Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide (1000000006976 v00)

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide (1000000006976 v00)

Local Run Manager

TruSight Tumor 15 Analysis Module

Workflow Guide

For Research Use Only. Not for use in diagnostic procedures.

Overview

Set Parameters

Analysis Methods

View Analysis Results

Analysis Report

Analysis Output Files

Technical Assistance

9

10

19

6

8

3

4

ILLUMINA PROPRIETARY

Document # 1000000006976 v00

January 2016

This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.

The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read and understood prior to using such product(s).

FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN

MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND

DAMAGE TO OTHER PROPERTY.

ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)

DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).

© 2016 Illumina, Inc. All rights reserved.

Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio,

Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect,

MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome,

TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the U.S. and/or other countries. All other names, logos, and other trademarks are the property of their respective owners.

Overview

The Local Run Manager TruSight Tumor 15 analysis module aligns reads against the reference specified in the manifest files using the banded Smith-Waterman algorithm.

After alignment, the somatic variant caller performs variant analysis. The results report somatic variants of a set of reference panel genes associated with cancer. This workflow is designed specifically for TruSight Tumor 15 libraries.

Input Requirements

In addition to sequencing data files generated during the sequencing run, such as base call files, the TruSight Tumor 15 analysis module requires the following files.

}

Manifest files (2)—The TruSight Tumor 15 analysis module requires 2 assay-specific manifest files: a manifest file for mix A and a manifest file for mix B. Manifest files are included as part of in the analysis module.

}

Reference genome—The TruSight Tumor 15 analysis module requires the hg19 reference genome for coordinates and chromosome mapping, which is included in with the Local Run Manager software installation.

About This Guide

This guide provides instructions for setting up run parameters for sequencing and analysis parameters for the TruSight Tumor 15 analysis module. For information about the Local Run Manager dashboard and system settings, see the Local Run Manager

Software Guide (document # 1000000002702).

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

3

Set Parameters

1 Click Create Run, and select TruSight Tumor 15.

2 Enter a run name that identifies the run from sequencing through analysis.

Use alphanumeric characters, spaces, underscores, or dashes.

3 [Optional] Enter a run description to help identify the run.

Use alphanumeric characters.

Specify Samples for the Run

Specify samples for the run using the following options:

}

Enter samples manually—Use the blank table on the Create Run screen.

}

Import samples—Navigate to an external file in a comma-separated values (*.csv) format. A template is available for download on the Create Run screen.

After you have populated the samples table, you can export the sample information to an external file, and use the file as a reference when preparing libraries or import the file for another run.

Enter Samples Manually

1 Click Add Row to adjust the samples table to an appropriate number of rows.

2 Enter a unique sample ID in the Sample ID field.

Use alphanumeric characters, dashes, or underscores.

3 [Optional] Enter a sample description in the Sample Description field.

Use alphanumeric characters, dashes, underscores, or spaces.

4 Enter index adapters for Mix A as follows.

a Expand the Mix A Index 1 drop-down list and select an Index 1 adapter.

b Expand the Mix A Index 2 drop-down list and select an Index 2 adapter. Rightclick in a table cell to use the Fill Down command.

c [Optional] Enter a mix description for Mix A.

5 Enter index adapters for Mix B as follows.

a Expand the Mix B Index 1 drop-down list and select an Index 1 adapter.

b Expand the Mix B Index 2 drop-down list and select an Index 2 adapter. Rightclick in a table cell to use the Fill Down command.

c [Optional] Enter a mix description for Mix B.

NOTE

The Report Definition field is populated automatically, by default.

6 [Optional] Click the Export Samples to export sample information to an external file.

7 When finished, click Save Run.

Import Samples

1 Click Template. The template file contains the correct column headings for import.

2 Enter the sample information in each column for the samples in the run, and then save the file.

4

Document # 1000000006976 v00

3 Click Import Samples and browse to the location of the sample information file.

4 When finished, click Save Run.

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

5

Analysis Methods

The TruSight Tumor 15 analysis module performs the following analysis steps and then writes analysis output files to the Analysis folder.

