography.
Oligonucleotide-directed mutagenesis.
A 33-residue synthetic oligonucleotide with the sequence 5'-TGTATTATTAGCAGCTGGTAATGAAAAAAATAA was
synthesized to alter the Cys-22 residue of the IppA protein (the underlined base differs from the wild-type sequence).
The point mutation in the resulting plasmid pMS67 was verified by DNA sequencing.
14
EP 0 635 055 B1
Example 1
Cloning and Characterization of H. somnus Haemin-Binding Protein and H. somnus Haemolysin
A genomic cosmid library of H. somnus HS25 DNA was constructed by cloning fragments, generated by partial
Sau3A restriction, into the BamHI site of the vector pHC79. The ligated DNA was packaged in vitro with a Lambda
packaging extract (Promega) and used to infect E. co//MC1061 . Ampicillin-resistant clones were stored at -70 degrees
C. This library was screened for clones which were capable of binding bovine haemin (Sigma) by plating cells on M9
minimal agar (Miller, J.H., Experiments in Molecular Genetics, (1972) Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York) supplemented with 0.01 % haemin. The formation of small dark colonies was indicative of haeminbinding. The library was also screened for clones which displayed haemolytic activity using sheep blood agar plates
from Oxoid, Canada. A number of clones exhibiting both the haemin-binding phenotype (Hb+) and the haemolytic
phenotype (Hly+). were obtained and two were selected for further study. The plasmid termed pRAP117 (ATCC Accession No. 68952) contained both the haemin-binding {hmb) gene and the haemolysin {hly) gene on a 25 kb insert
(Figure 1). Plasmid pAA504 (ATCC Accession No. 68953) contained the haemolysin {hly) gene. pRAP1 17 and pAA504
were subsequently shown to have similar restriction endonuclease digestion patterns and likely contained overlapping
regions of homology. This was confirmed by probing pAA504 DNA with an 8 kb Hindi 11fragment of pRAP117.
The hmb gene was subcloned by ligating the 8 kb Hindi 11fragment from pRAP117 into the vector pTZ19R (Pharmacia Canada Ltd.). This clone, termed pRAP401 (Figure 1), retained both the haemin-binding and haemolytic activity
of the parent. Subsequent subcloning in pTZ1 9R localized the Hb+, Hly- phenotype to a smaller 3 kb Xbal fragment.
This clone was termed pRAP501 (Figure 1). This clone bound haemin but was not haemolytic. Thus, the Wygene is
located at the distal end of the 8 kb Hindlll fragment shown in Figure 1.
Western blotting of the Hb+, Hly- clone with serum raised against HS25 outer membrane proteins (OMPs), detected
a protein having an apparent molecular mass of 50,000 kDa that comigrated with an iron-regulated protein from an
HS25 OMP-enriched fraction.
Example 2
Nucleotide Sequence Analysis of H. somnus Haemin-Binding Protein
Clone pRAP501 was used to generate Exonuclease III deletions for DNA sequence analysis and sequencing was
carried out on single-stranded DNA templates derived from these nested deletions. The sequence is shown in Figure
2. The open reading frames and ribosome binding sites are summarized in Table 1 and Figure 3. As can be seen, there
are a total of eight open reading frames which could code for the hmb gene. No significant open reading frames were
found in the opposite orientation.
Table 1
Predicted Open Reading Frames in Plasmid pRAP501
Position
Amino
ORF
From
To
Frame
Acids
2
5
3
8
1
4
6
7
29
735
1247
1475
1680
2209
2492
2778
628
1244
1459
1684
2213
2655
2782
END
2
3
2
2
3
1
2
3
200
170
71
70
178
149
97
>37
Example 3
Localization of the hmb Gene
In order to localize the hmb gene, two strategies were used:
15
Potential Ribosome Binding Sites
AGG
GGA
GAG
AGG
AGG
AGG
GGA
GGA
at
at
at
at
at
at
at
at
21
727
1236
1466
1672
21 98
2486
2767
EP 0 635 055 B1
(i) subcloning; and
(ii) transposon Tnphok mutagenesis.
5
10
15
20
A. Subcloning. pRAP501 DNA was digested with Xba\\Kpn~\, and the two fragments were ligated into pTZ18 to
give plasmids pPRAP503 and pRAP504. pRAP503 contained bases 1 through 1389 from pRAP501 (see Figure 2),
while pRAP504 contained the remainder of the insert. Cells containing pRAP504 were capable of binding haemin as
determined by plate bioassays, performed as described above, while those containing pRAP503 did not. Therefore,
the hmb gene was encoded by ORF1 , 4, 6, 7, or 8. ORF7 was ruled out due to its small size.
B. Transposon Tnphok mutagenesis. In order to localize the hmb gene further, transposon Tnphok mutagenesis
was employed. This technique is useful from two points of view:
(i) insertion in an open reading frame will eliminate the function of a gene product; and
(ii) in-frame fusion in an open reading frame coding for a secreted protein will result in blue colonies on BCIP agar
due to expression of alkaline phosphatase in the periplasm.
Mutagenesis of CC118/pRAP504 resulted in the isolation of three mutants, two of which were in ORF1 and the other
in ORF4. The phenotypes of these mutants are described in Table 2. These results indicate that ORF1 encodes the
hmb gene. The deduced amino acid sequence for the hmb gene is shown in Figure 4. The first 17 amino acids of this
protein represent a potential prokaryotic signal peptidase one signal sequence. The identification of ORF1 as the hmb
gene is supported by the observation that deletions constructed for DNA sequence analysis (see above) which extended
into this region abolished haemin-binding, while those outside of this open reading frame had no effect.
Table 2
Properties of Tnphok Fusions
Fusion
ORF
Hmb1
Color on BCIP agar
blue
1
p/7oA101
blue
1
phokm
white
4
phoMOO
+
1Hmb = hemin-binding phenotype
2 Location =site of insertion using base numbers from Figure 2
N.D. = not determined
Location (base #)2
1824
2100
N.D.
Example 4
Expression of hmb
The hmb gene was expressed in E. coli as a fusion to the P. haemolytica leukotoxin gene Iktk coded for by plasmid
pAA352 (ATCC Accession No. 68283). Plasmid pAA352 was digested with BamHI, treated with mung bean nuclease,
and, finally, calf intestinal phosphatase. Two restriction fragments containing the hmbqene were then inserted into this
vector. The first was a 1.2 kb Xmn~\\Sma\ fragment from pRAP501 , and the second was a 1.1 kb HincW fragment from
pRAP504. The former starts at the third amino acid residue of ORF1, while the latter starts at the 33rd amino acid
residue of the same open reading frame. These plasmids were named pGCH5 and pGCH4, respectively, and their
nucleotide plus amino acid sequences are shown in Figures 5 and 6, respectively.
Example 5
Cloning and Characterization of LppA
A. Cloning Ippk in E. coli
A genomic library of H. somnus HS25 DNA was constructed by cloning 2- to 7-kb fragments, generated by partial
Sau3k restriction, into the plasmid expression vector pGH433, and positive transformants were detected by the colony
blot method (French, B.T., et al. Anal. Biochem. (1986) 156:417-423) using antiserum against the H. somnus strain
HS25. Twenty-eight positive clones were identified and kept for further analysis. To identify the plasmid-encoded proteins reacting with the serum, whole cell lysatesof IPTG-inducedcell cultures were examined by PAGE and subsequent
Western blotting. Three plasmids encoding a seroreactive protein with an Mr of approximately 40,000 were identified.
16
EP 0 635 055 B1
s
One of these, with a DNA insert of 2-kb, was designated pMS22. Using the radiolabeled insert of pMS22 as a probe,
it was shown that the three plasmids contained common sequences, indicating that the 40 kDa recombinant proteins
were identical. AWestern blot of protein synthesized by E. co//JM105/pMS22 compared with cell fractions of H. somnus.
It is apparent that the seroreactive LppA protein is predominantly present in the outer membrane fractions of H. somnus
and that it comigrates with the recombinant 40 kDa protein. Moreover, serum from calves immunized with the recombinant LppA protein reacts strongly with the native 40 kDa OMP of H. somnus.
B. Analysis of recombinant plasmids
10
is
20
25
30
35
40
To subclone the Ippk gene and construct, plasmids suitable for exonuclease III degradation of the cloned region,
the Bgh\-Nco\ fragment of pMS22 was cloned into pTZ18R (Figure 8). Two plasmids, pMS63 and pMS65, with the
insert in opposite orientations, were obtained. Both expressed the LppA protein, indicating that the gene is transcribed
from a promoter located on the insert DNA. To generate a series of nested deletions, plasmids pMS63 and pMS65
were each cut at the unique Sad and SamHI sites (Figure 8) and subjected to exonuclease degradation, removal of
overhang by S1 nuclease, and religation. A number of plasmids were analyzed, the extent of the degradation (as judged
by restriction mapping or DNA sequencing) was compared with the phenotype (Figure 8). It appears from this deletion
experiment that the Ippk gene is located between the deletion endpoints of d.3 and d.8.1 because plasmids with a
larger insert are LppA+, whereas plasmids with deletion going further into the insert are LppA". This is true with one
exception, namely d.10, which produces a seroreactive truncated version of the LppA protein with an Mr of approximately 37,000 (data not shown). DNA sequencing of the deletion endpoints of the two plasmids revealed that in d.1 0,
the a-peptide of lad. is fused in frame with the Ippk ORF (see below), thereby allowing the gene to be transcribed
from lad? or another vector-encoded promoter and translation from the /acZ translational start site. In contrast, /acZ
in d.9 is fused out of frame with the Ippk ORF.
c. DNA sequencing and analysis
The complete DNA sequence of both strands of Ippk was determined by the dideoxy method with modified T7
DNA polymerase and single-stranded DNA as the template. The sequence is shown in Figure 7. Only one ORF sufficiently long to encode the Ippk gene product is present on the sequenced DNA. It begins with an ATG codon located
at position 791 -793 and terminates with the TAAstop codon at position 1532-1534. This ORF would encode a polypeptide with a molecular weight of 27,072. The ATG start codon is preceded by a purine-rich sequence AATGAG (underlined bases are complementary to 16 S rRNA), which serves as a ribosome binding site in E. coli (Theisen, M., and
Potter, A.A. Infect. Immun. (1992), in press).
The proposed reading frame was confirmed by sequencing two independent Ippk. Jnphok gene fusions (see
Figure 7). Further proof that the indicated ORF was Ippk was obtained by subcloning the Dral fragment of pMS22
(Figure 8) into the Smal site of pTZ18R and generating pMS83 and pMS84, with the insert in opposite orientations.
Dral cuts 209 base pairs upstream of the putative ATG start codon and immediately downstream of the TAAstop codon.
The Ippk protein was expressed in JM105 harboring both plasmids. The N-terminal part of the predicted polypeptide
strongly resembles a signal peptide, and the amino acid sequence Leu-Leu-Ala-Ala-Cys at position 842-856 is highly
homologous to the consensus cleavage site found in bacterial lipoproteins (von Gabin, A., et al. Proc. Natl. Acad. Sci.
USA (1983) 80:652-657).
D. Identification of the 5' terminus of Ippk mRNA.
45
so
The 5' terminus of the Ippk transcript was determined by primer extension mapping. The DNA used as primer was
a synthetic 5'-end labeled oligonucleotide complementary to nucleotides between 817 and 835. mRNA was isolated
from the H. somnus strain HS25 and the two E. coli strains JM105/pMS65(LppA+)and JM105/pGH433 (LppA"). One
major Ippk transcript beginning with the A residue at position 756 (Figure 7), is produced in both HS25 and
JM105/pMS65. No product was observed in cells harboring the plasmid vector pGH433. A Pribnowboxand -35 region,
characteristic of E. co//promoters (Harley, C.B., and Reynolds, R.P Nuc. Acids Res. (1 987) 15:2343-2361 ), are located
at positions 744 through 749 (TATGCT) and position 722 through 727 (TTATCA), respectively.
E. Post-translational modification of the LppA protein.
55
Because the deduced amino acid sequence of the LppA protein contains a sequence identical to the consensus
sequence Leu-Ala(Gly)-Ala(Gly)-Cys for lipid modification in E. coli (von Gabin etal., 1983), the Ippk gene product
may be a lipoprotein. In order to test whether the LppA protein was lipid modified, [3H]palmitate was incorporated into
H. somnus HS25 and the two E. coli strains, DH5aF'IQ/pMS65 and DH5aF'IQ/pTZ1 8R. Proteins from whole cell lysates
17
EP 0 635 055 B1
5
10
15
were separated by PAGE and transferred to nitrocellulose membranes. The IppA gene product was identified by immunoblotting with antiserum against HS25. At least ten H. somnus proteins were labeled with palmitate. One of these
was a 40 kDa protein which reacted strongly with H. somnus antiserum, showing that it was the IppA gene product.
Palmitate was also incorporated into the recombinant IppA gene product since a radiolabeled, immunoreactive 40 kDa
protein comigrating with the LppA protein from HS25 was detected in cells harboring pMS65 but not in the plasmid
vector pTZ18R. Thus, the H. somnus IppA gene product is lipid modified in E. coli. Treatment of cells with globomycin
leads to the accumulation of unprocessed lipoprotein, and both the natural H. somnus LppA and recombinant LppA
protein are predominantly present as a larger, putative precursor form in globomycin-treated cells.
To determine if lipid modification of the LppA protein occurs at the cysteine residue Cys-22, the cysteine codon
(TGT) was changed to a glycine codon (GGT) generating plasmid pMS67. Cells harboring pMS67 were LppA+. However, only a seroreactive protein comigrating with the larger precursor form was detected in a Western blot. Globomycin
did not alter the mobility of the mutated LppA protein, indicating that the mutated LppA protein was no longer a substrate
for signal peptidase II. Moreover, this protein was not labeled with palmitate, showing that lipid modification occurs at
the Cys-22 residue.
Example 6
Cloning and Characterization of LppB
20
25
30
35
40
45
so
55
A. Cloning of the gene for LppB
A genomic library in plasmid pGH433, constructed as described above, was transformed into JM105 and among
several thousand ampicillin-resistant transformants approximately 0.1% were found to bind Congo red on Congo red
agar plates (Crb+). The E. coli strain JM105 had only a modest ability to bind Congo red on these plates. Twenty Crb+
transformants were screened with hyperimmune serum in a colony blot assay, and five were found to be seroreactive.
Western blots (immunoblots) of proteins from whole cells separated on polyacrylamide gels showed that one transformant contained a plasmid (pMS10) encoding an approximately 60 kDa seroreactive protein, three transformants
contained plasmids (pMS11, pMS14 and pMS15) encoding an approximately 40 kDa seroreactive protein, and one
contained a plasmid (pCRx) coding for a 15 kDa antigen. The radiolabeled DNA insert from pMS11 was found to
hybridize to pMS14, pMS15 and H. somnus, but not to plasmids pMS10 and pCRx, indicating that the three 40 kDa
proteins were identical, but different from the 60 kDa and 15 kDa antigens. Also, the same insert did not hybridize to
plasmid pMS22, encoding LppA (Theisen etal, 1992) showing that pMS11 encodes a novel 40 kDa protein.
Both JM105/pMS11 and JM105/pMS10 form small dark colonies on minimal plates containing .01% hemin, suggesting that the 40 kDa and 60 kDa proteins could be hemin-binding.
B. Location of the gene for LppB
The 1.9 kb insert isolated from pMS11 was subcloned in the Sma\ site of pTZ18R using E. co//JM105 as the host
strain. Two plasmids, pMS92 and pMS96, were obtained, carrying the insert in opposite orientations. LppB was expressed from both plasmids indicating that IppB is transcribed from a promoter located on the insert DNA. The addition
of 2 mM IPTG to the growth medium increased IppB expression from pMS11 approximately four fold (as judged by a
western blot) indicating that IppB was on the DNA insert. The indicated plasmids were transformed into a minicell
producing strain, and plasmid encoded proteins were analyzed by PAGE. The plasmids pMS11, pMS92 and pMS105
all encode an LppB protein. Thus, LppB must be located downstream on the AhaW site at base 641 in Figure 9.
C. Nucleotide sequence analysis
To generate a series of nested deletions for sequencing, plasmids pMS92 and pMS96 were each cut at the unique
Sad and SamHI sites present in the vector, subjected to exonuclease degradation, removal of the overhangs by S1
nuclease and religation. Figure 9 shows the sequence of the entire chromosomal fragment. Two large ORFs were
identified on the insert. The first ORF starts with an ATG codon at nucleotide 256 and ends with a TAA codon at
nucleotide 829. Immediately downstream of this ORF is located a second ORF beginning with an ATG codon at position
872 and ending with a TAA codon at position 1708. The latter appears to correspond to the IppB gene since it is located
downstream of the AhaW site at position 641 in Figure 9 and therefore, contained on plasmid second which expressed
LppB in the minicell experiment. Upstream from this ORF, there is a putative ribosome binding site GGAG and a seven
base pair A/T rich spacer followed by the potential ATG start codon.
The DNA sequence was searched for nucleotide sequence homology in Genbank release 65. Sequences from
position 1590 to the end of the cloned DNA in Figure 9 showed 65.5% identity with the kalF promoter region from E.
18
EP 0 635 055 B1
coli (Mulvey & Loewen, 1989). The katF gene product is a putative sigmafactor which positively regulates catalase
HPII (katE) and exonuclease III (xth) expression (Sask et al. 1989). It is interesting that H. somnus has sequences
similar to katF because it lacks catalase activity (Sample & Czuprynsky, 1991).
5
D. Amino Acid sequence analysis
10
The ORF in the nucleotide sequence designated IppB encoded 279 amino acid residues, as
9. The molecular mass of the deduced protein was calculated to be 31307 Daltons. There is a
region from amino acids 1 to 13 followed by a lipoprotein box, Leu-Ala-Ala-Cys, at the predicted
cleavage site. The hydrophobic-lipoprotein-box sequences strongly resembles the signal peptide
proteins, including the recently characterized lipoprotein LppA from H. somnus.
The lipid nature of LppB was confirmed as described above.
15
20
25
30
35
40
indicated in Figure
short, hydrophobic
signal peptidase II
of procaryotic lipo-
Example 7
Cloning and Characterization of LppC
A genomic library of H. somnus DNA was constructed in E. coli using the expression vector pGH433, as described
above. This library was screened for clones able to bind Congo red by plating cells on LB agar supplemented with
ampicillin and 0.05% dye. After two days of incubation at 37°C, approximately 0.1% of the colonies turned dark red.
Twenty of these colonies were screened with hyperimmune serum against H. somnus in a colony blot assay, and five
clones were found to be seroreactive. Western blot analysis of these clones showed that three produced a 40,000 MW
protein (LppB; pMS11, pMS14, pMS15), while the other two coded for proteins with molecular weights of 15,000
(pCRR22) and 60,000 (LppC; pMS10). Since Congo Red can act as an analog of porphyrin compounds and one of
these clones (pMS10) produced a protein similar in size to other bacterial transferrin receptors, this clone was characterized in more detail.
The DNA insert was subcloned into the vectors pTZ1 8R and pTZ1 9R and overlapping deletions were constructed
using exonuclease III. The nucleotide sequence of the insert was then determined using the chain termination method
and is shown in Figure 10. An open reading frame starting at nucleotide 108 and ending at nucleotide 1850 codes for
a protein with a predicted molecular weight of approximately 65,000. The first 21 amino acids of this protein code for
a typical procaryotic signal sequence and therefore the DNA coding for the mature protein likely starts at nucleotide
171 . This protein has a predicted molecular weight of 63,336, close to the 60,000 MW observed on polyacrylamide
gels. This difference can be accounted for by the observation that LppC is lipid modified at the first cysteine of the
mature peptide. The predicted amino acid sequence of the mature peptide is shown in Figure 11 .
Another construct, pCRR27, was made by taking the insert from pMS1 0 and subcloning into the vector pTZ1 8R,
giving rise to pCRR26. A Hind\\\ digest of pCRR26 was subcloned into the Hind\\\ site of pGH432, resulting in plasmid
pCRR27. This construct gives a high level of expression of LppC.
The lipid nature of the molecule was confirmed as described above.
Example 8
Protective Capacity of LppB, LppB+LppA (Examples) and LppA (Comparative Example)
45
so
55
A. Antigen Preparation.
The LppA and LppB antigens were extracted from strains JM105/pMS88 and JM105/pMS103, respectively. Bacteria were grown to mid-log phase in one liter of L-broth supplemented with 50 u.g/ml of ampicillin. When the absorbance
at 600 nm reached 0.6, isopropyl-p,D-thiogalactoside (IPTG) was added to a final concentration of 1 mM and the
cultures were incubated with vigorous agitation for 2 h at 37°C. The bacteria were harvested by centrifugation, resuspended in 40 ml of 25% sucrose/50 mM Tris-HCI buffer (pH 8) and frozen at -70°C. The frozen cells were thawed at
room temperature and 10 ml of lysozyme (10 mg/ml in 250 mM Tris-HCI, pH 8) was added. After 15 minutes on ice,
300 ml of detergent mix (5 parts of 20 mM Tris-HCI, pH 7.4/300 mM sodium chloride/2% deoxycholic acid/2% NonidetP40 and 4 parts of 100 mM Tris-HCI, pH 8/50 mM EDTA/2% Triton X-100) were added. The viscosity was reduced by
sonication and protein aggregates were harvested by centrifugation at 27,000 X g for 15 minutes. The pellets were
dissolved in a minimal volume of 4 M guanidine hydrochloride. The proteins were analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis and the protein concentration was estimated by comparing the intensity of the
Coomassie blue-stained bands to a bovine serum albumin standard.
19
EP 0 635 055 B1
B. Vaccine Formulation.
5
Each vaccine dose was prepared by mixing 100 u.g of antigen, alone and in combination, with Emulsigen Plus so
that the final volume was 2 ml with an adjuvant concentration of 33% (v/v). Placebo doses were prepared by combining
sterile saline with Emulsigen Plus as described above. Each vaccine was mixed by sonication and stored in sterile
vaccine vials at 4°C.
C. Immunization.
10
All calves were immunized with 2 ml of vaccine administered by intramuscular injection. After three weeks, all
animals received a second vaccination as described above. The serological response to vaccination was monitored
using serum samples collected prior to vaccination, on the day of the second vaccination, and 10-12 days after the
second vaccination.
is
D. Vaccine Trial 1.
20
The objective of this experiment was to determine the serological response to vaccination with two vaccines according to the invention, one comprising LppB and one comprising both LppA + LppB, and, for comparison, with LppA
and a placebo. Four of six calves were immunized with these vaccines as described above and the serological response
was determined using an enzyme-linked immunosorbent assay (ELISA). The results shown in Table 3 indicate that
both antigens elicited an immune response, with LppB being the better of the two. No interference was observed when
both antigens were present in the same vaccine.
25
E. Vaccine Trial 2.
30
The objective of this vaccine trial was to determine the protective capacity of LppA (Comparative Example) and
LppB using an experimental challenge model. Three groups of eight calves each were vaccinated with LppA, LppB or
a placebo formulated as described above. Twelve days after the second vaccination, all animals were challenged by
intravenous inoculation of 1 X 108 cfu of H. somnus strain HS25. Animals were examined daily for clinical signs of
disease for 12 days post-challenge. The results are summarized in Tables 4 to 10. Immunization with LppA reduced
the severity of some of the clinical signs of Haemophilosis, including lameness and the daily sick score, while immunization with LppB significantly reduced all clinical signs of disease. Therefore, while both antigens appear to be useful
immunogens for the prevention of H. somnus disease, LppB appears to provide improved results over LppA.
35
Example 9
Construction of Leukotoxin-LppB Fusion Proteins
40
45
A gene fusion consisting of the P. haemolytica leukotoxin gene (IktA), found in plasmid pAA352 (ATCC Accession
No. 68283) and LppB, was made in order to increase expression levels. Plasmid pAA352 was digested with BamHI,
treated with mung bean nuclease and dephosphorylated with calf intestinal phosphatase. The plasmid pMS11 (described above), containing IppB, was digested with Mae\ and Acc\, and the resulting .855 kb fragment was filled in with
DNA polymerase I klenow fragment and ligated into the pAA352 vector. Following transformation, clones which reacted
with rabbit antisera against LppB in a colony immunoblot were selected, and one such clone, JM105/pCRR28, was
shown to produce an IPTG-inducible protein of the correct molecular weight. The predicted nucleotide and amino acid
sequence of this fusion is shown in Figure 11 .
Example 10
so
Protective Capacity of LktA::LppB
55
Avaccine trial was conducted using the leukotoxin-LppB fusion protein from Example 9, in order to test its protective
capacity. The recombinant protein was prepared from inclusion bodies as described in Example 8. The inclusion bodies
were solubilized in 0.5% sodium dodecyl sulfate, and the unbound detergent was removed by dialysis against four
litres of tris buffered saline for 48 hours. The proteins were analyzed by SDS-PAGE as described by Laemli (1970),
and the protein concentration was estimated by comparing the intensity of the Coomassie blue-stained band to a bovine
serum albumin standard (Pierce Chemical Co., Rockford, Illinois). The antigen was formulated in VSA such that the
final concentration was 100 u.g per ml of LktA::LppB, 30% Emulsigen Plus, 0.9% Tween-80, and 2.5 mg per ml of DDA.
20
EP 0 635 055 B1
5
10
The dose volume was 2 cc containing 200 u.g of recombinant antigen.
Three groups of eight calves each were included in the trial, and these received the LppB fusion protein vaccine,
Somnu-Star (formulated in VSA, obtained from BIOSTAR Inc.) as a positive control and, finally, a placebo. The vaccination and challenge schedule was as described in Example 8. The results of the trial are summarized in Table 11,
and it can be seen that vaccination with Somnu-Star or LktA:LppB reduced mortality, clinical score, and weight loss.
These results confirm that LppB is a protective antigen of H. somnus, and that fusion of the gene coding for LppB to
the P. haemolytica leukotoxin does not diminish its protective capacity. Since H. somnus and P. haemolytica vaccines
are often formulated together as combination products, this antigen has a further benefit of reducing production costs
for such a vaccine.
Thus, H. somnus immunogenic LppB protein analogues thereof, immunogenic fragments thereof, and chimeric
proteins are disclosed, as are methods of making and using the same. Although preferred embodiments of the subject
invention have been described in some detail, it is understood that obvious variations can be made as defined by the
appended claims.
