MTD | 243-670 | Dissertation - Publication Server of Goethe University Frankfurt

Bindung des C1-Carriers Tetrahydromethanopterin
und seiner Derivate an Enzyme des
Energiestoffwechselweges methanbildender Archaeen
Dissertation
zur Erlangung des Doktorgrades
der Naturwissenschaften
vorgelegt beim Fachbereich Biochemie, Chemie und Pharmazie
der Johann Wolfgang Goethe-Universität
in Frankfurt am Main
von
Katharina Elisabeth Ceh
geb. Körner
aus Stuttgart
Frankfurt am Main 2009
(D 30)
vom Fachbereich Biochemie, Chemie und Pharmazie der
Johann Wolfgang Goethe-Universität als Dissertation angenommen.
Dekan:
Prof. Dr. Dieter Steinhilber
1. Gutachter:
Prof. Dr. Bernd Ludwig
Institut für Molekulare Genetik
der Johann Wolfgang Goethe-Universität in Frankfurt am Main
2. Gutachter:
PD Dr. Ulrich Ermler
Max-Planck-Institut für Biophysik Frankfurt am Main
Datum der Disputation: 10. Juli 2009
EIDESSTATTLICHE ERKLÄRUNG
Hiermit versichere ich, dass ich die vorliegende Arbeit selbstständig angefertigt und
keine weiteren Hilfsmittel und Quellen als die hier aufgeführten verwendet habe.
Katharina Ceh
Frankfurt am Main
Die Untersuchungen zur vorliegenden Arbeit wurden von September 2005 bis
Februar 2009 unter Anleitung von PD Dr. Ulrich Ermler am Max-Planck-Institut
für Biophysik in Frankfurt am Main in der Abteilung Molekulare Membranbiologie
durchgeführt.
VERÖFFENTLICHUNGEN
Ceh, K., Demmer, U., Warkentin, E., Moll, J., Thauer, R. K., Shima, S. and Ermler, U.
(2009) Structural basis of the hydride transfer mechanism in F(420)-dependent
methylenetetrahydromethanopterin dehydrogenase, Biochemistry 48, 10098-10105.
Posterbeitrag:
Körner, K., Demmer, U., Warkentin, E., Shima, S., Thauer, R. K., and Ermler, U.
Structural characterization of tetrahydromethanopterin (H4MPT) binding enzymes
involved in the methanogenic energy metabolism.
Jahrestagung der Vereinigung für Allgemeine und Angewandte Mikrobiologie und der
Gesellschaft für Biochemie und Molekularbiologie.
Frankfurt am Main, März 2008.
SUMMARY
The aim of this thesis was a structural characterization of the binding of
tetrahydromethanopterin derivatives to enzymes of the energy conserving CO2reducing methanogenic pathway. In this pathway the stepwise reduction of CO2
proceeds via binding to the tetrahydrofolate analog tetrahydromethanopterin
(H4MPT) which is found i. a. in methanogenic archaea. Due to the adaptation of the
thermophilic
and
hyperthermophilic
source
organisms
(Methanothermobacter
marburgensis, Methanocaldococcus jannaschii and Methanopyrus kandleri) to their
extreme habitats by genomic, structural and enzymatic features, they are of special
interest for structural biology.
The first enzyme investigated in this thesis is the eight subunits containing
membrane bound complex of N5-methyl-H4MPT:coenzyme M methyltransferase
(MtrA-H). Firstly, it catalyzes the methyl group transfer from H4MPT to the Co(I) of the
prosthetic group (5’-hydroxybenzimidazolylcobamide; vitamin B12a). In a second step,
it transfers the methyl group to coenzyme M, which is coupled to an energy
conserving vectorial sodium ion transport across the membrane.
The purification protocol for Mtr complex from M. marburgensis (670 kDa)
previously established under anaerobic conditions was enhanced, simplified for
isolation and purification under aerobic conditions and optimized for electron
microscopic single particle reconstruction. Besides the preparation of the complete
complex MtrA-H, the preparation of enzyme complex MtrA-G without the most
hydrophilic subunit MtrH was chosen as a second approach. The purification method
developed for this purpose improved the control over dissociation of MtrH from
complex MtrA-G and enhanced the homogeneity of the sample significantly. Thus,
the prerequisites for crystallization and subsequent X-ray studies were created as
well as for electron microscopic single particle reconstruction, which was confirmed
by experiments with MtrA-G (without MtrH) promising far better results.
Concurrently to the studies on the complete Mtr complex, cobamide containing
subunit MtrA and H4MPT binding subunit MtrH should be purified to homogeneity in
quantities sufficient for crystallization and X-ray analysis. Therefore, MtrA and MtrH
from source organisms mentioned above were cloned for heterologous expression in
E. coli, expression conditions were optimized and purification protocols were
established.
experiments.
The
purified
proteins
were
used
for
extensive
crystallization
MtrA from M. jannaschii without its transmembrane helix could be produced in
E. coli as a soluble protein. The holoprotein could be purified to homogeneity but
crystallization failed presumably due to its exceptionally high solubility. MtrA from
M. kandleri was produced in E. coli as a StrepII fusion protein without
transmembrane helix only in marginal amounts.
The production of subunit MtrH in E. coli as a soluble protein was not possible
regardless of the variants tested in this thesis. Attempts to refold and purify to
homogeneity the M. marburgensis protein expressed in inclusion bodies were without
success. Co-expression of MtrA and MtrH with the objective of improving folding and
solubility also led to the production of inclusion bodies which could not be refolded
and purified together.
The second enzyme analyzed in this thesis, F420-dependent N5,N10-methyleneH4MPT dehydrogenase (Mtd), catalyzes the reversible stereospecific hydride transfer
between reduced F420 (F420H2) and methenyl-H4MPT+, the latter being thereby
reduced to methylene-H4MPT. The ternary complex involved in this reaction consists
of the protein part, substrate (methylene-H4MPT) and co-substrate (F420) and was
structurally characterized in this thesis. The purified recombinant enzyme from
M. kandleri was co-crystallized with several H4MPT and F420 derivatives, the structure
of the ternary complex was determined by X-ray crystallography and the binding of
H4MPT and F420 was analyzed. In the structure solved in the thesis methenyl-H4MPT+
and F420H2 are bound in a catalytically active conformation, but a resolution of 1.8 Å
precludes a discrimination between either methylene-H4MPT and F420 or methenylH4MPT+ and F420H2. Compared to the structure of M. kandleri Mtd (KMtd) without
substrate and co-substrate bound, only marginal variations of the protein
conformation were visible. Thus KMtd can be considered as a surprising and extreme
example of an enzyme with an exceptionally rigid, preformed binding pocket.
ZUSAMMENFASSUNG
In dieser Arbeit sollte die Bindung von Tetrahydromethanopterinderivaten an zwei
Enzyme
des
methanogenen,
CO2-reduzierenden
Energiestoffwechselweges
strukturell charakterisiert werden. In jenem Stoffwechselweg verläuft die schrittweise
Reduktion von CO2 über die Bindung an den C1-Carrier Tetrahydromethanopterin
(H4MPT), ein Tetrahydrofolat-Analogon, welches unter anderem in methanogenen
Archaeen zu finden ist. Die thermophilen bzw. hyperthermophilen Ursprungsorganismen
der
untersuchten
Enzyme,
Methanothermobacter
marburgensis,
Methanocaldococcus jannaschii und Methanopyrus kandleri, sind aufgrund ihrer
Anpassung an extreme Habitate durch spezielle genomische, strukturelle und
enzymatische Eigenschaften von strukturbiologischem Interesse.
Beim ersten in dieser Arbeit untersuchten Enzym handelte es sich um den aus
acht
Untereinheiten
bestehenden
membrangebundenen
N5-Methyl-
H4MPT:Coenzym M-Methyltransferasekomplex (MtrA-H). Dieser katalysiert in einem
zweistufigen Mechanismus den Methyltransfer von H4MPT zum Co(I) der
prosthetischen Gruppe 5’-Hydroxybenzimidazolylcobamid (Vitamin B12a), um die
Methylgruppe dann auf Coenzym M zu übertragen. Gleichzeitig findet ein der
Energiekonservierung dienender vektorieller Natriumtransport über die Membran
statt.
Für den Mtr-Komplex aus M. marburgensis (apparentes Molekulargewicht:
670 kDa) lag bereits ein Protokoll zur Reinigung unter anaeroben Bedingungen vor.
Dieses wurde im Rahmen dieser Arbeit verbessert, für die Isolierung und Reinigung
unter aeroben Bedingungen vereinfacht und für die Erfordernisse der zur
Strukturbestimmung
verwendeten
elektronenmikroskopischen
Einzelpartikel-
messung, welche von Frau Dr. Dilem Hizlan (Max-Planck-Institut für Biophysik,
Frankfurt) durchgeführt wurde, optimiert. Neben der Präparation des kompletten
Komplexes
MtrA-H
wurde
als
alternative
Strategie
die
Präparation
des
Enzymkomplexes MtrA-G unter möglichst vollständiger Abtrennung der hydrophilsten
Untereinheit MtrH gewählt. Mit der zu diesem Zweck entwickelten Methode konnte
das Abdissoziieren von MtrH besser als im etablierten Protokoll kontrolliert und somit
die Homogenität der Probe deutlich verbessert werden. Dies schafft zum einen die
Vorraussetzungen für eine Kristallisation zur Röntgenstrukturanalyse, zum anderen
war auch in ersten Versuchen bei der elektronenmikroskopischen Einzelpartikelmessung erkennbar, dass mit dem Mtr-Komplex ohne MtrH bessere Ergebnisse zu
erzielen sind.
I
Parallel zu den Untersuchungen am Gesamtkomplex sollten die den CobamidCofaktor bindende Untereinheit MtrA sowie die H4MPT-bindende Untereinheit MtrH
in für die Kristallisation und röntgenkristallographische Untersuchung ausreichender
Menge und Qualität gereinigt werden. Hierfür wurden MtrA und MtrH aus oben
genannten Organismen für die heterologe Expression in E. coli kloniert, die
Expressionsbedingungen optimiert und Reinigungsprotokolle etabliert. Anschließend
wurden die Untereinheiten umfangreichen Kristallisationsversuchen unterzogen.
Die Untereinheit MtrA aus M. jannaschii konnte ohne die C-terminale
Transmembranhelix als lösliches Protein in E. coli produziert und als Holoprotein bis
zur Homogenität gereinigt werden. Zur Kristallisation kam es jedoch vermutlich
aufgrund der außergewöhnlich guten Löslichkeit nicht. Bei M. kandleri MtrA gelang
die Herstellung von geringen Mengen teilweise löslichen StrepII-Fusionsproteins
ohne C-terminale Transmembranhelix in E. coli.
Eine Produktion der Untereinheit MtrH in E. coli als lösliches Protein war bei
keiner
der
in
dieser
Arbeit
getesteten
Varianten
möglich.
Mit
dem
in
Einschlusskörperchen exprimierten Protein aus M. marburgensis wurde eine
Reinigung und Rückfaltung versucht, was jedoch nicht bis zur Homogenität gelang.
Auch eine Co-Expression der Untereinheiten MtrA und MtrH, durch welche eine
bessere
Faltung
und
Löslichkeit
erreicht
werden
sollte,
war
nur
in
Einschlusskörperchen möglich, deren gemeinsame Reinigung und Rückfaltung
jedoch nicht gelang.
Das
5
zweite
in
dieser
Arbeit
untersuchte
10
N ,N -Methylen-H4MPT-Dehydrogenase
(Mtd),
Enzym,
die
katalysiert
F420-abhängige
den
reversiblen,
stereospezifischen Hydrid-Transfer zwischen reduziertem F420 (F420H2) und MethenylH4MPT+, welches hierbei zu Methylen-H4MPT reduziert wird. Die Reaktion verläuft
über einen ternären Komplex bestehend aus Protein, Substrat (Methylen-H4MPT)
und Cosubstrat (F420), welcher strukturell charakterisiert werden sollte. Das
gereinigte, rekombinante Enzym aus M. kandleri wurde mit verschiedenen H4MPTund
F420-Derivaten
co-kristallisiert,
die
Struktur
des
ternären
Komplexes
röntgenkristallographisch bestimmt und die Bindung von H4MPT und F420 analysiert.
Methenyl-H4MPT+ und F420H2 sind in der in dieser Arbeit gelösten Kristallstruktur in
katalytisch aktiver Konformation gebunden, jedoch kann bei einer Auflösung von
1,8 Å nicht beurteilt werden, ob Methylen-H4MPT und F420 oder Methenyl-H4MPT+
und F420H2 vorlagen. Ein Vergleich mit der Struktur von M. kandleri-Mtd (KMtd) ohne
Substrat und Cosubstrat ergab nur äußerst geringe Abweichungen in der
Proteinkonformation, sodass sich KMtd überraschenderweise als Beispiel für ein
Enzym mit ungewöhnlich starrer, vorgegebener Bindetasche erwies.
II
INHALT
Abkürzungen
Abbildungen
Gleichungen
Tabellen
VI
VIII
IX
X
1 Einleitung
1.1 Methanogene Archaeen
1.2 Der C1-Carrier Tetrahydromethanopterin (H4MPT)
1.3 Die N5-Methyl-H4MPT:Coenzym M-Methyltransferase (Mtr)
1.4 Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase (Mtd)
1.5 Ziel der Arbeit
1
4
4
9
13
2 Material
2.1 Computerprogramme
2.2 Geräte und Chemikalien
2.2.1 Allgemeine Geräte
2.2.2 Molekularbiologischen Arbeiten
2.2.3 Bakterienkultivierung
2.2.4 Proteinpräparation
2.2.5 PAGE
2.2.6 Chromatographie
2.2.7 Säulen/-materialien
2.2.8 Elektroblotten
2.2.9 Kristallisation
2.2.10 Kristallisationskits
2.2.11 Röntgenographischen Methoden
2.2.12 Chemikalien
2.2.13 Enzyme, Proteine, Vergleichsstandards und Antikörper
2.2.14 Kits
2.2.15 Verbrauchsmaterialien
2.3 Plasmide
2.4 Mikroorganismen und Medien
2.4.1 Archaeen-Stämme
2.4.2 Escherichia coli-Stämme
2.4.3 Medien und Agarplatten
14
15
15
15
16
16
16
16
17
18
18
18
18
19
20
21
21
21
22
22
22
23
3 Methoden
3.1 Planung der Vektorkonstrukte
3.2 Molekularbiologischen Methoden
3.2.1 Extraktion und Reinigung genomischer DNA aus Archaeen-Zellen
3.2.2 Herstellung künstlicher DNA-Fragmente mittels PCR
3.2.3 Restriktionsspaltung, Dephosphorylierung und Ligation von DNA
3.2.4 Herstellung von kompetenten E. coli-Zellen und Transformation
3.2.5 Plasmidpräparation
3.2.6 Agarosegelelektrophorese
3.2.7 Aufreinigung von DNA
3.2.8 Bestimmung von DNA-Konzentration und -Reinheit
3.2.9 Sequenzierung
24
26
26
26
28
29
30
30
30
30
31
III
3.3 Kultivierung von Bakterien
3.3.1 Bestimmung der Zelldichte
3.3.2 Kultivierung für die Plasmidpräparation
3.3.3 Kultivierung für die Proteinproduktion
3.3.4 Expressionstest und Optimierung der Proteinexpression
3.4 Proteinbiochemische Methoden
3.4.1 Bestimmung der Proteinkonzentration
3.4.2 SDS-Polyacrylamidgelelektrophorese (SDS-Page)
3.4.3 Blaue Native Polyacrylamidgelelektrophorese (BN-Page)
3.4.4 Elektrophoretischer Proteintransfer und direkter ELISA (Western Blot)
3.4.5 Analytische Gelfiltration
3.4.6 Massenspektrometrie
3.5 Proteinreinigung
3.5.1 Membranpräparation aus M. marburgensis-Zellen
3.5.2 Isolierung und Reinigung des Mtr-Komplexes aus M. marburgensis
3.5.3 Reinigung von rekombinantem M. marburgensis MtrH (MMRMtrH)
3.5.4 Reinigung von rekombinantem des-[225-246]-MtrA (MJMtrA3) aus
M. jannaschii
3.5.5 Reinigung und Rückfaltung von co-exprimierten des-[225-246]-MtrA
und MtrH (MJMtrA3 + MJMtrH) aus M. jannaschii
3.5.6 Reinigung von rekombinantem des-[238-252]-MtrA mit C-terminalem
StrepII-Anhängsel (MKMtrA) aus M. kandleri
3.5.7 Reinigung von rekombinanter F420-abhängiger
N5,N10-Methylentetrahydromethanopterin-Dehydrogenase (Mtd) aus
M. kandleri
3.6 Röntgenkristallographische Methoden
3.6.1 Kristallisation
3.6.2 Datensammlung und –prozessierung
3.6.3 Lösung des Phasenproblems
3.6.4 Modellbau und Verfeinerung
3.6.5 Validierung von Proteinstrukturen
3.6.6 Strukturdarstellung
3.7 Elektronenmikroskopische Einzelpartikelmessung
3.7.1 Probenvorbereitung
3.7.2 Datensammlung und –prozessierung
3.7.3 Datenanalyse und Rekonstruktion
32
32
32
32
34
35
35
35
36
37
37
38
39
39
40
42
43
44
45
45
46
46
47
48
49
49
50
50
50
51
51
4 Ergebnisse
4.1 Planung und Herstellung der Vektorkonstrukte
4.1.1 Sekundärstrukturanalyse zur Planung der Konstrukte MJmtrA1,
MJmtrA2 und MJmtrA3
4.1.2 Sequenzvergleich zur Planung der Konstrukte MKmtrH1 und MKmtrH
4.1.3 Herstellung der Vektorkonstrukte
4.2 Der N5-Methyl-H4MPT:Coenzym M-Methyltransferasekomplex aus
M. marburgensis
4.2.1 Isolierung und Reinigung
4.2.2 Charakterisierung
4.2.3 Kristallisation
4.2.4 Elektronenmikroskopische Einzelpartikelmessung
4.3 Ergebnisse der heterologen Expression der Untereinheiten MtrA
und MtrH
52
52
52
53
54
54
59
63
63
67
IV
4.4 Rekombinantes des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii
4.4.1 Reinigung
4.4.2 Charakterisierung
4.4.3 Kristallisation
4.5 Rekombinantes des-[238-252]-MtrA mit C-terminalem StrepIIAffinitätspeptid (MKMtrA) aus M. kandleri
4.6 Rekombinantes M. marburgensis MtrH (MMRMtrH)
4.7 Co-Expression und gemeinsame Reinigung von des-[225-246]-MtrA
und MtrH (MJMtrA3+MJMtrH) aus M. jannaschii
4.8 Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase (KMtd)
aus M. kandleri
4.8.1 Co-Kristallisation von KMtd mit H4MPT-Derivaten und F420
4.8.2 Strukturlösung
4.8.3 Strukturbeschreibung
69
69
70
71
72
74
75
77
77
78
80
5 Diskussion
5.1 Der N5-Methyl-H4MPT:Coenzym M-Methyltransferasekomplex aus
M. marburgensis
5.1.1 Isolierung und Reinigung des Mtr-Komplexes
5.1.2 Der oligomere Zustand des Mtr-Komplexes
5.1.3 Abtrennung der Untereinheit MtrH
5.4.1 Strukturbestimmung
5.2 Die Untereinheit MtrA des N5-Methyl-H4MPT:CoMMethyltransferasekomplexes
5.2.1 Heterologe Expression in E. coli
5.2.2 Des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii
5.2.3 Des-[238-252]-MtrA (MKMtrA) aus M. kandleri
5.3 Die Untereinheit MtrH des N5-Methyl-H4MPT:CoMMethyltransferasekomplexes
5.3.1 Heterologe Expression von mtrH
5.3.2 Rekombinantes MtrH (MMRMtrH) aus M. marburgensis
5.4 Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase (KMtd)
aus M. kandleri
5.4.1 Die Bindung von H4MPT und F420 an KMtd
5.4.2 Die Hydrid-Transferreaktion
5.5 Ausblick
88
88
89
90
91
92
92
93
94
95
95
96
97
97
99
101
6 Literatur
103
7 Anhang
113
V
ABKÜRZUNGEN
Aλ
Amp
AS
AU
bp
BSA
Cam
Carb
Co-M//Co-M-SH
CV
Da
deion.
dest.
DNA
dNTP
FAD
Fmd
FOM
Frh
Ftr
g
Hmd
H4MPT
Kan
kb
kDa
Lsg.
Mr
MALDI-TOF
Mch
Mcr
Mer
Methenyl-H4MPT+
Methylen-H4MPT
MF
min
Mtd
Mtr
MWCO
NCS
OD/OD600
p.a.
PAGE
PCR
RCSB
RNA
rpm
RT
SLS
U
UE
Absorbanz bei Wellenlänge λ
Ampicillin
Aminosäure(rest)
absorption units (Absorptionseinheiten)
base pairs (Basenpaare)
Rinderserumalbumin
Chloramphenicol
Carbenicillin
Coenzym M/reduziertes Coenzym M
column volume (Säulenvolumen)
Dalton
deionisiert
destilliert
desoxyribonucleic acid (Desoxyribonukleinsäure)
Desoxynukleotidtriphosphat
Flavinadenindinukleotid
Formylmethanofuran-Dehydrogenase
figure of merit
F420-reduzierende Hydrogenase
Formylmethanofuran:H4MPT Formyltransferase
Erdbeschleunigung
H2-bildende Dehydrogenase
5,6,7,8-Tetrahydromethanopterin
Kanamycin
Kilobasenpaare (1000 Basenpaare)
Kilodalton (1000 Dalton)
Lösung
Molekulargewicht
matrix assisted laser desorption/ionisation time of flight
Methenyl-H4MPT-Cyclohydrolase
Methyl-Coenzym M-Reduktase
Methylen-H4MPT-Reduktase
N5,N10-Methenyl-5,6,7,8-Tetrahydromethanopterin
N5,N10-Methylen-5,6,7,8-Tetrahydromethanopterin
Methanofuran
Minuten
F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase
N5-Methyl-H4MPT:Coenzym M Methyltransferase
molecular weight cut-off (Molekulares Ausschlussgewicht)
non crystallographic symmetry (nichtkristallographische Symmetrie)
Optische Dichte (bei 600 nm)
pro analysis (Reinheitsgrad für analytische Zwecke)
Polyacrylamidgelektrophorese
polymerase chain reaction (Polymerasekettenreaktion)
Research collaboratory for Structural Bioinformatics
(Proteinstrukturdatenbank)
ribonucleic acid (Ribonukleinsäure)
revolutions per minute (Umdrehungen pro Minute)
Raumtemperatur
Swiss Light Source (Synchrotron, Villigen, Schweiz)
Unit (μmol umgesetztes Substrat pro Minute)
Untereinheit
VI
UV
v/v
w/v
ε
Ultraviolettes Licht (λ < 400 nm)
Volumen pro Volumen
weight per volume (Gewicht pro Volumen)
Extinktionskoeffizient
SI-Einheiten sind nicht aufgeführt. Abkürzungen für Chemikalien sind dem
Chemikalienverzeichnis (Abschnitt 2.2.12) zu entnehmen.
VII
ABBILDUNGEN
1.1:
1.2:
1.3:
1.4:
1.5:
1.6:
1.7:
1.8:
1.9:
Der
CO2-reduzierende
methanogene
Stoffwechselweg
in
Methanobakterien, Methanococci und Methanopyrales und seine
energiekonservierenden Kopplungsstellen.
Tetrahydromethanopterin
(H4MPT)
und
sein
Strukturanalogon
Tetrahydrofolat (H4F).
Die Cofaktoren N5-Methyl-H4MPT und Methyl-Coenzym M der
N5-Methyl-H4MPT:Coenzym M-Methyltransferase (Mtr).
Cofaktor 5’-Hydroxybenzimidazolylcobamid (Vitamin B12a) der N5-MethylH4MPT:Coenzyme M-Methyltransferase (Mtr).
Zweidimensionales
Modell
der
N5-Methyl-H4MPT:Coenzym MMethyltransferase (Mtr).
Die von der F420-abhängigen N5,N10-Methylen-H4MPT-Dehydrogenase
(Mtd) katalysierte, stereogene Reaktion.
Die Domänenstruktur eines Monomers der F420-abhängigen
N5,N10-Methylen-H4MPT-Dehydrogenase (Mtd) aus M. kandleri.
Ribbon-Diagramm der Homohexamerstruktur von Mtd mit Blick in
Richtung der dreifachen Achse.
Die Helices α8 und α9 der sechs Monomere bilden ein um die dreifache
Achse arrangiertes Bündel aus zwölf Helices.
Seite 3
Seite 5
Seite 6
Seite 7
Seite 8
Seite 10
Seite 11
Seite 12
Seite 12
3.1:
Übersicht über die Reinigung des Mtr-Komplexes aus M. marburgensis.
Seite 41
4.1:
Sequenzvergleich der Untereinheit MtrH der N5-Methyl-H4MPT:Coenzym
M-Methyltransferase (MtrH) aus M. marburgensis (MMR), M. jannaschii
(MJ) und M. kandleri (MK) mit der Pterin bindenden 5-Methyltetrahydrofolat Corrinoid/Eisen-Schwefel-Protein Methyltransferase aus
Moorella thermoacetica (Q46389_MOOTH).
Elutionsprofile und Coomassie-gefärbte SDS-Pages der zugehörigen
Fraktionen der Ionenaustauschchromatographie auf DEAE-Sepharose
des vollständigen Komplexes MtrA-H und des Komplexes MtrA-G ohne
die 34 kDa-Untereinheit MtrH.
Elutionsprofile und Coomassie-gefärbte SDS-Pages der zugehörigen
Fraktionen der Ionenaustauschchromatographie auf Q-Sepharose der
Mtr-Komplexe mit und ohne Untereinheit MtrH.
Elutionsprofile und Coomassie-gefärbte SDS-Pages nach der Gelfiltration
der Mtr-Komplexe mit und ohne Untereinheit MtrH auf Superose 6.
Coomassie-gefärbte Blaue Native Page zur Molekulargewichtsbestimmung des Gesamtkomplexes MtrA-H.
Western Blot mit Anti-M. marburgensis MtrH-Antikörpern nach
Auftrennung der Untereinheiten der gereinigten Mtr-Komplexe mit und
ohne Untereinheit MtrH auf einem 12 %-igen SDS-Gel.
a) Elektronenmikroskopische Aufnahme des Mtr-Komplexes nach
Negativfärbung mit 1 % Uranylacetat.
b) Unter Cryo-Bedingungen entstandener Mikrograph des MtrKomplexes.
a) Iterative Berechnung der Struktur des Mtr-Komplexes.
b) Oberflächendarstellung eines Strukturmodells des Mtr-Komplexes.
Gelfiltrationschromatogramm und Coomassie-gefärbte SDS-Page mit
Proben der Produktion in E. coli und Reinigung von rekombinantem
M jannaschii des-[225-246]-MtrA (MJMtrA3).
Elutionsprofil der Rechromatographie auf Superdex 200 von bereits durch
Gelfiltration gereinigtem MJMtrA3.
Seite 53
4.2:
4.3:
4.4:
4.5:
4.6:
4.7:
4.8:
4.9:
4.10:
Seite 56
Seite 57
Seite 58
Seite 60
Seite 62
Seite 64
Seite 66
Seite 69
Seite 70
VIII
4.11:
4.12:
4.13:
4.14:
4.15:
4.16:
4.17:
4.18:
4.19:
4.20:
4.21:
Coomassie-gefärbte
SDS-Page
und
Aminosäuresequenz
von
M. jannaschii MtrA.
Western Blot mit Anti-StrepII-Antikörpern von Proben der Expression in
E. coli und Reinigung auf Strep-Tactin® von des-[238-252]MtrA mit Cterminalem StrepII-Affinitätspeptid aus M. kandleri (MKMtrA).
Coomassie-gefärbte SDS-Page mit Proben der Produktion in E. coli und
Reinigung von rekombinantem M. marburgensis MtrH (MMRMtrH).
Gelfiltrationschromatogramm und Coomassie-gefärbte SDS-Page mit
Proben der Co-Expression in E. coli und gemeinsamen Reinigung von
M. jannaschii des-[225-246]-MtrA und MtrH (MJMtrA3 + MJMtrH).
Kristalle von KMtd im Komplex mit dem Substrat Methylen-H4MPT und
dem Cosubstrat F420.
Übersicht der Bindetasche von Methylen-H4MPT und F420.
Verknüpfung des Pterin-Imidazolidin-Phenyl-Ringsystems von MethylenH4MPT (grau) mit dem Proteininneren und dem Gegenmonomer.
Wasserstoffbrückenbindungen und van-der-Waals-Kontakte zwischen
Aminosäureresten in der Bindetasche von KMtd und dem Pterin-,
Imidazolidin- und Phenylring von Methylen-H4MPT.
Die aromatischen Ringe von Methylen-H4MPT befindet sich annähernd in
einer Ebene.
a) F420 mit Wasserstoffbrückenbindungen und van-der-Waals-Kontakten
zu relevanten Aminosäureresten in der Bindetasche.
b) Der Deazaisoalloxazinring von F420 liegt in einer gebogenen
Konformation (Butterfly-Konformation) vor.
a) Der Deazaisoalloxazinring von F420 und das Benzyl-ImidazolidinPyrazin-Ringsystem von Methylen-H4MPT sind rechtwinklig zueinander
angeordnet, sodass der zentrale Pyridinring von F420 versetzt über dem
Imidazolidinring von Methylen-H4MPT zu liegen kommt.
b) Der Imidazolidinring von Methylen-H4MPT ist parallel, jedoch
verschoben zum Deazaisoalloxazinring von F420 orientiert.
Seite 71
Seite 73
Seite 74
Seite 76
Seite 78
Seite 81
Seite 82
Seite 84
Seite 85
Seite 86
Seite 87
GLEICHUNGEN
1.1:
1.2:
3.1:
3.2:
3.3:
3.4:
3.5:
3.6:
Zweistufiger
Mechanismus
der
durch
MtrA-H
Methyltransferreaktion von Methyl-H4MPT zu Coenzym M.
Zweistufiger
Mechanismus
der
durch
MtrA-H
Methyltransferreaktion von Methyl-H4MPT zu Coenzym M.
katalysierten
Seite 6
katalysierten
Seite 6
Proportionalität von Flugzeit, Masse und Ladung bei der FlugzeitmassenAnalyse (MALDI-TOF).
Berechnung des Matthews-Koeffizienten VM eines Proteinkristalls.
Berechnung des Solvensgehaltes VSolv eines Proteinkristalls.
Berechnung der Patterson-Funktion P(uvw) aus den Quadraten der
Strukturfaktoramplituden F(hkl).
Berechnung von Rcryst einer Kristallstruktur.
Berechnung von Rfreet einer Kristallstruktur.
Seite 39
Seite 48
Seite 48
Seite 48
Seite 49
Seite 50
IX
TABELLEN
2.1:
2.2:
2.3:
2.4:
2.5:
In dieser Arbeit verwendete Computerprogramme.
Parameter der verwendeten Chromatographiesäulen.
In dieser Arbeit eingesetzte Plasmide.
In dieser Arbeit verwendete Archaeen-Stämme.
In dieser Arbeit verwendete E. coli-Stämme.
Seite 14
Seite 17
Seite 21
Seite 22
Seite 22
3.1:
3.2:
3.3:
3.4:
3.5:
3.6:
3.7:
In dieser Arbeit verwendete Vektorkonstrukte.
Übersicht über die durchgeführten PCR-Reaktionen.
Temperaturprogramme für PCR-Reaktionen von MJMtrH und MJMtrA1.
Temperaturprogramme für PCR-Reaktionen von MJMtrA2 und MJMtrA3.
Übersicht über die Plasmidherstellung.
Für Sequenzierungsreaktionen verwendete Primer.
Übersicht über die zur Proteinexpression verwendeten Plasmide und
E. coli-Stämme.
Für die Kristallisation verwendete Proteinlösungen.
Seite 25
Seite 27
Seite 27
Seite 27
Seite 29
Seite 31
Seite 33
Übersicht über das mit verschiedenen Methoden bestimmte Molekulargewicht des Gesamtkomplexes MtrA-H.
Übersicht über die verschiedenen Methoden und Pufferbedingungen zur
Abtrennung der Untereinheit MtrH vom gereinigten Gesamtkomplex.
Übersicht über die Ergebnisse der durchgeführten Expressionsversuche
der rekombinanten Untereinheiten MtrA und MtrH des Mtr-Komplexes.
Zusammensetzung der selbst entwickelten Screens für die Proteinkristallisation.
Kristallisationsbedingungen für die Co-Kristallisation von KMtd mit
Methylen-H4MPT und F420.
Parameter und Statistiken des Datensatzes des ternären Komplexes aus
KMtd mit Methylen-H4MPT und F420.
Verfeinerungstatistik des ternären Komplexes aus KMtd mit MethylenH4MPT und F420.
Seite 59
3.8:
4.1:
4.2:
4.3:
4.4:
4.5:
4.6:
4.7:
Seite 46
Seite 61
Seite 68
Seite 72
Seite 77
Seite 78
Seite 79
X
1 Einleitung
1 Einleitung
1.1
Methanogene Archaeen
Archaeen bilden neben Bakterien und Eukaryoten die dritte Domäne des Lebens
und werden weiter in Crenarchaeota und Euryarchaeota, zu welchen auch die
methanbildenden
Archaeen
gehören,
unterteilt
(1).
Methanothermobacter
marburgensis wurde aus Klärschlamm isoliert und gilt mit einem pH- und
Temperaturoptimum von 7 bzw. 65°C als thermophil (2-5). Methanocaldococcus
jannaschii dagegen ist ein hyperthermophiles methanogenes Archaeon und kommt
natürlicherweise in hydrothermalen Tiefseequellen (Weißer Raucher) bei 48-94°C,
200 atm, einem pH-Wert von 5,2-7,0 und bei einem eher moderaten Salzgehalt von
1,0-5,0
%
vor
(6,
7).
Methanopyrus
kandleri
ist
nicht
nur
ein
extrem
hyperthermophiles sondern ebenso ein stark halophiles Archaeon, das mit einem
Temperaturoptimum von 98°C und einem intrazellulären Salzgehalt von 1,1 M
trianionischem cDPG (cyclisches 2,3-Diphosphoglycerat) sowie bis zu 3 M K+ an
seinen Lebensraum in hydrothermalen Schloten angepasst ist (8, 9).
Alle hier beschriebenen Methanbildner sind gram-positive, obligate Anaerobier
und kommen mit H2 und CO2 als alleiniger Energie- und Kohlenstoffquelle aus. Nicht
nur die Anpassung an extreme Habitate durch spezielle genomische, strukturelle und
enzymatische Eigenschaften ist aus strukturbiologischer Sicht interessant. Auch die
Tatsache, dass jährlich ca. 1 Milliarde Tonnen des Treibhausgases Methan als
Abbauprodukt organischen Materials z.B. im Boden unter Reisfeldern oder im
Verdauungstrakt von Wiederkäuern durch methanogene Archaeen gebildet werden,
machen diese im Hinblick auf die globale Erwärmung zu einem wichtigen
Forschungsobjekt (10, 11).
Der CO2-reduzierende energiekonservierende Stoffwechselweg, wie er in oben
genannten
Methanogenen
ohne
Cytochrom
vorkommt,
besteht
aus
zwölf
Reaktionsschritten (siehe Abbildung 1.1) (12). Zunächst wird Kohlendioxid durch die
Formylmethanofuran-Dehydrogenase (Fmd) an den C1-Carrier Methanofuran (MF)
gebunden und hierbei zu Formylmethanofuran reduziert. Fmd enthält EisenSchwefel-Cluster und Molybdopterin bzw. ein entsprechendes Wolfram-Analogon als
prosthetische
Gruppen
Formyltransferase
(Ftr)
(13,
14).
wird
die
Durch
die
Formylgruppe
Formylmethanofuran:H4MPTim
nächsten
Schritt
auf
Tetrahydromethanopterin (H4MPT), ein Tetrahydrofolat-Analogon und weiteren C1Carrier, weitergegeben (15, 16). Im dritten Schritt wird nun Formyl-H4MPT von der
1
1 Einleitung
Methenyl-H4MPT-Cyclohydrolase (Mch) in N5,N10-Methenyl-H4MPT umgewandelt,
welches als nächstes zu N5,N10-Methylen-H4MPT reduziert wird (17). Diese Reaktion
wird durch zwei Enzyme katalysiert, zum einen wie in Abschnitt 1.4 ausführlich
beschrieben durch die F420-abhängige Methylen-H4MPT-Dehydrogenase (Mtd), zum
anderen durch eine F420-unabhängige, H2-bildende Dehydrogenase (Hmd), welche
ein mononukleares Eisenzentrum besitzt und einen Hydridtransfer katalysiert
(18, 19). Danach wird N5,N10-Methylen-H4MPT durch die Methylen-H4MPTReduktase (Mer) mittels F420H2 weiter zu N5-Methyl-H4MPT reduziert (20). Die
Methylgruppe
wird
schließlich
durch
die
Methyl-H4MPT:Coenzyme M-
Methyltransferase (Mtr) an den dritten C1-Carrier Coenzym M abgegeben (siehe
Abschnitt 1.3). Methyl-Coenzym M wird im letzten Schritt der Methanogenese durch
die Methyl-Coenzym M-Reduktase (Mcr), welche das Nickelporphinoid F430 als
prosthetische Gruppe enthält, zu Methan reduziert, wobei Coenzym B als
Reduktionsmittel dient und mit Coenzym M zum Heterodisulfid oxidiert wird (21).
Der Energiegewinn beim methanogenen Stoffwechselweg ist aufgrund des unter
natürlichen Bedingungen relativ niedrigen Wasserstoffpartialdrucks von 1-10 Pa
gering (∆G’ zwischen -17 und -40 kJ/mol) (22, 23). Eine umso wichtigere Rolle spielt
die Energiekonservierung, welche über chemiosmotische Mechanismen durch die
Translokation von Natriumionen erfolgt. Die membrangebundenen Komplexe der
Methyl-H4MPT:Coenzyme M-Methyltransferase (Mtr) (siehe Abschnitt 1.3) und der
[NiFe]-Hydrogenasen Eha und Ehb sind hieran beteiligt. Letztere nutzen den
elektrochemischen Na+-Gradienten (ionenmotorische Kraft) zur Reduktion von
Ferredoxin,
welches
bei
der
endergonen
Fmd-Reaktion
wiederum
als
Reduktionsmittel dient (24, 25). Eha/Ehb spielt jedoch in Methanogenen ohne
Cytochrom für die Reduktion von CO2 zu Methan nur insofern eine Rolle, als dass
die Kopplung der Ferredoxin- mit der CoM-CoB-Heterodisulfid-Reduktion vermutlich
nicht ganz vollständig ist. Dagegen ist der aus der [NiFe]-Hydrogenase Mvh und der
Heterodisulfidreductass Hdr bestehende Komplex (Mvh-Hdr), welcher die exergone
Reduktion des CoM-CoB-Heterodisulfids mit der Ferredoxin-Reduktion in einer
Elektronengabelreaktion koppelt, im Cytoplasma lokalisiert (12, 26). Des Weiteren
besitzen methanogene Archaeen eine natriumionenpumpende A1A0-ATPase und
einen Na+/H+-Antiporter (27, 28).
2
1 Einleitung
Abbildung 1.1: Der CO2-reduzierende methanogene Stoffwechselweg in Methanobakterien,
Methanococci und Methanopyrales und seine energiekonservierenden Kopplungsstellen.
(nach Thauer et al. (12))
3
1 Einleitung
1.2
Der C1-Carrier Tetrahydromethanopterin (H4MPT)
Die Umwandlung von C1-Einheiten zu Fumarat, Formaldehyd oder Methanol
verläuft
in
methanogenen
und
Sulfat
reduzierenden
Archaeen,
in
vielen
methylotrophen α-, β- und γ-Proteobakterien sowie in einigen Planctomycetes über
Tetrahydromethanopterin (H4MPT) (29-36), in allen anderen Organismen dagegen
über Tetrahydrofolat (H4F). H4MPT und H4F haben eine analoge Struktur (siehe
Abbildung 1.2), jedoch besitzt H4MPT an Position 1c eine elektronenspendende, mit
dem aromatischen Ring und N10 konjugierte Methylgruppe, H4F dagegen eine
elektronenziehende Carbonylgruppe. Dementsprechend ist das Redox-Potential der
Paare
Methenyl-H4MPT+/Methylen-H4MPT
mit
-390
mV
und
Methylen-
H4MPT/Methyl-H4MPT mit -310 mV um je ca. 100 mV negativer als das der
entsprechenden Paare mit H4F (37, 38).
Es liegen bereits einige Strukturen H4MPT-bindender Enzyme vor, die der
Formylmethanofuran:H4MPT
Formyltransferase
(Ftr),
der
Methenyl-H4MPT
Cyclohydrolase (Mch), der F420-abhängigen Methylen-H4MPT-Dehydrogenase (Mtd),
der H2-bildende Methylen-H4MPT-Dehydrogenase (Hmd), der F420-abhängige
Methylen-H4MPT-Reductase (Mer) und der NADP-abhängige Methylen-H4MPTDehydrogenase (MtdA) (39-44). Bisher konnten jedoch nur das H4MPT-abhängige
Formaldehyd-aktivierende Enzym (Fae) und die Formylmethanofuran:H4MPTFormyltransferase (Ftr) im Komplex mit H4MPT oder einem seiner Derivate
co-kristallisiert und röntgenkristallographisch beschrieben werden (45, 46). Darüber
hinaus wurde die Konformation des an die H2-bildende Methylen-H4MPTDehydrogenase (Hmd) gebundene Methylen-H4MPT durch zweidimensionale NMRSpektroskopie bestimmt (47).
1.3
Die N5-Methyl-H4MPT:Coenzym M-Methyltransferase (Mtr)
Primäre Natriumionenpumpen lassen sich in zwei Kategorien einteilen. Zur
ersten werden z. B. ATP-abhängige Importer, Na+/H+-Antiporter und ATP-Synthasen
gezählt. Zur zweiten Kategorie gehören Natriumionen translozierende Enzyme, die
eine exergone Reaktion an den Aufbau eines elektrochemischen Gradienten
koppeln. Dieser wiederum dient der Energiekonservierung und wird von anderen
membrangebundenen Systemen (z. B. flagellaren Motoren, ATP-Synthasen,
Permeasen) über chemiosmotische Mechanismen genutzt. Als Beispiele gelten die
Methylmalonyl-CoA-Decarboxylase,
die
Glutaconyl-CoA-Decarboxylase,
die
Oxaloacetat-Decarboxylase und die Malonyl-CoA-Decarboxylase verschiedener
4
1 Einleitung
Abbildung
1.2:
Tetrahydromethanopterin
(H4MPT)
Tetrahydrofolat (H4F).
und
sein
Strukturanalogon
anaerober Bakterien, bei welchen der Na+-Transport auf Kosten der freien
Decarboxylierungsenergie
geschieht
(48-50).
Ähnlich
wie
bei
der
Methyl-H4MPT:CoM-Methyltransferase (Mtr) (siehe unten) verläuft die Reaktion über
einen
zweistufigen
Mechanismus,
wobei
der
Carboxyltransfer
in
einer
wasserlöslichen Untereinheit und die Decarboxylierungsreaktion in einem integralen
Membranteil
der
Komplexe
stattfindet.
Ein
weiteres
Beispiel
stellt
die
NADH:Ubichinon-Oxidoreduktase aus marinen Bakterien sowie aus Klebsiella
pneumoniae dar, bei der Na+ auf Kosten der freien Energie der Atmung transportiert
wird (51-53).
Die für die N5-Methyl-H4MPT:Coenzym M Methyltransferase (MtrA-H) codierende
Transkriptionseinheit mtrEDCBAFGH findet sich universell in Methanogenen, so
auch im Genom von M. marburgensis, M. jannaschii und M. kandleri (bei letzterem
jedoch ohne mtrF) (6, 54, 55).
