dissertation onlineversion MFe 2008 08 14 002a

dissertation onlineversion MFe 2008 08 14 002a
Rekonstruktion von
Gen-Interaktionsnetzen durch in vitro
RNA Interferenz und globale
Expressionsanalyse
Inaugural-Dissertation
zur
Erlangung der Doktorwürde der
Naturwissenschaftlich-Mathematischen Gesamtfakultät der
Ruprecht-Karls-Universität
Heidelberg
vorgelegt von
Dipl.-Chem. Mark Fellmann
aus
Mönchengladbach, NRW
Heidelberg, im August 2008
Aus der Abteilung
Molekulare Genomanalyse
am
Deutschen Krebsforschungszentrum
Erstgutachter:
Zweitgutachter:
Herr Prof. Dr. Werner Buselmaier
Herr PD Dr. Holger Sültmann
Einige der hier dargestellten Ergebnisse wurden vorab auf wissenschaftlichen
Konferenzen präsentiert:
Vorträge
• M. Fellmann, R. Kuner, H. Froehlich, A. Tresch, T. Beissbarth, M. Ruschhaupt,
A. Poustka, H. Sueltmann
„Reconstruction of gene interaction networks from microarray data and RNA
interference experiments“
10th Status Seminar Chip Technologies
Januar 2008, DECHEMA, Frankfurt/Main, Deutschland
• M. Fellmann, R. Kuner, H. Froehlich, A. Tresch, T. Beissbarth, M. Ruschhaupt,
A. Poustka, H. Sueltmann
„Reconstruction of gene interaction networks from microarray data and RNA
interference experiments“
4th Status Seminar Chemical Biology
November 2007, DECHEMA, Frankfurt/Main, Deutschland
• M. Fellmann, A. Buness, T. Beissbarth, M. Ruschhaupt, A. Tresch, R. Kuner,
A. Poustka, H. Sueltmann
„Unravel the ER-alpha pathway in breast cancer: A combinatorial approach of
RNA interference and DNA microarray technology“
NGFG Meeting
November 2006, Heidelberg, Deutschland
Poster Präsentationen
• M. Fellmann, H. Froehlich, A. Tresch, T. Beissbarth, M. Ruschhaupt, R. Kuner,
A. Poustka, H. Sueltmann
„Different approaches to estimate networks from microarray data and RNA
interference experiments“
Bioperspectives
Mai 2007, Köln, Deutschland
• M. Fellmann, A. Buness, T. Beissbarth, M. Ruschhaupt, A. Tresch, R. Kuner,
A. Poustka, H. Sueltmann
„Unravel the ER-alpha pathway in breast cancer: A combinatorial approach of
RNA interference and DNA microarray technology“
9th Status Seminar Chip Technologies
Februar 2007, DECHEMA, Frankfurt/Main, Deutschland
• M. Fellmann, A. Buness, M. Ruschhaupt, A. Tresch, T. Beissbarth, R. Kuner,
A. Poustka, H. Sueltmann
„Delineating breast cancer gene expression systems by RNA interference and
global microarray analysis in human tumor cells“
Internationl Conference on Systems Biology
Oktober 2006, Yokohama, Japan
• M. Fellmann, A. Buness, A. Tresch, R. Kuner, M. Ruschhaupt, O. Sahin, T.
Beissbarth, D. Arlt, S. Wiemann, A. Poustka, H. Sueltmann
„Delineating breast cancer gene expression systems by RNA interference and
global microarry analysis“
Systems Biology of Mammalian Cells Conference
Juli 2006, Heidelberg, Deutschland
• M. Fellmann, A. Buness, A. Tresch, M. Ruschhaupt, O. Sahin, T. Beissbarth,
D. Arlt, S. Wiemann, R. Kuner, A. Poustka, H. Sueltmann
„Construction of gene expression networks by RNA interference in human cells“
Genomes to Systems Conference
März 2006, Manchester, UK
vi
Danksagungen
In erster Linie bin ich Prof. Dr. Annemarie Poustka post mortem zu tiefem
Dank verpflichtet.
Herrn Prof. Dr. Werner Buselmaier danke ich für die freundliche Übernahme
des Erstgutachtens.
Meinem Gruppenleiter, Herrn PD Dr. Holger Sültmann, danke ich herzlich für
die Betreuung, Unterstützung und Finanzierung meiner Arbeiten.
Über die Jahre meiner Dissertation hat vor allem eine Person meinen besonderen
Dank für ihren unermüdlichen Laboreinsatz verdient: Sabrina Balaguer-Puig!
Very special thanks go to Andrew J. Smith, LATEX- and Photoshopexpert,
HelpDesk-Hotline and, first of all, very good friend. Thanks mate!
Holger Fröhlich danke ich für die bioinformatischen Arbeiten und geduldige
Diskussionsbereitschaft.
Einige Kollegen (offensichtlich sogar recht viele) waren in diese Arbeiten involviert und stets freundliche sowie kritische Diskussionspartner: Christian Löbke,
Özgür Sahin, Ruprecht Kuner, Florian Hahne, Achim Tresch, Tim Beissbarth,
Markus Ruschhaupt, Frauke Henjes, Andreas Buness, Dirk Ledwinka, Nicole
Chui Pressinotti und, nicht zuletzt, mein Praktikant Mathias Munschauer.
Als nächstes möchte ich einigen sehr guten Freunden für die Zeit in Heidelberg
und Düsseldorf danken: Florian Reh, Sven Mesecke, Anne Lotzemer-Jentges,
Jakob A. Tschäpe, Marianne Uteng, Van-Duc Luu, Christian Fenster, Maria
Georgiou, Thorsten Gelbrich und Andreas Kaiser.
Dank an meine Schwester Sonja mit Boris, Carolin und Sophie für die familiäre
Unterstützung.
Ein ganz besonderer, herzlicher Dank gebührt meinen wunderbaren und großartigen Eltern, die mich in all den Jahren stets liebevoll unterstützt, aufgemuntert,
und immer an mich geglaubt haben.
Til sist ønsker jeg å utrykke min dypeste takknemlighet til den viktigste personen i livet mitt: Linda Løvdok. Jeg får ikke gitt utrykk for hvor heldig og
takknemlig jeg er for at du er ved min side. Tusen takk for at du alltid er der
for meg.
In three minutes, 98 percent of all the matter there is or will ever be has been
produced. We have a universe. It is a place of the most wondrous and
gratifying possibility, and beautiful, too. And it was all done in about the time
it takes to make a sandwich
Bill Bryson
Rekonstruktion von
Gen-Interaktionsnetzen durch in
vitro RNA Interferenz und globale
Expressionsanalyse
Inaugural-Dissertation
vorgelegt von
Dipl.-Chem. Mark Fellmann
Inhaltsverzeichnis
Zusammenfassung
xvii
Abstract
xix
1 Einleitung
1.1 Epidemiologie des Mammakarzinoms . . . . . . .
1.2 Hormonabhängigkeit des Mammakarzinoms . . .
1.2.1 Endokrine Therapie des Mammakarzinoms
1.3 Der Estrogenrezeptor . . . . . . . . . . . . . . . .
1.4 Aktivitäten des ERα . . . . . . . . . . . . . . . .
1.4.1 Die genomische Aktivität des ERα . . . .
1.4.2 Die nicht-genomische Aktivität des ERα .
1.5 RNA Interferenz und siRNA . . . . . . . . . . . .
1.5.1 Der Mechanismus der RNA Interferenz . .
1.6 Zielsetzung dieser Arbeit . . . . . . . . . . . . . .
1
2
2
6
7
8
9
10
12
12
15
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
2 Material und Methoden
2.1 Zelllinien . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.2 Chemikalien . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.3 Puffer, Medien, Reaktionslösungen und Enzyme . . . . . . . . .
2.4 Reaktionskits . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.5 Nukleotide und Nukleinsäuren . . . . . . . . . . . . . . . . . . .
2.6 „Assay on Demand“ für TaqMan qRT-PCR-Analysen . . . . . .
2.7 siRNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.8 Kultivierung und Passagierung von MCF-7 Zellen . . . . . . . .
2.9 Transfektion humaner epithelialer Mammakarzinomzellen . . . .
2.10 Stimulation von Mammakarzinomzellen mit endokrinen Substanzen
2.11 Behandlung von Mammakarzinomzellen mit Tamoxifen . . . . .
2.12 Weiterverarbeitung von Nukleinsäuren . . . . . . . . . . . . . .
17
17
17
18
19
19
19
20
22
22
23
23
24
xiii
Inhaltsverzeichnis
2.13
2.14
2.15
2.16
2.17
2.18
2.12.1 RNA Isolation aus Zellkultur . . . . . . . . . . . . . . .
2.12.2 Präzipitation von Nukleinsäuren . . . . . . . . . . . . . .
2.12.3 Bestimmung von Nukleinsäurekonzentrationen . . . . . .
2.12.4 Qualitätskontrolle von isolierter total RNA . . . . . . . .
Erststrangsynthese von komplementärer DNA (cDNA-Synthese)
quantitative realtime-PCR (TaqMan) . . . . . . . . . . . . . . .
2.14.1 ∆∆Ct-Methode . . . . . . . . . . . . . . . . . . . . . . .
Biochemische Methoden . . . . . . . . . . . . . . . . . . . . . .
2.15.1 Zell-Lebensfähigkeits Assay WST-1 . . . . . . . . . . . .
cDNA Microarray-Technologie . . . . . . . . . . . . . . . . . . .
2.16.1 Herstellung von humanen, genomweiten cDNA-Microarrays
2.16.2 Nachbehandlung der gespotteten cDNA-Microarrays . . .
2.16.3 Lineare Amplifikation isolierter mRNA . . . . . . . . . .
2.16.4 Fluoreszenzmarkierung amplifizierter RNA . . . . . . . .
2.16.5 Hybridisierung von cDNA-Microarrays . . . . . . . . . .
2.16.6 Messung und Quantifizierung von cDNA-Microarrays . .
Statistische Auswertung der genomweiten Expressionsanalysen .
Netzwerkrekonstruktion durch Nested Effects Model Algorithmus
3 Ergebnisse
3.1 Auswahl der Gene für die post-transkriptionelle Genstilllegung
3.2 Etablierung des Messprinzips . . . . . . . . . . . . . . . . . .
3.3 Genomweite Expressionsanalyse des Etablierungsexperimentes
3.4 Überprüfung der Zell-Lebensfähigkeit . . . . . . . . . . . . . .
3.5 Post-Transkriptionelle Genstilllegung durch RNA Interferenz .
3.5.1 AKT1 . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.2 AKT2 . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.3 BCL2 . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.4 CCNG2 . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.5 ESR1 . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.6 FOXA1 . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.7 HSPB8 . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.8 MAPK1 . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.9 STAT5B . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.10 STC2 . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.11 TMEM45B . . . . . . . . . . . . . . . . . . . . . . . .
3.5.12 TP53 . . . . . . . . . . . . . . . . . . . . . . . . . . .
xiv
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
24
24
24
25
25
26
26
27
27
28
28
29
30
30
31
31
32
34
37
38
41
43
45
47
47
48
49
49
49
50
50
50
50
51
51
52
Inhaltsverzeichnis
3.6
3.7
3.8
3.9
3.10
3.11
3.12
3.13
3.5.13 XBP1 . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Kombinatorische post-transkriptionelle Genstilllegungen . . . . .
3.6.1 CCNG2 und ESR1 . . . . . . . . . . . . . . . . . . . . .
3.6.2 ESR1 und MAPK1 . . . . . . . . . . . . . . . . . . . . .
3.6.3 MAPK1 und STAT5B . . . . . . . . . . . . . . . . . . .
Stimulation und Inhibition des Estrogenrezeptors . . . . . . . .
3.7.1 Stimulation mit 17β-Estradiol . . . . . . . . . . . . . . .
3.7.2 Inhibition mit Tamoxifen . . . . . . . . . . . . . . . . . .
Expressionsanalysen nach Genstilllegung . . . . . . . . . . . . .
3.8.1 Expressionsprofil AKT1 Silencing . . . . . . . . . . . . .
3.8.2 Expressionsprofil AKT2 Silencing . . . . . . . . . . . . .
3.8.3 Expressionsprofil BCL2 Silencing . . . . . . . . . . . . .
3.8.4 Expressionsprofil CCNG2 Silencing . . . . . . . . . . . .
3.8.5 Expressionsprofil ESR1 Silencing . . . . . . . . . . . . .
3.8.6 Expressionsprofil ESR1/CCNG2 Silencing . . . . . . . .
3.8.7 Expressionsprofil ESR1/MAPK1 Silencing . . . . . . . .
3.8.8 Expressionsprofil FOXA1 Silencing . . . . . . . . . . . .
3.8.9 Expressionsprofil HSPB8 Silencing . . . . . . . . . . . .
3.8.10 Expressionsprofil MAPK1 Silencing . . . . . . . . . . . .
3.8.11 Expressionsprofil MAPK1/STAT5B Silencing . . . . . .
3.8.12 Expressionsprofil STAT5B Silencing . . . . . . . . . . . .
3.8.13 Expressionsprofil STC2 Silencing . . . . . . . . . . . . .
3.8.14 Expressionsprofil TMEM45B Silencing . . . . . . . . . .
3.8.15 Expressionsprofil TP53 Silencing . . . . . . . . . . . . .
3.8.16 Expressionsprofil XBP1 Silencing . . . . . . . . . . . . .
Netzwerkrekonstruktion aus den Literaturdaten . . . . . . . . .
Netzwerkrekonstruktion aus den genomweiten Expressionsanalysen
Epistaseanalyse der kombinierten Silencing Experimente . . . .
3.11.1 Epistaseanalyse von ESR1 und CCNG2 . . . . . . . . .
3.11.2 Epistaseanalyse von ESR1 und MAPK1 . . . . . . . . .
3.11.3 Epistaseanalyse von MAPK1 und STAT5B . . . . . . . .
Expressionsanalysen der Behandlung mit endokrinen Substanzen
3.12.1 Expressionsanalyse der 17β-Estradiol Behandlung . . . .
3.12.2 Expressionsanalyse der Tamoxifen Behandlung . . . . . .
Hierarchische Clusteranalysen . . . . . . . . . . . . . . . . . . .
3.13.1 Vergleich ERα Silencing und Tamoxifen Behandlung . .
52
52
53
53
53
54
55
56
57
58
59
60
60
61
61
62
62
63
63
64
64
64
64
65
65
65
67
68
70
71
71
72
73
73
74
74
xv
Inhaltsverzeichnis
3.13.2 Vergleich ERα Stimulation und Tamoxifen Behandlung
3.13.3 Vergleich ERα Stimulation und ERα Silencing . . . . .
3.14 Connectivity Map Vergleich . . . . . . . . . . . . . . . . . . .
3.14.1 Connectivity Map Vergleich ESR1 Silencing . . . . . .
3.14.2 Connectivity Map Vergleich ESR1 Stimulation . . . . .
3.14.3 Connectivity Map Vergleich ESR1 Inhibition . . . . . .
3.14.4 Connectivity Map Vergleich AKT2 Silencing . . . . . .
3.14.5 Connectivity Map Vergleich CCNG2 Silencing . . . . .
3.14.6 Connectivity Map Vergleich XBP1 Silencing . . . . . .
4 Diskussion
4.1 Validierung der konstruierten Netzwerkhypothese . . . . . . .
4.1.1 Vergleich mit literaturbekannten Interaktionen . . . . .
4.1.2 Validierung durch Epistaseanalysen . . . . . . . . . . .
4.2 Validierung der Expressionsprofile durch Connectivity Map . .
4.3 Einfluss endokriner Substanzen auf die globale Genexpression
4.4 Vorschlag neuer therapeutischer Ziele . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
76
76
77
79
79
81
81
83
83
.
.
.
.
.
.
85
85
86
91
92
93
95
A Anhang
101
A.1 Qualitätskontrolle isolierter total und amplifizierter RNA . . . . 101
A.2 Graphen der selektiven mRNA Reduktion . . . . . . . . . . . . 102
A.3 Hierarchische Clusteranalysen . . . . . . . . . . . . . . . . . . . 110
Literaturverzeichnis
113
Abbildungsverzeichnis
131
Tabellenverzeichnis
133
Abkürzungsverzeichnis
135
xvi
Zusammenfassung
In dieser Arbeit wurde durch die Kombination von gezielten posttranskriptionellen Genstilllegungen mit Hilfe von sequenzspezifischen siRNAs
und anschließender genomweiter Expressionsanalyse mit cDNA Microarrays die Rekonstruktion von Gen-Interaktionsnetzwerken in der ER-positiven
Mammakarzinom Zelllinie MCF-7 etabliert. Zunächst wurden die verfügbaren
Techniken der RNA Interferenz und der genomweiten Expressionsanalyse grundlegend an die Fragestellung und die Bedingungen der MCF-7 Zelllinie angepasst.
Durch die Experimente wurden hochwertige Messdaten für die statistische Auswertung der Messungen zur Erstellung bzw. Rekonstruktion von Netzwerken
erstellt.
Der „Nested Effects Model“ (NEM) Netzwerk Algorithmus konnte durch unterschiedliche Vergleiche (Literaturdaten, Epistaseanalyse und Connectivity Map
Datenbank) mehrfach biologisch validiert werden. Durch die Interpretation des
transitiv reduzierten, gerichteten Graphen der statistischen Analyse mit dem
NEM Algorithmus konnte der bisher nicht beschriebene aktivierende Effekt der
CCNG2 Expression auf die Expression von ESR1 dargestellt werden.
Die Vergleiche der Expressionsprofile nach Silencing von AKT2 bzw. XBP1 mit
den Experimenten der Connectivity Map Datenbank zeigten starke Korrelationen zu Behandlungen von MCF-7 Zellen mit antiestrogenen Substanzen (Fulvestrant und Raloxifen) bzw. PI3K Inhibitoren (Wortmannin und LY294002).
Aufgrund dieser Ergebnisse, sowie der Positionierung der beiden Gene oberhalb des Estrogenrezeptors im postulierten NEM-Interaktionsnetzwerk, wurden
AKT2 und XBP1 als potentielle neue therapeutische Ziele in der Behandlung
von estrogenabhängigen Mammakarzinomen postuliert.
Durch einen Vergleich der Expressionsänderung nach Stimulation des Estrogenrezeptors mit 17β-Estradiol bzw. Inhibition mit Tamoxifen und der gezielten
Stilllegung durch sequenzspezifische siRNAs in Form von hierarchischen Clusteranalysen konnte der transkriptionelle Kofaktor FHL2 als weiteres potentielles
therapeutisches Ziel postuliert werden.
xvii
Abstract
By combining targeted post-transcriptional gene silencing using sequence specific siRNAs and genome-wide cDNA microarrays, this work was focused on
reconstructing gene interaction networks in ER-positive MCF-7 breast carcinoma cells. Initially, the technique of RNA interference and genome-wide expression profiling was adapted to the constitutive problems and requirements of the
employed MCF-7 cell line system. High-grade performance data for statistical
interpretation of the recordings were compiled for use in generating and reconstructing gene interaction networks.
The „Nested Effects Model“ (NEM) algorithm was validated biologically using
different approaches (literature data, epistasis analysis and Connectivity Map
database). Interpretation of the transitive reduced and directed graph resulting
from the statistical analysis of the NEM algorithm yielded a description of the
activating effect of CCNG2 expression on the expression of ESR1 which was
unknown until now.
The comparison of the expression profiles (after silencing of AKT2 and XBP1 )
with the results from the Connectivity Map database resulted in a strong correlation to the treatment of MCF-7 cells with anti-estrogens (fulvestrant and
raloxifene) or PI3K inhibitors (Wortmannin and LY294002). According to these results, as well as the positioning of the AKT1 and XBP1 upstream of the
estrogen receptor in the postulated NEM interaction network, these two genes
could be postulated as potential new therapeutical targets in the treatment of
erstrogen depending breast carcinomas.