21
EP 0 635 055 B1
o
o
O VO
o in
CO fN
O
O
»D
1
«—
O
O
*D
—
i1
O
O O
VD ©
o
O
*r
VO
O
O
N
CI
o
o
VO
in
CM
O
o
T
rsl
O
i-(
o
o
*r
VO
o
O
V
VD
o
o
vo
iH
0)
c
0
o
4J
O
Z
o
O
N
W
O O O O
O O O O
VD VO (N
o
O O O O O O
O O O O V O O
N f 1/1 (N
<t
vo vo r*> vo f>J n
o
o
f
CM
O i
h
o
o
{NJ
0"N
- t
oo
o o
o o o
1" CO o
<N T <N
O O i H ^
h n if)
o
O O O O
O
o o o o o
o o o o o o
(0 * O
VOOOOCMVO
in o *r
in vo tN cm ih in
cncmvo
fNr-tnriintM
o
O O
o o ^
VO
© in
cnmi
o
O
a
o
O
r
N
o
H
o
o
o o o
f M O O
o t *r
H ID lO
•
• O O O O
Q O O O O Q
*r ^ vo •
•
«HZ
Z VO VO
o
o o o
V D O O
in *r r\
N IC n
iHrHtHHHrH
(N <N <N (NI <M CM
L,
t
i
;
;
O oo n
rsi r*> in vo vo oo
tt o>
rN (N (N O 00 CO
(N CM f*l 0v 0> 0>
tH <H iH
^fHiHr-trHiH
- iH i-H
22
EP 0 635 055 B1
Efa
O O O O
0 0 0 0
CN <N VO «N
oi
01
i-ttHOrH
0000900
O
O
P)
<n
«-l
CO
O
O
N
o\
t-l
CO
o O
O O O O
VO 00 O
Of « N
O O «H
« n in
o
O
CO
*
O
on
O O
O O O O O
O O O CO VO
N N N « m
H » H H O O
in in in <n 9
O
N
rH
in
O O
O O O O
O © fM 9
CO oo n VO
u
0)
4J
■H
Eh
<
a
a
O
O O
O VO
00 H
O O O O
O O O O
N N N N
o>
m oi
r-l H r-l «H
CO CO CO CO
o
O
O O O O
VO O O VO
H O 00 H
O O O O O O O O
O O O O O
O O O O
N f N V
CN 9 9 9
m (M 0\ N
0\CNCg«N
t H O r H o r
r - 1 0 0 0
CO «-l CO H
00 i-H H •-(
0 0 0
0 0 0 0
9 9 0 1 0
CN CN <J» CN
O O rH •—1
H H 00 in
O
O
00 N
g o
iH «-l
0 0 0
0 0 0
CN 9
ff\ C\l
H O
(0 rl
9
fN
O
rl
O
O O O
9 O O
V0 CO 9
O
O
VO
in
(N
O
O
O
9
VO
O
9
IN
O
rH
O
O
9
V0
O
O O
O CN
VO CTl
in «H
CN CO
m
n
n
n
9
© cn ci c*r i n n r i
H i-l H H
O
9
9
O
O
VO
H
O
O
9
IB
9
9
0
5>
C
0
• o
0
O
(N
H
IT
O
O
9
V0
9
o> «h
00 »h in
cn 0 n co co 0>
iHf-tiHr-ti-lr-t
Table 4.
ne Trial #2: Cumulative Weight Change Per Group
Placebo
-10.4
Vac LppA
-7.7
23
VacLppB
-3.5
m
a
a
•J
+
<.
Q.
a
t-l
11
9
a„
JJ
^
0 <^ O
(U a a
r - i a a
O, J iJ
0 11 11 11
c
»h <n n
II
„ a~
a_ a,
' 2 5 5 2
Q p p p O
* *j *i *i J*
2 O U U U
EP 0 635 055 B1
Table 4. (continued)
Vaccine Trial #2: Cumulative Weight Change Per Group
Placebo
-8.6
-10.4
-14.4
-10.8
-16.2
-22
-22.8
-24.6
-23.8
-24
-27.4
Day
2
3
4
5
6
7
8
9
10
11
12
Vac LppA
-6.3
-9.9
-13.7
-9.4
-12.7
-18.4
-17.2
-20.7
-21.5
-22.5
-24.5
VacLppB
-3.5
-4.3
-7.1
-4.3
-7.8
-11.9
-12.4
- 14.4
-14.7
- 15.6
- 16.7
Mean
-2.28333
-2.041667
-1.391667
Max
-27.4
-24.5
- 16.7
Table 5.
Vaccine Trail #2: Average Daily Temperatures Per Group
Placebo
Day
Vac LppA
VacLppB
1
2
3
4
5
6
7
8
9
10
11
12
39.91
39.53
39.56
39.2
39.3
38.98
39.16
39.22
38.98
39
39.2
39.38
39.69
39.47
39.64
39.43
39.25
39.08
39.15
39.12
39.35
39.42
39.37
39.13
39.3
39.3
39.33
39.18
39.41
39.06
39.15
38.86
38.95
38.83
38.98
38.86
Mean
39.285
39.34167
39.10083
Max
39.91
39.69
39.41
Table 6.
Vaccine Trial #2: Average Daily Lameness Score Per Group
Placebo
Day
1
2
3
4
5
6
7
8
9
0
Vac LppA VacLppB
0
0
0.143
0.083
0
0.167
0.333
0.583
0.583
0.25
0.2
0.2
0.2
0.3
0.9
1.1
1
24
0
0
0.063
0.125
0.188
0.25
0.25
0.375
0.688
EP 0 635 055 B1
Table 6. (continued)
Vaccine Trial #2: Average Daily Lameness Score Per Group
Placebo
1
1
1.1
Day
10
11
12
Vac LppA VacLppB
0.5
0.625
0.167
0.5
0.583
0.438
Mean
0.604167
0.261833
0.291833
Max
1.1
0.583
0.688
Table 7.
Vaccine Trial #2: Average Daily Sick Score Per Group
Day
Placebo
Vac LppA
VacLppB
1
2
3
4
5
6
7
8
9
10
11
12
0.3
0.5
0.4
0.3
0.2
0.2
0.5
0.6
0.7
0.6
0.7
0.8
0.2
0.1
0.5
0.3
0.2
0.3
0.3
0.5
0.7
0.7
0.4
0.3
0.1
0.1
0
0
0.1
0.1
0.2
0.1
0.6
0.3
0.3
0.2
Mean
0.483333
0.375
0.175
Max
0.8
0.7
0.6
Table 8.
Vaccine Trial #2: Daily Number of Calves with Fevers*
Day
Placebo
Vac LppA
VacLppB
1
2
3
4
5
6
7
8
9
10
11
12
3
1
2
1
0
0
0
1
0
0
1
0
3
1
Daily Maximum
3
1
2
1
25
1
1
1
1
1
Total
9
* Temperature > = 40.0
2
2
1
1
0
0
0
0
0
0
0
0
0
0
3
1
17
2
EP 0 635 055 B1
Table 9.
Vaccine Trial #2: Daily Number of Calves Sick*
Placebo
Day
Vac LppA
VacLppB
1
2
3
4
5
6
7
8
9
10
11
12
4
4
5
4
4
4
6
7
7
7
7
7
4
2
3
4
3
4
4
5
6
6
5
4
1
1
0
0
1
1
2
1
5
3
3
2
Daily Maximum
7
6
5
46
19
Total
62
* Clinical Sick Score > 0
(Dead animals counted as sick)
Table 10.
Vaccine Trial #2: Summary of Clinical Findings
Protection Against H. somnus Challenge by Subunit Vaccines
Vaccines
Calves
Placebo
Vaccine LppA
Vaccine LppB
8
8
8
Died
Sick
3
2
0
7
7
5
Febrile
5
5
2
Table 11.
Summary of the LktA::LppB Vaccine trial
Mortality
Mean clinical score
Weight change (kg)
Placebo
2/8
1.13
-5.75
5,800
8,694
Somnu-Star
0/8
0.38
-2.38
3,201
115,057
LktA:LppB
0/8
0.75
-2.25
85,730
29,373
Group
50
Claims
1.
55
Serological response
Somnu-Star
LppB
A vaccine composition comprising a pharmaceutical^ acceptable vehicle and a recombinant, immunogenic Haemophilus somnus protein, capable of eliciting a protective immune response against Haemophilus somnus, which
protein may be lipidated or non-lipidated and comprises
(a) an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
(b) an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
(c) an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
26
EP 0 635 055 B1
(d) a fragment of an amino acid sequence according to (a), (b) or (c).
5
10
is
20
25
2.
A vaccine composition as claimed in claim 1, in which the protein is either non-lipidated or is lipidated by a lipid
moiety not normally found in association with the protein.
3.
A vaccine composition as claimed in claim 1, in which the protein is lipidated by a lipid moiety usually found in
association with the protein.
4.
A vaccine composition as claimed in any one of claims 1 to 3, which further comprises an adjuvant.
5.
A vaccine composition as claimed in any one of claims 1 to 4, in which the amino acid sequence of (a), (b), (c) or
(d) is fused to a non-Haemophilus somnus amino acid sequence.
6.
A vaccine composition as claimed in claim 5, wherein the non-Haemophilus somnus amino acid sequence is an
amino acid sequence for the P. haemolytica leukotoxin.
7.
A vaccine composition as claimed in claim 6, wherein the protein has the sequence shown in Figure 11 .
8.
A vaccine composition as claimed in anyone of claims 1 to 7, which also comprises a Haemophilus somnus protein
other than a protein comprising an amino acid sequence as set out in (a), (b), (c) or (d) of claim 1.
9.
A method of producing a vaccine composition, said method comprising:
(1) culturing a transformed host cell, the host cell having been transformed with a recombinant vector, under
conditions whereby the protein encoded by the coding sequence present in said recombinant vector is expressed, the recombinant vector comprising:
(i) a nucleotide sequence comprising a coding sequence for an immunogenic Haemophilus somnus protein
capable of eliciting a protective immune response against Haemophilus somnus, which protein comprises
30
(a) an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
(b) an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
(c) an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or
(b); or
(d) a fragment of an amino acid sequence according to (a), (b) or (c);
and
35
(ii) control sequences that are operably linked to said nucleotide sequence whereby said coding sequence
can be transcribed and translated in a host cell, and at least one of said control sequences is heterologous
to said coding sequence; and
40
(2) admixing the expressed protein with a pharmaceutical^ acceptable vehicle.
45
50
55
10. A method as claimed in claim 9, which also comprises transforming a host cell with the recombinant vector to
obtain the transformed host cell.
11. Use of a recombinant, immunogenic Haemophilus somnus protein in the manufacture of a vaccine for treating or
preventing Haemophilus somnus infection in a vertebrate subject, the protein being capable of eliciting a protective
immune response against Haemophilus somnus, being lipidated or non-lipidated and comprising
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
12. Use of a recombinant, immunogenic Haemophilus somnus protein in the manufacture of a vaccine for the treatment
of or prevention of thromboembolic meningoencephalitis, septicemia, arthritis, pneumonia, myocarditis, pericarditis, spontaneous abortion, infertility and/or mastitis caused by infection with Haemophilus somnus, the protein
27
EP 0 635 055 B1
being capable of eliciting a protective immune response against Haemophilus somnus, being lipidated or nonlipidated and comprising
(a)
(b)
(c)
(d)
5
10
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
13. The invention of any one of claims 9 to 12, wherein the protein comprises an amino acid sequence according to
(a), (b), (c) or (d) fused to a non-Haemophilus somnus amino acid sequence.
14. The invention as claimed in claim 13, wherein the non-Haemophilus somnus amino acid sequence is an amino
acid sequence for the P.haemolytica leukotoxin.
is
15. The invention as claimed in claim 13, wherein the protein has the sequence shown in Figure 11.
16. A recombinant carrier virus capable of expressing an immunogenic Haemophilus somnus protein, capable of eliciting a protective immune response against Haemophilus somnus, which protein comprises
20
25
30
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
17. A vaccine composition comprising a pharmaceutical^ acceptable vehicle and a recombinant carrier virus as
claimed in claim 16.
18. A vaccine composition as claimed in claim 17, in which the carrier virus is a poxvirus, advantageously the vaccina
virus, an adenovirus or a herpes virus.
19. A pharmaceutical preparation suitable for nucleic acid immunization, which preparation comprises a pharmaceutical^ acceptable carrier and a nucleic acid sequence encoding an immunogenic Haemophilus somnus protein,
capable of eliciting a protective immune response against Haemophilus somnus, which protein comprises
35
(a)
(b)
(c)
(d)
an amino acid sequence shown at positions 1 to 279, inclusive, of Figure 9; or
an amino acid sequence shown at positions 17 to 279, inclusive, of Figure 9; or
an amino acid sequence which is at least 90% homologous to the amino acid sequence of (a) or (b); or
a fragment of an amino acid sequence according to (a), (b) or (c).
40
Patentanspriiche
1.
45
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von (a) oder
(b), oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c).
so
55
Impfzusammensetzung, umfassend ein pharmazeutisch vertragliches Vehikel und ein rekombinantes, immunogenes Haemophilus somnus-Protein, das in der Lage ist, eine protektive Immunantwort gegen Haemophilus somnus hervorzurufen, wobei das Protein lipidiert oder nicht-lipidiert sein kann und umfaBt
2.
Impfzusammensetzung nach Anspruch 1, wobei das Protein entweder nicht-lipidiert ist oder mit einer Lipidgruppe
lipidiert ist, die normalerweise nicht in Gesellschaft mit dem Protein gefunden wird.
3.
Impfzusammensetzung nach Anspruch 1, wobei das Protein mit einer Lipidgruppe lipidiert ist, die normalerweise
in Gesellschaft mit dem Protein gefunden wird.
28
EP 0 635 055 B1
Impfzusammensetzung nach einem der Anspruche 1 bis 3, die daruber hinaus ein Adjuvans umfaBt.
Impfzusammensetzung nach einem der Anspruche 1 bis 4, wobei die Aminosauresequenz von (a), (b), (c) oder
(d) mit einer Aminosauresequenz verknupft ist, die nicht von Haemophilus somnus stammt.
Impfzusammensetzung nach Anspruch 5, wobei die Aminosauresequenz, die nicht von Haemophilus somnus
stammt, eine Aminosauresequenz fur das Rhaemolvtica-Leukotoxin ist.
Impfzusammensetzung nach Anspruch 6, wobei das Protein die in Figur 11 dargestellte Sequenz aufweist.
Impfzusammensetzung nach einem der Anspruche 1 bis 7, die noch ein Haemophilus somnus-Protein umfaBt,
das ein anderes Protein ist, als dasjenige, das eine Aminosauresequenz umfaBt, die in (a), (b), (c) oder (d) von
Anspruch 1 dargestellt ist.
Verfahren zum Herstellen einer Impfzusammensetzung, wobei das Verfahren umfaBt:
(1) Zuchten einer transformierten Wirtszelle, wobei die Wirtszelle mit einem rekombinanten Vektor unter Bedingungen transformiert worden ist, bei denen dasjenige Protein exprimiert wird, das durch die in dem rekombinanten Vektor vorliegende Codierungssequenz codiert wird, wobei der rekombinante Vektor umfaBt:
(i) eine Nukleotidsequenz, umfassend eine Codierungssequenz fur ein immunogenes Haemophilus somnus-Protein, das in der Lage ist, eine protektive Immunantwort gegen Haemophilus somnus hervorzurufen, wobei das Protein umfaBt
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt
ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt
ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von
(a) oder (b), oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c),
und
(ii) Kontrollsequenzen, die funktionsfahig verknupft sind mit der Nukleotidsequenz, wobei die Codierungssequenz in eine Wirtszelle transkribiert und translatiert werden kann, und wobei mindestens eine der
Kontrollsequenzen zu der Codierungssequenz heterolog ist, und
(2) Mischen des exprimierten Proteins mit einem pharmazeutisch vertraglichen Vehikel.
Verfahren nach Anspruch 9, das daruber hinaus das Transformieren einer Wirtszelle mit dem rekombinanten Vektor
umfaBt, urn die transformierte Wirtszelle zu erhalten.
Verwendung eines rekombinanten, immunogenen Haemophilus somnus-Proteins bei der Herstellung eines Impfstoffes zur Behandlung oder Verhinderung einer Haemophilus somnus-lnfektion in einem Vertebraten, wobei das
Protein, das in der Lage ist, eine protektive Immunantwort gegen Haemophilus somnus hervorzurufen, lipidiert
oder nicht-lipidiert ist und umfaBt
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von (a) oder
(b), oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c).
Verwendung eines rekombinanten, immunogenen Haemophilus somnus-Proteins bei der Herstellung eines Impfstoffes zur Behandlung oder zur Prevention von thromboembolischer Meningoencephalitis, Septikamie, Arthritis,
Pneumonie, Myocarditis, Pericarditis, spontanem Abort, Infertilitat und/oder Mastitis, die durch Infektion mit
Haemophilus somnus verursacht werden, wobei das Protein in der Lage ist, eine protektive Immunantwort gegen
Haemophilus somnus hervorzurufen, und wobei das Protein lipidiert oder nicht-lipidiert ist und umfaBt
29
EP 0 635 055 B1
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von (a) oder
(b) , oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c).
5
13. Erfindung nach einem der Anspruche 9 bis 12, wobei das Protein eine Aminosauresequenz entsprechend (a), (b),
(c) oder (d), verknupft mit einer Aminosauresequenz, die nicht von Haemophilus somnus stammt, umfaBt.
10
14. Erfindung nach Anspruch 13, wobei die Aminosauresequenz, die nicht von Haemophilus somnus stammt, eine
Aminosauresequenz fur das Phaemolytica-Leukotoxin ist.
15. Erfindung nach Anspruch 13, wobei das Protein die in Figur 11 dargestellte Sequenz aufweist.
is
16. Rekombinanter Carriervirus, der in der Lage ist, ein immunogenes Haemophilus somnus-Protein zu exprimieren,
das in der Lage ist, eine protektive Immunantwort gegen Haemophilus somnus hervorzurufen, wobei das Protein
umfaBt
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von (a) oder
(b) , oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c).
20
25
30
35
17. Impfzusammensetzung, die ein pharmazeutisch vertragliches Vehikel und einen rekombinanten Carriervirus nach
Anspruch 16 umfaBt.
18. Impfzusammensetzung nach Anspruch 17, bei der der Carriervirus ein Pockenvirus, vorteilhafterweise der Vaccina-Virus, ein Adenovirus oder ein Herpesvirus ist.
19. PharmazeutischeZubereitung, die zur Nucleinsaureimmunisierung geeignet ist, wobei dieZubereitung einen pharmazeutisch vertraglichen Trager und eine Nucleinsauresequenz umfaBt, die ein immunogenes Haemophilus somnus-Protein codiert, das in der Lage ist, eine protektive Immunantwort gegen Haemophilus somnus hervorzurufen,
wobei das Protein umfaBt.
(a) eine Aminosauresequenz, die durch die Positionen 1 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(b) eine Aminosauresequenz, die durch die Positionen 17 bis einschlieBlich 279 von Figur 9 dargestellt ist, oder
(c) eine Aminosauresequenz, die zu mindestens 90% homolog ist zu der Aminosauresequenz von (a) oder
(b), oder
(d) ein Fragment einer Aminosauresequenz entsprechend (a), (b) oder (c).
40
Revendications
45
1. Composition de vaccin comprenant un vehicule acceptable en pharmacie et une proteine immunogene recombinee
de Haemophilus somnus, capable de declencher une reponse immunitaire protectrice contre Haemophilus somnus, laquelle proteine peut etre lipidee ou non lipidee, et comprend :
(a)
(b)
(c)
(a)
(d)
so
55
une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides amines de
ou (b) ; ou
un fragment d'une sequence d'acides amines selon (a), (b) ou (c).
2.
Composition de vaccin selon la revendication 1, dans laquelle la proteine est soit non lipidee soit lipidee par un
fragment lipidique qui ne se trouve normalement pas en association avec la proteine.
3.
Composition de vaccin selon la revendication 1, dans laquelle la proteine est lipidee par un fragment lipidique se
30
EP 0 635 055 B1
trouvant habituellement en association avec la proteine.
Composition de vaccin selon I'une quelconque des revendications 1 a 3, qui comprend en outre un adjuvant.
Composition de vaccin selon I'une quelconque des revendications 1 a 4, dans laquelle la sequence d'acides amines
de (a), (b), (c) ou (d) estfusionnee a une sequence d'acides amines non Haemophilus somnus.
Composition de vaccin selon la revendication 5, dans laquelle la sequence d'acides amines non Haemophilus
somnus est une sequence d'acides amines pour la leucotoxine P. haemolytica.
Composition de vaccin selon la revendication 6, dans laquelle la proteine a la sequence presentee sur la Figure 11 .
Composition de vaccin selon I'une quelconque des revendications 1 a 7, qui comprend aussi une proteine de
Haemophilus somnus autre qu'une proteine comprenant une sequence d'acides amines telle qu'indiquee en (a),
(b), (c) ou (d) de la revendication 1.
Procede pour produire une composition de vaccin, ledit procede comprenant :
(1) la mise en culture d'une cellule hote transformee, la cellule hote ayant ete transformee par un vecteur de
recombinaison, dans des conditions grace auxquelles la proteine codee par la sequence codante presente
dans ledit vecteur de recombinaison est exprimee, le vecteur de recombinaison comprenant :
(i) une sequence de nucleotides comprenant une sequence codante pour une proteine immunogene de
Haemophilus somnus capable de declencher une reponse immunitaire protectrice contre Haemophilus
somnus, laquelle proteine comprend :
(a) une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure
9 ; ou
(b) une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure
9 ; ou
(c) une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides
amines de (a) ou (b) ; ou
(d) un fragment d'une sequence d'acides amines selon (a), (b) ou (c) ;
et
(ii) des sequences de commande qui sont liees de facon operationnelle a ladite sequence de nucleotides,
grace auxquelles ladite sequence codante peut etre transcrite ou traduite dans une cellule hote, et au
moins I'une desdites sequences de commande est heterologue de ladite sequence codante ; et
(2) melanger la proteine exprimee avec un vehicule acceptable en pharmacie.
Procede selon la revendication 9, qui comprend aussi la transformation d'une cellule hote avec le vecteur de
recombinaison pour obtenir la cellule hote transformee.
Utilisation d'une proteine immunogene recombinee de Haemophilus somnus dans la fabrication d'un vaccin pour
traiter ou prevenir une infection par Haemophilus somnus chez un sujet vertebre, la proteine etant capable de
declencher une reponse immunitaire protectrice contre Haemophilus somnus, etant lipidee ou non limitee, et
comprenant :
(a)
(b)
(c)
(a)
(d)
une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides amines de
ou (b) ; ou
un fragment d'une sequence d'acides amines selon (a), (b) ou (c).
Utilisation d'une proteine immunogene recombinee de Haemophilus somnus dans la fabrication d'un vaccin pour
le traitement ou la prevention de meningoencephalite thromboembolique, de septicemie, d'arthrite, de pneumonie,
de myocardite, de pericardite, d'avortement spontane, d'infertilite et/ou de mastite, provoques par une infection
31
EP 0 635 055 B1
par Haemophilus somnus, la proteine etant capable de declencher une reponse immunitaire protectrice contre
Haemophilus somnus, etant lipidee ou non lipidee, et comprenant :
5
10
15
20
25
(a)
(b)
(c)
(a)
(d)
une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides amines de
ou (b) ; ou
un fragment d'une sequence d'acides amines selon (a), (b) ou (c).
13. Invention selon I'une quelconque des revendication 9 a 12, dans laquelle la proteine comprend une sequence
d'acides amines selon (a), (b), (c) ou (d) fusionnee a une sequence d'acides amines non Haemophilus somnus.
14. Invention selon la revendication 13, dans laquelle la sequence d'acides amines non Haemophilus somnus est une
sequence d'acides amines pour la leucotoxine P. haemolytica.
15. Invention selon la revendication 13, dans laquelle la proteine a la sequence presentee sur la Figure 11 .
16. Virus porteur de recombinaison capable d'exprimer une proteine immunogene de Haemophilus somnus, capable
de declenche une reponse immunitaire protectrice contre Haemophilus somnus, laquelle proteine comprend :
(a)
(b)
(c)
(a)
(d)
une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides amines de
ou (b) ; ou
un fragment d'une sequence d'acides amines selon (a), (b) ou (c).
17. Composition de vaccin comprenant un vehicule acceptable en pharmacie et un virus porteur de recombinaison
selon la revendication 16.
30
35
40
18. Composition de vaccin selon la revendication 17, dans laquelle le virus porteur est un poxvirus, avantageusement
le virus de la vaccine, un adenovirus ou un herpesvirus.
19. Preparation pharmaceutique convenant a une immunisation paracides nucleiques, laquelle preparation comprend
un porteur acceptable en pharmacie et une sequence d'acides nucleiques codant pour une proteine de Haemophilus somnus, capable de declencher une reponse immunitaire protectrice contre Haemophilus somnus, laquelle
proteine comprend :
(a)
(b)
(c)
(a)
(d)
une sequence d'acides amines presentee en positions 1 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines presentee en positions 17 a 279, bornes comprises, de la Figure 9 ; ou
une sequence d'acides amines qui est homologue a au moins 90 % de la sequence d'acides amines de
ou (b) ; ou
un fragment d'une sequence d'acides amines selon (a), (b) ou (c).