Der Gesamtkomplex besteht aus acht Untereinheiten (MtrA: 23 kDa, MtrB:
13 kDa, MtrC: 24 kDa, MtrE: 28 kDa, MtrF: 12 kDa, MtrG: 13 kDa und MtrH:
34 kDa) (54). Das Molekulargewicht wurde mittels Gelfiltration auf 670 kDa bestimmt,
was für das Vorliegen eines Tetramer eines Heterooktamers spricht (56). Die durch
MtrA-H katalysierte Reaktion, der Methyltransfer von Methyl-H4MPT zu Coenzym M,
verläuft über einen zweistufigen Mechanismus (57, 58):
5
1 Einleitung
CH3-H4MPT + E:Co(I) ' H4MPT + E:CH3-Co(III)
Gleichung 1.1
E:CH3-Co(III) + HSCoM ' E:Co(I) + CH3-S-CoM
Gleichung 1.2
Hierbei wird die an den C1-Carrier H4MPT (siehe Abbildung 1.3) gebundene
Methylgruppe
zunächst
auf
das
in
der
prosthetischen
Gruppe
5’-Hydroxybenzimidazolylcobamid (Vitamin B12a) (siehe Abbildung 1.4) enthaltene,
enzymgebundene
Co(I)
übertragen,
womit
dieses
zu
Co(III)
oxidiert
wird
(Gleichung 1.1). Im zweiten Reaktionsschritt geschieht dann der Transfer der
Methylgruppe zu Coenzym M (siehe Abbildung 1.3 und Gleichung 1.2). Letzterer
geht mit einem vektoriellen Natriumtransport über die Membran (1,7 Mol Na+ pro
übertragenem Mol Methylgruppe) einher (59, 60).
Die Cofaktoren N5-Methyl-H4MPT
N -Methyl-H4MPT:Coenzym M-Methyltransferase (Mtr).
Abbildung
5
1.3:
und
Methyl-Coenzym M
der
6
1 Einleitung
Abbildung 1.4: Cofaktor 5’-Hydroxybenzimidazolylcobamid (Vitamin B12a) der N5-Methyl-
H4MPT:Coenzyme M-Methyltransferase (Mtr). Als axiale Liganden fungieren ein Hydroxylund ein 5’-Hydroxybenzimidazolylrest. Im gebundenen Zustand wird letzterer durch einen
Histidinrest des Proteins ersetzt.
Laut Sekundärstrukturvorhersagen sind die hydrophobsten Untereinheiten MtrC,
MtrD und MtrE integrale Membranproteine mit jeweils sieben (MtrC) bzw. sechs
(MtrD und MtrE) Transmembranhelices. MtrA, MtrB, MtrF, und MtrG besitzen je eine
Transmembranhelix, wogegen MtrH als hydrophilste Untereinheit vermutlich keinen
Membrananker hat (54).
Nur die Funktionen und Eigenschaften der Untereinheiten MtrA, MtrH und MtrE
sind teilweise bekannt. MtrA besitzt als zweithydrophilste Untereinheit eine
C-terminale Transmembranhelix von 20 AS und enthält eine Corrinoid-Bindestelle,
wobei His-84 die prosthetische Gruppe in base-off/His-on-Konfiguration bindet (55,
61-64). Vermutlich finden in Verbindung mit der Methylierung bzw. Demethylierung
der Untereinheit Konformationsänderungen statt. Wie diese wiederum mit der
Translokation von Natriumionen verknüpft sind, bleibt jedoch zu klären.
7
1 Einleitung
MtrH
enthält
keinen
Membranteil
und
vermittelt
wahrscheinlich
den
Methylgruppentransfer zum Cob(I)amid (65). Aufgrund dieser Annahme ist davon
auszugehen, dass die Untereinheiten MtrA und MtrH zumindest während der
Methylübertragung in engem Kontakt zueinander stehen müssen.
MtrE besitzt neben sechs Transmembranhelices einen großen, aus 62 AS
bestehenden cytoplasmatischen Loop, welcher vermutlich eine Zink-Bindestelle
enthält
(66).
Aufgrund
des
Aminosäurerestes
Asp183
in
der
vierten
Transmembranhelix wird angenommen, dass Untereinheit MtrE den Methyltransfer
zu CoM und damit die Na+-abhängige Teilreaktion katalysiert (58). Eine
vergleichbare Aspartatgruppe hat sich bei anderen Na+-translozierenden Enzymen
bzw. in der C-Untereinheit der E. coli-ATPase als essenziell für die Natrium- bzw.
Protonentranslokation erwiesen (67-69). Ein Modell, das den Wissensstand
bezüglich Größe, Hydrophobizität, Topologie, Cofaktorgehalt und Funktionen der
Untereinheiten einbezieht, ist in Abbildung 1.5 dargestellt (70).
Zweidimensionales
Modell
der
N5-Methyl-H4MPT:Coenzym MMethyltransferase
(Mtr).
Die
Topologie
der
Untereinheiten
entspricht
der
Sekundärstrukturvorhersage. Co: Cobalt(I) in 5’-Hydroxybenzimidazolylcobamid (Vitamin B12a),
D: Asp183 in der Transmembranhelix von MtrA. (nach Gottschalk und Thauer (70))
Abbildung
1.5:
8
1 Einleitung
1.4
Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase (Mtd)
Der reversible Schritt der Reduktion von Methenyl-H4MPT+ oder Methenyl-H4F+
zu
Methylen-H4MPT
Dehydrogenasefamilien
bzw.
Methylen-H4F
katalysiert.
Die
wird
von
vier
H2-bildende
verschiedenen
Methylen-H4MPT-
Dehydrogenase (Hmd) und die F420-abhängige Methylen-H4MPT-Dehydrogenase
(Mtd) kommen in methanogenen bzw. in methanogenen und Sulfat reduzierenden
Archaeen vor, die NAD(P)-abhängigen Methylen-H4MPT-Dehydrogenasen (MtdA
und MtdB) werden in methylotrophen Archaeen angetroffen, und die NAD(P)abhängigen
Methylen-H4F-Dehydrogenasen
(z.
B.
FolD)
übernehmen
die
entsprechende Reaktion in allen übrigen Organismen (71-74).
Mtd katalysiert den reversiblen Hydrid-Transfer zwischen dem C5-Atom von
reduziertem F420 (F420H2) und dem C14-Atom von Methenyl-H4MPT+ (siehe
Abbildung 1.6) (72). Die Reaktion ist Re-seitenspezifisch aus Sicht des H4MPT- und
Si-seitenspezifisch aus Sicht des F420-Moleküls, d. h. der pro-R Wasserstoff am C14
des Methylen-H4MPT bzw. der pro-S Wasserstoff am C5 des F420H2 wird übertragen
(75, 76). Die Stereospezifität der enzymatischen Reaktion steht im Gegensatz zu
derjenigen einer entsprechenden Hydridübertragung in wässriger Lösung, bei der die
pro-S-CH-Bindung am C14 des Methylen-H4MPT reaktiver ist. Dies wird darauf
zurückgeführt, dass sich in letzterem Fall das pro-S-Proton in antiperiplanarer
Position zu den freien Elektronenpaaren der Stickstoffatome im Imidazolidinring
befindet. Es wird also vermutet, dass der Imidazolidinring durch das Protein in eine
Konformation gezwungen wird, in der die pro-R-Bindung reaktiver ist (47).
Da Mtd keine prosthetische Gruppe bindet, verläuft die Reaktion über einen
ternären Komplex bestehend aus Protein, Substrat (Methylen-H4MPT) und
Cosubstrat (F420). Bei 1 M (NH4)2SO4 beträgt Vmax = 4000 U/mg (kcat = 2400 s-1), der
apparente Km-Wert für N5,N10-Methyl-H4MPT 80 µM und für F420 20 µM (77).
9
1 Einleitung
Abbildung 1.6: Die von der F420-abhängigen N5,N10-Methylen-H4MPT-Dehydrogenase
(Mtd) katalysierte, stereogene Reaktion. F420 ist ein grün-blau fluoreszierendes
5’-Deazaflavin-Derivat und wird vorwiegend in Archaeen, aber auch in Streptomyces,
Cyanobakterien, Mycobakterien und einigen Eukaryoten angetroffen (78).
Unter normalen Wachstumsbedingungen, d. h. bei ausreichendem Nickelgehalt
im Medium, katalysiert Mtd die Methenyl-H4MPT+-Reduktion. F420 wiederum wird von
einer [NiFe]-Hydrogenase, der F420-reduzierenden Hydrogenase (Frh), reduziert.
Unter Nickellimitierung wird jedoch keine Frh produziert und die H2-bildende
Methylen-H4MPT-Dehydrogenase (Hmd) und Mtd übernehmen gemeinsam die
entsprechende Funktion und ersetzen das Nickelenzym (79-81).
Die F420-abhängige N5, N10-Methylen-H4MPT-Dehydrogenase (Mtd) konnte aus
M. marburgensis, M. barkeri, M. kandleri und A. fulgidus isoliert werden (72, 77, 8284). Mtd aus M. kandleri ist ein aus sechs 36 kDa-Untereinheiten aufgebauter
Proteinkomplex mit einem apparenten Molekulargewicht von 300 kDa. Das Enzym
zeigt nur bei sehr hohen Salzkonzentrationen (z.B. 2 M (NH4)2SO4, 2 M Na2HPO4,
1,5 M K2HPO4 und 2 M NaCl) Aktivität, ist jedoch relativ sauerstoffunempfindlich und
äußerst hitzestabil (77).
Wie von Hagemeier et al. (41) für die Kristallstruktur der rekombinanten Mtd aus
M. kandleri beschrieben (RCSB-Proteindatenbankeintrag 1QV9), haben die sechs
Monomere jeweils eine Größe von 51 x 47 x 23 Å und sind aus drei Domänen
aufgebaut (siehe Abbildung 1.7). Die α, β-Domäne setzt sich aus einem
10
1 Einleitung
gewundenen, sechssträngigen parallelen β-Faltblatt (β1-β6) zusammen, welches von
drei α-Helices (α2-α4) auf der Vorder- und zwei α-Helices (α1 und α6) auf der
Rückseite flankiert wird. Die Helixbündeldomäne wird von den Helices α5, α7, α8 und
α9 gebildet. Die β-Faltblatt-Domäne befindet sich am C-Terminus, besteht aus zwei
antiparallelen β-Strängen (β7 und β8) und ist über Wasserstoffbrückenbindungen mit
Helix α6 und einem Loop, der sich an β2 anschließt, mit der α, β-Domäne verknüpft.
Abbildung 1.7: Die Domänenstruktur eines Monomers der F420-abhängigen
N5,N10-Methylen-H4MPT-Dehydrogenase (Mtd) aus M. kandleri. Die α, β-Domäne ist in blau,
die Helixbündeldomäne in rot und das C-terminale ß-Faltblatt in grün dargestellt.
Die Größe des Hexamers, welches treffender als ein Trimer von Dimeren
beschrieben werden kann, beträgt 90 x 90 x 55 Å. Die Dimere bestehen aus zwei
dicht
gepackten,
um
jeweils
180°
gedrehten
Monomeren.
Vier
Wasserstoffbrückenbindungen der Hauptkette verknüpfen die zwei sechssträngigen
parallelen β-Faltblätter (β1-β6) in antiparalleler Weise zu einem zwölfsträngigen
β-Faltblatt. Eine zweite Kontaktfläche in Form eines Helixbündels wird von den
Helices α1 und α5 und ihren symmetrieverwandten Partnern gebildet. Das Hexamer
setzt sich schließlich aus drei Dimeren zusammen, wobei sich die Helices 8 und 9
11
1 Einleitung
der sechs Monomere in Form eines Bündels aus zwölf Helices um eine dreifache
Achse anordnen (siehe Abbildung 1.8 und 1.9).
Abbildung 1.8: Ribbon-Diagramm der Homohexamerstruktur von Mtd mit Blick in Richtung
der dreifachen Achse. Die drei Dimere (grün, blau und rot eingefärbt) setzten sich aus jeweils
zwei um 180° gedrehten Monomeren (jeweils dunkel und hell eingefärbt) zusammen.
Abbildung 1.9: Die Helices α8 und α9 der sechs Monomere bilden ein um die dreifache
Achse arrangiertes Bündel aus zwölf Helices. Diese ungewöhnliche Quarternärstruktur ergibt
eine äußerst kompakte Anordnung der Monomere.
12
1 Einleitung
1.5
Ziel der Arbeit
Ziel dieser Arbeit war die strukturelle Charakterisierung der Bindung von H4MPT-
Derivaten
an
zwei
Enzyme
des
methanogenen,
CO2-reduzierenden
Energiestoffwechselweges. Für die N5-Methyl-H4MPT:Coenzym M-Methyltransferase
(Mtr) aus M. marburgensis lag bereits ein Protokoll zur Reinigung unter anaeroben
Bedingungen vor (56). Dieses sollte für die aerobe Reinigung vereinfacht und für die
Erfordernisse der zur Strukturbestimmung verwendeten elektronenmikroskopischen
Einzelpartikelmessung optimiert werden. Dazu wurden zwei Strategien gewählt, zum
einen die Präparation des kompletten, acht Untereinheiten umfassenden Komplexes
MtrA-H, zum anderen die Präparation des Enzymkomplexes MtrA-G unter möglichst
vollständiger Abtrennung der Untereinheit MtrH. Der gereinigte Komplex sollte
sodann elektronenmikroskopisch untersucht werden.
Parallel dazu sollten die den Cob(I)amid-Cofaktor bindende Untereinheit MtrA
sowie die H4MPT-bindende Untereinheit MtrH in für die Kristallisation und
röntgenkristallographische
Untersuchung
ausreichender
Menge
und
Qualität
gereinigt werden. Hierfür wurden MtrA und MtrH aus M. jannaschii und M. kandleri
bzw. aus M. marburgensis, M. jannaschii und M. kandleri für die heterologe
Expression in E. coli kloniert, die Expressionsbedingungen optimiert und ein
Reinigungsprotokoll
etabliert.
Anschließend
wurden
die
Untereinheiten
umfangreichen Kristallisationsversuchen unterzogen.
Als zweites H4MPT-bindendes Enzym sollte die F420-abhängige N5,N10-MethylenH4MPT-Dehydrogenase (Mtd) aus M. kandleri im Komplex mit Substrat (MethylenH4MPT) und Cosubstrat (F420) strukturell charakterisiert werden. Das gereinigte,
rekombinante Enzym wurde mit verschiedenen H4MPT- und F420-Derivaten
co-kristallisiert und die Struktur röntgenkristallographisch bestimmt. Anhand dieser
Struktur sollte die Bindung von H4MPT und F420 analysiert werden.
13
2 Material
2 Material
2.1
Computerprogramme
Tabelle 2.1: In dieser Arbeit verwendete Computerprogramme.
Programm
blastp, bl2seq
Anwendung
Datenbankabfrage,
Sequenzabgleich
ccp4-suite
Verschiedene Programme
für die
Proteinkristallographie
Darstellung von
Elektropherogrammen
(DNA-Sequenzierung)
Erstellung von Vektorkarten
Chromas 2.33
Hersteller/Referenz
http://blast.ncbi.nlm.nih.gov/Blast.cgi (85),(86)
http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi
(87)
Daresbury Laboratory, Warrington, UK (88)
Technelysium, Tewantin, Australien
Scientific and Educational Software, Cary, USA
http://www.scied.com
Interaktives Grafikprogramm http://www.ysbl.york.ac.uk/~emsley/coot/ (89)
zum Modellbau von
Proteinstrukturen
Entwicklung von
Hamilton Robotics, Martinsried
Crystal
Kristallisationsscreens,
Liquid Handling Roboting
3D-Strukturvergleich von
http://ekhidna.biocenter.helsinki.fi/dali_server/ (90, 91)
DALI
Proteinen
Abbildung von chemischen
MDL Information Systems, Frankfurt
IsisDraw
Formeln
PredictProtein, Sekundärstrukturvorhersage http://www.predictprotein.org/ (92),(93)
http://bp.nuap.nagoya-u.ac.jp/sosui/ (94),(95),(96)
SOSUI
Berechnung von
http://davapc1.bioch.dundee.ac.uk/prodrg/ (97)
PRODRG
Stukturmodellen
DeLano Scientific, San Francisco, USA
Grafikprogramm zur 3DPyMOL
http://pymol.sourceforge.net/
Darstellung von
Biomolekülen
http://www.bioinformatics.org/sms2/index.html (98)
The Sequence Analyse und Formatierung
von DNA- und ProteinManipulation
Sequenzen
Suite
http://users.unimi.it/~camelot/tools/cut2.html
Webcutter 2.0 Simulation des
enzymatischen Verdaus v.
Nukleotidsequenzen
Prozessierung von
http://www.mpimfXDS
röntgenkristallographischen heidelberg.mpg.de/~kabsch/xds/html_doc/XDS.html
Daten
(99)
Clone
Manager 9.0
Coot
14
2 Material
2.2
2.2.4
Geräte und Chemikalien
Allgemeine Geräte
Analysenwaage
Eismaschine
Gefrierschrank (-20ºC)
(-80ºC)
Heizplatte mit Magnetrührer
Kühlschrank (4ºC)
Laborwaage
Mikrowellengerät
pH-Elektrode
pH-Meter
R180D-*D1
Pipetten
2 μL
10/20/200/1000/5000 μL
Multipette® plus
Pumpe
Spektrophotometer
Trockenschrank (80ºC)
Ultra pure Wasser-System
Ultraschallbad
Rotoren
Schüttelbrett
Schüttelgerät
Zentrifugen
Zentrifugenbecher
2.2.5
Ikamag® Ret
PM 4600 DeltaRange®
InLab® Semi-Micro pH
766 Calimatic
Ultrospec 2100 pro
Milli-Q Plus
Sonorex
Sorvall® SS34
Sorvall® GSA
Sorvall® SL-3000
GFL-3015
Vortex Genie 2
5415C
4K15
Sorvall® RC5B
26 mL, 250 mL, 500 mL
Sartorius, Göttingen
Ziegra, Isernhagen
Liebherr, Ochsenhausen
Colora, Lorch
IKA Werke, Staufen
Liebherr, Ochsenhausen
Mettler Toledo, Gießen
Sharp Electronics, Hamburg
Mettler Toledo, Gießen
Knick Elektronische Messgeräte,
Berlin
Rainin, Oakland, USA
Gilson, Villiers-le-bel, Frankreich
Eppendorf, Hamburg
Biometra, Göttingen
Amersham Biosciences
Binder, Tuttlingen
Millipore, Schwalbach
Bandelin electronic, Berlin
DuPont Instruments, Bad Homburg
GFL, Großburgwedel
Bender & Holbein, Zürich, Schweiz
Eppendorf, Hamburg
Sigma, Osterode am Harz
DuPont Instruments, Bad Homburg
Nalgene, Rochester, USA
Molekularbiologische Arbeiten
AgarosegelektrophoreseKammer
Geldokumentationsanlage
Spannungsquelle
Thermocycler
Thermoblock
Vakuumzentrifuge
Gel-DocEQ
PowerPac™ BASIC
PowerPac™ HC
T Gradient
TB 1
Concentrator 5301
Eigenbau MPI für Biophysik,
Frankfurt
BioRad, München
BioRad, München
Biometra, Göttingen
Biometra, Göttingen
Eppendorf, Hamburg
15
2 Material
2.2.6
Bakterienkultivierung
Brutschrank (37ºC)
Dampfsterilisator
BK-600
V-150
LAB-Shaker
JLA-8.1000
Microflow
Avanti™ J-20 XPI
1L
Kulturenschüttler
Rotor
Sterilbank
Zentrifuge
Zentrifugenbecher
2.2.7
Proteinpräparation
Dialyseknöpfe
Dispergiergerät
Einmal-Filterhalter
Hochdruckhomogenisator
Konzentratoren
Rotoren
Ultraschallgenerator
Ultrazentrifuge
Zentrifugenbecher
2.2.8
T 50 basic ULTRA-TURRAX®
150 mL, 250 mL
Microfluidizer®
0,5 mL, 4 mL, 15 mL
(MWCO: 10, 30, 100 kDa)
70Ti, 70.1Ti, 45Ti, SW 40Ti
Branson Sonifier 250
L8-M Ultracentrifuge
26 mL, 70 mL
Hampton Research, Aliso Viejo, USA
IKA-Werke, Staufen
Nalgene, Rochester, USA
Microfluidics, Newton, USA
Millipore, Schwalbach
Beckman Coulter, Krefeld
G. Heinemann, Schwäb. Gmünd
Beckman Coulter, Krefeld
Beckman Coulter, Krefeld
PAGE
Elektrophorese-Apparatur
Geltrockner
Spannungsquelle
2.2.9
Heraeus, Hanau
Holzner, Nussloch
Systech, Lauf/a. d. Pegnitz
Adolf Kühner, Birsfelden, Schweiz
Beckman Coulter, Krefeld
Nunc, Wiesbaden
Beckman Coulter, Krefeld
Beckman Coulter, Krefeld
PowerPac™ BASIC
PowerPac™ HC
Eigenbau MPI für Biophysik, Frankfurt
Biometra, Göttingen
BioRad, München
Chromatographie
Chromatographie-Anlagen
Steuerungssoftware
ÄKTA purifier™
SMART
UNICORN Version 3.21
SMART Manager
GE Healthcare, München
GE Healthcare, München
16
2 Material
2.2.10 Säulen/-materialien
Gepackte Säulen
Chromatographie-Säulen
Säulenmaterial
HiTrap™ Ion Exchange Selection Kit
HiTrap™ DEAE FF
HiTrap™ Q HP
HiLoad™ 26/10 Q-Sepharose HP
Superdex 200 16/60 prep grade
Superdex 200 PC 3.2/30
Superose 6 16/60
Superose 6 PC 3.2/30
PD-10 Desalting Column
Strep-Tactin® Spin Column
HR 16/10
DEAE Sepharose™ FF
GE Healthcare, München
IBA, Goettingen
GE Healthcare, München
GE Healthcare, München
Die Säulenparameter sind in Tabelle 2.2 aufgeführt.
Tabelle 2.2: Parameter der verwendeten Chromatographiesäulen.
Säule
Material
Ø
/[mm]
Höhe
/[mm]
CV
/[mL]
Trennbereich
/[kDa]
Eichgerade
HiTrap™
DEAE FF
DEAE
Sepharose™ Fast
Flow
Q Sepharose™
HP
DEAE
Sepharose™ Fast
Flow
Q Sepharose™
HP
Superdex™ 200
16
25
5
–
–
16
25
5
–
–
16
94
19
–
–
26
100
53
–
–
16
60
120
10-600
Superdex™ 200
3,2
30
2,6
10-600
Superose™ 6
16
60
120
5-5000
Anhang
7.1.1
Anhang
7.1.2
–
Superose™ 6
3,2
30
2,6
5-5000
Sephadex™ G-25
–
–
3,5
50001
Anhang
7.1.3
–
Strep-Tactin®
–
–
1
–
–
HiTrap™
Q HP
DEAE-Sepharose
HiLoad™ 26/10
Q-Sepharose HP
Superdex 200
16/60 prep grade
Superdex 200
PC 3.2/30
Superose 6
16/60
Superose 6
PC 3.2/30
PD-10
Desalting Column
Strep-Tactin®
Spin Column
1
Ausschlußgröße
17
2 Material
2.2.11 Elektroblotten
Blotapparatur
Spannungsquelle
PowerPac™ BASIC
PowerPac™ HC
Eigenbau MPI für Biophysik, Frankfurt
BioRad, München
2.2.12 Kristallisation
Deckgläser
Kristallisationsplatten
Kristallaufnahmen
Mikroskope
Pipettierroboter
Steuerungssoftware
Versiegelung
AxyGem™ Crystallography Plate
CrystalQuick™ RW
XRL™ Plates
Camedia C-3030 Zoom
DFL420
Leica M165 C
Olympus SZ-CTV
Hamilton STARlet
Mosqito
Cartesian
Crystal
Crystal Clear Tape
Axygen Biosciences, Union City, USA
Greiner Bio-One, Frickenhausen
Molecular Dimensions,
Cambridge, UK,
Olympus, Hamburg
Leica Microsystems, Wetzlar
Leica Microsystems, Wetzlar
Olympus, Hamburg
Hamilton Robotics, Martinsried
TTP LabTech, Melbourn, UK
Hamilton Robotics, Martinsried
Hamilton Robotics, Martinsried
Henkel, Düsseldorf
2.2.13 Kristallisationskits
Crystal Screen™ und Crystal Screen II™
100 verschiedene Pufferlösungen zur Proteinkristallisation
Highest Probability Salt Screen
96 verschiedene Pufferlösungen zur Proteinkristallisation
JB-Screen 1-10
240 verschiedene Pufferlösungen zur Proteinkristallisation
JB-Screen Membrane 1-3
72 verschiedene Pufferlösungen zur Proteinkristallisation
pHClear und pHClear II
96 verschiedene Pufferlösungen zur Proteinkristallisation
Precipitant Synergy™ Primary 64
64 verschiedene Pufferlösungen zur Proteinkristallisation
Structure Screen 1 und 2
96 verschiedene Pufferlösungen zur Proteinkristallisation
Hampton Research, Aliso Viejo,
USA
Axygen Biosciences, Union City,
USA
Jena-Biosciences, Jena
Jena-Biosciences, Jena
Qiagen, Hilden
Emerald BioSystems, Bainbridge
Island, USA
Molecular Dimensions,
Cambridge, UK
2.2.14 Röntgenographische Methoden
Cryo-loops
Detektor
Goniometerkopf
Röntgengenerator
Steuerungssoftware
Tieftemperaturgenerator
R-Axis IV++
MicroMax™-007 HF
StructureStudio™
X-stream™ 2000
Hampton Research, Aliso Viejo, USA
Rigaku, Sevenoaks, UK
Rigaku, Sevenoaks, UK
Rigaku, Sevenoaks, UK
Rigaku, Sevenoaks, UK
Rigaku, Sevenoaks, UK
18
2 Material
2.2.15 Chemikalien
Gängige Laborchemikalien sind nicht aufgeführt. Soweit nicht
beschrieben, wurden alle Chemikalien mit Reinheitsgrad p.a. verwendet.
Acrylamid 30 %/Bisacrylamid 0,8 %
Agarose, „SeaKem® LE Agarose”
6-Aminocapronsäure
Ampicillin (Natrium-Salz)
AHT (Anhydrotetracyclin Hydrochlorid)
APS (Ammoniumperoxodisulfat)
Bacto-Agar
Bacto-Casaminoacids
Bacto-Trypton
BCIP (5-Brom-4-chlor-3-indoxylphosphat)
Bis-TRIS-Propan
(1,3-Bis(tris(hydroxymethyl)methylamino)propan)
BugBuster® Protein Extraction Reagent
D-Biotin
Bradford-Reagenz „Bio-Rad Protein Assay“
Bromphenolblau Natriumsalz
Carbenicillin (Dinatrium-Salz)
CHAPS (3-[(3-Cholamidopropyl)dimethylammonium]1-propansulfonat)
Chloramphenicol
Cholat (Na-Salz)
Coomassie Brilliant Blue G-250
Coomassie Brilliant Blue R-250
DTT (Dithiothreitol)
EDTA (Ethylendiamintetraessigsäure), Natriumsalz
Ethidiumbromid
Ficoll 400
Glucose Monohydrat
Glycerin (99,5 %)
Guanidinhydrochlorid
Hefeextrakt (granuliert)
HEPES
(2-(4-(2-Hydroxyethyl)- 1-piperazinyl)-ethansulfonsäure)
Imidazol
IPTG (Isopropyl-β-D-thiogalactopyranosid)
Kanamycinsulfat
LDAO (N,N-Dimethyldodecylamin-N-oxid)
LM (n-Dodecyl-β-D-maltosid)
MES (2-(N-Morpholino)ethansulfonsäure)
MOPS
(3-(N-Morpholino)-Propansulfonsäure)
Natrium/Kalium-Tartrat
NBT (Nitroblau-Tetrazoliumchlorid)
OG (n-Octyl-β-D-glucosid)
PEG 400 (Polyethylenglykol 400)
Phenol/Chloroform
PMSF (Phenylmethansulfonylfluorid)
D(+)-Saccharose
anders
Roth, Karlruhe
Cambrex, Rockland, USA
Calbiochem, Darmstadt
Gerbu, Gaiberg
Fisher Scientific, Schwerte
Koch-Light, Haverhill, UK
Difco Laboratories, Augsburg
Difco Laboratories, Augsburg
Difco Laboratories, Augsburg
Roth, Karlsruhe
Gerbu, Gaiberg
Novagen, Darmstadt
Fluka, München
Bio-Rad Laboratories, München
Roth, Karlruhe
Gerbu, Gaiberg
Sigma-Aldrich, München
Gerbu, Gaiberg
Sigma-Aldrich, München
Serva, Heidelberg
Serva, Heidelberg
Gerbu, Gaiberg
Gerbu, Gaiberg
Roth, Karlruhe
Sigma-Aldrich, München
Roth, Karlsruhe
Gerbu, Gaiberg
Fluka, München
Merck, Darmstadt
Roth, Karlsruhe
Fluka, München
Gerbu, Gaiberg
Gerbu, Gaiberg
Fluka, München
Glycon, Luckenwalde
Gerbu, Gaiberg
Gerbu, Gaiberg
Fluka, München
Biomol, Hamburg
Glycon, Luckenwalde
Fluka, München
Roth, Karlsruhe
Biomol, Hamburg
Gerbu, Gaiberg
19
2 Material
SDS (Natriumdodecylsulfat)
TEMED
(N,N,N',N'-Tetramethyl-p-ethylendiamid)
Tricin
TRIS (Tris(hydroxymethyl)-aminomethan) Ultra Qualität
Triton X100 (t-Octylphenoxypolyethoxyethanol)
Tween 20 (Monolaureat)
Vitamin B12a (Hydroxocobalamin Hydrochlorid)
Xylencyanol FF
Gerbu, Gaiberg
Amersham Biosciences, Freiburg
Gerbu, Gaiberg
Roth, Karlruhe
Koch-Light, Haverhill, UK
Koch-Light, Haverhill, UK
Sigma-Aldrich, München
Fluka, München
2.2.16 Enzyme, Proteine, Vergleichsstandards und Antikörper
In dieser Arbeit verwendete Enzyme sind nur aufgeführt soweit nicht in Kits
enthalten.
Anti-Kaninchen IgG (ganzes Molekül) F(ab’)2Fragment-Alkalische Phosphatase-Konjugat aus Ziege
Anti-M. marburgensis MtrH-Antikörper aus Kaninchen
Anti-Polyhistidin-Alkalische Phosphatase-Konjugat aus
Maus
Anti-Strep-Alkalische Phosphatase-Konjugat aus Maus
Benzonase® Nuclease (250 U/μL)
BSA
DNAse I
Ferritin
Gel Filtration Calibration Kits LMW und HMW
1 kb DNA Ladder
Phusion® High-Fidelity DNA Polymerase
Prestained Protein Marker, Broad Range (6–175 kDa)
Proteinase K
RNAse
BamHI
Restriktionsenzyme:
BglII
EcoRI
MunI
NcoI
NdeI
SAP (shrimp alkaline phosphatase) (1 U/µL)
T4-DNA-Ligase (2U/µL)
Sigma-Aldrich, München
Genovac, Freiburg
Qiagen, Hilden
Qiagen, Hilden
Novagen, Darmstadt
Pierce Perbio, Bonn
Roche Diagnostics, Mannheim
Fluka, München
GE Healthcare, München
New England Biolabs, Frankfurt
Finnzymes, Espoo, Finnland
New England Biolabs, Frankfurt
Fluka, München
Sigma-Aldrich, München
MBI Fermentas, St. Leon-Rot
MBI Fermentas, St. Leon-Rot
MBI Fermentas, St. Leon-Rot
MBI Fermentas, St. Leon-Rot
New England Biolabs, Frankfur
New England Biolabs, Frankfur
MBI Fermentas, St. Leon-Rot
Epicentre, Madison, USA
20
2 Material
2.2.17 Kits
HiSpeed® Plasmid Maxi Kit
ProteoExtract® All-in-One Trypsin Digestion Kit
QIAquick® Gel Extraction Kit
QIAquick® PCR Purification Kit
QIAprep® Spin Miniprep Kit
Zero Blunt® PCR Cloning Kit
Qiagen, Hilden
Calbiochem, Darmstadt
Qiagen, Hilden
Qiagen, Hilden
Qiagen, Hilden
Invitrogen, Carlsbad, USA
2.2.18 Verbrauchsmaterialen
Gängiges Labormaterial ist nicht aufgeführt.
Dialyseschläuche
Filterpapier
Küvetten
Nitrocellulosefilter
PCR-Reaktionsgefäβe
PVDF-Membran
Sterilfilter
2.3
Visking
(MWCO ca. 14 kDa)
Whatman® Paper Grade I
UV/Vis Kunststoff
0,2 μm, 0,45 μm
200 μL
Imobilon P
0,2 μm, 0,45 μm
Roth, Karlsruhe
Schleicher & Schuell, Kassel
Sarstedt, Nümbrecht
Pall, East Hills, USA
Sarstedt, Nümbrecht
Millipore, Schwalbach
Flow Laboratories, Meckenheim
Plasmide
Tabelle 2.3: In dieser Arbeit eingesetzte Plasmide.
Vektor
pCR®-Blunt
pET-22b(+)
pACYCDuet-1
Anwendung
linearisierter
Klonierungsvektor
für PCR-Produkte
mit stumpfen Enden
Expressionsvektor
mit T7 lac-Promotor
Expressionsvektor
mit zwei Polylinkern
und zwei T7 lacPromotoren zur
Koexpression von
zwei Genen
Resistenz
Kan
Zeocin™
Replikon
pUC
Hersteller/Referenz
Invitrogen, Carlsbad, USA
(100),(101)
Amp
ColE1
Cam
P15A
Novagen, Darmstadt
(102),(103)
Novagen, Darmstadt (104)
21
2 Material
2.4
Mikroorganismen und Medien
2.4.4
Archaeen-Stämme
Tabelle 2.4: In dieser Arbeit verwendete Archaeen-Stämme.
Stamm
Methanothermobacter
marburgensis (DSM 2133)
(Methanobacterium
thermoautotrophicum
strain Marburg)
Methanocaldococcus
jannaschii (DSM 2661)
Methanopyrus kandleri
AV19 (DSM 6324)
Beschreibung
Mesophiles
methanogenes
Archaeon
Quelle/Referenz
Deutsche Sammlung für
Mikroorganismen und
Zellkulturen, Braunschweig
(3),(2)
Hyperthermophiles Dr. Seigo Shima, Marburg
methanogenes
GenBank Nr. NC_000909, (6)
Archaeon
Hyperthermophiles GenBank Nr. NC_003551, (105)
methanogenes
Archaeon
Methanothermobacter marburgensis-Zellen wurden von Frau Johanna Moll am
Max-Planck-Institut für terrestrische Mikrobiologie in Marburg angezogen (5),
Methanocaldococcus jannaschii-Zellen wurden von Herrn Dr. Seigo Shima (MaxPlanck-Institut für terrestrische Mikrobiologie, Marburg) zur Verfügung gestellt.
2.4.5
Escherichia coli- Stämme
Tabelle 2.5: In dieser Arbeit verwendete E. coli-Stämme.
Stamm
Beschreibung
DH5α
Klonierungsstamm, F-, φ80dlacZΔM15,
Herstellung von
Δ(lacZYA-argF)U169,
Plasmid-DNA
deoR, recA1, endA1,
hsdR17(rk-, mk+),
phoA,supE44, λ-, thi-1,
gyrA96,relA1
Klonierungsstamm, F-, mcrA, Δ(mrr-hsdRMSHerstellung von
mcrBC), φ80lacZΔM15,
Plasmid-DNA
ΔlacX74, recA1, araD139,
Δ(ara-leu)7697, galU, galK,
endA1, nupG
TOP10
Genotyp
Resistenz
–
–
Quelle/
Referenz
(106),(107)
Invitrogen,
Carlsbad,
USA
22
2 Material
Stamm
Beschreibung
BL21(DE3)
Starke
Überexpression
mit T7 Promotor
Rosetta(DE3)pLysS Eingeschränkte
Expression und
geringe
Basalexpression,
Plasmid mit 6
Genen für tRNA
von seltenen
Codons
2.4.6
Genotyp
F-, dcm, ompT,
hsdSB(rB-mB+),
gal, λ(DE3)
F-, dcm, ompT,
hsdSB(rB-mB+),
gal, λ(DE3),
pLysSRARE,
(CamR)
Resistenz
–
Cam
Quelle/
Referenz
Novagen,
Darmstadt
(103)
Novagen,
Darmstadt
(108)
Medien und Agarplatten
LB-Medium:
1,0 % (w/v) NaCl, 0,5 % (w/v) Hefeextrakt, 1,0 % (w/v) Trypton
M9-Minimalmedium:
6,0 g/L Na2HPO4, 3,0 g/L KH2PO4, 1 g/L NH4Cl, 0,5 g/L NaCl,
1 mM MgSO4, 0,2 mM CaCl2, 0,2 % Casaminoacids,
0,4 % (w/v) Glucose
0,5 % (w/v) Hefeextrakt, 2 % (w/v) Trypton, 5 mM NaCl,
2,5 mM KCl, 10 mM MgSO4, 20 mM Glucose, pH 7,0 (NaOH)
23,1 g/L KH2PO4, 12,54 g/L K2HPO4, 12 g/L Trypton,
24 g/L Hefeextrakt, 0,4 % (v/v) Glycerin
SOC-Medium:
TB-Medium (109):
Festagarplatten enthielten 1,5% (w/v) Bacto-Agar.
Ampicillin:
Carbenicillin
Chloramphenicol:
Kanamycin:
100 mg/mL in H2O (steril filtriert)
50 mg/mL in H2O (steril filtriert)
34 mg/mL in Ethanol
30 mg/mL in H2O (steril filtriert)
Antibiotika-Stammlösungen wurden wie oben beschrieben hergestellt und als
1:1000-Verdünnung eingesetzt.
23
3 Methoden
3 Methoden
3.1
Planung der Vektorkonstrukte
Das Vektorkonstrukt MMRmtrH/pET22b+ zur rekombinanten Expression der Mtr-
Untereinheit MtrH aus M. marburgensis in E. coli wurde von Frau Dr. Priyamvada
Acharya (Max-Planck-Institut für Biophysik, Frankfurt) zur Verfügung gestellt.
Vor der Planung der Vektorkonstrukte zur rekombinanten Expression der MtrUntereinheit MtrA aus M. jannaschii wurde eine Sekundärstrukturanalyse mit Hilfe
der Programme PredictProtein und SOSUI durchgeführt. Daraufhin wurden drei
verschiedene Konstrukte, zum einen zur vollständigen Expression (MJmtrA1), zum
anderen zur Expression zweier um die C-terminale Transmembranhelix verkürzter
Proteine MJmtrA2 (achtzehn C-terminale AS fehlen) und MJmtrA3 (22 C-terminale
AS fehlen), angefertigt.
Zur Klonierung von mtrH aus M. jannaschii wurde die entsprechende Sequenz
aus der Datenbank entnommen (GenBank Nr. NC_000909) (6).
Zwei weitere Konstrukte wurden zur Co-Expression der verkürzten Untereinheit
MtrA
mit
der
Untereinheit
MtrH
angefertigt
(MJmtrA3/pACYC-Duet1
und
MJmtrH/pACYC-Duet1), um eventuell eine bessere Faltung und Löslichkeit der
Untereinheit MtrH zu erreichen. Hintergrund dieses Ansatzes war, dass MtrA und
MtrH für die Methylübertragung im Komplexverbund in Kontakt miteinander stehen
müssen. Wie stark der Zusammenhalt dieses binären Komplexes außerhalb des
Gesamtkomplexes MtrA-H ausfällt, ist jedoch unklar. Der pACYC-Duet 1-Vektor kann
aufgrund seines von pET-Vektoren verschiedenen Replikationsursprungs und
abweichender Antibiotikaresistenz mit diesen zusammen exprimiert werden.
Zur heterologen Expression von M. kandleri MtrA wurden fünfzehn C-terminale
Aminosäuren durch ein Affinitätspeptid (StrepII) ersetzt.
Für die Produktion von M. kandleri MtrH in E. coli wurden zwei verschiedene
Vektorkonstrukte benutzt. Das eine enthielt eine vollständig Version des Gens
(pCHis_tet(mtrH1) bzw. MKmtrH1), im zweiten wurde nach einem Sequenzvergleich
von MtrH aus M. marburgensis, M. jannaschii und M. kandleri mit der
5-Methyltetrahydrofolat
Corrinoid/Eisen-Schwefel-Protein
Methyltransferase
aus
Moorella thermoacetica (Clostridium thermoaceticum) das Gen um die für die elf
N-terminalen Aminosäuren codierenden Basenpaare verkürzt (pCHis_tet(mtrH2)
bzw. MKmtrH2). Außerdem wurde jeweils ein C-terminales His6-Affinitätspeptid
angehängt. Die für die Produktion der Mtr-Untereinheiten aus M. kandleri
24
3 Methoden
verwendeten Plasmide wurden nach Absprache von Herrn PD Dr. Thorsten Selmer
(Fachbereich Biologie, Philipps-Universität Marburg) angefertigt. Eine Übersicht über
die verwendeten Vektorkonstrukte ist in Tabelle 3.1, Vektorkarten sind im Anhang
(Abschnitt 7.2) zu finden.
Tabelle 3.1: In dieser Arbeit verwendete Vektorkonstrukte.
Organismus
Klon
Vektor
Anwendung
Affinitätspeptid
M.
marburgensis
MMRmtrH
MMRmtrH/pET22b+
rekombinante
Produktion
–
M. jannaschii
MJmtrA1
MJmtrA1/pCRblunt
Subklonierung von
PCR-Produkten
Rekombinante
Produktion mit
Transmembranhelix
Subklonierung von
PCR-Produkten
Rekombinante
Produktion ohne
Transmembranhelix
(18 C-terminale AS
fehlen)
Subklonierung von
PCR-Produkten
Rekombinante
Produktion ohne
Transmembranhelix
(22 C-terminale AS
fehlen)
Coexpression mit
MJMtrH ohne
Transmembranhelix
(22 C-terminale AS
fehlen)
Subklonierung von
PCR-Produkten
Rekombinante
Produktion
Coexpression mit
MJMtrA3
Rekombinante
Produktion ohne
Transmembranhelix
(15 C-terminale AS
fehlen)
Rekombinante
Produktion
–
MJmtrA1/pET22b+
M. jannaschii
MJmtrA2
MJmtrA2/pCRblunt
MJmtrA2/pET22b+
M. jannaschii
MJmtrA3
MJmtrA3/pCRblunt
MJmtrA3/pET22b+
MJmtrA3/pACYCDuet1
M. jannaschii
MJmtrH
MJmtrH/pCRblunt
MJmtrH/pET22b+
M. kandleri
MKmtrA
MJmtrH/pACYCDuet1
pCSt_tet(mtrA)
M. kandleri
MKmtrH1
pCHis_tet(mtrH1)
M. kandleri
MKmtrH2
pCHis_tet(mtrH2)
Rekombinante
Produktion (11 Nterminale AS fehlen)
Quelle
Dr.
Priyamvada
Acharya,
Frankfurt
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
C-terminales
StrepIIAnhängsel
Dr. Thorsten
Selmer,
Marburg
C-terminales
His6Anhängsel
C-terminales
His6Anhängsel
Dr. Thorsten
Selmer,
Marburg
Dr. Thorsten
Selmer,
Marburg
25
3 Methoden
3.2
Molekularbiologische Methoden
3.2.1
Extraktion und Reinigung genomischer DNA aus Archaeen-Zellen
Zur Extraktion der genomischen DNA aus Archaeen-Zellen nach Kiener et al.
(110) und Marmur und Doty (111) wurden 2 g Methanocaldococcus jannaschii-Zellen
unter flüssigem Stickstoff mit Mörser und Stößel aufgeschlossen und in 14 mL
Saccharose-TE-Puffer (20 mM TRIS/HCl pH 8,0, 5 mM EDTA pH 8,0, 10 %
Saccharose) mit 2,8 mg Proteinase K resuspendiert. Nach einstündiger Inkubation
bei 37 °C wurde mit 2 % SDS (Endkonzentration) versetzt und wiederum 1 h bei
60 °C inkubiert. Nach Zugabe von 3,5 mL 5 M NaCl-Lösung wurde 1 h auf Eis
inkubiert und schließlich zentrifugiert (20000 x g, 4 °C, 30 min).
Die DNA wurde durch Zugabe des einfachen Volumens an eisgekühltem
Isopropanol aus dem Überstand gefällt und auf einen Glasstab gewickelt. Nach
Waschen mit 70 % Ethanol ließ man die DNA trocknen und löste sie schließlich in
10 mL TE-Puffer (20 mM TRIS/HCl pH 8,0, 5 mM EDTA pH 8,0). Anschließend
wurde 1 mg Proteinase K zugegeben und bei 37 °C für 1 h inkubiert.