Hierarchical cluster analysis of the expression profiles after selective stimulation of the estrogen receptor with 17β-Estradiol, the inhibition with tamoxifen,
and the targeted knock down of ESR1 with sequence specific siRNAs revealed
the transcriptional cofactor FHL2 as a potential new therapeutical target for
sufficient treatment of estrogen dependent breast cancer.
xix
1 Einleitung
Seit der Entwicklung der cDNA-Microarrays (Schena et al. [1995]) zur globalen
Expressionsanalyse wurden diese zur Untersuchung von genomweiten Expressionsänderungen in tumorösen Geweben verwendet (DeRisi et al. [1996]). Ziel
dieser Untersuchungen war die Entdeckung von eindeutigen Mustern in der Veränderung des genomweiten Expressionsprofils in Bezug auf bestimmten Stadien
einer Krebserkrankung oder die Vohersage von Krankheitsverläufen (Golub et al.
[1999], Perou et al. [1999]). Abgeleitet aus den ermittelten Expressionsprofilen
wurden Aussagen über die Prognose der Tumorerkrankung getroffen (van ’t Veer
et al. [2002], West et al. [2001]) und eine Vielzahl von Genen als Prognosemarker für den Krankheitsverlauf identifiziert (Badve et al. [2007], Esseghir et al.
[2007], Mackay et al. [2003], Oh et al. [2006], Park et al. [2002], Sagara et al.
[2004]). Im Fokus der Expressionsanalyse stehen vor allem Gene, denen Schlüsselfunktionen in Signaltransduktionspfaden zugeschrieben werden, wie z. B. das
Gen ESR1. Als ligandenaktivierter Transkriptionsfaktor ist der Estrogenrezeptor (ER) an der transkriptionellen Regulation einer großen Anzahl von Genen
beteiligt (Klinge [2001], O’Lone et al. [2004]) und wird zur pathologischen Einstufung von Mammakarzinomen verwendet (Block et al. [1975]).
Durch die Entwicklung von bioinformatischen Algorithmen zur Rekonstruktion von Netzwerken (Markowetz et al. [2005], Wagner [2001, 2002, 2004]) wurde
versucht, die Interaktionen in regulatorischen Pfaden aus experimentellen Daten
zu rekonstruieren, um mögliche neue therapeutische Ziele zu identifizieren. Die
Entdeckung der RNA Interferenz (Fire et al. [1998]) und die Anwendung dieser
Technologie auf humane Zellsysteme (Caplen et al. [2001]) führte zu neuen Möglichkeiten der Rekonstruktion von Gen-Interaktionsnetzwerken durch gezielte
Störung von regulatorischen Pfaden und Messung der Effekte durch genomweite Expressionsanalyse. Mit Hilfe von neu entwickelten Algorithmen sollen durch
die Rekonstruktion von Interaktionsnetzwerken aus Microarraydaten nach RNA
Interferenzexperimenten (Fröhlich et al. [2007, 2008]) bisher unbekannte, regula-
1
1 Einleitung
torische Interaktionen zwischen brustkrebsrelevanten Genen und mögliche neue
therapeutische Ziele ermittelt werden.
1.1 Epidemiologie des Mammakarzinoms
Derzeit erkranken in Deutschland jährlich mehr als 57.000 Frauen an Brustkrebs.
Damit stellt Brustkrebs die häufigste Krebserkrankung bei Frauen in Deutschland und weltweit dar (Stewart and Kleihues [2003]). Mit einem durchschnittlichen Erkrankungsalter von 63 Jahren (s. Abb. 1.1) liegt Brustkrebs sechs Jahre
unter dem mittleren Erkankungsalter aller Krebserkrankungen bei der Frau in
Deutschland. Seit 1980 steigt die Brustkrebsinzidenz in Deutschland stetig an,
während die Mortalität bei Mammakarzinomen seit 1990 leicht zurück geht (s.
Abb. 1.2). Derzeit liegt die relative 5-Jahres-Überlebenswahrscheinlichkeit von
Patientinnen mit Mammakarzinom bei ca. 81 % (betrachtet über alle Studien)
(Koch-Institut [2008]).
Neuerkrankungen/100.000
350
300
250
200
150
100
50
0
0-14 15-34 35-39 40-44 45-49 50-54 55-59 60-64 65-69 70-74 75-79 80-84 85+
Altersgruppe
Abbildung 1.1: Schätzung der altersspezifischen Inzidenz in Deutschland 2004,
ICD-10 C50 Neuerkrankungen pro 100.000 in Altersgruppen. Datenquelle: Koch-Institut [2008]
1.2 Hormonabhängigkeit des Mammakarzinoms
Die Entwicklung des Brustdrüsengewebes beginnt während der Embryogenese. Bei der Geburt haben weibliche sowie männliche Säuglinge ein ähnliches,
2
1.2 Hormonabhängigkeit des Mammakarzinoms
Frauen
150
150
135
135
120
120 105
Fälle/100.000
105 90
Inzidenz
90 75
Mortalität
Inzidenz
75 60
Mortalität
60 45
45 30
30 15
15
0
1980
0
1980
1985
1985
1990
1990
1995
Jahr1995
2000
2000
2005
2005
Abbildung 1.2: Altersstandardisierte Inzidenz und Mortalität in Deutschland 19802004, ICD-10 C50. Fälle pro 100.000 (Europastandard). Datenquelle:
Koch-Institut [2008]
rudimentäres Drüsengewebe (Ali and Coombes [2002]). Durch den Beginn der
weiblichen Pubertät wird die Entwicklung der Brustdrüsen in Folge der Abgabe
von Estrogenen in hoher Konzentration sowie von Progesteronen durch die Ovarien eingeleitet. Nach der Pubertät durchläuft das weibliche Brustdrüsengewebe
Zyklen von Wachstum und Involution, welche durch die hormonellen Änderungen während der Monatszyklen sowie durch Schwangerschaft und Milchbildung
reguliert werden. Eine Schwangerschaft führt zu einer Erhöhung der ductalen
Verästelung und vermehrter Differenzierung innerhalb des Brustdrüsengewebes,
welches nach der Entwöhnung des Säuglings zu einer Regression des Brustgewebes durch Apoptose führt (Russo and Russo [1994]). Abb. 1.3 zeigt schematisch den Aufbau der weiblichen Brustdrüse. Die ductale Struktur des weiblichen
Brustdrüsengewebes besteht aus einer kontinuierlichen Schicht aus epithelialen
Zellen (s. Abb. 1.4), welche für die Produktion der Milch verantwortlich sind.
3
1 Einleitung
Clavicula
Haut
Rippe
Muskulatur der
Brustwand
subkutanes Fettgewebe
Stroma
loses
Bindegewebe
Mamille
Milchgang
Alveole
Drüsenläppchen
Abbildung 1.3: Schematischer Aufbau der Brustdrüse
Diese epithelialen Zellen sind ebenfalls für die zelluläre Antwort auf das Sexualhormon 17β-Estradiol zuständig. Im normalen, ruhenden Brustgewebe sind
15 - 20 % der Epithelzellen ER-positiv, die Anzahl der Estrogen-positiven Zellen
ändert sich jedoch im Laufe des Menstruationszyklus. ER-positive Epithelzellen
in der nicht-tumorösen Brust reagieren meist nicht mit einer Differenzierung in
Folge einer 17β-Estradiol-Bindung. Stattdessen differenzieren die ER-negativen
Epithelzellen in unmittelbarer räumlicher Nachbarschaft der ER-positiven Zellen. Es wird vermutet, dass die ER-positiven Epithelzellen die Proliferation der
ER-negativen Zellen durch die Sekretion von parakrinen Faktoren unterstützen (Ali and Coombes [2002]). Der Einfluss der von den Ovarien produzierten
Estrogene auf das Wachstum von metastasierenden Mammakarzinomen wurde
4
1.2 Hormonabhängigkeit des Mammakarzinoms
Myoepithelialzelle
ER-positive Epithelzelle
Basalmembran
ER-negative Epithelzelle
Abbildung 1.4: Schematischer Aufbau eines Milchgangs im Querschnitt
bereits 1896 von George Beatson beschrieben. Beatson konnte zeigen, dass eine Ovarektomie bei Frauen mit metastasierendem Mammakarzinom zu einem
Anstieg der Lebenserwartung führte (Beatson [1896]). Es ist bekannt, dass das
Risiko der Entwicklung eines Mammakarzinoms mit einer frühen Menarche,
einer späten (vollständigen) Schwangerschaft, spät einsetzender Menopause sowie der prolongierten Estrogenexposition einhergeht (Ali and Coombes [2002]).
Weiterhin konnte in mehreren Studien ein Zusammenhang zwischen einer dauerhaft erhöhten Estrogenkonzentration im Blut und dem Risiko der Entwicklung
eines Mammakarzinoms beschrieben werden (Yager and Davidson [2006]). Diese Einflüsse der Estrogene auf die Progression eines Mammakarzinoms haben
zur Entwicklung endokriner Therapieformen geführt, welche darauf abzielen,
die proliferierende Wirkung der Estrogene zu unterbinden. Das Sexualhormon
17β-Estradiol wird bei prämenopausalen Frauen primär in den Ovarien synthetisiert. Neben den Ovarien kann das Hormon jedoch auch u. a. in den mesenchymalen Zellen des Fettgewebes synthetisiert werden (Simpson et al. [2000]).
Die 17β-Estradiol Biosynthese wird durch Aromatase, ein Enzym der Cytochrom P450 Superfamilie, aus androgenen Steroiden in mehreren Schritten synthetisiert (Pasqualini et al. [1996], Simpson and Davis [2001]). Diese ovarienunabhängige Synthese von 17β-Estradiol ist vor allem bei postmenopausalen
Frauen von großer Bedeutung, da so die Versorung mit 17β-Estradiol für die
nicht-reproduktiven Funktionen des Hormons, wie die Aufrechterhaltung der
Knochendichte und den Schutz vor kardiovaskulären Erkrankungen, gewährleistet wird. Die Synthese von 17β-Estradiol in den Ovarien wird durch die Menopause beendet. In postmenopausalen Patientinnen ist die Konzentration an
17β-Estradiol innerhalb von Tumoren oftmals stark erhöht (Pasqualini et al.
5
1 Einleitung
[1996]), da Mammakarzinome in hohem Maße Aromatasen produzieren und
somit die ovarienunabhängige 17β-Estradiol Produktion fördern (Castagnetta
et al. [1996]).
1.2.1 Endokrine Therapie des Mammakarzinoms
Das Mittel der Wahl nach Diagnose eines Mammakarzinoms ist die chirurgische Entfernung des tumorösen Gewebes. An die chirurgische Entfernung des
Tumors schließt meist eine adjuvante Therapie an. Dabei wird durch die Kombination verschiedenster Therapiewege versucht, die Erkrankung, wenn möglich, kurativ zu behandeln. Im Rahmen einer adjuvanten Therapie kommen
meist Chemotherapie, Hormontherapie und Strahlentherapie zur Anwendung.
Die Hormontherapie des Mammakarzinoms kann dabei auf unterschiedlichen
Wegen erfolgen. Zum einen wird versucht, den Effekt der Estrogene auf das
Wachstum von ER-positiven Mammakarzinomen zu unterbinden. Dabei wurde
der selektive Estrogen Rezeptor Modulator (SERM) Tamoxifen anfänglich bei
der Behandlung von metastasierenden ER-positiven Mammakarzinomen eingesetzt (Ward [1973]). In der Zwischenzeit gehört Tamoxifen zur Standardtherapie
nach chirurgischer Entfernung von ER-positiven Mammakarzinomen (Osborne
[1998], Osborne and Schiff [2005]) bei prämenopausalen Patientinnen. Die Therapie von Patientinnen mit operablem Mammakarzinom mit Tamoxifen über
einen Zeitraum von ein bis zwei Jahren führt zu einer Verminderung des Wiederauftretens des Karzinoms sowie zu einer Lebensverlängerung. Durch eine
fünfjährige Behandlung wird dabei eine Reduktion der Sterberate um 28 % und
des Wiederauftretens um 51 % erzielt (Osborne [1998]). Bei postmenopausalen
Patientinnen hat sich die Behandlung mit Aromatase Inhibitoren als ein neuer
Standard durchgesetzt (Howell et al. [2005]). Durch die Inhibition der Aromatase wird die katalytische Umwandlung von Androstendion und Testosteron in
die Estrogene Estron und Estradiol unterbunden (Simpson et al. [1994]). Die
Behandlung von prämenopausalen Patientinnen mit Aromatase Inhibitoren ist
nicht angezeigt, da diese lediglich die ovarienunabhängige Estrogenproduktion unterbinden. Daher kann im Rahmen einer adjuvanten Therapie bei prämenopausalen Patientinnen durch eine medikamentöse Ovarektomie mit einem
Agonisten gegen das „Luteinizing-hormone-releasing hormone“ (LHRH) (z.B.
Goserelin, Leuprorelin und Buserelin) die Sektretion des luteinisierenden Hormons (LH) durch die Hypophyse vermindert werden, was zu einer Blockade der
6
1.3 Der Estrogenrezeptor
Folikelreifung und damit zu einer Verringerung der Estrogenproduktion in den
Ovarien führt (Klijn et al. [2001]). In 15 - 25 % der Patientinnen mit Mammakarzinom ist eine Überexpression des Gens HER2/neu zu verzeichnen (Slamon
et al. [1987, 1989]). Her2/neu gehört zur Familie der Vier-Transmembran Rezeptor Tyrosin Kinasen, die Wachstum, Differenzierung und Überleben von Zellen
regulieren (Gschwind et al. [2004], Yarden and Sliwkowski [2001]). Trastuzumab
(Herceptin, Roche), ein monoklonaler Antikörper gegen die extrazelluläre Domäne der Rezeptor-Tyrosin-Kinase Her2/neu, wird bei Patientinnen mit Her2/neu
positiven, matastasierenden Mammakarzinomen als zusätzliche Therapie eingesetzt (Baselga et al. [2005], Gonzalez-Angulo et al. [2006], Vogel et al. [2002]).
1.3 Der Estrogenrezeptor
Estrogene gehören zur Klasse der Steroidhormone und haben Einfluss auf eine
große Anzahl von unterschiedlichen Prozessen im menschlichen Körper. Hauptsächlich sind sie an der Regulation des Wachstums und der Zelldifferenzierung
beteiligt (Nilsson et al. [2001]). 17β-Estradiol stellt das häufigste und wichtigste Estrogen dar, parallel dazu sind jedoch auch geringe Konzentrationen der
Estrogene Estron und Estriol zu finden (Björnstrom and Sjöberg [2005]). Die
biologischen Effekte der Estrogene werden durch die Estrogenrezeptoren ERα
und ERβ, welche beide zur großen Superfamilie der Kernrezeptoren gehören,
vermittelt.
Die Struktur des ERα Der ERα gehört zur Superfamilie der Kernrezeptoren,
wird durch das Gen ESR1 auf Chromosom 6q25.1 codiert (Gosden et al. [1986])
und ist modular aus einzelnen Regionen aufgebaut (s. Abb. 1.5), welche zur Bildung von unabhängigen Domänen führen (Claessens and Gewirth [2004], Kumar et al. [2004], Nilsson et al. [2001]). Die N-terminale Domäne (A/B-Region)
ist an der inter- sowie intramolekularen Wechselwirkung des Estrogenrezeptors
sowie der Transkription von Genen beteiligt. Die DNA-Binde-Domäne (C in
Abb. 1.5) ermöglicht die Dimerisierung des ERα und die anschließende Bindung an die spezifischen ERE-Sequenzen (Estrogen Response Elements) innerhalb der Promoterregionen von Zielgenen. Die Bindung erfolgt dabei mit Hilfe
der beiden Zink-Finger Domänen innerhalb des Estrogenrezeptordimers. Durch
die D-Region (Hinge-Domäne) wird ebenfalls die Dimerisierung des Rezeptors,
7
1 Einleitung
AF-2
AF-1
A/B
1
C
180
D
E
595
263 302
DBD
F
LBD
Abbildung 1.5: Organisation der funktionellen Domänen des ERα. Die Positionen
der Aminosäuren sind an den Grenzen der jeweiligen Domänen angegeben.
sowie die Bindung des Rezeptors an Chaperone heat-shock Proteine vermittelt.
Die „Ligand Binding Domain“ LBD (E/F Region in Abb. 1.5) ermöglicht die
Bindung des 17β-Estradiol und reguliert die Transkription der Zielgene (Nilsson et al. [2001]). Die A/B- und E/F Region des ERα entspricht den beiden
spezifische Aktivierungsfunktionen (s. Abschnitt 1.5), die wichtig sind für die
Aktivierung der ligandenabhängigen Transkription. Durch Interaktion mit einer
Reihe von Kofaktoren wird die Transkription von Zielgenen vermittelt, die keine
spezifischen ERE-Sequenzen in ihren Promoterregionen tragen (Björnstrom and
Sjöberg [2005]).
1.4 Aktivitäten des ERα
Der Estrogenrezeptor kann das Signal einer Estradiolbindung auf zwei verschiedene Weisen weitervermitteln. Der klassische Mechanismus der Estrogenrezeptoraktivität beinhaltet die Bindung des Estrogens an den Estrogenrezeptor im
Kern, was zu einer Dimerisierung des Estrogenrezeptors mit anschließender Bindung an die ERE innerhalb der Promotoren seiner Zielgene führt (Nilsson et al.
[2001]). Weiterhin führt die Bindung des Estrogens zu einer Konformationsänderung innerhalb der „Ligand Binding Domain“ (LBD, s. Abb. 1.5) des Rezeptor,
wodurch die Bindung von Koaktivatorproteinen ermöglicht wird (Rosenfeld and
Glass [2001], Stossi et al. [2006]). In beiden Fällen führt die Interaktion des
Estrogenrezeptor mit 17β-Estradiol zu einer transkriptionellen Aktivierung der
assoziierten Gene, indem Koaktivatoren und Komponenten der basalen Tran-
8
1.4 Aktivitäten des ERα
skriptionsmaschinerie rekrutiert werden (Glass and Rosenfeld [2000], McKenna and O’Malley [2002]). Zusätzlich zu den kernständigen Estrogenrezeptoren können die plasmamembranassoziierten Estrogenrezeptoren den sog. nichtgenomischen Signaltransduktionsweg der Estrogenbindung vermitteln (Björnstrom and Sjöberg [2005], Zhang and Trudeau [2006]), was zu Änderungen in
der Regulation der Genexpression führt. Abb. 1.7 und Abb. 3.1 stellen schematisch die Interaktionen der Gene im Estrogenrezeptor Signalweg dar.
1.4.1 Die genomische Aktivität des ERα
Direkte Assoziation zu ERE-Sequenzen In grundlegenden Arbeiten wurde
die Funktion des ERα als ligandenaktivierter Transkriptionsfaktor beschrieben
(Saceda et al. [1988]). Die Bindung von 17β-Estradiol an den ERα im Kern hat
eine Konformationsänderung zur Folge, was zum Lösen des ERα von den Chaperonen führt (Fliss et al. [2000]). Es folgt die Dimerisierung des Rezeptors und
damit die Aktivierung der transkriptionellen Domäne des ERα. Der dimerisierte
Rezeptor kann nun an spezifische ERE in den Promotorregionen der Zielgene
binden (Abb. 1.6) und deren Transkription regulieren (O’Lone et al. [2004]).
Abbildung 1.6: Schematische Darstellung der Bindung des dimerisierten ERα an
die ERE der DNA (PDB ID:1HCQ nach Schwabe et al. [1993])
ERE-unabhängige genomische Aktivität Neben der direkten Assoziation des
ERα zur DNA aufgrund der Sequenzspezifität der ERE kann der ERα auch indirekt als Transkriptionsfaktor fungieren, ohne direkt an die Ziel-DNA zu binden.