}

Demultiplexes index reads

}

Generates FASTQ files

} Aligns to a reference

}

Identifies variants

Demultiplexing

Demultiplexing compares each Index Read sequence to the index sequences specified for the run. No quality values are considered in this step.

Index reads are identified using the following steps:

}

Samples are numbered starting from 1 based on the order they are listed for the run.

}

Sample number 0 is reserved for clusters that were not assigned to a sample.

} Clusters are assigned to a sample when the index sequence matches exactly or when there is up to a single mismatch per Index Read.

FASTQ File Generation

After demultiplexing, the software generates intermediate analysis files in the FASTQ format, which is a text format used to represent sequences. FASTQ files contain reads for each sample and the associated quality scores. Any controls used for the run and clusters that did not pass filter are excluded.

Each FASTQ file contains reads for only 1 sample, and the name of that sample is included in the FASTQ file name. In the TruSight Tumor 15 workflow, 2 FASTQ files are generated per sample, 1 from the Mix A library, and 1 from the Mix B library. FASTQ files are the primary input for alignment.

Read Stitching

The TruSight Tumor 15 analysis module performs read stitching by default.

When enabled, paired-end reads that overlap are stitched to form a single read in the

FASTQ file. At each overlap position, the consensus stitched read has the base call and quality score of the read with higher Q-score.

For each paired read, a minimum of 10 bases must overlap between Read 1 and Read 2 to be a candidate for read stitching. The minimum threshold of 10 bases minimizes the number of reads that are stitched incorrectly due to a chance match. Candidates for read stitching are scored as follows:

}

For each possible overlap of 10 base pairs or more, a mismatch score is calculated.

Perfectly matched overlaps have a MismatchRate of 0, resulting in a score of 1.

}

If the best overlap has a score of ≥ 0.9 and the score is ≥ 0.1 higher than any other candidate, then the reads are stitched together at this overlap.

} Paired-end reads that cannot be stitched are converted to 2 single reads in the

FASTQ file.

Although the stitched reads are aligned as a single sequence, the stitched read is split into individual alignments in the BAM file.

6

Document # 1000000006976 v00

Alignment

During the alignment step, the banded Smith-Waterman algorithm aligns clusters from each sample against amplicon sequences specified in the manifest file.

The banded Smith-Waterman algorithm performs local sequence alignments to determine similar regions between 2 sequences. Instead of comparing the total sequence, the Smith-Waterman algorithm compares segments of all possible lengths. Local alignments are useful for dissimilar sequences that are suspected to contain regions of similarity within the larger sequence. This process allows alignment across small amplicon targets, often less than 10 bp.

Each paired-end read is evaluated in terms of its alignment to the relevant probe sequences for that read.

}

Read 1 is evaluated against the reverse complement of the Downstream Locus-

Specific Oligos (DLSO).

} Read 2 is evaluated against the Upstream Locus-Specific Oligos (ULSO).

} If the start of a read matches a probe sequence with no more than 1 mismatch, the full length of the read is aligned against the amplicon target for that sequence.

Alignments that include more than 3 indels are filtered from alignment results. Filtered alignments are written in alignment files as unaligned and are not used in variant calling.

Variant Calling

Developed by Illumina, the somatic variant caller identifies variants present at low frequency in the DNA sample.

The somatic variant caller identifies SNPs in 3 steps:

} Considers each position in the reference genome separately

}

Counts bases at the given position for aligned reads that overlap the position

}

Computes a variant score that measures the quality of the call using Poisson model.