Durch
dreimalige
Zugabe
von
Phenol/Chloroform
im
Verhältnis
5:1,
zehnminütiger Inkubation unter Schütteln und anschließender Zentrifugation
(4500 x g, 4 °C, 20 min) wurde die DNA von Protein gereinigt.
Zur Entfernung von Salzen und Nukleotiden wurde Na-Acetat-Puffer (3 M
Na-Acetat pH 5,2) im Verhältnis 1:10 sowie das dreifache Volumen an eisgekühltem
Ethanol und zentrifugiert (4500 x g, 4 °C, 20 min). Das Pellet wurde mit 1 mL
eisgekühltem Ethanol (70 % v/v) gewaschen, nach erneutem Zentrifugieren
(4500 x g, 4 °C, 20 min) an der Luft getrocknet und schließlich in 3 mL TE-Puffer
resuspendiert.
Um RNA zu entfernen wurde 20 µg/mL RNAse (Endkonzentration) zugegeben,
dreimal mit Phenol/Chloroform extrahiert, erneut mit Na-Acetat sowie Ethanol gefällt,
mit 70 % Ethanol gewaschen und in 3 mL TE-Puffer resuspendiert.
3.2.2
Herstellung künstlicher DNA-Fragmente mittels PCR
Die für MtrH und MtrA aus M. jannaschii codierenden Genabschnitte bzw. deren
verkürzte Varianten
wurden mittels Polymerasekettenreaktion amplifiziert. Dabei
wurden durch entsprechende Primer Restriktionsschnittstellen zur Klonierung in
verschiedene Zielvektoren eingeführt (siehe Tabelle 3.2). Die Primer-Sequenzen sind
im Anhang (Abschnitt 7.3) zu finden.
26
3 Methoden
Tabelle 3.2: Übersicht über die durchgeführten PCR-Reaktionen.
Klon
Templat
Vorwärts-Primer
(Schnittstelle)
Rückwärts-Primer
(Schnittstelle)
Zielvektoren
MJmtrH
genom. DNA
M. jannaschii
genom. DNA
M. jannaschii
genom. DNA
M. jannaschii
genom. DNA
M. jannaschii
MJmtrH+ (NdeI)
MJmtrH– (EcoRI)
MJmtrA+ (NdeI)
MJmtrA1– (BamHI)
pET22b+,
pACYC-Duet 1
pET22b+
MJmtrA+ (NdeI)
MJmtrA2– (NcoI)
pET22b+
MJmtrA+ (NdeI)
MJmtrA3– (EcoRI)
pET22b+,
pACYC-Duet 1
MJmtrA1
MJmtrA2
MJmtrA3
Ein Reaktionsansatz von 10-50 µL enthielt 0,3-1 µg Templat, 0,2 µM je Primer,
2 U Phusion® High-Fidelity DNA Polymerase, 1x Phusion® HF Reaction Buffer
(Finnzymes,
Espoo,
Finnland)
und
200
µM
je
dNTP.
Die
verwendeten
Temperaturprogramme sind in Tabelle 3.3 und 3.4 zu finden. Der Erfolg der PCRReaktionen wurde mittels Agarosegelelektrophorese überprüft.
Tabelle 3.3: Temperaturprogramme für PCR-Reaktionen von MJMtrH und MJMtrA1.
Programmschritt
MJMtrH
T/[°C] Zeit/[s]
MJMtrA1
T/[°C] Zeit/[s]
Initiale Denaturierung
Denaturierung
Primer-Anlagerung
Kettenverlängerung
Finale Kettensynthese
98
98
45-56
72
72
98
98
60
72
72
30
10
30 30 Zyklen
30
420
60
60
60 30 Zyklen
60
600
Tabelle 3.4: Temperaturprogramme für PCR-Reaktionen von MJMtrA2 und MJMtrA3.
Programmschritt
MJMtrA2
T/[°C]
Zeit/[s]
MJMtrA3
T/[°C] Zeit/[s]
Initiale Denaturierung
Denaturierung
Primer-Anlagerung
Kettenverlängerung
Finale Kettensynthese
98
98
60,5
72
72
98
98
45-65
72
72
300
60
60 30 Zyklen
60
600
180
30
30 34 Zyklen
30
600
27
3 Methoden
3.2.3
Restriktionsspaltung, Dephosophorylierung und Ligation von DNA
Zum
analytischen
Restriktionsverdau
wurde
folgende
Reaktionsmischung
angesetzt:
2 µL
DNA
je 0,33 µL
Restriktionsenzym
1-2 µL
Restriktionspuffer (Endkonzentration: 1x oder 2x)
H2O
ad 10 µL
(autoklaviert)
Für eine präparative Restriktionsspaltung wurden 20 µg Vektor-DNA mit 50 U
Restriktionsenzym und dem vom Hersteller empfohlenen Puffer in einem 50 µLAnsatz 4 h bei 37 °C inkubiert.
Um eine Religation der durch Restriktionsenzyme linearisierten Plasmide zu
verhindern, wurde mit Hilfe einer alkalischen Phosphatase die 5’-endständige
Phosphatgruppe
hydrolysiert.
Hierfür
wurde
der
Reaktionsansatz
der
Restriktionsspaltung mit 5,5 U Alkalischer Phosphatase aus Kaltwassergarnelen
(SAP) und dem mitgelierten SAP-Puffer versetzt und zunächst 1 h bei 37 °C
inkubiert, dann 20 min zur Inaktivierung der Phosphatase auf 65 °C erhitzt.
Anschließend wurden die DNA-Fragmente in einem Agarosegel elektrophoretisch
getrennt und die entsprechende Banden ausgeschnitten und gereinigt.
Zur Ligation wurden 200 ng Vektor-DNA (linearisierter pCR®-Blunt-Vektor bzw.
mit geeigneten Restriktionsenzymen verdauter pET-22b(+)- oder pACYCDuet-1Vektor) mit der entsprechenden Menge des einzubauenden DNA-Fragments (PCRProdukt mit stumpfen Enden bzw. das Zielgen enthaltendes Bruchstück mit
kompatiblen Enden) im Verhältnis 1:10, dem vom Hersteller mitgelieferten Puffer,
10 mM ATP und 3 U T4-DNA-Ligase in einem Reaktionsansatz von 30 µL gemischt.
Zunächst wurde bei 16 °C für 5 h inkubiert und anschließend die Ligase für 10 min
bei 65 °C inaktiviert. Nachfolgende Tabelle gibt einen Überblick über die
durchgeführten Ligationen. Die Ligation von pCR®-Blunt-Vektor mit PCR-Produkten
mit stumpfen Enden wurden nach Herstellerangaben (Invitrogen, Carlsbad, USA)
ausgeführt.
28
3 Methoden
Tabelle 3.5: Übersicht über die Plasmidherstellung.
Ausgangsvektor Restriktionsspaltung
MJmtrA1/pCRblunt
MJmtrA2/pCRblunt
MJmtrA3/pCRblunt
MJmtrA3/pCRblunt
MJmtrH/pCRblunt
MJmtrH/pCRblunt
NdeI, BamHI
NdeI, NcoI
NdeI, EcoRI
NdeI, EcoRI
NdeI, EcoRI
NdeI, EcoRI
Eingesetzter
Vektor
pET-22b(+)
pET-22b(+)
pET-22b(+)
pACYC-Duet1
pET-22b(+)
pACYC-Duet1
Restriktions- Zielvektor
spaltung
NdeI, BamHI
NdeI, NcoI
NdeI, EcoRI
NdeI, MunI
NdeI, EcoRI
NdeI, MunI
MJmtrA1/pET22b+
MJmtrA2/pET22b+
MJmtrA3/pET22b+
MJmtrA3/pACYC-Duet1
MJmtrH/pET22b+
MJmtrH/pACYC-Duet1
Zur Analyse der Klonierungen wurden je 3 µL des Ligationsansatzes in E. coli
DH5α-Zellen oder One Shot® TOP10 chemically competent E. coli (Invitrogen,
Carlsbad, USA) wie beschrieben transformiert (Abschnitt 3.2.4) und die Zellen
angezogen. Aus den Kolonien der positiven Klone wurden sodann die Plasmide
isoliert (siehe Abschnitt 3.2.5), diese mit geeigneten Restriktionsenzymen verdaut
(siehe
oben)
und
die
entstandenen
DNA-Fragmente
mittels
Agarosegel-
elektrophorese (siehe Abschnitt 3.2.6) auf die Anwesenheit des Zielgens überprüft.
Des Weiteren wurden die hergestellten Plasmide durch Sequenzierung (siehe
Abschnitt 3.2.9) kontrolliert.
3.2.4
Herstellung von kompetenten E. coli-Zellen und Transformation
Zur Herstellung Hitzeschock-kompetenter E. coli-Zellen wurde eine Variante der
Rubidiumchlorid-Methode verwendet (112). 50 mL LB-Medium (ggf. mit geeignetem
Antibiotikum) wurden mit 100 µL einer Übernacht-Kultur angeimpft und bis zu einer
OD600 von 0,3-0,5 bei 37 °C angezogen. Die Bakteriensuspension wurde kurz auf Eis
gekühlt, zentrifugiert (3000 x g, 4 °C, 10 min), das Pellet in 15 mL eisgekühltem
TF-Puffer 1 (30 mM K-Acetat pH 5,8, 10 mM CaCl2, 100 mM RbCl, 50 mM MnCl2,
15 % (v/v) Glycerin) resuspendiert und 15 min auf Eis inkubiert. Nach erneutem
Zentrifugieren (3000 x g, 4 °C, 10 min) wurde das Pellet in 2 mL eisgekühltem
TF-Puffer 2 (10 mM MOPS/KOH pH 7,0, 10 mM RbCl, 75 mM CaCl2, 15 % (v/v)
Glycerin) resuspendiert. Je 100 µL Bakteriensuspension wurde in flüssigem
Stickstoff schockgefroren und bei -80 °C gelagert.
Zur Transformation von 50 µL kompetenten Zellen ließ man diese auf Eis
auftauen und inkubierte nach Zugabe von 1 µL Plasmid-Lösung für 30 min bei 0 °C.
Nach dem Hitzeschock (42 °C, 60 s) kühlte man 2 min auf Eis. Die Zellen wurden
nach Zugabe von 250 µL SOC-Medium 1 h bei 37 °C geschüttelt und schließlich auf
LB-Agar-Platten mit geeignetem Antibiotikum ausgestrichen. Die Transformanden
wurden bei 37 °C über Nacht angezogen.
29
3 Methoden
3.2.5
Plasmidpräparation
Plasmidpräparationen für analytische Zwecke wurden aus 5 mL LB-Kultur mit
dem QIAprep® Spin Miniprep Kit (Qiagen, Hilden) nach Anleitung durchgeführt,
wobei mit 50 µL Puffer EB (10 mM TRIS/HCl pH 8,5) eluiert wurde.
Für präparative Zwecke wurde Plasmid aus 100-250 mL LB-Kultur mit dem
HiSpeed® Plasmid Maxi Kit (Qiagen, Hilden) nach Vorschrift isoliert und mit 1 mL
Plasmidpuffer (10 mM TRIS/HCl pH 8,0) eluiert.
Die Ausbeute der Plasmidpräparationen wurde durch Messung der Absorption
bei 260 nm, die Reinheit durch Verhältnis der Absorptionen bei 260 und 230 nm
sowie 260 und 280 nm ermittelt (siehe Abschnitt 3.2.8).
3.2.6
Agarosegelelektrophorese
Zur Analyse und Präparation von DNA-Fragmenten wurden diese in horizontalen
Agarosegelen (1 % (w/v) in TBE-Puffer (45 mM TRIS, 45 mM Borsäure, 1 mM EDTA
pH 8,0)) mit 1 µg/mL Ethidiumbromid zur Detektion bei UV-Licht elektrophoretisch bei
Raumtemperatur und 90 V bzw. 120 mA getrennt (109). Die Proben wurden vor der
Elektrophorese mit 6x DNA-Probenpuffer (0,25 % Bromphenolblau, 0,25 %
Xylencyanol FF, 15 % Ficoll 400) versetzt, als interner Längenstandard wurden 5 µL
1 kb DNA Ladder (New England Biolabs, Frankfurt) eingesetzt.
3.2.7
Aufreinigung von DNA
Die präparative Aufreinigung von DNA-Fragmenten aus Agarosegelen erfolgte
mit dem QIAquick® Gel Extraction Kit (Qiagen, Hilden) nach Herstellerangaben,
wobei mit 30 µL EB-Puffer eluiert wurde.
Zur Abtrennung von kleineren Oligonukleotiden sowie Enzymen z.B. nach der
PCR wurden die DNA-Proben nach Anleitung mit dem QIAquick® PCR Purification
Kit (Qiagen, Hilden) gereinigt, die Elution erfolgte dabei mit 50 µL EB-Puffer.
3.2.8
Die
Bestimmung von DNA-Konzentration und -Reinheit
DNA-Konzentration
einer
Probe
kann
durch
Messung
des
Absorptionsmaximums bei 260 nm bestimmt werden, wobei A260 = 1 einer
Konzentration von 50 µg/mL DNA entspricht.
30
3 Methoden
Proteine hingegen zeigen ein Absorptionsmaximum bei 280 nm, sodass das
Verhältnis A260/A280 zur Überprüfung der Probe auf Kontaminationen genutzt werden
kann. Hierbei gilt:
A260/A280 = 1:
reine DNA
A260/A280 > 1:
RNA-Verunreinigungen
A260/A280 < 1:
Protein-Kontamination.
Eine weitere Möglichkeit zur Bestimmung der DNA-Konzentration stellt die
Abschätzung anhand eines Vergleichs der Intensitäten der Banden im Agarosegel
mit den Banden des DNA-Längenstandards mit bekannten Konzentrationen dar.
3.2.9
Sequenzierung
Zur Überprüfung der Klonierungen wurden die hergestellten Plasmide mittels der
Didesoxymethode nach Sanger et al. (113) von den Firmen Seqlab (Göttingen) oder
Agowa (Berlin) sequenziert. Pro Sequenzierung wurden 0,7 ng DNA lyophylisiert und
eingeschickt. Die verwendeten Primer und ihre Sequenzen sind in Tabelle 3.6, die
Ergebnisse der Sequenzierungen im Anhang (Abschnitt 7.4) aufgeführt. Zur
Überprüfung der Elektropherogramme wurde das Programm Chromas 2.33
(Technelysium, Tewantin, Australien) verwendet.
Tabelle 3.6: Für Sequenzierungsreaktionen verwendete Primer.
Nr.
Vektor
Primer
Richtung
Sequenz 5’ → 3’
1
MJmtrH/pCRblunt
2
MJmtrH/pet22b+
3
MJmtrA1/pCRblunt
4
MJmtrA2/pCRblunt
5
MJmtrA3/pCRblunt
6
MJmtrH/pACYC-Duet1
7
MJmtrA3/pACYC-Duet1
M13 Reverse
M13 Forward (-20)
T7-Promotor
T7-Terminator
M13 Reverse
M13 Forward (-20)
M13 Reverse
M13 Forward (-20)
M13 Reverse
M13 Forward (-20)
Duet UP2
T7-Terminator
Duet UP2
T7-Terminator
rückwärts
vorwärts
vorwärts
rückwärts
rückwärts
vorwärts
rückwärts
vorwärts
rückwärts
vorwärts
vorwärts
rückwärts
vorwärts
rückwärts
CAGGAAACAGCTATGAC
GTAAAACGACGGCCAG
AATACGACTCACTATAGGG
GCTAGTTATTGCTCAGCGG
CAGGAAACAGCTATGAC
GTAAAACGACGGCCAG
CAGGAAACAGCTATGAC
GTAAAACGACGGCCAG
CAGGAAACAGCTATGAC
GTAAAACGACGGCCAG
TTGTACACGGCCGCATAATC
GCTAGTTATTGCTCAGCGG
TTGTACACGGCCGCATAATC
GCTAGTTATTGCTCAGCGG
31
3 Methoden
3.3
Kultivierung von Bakterien
3.3.1
Bestimmung der Zelldichte
Zur Bestimmung der Zelldichte wurde die optische Dichte bei 600 nm (OD600),
welche sich proportional zur Zelldichte verhält, mittels eines Photometers bestimmt.
3.3.2
Kultivierung für die Plasmidpräparation
Für die analytische Plasmidpräparation wurden 5 mL, für präparative Zwecke
100-250 mL LB-Medium mit dem entsprechenden Antibiotikum versetzt und mit
plasmidtragenden E. coli-Bakterien von einer Agar-Platte bzw. mit 1-2,5 mL einer
Übernachtkultur angeimpft. Nach 17 h Schütteln bei 37 °C wurden die Zellen durch
Zentrifugation geerntet (5000 x g, 4 °C, 10 min).
3.3.3
Kultivierung für die Proteinproduktion
Für die Proteinproduktion wurden von den entsprechenden plasmidtragenden
E. coli-Stämmen (vgl. Tabelle 3.7) zunächst Glycerinkulturen angelegt. Hierzu
wurden 5 mL LB-Medium mit einem geeigneten Antibiotikum versetzt und mit einer
Kolonie von einer Festagarplatte angeimpft. Bei 37 °C wurde unter Schütteln bis zu
einer OD600 von 0,5 angezogen, sodann auf Eis gekühlt und je 830 µL Zellkultur mit
170 µL sterilem Glycerin (37 % w/v) versetzt. Die Glycerinkulturen wurden in
flüssigem Stickstoff schockgefroren und bei -80 °C gelagert.
32
3 Methoden
Tabelle 3.7: Übersicht über die zur Proteinexpression verwendeten Plasmide und
E. coli-Stämme.
Protein(e)
Beschreibung
Plasmid(e)
E. coli-Stamm
MMRMtrH
MJMtrA1
MtrH (33 kDa)
vollständiges MtrA (26 kDa) mit
Transmembranhelix
des-[229-246]-MtrA (24 kDa) 18 Cterminale AS fehlen
des-[225-246]-MtrA (24 kDa) 22 Cterminale AS fehlen
MtrH (36 kDa)
vollständiges MtrA (26 kDa)
+ MtrH (36 kDa)
des-[229-246]-MtrA (24 kDa)
+ MtrH (36 kDa)
des-[225-246]-MtrA (24 kDa)
+ MtrH (36 kDa)
des-[225-246]-MtrA (24 kDa)
+ MtrH (36 kDa)
des-[238-252]-MtrA (27 kDa)
mit C-terminalem StrepII-Anhängsel
15 C-terminale AS fehlen
MtrH (36 kDa) mit
C-terminalem His6-Anhängsel
des-[1-11]-MtrH (35 kDa)
mit C-terminalem His6-Anhängsel
11 N-terminale AS fehlen
MMRmtrH/pET22b+
MJmtrA1/pET22b+
BL21 (DE3)
BL21 (DE3)
MJmtrA2/pET22b+
BL21 (DE3)
MJmtrA3/pET22b+
BL21 (DE3)
MJmtrH/pET22b+
MJmtrA1/pET22b+
& MJmtrH/pACYC-Duet1
MJmtrA2/pET22b+
& MJmtrH/pACYC-Duet1
MJmtrA3/pET22b+
& MJmtrH/pACYC-Duet1
MJmtrH/pET22b+
& MJmtrA3/pACYC-Duet1
pCSt_tet(mtrA)
BL21 (DE3)
BL21 (DE3)
pCHis_tet(mtrH1)
Rosetta(DE3)pLysS
pCHis_tet(mtrH2)
Rosetta(DE3)pLysS
MJMtrA2
MJMtrA3
MJMtrH
MJMtrA1+MJMtrH
MJMtrA2+MJMtrH
MJMtrA3+MJMtrH
MKMtrA
MKMtrH1
MKMtrH2
BL21 (DE3)
BL21 (DE3)
BL21 (DE3)
Rosetta(DE3)pLysS
Rekombinantes M. marburgensis MtrH (MMRMtrH):
Zur Produktion von rekombinantem MtrH aus M. marburgensis in E. coli
BL21 (DE3) wurde mit Ampicillin komplementiertes LB-Medium mit 10 mL/L einer
Übernachtkultur angeimpft und bei 37 °C unter Schütteln bis zu einer OD600 = 0,7-0,8
angezogen. Es wurde mit 0,5 mM IPTG induziert und nach 3 h Schütteln bei 37 °C
geerntet.
Des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii:
MJMtrA3 aus M. jannaschii wurde in E. coli BL21 (DE3) produziert, indem
Ampicillin-haltiges LB-Medium mit 100 mL/L einer Übernachtkultur angeimpft und bei
28 °C und langsamem Schütteln inkubiert wurde. Bei einer OD600 = 0,7-0,8 wurde mit
0,3 mM IPTG induziert. Nach weiteren 5 h bei 28 °C und langsamem Schütteln
wurden die Zellen abzentrifugiert.
33
3 Methoden
Coexpression von des-[225-246]-MtrA und MtrH (MJMtrA3+MJMtrH) aus
M. jannaschii:
Die Coexpression von des-[225-246]-MtrA und MtrH (MJMtrA3+MJMtrH) aus
M. jannaschii wurde in die Plasmide MJmtrH/pACYCDuet-1 und MJmtrA3/pet22b+tragenden E.coli BL21 (DE3)-Zellen durchgeführt.
Dazu wurde mit Ampicillin und Chloramphenicol versetztes LB-Medium mit
60 mL/L einer 15 h lang angezogenen Vorkultur angeimpft. Die Zellen ließ man bei
30 °C unter Schütteln bis zu einer OD600 = 0,5-0,7 wachsen und induzierte dann mit
0,3 mM IPTG. Nach weiteren 5 h bei 30 °C unter Schütteln wurde geerntet.
Des-[238-252]-MtrA
mit
C-terminalem
StrepII-Anhängsel
(MKMtrA)
aus
M. kandleri:
Zur Expression von MKMtrA in E. coli Rosetta (DE3) pLysS-Zellen wurde mit
Chloramphenicol
und
Carbenicillin
versetztes
TB-Medium
mit
50
mL/L
Übernachtkultur beimpft und bei 37 °C unter Schütteln bis zu einer OD600 = 1
angezogen. Sodann wurde mit 20 ng/mL AHT induziert und nach 6,5 h bei 25 °C und
unter Schütteln geerntet.
Die Bakterien wurden geerntet, sobald die stationäre Phase erreicht war. Dazu
wurde die Zellsuspension auf Eis gekühlt und abzentrifugiert (6000 x g, 4 °C,
20 min). Das Zellpellet wurde in 40 mL/L Kulturmedium STE-Puffer (10 mM TRIS/HCl
pH 8,0, 100 mM NaCl, 1 mM EDTA pH 8,0) resuspendiert, erneut zentrifugiert
(4500 x g, 4 °C, 20 min) und nach Verwerfen des Überstands bei -20 °C gelagert.
3.3.4
Um
Expressionstests und Optimierung der Proteinexpression
zu
überprüfen,
ob
das
Protein
nach
der
Expression
je
nach
Wachstumsbedingungen in der löslichen oder membranständigen/unlöslichen
Fraktion vorlag sowie um eine Maximierung der Ausbeute zu erreichen, wurden
Expressionstests durchgeführt. Hierzu wurden sowohl verschiedene Medien (LB-,
TB- und M9-Minimalmedium), verschiedene Temperaturen (25-37 °C) als auch
unterschiedliche Konzentrationen zur Induktion (IPTG: 0,1-1 mM, AHT: 2-200 ng/mL)
getestet. Im Abstand von jeweils 1 h wurde die OD600 von 1 mL Zellsuspension
bestimmt und die Proben bei -20 °C eingefroren.
Zur Analyse wurden die Proben aufgetaut, zentrifugiert (13000 x g, RT, 10 min)
und der Überstand verworfen. Das Zellpellet wurde in 50 µL BugBuster® Protein
Extraction
Reagent
(Novagen,
Darmstadt)
resuspendiert,
mit
12,5
U
34
3 Methoden
Benzonase® Nuclease (Novagen, Darmstadt) und 5 µg Lysozym versetzt und 30 min
bei RT inkubiert. Bei den vor der Induktion genommenen Proben wurde zur Analyse
der gesamten in der Zelle enthaltenen Proteine 15 µL dieses Zelllysats mit 5 µL
5x SDS-Probenpuffer (250 mM TRIS/HCl pH 6,8, 500 mM DTT, 10 % (w/v) SDS,
0,5 % Bromphenolblau, 10 % (v/v) Glycerin) versetzt und 15 min auf 99 °C erhitzt.
Das restliche Lysat wurde zentrifugiert (13000 x g, RT, 10 min), das Pellet (unlösliche
Fraktion/Membranfraktion) in 25 µL SDS-Lösung (1 % w/v) unter Erhitzen auf 99 °C
gelöst und 5-15 µL davon mit 5 µL SDS-Probenpuffer versetzt. 10-15 µL des
Überstand (lösliche Fraktion/cytosolische Fraktion) wurden ebenfalls mit 5 µL SDSProbenpuffer versetzt und 15 min auf 99 °C erhitzt. Die Proben wurden anschließend
per SDS-Polyacrylamidgelelektrophorese (siehe Abschnitt 3.4.2) und Western Blot
(Abschnitt 3.4.4) analysiert.
3.4
Proteinbiochemische Methoden
3.4.1
Bestimmung der Proteinkonzentration
Die Proteinkonzentration einer Lösung wurde nach Bradford bestimmt (114).
Dieser Test beruht auf einer Verschiebung des Absorptionsmaximums der freien
kationischen Form von Coomassie Brilliant Blue G-250 (im Bradford-Reagenz
„Bio-Rad Protein Assay“, Bio-Rad Laboratories, München enthalten) bei 470 nm zu
595 nm bei der anionischen, an Arginin und aromatische Aminosäurereste
gebundenen Form.
Die Proteinbestimmung wurde anhand einer Eichgeraden, bei der A595 gegen die
Konzentration an BSA (1-5 µg/mL) aufgetragen wurde, durchgeführt.
3.4.2
SDS-Polyacrylamidgelelektrophorese (SDS-Page)
Für die SDS-Gelelektrophorese wurden vertikale Minigele mit 4 %-igem
Sammelgel (4 % (w/v) Acrylamid, 0,1 % (w/v) Bisacrylamid, 125 mM TRIS/HCl
pH 6,8, 0,1 % (w/v) SDS, 0,1 % (w/v) APS, 0,01 % (v/v) TEMED) und 15 %-igem
Trenngel (15 % (w/v) Acrylamid, 0,4 % (w/v) Bisacrylamid, 375 mM TRIS/HCl pH 8,8,
0,1 % (w/v) SDS, 0,1 % (w/v) APS, 0,01 % (v/v) TEMED) nach der Methode von
Laemmli (115) verwendet.
Je 15 µL Probe wurde mit 5 µL 5x Probenpuffer (250 mM TRIS/HCl pH 6,8,
500 mM DTT, 10 % (w/v) SDS, 0,5 % Bromphenolblau, 10 % (v/v) Glycerin)
gemischt, bis zu 15 min auf 99 °C erhitzt und in die Geltaschen pipettiert. Als interner
35
3 Methoden
Standard zum Größenvergleich wurden 8 µL Prestained Protein Marker, Broad
Range (6–175 kDa) (New England Biolabs, Frankfurt) aufgetragen.
Danach
wurden
Anoden-
und
Kathodenraum
mit
Elektrophoresepuffer
(25 mM TRIS/250 mM Glycin pH 8,3, 0,1 % (w/v) SDS) gefüllt. Die Auftrennung der
Proteine
erfolgte
bei
konstanter
Stromstärke
(20
mA
pro
Gel)
und
Spannungsbegrenzung auf maximal 200 V bei 4 °C.
Anschließend wurde das Gel aus der Halterung entfernt und 15 min mit heißer
Coomassie-Färbelösung (40 % (v/v) Ethanol, 10 % (v/v) Essigsäure, 0,1 % (w/v)
Coomassie Brilliant Blue R-250) behandelt. Sodann wurde der Hintergrund 30 min
mit heißem Entfärber (40 % (v/v) Ethanol, 10 % (v/v) Essigsäure) entfärbt und die
Gele über Nacht in Wasser gewaschen.
Zur Dokumentation und Aufbewahrung wurden die sorgfältig gewaschenen Gele
auf angefeuchtetes Filterpapier (Whatman® Paper Grade I, Schleicher & Schuell,
Kassel) gelegt und bei 80 °C zwei Stunden unter Vakuum in einer Geltrockenanlage
getrocknet.
3.4.3
Blaue native Polyacrylamidgelelektrophorese (BN-Page)
Zur elektrophoretischen Auftrennung von nativen Proteinen und ProteinKomplexen wurde die Blaue Native Gelelektrophorese nach Schägger in einer von
Richers für Minigel-Apparaturen abgewandelten Form verwendet (116-118).
10 µL Probe wurde mit 10 µL Probenpuffer (50 mM Tricin, 7,5 mM Imidazol,
0,002 % (w/v) Coomassie Brilliant Blue G-250, 20 % Glycerin) versetzt und in die
Taschen
eines
(3,5-18 % (w/v)
3,5-18
%
Acrylamid,
(w/v)
Acrylamid
0,09-0,48
%
enthaltenden
(w/v)
Gradientengels
Bisacrylamid,
500
mM
6-Aminocapronsäure, 25 mM Imidazol/HCl pH 7,0, 0-16 % Glycerin, 0,4 % (w/v)
APS, 0,04 % (v/v) TEMED) pipettiert.
Als interner Vergleichsstandard wurden 8 µg BSA und 25 µg Ferritin in 20 µL
Probenpuffer aufgetragen.
Der Anodenraum wurde mit Anodenpuffer (25 mM Imidazol/HCl pH 7,0), der
Kathodenraum mit Kathodenpuffer (50 mM Tricin, 7,5 mM Imidazol, 0,002 % (w/v)
Coomassie Brilliant Blue G-250) gefüllt und zunächst 20 min bei 50 V bzw. 12 mA,
dann 40 min bei 250 V bzw. 12 mA bei 4 °C aufgetrennt.
Die Proteinbanden wurden nach dem Lauf wie im Abschnitt 3.4.2 beschrieben mit
Coomassie Brilliant Blue R-250 gefärbt und dokumentiert.
36
3 Methoden
3.4.4
Elektrophoretischer Proteintransfer und direkter ELISA (Western Blot)
Um die durch SDS-Page aufgetrennten Proteine aus der Polyacrylamidmatrix auf
PVDF-Membranen zu übertragen, wurde nach der Methode des semi-dry-Blottings
mit diskontinuierlichem Puffersystem
verfahren (119, 120). Ein Stapel aus mit
Transferpuffer (25 mM TRIS/150 mM Glycin pH 8,3, 10 % (v/v) Methanol) getränkten
Filterpapieren (Whatman® Paper Grade I, Schleicher & Schuell, Kassel), Gel und
Membran (Imobilon P, Millipore, Schwalbach) wurde horizontal zwischen zwei
Plattenelektroden gelegt. Durch Anlegen eines elektrischen Feldes (60-70 mA/pro
Gel, 1,5 h, 4 °C) wurden die Proteinbanden im Gel auf die Membran übertragen.
Anschließend wurde die Membran zunächst über Nacht bei 4 °C mit BSA
geblockt (2 % (w/v) in TBST-Puffer (10 mM TRIS/HCl pH 8,0, 150 mM NaCl,
0,05 % (w/v) Tween 20), dann mit konjugierten Antikörpern (Anti-PolyhistidinAlkalische
Phosphatase-Konjugat
aus
Maus
oder
Anti-Strep-Alkalische
Phosphatase-Konjugat aus Maus; Qiagen, Hilden) in einer Verdünnung von 1:2000
in TBST-Puffer 2 h bei RT behandelt.
Anti-M. marburgensis MtrH-Antikörper wurden von der Firma Genovac (Freiburg)
durch Immunisierung mit zwei synthetisch hergestellten Peptiden (AS 133-147:
(C)AADESELEALKNTKL und AS 231-249: (C)PSAWDWLREYUKEHKEAWP), die
mit den Immunstimulatoren KLH (Keyhole limpet Hämocyanin) und Ovalbumin
konjugiert worden waren, aus Kaninchenserum gewonnen. Die Membran wurde
1,5 h mit Anti-M. marburgensis MtrH-Antikörpern in einer Verdünnung von 1:2000 in
TBST-Puffer behandelt, mit TBST-Puffer gewaschen und schließlich 1,5 h mit
sekundären
Antikörpern
(Anti-Kaninchen
IgG
F(ab’)2-Fragment-Alkalische
Phosphatase-Konjugat aus Ziege; 1:3000 in TBST) behandelt.
Nach Waschen der Membran in TBST- und AP-Puffer (100 mM TRIS/HCl pH 9,5,
100 mM NaCl, 5 mM MgCl2) wurden die Antikörper durch eine Farbreaktion mit BCIP
und NBT detektiert (121, 122).
3.4.5
Analytische Gelfiltration
Zur Überprüfung der Reinheit und Einheitlichkeit von Proteinproben, zur
Molekulargewichtsbestimmung und Analyse des oligomeren Zustands von Proteinen
bzw.
Proteinkomplexen
sowie
zur
Erprobung
verschiedener
Pufferzusammensetzungen wurde die Methode der analytischen Gelfiltration
verwendet. Diese wurde mit Hilfe des SMART-Systems (GE Healthcare, München)
bei 4 °C durchgeführt.
37
3 Methoden
Hierbei wurde eine minimale Proteinprobe (ca. 100 µg, maximal 50 µL) auf einer
geeigneten Gelfiltrationssäule (Superdex 200 PC 3.2/30 oder Superose 6 PC 3.2/30,
CV: je 2,6 mL) über 1,2 CV mit einem entsprechenden Puffer bei einer Flussrate von
50 µL/min isokratisch eluiert. Die Detektion erfolgte mittels Messung der UV/VisAbsorption bei bis zu drei Wellenlängen. Teilweise wurde darüber hinaus eine
Fraktionierung des Eluats zur weiteren Analyse durchgeführt.
Zur Abschätzung des Molekulargewichts der eluierten Proteine wurde eine
Probenmischung löslicher Standardproteine aufgetragen (Gel Filtration Calibration
Kits LMW und HMW, GE Healthcare, München) und anhand des Elutionsprofils eine
Eichgerade (siehe Anhang, Abschnitt 7.1) erstellt.
3.4.6
Massenspektrometrie
Elektrospray-Ionisations-Massenspektrometrie (ESI-MS):
Bei dieser Methode wird die flüssige Probe durch eine Kapillare in ein
elektrisches
Feld
gebracht.
Oberflächenspannung
beschleunigt.
Am
gelangen
Interface
Durch
die
gehen
elektrostatische
Ionen
die
in
Ionen
die
Kräfte
Gasphase
vom
und
und
die
werden
Atmosphärendruck
der
Ionisationskammer zum Hochvakuum des Analysators über. Im QuadrupolAnalysator erfolgt die Auftrennung der Ionen nach ihrem Masse-Ladungs-Verhältnis,
sodass ein charakteristisches Spektrum entsteht. Dieses Spektrum wird mit Hilfe des
Programms Mascot mit einer Datenbank verglichen und so das Protein identifiziert.
Die Analyse der Molekularmassen der Peptidfragmente nach einem TrypsinVerdau von MJMtrA3 (heterolog exprimiertes des-[225-246]-MtrA aus M. jannaschii)
wurde von der Firma Proteome Factory (Berlin) durchgeführt. Dazu wurden die zu
untersuchenden
Banden
aus
einem
15
%-igen
SDS-Polyacrylamidgel
ausgeschnitten und eingeschickt.
Der gereinigte Mtr-Komplex mit Untereinheit MtrH (MtrA-H) sowie der ohne
Untereinheit MtrH gereinigte Komplex MtrA-G wurden in einem 15 %-igen SDS-Gel
in
ihre
Untereinheiten
ausgeschnitten
®
ProteoExtract
und
aufgetrennt.
einem
Die
Trypsin-Verdau
entsprechenden
unterzogen.
Banden
Dazu
wurden
wurde
das
All-in-One Trypsin Digestion Kit (Calbiochem, Darmstadt) nach
Vorschrift verwendet. Die verdauten Proben wurden von Herrn Dr. Julian Langer am
Max-Planck-Institut für Biophysik in Frankfurt mittels ESI-MS analysiert.
38
3 Methoden
Matrix-unterstützte
Laserdesorptions/Ionisations-Massenspektrometrie
mit
Flugzeitmassen-Analyse (MALDI-TOF):
Bei dieser Methode werden die Peptidfragmente oder Proteine mit einer
Matrixsubstanz (α-Cyano-4-hydroxy-Zimtsäure) co-kristallisiert. Die Matrix wird nun
im Hochvakuum durch Laserbeschuss verdampft, sodass die zu untersuchenden
Moleküle mitgerissen und gleichzeitig ionisiert werden. Die Ionen werden im
elektrischen Feld beschleunigt und die Flugzeit mittels eines FlugzeitmassenAnalysators gemessen. Hierbei gilt:
tof ∝
Gleichung 3.1
m
z
tof: Flugzeit (time of flight)
m: Masse
z: Ladungszahl
Das
erhaltene
Masse/Ladungs-Spektrum
wird
ebenfalls
durch
Datenbankabgleich mittels des Programms Mascot analysiert.
Der Vorteil der Methode liegt darin, dass auch große Massen, d.h. komplette
Proteine sowie hydrophobe Proben, detektiert werden können.
Innerhalb dieser Arbeit wurden Peptidfragmente nach Trypsinverdau von
MJMtrA3 (heterolog exprimiertes des-[225-246]-MtrA aus M. jannaschii) und von
verschiedenen Untereinheiten des Mtr-Gesamtkomplexes aus M. marburgensis
sowie MKMtrA aus SDS-Polyacrylamidgelbanden von Herrn Jörg Kahnt am
Max-Planck-Institut für terrestrische Mikrobiologie in Marburg analysiert.
3.5
Proteinreinigung
3.5.1
Membranpräparation aus M. marburgensis-Zellen
Zur Präparation der Membranen aus M.
marburgensis unter aeroben
Bedingungen wurde das von Gärtner et al. (56) etablierte Protokoll modifiziert. 60 g
Zellen wurden auf Eis aufgetaut und in 3-5 mL Lysepuffer 1 (50 mM MOPS/KOH
pH 7,0, 10 mL MgCl2, 2 mM DTT) pro g Bakterienfeuchtgewicht resuspendiert. Nach
Zugabe von 30 mg DNAse I wurde im Hochdruckhomogenisator (4 x 80 psi/100 bar,
0 °C) aufgeschlossen und das Zelldebris abzentrifugiert (15 000 x g, 2 x 30 min,
4 °C).
Aus dem Überstand wurde durch Ultrazentrifugation (100 000 x g, 3 h, 4˚C) die
Membranfraktion abgetrennt. Diese wurde sodann in 50 mL Lysepuffer 1
39
3 Methoden
resuspendiert, mit einem Dispergiergerät homogenisiert und erneut zentrifugiert
(100 000 x g, 1 h, 4˚C). Beim zweiten Waschschritt wurde in 50 mL Waschpuffer 1
(50 mM MOPS/KOH pH 7,0, 10 mL MgCl2, 2 mM DTT, 0,05 % (w/v) LM)
resuspendiert, homogenisiert und zentrifugiert (100 000 x g, 1 h, 4˚C). Die
Membranen wurden bis zur weiteren Verwendung mit 15 mL Waschpuffer in
flüssigem Stickstoff schockgefroren und bei -80 °C verwahrt.
Zur Reinigung des Mtr-Komplexes ohne Untereinheit MtrH (MtrA-G) wurde eine
abgewandelte Version des oben beschriebenen Protokolls verwendet. 40 g Zellen
wurden in 1,75 mL Lysepuffer 2 (50 mM TRIS/HCl pH 7,6, 2 mM DTT) pro g
Bakterienfeuchtgewicht resuspendiert, durch Ultraschall-Behandlung (7 x 8 min mit je
5 min Pause, Puls: 50 %, Leistung: 5 W, 0 °C) aufgeschlossen und zentrifugiert
(13 000 x g, 2 x 30 min, 4 °C).
Durch Ultrazentrifugation (150 000 x g, 2 h, 4˚C) wurden die Membranen
abgetrennt und der Überstand verworfen. Die Membranen wurden in 20 mL
Lysepuffer 2 resuspendiert, homogenisiert und 8 min mit Ultraschall (Puls: 50 %,
Leistung: 5 W, 0 °C) behandelt. Nach erneuter Ultrazentrifugation (150 000 x g,
1,5 h, 4˚C) wurden die Membranen ein zweites Mal mit 20 mL Waschpuffer 2 (50 mM
TRIS/HCl pH 7,6, 2 mM DTT, 0,05 % (w/v) LM) gewaschen indem sie ebenfalls
homogenisiert, mit Ultraschall behandelt (8 min, Puls: 50 %, Leistung: 5 W, 0 °C) und
abzentrifugiert (150 000 x g, 1,5 h, 4˚C) wurden.
3.5.2
Isolierung und Reinigung des Mtr-Komplexes aus M. marburgensis
Die Reinigung des Gesamtkomplexes (MtrA-H) und des Mtr-Komplexes ohne
Untereinheit MtrH (MtrA-G) wurde in abgewandelter Form nach Gärtner et al. (56)
durchgeführt (zur Übersicht siehe Abbildung 3.1). Alle chromatographischen
Reinigungsschritte erfolgten mit dem ÄKTA purifier™-System (GE Healthcare,
München) bei RT, wobei durch Absorptionsmessung bei 280 nm und 365 nm, dem
Absoptionsmaximums des Corrinoid-Cofaktors, detektiert wurde. Die Fraktionen
wurden mittels SDS-Page (siehe Abschnitt 3.4.2) auf ihren Gehalt an Mtr-Komplex
überprüft.
40
3 Methoden
Solubilisierte Membranen
↓
Ionenaustauschchromatographie:
DEAE-Sepharose
↓
Ionenaustauschchromatographie:
Q-Sepharose
↓
Gelfiltration:
Superose 6
Abbildung 3.1: Übersicht über die Reinigung des Mtr-Komplexes aus M. marburgensis.
Solubilisierung:
Die wie in Abschnitt 3.5.1 beschrieben präparierten Membranen wurden für den
Gesamtkomplex (MtrA-H) in 80 mL Solubilisierungspuffer 1 (50 mM MOPS/KOH
pH 7,0, 10 mL MgCl2, 2 mM DTT, 2,5 % LM), für den Komplex ohne Untereinheit
MtrH (MtrA-G) in 40 mL Solubilisierungspuffer 2 (50 mM TRIS/HCl pH 7,6, 2 mM
DTT, 2,5 % LM) aufgenommen, homogenisiert und über Nacht bei 4˚C inkubiert.
Durch Ultrazentrifugation (100 000 x g, 1,5 h, 4˚C) wurden verbliebene Membranteile
abgetrennt.
Ionenaustauschchromatographie mit DEAE-Sepharose:
Das Membransolubilisat (siehe vorheriger Abschnitt) wurde durch eine 0,2 µmMembran
filtriert
und
einer
Ionenaustauschchromatographie
auf
DEAE Sepharose™ FF (HR 16/10-Säule, CV: 19 mL) unterzogen. Eluiert wurde
durch graduelle Erhöhung der NaCl-Konzentration von 0-60 % Puffer B in 5 CV und
von 60-100 % Puffer B in 2 CV
bei einer die Flussrate von 0,5 mL/min
(Pufferlösungen wie folgt). Die Mtr enthaltenden Fraktionen wurden vereinigt.
Puffer A.1 (für MtrA-H):
50 mM MOPS/KOH pH 7,0, 100 mM NaCl, 2 mM DTT, 0,1 % LM
Puffer B.1 (für MtrA-H):
50 mM MOPS/KOH pH 7,0, 1 M NaCl, 2 mM DTT, 0,1 % LM
Puffer A.2 (für MtrA-G):
50 mM TRIS/HCl pH 7,6, 2 mM DTT, 0,1 % LM
Puffer B.2 (für MtrA-G):
50 mM TRIS/HCl pH 7,6, 1 M NaCl, 2 mM DTT, 0,1 % LM
41
3 Methoden
Ionenaustauschchromatographie mit Q-Sepharose:
Die vereinigten Fraktionen des vorherigen Abschnitts wurden mit der doppelten
Menge Puffer A.1 (für MtrA-H) bzw. Puffer A.2 (für MtrA-G) versetzt, und auf einem
stärkeren Anionentauscher (HiLoad™ 26/10 Q-Sepharose HP, CV: 53 mL) weiter
gereinigt. Für MtrA-H wurde hierfür ein Gradient von 0-100 % Puffer B.1 über 2 CV,
für MtrA-G von 0-100 % Puffer B.2 über 8 CV gewählt. Die Flussrate betrug
0,7 mL/min. Diejenigen Fraktionen, welche Mtr enthielten, wurden vereinigt.