9
1 Einleitung
Dazu benötigen die Promotoren, die nicht über eine ERE-ähnliche Sequenz verfügen, einen sekundären DNA-bindenden Transkriptionsfaktor, der durch Interaktion mit dem ERα die Transkription des Zielgens aktiviert. Dieser Mechanismus wird im allgemeinen als „transcriptional cross-talk“ bezeichnet (Gottlicher
et al. [1998]). In ca. 35 % der primär als 17β-Estradiol-abhängig bezeichneten
Gene wird die Transkription durch eine indirekte ERα-DNA-Interaktion aktiviert. Die Transkription von Genen, die GC-reiche Promotorsequenzen beinhalten, wird durch Interaktion des ERα mit dem Transkriptionsfaktor SP1 reguliert
(Porter et al. [1997]). Zusätzlich kann die Transkription von Zielgenen durch die
Interaktion des ERα mit dem Aktivator Protein-1 (AP-1) aktiviert (Gaub et al.
[1990], Sabbah et al. [1999], Umayahara et al. [1994], Webb et al. [1995]), aber
auch deaktiviert (Philips et al. [1998], Schmitt et al. [1995]) werden (s. Abb. 1.7).
Bei der ERE-unabhängigen genomischen Aktivität des ERα ist eine direkte Bindung des ERα an die DNA, wie im Falle der direkten DNA-Assoziation, nicht
zwingen notwendig, auch wenn die DNA-Bindedomäne des ERα häufig beteiligt
ist (Jakacka et al. [2001]).
1.4.2 Die nicht-genomische Aktivität des ERα
Eine Vielzahl der Effekte, die durch die Estrogene ausgeübt werden, findet aufgrund des Einflusses des ERα auf die Genexpression statt. Diese Einflüsse auf
transkriptioneller Ebene treten mit einer Zeitverzögerung von ungefähr zwei
Stunden ein (Farach-Carson and Davis [2003], Marino et al. [2005]). Daneben
sind jedoch Effekte durch Estrogene bekannt, die sehr schnell stattfinden und
somit nicht auf die Aktivierung von bestimmten Genen und darauf folgender
Proteinsynthese beruhen können. Diese Effekte werden als nicht-genomische Aktivitäten der Estrogenrezeptoren bezeichnet und sind häufig mit der Aktivierung
von unterschiedlichen Protein-Kinase-Kaskaden assoziiert (Losel and Wehling
[2003]). Diese sehr schnellen Einflüsse der Estrogenbindung an die Estrogenrezeptoren werden hauptsächlich durch vier Signaltransduktionskaskaden vermittelt: Phospholipase C (PLC )/ Protein Kinase-C (PKC ) (Morley et al. [1992]),
RAS/RAFf/MAPK (Klinge et al. [2005], Marino et al. [2002]), PhosphatidylInositol-3 Kinase (PI3K/AKT )(Björnstrom and Sjöberg [2005]) und cAMP/
Protein Kinase-A (Picotto et al. [1996]). Diese Signalwege sind sehr eng mit weiteren Signaltransduktionskaskaden verknüpft. Der 17β-Estradiol- ERα Komplex
interagiert mit dem IGF1 Rezeptor, was zu einer Aktivierung dieses Rezeptors
10
1.4 Aktivitäten des ERα
E2
Plasmamembran
PA
Shc
Zytoplasma
Caveolin
ER
p38
Src
P
P
ER
MNAR
Aktivierung der
Signaltransduktionskaskade
ER
Zelluläre Funktionen
Nukleusmembran
Nukleus
Transkriptionelle
Koaktivatoren
ERER
RNA Pol
II
ER
AP-1
ER
ER
AP-1
Sp-1
RNA Pol
II
ER
Sp-1
RNA Pol
II
Transkription
Zelluläre Funktionen
Abbildung 1.7: Schematische Darstellung der verschiedenen Aktivitäten im ERαSignalweg. Die Palmityolierung (PA) ermöglicht die Lokalisation
des ERα (ER) an der Plasmamembran. Bindung von 17β-Estradiol
(E2) induziert die Relokalisation des ERα, was zur Assoziation von
Signalproteinen und der Aktivierung der Signaltransduktionskaskaden führt. Die Kinasen phosphorylieren den ERα, vermitteln die
Bindung von Koaktivatoren und ermöglichen somit die Aktivierung
von AP-1 und Sp-1. Nach der Dimerisierung ist der ERα in der Lage,
direkt mit den ERE der DNA zu interagieren. Die indirekte Assoziation des ERα mit der DNA wird durch Protein-Protein Interaktionen mit den Transkriptionsfaktoren AP-1 und Sp-1 vermittelt.(AP1, activating protein-1; MNAR, modulator of non-genomic activity des
ERα;PA, Palmitinsäure; Sp-1, stimulating factor-1)
11
1 Einleitung
und damit zur Aktivierung des MAPK Signalwegs führt (Kahlert et al. [2000]).
Zusätzlich aktiviert der 17β-Estradiol- ERα Komplex den EGF- Rezeptor durch
Involvierung von G-Proteinen, der SRC Kinase und Matrix-Metalloproteinasen,
was zu einer Aktivierung des Mapk und Akt Signalwegs führt (Razandi et al.
[2003]).
1.5 RNA Interferenz und siRNA
Das Phänomen der RNA Interferenz (RNAi) (Fire et al. [1998]) wurde zuerst
in Pflanzen entdeckt und ist in einer Vielzahl von eukaryontischen Organismen bekannt (Tijsterman et al. [2002], Ullu et al. [2004]). Ausgelöst wird die
RNAi durch dsRNA Vorläufermoleküle, welche im Zytoplasma der Zelle in kurze, doppelsträngige RNA Moleküle mit einer Länge von 21 bis 28 Nukleotiden
prozessiert werden. Diese kurzen RNA-Duplices leiten die Erkennung und unmittelbare Spaltung der komplementären, einzelsträngigen Ziel-RNA ein (Meister
and Tuschl [2004]). In Abhängigkeit von ihrer Herkunft bzw. ihrer Funktion
wird zwischen drei Typen natürlich vorkommender, kurzer RNAs unterschieden: short interfering RNAs (siRNAs), repeat-associated RNAs (rasiRNAs) und
microRNAs (miRNAs). Durch RNA-Matrizen abhängige RNA Polymerisation
oder durch Hybridisierung überlappender Transkripte können dsRNA Moleküle natürlich synthetisiert werden, welche anschließend als Quelle für siRNAs
und rasiRNAs fungieren können (Meister and Tuschl [2004]). Daneben können
aus hairpin-RNA Konstrukten miRNAs prozessiert werden, die anschließend eine Gen-Repression auf Translationsebene vermitteln oder eine Degradation der
mRNA einleiten können.
1.5.1 Der Mechanismus der RNA Interferenz
Anfänglich wurde das RNA silencing als ein antiviraler Mechanismus betrachtet, mit dem sich ein Organismus vor der RNA eines Virus schützen (Waterhouse et al. [2001]), oder eine zufällige Integration von transponierbaren Elementen verhindern kann. Die generelle Rolle des Silencings in der Regulation der
Genexpression wurde erst erkannt, nachdem in Pflanzen und Tieren die Vorläufermoleküle der miRNAs entdeckt worden waren (Bartel [2004]). In Pflanzen
12
1.5 RNA Interferenz und siRNA
fungieren die miRNAs analog zu den siRNAs durch Spaltung der mRNA komplementärer Sequenz. Im Nematoden Caenorhabditis elegans hingegen inhibieren
miRNAs die Translation, indem spezifisch komplementäre Bereiche der mRNA
im Bereich der 3’ UTR (nicht-translatierte Region) erkannt werden und die Proteinsynthese durch Inhibition der Elongation unterbunden wird. Abb. 1.8 zeigt
schematisch den Mechanismus der RNA Interferenz.
Prozessierung der dsRNA Vorläufer Die Prozessierung von kurzen RNAs
innerhalb einer Zelle erfolgt schrittweise durch katalytisch wirksame dsRNAspezifische RNase-III Typ Endonukleasen. miRNAs werden in Form von langen
Primärtranskripten transkribiert und im Kern durch die RNAse-III Typ Endonuklease Drosha im Zellkern präprozessiert (Lee et al. [2003, 2002]). Nach erfolgter Präprozessierung trägt die dsRNA eine 5’- Phosphatgruppe und einen zwei
Nukleotide langen 3’-Überhang. Die miRNA-Vorläufer werden durch Exportin5 aus dem Zellkern in das Zytoplasma geschleust (Bohnsack et al. [2004]) und
dort von einer weiteren Endonuklease (Dicer) in die native miRNA prozessiert
(Hutvagner et al. [2001]). Durch die Prozessierung der miRNA-Vorläufer durch
Dicer entstehen doppelsträngige RNA Moleküle mit einer Länge von 21 Nukleotiden, die, analog zu ihren Vorläufern, eine 5’-Phosphatgruppe sowie einen
3’-Überhang von zwei Nukleotiden besitzen. Die Schritte der Präprozessierung
von langen dsRNA Molekülen werden nicht benötigt, wenn chemisch synthetisierte siRNA, die in ihrer Struktur den miRNAs entsprechen, gezielt zur RNA
Interferenz in das Zytoplasma einer Zelle eingebracht werden.
Zusammensetzung des Silencing Komplexes Die frei im Zytoplasma verfügbaren doppelsträngigen siRNAs oder miRNAs werden nach der DicerProzessierung in den sog. RNA Induced Silencing Complex (RISC) eingebunden
(Hammond et al. [2000]). Es wird zwischen einem siRNA enthaltenden RISC
Komplex und einem miRNA enthaltenden miRNP (micro ribonuclear particle) (Mourelatos et al. [2002]) unterschieden. Jeder RISC oder miRNP enthält
ein Protein aus der Argonaut (Ago) Familie, welches wahrscheinlich direkt an
die RNA bindet (Mourelatos et al. [2002]). Durch die Bildung des RISC oder
miRNP werden die doppelsträngingen siRNA oder miRNA Moleküle unter ATPVerbrauch entwunden und in Form ihr einzelsträngigen Analoga in die Komplexe
eingebaut. Dabei ist eine Neigung zum ausschließlichen Einbau des zur Ziel-
13
1 Einleitung
siRNA
Zytoplasma
RISC
Antisense Strang
mRNA Erkennung
mRNA
Poly-A
degradierte mRNA
Abbildung 1.8: Schematische Darstellung der RNA Interferenz
RNA komplementären antisense-Strang der siRNA oder miRNA zu beobachten
(Schwarz et al. [2003]).
mRNA Spaltung und translatorische Hemmung Die einzelsträngige siRNA
des RISC vermittelt die seuqenzspezifische Degradation der komplementären,
oder nahezu komplementären Ziel-mRNA (Martinez et al. [2002]). Dabei wird
die mRNA durch den RISC in der Mitte, zehn Nukleotide stromaufwärts des mit
dem 5’-Ende gepaarten Nukleotids der siRNA, gespalten (Elbashir et al. [2001]).
Der RISC Komplex katalysiert die Hydrolyse der Phosphodiesterbindung in der
Ziel-RNA, was zu einer Freisetzung von zwei Molekülen mit einem 5’-Phosphatund einem 3’-Hydroxylterminus führt (Martinez and Tuschl [2004]). Die Spaltungsreaktion durch den RISC ist ATP-unabhängig (Nykänen et al. [2001]) und
die siRNA geht unverändert aus der Spaltungsreaktion hervor. Durch Bindung
des miRNP Komplexes an die Ziel-RNA wird die translatorische Elongation
gehemmt, wodurch eine Reduktion der Proteinmenge ohne Veränderung der
mRNA-Konzentration erreicht wird (Bartel [2004]).
14
1.6 Zielsetzung dieser Arbeit
1.6 Zielsetzung dieser Arbeit
Ziel dieser Arbeit war die Etablierung und Durchführung von in vitro RNAInterferenz Experimenten zur gezielten, post-transkriptionellen Genstilllegung
von spezifischen Genen mit Relevanz in der Entwicklung und Progression von
metastasierenden Mammakarzinomen. Dazu mussten in vorbereitenden Experimenten die Bedingungen für die RNA Interferenz in der Brustkrebszelllinie
MCF-7 entsprechend der Fragestellung etabliert werden. Die Zelllinie stellt einen
idealen Modellorganismus für Untersuchungen des Estrogenrezeptor Signalwegs in Mammakarzinomen dar, da sowohl der ERα als auf der ERβ exprimiert wird. Durch die Auswahl der Gene für die RNA Interferenz Experimente
(s. Abschnitt 3.1) wurde die Anknüpfung der zu erhebenden Daten an bisher bekannte Singaltransduktionswege in hormonabhängigen Mammakarzinomen erreicht. Die Datenerfassung erfolgte durch die Technologie der cDNA-Microarrays
und anschließender statistischer Auswertung der erhaltenen Datensätze. Dazu
wurden in Zusammenarbeit mit Bioinformatikern neue Algorithmen zur Rekonstruktion von Gen-Interaktionsnetzwerken entwickelt. Durch die Analyse der
Messdaten sollen bisher unbekannte Gen-Gen-Interaktionen mit Bezug auf die
Entwicklung von hormonabhängigen Mammakarzinomen sowie mögliche therapeutische Zielgene evaluiert werden. Mit Hilfe von kombinatorischen posttranskriptionellen Genstilllegungen von jeweils zwei Genen soll durch Epistaseanalyse die rekonstruierte Netzwerkhypothese validiert werden. Weiterhin sollen durch plattformübergreifende Vergleiche der aufgenommenen Expressionsprofile vorhergesagte Positionen einzelner Gene innerhalb des rekonstruierten
Netzwerks überprüft werden.
15
2 Material und Methoden
Vor einer ausführlichen Beschreibung der durchgeführten Experimente im Rahmen dieser Dissertation werden im Folgenden die verwendeten Zelllinien, Materialien sowie Reagenzien mitsamt der Bezugsquellen aufgelistet. Bezugsquellen
der nicht im Folgenden aufgelisteten Materialien sind direkt im Text vermerkt.
Alle verwendeten Chemikalien entsprachen mindestens dem Reinheitsgrad „pro
Analysis“.
2.1 Zelllinien
• MCF-7 HTB-22, American Type Culture Collection, LGC Prochem, Wesel
• HeLa CCL-2, American Type Culutre Collection, LGC Prochem, Wesel
2.2 Chemikalien
• 5 M Ammoniumacetat, Ambion, Austin, Texas, USA
• 0.5 M Ethylendiamintetraacetat (EDTA), pH 8, Ambion, Austin, Texas,
USA
• 5 M Essigsäure, Riedel-deHaen, Seelze
• 1 M Natronlauge, Roth GmbH, Karlsruhe
• 1,4-Bis(sulfanyl)butan-2,3-diol (DTT), Karlsruhe
• Ethanol absolut, Riedel-deHaen, Seelze
• Dimethylsulfoxid (DMSO), Sigma-Aldrich, Taufkirchen
• DIG-Easy, Roche Diagnostics, Mannheim
• 0,25 % Trypsin-EDTA, Invitrogen,Karlsruhe
• 17β-Estradiol, Sigma-Aldrich, Taufkirchen
• Tamoxifen, Sigma-Aldrich, Taufkirchen
17
2 Material und Methoden
2.3 Puffer, Medien, Reaktionslösungen und
Enzyme
• 2x ABsolute QPCR Rox Mix, Thermo (ABgene), Epsom, UK
• 5x RT-Puffer, Invitrogen, Karlsruhe
• HiPerFect Transfection Reagent, Qiagen, Hilden
• SuperScript III RNase-H, Invitrogen, Karlsruhe
• RNasin, Promega, Madison, Wisconsin, USA
• 20x SSC, 300 mM NaCl, 30 mM Natriumcitrat, pH 7
• 2x Hybridisierungspuffer, 2x DIG-Easy, 10x Denhardts Reagenz, Cot-1DNA (2 ng/µl)
• 50 x Denhardts Reagenz, Ficoll (Typ 400, Serva), Polyvinylpyrrolid
(Merck), BSA (Fraktion V; Roche)
• Spottingpuffer, 3x SSC, 1,5 M Betain
• GIBCO DPBS, Invitrogen, Karlsruhe
• GIBCO MEM 1x, Invitrogen,Karlsruhe
• GIBCO OptiMem 1x, Invitrogen, Karlsruhe
• GIBCO PEN-STREP, 5000 U/ml Penicillin, 5000 µg/ml Streptomycin,
Invitrogen, Karlsruhe
• GIBCO MEM NEAA 100x, Invitrogen, Karlsruhe
• Fetal Bovine Serum, Invitrogen, Karlsruhe
• Insulin Bovine, Sigma-Aldrich, Taufkirchen
18
2.4 Reaktionskits
2.4 Reaktionskits
• Reverd Aid H-Minus First Strand cDNA Synthesis Kit, Fermentas, Burlington, Ontario, Kanada
• Low RNA Input Linear Amplification Kit, Agilent Technologies, Santa
Clara, Kalifornien, USA
• RNA 6000 Nano Lab Chip Kit, Agilent Technologies, Santa Clara, Kalifornien, USA
• RNeasy® Mini Kit, Qiagen, Hilden
• WST-1 Assay, Roche Diagnostics, Mannheim
2.5 Nukleotide und Nukleinsäuren
• RNA 6000 Ladder, Ambion, Austin, Texas, USA
• Human Cot-1-DNA, Invitrogen, Karlsruhe
• Random Hexamere Primer, MWG, Ebersberg
• dATP, dCTP, dGTP, dTTP, Peqlab Biotechnologie, Erlangen
• Cy3-dCTP, Perkin-Elmer, Waltham, Massachusetts, USA
• Cy5-dCTP, Perkin-Elmer, Waltham, Massachusetts, USA
2.6 „Assay on Demand“ für TaqMan
qRT-PCR-Analysen
Die in Tabelle 2.1 verwendeten „Assay on Demand“ Sonden für die TaqMan
Analysen (s. Abschnitt 2.14) wurden von Applied Biosystems, Darmstadt bezogen.
19
2 Material und Methoden
Tabelle 2.1: Verwendete TaqMan-Assays
Gen Symbol
AKT1
AKT2
BCL2
CCNG2
ESR1
FOXA1
GAPDH
HSPB8
MAPK1
STAT5B
STC2
TMEM45B
TP53
XBP1
Assay ID
HS00178289_m1
HS00609846_m1
HS00153350_m1
HS00171119_m1
HS00174860_m1
HS00270129_m1
Hs99999905_m1
HS00205053_m1
Hs01046830_m1
Hs00560035_m1
HS00175027_m1
HS00431155_m1
Hs00153349_m1
HS00231936_m1
Gen Name
v-akt murine thymoma viral oncogene homolog 1
v-akt murine thymoma viral oncogene homolog 2
BCL2-antagonist of cell death
cyclin G2
estrogen receptor 1
forkhead box A1
glyceraldehyde-3-phosphate dehydrogenase
heat shock 22kDa protein 8
mitogen-activated protein kinase 1
signal transducer and activator of transcription 5B
stanniocalcin 2
transmembrane protein 45B
tumor protein p53
X-box binding protein 1
2.7 siRNAs
Für die selektiven post-transkriptionellen Genstilllegungen im Rahmen dieser
Dissertation wurden chemisch synthetisierte siRNAs mit einer Länge von 21
Nukleotiden der Firmen Dharmacon, Lafayette, Collorado, USA sowie Qiagen,
Hilden, Deutschland verwendet. Die jeweiligen Sqeuenzen und ID-Nummern der
einzelnen siRNAs sind in Tabelle 2.2 zu finden.