Variants are first called for each library separately. Then, variants from each library are compared and combined into a single output file. If a variant meets the following criteria, the variant is marked as PASS in the variant call (VCF) file:

}

The variant is present in both libraries

}

Has a cumulative depth of 1000 or an average depth of 500x per library

} Has a variant frequency of ≥ 2.6% as reported in the merged VCF file

A locus for a mutation or reference is classified as a no call under the following conditions:

}

The variant frequency is near the signal noise level between 1% and 2.6%

} The variant quality is < Q30

}

The depth is < 500

}

Significant strand bias is detected

}

The indel occurs in a homopolymer region

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

7

View Analysis Results

1 From the Local Run Manager dashboard, click the run name.

2 From the Run Overview tab, review the sequencing run metrics.

3 [Optional] Click the Copy to Clipboard icon for access to the output run folder.

4 Click the Sequencing Information tab to review run parameters and consumables information.

5 Click the Samples and Results tab.

6 If analysis was repeated, expand the Select Analysis drop-down and select the appropriate analysis.

7 [Optional] Click the Copy to Clipboard icon for access to the Analysis folder.

8

Document # 1000000006976 v00

Analysis Report

Analysis results are summarized on the Samples and Results tab. The report is also available in a PDF and *.txt file format for each sample and as an aggregate report in the

Analysis folder.

Sample Information

Table 1 Sample Information Table

Column Heading

Sample ID

Description

The sample ID provided when the run was created.

Sample Description

Run ID

The sample description, if provided.

The name of the run folder.

Variant Results

Table 2 Variant Results Table

Column Heading Description

Gene

Amino Acid Change

Variant Type

Nucleotide Change

Variant Frequency

Transcript

The gene where the SNV, insertion, or deletion is detected.

Human Genome Variation Society (HGVS) protein notation.

Consequence on protein function.

HGVS nucleotide notation.

Fraction of reads in which the variant was detected.

Ensembl canonical transcript.

No Calls

Table 3 No Calls Table

Column Heading

Gene

Chromosome

Coordinate

Failed Filter

Description

The gene where the no call is located.

The chromosome where the no call is located.

The coordinate where the no call is located.

The reason for the no call.

Low Variant Frequency—The variant frequency is below a cutoff. Identical to LowVariantFreq in the VCF File Filter entry.

Low Coverage—The depth of coverage is below a cutoff.

Identical to LowDP in the VCF File Filter entry.

Low Genotype Quality—The genotyping quality is below a cutoff. Identical to LowGQ in the VCF File Filter entry.

Indel Reference Repeat—For an indel, the number of adjacent repeats (1-base or 2-base) in the reference is greater than 8. Identical to R8 in the VCF File Filter entry.

Strand Bias—The strand bias is more than the given threshold. Identical to SB in the VCF File Filter entry.

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

9

Analysis Output Files

The following analysis output files are generated for the TruSight Tumor 15 analysis module and provide analysis results for alignment and variant calling. Analysis output files are located in the Analysis folder.

File Name

Demultiplexing (*.demux)

FASTQ (*.fastq.gz)

Description

Intermediate files containing demultiplexing results.

Intermediate files containing quality scored base calls.

FASTQ files are the primary input for the alignment step.

Contains aligned reads for a given sample.

Alignment files in the

BAM format (*.bam)

Per-library variant call files in the VCF format

(*.vcf)

Variant call files in the genome VCF format

(*.genome.vcf)

Merged variant call files in the VCF format (*.vcf)

Contains information about variants found at specific positions in a reference genome.

Contains the genotype for each position, whether called as a variant or called as a reference.

RunMetricsReport.txt

SampleMetricsReport.txt

Filtered gVCF File

Report.vcf

AmpliconCoverage_M1.tsv

*.ant files

Contains selected specific coordinates from the gVCF files for Mix A and Mix B for a final merged VCF file for the sample.

The Run Metrics Report shows run metrics and suggested values to determine if run quality results are within an acceptable range. For Read 1 and Read 2, shows the average percentage of bases ≥ Q30, which is a quality score (Q-score) measurement. A Q-score is a prediction of the probability of a wrong base call.

Provides calculations from the gVCF file for each sample in Mix A and Mix B.