Gelfiltration:
Die Proben vom vorherigen Abschnitt wurden auf maximal 1 mL eingeengt
(Konzentrator mit MWCO von 100 kDa), durch eine 0,2 µm-Membran filtriert und auf
Superose 6 (16/60-Säule, CV: 120 mL) mit Gelfiltrationspuffer 1 (50 mM MOPS/KOH
pH 7,0, 100 mM NaCl, 10 % (w/v) Glycerin, 2 mM DTT, 0,1 % LM) für MtrA-H und
Gelfiltrationspuffer 2 (50 mM TRIS/HCl pH 7,6, 100 mM NaCl, 2 mM DTT, 0,1 % LM)
für MtrA-G isokratisch über 1,2 CV mit einer Flussrate von 0,5 mL/min eluiert. Die als
Mtr-haltig identifizierten Proben wurden vereinigt und die Ausbeute mittels BradfordTest (siehe Abschnitt 3.4.1) bestimmt.
3.5.3
Reinigung von rekombinantem M. marburgensis MtrH (MMRMtrH)
Die gemäß Abschnitt 3.3.3 kultivierten E. coli-Bakterien wurden in 3 mL
Lysepuffer (50 mM Tris/HCl pH 8,0, 0,1 M NaCl, 1 mM EDTA pH 8,0) pro g
Bakterienfeuchtgewicht resuspendiert und nach Zugabe von 267 µg/mL Lysozym
und 67 µg/mL DNAse I 30 min bei RT inkubiert. Durch Ultraschallbehandlung
(15 min, Puls: 40 %, Leistung: 5 W, 0 °C) wurden die Zellen aufgeschlossen und die
Zellbruchstücke und Einschlusskörperchen abzentrifugiert (43 000
x g, 30 min,
4 °C). Diese wurden anschließend mit 5 ml Waschpuffer (50 mM MOPS/KOH pH 7,0,
100 mM NaCl, 2 mM DTT, 0,005 % LM) gewaschen und erneut zentrifugiert
(43 000 x g, 30 min, 4 °C).
Zur
Solubilisierung
der
Einschlusskörperchen
wurden
diese
in
1
mL
Entfaltungspuffer (50 mM MOPS/KOH pH 7,0, 5 M Guanidinhydrochlorid, 100 mM
NaCl, 2 mM DTT) aufgenommen und über Nacht unter Rühren bei 4 °C inkubiert.
Unlösliche Bestandteile wurden durch Zentrifugation (43 000 x g, 30 min, 4 °C)
abgetrennt.
Der Überstand wurde nun einer Gelfiltration auf Superdex 200 (Superdex 200
16/60 prep grade, CV: 120 mL) unterzogen, wobei mit 1,2 CV Entfaltungspuffer bei
4°C und einer Flussrate von 1 mL/min eluiert wurde. Die durch Absorption bei
42
3 Methoden
280 nm als proteinhaltig identifizierten Fraktionen wurden vereinigt und mit einem
Konzentrator mit einem MWCO von 10 kDa auf ca. 250 µL eingeengt.
Die Rückfaltung von MtrH wurde initiiert, indem die Proteinlösung langsam und
unter Rühren bei RT in 25 mL Rückfaltungspuffer (50 mM MOPS/KOH pH 7,0,
10 mM NaCl, 2 mM DTT, 0,05 % LM) getropft wurde. Nach Rühren über Nacht bei
RT wurde ausgefallenes Protein abzentrifugiert (43 000 x g, 30 min, 4 °C), der
Überstand mittels eines Konzentrators mit 10 kDa-Membran auf 1 mL eingeengt und
durch eine 0,2 µm-Membran filtriert.
Das rückgefaltete MtrH wurde nochmals einer Gelfiltration auf Superdex 200
(Superdex 200 16/60 prep grade, CV: 120 mL) mit 1,2 CV Rückfaltungspuffer bei
4°C, Flussrate 0,5 mL/min unterzogen. Detektiert wurde bei 280 nm. MtrH
enthaltende Fraktionen wurden durch SDS-Page identifiziert.
3.5.4
Reinigung von rekombinantem des-[225-246]-MtrA (MJMtrA3) aus
M. jannaschii
Die wie in Abschnitt 3.3.3 beschrieben angezogenen E. coli-Zellen wurden in
7,5 mL Lysepuffer (50 mM MOPS/KOH pH 7,0, 100 mM NaCl, 1 mM PMSF, 0,1 mM
Vitamin B12a) pro g Bakterienfeuchtgewicht resuspendiert und mit 267 µg/mL
Lysozym und 67 µg/mL DNAse I 30 min bei RT inkubiert. Anschließend wurde mittels
Ultraschallbehandlung (15 min, Puls: 50 %, Leistung: 5 W, 0°C) aufgeschlossen und
das Zelldebris durch Zentrifugation (43 000 x g, 30 min, 4 °C) entfernt. Weiterhin
wurden die Zellmembranen in einem Ultrazentrifugationsschritt (150 000 x g, 1 h,
4 °C) pelletiert.
Der Überstand (lösliche Fraktion) wurde nun für 30 min auf 70 °C erhitzt und
anschließend über Nacht auf 4 °C gekühlt, bis alle denaturierten E. coli-Proteine
ausgefallen waren. Diese wurden durch Ultrazentrifugation entfernt (150 000 x g, 1 h,
4 °C).
Zur weiteren Reinigung wurde der Überstand durch eine 0,45 µm-Membran
filtriert und auf einer mit Puffer A (50 mM MOPS/KOH pH 7,0) äquilibrierten
Q-Sepharose-Säule (HiLoad™ 26/10 Q-Sepharose HP, CV: 53 mL) einer
Ionenaustauschchromatographie bei RT unterzogen. Zur Elution wurde ein Gradient
von 0-100 % Puffer B (50 mM MOPS/KOH pH 7,0, 1 M NaCl) über 7 CV bei einer
Flussrate von verwendet. Detektiert wurde mittels Absorptionsmessung bei 280 nm
und 365 nm (Absorptionsmaximum von Vitamin B12a). Die laut SDS-Page MJMtrA3
enthaltenden Fraktionen wurden vereinigt.
43
3 Methoden
Nach Zugabe von Vitamin B12a bis zu einer Endkonzentration von 0,1 mM wurde
zur Entfernung von ungebundenem Vitamin B12a gegen 1 L Gelfiltrationspuffer
(50 mM MOPS/KOH pH 7,0, 100 mM NaCl, 10 % (w/v) Glycerin) über Nacht bei 4 °C
dialysiert.
Die Probe wurde sodann auf 1 mL eingeengt (Konzentrator mit 10 kDa MWCO),
durch eine 0,2 µm-Membran filtriert und in einer Gelfiltration auf Superdex 200
(Superdex 200 16/60 prep grade, CV: 120 mL) über 1,2 CV mit Gelfiltrationspuffer
isokratisch bei 4 °C und einer Flussrate von 0,5 mL/min eluiert. Die Detektion erfolgte
wiederum bei 280 nm und 365 nm. Nach einer SDS-Page zur Identifizierung von
Fraktionen, die MJMtrA3 enthielten, wurden diese vereinigt und einem Bradford-Test
unterzogen.
3.5.5
Reinigung und Rückfaltung von co-exprimierten des-[225-246]-MtrA und
MtrH (MJMtrA3+MJMtrH) aus M. jannaschii
Das wie in Abschnitt 3.3.3 beschrieben gewonnene E. coli-Zellpellet wurde in
3 mL Lysepuffer (50 mM Tris/HCl pH 8,0, 100 mM NaCl, 1 mM EDTA pH 8,0,
1 mM PMSF)
pro
g
Bakterienfeuchtgewicht
resuspendiert
und
mit
267 µg/mL Lysozym und 67 µg/mL DNAse I 30 min bei RT inkubiert. Nach dem
Ultraschallaufschluss (15 min, Puls: 50 %, Leistung: 5 W, 0 °C) wurde zentrifugiert
(43 000 rpm, 30 min, 4 °C), das Pellet in 1 mL Waschpuffer (50 mM MOPS/KOH pH
7,0, 100 mM NaCl, 0,05 % LM) resuspendiert und erneut zentrifugiert (13 000 x g,
30 min, 4 °C).
Die
Einschlusskörperchen
wurden
in
50
µL/mg
Entfaltungspuffer
(50 mM MOPS/KOH pH 7,0, 5 M Guanidinhydrochlorid, 100 mM NaCl, 2 mM DTT)
aufgenommen und bei 4 °C über Nacht unter Rühren inkubiert. Anschließend wurde
zentrifugiert (13 000 x g, 30 min, 4 °C) und der Überstand durch eine
0,2 µm-Membran filtriert.
Die Probe wurde nun einer Gelfiltration auf Superdex 200 (Superdex 200
PC 3.2/30, CV: 2,6 mL) mit 1,2 CV Entfaltungspuffer bei 4 °C und Flussrate
50 μL/min unterzogen.
Die laut Absorptionsmessung bei 280 nm proteinhaltigen Fraktionen wurden auf
500 µL (Konzentrator mit 10 kDa MWCO) eingeengt und unter Rühren langsam in
das 100-fache Volumen an Rückfaltungspuffer (50 mM MOPS/KOH pH 7,0,
100 mM NaCl, 0,01 mM Vitamin B12a, 0,5 % OG) getropft. Nach fortgesetztem
Rühren bei 4 °C über Nacht wurde die Lösung auf 1 mL (Konzentrator mit
10 kDa MWCO) konzentriert und durch eine 0,2 µm-Membran filtriert.
44
3 Methoden
Die rückgefaltete Proteine wurden wiederum einer Gelfiltration auf Superdex 200
(Superdex 200 PC 3.2/30, CV: 2,6 mL) bei 4 °C und Flussrate 50 μL /min
unterzogen. Es wurde mit 1,2 CV Gelfiltrationspuffer (50 mM MOPS/KOH pH 7,0,
100 mM NaCl, 0,5 % OG) eluiert und zur Detektion die Absorption bei 280 nm
gemessen, sowie die Fraktionen mittels SDS-Page analysiert.
3.5.6
Reinigung von rekombinantem des-[238-252]-MtrA mit C-terminalem
StrepII-Anhängsel (MKMtrA) aus M. kandleri
Die nach der Beschreibung in Abschnitt 3.3.3 gewonnenen E. coli-Zellen wurden
in 7,5 mL Lysepuffer (50 mM MOPS/KOH pH 7,0, 100 mM NaCl, 1 mM PMSF,
0,1 mM Vitamin B12a) pro g Bakterienfeuchtgewicht resuspendiert und mit 267 µg/mL
Lysozym und 67 µg/mL DNAse I 30 min bei RT inkubiert. Nach der
Ultraschallbehandlung (15 min, Puls: 50 %, Leistung: 5 W, 0 °C) wurde das
Zelldebris durch Zentrifugation (43 000 x g, 30 min, 4 °C) pelletiert und die
Zellmembranen aus dem Überstand durch Ultrazentrifugation (150 000 x g, 1 h, 4 °C)
entfernt.
Zur Fällung der E. coli-Proteine wurde der Überstand (lösliche Fraktion) zunächst
für 30 min auf 70 °C erhitzt, dann über Nacht auf 4 °C gekühlt. Denaturiertes Protein
wurden durch Ultrazentrifugation entfernt (150 000 x g, 1 h, 4 °C).
Der MKMtrA enthaltende Überstand wurde auf 500 µL konzentriert (Konzentrator
mit 10 kDa MWCO), durch eine 0,2 µm-Membran filtriert und auf eine mit Puffer W
(100 mM TRIS/HCl pH 8,0, 150 mM NaCl) äquilibrierte Strep-Tactin®-Säule
(Strep-Tactin® Spin Column, CV: 1 mL) aufgetragen. Es wurde nach Angaben des
Herstellers (IBA, Goettingen) nach viermaligem Waschen mit je 100 µL Puffer W mit
2 x 50 µL Puffer BE (100 mM TRIS/HCl pH 8,0, 150 mM NaCl, 2 mM D-Biotin) eluiert.
Die gewonnenen Proben wurden mittels Western Blot analysiert.
3.5.7
Reinigung von rekombinanter F420-abhängiger N5,N10-Methylen-H4MPTDehydrogenase (KMtd) aus M. kandleri
Die Reinigung der F420-abhängigen N5,N10-Methylen-H4MPT-Dehydrogenase
(KMtd) aus M. kandleri wurde wie bei Klein und Thauer (123) beschrieben von Frau
Ulrike Demmer am Max-Planck-Institut für Biophysik in Frankfurt durchgeführt.
Die Substrate H4MPT und Methenyl-H4MPT+ sowie das Cosubstrat F420 wurden
aus M. marburgensis-Zellen von Frau Johanna Moll am Max-Planck-Institut für
terrestrische Mikrobiologie in Marburg gereinigt (124, 125). Methylen-H4MPT
45
3 Methoden
entstand aus der spontanen Reaktion von H4MPT mit Formaldehyd und
anschließender Lyophilisierung. Chemisch synthetisiertes F0 wurde von Herrn Prof.
Dr. Thomas Carell (Fakultät für Chemie und Pharmazie, Ludwig-MaximiliansUniversität München) zur Verfügung gestellt.
3.6
Röntgenkristallographische Methoden
3.6.1
Kristallisation
Um die Proteinlösungen für die Kristallisation zu verwenden, wurde falls nötig ein
Pufferwechsel mittels Dialyse oder einer Entsalzungssäule (PD-10 Desalting
Column, GE Healthcare, München) durchgeführt und bis zu einer geeigneten
Proteinkonzentration eingeengt. Die eingesetzten Proteinlösungen sind in Tabelle 3.8
aufgeführt.
Alle
Kristallisationsversuche
wurden
mittels
Gasphasendiffusion
durchgeführt.
Tabelle 3.8: Für die Kristallisation verwendete Proteinlösungen.
Protein
Konzentration Puffer
Mtr(A-H) aus M. marburgensis
22 mg/mL
MJMtrA3
20-92 mg/mL
KMtd
15 mg/mL
50 mM MOPS/KOH pH 7,0
10 mM MgCl2
100 mM Ammoniumsulfat
10 % Glycerin
2 mM DTT
0,1 % LM
10-50 mM MOPS/KOH pH 7,0
0-100 mM NaCl
0-100 mM Ammoniumsulfat
2,5-20 % Glycerin
0-1 mM DTT
0-2 mM Vitamin B12a
10 mM MES pH 5,5
5 mM Methylen-H4MPT
bzw. 5 mM Methenyl-H4MPT+
1 mM F0 bzw. 5 mM F420
Zum Auffinden von initialen Kristallisationsbedingungen wurde die sitting dropMethode
in
Kristallisationsplatten
mit
96
Vertiefungen
verwendet.
Als
Reservoirlösung wurden 90-100 µL der kommerziell erhältlichen Sparse matrix
screens oder selbst entwickelte Screens eingesetzt. In den dafür vorgesehenen
Vertiefungen wurden je 0,2-1 µL Proteinlösung und Reservoirlösung gemischt, die
Platten mit Klebeband versiegelt und bei 4 °C oder 18 °C gelagert.
Zur Verfeinerung der erfolgreichen Bedingungen wurde die Hanging dropMethode in Kristallisationsplatten mit 24 Vertiefungen, die mit silanisierten
46
3 Methoden
Deckplättchen und Silikonfett abgedichtet wurden, verwendet. Das Volumen der
Reservoirlösung betrug hier 0,5-1 mL, der Tropfen bestand aus 1 µL Bodenlösung
und 1 µL Proteinlösung.
Die Co-Kristallisation von KMtd mit Substrat und Cosubstrat wurde von Frau
Ulrike Demmer (Max-Planck-Institut für Biophysik, Frankfurt) im Anaerobenzelt und
unter Rotlicht durchgeführt. Sämtliche Lösungen wurden dazu anaerobisiert und je
500 µL Reservoirlösung in Sitting drop-Kristallisationsplatten mit 24 Vertiefungen
gefüllt. Je 1 µL Reservoirpuffer wurde mit 1 µL Proteinlösung in den dafür
vorhergesehenen Vertiefungen gemischt, die Platten mit Klebeband verschlossen
und bei 20 °C gelagert.
Zum Einfrieren der Proteinkristalle vor der röntgenographischen Untersuchung
wurde zunächst das Auftreten von Eisringen im Streubild der mit verschiedenen
Glycerin-
oder
PEG-Konzentrationen
als
Frostschutzmittel
versetzten
Reservoirlösung überprüft. War die geringst mögliche Frostschutzmittelkonzentration
gefunden, wurden die Kristalle darin kurz inkubiert, mit einem passenden Cryo-loop
eingefangen und im laminaren Stickstoffstrom bei 100 K eingefroren. Bis zur
Messung wurden die Kristalle in flüssigem Stickstoff gelagert.
3.6.2
Datensammlung und -prozessierung
Sämtliche Daten zur Röntgenstrukturanalyse wurden am SLS (Synchrotron,
Villigen, Schweiz), Beamline PX02 gemessen. Die Rotation pro image betrug
standardmäßig 0,5° bei einer Wellenlänge von ca. 1 Å (12,3984 keV).
Die gesammelten Daten wurden mittels des Programms XDS prozessiert (99),
wobei
zunächst
die
möglichen
Bravais-Typen
bestimmt
und
die
Reflexe
entsprechend indiziert wurden. Die Raumgruppe konnte anhand der Statistiken für
die
jeweilige
Raumgruppe
sowie
die
Analyse
von
Auslöschungen
durch
Schraubenachsen bestimmt werden. Danach konnten die indizierten und integrierten
Reflexintensitäten mittels der Programme XSCALE und XDSCONV skaliert und
reduziert sowie die Friedel-Paare zusammengefasst werden.
Um die Anzahl von Monomeren pro asymmetrischer Einheit voraussagen zu
können, wurde der Matthews-Koeffizient VM nach Gleichung 3.2 mit dem Programm
MATTHEWS_COEFF (ccp4-suite) berechnet. Werte von n, für die VM zwischen
1,7 Å3/Da und 3,5 Å3/Da liegt, entsprechen nach Gleichung 3.3 einem Solvensgehalt
von 27-65 %. Laut statistischen Untersuchungen liegt der Solvensgehalt von
Proteinkristallen am häufigsten bei 43 % und der VM somit bei 2,2 Å3/Da (126). Werte
von n, für die VM nahe dem statistischen Maximum liegt, sind somit wahrscheinlich.
47
3 Methoden
VM =
VZ
n⋅ z ⋅Mr
Gleichung 3.2
1,23
VM
Gleichung 3.3
VSolv = 1 −
VM: Matthews-Koeffizient
Vz: Volumen der Elementarzelle
n: Anzahl der Moleküle pro
asymmetrische Einheit
z: Anzahl der asymmetrischen
Einheiten pro Elementarzelle
Mr: Molekulargewicht
VSolv: Solvensgehalt
3.6.3
Lösung des Phasenproblems
Da für die in dieser Arbeit vorgestellte Proteinstruktur bereits ein hinreichend
gutes Modell vorlag, konnte zur Lösung des Phasenproblems die Methode des
molekularen Ersatzes angewendet werden. Dazu wurde das im Programmpaket
ccp4-suite enthaltene Programm AMoRe
benutzt (88, 127). Die mittels der
Patterson-Funktion P(uvw) (siehe Gleichung 3.4) aus den Quadraten der
Strukturfaktoramplituden
F(hkl)
Differenzvektoren
und
u,
v,
durch
w
der
Fourier-Transformation
Elektronendichteverteilung
berechneten
können
als
urpsrungszentrierte Abstandsvektoren aufgrund ihres Betrags in Selbstvektoren
(Länge 0), kurze intramolekulare Vektoren und lange intermolekulare Vektoren
eingeteilt werden.
P (uvw) = ∑ F (hkl ) ⋅ e −2πi ( hu +kv+lw)
2
Gleichung 3.4
hkl
uvw: Differenzvektor der Elektronendichte
│F(hkl)│: Strukturfaktoramplitude
Liegt nun ein geeignetes Modell vor, können dessen intramolekularen Vektoren
berechnet, verglichen und in einem Algorithmus durch eine entsprechende
Rotationsfunktion zu einer übereinstimmenden Orientierung gebracht werden. Mit der
aus der Indizierung erhaltenen Kristallsymmetrie können nun die intermolekularen
Vektoren verglichen und durch eine Translationsfunktion ebenfalls angepasst
werden. In einem Verfeinerungsschritt kann die Positionierung des Modells und die
Anpassung an die beobachteten Daten weiter verbessert werden. Die Berechnung
der Strukturfaktoren Fcalc und der entsprechenden Phasen aus dem Modell sowie die
48
3 Methoden
beobachteten Strukturfaktoren aus den Messdaten Fobs ermöglichen die Erstellung
von Elektronendichtekarten.
3.6.4
Modellbau und Verfeinerung
Zum Modellbau wurde in dieser Arbeit das Grafikprogramm Coot benutzt (89), bei
dem anhand des Vergleichs der (2Fobs – Fcalc)-Elektronendichtekarte, die eine
Hüllfunktion des Modells darstellt, mit der Differenz-Fourierkarte (Fobs – Fcalc), die die
Unterschiede zwischen dem Modell und den gemessenen Daten anzeigt, eine
manuelle Anpassung des zuvor erstellten groben Modells vorgenommen wurde. Das
neue, verbesserte Modell floss dann in die Verfeinerung mit dem Programm
REFMAC ein (128), bei dem mittels Minimierung der Atomkoordinaten und des BFaktors
sowie
durch
die
Einführung
von
NCS-restraints
eine
neue
Elektronendichtekarte berechnet wurde, welcher wiederum im nächsten Schritt in
Coot das Modell angepasst wurde. In mehreren Durchgängen wurde sich so Schritt
für Schritt der tatsächlich vorliegenden Struktur angenähert.
Für die Substrate Methylen-H4MPT und Methenyl-H4MPT+ sowie das Cosubstrat
F420 wurden zunächst separat mit dem Programm PRODRG Modelle berechnet und
manuell angeglichen (97). Diese wurden sodann in Coot in die DifferenzFourierkarten modelliert und ebenfalls der schrittweisen Verfeinerung mittels
REFMAC und Coot unterzogen.
3.6.5
Validierung von Proteinstrukturen
Um den Fortschritt der Verfeinerung und die Qualität der vorliegenden Struktur zu
beurteilen, wurden die in REFMAC angegebenen R-Faktoren beobachtet (siehe
Gleichung 3.5 und 3.6).
Rcryst =
∑F
obs
hkl
(hkl ) − k ⋅ Fcalc (hkl )
∑F
obs
Gleichung 3.5
(hkl )
hkl
49
3 Methoden
R free =
∑F
obs
hkl∈T
Gleichung 3.6
(hkl ) − k ⋅ Fcalc (hkl )
∑F
hkl∈T
obs
(hkl )
│Fobs(hkl)│: Strukturfaktoramplitude aus den
Messdaten
│Fcalc(hkl)│: Berechnete Strukturfaktoramplitude des
Modells
k: Auflösungsabhängiger Skalierungsfaktor
Rcryst ist hierbei ein Maß für die Übereinstimmung des Strukturmodells mit den
Messwerten. Rfree wird analog berechnet, jedoch ohne Einbeziehung eines zufällig
ausgewählten Testdatensatzes von 5 % der Reflexe, der nur zur Validierung des
Modells verwendet wird (129).
Darüber hinaus wurden in Coot die Bindungswinkel und -längen, die Rotamere
der Seitenketten im Vergleich zu Standardwerten und die RamachandranTorsionswinkel überprüft. Ein dreidimensionaler Vergleich von Proteinstrukturen
wurde mittels des Programms DALI durchgeführt (90, 91).
3.6.6
Strukturdarstellung
Für
die
Erstellung
von
Abbildungen
der
Strukturmodelle
wurde
das
Grafikprogramm PyMOL verwendet. Um auch Elektronendichte anzeigen zu können,
wurde mit REFMAC eine entsprechende Datei im mtz-Format erstellt, diese in
PyMOL eingelesen und so modifiziert, dass nur der für die Abbildung relevante Teil
zu sehen war.
3.7
Elektronenmikroskopische Einzelpartikelmessung
3.7.1
Probenvorbereitung
Sämtliche elektronenmikroskopische Untersuchungen wurden von Frau Dr. Dilem
Hizlan, Frau Dr. Janet Vonck und Frau Ming Yang am Max-Planck-Institut für
Biophysik in Frankfurt durchgeführt.
Beim Verfahren mit Negativfärbung wurde die auf ein Trägernetz aufgetragene
Probe des Mtr-Komplexes (MtrA-H) mit 1 % Uranylacetat als Kontrastmittel versetzt
und luftgetrocknet. Das Kontrastmittel bildet um die Probenpartikel eine amorphe,
vom Elektronenstrahl nicht durchdringbare Schicht, sodass die Partikel in der
elektronenmikroskopischen Untersuchung hell vor dunklem Hintergrund erscheinen.
50
3 Methoden
Zur Vorbereitung für die Messung unter Cryo-Bedingungen wurden 3 µL der
Probe (MtrA-H; 0,8 mg/mL in 20 mM MOPS/KOH pH 7,0, 10 mM MgCl2, 0,05 % LM,
1 mM DTT) für 30 s auf ein beglimmtes (ionisiertes) Karbongitter (Quantifoil Micro
Tools, Jena) aufgetragen. Nach Entfernen der überschüssigen Flüssigkeit wurden
diese in flüssigem Ethan (-180 °C) schockgefroren.
3.7.2
Datensammlung und -prozessierung
Das Negativfärbungsverfahren wurde dazu verwendet, die Qualität der
Probenpräparation, z. B. deren Homogenität, zu beurteilen. Die Datensammlung für
die Einzelpartikelmessungen geschah dann unter Cryo-Bedingungen. Die Bilder
wurden mit einem Philips CM120 Elektronenmikroskop (Philips, Hamburg) bei 120 V
und geringer Strahlendosis mit 44 000-facher Vergrößerung auf einem Kodak
SO-163 Electron Emulsion Film (Eastman Kodak Company, Rochester, USA)
aufgenommen, welcher mit einem Kodak D-19 Entwickler (Eastman Kodak
Company, Rochester, USA) für 12 min entwickelt wurde. Die Negative wurde mittels
eines Zeiss SCAI Scanners (Carl Zeiss, Jena) mit einer Pixelgröße von 7 µm
eingelesen. Benachbarte Pixel wurden gemittelt, sodass die Probe schlussendlich
mit einer Pixelgröße von 3,18 Å erfasst wurde.
3.7.3
Datenanalyse und Rekonstruktion
Zur Auswahl der Partikel wurde das Programmpaket EMAN verwendet (130). Die
CTF (Kontrast-Transfer-Funktion) wurde mit CTFFIND3 berechnet und mit dem
Programm
ctfit
des
EMAN-Programmpakets
einberechnet
(131).
Für
die
Rekonstruktion wurden 7380 Einzelpartikel einbezogen. Die Klassensummen für
Abbildung 4.8a wurden mit dem Programm IMAGIC (Image Science Software, Berlin)
erstellt.
51
4 Ergebnisse
4 Ergebnisse
4.1
Planung und Herstellung der Vektorkonstrukte
4.1.1
Sekundärstrukturanalyse
zur
Planung
der
Konstrukte
MJmtrA1,
MJmtrA2 und MJmtrA3
Vor der Planung der Vektorkonstrukte zur rekombinanten Erzeugung von
Untereinheit MtrA aus M. jannaschii wurde eine Sekundärstrukturanalyse mit Hilfe
der Programme PredictProtein und SOSUI durchgeführt. Basierend auf der PHDMethode, die PredictProtein verwendet, wurde eine die achtzehn C-terminalen
Aminosäurereste (AS 228-245) umfassende Transmembranhelix identifiziert. Durch
SOSUI ergab sich davon abweichend eine C-terminale Transmembranhelix von 22
Aminosäureresten (AS 224-245). Daraufhin wurden drei verschiedene Konstrukte,
zum einen zur vollständigen Expression (MJmtrA1), zum anderen um die
Hydrophobizität des Proteins zu senken zur Expression zweier verkürzter Proteine
MJmtrA2 (achtzehn C-terminale AS fehlen) und MJmtrA3 (22 C-terminale AS fehlen),
angefertigt.
4.1.2
Sequenzvergleich zur Planung der Konstrukte MKmtrH1 und MKmtrH
Für die Produktion von M. kandleri MtrH in E. coli wurden zwei verschiedene
Vektorkonstrukte hergestellt. Das eine enthielt eine vollständig Version des Gens
(pCHis_tet(mtrH1) bzw. MKmtrH1), im zweiten wurde das Gen um die für die elf
N-terminalen Aminosäuren codierenden Basenpaare verkürzt (pCHis_tet(mtrH2)
bzw. MKmtrH2). Diese Verkürzung wurde vorgenommen, da ein Sequenzvergleich
von MtrH aus M. marburgensis, M. jannaschii und M. kandleri mit der
5-Methyltetrahydrofolat
Corrinoid/Eisen-Schwefel-Protein
Methyltransferase
aus
Moorella thermoacetica (Clostridium thermoaceticum), die ebenfalls Pterin bindet und
deren Kristallstruktur bereits vorliegt (RCSB-Proteindatenbankeintrag 1F6Y) (132),
zeigte, dass bei ansonsten großer Sequenzhomologie der Hauptunterschied aus
jenen bei M. thermoacetica fehlenden 11 N-terminalen Aminosäuren bestand (siehe
Abbildung 4.1). Außerdem wurde den Konstrukten MKmtrH1 und MKmtrH2 jeweils
ein C-terminales His6-Affinitätspeptid angehängt.
52
4 Ergebnisse
Abbildung 4.1: Sequenzvergleich der Untereinheit MtrH der N5-Methyl-H4MPT:Coenzym M-
Methyltransferase (MtrH) aus M. marburgensis (MMR), M. jannaschii (MJ) und M. kandleri
(MK) mit der Pterin bindenden 5-Methyltetrahydrofolat Corrinoid/Eisen-Schwefel-Protein
Methyltransferase
aus
Moorella
thermoacetica
(Q46389_MOOTH).
Identische
Aminosäurereste sind mit * gekennzeichnet, ähnliche mit Punkt und Doppelpunkt.
4.1.3
Herstellung der Vektorkonstrukte
Die in Tabelle 3.1 (siehe Abschnitt 3.1) aufgeführten Vektorkonstrukte wurden
wie im Abschnitt 3.2 beschrieben hergestellt und das jeweilige Ergebnis anhand
einer Sequenzierung überprüft (siehe Anhang, Abschnitt 7.4). Vektorkarten der in
dieser Arbeit verwendeten Plasmide sind ebenfalls im Anhang (Abschnitt 7.2) zu
finden.
53
4 Ergebnisse
4.2
N5-Methyl-H4MPT:Coenzym
Der
M
Methyltransferasekomplex
aus
M. marburgensis
4.1.4
Isolierung und Reinigung
Membranpräparation und Solubilisierung:
Für die Reinigung des Gesamtkomplexes MtrA-H wurden die M. marburgensisZellen
wie
in
Abschnitt
3.5.1
beschrieben
im
Hochdruckhomogenisator
aufgeschlossen. Dadurch konnte der Anteil an vollständigem, Untereinheit MtrH
enthaltendem Komplex in der Membranfraktion erhöht werden. Wie hoch dieser
Anteil war, konnte jedoch erst nach dem ersten säulenchromatographischen
Reinigungsschritt anhand einer Analyse mittels SDS-Page der hierbei gesammelten
Fraktionen bestimmt werden (siehe folgender Abschnitt). Um erwähnten Anteil zu
erhöhen, wurden neben unterschiedlichen Aufschlussmethoden auch verschiedene
Pufferlösungen zur Membranpräparation und Solubilisierung getestet. Die pH-Werte
wurden zwischen 4,0 und 7,0, der NaCl-Gehalt von 0-2 M variiert und LM wurde
gegen 2,5 % (w/v) CHAPS ausgetauscht. Es zeigte sich jedoch, dass dadurch kaum
Einfluss auf den Gehalt der Fraktionen an MtrH genommen werden konnte, woraus
geschlossen wurde, dass dieser vor allem vom möglichst schonenden Zellaufschluss
abhängig war.
Dies wurde sich im Umkehrschluss bei der Reinigung des Komplexes MtrA-G
ohne Untereinheit MtrH zunutze gemacht, indem die Zellen mittels Ultraschall
aufgeschlossen und die aus dem Lysat abgetrennten Membranen bei insgesamt
zwei Waschschritten wiederum mit Ultraschall behandelt wurden (siehe Abschnitt
3.5.1). Durch diese Vorgehensweise bei der Membranpräparation wurde Untereinheit
MtrH bereits größtenteils aus dem Komplexverband gelöst, wie sich nach der
Analyse
der
bei
der
Ionenaustauschchromatographie
auf
DEAE-Sepharose
gesammelten Fraktionen und der vollständig gereinigten Proben zeigte (siehe
folgender Abschnitt).
Sowohl MtrA-H als auch MtrA-G wurden schließlich mit 2,5 % LM solubilisiert und
die restlichen Membranteile durch Ultrazentrifugation abgetrennt.
54
4 Ergebnisse
Ionenaustauschchromatographie mit DEAE-Sepharose:
Für
den
ersten
Membransolubilisat
chromatographischen
(siehe
vorheriger
Reinigungsschritt
Abschnitt)
auf
wurde
den
das
schwachen
Anionenaustauscher DEAE Sepharose™ FF aufgetragen. Der Gesamtkomplex
(MtrA-H) wurde bei 306-404 mM NaCl (23-34 % Puffer B.1) eluiert, der Komplex
ohne Untereinheit MtrH (MtrA-G) bei 300-400 mM NaCl (30-40 % Puffer B.2) (siehe
Abbildung 4.2).
Bei der Reinigung des Gesamtkomplexes MtrA-H erhielt man zunächst einige
Fraktionen, die der zur Analyse durchgeführten SDS-Page zufolge zwar den
Komplex, jedoch im Vergleich zu den anderen Untereinheiten nur geringe Mengen
der 34 kDa-Untereinheit MtrH enthielten. Diesen folgten mehrere Fraktionen mit dem
vollständigen, MtrH enthaltenden Komplex. Schließlich nahm der Gehalt an MtrA-H
ab und stattdessen traten diverse Verunreinigungen hinzu (siehe SDS-Page,
Abbildung 4.2).Bei der Vereinigung der Fraktionen galt es einen Kompromiss zu
schließen zwischen der Menge an Gesamtkomplex einerseits und der Reinheit der
Proben andererseits. Die Fraktionen mit geringerem Gehalt an Untereinheit MtrH
wurden bei diesem ersten Reinigungsschritt mit vereinigt, da das Vorliegen eines
Gleichgewichts zwischen dem Gesamtkomplex MtrA-H auf der einen Seite und
Komplex
MtrA-G
plus
lösliche
Untereinheit
MtrH
auf
der
anderen
nicht
ausgeschlossen werden konnte und eine weitere Dissoziation so gering wie möglich
gehalten werden sollte.
Um den Anteil an Fraktionen mit dem vollständigen Komplex MtrA-H zu erhöhen,
wurden auch bei der Ionenaustauschchromatographie auf DEAE-Sepharose
verschiedene Pufferzusammensetzungen zur Bindung und Elution getestet. Die
pH-Werte wurden ebenfalls zwischen 4,0 und 7,0 sowie der NaCl-Gehalt von Puffer
A.1 zwischen 0 mM und 450 mM variiert. Es zeigte sich jedoch, dass die Versuche
die Bindung von MtrH an den restlichen Komplex MtrA-G kaum veränderten, woraus
geschlossen wurde, dass letztere vor allem von der Membranpräparation abhängig
war.
Bei der säulenchromatographischen Reinigung auf DEAE-Sepharose des
Komplexes MtrA-G ohne Untereinheit MtrH wurden dagegen so gut wie keine
Fraktionen mit MtrH eluiert (siehe Abbildung 4.2) und alle MtrA-G enthaltenden
Faktionen wurden vereinigt.
55
4 Ergebnisse
DEAE Sepharose MtrA-H
100
Absorption 280nm/[mAU]
1600
280 nm
Puffer B.1
Fraktionen
mit MtrA-H
1400
1200
80
60
1000
800
40
600
400
Puffer B.1/[%]
1800
20
200
0
0
138
188
238
Elutionsvolumen/[mL]
DEAE Sepharose MtrA-G
1600
100
280 nm
Puffer B.2
Fraktionen
mit MtrA-H
1200
1000
80
60
800
40
600
400
Puffer B.2/[%]
1400
Absorption 280 nm/[mAU]
288
20
200
0
0
84
134
184
234
Elutionsvolumen/[mL]
284
Abbildung 4.2: Elutionsprofile und Coomassie-gefärbte SDS-Pages der zugehörigen
Fraktionen der Ionenaustauschchromatographie auf DEAE-Sepharose des vollständigen
Komplexes MtrA-H und des Komplexes MtrA-G ohne die 34 kDa-Untereinheit MtrH. In Bahn 1
der SDS-Page ist eine Fraktion mit wenig MtrH zu sehen, in Bahn 2 befindet sich der
vollständige Komplex MtrA-H, in Bahn 3 nimmt der Anteil an Verunreinigungen im Bereich
zwischen 83 und 40 kDa neben dem Komplex MtrA-H zu. In Bahn 4 ist die Probe einer
Fraktion nach dem modifizierten Reinigungsprotokoll zu sehen. Der Komplex besteht nur aus
den Untereinheiten MtrA-G. Bei der dicken Bande bei ca. 30 kDa handelt es sich nicht um
MtrH (siehe MALDI-Analyse, Abschnitt 4.2.2)
56
4 Ergebnisse
Ionenaustauschchromatographie mit Q-Sepharose:
Die vereinigten Fraktionen des vorherigen Abschnitts wurden einer weiteren
Chromatographie
auf
einem
starken
Anionentauscher
(Q-Sepharose
HP)
unterzogen. Der Gesamtkomplex (MtrA-H) wurde bei 748-829 mM NaCl (72-81 %
Puffer B.1) eluiert, der Komplex ohne Untereinheit MtrH (MtrA-G) bei 530-590 mM
NaCl (53-59 % Puffer B.2) (siehe Abbildung 4.3).
Nach Analyse der erhaltenen Fraktionen mittels SDS-Page zeigte sich beim
Gesamtkomplex MtrA-H, dass nach diesem Reinigungsschritt wiederum einige
Fraktionen auftraten, die zwar den Komplex jedoch nur geringe Mengen an
Untereinheit MtrH enthielten. Diese wurden verworfen. Diejenigen Fraktionen, welche
MtrA-H enthielten, wurden vereinigt.
Bei der Reinigung von MtrA-G traten dagegen nur Fraktionen mit sehr wenig
MtrH
auf
und
alle
den
Restkomplex
enthaltende
Fraktionen
konnten
zusammengeführt werden.
Q Sepharose MtrA-H
100
280 nm
365 nm
Puffer B.1
600
500
80
60
400
300
40
200
Puffer B.1/[%]
Absorption 280 nm/[mAU]
700
20
100
0
0
170
220
270
320
370
Elutionsvolumen/[mL]
Q Sepharose MtrA-G
100
280 nm
365 nm
Puffer B.2
600
500
80
60
400
300
40
Puffer B.1/[%]
Absorption 280 nm/[mAU]
700
200
20
100
0
0
170
220
270
320
370
Elutionsvolumen/[mL]
420
470
Abbildung 4.3: Elutionsprofile und Coomassie-gefärbte SDS-Pages der zugehörigen
Fraktionen der Ionenaustauschchromatographie auf Q-Sepharose der Mtr-Komplexe mit und
ohne Untereinheit MtrH. Auf Bahn 1 der SDS-Page ist der vollständigen Komplexes MtrA-H,
auf Bahn 2 ist der Komplexes MtrA-G mit sehr geringem Gehalt an Untereinheit MtrH (34 kDa)
nach dem zweiten Reinigungsschritt zu sehen.
57
4 Ergebnisse
Präparative Gelfiltration:
Als letzter Reinigungsschritt wurde mit den jeweils vereinigten Fraktionen der
Ionenaustauschchromatographie auf Q-Sepharose eine Gelfiltration durchgeführt.
Hierbei konnten einige niedermolekulare Verunreinigungen und ein nicht Basisliniengetrennter Peak bei ca. 350 kDa abgetrennt werden sowie Proteinkomplex MtrA-H in
den für die Lagerung bei -80 °C geeigneten Gelfiltrationspuffer mit 10 % (w/v)
Glyceringehalt überführt werden. Die MtrA-H (66-77 mL; ca. 670 kDa) bzw. MtrA-G
(63-80 mL; ca. 640 kDa) enthaltenden Fraktionen wurden vereinigt (siehe
Abbildung 4.4) und die Ausbeute auf 3-7 mg pro 60 g Bakterienfeuchtgewicht für
MtrA-H bzw. 8 mg pro 60 g Bakterienfeuchtgewicht für MtrA-G mittels Bradford-Test
bestimmt. MtrA-H war bei -80 °C mehrere Wochen stabil, wie durch analytische
Gelfiltration gezeigt werden konnte.
Superose 6 MtrA-H
18
280 nm
365 nm
295
16
~ 670 kDa
14
Fraktionen mit MtrA-H
245
12
10
195
8
145
6
95
~ 350 kDa
4
2
45
0
-5
Absorption 365 nm/[mAU]
Absorption 280 nm/[mAU]
345
-2
0
20
40
60
80
100
120
Elutionvolumen/[mL]
Superose 6 MtrA-G
195
33
~ 640 kDa
280 nm
365 nm
Fraktionen mit
MtrA-G
245
28
23
18
145
~ 350 kDa
95
13
8
45
Absorption
365 nm/[mAU]
Absorption 280 nm/[mAU]
295
3
-5
-2
0
20
40
60
80
100
120
Elutionvolumen/[mL]
Abbildung 4.4: Elutionsprofile und Coomassie-gefärbte SDS-Pages nach der Gelfiltration
der Mtr-Komplexe mit und ohne Untereinheit MtrH auf Superose 6. Es wurden jeweils nur die
zum Hauptpeak bei 670 kDa bzw. 640 kDa gehörenden Fraktionen vereinigt. Auf Bahn 1 der
SDS-Page ist der vollständige, gereinigte Komplex MtrA-H zu sehen. Auf Bahn 2 wurde der
Komplex MtrA-G mit nur sehr wenig MtrH (34 kDa) nach dem letzten Reinigungsschritt
aufgetragen. Die unidentifizierte Bande bei ca. 30 kDa konnte nicht abgetrennt werden.
58
4 Ergebnisse
4.2.2
Charakterisierung
Molekulargewichtsbestimmung:
Das Molekulargewicht des isolierten Gesamtkomplexes MtrA-H wurde bestimmt,
um eine Aussage über den oligomeren Zustand treffen zu können. Dazu wurden
verschiedene Methoden verwendet, die zum Teil zu unterschiedlichen Ergebnissen
führten (siehe Tabelle 4.1). Bei sämtlichen präparativen und analytischen
Gelfiltrationen zeigte sich neben einem Hauptpeak bei 670-770 kDa eine Schulter
von 300-400 kDa (siehe Abbildung 4.4). Bei der Analyse der entsprechenden
Fraktionen mittels SDS-Page konnte jedoch kein Unterschied zum Hauptpeak
festgestellt werden. Durch Blaue Native Gelelektrophorese (BN-Page) wurde das
Molekulargewicht auf ca. 300 kDa bestimmt (siehe Abbildung 4.5). Durch eine
analytische Ultrazentrifugation des Gesamtkomplexes MtrA-H, welche von Dr. Vitali
Vogel (Institut für Biophysik, Johann Wolfgang Goethe-Universität Frankfurt)
durchgeführt wurde, ergab sich ein Molekulargewicht von 620 kDa. Bei der von
Dr. Dilem Hizlan (Max-Planck-Institut für Biophysik, Frankfurt) durchgeführten
elektronenmikroskopischen Einzelpartikelmessung konnte das Molekulargewicht
anhand der Größe des Komplexes auf ca. 600 kDa geschätzt werden.