Tabelle 2.2: Verwendete siRNA von Qiagen und Dharmacon
20
Gen Symbol
siRNA ID
antisense Sequenz 5’ - 3’
AKT1
AKT1
AKT2
AKT2
BCL2
BCL2
CCNG2
SI00299159
SI00299145
SI00299173
SI00287672
SI00299397
SI00299418
SI00063021
GUGGGUCUGGAAAGAGUACtt
UCUUGGUCAGGUGGUGUGAtt
AAUUCAUCAUCGAAGUACCtt
UUCAUGGUCACUUUAGCCCgt
UCUGCGACAGCUUAUAAUGga
CUUCAUCACUAUCUCCCGGtt
UAUAAUAGUAUGGUAUAAGtg
Fortsetzung auf der nächsten Seite
2.7 siRNAs
Tabelle 2.2 – Fortsetzung Tabelle 2.2
Gen Symbol
siRNA ID
antisense Sequenz 5’ - 3’
CCNG2
SI00063028
UUAAGGAUUAUCCACUGUCcc
CCNG2
SI00063014
UAGCCUAAUUAUUUCUGCCtt
ESR1
SI00002527
UUUGCUACAUAAGAUUGUCtg
ESR1
SI00002520
UUUAAGUACUGGUCUCCCGag
ESR1
SI00002513
UUGGCUUAAACAUCACUCCag
ESR1
SI00002506
UUGGUGUUGGAUGCAUGCCgg
FOXA1
SI00420476
UUUAAUUACAAUCACAUUGat
FOXA1
SI00420483
UUUAUUAUGCUGUUGACGGtt
FOXA1
SI00420490
UUCACAGUUCCUAACAUCCtg
HSPB8
SI02224502
UUCAUUAACCAAACCAUGCgg
HSPB8
SI02224509
UUUCAUUAACCAAACCAUGcg
MAPK1
SI00300755
UCUUGAUAGCUACUCGAACtt
MAPK1
SI00300762
UGGUGCUCGAAUAAUGUCAtt
STAT5B
SI00100394
UUCAUUGUACAAUAUAUGGcg
STAT5B
SI00100408
UAAUUCAAGUCUCCCAAGCgg
STC2
SI00055013
UUGGUAUUAACCUCCCGUCgg
STC2
SI00055020
UUCUCCUGCAUUCUAAGCGat
STC2
SI00055027
AAAGGUACGAGGAUAACGCgg
TMEM45B
SI00472367
UUUCUAAUAAGAAAGUACCtg
TMEM45B
SI00472374
UUGAUUUCUCUUGACACUGag
TP53
SI02623747
UUAGGUACUAAGGUCGACCdA
TP53
SI02623754
UGAACCAUUGUUCAAUAUCdG
TP53
SI02655170
UAACCCUCACAAUGCACUCdT
TP53
SI04384079
UUCAGCUCUCGGAACAUCUdC
XBP1
SI02656661
UCAAUUAUAGUAAUAUUUCtt
XBP1
SI00763833
UAAAUUUCUAUAAUUUCACaa
XBP1
SI00763840
UUCAUUAAUGGCUUCCAGCtt
non-silencing Control SI1022076
ACGUGACACGUUCGGAGAA
ESR1
ESR1
ESR1
ESR1
D-003401-01
D-003401-02
D-003401-03
D-003401-09
UCUCUAGCCAGGCACAUUCUU
AAGGUUGGCAGCUCUCAUGUU
UACUGGCCAAUCUUUCUCUUU
CUUCUUAFAFCFUUUGAUCUU
21
2 Material und Methoden
2.8 Kultivierung und Passagierung von MCF-7
Zellen
Die Zellen der humanen, epithelialen Mammakarzinom Zelllinie MCF-7 wurden in MEM Medium, ergänzt mit 10% (v/v) FBS, 1% (v/v) nichtessentiellen
Aminosäuren (GIBCO MEM NEAA 100x), 5 mg Rinderinsulin sowie 25.000 U
Penicillin und 25 mg Streptomycin kultiviert. Um die Zellen kontinuierlich in der
exponentiellen Wachstumsphase zu halten, wurden die Zellen alle zwei bis drei
Tage im Verhältnis 1:2 bzw. 1:3 geteilt und in frisches Kulturmedium überführt.
Dabei wurde streng darauf geachtet, dass die Konfluenz der Zellen stets unter
80% lag. Zum Splitten der Zellen wurde zuerst das Medium vollständig entfernt,
die Zellen mit 5 ml DPBS gewaschen und anschließend durch 3 minütige Inkubation bei 37◦ C mit 3 ml 0,25% Trypsin-EDTA vom Boden der Kulturflasche
abgelöst. Durch Zugabe von 3 ml Medium wurde das Trypsin deaktiviert und
die Zellen in geeigneter Dichte in neue Gewebekulturflaschen überführt. Die
Kultivierung erfolgte in Greiner Bio-one Gewebekulturflaschen (250 ml) mit
einer Bodenfläche von 75 cm2 im Inkubator bei 37◦ C, 5% CO2 und 90% Luftfeuchtigkeit. Um für alle Experimente Zellen der gleichen Ursprungszelllinie zu
verwenden, wurden zu Begin aller Arbeiten Kryokulturen der MCF-7 Zellen in
DMSO-haltigem Einfriermedium angelegt und in flüssigem Stickstoff gelagert.
Innerhalb einer Experimentreihe wurden die Zellen maximal bis zur Passage 15
verwendet.
2.9 Transfektion humaner epithelialer
Mammakarzinomzellen
Zur gezielten Verringerung der mRNA Konzentration bestimmter Gene wurden
chemisch synthetisierte siRNA (small interfering RNA) verwendet (Caplen et al.
5
[2001]). Für die Transfektion wurden 3 × 10 MCF-7 Zellen/well in 6-well Kulturplatten (Nunclon ∆ Surface, Nunc, Roskilde, Dänemark) in antibiotikafreiem
Medium ausgesät und 24 h präinkubiert. Die Transfektionen erfolgten mit einer
Endkonzentration der siRNA von 50 nM in einem Volumen von 2400 µl. Die
jeweiligen siRNAs wurden zusammen mit dem Transfektionsreagenz HiPerFect
(Qiagen, Hilden) nach Herstellerangaben vermischt und für 10 min inkubiert.
22
2.10 Stimulation von Mammakarzinomzellen mit endokrinen Substanzen
Anschließend wurden die Transfektionskomplexe tropfenweise zu den präinkubierten Zellen hinzugegeben und für weitere 42 h bei 37◦ C, 5% CO2 und 90%
Luftfeuchtigkeit inkubiert. Die Transfektion wurde durch Entfernen des Mediums und Waschen mit DPBS gestoppt. Anschließend erfolgte die Isolierung der
total RNA (s. Abschnitt 2.12.1).
2.10 Stimulation humaner, epithelialer
Mammakarzinomzellen mit endokrinen
Substanzen
Für eine gezielte Stimulation des Estrogenrezeptors (ESR1) in den verwendeten
MCF-7 Zellen wurden diese mit dem endokrinen Steroidhormon 17β-Estradiol
behandelt. Dazu wurden die Zellen in phenolrotfreiem Medium GIBCO RPMI
(Invitrogen, Karlsruhe) mit identischen Zusätzen wie in 2.8 für 66 h präinkubiert
und anschließend für 3 h mit 10 nM 17β-Estradiol behandelt. Danach erfolgte,
analog zu 2.9, die Isolation der total RNA (s. Abschnitt 2.12.1).
2.11 Behandlung humaner, epithelialer
Mammakarzinomzellen mit Tamoxifen
Analog zu 2.10 erfolgte eine gezielte Inhibition des Estrogenrezeptors (ESR1) in
den verwendeten MCF-7 Zellen durch Behandlung mit dem Selektiven Estrogen
Rezeptor Modulator (SERM). Die Inhibition wurde in MEM Kulturmedium
(analog zu 2.8) nach 24-stündiger Präinkubation für 48 h mit einer Endkonzentration von 100 nM durchgeführt. Anschließend erfolgte die Isolation der total
RNA (s. Abschnitt 2.12.1).
23
2 Material und Methoden
2.12 Isolation, Aufreinigung,
Konzentrationsbestimmung und
Qualitätskontrollen von Nukleinsäuren
2.12.1 Isolation von total RNA aus eukaryontischen Zellen
aus Zellkultur
Die Zellen wurden nach erfolgter Transfektion und Entfernen des Kulturmediums mit DPBS gewaschen und unmittelbar durch Zugabe von 350 µl RLT Puffer
(aus RNeasy-Kit, Qiagen, Hilden) in der Kulturschale lysiert. Das Zelllysat wurde in nucleasefreie Eppendorf Reaktionsgefässe überführt, mit 350 µl 70% (v/v)
Ethanol versetzt und auf die RNeasy-Isolationssäulen pipettiert. Die Isolation
der total RNA aus eukaryontischen Zellen erfolgte nach den Angaben des Herstellers (Qiagen, Hilden). Die Elution der total RNA erfolgte durch zweimalige
Zugabe von jeweils 50 µl nucleasefreiem Wasser.
2.12.2 Präzipitation von Nukleinsäuren
Zur Erhöhung der Konzentration der RNA-Lösung wurde eine Präzipitation
mit 1/10 (v/v) 5 M NH4 OAc und 2,5 (v/v) 100% Ethanol bei -20◦ C über Nacht
durchgeführt. Die Nukleinsäuren wurden durch Zentrifugation (Biofuge fresco, 4◦ C, 16000 x g, 60 min) sedimentiert, nach Entfernen des Überstandes mit
500 µl 70% (v/v) Ethanol gewaschen, zentrifugiert (4◦ C, 16000 x g, 30 min)
und nach erneuter Entfernung des Überstandes im Heizblock bei 37◦ C getrocknet. Anschließend wurde die präzipitierte RNA in einem geeigneten Volumen
nucleasefreiem Wasser aufgenommen.
2.12.3 Bestimmung von Nukleinsäurekonzentrationen
Die Bestimmung der total RNA Konzentration erfolgte durch Aufnahme des
Absorptionsspektrums der wässrigen Nukleinsäurelösung zwischen 230 nm und
280 nm mit Hilfe eines NanoDrop ND-1000 UV/VIS Spectrophotometers
(NanoDrop Technologies, Wilmington, Delaware, USA). Die Umrechnung der
Extinktionswerte in die jeweiligen Konzentrationen erfolgte automatisch durch
24
2.13 Erststrangsynthese von komplementärer DNA (cDNA-Synthese)
die Software des Geräteherstellers anhand des Lambert Beer’schen Gesetzes.
Zusätzlich zur Konzentration wurde die Reinheit der isolierten Nukleinsäurelösung durch Bildung der Quotienten der Extinktionen bei 260 nm/280 nm und
260 nm/230 nm bestimmt.
2.12.4 Qualitätskontrolle von isolierter total RNA
Durch die Omnipräsenz von RNasen und die Instabilität der RNA ist eine Qualitätskontrolle der isolierten total RNA vor weiteren Analyseschritten zwingend
notwendig. Die microfluidbasierte Analyse der RNA-Integrität mittels des Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, Kalifornien, USA)
bietet eine schnelle und einfache Bestimmung der Konzentration sowie der Integrität der isolierten total RNA. Die Aufbreitung der Proben erfolgte nach den
Angaben des Herstellers. Die Analyse liefert ein Elektorpherogram sowie einen
Wert für die RNA-Integrität (RIN-Wert). Nur Proben mit einem RIN-Wert ≥
8 wurden für weitere Analysen verwendet. Ein Beispiel einer RNA Probe hoher
Integrität ist in Abb. A.1 im Anhang A.1 zu finden.
2.13 Erststrangsynthese von komplementärer DNA
(cDNA-Synthese)
Eine Erststrangsynthese komplementärer DNA (cDNA) erfolgte unter Verwendung des ReverdAid™ H-Minus First Strand cDNA Synthesis Kit von Fermentas.
Dazu wurden 10 - 1000 ng der extrahierten total RNA aus 2.12.1 mit 500 ng
oligo(dT)18 -Primer versetzt, für 5 min bei 70◦ C (Biometra T-Personal PCRCycler) inkubiert und anschließend auf Eis auf 4◦ C abgekühlt. Nach Zugabe
von 8 µl Master-Reaktionsmix (4 µl 5x Reaktionspuffer, 2 µl 10 nM dNTP-Mix,
20 U RiboLock ™ und 200 U RevertAid™ H Minus M-MuLV Reverse Transkriptase) wurde die Erststrangsynthese für 60 min bei 42◦ C durchgeführt und durch
Erhitzen auf 70◦ C für 10 min (Hitzedenaturierung der Reversen Transkriptase)
gestoppt. Die erhaltene cDNA-Lösung wurde direkt zur quantitative realtimePCR verwendet.
25
2 Material und Methoden
2.14 quantitative realtime-PCR (TaqMan)
Die TaqMan realtime-PCR bietet die Möglichkeit, die relative Expression einzelner Gene in kurzer Zeit mit einer sehr hohen Sensitivität zu bestimmen. Zur
Quantifizierung einer cDNA wird dabei eine mit Fluoreszenzfarbstoffen markierte sequenzspezifische Sonde eingesetzt, welche am 5’-Ende einen Reporterfarbstoff (Fluoreszeinderivat) und am 3’-Ende einen Quencherfarbstoff (Rhodaminderivat) trägt. Solange sich diese beiden Farbstoffe in räumlicher Nähe zueinander befinden, kommt es zu einer Fluoreszenzauslöschung durch Quenching trotz
Anregung. Die im qRT-PCR Mastermix enthaltene DNA-Polymerase besitzt eine Exonukleaseaktivität und entfernt bei der DNA Polymerisation die sequenzspezifische Sonde von der cDNA Matrize. Die Restriktion der TaqMan-Sonde
führt zu einer räumlichen Trennung von Fluoreszenz- und Quencherfarbstoff.
Nicht gebundene TaqMan-Sonden werden von der matrizenabhängigen DNAPolymerase nicht gespalten. Dadurch ergibt sich eine zur cDNA-Konzentration
direkt proportionale Zunahme der Fluoreszenz, welche geräteintern (7900HT
Fast Real-Time PCR System, Applied Biosystems, Foster City, Kalifornien,
USA) in Anhängigkeit der durchlaufenen PCR-Zyklen registriert wird.
2.14.1 Bestimmung der relativen Genexpression nach
quantitativer realtime-PCR (∆∆Ct-Methode)
Die in 2.13 hergestellten cDNA-Lösungen konnten ohne weitere Aufreinigungsschritte zur quantitativen realtime-PCR Reaktion eingesetzt werden. Dazu wurden mind. 10 ng cDNA pro Reaktion in 5 µl nukleasefreiem Wasser vorgelegt
und die sequenzspezifische TaqMan-Sonde (0,5 µl TaqMan-Sonde, 5,5 µl qRTPCR MasterMix) hinzugegeben. Die qRT-PCR Reaktion wurde im 7900HT
Fast Real-Time PCR System (Applied Biosystems, Foster City, Kalifornien,
USA) Thermocycler für 40 Reaktionszyklen durchgeführt. Anschließend wurden die Ct-Werte mit Hilfe der SDS-Software (Applied Biosystems, Foster City,
Kalifornien, USA) für die gesamte Reaktion anhand der Messdaten bestimmt.
Zur Minimierung der Standardabweichung wurden alle Proben in Triplikaten
aufgetragen und die mRNA Konzentrationen der jeweiligen Gene sowie des
Housekeeping-Gens GAPDH (für die Normalisierung) bestimmt. Um eine Änderung der Expression eines Gens als Folge der Behandlung mit einer spezifischen
siRNA zu bestimmen, wurden zusätzlich cDNA Proben aus mit Kontoll-siRNA
26
2.15 Biochemische Methoden
transfizierten Zellen aufgetragen. In einem ersten Auswerteschritt wurden zuerst
für jede Probe die Mediane der GAPDH Ct-Werte (CtH,j ) der Probentriplikate
erstellt und von den Medianen der Probentriplikate der Ct-Werte (Cti,j ) des zu
bestimmenden Gens subtrahiert (∆Ct) (Gl. (2.1)).
∆Cti,j = Cti,j − CtH,j
Gl. (2.1)
In einem zweiten Schritt wurden für jedes Gen die auf die GAPDH Expression
normalisierten Expressionswerte der Kontrolltransfektionen (∆Cti,R ) von den
∆Ct-Werten der jeweiligen Transfektionen (∆Cti,j ) subtrahiert. Diese Berechnung ergaben die ∆∆Ct-Werte (Gl. (2.2)).
∆∆Cti,j = ∆Cti,j − ∆Cti,R
Gl. (2.2)
Die Änderungen des mRNA Expressionsniveaus nach Behandlung mit einer sequenzspezifischen siRNA gegenüber dem Expressionsniveau der gleichen mRNA,
nach Behandlung mit einer Kontroll-siRNA, normalisiert gegen das Expressionsniveau des Houskeeping-Gens GAPDH, ergibt sich demnach aus Gl. (2.3).
Expressionsniveaui,j = 2−∆∆Ct
Gl. (2.3)
Expressionsniveaus >1 zeigen eine Überexpression der gemessenen mRNA in
den transfizierten Zellen gegenüber den Kontrollen an. Expressionsniveaus <1
entsprechen demnach einer geringeren Expression der jeweiligen mRNA in den
transfizierten Zellen.
2.15 Biochemische Methoden
2.15.1 Zell-Lebensfähigkeits Assay WST-1
Mit Hilfe des WST-1 Proliferation Assays kann auf die Lebensfähigkeit der
Zellen innerhalb des Experiments geschlossen werden. Der Assay beinhaltet
27
2 Material und Methoden
ein Tetrazoliumsalz (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3benzene disulfonat), welches durch mitochondriale Dehydrogenasen reduziert
wird (s. Abb. 2.1). Die Reduktion des hellroten Tetrazoliumsalz zum tiefroten
Formazan ist direkt proportional zur Anzahl an metabolisch aktiven Zellen innerhalb einer Kultur. Die Produktion des Formazans durch die metabolisch
aktiven Zellen kann spektrophotometrisch durch Messung der Absorption bei
450 nM bestimmt werden (Berridge et al. [1996]). Die Zellen wurden zur Mes-
WST-1
Formazan
Abbildung 2.1: Spaltung des Tetrazoliumsalzes WST-1 (4-[3-(4-Iodophenyl)-2-(4nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonat) in Formazan.
EC = Elektronen-koppelndes Reagenz RS = mitochondriales
Succinat-Tetrazolium-Reduktase System
sung der Lebensfähigkeit wie unter 2.9 beschrieben kultiviert und mit unterschiedlichen siRNA Konzentrationen (10 nM, 50 nM und 100 nM) transfiziert.
Nach 42 h Inkubation wurde die Zelllebensfähigkeit mit Hilfe des WST-1 Assays
nach den Angaben des Herstellers spektrophotometrisch gemessen.