32
EP 0 635 055 B1
L- '
PRAP1 17
'
1
H m b Hly
1 kb
H m b Hly
pRAP401
Hmb
pRAP50l
FIGURE
33
1
EP 0 635 055 B1
40
20
30
10
*
•
»
»
*
*
•
*
•
TCTAGAAGTTTCAGCGAAAAAGGCACAT ATG CAA GAA GAA CGC ATA CTT
AGATCTTCAAAGTCGCTTTTTCCGTGTA TAC GTT CTT CTT GCG TAT GAA
Met Gin Glu Glu Arc; He Leu>
>
ORF 2
a
a
a
a
90
80
70
£0
100
50
*
*
*
*
•
*
•
*
»
*
•
AGC GAA GCG ACG GAA TAC GAA AGA ATG TTG TAT CTT CTT GCA CGC CAT AAA
TCG CTT CGC TGC CTT ATG CTT TCT TAC AAC ATA GAA GAA CGT GCG GTA TTT
Ser Glu Ala Thr Glu Tyr Glu Arg Met Leu Tyr Leu Leu Ala Arg His Lys>
ORF2
a
>
a
a
a
a
a
a
a
a
a
a_ a
a
a
120
130
140
ISO
110
*
*
*
*
*
*
*
*
*
*
AAG GAT TTA AAA CAA ATT CAT TCT ATG GCG TTA AAA GCG GAC TAC AAA AAG
TTC CTA AAT TTT GTT TAA GTA AGA TAC CGC AAT TTT CGC CTG ATG TTT TTC
Lys Asp Leu Lys Gin He His Ser Met Ala Leu Lys Ala Asp Tyr Lys Lys>
ORF2
>
a
a
a
a
a
a
a
a
a
a
a
a
a
a
160
170
180
190
200
*
•
»
*
*
*
*
»
•
•
AAC ATT TTA CCG GAT TAT TTA CCT TGG ATA GAG GGA GCG TTA AGT AGT GCA
TTG TAA AAT GGC CTA ATA AAT GGA ACC TAT CTC CCT CGC AAT TCA TCA CGT
Asn He Leu Pro Asp Tyr Leu Pro Trp He Glu Gly Ala Leu Ser Ser Ala>
ORF2
a
a
a
a
>
a
a
a
a
a
a
a
a
a
a
220
230
210
*
*
*
*
*
AGT GGC AAA CAA GAT AAC GTC TTA ATG
TCA CCG TTT GTT CTA TTG CAG AAT TAC
Ser Gly Lys Gin Asp Asn Val Leu Met
ORF2
a
a
a
a
a
a
a
240
250
•
*
*
*
.*
ACA TGG CTA ATT TGG TTA ATA GAC
TGT ACC GAT TAA ACC AAT TAT CTG
Thr Trp Leu He Trp Leu He Asp>
>
a
a
a
a
a
a_ a
280
290
260
270
300
•
*
*
*
*
•
*
*
*
*
TGT GAG CAA TAT CAC CTC GCA TTA CAA ATT GCC GAC TAT GCT ATA CAT CAA
ACA CTC GTT ATA GTG GAS CGT AAT GTT TAA CGG CTG ATA CGA TAT GTA GTT
Cys Glu Gin Tyr His Leu Ala Leu Gin He Ala Asp Tyr Ala He His Gln>
ORF2
>
a
a
a
a
a
a
a
a
a
a
a
a
a
a
330
320
340
350
310
*
*
*
•
*
*
*
*
*
*
•
GGA TTA GTA TTG CCC GAA AAC TTT AAC CGC ACC TTA TGT TCT GCC CTA GCG
CCT AAT CAT AAC GGG CTT TTG AAA TTG GCG TGG AAT ACA AGA CGG GAT CGC
Gly Leu Val Leu Pro Glu Asn Phe Asn Arg Thr Leu Cys Ser Ala Leu Ala>
ORF2
>
a
a
a
a
a
a
a
a
a
a
a
a
a
a
380
390
370
400
360
• •
•
•
•
•
•
•
•
*
GAA GAA TTT GCC GAT AAA GCC AAA ATT GCA CAA AAA CTT AAC CGC CCT TTT
CTT CTT AAA CGG CTA TTT CGG TTT TAA CGT GTT TTT GAA TTG GCG GGA AAA
Glu Glu Phe Ala Asp Lys Ala Lys He Ala Gin Lys Leu Asn Arg Pro Phe>
ORF 2
>
a
a
a
a
a
a
a
a
a
a
a
a
a
a
FIGURE
34
2
EP 0 635 055 B1
410
420
430
440
450
«
*
*
*
•
*
*
•
•
•
GAC GTG GCT TAT TTA GAA CGA GTA GCG AAC CTC ACT GAT GAC CAA GAT ATA
CTG CAC CGA ATA AAT CTT GCT CAT CGC TTG GAG TGA CTA CTG GTT CTA TAT
Asp Val Ala Tyr Leu Glu Arc; Val Ala Asn Leu Thr Asp Asp Gin Asp Xle>
a
a
a
•
ORF2
a
a
a
•
a
*
•
a
a
a
>
460
470
460
*
*
•
•
*
CCG GAT GAA AGT AGA GCG AGG CTT TAT
GGC CTA CTT TCA TCT CGC TCC GAA ATA
Pro Asp Glu Ser Arg Ala Arg Leu Tyr
a
a
a
a
ORF2
a
a
a
490
500
*
*
*
*
*
AGA GAA ATC GGA CTA TTA AAG CTC
TCT CTT TAG CCT GAT AAT TTC GAG
Arg Glu Zle Gly Leu Leu Lys Leu>
a
a
a
a
>
a
a
a
310
520
530
540
550
•
»
«
*
*
*
*
•
«
»
ACA TCA GCA CCG CAA ACC GCC TTA GCC TAC TTG GAA AAG GCA TTA GAA CTG
TGT AGT CGT GGC GTT TGG CGG AAT CGG ATG AAC CTT TTC CGT AAT CTT GAC
Thr Ser Ala Pro Gin Thr Ala Leu Ala Tyr Leu Glu Lys Ala Leu Glu Leu>
a
a
a
a
a
a
a
ORF2_
a
a
a
a
a
a
>
a
560
570
580
590
€00
€10
*
*
*
*
»
*
»
*
*
•
•
AAT TTA AAT ATT GGC GTT CAA GGA GAT GTA AAA AAA TTG CGA AAA CAA TTA
TTA AAT TTA TAA CCG CAA GTT CCT CTA CAT TTT TTT AAC GCT TTT GTT AAT
Asn Leu Asn Zle Gly Val Gin Gly Asp Val Lys Lys Leu Arg Lys Gin Leu>
a
a
a
ORF2
a
a
a
a
a
a
a
a
a
>
a
a
620
630
640
650
660
•
*
*
*
«
*
*
•
»
*
ACG CAA GAA AAT CCC CGC TGAACACGAAACAGAGCAACCTAGCCCAAGCCA
TGC GTT CTT TTA GGG GCG ACTTGTGCTTTGTCTCGTTGGATCGGGTTCGGT
Thr Gin Glu Asn Pro Arg>
a
>
a
a_ORF2 a
670
680
690
700
710
*
•
*
«
•
»
•
»
•
«
AGCGAGGCGGAAAGTAAAGGTTTTTTGCCTCATCACTTTCCTCACCTCGCT
TCGCTCCGCCTTTCATTTCCAAAAAACGGAGTAGTGAAAGGAGTGGAGCGA
720
730
740
750
760
•
«
»
*
*
«
•
«
*
*
TTTTTACAGTTAAAGGAACATC ATG TAT AAC AGC ATC GCC ATC AAA AAA
fcAAAATGTCAATTTCCTTGTAG TAC ATA TTG TCG TAG CGG TAG TTT TTT
Met Tyr Asn Ser He Ala He Lys Lys>
b
b
b
ORF 5
b
b
>
b
770
780
790
800
810
*
•
»
*
*
•
*
*
*
»
3TC AAA AAT TAC GCC ATG GAC GAC TTA AAA CGA CAG GCG GAA GAA CAA GCA
:AG TTT TTA ATG CGG TAC CTG CTG AAT TTT GCT GTC CGC CTT CTT GTT CGT
/al Lys Asn Tyr Ala Met Asp Asp Leu Lys Arg Gin Ala Glu Glu Gin Ala>
b
b
b
b
b
b
b
ORF 5
b
b
b
b
b
b
b
>
FIGURE
2 CONTINUED
15
EP 0 635 055 B1
830
640
620
•
*
*
*
•
ACA GAT AAC GAA ACA ATC CAA AAC AAC
TGT CTA TTG CTT TGT TAG GTT TTG TTG
Thr Asp Asn Glu Thr He Gin Asn Asn
b
b
b
b
b
b
ORF 5
b
850
6 60
«
•
«
•
4
GGC TTT TTC CCT GAT ATT CAT TTA
CCG AAA AAG GGA CTA TAA GTA AAT
Gly Phe Phe Pro Asp lie His Leu>
b
b
b
b
b
b
b
>
660
890
670
900
910
»
•
•
•
«
•
•
*
»
■
CTT GAT GTA AGA AAT GCA ATG CGA ATA GAC GGA ACG GTA ACG AAT GAA CGG
GAA CTA CAT TCT TTA CGT TAC GCT TAT CTG CCT TGC CAT TGC TTA CTT GCC
Leu Asp Val Arg Asn Ala Met Arg H e Asp Gly Thr Val Thr Asn Glu Arg>
b
b
b
b
b
b
b
ORF5
b
b
b
b
b
b
b
>
920
930
940
950
960
*
•
•
«
»
•
*
*
*
•
*
TTG AAA ATG GAA GTT ATC GAA GCC ATG GCA ACC GCT AAC AAC GCC TTA AAA
AAC TTT TAC CTT CAA TAG CTT CGG TAC CGT TGG CGA TTG TTG CGG AAT TTT
Leu Lys Met Glu Val He Glu Ala Met Ala Thr Ala Asn Asn Ala Leu Lys>
b
b
b
b
b
b
b
ORFS
b
b
b
b
b
b
b
>
970
960
990
1000
1010
»
*
«
*
*
»
*
*
»
•
CAT TAC CAA AAA ACC CTA AAA GAA AAA CAC ATT CAT CGC CTT GAA GAC ATG
GTA ATG GTT TTT TGG GAT TTT CTT TTT GTG TAA GTA GCG GAA CTT CTG TAC
His Tyr Gin Lys Thr Leu Lys Glu Lys His He His Arg Leu Glu Asp Met>
b
b
b
b
b
b
b
b
ORF 5
b
b
b
b
b
b
>
1020
1030
1040
1050
1060
*
*
•
•
*
*
*
*
•
*
GAT GAC GAA AAA ATC AAC GGC GAA AAT ATC GTA ATA CAA CGC TAC AAA AGA
CTA CTG CTT TTT TAG TTG CCG CTT TTA TAG CAT TAT GTT GCG ATG TTT TCT
Asp Asp Glu Lys He Asn Gly Glu Asn He Val Zle Gin Arg Tyr Lys Arg>
b
b
b
b
b
b
b
ORF5
b
b
b
b
b
b
b
>
1070
1080
1090
1100
1110
•
•
•
•
•
»
*
«
GCG GTG TAT TGT TTC GCC TTA GCC AAT TTA AAC GAA CGC TAT CGC TCA TAC
CGC CAC ATA ACA AAG CGG AAT CGG TTA AAT TTG CTT GCG ATA GCG AGT ATG
Ala Val Tyr Cys Phe Ala Leu Ala Asn Leu Asn Glu Arg Tyr Arg Ser Tyr>
b
b
b
b
b
b
ORFS
b
b
b
b
b
b
b
b
>
1120
1130
1140
1150
•
*
•
*
•
•
•
GAC ACC ACC AAA CAA GGG GCG GAA AAA GCA CAG GAC
CTG TGG TGG TTT GTT CCC CGC CTT TTT CGT GTC CTG
Asp Thr Thr Lys Gin Gly Ala Glu Lys Ala Gin Asp
ORF5
b
b
b
b
b
b
b
b
b
b
1160
•
*
«
TTT GAA CAA AGC GTA
AAA CTT GTT TCG CAT
Phe Glu Gin Ser Val>
b
b
b
b
>
1180
1190
1200
1170
1220
1210
•
•
•
•
•
•
•
•
*
»
•
GAT GAT TTA AGA CGT GAC GGA CGC TTT GCT ATC CGC GAT ATA GTA GGA CAA
CTA CTA AAT TCT GCA CTG CCT GCG AAA CGA TAG GCG CTA TAT CAT CCT GTT
Asp Asp Leu Arg Arg Asp Gly Arg Phe Ala He Arg Asp He Val Gly Gln>
b
b
b
b
ORFS
b
b
b
b
b
b
b
b
>
b
b
FIGURE
2 CONTINUED
36
:P 0 635 055 B1
1^/0
126U
1250
1240
1230
* *
*
*
*
*
*
*
*
*
IAC AGA ATG ATA GTA GAG TTA ATC TA ATG GCA AGA ATG GTT TAT GCA AAA
iTG TCT TAC TAT CAT CTC AAT TAG AT TAC CGT TCT TAC CAA ATA CG* TTT
lia Arg Met He Val Glu Leu I l e >
>
b
b
b ORF 5 b
b
b
Met Ala Arg Met Val Tyr Ala Lys>
>
c
c
c
c
c_ORF 3 c
u^u
1300
1310
1290
1280
* »
*
•
•
*
*
•
•
•
:AA AAC GAC ACA CTA GAT AGC ATT GTC TAT CGT TAT TTT GGG AAA ACG CTT
5TT TTG CTG TGT GAT CTA TCG TAA CAG ATA GCA ATA AAA CCC TTT TGC GAA
51n Asn Asp Thr Leu Asp Ser He Val Tyr Arg Tyr Phe Gly Lys Thr Leu>
>
c
c
c
c
ORF 3
c
c
c
c
c
c
c
c
c
c
1340
1330
•
•
•
•
5GC TTA GTA GAA CAC GTA
:CG AAT CAT CTT GTG CAT
Jly Leu Val Glu His Val
c
c c
c
c
c
u'u
I3bu
1350
*
*
•
•
•
•
TTG GAG CTA AAC CCA ACA TTA GCC AAC TTA CCA
AAC CTC GAT TTG GGT TGT AAT CGG TTG AAT GGT
Leu Glu Leu Asn Pro Thr Leu Ala Asn Leu Pro>
>
c
c
c
c
ORF3
c
c
c
c
istu
1410
140 J
1400
1390
1380
*
*
*
*
>
*
*
*
*
*
HTC CTC GCC ATT GGT ACC GTC GTT ATC rTG CCT AAT AGT GAA GAT ATA CAA
rAG GAG CGG TAA CCA TGG CAG CAA TAG ^AC GGA TTA TCA CTT CTA TAT GTT
tie Leu Ala He Gly Thr Val Val H e Leu Pro Asn Ser Glu Asp He Gln>
>
c
c
c
c
ORF 3_
c
c
c
c
c
c
c
c
c
c
1460
14/0
1450
1440
1430
*
*
*
*
*
*
•
•
•
*
«iCC ACC ACC AAC AAA AAT ACA TTG AGT TTA TGG GAT TAAATGAGGTTTAAC
rGG TGG TGG TTG TTT TTA TGT AAC TCA AAT ACC CTA ATTTACTCCAAATTG
rhr Thr Thr Asn Lys Asn Thr Leu Ser Leu Trp Asp>
>
c
c
c
c
c
c ORF3 c
c
c
c
15^0
1510
1500
1490
1480
*
*
•
•
•
*
*
*
*
•
ATC
GCC
TCT
TAT
GGA
SCG
GTC
GGG
ACA
ACA
ATG TTA AAA AAT AGT GAA
TAC AAT TTT TTA TCA CTT TGT TGT CCC CGC ATA CAG CCT AGA CGG TAG
Met Leu Lys Asn Ser Glu Thr Thr Gly Ala Tyr Val Gly Ser Ala He
d
d
d
d
d
d
d
ORF 8
d
d
d
d
d
d
d
•
GCC
CGG
Ala>
>
13/0
1560
1550
1540
1530
*
*
*
*
*
*
*
*
*
*
TTA
ATT
TTT
ATC
GGT
GCA
TGG
GCT
GAC
GCA
TTG
ACC
TTT
ATT TAT AGC GGC
TAA ATA TCG CCG AAA TGG AAC CGT CTG ACC CGT CGA TAG AAA CCA TAA AAT
He Tyr Ser Gly Phe Thr Leu Ala Asp Trp Ala Ala He Phe Gly He Leu>
>
d
d
d
d
d
d
d
d
ORF 8_
d
d
d
d
d
d
1620
1610
1600
1590
1580
*
*
*
*
*
*
*
*
*
■
GAA ATC
AAC
TAC
AAA
AAA
TAT
TGG
ATT
AAC
CTG
ATG
ACC
TTT
TTA
TTT GGC
CTT TAG
TTT
TTG
TTT
ATG
ACC
ATA
TTG
TAA
GAC
AAA CCG AAT AAA TGG TAC
Phe Gly Leu Phe Thr Met Leu He Asn Trp Tyr Tyr Lys Asn Lys Glu I l e >
>
d
d
d
d
d
d
d
d
ORF 8.
d
d
d
d
d
d
FIGURE
2 CONTINUED
37
:P 0 635 055 B1
1650
1640
630
•
*
*
•
*
.
CAA
AAA
CTC
GAA
ACC
GCA
AAA
AAA TTA
TTT AAT TTT CTT TGG CGT GAG TTT GTT
Lys Leu Lys Glu Thr Ala Leu Lys Gin
ORF B
d
d
d
d
d
d
d
1700
1690
.680
«
»
•
*
*
•
JAT GAA T AAA TTC ACA AAA TGG GGG
5TA CTT A TTT AAG TGT TTT ACC CCC
lis Glu>
>
d
"Eet~Asn
Lys Phe Thr Lys Trp Gly
HMB GENE
e
e
e
e e
e
16/0
1660
*
«
•
*
AAG ATT GAC TTA AAG GAA GGC GAC
TTC TAA CTG AAT TTC CTT CCG CTG
Lys He Asp Leu Lys Glu Gly Asp>
d d >
d d d d d
l
1710
»
*
•
•
ACA GGG GCT ATT TGT AGC GTA GTT
TGT CCC CGA TAA ACA TCG CAT CAA
Thr Gly Ala He Cys Ser Val Val>
>
e
e
e
e
e
(ORFl)_e
1//0
1760
1750
1740
L730
*
*
*
*
*
»
* *
•
*
ATA
AGT
CAA
CGC
TTA
GAG
CAA
AAC
CAT
GCA
AAA
GTC
GCC ATT ATT GCC CTT
CGG TAA TAA CGG GAA CAG TTT CGT TTG GTA GTT CTC AAT GCG TAT TCA GTT
Ala Zle Zle Ala Leu Val Lys Ala Asn His Gin Glu Leu Arg Zle Ser Gln>
>
e
e
e
e
e
e
e HMB GENE (ORF1)
e
e
e
e
e
1800
1790
L780
*
•
*
•
*
*
•
:AA GGC TTA GAC CTT ATA GGA AAT GTA GAA
3TT CCG AAT CTG GAA TAT CCT TTA CAT CTT
31n Gly Leu Asp Leu He Gly Asn Val Glu
e HMB GENE (ORF1)
e
e
e
e
e
1B2U
»
*
*
GGT TGC AGA AGA GAC CCC TAT
CCA ACG TCT TCT CTG GGG ATA
Gly Cys Arg Arg Asp Pro Tyr>
>
e
e
e
e
e
e
1B10
ibbu
1B70
I860
1850
1840
L830
*
*
*
*
»
*
«
*
•
•
*
CAC TGC CCC GCC GAC GTC TTA ACG GTG GGC ATA GGC TCC ACG GAA GCA AAC
GTG ACG GGG CGG CTG CAG AAT TGC CAC CCG TAT CCG AGG TGC CTT CGT TTG
His Cys Pro Ala Asp Val Leu Thr Val Gly He Gly Ser Thr Glu Ala Asn>
>
e
e
e
e
e
e
e
e HMB GENE (ORF1)
e
e
e
e
isju
1920
1910
1900
1890
*
«
*
*
*
»
•
*
*
•
CAA
GCC
GAA
ATA
GAC
AAA
AGC
CGT
TAT
AAA
CCT
AAA
GAC
ATT
AAC
GGA AAA
CCT TTT TTG TAA CTG GGA TTT TTT GCA ATA TCG CTG TTT CTT TAT CGG GTT
Gly Lys Asn He Asp Pro Lys Lys Arg Tyr Ser Asp Lys Glu He Ala Gln>
>
e
e
e
e
e
e
e
e
e
e_HMB GENE (ORF1)
e
e
I960
1950
1940
,
»
*
*
•
*
AGA TGG GCA TAT GAT TTA CGC CTG GCG GAA
TCT ACC CGT ATA CTA AAT GCG GAC CGC CTT
Arg Trp Ala Tyr Asp Leu Arg Leu Ala Glu
e
e
e_HMB GENE (ORF1)
e
e
e
FIGURE
lsou
1970
»
*
*
*
CAA TGC GTA AAC CGC TAT GGA
GTT ACG CAT TTG GCG ATA CCT
Gin Cys Val Asn Arg Tyr Gly>
>
e
e
e
e
e
e
2 CONTINUED
38
cr U DOS UOO D I
-'"
»wvw
tuiv
2U20
2030
•
•
•
•
•
•
*
.
.
.
AAC GGC AAA AAT CTA CCG CAA GGG GCG TTT GAT GCC TTT GTT TCC
ATT » r r
TTG CCG TTT TTA GAT GGC GTT CCC CGC AAA CTA CGG AAA CAA
Aan Gly Lys Asn Leu Pro Gin Gly Ale Phe Asp Ale Phe Val AGG TAA TGG
Ser lie Thr>
• _ « _ _ _ « _ « _ _ « _ H M B GENE (ORFl)
e
e
e
e
e %
>
~
*v-v
*uov
2070
2080
#
^
^
TGT GGA AAA ATG CAA AAA AGC ACC TTA TTT AAA CAA
FIT 2£T GT* ^
ACA Sf* T T TAC G " T " TCG TGG AAT AAA J?? GTT tGCA
il
S i £*?
Phe Asn Val Gly Cys Gly Lys Met Gin Lys Ser Thr Leu
Phe Lys Gin Ala>
•
•
e
e
•
e_HMB GENE (ORFl)
e
e
e
e
e
>
e
2120
2130
GXA £5°. TTT ACC CCT M
CTC TGT CAC CAG TTT GAA CGC
rTG GTT CCG AAA TGG GGA GTT GAG ACA GTG GTC AAA CTT GCG TGG ATT TAC
ACC TAA ATG
tsn Gin Gly Phe Thr Pro Gin Leu Cys His Gin Jhe Glu
i% n J JJ?>
Arg
•
e _ « _ e _ _ e _ _ e _ H M B GENE (ORFl )
e
e
e
e
e
>
e
21/0
2180
* *
*
*
*
*
• »
*
_
.CA
GGC GGA AAA AAA TTA AAC GGC TTA GTA GCA CGC AGA GCA
AAA
GAA
AAA
TTG CCG AAT
CGT GCG J S CGT TTT CTT
?I r?°
9 "T
Ha Gly Gly F
Lys Lys Leu Asn Gly Leu Val Ala Arg Arg Ala Lys Glu TTT
Lys>
«
«
«-_«___«_HMB GENE (ORFl)
e
— '
e
e
e
e _ e _ >
2230
•
*
*. . *
*
CC CTC TGT TTA GGT GAA TAC CAT GAT T AAC CGT GCA
TTA TTT TTA AAC
GG GAG ACA AAT CCA CTT ATG GTA CTA A TTG GCA CGT
AAT
aat
AAA AAT TTG
la Leu Cys Leu Gly Glu Tyr His Asp>
e
e HMB GENE (ORFl)
>
e
e
Met H e
Asn Arg Ala Leu Phe Leu Asn>
'
£ ORF4_f
t_f
f
f
f
>
■~b.iv
((IV
22/u
2280
*
*
»
•
■
*
•
•
*
.