Das mit Hilfe der Aminosäuresequenzen der Untereinheiten berechnete
Molekulargewicht des Tetramers eines Heterooktamers liegt bei 672 kDa, womit der
Hauptpeak der Gelfiltration sowie die Ergebnisse der Analytischen Ultrazentrifugation
und der elektronenmikroskopischen Einzelpartikelmessung übereinstimmen. Das
berechnete Molekulargewicht des Dimers eines Heterooktamers liegt bei 336 kDa.
Mit diesem Wert decken sich der in der Gelfiltration auftretende Schulterpeak und
das Ergebnis der BN-Page.
Tabelle 4.1: Übersicht über das mit verschiedenen Methoden bestimmte Molekulargewicht des Gesamtkomplexes MtrA-H.
Methode
Berechnete Werte
Gelfiltration
BN-Page
Analytische
Ultrazentrifugation
Elektronenmikroskopische
Einzelpartikelmessung
Dimer eines
Heterooktamers
336 kDa
Schulter bei 300-400 kDa
300 kDa
Tetramer eines
Heterooktamers
672 kDa
670-770 kDa
620 kDa
600 kDa
59
4 Ergebnisse
Abbildung 4.5: Coomassie-gefärbte Blaue Native Page zur Molekulargewichtsbestimmung
des Gesamtkomplexes MtrA-H. Auf Bahn 1 sind die zur Größenabschätzung aufgetragenen
Eichproteine zu sehen, auf Bahn 2 der Komplex MtrA-H. Dessen Molekulargewicht liegt nach
dieser Methode bei ca. 300 kDa.
Abtrennung der Untereinheit MtrH vom Gesamtkomplex MtrA-H:
Neben der in Abschnitt 4.2.1 beschriebenen Entfernung von MtrH während der
Membranpräparation wurde auch eine Abtrennung vom bereits gereinigten
Gesamtkomplex versucht. Dazu wurden eine Verschiebung des pH-Wertes, eine
Anzahl
von
Detergenzien,
eine
Hitzebehandlung
und
Pufferlösungen
mit
unterschiedlichem NaCl-Gehalt getestet (siehe Tabelle 4.2). Die Proben wurden
mehrfach mit der jeweiligen Pufferlösung verdünnt und mittels eines Konzentrators
mit 100 kDa-Membran eingeengt. Der Austausch des Detergenz geschah anhand
einer PD-10-Säule. Die Proben wurden anschließend per SDS-Page oder
Gelfiltration auf Superose 6 analysiert.
Durch die angewendeten Methoden war es nicht möglich, MtrH abzutrennen und
gleichzeitig den restlichen Komplex MtrA-G stabil zu halten. Entweder blieb der
Gesamtkomplex MtrA-H bestehen, oder es kam bei zu harschen Bedingungen zur
Bildung von höhermolekularen Aggregaten bzw. zur Präzipitation des Proteins.
60
4 Ergebnisse
Tabelle 4.2: Übersicht über die verschiedenen Methoden und Pufferbedingungen zur
Abtrennung der Untereinheit MtrH vom gereinigten Gesamtkomplex.
Methode
pH-Wert
Bedingung
5,0
7,0
7,4
8,5
9,5
1 % (v/v) Triton X100
40 mM OG
2 % (v/v) LDAO
2 % (w/v) Cholat
42
50
55
60
100
200
500
1000
2000
Detergenz
Hitzebehandlung/[°C]
Salzgehalt/[mM]
ESI-MS-Analyse des Mtr-Komplexes:
Eine ESI-MS-Analyse der zu den verschiedenen Untereinheiten des MtrKomplexes gehörenden Banden im SDS-Gel wurde von Herrn Dr. Julian Langer am
Max-Planck-Institut für Biophysik in Frankfurt durchgeführt. Die entsprechenden
Banden
wurden
aus
einem
SDS-Polyacrylamidgel
ausgeschnitten
(siehe
Abbildung 4.4) und das Masse-Ladungs-Verhältnis der Peptidfragmente nach einem
Trypsin-Verdau bestimmt. Anhand eines Vergleichs dieses Spektrums mit einer
Datenbank wurde die oberste Bande bei ca. 33 kDa als Untereinheit MtrH des MtrKomplexes aus M. marburgensis identifiziert. Bei den Präparationen des MtrKomplexes ohne Untereinheit MtrH (MtrA-G) konnte diese Bande nicht identifiziert
werden. Es ist jedoch aufgrund der Ergebnisse des Western Blots mit
Anti-M. marburgensis
MtrH-Antikörpern
(siehe
folgender
Abschnitt)
davon
auszugehen, dass es sich bei der besagten Bande auch um MtrH handelt. Die
anderen Untereinheiten des Mtr-Komplexes konnten vermutlich aufgrund ihrer
Hydrophobizität mittels ESI-MS nicht nachgewiesen werden.
61
4 Ergebnisse
Western Blot mit Anti-M. marburgensis MtrH-Antikörpern:
Der vollständig gereinigte Mtr-Komplex mit Untereinheit MtrH (MtrA-H) sowie der
nach dem in dieser Arbeit neu etablierten Protokoll gereinigte Mtr-Komplex ohne
Untereinheit MtrH (MtrA-G) (siehe Abschnitte 3.5.1 und 3.5.2) wurden per SDS-Page
elektrophoretisch in ihre einzelne Untereinheiten aufgetrennt (siehe Abschnitt 3.4.2).
Die aufgetrennten Peptide wurden sodann auf eine PVDF-Membran übertragen und
die Untereinheit MtrH per direktem ELISA mit Anti-M. marburgensis MtrH-Antikörpern
(primäre
Antikörper)
Phosphatase-Konjugat
und
Anti-Kaninchen
(sekundäre
IgG
Antikörper)
F(ab’)2-Fragment-Alkalische
durch
eine
Farbreaktion
nachgewiesen (siehe Abschnitt 3.4.4).
Wie in Abbildung 4.6 zu sehen, ist beim vollständigen Mtr-Komplex mit MtrH
(MtrA-H) eine deutliche Bande bei ca. 33 kDa zu sehen, bei der es sich aufgrund der
Farbreaktion um MtrH handeln muss. Bei der Präparation des Mtr-Komplexes ohne
Untereinheit MtrH (MtrA-G) ist diese Bande nur sehr schwach ausgeprägt, d. h. eine
Abtrennung der Untereinheit MtrH ist bis auf einen äußerst geringen Restgehalt so
gut wie vollständig gelungen.
Abbildung 4.6: Western Blot mit Anti-M. marburgensis MtrH-Antikörpern nach Auftrennung
der Untereinheiten der gereinigten Mtr-Komplexe mit und ohne Untereinheit MtrH auf einem
12 %-igen SDS-Gel. Es wurden jeweils 2 µg gereinigtes Protein eingesetzt. Auf Bahn 1 wurde
der vollständige Mtr-Komplex mit Untereinheit MtrH (MtrA-H) aufgetragen. MtrH erscheint als
deutliche Bande bei ca. 33 kDa. Auf Bahn 2 wurde der Mtr-Komplex nach der Präparation
ohne Untereinheit MtrH aufgetrennt. Die 33 kDa-Bande von MtrH ist nur schwach sichtbar,
eine Abtrennung von MtrH während der Reinigung ist also weitgehend gelungen.
62
4 Ergebnisse
4.2.3
Kristallisation
Für die Kristallisationsversuche des Gesamtkomplexes MtrA-H lag dieser im
Kristallisationspuffer (50 mM MOPS/KOH pH 7,0, 10 mM MgCl2, 100 mM
Ammoniumsulfat, 10 % (w/v) Glycerin, 2 mM DTT, 0,1 % LM) mit einer Konzentration
von 22 mg/mL vor. Es wurde nach der sitting drop-Methode in Kristallisationsplatten
mit 96 Vertiefungen verfahren. Als Reservoirlösung wurden je 100 µL der
JB-Screens 1-10 eingesetzt. Pro Ansatz wurden je 0,3 µL Proteinlösung und
Reservoirlösung gemischt und die Platten bei 18 °C gelagert. Auch nach mehreren
Wochen wurden keine Kristalle gefunden.
4.2.4
Elektronenmikroskopische Einzelpartikelmessung
Die wie in Abschnitt 3.7.1 beschrieben mit Negativfärbung aufgenommen
Mikrographen des Mtr-Komplexes (MtrA-H) wurden zur Beurteilung der Homogenität
der Probe verwendet (Abbildung 4.7). Darüber hinaus wurde aus diesen Aufnahmen
von Frau Ming Yang (Max-Planck-Institut für Biophysik, Frankfurt) mittels der
Random-conical-tilt-Methode ein erstes dreidimensionales Modell erstellt, dass für
weitere Rekonstruktionen als Startmodell diente (133).
63
4 Ergebnisse
a)
b)
Abbildung 4.7: a) Elektronenmikroskopische Aufnahme des Mtr-Komplexes nach
Negativfärbung mit 1 % Uranylacetat. Die Partikel erscheinen kontrastreich und hell vor
dunklem Hintergrund. Dieses Verfahren wurde zur Beurteilung der Probenhomogenität sowie
zur Erstellung eines Startmodells mittels Random conical tilt verwendet. b) Unter CryoBedingungen entstandener Mikrograph des Mtr-Komplexes. Der Kontrast zwischen den
einzelnen Partikeln und dem Bildhintergrund ist schwächer, jedoch werden bei der
Rekonstruktion Artefakte aufgrund von mangelnder Färbung vermieden.
(Bilder: Dr. Dilem Hizlan)
Aus
den
unter
Cryo-Bedingungen
aufgenommenen
Mikrographen
(vgl.
Abschnitt 3.7.1) wurde von Frau Dr. Dilem Hizlan (Max-Planck-Institut für Biophysik,
Frankfurt) in einer iterativen Vorgehensweise durch so genannte Rückprojektionen,
d. h. simulierte Projektionen aus einer dreidimensionalen Rekonstruktion (dem
Startmodell) mit definierten Winkeln, ein verbessertes Modell erstellt, das wiederum
als Referenz für weitere Iterationen diente.
Durch Mittelung einzelner Bilder des gleichen Partikels verbessert sich das
Kontrastverhältnis
zwischen
Bildsignal
und
Hintergrundrauschen.
Diese
so
genannten Klassensummen entsprechen also verschiedenen „Ansichten“ des
Moleküls und wurden dazu verwendet, deren unbekannte Winkelbeziehungen zu
berechnen (134) (Abbildung 4.8a).
Das schlussendlich erhaltene Modell ließ sich als dreidimensionales, das Molekül
umhüllendes
Oberflächenbild
darstellen
(Abbildung
4.8b).
Die
Größe
des
Modellvolumens beträgt ungefähr 165 x 105 Å, was einem Molekulargewicht von ca.
600 kDa und damit einem Tetramer des acht Untereinheiten umfassenden
Komplexes MtrA-H entspricht. Im Modell besteht das Molekül aus einem größeren,
dreieckigen Teil von ca. 165 x 64 Å, welcher Regionen geringerer Dichte aufweist,
64
4 Ergebnisse
die als Einkerbung erscheinen, und einem kleineren, spitzen Teil von ca. 41 Å,
sodass das Molekül insgesamt wie eine Pyramide erscheint. Im kleineren, oberen
Teil des Modellmoleküls zeigen sich starke Unterschiede zwischen den einzelnen
aufgenommenen Partikeln (siehe Abbildung 4.8a). In manchen Partikeln erscheint
dieser Teil kugelförmig, in anderen zylindrisch, in wieder anderen ist er überhaupt
nicht vorhanden. Dies wurde als eventuelle Flexibilität dieses Teils gedeutet. Anhand
des Modells sind keinerlei Symmetrien innerhalb des Moleküls zu erkennen, auch
über die Anordnung in der Membran konnte keine Aussage getroffen werden.
Ein Maß dafür, inwiefern ein Strukturmodell tatsächlich zutrifft, ist die
Übereinstimmung
zwischen
Klassensummen
und
Rückprojektion.
Der
Kreuzkorrelationskoeffizient betrug im vorliegenden Fall 0,5. Außerdem sollte ein
Modell die Beschreibung möglichst vieler unterschiedlicher Ansichten liefern sowie
eine zusammenhängende Dichte bilden. Letztere zwei Eigenschaften, welche visuell
überprüft werden können, trafen beim vorliegenden Modell zu, jedoch sind weitere
Aufnahmen, insbesondere mit dem Mtr-Komplex ohne Untereinheit MtrH (MtrA-G)
angebracht.
65
4 Ergebnisse
a)
b)
Abbildung 4.8: a) Iterative Berechnung der Struktur des Mtr-Komplexes. Aus 7380
Einzelpartikeln wurden neun Klassensummen berechnet. b) Oberflächendarstellung eines
Strukturmodells des Mtr-Komplexes. Bei dem kleinen spitzen Teil im oberen Bereich könnte
es sich um Untereinheit MtrH handeln. Der cut-off-Wert des Modellvolumens beträgt 30,2 Å.
(Bilder: Dr. Dilem Hizlan)
66
4 Ergebnisse
4.3 Ergebnisse der heterologen Expression der Untereinheiten MtrA und MtrH
Mit sämtlichen hergestellten Vektorkonstrukten (siehe Tabelle 3.1) wurden
Expressionstest durchgeführt, um die Abhängigkeit der Löslichkeit des Proteins von
den
Wachstumsbedingungen
zu
überprüfen
sowie
eine
Maximierung
der
Proteinausbeute zu erreichen. Es wurden sowohl verschiedene Medien (LB-, TBund M9-Minimalmedium), verschiedene Temperaturen (25-37 °C) als auch
unterschiedliche Konzentrationen zur Induktion (IPTG: 0,1-1 mM, AHT: 2-200 ng/mL)
getestet (siehe Abschnitt 3.3.4).
Tabelle 4.3 gibt eine Übersicht über die Ergebnisse der durchgeführten
Expressionsversuche zur Produktion der rekombinanten Untereinheiten MtrA und
MtrH in E. coli. Bei MtrA aus M. jannaschii war die lösliche Expression abhängig von
der Temperatur und der zur Induktion verwendeten IPTG-Konzentration. So wurde
vollständiges MtrA mit C-terminaler Transmembranhelix (MJMtrA1) in LB-Medium bei
37 °C Anzuchttemperatur löslich, des-[229-246]-MtrA (MJMtrA2) jedoch nur teilweise
löslich und des-[225-246]-MtrA (MJMtrA3) vollständig unlöslich produziert. Durch
eine Absenkung der Temperatur nach der Induktion und eine Verringerung der IPTGKonzentration wurden MJMtrA2 und MJMtrA3 jedoch ebenfalls löslich exprimiert.
MtrA aus M. kandleri konnte bei den in Tabelle 4.3 aufgeführten Bedingungen
zumindest teilweise als lösliches Protein in E. coli produziert werden.
MtrH
wurde
unabhängig
vom
Ursprungsorganismus,
den
Wachstumsbedingungen oder dem verwendeten Induktionssystem (lac-Operon oder
tet-Repressor) immer unlöslich in Einschlusskörperchen exprimiert.
Bei der Co-Expression von MtrA3 und MtrH aus M. jannaschii zeigte sich
ebenfalls, dass diese immer als Einschlusskörperchen produziert wurden. Hier
konnte auch durch eine Änderung der Anzuchtbedingungen kein lösliches Protein
erzeugt werden.
67
4 Ergebnisse
Tabelle 4.3: Übersicht über die Ergebnisse der durchgeführten Expressionsversuche
der rekombinanten Untereinheiten MtrA und MtrH des Mtr-Komplexes.
Protein
MJMtrA1
MJMtrA2
MJMtrA3
MKMtrA
MMRMtrH
MJMtrH
MKMtrH1
MKMtrH2
Co-Expression
MJMtrA3+MJMtrH
Anzuchtbedingungen
Beschreibung
vollständiges
M. jannaschii MtrA
(26 kDa) mit
Transmembranhelix
M. jannaschii
des-[229-246]-MtrA
(24 kDa)
18 C-terminale AS
fehlen
M. jannaschii
des-[225-246]-MtrA
(24 kDa) 22
C-terminale AS
fehlen
M. kandleri des[238-252]-MtrA
(27 kDa)
mit C-terminalem
StrepIIAffinitätspeptid
15 C-terminale AS
fehlen
M. marburgensis
MtrH (33 kDa)
M. jannaschii MtrH
(36 kDa)
M. kandleri MtrH
(36 kDa) mit
C-terminalem His6Affinitätspeptid
M. kandleri
des-[1-11]-MtrH
(35 kDa)
mit C-terminalem
His6-Affinitätspeptid
11 N-terminale AS
fehlen
M. jannaschii des[225-246]-MtrA
(24 kDa)
+ M. jannaschii
MtrH (36 kDa)
Löslichkeit
Medium
LB
T/[°C]
37
Induktion
0,6-11
löslich
LB
LB
LB
37
37
28
0,3-0,61
11
0,1-0,61
löslich/unlöslich
unlöslich
löslich
LB
LB
37
28
0,5-11
0,1-0,61
unlöslich
löslich
LB
LB
TB
37
25
25
2-2002
202
202
löslich/unlöslich
löslich/unlöslich
löslich/unlöslich
LB
37
0,51
unlöslich
LB
LB
LB
LB
LB
TB
37
30
25
37
25
25
0,25-11
0,5-11
0,5-11
2-2002
202
202
unlöslich
unlöslich
unlöslich
unlöslich
unlöslich
unlöslich
LB
LB
TB
37
25
25
2-2002
202
202
unlöslich
unlöslich
unlöslich
LB
M9
30
28
0,3-11
0,3-11
unlöslich
unlöslich
1
2
[IPTG]/[mM]
[AHT]/[ng/mL]
68
4 Ergebnisse
4.4 Rekombinantes des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii
4.4.1
Reinigung
Des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii konnte wie in Abschnitt 3.3.3
beschrieben mittels des Vektors MJmtrA3/pET22b+ als lösliches Protein in
E. coli BL21
(DE3)
Anschließend
produziert
wurde
nach
werden
Zugabe
(siehe
von
SDS-Page,
0,1
mM
Abbildung
Vitamin
B12a
4.9).
per
Ultraschallbehandlung aufgeschlossen und nach Abtrennen der Zellmembranen
mittels Ultrazentrifugation der Großteil der E. coli-Proteine durch Erhitzen auf 70 °C
aus der löslichen Fraktion ausgefällt (siehe SDS-Page, Abbildung 4.9).
Zur weiteren Reinigung wurde MJMtrA3 einer Anionenaustauschchromatographie
auf Q-Sepharose HP unterzogen und hierbei mit 422-443 mM NaCl (42-44 %
Puffer B) eluiert. Die bei 365 nm absorbierenden Fraktionen wurden mittels SDSPage untersucht (siehe Abbildung 4.9) und diejenigen, welche MJMtrA3 enthielten,
vereinigt. Nach erneuter Zugabe von 0,1 mM Vitamin B12a wurde zur Entfernung von
ungebundenem
Cofaktor
gegen
Gelfiltrationspuffer
dialysiert.
Durch
die
anschließende Gelfiltration auf Superdex 200 als letzter Reinigungsschritt konnte
weiterer ungebundener Cofaktor abgetrennt werden (siehe Chromatogramm,
Abbildung 4.9). Die MJMtrA3 enthaltenden Fraktionen (82-90 mL) wurden vereinigt
und die Ausbeute mittels Bradford-Test auf 8 mg/L Kulturvolumen bestimmt.
Superdex 200 MJMtrA3
Absorption 280 nm/[mAU]
175
50
32 kDa
280 nm
365 nm
155
45
40
Fraktionen mit
MJMtrA3
135
115
35
95
30
75
25
55
20
35
4 kDa
15
15
Absorption 365 nm/[mAU]
195
10
-5
0
20
40
60
80
100
120
Elutionvolumen/[mL]
Abbildung 4.9: Gelfiltrationschromatogramm und Coomassie-gefärbte SDS-Page mit
Proben der Produktion in E. coli und Reinigung von rekombinantem M. jannaschii
des-[225-246]-MtrA (MJMtrA3). MJMtrA3 wird in der Gelfiltration als einzelner Peak bei ca.
32 kDa eluiert. Der kleine Peak bei ca. 4 kDa rührt von nicht gebundenem Cofaktor Vitamin
B12a her. Auf Bahn 1 der SDS-Page befindet sich die lösliche Fraktion einer Probe der
Zellsuspension fünf Stunden nach Induktion. Auf Bahn 2 wurde der Überstand nach der
Hitzefällung eines Großteils der E. coli-Proteine aufgetragen. Auf Bahn 3 ist eine Probe von
MJMtrA3 nach der Ionenaustauschchromatographie zu sehen. Bahn 4 zeigt gereinigtes
MJMtrA3 nach der präparativen Gelfiltration. Im Laufe der Reinigung ist eine zunehmende
Anreicherung der 24 kDa-Bande von MJMtrA3 zu beobachten.
69
4 Ergebnisse
4.4.2
Charakterisierung
Proteinidentifizierung
und
Untersuchung
der
Cofaktor-Bindung
durch
analytische Gelfiltration:
MJMtrA3 wurde bei der analytischen Gelfiltration als basisliniengetrennter Peak
eluiert (siehe Abbildung 4.10). Das Molekulargewicht konnte anhand einer
Eichgerade (siehe Anhang, Abschnitt 7.1) auf ca. 31 kDa geschätzt werden. Die
Absorption bei 365 nm lässt darauf schließen, dass der bei dieser Wellenlänge
absorbierende Cofaktor Vitamin B12a an das Enzym gebunden ist. Bei der
Rechromatographie auf Superdex 200 von bereits mit Gelfiltration gereinigtem
Protein trat nur ein schwacher niedermolekularer Peak bei ca. 1 kDa auf, bei dem es
sich um nicht gebundenes Vitamin B12a handelt. Es ist also davon auszugehen, dass
der Cofaktor an MJMtrA3 relativ stabil und damit wahrscheinlich spezifisch gebunden
ist.
Superdex 200 MJMtrA3
0,06
~ 31 kDa
280 nm
365 nm
0,5
0,05
0,4
0,04
0,3
0,03
0,2
0,02
0,1
0,01
~ 1 kDa
Absorption 365 nm/[mAU]
Absorption 280 nm/[mAU]
0,6
0,00
0,0
0,4
0,9
1,4
1,9
2,4
Elutionvolumen/[mL]
Abbildung 4.10: Elutionsprofil der Rechromatographie auf Superdex 200 von bereits durch
Gelfiltration gereinigtem MJMtrA3. Das Protein wird als Basislinien getrennter Peak bei ca.
31 kDa eluiert. Der Peak von 1 kDa ist eine kleine Menge des nicht gebundenen Cofaktors
Vitamin B12a.
70
4 Ergebnisse
ESI-MS-Analyse:
Die Analyse wurde von der Firma Proteome Factory (Berlin) durchgeführt. Dazu
wurde
die
zu
untersuchende
Bande
aus
einem
SDS-Polyacrylamidgel
ausgeschnitten (siehe Abbildung 4.11) und das Masse-Ladungs-Verhältnis der
Peptidfragmente nach einem Trypsin-Verdau bestimmt. Dieses Spektrum wurde mit
einer Datenbank verglichen und so das gereinigte Protein als Untereinheit A des
Mtr-Komplexes
aus
M.
jannaschii
identifiziert.
Die
mit
der
Datenbank
übereinstimmenden Fragmente sind in Abbildung 4.11 gezeigt. Die detektierten
Fragmente und ihre Scores sind im Anhang (Abschnitt 7.5) aufgeführt.
Aminosäuresequenz von M. jannaschii MtrA:
Abbildung
4.11: Coomassie-gefärbte SDS-Page und Aminosäuresequenz von
M. jannaschii MtrA. Die Bande bei ca. 24 kDa wurde aus dem Gel ausgeschnitten, einem
Trypsin-Verdau unterzogen und das Masse-Ladungsspektrum der Peptidfragmente mittels
ESI-MS aufgenommen. Beim Vergleich dieser Peptidfragmente mit der Datenbanksequenz
von M. jannaschii MtrA zeigte sich eine Übereinstimmung von 33 %. Die übereinstimmenden
Fragmente der ESI-MS-Anlalyse sind rot gefärbt.
4.4.3
Für
Kristallisation
die
Kristallisation
wurde
gereinigtes
MJMtrA3
gegen
verschiedene
Pufferlösungen dialysiert und anschließend bis zur gewünschten Konzentration
eingeengt.
Die
Ansätze
wurden
nach
der
Sitting
drop-Methode
in
Kristallisationsplatten mit 96 Vertiefungen mit 90-100 µL Reservoirlösung oder nach
der Hangig drop-Methode in Platten mit 24 Vertiefungen mit 1 mL Reservoirlösung
hergestellt. Es wurde sowohl der Gehalt an Puffersubstanz, Salz, Glycerin,
Reduktionsmittel und Cofaktor Vitamin B12a als auch die Proteinkonzentration variiert
(siehe Tabelle 3.8). Letztere bewegte sich im Bereich von 20-92 mg/mL. Sämtliche
im Materialteil (Abschnitt 2.2.10) aufgeführten, kommerziell erhältlichen Screens
71
4 Ergebnisse
sowie selbst hergestellte Reservoirlösungen (siehe Tabelle 4.4) kamen zum Einsatz.
Außerdem
wurden
Tropfengrößen
von
0,4-2
µL
und
verschiedene
Lagerungstemperaturen (4 °C und 18 °C) erprobt. Trotz dieser umfangreichen
Versuche konnte keine Kristallisationsbedingung aufgefunden werden. Es zeigte sich
darüber hinaus, dass das Protein selbst bei extremen Bedingungen (hohe
Proteinkonzentration und hoher Fällungsmittelgehalt) stabil war und nur in geringem
Maße ausfiel.
Tabelle 4.4: Zusammensetzung der selbst entwickelten Screens für die Proteinkristallisation.
Bezeichnung
Zusammensetzung
Na/K-Tartrat/Ammoniumsulfat-Screen
(96 Bedingungen)
100 mM Bis-TRIS-Propan
100-375 mM Ammoniumsulfat
1-1,55 M Na/K-Tartrat
100 mM HEPES pH 8,5
1,5-2,02 M Ammoniumsulfat
0-15 % Glycerin
Ammoniumsulfat/Glycerin-Screen
(96 Bedingungen)
4.5 Rekombinantes
des-[238-252]-MtrA
mit
C-terminalem
StrepII-
Affinitätspeptid (MKMtrA) aus M. kandleri
Zur Expression von des-[238-252]-MtrA (MKMtrA; 27 kDa) als lösliches Protein
mit StrepII-Affinitätspeptid wurden mit pCSt_tet(mtrA) transformierte E. coli Rosetta
(DE3) pLysS-Zellen verwendet (siehe Abschnitt 3.3.3).
Nach dem Zellaufschluss durch Ultraschall wurde die lösliche Fraktion zur
Fällung der E. coli-Proteine auf 70 °C erhitzt. Die weitere Reinigung gelang
säulenchromatographisch durch Bindung von MKMtrA an Strep-Tactin® und
anschließende Elution mit 2 mM D-Biotin (siehe Abschnitt 3.5.6). Die während der
Aufreinigung gewonnenen Proben wurden mittels Western Blot mit Anti-StrepIIAntikörpern analysiert.
Wie auf den Western Blots in Abbildung 4.12 zu sehen, ließ sich MKMtrA nur
teilweise als lösliches Protein in E. coli produzieren. Ein weiterer Teil befindet sich
nach dem Zellaufschluss in der unlöslichen Fraktion. Insgesamt wurde MKMtrA in
relativ geringen Mengen exprimiert. Darüber hinaus betrug das anhand von
SDS-Page und Western Blot geschätzte Molekulargewicht von MKMtrA ca. 16,5 kDa,
was vom berechneten Wert von 27 kDa stark abwich. Das C-terminale Ende von
MKMtrA mit StrepII-Affinitätspeptid ließ sich jedoch durch Western Blot und die
72
4 Ergebnisse
Bindung von MKMtrA an die Strep-Tactin®-Säule nachweisen. Diese Bindung
geschah nur unvollständig, da sich MKMtrA sowohl im Säulendurchfluss als auch in
der Elutionsfraktion wiederfand. Darüber hinaus trat teilweise eine weitere Bande bei
ca. 6 kDa auf, die jedoch nicht identifiziert werden konnte.
Als weitere Identifikationsmethode wurde eine MALDI-TOF-Fingerprint-Analyse
nach dem Trypsin-Verdau der im Western Blot sichtbaren Banden versucht. MtrA
aus M. kandleri konnte mit dieser Methode jedoch nicht nachgewiesen werden.
Aufgrund der mangelnden Expression und der Schwierigkeiten bei der Identifikation
wurden die Versuche mit pCSt_tet(mtrA) bzw. MKMtrA abgebrochen.
Abbildung 4.12: Western Blot mit Anti-StrepII-Antikörpern von Proben der Expression in
E. coli und Reinigung auf Strep-Tactin® von des-[238-252]MtrA mit C-terminalem StrepIIAffinitätspeptid aus M. kandleri (MKMtrA). Auf Bahn 1 ist die lösliche Fraktion, auf Bahn 2 die
unlösliche Fraktion nach dem Zellaufschluss zu sehen. In beiden Proben ist MKMtrA zu
finden. Auf Bahn 3 wurde der Überstand nach der Hitzefällung und Entfernung der E. coliProteine mittels Ultrazentrifugation aufgetragen. Auf Bahn 4 befindet sich der Durchfluss nach
Auftragen der Probe auf die Strep-Tactin®-Säule. Auf Bahn 5 ist MKMtrA nach der Elution mit
2 mM D-Biotin zu sehen. Die zwei letzten Proben zeigen, dass MKMtrA nur teilweise an das
Säulenmaterial gebunden wurde. Die schwächere Bande bei ca. 6 kDa konnte nicht
identifiziert werden. Auffällig ist bei allen Proben das apparente Molekulargewicht von ca.
16,5 kDa, das vom errechneten Wert von 27 kDa stark abweicht.
73
4 Ergebnisse
4.6 Rekombinantes M. marburgensis MtrH (MMRMtrH)
Rekombinantes M. marburgensis MtrH, im folgenden MMRMtrH genannt, konnte,
wie in Abschnitt 3.3.3 beschrieben, mittels des Plasmids MMRmtrH/pET22b+ in
E. coli BL21 (DE3) in größeren Mengen als Einschlusskörperchen produziert werden
(siehe Abbildung 4.13). Diese wurden nach dem Zellaufschluss mit Ultraschall mit
5 M Guanidinhydrochlorid solubilisiert. Nach einer Gelfiltration auf Superdex 200 im
entfalteten Zustand wurden die durch Absorption bei 280 nm als proteinhaltig
identifizierten Fraktionen vereinigt, konzentriert und bei 1000-facher Verdünnung mit
0,05 % LM rückgefaltet. Als abschließender Reinigungsschritt wurde wiederum eine
Gelfiltration auf Superdex 200 durchgeführt und die eluierten Fraktionen mittels
SDS-Page analysiert (siehe Abschnitt 3.5.3).
Die Gelfiltration des rückgefalteten Proteins ergab keinen basisliniengetrennten
Peak und die Analyse der gesammelten Fraktionen mittels SDS-Page (siehe
Abbildung 4.13) zeigte zwar eine Anreicherung von MMRMtrH, jedoch waren auch
zahlreiche weitere Banden unklarer Identität zu sehen. Darüber hinaus bestand keine
Möglichkeit, die korrekte Faltung des Proteins zu überprüfen, sodass weitere
Rückfaltungs- und Reinigungsversuche eingestellt werden mussten.
Abbildung 4.13: Coomassie-gefärbte SDS-Page mit Proben der Produktion in E. coli und
Reinigung von rekombinantem M. marburgensis MtrH (MMRMtrH). Auf Bahn 1 befindet sich
die lösliche Fraktion, auf Bahn 2 die unlösliche Fraktion einer Probe der Zellsuspension drei
Stunden nach Induktion. MMRMtrH (33 kDa) ist in letzterer zu finden, da es in
Einschlusskörperchen exprimiert wird. Auf Bahn 3 ist eine Probe von MMRMtrH nach der
zweiten Gelfiltration im rückgefalteten Zustand zu sehen. Neben MMRMtrH sind noch
zahlreiche weitere Banden mit unklarer Identität zu erkennen.
74
4 Ergebnisse
4.7 Co-Expression und gemeinsame Reinigung von des-[225-246]-MtrA und
MtrH (MJMtrA3+MJMtrH) aus M. jannaschii
Die Co-Expression von des-[225-246]-MtrA und MtrH (MJMtrA3+MJMtrH) aus
M. jannaschii wurde in zwei Plasmide mit den die entprechenden Gensequenzen
tragenden E. coli BL21 (DE3)-Zellen durchgeführt (siehe Abschnitt 3.3.3). Hierzu
wurden
zwei
Plasmidkombinationen,
zum
einen
MJmtrA3/pET22b+
und
MJmtrH/pACYC-Duet1, zum anderen MJmtrH/pET22b+ und MJmtrA3/pACYCDuet1, verwendet. Bei der ersten Variante wurden sowohl MJmtrA3 als auch MJMtrH
unlöslich in Einschlusskörperchen exprimiert. Bei der zweiten Kombination wurde
MJMtrH zwar ebenfalls in Einschlusskörperchen, MJMtrA3 jedoch in nur sehr
geringem Maße exprimiert, sodass diese Kombinationsmöglichkeit nicht weiter
verfolgt wurde (siehe Abbildung 4.14).
Nach
dem
Zellaufschluss
durch
Ultraschall
und
dem
Abtrennen
der
Einschlusskörperchen wurden diese mit 5 M Guanidinhydrochlorid solubilisiert. Die
Proteine wurden zunächst im entfalteten Zustand einer Gelfiltration auf Superdex 200
unterzogen, in den gesammelten Fraktionen durch Absoprtion bei 280 nm identifiziert
und vereinigt. Nach der Rückfaltung unter Zusatz von 0,5 % OG und 0,01 mM
Vitamin B12a im 100-fachen Volumen an Pufferlösung wurde erneut eine Gelfiltration
auf Superdex 200 durchgeführt. Die Fraktionen wurden mittels SDS-Page untersucht
(siehe Abschnitt 3.5.5).
Im Elutionsprofil der zweiten Gelfiltration waren sowohl höhermolekulare, auf
Aggregation der Proteine hindeutende, als auch nicht basisliniengetrennte Peaks im
mittleren und niedermolekularen Bereich zu sehen. Ein Peak der Absorptionskurve
bei 365 nm bei etwa 40 kDa zeigte bei der SDS-Page-Analyse zwar eine
Anreicherung von MJMtrA3, jedoch konnte kein gebundenes MJMtrH identifiziert
werden (siehe Abbildung 4.14). Auch eine Variation der Entfaltung bei 3-7 M
Guanidinhydrochlorid sowie unterschiedliche Bedingungen bei der Rückfaltung durch
10- bis 100-fache Verdünnung der Proteinprobe oder verschieden Detergenzien
(0,05-1 % LM, 0,5-1 % OG) ermöglichten keine gemeinsame Reinigung von
MJMtrA3 und MJMtrH.
75
4 Ergebnisse
Superdex 200 MJMtrH + MJMtrA3
280 nm
365 nm
0,4
0,12
~ 8000 kDa
(0.84 mL)
~ 1 kDa
(2.02 mL)
~ 40 kDa
(1.56 mL)
0,3
0,06
~ 8 kDa
(1.78 mL)
0,2
0,1
Absorption 365 nm/[mAU]
Absorption 280 nm/[mAU]
0,5
0,00
0,0
0,4
0,9
1,4
1,9
2,4
Elutionvolumen/[mL]
Abbildung 4.14: Gelfiltrationschromatogramm und Coomassie-gefärbte SDS-Page mit
Proben der Co-Expression in E. coli und gemeinsamen Reinigung von M. jannaschii
des-[225-246]-MtrA und MtrH (MJMtrA3 + MJMtrH). Die höhermolekularen Peaks im
Elutionsprofil der Gelfiltration sind durch Aggregation der Proteine zu erklären. Eine Probe des
40 kDa-Peaks wurde mittels SDS-Page als MJMtrA3 identifiziert. Da dieses Vitamin B12a
bindet, ist bei 365 nm ebenfalls eine starke Absorption zu beobachten. Der Peak bei ca. 8 kDa
konnte nicht zugeordnet werden. Der 1 kDa-Peak dagegen rührt von nicht gebundenem
Cofaktor her. Auf Bahn 1 der SDS-Page befindet sich die unlösliche Fraktion einer Probe der
Zellsuspension der Anzucht von MJmtrA3/pET22b+ und MJmtrH/pACYC-Duet1 tragenden
E. coli-Zellen fünf Stunden nach Induktion. Sowohl MJMtrH als auch MJmtrA3 wurden
exprimiert. Auf Bahn 2 wurde eine Probe der unlöslichen Fraktion des
Co-Expressionsversuchs von MJmtrH/pET22b+ und MJmtrA3/pACYC-Duet1 in E. coli fünf
Stunden nach Induktion aufgetragen. Bei dieser Plasmidkombination wurde nur MJMtrH
exprimiert. Auf Bahn 3 ist eine Probe des 40 kDa-Peaks der gezeigten Gelfiltration zu sehen,
die die Identifizierung von MJMtrA3 ermöglichte.
76
4 Ergebnisse
4.8 Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase
(KMtd)
aus
M. kandleri
4.8.1
Co-Kristallisation von KMtd mit H4MPT-Derivaten und F420
Die Co-Kristallisation von KMtd mit Substrat (H4MPT-Derivate) und Cosubstrat
(F420 bzw. F0) wurde in Zusammenarbeit mit Frau Ulrike Demmer (Max-Planck-Institut
für Biophysik, Frankfurt) in Sitting drop-Kristallisationsplatten unter anaeroben
Bedingungen und Rotlicht durchgeführt (siehe Abschnitt 3.6.1). Zum Einfrieren der
Proteinkristalle vor der röntgenographischen Untersuchung wurden diese mit einem
passenden Cryo-loop eingefangen, im laminaren Stickstoffstrom eingefroren und bis
zur Messung in flüssigem Stickstoff gelagert.
Die Kristallisationsversuche wurden sowohl in Anwesenheit von Methylen-H4MPT
als auch Methenyl-H4MPT+ sowie von F420 bzw. F0 durchgeführt, jedoch wurden nur
mit Methylen-H4MPT und F420 Kristalle erhalten, die besser als bis zu 2 Å streuten
(siehe Abbildung 4.15). Die Kristallisationsbedingungen sind in Tabelle 4.5
aufgeführt.
Tabelle 4.5: Kristallisationsbedingungen für die Co-Kristallisation von KMtd mit
Methylen-H4MPT und F420.
Parameter
Wert
Kristallisationspuffer
10 mM MES pH 5,5
5 mM Methylen-H4MPT
1 mM F420
15 mg/mL
Proteinkonzentration
Kristallisationsmethode
Reservoirpuffer
Tropfengröße
Vorsättigung
Temperatur
sitting drop
100 mM MES pH 6,5
100 mM Na-Acetat
31 % PEG 400
5 mM Methylen-H4MPT
1 mM F420
2 µL
50 % (v/v) des Reservoirpuffers
20 °C
77
4 Ergebnisse
Abbildung 4.15: Kristalle von KMtd im Komplex mit dem Substrat Methylen-H4MPT und
dem Cosubstrat F420. Die Kristalle entstanden unter anaeroben Bedingungen und Rotlicht bei
20 °C und streuten bis 1,8 Å.
4.8.2
Strukturlösung
Die Datensammlung zur Röntgenstrukturanalyse wurde am SLS (Synchrotron,
Villigen, Schweiz), Beamline PX02 durchgeführt. In Tabelle 4.6 sind Parameter und
Statistiken des für den ternären Komplex aus KMtd, Methylen-H4MPT und F420
aufgenommenen Datensatzes zusammengefasst.
Tabelle 4.6: Parameter und Statistiken des Datensatzes des ternären Komplexes
aus KMtd mit Methylen-H4MPT und F420.
Datensatz
KMtd + Methylen-H4MPT + F420
Wellenlänge/[Å]
Raumgruppe
Elementarzellparameter
a, b, c/[ Å]
β/[°]
Auflösungsbereich/[ Å] 1
Anzahl unabhängiger Reflexe 1
Vollständigkeit/[%] 1
Multiplizität 1
Rmerge/[%]
I/σ 1
Wilson B-Faktor/[Å2]
Matthews-Parameter/[ Å3 Da-1]
Lösungsmittelgehalt/[%]
0,9918
P21
1
61,1; 165,5; 93,6
99,14
92,5-1,8 (1,9-1,8)
169 214 (11 197)
95,7 (94,6)
7,9 (7,7)
6,4 (70,1)
17,2 (4,2)
29,5
2,3
47
Werte in Klammern beziehen sich auf die letzte Auflösungsschale
Die Phasierung von KMtd im Komplex mit Methylen-H4MPT und F420 geschah
durch molekularen Ersatz mit Hilfe des im Programmpaket ccp4-suite enthaltenen
Programm AMoRe. Als Modell wurde die von Hagemeier et al. gelöste Struktur der
Selenomethioninvariante
des
substratfreien
Enzyms
verwendet
(41).
Die
78
4 Ergebnisse
Verfeinerung geschah schrittweise mittels REFMAC und Coot. Für das Substrat
Methylen-H4MPT sowie das Cosubstrat F420 wurden zunächst separat mit dem
Programm PRODRG Modelle berechnet, manuell angeglichen und in Coot in die
Differenz-Fourierkarten modelliert. Der ternäre Komplex wurde bis zu einem Rcryst
von 20,3 % und einem Rfree von 24,6 % im Auflösungsbereich von 92,5-1,8 Å
verfeinert (siehe Tabelle 4.7). Die Proteinstruktur von KMtd mit gebundenem
Substrat und Cosubstrat ist fast identisch mit derjenigen des substratfreien Enzyms,
wie die rms-Abweichungen von ca. 0,3 Å für 100 % der Cα-Atome des Hexamers
belegen. Methylen-H4MPT war in allen sechs Untereinheiten nahezu vollständig
besetzt, bei F420 variierte die Besetzung jedoch zwischen 50 % und 70 %. Die im
Abschnitt 4.8.3 beschriebenen Strukturen beziehen sich daher auf die am stärksten
besetzte Bindestelle in Untereinheit B.
Tabelle 4.7: Verfeinerungstatistik des ternären Komplexes aus KMtd mit MethylenH4MPT und F420.
Parameter
Wert
Auflösungsbereich/[Å]
Anzahl unabhängiger Reflexe
Anzahl der Reflexe im test set
Rcryst/[%]
Rfree/[%]
Anzahl von AS
Anzahl von Nichtproteinmolekülen
Methylen-H4MPT
F420
Wasser
rms-Abweichungen
Bindungslänge/[Å]
Bindungswinkel/[°]
Cruickshanks DPI/[ Å]
Mittlerer B-Faktor/[Å2]
92,5-1,8
153 746
8157
20,3
24,6
1697
6
6
746
0,020
2,3
0,15
27,979
79
4 Ergebnisse
4.8.3
Strukturbeschreibung
Die Bindetasche von Methylen-H4MPT und F420:
Methylen-H4MPT und F420 sind in eine Spalte zwischen der α, β- und der
Helixbündel-Domäne eingebettet, welche von einem Loop-Segment zwischen Helix
α1 (Thr16-Asp25) und Faltblattstrang β2 (Val33-Gly39) des Gegenmonomers, d. h.
des
um
180°
gedrehten
benachbarten
Monomers,
verengt
wird
(siehe
Abbildung 4.16). Die Si-Seite des aus einem Pterin-, Imidazolidin- und Phenylrest
bestehenden Ringsystems von Methylen-H4MPT wird von dem Polypeptidsegment
zwischen Faltblattstrang β5 (Gly115-Val119) und Helix α5 (Asp133-Thr151), welcher
die α, β- und die Helixbündel-Domäne verbindet, sowie Helix α1 flankiert. Auf der
Re-Seite liegen die N-terminalen Stränge β1 (Ala4-Lys10) und β2 des zentralen
β-Faltblatts
sowie
F420.
Letzteres
wird
auf
der
Re-Seite
seines
Deazaisoalloxazinrings vom C-terminalen Ende des zentralen β-Faltblatts und auf
seiner Si-Seite von Methylen-H4MPT eingeschlossen. Die F420-Bindestelle wird von
dem sich an Strang β2 anschließenden Loop (Glu26-Asp32) des Gegenmonomers
verengt, sodass F420 nicht so tief in die Bindetasche eintaucht wie Methylen-H4MPT.