2.16 cDNA Microarray-Technologie
2.16.1 Herstellung von humanen, genomweiten
cDNA-Microarrays
Im Rahmen dieser Dissertation wurden genomweite cDNA-Microarrays (DeRisi et al. [1996], Schena et al. [1995, 1996], Shalon et al. [1996]) auf Basis des
28
2.16 cDNA Microarray-Technologie
RZPD Unigene 3.1 cDNA Satz hergestellt. Der RZPD Unigene 3.1 cDNA Satz
enthält 37500 annotierte Gene und EST. Vorbereitend für das Spotting der
cDNA-Microarrays wurden Hochdurchsatz-PCRs der Klone durchgeführt und
die aufgereinigten PCR Produkte für das Spotting vorbereitet. Anschließend
wurden die in Spottingpuffer (3x SSC, 1,5 M Betain) gelösten PCR-Produkte
mittels des VersArray ChipWriter™ Pro Arrayer (Bio-Rad, München) nach einem programmierten Verfahren auf mit Epoxysilan beschichtete Nexterion E
Slides (Schott, Jena) transferiert. Die einzelnen PCR-Produkte wurden dabei
parallel mit 48 Split-Pin ArrayIt 946 MP3 Spotting Nadeln (ArrayIt, Sunnyvale, Kalifornien, USA) auf insgesamt 108 Slides übertragen. Die Spottingnadeln
besaßen ein Aufnahmevolumen von 0,35 µl und ein Abgabevolumen von 0,7 nl
was zu einem Spotdurchmesser von ca 90 µm führte. Pro Nadel wurde ein Grid
von 28x29 Spots produziert, was zu einer maximalen Zahl von 38976 Spots auf
einem Array führte. Vor jedem Spottingdurchlauf wurde überschüssiges PCRProdukt auf einem Blottingpad entfernt um gleichmässige Spots auf allen Slidereplikaten zu erhalten. Nach jedem Spottingzyklus wurden die Nadeln einem
intensiven Wasch- und Sonifizierprogramm unterzogen um eine Kreuzkontamination der einzelnen PCR-Produkte zu verhindern. Die gesamte Spottingprozedur wurde bei 22◦ C Raumtemperatur und einer Luftfeuchte von 42% unter
staubfreien Bedingungen durchgeführt.
2.16.2 Nachbehandlung der gespotteten cDNA-Microarrays
Vor einer Verwendung der gespotteten cDNA-Microarrays zur Hybridisierung
mussten diese einer speziellen Nachbehandlung unterzogen werden, wobei nicht
gebundenes PCR Produkt entfernt und die DNA denaturiert wurde. Zu Beginn
der Nachbehandlung wurden die Arrays in einem ersten Schritt für eine Minute
mit Wasserdampf bei 37◦ C rehydriert und anschließend sofort mit der Rückseite für 10 sec auf eine 100◦ C Ceranheizplatte gelegt. Durch diese Prozedur
wurden die Nukleinsäuren kovalent an die Epoxysilanoberfläche der Glasslides
gebunden (Chiu et al. [2003], Conzone and Pantano [2004]). Nach vollständigem
Trocknen wurden die Chips 2 min in 0,2% (w/v) SDS-Lösung und anschließend
2 min in aqua bidest gewaschen (beide Waschschritte erfolgten bei Raumtemperatur). Zur Denaturierung der doppelsträngigen DNA-Spots auf den DNA-Chips
wurden diese für 1,5 min in 95 °C heißem Wasser inkubiert und die danach vorliegenden Einzelstränge durch sofortige Inkubation in kaltem Ethanol (absolut)
29
2 Material und Methoden
fixiert. Anschließend wurden die Chips durch Zentrifugation (50 x g, 6 min, RT)
in einer Eppendorf 5810R Zentrifuge getrocknet und bis zur weiteren Verwendung staubfrei gelagert.
2.16.3 Lineare Amplifikation isolierter mRNA
Zur linearen Amplifikation der isolierten mRNA aus den MCF-7 Zellen wurde das Low RNA Input Linear Amplification Kit (Agilent Technologies, Santa
Clara, Kalifornien, USA) nach den Angaben des Herstellers verwendet. Dazu
wurden 1,5 - 2 µg isolierte und aufgereinigte total RNA aus 2.12.2 in einem ersten Schritt revers transkribiert. Anschließend erfolgte die lineare Amplifikation
der erstellten cDNA durch zweistündige Inkubation. Nach erfolgter Amplifikation wurden die überschüssigen, nicht eingebauten Nukleotide durch Grössenausschluss entfernt und das Eluat einer Nukleinsäurepräzipitation unterzogen
(s. Abschnitt 2.12.2). Alle amplifizierten RNA Proben wurden vor der Fluoreszenzmarkierung einer Qualitätskontrolle unterzogen (s. Abschnitt 2.12.4). Nur
aRNA hoher Qualität wurde für die weiteren Schritte verwendet. Abschnitt A.2
zeigt ein Messdiagram einer amplifizierten RNA hoher Integrität. Die aufgereinigte und amplifizierte RNA konnte anschließend direkt zur Fluoreszenzmarkierung (s. Abschnitt 2.16.4) eingesetzt werden.
2.16.4 Fluoreszenzmarkierung amplifizierter RNA
Vor einer Hybridisierung der in 2.16.3 erstellten aRNA muss diese in einer reversen Transkription in cDNA umgeschrieben werden, wobei zeitgleich fluoreszenzmarkierte Cytidin-Derivate (Cy3-dCTP bzw. Cy5-dCTP) in die neu synthetisierte, einzelsträngige cDNA eingebaut wurden. Die reverse Transkription
erfolgte unter Verwendung des Enzyms SuperScript™ III (Invitrogen, Karlsruhe). Dabei wurden jeweils gleiche Mengen der zu vergleichenden aRNA-Proben
eingesetzt. Für die Reaktion wurden 2 µg aRNA zusammen mit 500 µg Random Hexamer Primer (MWG, Ebersberg) in einem Gesamtvolumen von 6,25 µl
gelöst, für 10 min bei 70◦ C zur Denaturierung inkubiert und anschließend sofort auf Eis gekühlt. Nach vollständiger Abkühlung der Proben wurden mit
2,5 µl 5x RT-Erststrangpuffer, 1,25 µl 0,1 M DTT, 0,5 µl RNasin (20 U), 0,5 µl
SuperScript™ III Reverse Transkriptase (100 U), 1 µl Nukleotidmix (dATP,
30
2.16 cDNA Microarray-Technologie
dGTP, dTTP; jeweils 5 mM) und 1 µl 3 mM dCTP hinzugefügt. Zusätzlich
wurde zur Fluoreszenzmarkierung jeweils 0,5 µl dCTP-Cy3 bzw. dCTP-Cy5 zugesetzt. Die Reaktion erfolgte durch Inkubation für 60 min bei 42◦ C und wurde
durch Zugabe von 1,25 µl 50 mM EDTA pH 8 beendet. Durch Hinzufügen von
5 µl 1 M Natronlauge, Inkubation für 10 min bei 60◦ C und anschließender Neutralisation mit 1 µl 5M Essigsäure wurde die aRNA hydrolysiert. Die Aufreinigung der fluoreszenzmarkierten cDNA erfolgte über YM-30 Zentrifugationssäulchen (Millipore), wobei die zu vergleichenden Proben in ein Endvolumen von
15 µl eluiert wurden. Die Proben wurden anschließend direkt zur Hybridisierung
der cDNA-Microarrays eingesetzt (s. 2.16.5)
2.16.5 Hybridisierung von cDNA-Microarrays
Die in 2.16.4 hergestellten Cy3- und Cy5-markierten cDNA-Sonden wurden zur
Bestimmung relativer mRNA-Spiegel gleichzeitig auf einen DNA-Chip gebracht
und mit der dort vorhandenen DNA der PCR-Produkte hybridisiert. Dazu wurden die fluoreszenzmarkierten cDNA-Proben mit aqua bidest auf ein Volumen
von 25 µl aufgefüllt und mit dem gleichen Volumen 2x Hybridisierungspuffer
auf ein Endvolumen von 50 µl verdünnt. Die Hybridisierungssonden wurden für
2 min bei 65◦ C denaturiert und nach Abkühlen auf den Microarray pipettiert.
Die Sonde wurde dabei zwischen den Glasobjektträger mit der immobilisierten cDNA und einem speziellen Deckgläschen (LifterSlip, Erie Scientific, New
Hampshire, USA) blasenfrei pipettiert und der Microarray zur Inkubation im
Wasserbad (37◦ C, über Nacht) in eine Hybridisierungskammer (Corning, New
York, USA) verbracht. Nach der Hybridisierung erfolgte ein stringentes Waschen
in 1x SSC mit 1% SDS, 0,1x SSC mit 0,1% SDS und daran anschließend in 0,05x
SSC zum Entfernen unspezifisch gebundener fluoreszenzmarkierter cDNA. Nach
Trocknung des Chips durch Zentrifugation (5 min, 50 x g) wurde die Fluoreszenz
der einzelnen DNA-Spots auf der Microarray Oberfläche durch laserinduzierte
Anregung der fluoreszenzmarkierten dCTP-Analoga bestimmt.
2.16.6 Messung und Quantifizierung der Fluoreszenzsignale
von hybridisierten cDNA-Microarrays
Zur Bestimmung der relativen mRNA-Spiegel wurden die Fluoreszenzintensitäten der Cy3 und Cy5 markierten, hybridisierten cDNA-Sonde auf dem cDNA-
31
2 Material und Methoden
Microarry nach Laseranregung gemessen. Die Intensität der Fluoreszenz ist dabei direkt proportional zur Menge an gebundener, fluoreszenzmarkierter cDNA.
Die Messung der ortsaufgelösten Fluoreszenzintensitäten nach Hybridisierung
und stringentem Waschen der Chips erfolgte mit einem GenePix 4000B Microarray Laserscanner (Axon Inc., Union City, Kalifornien, USA). Die Anregung von
Cy3-dCTP erfolgte mit monochromatischen Licht der Wellenlänge 532 nm (Messung der Emission bei 570 nm), die Anregung von Cy5-dCTP mit monochromatischen Licht der Wellenlänge 635 nm (Emission bei 670 nm); die Detektion der
Fluoreszenz erfolgte geräteintern über lichtempfindliche Kathoden. Im Rahmen
der Messung wird das Bild in Bildpunkte der Größe 10 x 10 µm bezogen auf die
Originalgröße des gescannten Microarray unterteilt. Die Datenaufnahme erfolgte
in Form einer 16-bit-TIFF-Datei und die aufgezeichneten Fluorogramme wurden
mit der GenePix Software (GenePix Pro 6.0 Software, Axon Inc.) quantitativ
analysiert. Als Maß für das Verhältnis der roten zur grünen Fluoreszenz wurde
dabei der Quotient der Mediane (med in Gl. (2.4)) errechnet. Zur Berechnung
des Quotienten der Signalemediane aller Pixel eines Spots wird vor der Bildung
des Cy5/Cy3- Fluoreszenzverhältnisses die Hintergrundfluoreszenz (IB,λ2 und
IB,λ1 aus Gl. (2.4), I ≡ Intensität) von der Signalfluoreszenz (IP ,λ2 und IP ,λ1
aus Gl. (2.4)) bei der entsprechenden Wellenlänge subtrahiert (s. Gl. (2.4)).
D
(IP ,λ2 )n
D
(IP ,λ1 )n
E
Emed
med
D
E
D
Emed
− (IB,λ2 )m
− (IB,λ1 )m
Gl. (2.4)
med
Die Quantifizierung der Hybridisierungssignal-Fluoreszenz erfolgte wie in
Abb. 2.3 dargestellt. Die Bildpunkte des inneren Kreises bilden das Hybridisierungssignal, die lokale Hintergrundfluoreszenz wird vom zweifachen Radius des
Hybridisierungssignals gebildet (weißer Kreis), wobei die Bereiche der lokalen
Hintergrundfluoreszenz, die auf dem Hybridisierungssignal des nächsten Spots
liegen, aus der Berechnung der Hintergrundfluoreszenz ausgeschlossen werden.
2.17 Statistische Auswertung der genomweiten
Expressionsanalysen
Vor einer statistischen Analyse der Mediane der Fluoreszenzen wurden präprozessierende Schritte durchgeführt. Zunächst wurden Klone, die zur Spottingkon-
32
2.17 Statistische Auswertung der genomweiten Expressionsanalysen
Abbildung 2.2: Ausschnitt aus einem Fluorogramm mit identifzierten Signalen
Abbildung 2.3: Schematische Darstellung der Quantifizierung der Fluoreszenzsignale
trolle verwendet wurden entfernt. Anschließend wurden die einzelnen Expressionswerte mit Hilfe des vsn Modells (Huber et al. [2002]) normalisiert, um Unterschiede in den Gesamtintensitäten von Cy3 und Cy5 sowie intensitätsabhängige
Abweichungen im Verhältnis Cy3/Cy5 auszugleichen. Dieser Präprozessierung
der Messdaten folgte die statistische Auswertung der relativen Expressionslevel
der einzelnen auf den Microarrays verfügbaren Klonen innerhalb eines einzelnen Experiments. Dazu wurden die Messdaten mit Hilfe des limma-Algorithmus
(Smyth [2004]) statistisch ausgewertet. Alle Auswerteschritte wurden mit Hilfe
der Statistikumgebung R durchgeführt.
33
2 Material und Methoden
2.18 Netzwerkrekonstruktion durch Nested Effects
Model Algorithmus
Die aus Abschnitt 2.17 erhaltenen Daten der statistischen Auswertung
der Microarray Hybridisierungen wurden zur Rekonstruktion von GenInteraktionsnetzwerken mit dem Nested Effects Model Netzwerk Algorithmus
(Fröhlich et al. [2007, 2008]) verwendet. Bei dem NEM-Algorithmus (basierend
auf Markowetz et al. [2005]) wird prinzipiell zwischen zwei Variablen unterschieden, den Signalen (S) und den Effekten (E). Bezogen auf ein RNA-Interferenz
Experiment entspricht ein Signal S der post-transkriptionellen Genstilllegung
eines spezifischen Gens, wogegen ein Effekt E einer mRNA mit veränderter
Expression entspricht. Es wird angenommen, dass jeder Effekt an ein stromaufwärts liegendes Signal gekoppelt ist, wobei eine Störung des Signals Sk eine
Änderung des Signalflusses in dem zugrundelegenden Netzwerk zur Folge hat.
Demnach wird ein Einfluss auf die Effekte, die von Sk beeinflusst werden, erwartet. Abb. 2.4 zeigt schematisch den Zusammenhang zwischen Signalen und
Effekten innerhalb eines Netzwerks. Bei einer Störung des Signales S2 (Abb. 2.4)
S1
E
S2
E
E
E
S3
E
E
S4
E
E
E
Abbildung 2.4: Grundidee des NEM-Algorithmus. Eine Netzwerkhypothese ist ein
gerichteter Graph zwischen Signalen mit unterschiedlichen angehangenen Effekten. Eine Störung von Signal S2 verändert den Signalfluss des stromabwärts liegenden Signalwegs, was zu einem Einfluss
auf die mit S2 und S1 verknüpften Effekte erwarten läßt.
würden Änderungen der Effekte der Signale S1 und S2 erwartet. Die Verknüpfung von Effekten mit Signalen kann formell durch eine binäre |S| × |E| Matrix
Θ = (θsk ) dargestellt werden, mit θsk = 1 wenn der Effekt k mit dem Signal
34
2.18 Netzwerkrekonstruktion durch Nested Effects Model Algorithmus
s verknüpft ist, ansonsten gilt θsk = 0. Die Verknüpfung von Signalen (in diesem Fall entsprechend der Netzwerkhypothese) wird durch die binäre Matrix
Φ = (φij ), mit φij = 1 vorausgesetzt, dass ein Signal i ein Signal j impliziert
und die Bedingung φii = 1 für alle i ∈ S gilt. Das Nested Effects Model sagt
einen Effekt von s ∈ S auf einen Effekt k immer genau dann vorraus, wenn ein
Signal t ∈ S stromabwärts von S existiert und k verknüpft mit t ist (Fröhlich
et al. [2008]). Diese Bedingung wird genau dann erfüllt, wenn gilt φst = 1 und
θtk = 1.
Bei einem gegebenen Datensatz D besteht das Ziel darin, Rückschlüsse auf den
Signalgraphen Φ zu ziehen. Dies erfolgt dadurch, dass zunächst ein hypothetischer Signalweg Φ angenommen wird, für den eine Likelihood berechnet wird.
Die Likelihood entspricht dabei einem Maß für die Wahrscheinlichkeit, mit der
ein Datensatz D unter Annahme eines hypothetischen Netzwerks Φ beobachtet
werden kann. Eine hohe Likelihood entspricht daher einer guten Übereinstimmung der beobachteten Daten D mit der errechneten Netzwerkhypothese Φ.
Markowetz et al. (Markowetz et al. [2005]) haben a priori die Likelihood für
alle denkbaren Netzwerkhypothesen Φ berechnet, um anschließend die Übereinstimmungen der Hypothesen mit dem gemessenen Datensatz zu vergleichen. De
facto ist diese Berechnung für große Netzwerke auch mit leistungsstarken Computersystemen nicht durchführbar, da die Anzahl der hypothetischen Netze sehr
schnell wächst. Für ein Netzwerk mit zehn Signalen (S) existieren bereits 1027
mögliche Signalgraphen. Daher entwickelten Fröhlich et al. (Fröhlich et al. [2007,
2008]) heuristische Algorithmen, um näherungsweise eine Netzwerkhypothese zu
generieren, die eine besonders hohe Likelihood für einen gegebenen Datensatz
aufweist. Die in dieser Arbeit dargestellten Ergebnisse beziehen sich dabei insbesondere auf eine Methode, in der, ausgehend von einem leeren Signalgraphen,
sukzessive die Kante in das Signalnetz integriert wird, die den maximalen Gewinn in der Likelihood verspricht. Das Verfahren endet, sobald durch ein Kante
keine Steigerung der Likelihood mehr erzielt werden kann.
35
3 Ergebnisse
Zur Rekonstruktion von Gen-Gen Interaktionsnetzwerken wurden insgesamt 13 Gene, die eng mit dem Estrogenrezeptor Signalweg verknüft sind
(s. Abschnitt 1.3), post-transkriptionell durch die Verwendung von sequenzspezifischen siRNAs in ihrer Expression reduziert. Die resultierenden Effekte
der post-transkriptionellen Reduktion der mRNA Konzentration wurde mit genomweiten cDNA-Microarrays gemessen. Die Daten aus den statistischen Auswertungen der durchgeführten Microarray Experimente wurden anschließend
mit dem „Nested Effects Model“ Algorithmus (Fröhlich et al. [2007, 2008],
s. Abschnitt 2.18) einer weiteren statistischen Analyse unterzogen und in Form
eines Interaktionsnetzwerks grafisch dargestellt. Zur weiteren Validierung des
berechneten Netzwerks wurden neben dem Silencing von einzelnen Genen zusätzlich kombinatorische post-transkriptionelle Genstilllegungen von ausgesuchten Genpaaren aus der Liste der 13 Gene des Einzelsilencings durchgeführt.
Die RNA Interferenz Experimente wurden nach einem standardisierten Schema
durchgeführt, was zu einer höheren Konsistenz der Daten für die spätere Netzwerkrekonstruktion führte. Für jedes Experiment wurden mindestens zwei spezifische siRNAs mit unterschiedlichen Antisense-Sequenzen pro Gen im Duplikat
in einer Endkonzentration von 50 nM (soweit nicht anders angegeben) eingesetzt
(s. Abschnitt 2.9). Zusätzlich wurden vier unabhängige Transfektionen mit einer
„non-silencing control“ siRNA (Qiagen, Hilden) sowie eine Mock-Transfektion
(enthielt nur Transfektionsmedium und Transfektionsreagenz) parallel durchgeführt. Dadurch wurde gewährleistet, dass für jedes siRNA-Experiment eine
genomweite Expressionsanalyse von acht biologischen Ansätzen mit vier cDNAMicroarrays im sogenannten Dye-Swap Design durchgeführt werden konnte.