CC ACA TTA AAC AAA GTC ATC ATC GTT C CA GTT GCT ATA
CTT
ATC
AGC ATC
GG TGT AAT TTG TTT CAG TAG TAG CAA C GT CAA CGA TAT
hr Thr Leu Asn Lys Val He He Val I la Val Ala He GAA TAG TCG TAG
Leu He Ser H e >
f
f
f
_f
£
f
f
ORF 4
*
f
£
£
£
f
>
(
V
2J2U
2330
•
*
*
•
»
*
KC GGC TAT TTG TAT TTT AAC AAC CAA G rA AAA GAA CAA
rG CCG ATA AAC ATA AAA TTG TTG GTT C *T TTT CTT GTT AAA ATC ATC AAC
»n Gly Tyr Leu Tyr Phe Asn Asn Gin V ■1 Lya Glu Gin TTT TAG TAG TTG
Lys He He Asn>
£
£
£
f
_f
f
£
ORF4
f
_f
£
£
£
£
f
>
Ivy U rv.il/ L v ^ U r N l l i N U i L l J
P 0 635 055 B1
2J0U
2370
2360
2350
340
»
*
*
•
»
»
»
«
•
CAA
CTA
AAG
AAA
GCT
ACC
ACG
;AA
AAG
I
GCA AAC AAC ATC CTC AAC CAA GAA
CGT TTG TTG TAG GAG TTG GTT CTT TTC I ITT TGC TGG TTT GTT GAT TTC CGA
Ala Asn Asn Zle Leu Asn Gin Glu Lys I llu Thr Thr Lys Gin Leu Lys Ala>
£■ £
f
f
£
£
>
£
f
£
f
f
f
f
ORF4_
f
2430
2420
2410
2400
1390
*
*
*
•
*
»
*
*
«
•
:AA TTA GAT CAT GCA AAA AAA CAA CTC lAC CAC TAT CAA GAA CAA GTA AAA
!TT AAT CTA GTA CGT TTT TTT GTT GAG ' 'TG GTG ATA GTT CTT GTT CAT TTT
;in Leu Asp His Ala Lys Lys Gin Leu is n His Tyr Gin Glu Gin Val Lys>
£
£
>
£
f
£
£
£
f
ORF 4_
£
f
f
£
£
f
249U
240U
2470
2460
2450
!440
»
•
»
•
•
*
*
*
»
*
»
AAA CTG AAT GAC AAC CTC TTA ACT CAT rTA CAC CAA GCG GAG AAA CGG ACT
TTT GAC TTA CTG TTG GAG AAT TGA GTA lAT GTG GTT CGC CTC TTT GCC TGA
Lys Leu Asn Asp Asn Leu Leu Thr His ,eu His Gin Ala Glu Lys Arc; Thr>
f
£
>
f
f
f
£
f
f
£
f
£
f
ORF4_
f
f
2540
2520
2530
2510
2500
*
*
»
•
*
•
*
•
•
•
SAT GAA ATT AAA CAA GCG TTA CAA TAT GAG AGC TGG AGC GGT CAG CCT GTG
:TA CTT TAA TTT GTT CGC AAT GTT ATA CTC TCG ACC TCG CCA GTC GGA CAC
\sp Glu lie Lys Gin Ala Leu Gin Tyr Glu Ser Trp Ser Gly Gin Pro Val>
f
>
£
f
£
£
f
f
£
ORF 4
f
£
f
f
f
£
"Me"t~Ly3 Leu Asn Lys Arg Tyr Asn Met Arg Ala Gly Ala Val Ser Leu Cys>
>
ORF6
g
g
g
g _g
q
g
g
g
g
g
g
g
g
tow
Z5»u
2570
2560
2550
•
»
,
«
•
»
•
•
•
•
TT AAT CGC ATT ATC CGC CTG TTC AAC GAA CGA ACA CAT CAG ATT AAT AGA
3GA TTA GCG TAA TAG GCG GAC AAG TTG CTT GCT TGT GTA GTC TAA TTA TCT
?ro Asn Arg Zle lie Arg Leu Phe Asn Glu Arg Thr His Gin Zle Asn Arg>
>
f
f
£
£
£
£
f
£
ORF 4
£
£
t
£
£
£
Teu"TIe~ATa~Leu Ser~ATa Cys Ser Thr Asn Glu~HTs~TTe Arg Leu lie Glu >
QRF6
g
g
g
g
g
g
g
>
g
g
g
g
g
g
g
2640
Z630
2620
2610
2600
«
«
•
«
•
*
«
*
•
•
GCC GAT ACC GCT ACT TTG CCC GAC AGA TCA ACT ATG CCA AAA ACC GAC AAT
CGG CTA TGG CGA TGA AAC GGG CTG TCT AGT TGA TAC GGT TTT TGG CTG TTA
Ala Asp Thr Ala Thr Leu Pro Asp Arg Ser Thr Met Pro Lys Thr Asp Asn>
£
>
£
£
£
£
f
£
ORF 4
£
f
f
f
£
f
f
"Fro lie Pro Leu Leu Cys Pro Thr Asp Gin Leu Cys Gin Lys Pro Thr I l e >
>
ORF 6
g
q
q
g
g
g
g
g
g
g
g
g
g
g
2660
2650
,
«
*
*
•
AAC ACT AAA AAA T AAC GGA GAT
TTG TGA TTT TTT A TTG CCT CTA
Asn Thr Lys Lys>
>
£ ORF4 f
~Thr~Leu Lys"Asn
Asn Gly Asp
g
g
g g
g
g
g
FIGURE
2b»U
26B0
2670
•
*
*
•
•
CTC GTC GTT GCC TTG GAT AAA ACA CTC
GAG CAG CAA CGG AAC CTA TTT TGT GAG
Leu Val Val Ala Leu Asp Lys Thr Leu>
>
° R F 6 _ 9 _ g _ _ g _ g _ g _ 9 _ 9
2 CONTINUED
40
EP 0 635 055 B1
2720
2730
2740
2710
2700
*
*
*
* *
*
*
*
»
•
AAT CAA ATA GAA AAA TGT ATG CTG ATA AAT CAA GCA CTT ACA CAG TGC ATA
TTA CTT TAT CTT TTT ACA TAC GAC TAT TTA GTT CGT GAA TGT GTC ACG TAT
Asn Glu He Glu Lys Cys Met Leu He Asn Gin Ala Leu Thr Gin Cys I l e >
ORT6
>
q
q
q
q
q
q
g
g
g
o
o
q
g
o
2780
2790
2770
2760
2750
•
•
»
•
*
•
•
•
•
•
GAA AAC TAC AAC CGC ACA TTA CAG CAA AAA AAA CAT GAC T GAT CAA GTA
CTT TTG ATG TTG GCG TGT AAT GTC CTT TTT TTT GTA CTG A CTA GTT CAT
Glu Asn Tyr Asn Arg Thr Leu Gin Glu Lys Lys His Asp>
>
QRf 6
q
g
q
g
q
q
q
g
q
q
Met Thr Asp Gin Val>
h
ORF7 h
>
h
2840
2830
2820
2810
2800
*
•
»
» «
»
»
*
•
•
GAC AGA GCC AAC GAA TAC ACA GAA ATA ATG CAA CAA CTT GCC ATC CAA AAA
CTG TCT CGG TTG CTT ATG TGT CTT TAT TAC GTT GTT GAA CGG TAG GTT TTT
Asp Arg Ala Asn Glu Tyr Thr Glu He Met Gin Gin Leu Ala He Gin Lys>
h
h
h
h
h
h
h
>
h
h
h
h
h
ORF 7
h
h
2850
2860
*
*
*
«
•
CAC CAA CAA AAA ACA CGG GAA
GTG GTT GTT TTT TGT GCC CTT
His Gin Gin Lys Thr Arg Glu
h
h
h
h
h
h
FIGURE
2690
2880
2870
»
*
»
*
•
AAA AGC ACA GTG AAA TAC TGT CTA GA
TTT TCG TGT CAC TTT ATG ACA GAT CT
Lys Ser Thr Val Lys Tyr Cys Leu Xxx>
h
h
h >
h
ORF7
h
h
n
2 CONTINUED
41
EP 0 635 055 B1
Kpnl
PRAP501 1
|
0
500
^
|
I
1500
1000
2000
I
1
2500
2890
pRAP503
pRAP504
ORF2
ORF5
ORF3
ORF8
ORF1
ORF4
ORF6
ORF7
FIGURE
42
3
h>u ba& van b i
1
51
01
51
MNKFTKWGTG A I C S V V A I I A l,vkamhu£J-1k
HCPADVLTVG IGSTEANGKN IDPKKRYSDK
GNGKNLPQGA FDAFVSITFN VGCGKMQKST
IYAGGKKLNG LVARRAKEKA LCLGEYHD
to
ioww-^^«
EIAQRWAYDL
LFKQANQGFT
n v w ^ n
RLAEQCVNRY
PQLCHQFERW
EP 0 635 055 B1
10
20
30
40
50
*
*
•
*
«
»
*
»
■
«
ATG GCT ACT GTT ATA GAT CTA AGC TTC CCA AAA ACT GGG GCA AAA AAA ATT
TAC CGA TGA CAA TAT CTA GAT TCG AAG GGT TTT TGA CCC CGT TTT TTT TAA
Met Ala Thr Val He Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys l l e >
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
60
70
60
90
100
*
*
«
•
*
•
*
*
#
.
ATC CTC TAT ATT CCC CAA AAT TAC CAA TAT GAT ACT GAA CAA GGT AAT GGT
TAG GAG ATA TAA GGG GTT TTA ATG GTT ATA CTA TGA CTT GTT CCA TTA CCA
He Leu Tyr He Pro Gin Asn Tyr Gin Tyr Asp Thr Glu Gin Gly Asn Gly>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
110
120
130
140
150
«
•
•
*
*
•
•
•
*
*
TTA CAG GAT TTA GTC AAA GCG GCC GAA GAG TTG GGG ATT GAG GTA CAA AGA
AAT GTC CTA AAT CAG TTT CGC CGG CTT CTC AAC CCC TAA CTC CAT GTT TCT
Leu Gin Asp Leu Val Lys Ala Ala Glu Glu Leu Gly He Glu Val Gin Arg>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
>
s
a
160
170
160
190
200
*
*
»
•
•
•
•
.
GAA GAA CGC AAT AAT ATT GCA ACA GCT CAA ACC AGT TTA GGC ACG ATT CAA
CTT CTT GCG TTA TTA TAA CGT TGT CGA GTT TGG TCA AAT CCG TGC TAA GTT
Glu Glu Arg Asn Asn He Ala Thr Ala Gin Thr Ser Leu Gly Thr He Gln>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
210
220
230
240
250
*
*
*
*
*
*
«
»
•
»
«
ACC GCT ATT GGC TTA ACT GAG CGT GGC ATT GTG TTA TCC GCT CCA CAA ATT
TGG CGA TAA CCG AAT TGA CTC GCA CCG TAA CAC AAT AGG CGA GGT GTT TAA
Thr Ala He Gly Leu Thr Glu Arg Gly He Val Leu Ser Ala Pro Gin I l e >
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
a
260
270
280
290
300
•
•
•
*
•
*
•
•
•
•
GAT AAA TTG CTA CAG AAA ACT AAA GCA GGC CAA GCA TTA GGT TCT GCC GAA
CTA TTT AAC GAT GTC TTT TGA TTT CGT CCG GTT CGT AAT CCA AGA CGG CTT
Asp Lys Leu Leu Gin Lys Thr Lys Ala Gly Gin Ala Leu Gly Ser Ala Glu>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
310
320
330
340
350
»
*
*
•
•
»
*
•
*
a
*GC ATT GTA CAA AAT GCA AAT AAA GCC AAA ACT GTA TTA TCT GGC ATT CAA
TCG TAA CAT GTT TTA CGT TTA TTT CGG TTT TGA CAT AAT AGA CCG TAA GTT
Ser He Val Gin Asn Ala Asn Lys Ala Lys Thr Val Leu Ser Gly He Gln>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
360
370
380
390
400
rCT ATT TTA GGC TCA GTA TTG GCT GGA ATG GAT TTA GAT GAG GCC TTA CAG
KG\ TAA AAT CCG AGT CAT AAC CGA CCT TAC CTA AAT CTA CTC CGG AAT GTC
Ser He Leu Gly Ser Val Leu Ala Gly Met Asp Leu Asp Glu Ala Leu Gln>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
FIGURE
5
14
«u
«30
420
LO
•
»
*
•
*
*
*
*
*
•
\M AAC ACC AAC CAA CAT GCT CTT GCT AAA GCT GGC TTG GAG CTA ACA AAT
rTA TTG TCG TTG GTT GTA CGA GAA CGA TTT CGA CCG AAC CTC GAT TGT TTA
*an Asn Ser Asn Gin His Ala Lau Ala Lys Ala Gly Leu Glu Leu Thr Asn>
a
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
SAU
»»u
«B0
470
60
.
.
.
*
»
*
•
•
•
"
*
TCA TTA ATT GAA AAT ATT GCT AAT TCA GTA AAA ACA CTT GAC GAA TTT GGT
AAA CCA
AGT AAT TAA CTT TTA TAA CGA TTA AGT CAT TTT TGT GAA CTG CTT
Ser Leu He Glu Asn He Ala Asn Ser Val Lys Thr Leu Asp Glu Phe Gly>>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
520
530
*
•
*
•
.
.
.
AG CAA ATT AGT CAA TTT GGT TCA AAA CTA CAA AAT ATC
TC GTT TAA TCA GTT AAA CCA AGT TTT GAT GTT TTA TAG
lu Gin He Ser Gin Phe Gly Ser Lys Leu Gin Asn He
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
* *
AAA GGC TTA GGG
TTT CCG AAT CCC
Lys Gly Leu Gly>
>
a
a
a
»vv
3»v
5B0
570
*
• «
*
*
.
•
. .
CTT
,CT TTA GGA GAC AAA CTC AAA AAT ATC GGT GGA CTT GAT AAA GCT GGC
GAA
CCG
CGA
TTT
CTA
GAA
CCT
CCA
TAG
TTA
TTT
GAG
TTT
GA AAT CCT CTG
'hr Leu Gly Asp Lys Leu Lys Asn He Gly Gly Leu Asp Lys Ala Gly Leu>>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
»«o
630
620
.
.
•
»
*
•
*
•
*
*
CTT GTA
GCA
GCT
ACA
GCA
GGC
TCG
TTA
CTA
GGG
TCA
ATC
GTT
GAT
TTA
5GT
CAT
GAA
CGT
CGA
TGT
CGT
AGC
CCG
AAT
GAT
CCC
AGT
•CA AAT CTA CAA TAG
ilv Leu Asp Val He Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
**w
,vv
6»o
680
670
.
.
*
•
•
•
*
•
*
•
GAA
•TT GCA GAT AAA AAT GCT TCA ACA GCT AAA AAA GTG GGT GCG GGT TTT
CTT
AAA
CCA
CGC
CCA
TTT
CAC
TTT
CGA
TGT
;AA CGT CTA TTT TTA CGA AGT
Glu>
^eu Ala Asp Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe
>
a
a
a
[SPLIT]
PEPTIDE
LEUKOTOXIN
RECOMBINANT
a
a
a
>vv
/sv
'*u
'30
720
,
,
*
•
•
*
*
•
*
•
*
TAC
ATT
TCT
TCT
GTT
GCC
ACC
AAA
ATT
AAT
GTT
GGT
GTT
CAA
AAC
GCA
rTG
ATG
TAA
AGA
AGA
CAA
TTT
CGG
TGG
TAA
TTA
CCA
CAA
*AC CGT TTG GTT CAA
Ile>
Leu Ala Asn Gin Val Val Gly Asn He Thr Lys Ala Val Ser Ser Tyr
>
a
a
a
PEPTIDE
[SPLIT]
LEUKOTOXIN
RECOMBINANT
a
a
a
'»o
ouu
780
770
.
.
*
•
•
«
•
•
•
•
GCT
TTA GCC CAA CGT GTT GCA GCA GCT TTA TCT TCA ACT GGG CCT GTG GCT CGA
CGA
CAC
GGA
CCC
AGT
TGA
AGA
AAT
CCA
CGT
CGT
CAA
GCA
AAT CGG GTT
Ala Ala>
Leu Ala Gin Arg Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val
>
a
a
a
PEPTIDE
[SPLIT]
LEUKOTOXIN
RECOMBINANT
a
a
a
FIGURE
5 UUmilNUUlJ
to
EP 0 635 055 B1
860
850
830
840
820
*
*
»
*
»
«
*
*
•
•
TTA ATT GCT TCT ACT GTT TCT CTT GCG ATT AGC CCA TTA GCA TTT GCC GGT
AAT TAA CGA AGA TGA CAA AGA GAA CGC TAA TCG GGT AAT CGT AAA CGG CCA
Leu He Ala Sec Thr Val Ser Leu Ala He Ser Pro Leu Ala Phe Ala Gly>
a
a
>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
910
900
860
890
870
*
*
»
•
*
*
•
*
•
*
ATT GCC GAT AAA TTT AAT CAT GCA AAA AGT TTA GAG AGT TAT GCC GAA CGC
TAA CGG CTA TTT AAA TTA GTA CGT TTT TCA AAT CTC TCA ATA CGG CTT GCG
He Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala Glu Arg>
a
a
>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
960
940
950
930
920
»
»
»
*
*
*
*
»
•
•
TTT AAA AAA TTA GGC TAT GAC GGA GAT AAT TTA TTA GCA GAA TAT CAG CGG
AAA TTT TTT AAT CCG ATA CTG CCT CTA TTA AAT AAT CGT CTT ATA GTC GCC
Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu Tyr Gin Arg>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1000
1010
1020
990
980
970
*
»
*
*
*
«
•
•
•
*
.
GGA ACA GGG ACT ATT GAT GCA TCG GTT ACT GCA ATT AAT ACC GCA TTG GCC
CCT TGT CCC TGA TAA CTA CGT AGC CAA TGA CGT TAA TTA TGG CGT AAC CGG
Gly Thr Gly Thr He Asp Ala Ser Val Thr Ala He Asn Thr Ala Leu Ala>
>
a
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
1070
1050
1060
1040
1030
*
»
»
*
•
• *
»
•
«
GCT ATT GCT GGT GGT GTG TCT GCT GCT GCA GCC GGC TCG GTT ATT GCT TCA
CGA TAA CGA CCA CCA CAC AGA CGA CGA CGT CGG CCG AGC CAA TAA CGA AGT
Ala He Ala Gly Gly Val Ser Ala Ala Ala Ala Gly Ser Val He Ala Ser>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
1120
1100
1110
1090
1060
*
»
«
•
*
•
•
»
•
•
CCG ATT GCC TTA TTA GTA TCT GGG ATT ACC GGT GTA ATT TCT ACG ATT CTG
GGC TAA CGG AAT AAT CAT AGA CCC TAA TGG CCA CAT TAA AGA TGC TAA GAC
Pro He Ala Leu Leu Val Ser Gly He Thr Gly Val He Ser Thr He Leu>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1160
1170
1150
1140
1130
•
*
»
*
• *
•
•
•
•
CAA TAT TCT AAA CAA GCA ATG TTT GAG CAC GTT GCA AAT AAA ATT CAT AAC
GTT ATA AGA TTT GTT CGT TAC AAA CTC GTG CAA CGT TTA TTT TAA GTA TTG
Gin Tyr Ser Lys Gin Ala Met Phe Glu His Val Ala Asn Lys He His Asn>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1200
1210
1220
1190
HBO
*
*
*
•
*
•
*
•
•
*
AAA ATT GTA GAA TGG GAA AAA AAT AAT CAC GGT AAG AAC TAC TTT GAA AAT
TTT TAA CAT CTT ACC CTT TTT TTA TTA GTG CCA TTC TTG ATG AAA CTT TTA
Lys He Val Glu Trp Glu Lys Asn Asn His Gly Lys Asn Tyr Phe Glu Asn>
>
a
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
FIGURE
5 CONTINUED
46
:P 0 635 055 B1
12/u
126U
1250
1240
1230
*
* *
*
•
*
*
«
•
.
AAT
ATG
AAA
GAT
TTA
CAA
TTC
TTA
GCG
AAT
CTT
TAT
CGT
IGT TAC GAT GCC
:CA ATG CTA CGG GCA ATA GAA CGC TTA AAT GTT CTA TTA TAC TTT AAG AAT
ily Tyr Asp Ala Arg Tyr Leu Ala Asn Leu Gin Asp Asn Met Lys Phe Leu>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1320
1310
1300
1290
1280
*
*
*
*
*
*
*
*
*
*
'TG AAC TTA AAC AAA GAG TTA CAG GCA GAA CGT GTC ATC GCT ATT ACT CAG
!AC TTG AAT TTG TTT CTC AAT GTC CGT CTT GCA CAG TAG CGA TAA TGA GTC
,eu Asn Leu Asn Lys Glu Leu Gin Ala Glu Arg Val He Ala He Thr Gln>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1360
1350
1340
1330
•
•
•
•
*
*
*
•
:AG CAA TGG GAT AAC AAC ATT GGT GAT TTA GCT GGT ATT
;TC GTT ACC CTA TTG TTG TAA CCA CTA AAT CGA CCA TAA
51n Gin Trp Asp Asn Asn He Gly Asp Leu Ala Gly He
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
13/0
•
•
AGC CGT TTA GGT
TCG GCA AAT CCA
Ser Arg Leu Gly>
>
a
a
a
1420
1410
1400
1390
360
*
•
*
*
*
•
*
•
•
•
GAA AAA GTC CTT AGT GGT AAA GCC TAT GTG GAT GCG TTT GAA GAA GGC AAA
CTT TTT CAG GAA TCA CCA TTT CGG ATA CAC CTA CGC AAA CTT CTT CCG TTT
Glu Lys Val Leu Ser Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1470
1460
1450
1440
L430
«
«
•
•
*
•
*
•
•
*
CAC ATT AAA GCC GAT AAA TTA GTA CAG TTG GAT TCG GCA AAC GGT ATT ATT
GTG TAA TTT CGG CTA TTT AAT CAT GTC AAC CTA AGC CGT TTG CCA TAA TAA
His He Lys Ala Asp Lys Leu Val Gin Leu Asp Ser Ala Asn Gly He I l e >
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1330
1510
1520
1490
1500
L480
* *
*
* *
•
•
•
*
•
•
GAT GTG AGT AAT TCG GGT AAA GCG AAA ACT CAG CAT ATC TTA TTC AGA ACG
CTA CAC TCA TTA AGC CCA TTT CGC TTT TGA GTC GTA TAG AAT AAG TCT TGC
Asp Val Ser Asn Ser Gly Lys Ala Lys Thr Gin His He Leu Phe Arg Thr>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
13BU
1570
1560
1550
1540
»
*
•
*
*
*
•
•
*
*
CCA TTA TTG ACG CCG GGA ACA GAG CAT CGT GAA CGC GTA CAA ACA GGT AAA
GGT AAT AAC TGC GGC CCT TGT CTC GTA GCA CTT GCG CAT GTT TGT CCA TTT
Pro Leu Leu Thr Pro Gly Thr Glu Mis Arg Glu Arg Val Gin Thr Gly Lys>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
1610
16Z0
1600
1590
.
«
*
•
*
*
*
•
TAT GAA TAT ATT ACC AAG CTC AAT ATT AAC CGT GTA GAT
ATA CTT ATA TAA TGG TTC GAG TTA TAA TTG GCA CAT CTA
Tyr Glu Tyr He Thr Lys Leu Asn He Asn Arg Val Asp
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
FIGURE
5 LONTUNUfcD
47
ifcju
•
*
AGC TGG AAA ATT
TCG ACC TTT TAA
Ser Trp Lys I l e >
>
a
a
a
EP 0 635 055 B1
1640
1650
1660
1670
1660
*
*
*
* •
«
»
•
*
*
ACA GAT GGT GCA GCA AGT TCT ACC TTT GAT TTA ACT AAC GTT GTT CAG CGT
TGT CTA CCA CGT CGT TCA AGA TGG AAA CTA AAT TGA TTG CAA CAA GTC GCA
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gin Arg>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
_a
1690
1700
1710
1720
1730
ATT GGT ATT GAA TTA GAC AAT GCT GGA AAT GTA ACT AAA ACC AAA GAA ACA
TAA CCA TAA CTT AAT CTG TTA CGA CCT TTA CAT TGA TTT TGG TTT CTT TGT
He Gly He Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys Glu Thr>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
>
a
a
1740
1750
1760
1770
1780
»
«
*
*
*
*
*
*
•
AAA ATT ATT GCC AAA CTT GGT GAA GGT GAT GAC AAC GTA TTT GTT GGT TCT
TTT TAA TAA CGG TTT GAA CCA CTT CCA CTA CTG TTG CAT AAA CAA CCA AGA
Lys He He Ala Lys Leu Gly Glu Gly Asp Asp Asn Val Phe Val Gly Ser>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
1800
1790
1810
1820
1830
•
*
«
»
»
*
•
•
*
»
GGT ACG ACG GAA ATT GAT GGC GGT GAA GGT TAC GAC CGA GTT CAC TAT AGC
CCA TGC TGC CTT TAA CTA CCG CCA CTT CCA ATG CTG GCT CAA GTG ATA TCG
Gly Thr Thr Glu He Asp Gly Gly Glu Gly Tyr Asp Arg Val His Tyr Ser>
>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
1840
1650
1860
1870
1880
* •
*
*
*
*
a
•
CGT GGA AAC TAT GGT GCT TTA ACT ATT GAT GCA ACC AAA GAG ACC GAG CAA
GCA CCT TTG ATA CCA CGA AAT TGA TAA CTA CGT TGG TTT CTC TGG CTC GTT
Arg Gly Asn Tyr Gly Ala Leu Thr He Asp Ala Thr Lys Glu Thr Glu Gln>
>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
1890
1900
1910
1920
1930
*
*
•
•
•
•
•
•
•
•
GGT AGT TAT ACC GTA AAT CGT TTC GTA GAA ACC GGT AAA GCA CTA CAC GAA
CCA TCA ATA TGG CAT TTA GCA AAG CAT CTT TGG CCA TTT CGT GAT GTG CTT
Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr Gly Lys Ala Leu His Glu>
>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
1950
1960
1970
1940
1980
•
*
•
*
»
»
•
»
«
*
GTG ACT TCA ACC CAT ACC GCA TTA GTG GGC AAC CGT GAA GAA AAA ATA GAA
CAC TGA AGT TGG GTA TGG CGT AAT CAC CCG TTG GCA CTT CTT TTT TAT CTT
Val Thr Ser Thr His Thr Ala Leu Val Gly Asn Arg Glu Glu Lys He Glu>
>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
a
a
2020
2010
2000
2040
2030
1990
•
•
•
»
*
•
»
•
*
TAT CGT CAT AGC AAT AAC CAG CAC CAT GCC GGT TAT TAC ACC AAA GAT ACC
ATA GCA GTA TCG TTA TTG GTC GTG GTA CGG CCA ATA ATG TGG TTT CTA TGG
Tyr Arg His Ser Asn Asn Gin His His Ala Gly Tyr Tyr Thr Lys Asp Thr>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
FIGURE
5 CONTINUED
48
EP 0 635 055 B1
2050
2060
2070
2080
2090
*
*
•
•
*
•
•
•
•
„
TTG AAA GCT GTT GAA GAA ATT ATC GGT ACA TCA CAT AAC GAT ATC TTT AAA
AAC TTT CGA CAA CTT CTT TAA TAG CCA TGT AGT GTA TTG CTA TAG AAA TTT
Leu Lys Ala Val Glu Glu He He Gly Thr Ser His Asn Asp He Phe Lys>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
>
2100
2110
2120
2130
2140
GGT AGT AAG TTC AAT GAT GCC TTT AAC GGT GGT GAT GGT GTC GAT ACT ATT
CCA TCA TTC AAG TTA CTA CGG AAA TTG CCA CCA CTA CCA CAG CTA TGA TAA
Gly Ser Lys Phe Asn Asp Ala Phe Asn Gly Gly Asp Gly Val Asp Thr I l e >
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
2150
2160
2170
2180
2190
•
*
*
*
*
•
*
*
•
«
GAC GGT AAC GAC GGC AAT GAC CGC TTA TTT GGT GGT AAA GGC GAT GAT ATT
CTG CCA TTG CTG CCG TTA CTG GCG AAT AAA CCA CCA TTT CCG CTA CTA TAA
Asp Gly Asn Asp Gly Asn Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp I l e >
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
>
a
a
a
2200
2210
2220
2230
2240
•
•
•
•
*
*
•
•
•
•
CTC GAT GGT GGA AAT GGT GAT GAT TTT ATC GAT GGC GGT AAA GGC AAC GAC
GAG CTA CCA CCT TTA CCA CTA CTA AAA TAG CTA CCG CCA TTT CCG TTG CTG
Leu Asp Gly Gly Asn Gly Asp Asp Phe He Ass Gly Gly Lys Gly Asn Asp>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2250
2260
2270
2280
2290
*
*
•
»
*
•
»
»
•
»
»
CTA TTA CAC GGT GGC AAG GGC GAT GAT ATT TTC GTT CAC CGT AAA GGC GAT
GAT AAT GTG CCA CCG TTC CCG CTA CTA TAA AAG CAA GTG GCA TTT CCG CTA
Leu Leu His Gly Gly Lys Gly Asp Asp He Phe Val His Arg Lys Gly Asp>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2300
2310
2320
2330
2340
•
*
•
•
•
»
*
*
■
•
GGT AAT GAT ATT ATT ACC GAT TCT GAC GGC AAT GAT AAA TTA TCA TTC TCT
CCA TTA CTA TAA TAA TGG CTA AGA CTG CCG TTA CTA TTT AAT AGT AAG AGA
Gly Asn Asp He He Thr Asp Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2350
2360
2370
2380
*
*
«
*
•
«
*
»
SAT TCG AAC TTA AAA GAT TTA ACA TTT GAA AAA GTT AAA
CTA AGC TTG AAT TTT CTA AAT TGT AAA CTT TTT CAA TTT
Asp Ser Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
2390
»
»
CAT AAT CTT GTC
GTA TTA GAA CAG
His Asn Leu Val>
>
a
a
a
2400
2410
2420
2430
2440
*
*
*
*
•
*
*
*
•
•
ATC ACG AAT AGC AAA AAA GAG AAA GTG ACC ATT CAA AAC TGG TTC CGA GAG
TAG TGC TTA TCG TTT TTT CTC TTT CAC TGG TAA GTT TTG ACC AAG GCT CTC
He Thr Asn Ser Lys Lys Glu Lys Val Thr He Gin Asn Trp Phe Arg Glu>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
FIGURE
5 CONTINUED
19
EP 0 635 055 B1
2460
2450
2470
2490
24B0
*
»
•
•
*
GCT GAT TTT GCT AAA GAA GTG CCT AAT TAT AAA GCA ACT AAA GAT GAG AAA
CGA CTA AAA CGA TTT CTT CAC GGA TTA ATA TTT CGT TGA TTT CTA CTC TTT
Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lya Ala Thr Lys Asp Glu Lys>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
>
a
2500
2520
2510
2530
2540
2550
»
•
*
•
•
•
•
»
ATC GAA GAA ATC ATC GGT CAA AAT GGC GAG CGG ATC ACC TCA AAG CAA GTT
TAG CTT CTT TAG TAG CCA GTT TTA CCG CTC GCC TAG TGG AGT TTC GTT CAA
He Glu Glu He He Gly Gin Asn Gly Glu Arg He Thr Ser Lys Gin Val>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
a
>
a
2570
2560
2580
2590
2600
*
»
»
*
*
«
*
*
*
»
GAT GAT CTT ATC GCA AAA GGT AAC GGC AAA ATT ACC CAA GAT GAG CTA TCA
CTA CTA GAA TAG CGT TTT CCA TTG CCG TTT TAA TGG GTT CTA CTC GAT AGT
Asp Asp Leu He Ala Lys Gly Asn Gly Lys He Thr Gin Asp Glu Leu Ser>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
a
a
2610
2620
2630
2640
2650
*
* •
•
*
*
•
•
*
•
AAA GTT GTT GAT AAC TAT GAA TTG CTC AAA CAT AGC AAA AAT GTG ACA AAC
TTT CAA CAA CTA TTG ATA CTT AAC GAG TTT GTA TCG TTT TTA CAC TGT TTG
Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys Asn Val Thr Asn>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2660
2670
2680
2690
2700
«
»
*
»
»
*
*
*
•
•
AGC TTA GAT AAG TTA ATC TCA TCT GTA AGT GCA TTT ACC TCG TCT AAT GAT
TCG AAT CTA TTC AAT TAG AGT AGA CAT TCA CGT AAA TGG AGC AGA TTA CTA
Ser Leu Asp Lys Leu He Ser Ser Val Ser Ala Phe Thr Ser Ser Asn Asp>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2710
2720
2730
2740
2750
TCG AGA AAT GTA TTA GTG GCT CCA ACT TCA ATG TTG GAT CAA AGT TTA TCT
AGC TCT TTA CAT AAT CAC CGA GGT TGA AGT TAC AAC CTA GTT TCA AAT AGA
Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met Leu Asp Gin Ser Leu Ser>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2760
2770
2780
2790
2600
»
•
•
•
»
•
*
•
•
a
*
TCT CTT CAA TTT GCT AGG G AA TTC ACA AAA TGG GGG ACA GGG GCT ATT TGT
AGA GAA GTT AAA CGA TCC C TT AAG TGT TTT ACC CCC TGT CCC CGA TAA ACA
Glu Phe Thr Lys Trp Gly Thr Gly Ala He Cys>
b
b
b HMB GENE (ORFl)
b
b
b
>
~
Ser Leu Gin Phe Ala Arg>
RECOMBINANT LEUKOT a >
2610
2820
2830
2840
2650
AGC GTA GTT GCC ATT ATT GCC CTT GTC AAA GCA AAC CAT CAA GAG TTA CGC
TCG CAT CAA CGG TAA TAA CGG GAA CAG TTT CGT TTG GTA GTT CTC AAT GCG
Ser Val Val Ala He He Ala Leu Val Lys Ala Asn His Gin Glu Leu Arg>
b
b
b HMB GENE (ORFl)
b
b
b
to
b
b
b
b
b
>
FIGURE
5 CONTINUED
50
r U b3b Ubb Bl
2880
2870
2860
,
*
•
*
*
*
TA ACT CAA CAA GGC TTA GAC CTT ATA GGA
AT TCA GTT GTT CCG AAT CTG GAA TAT CCT
le Ser Gin Gin Gly Leu Asp Leu He Gly
b HMB GENE (ORFl)
b
b
b
b
b
«>vv
2B»u
«
*
*
»
AAT GTA GAA GGT TGC AGA AGA
TTA CAT CTT CCA ACG TCT TCT
Asn Val Glu Gly Cys Arg Arg>
b
b
b
b
b
b
>
2940
2930
2920
910
•
•
«
*
»
•
*
*
« •
GGC
ATA
TCC ACG
GTG
GGC
ACG
TTA
GTC
GAC
GCC
CAC
TGC
CCC
TAT
CCC
GAC
CTG GGG ATA GTG ACG GGG CGG CTG CAG AAT TGC CAC CCG TAT CCG AGG TGC
Asp Pro Tyr His Cys Pro Ala Asp Val Leu Thr Val Gly He b Gly b Ser b Thr>>
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
Jvvv
2»su
Z9BO
2970
960
.