Die den Ringsystemen entgegengesetzten Enden von H4MPT und F420 weisen beide
in Richtung Ausgang der Bindetasche, berühren einander jedoch nicht.
80
4 Ergebnisse
Abbildung 4.16: Übersicht der Bindetasche von Methylen-H4MPT und F420. Die
α, β-Domäne ist in blau, die Helixbündeldomäne in rot und das C-terminale β-Faltblatt in
hellgrün dargestellt. Methylen-H4MPT (grau) ist vornehmlich an die Helixbündeldomäne, F420
(grün) an die α, β-Domäne gebunden. Ein Loop (α1’ → β1’) des Gegenmonomers (hellblau)
verengt die Bindetasche, deren ungefähre Abmessungen in orange angegeben sind.
Überraschenderweise geht die Bindung der verhältnismäßig sperrigen Moleküle
nicht mit signifikanten Konformationsänderungen einher und stellt somit ein
besonders ausgeprägtes Beispiel für eine vorgegebene Bindetasche dar. Ermöglicht
wird diese Besonderheit durch die vielfältigen Verknüpfungen der exponierten
Bindestelle mit dem Proteininneren. So wird die Innenwand der Bindetasche, an die
sich das Pterin-Imidazolidin-Phenyl-Ringsystem von Methylen-H4MPT anheftet, aus
den Seitenketten der Aminosäurereste Leu125, Met137, Tyr140 and Leu144
gebildet. Diese wiederum sind alle direkt mit dem hydrophoben Innenteil der
helicalen Domäne verbunden, welche über die Wechselwirkungen mit den anderen
Monomeren innerhalb des aus zwölf Helices bestehenden Bündels zusätzlich
stabilisiert wird. Die gegenüberliegende Wand der Bindetasche wird von kurzen
Loops nach den Strängen β1, β2, β3 (Phe67-Gly71) und β4 (Ala94-Asp99) des
starren zentralen β-Faltblatts gebildet. Das Loop-Segment des Gegenmonomers
steht über die Aminosäurereste Asp25, Glu26 and Arg27 in Van-der-Waals-Kontakt
zum Imidazolidin- und Pyrazinring von Methylen-H4MPT und wird durch ein Netzwerk
81
4 Ergebnisse
von Ionenbindungen zwischen Arg129 und Lys43 des betrachteten Monomers und
Asp25, Glu26, Arg27, Asp29, Arg30, Asp162 und His266 des Gegenmonomers
stabilisiert (siehe Abbildung 4.17).
Abbildung 4.17: Verknüpfung des Pterin-Imidazolidin-Phenyl-Ringsystems von MethylenH4MPT (grau) mit dem Proteininneren und dem Gegenmonomer. F420 ist in grün dargestellt.
Das erste Monomer von KMtd ist in türkis, das Gegenmonomer in blau eingefärbt.
Die Bindung von Methylen-H4MPT:
Das Methylen-H4MPT-Molekül kann in der Elektronendichtekarte vom Pterinring
bis zur Phosphatgruppe identifiziert werden, die Hydroxyglutaratgruppe ist jedoch
ungeordnet. Der Temperaturfaktor erhöht sich langsam vom Pterinring (N8: 22,64 Å2)
am Grund der Bindetasche bis zur Ribitolgruppe (CX3: 27,68 Å2), und steigt dann
vom Riboserest (C3J: 33,71 Å2) zur Phosphatgruppe (PA: 57,05 Å2) stark an (siehe
Abbildung 4.18).
Pterin-, Imidazolidin- und Benzylring sind beinahe geradlinig angeordnet und
füllen die Bindetasche mit den Abmessungen 15 x 10 x 7 Å3 in voller Länge aus
(Abbildung 4.16). Nach der Benzylgruppe krümmt sich das Molekül und bleibt somit
in Kontakt mit der Polypeptidkette (siehe Abbildung 4.17).
82
4 Ergebnisse
Wie erwartet liegen die sp3-konfigurierten Atome C6, C7 und C9 des
Tetrahydropyrazin- und des Imidazolindinrings sowie die Methylgruppen, welche an
letztere kovalent gebunden sind, außerhalb der Ringebene. Die an C7 gebundene
Methylgruppe ragt fast senkrecht zur Ringebene in Richtung der Re-Seite von
Methylen-H4MPT (siehe Abbildung 4.19). Die Wechselwirkungen zwischen MethylenH4MPT
und
der
Polypetidkette
zeichnen
sich
durch
wenige
ausgeprägte
Wasserstoffbrückenbindungen und eine große Anzahl von gleichmäßig auf das
Molekül verteilten Van-der-Waals-Kontakten aus (siehe Abbildung 4.17). Anders
ausgedrückt, der Pterin-, Imidazolidin- und der Benzylring passen sich ihren
jeweiligen Bindestellen exakt an und sorgen somit sowohl für Bindestärke als auch
Stabilität. Bemerkenswerterweise stehen die beiden an den Pyrazin- bzw.
Imidazolidinring gebundenen Methylgruppen in Van-der-Waals-Kontakt zu den
Aminosäureresten Glu26 und Ala28 des Gegenmonomers. Ein wichtiger invarianter
Aminosäurerest ist Asn141, welcher über eine Wasserstoffbrückenbindung mit dem
N1-Atom und über die Amidgruppe seiner Seitenkette mit der NH2-Grupppe des
Pyrimidinrings zweizähnig verknüpft ist (siehe Abbildung 4.18). Ein weiterer
hervorstechender, an der Bindung von Methylen-H4MPT beteiligter Aminosäurerest
ist das invariante Asp122, welches über ein vollständig besetztes Wassermolekül N3
und die NH2-Gruppe des Pyrimidinrings bindet. Asp122 bildet darüber hinaus zwei
Wasserstoffbrückenbindungen mit den Aminogruppen von Thr16 und Gly15.
Letzteres befindet sich am positiv geladenen N-terminalen Ende von Helix α1,
sodass durch die Wechselwirkungen mit Asp122 die beiden Peptidsegmente, die den
Pterinring einschließen, verknüpft werden (siehe Abbildung 4.17). Sowohl Asn141 als
auch Asp122 sind Teil des am stärksten konservierten Abschnitts des gesamten
Proteins, welcher sich auf der Si-Seite von Methylen-H4MPT befindet.
83
4 Ergebnisse
Abbildung 4.18: Wasserstoffbrückenbindungen (blau) und van-der-Waals-Kontakte (grün)
zwischen Aminosäureresten in der Bindetasche von KMtd und dem Pterin-, Imidazolidin- und
Phenylring von Methylen-H4MPT. Der Abstand zwischen Cβ von Ala127 und C13 von
Methylen-H4MPT beträgt 3,42 Å. Die Wasserstoffbrückenbindungen zwischen dem Sauerstoff
sowie dem Nδ von Asn13 und N3 bzw. N1 von Methylen-H4MPT wurden der Übersichtlichkeit
halber weggelassen. Die Reste bzw. Sekundärstrukturen des Gegenmonomers sind mit
Apostrophen gekennzeichnet. Das Methylen-H4MPT-Molekül ist nach Temperaturfaktoren
eingefärbt (dunkelblau: < 26 Å2, mittelblau: < 28 Å2, hellblau: <30 Å2, hellgrün: < 34 Å2,
dunkelgrün: < 39 Å2, orange: < 50 Å2, rot: > 50 Å2).
84
4 Ergebnisse
Abbildung 4.19: Die aromatischen Ringe von Methylen-H4MPT befindet sich annähernd in
einer Ebene. Die an Atom C7 gebundene Methylgruppe (C7M) ragt in Richtung der Re-Seite
des Moleküls.
Die Bindung von F420:
Das F420-Molekül ist in der Elektronendichtekarte vom Deazaisoalloxazinring bis
zur ersten Phosphatgruppe sichtbar. Der Deazaisoalloxazinring ist am tiefsten in die
Bindetasche eingebettet, die Ribitol- und die Phosphatgruppe sind geradlinig auf den
Eingang gerichtet. Die Phosphatgruppe ist bereits stark lösungsmittelexponiert, der
übrige Teil von F420 hat keinen Kontakt zum Protein und ist ungeordnet (siehe
Abbildung 4.20a). Der Deazaisoalloxazinring von F420 und das Benzyl-ImidazolidinPyrazin-Ringsystem von Methylen-H4MPT sind rechtwinklig zueinander angeordnet,
sodass der zentrale Pyridinring von F420 versetzt über dem Imidazolidinring von
Methylen-H4MPT zu liegen kommt. Der Imidazolidinring ist parallel, jedoch
verschoben zum Deazaisoalloxazinring orientiert (siehe Abbildung 4.21). Das
dreigliedrige Ringsystem von F420 liegt in einer gebogenen Konformation (ButterflyKonformation) mit einem Biegewinkel von ca. 25° vor, die von strukturellen Vorgaben
stabilisiert oder sogar induziert wird (siehe Abbildung 4.20b). Der zentrale Pyridinring
wird durch Pro73, dessen starrer, hydrophober Ring auf die Re-Seite von F420
gerichtet ist und welches gleichsam als Sperre fungiert, in seiner Position außerhalb
der Ringebene gehalten. Der minimale Abstand zwischen dem Cγ-Atom von Pro73
und dem C5-Atom von F420 beträgt 2,74 Å. Pro73 ist streng konserviert und befindet
85
4 Ergebnisse
sich an der Spitze eines ungewöhnlichen Loops nach Faltblattstrang β3. Dieser
Strang bildet zusammen mit Strang β1 den Schaltpunkt des β-Faltblatts, welches die
entscheidende Stelle in allen α/β-Proteinen darstellt und bereits anhand der Struktur
ohne Substrat und Cosubstrat als Bindestelle von F420 identifiziert wurde (41). Der
Pyrimidinring von F420 ist von Methylen-H4MPT weggedreht, insbesondere um
dessen C9M-Methylgruppe, aber auch um Met44 auf der Re-Seite auszuweichen.
Bemerkenswerterweise sind die polaren Atome O4F und N3F des Pyrimidinrings
über Wasserstoffbrücken mit Asn13 und Val42 verbunden, welche ebenso mit
Methylen-H4MPT wechselwirken. Der Hydroxybenzylflügel des Deazaisoalloxazins
wird durch Met124 auf der Si-Seite und Asp99 auf der Re-Seite, dessen
Carboxylatgruppe eine Wasserstoffbrückenbindung zur Hydroxygruppe bildet, von
Methylen-H4MPT
weggedrückt
(siehe
Abbildung
4.20a).
Der
invariante
Aminosäurerest Asp99 spielt, in Analogie zu Asp122, eine wichtige Rolle in der
Verknüpfung der Verbindung zwischen dem F420 benachbarten Proteinabschnitt
sowie dem Loop nach dem Faltblattstrang β3 und ist an der Stabilisierung von Pro73
beteiligt.
Darüber
hinaus
könnte
die
Wechselwirkung
mit
Asp99
für
die
Stereospezifität der Bindung von F420 verantwortlich sein.
a)
b)
Abbildung 4.20: a) F420 mit Wasserstoffbrückenbindungen (blau) und van-der-WaalsKontakten (rot) zu relevanten Aminosäureresten in der Bindetasche. Das Molekül ist nach
Temperaturfaktoren eingefärbt (dunkelblau: < 26 Å2, mittelblau: < 28 Å2, hellblau: <30 Å2,
hellgrün: < 34 Å2, dunkelgrün: < 39 Å2, orange: < 50 Å2, rot: > 50 Å2). b) Der
Deazaisoalloxazinring von F420 liegt in einer gebogenen Konformation (Butterfly-Konformation)
vor.
86
4 Ergebnisse
a)
b)
Abbildung 4.21: a) Der Deazaisoalloxazinring von F420 (grün) und das Benzyl-ImidazolidinPyrazin-Ringsystem von Methylen-H4MPT (grau) sind rechtwinklig zueinander angeordnet,
sodass der zentrale Pyridinring von F420 versetzt über dem Imidazolidinring von MethylenH4MPT zu liegen kommt. Die mit 3,43 Å kürzeste Distanz befindet sich zwischen den am
Hydridtransfer beteiligten Atomen C5 von Methylen-H4MPT und C10 von F420. b) Der
ist
parallel,
jedoch
verschoben
zum
Imidazolidinring
von
Methylen-H4MPT
Deazaisoalloxazinring von F420 orientiert.
87
5 Diskussion
5 Diskussion
5.4 Der
N5-Methyl-H4MPT:Coenzym M-Methyltransferasekomplex
aus
M. marburgensis
5.1.1
Isolierung und Reinigung des Mtr-Komplexes
Im Rahmen dieser Arbeit gelang die Verbesserung und Vereinfachung der
Isolierung und Reinigung des Mtr-Komplexes aus M. marburgensis unter aeroben
Bedingungen. Eine entscheidende Hürde hierbei war, das Abdissoziieren der
hydrophilsten, 34 kDa großen Untereinheit MtrH vom restlichen Komplex zu
kontrollieren. Zwei Strategien wurden hierzu gewählt, zum einen die möglichst
schonende
Präparation
des
kompletten,
acht
Untereinheiten
umfassenden
Komplexes MtrA-H, zum anderen die Präparation des Enzymkomplexes MtrA-G
unter möglichst vollständiger Abtrennung der Untereinheit MtrH.
Das von Gärtner et al. (56) für die anaerobe Reinigung etablierte Protokoll wurde
modifiziert, indem die Zellen im Hochdruckhomogenisator aufgeschlossen wurden.
Dadurch konnte der Gehalt an MtrH im Komplexverbund etwas erhöht werden. Bei
der sich anschließenden Ionenaustauschchromatographie auf DEAE-Sepharose
zeigte sich eine Auftrennung in verschiedene Fraktionen. Diejenigen, die zwar den
Mtr-Komplex, jedoch im Vergleich zu den übrigen Untereinheiten wenig MtrH
enthielten, diejenigen, welche alle acht Untereinheiten in gleicher Menge
beinhalteten und jene, welche neben dem Mtr-Komplex eine zunehmende Menge an
anderen Proteinen umfassten. An der Anzahl der Fraktionen mit wenig MtrH sowie
deren Gesamtproteingehalt konnte die Qualität der Membranpräparation abgelesen
werden. Bei der folgenden Ionenaustauschchromatographie auf Q-Sepharose traten
wiederum einige Fraktionen mit im Vergleich zu den übrigen Untereinheiten weniger
MtrH auf. Die abschließende Gelfiltration zeigte, dass MtrA-H größtenteils als
monodisperse Probe vorlag.
Vergleicht man die Reinigung unter anaeroben Bedingungen (56, 65) mit der in
dieser Arbeit durchgeführten Präparation, fällt auf, dass bei letzterer die
Salzkonzentration zur Elution von MtrA-H bei der säulenchromatographischen
Reinigung insgesamt etwas höher lag. Die in der Literatur beschriebene vollständige
Abtrennung
von
MtrH
während
der
Ionenaustauschchromatographie
auf
Q-Sepharose konnte in dieser Arbeit nicht bestätigt werden. Die Anzahl an
Fraktionen mit wenig MtrH variierte von Präparation zu Präparation stark, nur die Art
88
5 Diskussion
des Zellaufschlusses schien einen gewissen Einfluss zu haben. Wann genau es
hauptsächlich zu einem Verlust der Untereinheit MtrH kam, konnte nicht
abschließend
geklärt
werden,
die
Membranpräparation
schien
jedoch
von
entscheidender Bedeutung zu sein. Es ist darüber hinaus möglich, dass schon der
Zustand der Zellen bei der Ernte eine Rolle spielte, oder dass auch während der
Reinigung
weiteres
MtrH
abgetrennt
wurde,
ohne
dass
dies
durch
die
Zusammensetzung der Pufferlösung zu kontrollieren war.
Um die Homogenität der Probe zu verbessern, wurde als alternative Strategie die
Reinigung des Enzymkomplexes MtrA-G unter möglichst vollständiger Abtrennung
der Untereinheit MtrH durchgeführt. Dies gelang durch die Behandlung der
sedimentierten Membranen mit Ultraschall und mehrfaches Auswaschen von MtrH.
Der Gehalt an MtrH der bei der anschließenden säulenchromatographischen
Reinigung gesammelten Fraktionen lag an der Nachweisgrenze von mit Coomassie
Brilliant Blue gefärbten SDS-Pages. Bei einer ESI-MS-Analyse der gereinigten Probe
konnte kein MtrH mehr nachgewiesen werden. Bei der Western Blot-Analyse der
Proben mit Anti-M. marburgensis MtrH-Antikörpern trat nur noch eine sehr schwache
Bande auf, d. h. eine Abtrennung der Untereinheit MtrH ist bis auf einen äußerst
geringen Restgehalt so gut wie vollständig gelungen. Auch die Ergebnisse der
Präparation
von
MtrA-G
ohne
MtrH
sprechen
also
dafür,
dass
die
Membranpräparation eine entscheidende Rolle beim Verlust von MtrH spielt.
5.1.2
Um
Der oligomere Zustand des Mtr-Komplexes
einen
Aussage
über
den
oligomeren
Zustand
des
isolierten
Gesamtkomplexes MtrA-H treffen zu können, wurde das Molekulargewicht mit
verschiedenen Methoden bestimmt. Bei sämtlichen präparativen und analytischen
Gelfiltrationen zeigte sich neben einem Hauptpeak bei 670-770 kDa eine Schulter
von 300-400 kDa. Durch Blaue Native Gelelektrophorese (BN-Page) dagegen wurde
das Molekulargewicht auf ca. 300 kDa bestimmt, die analytische Ultrazentrifugation
ergab ein Molekulargewicht von 620 kDa und bei der elektronenmikroskopischen
Einzelpartikelmessung wurde das Molekulargewicht anhand der Größe des
Komplexes auf ca. 600 kDa geschätzt.
Für ein Tetramer eines Heterooktamers liegt das berechnete Molekulargewicht
bei 672 kDa, womit der Hauptpeak der Gelfiltration sowie die Ergebnisse der
Analytischen
Ultrazentrifugation
und
der
elektronenmikroskopischen
Einzelpartikelmessung übereinstimmen. Das Dimer eines Heterooktamers hat ein
89
5 Diskussion
berechnetes Molekulargewicht von 336 kDa, welches mit dem in der Gelfiltration
auftretenden Schulterpeak und dem Ergebnis der BN-Page in Einklang steht.
In der Literatur wird das mittels Gelfiltration bestimmte Molekulargewicht mit
670 kDa angegeben und dementsprechend der oligomere Zustand eines Tetramers
angenommen (56), wofür auch die in dieser Arbeit erhaltenen Ergebnisse in
überwiegender Zahl sprechen. Die widersprüchlichen Werte der Blauen Nativen
Gelelektrophorese sowie der bei der Gelfiltration auftretenden Schulterpeak deuten
jedoch darauf hin, dass die Probe möglicherweise nicht vollständig monodispers
vorlag. Auch bei der analytischen Ultrazentrifugation traten Abweichungen der
Sedimentationskonstanten bei verschiedenen Messungen auf. Als Grund für die
aufgeführten Diskrepanzen kommt im Wesentlichen ein veränderlicher Gehalt an
Untereinheit MtrH innerhalb des Komplexverbunds in Betracht, wie bereits in
Abschnitt 5.1.1 diskutiert wurde. Weiterhin könnten Unterschiede im Detergenzgehalt
der Probe vorliegen. Dadurch könnten im isolierten Stadium Dimer und Tetramer des
Mtr-Komplexes im Gleichgewicht miteinander stehen. Auf welcher Seite dieses
Gleichgewicht liegt, könnte wiederum in Zusammenhang mit der Bindung und
Dissoziation von MtrH sowie dem Detergenzgehalt der Probe stehen.
5.1.3
Abtrennung der Untereinheit MtrH
Wie schon im Abschnitt 5.1.1 beschrieben, traten bei der Reinigung des
Gesamtkomplexes
MtrA-H,
insbesondere
bei
den
beiden
durchgeführten
Ionenaustauschchromatographien, Fraktionen mit nur geringem Gehalt an MtrH auf.
Es ist davon auszugehen, dass die Abtrennung von MtrH überwiegend während der
Membranpräparation geschehen war und während der Reinigung nur noch wenig
MtrH vom Komplex abdissoziierte. Darüber hinaus konnten die Proben mit
unterschiedlicher Menge an MtrH chromatographisch nicht vollständig voneinander
getrennt werden. Neben der Entfernung von MtrH während der Membranpräparation
wurde deshalb auch eine Abtrennung vom bereits gereinigten Gesamtkomplex
versucht. Dazu wurden eine Verschiebung des pH-Wertes, eine Anzahl von
Detergenzien, eine Hitzebehandlung und Pufferlösungen mit unterschiedlichem
Salzgehalt getestet. Dies geschah in Anlehnung an Protokolle zur Reinigung von
Cytochrom c-Oxidase unter Abtrennung von Untereinheit III (135-142).
Es war jedoch durch einen Austausch der Pufferlösung nicht möglich, MtrH
gezielt abzutrennen und gleichzeitig den restlichen Komplex MtrA-G stabil zu halten.
Entweder blieb der Gesamtkomplex MtrA-H bestehen, oder es kam bei zu harschen
Bedingungen zur Bildung von höhermolekularen Aggregaten bzw. zur Präzipitation
90
5 Diskussion
des
Proteins.
Dies
bestätigte
den
Befund,
der
schon
während
der
Membranpräparation und Reinigung gemacht worden waren, dass nämlich der
Gehalt an MtrH im Gesamtkomplex MtrA-H vermutlich weitgehend von den
Bedingungen während der Membranpräparation abhing.
5.1.4
Strukturbestimmung
Die wenigen in dieser Arbeit mit dem Gesamtkomplex MtrA-H durchgeführten
Kristallisationsversuche
waren
bisher
nicht
erfolgreich.
Bei
einem
membrangebundenen Komplex dieser Größe war jedoch auch nicht von einer
spontanen
Kristallisation
unter
für
lösliche
Proteine
optimierten
Standardbedingungen, wie sie im verwendeten JB-Screen vorliegen, auszugehen.
Bevor das Augenmerk verstärkt auf die Kristallisation gerichtet werden kann, muss
zunächst die Homogenität der Proteinprobe sichergestellt werden. Hierzu muss vor
allem das Abdissoziieren der Untereinheit MtrH vom Restkomplex kontrolliert
werden. Die in dieser Arbeit erfolgreich durchgeführte Reinigung des Komplexes
MtrA-G ohne Untereinheit MtrH eröffnet somit neue Möglichkeiten für das Auffinden
von Kristallisationsbedingungen.
Der Schwerpunkt in der Strukturbestimmung des Gesamtkomplexes lag in dieser
Arbeit auf der Herstellung von für die elektronenmikroskopische Untersuchung
geeigneten Proteinproben. Auch hier stellte sich heraus, dass die Homogenität der
Probe
entscheidend
Klassifizierung
der
war.
Eine
Hauptschwierigkeit
Aufnahmen
für
die
bereitete
so
auch
die
elektronenmikroskopische
Einzelpartikelmessung. Das das pyramidenähnliche Molekül schien aus einem
größeren, dreieckigen, eingekerbten Teil und einem kleineren, spitzen Teil zu
bestehen. Jener kleinere Teil des Moleküls wies bei den verschiedenen
aufgenommenen Partikeln starke Unterschiede auf, was als eventuelle Flexibilität
dieses Teils gedeutet wurde. Da bereits bei der Aufreinigung des Mtr-Komplexes das
Abdissoziieren der Untereinheit MtrH beobachtet wurde, lag die Annahme nahe, es
könnte sich bei dem flexiblen Molekülteil um MtrH handeln. Das unterschiedliche
Erscheinungsbild der Partikel einer Probe ließe sich damit erklären, dass es sich
hierbei um Zustände mit verschiedener Anzahl an gebundenen MtrH-Untereinheiten
handelte. Da jedoch anhand des Modells keinerlei Symmetrien innerhalb des
Moleküls zu erkennen waren und auch über eine mögliche Anordnung in der
Membran keine Aussage getroffen werden konnte, bleiben diese Aussagen
Spekulation. Umso interessanter ist die Tatsache, dass die in dieser Arbeit
erfolgreich durchgeführte Reinigung des Komplexes MtrA-G ohne Untereinheit MtrH
91
5 Diskussion
in den bisher erfolgten elektronenmikroskopischen Aufnahmen mit Negativfärbung
weniger heterogen erschien. Es besteht also die berechtigte Hoffnung, mit nach dem
neuen, in dieser Arbeit etablierten Reinigungsprotokoll präparierten Proben eine
Strukturbestimmung
durch
elektronenmikroskopische
Einzelpartikelmessung
durchführen zu können.
Die Untereinheit MtrA des N5-Methyl-H4MPT:CoM-Methyltransferase-
5.2
komplexes
5.2.1
Die
Heterologe Expression in E. coli
von
Harms
und
Thauer
beschriebene
Überexpression
von
des-[214-239]-MtrA aus M. marburgensis in E. coli als lösliches Protein (143), welche
von Frau Dr. Priyamvada Acharya am Max-Planck-Institut für Biophysik in Frankfurt
reproduziert werden konnte, gab zur Hoffnung Anlass, MtrA aus M. jannaschii und
M. kandleri auf analoge Weise heterolog exprimieren zu können.
Die in dieser Arbeit durchgeführten Expressionsversuche ergaben, dass bei MtrA
aus M. jannaschii die lösliche Expression abhängig von der Temperatur und der zur
Induktion verwendeten IPTG-Konzentration war. Da vollständiges MtrA mit
C-terminaler Transmembranhelix (MJMtrA1) bei Standardbedingungen (LB-Medium,
37 °C Anzuchttemperatur, Induktion mit 1 mM IPTG) löslich, des-[229-246]-MtrA
(MJMtrA2) jedoch nur teilweise löslich und des-[225-246]-MtrA (MJMtrA3) vollständig
unlöslich exprimiert wurde, ist anzunehmen, dass nicht die Hydrophobizität sondern
die Proteinfaltung betreffende Faktoren die wichtigste Rolle spielten. Da durch
Absenken der Anzuchttemperatur auf 28 °C auch MJMtrA2 und MJMtrA3 vollständig
löslich produziert werden konnten und bei MJMtrA3 zudem noch eine sehr hohe
Expressionsrate auffiel, wurde letzteres zur Aufreinigung weiterverwendet. Ob bereits
während der heterologen Expression Cobalamin gebunden wurde, konnte nicht
festgestellt werden. Bei Zugabe von 0,1 mM Vitamin B12a zum Anzuchtmedium ließ
sich keine Veränderung des exprimierten Proteins feststellen.
MtrA aus M. kandleri konnte ebenfalls teilweise als lösliches Protein in E. coli
produziert werden, wurde allerdings in nur relativ geringen Mengen exprimiert. Ein
Grund hierfür könnte das im Vektorkonstrukt pCSt_tet(mtrA) zur Induktion
verwendete tet-Repressor-System sein. Für zukünftige Expressionsversuche sollte
die Kombination von Vektor und Wirtszelle neu überdacht werden.
92
5 Diskussion
5.2.2
Des-[225-246]-MtrA (MJMtrA3) aus M. jannaschii
In dieser Arbeit konnte erstmalig um 22 C-terminale Aminosäuren verkürztes
MtrA aus M. jannaschii bis zur Homogenität gereinigt werden. Die Reinigung von
MtrA aus M. marburgensis als Apoprotein mit anschließender Rekonstituierung des
Holoproteins wurde bereits beschrieben, jedoch konnte in jener Arbeit das
Holoprotein nicht in monodispers Form erhalten werden (143). Im Unterschied zu
dem bereits veröffentlichten Protokoll wurde im hier vorliegenden Fall Cofaktor
Vitamin B12a schon zum Lysepuffer zugegeben. Die MJMtrA3 enthaltenden
Fraktionen konnten während der Reinigung durch ihre rötliche Farbe und die
Absorption bei 365 nm identifiziert werden. Auch nach erneuter Zugabe von Vitamin
B12a, Dialyse und zweimaliger Gelfiltration blieben diese Eigenschaften erhalten.
Die bei SDS-Pages auftretende 24 kDa-Bande ließ sich per ESI-MS eindeutig als
MJMtrA3 identifizieren. Das apparente Molekulargewicht stimmte mit dem anhand
der Aminosäuresequenz berechneten überein und das in der Literatur beschriebene
Auftreten verringerter elektrophoretischer Mobilität des denaturierten Proteins bzw.
des Apoproteins im Vergleich zum rekonstituierten Holoprotein ließ sich nicht
beobachten (56, 57, 143). Dies wurde als weiterer Hinweis gewertet, dass MJMtrA3
als korrekt gefaltetes Holoprotein mit gebundenem Cofakor Vitamin B12a gereinigt
werden konnte.
Die Aufnahme eines UV/Vis-Spektrums des gereinigten Proteins zeigte ein
Absorptionsmaximum bei 365 nm, das demjenigen von ungebundenem Vitamin B12a
entsprach. Dagegen sind bei rekonstituiertem MtrA aus M. marburgensis die für
Cob(II)amid
enthaltende
Corrinoidproteine
typischen
Absorptionsmaxima
von
278 nm, 315 nm, 424 nm und 492 nm zu finden. Die Präparation von MJMtrA3 fand
im Gegensatz zu M. marburgensis MtrA ohne Reduktionsmittel, wie z. B. DTT, unter
aeroben Bedingungen statt, sodass bei MJMtrA3 eventuell eine Bindung von
Cob(III)alamin vorliegen könnte. Eine weitere Untersuchung mittels EPR- oder NMRSpektroskopie könnte hier Klarheit schaffen.
Sowohl an MtrA gebundenes Cob(I)alamin als auch Methylcob(III)alamin werden
als Zwischenstufen der vom Mtr-Komplex katalysierten Methylübertragungsreaktion
angenommen (56, 57). Die Methylierungs- bzw. Demethylierungsreaktion und damit
verbundene Oxidation und Reduktion von enzymgebundenem Cobalamin sind
vermutlich der Auslöser von Konformationsänderungen, welche wiederum mit dem
vektoriellen
Natriumtransport
über
die
Membran
gekoppelt
sind
(58).
EPR-spektroskopische Studien und Mutationsversuche mit rekonstituiertem MtrA aus
M. marburgensis deuteten darauf hin, dass Cob(II)alamin in der base-off/His-on93
5 Diskussion
Konfiguration gebunden wird (55, 143). Anders als andere Cob(I)amid- und
Cob(II)amid
in
base-off/His-on-Konfiguration
bindende
Enzyme,
deren
Kristallstrukturen zum Teil bereits vorliegen, besitzt MtrA jedoch nicht die KonsensusSequenz (DXHXXG - 41-42 AS – SXL - 21-22 AS - GG) (144-148). Die genaue
Strukturbestimmung des MtrA-Holoproteins bleibt also nicht nur im Hinblick auf die in
Abhängigkeit von der Oxidationsstufe des gebunden Cobalamin zu erwartenden
Konformationsänderungen interessant.
Zur
röntgenographischen
Strukturbestimmung
von
MJMtrA3
wurden
umfangreiche Kristallisationsversuche unternommen. Zuerst wurden kommerziell
erhältlichen Screens verwendet, wobei jedoch auffiel, dass MJMtrA3 auch nach
Wochen bei nur sehr wenigen Bedingungen präzipitierte. Deshalb wurden die
Proteinpufferlösung,
Proteinkonzentration
und
Lagerungstemperatur
der
Kristallisationsansätze variiert. Da sich auch durch diese Maßnahmen keine
Kristallisation herbeiführen ließ, wurden zwei eigene Screens mit je 96 Bedingungen
entwickelt. Bei der Kristallisation wird die Löslichkeit des Proteins durch Zugabe von
Fällungsmittel stetig verringert, bis die Sättigungsgrenze überschritten und ein
metastabiler Zustand erreicht ist. In diesem Zustand ist die Kristallbildung, jedoch
keine Keimbildung möglich. Bei weiter steigender Fällungsmittelkonzentration geht
das System in einen labilen Zustand über, in dem Keimbildung und -wachstum
möglich werden. Idealerweise findet die Kristallisation im Grenzbereich zwischen
metastabilem und labilem Zustand statt (149). Als Fällungsmittel werden im
allgemeinen
Salze,
wasserlösliche
Polymere
und
organische
Lösungsmittel
verwendet, die mit dem Protein um die Lösungsmittelmoleküle konkurrieren. Daher
wurden bei den selbst entwickelten Screens zum einen zwei Salze (Na/K-Tartrat und
Ammoniumsulfat),
zum
anderen
Ammoniumsulfat
und
Glycerin
jeweils
in
unterschiedlicher Konzentration kombiniert. Doch auch dadurch ließ sich die äußerst
gute Löslichkeit von MJMtrA3 nicht stark genug verringern, um eine Kristallbildung zu
erreichen. Bedenkt man, dass M. jannaschii, der Ursprungsorganismus von
MJMtrA3, ein extremophiles Archaeon ist, erscheint diese Eigenschaft jedoch nicht
verwunderlich.
5.2.3
Des-[238-252]-MtrA (MKMtrA) aus M. kandleri
Die Produktion von des-[238-252]-MtrA (MKMtrA) aus M. kandleri gelang in
E. coli zumindest teilweise als lösliches Protein. Wie SDS-Page und Western Blot mit
Anti-StrepII-Antikörpern jedoch zeigten, betrug das apparente Molekulargewicht von
MKMtrA ca. 16,5 kDa, wogegen sich der anhand der Aminosäuresequenz
94
5 Diskussion
berechnete Wert auf 27 kDa belief. Gründe hierfür könnten eine erhöhte
elektrophoretische Mobilität des korrekt gefalteten Apoproteins sein, wie sie bereits
für MtrA aus M. marburgensis beschrieben wurde (56, 57, 143). Wahrscheinlicher
jedoch ist eine unvollständige Expression des Gens in E. coli, deren Produkte als
niedermolekulare Banden im SDS-Gel auftraten. Bruchstücke, die den C-Terminus
von MKMtrA enthielten, waren aufgrund des StrepII-Anhängsels im Western Blot
nachweisbar.
Die Bindung von MKMtrA an eine Strep-Tactin®-Säule gelang zwar teilweise,
jedoch war eine Reinigung auf diese Weise nicht möglich, da die Bindung nur
unvollständig geschah. Dies könnte dadurch begründet sein, dass der C-Terminus
mit dem StrepII-Anhängsel im gefalteten Zustand nicht richtig zugänglich ist und
deswegen nicht an Strep-Tactin® gebunden werden kann.
Eine MALDI-TOF-Fingerprint-Analyse nach einem Trypsin-Verdau der im
Western Blot sichtbaren Bande sollte Klarheit über das exprimierte Produkt bringen.
MtrA aus M. kandleri konnte mit dieser Methode jedoch nicht eindeutig
nachgewiesen werden. Ein neuerlicher Versuch mittels ESI-MS könnte eventuell
Aufschluss bringen. Aufgrund der bereits auf der Expressionsebene aufgetretenen
Schwierigkeiten wurden die Versuche mit MKMtrA abgebrochen.
Die Untereinheit MtrH des N5-Methyl-H4MPT:CoM-Methyltransferase-
5.3
komplexes
5.3.1
Heterologe Expression
MtrH enthält nur 38,1 % hydrophobe Aminosäurereste und besitzt laut
Sekundärstrukturanalyse keine Transmembranhelices, womit es die hydrophilste
Untereinheit des Methyltransferasekomplexes darstellt (54). Dennoch wurde sowohl
MtrH aus M. marburgensis, als auch aus M. jannaschii und M. kandleri unabhängig
von
den
Wachstumsbedingungen
oder
dem
Induktionssystem
unlöslich
in
Einschlusskörperchen exprimiert. Auch eine in Analogie zur ebenfalls Pterinbindenden
5-Methyltetrahydrofolat
Corrinoid/Eisen-Schwefel-Protein
Methyl-
transferase aus Moorella thermoacetica vorgenommenen Verkürzung um elf
N-terminale Aminosäuren bei M. kandleri MtrH ermöglichte keine lösliche Expression
in E. coli.
Wie sich herausstellte, wurde die Annotation der in dieser Arbeit zur Klonierung
von mtrH aus M. jannaschii verwendeten Sequenz im März 2007 in der Datenbank
(GenBank Nr. NC_000909, (6)) korrigiert. Das in dieser Arbeit heterolog exprimierte
95
5 Diskussion
MJMtrH besitzt deswegen 14 zusätzliche N-terminale Aminosäuren, welche
vermutlich die Faltung des Proteins in E. coli weiter erschwerten.
Zur heterologen Expression von mtrH wurden am Max-Planck-Institut für
terrestrische Mikrobiologie in Marburg bereits zahlreiche Versuche unternommen.
MtrH
aus
M.
marburgensis
wurde
als
Maltosebindeprotein-,
Hexahistidin-,
Calmodulin- und Thioredoxinfusionsprotein in E. coli produziert, ferner wurde eine
Co-Expression mit den Chaperonen GroEL und GroES versucht. Darüber hinaus
wurde mit Methanosarcina barkeri ein weiterer Ursprungsorganismus sowie mit
Aspergillus nidulans ein eukaryotisches Expressionssystem für M. marburgensis
mtrH getestet. In allen aufgeführten Experimenten lag MtrH als unlösliches Protein in
Einschlusskörperchen vor oder wurde erst gar nicht in nennenswerten Mengen
produziert (150).
Alle bisher durchgeführten Experimente lassen vermuten, dass der Unterschied
zwischen Archaeen und Bakterien zu groß ist, um eine heterologe Expression von
mtrH zu ermöglichen. Die Isolierung und Reinigung von nativem MtrH aus dem
Ursprungsorganismus oder ein archaeelles Expressionssystem könnten hier Abhilfe
schaffen.
5.3.2
Rekombinantes MtrH (MMRMtrH) aus M. marburgensis
Rekombinant erzeugtes MtrH aus M. marburgensis (MMRMtrH) lag in
Einschlusskörperchen vor, welche zunächst entfaltet, im entfalteten Zustand
gereinigt und schließlich wieder rückgefaltet werden sollten. Während dieser Schritte
war zwar eine Anreicherung von MMRMtrH zu beobachten, jedoch zeigte sich in der
abschließenden Gelfiltration des rückgefalteten Proteins, dass die Probe nicht
monodispers vorlag. Auch traten bei der Analyse mittels SDS-Page zahlreiche
weitere Banden auf, deren Identität nicht geklärt werden konnte. Diese Heterogenität
der Probe ist wahrscheinlich auf die inkorrekte Faltung und partielle Aggregation des
Proteins zurückzuführen. Hinzu kommen vermutlich Abbauprodukte von MMRMtrH,
da entfaltete Proteine besonders anfällig für Proteasen sind.
Da keine Möglichkeit bestand, die korrekte Faltung des Proteins zu überprüfen,
wurden weitere Rückfaltungs- und Reinigungsversuche eingestellt. Als Alternative zu
rekombinantem MtrH wurde bereits im vorhergehenden Abschnitt die Isolierung und
Reinigung des Proteins aus dem Ursprungsorganismus genannt. Dies wurde bereits
für MtrH aus M. marburgensis beschrieben (65). In genanntem Protokoll wurde der
Mtr-Komplex mit LM solubilisiert und MtrH anschließend chromatographisch auf
Q-Sepharose vom Komplex abgetrennt. Das Abdissoziieren der Untereinheit MtrH
96
5 Diskussion
vom Gesamtkomplex wurde auch in dieser Arbeit beobachtet, allerdings war eine
chromatographische Abtrennung nicht vollständig möglich. Um eine für die
Kristallographie ausreichende Homogenität der Probe zu erhalten, müssten weitere
Reinigungsschritte durchgeführt werden.
Eine weitere Möglichkeit, MtrH aus M. marburgensis nativ zu reinigen, besteht in
der Präparation unter anaeroben Bedingungen zusammen mit der F420-reduzierende
Hydrogenase (Frh). Frh befindet sich als lösliches Enzym nach dem Zellaufschluss in
der
cytosolischen
Reinigungsschritte
Fraktion
bis
zur
und
kann
Homogenität
über
mehrere
aufgereinigt
chromatographische
werden.
Als
störende
Verunreinigung tritt während der Präparation in SDS-Page-Analysen eine Bande von
ca. 35 kDa auf, die mittels MALDI-TOF als die lösliche Untereinheit MtrH des MtrKomplexes identifiziert wurde. Durch Gelfiltration konnte MtrH jedoch von Frh
abgetrennt werden und lag schließlich als monodisperse Probe vor, wie analytische
Gelfiltration und SDS-Page zeigten (Dr. Kezen Ma, Max-Planck-Institut für
terrestrische Mikrobiologie, Marburg, mündliche Mitteilung). Diese Methode unter
aeroben Bedingungen zu reproduzieren gelang innerhalb der vorliegenden Arbeit
nicht, sie gab jedoch interessante Hinweise darauf, dass MtrH sich nach Dissoziation
vom Mtr-Komplex in der cytosolischen Fraktion befindet und an andere, lösliche
Proteine bindet. Es eröffnen sich damit neue Möglichkeiten, MtrH nativ zu reinigen
und z. B. für die Rekonstruktion von MtrA-H aus MtrA-G zu verwenden.
Die F420-abhängige N5,N10-Methylen-H4MPT-Dehydrogenase (KMtd) aus M.
5.4
kandleri
5.4.1
Die Bindung von H4MPT und F420 an KMtd
Ein Vergleich der von Hagemeier et al. (41) veröffentlichten Struktur mit der in
dieser Arbeit gelösten Kristallstruktur von KMtd in Komplex mit Substrat und
Cosubstrat zeigte überraschenderweise, dass die Bindung der verhältnismäßig
sperrigen Moleküle nicht mit signifikanten Konformationsänderungen einher geht. Ein
Grund hierfür könnten die vielfältigen Verknüpfungen der exponierten Bindestelle mit
dem Proteininneren, d. h. mit dem hydrophoben Kern der helicalen Domäne und dem
zentralen β-Faltblatt, sein. Es handelt sich also um ein besonders ausgeprägtes
Beispiel für ein Enzym mit einer vorgegebenen Bindetasche.
Die in dieser Arbeit vorgestellte Struktur des ternären Komplexes aus KMtd,
H4MPT-Derivat und F420 bei 1,8 Å Auflösung sowie eine weitere, hier nicht gezeigte
Struktur des binären Komplexes aus KMtd und H4MPT-Derivat bei einer Auflösung
97
5 Diskussion
von 2,0 Å zeigten keine wesentlichen Unterschiede in der Substratbindung und
-konformation. Es ist davon auszugehen, dass es sich bei dem ternären Komplex um
die aktive Konformation handelte (siehe Abschnitt 5.4 2), sodass entweder MethylenH4MPT oder nach erfolgter Hydridübertragung auf F420 auch Methenyl-H4MPT+
vorgelegen haben könnte, wobei sogar eine Mischung der beiden Derivate denkbar
ist. Eine Unterscheidung von Methylen-H4MPT und Methenyl-H4MPT+ bzw. F420 und
F420H2 war anhand der vorliegenden Strukturen nicht möglich. Allerdings wurden für
die Kristallisation des ternären und des binären Komplexes Methylen-H4MPT und
F420 bzw. F0 bei einem pH-Wert von 6,5, bei welchem das Reaktionsgleichgewicht
auf der Seite von Methenyl-H4MPT+ und F420H2 liegt, verwendet. Dementsprechend
wird im Folgenden von Methenyl-H4MPT+ und F420H2 ausgegangen.
Bei der Struktur von Methenyl-H4MPT+ im Komplex mit KMtd und F420H2 fällt vor
allem die geradlinige Konformation des aus Pterin-, Imidazolidin- und Benzylrest
bestehenden Ringsystems auf. Dies ist umso überraschender, wenn man die
vorliegende Struktur mit denjenigen in wässriger Lösung und im Komplex mit der H2bildenden Dehydrogenase (Hmd) sowie dem H4MPT-abhängigen Formaldehydaktivierenden Enzym (Fae) vergleicht (45, 47). In Lösung und im Komplex mit Hmd
befindet sich zwischen dem Pterin- und dem Imidazolidinring ein Knick mit einem
Winkel von 50° bzw. 40°. Atom C7 weist daher auf die Si-Seite des Moleküls und der
Benzylring befindet sich in äquatorialer Position zum Pterinring. Bei Fae beträgt der
Knickwinkel 70°, wodurch C7 auf der Re-Seite und der Benzylring senkrecht zum
Pterin steht. Bei KMtd dagegen befinden sich alle vier Ringe in nahezu einer Ebene
und C7 weist auf die Re-Seite. Für die Anwesenheit von Methenyl-H4MPT+ in der hier
vorliegenden Kristallstruktur spricht, dass bei diesem ein ausgedehntes, durchgängig
konjugiertes π-Elektronensystem vorliegt, sodass Methenyl-H4MPT+ eher eine flache
Konformation einnehmen kann als Methylen-H4MPT. Das ausgesprochen starre
Polypeptidgerüst von KMtd gibt jedoch für beide Derivate eine geradlinige Anordnung
vor, sodass letztendlich nicht abschließend beurteilt werden kann, ob es sich bei dem
im Komplex mit KMtd gebundenen H4MPT-Derivat um Methylen-H4MPT oder
Methenyl-H4MPT+ handelt, welches aus dem bei der Kristallisation eingesetzten
Methylen-H4MPT durch Oxidation entstanden ist.
