Vulcan-Hart | ML-052200 | Use

US 20130053332A1
(19) United States
(12) Patent Application Publication (10) Pub. No.: US 2013/0053332 A1
Mithen
(54)
(43) Pub. Date:
USE
Publication Classi?cation
_
.
(75) Inventor.
.
Feb. 28, 2013
.
.
Richard Mithen, NorW1ch (GB)
(51)
_
(73) Assignee. PLANT BIOSCIENCE LIMITED,
Int. Cl.
A 61K 31/7028
A61K 31/26
(200601)
(2006.01)
A61P 9/10
(2006.01)
A61P 29/00
A61P 7/02
A61P 9/12
A61P 3/06
A61P 9/00
A61P 9/04
(2006.01)
(2006.01)
(2006.01)
(2006.01)
(200601)
(2006.01)
A611, 3/02
NOrWwh (GB)
(2006.01)
(21) Appl. No.:
13/518,777
(22)
PCT Filed:
Dec. 23, 2010
(86)
PCT NO;
PCT/GB2010/052200
(52)
§ 371 (0(1). _
(2)’ (4) Date‘
NOV‘ 16’ 2012
AIBtSTtRACT
. . a
e) present.invent.ion re
a es 0 a composi.t.ion comprising
high glucosinolate Cruciferous vegetable (such as a high glu
_
(30)
_
_
_
_
Forelgn APPhcatmn Prlorlty Data
Dec. 23, 2009
(GB) ................................. .. 09225053
US. Cl. ........................................ .. 514/24; 514/514
cosinolate broccoli) having a high level of glucosinolate and/
or at least one derivative thereof for use in the treatment or
prevention of a cardiovascular disease or foruse in promoting
heart and/or cardiovascular health.
Patent Application Publication
Feb. 28, 2013 Sheet 2 0f 19
US 2013/0053332 A1
CVD risk <1’10%
over next 10 years
C0WW rn.6 km mmn/mV:De%a
WM
COWm rnBekn >1.20WV.0%
m
r
A
rS
Non diabetic men
Smoker
Non-smaker
CVD risk over
next 10 years
‘30%
Mm
SBP=systolic blood
pressure mmHg
345678910
TCzHDL=serum totai
3 4 5 5 7 8 910 choiesterol to HDL
Ch0i€$t€f0| ratio
Aga 60 years and over
345678911)
TCiHDL
345678910
TCZHDL
Patent Application Publication
Feb. 28, 2013 Sheet 3 0f 19
US 2013/0053332 A1
Non diabetic women
Smoker
Non-smoker
Age under 50 years
180
180?
160
SBP
2% 2,; "
160
I
I
CVD risk <10%
I ’
over next 10 years
,
140
[Z CVD risk 10-20%
35F’ 140
"
*
‘I20
'
120
Q % eve risk >2o%
‘
//
) // U34’,
160
over next 10 years
over next 10 years
I;
M
345678 910
TC:HDL
‘580
SBP
TCzHDL
Age 5069 years
180
CVD risk ever
next 10 years
160
160
/p,
140
SBP 140
j
120
100
120:
.
Yz” %
W
‘X.
/
100 L
3;“4'5' 6 7 8 910
TCZHDL
Age 60 years and over
SBP
180
180
160
160
140
SBP 140
120
120
100
100 - 3i
I
30%
1\OO/;20%
SBP=systoiic blood
pressure mmHg
TC:HDL=serum total
cholesterol to HDL
Cholesterol ratio
Patent Application Publication
Feb. 28, 2013 Sheet 4 0f 19
US 2013/0053332 A1
FIGURE 3
Brie? Study Outiine
Sampies
[ nscaun'mwjr J
"Mid stream urine
[ information
exchange 1~HNU ]
Arrange Screening date
‘
‘*’
\
~1§$mL Fasted Mood
145ml.
x
F zuslsum' scweemmsmwu
Glucose; FBC;
v,
1,,
Risk caiwkatec! accurding to
Prediction chart
HEM; Lipid
Pro?le;
Albumin;
U&ES; CRP
W‘Y...Z“.,,W
Assigned tn group
WWW‘
,
(
5"“ Genotype
MM‘ for E51 frarmii
mforma?c-n exchange Z-HNU
hirange C?nicat appointments
Clinical Appointment l-QBTQ Week 0
r
*Zi'mL Fasted Bwod
'
.
1.1m
.
Glucose; FBC;
Start of 12 wk mtewentmn
..__~
}
~
HE A 1; “Did
7
Frame;
1 Compliance! phone cans l
Aibumin; CRP
M
i
7-day die: (Man;
--'
‘
End 0712 wk intervention
J
~
15ml.
".5; Vit D; hsv
'
Clinicai Appointment z-ggmua Week 12
{33p
‘l ' ¥> "Ambulatory BP
'Puise Wave Velocity
\'Augmentation index
i
Patent Application Publication
Training set
Feb. 28, 2013 Sheet 6 0f 19
Test set
US 2013/0053332 A1
Patent Application Publication
Feb. 28, 2013 Sheet 7 0f 19
US 2013/0053332 A1
400»
pofNurmobers
300
200J
100~
Peas
160
ofpNurmobers
Patent Application Publication
25
Feb. 28, 2013 Sheet 8 0f 19
US 2013/0053332 A1
A
20~
‘$3X 15
é‘
%
g 10
51
G
M‘
0
2
4
I
AMA “\QE
6
8
'10
Time (min)
25} B
m
6.46
in
2 15~
2‘
‘as
5
g 10~
7.08
5.