Provides a report for a subset of variants listed in the

TruSight Tumor 15 Report Definition File.

Contains information about coverage per amplicon per sample for each manifest provided. M# represents the manifest number.

*.gVCF and filtered *.vcf files information is also provided in the *.ant file annotation format.

Demultiplexing File Format

The process of demultiplexing reads the index sequence attached to each cluster to determine from which sample the cluster originated. The mapping between clusters and sample number are written to 1 demultiplexing (*.demux) file for each tile of the flow cell.

Demultiplexing files are binary files written to the L001 folder in

Data\Intensities\BaseCalls\L001 . The file naming format is s_1_X.demux, where X is the tile number.

Demultiplexing files start with a header:

10

Document # 1000000006976 v00

} Version (4 byte integer), currently 1

}

Cluster count (4 byte integer)

The remainder of the file consists of sample numbers for each cluster from the tile.

When the demultiplexing step is complete, a demultiplexing file named

DemultiplexSummaryF1L1.txt is written to the Analysis folder.

}

In the file name, F1 represents the flow cell number.

} In the file name, L1 represents the lane number.

}

Demultiplexing results in a table with 1 row per tile and 1 column per sample, including sample 0.

}

The most commonly occurring sequences in index reads.

FASTQ File Format

FASTQ file is a text-based file format that contains base calls and quality values per read.

Each record contains 4 lines:

} The identifier

}

The sequence

}

A plus sign (+)

} The quality scores in an ASCII encoded format

The identifier is formatted as:

@Instrument:RunID:FlowCellID:Lane:Tile:X:Y ReadNum:FilterFlag:0:SampleNumber

Example:

@SIM:1:FCX:1:15:6329:1045 1:N:0:2

TCGCACTCAACGCCCTGCATATGACAAGACAGAATC

+

<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=

FASTQ File Names

FASTQ files are named with the sample name and the sample number. The sample number is a numeric assignment based on the order that the sample is listed for the run.

For example:

Data\Intensities\BaseCalls\samplename_S1_L001_R1_001.fastq.gz

}

samplename—The sample name listed for the sample. If a sample name is not provided, the file name includes the sample ID.

} S1—The sample number based on the order that samples are listed for the run starting with 1. In this example, S1 indicates that this sample is the first sample listed for the run.

NOTE

Reads that cannot be assigned to any sample are written to a FASTQ file for sample number 0, and excluded from downstream analysis.

}

L001—The lane number.

} R1—The read. In this example, R1 means Read 1. For a paired-end run, a file from

Read 2 includes R2 in the file name.

}

001—The last segment is always 001.

FASTQ files are compressed in the GNU zip format, as indicated by *.gz in the file name.

FASTQ files can be uncompressed using tools such as gzip (command-line) or 7-zip

(GUI).

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

11

BAM File Format

A BAM file (*.bam) is the compressed binary version of a SAM file that is used to represent aligned sequences up to 128 Mb. SAM and BAM formats are described in detail at https://samtools.github.io/hts-specs/SAMv1.pdf.

BAM files are written to the Analysis folder and use the file naming format of

SampleName_S#.bam, where # is the sample number determined by the order that samples are listed for the run.

BAM files contain a header section and an alignments section:

}

Header—Contains information about the entire file, such as sample name, sample length, and alignment method. Alignments in the alignments section are associated with specific information in the header section.

} Alignments—Contains read name, read sequence, read quality, alignment information, and custom tags. The read name includes the chromosome, start coordinate, alignment quality, and the match descriptor string.

The alignments section includes the following information for each or read pair:

} RG: Read group, which indicates the number of reads for a specific sample.

}

BC: Barcode tag, which indicates the demultiplexed sample ID associated with the read.

}

SM: Single-end alignment quality.

} AS: Paired-end alignment quality.

}

NM: Edit distance tag, which records the Levenshtein distance between the read and the reference.

}

XN: Amplicon name tag, which records the amplicon tile ID associated with the read.