«
«
*
*
•
*
*
*
*
GAA GCA AAC GGA AAA AAC ATT GAC CCT AAA AAA CGT TAT AGC GAC AAA GAA
CTT CGT TTG CCT TTT TTG TAA CTG GGA TTT TTT GCA ATA TCG CTG TTT CTT
Glu Ala Asn Gly Lys Asn He Asp Pro Lys Lys Arg Tyr Ser Asp Lys Glu>
b
b
>
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
juo*
3040
3030
3020
010
*
•
*
*
*
*
» •
•
*
«
TGC
AAC
GTA
CAA
GAA
GCG
CTG
CGC
TTA
GAT
TAT
TGG
GCA
AGA
CAA
GCC
ATA
TAT CGG GTT TCT ACC CGT ATA CTA AAT GCG GAC CGC CTT GTT ACG CAT TTG
He Ala Gin Arg Trp Ala Tyr Asp Leu Arg Leu Ala Glu Gin Cys Val Asn>
>
b
b
b
b ._ _b
b
b HMB GENE (ORFl)
b
b
b
b
b
jiuw
30»0
3080
3070
.
«
«
»
*
»
»
*
*
*
TTT GTT
GCC
GAT
GCG
TTT
GGG
CAA
CCG
CTA
AAT
AAA
GGC
GGA
AAC
:GC TAT
JCG ATA CCT TTG CCG TTT TTA GAT GGC GTT CCC CGC AAA CTA CGG AAA CAA
Val>
^rg Tyr Gly Asn Gly Lys Asn Leu Pro Gin Gly Ala Phe Asp Ala b Phe b
>
b
b
b
b
(ORFl)
b
H
M
B
GENE
b
b
b
b
b
3140
3130
3120
•
•
•
*
•
•
rCC ATT ACC TTT AAT GTA GGA TGT GGA AAA
KGG TAA TGG AAA TTA CAT CCT ACA CCT TTT
Ser He Thr Phe Asn Val Gly Cys Gly Lys
b HMB GENE (ORFl)
b
b
b
b
b
jiwu
Jisu
*
•
*
*
ATG CAA AAA AGC ACC TTA TTT
TAC GTT TTT TCG TGG AAT AAA
Met Gin Lys Ser Thr Leu Phe>
>
b
b
b
b
b
b
J* u u
3190
31B0
3170
»
»
*
•
*
*
»
*
*
*
GAA CGC
TTT
CAC
CAG
TGT
CAA
CTC
CCT
ACC
TTT
CAA
GGC
AAC
AAA CAA GCA
TTT GTT CGT TTG GTT CCG AAA TGG GGA GTT GAG ACA GTG GTC AAA CTT GCG
Lys Gin Ala Asn Gin Gly Phe Thr Pro Gin Leu Cys His Gin Phe Glu Arg>
>
b
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
3220
3230
3240
3250
«pw
TGG ATT TAC GCA GGC GGA AAA AAA TTA AAC GGC TTA GTA GCA CGC AGA GCA
ACC TAA ATG CGT CCG CCT TTT TTT AAT TTG CCG AAT CAT CGT GCG TCT CGT
Trp He Tyr Ala Gly Gly Lys Lys Leu Asn Gly Leu Val Ala Arg Arg Ala>
>
b
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
FIGURE
5 COINTUNUkD
EP 0 635 055 B1
3270
3280
*
*
*
AAA GAA AAA GCC CTC TGT
TTT CTT TTT CGG GAG ACA
Lys Glu Lys Ala Leu Cys
b
b
b
HMB GENT
3320
3330
3300
3290
3310
•
*
»
«
.
»
TTA GGT GAA TAC CAT GAT TAACCGTGCATTATT
VAT CCA CTT ATG GTA CTA ATTGGCACGTAATAA
Leu Gly Glu Tyr His Asp>
b
b
b
(ORFl)
>
3340
3350
3360
TTTAAACACCACATTAAACAAAGTCATCATCGTTGCAGTTGCTATACTTAT
AAATTTGTGGTGTAATTTGTTTCAGTAGTAGCAACGTCAACGATATGAATA
3380
3390
3400
3370
3410
*
*
#
»
•
»
•
*
»
*
CAGCATCAACGGCTATTTGTATTTTAACAACCAAGTAAAAGAACAAAAAAT
GTCGTAGTTGCCGATAAACATAAAATTGTTGGTTCATTTTCTTGTTTTTTA
3420
3430
3440
3450
3460
•
•
•
•
*
•
•
•
•
•
CATCAACGCAAACAACATCCTCAACCAAGAAAAGGAAACGACCAAACAACT
GTAGTTGCGTTTGTTGTAGGAGTTGGTTCTTTTCCTTTGCTGGTTTGTTGA
3470
3480
3490
3500
3510
»
*
»
*
*
*
*
»
*
»
AAAGGCTCAATTAGATCATGCAAAAAAACAACTCAACCACTATCAAGAACA
TTTCCGAGTTAATCTAGTACGTTTTTTTGTT6AGTTGGTGATAGTTCTTGT
3520
3530
3540
3550
3560
3570
•
•
•
»
*
•
•
*
•
•
»
AGTAAAAAAACTGAATGACAACCTCTTAACTCATTTACACCAAGCGGAGAA
TCATTTTTTTGACTTACTGTTGGAGAATTGAGTAAATGTGGTTCGCCTCTT
3580
3590
3600
3610
3620
ACGGACTGATGAAATTAAACAAGCGTTACAATATGAGAGCTGGAGCGGTCA
TGCCTGACTACTTTAATTTGTTCGCAATGTTATACTCTCGACCTCGCCAGT
3630
3640
3650
3660
3670
*
•
*
»
«
•
*
•
»
*
GCCTGTGCCTAATCGCATTATCCGCCTGTTCAACGAACGAACACATCAGAT
CGGACACGGATTAGCGTAATAGGCGGACAAGTTGCTTGCTTGTGTAGTCTA
3690
3680
3700
3710
3720
TAATAGAGCCGATACCGCTACTTTGCCCGACAGATCAACTATGCCAAAAAC
ATTATCTCGGCTATGGCGATGAAACGGGCTGTCTAGTTGATACGGTTTTTG
3740
3750
3760
3730
3770
•
•
•
•
•
•
•
•
•
a
CGACAATAACACTAAAAAATAACGGAGATCTCGTCGTTGCCTTGGATAAAA
GCTGTTATTGTGATTTTTTATTGCCTCTAGAGCAGCAACGGAACCTATTTT
•
3780
•
•
3790
*
•
FIGURE
3800
*
•
3810
*
•
5 CONTINUED
52
3820
*
•
P 0 635 055 B1
ACTCAATGAAAT AGAAAAATGTATQCTOATAAAT MW. A>- J i ai-av.*u i
iTGAGTTACTTTATCTTTTTACATACGACTATTTA 1TTCGTGAATGTGTCA
3B/u
3860
3850
3840
3630
«
*
»
*
*
*
»
*
•
•
iCATAGAAAACTACAACCGCACATTACAGGAAAAAAAACATGACTGATCAA
IGTATCTTTTGATGTTGGCGTGTAATGTCCTTTTTTTTGTACTGACTAGTT
Jno
3910
3900
3690
880
„
*
•
•
*
•
•
•
•
•
itagacagagccaacgaatacacagaaataatgcaacaacttgccatccaa
:atctgtctcggttgcttatgtgtctttattacgttgttgaacggtaggtt
3S/u
3960
3950
3940
1930
»
•
•
*
»
»
»
*
*
*
AAACACCAACAAAAAACACGGGAAAAAAGCACAGTGAAATACTGTCTAGA
TTTGTGGTTGTTTTTTGTGCCCTTTTTTCGTGTCACTTTATGACAGATCT
FIGURE
53
5 CONTINUED
EP 0 635 055 B1
40
30
50
20
10
*
»
*
*
•
*
»
»
»
»
ATG GCT ACT GTT ATA GAT CTA AGC TTC CCA AAA ACT GGG GCA AAA AAA ATT
TAC CGA TGA CAA TAT CTA GAT TCG AAG GGT TTT TGA CCC CGT TTT TTT TAA
Met Ala Thr Val He Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys I l e >
a
a
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
90
60
70
60
»
*
»
*
*
*
»
•
ATC CTC TAT ATT CCC CAA AAT TAC CAA TAT GAT ACT GAA
TAG GAG ATA TAA GGG GTT TTA ATG GTT ATA CTA TGA CTT
He Leu Tyr He Pro Gin Asn Tyr Gin Tyr Asp Thr Glu
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
100
*
»
CAA GGT AAT GGT
GTT CCA TTA CCA
Gin Gly Asn Gly>
>
a
a
a
140
130
150
120
110
*
*
»
»
»
»
»
«
*
•
TTA CAG GAT TTA GTC AAA GCG GCC GAA GAG TTG GGG ATT GAG GTA CAA AGA
AAT GTC CTA AAT CAG TTT CGC CGG CTT CTC AAC CCC TAA CTC CAT GTT TCT
Leu Gin Asp Leu Val Lys Ala Ala Glu Glu Leu Gly He Glu Val Gin Arg>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
200
190
170
1B0
160
•
•
•
•
•
•
•
•
•
•
GAA GAA CGC AAT AAT ATT GCA ACA GCT CAA ACC AGT TTA GGC ACG ATT CAA
CTT CTT GCG TTA TTA TAA CGT TGT CGA GTT TGG TCA AAT CCG TGC TAA GTT
Glu Glu Arg Asn Asn He Ala Thr Ala Gin Thr Ser Leu Gly Thr He Gln>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
250
240
230
220
210
*
*
»
•
*
•
•
ACC GCT ATT GGC TTA ACT GAG CGT GGC ATT GTG TTA TCC GCT CCA CAA ATT
TGG CGA TAA CCG AAT TGA CTC GCA CCG TAA CAC AAT AGG CGA GGT GTT TAA
Thr Ala He Gly Leu Thr Glu Arg Gly He Val Leu Ser Ala Pro Gin I l e >
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
290
300
280
270
260
•
•
*
•
*
*
•
»
»
•
GAT AAA TTG CTA CAG AAA ACT AAA GCA GGC CAA GCA TTA GGT TCT GCC GAA
CTA TTT AAC GAT GTC TTT TGA TTT CGT CCG GTT CGT AAT CCA AGA CGG CTT
Asp Lys Leu Leu Gin Lys Thr Lys Ala Gly Gin Ala Leu Gly Ser Ala Glu>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
350
340
330
320
310
*
*
*
*
*
»
*
*
•
*
AGC ATT GTA CAA AAT GCA AAT AAA GCC AAA ACT GTA TTA TCT GGC ATT CAA
TCG TAA CAT GTT TTA CGT TTA TTT CGG TTT TGA CAT AAT AGA CCG TAA GTT
Ser He Val Gin Asn Ala Asn Lys Ala Lys Thr Val Leu Ser Gly He Gln>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
400
380
390
370
360
•
*
•
»
»
»
*
•
*
*
TCT ATT TTA GGC TCA GTA TTG GCT GGA ATG GAT TTA GAT GAG GCC TTA CAG
AGA TAA AAT CCG AGT CAT AAC CGA CCT TAC CTA AAT CTA CTC CGG AAT GTC
Ser He Leu Gly Ser Val Leu Ala Gly Met Asp Leu Asp Glu Ala Leu Gln>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
FIGURE
54
6
EP 0 635 055 B1
410
42U
430
440
«
»
*
*
*
*
*
»
,
AAT AAC AGC AAC CAA CAT GCT CTT GCT AAA GCT GGC TTG
TTA TTG TCG TTG GTT GTA CGA GAA CGA TTT CGA CCG AAC
Asn Asn Ser Asn Gin His Als Leu Ala Lys Ala Gly Leu
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
450
*
GAG CTA ACA AAT
CTC GAT TGT TTA
Glu Leu Thr Asn>
a
a
a
>
""60
470
4B0
490
500
510
*
*
»
•
•
•
•
*
»
.
.
TCA TTA ATT GAA AAT ATT GCT AAT TCA GTA AAA ACA CTT GAC GAA TTT GGT
AGT AAT TAA CTT TTA TAA CGA TTA AGT CAT TTT TGT GAA CTG CTT AAA CCA
Ser Leu He Glu Asn He Ala Asn Ser Val Lys Thr Leu Asp Glu Phe Gly>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
>
a
520
530
540
550
560
*
•
•
«
•
•
•
•
•
•
GAG CAA ATT AGT CAA TTT GGT TCA AAA CTA CAA AAT ATC AAA GGC TTA GGG
CTC GTT TAA TCA GTT AAA CCA AGT TTT GAT GTT TTA TAG TTT CCG AAT CCC
Glu Gin He Ser Gin Phe Gly Ser Lys Leu Gin Asn He Lys Gly Leu Gly>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
580
590
600
610
* *
*
•
.
ACT TTA GGA GAC AAA CTC AAA AAT ATC GGT GGA CTT GAT AAA GCT GGC CTT
TGA AAT CCT CTG TTT GAG TTT TTA TAG CCA CCT GAA CTA TTT CGA CCG GAA
Thr Leu Gly Asp Lys Leu Lys Asn He Gly Gly Leu Asp Lys Ala Gly Leu>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
6ZO
630
640
650
660
•
»
«
•
«
»
«
»
*
,
3GT TTA GAT GTT ATC TCA GGG CTA TTA TCG GGC GCA ACA GCT GCA CTT GTA
-CA AAT CTA CAA TAG AGT CCC GAT AAT AGC CCG CGT TGT CGA CGT GAA CAT
Sly Leu Asp Val He Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
670
680
690
700
710
:TT GCA GAT AAA AAT GCT TCA ACA GCT AAA AAA GTG GGT GCG GOT TTT GAA
3AA CGT CTA TTT TTA CGA AGT TGT CGA TTT TTT CAC CCA CGC CCA AAA CTT
Leu Ala Asp Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe Glu>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
720
730
740
750
760
» *
•
•
•
•
•
»
*
*
*
rTG GCA AAC CAA GTT GTT GGT AAT ATT ACC AAA GCC GTT TCT TCT TAC ATT
1AC CGT TTG GTT CAA CAA CCA TTA TAA TGG TTT CGG CAA AGA AGA ATG TAA
Leu Ala Asn Gin Val Val Gly Asn He Thr Lys Ala Val Ser Ser Tyr I l e >
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
770
780
790
800
810
•
•
*
•
•
*
•
•
•
*
rTA GCC CAA CGT GTT GCA GCA GGT TTA TCT TCA ACT GGG CCT GTG GCT GCT
WT CGG GTT GCA CAA CGT CGT CCA AAT AGA AGT TGA CCC GGA CAC CGA CGA
-eu Ala Gin Arg Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
FIGURE
6 CONTINUED
5
EP 0 635 055 B1
0*0
0J0
640
650
*
*
•
»
»
•
»
*
TT:> ATT GCT TCT ACT GTT TCT CTT GCG ATT AGC CCA TTA
AAT TAA CGA AGA TGA CAA AGA GAA CGC TAA TCG GGT AAT
Leu He Ala Ser Thr Val Ser Leu Ala He Ser Pro Leu
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
860
«
,
GCA TTT GCC GGT
CGT AAA CGG CCA
Ala Phe Ala Glv>
"a
a
a
>
o'v
BOH
890
900
910
•
•
*
*
•
*
•
»
*
,
ATT GCC GAT AAA TTT AAT CAT GCA AAA AGT TTA GAG AGT TAT GCC GAA CGC
TAA CGG CTA TTT AAA TTA GTA CGT TTT TCA AAT CTC TCA ATA CGG CTT GCG
He Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala Glu Arq>
a
a__a_RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
>
w
»ju
940
950
*
*
*
*
*
•
»
»
•
TTT AAA AAA TTA GGC TAT GAC GGA GAT AAT TTA TTA GCA
AAA TTT TTT AAT CCG ATA CTG CCT CTA TTA AAT AAT CGT
Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
"u
»«>v
990
9£0
♦
GAA TAT CAG CGG
CTT ATA GTC GCC
Glu Tyr Gin Arq>
a
a
>
a
1000
1010
1020
*
.
.
.
GGA ACA GGG ACT ATT GAT GCA TCG GTT ACT GCA ATT AAT ACC GCA TTG GCC
CCT TGT CCC TGA TAA CTA CGT AGC CAA TGA CGT TAA TTA TGG CGT AAC CGG
Gly Thr Gly Thr He Asp Ala Ser Val Thr Ala He Asn Thr Ala Leu Ala>
»
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
>
a
a
1040
1050
1060
1070
*
*
*
*
•
*
•
•
*
.
3CT ATT GCT GGT GGT GTG TCT GCT GCT GCA GCC GGC TCG GTT ATT GCT TCA
:GA TAA CGA CCA CCA CAC AGA CGA CGA CGT CGG CCG AGC CAA TAA CGA
Ma He Ala Gly Gly Val Ser Ala Ala Ala Ala Gly Ser Val He Ala AGT
Ser>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
__»__•
a
a
>
a
aooo
1090
1100
1110
*
*
*
•
*
•
*
•
:CG ATT GCC TTA TTA GTA TCT GGG ATT ACC GGT GTA ATT
KJC TAA CGG AAT AAT CAT AGA CCC TAA TGG CCA CAT TAA
>ro He Ala Leu Leu Val Ser Gly He Thr Gly Val He
»
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
■njo
H40
1150
1160
1120
•
»
TCT ACG ATT CTG
AGA TGC TAA GAC
Ser Thr He Leu>
a
>
a
a
1170
:AA TAT TCT AAA CAA GCA ATG TTT GAG CAC GTT GCA AAT AAA ATT CAT AAC
iTT ATA AGA TTT GTT CGT TAC AAA CTC GTG CAA CGT TTA TTT TAA GTA TTG
!ln Tyr Ser Lya Gin Ala Met Phe Glu His Val Ala Asn Lys He His Asn>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
a
a
iioo
1190
izoo
1210
1220
*
•
*
•
*
*
*
•
*
*
AA ATT GTA GAA TGG GAA AAA AAT AAT CAC GGT AAG AAC TAC TTT GAA AAT
■TT TAA CAT CTT ACC CTT TTT TTA TTA GTG CCA TTC TTG ATG AAA CTT TTA
.ya He Val Glu Trp Glu Lys Asn Asn His Gly Lya Asn Tyr Phe Glu Asn>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
FIGURE
6 CONTINUED
b
K»U b35 Ubb Bl
I2»u
1230
1240
1230
*
•
»
•
*
*
•
*
»
GT TAC GAT GCC CGT TAT CTT GCG AAT TTA CAA GAT AAT ATG AAA
CA ATG CTA CGG GCA ATA GAA CGC TTA AAT GTT CTA TTA TAC TTT
ly Tyr Asp Ala Arg Tyr Leu Ala Asn Leu Gin Asp Asn Met Lys
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]___a___a
a
a
•
TTC TTA
AAG AAT
Phe Leu>
>
a
iJiu
1300
1290
1280
»
*
*
•
*
*
*
*
•
•
TG AAC TTA AAC AAA GAG TTA CAG GCA GAA CGT GTC ATC GCT ATT ACT CAG
AC TTG AAT TTG TTT CTC AAT GTC CGT CTT GCA CAG TAG CGA TAA TGA GTC
eu Asn Leu Asn Lys Glu Leu Gin Ala Glu Arg Val He Ala He Thr Gln>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE I SPLIT]
a
a
13-u
1350
1340
1330
«
•
*
•
*
*
*
*
AG CAA TGG GAT AAC AAC ATT GGT GAT TTA GCT GGT ATT
ITC GTT ACC CTA TTG TTG TAA CCA CTA AAT CGA CCA TAA
iln Gin Trp Asp Asn Asn He Gly Asp Leu Ala Gly He
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
*
•
AGC CGT TTA GGT
TCG GCA AAT CCA
Ser Arg Leu Gly>
>
a
a
a
m o
1400
1390
380
*
*
*
•
*
*
*
„
*
«
GAA AAA GTC CTT AGT GGT AAA GCC TAT GTG GAT GCG TTT GAA GAA GGC AAA
CTT TTT CAG GAA TCA CCA TTT CGG ATA CAC CTA CGC AAA CTT CTT CCG TTT
Glu Lys Val Leu Ser Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
i««w
1430
1440
430
,
*
«
*
*
*
•
•
*
*
CAC ATT AAA GCC GAT AAA TTA GTA CAG TTG GAT TCG GCA AAC GGT ATT ATT
GTG TAA TTT CGG CTA TTT AAT CAT GTC AAC CTA AGC CGT TTG CCA TAA TAA
His He Lys Ala Asp Lys Leu Val Gin Leu Asp Ser Ala Asn Gly He I l e >
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
*■»•»»'
isiu
1500
1490
,<80
.