F420H2 liegt mit seinem dreigliedrigen Ringsystem in einer gebogenen
Konformation (Butterfly-Konformation) vor. Diese charakteristische Eigenschaft des
komplexgebundenen F420 taucht auch in weiteren Strukturen auf, wobei die
Biegewinkel von 26° in der F420-abhängigen sekundäre Alkoholdehydrogenase (Adf)
über 27° in der Methylen-H4MPT Reduktase (Mer) und 8° in der F420H2:NADP+
Oxidoreduktase (Fno) bis zu 25° in KMtd variieren (43, 151, 152). Der Grund für
98
5 Diskussion
genannte Anordnung könnte sein, dass diese den Van-der-Waals-Kontakt des
äußerst sperrigen H4MPT-Moleküls zum C5-Atom von F420 vereinfacht, ohne eine
Abstoßung oder Überlappung hervorzurufen.
5.4.2
Die Hydrid-Transferreaktion
Alle
bereits
genannten
Methylenpterin-Dehydrogenasen
katalysieren
die
Hydridtransferreaktion in einem über einen ternären Komplex verlaufenden
Mechanismus, welcher voraussetzt, dass der Hydriddonor und -akzeptor in
Van-der-Waals-Kontakt zueinander stehen (71, 73, 74).
Die durch Mtd katalysierte Hydridtransferreaktion findet in einer vollständig
vorgegebenen Bindetasche statt, deren Form durch die Anpassung sowohl an
Methenyl-H4MPT+ als auch an F420H2 bestimmt wird, wie die Überlagerung der
Strukturen mit und ohne Substrat bzw. Cosubstrat zeigten. Methenyl-H4MPT+ und
F420H2 befinden sich Seite an Seite in der Bindetasche und bilden so den ternären, in
kinetischen Studien vorhergesagten Komplex (77). Das H4MPT-Derivat taucht tiefer
in die Bindetasche ein als das Cosubstrat und wird vermutlich als erstes eingebettet.
Anschließend dringt F420 in die Bindetasche ein und wird größtenteils durch
Wechselwirkungen mit Methylen-H4MPT gebunden. Die Annahmen zu dieser Art von
substratinduzierter Bindung werden durch die Beobachtungen bei mehreren
Versuchen zur Substratbindung im kristallinen Zustand, bei denen F420 nur gebunden
werden konnte, wenn Methylen-H4MPT bereits im aktiven Zentrum vorlag,
unterstützt. Dennoch wirkt das hier postulierte Szenario überraschend, da z. B. in der
Methylen-H4MPT Reduktase (Mer), welche die Reduktion von Methylen-H4MPT zu
Methyl-H4MPT über F420H2 katalysiert, die Reihenfolge der Bindung umgekehrt
erfolgt.
Die Ringsysteme des Substrats und des Cosubstrats sind dicht gepackt in einer
Weise angeordnet, dass die Re-Seite von Methenyl-H4MPT+ der Si-Seite von F420H2
gegenüberliegt. Die immer noch unbeantwortete Frage, warum im Gegensatz zu
über FAD und NADP verlaufenden Reaktionen (153) der Hydridtransfer bei F420
immer auf der Si-Seite des Moleküls stattfindet, d. h. der pro-S-Wasserstoff
übertragen wird, bleibt weiterhin offen, obwohl in der in dieser Arbeit gelösten
Struktur die Bauweise des aktiven Zentrums eine Bindung von F420H2 nur in der oben
beschriebenen Orientierung erlaubt.
Die Ringsysteme von Methenyl-H4MPT+ und F420H2 sind näherungsweise
rechtwinklig zueinander angeordnet. Die katalytisch aktiven Imidazolidin- und
Pyridinringe liegen versetzt zueinander und bilden einen Winkel von 165-170°,
99
5 Diskussion
sodass die meisten der Ringatome in Van-der-Waals-Kontakt zueinander stehen. Die
mit 3,43 Å kürzeste Distanz befindet sich zwischen den am Hydridtransfer beteiligten
Atomen C5 und C10. Der Imidazolidinring liegt in sehr schwach ausgeprägter
Envelope-Konformation vor, wobei das aufgeklappte C10 minimal zur Re-Seite hin
orientiert ist. Anhand der Strukturdaten ist letztendlich nicht ersichtlich, warum C10
nicht dieselbe Stereokonformation wie in Lösung auf der Si-Seite einnimmt. Die
Konformationen der Ringe bestimmen im Wesentlichen die Positionen der
Wasserstoffatome an C10 und C5, sodass daran die Hydridübertragung direkt
beobachtet werden kann. Die für einen Hydridtransfer plausible Geometrie spricht
dafür, dass die Kristallstruktur die Konformation vor der Reaktion widerspiegelt.
Keiner der Aminosäurereste scheint direkt an der Hydridübertragungsreaktion
beteiligt zu sein. Die Hauptaufgabe der Polypeptidkette ist somit, die sperrigen
Methylen-H4MPT- und F420-Moleküle in für eine Hydridübertragung optimalem
Abstand und bestmöglicher Orientierung auszurichten, was durch das feine
Zusammenspiel vieler Aminosäurereste erreicht wird. Die starre Bindungstasche
erscheint genau dafür geeignet, die Ringe in Konformationen mit Van-der-WaalsKontakt zwischen den an der Hydridübertragung beteiligten Atomen einerseits aber
ohne Zusammenstöße andererseits zu zwingen. Die Butterfly-Konformation von
F420H2 und die vergleichsweise flache Geometrie von Methenyl-H4MPT+ sind also
unabdingbare Vorraussetzungen für die Katalyse. Ein Knick zwischen dem Pterinund dem Imidazolidinring wie von Methylen-H4MPT in Lösung und in dem H4MPTabhängigen
Formaldehyd-aktivierenden
Enzym
(Fae)
würde
zu
einem
Zusammenprall mit F420H2 führen oder die hydridübertragenden C-Atome außerhalb
des notwendigen Van-der-Waals-Abstands rücken. Eine weitere Aufgabe der
Polypeptidkette ist darüber hinaus, durch die Aminosäurereste Pro73, Leu125 und
Glu26 die Atome C5 und C10 soweit zusammen zu drängen, dass deren
Van-der-Waals-Radien
überlappen,
die
Katalyse
also
gleichsam
durch
stereoelektronische Effekte verbessert wird. Die Auflösung der Kristallstruktur von
1,8 Å reicht jedoch nicht aus, eine für die Reaktionskatalyse eventuell maßgebliche
Verformung der beteiligten Ringe zu ermitteln, wie sie z. B. in anderen Enzymen, die
eine Hydridübertragung zwischen sperrigen Lösungsmittelmolekülen katalysieren,
vorkommt.
100
5 Diskussion
5.5
Ausblick
Mit
der
in
dieser
Arbeit
entwickelten
Methode
zur
Reinigung
des
5
N -Methyl-H4MPT:Coenzym M-Methyltransferasekomplexes ohne Untereinheit MtrH
(MtrA-G) konnte das Abdissoziieren derselben Untereinheit besser als im für die
Reinigung unter anaeroben Bedingungen etablierten Protokoll kontrolliert werden.
Die bisherigen Komplexreinigungsversuche beschränkten sich auf M. marburgensis
als Ursprungsorganismus, es bestünde jedoch die Möglichkeit, auf M. jannaschii
oder M. kandleri auszuweichen und so noch bessere Ergebnisse entweder im Bezug
auf die vollständige Abtrennung der Untereinheit MtrH oder auf die homogene
Präparation des Mtr-Komplexes mit MtrH zu erzielen.
Mit dem nun zur Verfügung stehenden Protokoll zur Reinigung des MtrKomplexes ohne Untereinheit MtrH rückt zum ersten Mal eine Strukturaufklärung in
den Bereich des Möglichen. Zum einen schafft die deutlich verbesserte Homogenität
der Probe die Vorraussetzungen für eine Kristallisation zur Röntgenstrukturanalyse.
Hier kämen unter anderem speziell für Membranproteine geeignete Methoden wie
Lipidic cubic phase- und Lipidic sponge phase-Kristallisation in Frage.
Auch
bei
der
elektronenmikroskopischen
Einzelpartikelmessung
ist
die
Einheitlichkeit der Probe von entscheidender Bedeutung, sodass hier ebenso die
Hoffnung besteht, mit dem Mtr-Komplex ohne MtrH bessere Ergebnisse als die
bisher erbrachten zu erzielen. Neben der Einzelpartikelmessung wäre MtrA-G
überdies
für
die
2D-Kristallisation
und
eine
anschließende
elektronenkristallographische Analyse geeignet. Mit den Anti-MtrH-Antikörpern
besteht darüber hinaus die Möglichkeit, MtrH durch eine Markierung mit an
sekundäre Antikörper gebundenen Goldatomen in elektronenmikroskopischen
Aufnahmen von MtrA-H zu lokalisieren und so weitere strukturelle Informationen zu
erhalten.
Die Untereinheit MtrA aus M. jannaschii konnte ohne die C-terminale
Transmembranhelix als lösliches Protein in E. coli produziert und als Holoprotein bis
zur Homogenität gereinigt werden. Zur Kristallisation kam es jedoch vermutlich
aufgrund der außergewöhnlich guten Löslichkeit nicht. Bei M. kandleri MtrA gelang
die Herstellung von geringen Mengen teilweise löslichen StrepII-Fusionsproteins
ohne C-terminale Transmembranhelix in E. coli. Eine Veränderung in der
Kombination von Vektor und Wirtsstamm oder der Wechsel zu einem archaeellen
Expressionssystem könnten die Expression von M. kandleri MtrA soweit verbessern,
dass eine Reinigung und anschließende Kristallisationsversuche ermöglicht würden.
101
5 Diskussion
Zur heterologen Expression der Untereinheit MtrH wurden neben den Versuchen
in dieser Arbeit bereits zahlreiche Varianten getestet. Eine Produktion als lösliches
Protein war in keinem der Fälle möglich. Auch durch Entfaltung und Rückfaltung des
in Einschlusskörperchen exprimierten Proteins konnte dieses nicht bis zur
Homogenität
aufgereinigt
werden.
Neben
der
Nutzung
eines
archaeellen
Expressionssystems verbleiben als Alternative die Isolierung und Reinigung aus dem
Ursprungsorganismus, zu der im Abschnitt 5.3.2 Ansätze angedeutet wurden. Bis zu
Homogenität gereinigtes MtrH könnte zur Rekonstruktion des Gesamtkomplexes
MtrA-H aus MtrA-G verwendet werden und somit eine Lösung für die Schwierigkeit
der Präparation des Mtr-Komplexes mit allen acht Untereinheiten bieten.
Die
Kristallstruktur
des
ternären
Komplexes
aus
der
F420-abhängigen
N5,N10-Methylen-H4MPT-Dehydrogenase aus M. kandleri (KMtd), dem Substrat
Methenyl-H4MPT+ und dem Cosubstrat F420H2 konnte in dieser Arbeit gelöst werden.
Die Polypetidkette ist nur indirekt durch Beeinflussung der Konformation und
Orientierung von Methenyl-H4MPT+ und F420H2 an der Hydridübertragung beteiligt,
sodass sich KMtd überraschenderweise als Beispiel für ein Enzym mit ungewöhnlich
starrer, vorgegebener Bindetasche erwies. Methenyl-H4MPT+ und F420H2 sind in
katalytisch aktiver Konformation gebunden, jedoch reichte die Auflösung der
Kristallstruktur nicht aus, um zu beurteilen, ob Methylen-H4MPT und F420 oder nach
erfolgter Hydridübertragung Methenyl-H4MPT+ und F420H2 vorlagen. Neben der
Verbesserung der Auflösung wäre also auch die Co-Kristallisation von KMtd mit
Methenyl-H4MPT+ ohne F420 interessant, um zu ergründen, ob dieses in wesentlich
anderer Konformation als das in der vorliegenden Struktur gebundene H4MPTDerivat vorliegt, wenn keine Möglichkeit einer Hydridübertragungsreaktion besteht.
Anhand dieser Ergebnisse könnten dann eventuell weitere Rückschlüsse auf den
Zusammenhang zwischen Konformation und Oxidationszustand der H4MPT-Derivate
gezogen sowie zum ersten Mal eine röntgenkristallographische Struktur von
Methenyl-H4MPT+ beschrieben werden.
102
6 Literatur
6 Literatur
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Woese, C. R., Kandler, O., and Wheelis, M. L. (1990) Towards a natural
system of organisms: proposal for the domains Archaea, Bacteria, and
Eucarya, Proc Natl Acad Sci U S A 87, 4576-4579.
Wasserfallen, A., Noelling, J., Pfister, P., Reeve, J., and de Macario, E. C.
(2000) Phylogenetic analysis of 18 thermophilic Methanobacterium isolates
supports the proposals to create a new genus, Methanothermobacter gen.
nov., and to reclassify several isolates in three species, Methanothermobacter
thermautotrophicus comb. nov., Methanothermobacter wolfeii comb. nov.,
and Methanothermobacter marburgensis sp. nov., Int J Syst Evol Microbiol
50, 43–53.
Stettler, R., and Leisinger, T. (1992) Physical Map of the Methanobacterium
thermoautotrophicum Marburg Chromosome, J Bacteriol 174, 7227-7234.
Zeikus, J. G., and Wolfe, R. S. (1972) Methanobacterium
thermoautotrophicus sp. n., an anaerobic, autotrophic, extreme thermophile,
J Bacteriol 109, 707-715.
Schönheit, P., Moll, J., and Thauer, R. K. (1980) Growth parameters (Ks, μmax,
Ys) of Methanobacterium thermoautotrophicum, Arch Microbiol 127, 59-65.
Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D.,
Sutton, G. G., Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D.,
Kerlavage, A. R., Dougherty, B. A., Tomb, J. F., Adams, M. D., Reich, C. I.,
Overbeek, R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A.,
Scott, J. L., Geoghagen, N. S., and Venter, J. C. (1996) Complete genome
sequence of the methanogenic archaeon, Methanococcus jannaschii,
Science 273, 1058-1073.
Jones, W. J., Leigh, J. A., Mayer, F., Woese, C. R., and Wolfe, R. S. (1983)
Methanococcus jannaschii sp. nov., an extremely thermophilic methanogen
from a submarine hydrothermal vent, Arch Microbiol 136, 254-261.
Huber, R., Kurr, M., Jannasch, H. W., and Stetter, K. O. (1989) A novel group
of abyssal methanogenic archaebacteria (Methanopyrus) growing at 110 °C
Nature 342, 833.
Kurr, M., Huber, R., Koenig, H., Jannasch, H. W., Fricke, H., Trineone, A.,
Kristjansson, J. K., and Stetter, K. O. (1991) Methanopyrus kandleri, gen. and
sp. nov. represents a novel group of hyperthermophilic methanogens,
growing at 110 °C, Arch Microbiol 156, 239.
Ferry, J. G. (1993) Methanogenesis. Ecology, physiology, biochemistry and
genetics, Chapman and Hall, New York.
Thauer, R. K. (1998) Biochemistry of methanogenesis: a tribute to Marjory
Stephenson. 1998 Marjory Stephenson Prize Lecture, Microbiology 144
( Pt 9), 2377-2406.
Thauer, R. K., Kaster, A.-K., Seedorf, H., Buckel, W., and Hedderich, R.
(2008) Methanogenic archaea: ecologically relevant differences in energy
conservation, Nature Reviews Microbiol 6, 579-592.
Vorholt, J. A., Vaupel, M., and Thauer, R. K. (1996) A polyferredoxin with
eight [4Fe-4S] clusters as a subunit of molybdenum formylmethanofuran
dehydrogenase from Methanosarcina barkeri, Eur J Biochem 236, 309-317.
Hochheimer, A., Linder, D., Thauer, R. K., and Hedderich, R. (1996) The
molybdenum formylmethanofuran dehydrogenase operon and the tungsten
formylmethanofuran dehydrogenase operon from Methanobacterium
thermoautotrophicum.
Structures
and
transcriptional
regulation,
Eur J Biochem 242, 156-162.
103
6 Literatur
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Breitung, J., and Thauer, R. K. (1990) Formylmethanofuran:
tetrahydromethanopterin formyltransferase from Methanosarcina barkeri.
Identification of N5-formyltetrahydromethanopterin as the product, FEBS Lett
275, 226-230.
Breitung, J., Borner, G., Scholz, S., Linder, D., Stetter, K. O., and
Thauer, R. K. (1992) Salt dependence, kinetic properties and catalytic
mechanism
of
N-formylmethanofuran:tetrahydromethanopterin
formyltransferase from the extreme thermophile Methanopyrus kandleri,
Eur J Biochem 210, 971-981.
Breitung, J., Schmitz, R. A., Stetter, K. O., and Thauer, R. K. (1991)
N5,N10-Methenyltetrahydromethanopterin cyclohydrolase from the extreme
thermophile Methanopyrus kandleri: increase of catalytic efficiency (kcat/KM)
and thermostability in the presence of salts, Arch Microbiol 156, 517-524.
Zirngibl, C., Van Dongen, W., Schwörer, B., Von Bünau, R., Richter, M.,
Klein,
A.,
and
Thauer,
R.
K.
(1992)
H2-forming
methylenetetrahydromethanopterin dehydrogenase, a novel type of
hydrogenase without iron-sulfur clusters in methanogenic archaea,
Eur J Biochem 208, 511-520.
Shima, S., Pilak, O., Vogt, S., Schick, M., Stagni, M. S., Meyer-Klaucke, W.,
Warkentin, E., Thauer, R. K., and Ermler, U. (2008) The crystal structure of
[Fe]-hydrogenase reveals the geometry of the active site, Science 321,
572-575.
Shima, S., Warkentin, E., Grabarse, W., Sordel, M., Wicke, M., Thauer, R. K.,
and Ermler, U. (2000) Structure of coenzyme F420 dependent
methylenetetrahydromethanopterin reductase from two methanogenic
archaea, J Mol Biol 300, 935–950.
Ermler, U., Merckel, M. C., Thauer, R. K., and Shima, S. (1997) Crystal
Structure of methyl-coenzyme M reductase: the key enzyme of biological
methane formation, Structure 5, 635–646.
Hoehler, T. M., Alperin, M. J., Albert, D. B., and Martens, C. S. (1998)
Thermodynamic control on hydrogen concentrations in anoxic sediments,
Geochim Cosmochim Acta 62, 1745-1756.
Conrad, R. (1999) Contribution of hydrogen to methane production and
control of hydrogen concentrations in methanogenic soils and sediments,
FEMS Microbiol Ecol 28, 193-303.
Kaesler, B., and Schönheit, P. (1989) The role of sodium ions in
methanogenesis. Formaldehyde oxidation to CO2 and 2 H2 in methanogenic
bacteria is coupled with primary electrogenic Na+ translocation at a
stoichiometry of 2-3 Na+/CO2, Eur J Biochem 184, 223-232.
Sapra, R., Bagramyan, K., and Adams, M. W. (2003) A simple energyconserving system: proton reduction coupled to proton translocation,
Proc Natl Acad Sci U S A 100, 7545-7550.
Li, F., Hinderberger, J., Seedorf, H., Zhang, J., Buckel, W., and Thauer, R. K.
(2008) Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with
NADH catalyzed by the butyryl-CoA dehydrogenase/Etf complex from
Clostridium kluyveri, J Bacteriol 190, 843-850.
Schönheit, P., and Beimborn, D. B. (1985) Presence of a Na+/H+ antiporter in
Methanobacterium thermoautotrophicum and its role in Na+ dependent
methanogenesis, Arch Microbiol 142, 354-361.
Schönheit, P., and Perskia, H. J. (1983) ATP synthesis driven by a potassium
diffusion potential in Methanobacterium thermoautotrophicum is stimulated by
sodium, FEMS Microbiol Lett 20, 263-267.
Gorris, L. G., Voet, A. C., and van der Drift, C. (1991) Structural
characteristics of methanogenic cofactors in the non-methanogenic
archaebacterium Archaeoglobus fulgidus, Biofactors 3, 29-35.
104
6 Literatur
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
Thauer, R. K., and Kunow, J. (1995) in Sulfate Reducing Bacteria
(Barton, L. L., Ed.), pp 33-48, Plenum Press, New York.
Chistoserdova, L., Vorholt, J. A., Thauer, R. K., and Lidstrom, M. E. (1998)
C1 transfer enzymes and coenzymes linking methylotrophic bacteria and
methanogenic Archaea, Science 281, 99-102.
Vorholt, J. A., Chistoserdova, L., Stolyar, S. M., Thauer, R. K., and
Lidstrom, M. E. (1999) Distribution of tetrahydromethanopterin-dependent
enzymes in methylotrophic bacteria and phylogeny of methenyl
tetrahydromethanopterin cyclohydrolases, J Bacteriol 181, 5750-5757.
Krüger, M., Meyerdierks, A., Glockner, F. O., Amann, R., Widdel, F.,
Kube, M., Reinhardt, R., Kahnt, J., Bocher, R., Thauer, R. K., and Shima, S.
(2003) A conspicuous nickel protein in microbial mats that oxidize methane
anaerobically, Nature 426, 878-881.
Boetius, A., Ravenschlag, K., Schubert, C. J., Rickert, D., Widdel, F.,
Gieseke, A., Amann, R., Jorgensen, B. B., Witte, U., and Pfannkuche, O.
(2000) A marine microbial consortium apparently mediating anaerobic
oxidation of methane, Nature 407, 623-626.
Michaelis, W., Seifert, R., Nauhaus, K., Treude, T., Thiel, V., Blumenberg, M.,
Knittel, K., Gieseke, A., Peterknecht, K., Pape, T., Boetius, A., Amann, R.,
Jorgensen, B. B., Widdel, F., Peckmann, J., Pimenov, N. V., and Gulin, M. B.
(2002) Microbial reefs in the Black Sea fueled by anaerobic oxidation of
methane, Science 297, 1013-1015.
Chistoserdova, L., Jenkins, C., Kalyuzhnaya, M. G., Marx, C. J., Lapidus, A.,
Vorholt, J. A., Staley, J. T., and Lidstrom, M. E. (2004) The enigmatic
planctomycetes may hold a key to the origins of methanogenesis and
methylotrophy, Mol Biol Evol 21, 1234-1241.
Maden, B. E. (2000) Tetrahydrofolate and tetrahydromethanopterin
compared: functionally distinct carriers in C1 metabolism, Biochem J 350 Pt 3,
609-629.
Thauer, R. K., Klein, A. R., and Hartmann, G. C. (1996) Reactions with
molecular hydrogen in microorganisms: Evidence for a purely organic
hydrogenation catalyst, Chemical reviews 96, 3031-3042.
Ermler, U., Merckel, M., Thauer, R., and Shima, S. (1997)
Formylmethanofuran: tetrahydromethanopterin formyltransferase from
Methanopyrus kandleri - new insights into salt-dependence and
thermostability, Structure 5, 635-646.
Grabarse, W., Vaupel, M., Vorholt, J. A., Shima, S., Thauer, R. K.,
Wittershagen, A., Bourenkov, G., Bartunik, H. D., and Ermler, U. (1999) The
crystal structure of methenyltetrahydromethanopterin cyclohydrolase from the
hyperthermophilic archaeon Methanopyrus kandleri, Structure 7, 1257-1268.
Hagemeier, C. H., Shima, S., Thauer, R. K., Bourenkov, G., Bartunik, H. D.,
and
Ermler,
U.
(2003)
Coenzyme
F420-dependent
methylenetetrahydromethanopterin dehydrogenase (Mtd) from Methanopyrus
kandleri: a methanogenic enzyme with an unusual quarternary structure,
J Mol Biol 332, 1047-1057.
Pilak, O., Mamat, B., Vogt, S., Hagemeier, C. H., Thauer, R. K., Shima, S.,
Vonrhein, C., Warkentin, E., and Ermler, U. (2006) The crystal structure of the
apoenzyme of the iron-sulphur cluster-free hydrogenase, J Mol Biol 358,
798-809.
Aufhammer, S. W., Warkentin, E., Ermler, U., Hagemeier, C. H.,
Thauer, R. K.,
and
Shima,
S.
(2005)
Crystal
structure
of
methylenetetrahydromethanopterin reductase (Mer) in complex with
coenzyme F420: Architecture of the F420/FMN binding site of enzymes within
the nonprolyl cis-peptide containing bacterial luciferase family, Protein Sci 14,
1840-1849.
105
6 Literatur
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
Ermler, U., Hagemeier, C. H., Roth, A., Demmer, U., Grabarse, W.,
Warkentin, E., and Vorholt, J. A. (2002) Structure of methylenetetrahydromethanopterin
dehydrogenase
from
Methylobacterium
extorquens AM1, Structure 10, 1127-1137.
Acharya, P., Goenrich, M., Hagemeier, C. H., Demmer, U., Vorholt, J. A.,
Thauer, R. K., and Ermler, U. (2005) How an enzyme binds the C1 carrier
tetrahydromethanopterin. Structure of the tetrahydromethanopterindependent formaldehyde-activating enzyme (Fae) from Methylobacterium
extorquens AM1, J Biol Chem 280, 13712-13719.
Acharya, P., Warkentin, E., Ermler, U., Thauer, R. K., and Shima, S. (2006)
The
structure
of
formylmethanofuran:
tetrahydromethanopterin
formyltransferase in complex with its coenzymes, J Mol Biol 357, 870-879.
Bartoschek, S., Buurman, G., Thauer, R. K., Geierstanger, B. H.,
Weyrauch, J. P., Griesinger, C., Nilges, M., Hutter, M. C., and Helms, V.
(2001) Re-face stereospecificity of methylene-tetrahydromethanopterin and
methylene-tetrahydrofolate dehydrogenases is predetermined by intrinsic
properties of the substrate, Chembiochem 2, 530-541.
Dimroth, P. (1982) The generation of an electrochemical gradient of sodium
ions upon decarboxylation of oxaloacetate by the membrane-bound and
Na+-activated oxaloacetate decarboxylase from Klebsiella aerogenes,
Eur J Biochem 121, 443-449.
Hilpert, W., and Dimroth, P. (1983) Purification and characterization of a new
sodium-transport decarboxylase. Methylmalonyl-CoA decarboxylase from
Veillonella alcalescens, Eur J Biochem 132, 579-587.
Buckel, W., and Semmler, R. (1983) Purification, characterisation and
reconstitution of glutaconyl-CoA decarboxylase, a biotin-dependent sodium
pump from anaerobic bacteria, Eur J Biochem 136, 427-434.
Tokuda, H., and Unemoto, T. (1982) Characterization of the respirationdependent Na+ pump in the marine bacterium Vibrio alginolyticus,
J Biol Chem 257, 10007-10014.
Ken-Dror, S., Lanyi, J. K., Schobert, B., Silver, B., and Avi-Dor, Y. (1986) An
NADH:quinone oxidoreductase of the halotolerant bacterium Ba1 is
specifically dependent on sodium ions, Arch Biochem Biophys 244, 766-772.
Dimroth, P., and Thomer, A. (1989) A primary respiratory Na+ pump of an
anaerobic bacterium: the Na+-dependent NADH:quinone oxidoreductase of
Klebsiella pneumoniae, Arch Microbiol 151, 439-444.
Harms, U., Weiss, D. S., Gärtner, P., Linder, D., and Thauer, R. K. (1995)
The energy conserving N5-methyltetrahydromethanopterin:coenzyme M
methyltransferase complex from Methanobacterium thermoautotrophicum is
composed of eight different subunits, Eur J Biochem 228, 640-648.
Harms, U., and Thauer, R. K. (1997) Identification of the active site histidine
in the corrinoid protein MtrA of the energy-conserving methyltransferase
complex from Methanobacterium thermoautotrophicum, Eur J Biochem 250,
783-788.
Gärtner, P., Ecker, A., Fischer, R., Linder, D., Fuchs, G., and Thauer, R. K.
(1993)
Purification
and
properties
of
5
N -methyltetrahydromethanopterin:coenzyme M methyltransferase from
Methanobacterium thermoautotrophicum, Eur J Biochem 213, 537-545.
Gärtner, P., Weiss, D. S., Harms, U., and Thauer, R. K. (1994)
N5-Methyltetrahydromethanopterin:coenzyme M methyltransferase from
Methanobacterium thermoautotrophicum. Catalytic mechanism and sodium
ion dependence, Eur J Biochem 226, 465-472.
106
6 Literatur
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
Weiss, D. S., Gärtner, P., and Thauer, R. K. (1994) The energetics and
sodium-ion dependence of N5-methyltetrahydromethanopterin:coenzyme M
methyltransferase studied with cob(I)alamin as methyl acceptor and
methylcob(III)alamin as methyl donor, Eur J Biochem 226, 799-809.
Becher,
B.,
Müller,
V.,
and
Gottschalk,
G.
(1992)
N5-Methyltetrahydromethanopterin:coenzyme
M
methyltransferase
of
Methanosarcina strain Gö1 is an Na+-translocating membrane protein,
J Bacteriol 174, 7656-7660.
Lienard, T., Becher, B., Marschall, M., Bowien, S., and Gottschalk, G. (1996)
Sodium ion translocation by N5-methyltetrahydromethanopterin: coenzyme M
methyltransferase from Methanosarcina mazei Gö1 reconstituted in ether lipid
liposomes, Eur J Biochem 239, 857-864.
Stupperich, E., Juza, A., Hoppert, M., and Mayer, F. (1993) Cloning,
sequencing and immunological characterization of the corrinoid-containing
subunit
of
the
N5-methyltetrahydromethanopterin:
coenzyme
M
methyltransferase
from
Methanobacterium
thermoautotrophicum,
Eur J Biochem 217, 115-121.
Harms, U., and Thauer, R. K. (1996) The corrinoid-containing 23-kDa subunit
MtrA of the energy-conserving N5-methy1tetrahydromethanopterin:coenzyme
M methyltransferase complex from Methanobacterium thermoautotrophicum.
EPR spectroscopic evidence for a histidine residue as a cobalt ligand of the
cobamide, Eur J Biochem 241, 149-154.
Sauer, K., and Thauer, R. K. (1998) His84 rather than His35 is the active site
histidine in the corrinoid protein MrtA of the energy conserving
methyltransferase complex from Methanobacterium thermoautotrophicum,
FEBS Lett 436, 401-402.
Sauer, K., Harms, U., and Thauer, R. K. (1997) Methanol:coenzyme M
methyltransferase from Methanosarcina barkeri. Purification, properties and
encoding genes of the corrinoid protein MT1, Eur J Biochem 243, 670-677.
Hippler, B., and Thauer, R. K. (1999) The energy conserving
methyltetrahydromethanopterin:coenzyme M methyltransferase complex from
methanogenic archaea: function of the subunit MtrH, FEBS Lett 449,
165-168.
Vallee, B. L., and Auld, D. S. (1990) Active-site zinc ligands and activated
H2O of zinc enzymes, Proc Natl Acad Sci U S A 87, 220-224.
Di Berardino, M., and Dimroth, P. (1996) Aspartate 203 of the oxaloacetate
decarboxylase beta-subunit catalyses both the chemical and vectorial
reaction of the Na+ pump, EMBO J 15, 1842-1849.
Braune, A., Bendrat, K., Rospert, S., and Buckel, W. (1999) The sodium ion
translocating glutaconyl-CoA decarboxylase from Acidaminococcus
fermentans: cloning and function of the genes forming a second operon,
Mol Microbiol 31, 473-487.
Hoppe, J., and Sebald, W. (1984) The proton conducting F0-part of bacterial
ATP synthases, Biochimica et biophysica acta 768, 1-27.
Gottschalk, G., and Thauer, R. K. (2001) The Na+-translocating
methyltransferase complex from methanogenic archaea, Biochimica et
biophysica acta 1505, 28-36.
Zirngibl,
C.,
Hedderich,
R.,
and
Thauer,
R.
K.
(1990)
N5,N10-Methylenetetrahydromethanopterin
dehydrogenase
from
Methanobacterium thermoautotrophicum has hydrogenase activity, FEBS Lett
261, 112-116.
107
6 Literatur
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
Mukhopadhyay, B., and Daniels, L. (1989) Aerobic purification of
N5,N10-methylenetetrahydromethanopterin dehydrogenase, separated from
N5,N10-methylenetetrahydromethanopterin
cyclohydrolase,
from
Methanobacterium thermoautotrophicum strain Marburg, Can J Microbiol 35,
499-507.
Vorholt, J. A., Chistoserdova, L., Lidstrom, M. E., and Thauer, R. K. (1998)
The NADP-dependent methylene tetrahydromethanopterin dehydrogenase in
Methylobacterium extorquens AM1, J Bacteriol 180, 5351-5356.
Tan, L. U., Drury, E. J., and MacKenzie, R. E. (1977)
Methylenetetrahydrofolate
dehydrogenase-methenyltetrahydrofolate
cyclohydrolase-formyltetrahydrofolate synthetase. A multifunctional protein
from porcine liver, J Biol Chem 252, 1117-1122.
Kunow, J., Schwörer, B., Setzke, E., and Thauer, R. K. (1993) Si-face
stereospecificity at C5 of coenzyme F420 for F420-dependent
N5,N10-methylenetetrahydromethanopterin dehydrogenase, F420-dependent
N5,N10-methylenetetrahydromethanopterin
reductase
and
F420H2:dimethylnaphthoquinone oxidoreductase, Eur J Biochem 214,
641-646.
Klein, A. R., and Thauer, R. K. (1995) Re-face specificity at C14a of
methylenetetrahydromethanopterin and Si-face specificity at C5 of coenzyme
F420 for coenzyme F420-dependent methylenetetrahydromethanopterin
dehydrogenase from methanogenic Archaea, Eur J Biochem 227, 169-174.
Klein, A. R., Koch, J., Stetter, K. O., and Thauer, R. K. (1993) Two
N5,N10-methylenetetrahydromethanopterin dehydrogenases in the extreme
thermophile Methanopyrus kandleri: characterization of the coenzyme
F420-dependent enzyme, Arch Microbiol 160, 186-192.
DiMarco, A. A., Bobik, T. A., and Wolfe, R. S. (1990) Unusual coenzymes of
methanogenesis, Annual review of biochemistry 59, 355-394.
Afting, C., Hochheimer, A., and Thauer, R. K. (1998) Function of H2-forming
methylene-tetrahydromethanopterin dehydrogenase from Methanobacterium
thermoautotrophicum in coenzyme F420 reduction with H2, Arch Microbiol 169,
206-210.
von Bünau, R., Zirngibl, C., Thauer, R. K., and Klein, A. (1991) Hydrogenforming and coenzyme-F420-reducing methylene tetrahydromethanopterin
dehydrogenase are genetically distinct enzymes in Methanobacterium
thermoautotrophicum (Marburg), Eur J Biochem 202, 1205-1208.
Livingston, D. J., Fox, J. A., Orme-Johnson, W. H., and Walsh, C. T. (1987)
8-Hydroxy-5-deazaflavin-reducing hydrogenase from Methanobacterium
thermoautotrophicum: 2. Kinetic and hydrogen-transfer studies, Biochemistry
26, 4228-4237.
Enßle, M., Zirngibl, C., Linder, D., and Thauer, R. K. (1991) Coenzyme F420
dependent N5,N10-methylenetetrahydromethanopterin dehydrogenase in
methanol grown Methanosarcina barkeri, Annu Rev Microbiol 155, 483-490.
Te Brommelstroet, B. W., Geerts, W. J., Keltjens, J. T., van der Drift, C., and
Vogels,
G.
D.
(1991)
Purification
and
properties
of
N5,N10-methylenetetrahydromethanopterin
dehydrogenase
and
N5,N10-methylenetetrahydromethanopterin
reductase,
two
coenzyme
F420-dependent enzymes, from Methanosarcina barkeri, Biochimica et
biophysica acta 1079, 293-302.
Schwörer, B., Breitung, J., Klein, A. R., Stetter, K. O., and Thauer, R. K.
(1993) Formylmethanofuran: tetrahydromethanopterin formyltransferase and
N5,N10-methylenetetrahydromethanopterin dehydrogenase from the sulfatereducing Archaeoglobus fulgidus: similarities with the enzymes from
methanogenic Archaea, Arch Microbiol 159, 225-232.
108
6 Literatur
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
Altschul, S. F., Madden, T. L., Schaeffer, A. A., Zhang, J. H., Zhang, Z.,
Miller, W., and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs., Nucleic Acids Res 25,
3389-3402.
Schaeffer, A. A., Aravind, L., Madden, T. L., Shavirin, S., Spouge, J. L., Wolf,
Y. I., Koonin, E. V., and Altschul, S. F. (2001) Improving the accuracy of PSIBLAST protein database searches with composition-based statistics and
other refinements, Nucleic Acids Res 29, 2994-3005.
Tatusova, T. A., and Madden, T. L. (1999) Blast 2 sequences - a new tool for
comparing protein and nucleotide sequences, FEMS Microbiol Lett 174
247-250
(1994) The CCP4 suite: programs for protein crystallography, Acta
Crystallogr D 50, 760-763.
Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular
graphics, Acta Crystallogr D 60, 2126-2132.
Holm, L., and Sander, C. (1993) Protein structure comparison by alignment of
distance matrices, J Mol Biol 233, 123-138.
Holm, L. (1998) Unification of protein families, Curr Opin Struct Biol 8,
372-379.
Rost, B., Yachdav, G., and Liu, J. (2004) The PredictProtein Server, Nucleic
Acids Res 32, W321-W326.
Rost, B. (1996) PHD: Predicting one-dimensional protein structure by profile
based neural networks, Computer Methods for Macromolecular sequence
analysis 266, 525-539.
Hirokawa, T., Boon-Chieng, S., and Mitaku, S. (1998) SOSUI: classification
and secondary structure prediction system for membrane proteins,
Bioinformatics 14, 378-379.
Mitaku, S., and Hirokawa, T. (1999) Physicochemical factors for
discriminating between soluble and membrane proteins: hydrophobicity of
helical segments and protein length, Protein Eng 11.
Mitaku, S., Hirokawa, T., and Tsuji, T. (2002) Amphiphilicity index of polar
amino acids as an aid in the characterization of amino acid preference at
membrane-water interfaces., Bioinformatics 18, 608-616.
Schüttelkopf, A. W., and van Aalten, D. M. (2004) PRODRG: a tool for highthroughput crystallography of protein-ligand complexes, Acta Crystallogr D
60, 1355-1363.
Stothard, P. (2000) The Sequence Manipulation Suite: JavaScript programs
for analyzing and formatting protein and DNA sequences, Biotechniques 28,
1102-1104.
Kabsch, W. (1993) Automatic processing of rotation diffraction data from
crystals of initially unknown symmetry and cell constants, J Appl Cryst 26,
795-800.
Bernard, P., Gabant, P., Bahassi, E. M., and Couturier, M. (1994) Positiveselection vectors using the F plasmid ccdB killer gene, Gene 148, 71-74.
Jaffe, A., Ogura, T., and Hiraga, S. (1985) Effects of the ccd function of the
F plasmid on bacterial growth, J Bacteriol 163, 841-849.
Dubendorff, J. W., and Studier, F. W. (1991) Controlling basal expression in
an inducible T7 expression system by blocking the target T7 promoter with lac
repressor, J Mol Biol 219, 45-59.
Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990)
Use of T7 RNA polymerase to direct expression of cloned genes, Methods
Enzymol 185, 60-89.
Selzer, G., Som, T., Itoh, T., and Tomizawa, J. (1983) The origin of replication
of plasmid p15A and comparative studies on the nucleotide sequences
around the origin of related plasmids, Cell 32, 119-129.
109
6 Literatur
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
Slesarev, A. I., Mezhevaya, K. V., Makarova, K. S., Polushin, N. N.,
Shcherbinina, O. V., Shakhova, V. V., Belova, G. I., Aravind, L., Natale, D. A.,
Rogozin, I. B., Tatusov, R. L., Wolf, Y. I., Stetter, K. O., Malykh, A. G.,
Koonin, E. V., and Kozyavkin, S. A. (2002) The complete genome of
hyperthermophile Methanopyrus kandleri AV19 and monophyly of archaeal
methanogens, Proc Natl Acad Sci U S A 99, 4644–4649.
Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage
cloning vectors and host strains: nucleotide sequences of the M13mp18 and
pUC19 vectors, Gene 33, 103-119.
Hanahan, D. (1983) Studies on transformation of Escherichia coli with
plasmids, J Mol Biol 166, 557-580.
Novy, R., and Morris, B. (2001) inNovations 13, 8-10.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, USA.
Kiener, A., Koenig, H., Winter, J., and Leisinger, T. (1987) Purification and
use of Methanobacterium wolfei pseudomurein endopeptidase for lysis of
Methanobacterium thermoautotrophicum, J Bacteriol 169, 1010-1016.
Marmur, J., and Doty, P. (1961) Thermal renaturation of deoxyribonucleic
acids, J Mol Biol 3, 585-594.
Chung, C. T., Niemela, S. L., and Miller, R. H. (1989) One-step preparation of
competent Escherichia coli: transformation and storage of bacterial cells in
the same solution, Proc Natl Acad Sci U S A 86, 2172-2175.
Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with
chain-terminating inhibitors, Proc Natl Acad Sci U S A 74, 5463-5467.
Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding,
Anal. Biochem. 72, 248-254.
Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of
the head of bacteriophage T4, Nature 227, 680-685.
Schägger, H., and von Jagow, G. (1991) Blue native electrophoresis for
isolation of membrane protein complexes in enzymatically active form, Anal
Biochem 199, 223-231.
Schägger, H., Cramer, W. A., and von Jagow, G. (1994) Analysis of
molecular masses and oligomeric states of protein complexes by blue native
electrophoresis and isolation of membrane protein complexes by twodimensional native electrophoresis, Anal Biochem 217, 220-230.
Richers, S. (2008) Purification and characterisation of the respiratory
supercomplex III/IV from Corynebacterium glutamicum and phospholipid
analysis of membrane proteins, Dissertation, Johann Wolfgang GoetheUniversität, Frankfurt a. M.
Renart, J., Reiser, J., and Stark, G. R. (1979) Transfer of proteins from gels to
diazobenzyloxymethyl-paper and detection with antisera: a method for
studying antibody specificity and antigen structure, Proc Natl Acad Sci U S A
76, 3116-3120.
Kyse-Andersen, J. (1984) Electroblotting of multiple gels: a simple apparatus
without buffer tank for rapid transfer of proteins from polyacrylamide to
nitrocellulose, J. Biochem. Biophys. Methods 87, 203-209.
McGadey, J. (1970) A tetrazolium method for non-specific alkaline
phosphatase, Histochemie 23, 180-184.
Knecht, D. A., and Dimond, R. L. (1984) Visualization of antigenic proteins on
Western blots, Anal Biochem 136, 180-184.
110
6 Literatur
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
Klein, A. R., and Thauer, R. K. (1997) Overexpression of the coenzyme
F420-dependent N5,N10-methylenetetrahydromethanopterin dehydrogenase
gene from the hyperthermophilic Methanopyrus kandleri, Eur J Biochem 245,
386-391.
Escalante-Semerena, J. C., Rinehart, K. L., Jr., and Wolfe, R. S. (1984)
Tetrahydromethanopterin, a carbon carrier in methanogenesis, J Biol Chem
259, 9447-9455.
Shima, S., and Thauer, R. K. (2001) Tetrahydromethanopterin-specific
enzymes from Methanopyrus kandleri, Methods Enzymol 331, 317-353.
Matthews, B. W. (1968) Solvent content of protein crystals, J Mol Biol 33,
491-497.
Navaza, J. (2001) Implementation of molecular replacement in AMoRe, Acta
Crystallogr D 57, 1367-1372.
Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of
macromolecular structures by the maximum-likelihood method, Acta
Crystallogr D 53, 240-255.
Brunger, A. T. (1992) Free R value: a novel statistical quantity for assessing
the accuracy of crystal structures, Nature 355, 472-475.