BAM files are suitable for viewing with an external viewer such as IGV or the UCSC

Genome Browser.

BAM index files (*.bam.bai) provide an index of the corresponding BAM file.

VCF File Format

VCF is a widely used file format developed by the genomics scientific community that contains information about variants found at specific positions in a reference genome.

VCF files use the file naming format SampleName_S#.vcf, where # is the sample number determined by the order that samples are listed for the run.

VCF File Header—Includes the VCF file format version and the variant caller version.

The header lists the annotations used in the remainder of the file. If MARS is listed, the

Illumina internal annotation algorithm annotated the VCF file. The VCF header includes the reference genome file and .bam file. The last line in the header contains the column headings for the data lines.

VCF File Data Lines—Each data line contains information about a single variant.

VCF File Headings

Heading

CHROM

Description

The chromosome of the reference genome. Chromosomes appear in the same order as the reference FASTA file.

12

Document # 1000000006976 v00

Heading

POS

REF

ALT

QUAL

Description

The single-base position of the variant in the reference chromosome.

For SNPs, this position is the reference base with the variant; for indels or deletions, this position is the reference base immediately before the variant.

The reference genotype. For example, a deletion of a single T is represented as reference TT and alternate T. An A to T single nucleotide variant is represented as reference A and alternate T.

The alleles that differ from the reference read.

For example, an insertion of a single T is represented as reference A and alternate AT. An A to T single nucleotide variant is represented as reference A and alternate T.

A Phred-scaled quality score assigned by the variant caller.

Higher scores indicate higher confidence in the variant and lower probability of errors. For a quality score of Q, the estimated probability of an error is 10

-(Q/10)

. For example, the set of Q30 calls has a 0.1% error rate. Many variant callers assign quality scores based on their statistical models, which are high in relation to the error rate observed.

VCF File Annotations

Heading

FILTER

INFO

Description

If all filters are passed, PASS is written in the filter column.

LowDP—Applied to sites with depth of coverage below a cutoff.

LowGQ—The genotyping quality (GQ) is below a cutoff.

LowQual—The variant quality (QUAL) is below a cutoff.

LowVariantFreq—The variant frequency is less than the given threshold.

R8—For an indel, the number of adjacent repeats (1-base or 2-base) in the reference is greater than 8.

SB—The strand bias is more than the given threshold.

Possible entries in the INFO column include:

CSQ—Consequence as predicted by Illumina Annotation Engine (IAE).

DP—The depth (number of base calls aligned to a position and used in variant calling).

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

13

Heading

FORMAT

SAMPLE

Description

The format column lists fields separated by colons. For example, GT:GQ.

Available fields include:

AD—Entry of the form X,Y, where X is the number of reference calls, and Y is the number of alternate calls.

GQ—Genotype quality.

GQX—Genotype quality. GQX is the minimum of the GQ value and the QUAL column. In general, these values are similar; taking the minimum makes GQX the more conservative measure of genotype quality.

GT—Genotype. 0 corresponds to the reference base, 1 corresponds to the first entry in the ALT column, and so on. The forward slash (/) indicates that no phasing information is available.

NL—Noise level; an estimate of base calling noise at this position.

SB—Strand bias at this position. Larger negative values indicate less bias; values near 0 indicate more bias. Used with the somatic variant caller and

GATK.

VF—Variant frequency; the percentage of reads supporting the alternate allele.

The sample column gives the values specified in the FORMAT column.

Genome VCF Files

Genome VCF (gVCF) files are VCF v4.1 files that follow a set of conventions for representing all sites within the genome in a reasonably compact format. The gVCF files include all sites within the region of interest in a single file for each sample.

The gVCF file shows no-calls at positions with low coverage, or where a low-frequency variant (< 2.6%) occurs often enough (> 1%) that the position cannot be called to the reference. A genotype (GT) tag of ./. indicates a no-call.

For more information, see sites.google.com/site/gvcftools/home/about-gvcf .