*
•
*
•
*
*
*
•
*
*
GAT GTG AGT AAT TCG GGT AAA GCG AAA ACT CAG CAT ATC TTA TTC AGA ACG
CTA CAC TCA TTA AGC CCA TTT CGC TTT TGA GTC GTA TAG AAT AAG TCT TGC
Thr>
Asp Val Ser Asn Ser Gly Lys Ala Lys Thr Gin His He Leu Phe Arg
>
a
a
SPLIT]
a
PEPTIDE
t
LEUKOTOXIN
a RECOMBINANT
a
a
*.jow
13/v
1360
1550
1540
*
•
*
*
*
•
*
*
•
•
AAA
CCA TTA TTG ACG CCG GGA ACA GAG CAT CGT GAA CGC GTA CAA ACA GGT
GGT AAT AAC TGC GGC CCT TGT CTC GTA GCA CTT GCG CAT GTT TGT CCA TTT
Pro Leu Leu Thr Pro Gly Thr Glu His Arg Glu Arg Val Gin Thr Gly Lys>>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
imv
itio
1600
1590
,
«
*
•
•
*
•
•
TAT GAA TAT ATT ACC AAG CTC AAT ATT AAC CGT GTA GAT
ATA CTT ATA TAA TGG TTC GAG TTA TAA TTG GCA CAT CTA
Asn He Asn Arg Val Asp
Tvr
* Glu Tyr He Thr Lya LeuLEUKOTOXIN PEPTIDE [SPLIT]
RECOMBINANT
a
,
a
FIGURE
6 CONTINUED
13/
i»jv
*
*
AGC TGG AAA ATT
TCG ACC TTT TAA
Ser Trp Lys I l e >
>
a
a
a
EP 0 635 055 B1
1660
1670
1640
1650
1660
*
»
•
•
•
•
*
*
•
•
ACA GAT GGT GCA GCA AGT TCT ACC TTT GAT TTA ACT AAC GTT GTT CAG CGT
TGT CTA CCA CGT CGT TCA AGA TGG AAA CTA AAT TGA TTG CAA CAA GTC GCA
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gin Arg>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
1710
1720
1690
1700
1730
»
«
•
•
*
*
*
*
ATT GGT ATT GAA TTA GAC AAT GCT GGA AAT GTA ACT AAA ACC AAA GAA ACA
TAA CCA TAA CTT AAT CTG TTA CGA CCT TTA CAT TGA TTT TGG TTT CTT TGT
He Gly He Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys Glu Thr>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
>
a
a
a
1760
1770
1780
1740
1750
*
*
*
*
»
*
*
•
•
•
*
AAA ATT ATT GCC AAA CTT GGT GAA GGT GAT GAC AAC GTA TTT GTT GGT TCT
TTT TAA TAA CGG TTT GAA CCA CTT CCA CTA CTG TTG CAT AAA CAA CCA AGA
Lys He He Ala Lys Leu Gly Glu Gly Asp Asp Asn Val Phe Val Gly Ser>
>
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
a
a
1790
1800
1810
1620
1830
•
*
*
*
«
•
•
*
•
»
GGT ACG ACG GAA ATT GAT GGC GGT GAA GGT TAC GAC CGA GTT CAC TAT AGC
CCA TGC TGC CTT TAA CTA CCG CCA CTT CCA ATG CTG GCT CAA GTG ATA TCG
Gly Thr Thr Glu He Asp Gly Gly Glu Gly Tyr Asp Arg Val His Tyr Ser>
>
a
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE ISPLIT]
1840
1850
I860
1870
I860
*
»
»
*
*
•
»
•
*
•
CGT GGA AAC TAT GGT GCT TTA ACT ATT GAT GCA ACC AAA GAG ACC GAG CAA
GCA CCT TTG ATA CCA CGA AAT TGA TAA CTA CGT TGG TTT CTC TGG CTC GTT
Arg Gly Asn Tyr Gly Ala Leu Thr He Asp Ala Thr Lys Glu Thr Glu Gln>
>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
1890
1900
1910
1920
1930
•
*
• *
GGT AGT TAT ACC GTA AAT CGT TTC GTA GAA ACC GGT AAA GCA CTA CAC GAA
CCA TCA ATA TGG CAT TTA GCA AAG CAT CTT TGG CCA TTT CGT GAT GTG CTT
Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr Gly Lys Ala Leu His Glu>
>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
1960
1940
1950
1970
1980
»
«
*
•
»
»
»
*
«
»
GTG ACT TCA ACC CAT ACC GCA TTA GTG GGC AAC CGT GAA GAA AAA ATA GAA
CAC TGA AGT TGG GTA TGG CGT AAT CAC CCG TTG GCA CTT CTT TTT TAT CTT
Val Thr Ser Thr His Thr Ala Leu Val Gly Asn Arg Glu Glu Lys He Glu>
>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
a
2020
2010
2000
2040
1990
2030
*
*
•
*
•
*
*
*
•
•
•
TAT CGT CAT AGC AAT AAC CAG CAC CAT GCC GGT TAT TAC ACC AAA GAT ACC
ATA GCA GTA TCG TTA TTG GTC GTG GTA CGG CCA ATA ATG TGG TTT CTA TGG
Tyr Arg His Ser Asn Asn Gin His His Ala Gly Tyr Tyr Thr Lys Asp Thr>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
FIGURE
6 CONTINUED
58
EP 0 635 055 B1
2050
2060
2070
2080
2090
*
*
*
•
*
»
•
*
«
»
TTG AAA GCT GTT GAA GAA ATT ATC GGT ACA TCA CAT AAC GAT ATC TTT AAA
AAC TTT CGA CAA CTT CTT TAA TAG CCA TGT AGT GTA TTG CTA TAG AAA TTT
Leu Lys Ale Val Glu Glu He Zle Gly Thr Ser His Asn Asp Zle Phe Lys>
a
a
a RECOMBINANT LEUKOTOXZN PEPTIDE [SPLIT]
a
a
a
>
2100
2110
2120
2130
•
•
•
•
»
*
»
•
GGT AGT AAG TTC AAT GAT GCC TTT AAC GGT GGT GAT GGT
CCA TCA TTC AAG TTA CTA CGG AAA TTG CCA CCA CTA CCA
Gly Ser Lys Phe Asn Asp Ala Phe Asn Gly Gly Asp Gly
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
2140
•
«
GTC GAT ACT ATT
CAG CTA TGA TAA
Val Asp Thr I l e >
a
a
>
a
2150
2160
2170
2180
2190
*
*
•
•
•
•
•
•
«
.
GAC GGT AAC GAC GGC AAT GAC CGC TTA TTT GGT GGT AAA GGC GAT GAT ATT
CTG CCA TTG CTG CCG TTA CTG GCG AAT AAA CCA CCA TTT CCG CTA CTA TAA
Asp Gly Asn Asp Gly Asn Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp I l e >
«
*
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
>
a
2200
2210
2220
2230
2240
*
*
*
*
*
»
*
•
«
»
CTC GAT GGT GGA AAT GGT GAT GAT TTT ATC GAT GGC GGT AAA GGC AAC GAC
GAG CTA CCA CCT TTA CCA CTA CTA AAA TAG CTA CCG CCA TTT CCG TTG CTG
Leu Asp Gly Gly Asn Gly Asp Asp Phe He Asp Gly Gly Lys Gly Asn Asp>
a
a____a__RECOMB IN ANT LEUKOTOXIN PEPTIDE [SPLIT]
>
a
a
a
2250
ZZ60
2270
2280
2290
* *
*
*
*
•
•
«
•
•
•
CTA TTA CAC GGT GGC AAG GGC GAT GAT ATT TTC GTT CAC CGT AAA GGC GAT
GAT AAT GTG CCA CCG TTC CCG CTA CTA TAA AAG CAA GTG GCA TTT CCG CTA
Leu Leu His Gly Gly Lys Gly Asp Asp He Phe Val His Arg Lys Gly Asp>
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
>
a
a
2300
2310
2320
2330
*
*
•
»
•
*
*
SGT AAT GAT ATT ATT ACC GAT TCT GAC GGC AAT GAT AAA
CCA TTA CTA TAA TAA TGG CTA AGA CTG CCG TTA CTA TTT
Sly Asn Asp He He Thr Asp Ser Asp Gly Asn Asp Lys
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
2340
•
«
•
TTA TCA TTC TCT
AAT AGT AAG AGA
Leu Ser Phe Ser>
>
a
a
a
2350
2360
2370
2380
*
«
«
*
*
*
«
*
SAT TCG AAC TTA AAA GAT TTA ACA TTT GAA AAA GTT AAA
:TA AGC TTG AAT TTT CTA AAT TGT AAA CTT TTT CAA TTT
ksp Ser Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
2390
#
•
CAT AAT CTT GTC
GTA TTA GAA CAG
His Asn Leu Val>
>
a
a
a
'400
2410
2420
2430
2440
ATC ACG AAT AGC AAA AAA GAG AAA GTG ACC ATT CAA AAC TGG TTC CGA GAG
TAG TGC TTA TCG TTT TTT CTC TTT CAC TGG TAA GTT TTG ACC AAG GCT CTC
He Thr Asn Ser Lys Lys Glu Lys Val Thr He Gin Asn Trp Phe Arg Glu>
a
a
>
a, mRECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
a
FIGURE
6 CONTINUED
IP 0 635 055 B1
2490
2470
2460
2460
•450
»
• *
*
•
*
*
»
GCT GAT TTT GCT AAA GAA GTG CCT AAT TAT AAA GC\ ACT AAA GAT GAG AAA
CGA CTA AAA CGA TTT CTT CAC GGA TTA ATA TTT CGT TGA TTT CTA CTC TTT
Ala Asp Phe Ala lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu Lys>
.a
a
>
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
2540
2530
2550
2520
2510
!500
»
*
»
*
*
•
•
•
*
*
•
ATC GAA GAA ATC ATC GGT CAA AAT GGC GAG CGG ATC ACC TCA AAG CAA GTT
TAG CTT CTT TAG TAG CCA GTT TTA CCG CTC GCC TAG TGG AGT TTC GTT CAA
He Glu Glu He He Gly Gin Asn Gly Glu Arg He Thr Ser Lys Gin Val>
a
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
2590
2600
2560
2570
2560
«
*
*
*
•
*
*
*
•
•
SAT GAT CTT ATC GCA AAA GGT AAC GGC AAA ATT ACC CAA GAT GAG CTA TCA
:TA CTA GAA TAG CGT TTT CCA TTG CCG TTT TAA TGG GTT CTA CTC GAT AGT
Ksp Asp Leu He Ala Lys Gly Asn Gly Lys He Thr Gin Asp Glu Leu Ser>
>
a
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
2630
2640
2650
2620
2610
*
*
•
»
»
*
*
»
•
*
AAA GTT GTT GAT AAC TAT GAA TTG CTC AAA CAT AGC AAA AAT GTG ACA AAC
ITT CAA CAA CTA TTG ATA CTT AAC GAG TTT GTA TCG TTT TTA CAC TGT TTG
Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys Asn Val Thr Asn>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
2700
2660
2690
2670
2660
«
»
*
•
«
•
*
*
•
*
&GC TTA GAT AAG TTA ATC TCA TCT GTA AGT GCA TTT ACC TCG TCT AAT GAT
TCG AAT CTA TTC AAT TAG AGT AGA CAT TCA CGT AAA TGG AGC AGA TTA CTA
Ser Leu Asp Lys Leu He Ser Ser Val Ser Ala Phe Thr Ser Ser Asn Asp>
>
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
a
2740
2750
2730
2720
2710
*
•
•
•
•
•
*
•
*
*
TCG AGA AAT GTA TTA GTG GCT CCA ACT TCA ATG TTG CAT CAA AGT TTA TCT
AGC TCT TTA CAT AAT CAC CGA GGT TGA AGT TAC AAC CTA GTT TCA AAT AGA
Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met Leu Asp Gin Ser Leu Ser>
>
a
a
a
a
a RECOMBINANT LEUKOTOXIN PEPTIDE [SPLIT]
a
2790
2800
2780
2770
2760
,
«
«
*
•
•
»
*
*
*
*
GAA
GTA
GAC
CTT
AAT
TTA
ATA
GGA
GGC
CAA
AA
TTT
GCT
AGG
G
CAA
CTT
TCT
AGA GAA GTT AAA CGA TCC C TT GTT CCG AAT CTG GAA TAT CCT TTA CAT CTT
Glu Gin Gly Leu Asp Leu He Gly Asn Val Glu>
>
b
b
b HMB GENE (ORFl)
b
b
b
Ser Leu Gin Phe Ala Arg>
RECOMBINANT LEUKOT a_>
2850
2B40
2830
2820
2810
*
*
•
•
•
*
•
•
•
*
GGC
GTG
TGC
CCC
GCC
ACG
GAC
GTC
TTA
CAC
TAT
GAC
CCC
AGA
GGT TGC AGA
CCA ACG TCT TCT CTG GGG ATA GTG ACG GGG CGG CTG CAG AAT TGC CAC CCG
Gly Cys Arg Arg Asp Pro Tyr His Cys Pro Ala Asp Val Leu Thr Val Gly>
>
b
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
FIGURE
6 CONTINUED
60
EP 0 635 055 B1
2660
2870
2680
2890
2900
ATA GGC TCC ACG GAA GCA AAC GGA AAA AAC ATT GAC CCT AAA AAA CGT TAT
TAT CCG AGG TGC CTT CGT TTG CCT TTT TTG TAA CTG GGA TTT TTT GCA ATA
XI* Gly Ser Thr Glu Ala Asn Gly Lya Asn lie Asp Pro Lys Lys Arg Tyr>
b
b
b
b
b
b HMB GENS (ORFl)
b
b
b - b
b
b
>
2910
2920
2930
2940
2950
*
•
»
*
*
* *
*
•
•
AGC GAC AAA GAA ATA GCC CAA AGA TGG GCA TAT GAT TTA CGC CTG GCG GAA
TCG CTG TTT CTT TAT CGG GTT TCT ACC CGT ATA CTA AAT GCG GAC CGC CTT
Ser Aap Lys Glu lie Ala Gin Arg Trp Ala Tyr Asp Leu Arg Leu Ala Glu>
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
b
>
2960
2970
2980
2990
3000
•
*
*
*
»
*
»
•
*
«
CAA TGC GTA AAC CGC TAT GGA AAC GGC AAA AAT CTA CCG CAA GGG GCG TTT
GTT ACG CAT TTG GCG ATA CCT TTG CCG TTT TTA GAT GGC GTT CCC CGC AAA
Gin Cys Val Asn Arg Tyr Gly Asn Gly Lys Asn Leu Pro Gin Gly Ala Phe>
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
b
>
3010
3020
3030
3040
3050
3060
*
*
*
*
*
»
»
»
»
«
»
GAT GCC TTT GTT TCC ATT ACC TTT AAT GTA GGA TGT GGA AAA ATG CAA AAA
CTA CGG AAA CAA AGG TAA TGG AAA TTA CAT CCT ACA CCT TTT TAC GTT TTT
Asp Ala Phe Val Ser lie Thr Phe Asn Val Gly Cys Gly Lys Met Gin Lys>
b
b
b
to
b
b HMB GENE (ORFl)
b
b
b
b
b
b
>
3070
3080
3090
3100
3110
*
•
•
•
•
•
*
•
»
«
AGC ACC TTA TTT AAA CAA GCA AAC CAA GGC TTT ACC CCT CAA CTC TGT CAC
TCG TGG AAT AAA TTT GTT CGT TTG GTT CCG AAA TGG GGA GTT GAG ACA GTG
Ser Thr Leu Phe Lys Gin Ala Asn Gin Gly Phe Thr Pro Gin Leu Cys Hls>
b
b
b
b
b
b HMB GENE (ORFl)
b
b
b
b
b
b
>
3120
3130
3140
*
•
*
•
*
•
CAG TTT GAA CGC TGG ATT TAC GCA GGC GGA
GTC AAA CTT GCG ACC TAA ATG CGT CCG CCT
Gin Phe Glu Arg Trp lie Tyr Ala Gly Gly
b
b
b
b
b
b HMB GENE (ORFl)
3170
3180
•
•
•
•
•
3CA CGC AGA GCA AAA GAA AAA GCC
CGT GCG TCT CGT TTT CTT TTT CGG
Ma Arg Arg Ala Lys Glu Lys Ala
b
b
b
b
b
HMB GENE
3150
3160
•
•
*
»
AAA AAA TTA AAC GGC TTA GTA
TTT TTT AAT TTG CCG AAT CAT
Lys Lys Leu Asn Gly Leu Val>
b
b
b
b
to
b
>
3190
3200
3210
•
*
•
•
•
CTC TGT TTA GGT GAA TAC CAT GAT TAA
GAG ACA AAT CCA CTT ATG GTA CTA ATT
Leu Cys Leu Gly Glu Tyr His Asp>
(ORFl)
b
b
b
b
b
>
3220
3230
3240
3250
3260
*
*
*
•
*
•
»
»
*
,
XGTGCATTATTTTTAAACACCACATTAAACAAAGTCATCATCGTTGCAGT
3GCACGTAATAAAAATTTGTGGTGTAATTTGTTTCAGTAGTAGCAACGTCA
FIGURE
6 CONTINUED
EP 0 635 055 B1
3300
3290
3310
3260
3270
*
*
•
•
•
•
*
•
•
*
•
TGCTATACTTATCAGCATCAACGGCTATTIGTATTTTAACAACCAAGTAAA
^GATATGAATAGTCGTAGTTGCCGATAAACATAAAATTGTTGGTTCATTT
3350
3360
3340
3330
3320
*
•
•
•
•
*
*
•
•
•
AGAACAAAAAATCATCAACGCAAACAACATCCTCAACCAAGAAAAGGAAAC
TCTTGTTTTTTAGTAGTTGCGTTTGTTGTAGGAGTTGGTTCTTTTCCTTTG
3370
3360
3400
3390
3410
GACCAAACAACTAAAGGCTCAATTAGATCATGCAAAAAAACAACTCAACCA
CTGGTTTGTTGATTTCCGAGTTAATCTAGTACGTTTTTTTGTTGAGTTGGT
3450
3460
3440
3430
3420
•
•
•
•
•
•
•
•
•
a
.
CTATCAAGAACAAGTAAAAAAACTGAATGACAACCTCTTAACTCATTTACA
GATAGTTCTTGTTCATTTTTTTGACTTACTGTTGGAGAATTGAGTAAATGT
3500
3460
3490
3510
3470
«
•
•
*
•
*
•
•
•
•
CCAAGCGGAGAAACGGACTGATGAAATTAAACAAGCGT7ACAATATGAGAG
GGTTCGCCTCTTTGCCTGACTACTTTAATTTGTTCGCAATGTTATACTCTC
3S20
3530
3540
3550
3560
3570
*
*
*
*
■
*
*
•
•
•
*
CTGGAGCGGTCAGCCTGTGCCTAATCGCATTATCCGCCTGTTCAACGAACG
GACCTCGCCAGTCGGACACGGATTAGCGTAATAGGCGGACAAGTTGCTTGC
3590
3600
3560
3610
3620
*
»
»
•
*
•
*
*
*
*
AACACATCAGATTAATAGAGCCGATACCGCTACTTTGCCCGACAGATCAAC
TTGTG7AGTCTAATTATCTCGGCTATGGCGATGAAACGGGCTGTCTAGTTG
3630
3640
3650
3660
3670
•
•
»
•
«
•
»
»
»
»
TATGCCAAAAACCGACAATAACACTAAAAAATAACGGAGATCTCGTCGTTG
ATACGGTTTTTGGCTGTTATTGTGATTTTTTATTGCCTCTAGAGCAGCAAC
3660
3690
3700
3710
3720
•
•
•
•
•
•
•
•
•
•
CCT7GGATAAAACACTCAATGAAATAGAAAAATGTATGCTGATAAATCAAG
GGAACCTATTTTGTGAGTTACTTTATCTTTTTACATAC6ACTATTTAGTTC
3740
3750
3760
3730
3770
*
*
•
«
*
*
•
•
•
«
CAC7TACACAGTGCATAGAAAACTACAACCGCACATTACAGGAAAAAAAAC
GTGAATGTGTCACGTATCTTTTGATGTTGGCGTGTAATGTCCTTTTTTTTG
3790
3800
3810
3780
3820
»
*
*
•
»
•
*
•
»
*
•
ATGACTGATCAAGTAGACAGAGCCAACGAATACACAGAAATAATGCAACAA
TACTGACTAGTTCATCTGTCTCGGTTGCTTATGTGTCTTTATTACGTTGTT
FIGURE
6 CONTINUED
62
EP 0 635 055 B1
3860
3670
3650
3640
3B30
*
»
•
•
•
*
«
•
*
*
CTTGCCATCCAAKAACACCAACAAAAAACACGGGAAaAAAGCACAGTGAAA
GAACGGTAGGTTTTTGTGGTTGTTTTTTGTGCCCTTTTTTCGTGTCACTTT
3880
*
•
TACTGTCTAGA
ATGACAGATCT
FIGURE
6 CONTINUED
63
EP 0 635 055 B1
AAAAAATCCA TTGATAGCAA TCAGTTTTAT CTGAAATTGG TACAAAAAAT AATTACTATT
60
TTTAGTATGA ATACCAGTGC AGAATACTTT ACGACTAGAA CTTCGTTTAC GTCTGCCGGT
12 0
GATGCAGGGT TATTGGGGTG TTCCTTAAAT GCCTTTGAAA ATTACCAACT GAATGAAGCG
180
TGGACTTGGG AAAAACAGGC TTTAGTTCGT TGTAGGGCGG TATACGGCGA TATTGATTTA
24 0
TGTGAACGCT TTGAAAAAAT TCGTTGTAAT GTGCTTTCAG CTCCAAGAAA TGTGGAACAG
300
CTGAAGCAAG ATATACGAGA GATGCGTCAA AAAATGTATC ATCATCTCTC TAAACATAAA
360
ACGGACGAAT TTAATATTAA GACTGATTTG GGCGGTATCA CAGATATTGA GTTTATTGCA
420
CAATACTTAG TTTTAGCTTA TGCTCCCCAA CACTAGCATT AACACGTTGG TCTGATAATG
480
TAGGATATTT GACTGTATGG CTGAAAGTGC GGTGATTTCA CAAGAAGTTT CCACAAAGTC
54 0
AAAAAAA TGC TATGTAAATT TACGAAACCA AATTCATCAT TTAAATTTAT TAGGTCAAGA
600
ACCGATTATT AATGCACAAC TATTTAGCAA GGAAAGAACG TTTATTCTCA ATACATGGAA
660
AAGTTTATTG GAATGAATGA ACTTATAATT GCCCTAAAAT CAGCATATGA TAA GAAA TTA
720
TTTATCATTT GTATTTTCTT TGTTATGCTA TGCAGACCTT TAACTTACAT TAACAAATGA
78 0
GAAATAAACG ATG AAA TTA AAT AAA TCA CTT TTG GTC GGC ACA TTA GTC
Met Lys Leu Asn Lys Ser Leu Leu Val Gly Thr Leu V a l
1
5
10
GCC TCA ACT GTA TTA TTA GCA GCT TGT AAT GAA AAA AAT AAA GCG GAA
Ala Ser Thr Val Leu Leu Ala Ala Cys Asn Glu Lys Asn Lys Ala Glu
15
20
25
829
877
ACA ACG CCA ACT GAA CCG GTT ACA GTT GCA GAA ACT CAA GCT CAA CCT
Thr Thr Pro Thr Glu Pro Val Thr Val Ala Glu Thr Gin Ala Gin P r o
30
35
40
45
925
GAC GTT CAA GGA AAA ACT GAA ACA ACT TCA TCT GAA TCA ACC GCA ATT
Asp Val Gin Gly Lys Thr Glu Thr Thr Ser Ser Glu Ser Thr Ala H e
50
55
60
973
GAA AAT ACA CAA TCT GAT GCT CAA GAA AAA ACT GAG ACA ACT TCA GTT
Glu Asn Thr Gin Ser Asp Ala Gin Glu Lys Thr Glu Thr Thr Ser V a l
65
70
75
1021
GAA ACA ACC TCG ACT GAA CCA ACC GCA GCT GGA AAC ACA CAA CCT GAA
Glu Thr Thr Ser Thr Glu Pro Thr Ala Ala Gly Asn Thr Gin Pro Glu
80
85
90
1069
TCT CAA GAA AAA GTT GTT TCA GAA AAA AGT GAG ACA GTT GTT CAA GAA
Ser Gin Glu Lys Val Val Ser Glu Lys Ser Glu Thr Val Val Gin Glu
95
100
105
1117
ATT CTT AAT CAG TTT AAC AAT ACA GTT ACG ATC CAA TTG GTG GGG TAT
He Leu Asn Gin Phe Asn Asn Thr Val Thr He Gin Leu Val Gly T y r
115
120
110
125
1165
FIGURE
64
7
EP 0 635 055 B1
CAG AGT GAA AAA ATA GAG GGT GAA GAT ACT TTA TCT TTC GTT TAT AAC
Gin Ser Glu Lys H e Glu Gly Glu Asp Thr Leu Ser Phe Val Tyr Asn
135
130
140
1213
GTT AAG AAT AAA GGT GAT AAA GCA ATC AAA GAA CTT CAG TGG TAT AAC
Val Lys Asn Lys Gly Asp Lys Ala H e Lys Glu Leu Gin Trp Tyr Asn
145
150
155
1261
CTT GTT TTC TTT AAT TCG ACT CTG GTA GAG CCT CTT TCA ATA GCC TAT
Leu Val Phe Phe Asn Ser Thr Leu Val Glu Pro Leu Ser H e Ala Tyr
160
165
170
13 09
TCT TTT GAG GAT ACG CTT GCT CCG GAA GGC GAG GGC GAA ATA AAA TTA