Ludtke, S. J., Baldwin, P. R., and Chiu, W. (1999) EMAN: semiautomated
software for high-resolution single-particle reconstructions, J Struct Biol 128,
82-97.
Mindell, J. A., and Grigorieff, N. (2003) Accurate determination of local
defocus and specimen tilt in electron microscopy, J Struct Biol 142, 334-347.
Doukov, T., Seravalli, J., Stezowski, J. J., and Ragsdale, S. W. (2000) Crystal
structure
of
a
methyltetrahydrofolateand
corrinoid-dependent
methyltransferase, Structure 8, 817-830.
Radermacher, M., Wagenknecht, T., Verschoor, A., and Frank, J. (1987)
Three-dimensional reconstruction from a single-exposure, random conical tilt
series applied to the 50S ribosomal subunit of Escherichia coli, J Microsc 146,
113-136.
Van Heel, M. (1987) Angular reconstitution: a posteriori assignment of
projection directions for 3D reconstruction, Ultramicroscopy 21, 111-123.
Saraste, M., Penttila, T., and Wikstrom, M. (1981) Quaternary Structure of
Bovine Cytochrome Oxidase, Eur J Biochem 115, 261-268.
Penttilä, T. (1983) Properties and Reconstitution of a Cytochrome Oxidase
Deficient in Subunit III, Eur J Biochem 133, 355-361.
Puettner, I., Carafoli, E., and Malatesta, F. (1985) Spectroscopic and
functional roperties of subunit III-depleted cytochrome oxidase, J Biol Chem
260, 3719-3723.
Finel, M., and Wikstrom, M. (1988) Monomerization of cytochrome oxidase
may be essential for the removal of subunit III, Eur J Biochem 176, 125-129.
Prochaska, L. J., and Reynolds, K. A. (1986) Characterization of electrontransfer and proton-translocation activities in bovine heart mitochondrial
cytochrome c oxidase deficient in Subunit III, Biochemistry 25, 781-787.
Hill, B. C., and Robinson, N. C. (1986) Cyanide binding to bovine heart
cytochrome c oxidase depleted of subunit III by treatment with lauryl
maltoside, J Biol Chem 261, 15356-15359.
Rigell, C. W., Saussure, C. d., and Freire, E. (1985) Protein and lipid
structural transitions in cytochrome c oxidase-dimyristoylphosphatidylcholine
reconstitutions, Biochemistry 24, 5638-5646.
Rigell, C. W., and Freire, E. (1987) Differential detergent solubility
investigation of thermally induced transitions in cytochrome c oxidase,
Biochemistry 26, 4366-4371.
111
6 Literatur
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
Harms, U., and Thauer, R. K. (1996) The corrinoid-containing 23-kDa subunit
MtrA
of
the
energy-conserving
N5-methyltetrahydromethanopterin:
coenzyme M
methyltransferase
complex
from
Methanobacterium
thermoautotrophicum. EPR spectroscopic evidence for a histidine residue as
a cobalt ligand of the cobamide, Eur J Biochem 241, 149-154.
Luschinsky-Drennan, C., Huang, S., Drummond, J. T., Matthews, R. G., and
Ludwig, M. L. (1994) How a protein binds B12: A 3.0 A X-ray structure of B12
domains of methionine synthase, Science 266.
Mancia, F., Keep, N. H., Nakagawa, A., Leadlay, P. F., McSweeney, S.,
Rasmussen, B., Bosecke, P., Diat, O., and Evans, P. R. (1996) How
coenzyme B12 radicals are generated: the crystal structure of methylmalonylcoenzyme A mutase at 2 A resolution, Structure 4, 339-350.
Marsh, E. N. (1999) Coenzyme B12 (cobalamin)-dependent enzymes, Essays
in biochemistry 34, 139-154.
Padmakumar, R., Taoka, S., Padmakumar, R., and Banerjee, R. (1995)
Coenzyme B12 is coordinated by histidine and not dimethylbenzimidazole on
methylmalonyl-CoA mutase, J Am Chem Soc 117 7033-7034.
Zelder, O., Beatrix, B., Kroll, F., and Buckel, W. (1995) Coordination of a
histidine residue of the protein-component S to the cobalt atom in coenzyme
B12-dependent glutamate mutase from Clostridium cochlearium, FEBS Lett
369, 252-254.
McPherson, A. (1990) Current approaches to macromolecular crystallization,
Eur J Biochem 189, 1-23.
Hippler,
B.
(1999)
Der
energiekonservierende
N5-Methyltetrahydromethanopterin:Coenzym-M-Methyltransferasekomplex
aus
methanogenen Archaea. Struktur und Funktion der Untereinheiten MtrH und
MtrE, Dissertation, Philipps-Universität, Marburg.
Warkentin, E., Mamat, B., Sordel-Klippert, M., Wicke, M., Thauer, R. K.,
Iwata, M., Iwata, S., Ermler, U., and Shima, S. (2001) Structures of
F420H2:NADP+ oxidoreductase with and without its substrates bound, EMBO J
20, 6561-6569.
Aufhammer, S. W., Warkentin, E., Berk, H., Shima, S., Thauer, R. K., and
Ermler, U. (2004) Coenzyme binding in F420-dependent secondary alcohol
dehydrogenase, a member of the bacterial luciferase family, Structure 12,
361-370.
Sumner, J. S., and Matthews, R. G. (1992) Stereochemistry and mechanism
of hydrogen transfer between NADPH and methylenetetrahydrofolate in the
reaction catalyzed by methylenetetrahydrofolate reductase from pig liver,
J Am Chem Soc 114, 6949-6959.
112
7 Anhang
7 Anhang
7.1
Eichgeraden der Gelfiltrationssäulen
7.1.1
Eichgerade Superdex 200 16/60 prep grade
13,5
y = -0,0812x + 17,374
13
ln MW [in Da]
12,5
12
11,5
11
10,5
10
9,5
9
50
60
70
80
90
100
2,1
2,3
Elutionsvolumen [mL]
7.1.2
Superdex 200 PC 3.2/30
13
y = -7,4583x + 22,209
12
ln MW [in Da]
11
10
9
8
7
6
5
1,3
1,5
1,7
1,9
Elutionsvolumen [mL]
113
7 Anhang
7.1.3
Superose 6 PC 3.2/30
6,7
y = -3,5248x + 11,23
6,5
ln MW [in kDa]
6,3
6,1
5,9
5,7
5,5
5,3
5,1
4,9
4,7
4,5
1,3
1,4
1,5
1,6
1,7
1,8
Elutionsvolumen [mL]
114
7 Anhang
7.2
Vektorkarten
115
7 Anhang
116
7 Anhang
117
7 Anhang
118
7 Anhang
7.3
Primer-Sequenzen für die Polymerasekettenreaktion
Tabelle 7.1: Primer für die Amplifikation mittels PCR (siehe Abschnitt 3.2.2). Die
Restriktionsschnittstellen sind gelb unterlegt.
Primer
Sequenz (5’→3’)
Schnittstelle
MJmtrH+
GTTTAAAAGCATATGTTCAACAATAAA
NdeI
MJmtrH–
TATTTTTTGAATTCTTAGACCAATTTCTTG
EcoRI
MJmtrA+
TAAAAATTCATATGGTGATGTCTATGGCAA
NdeI
MJmtrA1–
TCTCACCGGATCCAATTAGAACATTAAGA
BamHI
MJmtrA2–
GAACAAACCCATGGCAATTCATTGAATCTT NcoI
MJmtrA3–
ACCAGTGGGAATTCCTTGAATCTTTCAATT
EcoRI
119
7 Anhang
7.4
Gensequenzen
Sequenzierung 1 : MJmtrH/pCRblunt
1.1 Primer M13 Forward (-20)
1
TTTTGATGTA TACGACTCAC TATAGGGCGA ATTGGGCCCT CTAGATGCAT GCTCGAGCGG CCGCCAGTGT GATGGATATC
81
TGCAGAATTC AGGGTTTAAA AGCATATGTT CAACAATAAA TATATAAAAA TTATGAGGTG GGAAATTATG TTTAAGTTTG
161 ACAGAGAGCA AATGGTCGTT GAAATTGCGG GGAGAAAAAT TGGAGGTCAG CCAGGAGAGT ATCCTACAGC TTTAGCAGGG
241 ACTATATTCT ATGCAAGACA CAAAATTGTT GAAGATGAGA GAAAAGGTAT CTTTGACAAA GCAGCGGCAG AGGATTTAAT
321 TAACAAACAG GCAGAGATGG AAGACATTAC TGGAAACCCA GCGTTAGTTC AGGTATTTGG AGGAACCCCA GAGGCGTTAG
401 TTAATTATAT TGACTTTGTT GCTGAGGTTT GGGATGGTCC AATGTTATTG GACTCTACAT CAGGAGAAGC AAGAATGGCT
481 GCTGCAAAGA GAGCTACTGA AGCTGGATAT GCTAAGCAGT GTATTTATAA CTCTATTAAC GTTTCTATTG ATGAGCAAGA
561 ATATCAGGTT TTAGTTGAAA GTGATTTGGA AGCATCAATT GTTTTATGTT TCGACCCAAT GGACCCAACT GTTGAAGGAA
641 AGATAAATGT CTTAACAAAT GGTGGGAAAA CAGCAGATAA GGGGGATGTT AGAACTCGCT GAAAAAGCAG GTATTAAGTA
721 TCCTTTAATC GATACAGCAG TTACACCATT AGGTAACGGA GCAGGAGCTG CTGTTAGAGC ATCATTTGCT GTTAAAGCAC
801 TATTTGGATA TCCAGTAGGG AGTGGTATTC ACAACATTCC ATCAGCATGG GACTGGTTAA GAGAGTTTAG AAAACAGTTA
881 AGAGAAGCTG GAGAAAGAGA AAAGAAAGAN TCACACGTTG TGNGTGGACA ACTATCCAGT ATGCGCAGAA
1.2 Primer M13 Reverse
1
NNNNNNACGC GNTCGCCAGC TATTTAGGTG AGCGTTAGAA TACTCAAGCT ATGCATCAAG CTTGGTACCG AGCTCGGATC
81
CACTAGTAAC GGCCGCCAGT GTGCTGGAAT TCAGGTTTTG AATTCTTAGA CCAATTTCTT GAATGGATGT GTATCTATTG
161 GTTCAATTCC TAATTCTTTT GCTGCCTCTG CAATAATTGC ATCAACCATA GCTACTGCTG GGAATGTCAT ATATGCATTG
241 TCAATTGGGC CATAAAGGAC AAAGTCTCCT GACGCCATAA CTTGGACTAA GTTTGCTCCA ACATCACAAA CGTGGTGAAT
321 ATCTTTTGCT TTTTCTCTTT CTCCAGCTTC TCTTAACTGT TTTCTAAACT CTCTTAACCA GTCCCATGCT GATGGAATGT
401 TGTGAATACC ACTCCCTACT GGATATCCAA ATAGTGCTTT AACAGCAAAT GATGCTCTAA CAGCAGCTCC TGCTCCGTTA
481 CCTAATGGTG TAACTGCTGT ATCGATTAAA GGATACTTAA TACCTGCTTT TTCAGCGAGT TCTAACATCC CCTTATCTGC
561 TGTTTTCCCA CCATTTGTTA AGACATTTAT CTTTCCTTCA ACAGTTGGGT CCATTGGGTC GAAACATAAA ACAATTGATG
641 CTTCCAAATC ACTTTCAACT AAAACCTGAT ATTCTTGCTC ATCAATAGAA ACGTTAATAG AGTTATAAAT ACACTGCTTA
721 GCATATCCAG CTTCAGTAGC TCTCTTTGCA GCAGCCATTC TTGCTTCTCC TGATGTAGAG TCCAATAACA TTGGACCATC
801 CCAAACCTCA GCAACAAAGT CAATATAATT AACTAACGCC TCTGGGGTTC CTCCAAATAC CTGAACTAAC GCTGGGTTTC
881 CAGTAATGTC TTCCATCTCT GCCTGTTGTA WTAATCCTCT GCGCTGCTTG TCAARAACTT TCNTCTCTTC
Sequenzierung 2 : MJmtrH/pet22b+
2.1 Primer T7-Promoter
1
GCTAACGTCA TTCCCCTCTA GAATAATTTT GTTTAACTTT AAGAAGGAGA TATACATATG TTCAACAATA AATATATAAA
81
AATTATGAGG TGGGAAATTA TGTTTAAGTT TGACAGAGAG CAAATGGTCG TTGAAATTGC GGGGAGAAAA ATTGGAGGTC
161
AGCCAGGAGA GTATCCTACA GCTTTAGCAG GGACTATATT CTATGCAAGA CACAAAATTG TTGAAGATGA GAGAAAAGGT
241
ATCTTTGACA AAGCAGCGGC AGAGGATTTA ATTAACAAAC AGGCAGAGAT GGAAGACATT ACTGGAAACC CAGCGTTAGT
321
TCAGGTATTT GGAGGAACCC CAGAGGCGTT AGTTAATTAT ATTGACTTTG TTGCTGAGGT TTGGGATGGT CCAATGTTAT
401
TGGACTCTAC ATCAGGAGAA GCAAGAATGG CTGCTGCAAA GAGAGCTACT GAAGCTGGAT ATGCTAAGCA GTGTATTTAT
481
AACTCTATTA ACGTTTCTAT TGATGAGCAA GAATATCAGG TTTTAGTTGA AAGTGATTTG GAAGCATCAA TTGTTTTATG
561
TTTCGACCCA ATGGACCCAA CTGTTGAAGG AAAGATAAAT GTCTTAACAA ATGGTGGGAA AACAGCAGAT AAGGGGATGT
641
TAGAACTCGC TGAAAAAGCA GGTATTAAGT ATCCTTTAAT CGATACAGCA GTTACACCAT TAGGTAACGG AGCAGGAGCT
721
GCTGTTAGAG CATCATTTGC TGTTAAAGCA CTATTTGGAT ATCCAGTAGG GAGTGGTATT CACAACATTC CATCAGCATG
801
GGACTGGTTA AGAGAGTTTA GAAAACAGTT AAGAGAAGCT GGAGAAAGAG AAAAAGCAAA AGATATTCAC CACGTTTGTG
881
ATGTTGGAGC AAACTTAGTC CAAGTTATGG CGTCAGGAGA CTTTGTCCTT TATGGGCCCA ATTGACAATG CATATATGAC
961
ATTCCCAGCA GTAGCTATGG TTGATGCATT ATTGCAGAGG CAGCAAAAGA TTAGGATTGA CCAATAGATA CACATCCATT
1041 CAAGAAATTG GTCTAAGAATT
120
7 Anhang
2.2 Primer T7-Terminator
1
TTGAACATAG CTCTTTCGGG CTTTGTTAGC AGCCGGATCT CAGTGGTGGT GGTGGTGGTG CTCGAGTGCG GCCGCAAGCT
81
TGTCGACGGA GCTCGAATTC TTAGACCAAT TTCTTGAATG GATGTGTATC TATTGGTTCA ATTCCTAATT CTTTTGCTGC
161
CTCTGCAATA ATTGCATCAA CCATAGCTAC TGCTGGGAAT GTCATATATG CATTGTCAAT TGGGCCATAA AGGACAAAGT
241
CTCCTGACGC CATAACTTGG ACTAAGTTTG CTCCAACATC ACAAACGTGG TGAATATCTT TTGCTTTTTC TCTTTCTCCA
321
GCTTCTCTTA ACTGTTTTCT AAACTCTCTT AACCAGTCCC ATGCTGATGG AATGTTGTGA ATACCACTCC CTACTGGATA
401
TCCAAATAGT GCTTTAACAG CAAATGATGC TCTAACAGCA GCTCCTGCTC CGTTACCTAA TGGTGTAACT GCTGTATCGA
481
TTAAAGGATA CTTAATACCT GCTTTTTCAG CGAGTTCTAA CATCCCCTTA TCTGCTGTTT TCCCACCATT TGTTAAGACA
561
TTTATCTTTC CTTCAACAGT TGGGTCCATT GGGTCGAAAC ATAAAACAAT TGATGCTTCC AAATCACTTT CAACTAAAAC
641
CTGATATTCT TGCTCATCAA TAGAAACGTT AATAGAGTTA TAAATACACT GCTTAGCATA TCCAGCTTCA GTAGCTCTCT
721
TTGCAGCAGC CATTCTTGCT TCTCCTGATG TAGAGTCCAA TAACATTGGA CCATCCCAAA CCTCAGCAAC AAAGTCAATA
801
TAATTAACTA ACGCCTCTGG GGTTCCTCCA AATACCTGAA CTAACGCTGG GTTTCCAGTA ATGTCTTCCA TCTCTGCCTG
881
TTTGTTAATT AAATCCTCTG CCGCTGCTTT GTCAAAGATA CCTTTTCTCT CATCTTCAAC AATTTTGTGT CTTGCATAGA
961
ATATAGTCCC TGCTAAAGCT GTAGGATACT CTCCTGGCTG ACCTCCAATT TTCTCCCGCA ATTTCAACGA CCATTTGCTC
1041 TCTGTCAACT TAAACATAACTC
Sequenzierung 3 : MJmtrA1/pCRblunt
3.1 Primer M13 Forward (-20)
1
AGGGGGGGTT CGAGGGCCAG TGATTGTAAT ACGACTCACT ATAGGGCGAA TTGGGCCCTC TAGATGCATG CTCGAGCGGC
81
CGCCAGTGTG ATGGATATCT GCAGAATTCA GGAATTCATA TGGTGATGTC TATGGCAAAT AAAAGAGAAC CAGCACCAGG
161
ATGGCCAATT GTCTCTGGTG AATATGTTGT TGGAAATCCG GAAAGTTGTG TTGGAGTTGT AACTTTAGGT TCTCACGGTT
241
TGGAGCAAGC ATGTATCGAT GCAGGGGCTG CTATAGCAGG ACCTTGCCAC ACAGAAAACT TGGGTATTGA AAAGGTTGTA
321
GCAAACTATA TATCAAACCC AAACATTAGG TTTATGATTC TCTGTGGTTC AGAAGTCCAA GGGCATATAA CTGGACAGTG
401
TTTTAAAGCA TTATGGGAAA ATGGCATTGG AGACGATGGA GGTATTATTG GAGCTAAAGG GGCCATACCA TTCTTAGAGA
481
ACGTGAATAA AGAAGCAGTT GAAAGATTTA GAAGGCAGAT AGTTGAAGTT GTTGATTTAA TTGACTGTGA AGATATTGGT
561
AAAATAACAC AAGCAATAAA AGAGTGTTTA AGTAAAGACC CAGGAGCTAT TGACGAAGAC CCATTTATAA TTGAGTTAGA
641
AGGAGGAAAA GGAGGAGGAG AAGAGGAAGA GGGTGTTATA AAACCAATAA CACCAGAAAT GGCAATAATT GAGAGTAGAA
721
TGAGATTAAT TGGAAATGAA ATGTGCTATA ATGTATTGTT AGCAAAGTGG CAGGCAGGAT ATTATAATGT AAGATTCAAG
801
GAATTGCCAC TGGTTTGTTC TTAATGCTAC TAATTATGGG AATCTTAATG TTCTAATTGG ATCCGGTGAG ACCTGAATTC
881
CAGCACACTG GCGGCCGTTA CTAGGGATCC GAGCTCGGTA CCAAGCTTGA TGCATAGCTT GAGTATTCTA ACGCGTCACC
961
TAATAGCTTT GCGTATCATG ATCATAGCTG TTTCCTGGGG TGAAATTGTT ATCCGCCTCA CAATTCCACA CAACATACGA
1041 GGCCGGAAGC
3.2 Primer M13 Reverse
1
AGGCCATGAC TGATTACGCC AGCTATTTAG GTGACGCGTT AGAATACTCA AGCTATGCAT CAAGCTTGGT ACCGAGCTCG
81
GATCCACTAG TAACGGCCGC CAGTGTGCTG GAATTCAGGT CTCACCGGAT CCAATTAGAA CATTAAGATT CCCATAATTA
161
GTAGCATTAA GAACAAACCA GTGGCAATTC CTTGAATCTT ACCATTATAA TATCCTGCCT GCCACTTTGC TAACAATCCA
241
TTATAGCACA TTTCATTTCC AATTAATCTC ATTCTACTCT CAATTATTGC CATTTCTGGT GTTATTGGTT TTATAACACC
321
CTCTTCCTCT TCTCCTCCTC CTTTTCCTCC TTCTAACTCA ATTATAAATG GGTCTTCGTC AATAGCTCCT GGGTCTTTAC
401
TTAAACACTC TTTTATTGCT TGTGTTATTT TACCAATATC TTCACAGTCA ATTAAATCAA CAACTTCAAC TATCTGCCTT
481
CTAAATCTTT CAACTGCTTC TTTATTCACG TTCTCTAAGA ATGGTATGGC CCCTTTAGCT CCAATAATAC CTCCATCGTC
561
TCCAATGCCA TTTTCCCATA ATGCTTTAAA ACACTGTCCA GTTATATGCC CTTGGACTTC TGAACCACAG AGAATCATAA
641
ACCTAATGTT TGGGTTTGAT ATATAGTTTG CTACAACCTT TTCAATACCC AAGTTTTCTG TGTGGCAAGG TCCTGCTATA
721
GCAGCCCCTG CATCGATACA TGCTTGCTCC AAACCGTGAG AACCTAAAGT TACAACTCCA ACACAACTTT CCGGATTTCC
801
AACAACATAT TCACCAGAGA CAATTGGCCA TCCTGGGTGC TGGTTCTCTT TTATTTGCCA TAGACATCAC CATATGAATT
881
CCTGAATTCT GCAGATATCC ATCACACTGG CGGCCGCTCG AGCATGCATC TAGAGGGCCC AATTCGCCCT ATAGTGAGTC
961
GTATTACATT CACTGGACGT CGTTTACACG TCGTGACTGG AAACCCTGGC GTACCCACTT ATCGCTTGCA GCACATCCCC
1041 TTCGCAGCTG GCGTAATAGG CGAAGAG
121
7 Anhang
Sequenzierung 4 : MJmtrA2/pCRblunt
4.1 Primer M13 Forward (-20)
1
GGGGATTACG ACGGCAGTGA TTGTAATACG ACTCACTATA GGGCGAATTG GGCCCTCTAG ATGCATGCTC GAGCGGCCGC
81
CAGTGTGATG GATATCTGCA GAATTCAGGT AAAAATTCAT ATGGTGATGT CTATGGCAAA TAAAAGAGAA CCAGCACCAG
161
GATGGCCAAT TGTCTCTGGT GAATATGTTG TTGGAAATCC GGAAAGTTGT GTTGGAGTTG TAACTTTACG TTCTCACGGT
241
TTGGAGCAAG CATGTATCGA TGCAGGGGCT GCTATAGCAG GACCTTGCCA CACAGAAAAC TTGGGTATTG AAAAGGTTGT
321
AGCAAACTAT ATATCAAACC CAAACATTAG GTTTATGATT CTCTGTGGTT CAGAAGTCCA AGGGCATATA ACTGGACAGT
401
GTTTTAAAGC ATTATGGGAA AATGGCATTG GAAACGATGG AGGTATTATT GGAGCTAAAG GGGCCATACC ATTCTTAGAG
481
AACGTGAATA AAGAAGCAGT TGAAAGATTT AGAAGGCAGA TAGTTGAAGT TGTTGATTTA ATTGACTGTG AAGATATTGG
561
TAAAATAACA CAAGCAATAA AAGAGTGTTT AAGTAAAGAC CCAGGAGCTA TTGACAAAGA CCCATTTATA ATTGAGTTAG
641
AAGGAGGAAA AGGAGGAGGA GAAGAGAAAG AGGGTGTTAT AAAACCAATA CCACCAGAGA TGGCAATAAT TGAGAGTAGA
721
ATGAGATTAA TTGGAAATGA AATGTGCTAT AATGGATTGT TAGCAGAGTG GCAGGCAGGA TATTAGAATG GAAAGATTCA
801
ATGAATTGCC ATGGGTTTGC TCCCTGAATT CCAGCACACT GGCGGCCGTT ACTAGTGGAT CCGAGCTCGG TACCAAGCTT
881
GATGCATAGC TTGAGTATTC TAGCGCGTCA CCTAAATAGC TTGGCGTAAT CATGGTCATA GCTGCTTCCT GGGGTGAAAT
961
TGTCATCCGC TCACCATCCA CACAACATAC GAGCGGAGGC ATAAAGTGTA AAGGCTGGGC GGACTGATGA GTGAGCTACC
1041 TCACATTAGA TTGGGGTTGC GGCTGCCTGC
4.2 Primer M13 Reverse
1
CGCCAATGAA TGATTACGCC AGCTATTTAG GTGACGCGTT AGAATACTCA AGCTATGCAT CAAGCTTGGT ACCGAGCTCG
81
GATCCACTAG TAACGGCCGC CAGTGTGCTG GAATTCAGGG AACAAACCCA TGGCAATTCA TTGAATCTTA CCATTATAAT
161
ATCCTGCCTG CCACTTTGCT AACAATCCAT TATAGCACAT TTCATTTCCA ATTAATCTCA TTCTACTCTC AATTATTGCC
241
ATTTCTGGTG TTATTGGTTT TATAACACCC TCTTCCTCTT CTCCTCCTCC TTTTCCTCCT TCTAACTCAA TTATAAATGG
321
GTCTTCGTCA ATAGCTCCTG GGTCTTTACT TAAACACTCT TTTATTGCTT GTGTTATTTT ACCAATATCT TCACAGTCAA
401
TTAAATCAAC AACTTCAACT ATCTGCCTTC TAAATCTTTC AACTGCTTCT TTATTCACGT TCTCTAAGAA TGGTATGGCC
481
CCTTTAGCTC CAATAATACC TCCATCGTCT CCAATGCCAT TTTCCCATAA TGCTTTAAAA CACTGTCCAG TTATATGCCC
561
TTGGACTTCT GAACCACAGA GAATCATAAA CCTAATGTTT GGGTTTGATA TATAGTTTGC TACAACCTTT TCAATACCCA
641
AGTTTTCTGT GTGGCAAGGT CCTGCTATAG CAGCCCCTGC ATCGATACAT GCTTGCTCCA AACCGTGAGA ACCTAAAGTT
721
ACAACTCCAA CACAACTTTC CGGATTTCCA ACAACATATT CACCAGAGAC AATTGGCCAT CCTGGTGCTG GTTCTCTTTT
801
ATTTGCCATA GACATCACCA TATGAATTTT TACCTGAATT CTGCAGATAT CCATCACACT GGCGGTCGCT CGAGCATGCA
881
TCTAGAGGGC TCATTCGCCC TATAGTGAGT CGTATTACAT TCACTGGCCG TCGATTTACA CGTCGTGACT GGGAAAACCC
961
TGGCGTTACC TACTTATCGG CATGCAGCAC ATCCCTCTTT CGCAGCTGAC GTAATAGCGA AGAGGCCCGC ACGATCGTCC
1041 TTCCAACAGT GCGCATCTAT ACGTACGGGT AGTTATG
Sequenzierung 5 : MJmtrA3/pCRblunt
5.1 Primer M13 Forward (-20)
1
GGGCGTTCGA CGGCAGTGAT TGTAATACGA CTCACTATAG GGCGAATTGG GCCCTCTAGA TGCATGCTCG AGCGGCCGCC
81
AGTGTGATGG ATATCTGCAG AATTCAGGAC CAGTGGGAAT TCCTTGAATC TTTCAATTAT AATATCCTGC CTGCCACTTT
161
GCTAACAATC CATTATAGCA CATTTCATTT CCAATTAATC TCATTCTACT CTCAATTATT GCCATTTCTG GTGTTATTGG
241
TTTTATAACA CCCTCTTCCT CTTCTCCTCC TCCTTTTCCT CCTTCTAACT CAATTATAAA TGGGTCTTCG TCAATAGCTC
321
CTGGGTCTTT ACTTAAACAC TCTTTTATTG CTTGTGTTAT TTTACCAATA TCTTCACAGT CAATTAAATC AACAACTTCA
401
ACTATCTGCC TTCTAAATCT TTCAACTGCT TCTTTATTCA CGTTCTCTAA GAATGGTATG GCCCCTTTAG CTCCAATAAT
481
ACCTCCATCG TCTCCAATGC CATTTTCCCA TAATGCTTTA AAACACTGTC CAGTTATATG CCCTTGGACT TCTGAACCAC
561
AGAGAATCAT AAACCTAATG TTTGGGTTTG ATATATAGTT TGCTACAACC TTTTCAATAC CCAAGTTTTC TGTGTGGCAA
641
GGTCCTGCTA TAGCAGCCCC TGCATCGATA CATGCTTGCT CCAAACCGTG AGAACCTAAA GTTACAACTC CAACACAACT
721
TTCCGGATTT CCAACAACAT ATTCACCAGA GACAATTGGC CATCCTGGTG CTGGTTCTCT TTTATTTGCC ATAGACATCA
801
CCATATGAAT TTTTACCTGA ATTCCAGCAC ACTGGCGGCC GTTACTAGTG TATCCGAGCT CGGTACCAAG CTTGATGCAT
881
AGCTTGAGTA TTCTAACGCG TCACCTAAAT AGCTTGCGTA ATCATGGTCA TAGCTGTTTC CTGTGTGAAA TTGTTATCCG
961
CTCACAATTC CACACACATA CGAGCCGGAG CATAAAGTGT AAAGCCTGGG TGCCTAATGA TGGAGCTACT CACATTATGC
1041 GTTGCGCTCA CTGCCCGCTT TCAGTCGGAA ACCTGTCGTG CAGCTGCATA ATGATCGGCACG
122
7 Anhang
5.2 Primer M13 Reverse
1
CCGCATGACT GATTACGCCA GCTATTTAGG TGACGCGTTA GAATACTCAA GCTATGCATC AAGCTTGGTA CCGAGCTCGG
81
ATCCACTAGT AACGGCCGCC AGTGTGCTGG AATTCAGGTA AAAATTCATA TGGTGATGTC TATGGCAAAT AAAAGAGAAC
161
CAGCACCAGG ATGGCCAATT GTCTCTGGTG AATATGTTGT TGGAAATCCG GAAAGTTGTG TTGGAGTTGT AACTTTAGGT
241
TCTCACGGTT TGGAGCAAGC ATGTATCGAT GCAGGGGCTG CTATAGCAGG ACCTTGCCAC ACAGAAAACT TGGGTATTGA
321
AAAGGTTGTA GCAAACTATA TATCAAACCC AAACATTAGG TTTATGATTC TCTGTGGTTC AGAAGTCCAA GGGCATATAA
401
CTGGACAGTG TTTTAAAGCA TTATGGGAAA ATGGCATTGG AGACGATGGA GGTATTATTG GAGCTAAAGG GGCCATACCA
481
TTCTTAGAGA ACGTGAATAA AGAAGCAGTT GAAAGATTTA GAAGGCAGAT AGTTGAAGTT GTTGATTTAA TTGACTGTGA
561
AGATATTGGT AAAATAACAC AAGCAATAAA AGAGTGTTTA AGTAAAGACC CAGGAGCTAT TGACGAAGAC CCATTTATAA
641
TTGAGTTAGA AGGAGGAAAA GGAGGAGGAG AAGAGGAAGA GGGTGTTATA AAACCAATAA CACCAGAAAT GGCAATAATT
721
GAGAGTAGAA TGAGATTAAT TGGAAATGAA ATGTGCTATA ATGGATTGTT AGCAAAGTGG CAGGCAGGAT ATTATAATTG
801
AAAGATTCAA GGAATTCCCA CTGGTCCTGA ATTCTGCAGA TATCCATCAC ACTGGCGGCC GCTCGAGCAT GCATCTAGAG
881
GGCCCAATTC GCCCTATAGT GAGTCGTATT ACAATTCACT CCCGTCGTTT TACAACGTCG TGACTGGGAA AACCCTGCGT
961
TACCCAACTT AATCGCCTTG CAGCACATCC CCCTTTCGCA GCTGCGTATA GCGAAGAGGC CGCACCGATC GCCCTTCCCA
1041 CAGTGCGCAG CTATACGTAC GGCAGTTAGT TACACCTATA AAAGAGAGAG CCGTATCGTC TGTTTGTGAT GTACAGGAGT
1121 GAATATATGA CAG
Sequenzierung 6 : MJmtrH/pACYC-Duet1
6.1 Primer Duet UP2
1
TGTGAGCGGA TAACAATTCC CCATCTTAGT ATATTAGTTA AGTATAAGAA GGAGATATAC ATATGTTCAA CAATAAATAT
81
ATAAAAATTA TGAGGTGGGA AATTATGTTT AAGTTTGACA GAGAGCAAAT GGTCGTTGAA ATTGCGGGGA GAAAAATTGG
161 AGGTCAGCCA GGAGAGTATC CTACAGCTTT AGCAGGGACT ATATTCTATG CAAGACACAA AATTGTTGAA GATGAGAGAA
241 AAGGTATCTT TGACAAAGCA GCGGCAGAGG ATTTAATTAA CAAACAGGCA GAGATGGAAG ACATTACTGG AAACCCAGCG
321 TTAGTTCAGG TATTTGGAGG AACCCCAGAG GCGTTAGTTA ATTATATTGA CTTTGTTGCT GAGGTTTGGG ATGGTCCAAT
401 GTTATTGGAC TCTACATCAG GAGAAGCAAG AATGGCTGCT GCAAAGAGAG CTACTGAAGC TGGATATGCT AAGCAGTGTA
481 TTTATAACTC TATTAACGTT TCTATTGATG AGCAAGAATA TCAGGTTTTA GTTGAAAGTG ATTTGGAAGC ATCAATTGTT
561 TTATGTTTCG ACCCAATGGA CCCAACTGTT GAAGGAAAGA TAAATGTCTT AACAAATGGT GGGAAAACAG CAGATAAGGG
641 GATGTTAGAA CTCGCTGAAA AAGCAGGTAT TAAGTATCCT TTAATCGATA CAGCAGTTAC ACCATTAGGT AACGGAGCAG
721 GAGCTGCTGT TAGAGCATCA TTTGCTGTTA AAGCACTATT TGGATATCCA GTAGGGAGTG GTATTCACAA CATTCCATCA
801 GCATGGGACT GGTTAAGAGA GTTTAGAAAA CAGTTAAGAG AAGCTGGAGA AAGAGAAAAA GCAAAAGATA TTCACCACGT
881 TTGTGATGTT GGAGCAAACT TAGTCCAAGT TATGGCGTCA GGAGACTTTG TCCTTTA
6.2 Primer T7-Terminator
1
CTGCGCTAGT AGACGAGTCC ATGTGCTGGC GTTCAAATTT CGCAGCAGCG GTTTCTTTAC CAGACTCGAG GGTACCGACG
81
TCAGCGATCG CGTGGCCGGC CGATATCCAA TTCTTAGACC AATTTCTTGA ATGGATGTGT ATCTATTGGT TCAATTCCTA
161 ATTCTTTTGC TGCCTCTGCA ATAATTGCAT CAACCATAGC TACTGCTGGG AATGTCATAT ATGCATTGTC AATTGGGCCA
241 TAAAGGACAA AGTCTCCTGA CGCCATAACT TGGACTAAGT TTGCTCCAAC ATCACAAACG TGGTGAATAT CTTTTGCTTT
321 TTCTCTTTCT CCAGCTTCTC TTAACTGTTT TCTAAACTCT CTTAACCAAT CCCATGCTGA TGGAATGTTG TGAATACCAC
401 TCCCTACTGG ATATCCAAAT AATGCTTTAA CAGCAAATGA TGCTCTAACA GCAGCTCCTG CTCCGTTACC TAATGGTGTA
481 ACTGCTGCAT CGATTAAAGG ATACTTAATA CCTGCTTTTT CAGCGAGTTC TAACATCCCC TTATCTGCTG TTTTCCCACC
561 ATTTG
123
7 Anhang
Sequenzierung 7 : MJmtrA3/pACYC-Duet1
7.1 Primer Duet UP2
1
ATTGTGAGCG GATAACAATT CCCCATCTTA GTATATTAGT TAAGTATAAG AAGGAGATAT ACATATGGTG ATGTCTATGG
81
CAAATAAAAG AGAACCAGCA CCAGGATGGC CAATTGTCTC TGGTGAATAT GTTGTTGGAA ATCCGGAAAG TTGTGTTGGA
161 GTTGTAACTT TAGGTTCTCA CGGTTTGGAG CAAGCATGTA TCGATGCAGG GGCTGCTATA GCAGGACCTT GCCACACAGA
241 AAACTTGGGT ATTGAAAAGG TTGTAGCAAA CTATATATCA AACCCAAACA TTAGGTTTAT GATTCTCTGT GGTTCAGAAG
321 TCCAAGGGCA TATAACTGGA CAGTGTTTTA AAGCATTATG GGAAAATGGC ATTGGAGACG ATGGAGGTAT TATTGGAGCT
401 AAAGGGGCCA TACCATTCTT AGAGAACGTG AATAAAGAAG CAGTTGAAAG ATTTAGAAGG CAGATAGTTG AAGTTGTTGA
481 TTTAATTGAC TGTGAAGATA TTGGTAAAAT AACACAAGCA ATAAAAGAGT GTTTAAGTAA AGACCCAGGA GCTATTGACG
561 AAGACCCATT TATAATTGAG TTAGAAGGAG GAAAAGGAGG AGGAGAAGAG GAAGAGG
7.2 Primer T7-Terminator
1
CTGCGCTAGT AGACGAGTCC ATGTGCTGGC GTTCAAATTT CGCAGCAGCG GTTTCTTTAC CAGACTCGAG GGTACCGACG
81
TCAGCGATCG CGTGGCCGGC CGATATCCAA TTCCTTGAAT CTTTCAATTA TAATATCCTG CCTGCCACTT TGCTAACAAT
161 CCATTATAGC ACATTTCATT TCCAATTAAT CTCATTCTAC TCTCAATTAT TGCCATTTCT GGTGTTATTG GTTTTATAAC
241 ACCCTCTTCC TCTTCTCCTC CTCCTTTTCC TCCTTCTAAC TCAATTATAA ATGGGTCTTC GTCAATAGCT CCTGGGTCTT
321 TACTTAAACA CTCTTTTATT GCTTGTGTTA TTTTACCAAT ATCTTCACAG TCAATTAAAT CAACAACTTC AACTATCTGC
401 CTTCTAAATC TTTCAACTGC TTCTTTATTC ACGTTCTCTA AGAATGGTAT GGCCCCTTTA GCTCCAATAA TACCTCCATC
481 GTCTCCAATG CCATTTTCCC ATAATGCTTT AAAACACTGT CCAGTTATAT GCCCTTGGAC TTCTGAACCA CAGAGAATCA
561 TAAACCTAAT GTTTGGGTTT GATATATAGT TTGCTACAAC CTTTTCAATA CCCAAGTTTT CTGTGTGGCA AGGTCCTGCT
641 ATAGCAGCCC CTGCATCGAT ACATGCTTGC TCCAAACCGT GAGAACCTAA AGTTACAACT CCAACACAAC TTTCCGGATT
721 TCCAACAACA TATTCACCAG AGACAATTGG CCATCCTGGT GCTGGTTCTC TTTTATTTGC CATAGACATC ACCATATGTA
801 TATCTCCTTC TTATACTTAA CTAATATACT AAGATGGGGA ATTGTTATCC GCTCACAATT CCCCTATAGT GAGTCGTATT
881 AATTTCGATT ATGCGGCCGT GTACAATACG ATTACTTTCT GTTCGACTTAA
124
7 Anhang
7.5
Daten ESI-MS-Analyse von MJMtrA3
125
DANKSAGUNG
Bei PD Dr. Ulrich Ermler möchte ich mich von Herzen für die exzellente fachliche
Anleitung, die fürsorgliche und wohlwollende Betreuung während dieser Arbeit, seine
stete (!) Diskussionsbereitschaft und seine Hilfe bei der Planung meiner weiteren
Berufslaufbahn bedanken.
Dr. Seigo Shima und Prof. Dr. Rudolf Thauer vom Max-Planck-Institut für
terrestrische Mikrobiologie in Marburg danke ich herzlich für ihre Unterstützung, ihr
Interesse am Fortschritt meiner Arbeit und die vielen Denkanstöße und interessanten
Diskussionen, die sich vor allem bei den Einladungen nach Hirschegg ergaben.
Vielen Dank auch an Johanna Moll für die Anzucht der M. marburgensis-Zellen und
Aufreinigung der H4MPT-Derivate und F420 sowie Jörg Kahnt für die MALDI-TOFAnalyse diverser Proteinproben.
Prof. Dr. Hartmut Michel danke ich für die zeitweilige Finanzierung dieser Arbeit
und die Möglichkeit, in der Abteilung Molekulare Membranbiologie am Max-PlanckInstitut für Biophysik in Frankfurt forschen zu können.
Prof. Dr. Bernd Ludwig sei für die Betreuung dieser Arbeit seitens der
Johann Wolfgang Goethe-Universität Frankfurt gedankt.
Allen derzeitigen und ehemaligen Kollegen und Mitarbeitern des Max-PlanckInstituts für Biophysik in Frankfurt, die ein reibungsloses Arbeiten im Labor
ermöglichten, mit Rat und Tat zur Seite standen, für ein offenes Arbeitsklima und
manche fröhliche Kaffeerunde sorgten, sei dafür herzlich gedankt. Mein besonderer
Dank gilt Dr. Eberhard Warkentin, der mich geduldig und anschaulich in die
Geheimnisse der Strukturaufklärung einführte und sogar im Ruhestand zur
Verfügung steht. Ulrike Demmer danke ich für ihr Engagement bei der Kristallisation
von KMtd und für die Unterstützung im Labor. Meiner Vorgängerin in der Arbeit am
Mtr-Komplex, Dr. Priyamvada Acharya, danke ich für die freundliche Einführung in
die Welt der Membranproteinkomplexe.
Bei Dr. Dilem Hizlan bedanke ich mich für die gute Zusammenarbeit, ich
wünsche ihr viel Erfolg bei der elektronenmikroskopischen Einzelpartikelmessung
des Mtr-Komplexes. Dr. Janet Vonck und Ming Yang sei an dieser Stelle ebenfalls
gedankt.
Vielen Dank an Dr. Vitali Vogel vom Institut für Biophysik der
Johann Wolfgang Goethe-Universität Frankfurt für die Durchführung der analytischen
Ultrazentrifugationsexperimente.
Meiner Familie danke ich herzlich für die liebevolle moralische und tatkräftige
Unterstützung während meiner Doktorarbeitszeit. Mein besonderer Dank gilt meinem
Mann Patrick, der, obwohl er oft auf mich verzichten musste, immer wieder
Verständnis und Interesse für meine Arbeit aufbringen konnte. Ihm sei diese Arbeit
gewidmet.
Für die Finanzierung dieser Arbeit danke ich
Forschungsgemeinschaft und der Max-Planck-Gesellschaft.
der
Deutschen
PERSÖNLICHE ANGABEN
Katharina Elisabeth Ceh
geb. Körner
Geburtstag und -ort
28.06.1977 in Stuttgart
Familienstand
verheiratet
Nationalität
deutsch
Schulausbildung
09.1983 - 06.1987
Grundschule in Stuttgart-Heumaden
09.1987 - 06.1996
Evangelisches Heidehof-Gymnasium Stuttgart
Abschluss: Abitur
Scheffel-Preisträgerin 1996
(Preis der Deutschen Literarischen Gesellschaft Karlsruhe für
das beste Abitur im Fach Deutsch)
Hochschulausbildung
10.1996 - 07.2005
Studium der Chemie
Albert-Ludwigs-Universität Freiburg im Breisgau
Schwerpunktsfach Biochemie
Abschluss: Diplom-Chemikerin
10.2004 - 07.2005
Diplomarbeit bei Prof. Dr. Georg E. Schulz
am Institut für Organische Chemie und Biochemie,
Albert-Ludwigs-Universität Freiburg im Breisgau
zum Thema „Mutagenese, Expression, Reinigung und
Kristallisation des monomeren Porin A aus
Mycobacterium smegmatis“
Promotion
09.2005 - 02.2009
Doktorarbeit bei PD Dr. Ulrich Ermler
am Max-Planck-Institut für Biophysik, Frankfurt am Main,
Abteilung für Molekulare Membranbiologie
zum Thema „Bindung des C1-Carriers
Tetrahydromethanopterin und seiner Derivate an Enzyme des
Energiestoffwechselweges methanbildender Archaeen“
Download PDF

advertising