Per-Library and Merged gVCF Files

The TruSight Tumor 15 workflow generates 2 sets of variant call files.

}

Per-library VCF and gVCF files—Contains variants called in either library. Perlibrary files are written to the Libraries folder.

} Merged gVCF files—Contain variants called from both libraries. Merged files are written to the Analysis folder.

Per-library files include both VCF (*.vcf) and gVCF (*.genome.vcf) files, and use the following naming convention, where S# represents the order that the sample is listed for the run:

} Reports for all sites—SampleName_S#.genome.vcf

}

Reports variants only—SampleName_S#.vcf

Merged gVCF files use the following naming convention:

}

Reports for all sites—SampleName.genome.vcf

For filtered gVCF files, see

Filtered gVCF File Report on page 15 .

Per-Library VCF Files

Variants are called in the Mix A library and the Mix B library to produce an independent set of VCF files for each library. The set of per-library VCF files include both

VCF and gVCF files.

14

Document # 1000000006976 v00

Variants are listed in the VCF file using the following criteria:

}

Include variants that were flagged as filtered

} Exclude variants with a variant frequency of less than 2.6%

} Variants that pass filters include PASS in the FILTER column

}

Variants that fail filters include the filter name in the FILTER column

}

Filter variants due to probe bias (PB) when the variant frequency differs significantly between libraries

Merged gVCF Files

The software selects specific coordinates from the gVCF files generated for Mix A and

Mix B to create a final merged VCF file for the sample.

Merged gVCF files are written to the Analysis folder.

Run Metrics Report

Table 4 Run Metrics Report Table

Column Heading

Metric

Description

Type of metric.

Reads PF (%)

Q30+(R1)

Q30+(R2)

Value

The percentage of reads passing filter.

The percentage of reads in Read 1 with a quality score of 30

(Q30) or greater.

The percentage of reads in Read 2 with a quality score of 30

(Q30) or greater.

Percentage of reads.

Sample Metrics Report

Table 5 Sample Metrics Results Table

Column Heading Description

Sample ID

MixABases≥500x (%)

MixBBases≥500x (%)

MixAOnTarget (%)

MixBOnTarget (%)

The sample ID provided when the run was created.

For the sample, the number of bases in library A that have ≥ 500 coverage.

For the sample, the number of bases in library B that have ≥ 500 coverage.

For the sample, percentage of reads in library A that aligned to the manifest.

For the sample, percentage of reads in library B that aligned to the manifest.

Filtered gVCF File Report

The TruSight Tumor 15 workflow provides variant calls for all genes specified in the manifest files. The workflow also filters gVCF file information for a subset of variants.

The subset is listed in the TruSight Tumor 15 Report Definition File and is included with the Local Run Manager software installer. When a variant from this list is detected, it is added to a filtered gVCF file report that is provided in the *.vcf format. For more information on gVCF files, see Genome VCF Files on page 1 .

Filtered gVCF files are written to the Analysis folder and use the following naming convention:

}

SampleName_Report.vcf

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

15

Amplicon Coverage File

An amplicon coverage file is generated for each manifest file. The M# in the file name represents the manifest number as it is listed in the samples table for the run.

Each file includes a header row that contains the sample IDs associated with the manifest. Under the header row are 3 columns that list the following information:

} The Target ID as it is listed in the manifest.

} The coverage depth of reads passing filter.

}

The total coverage depth.

Supplementary Output Files

The following output files provide supplementary information, or summarize run results and analysis errors. Although, these files are not required for assessing analysis results, they can be used for troubleshooting purposes. All files are located in the Analysis folder unless otherwise specified.

File Name

AnalysisLog.txt

AnalysisError.txt

CompletedJobInfo.xml

DemultiplexSummaryF1L1.txt

ErrorsAndNoCallsByLaneTile

ReadCycle.csv

Mismatch.htm

AmpliconRunStatistics.xml

Summary.xml

Summary.htm

Description

Processing log that describes every step that occurred during analysis of the current run folder. This file does not contain error messages.