Ser Phe Glu Asp Thr Leu Ala Pro Glu Gly Glu Gly Glu He Lys Leu
175
180
185
13 57
ACA AAA TTA GCT AAA ACT TAT GCT GAA GAG ATT CGT GCA GAT ATA CTA
Thr Lys Leu Ala Lys Thr Tyr Ala Glu Glu H e Arg Ala Asp l i e Leu
190
195
200
205
14 05
AAA CCG GAA GCT AAT CTT CAA TTT AGC CCA ATA ATT GCA GGT CGA ATT
Lys Pro Glu Ala Asn Leu Gin Phe Ser Pro He H e Ala Gly Arg H e
210
215
220
14 53
ATT TTT GAA GAC GGT ACG CAA TTA GTT GTA ACT ACA GAT GAA GAG CTT
H e Phe Glu Asp Gly Thr Gin Leu Val Val Thr Thr Asp Glu Glu Leu
225
230
235
1501
ACT CAA TCT TTA CAG CAA ATT TTA ACG CAA TAATTTTTAA AAATAATTAT
Thr Gin Ser Leu Gin Gin H e Leu Thr Gin
240
245
1551
TCAACGCATT AGTTATCTAT CCGCTCTTAC AAATCTATAA TATTTATAAA TAA CTA CAAA
1611
AAGTTATCAA TAAGATTTTA TAGATTGGTA AGATCGGTTA TGTTTCCGCA TCGAAATCTA
1671
CTGCCCATTA TTGGCGAAAC CGAAAGAAAT TCGTCGTAAA AAGCGTGCAG AGCAACAAGA
17 31
AAAAGAAGTG TGAAGAAAAA AAGCTGAGAA TTTGCTAAAA ATCAGCTCAA CAAACCGCAC
1791
TTTAATAATA AAAATTT CTG CGAGAAATCA TGTAAAAAAA ATAACACCCT CTTAACAAGA
1851
AGAGGGTGAA TAATCAATTT ACCATTGGTA CCCTATAGAA ACTGAACCTG CCATTTTGCC
1911
TTGAGAATTT CTATTTCCTT GAAATTTAAG CATAATCTTA CGTTATCACT CATACGAGAA
1971
TAACCAATCG CCAT
198 5
FIGURE
7 CONTINUED
65
e
IppA
k8
TGAAGAGATT TATTGGATTG GACCAATAGG
ACTGGCAGAA AATGAATCGG AAGGAACGGA
CTTCCATGCC GTTAAAAACG GCTATGTGTC
AAT7ACACCC AX7CAAACAG ATATGACGGC
.TATCATTCA ATGACAGCTT TACAACAATG
GT7AGATAAG GAA7AACGAT AATCTTTTCA
rCGAAGGAAT AAAACATGAA AATTTTCGGT
ACCCTATATG ATAAAACTAT GCAATGGGCA
LATCACCGTT TTGCTACATT TTGGCTAACT
TTTGTTAGTT TTATTGAGGC TATTTTCTTC
:CAATACCAC CTGATGTCAT GCTTATTCCG
ATGTCAATAA ATAAACCTAA ATGTGCTACT
AATTTGCAT TTTATGCAGC AATGGCTTCA
GCCATTGGTG GGGCAATTGG TTATGGATTA
GTTATTACG CTTTTGATTT CATACAAAGT
TATATTCAAC AATGGGGTTA TCAACAACAT
GGGAAACTG CTCTTTCTTG GTTCAAAGAA
TCGGGTATTT GGGTAGTTTT CGTTGCAGGT
TTTCACCTA TTCCTTATAA AATTTTTACG
ATTTGTGCAG GCGTCATGCA AATGGCATTT
TGCCTTTCT TACTTACTGC CTTTATTTCT
CGTATTGCAA GATTTTTGCT CGTTACCCAT
TAG CGG CTT GGAGCGGAAA AAAATTTGCT
GCGAAATTAC GTCAATCTAT TGAATTTATC
GTTGGTCAG TTGTCATTAT TGCTATAGTT
GTATATCTTG TCTTGAAATA ATCTAAGATA
&AAATGAAT ATAAAGTAAC GGAGAATTTA
C ATG AAA AAA TTT TTA CCT TTA
Met Lys Lys Phe Leu Pro Leu
2
£
120
18o
2A0
3 00
360
420
480
54 0
600
660
720
7 80
840
892
E
E
E
E
2
s
E
E
E
E
HJ
E
S E
e
e
e
e
ss
s
e
s
e
in
e
e
ss
in
E
E
E
2
E
E
K
E
E
E
SI
E
Si
Si
E
? E
E
E
S
E
E
E
E
E
E
E
E
E
£
E
1084
i. s i
5
60
65
}0
-
•••
: E
E
E
E
E
E
E
E
E
E
E
E
E
S
E
1132
i E
E
E
E
E
£1
E
E
S
E
E
S
E
E
E
1160
•J i, -i i x i . 7
EP 0 635 055 B1
oio l u
bii
Val Fro Val
105
lfti al-i_ AAA AT I GAT AAG GGT TTT TAC AAA GGT GAT ACT
Tyr Ser Lys He Asp Lys Gly Phe Tyr Lys Gly Asp T h r
110
115
1228
TAC AAA GTA CGC AAA GC-C GAT ACC ATG TTT CTT ATT GCT TAT ATT TCA
Tyr Lys Val Arg Lys Gly Asp Thr Met Phe Leu H e Ala Tyr H e S e r
120
125
130
135
127 6
GGC ATG GAT ATA AAA GAA TTG GCC ACA CTA AAT AAT ATG TCT GAG CCA
Gly Met Asp He Lys Glu Leu Ala Thr Leu Asn Asn Met Ser Glu P r o
140
145
150
1324
TAT CAT CTG AGT ATT GGA CAA GTA TTG AAA ATT GCA AAT AAT ATT CCC
Tyr His Leu Ser He Gly Gin Val Leu Lys He Ala Asn Asn H e P r o
155
160
165
1372
GAT AGC AAT ATG ATA CCA ACA CAG ACA ATA AAT GAA TCA GAG GTG ACA
Asp Ser Asn Met He Pro Thr Gin Thr H e Asn Glu Ser Glu Val T h r
170
175
180
14 2 0
CAA AAT ACA GTC AAT GAG ACA TGG AAT GCT AAT AAA CCA ACA AAT GAA
Gin Asn Thr Val Asn Glu Thr Trp Asn Ala Asn Lys Pro Thr Asn Glu
185
190
195
14 68
CAA ATG AAA CCC GTT GCT ACA CCA ACA CAT TCA ACA ATG CCA ATC AAT
Gin Net Lys Pro Val Ala Thr Pro Thr His Ser Thr Met Pro H e A s r
200
205
210
215
1516
ftAA ACA CCT CCA GCC ACC TCA AAT ATA GCT TGG ATT TGG CCA ACA AAT
Lys Thr Pro Pro Ala Thr Ser Asn He Ala Trp H e Trp Pro Thr Asn
220
225
230
1564
GGA AAA ATT ATT CAA GGA TTT TCC AGT GCT GAT GGA GGC AAT AAA GGT
Sly Lys He H e Gin Gly Phe Ser Ser Ala Asp Gly Gly Asn Lys Gly
235
240
245
1612
VTT GAT ATT AGC GGT TCT CGT GGA CAA GCT GTT AAT GCA GCA GCT GCA
He Asp He Ser Gly Ser Arg Gly Gin Ala Val Asn Ala Ala Ala A l a
250
255
260
1660
rGG ACG CAG TTG TAT ATG CCG GAG ACG CTT TAC GTG GAT ATG GTA ATT
rrp Thr Gin Leu Tyr Met Pro Glu Thr Leu Tyr Val Asp Met Val H e
265
270
275
1708
rAATTATTAT TAAACATAAT GACAGTTATT TAA GTG CTT A TG CAC ATAAT GAAAGTATAC
1768
rCGTCAAAGA TCAGCAAGAA GTTAAAGCGG GTCAACAAAT TGCTAAAATG GGAAGTTCTG
1828
SAACAAACAC AATCAAACTC CATTTTAAAT TCGTTATTTT GGTCAATCAG TAGATCC
1885
r-IGURE
9 CONTINUED
18
EP 0 635 055 B1
rTTAATACGA CTCACTATAG GGAATTCGAG TCGATCTAAG CTTCCCGGGG ATCACCGTGC
60
ftTTTTACATT GCACATACTC AAGGAGCAAT TTATGTTATC TATTTTA ATG CAA GGT
Met Gin Gly
1
116
TTA CGC TTA AAA AAA TGC TTT CTC CCG ATT TTA GTT ATG TTT TTT TTA
Leu Arg Leu Lys Lys Cys Phe Leu Pro He Leu Val Met Phe Phe Leu
15
10
5
164
GCA GGC TGT GTC AAT TTA TTA GGC AGT AGC TTT ACG GCA AGC TTA AAA
Ala Gly Cys Val Asn Leu Leu Gly Ser Ser Phe Thr Ala Ser Leu Lys
35
30
25
20
212
AAT GAT GCC AAT GCA AGT TCT GAT TTT TAC ATT CGG AAA ATT GAA CAA
Asn Asp Ala Asn Ala Ser Ser Asp Phe Tyr He Arg Lys H e Glu Gin
50
45
40
2 60
ACA CAA AAT CAA CAA GAT TTA CAA ACC TAT AAA CTT TTA GCT GCT CGA
Thr Gin Asn Gin Gin Asp Leu Gin Thr Tyr Lys Leu Leu Ala Ala Arg
65
60
55
2 08
GTT TTA GTA ACA GAA AAT AAA ATC CCG CAA GCG GAA GCA TAT CTT GCT
Val Leu Val Thr Glu Asn Lys H e Pro Gin Ala Glu Ala Tyr Leu A l a
80
75
70
3 56
GAA TTG ATA GAT TTA AAT GAT GAA CAA AAA CTA GAT AAA TCC CTG ATT
Glu Leu He Asp Leu Asn Asp Glu Gin Lys Leu Asp Lys Ser Leu H e
95
90
85
4 04
GAA GCT CAT ATT TCT GCT GTT AAA GGC AAA AAT GAA ACG GCA GAA TAT
Glu Ala His He Ser Ala Val Lys Gly Lys Asn Glu Thr Ala Glu T y r
115
110
105
100
4 52
CAA TTA TCT TTA ATT CAC TTG ACA TTA CTT AGT CCT TCA CAA AAA TCA
Gin Leu Ser Leu H e His Leu Thr Leu Leu Ser Pro Ser Gin Lys S e r
130
125
120
5 00
CGT TAT TAT GAG ATT GTT TCT CGT ATT GCA GAA AAT CGT CAT GAT AAT
Arg Tyr Tyr Glu H e Val Ser Arg He Ala Glu Asn Arg His Asp Asn
145
140
135
54 8
ATT TCA GCG ATA AAA GCT CGA ATT CAA ATG GAT AAT TTT TTA AGT GAT
H e Ser Ala l i e Lys Ala Arg H e Gin Met Asp Asn Phe Leu Ser Asp
160
155
150
596
ATT CAA CGA AAA CAA CAA AAT AAT GAC CGC ACT TGG GCA TTG CTA CGC
H e Gin Arg Lys Gin Gin Asn Asn Asp Arg Thr Trp Ala Leu Leu Arg
175
170
165
64 4
AAT ACA GAT AGT GAA GTA CTA AAT AAT ACT GAT GCG GAA GGA AAT ATT
Asn Thr Asp Ser Glu Val Leu Asn Asn Thr Asp Ala Glu Gly Asn H e
190
195
185
180
692
ACA TTG AGC GGT TGG TTA ACA TTA GCT CAA CTA TAC AAT GAT AAC CTT
Thr Leu Ser Gly Trp Leu Thr Leu Ala Gin Leu Tyr Asn Asp Asn Leu
205
210
200
74 0
FIGURE
69
10
EP 0 635 055 B1
AAT CAA CCT GCA CAA TTA ATT CAA ACA TTA CTG ACT TC-G AAA AAT TAT
Asn Gin Pro Ala Gin Leu He Gin Thr Leu Leu Thr Trp Lys Asn Tyr
220
215
225
7 88
TAT CCA ACA CAT ACG GCA GCA CAT TTA TTA CCT ACA GAA TTA CAA GGG
Tyr Pro Thr His Thr Ala Ala His Leu Leu Pro Thr Glu Leu Gin Gly
230
235
240
S36
CTT GCC AAT TTT CAA CAA ACT ACT TTA ACG CAA GTC C-GT CTA ATA CTC
Leu Ala Asn Phe Gin Gin Thr Thr Leu Thr Gin Val Gly Leu He Leu
245
250
255
8 84
CCT TTA AGC GGC AAT ACA CGA CTT ATC GGT GAA ACA ATC AAA AAC GGG
Pro Leu Ser Gly Asn Thr Arg Leu He Gly Glu Thr He Lys Asn Gly
260
265
270
275
932
TTT GAT GAT GCC AAA GTC AAT TAC AAT GTT CAA GTT CAC GTA TTT GAC
Phe Asp Asp Ala Lys Val Asn Tyr Asn Val Gin Val His Val Phe Asp
285
280
290
980
TCA ATG AAA ATG TCT ATA GAA CAA ATT ATT AAT CAA GCA AAA AAA CAG
Ser Met Lys Met Ser l i e Glu Gin l i e l i e Asn Gin Ala Lys Lys Gin
295
300
305
102 8
GGA ATT AAC ACT CTT GTC GGA CCA TTA CTC AAA CAA AAT GTT GAT GTT
Gly He Asn Thr Leu Val Gly Pro Leu Leu Lys Gin Asn Val Asp Val
310
315
320
107 6
ATA GTC AAT AAT CCG TAT TTG GTA CAA GAT TTA AAT GTA TTA GCG TTG
H e Val Asn Asn Pro Tyr Leu Val Gin Asp Leu Asn Val Leu Ala Leu
325
330
335
1124
AAC TCT ACG CCT AAT GCA CGG GCA ATT GAA CAC CTT TGT TAT TAT GGA
Asn Ser Thr Pro Asn Ala Arg Ala He Glu His Leu Cys Tyr Tyr Gly
340
345
350
355
117 2
TTA TCG CCT GAA GAT GAA GCT GAA AGT GCG GCA AGT AAA ATG TGG AAT
Leu Ser Pro Glu Asp Glu Ala Glu Ser Ala Ala Ser Lys Met Trp Asn
360
365
370
122 0
GAT GCA GTA CGT ATT CCA CTT GTT TTA GTA CCG CAA AAT AAT CTG GGG
Asp Ala Val Arg H e Pro Leu Val Leu Val Pro Gin Asn Asn Leu Gly
375
380
385
12 68
CGA CGC ACG GCA GCG GCA TTT ACT CTA CGT TGG CAA CAA CTA TTG GGT
Arg Arg Thr Ala Ala Ala Phe Thr Leu Arg Trp Gin Gin Leu Leu Gly
390
395
400
1316
ACT GAT GCC AAT ATT AAA TTC TAT AAT CAA ACC GCA GAT ATT AAT TTT
Thr Asp Ala Asn He Lys Phe Tyr Asn Gin Thr Ala Asp He Asn Phe
405
410
415
13 64
GCA TTA AAA TCG GGG TTA AGT GAA AGT ACT GAC GGC GTG TAT ATT ATT
Ala Leu Lys Ser Gly Leu Ser Glu Ser Thr Asp Gly Val Tyr l i e l i e
425
420
430
435
1412
GCT AAT AAC AAA CAA TTA GCT GAA ATT AAA GCA GTG TTG GAT AAT ATT
Ala Asn Asn Lys Gin Leu Ala Glu l i e Lys Ala Val Leu Asp Asn l i e
440
445
450
14 6 0
FIGURE
10 C O N T I N U E D
70
Asn Pro Thr Leu Lys Leu Tyr a7.
455
i e r Ver Arg £ J
<60
£n
Ser Pro' A^n
465
^
ACT GGT CCT GAA CAT CGT TTG TTT CTG AAT
AAT
CAA TTT AGT GAT
ser Gly Pro Glu His Arg Leu Phe Leu Asn Asn CTG cl£
p £ Se?
Leu
475
,««
1556
VTT CCG TTC TTC AAA GAT AGG GAA TCG GAA
e*i
Ue Pro Phe Phe Lys Asp Arg Glu Ser Glu CAA TAT AAA AAA iATT
Gin Tyr Lys Lys l l
3
490
495
1604
^
Jet
i00
iS
iin
fT
^
^ C TCA TTA ATG CAT TTA TAT GCT ATG GGT
tSP Tyr Ser L6U M6t His Leu T ^ Ala Met Gly
505
510
515
:AT GAT GCT TGG TTA TTA ATA AAT CAA TTT
AAT
TTC CGT CAA ATT
* r Asp Ala Trp Leu Leu He Asn Gin Phe Asn GAA
gYu Phe Arg S i i 2
*
520
525
53o
XC GGA TTT ACC ATT GAT GGG TTA ACA GGA AAA
CTC AGT GCC GGC CCT
>ro Gly Phe Thr l i e Asp Gly Leu Thr
Gly Lys Leu Ser Ala Gly P r o
535
540
545
AC TGT AAT GTT GAA CGT GAT ATG ACT TGG TTC
CAA TAT
™ CAA AAT GGC
sn Cys Asn Val Glu Arg Asp Met Thr Trp Phe g X
£5
S50
555
560
GT ATC TAT CCG CTT AAC GAG CAA GAT GAC AGC
ATC
CTG ATT AAC
er l i e Tyr Pro Leu Asn Glu Gin Asp Asp Ser l i e TAT Leu
i l l J£n
Tyr
565
570
575
AA GAA TGATACAATC CAAACGTCAA CAAGGTGCGA
GTTTTGAATA TCAGGCTCGC
80
MTTGGATT TGATTATGCA AGATCGGCAA ACGATCGTTT
TTGTTGAGGT TCGTCAGCGT
UAATCAAA TTTTCGGTTC AGCAATTGAC AGTGTAGATT
GGAAAAAGCA GCAAAAATGG
rTGATGCAG CCAACCTATG GTTAGCACAA TATGATTCCA
GTTTAGAAGA TGCGGACTGC
; t t t c g a t c TGGTCGCTTT TGGAGCAACA ACAAATGATA
TCCAATGGAT ACCTAATTTT
tTGATGAAT AAAAATTATG AAAAAGTTAA AGATATTTAT
ACGGAAAGTA TTCAAACTCA
kTTTCTTCC TCCAGCTTAC TTG CAACAAA AATCGTAGAG
GCAACTCAAC ATATTGTAAA
XSCCTGCTG AAAGGTAATA AAATTATTGT CTGTGGGCAT
GGTAGATCCT AGCTAGCTAG
:ATGGACCT GCAGGCATGC AAGCTTGGCA CTGAGTCGTT
CGTTTTTACA ACGTTCGTTG
TGGGAAAA CCCTGGTCCG TTT AG
1652
nnn
i v ,
i7«
1796
184 4
1900
2 020
2080
2140
22 00
2260
2320
2380
24 4 0
^. 65
rr
24
EP 0 635 055 B1
10
20
*
*
*
*
ATG GCT ACT GTT ATA GAT CTA
TAC CGA TGA CAA TAT CTA GAT
Met Ala Thr Val H e Asp Leu
b
b
b
b
b
b
40
50
30
*
*
*
*
*
*
AGC TTC CCA AAA ACT GGG GCA AAA AAA ATT
TCG AAG GGT TTT TGA CCC CGT TTT TTT TAA
Ser Phe Pro Lys Thr Gly Ala Lys Lys I l e >
b
b
b
b
b
b
LEUKOTOXIN b
>
60
70
*
*
*
*
*
ATC CTC TAT ATT CCC CAA AAT
TAG GAG ATA TAA GGG GTT TTA
He Leu Tyr H e Pro Gin Asn
b
b
b
b
b
b
90
100
80
*
*
*
*
*
TAC CAA TAT GAT ACT GAA CAA GGT AAT GGT
ATG GTT ATA CTA TGA CTT GTT CCA TTA CCA
Tyr Gin Tyr Asp Thr Glu Gin Gly Asn Gly>
b
b
b
b
b
b
LEUKOTOXIN b
>
120
110
*
*
*
*
*
TTA CAG GAT TTA GTC AAA GCG
AAT GTC CTA AAT CAG TTT CGC
Leu Gin Asp Leu Val Lys Ala
b
b
b
b
b
b
140
150
130
*
*
*
*
*
GCC GAA GAG TTG GGG ATT GAG GTA CAA AGA
CGG CTT CTC AAC CCC TAA CTC CAT GTT TCT
Ala Glu Glu Leu Gly He Glu Val Gin Arg>
b
b
b
b
b
b
>
LEUKOTOXIN b
170
160
*
*
*
*
*
GAA GAA CGC AAT AAT ATT GCA
CTT CTT GCG TTA TTA TAA CGT
Glu Glu Arg Asn Asn He Ala
b
b
b
b
b
b
190
200
180
*
*
*
*
*
ACA GCT CAA ACC AGT TTA GGC ACG ATT CAA
TGT CGA GTT TGG TCA AAT CCG TGC TAA GTT
Thr Ala Gin Thr Ser Leu Gly Thr He Gln>
LEUKOTOXIN b b b b b b t
>
220
210
* *
*
* *
ACC GCT ATT GGC TTA ACT GAG
TGG CGA TAA CCG AAT TGA CTC
Thr Ala H e Gly Leu Thr Glu
b
b
b
b
b
b
250
240
230
*
*
*
*
* *
CGT GGC ATT GTG TTA TCC GCT CCA CAA ATT
GCA CCG TAA CAC AAT AGG CGA GGT GTT TAA
Arg Gly H e Val Leu Ser Ala Pro Gin I l e >
b
b
b
b
b
b
>
LEUKOTOXIN b
270
260
*
*
*
*
GAT AAA TTG CTA CAG AAA ACT
CTA TTT AAC GAT GTC TTT TGA
Asp Lys Leu Leu Gin Lys Thr
b
b
b
b
b
b
290
280
*
*
*
AAA GCA GGC CAA GCA
TTT CGT CCG GTT CGT
Lys Ala Gly Gin Ala
b
b
LEUKOTOXIN b
300
*
*
*
TTA GGT TCT GCC
AAT CCA AGA CGG
Leu Gly Ser Ala
b
b
b
b
GAA
CTT
Glu>
>
340
330
350
320
310
*
*
*
*
*
*
*
*
* *
AGC ATT GTA CAA AAT GCA AAT AAA GCC AAA ACT GTA TTA TCT GGC ATT CAA
TCG TAA CAT GTT TTA CGT TTA TTT CGG TTT TGA CAT AAT AGA CCG TAA GTT
Ser H e Val Gin Asn Ala Asn Lys Ala Lys Thr Val Leu Ser Gly He Gln>
b
b
b
>
b
b
b
b
b
LEUKOTOXIN b
b
b
b
b
390
400
380
370
360
*
*
*
*
*
*
*
*
*
*
TCT ATT TTA GGC TCA GTA TTG GCT GGA ATG GAT TTA GAT GAG GCC TTA CAG
AGA TAA AAT CCG AGT CAT AAC CGA CCT TAC CTA AAT CTA CTC CGG AAT GTC
Ser H e Leu Gly Ser Val Leu Ala Gly Met Asp Leu Asp Glu Ala Leu Gln>
>
b
b
b
b
b
b
b
b
LEUKOTOXIN b
b
b
b
b
FIGURE
72
11
EP 0 635 055 B1
«<!U
430
440
450
*
*
*
*
*
*
*
*
*
*
AAT AAC AGC AAC CAA CAT GCT CTT GCT AAA GCT GGC TTG GAG CTA ACA AAT
TTA TTG TCG TTG GTT GTA CGA GAA CGA TTT CGA CCG AAC CTC GAT TGT
Asn Asn Ser Asn Gin His Ala Leu Ala Lys Ala Gly Leu Glu Leu Thr TTA
Asn>
'
b
b
b
b
b
b
b
b
b
b
LEUK0T0XIN_b
b
b
>
4/u
480
490
500
sin
*
*
*
*
*
*
* *
*
*
*
TCA TTA ATT GAA AAT ATT GCT AAT TCA GTA AAA ACA CTT GAC GAA TTT GGT
AGT AAT TAA CTT TTA TAA CGA TTA AGT CAT TTT TGT GAA CTG CTT AAA CCA
Ser Leu H e Glu Asn H e Ala Asn Ser Val Lys Thr Leu Asp Glu Phe Gly>
b
b
b
b
b
b
LEUKOTOXIN b
b
b
b
b
b
b
>
S30
*
*
*
*
GAG CAA ATT AGT CAA TTT GGT
CTC GTT TAA TCA GTT AAA CCA
Glu Gin H e Ser Gin Phe Gly
b
b
b
b
b
b
540
550
560
*
*
*
*
*
*
TCA AAA CTA CAA AAT ATC AAA GGC TTA GGG
AGT TTT GAT GTT TTA TAG TTT CCG AAT CCC
Ser Lys Leu Gin Asn He Lys Gly Leu Gly>
LEUKOTOXIN b
b
b
b
b
b
b
>
='u
sac
*
*
*
*
ACT TTA GGA GAC AAA CTC AAA
TGA AAT CCT CTG TTT GAG TTT
Thr Leu Gly Asp Lys Leu Lys
b
b
b
b
b
b
590
600
610
*
*
*
*
*
*
AAT ATC GGT GGA CTT GAT AAA GCT GGC CTT
TTA TAG CCA CCT GAA CTA TTT CGA CCG GAA
Asn H e Gly Gly Leu Asp Lys Ala Gly Leu>
LEUKOTOXIN b b b b b b
b >
»JU
*
*
*
*
*
GGT TTA GAT GTT ATC TCA GGG
CCA AAT CTA CAA TAG AGT CCC
Gly Leu Asp Val H e Ser Gly
b
b
b
b
b
b
640
650
660
*
*
*
*
*
CTA TTA TCG GGC GCA ACA GCT GCA CTT
GAT AAT AGC CCG CGT TGT CGA CGT GAA
Leu Leu Ser Gly Ala Thr Ala Ala Leu
LEUKOTOXIN b
b
b
b
b
b
b
o'u
ecu
*
*
*
*
*
CTT GCA GAT AAA AAT GCT TCA
GAA CGT CTA TTT TTA CGA AGT
Leu Ala Asp Lys Asn Ala Ser
b
b
b
b
b
b
690
*
*
ACA GCT AAA AAA
TGT CGA TTT TTT
Thr Ala Lys Lys
LEUKOTOXIN b b
/2U
/ju
* *
*
* *
TTG GCA AAC CAA GTT GTT GGT
AAC CGT TTG GTT CAA CAA CCA
Leu Ala Asn Gin Val Val Gly
b
b
b
b
b
b
740
750
760
*
*
*
*
*
*
AAT ATT ACC AAA GCC GTT TCT TCT TAC ATT
TTA TAA TGG TTT CGG CAA AGA AGA ATG TAA
Asn H e Thr Lys Ala Val Ser Ser Tyr I l e >
LEUKOTOXIN b
b
b
b
b
b
b
>
"u
/bu
*
*
*
*
:TA GCC CAA CGT GTT GCA GCA
LAT CGG GTT GCA CAA CGT CGT
,eu Ala Gin Arg Val Ala Ala
b
b
b
b
b
b
GTA
CAT
Val>
>
700
710
*
*
*
GTG GGT GCG GGT TTT GAA
CAC CCA CGC CCA AA* CTT
Val Gly Ala Gly Phe Glu>
b b b
b b >
790
800
810
*
*
*
*
*
*
GGT TTA TCT TCA ACT GGG CCT GTG GCT GCT
CCA AAT AGA AGT TGA CCC GGA CAC CGA CGA
Gly Leu Ser Ser Thr Gly Pro Val Ala Ala>
b
b
LEUKOTOXIN_b
b
b
b
b
>
uGURE
11 C O N T I N U E D
3
EP 0 635 055 B1
830
820
*
*
*
*
TTA ATT GCT TCT ACT GTT TCT
AAT TAA CGA AGA TGA CAA AGA
Leu H e Ala Ser Thr Val Ser
b
b
b
b
b
b
840
850
860
*
* .