Q
9
m
2x
‘
,
4
,
s
Time (min)
K "
NM
s
10
Patent Application Publication
1.397
A
Feb. 28, 2013 Sheet 10 0f 19
US 2013/0053332 A1
13s?
B
23.4?
Q‘
U)
C
2
E
23.40
k
L
a .08D5
snag
3096
.35‘
U’)
C
a
E
27.93
24.31
L
m.
0
1'0
2'0
3'0
l
40
Time (min)
‘A
so
?
60
0
‘
\
1
1o
20
30
Mmnm
4o
Time (min)
.Anr
50
1
60
Patent Application Publication
Feb. 28, 2013 Sheet 11 0f 19
US 2013/0053332 A1
v»!
1085
858.4
19
-
1021.4
Intesity
1
/
11'“NJ-i141
1 111,411,111
1 H 1',
"15
14615-6
/ y
1.01.111 Mu
11
2.364
1351.5
8
yn yea 5/9 ya y? ‘1635 V4 ya
T
b2 b3 b4 b5 b8 bl b0 9 10b“
Intesity
374.2
,
17
858.5
y
10 N
M2
8096
402.1
1
{5:1 .32
5\7'
31,;
464-4
£252
Y:
155173 69864
A114
6182
310.2
wwwhl. 1..“ ....
300 400
'
y
LL11; 1
1
1
1295.0
Ana
41%
ya 1202.03 1128973
ME @0214 y
895.4
i
'9
11555.5‘
1 AD?
1
1055.3
1
3/12
2,
1464.6
u !‘ NINJA...“ "LL11! "1.1.11 41L)‘. A ............11_L.l s
600 700 800 900 100011001200130014001500
Patent Application Publication
Feb. 28, 2013 Sheet 12 0f 19
P410001
Al 0 0
P410001
TGFb’i (2 ng/mi)
SF (2 0M)
DTT (10 mM)
Ea.
4.2 45
US 2013/0053332 A1
Patent Application Publication
.£wT1m0vpk.
uzmEwam2£oi=65Emw“8,<oag.5xhm
AIE£LV
+
E0kM5wc0m1?3wk05otzw
Feb. 28, 2013 Sheet 13 0f 19
A396.6V33;A82 ,a.
US 2013/0053332 A1
Patent Application Publication
Feb. 28, 2013 Sheet 14 0f 19
US 2013/0053332 A1
Primers and probes for genotype analysis.
Gene
Sequence
Primer & probe lnlll‘l)
GSTM’I - glulathione S-lransferase M1
F
R
P
5‘~ GGAGACAGAAGAGGAGAAGATTCG -3‘
5’- TGCCCAGCTGCATATGGTT -3‘
5‘- TCCATGGTCTGGTTCTCCAAAATGTCCA~3’
500
500
200
Control gene (BRCM)
F
5'“ GTCTGCTFl'l‘ACATCTGAACCTCTGT -3’
500
R
P
5’-AGGCCTGAGCAGTCTTCAGAGA-B'
5’—ACTCTCACACCCAGATGCTGCTTCACCT—3'
500
200
Sequences and concentration of forward (F) and reserve (R) prlmere and lluorogenic probes (P)
for the determination of GSTMl gene deletion are shown. Probes were labelled with a 5’
reporter dye, FAM (6»carboxyfluoresceln) and a 3’ quencher dye, TAMRA (6~
carboxyletramelhyllhodamlne). Triplicate reacllons were carried out in a total volume of 25
uLlwell consisting of Universal Maslerlvlix, primers and probes and 50 ng DNA. Amplitaq Gold
activation for 10 min at 95°C, followed by 40 cycles PCR of denaturatlon for 15 s at 95°C and
annealing/extension for ‘l min at 60"0
Patent Application Publication
Feb. 28, 2013 Sheet 15 0f 19
US 2013/0053332 A1
p~EGFR (Ty/r1065) in BPHi ceHs ~ 10
min 10 ng/ul EGF & 10 MW SF -
GAPDH normalised
400
3150
3.00
ibRenalt isdvety
2.50
2.00
1.50
1.00
0.50
0,00
1
1Controi 2Centre?
I
EGF'I EGFZ
SFN1 SFNZ
EGFISNi
EGFISNZ_: EGF1S.N53:
Patent Application Publication
Feb. 28, 2013 Sheet 16 0f 19
US 2013/0053332 A1
500~
400*
300~
24m
200*
100"
O
wxmi,wm
I L-B
8
Moscw.
Patent Application Publication
Feb. 28, 2013 Sheet 18 0f 19
US 2013/0053332 A1
BPHA Cells J? Growth factovs
Contra!
Contro!
EGF
SF 211M
iNSULIN
SF 10pM
SF 20%)!
pAKT
60kDa
Total AKT 60kDa
“
pPDK1
58-68kDa
G
3a
DAKT
60 ‘(D8
GAPDH
36kDa
P03 Ceils + SF - FCS
Control
SF 2pm
SF 10pm SF ZOpM
Patent Application Publication
Feb. 28, 2013 Sheet 19 0f 19
Fig‘ 21
US 2013/0053332 A1
Download PDF

advertising