Located in the root level of the run folder.

Processing log that lists any errors that occurred during analysis. This file is present only if errors occurred.

Located in the root level of the run folder.

Written after analysis is complete, contains information about the run, such as date, flow cell ID, software version, and other parameters.

Located in the root level of the run folder.

Reports demultiplexing results in a table with 1 row per tile and 1 column per sample.

A comma-separated values file that contains the percentage of errors and no-calls for each tile, read, and cycle.

Contains histograms of mismatches per cycle and nocalls per cycle for each tile.

Contains summary statistics specific to the run.

Located in the root level of the run folder.

Contains a summary of mismatch rates and other base calling results.

Contains a summary web page generated from

Summary.xml.

Analysis Folder

The analysis folder holds the files generated by the Local Run Manager software.

The relationship between the output folder and analysis folder is summarized as follows:

16

Document # 1000000006976 v00

} During sequencing, Real-Time Analysis (RTA) populates the output folder with files generated during image analysis, base calling, and quality scoring.

}

RTA copies files to the analysis folder in real time. After RTA assigns a quality score to each base for each cycle, the software writes the file RTAComplete.xml to both folders.

} When the file RTAComplete.xml is present, analysis begins.

} As analysis continues, Local Run Manager writes output files to the analysis folder, and then copies the files back to the output folder.

Folder Structure

Data

Intensities

BaseCalls

Analysis—Contains *.bam and *.vcf files, and files specific to the analysis module.

L001—Contains one subfolder per cycle, each containing *.bcl files.

Sample1_S1_L001_R1_001.fastq.gz

Sample2_S2_L001_R1_001.fastq.gz

Undetermined_S0_L001_R1_001.fastq.gz

L001—Contains *.locs files, 1 for each tile.

RTA Logs—Contains log files from RTA software analysis.

InterOp—Contains binary files used by Sequencing Analysis Viewer (SAV).

Logs—Contains log files describing steps performed during sequencing.

Queued—A working folder for software; also called the copy folder.

AnalysisError.txt

AnalysisLog.txt

CompletedJobInfo.xml

QueuedForAnalysis.txt

AmpliconRunStatistics.xml

RTAComplete.xml

RunInfo.xml

runParameters.xml

Analysis Folders

Each time that analysis is requeued, the Local Run Manager creates an Analysis folder named Analysis_N, where N is a sequential number.

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

17

Notes

Technical Assistance

For technical assistance, contact Illumina Technical Support.

Table 6 Illumina General Contact Information

Website

www.illumina.com

Email

[email protected]

Table 7 Illumina Customer Support Telephone Numbers

Region

North America

Australia

Austria

Belgium

China

Denmark

Finland

France

Germany

Hong Kong

Ireland

Italy

Contact Number

1.800.809.4566

1.800.775.688

0800.296575

0800.81102

400.635.9898

80882346

0800.918363

0800.911850

0800.180.8994

800960230

1.800.812949

800.874909

Region

Japan

Netherlands

New Zealand

Norway

Singapore

Spain

Sweden

Switzerland

Taiwan

United Kingdom

Other countries

Contact Number

0800.111.5011

0800.0223859

0800.451.650

800.16836

1.800.579.2745

900.812168

020790181

0800.563118

00806651752

0800.917.0041

+44.1799.534000

Safety data sheets (SDSs)—Available on the Illumina website at support.illumina.com/sds.html

.

Product documentation—Available for download in PDF from the Illumina website. Go to support.illumina.com, select a product, then select Documentation & Literature.

Local Run Manager TruSight Tumor 15 Analysis Module Workflow Guide

Illumina

5200 Illumina Way

San Diego, California 92122 U.S.A.

+1.800.809.ILMN (4566)

+1.858.202.4566 (outside North America) [email protected]

www.illumina.com

Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement

Table of contents