37
3 Ergebnisse
3.1 Auswahl der Gene für die post-transkriptionelle
Genstilllegung
Im Rahmen dieser Arbeit war das Interesse auf Gene fokussiert, die im direkten Zusammenhang mit estrogenabhängigen Mammakarzinomen stehen. Dazu
wurden zum einen gezielt Gene ausgewählt, die bekanntermaßen dem Estrogenrezeptor Signalweg zuzuordnen sind (s. Abschnitt 1.3). Des weiteren wurden Gene ausgewählt, denen in vorherigen Studien eine klare Assoziation zu
estrogenabhängigen Brustkrebserkrankungen zugeschrieben werden konnte, Gene, welche einen direkten Einfluss auf den Estrogenrezeptor Signaltransduktionsweg ausüben, bzw. Gene, die im direkten Einfluss des Estrogenrezeptor
Signaltransduktionswegs stehen. Tabelle 3.1 zeigt die Auflistung der im Folgenden beschriebenen Gene, die für die post-transkriptionellen Genstilllegungsexperimente ausgewählt wurden. Grundsätzlich muss bei dem EstrogenrezepTabelle 3.1: Ausgewählte Gene für die post-transkriptionelle Genstilllegung
Gen Symbol
AKT1
AKT2
BCL2
CCNG2
ESR1
FOXA1
HSPB8
MAPK1
STAT5B
STC2
TMEM45B
TP53
XBP1
Beschreibung
v-akt murine thymoma viral oncogene homolog 1
v-akt murine thymoma viral oncogene homolog 2
B-cell CLL/lymphoma 2
cyclin G2
estrogen receptor 1
forkhead box A1
heat shock 22kDa protein 8
mitogen-activated protein kinase 1
signal transducer and activator of transcription 5B
stanniocalcin 2
transmembrane protein 45B
tumor protein p53
X-box binding protein 1
tor Signalweg zwischen den beiden in Abschnitt 1.3 beschriebenen Effekten der
Estradiolbindung unterschieden werden. Wie beschrieben, haben eine Reihe von
Genen einen direkten Einfluss auf den Signaltransduktionsweg des ERα bzw.
werden in direkter Weise von dessen Expression beeinflusst. Dabei trennt sich
die Funktionalität des ERα in die genomische und die nicht-genomische Ak-
38
3.1 Auswahl der Gene für die post-transkriptionelle Genstilllegung
tivität (s. Abschnitt 1.4.1 und 1.4.2). Die Expression und Aktivität der Gene
AKT1, AKT2, MAPK1 und STAT5B sind direkt durch die nicht-genomische
Aktivität des ERα reguliert (Björnstrom and Sjöberg [2005]). Die Aktivität der
einzelnen Signaltransduktionskaskaden kann steroidabhängig, aber auch steroidunabhängig erfolgen. Eine Interaktion des 17β-Estradiol mit der membranständigen Rezeptor-Tyrosin-Kinase (RTK) ErbB2 resultiert in einer Aktivierung des Akt Signaltransduktionswegs ohne den Einfluss des ERα (Stoica et al.
[2003b]). Gleichzeitig kann durch die Serin/Threonin Protein-Kinase Akt die
Aktivität des Estrogenrezeptors durch Interaktion mit der N-terminalen Aktivierungsfunktion AF-1 (s. Abschnitt 1.3) erhöht werden. Demnach stellen die
Gene AKT1 und AKT2 durch ihre weitreichenden Interaktionen mit dem ERα
sehr interessante Ziele zur Aufklärung von Gen-Gen Interaktionen im Estrogenrezeptor Signaltransduktionsweg dar.
Neben den beiden genannten Akt Kinasen werden auch die „mitogen-activated
protein kinase 1“ (MAPK1 ) sowie der „signal transducer and activator
of transcription 5b“ (STAT5B) direkt von der nicht-genomischen Aktivität
des ERα beeinflusst. Membranständige ERα Rezeptoren werden nach Bindung von 17β-Estradiol durch Konformationsänderung aktiviert, wodurch die
Src/Ras/Raf/Mek Kaskade aktiviert wird, was in einer Aktivierung von Mapk1
resultiert (Klinge et al. [2005]). Der Einfluss von 17β-Estradiol vermittelt eine
Phosphorylierung und damit Aktivierung von STAT5B (Björnstrom and Sjöberg
[2002]). Abb. 3.1 zeigt grafisch die Zusammenhänge der Gene im Estrogenrezeptor Signalweg.
Unabhängig von den direkten Einflüssen (genomisch und nicht-genomisch) des
ERα auf die Aktivität der oben aufgezählten Gene konnte in zahlreichen Studien
die Expression vieler Gene mit dem Estrogenrezeptorstatus von Mammakarzinomen assoziiert werden. Diese Gene stellen demnach ebenfalls sehr interessante
Ziele zur Identifizierung von Gen-Gen Interaktionen dar.
Durch die Kombination des Estrogenrezeptorstatus mit der Expression von
BCL2 wurde ein Zusammenhang mit der Prognose bei Patientinnen mit invasiv ductalem Karzinom (IDC) gezeigt (Park et al. [2002]). Die persistente Expression von BCL2 ist signifikant mit der Expression des ERα assoziiert. Eine
signifikante Reduktion in der Expression von BCL2 ist stark mit der fehlenden
Expression des ERα korreliert. BCL2 codiert für einen negativen Regulator der
Apoptose und verhindert durch seine Expression die Bildung von Kanälen in
der Mitochondrienmembran durch das Protein BAX. Dies verhindert die Frei-
39
3 Ergebnisse
Abbildung 3.1: Schematisch Darstellung der Zusammenhänge der Gene im Estrogenrezeptor Signaltransduktionsweg (aus Björnstrom and Sjöberg
[2005])
setzung von Cytochrom C und damit die Fortsetzung der Reaktionskaskade zur
Ausführung der Apoptose. Die beiden Proteine BCL2 und BAX stehen bei der
Regulation in einem Gleichgewicht, wobei die Fähigkeit von BCL2 die Apoptose
zu verhindern von der Fähigkeit der Heterodimerenbildung zwischen BCL2 und
BAX abhängt (Teixeira et al. [1995]).
Im Gegensatz zu den bisher genannten Genen wird die Expression des Gens
CCNG2 negativ durch den, durch 17β-Estradiol aktivierten, ERα reguliert. Die
Fähigkeit des 17β-Estradiol, die Expression von CCNG2 (einem negativen Regulator des Zellzyklus) zu reprimieren, könnte eine maßgebende Rolle in der
verstärkten Beförderung von tumorösen Zellen durch den Zellzyklus darstellen
(Stossi et al. [2006]). Die Bindung des durch 17β-Estradiol aktivierten Estrogenrezeptors an die Estrogen Responsive Element in Brustkrebszellen wird u.
a. durch das Gen FOXA1 hergestellt, wobei gleichzeitig eine Abhängigkeit der
Estrogenrezeptorexpression an das Vorhandensein von FOXA1 gekoppelt ist
(Carroll et al. [2005]).
40
3.2 Etablierung des Messprinzips
HSPB8, ein Mitglied der Superfamilie „der small heat shock proteins“ (sHSP),
ist in estrogenabhängigen Mammakarzinomen eng mit der Expression des ERα
verknüpft. In MCF-7 Zellen konnte gezeigt werden, dass die Behandlung mit
17β-Estradiol zu einem erhöhten Level an HSPB8 mRNA und damit auch zu
einem erhöhten Level an Protein führte (Sun et al. [2007]). Weiterhin konnte
gezeigt werden, dass das Gen STC2 positiv mit der Expression des ERα korreliert ist und estrogenabhängig exprimiert wird (Charpentier et al. [2000]). Die
enge Verknüpfung der Überexpression von STC2 mit dem Estrogenrezeptorstatus führte zur Entwicklung von STC2 zu einem prognostischen Marker bei
ERα-positiven Mammakarzinomen. Dabei wurde eine verlängerte krankheitsfreie Überlebenszeit bei Patientinnen mit STC2 Expression berichtet (Esseghir
et al. [2007]).
Das Gen TMEM45B, welches für ein transmembranes Protein codiert (Lian
et al. [2006]), zeigt ein verändertes Expressionsniveau in globalen Expressionsanalysen von estrogenabhängigen Mammakarzinomen (Daten unveröffentlicht).
Der schnelle Abbau des Estrogenrezeptors bei 17β-Estradiol Behandlung wird
über die proteasomale Degradation reguliert. Dazu bilden der ERα und die Proteine MDM2 und TP53 einen ternären Komplex und regulieren somit die zur
Verfügung stehende Konzentration von ERα (Duong et al. [2007]).
Der Transkriptionsfaktor XBP1 (Clauss et al. [1996], Liou et al. [1990]) wurde
ebenfalls als positiv korreliert in Bezug auf den Estrogenrezeptorstatus gefunden
(West et al. [2001]) und verstärkt die transkriptionelle Aktivität des ERα ligandenunabhängig (Lacroix and Leclercq [2004]). Außerdem konnte gezeigt werden,
dass die Protein- sowie die mRNA Konzentration von XBP1 in Tumoren mit
Antiestrogen-resistenten Zellen erhöht ist (Gomez et al. [2007]). XBP1 könnte demnach ein Schlüsselfaktor in Bezug auf das Ansprechen auf antiestrogene
Therapien sein (Romero-Ramirez et al. [2004]).
3.2 Etablierung des Messprinzips
Um das geplante Messprinzip zu Begin dieser Arbeit zu etablieren, wurde eine Testtransfektion der sequenzspezifischen siRNA gegen das Gen TP53 in der
epithelialen Cervix-Adenokarzinom Zelllinie HeLa durchgeführt. Dabei wurden
insgesamt zwei siRNAs unterschiedlicher Sequenz einzeln in einer Konzentration von 10 nM eingesetzt und für 42 h inkubiert (s. Abschnitt 2.9). HeLa Zellen
41
3 Ergebnisse
TP53
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
TP
53
_
TP 1 -1
53
_
TP 1 -2
53
_
TP 1 -3
53
_
TP 1 -4
53
_
TP 2 -1
53
_
TP 2 -2
53
_
TP 2 -3
53
_3
TP -4
53
_
TP K 1
53
_
TP K 2
53
_
TP K 3
53
_
TP K 4
53
_
TP K 5
53
TP _K
6
53
_M
oc
k
0
Abbildung 3.2: Selektive Reduktion der mRNA Konzentration von TP53 in HeLa
Zellen
zeichnen sich durch ihre einfache Handhabbarkeit aus und werden von den kommerziellen Anbietern von RNA-Interferenz Produkten als Standard verwendet.
Aus diesen Gründen wurde dieses System zur Etablierung des experimentellen
Designs (erfolgreiche post-transkriptionelle Genstilllegung, validiert mit qRTPCR, gefolgt von globaler Expressionsanalyse mit cDNA-Microarrays) verwendet. Da für die gezielte Stilllegung des Gens TP53 insgesamt zwei validierte
(vom Hersteller auf Funktion überprüft) siRNAs vorlagen, wurde dieses Gen
für die Etablierung des Messprinzips verwendet. Gleichzeitig sind das Gen und
seine Interaktionen sehr gut beschrieben (Agarwal et al. [1998], Levine [1997],
Prives and Hall [1999]), wodurch die Interpretation des zu messenden Expressionsprofiles nach erfolgter Genstilllegung vereinfacht wurde. Abb. 3.2 zeigt das
Ergebnis der post-transkriptionellen Genstilllegung von TP53 in HeLa Zellen.
Die Quantifizierung erfolgte in diesem Experiment auf Basis der Konzentration
der zur cDNA Synthese eingesetzten RNA. Alle Kontrollen zeigten ein wenig variables und kaum verringertes Expressionsniveau von TP53. Die Varianzen und
die relativ große Standardabweichung bei den Kontrolltransfektionen sind auf
Pipettierschwankungen zurückzuführen. Bei den mit spezifischer siRNA gegen
TP53 transfizierten Zellen konnte eine Reduktion der relativen mRNA Konzentration von 90 - 95 % erzielt werden. Die Fehlerbalken entsprechen der Stan-
42
3.3 Genomweite Expressionsanalyse des Etablierungsexperimentes
dardabweichung der Messwerte der Triplikate aus den jeweiligen Messungen.
Hiermit konnte der erste Teil des Messprinzips etabliert werden.
3.3 Genomweite Expressionsanalyse des
Etablierungsexperimentes
Nachdem, wie in Abschnitt 3.2 beschrieben, die post-transkriptionelle Genstilllegung von TP53 in HeLa Zellen etabliert werden konnte, wurde ein genomweites Expressionsprofil der HeLa Zellen nach siRNA Transfektion gegen TP53
erstellt. Dazu wurden insgesamt acht cDNA Microarrays im Dye-Swap Design
erstellt und anschließend, wie in Abschnitt 2.17 beschrieben, einer statistischen
Analyse unterzogen. Aufgrund des Silencing von TP53 wurden in den HeLa
Zellen 575 Gene signifikant (adjustierter p-Wert ≤ 0.05) dereguliert. Aus diesen
Genen sind fünf zur Validierung des mRNA Silencings exemplarisch mit den zugehörigen p-Werten und Expressionsänderungen in Tabelle 3.2 aufgeführt. Zur
Validierung der globalen Expressionsanalyse wurde die Liste der signifikant deregulierten Gene mit der Literaturdatenbank Ingenuity Pathway Analysis (Ingenuity Systems® , http://www.ingenuity.com) verglichen und die Übereinstimmungen in Form eines Netzwerks dargestellt (s. Abschnitt 3.3). Die Transkrip-
Tabelle 3.2: Resultate TP53 Knockdown HeLa
Gen Symbol
CDKN1A
BIRC5
GDF15
BTG2
MAPK14
Beschreibung
p-Wert
cyclin-dependent kinase inhibitor 1A 2.32 × 10−5
baculoviral IAP repeat-containing 5 1.19 × 10−3
growth differentiation factor 15
1.83 × 10−2
BTG family, member 2
1.7 × 10−2
mitogen-activated protein kinase 14
4.7 × 10−2
FoldChange
0.164
2.012
0.568
0.680
1.277
tion von CDKN1A (p21) wird von TP53 aktiviert (Xiong et al. [1993]), folglich
führt ein Silencing von TP53 zu einer Reduktion der mRNA von CDKN1A.
BIRC5 (survivin) hingegen wird durch TP53 inhibiert. Eine Reduktion der
mRNA von TP53 führt demnach zu einer Überexpression von BIRC5 (Hoffman et al. [2002], Mirza et al. [2002]). Albertoni et al., Kannan et al. und Tan
et al. (Albertoni et al. [2002], Kannan et al. [2000], Tan et al. [2000]) konnten
43
3 Ergebnisse
Abbildung 3.3: Validierung der genomweiten Expressionsanalyse nach TP53 Silencing. Nur direkte Interaktionen wurden gewählt. Rote Knoten entsprechen Genen mit gesteigerter mRNA Expression in den experimentellen, sowie den Literaturdaten. Grüne Knoten entsprechen
Genen mit verringerter mRNA Expression in Folge des Silencings
von TP53. Unter den Knoten sind die jeweiligen Fold Changes verzeichnet (F C ≥ 1 ≡ Überexpression, F C ≤ −1 ≡ Repression).
Aus: Ingenuity: IPA 6.3 - 1402 Build: 54960
44
3.4 Überprüfung der Zell-Lebensfähigkeit
zeigen, dass TP53 direkt an der Expression des Gens GDF15 (MIC-1) beteiligt ist. Ein Silencing der mRNA von TP53 führt demnach ebenfalls zu einer
Reduktion der Expression von GDF15. Das Silencing von TP53 führte desweiteren zu einer Repression der mRNA von BTG2. Wie Daoud et al. (Daoud et al.
[2003]) beschrieben, ist TP53 notwendig für die Expression der BTG2 mRNA.
Die „mitogen-activatet protein kinase 14“ (MAPK14 ) verstärkt die Aktivierung
von TP53 durch Phosphorylierung (Bulavin et al. [1999]) indem sie selbst durch
Phosphorylierung über den Ras-Raf-Mek-Erk Signaltransduktionsweg aktiviert
wird. Dieser Signaltransduktionsweg kann über WIP1, einem TP53 regulierten
Gen, durch Bildung einer negativen autoregulatorischen feedback Schleife inaktiviert werden (Takekawa et al. [2000]). Die Reduktion der TP53 mRNA selbst
konnte im Rahmen der genomweiten Expressionsanalyse mit cDNA Microarrays nicht verifiziert werden, da der zur Herstellung der Microarrays verwendete
RZPD Unigene 3.1 cDNA Satz lediglich einen Klon schlechter Qualität für das
Gen TP53 beinhaltet.
3.4 Überprüfung der Zell-Lebensfähigkeit nach
Transfektionen mit hohen siRNA
Konzentrationen
Da die Rekonstruktion der Gen-Gen Interaktionsnetzwerke auf spezifische Fragestellungen in Brustkrebs angewandt werden sollte, mussten die experimentellen Konditionen aus Abschnitt 3.2 auf die Besonderheiten der MCF-7 Zellen angepasst werden. Hauptsächlich war eine Erhöhung der Konzentration der
eingesetzen siRNA notwendig, da bei niedrigen Konzentrationen (10 nM) keine adäquate post-transkriptionelle Genstilllegung in den MCF-7 Zellen möglich
war (Daten nicht gezeigt). In mehreren Konzentrationsreihenexperimenten wurden siRNA Konzentrationen von 10 nM bis 100 nM exemplarisch für die Gene
AKT1, AKT2, FOXA1 und HSPB8 auf ihren Einfluss auf die Lebensfähigkeiten
der Zellen unter Verwendung des in Abschnitt 2.15.1 beschriebenen WST-1 CellViability Assays getestet. Abb. 3.4 und 3.5 zeigen die Einflüsse der Transfektion der siRNAs gegen die oben genannten Gene in den Konzentrationen 10 nM,
50 nM und 100 nM. Die Transfektionen wurden über einen Zeitraum von 42 h
durchgeführt und die Auswertung anschließend auf die Lebensfähigkeit der Zellen in der Mock-Transfektion bezogen. Bei den Transfektionen der in Abb. 3.4
45
3 Ergebnisse
140
120
100
10nM
50nM
100nM
80
60
40
20
0
AKT1_1
AKT1_2
AKT2_1
AKT2_2
Control
Mock
Abbildung 3.4: Lebensfähigkeiten der MCF-7 Zellen nach Transfektion mit siRNA
gegen AKT1 und AKT2 in unterschiedlichen Konzentrationen
140
120
100
10nM
80
50nM
60
100nM
40
20
0
FOXA1_1
FOXA1_2
HSPB8_1
HSPB8_2
Control
Mock
Abbildung 3.5: Lebensfähigkeiten der MCF-7 Zellen nach Transfektion mit siRNA
gegen FOXA1 und HSPB8 in unterschiedlichen Konzentrationen
46
3.5 Post-Transkriptionelle Genstilllegung durch RNA Interferenz
und 3.5 dargestellten siRNAs war kein starker Einfluss der siRNA Konzentration
auf die Lebensfähigkeit der Zellen zu erkennen. Daher wurde als Grundansatz
in den nachfolgenden Experimenten stets eine siRNA Konzentration von 50 nM
verwendet. Die Ergebnisse des Cell-Viability Assays ließen dennoch die Möglichkeit der Verwendung höherer siRNA Konzentrationen ohne negativen Einfluss
auf die Zelllebensfähigkeit zu. Demnach wurde immer dann, wenn mit einer
Konzentration von 50 nM keine adäquaten post-transkriptionellen Genstilllegungen möglich waren, die siRNA Konzentration auf 100 nM erhöht (jeweils im
Text angegeben).
3.5 Post-Transkriptionelle Genstilllegung durch
RNA Interferenz
Die Untersuchungen in Abschnitt 3.2 und Abschnitt 3.3 zeigten die Etablierung des erarbeiteten Messprinzips. Im Folgenden werden die Ergebnisse der
einzelnen selektiven post-transkriptionellen Genstilllegungen aufgeführt. Exemplarisch sei hier nur das Ergebnis für den Knock-down des Gens AKT1 grafisch
dargestellt. Die Graphen der anderen 12 Experimente finden sich im Anhang
(A.2 - A.14). Die relativen Konzentrationen der jeweiligen mRNAs wurden mit
der in Abschnitt 2.14 beschriebenen TaqMan qRT-PCR Methode quantifiziert
und die Messergebnisse grafisch dargestellt. Die Zusammenfassung der einzelnen
Messungen ist in Tabelle 3.3 auf Seite 51 zu finden.