*
*
*
*
CTT GCG ATT AGC CCA TTA GCA TTT GCC GGT
GAA CGC TAA TCG C-GT AAT CGT AAA CGG CCA
Leu Ala H e Ser Pro Leu Ala Phe Ala Gly>
b
b
LEUKOTOXIN b
b
b
b
b
>
890
870
880
900
910
*
*
*
*
*
*
*
*
*
*
ATT GCC GAT AAA TTT AAT CAT GCA AAA AGT TTA GAG AGT TAT GCC GAA CGC
TAA CGG CTA TTT AAA TTA GTA CGT TTT TCA AAT CTC TCA ATA CGG CTT GCG
H e Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala Glu Arg>
b
b
b
b
b
b
b
b
b
>
b
b
LEUKOTOXIN b
b
940
950
920
930
* *
*
*
* *
*
TTT AAA AAA TTA GGC TAT GAC GGA GAT AAT TTA TTA
AAA TTT TTT AAT CCG ATA CTG CCT CTA TTA AAT AAT
Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu
b
b
b
b
b
b
b
LEUKOTOXIN b
b
960
*
*
*
GCA GAA TAT CAG
CGT CTT ATA GTC
Ala Glu Tyr Gin
b
b
b
b
1000
970
980
990
1010
* *
* *
*
*
*
*
*
GGA ACA GGG ACT ATT GAT GCA TCG GTT ACT GCA ATT AAT ACC GCA
CCT TGT CCC TGA TAA CTA CGT AGC CAA TGA CGT TAA TTA TGG CGT
Gly Thr Gly Thr l i e Asp Ala Ser Val Thr Ala H e Asn Thr Ala
b
b
b
b
b
b
b
b
b
b
b
LEUKOTOXIN b
1030
1040
*
*
*
*
*
GCT ATT GCT GGT GGT GTG TCT
CGA TAA CGA CCA CCA CAC AGA
Ala H e Ala Gly Gly Val Ser
b
b
b
b
b
b
1050
1060
*
*
GCT GCT GCA GCC GGC TCG
CGA CGA CGT CGG CCG AGC
Ala Ala Ala Ala Gly Ser
b
b
b
LEUKOTOXIN b
*
TTG
AAC
Leu
b
CGG
GCC
Arg>
>
1020
*
GCC
CGG
Ala>
>
1070
*
*
*
GTT ATT GCT TCA
CAA TAA CGA AGT
Val H e Ala S e r >
b
b
b
>
1120
1100
1110
1080
1090
*
*
*
*
*
*
*
*
* *
CCG ATT GCC TTA TTA GTA TCT GGG ATT ACC GGT GTA ATT TCT ACG ATT
GGC TAA CGG AAT AAT CAT AGA CCC TAA TGG CCA CAT TAA AGA TGC TAA
Pro H e Ala Leu Leu Val Ser Gly He Thr Gly Val l i e Ser Thr H e
b
b
b
b
b
b
b
b
b
b
b
b
LEUKOTOXIN b
CTG
GAC
Leu>
>
1130
1140
*
*
*
*
CAA TAT TCT AAA CAA GCA ATG
GTT ATA AGA TTT GTT CGT TAC
Gin Tyr Ser Lys Gin Ala Met
b
b
b
b
b
b
1170
1150
1160
*
*
*
*
*
*
TTT GAG CAC GTT GCA AAT AAA ATT CAT AAC
AAA CTC GTG CAA CGT TTA TTT TAA GTA TTG
Phe Glu His Val Ala Asn Lys H e His Asn>
b
>
b
b
b
b
b
LEUKOTOXIN b
1190
1180
*
*
* *
AAA ATT GTA GAA TGG GAA AAA
TTT TAA CAT CTT ACC CTT TTT
Lys H e Val Glu Trp Glu Lys
b
b
b
b
b
b
1220
1210
1200
*
*
*
*
* *
AAT AAT CAC GGT AAG AAC TAC TTT GAA AAT
TTA TTA GTG CCA TTC TTG ATG AAA CTT TTA
Asn Asn His Gly Lys Asn Tyr Phe Glu Asn>
b
>
b
b
b
b
b
LEUKOTOXIN b
FIGURE
11 C O N T I N U E D
74
cr U DoO UOO D I
*
*
*
*
*
GGT TAC GAT GCC CGT TAT CTT
CCA ATG CTA CGG GCA ATA GAA
Gly Tyr Asp Ala Arg Tyr Leu
b
b
b
b
b
b
"
j.*^v
*
*
*
CTG AAC TTA AAC AAA GAG TTA
ftu I l n AAT TG T T ^ C i*7
Leu Asn Leu Asn
Lys Glu Leu
b
b
b
b
b
b
1270
* "60.
,
GCG AAT TTA CAA GAT AAT ATG AAA TTC T t I
I S
CGC TTA AAT GTT CTA TTA TAC TTT
Ala Asn Leu Gin Asp Asn Met Lys Phe J i J >
LEUKOTOXIN b
I
b
b
b
b
b
b
ijuw
1310
1320
*
*
*
*
*
*
CAG GCA GAA CGT GTC ATC GCT ATT ACT r i r
GTC CGT CTT GCA CAG
CGA TAA T*£ S ?
Gin Ala Glu Arg Val l i e Ala l i e Thr Gln>
b
b
LEUKOTOXIN_b
b
b
b
b
>
j.j3u
1360
7
1370
*
*
*
*
*
*
*
*
*
*
:iG GA^'T5G GAT AAC AAC ATT GGT GAT TTA GCT GGT ATT AGC CGT TTA GGT
.TC GTU ACC CTA TTG TTG TAA CCA CTA AAT CGA CCA TAA TCG
GCA AAT CCA
.In Gin Trp Asp Asn Asn l i e Gly Asp Leu Ala
Gly H e Ser Arg Leu Glv>
b
b
b
b
b
b
b
b
LEUK0T0XIN_b
b
b
b
b
>
ii
*
*
*
*
*
GAA £££ ?JC CTT AGT GGT *AA
CTT TTT CAG GAA TCA CCA TTT
Glu Lys Val Leu Ser Gly Lys
b
b
b
b
b
b
uu
J.41U
1420
*
*
*
*
*
GCC TAT GTG GAT GCG TTT GAA GAA GGC AAA
CGG ATA CAC CTA CGC AAA CTT CTT CCG TTT
Ala Tyr Val Asp Ala Phe Glu Glu Gly Lvs>
b
b
LEUK0T0XIN_b
b
b
b
b
>
"
*■»■»«
*
*
*
*
*
'A5 ATF 2 ^ GCC GAT *** TTA
;TG TAA TTT CGG CTA TTT AAT
lis l i e Lys Ala Asp Lys Leu
b
b
b
b
b
b
1460
1470
*
*
*
*
*
GTA CAG TTG GAT TCG GCA AAC GGT ATT ATT
CAT GTC AAC CTA AGC CGT TTG CCA TAA TAA
Val Gin Leu Asp Ser Ala Asn Gly H e I l e >
LEUKOTOXIN b
b
b
b
b
b
b
>
uuu
13J.U
1520
1530
*
*
*
*
*
*
*
*
*
*
AT GTG AGT AAT TCG GGT AAA GCG AAA ACT CAG CAT ATC TTA TTC
AGA ACG
TA CAC TCA TTA AGC CCA TTT CGC TTT TGA GTC GTA TAG AAT
AAG TCT TGC
sp Val Ser Asn Ser Gly Lys Ala Lys Thr Gin His H e Leu Phe Arc T h r >
b
b
b
b
b
b
b
b
LEUKOTOXIN_b
b
b
b
b
>
---*
*
*
*
*
CA TTA TTG ACG CCG GGA ACA
GT AAT AAC TGC GGC CCT TGT
ro Leu Leu Thr Pro Gly Thr
b
b
b
b
b
b
i3ou
1370
1580
*A30U
*
*
*
*
GAG CAT CGT GAA CGC GTA CAA ACA GGT AAA
CTC GTA GCA CTT GCG CAT GTT TGT CCA TTT
Glu His Arg Glu Arg Val Gin Thr Gly Lys>
LEUKOTOXIN b
b
b
b
b
b
b
>
*
*
*
*
GAA TAT ATT ACC AAG CTC
CTT ATA TAA TGG TTC GAG
Glu Tyr H e Thr Lys Leu
b
b
b
b
b
ioxu
1020
1630
*
*
*
*
*
*
AAT ATT AAC CGT GTA GAT AGC TGG AAA ATT
TTA TAA TTG GCA CAT CTA TCG ACC TTT TAA
Asn He Asn Arg Val Asp Ser Trp Lys I l e >
LEUKOTOXIN b
b
b
b
b
b
b
>
AT
TA
yr
_b
lUUKt
II U U r N T l J N U J b D
*
•
.
,
is "I si s
ss is is
rhr A«P oly »1. Al. Se? { £
C
b
b
b
b
b
,
s i Hi j g ss ?* m
J 3 i S SS I S 5 "
LEUK0TOXIN_b
b
b
b
b
g"
in
E
*
*
*
*
*
;
^
ATT GGT ATT GAA TTA GAC AAT GCT GGA
AAT rTi
SJ
ill
ill
cic
£$
§H
K
1680
""J
.
S?
SS
«I
*«~t t»»
gg
ii?
*
*
*
*
*
*
GT GGA AAC TAT GGT GCT TTA ACT ATT GAT rra
irr
™
-b — b
hi
?0ci
b
si
b
js
b
g
b
is
si
T"
«™
»»„
b
*
< a
h
y
sj
*
~«
LnncoToxiN_b_b_b_b^b
§2
«"»
I
tct
^«Bo
*
„
*«
&c
b
1730
*
s*
§s
b
»„i
*
*
*
*
*
*
IGT AGT TAT ACC CTA AAT CGT TTC GTA
GAA ACC GCT *t»
s
i
£
s
s
g
g
a
a
s
g
is s
b
b
b
b
b
b
—
b
LEUK0T0XIN_b
bj_b
t &
<*=
%
I
» *
b
Pb
>
EP 0 635 055 B1
2050
2060
*
*
* *
TTG AAA GCT GTT GAA GAA ATT
AAC TTT CGA CAA CTT CTT TAA
Leu Lys Ala Val Glu Glu H e
b
b
b
b
b
b
2070
2080
2090
*
*
*
*
*
*
ATC GGT ACA TCA CAT AAC GAT ATC TTT AAA
TAG CCA TGT AGT GTA TTG CTA TAG AAA TTT
H e Gly Thr Ser His Asn Asp H e Phe Lys>
LEUKOTOXIN b
b
b
b
b
b
b
>
2100
2110
*
*
*
*
*
GGT AGT AAG TTC AAT GAT GCC
CCA TCA TTC AAG TTA CTA CGG
Gly Ser Lys Phe Asn Asp Ala
b
b
b
b
b
b
2120
2130
2140
*
*
*
*
*
TTT AAC GGT GGT GAT GGT GTC GAT ACT ATT
AAA TTG CCA CCA CTA CCA CAG CTA TGA TAA
Phe Asn Gly Gly Asp Gly Val Asp Thr I l e >
LEUKOTOXIN b
b
b
b
b
b
b
>
2150
2160
*
*
*
*
*
GAC GGT AAC GAC GGC AAT GAC
CTG CCA TTG CTG CCG TTA CTG
Asp Gly Asn Asp Gly Asn Asp
b
b
b
b
b
b
2170
2180
2190
*
*
*
*
*
CGC TTA TTT GGT GGT AAA GGC GAT GAT ATT
GCG AAT AAA CCA CCA TTT CCG CTA CTA TAA
Arg Leu Phe Gly Gly Lys Gly Asp Asp I l e >
b
b
b
b
b
b
LEUKOTOXIN_b
>
2200
2210
*
*
*
*
*
CTC GAT GGT GGA AAT GGT GAT
GAG CTA CCA CCT TTA CCA CTA
Leu Asp Gly Gly Asn Gly Asp
b
b
b
b
b
b
2220
2230
2240
*
*
*
*
*
GAT TTT ATC GAT GGC GGT AAA GGC AAC GAC
CTA AAA TAG CTA CCG CCA TTT CCG TTG CTG
Asp Phe He Asp Gly Gly Lys Gly Asn Asp>
LEUKOTOXIN b
b
b
b
b
b
b
>
2250
2260
* *
*
* *
CTA TTA CAC GGT GGC AAG GGC
GAT AAT GTG CCA CCG TTC CCG
Leu Leu His Gly Gly Lys Gly
b
b
b
b
b
b
2270
2280
2290
*
* *
*
*
*
GAT GAT ATT TTC GTT CAC CGT AAA GGC GAT
CTA CTA TAA AAG CAA GTG GCA TTT CCG CTA
Asp Asp H e Phe Val His Arg Lys Gly Asp>
LEUKOTOXIN b
b
b
b
b
b
b
>
2300
2310
*
*
*
*
GGT AAT GAT ATT ATT ACC GAT
CCA TTA CTA TAA TAA TGG CTA
Gly Asn Asp H e H e Thr Asp
b
b
b
b
b
b
2320
2330
2340
*
*
*
*
*
*
TCT GAC GGC AAT GAT AAA TTA TCA TTC TCT
AGA CTG CCG TTA CTA TTT AAT AGT AAG AGA
Ser Asp Gly Asn Asp Lys Leu Ser Phe S e r >
LEUKOTOXIN b
b
b
b
b
b
b
>
2350
2360
2370
2380
2390
*
*
*
*
*
*
*
*
*
*
SAT TCG AAC TTA AAA GAT TTA ACA TTT GAA AAA GTT AAA CAT AAT CTT GTC
CTA AGC TTG AAT TTT CTA AAT TGT AAA CTT TTT CAA TTT GTA TTA GAA CAG
*sp Ser Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn Leu Val>
b
b
b
b
b
b
b
b
b
b
b
b
LEUKOTOXIN_b
>
2400
2410
2420
2430
2440
*
*
*
*
*
*
*
*
*
*
ATC ACG AAT AGC AAA AAA GAG AAA GTG ACC ATT CAA AAC TGG TTC CGA GAG
TAG TGC TTA TCG TTT TTT CTC TTT CAC TGG TAA GTT TTG ACC AAG GCT CTC
H e Thr Asn Ser Lys Lys Glu Lys Val Thr H e Gin Asn Trp Phe Arg Glu>
b
b
b
b
b
b
b
b
b
b
b
b
LEUKOTOXIN_b
>
FIGURE
11 C O N T I N U E D
i^ou
*
*
*
*
*
GCT GAT TTT GCT AAA GAA GTG
CGA CTA AAA CGA TTT CTT CAC
Ala Asp Phe Ala Lys Glu Val
b
b
t>
b
b
b
^/u
*-ww
*
*
*
*
ATC GAA GAA ATC ATC GGT CAA
TAG CTT CTT TAG TAG CCA GTT
H e Glu Glu H e H e Gly Gin
b
b
b
b
b
b
2530
2540
2550
*
*
*
*
*
*
AAT GGC GAG CGG ATC ACC TCA AAG CAA GTT
TTA CCG CTC GCC TAG TGG AGT TTC GTT CAA
Asn Gly Glu Arg H e Thr Ser Lys Gin V a l >
b
b
b
LEUK0T0XIN_b
b
b
b
>
*
*
*
*
GAT GAT CTT ATC GCA AAA GGT
CTA CTA GAA TAG CGT TTT CCA
Asp Asp Leu H e Ala Lys Gly
b
b
b
b
b
b
^3BU
2590
2600
*
*
*
*
*
*
AAC GGC AAA ATT ACC CAA GAT GAG CTA TCA
TTG CCG TTT TAA TGG GTT CTA CTC GAT AGT
Asn Gly Lys H e Thr Gin Asp Glu Leu S e r >
b
b
b
LEUK0T0XIN_b
b
b
b
>
<:o*u
*
*
*
*
*
AAA GTT GTT GAT AAC TAT GAA
TTT CAA CAA CTA TTG ATA CTT
Lys Val Val Asp Asn Tyr Glu
b
b
b
b
b
b
^dju
*
*
*
TTG CTC AAA CAT
AAC GAG TTT GTA
Leu Leu Lys His
LEUKOTOXIN b
b
*d/u
*
*
*
*
*
\GC TTA GAT AAG TTA ATC TCA
rCG AAT CTA TTC AAT TAG AGT
5er Leu Asp Lys Leu H e Ser
b
b
b
b
b
b
^680
2690
2700
*
*
*
*
*
TCT GTA AGT GCA TTT ACC TCG TCT AAT GAT
AGA CAT TCA CGT AAA TGG AGC AGA TTA CTA
Ser Val Ser Ala Phe Thr Ser Ser Asn A s p >
LEUKOTOXIN b
b
b
b
b
b
b _>
t/tu
*
*
*
*
*
XG AGA AAT GTA TTA GTG GCT
iGC TCT TTA CAT AAT CAC CGA
>er Arg Asn Val Leu Val Ala
b
b
b
b
b
b
i/iv
*
*
CCA ACT TCA ATG
GGT TGA AGT TAC
Pro Thr Ser Met
LEUKOTOXIN b
b
2480
2490
*
*
*
*
*
CCT AAT TAT AAA GCA ACT AAA GAT GAG AAA
GGA TTA ATA TTT CGT TGA TTT CTA CTC TTT
Pro Asn Tyr Lys Ala Thr Lys Asp Glu L v s >
b
b
LEUK0T0XIN_b
b
b
b
b
>
*'ou
niv
z/eo
'
*
*
*
*
*
'CT CTT CAA TTT GCT AGG G TA GCT GCT
>GA GAA GTT AAA CGA TCC C AT CGA CGA
Xxx Ala Ala Cys
a
LPPB
a
ier Leu Gin Phe Ala Arg>
b
LEUKOTOXIN
b
b >
^GURE
2640
2650
*
*
AGC AAA AAT GTG ACA
TCG TTT TTA CAC TGT
Ser Lys Asn Val Thr
b
b
b
b
b
2740
*
*
TTG GAT
AAC CTA
Leu Asp
b
b
2750
*
CAA AGT TTA TCT
GTT TCA AAT AGA
Gin Ser Leu S e r >
b
b
b
>
2790
2800
*
*
*
*
*
TGT AGT TCA CAC ACT CCG GCT CCG
ACA TCA AGT GTG TGA GGC CGA GGC
Ser Ser His Thr Pro Ala P r o
PEPTIDE [SPLIT]
>
a
a
11 C O N T I N U E D
3
AAC
TTG
Asn>
>
cr U DoO UOO D I
*e*u
^OJU
*
*
*
*
*
GTA GAA AAT GCT AAG GAT TTA GCA CCA
CAT CTT TTA CGA TTC CTA AAT CGT GGT
Val Glu Asn Ala Lys Asp Leu Ala P r o
a
a
a
a
a
LPPB PEPTIDE
<:biu
2850
*
*
*
*
*
AGT ATT ATC AAA CCG ATT AAT GGT
TCA TAA TAG TTT GGC TAA TTA CCA
Ser H e H e Lys Pro H e Asn Gly>
I SPLIT]
a
a
a
a
a _ >
<«
<eeu
*
*
*
*
*
ACA AAC TCA ACC GCT TGG GAA CCT CAA
TGT TTG AGT TGG CGA ACC CTT GGA GTT
Thr Asn Ser Thr Ala Trp Glu Pro G i n
a
a
a
a
a
LPPB PEPTIDE
2900
*
*
*
*
*
GTT ATT CAA CAA AAG ATG CCC GAA
CAA TAA GTT GTT TTC TAC GGG CTT
Val H e Gin Gin Lys Met Pro Glu>
[ SPLIT]
a
a
a
a
a
>
w
<}JU
*
*
*
*
*
AGT ATG AGA GTG CCG AAA GCA ACA AAC
TCA TAC TCT CAC GGC TTT CGT TGT TTG
Ser Met Arg Val Pro Lys Ala Thr A s n
a
a
a
a
LPPB PEPTIDE
a
*
*
*
*
*
rCC ACT TAT CAA CCT GAA ATC ATT
,GG TGA ATA GTT GGA CTT TAG TAA
Ser Thr Tyr Gin Pro Glu l i e I l e >
[SPLIT]
a
a
a
a
a
>
*
*
*
*
*
:AA CAA AAT CAA CAA AAA ACA
5TT. GTT TTA GTT GTT TTT TGT
51n Gin Asn Gin Gin Lys Thr
a
a
a
a
a
LPPB
<;su
2»»u
3000
*
*
*
*
*
GAA TCG kTA GCA AAA AAA CAG GCT CTA CAA
CTT AGC AT CGT TTT TTT GTC CGA GAT GTT
Glu S e r :ie Ala Lys Lys Gin Ala Leu G l n >
PEPTIDE SPLIT]
a
a
a
a
a
>
«<w*w
JUJU
JU«u
3050
3060
*
*
*
*
*
*
*
*
*
*
AT TTT GAA ATT CCA AGA GAT CCT AAA iCT AAT GTG CCT GTT
'TA AAA CTT TAA GGT TCT CTA GGA TTT ,1"GA TTA CAC GGA CAA TAT AGC AAA
ATA TCG TTT
isn Phe Glu H e Pro Arg Asp Pro Lys ' "hr Asn Val Pro Val
Tyr Ser L v s >
a
a
a
a
LPPB PEPTIDE SPLIT]
a
a
a
a
a
a
>
*
*
*
*
*
*
TT GAT AAG GGT TTT TAC AAA GGT GAT j CT TAC
AA CTA TTC CCA AAA ATG TTT CCA CTA ' GA ATG
le Asp Lys Gly Phe Tyr Lys Gly Asp ' hr Tyr
a ' a
a
a
LPPB PEPTIDE SPLIT]
a
3100
3110
*
*
*
*
AAA GTA CGC AAA GGC GAT
TTT CAT GCG TTT CCG CTA
Lys Val Arg Lys Gly Asp>
a
a
a
a
a
>
*
*
*
*
CC ATG TTT CTT ATT GCT TAT
GG TAC AAA GAA TAA CGA ATA
hr Met Phe Leu H e Ala Tyr
a
a
a
a
LPPB
a
*
ATT TCA
TAA AGT
H e Ser
PEPTIDE
3150
3160
*
*
*
*
GAT ATA AAA GAA TTG GCC
CTA TAT TTT CTT AAC CGG
Asp H e Lys Glu Leu A l a >
a
a
a
a
>
a
-- '*
*
* *
CA CTA AAT AAT ATG TCT GAG
'GT GAT TTA TTA TAC AGA CTC
hr Leu Asn Asn Met Ser Glu
3
a
LPPB
a
a
_»
jiju
3^00
3210
*
* *
*
*
*
CCA TAT CAT CTG AGT ATT GGA CAA GTA TTG
GGT ATA GTA GAC TCA TAA CCT GTT CAT AAC
Pro Tyr His Leu Ser H e Gly Gin Val Leu>
PEPTIDE [SPLIT]
a
a
a
a
>
a
•IGURE
*
( GC ATG
( CG TAC
Cly Met
| SPLIT]
11 C O N T I N U E D
— -*w
*
*
*
*
*
AAA ATT GCA AAT AAT ATT CCC
TTT TAA CGT TTA TTA TAA GGG
Lys H e Ala Asn Asn He Pro
a
a
a
a
a
LPPB
^V
*
GAT AGC
CTA TCG
Asp S e r
PEPTIDE
J««
3260
*
*
*
*
AAT ATG ATA CCA ACA CAG ACA ATA
TTA TAC TAT GGT TGT GTC TGT TAT
316 Pr° Thr Gln Thr H e >
™?2£
[ SPLIT ]
a
a
a
a
a
>
——w
*
*
*
*
*
AAT GAA TCA GAG GTG ACA CAA
TTA CTT AGT CTC CAC TGT GTT
\sn Glu Ser Glu Val Thr Gin
a
a
a
a
a
LPPB
J 43 V
*
AAT ACA
TTA TGT
Asn T h r
PEPTIDE
jjuu
3310
*
*
*
*
.
STC AAT GAG ACA TGG AAT GCT AAT
CAG TTA CTC TGT ACC TTA CGA TTA
™ A S " G1U Thr TrD Asn Ala Asn>
[SPLIT]
a
a
a
a
a
>
———~
^^tv
*
*
*
*
*
^AA CCA ACA AAT GAA CAA ATG AAA CCC
[TT GGT TGT TTA CTT GTT TAC TTT GGG
-ys Pro Thr Asn Glu Gin Met Lys P r o
a
a
a
a
a
LPPB PEPTIDE
JJ3U
3360
*
*
*
*
*
5TT GCT ACA CCA ACA CAT TCA ACA
:AA CGA TGT GGT TGT GTA AGT TGT
fal Ala Thr Pro Thr His Ser Thr>
!SPLIT]
a
a
a
a
a
>
—vvw
«4a#9 W
*
*
*
*
*
ITG CCA ATC AAT AAA ACA CCT CCA GCC
["AC GGT TAG TTA TTT TGT GGA GGT CGG
let Pro H e Asn Lys Thr Pro Pro Ala
a
a
a
a
a
LPPB PEPTIDE
Jiuu
3410
*
*
*
*
*
. kCC TCA AAT ATA GCT TGG ATT TGG
' 'GG AGT TTA TAT CGA ACC TAA
ACC
1•hr Ser Asn He Ala
Trp H e Trp>
SPLIT]
a
a
a
a
a
>
*
*
*
*
*
CCA ACA AAT GGA AAA ATT ATT
CGT TGT TTA CCT TTT TAA TAA
Pro Thr Asn Gly Lys He H e
a
a
a
a
a
LPPB
,
CAA GGA
CTT CCT
Gin Gly
PEPTIDE
J«w
3460
*
*
*
*
' TT TCC AGT GCT GAT GGA GGC
j AA AGG TCA CGA CTA CCT CCG AAT
TTA
] he Ser Ser Ala Asp Gly Gly Asn>
| SPLIT]
a
a
a
a
a
>
—- ——
*
*
*
*
*
AA GGT ATT GAT ATT AGC GGT
TT CCA TAA CTA TAA TCG CCA
ys Cly H e Asp H e Ser Cly
a
a
a
a
LPPB
a
W^ 7 V
*
TCT CGT
AGA CCA
Ser Arg
PEPTIDE
J3UU
3510
*
*
*
*
( GA CAA GCT GTT AAT GCA GCA GCT
( CT GTT CGA CAA TTA CGT CGT CGA
Cly Gin Ala Val Asn Ala Ala Ala>
( SPLIT]
a
a
a
a
a
>
—
*j*«^w
*
*
*
*
*
CA TGG ACG CAC TTG TAT ATG CCC GAG
ST ACC TCC CTC AAC ATA TAC GCC CTC
la Trp Thr Gin Leu Tyr Met Pro Glu
a
a
a
a
a
LPPB PEPTIDE
3560
3570
*
*
*
*
*
A-C CTT TAC GTG GAT ATG GTA ATT
I 5C GAA ATG CAC CTA TAC CAT TAA
1 ir Leu Tyr Val Asp Met Val I l e >
[ SPLIT]
a
a
a
a
a
>
——- "
tfwww
JOXU
JOIU
*
*
*
*
*
*
*
*
*
*
JlATTATTATTAAACATAATGACAGTTATTTAAGTGCTTATGCACATAATG
fTAAT AAT AATTTGT ATT ACTGTCAATAAATTCA CGAATACGTG TATTA C
*
*
*
*
*
AAGTATCTAGCTAGCTAGCCATCG
TTCATAGATCGATCGATCGGTACC
1UUKH
11 U U m i N U E D