3.5.1 AKT1
Abb. 3.6 zeigt das Ergebnis der Behandlung der MCF-7 Zellen mit siRNA gegen das Gen AKT1. Auf der Ordinate sind die jeweiligen Replikate mit den
zugehörigen siRNA Bezeichnungen verzeichnet. Die Abzisse entspricht der relativen mRNA Expression, normalisiert auf die Expression des Housekeeping-Gens
GAPDH. Die Proben zeigten eine selektive Reduktion der mRNA Konzentration des Gens AKT1 von 58 - 65 %, wobei die Replikate der jeweiligen siRNAs
nur gering voneinander abwichen. Die Kontrollen wiesen geringfügige Varianzen
auf, die auf die quantitativen realtime-PCR zurückzuführen sind. Eine zufriedenstellende Reduktion der mRNA konnte für das Gen AKT1 nur mit einer
47
3 Ergebnisse
AKT1
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
T1
_M
oc
k
AK
T1
_K
4
AK
T1
_K
3
AK
T1
_K
2
AK
T1
_K
1
AK
T1
_7
-2
AK
T1
_7
-1
AK
T1
_5
-2
AK
AK
T1
_5
-1
0
Abbildung 3.6: Selektive Reduktion der mRNA Konzentration von AKT1
siRNA Endkonzentration von 100 nM erzielt werden. Da alle vier Replikate
der Transfektion eine ausreichende Reduktion der mRNA Konzentration ergaben, konnten die Proben für die nachfolgenden Expressionsanalysen vorbereitet
werden.
3.5.2 AKT2
Wie in A.3 abgebildet, zeigte die Transfektion der MCF-7 Zellen mit zwei sequenzspezifischen siRNAs gegen AKT2 eine Reduktion der AKT2 mRNA von
77 - 88 %. Die Kontrollen wiesen nur geringe Schwankungen und keine Reduktion
der mRNA Konzentration von AKT2 auf. Abweichend von den in Abschnitt 2.9
angegebenen Bedingungen wurden die siRNA gegen AKT2 in diesem Experiment in einer Endkonzentration von 100 nM eingesetzt. Alle vier Transfektionen resultierten in einer ausreichenden Reduktion der mRNA von AKT2 ; somit
konnten die Proben zur weiteren Analyse verwendet werden.
48
3.5 Post-Transkriptionelle Genstilllegung durch RNA Interferenz
3.5.3 BCL2
Die Behandlung der MCF-7 Zellen mit siRNAs gegen BCL2 führte zu einer
Reduktion der mRNA von BCL2 um 71 - 78 % (s. Abb. A.4). Eine Reduktion
der mRNA in diesem Maße war nur durch eine siRNA-Endkonzentration von
100 nM möglich. Die Kontrollen zeigten eine gleichmäßige, nicht reduzierte Expression des Gens BCL2. Daher konnten alle Proben aus dieser Transfektion für
die genomweite Expressionsanalyse und spätere Rekonstruktion des Interaktionsnetzwerks verwendet werden.
3.5.4 CCNG2
Für die gezielte Verringerung der mRNA des Gens CCNG2 standen insgesamt
drei verschiedene siRNAs unterschiedlicher Sequenz zur Verfügung. Alle siRNAs
wurden einzeln in einer Endkonzentration von 50 nM wie in Abschnitt 2.9 beschrieben für die Transfektionen eingesetzt. Dabei konnten Verringerungen der
mRNA von CCNG2 um 71 - 82 % erzielt werden (s. Abb. A.5). Die Kontrollen zeigten ein durchweg stabiles und nicht vermindertes Expressionslevel der
mRNA von CCNG2. Da alle sechs Replikate der Transfektionen eine Verringerung der mRNA Konzentration von mehr als 70% zeigten, konnten für dieses Experiment insgesamt sechs genomweite cDNA Microarrays im Dye-Swap-Design
hybridisiert werden.
3.5.5 ESR1
Die spezifische Verringerung der mRNA Konzentration des Gens ESR1 ist
in Abb. A.6 dargestellt. In diesem Experiment wurden, abweichend von
Abschnitt 2.9, keine einzelnen siRNAs eingesetzt. Um eine ausreichende Verringerung der mRNA Konzentration zu erreichen, mussten im Falle des Gens
ESR1 siRNA Gemische verwendet werden. Dabei wurden für beide Replikate
jeweils ein Mix aus drei siRNAs unterschiedlicher Sequenz erstellt und in einer
Konzentration von 50 nM eingesetzt. Durch den Einsatz von drei verschiedenen
siRNAs pro Mix gegen das Gen ESR1 wurde eine deutlich höhere Effizienz in
der Verringerung der mRNA Konzentration erzielt. Die vier Replikate des Experiments zeigten eine Verringerung der mRNA Konzentration um 67 - 76 %
bezogen auf die Expression des Gens in den Kontrollen.
49
3 Ergebnisse
3.5.6 FOXA1
Abb. A.7 stellt die Ergebnisse des mRNA Silencing für das Gen FOXA1 dar.
Die Kontrollen zeigten eine gleichmäßige und nicht reduzierte Expression der
mRNA. Die Konzentration der mRNA von FOXA1 wurde durch die Behandlung
mit zwei unterschiedlichen siRNAs in einer Konzentration von 100 nM um 71 85 % reduziert. Transfektionen mit einer geringeren Konzentration der siRNA
führten zu keiner adäquaten Reduktion der mRNA Konzentration.
3.5.7 HSPB8
Das in Abb. A.8 aufgeführte Diagramm zeigt die mRNA Reduktion nach der
Behandlung mit siRNAs gegen das Gen HSPB8. In diesem Experiment wurden
die siRNAs in einer Konzentration von 100 nM eingesetzt. Nach 42 h Inkubation
war die Expression der mRNA von HSPB8 um 82 - 87 %, bei gleichbleibender,
nicht veränderter Expression der Kontrollen, reduziert. Die Schwankungen der
Replikate untereinander war ebenfalls sehr gering.
3.5.8 MAPK1
Eine Behandlung der MCF-7 Zellen mit siRNAs gegen das Gen MAPK1 führte
zu einer Reduktion der mRNA von MAPK1 von 54 - 83 %. Das Expressionsniveau von MAPK1 war in den Kontrollen ebenfalls weitestgehend konstant
(s. Abb. A.9). Die Transfektion wurde anhand der Angaben in Abschnitt 2.9
durchgeführt. Da alle Proben eine ausreichende Reduktion der mRNA aufwiesen, konnten die Proben für die Hybridisierung auf cDNA Microarrays verwendet
werden.
3.5.9 STAT5B
Abb. A.10 zeigt die Verringerung der mRNA Konzentration des Gens STAT5B
nach Inkubation mit drei siRNAs unterschiedlicher Sequenz. Alle siRNAs wurden dabei in einer Konzentration von 50 nM eingesetzt. Die Transfektionen führten zu einer Reduktion der mRNA Konzentration von STAT5B um 62 - 69 %.
Da die Transfektion nur bei den Replikaten von zwei siRNAs zu einer adäquate
Verringerung der mRNA Konzentration führte, wurden zu diesem Experiment
vier unabhängige cDNA-Microarrays erstellt.
50
3.5 Post-Transkriptionelle Genstilllegung durch RNA Interferenz
Tabelle 3.3: Zusammenfassung der post-transkriptionellen Einzelgenstilllegungen
Gen Symbol
AKT1
AKT2
BCL2
CCNG2
ESR1
FOXA1
HSPB8
MAPK1
STAT5B
STC2
TMEM45B
TP53
XBP1
Anzahl siRNA
2
2
2
3
2*
2
2
2
3
3
2
2
2
siRNA Konzentration % mRNA Reduktion
100 nM
58 - 65
100 nM
88 - 77
100 nM
71 - 78
50 nM
71 - 82
50 nM
67 - 76
100 nM
71 - 85
100 nM
82 - 87
50 nM
54 - 83
50 nM
62 - 69
50 nM
81 - 90
50 nM
79 - 83
50 nM
68 - 87
50 nM
62 - 65
* Bei der Transfektion mit ESR1 siRNA wurden anstatt der einzelnen siRNAs zwei
unterschiedliche Gemische bestehend aus jeweils drei unterschiedlichen siRNA verwendet.
3.5.10 STC2
Die in Abb. A.11 dargestellte Transfektion von drei siRNAs gegen das Gen STC2
zeigte eine Reduktion der mRNA Konzentration von STC2 um 81 - 90 %.
Für das Silencing von STC2 standen in diesem Experiment drei siRNAs unterschiedlicher Sequenz zur Verfügung. Alle Replikate wiesen eine adäquate und
gleichmäßige Reduktion der mRNA Konzentration von STC2 auf und konnten
demnach für die folgenden genomweiten Expressionsanalysen eingesetzt werden.
3.5.11 TMEM45B
Die Effizienz der post-transkriptionellen mRNA Reduktion des Gens TMEM45B
ist in Abb. A.12 dargestellt. Dabei zeigten alle Replikate der siRNA Behandlung eine sehr gute Reduktion der relativen mRNA Konzentration (79 - 83 %).
Die Kontrollen wiesen eine ausgeglichene und nicht verminderte Expression der
mRNA des Gens TMEM45B auf.
51
3 Ergebnisse
3.5.12 TP53
Abb. A.13 zeigt die relativen Expressionsniveaus des Gens TP53 nach 42 h
Transfektion mit siRNA gegen dieses Gen. Die mRNA Konzentration wurde
dabei in den Proben um 79 - 83 % reduziert, wogegen die mRNA des Gens in
den Kontrollen nicht beeinflusst und gleichmäßig exprimiert wurden. Die Proben konnten demnach alle für die folgenden genomweiten Expressionsanalysen
verwendet werden.
3.5.13 XBP1
Abb. A.14 stellt grafisch die selektive Reduktion der mRNA Konzentration von
XBP1 nach Behandlung mit zwei siRNAs unterschiedlicher Sequenz in einer
Konzentration von 50 nM dar. Die Transfektion zeigte eine Reduktion der
mRNA von XBP1 um 62 - 65 % in den Proben, bei gleichbleibender Expression
in den Kontrollen. Die Proben waren demnach für eine genomweite Expressionsanalyse verwendbar.
3.6 Kombinatorische post-transkriptionelle
Genstilllegungen
Neben den Silencingexperimenten (s. Abschnitt 3.5.1 - 3.5.13), in denen jeweils
ein Gen selektiv post-transkriptionell stillgelegt wurde, wurden zusätzlich kombinatorische Transfektionen durchgeführt. Dabei wurden siRNAs gegen zwei
Gene parallel transfiziert und die Effizienz der Transfektion anschließend für
beide Gene überprüft. Durch die Auswahl der Genpaare wurde zum einen versucht, den Estrogenrezeptor Signaltransduktionsweg an zwei unterschiedlichen
Punkten zu beeinflussen (ESR1 und MAPK1 bzw. MAPK1 und STAT5B).
Zum anderen wurde das Genpaar (CCNG2 und ESR1 ) ausgewählt, da die Expression der beiden Gene voneinander abhängig ist (Bennin et al. [2002]). Somit
konnte eine Anknüpfung an die Kontrolle des Zellzyklus hergestellt werden.
52
3.6 Kombinatorische post-transkriptionelle Genstilllegungen
3.6.1 CCNG2 und ESR1
Die Ergebnisse der parallelen Transfektion mit siRNAs gegen die Gene CCNG2
und ESR1 sind in Abb. A.15 dargestellt. Dabei zeigte die mRNA von ESR1 eine
Reduktion von 54 - 62 % bezogen auf die Expression in den Kontrollen. Die Kontrollen wiesen für beide Gene ein ausgeglichenes Expressionsniveau auf. Obwohl,
wie bereits in Abschnitt 3.5.4 präsentiert, die siRNAs gegen CCNG2 in den Einzeltransfektionen eine adäquate Reduktion der mRNA zeigten, kam es im Fall
des parallelen Silencings zu einer Überexpression von 34 - 60 % von CCNG2
trotz Anwesenheit der spezifischen siRNAs gegen dieses Gen. Zum gezielten Silencing der mRNA von ESR1 wurden, wie in Abschnitt 3.5.5 beschrieben, Gemische von jeweils drei siRNAs gegen ESR1 verwendet. Diese Gemische wurden
in einer Konzentration von 50 nM eingesetzt. Zusätzlich wurden die Zellen mit
einer siRNA gegen CCNG2 (ebenfalls 50 nM) transfiziert. Die Transfektion der
Kontrollen erfolgte daher mit non-silencing control siRNA (Qiagen, Hilden) in
einer Konzentration von 100 nM.
3.6.2 ESR1 und MAPK1
Analog zu Abschnitt 3.6.1 wurden die MCF-7 Zellen mit siRNAs gegen die
Gene ESR1 und MAPK1 parallel transfiziert und die resultierenden Expressionsänderungen der spezifischen mRNA mit TaqMan qRT-PCR gemessen (s.
Abb. A.16). Die mRNA von ESR1 zeigte in den transfizierten Zellen eine Reduktion von 53 - 66 % gegenüber der Expression in den Kontrollen, welche
ein konstantes und unverändertes Expressionsniveau zeigten. Gleichzeitig führte die Transfektion der siRNAs gegen ESR1 und MAPK1 zu einer Reduktion
der mRNA Konzentration von MAPK1 um 29 - 42 % für die erste siRNA, aber
zu keiner Verringerung der mRNA Konzentration bei der Transfektion mit der
zweiten siRNA. Trotz einer nur unzureichenden Verringerung der mRNA Konzentration von MAPK1 im Falle der zweiten eingesetzten siRNA wurden die
Proben für die weiterführenden Experimente verwendet.
3.6.3 MAPK1 und STAT5B
Abb. A.17 zeigt das Ergebnis des kombinatorischen Silencings der Gene MAPK1
und STAT5B in einer Konzentration von jeweils 50 nM. Dabei ist eine Verringerung der mRNA von MAPK1 von 76 - 90 % im Falle der ersten siRNA zu
53
3 Ergebnisse
erkennen. Die zweite siRNA gegen MAPK1 zeigte lediglich eine Verringerung
der mRNA Konzentration von 46 - 48 %. Die reduzierte Effizienz der zweiten siRNA gegen MAPK1 in kombinatorischen Transfektionen entsprach dem
kombinatorischen Silencing Experiment in Abschnitt 3.6.2. Die Transfektion der
Zellen mit siRNA gegen STAT5B führte zu einer Verringerung der mRNA von
STAT5B um 65 - 86 %. Analog zu Abschnitt 3.6.2 wurden die Proben, trotz
geringer Reduktion der mRNA von MAPK1 für den Fall der zweiten siRNA,
für die genomweiten Expressionsanalysen verwendet.
Tabelle 3.4: Zusammenfassung der kombinatorischen post-transkriptionellen Genstilllegungen
Kombination
CCNG2/ESR1
ESR1/MAPK1
MAPK1/STAT5B
Gen Symbol
CCNG2
ESR1
ESR1
MAPK1
MAPK1
STAT5B
Anzahl siRNA
2
2*
2*
2
2
2
% mRNA Reduktion
134 - 160**
54 - 62
53 - 66
29 - 42
76 - 79
46 - 48
* Bei der Transfektion mit ESR1 siRNA wurden anstatt der einzelnen siRNAs zwei
unterschiedliche Gemische, bestehend aus jeweils drei unterschiedlichen siRNAs, verwendet.
** Im Falle von CCNG2 war eine Überexpression der mRNA zu verzeichnen.
3.7 Stimulation und Inhibition des
Estrogenrezeptors
Neben den Effekten aufgrund eines Silencings des Estrogenrezeptors
(s. Abschnitt 3.5.5), waren die Entschlüsselung der Effekte aufgrund einer gezielten Stimulation bzw. Inhibition des Estrogenrezeptors Gegenstand der Untersuchungen in dieser Arbeit. Dazu wurden komerziell verfügbare Varianten
des humanen Steroidhormons 17β-Estradiol, sowie des Selektiven Estrogen Rezeptor Modulators Tamoxifen in physiologischen bzw. therapeutischen Konzentrationen verwendet.
54
3.7 Stimulation und Inhibition des Estrogenrezeptors
Estradiol
1.4
1.2
1
0.8
3h
0.6
6h
0.4
0.2
Es
tra
di
ol
_1
Es
tra
di
ol
_2
Es
tra
di
ol
_3
Es
tra
di
ol
_4
Es
tra
di
ol
_5
Es
tra
di
ol
_6
M
oc
k_
1
M
oc
k_
2
M
oc
k_
3
M
oc
k_
4
M
oc
k_
5
M
oc
k_
6
0
Abbildung 3.7: Relative Expressionsniveaus von ESR1 nach Behandlung mit 17βEstradiol
3.7.1 Gezielte Stimulation des Estrogenrezeptors mit
17β-Estradiol
Zur gezielten Stimulation des Estrogenrezeptors wurden die MCF-7 Zellen, wie
in Abschnitt 2.10 beschrieben, für drei, bzw. sechs Stunden mit dem endokrinen Steroidhormon 17β-Estradiol stimuliert und anschließend aus diesen Zellen
die RNA isoliert. Abb. 3.7 zeigt die relativen Expressionsniveaus des Estrogenrezeptors nach einer Stimulation mit 17β-Estradiol. Die Kontrollen zeigten für
beide Zeitpunkte eine ausgeglichene und nicht reduzierte Expression des Estrogenrezeptors. Eine dreistündige Inkubation der Zellen mit 17β-Estradiol führte
zu einer Reduktion der mRNA von ESR1 von 15 - 30 %, welche sich durch Verlängerung der 17β-Estradiol Exposition auf 6 h auf bis zu 43 % erhöhte. Diese
feedback-Regulation des Estrogenrezeptors durch 17β-Estradiol stellt ein bereits
bekanntes Phänomen dar (Cidlowski and Muldoon [1978], Saceda et al. [1988,
1989]). Da 17β-Estradiol einen direkten Einfluss auf die Expression des Estrogenrezeptors ausübt, ist mit einer Änderung der Expression von stromabwärts
liegenden Genen zu rechnen. Die Proben wurden daher für eine anschließende
genomweite Expressionsanalyse weiterverarbeitet.
55
3 Ergebnisse
Tam oxifen
1.2
1
0.8
0.6
0.4
0.2
M
oc
k_
4
M
oc
k_
3
M
oc
k_
2
M
oc
k_
1
ife
n_
4
Ta
m
ox
ife
n_
3
Ta
m
ox
ife
n_
2
Ta
m
ox
Ta
m
ox
ife
n_
1
0
Abbildung 3.8: Relative Expressionsniveaus von ESR1 nach Behandlung mit Tamoxifen
3.7.2 Gezielte Inhibition des Estrogenrezeptors mit
Tamoxifen
Abb. 3.8 zeigt die relativen Expressionsniveaus der mRNA des Estrogenrezeptors (ESR1 ) nach einer 48-stündigen Inkubation der MCF-7 Zellen mit dem
Selektiven Estrogen Rezeptor Modulator (SERM) Tamoxifen. Dabei wurden
die Zellen, wie in Abschnitt 2.11 beschrieben, nach 24-stündiger Präinkubation
für 48 h mit 100 nM Tamoxifen behandelt und anschließend die relativen Expressionsniveaus in vier biologischen Replikaten bestimmt. Die vier Replikate
der Tamoxifen Behandlung sowie die unbehandelten Kontrollen zeigten ein ausgeglichenes und nicht verändertes Expressionsniveau der mRNA von ESR1. Die
Bindung von Tamoxifen an den Estrogenrezeptor induziert eine strukturelle Änderung in der räumlichen Struktur des Estrogenrezeptors (Dutertre and Smith
[2000]), wodurch die Fähigkeit zur Interaktion mit anderen Proteinen (z.B. Koaktivatoren oder Korepressoren) gestört wird. Da Tamoxifen keinen Einfluss auf
die Expression des Estrogenrezeptors an sich besitzt, ist mit keiner Veränderung der mRNA Konzentration nach Behandlung mit Tamoxifen zu rechnen.
Die hier gezeigten Daten entsprechen dieser Erwartung. Aufgrund von Interaktionsstörungen des Estrogenrezeptors mit anderen Proteinen als Folge der
56
3.8 Expressionsanalysen nach Genstilllegung
Tamoxifenbindung, ist mit Änderungen des Expressionsverhaltens von stromabwärts liegenden Genen aus dem Estrogenrezeptor Signaltransduktionsweg zu
rechnen. Aus diesem Grund wurden anschließend die Proben für eine genomweite Expressionsanalyse aufbreitet.
3.8 Genomweite Expressionsanalysen der
post-transkriptionellen Genstilllegungen
Im Folgenden werden die Ergebnisse der genomweiten Expressionsanalysen des
mRNA Silencings für die unter Abschnitt 3.1 angegebenen 13 Gene (3.5.1 3.5.13), des kombinatorischen Silencings (3.6.1 - 3.6.3) und der Behandlung mit
den endokrinen Substanzen 17β-Estradiol (3.7.1) und Tamoxifen (3.7.2) aufgeführt. Die Ergebnisse stammen aus den statistischen Analysen der cDNA Microarrays (s. Abschnitt 2.17) in der Statistikumgebung R mittels der Pakete vsn
(Huber et al. [2002]) und limma (Smyth [2004]). Die ausgewerteten Daten wurden in Form einer .RData Datei abgespeichert. Die für diese Dissertation verwendeten Daten sind in Form der Rohdaten unter der GEO-ID: GSE12291 öffentlich
zugänglich (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE12291).
Tabelle 3.5 zeigt eine Zusammenfassung der statistischen Auswertung aller genomweiten Expressionsanalysen.
Im Folgenden werden die einzelnen Expressionsprofile der jeweiligen posttranskriptionellen Genstilllegungen erläutert und, soweit vorhanden, die Expressionsänderungen der 13 Gene aus Abschnitt 3.1 tabellarisch aufgeführt. Die
Einträge der Tabellen 3.6 - 3.12 sind nach der Signifikanz der einzelnen Gene geordnet. Signifikante Expressionsänderungen wiesen einen p − W ert ≤ 0.05 auf.
Zusammenfassend wurden die Expressionsänderungen der 13 stillgelegten Gene in den durchgeführten globalen Expressionsanalysen grafisch in Form einer
hierarchischen Clusteranalyse dargestellt (Abb. 3.9). Die Ordinate der hierarchischen Clusteranalyse zeigt die 13 für die post-transkriptionelle Genstillegung
ausgewählten Gene. Auf der Abzisse sind die 17 im folgenden beschriebenen
genomweiten Expressionsanalysen aufgeführt. Durch die Clusteranalyse wird
demnach die Expression der 13 selektierten Gene in jeder der durchgeführten
genomweiten Expressionsanalysen angezeigt. In den Expressionsprofilen ähnliche Experimente, bzw. Gene mit ähnlichem Expressionsverhalten sind in der
Clusteranalyse räumlich nah zueinander angeordnet. Die hierarchische Cluster-
57
3 Ergebnisse
Tabelle 3.5: Zusammenfassung der genomweiten Expressionsprofile
Gen Symbol
AKT1
AKT2
BCL2
CCNG2
ESR1
ESR1/CCNG2
ESR1/MAPK1
FOXA1
HSPB8
MAPK1
MAPK1/STAT5B
STAT5B
STC2
TMEM45B
TP53
XBP1
p-Wert < 0.05
23
1291
3
1680
228
20
3037
26
0
1
36
113
6
5
2
2
FC > 1
11
892
1
430
92
2
2137
17
0
0
17
32
4
2
2
0
FC < 1
12
399
2
1250
136
18
900
9
0
1
19
81
2
3
0
2
% FC > 1
48
69
33
26
40
10
70
65
0
47
28
67
40
100
0
% FC < 1
52
31
67
74
60
90
30
35
100
53
72
33
60
0
100
17β-Estradiol
Tamoxifen
117
2937
88
957
29
1980
75
33
25
67
Legende: FC = fold change, ESR1 /CCNG2, ESR1 /MAPK1 und MAPK1 /STAT5B stehen
für die kombinatorischen Genstilllegungen der angegebenen Gene.
analyse läßt deutlich erkennen, dass in den meisten Experimenten eine Reduktion der relativen mRNA Konzentration der selektierten Gene erfolgte. Diese
Beobachtung geht einher mit der Tatsache, dass die Gene eine enge Verknüpfung mit dem Estrogenrezeptor Signaltransduktionsweg aufweisen und bei einer
Störung dieses Systems hauptsächlich eine Repression der Expression zu erwarten ist.
3.8.1 Expressionsprofil AKT1 Silencing
Das Silencing von AKT1 ergab insgesamt 23 signifikante Gene mit verändertem Expressionsverhalten. Darunter das Gen STC2 mit einer Reduktion der
58
3.8 Expressionsanalysen nach Genstilllegung
1.74
1.35
Estradiol
CCNG2
0.97
Tamoxifen
TMEM45B
0.58
HSPB8
TP53
0.19
AKT1
BCL2
−0.19
XBP1
−0.58
MAPK1/STAT5B
MAPK1
−0.97
STC2
ESR1/CCNG2
−1.35
ESR1/MAPK1
FOXA1
−1.74
AKT2
ESR1
HSPB8
CCNG2
AKT2
FOXA1
AKT1
TP53
STAT5B
TMEM45B
BCL2
MAPK1
STC2
XBP1
ESR1
Abbildung 3.9: Hierarchische Clusteranalyse der post-transkriptionellen Genstilllegungen und der gemessenen Effekte.
Das Clustering erfolgte sowohl für die Behandlungen als auch für die gemessenen Effekte. Ordinate: Expressionswerte der einzelnen Experimente
Abzisse: Effekt der einzelnen Experimente auf die Expression des angegebenen Gens
relativen mRNA Konzentration (p-Wert = 2.87 × 10−2 , FC = 0.709). Das Verhältnis zwischen Überexpression und Repression war ausgeglichen. Die Expressionänderung von AKT1 selbst konnte in der genomweiten Expressionsanalyse
nicht dargestellt werden, wurde jedoch über die qRT-PCR Analyse nachgewiesen (s. Abschnitt 3.5.1).
3.8.2 Expressionsprofil AKT2 Silencing
Durch die post-transkriptionelle Verringerung der mRNA Konzentration von
AKT2 zeigten insgesamt 1291 Gene eine signifikante Änderung ihres Expressionsverhaltens, wobei eine leichte Tendenz zur Überexpression der Gene aufgrund
des Silencings zu erkennen ist. Tabelle 3.6 zeigt einen Ausschnitt der signifikant
regulierten Gene nach Silencing von AKT2. Eine Verringerung der Expression
59
3 Ergebnisse
von AKT2 konnte durch die cDNA Microarrays nicht, jedoch durch die qRTPCR Analyse (s. Abschnitt 3.5.2), nachgewiesen werden.
Tabelle 3.6: Expressionswerte einzelner Gene nach AKT2 Silencing
Gen Symbol
STC2
XBP1
ESR1
MAPK1
p-Wert
1.87 × 10−5
9.51 × 10−3
1.95 × 10−2
4.85 × 10−2
FC
0.281
0.454
0.591
1.356
Legende: FC = fold change
3.8.3 Expressionsprofil BCL2 Silencing
Die Behandlung der MCF-7 Zellen mit siRNA gegen das Gen BCL2 ergab drei
Gene mit signifikant veränderter Expression. Die stärkste Expressionsänderung
zeigte dabei das Gen XBP1 ( p-Wert = 6 × 10−3 , FC = 0.533). XBP1 wird als
einer der Schlüsselfaktoren für eine antiestrogene Therapie betrachtet (Gomez
et al. [2007]) und ist sehr eng verknüft mit der Expression des Estrogenrezeptors
(Lacroix and Leclercq [2004]). Die Reduktion der mRNA Expression von BCL2
konnte durch die Microarrayanalyse nicht bestätigt werden. Die qRT-PCR Analyse zeigte jedoch eine klare Reduktion von 71 - 78 % (s. Abschnitt 3.5.2).
3.8.4 Expressionsprofil CCNG2 Silencing
Das Silencing von CCNG2 ergab 1680 signifikant veränderte Gene. CCNG2 ist
in die Regulation des Zellzyklus involviert, woraus mit einer großen Anzahl an
deregulierten Genen nach einem Silencing zu rechnen ist. Unter den Genen mit
signifikant veränderter Expression waren auch acht Gene der zu Beginn aller
Arbeiten ausgewählten Zielgene (s. Abschnitt 3.1). Tabelle 3.7 zeigt die korrespondierenden Expressionsänderungen der Gene nach Silencing von CCNG2.
Außer dem Gen HSPB8 zeigten alle Gene eine positive Korrelation in Bezug
auf die Expression von CCNG2. Das Gen CCNG2 selbst zeigte die größte Signifikanz und die stärkste Änderung der relativen mRNA Konzentration in der
genomweiten Expressionsanalyse.
60
3.8 Expressionsanalysen nach Genstilllegung
Tabelle 3.7: Expressionswerte einzelner Gene nach CCNG2 Silencing
Gen Symbol
CCNG2
STC2
ESR1
BCL2
HSPB8
FOXA1
MAPK1
TMEM45B
p-Wert
5.99 × 10−7
2.10 × 10−3
2.43 × 10−3
3.32 × 10−3
6.04 × 10−3
9.85 × 10−3
4.40 × 10−2
4.62 × 10−2
FC
0.274
0.595
0.651
0.690
1.344
0.716
0.818
0.835
Legende: FC = fold change
3.8.5 Expressionsprofil ESR1 Silencing
Aufgrund der Genstillegung von ESR1 änderte sich bei 228 Genen signifikant
die relative mRNA Konzentration. Tabelle 3.8 zeigt die Expressionswerte der zur
post-transkriptionellen Genstilllegung ausgewählten Gene nach durchgeführtem
Silencing von ESR1. Die in der Literatur beschriebenen Abhängigkeiten der
Expression von STC2 (Bouras et al. [2002]) und XBP1 (Lacroix and Leclercq
[2004]) konnten im Rahmen der Messung klar dargestellt werden. Ebenso konnte
die Co-expression von HSPB8 mit ESR1 (Charpentier et al. [2000], Sun et al.
[2007]) durch die Messung validiert werden.
Tabelle 3.8: Expressionswerte einzelner Gene nach ESR1 Silencing
Gen Symbol
STC2
XBP1
ESR1
HSPB8
p-Wert
6.11 × 10−8
4.66 × 10−6
2.92 × 10−6
6.25 × 10−2
FC
0.262
0.389
0.370
0.631
Legende: FC = fold change
3.8.6 Expressionsprofil ESR1/CCNG2 Silencing
Durch die kombinatorische post-transkriptionelle Genstilllegung von ESR1 und
CCNG2 wurden insgesamt 20 Gene signifikant in ihrer Expression verändert.
61
3 Ergebnisse
Dazu zählten STC2 (p-Wert = 2.79 × 10−2 , FC = 0.443) sowie XBP1 (pWert = 4.18 × 10−2 , FC = 0.53). Die gemessenen Daten entsprechen den in
Abschnitt 3.8.5 dargestellten Literaturdaten. Bei einem Vergleich des Expressionsprofils nach kombinatorischem Silencing mit dem Expressionsprofil nach
ESR1 -Silencing wurden zehn Gene ermittelt, die in beiden Experimenten den
gleichen Effekt zeigten. Ein Vergleich des Expressionsprofils mit dem Expressionsprofil des CCNG2 -Silencing ergab eine Schnittmenge von sechs Genen.
Zur Visualisierung und für spätere Auswertungen sind diese Ergebnisse unter
Abschnitt 3.11.1 näher besprochen.
3.8.7 Expressionsprofil ESR1/MAPK1 Silencing
Unter den 3037 signifikant regulierten Genen in Folge des kombinatorischen
Silencings der Gene ESR1 und MAPK1 befanden sich die in Tabelle 3.9 aufgelisteten Gene. Ein Vergleich der signifikant differentiell regulierten Gene des
Tabelle 3.9: Expressionswerte
einzelner
ESR1 /MAPK1 Silencing
Gen Symbol
XBP1
STC2
HSPB8
CCNG2
ESR1
Gene
p-Wert
5.40 × 10−9
5.40 × 10−9
1.03 × 10−7
4.54 × 10−6
9.21 × 10−4
nach
kombinatorischem
FC
0.514
0.509
0.577
1.438
0.798
Legende: FC = fold change
kombinatorischen Silencings von ESR1 und MAPK1 mit dem Expressionsprofil
des ESR1 Silencings ergab eine gemeinsame Schnittmenge von 155 Genen, wohingegen der Vergleich des kombinatorischen Silencings mit der Stilllegung von
MAPK1 lediglich ein gemeinsam signifikant reguliertes Gen ergab. Eine weitere
Darstellung erfolgte im Rahmen der Epistaseanalyse (s. Abschnitt 3.11.2).
3.8.8 Expressionsprofil FOXA1 Silencing
Tabelle 3.10 zeigt die Änderungen der Expressionen der ausgewählten Gene nach
Silencing des Gens FOXA1. Durch das Silencing des „Forkhead Box1“ Gens
62
3.8 Expressionsanalysen nach Genstilllegung
FOXA1 wird die Fähigkeit des ERα zur Assoziation mit Chromatin unterbunden und somit die 17β-Estradiol induzierte Genexpression unterdrückt (Carroll
et al. [2005]). Das Silencing von FOXA1 führt demnach zu einem ähnlichen
Expressionsprofil wie des Silencing des ERα selbst.
Tabelle 3.10: Expressionswerte einzelner Gene FOXA1 Silencing
Gen Symbol
XBP1
STC2
FOXA1
ESR1
p-Wert
1.71 × 10−5
2.00 × 10−4
5.94 × 10−4
3.23 × 10−2
FC
0.175
0.262
0.393
0.606
Legende: FC = fold change
3.8.9 Expressionsprofil HSPB8 Silencing
Das Silencing von HSPB8 wies keine signifikante Veränderung im Expressionsverhalten der auf dem verwendeten cDNA Microarray vorhandenen Gene auf.
Die qRT-PCR Messungen (s. Abschnitt 3.5.7) zur relativen Quantifizierung der
mRNA Konzentration des Gens HSPB8 zeigte jedoch eine Reduktion der mRNA
von 82 - 87 %. Die Verwendung der Messdaten der globalen Expressionsanalyse
können dennoch für weitere Analysen verwendet werden, da die Rekonstruktion
der Gen-Interaktionsnetzwerke nicht die Signifikanz der Expressionsänderung
als Auswahlkriterium zu grunde legt (Fröhlich et al. [2007, 2008]).
3.8.10 Expressionsprofil MAPK1 Silencing
Durch die post-transkriptionelle Stilllegung von MAPK1 wurde lediglich das
Gen STC2 signifikant dereguliert (p-Wert = 4.59 × 10−2 , FC = 0.486).
Die Verteilung der p-Werte aller Gene innerhalb dieses Experiments entsprach jedoch den Anforderungen von Fröhlich et al. zur Inferenz von GenInteraktionsnetzwerken aus Microarray Experimenten (Fröhlich et al. [2007,
2008]). Die Verringerung der relativen mRNA Konzentration konnte durch die
Expressionsanalyse nicht gemessen werden, jedoch wurden durch die qRT-PCR
Analyse aus 3.5.8 eine Reduktion der mRNA von 54 - 83 % ermittelt.
63
3 Ergebnisse
3.8.11 Expressionsprofil MAPK1/STAT5B Silencing
Die statistische Analyse der Microarraydaten nach kombinatorischem Silencing von MAPK1 und STAT5B ergab 36 signifikant differentiell regulierte Gene, darunter MAPK1 (p-Wert = 6.97 × 10−3 , FC = 0.712) und STC2
(p-Wert = 5.87 × 10−3 , FC = 0.579). Zusätzlich wurde das zum MapkSignaltransduktionsweg gehörende Gen RAC1 als signifikant überexprimiert (pWert = 6.97 × 10−3 , FC = 1.481) ermittelt. Ein Vergleich des kombinatorischen
Silencings von MAPK1 und STAT5B mit den korrespondierenden Einzelgenstilllegungen ergab eine gemeinsam Schnittmenge von einem Gen im Fall von
MAPK1 und 16 Genen bei Silencing des Gens STAT5B.
3.8.12 Expressionsprofil STAT5B Silencing
Das Silencing von STAT5B ergab insgesamt 113 signifikant differentiell exprimierte Gene, wobei die Gene STC2 (p-Wert = 7.37 × 10−5 , FC = 0.586) und
XBP1 (p-Wert = 7.28 × 10−3 , FC = 0.753) aus der Liste der ausgesuchten Gene
für die post-transkriptionelle Genstilllegung ebenfalls als differentiell reguliert
gefunden wurden. Die Schnittmenge des Expressionsprofils mit dem Expressionsprofil des kombinatorischen Silencings von MAPK1 und STAT5B wurde
bereits in Abschnitt 3.8.11 erläutert.
3.8.13 Expressionsprofil STC2 Silencing
Insgesamt wurden durch das Silencing von STC2 sechs Gene signifikant dereguliert. Die Reduktion der relativen mRNA Konzentration von STC2, wie sie
bereits durch die qRT-PCR Analyse (s. Abschnitt 3.5.10) gezeigt wurde, konnte
durch die globale Expressionsanalyse durch Verwendung von cDNA Microarrays
bestätigt werden (p-Wert = 2.32 × 10−2 , FC = 0.442).
3.8.14 Expressionsprofil TMEM45B Silencing
Die post-transkriptionelle Stilllegung von TMEM45B ergab insgesamt fünf signifikant deregulierte Gene. Das Silencing von TMEM45B selbst konnte nur
durch die qRT-PCR Messungen aus Abschnitt 3.5.11, nicht jedoch durch die
64
3.9 Netzwerkrekonstruktion aus den Literaturdaten
cDNA Microarray Analyse, als signifikant reguliert bestätigt werden. Durch die
Microarray Analyse stellte sich das Gen zwar als repremiert dar, jedoch mit
einem nicht signifikanten p-Wert = 7.22 × 10−2 .
3.8.15 Expressionsprofil TP53 Silencing
Das Silencing von TP53 konnte durch die cDNA Microarray Analyse nicht gemessen werden. Durch Qualitätskontrolle der zur Chipproduktion verwendeten
cDNA wurde festgestellt, dass die cDNA des verwendeten Klons für TP53 lediglich in unzureichender Qualität vorhanden war, was das Fehlen einer signifikanten Deregulation dieses Gens erklärt. Insgesamt zeigten zwei Gene ein signifikant verändertes Expressionsverhalten nach post-transkriptioneller Genstilllegung von TP53. Die Verringerung der relativen mRNA Konzentration von TP53
konnte durch die qRT-PCR Analyse nachgewiesen werden (s. Abschnitt 3.5.12).
3.8.16 Expressionsprofil XBP1 Silencing
Die statistische Analyse der Microarray Daten nach post-transkriptioneller Genstillegung von XBP1 ergab zwei signifikant regulierte Gene, darunter das Gen
XBP1 (p-Wert = 7.27 × 10−4 , FC = 0.349). Dieses Messergebnis steht im Einklang mit den in Abschnitt 3.5.13 erhaltenen Messergebnissen der qRT-PCR
nach erfolgter Genstilllegung.
3.9 Netzwerkrekonstruktion aus den
Literaturdaten
Abb. 3.10 zeigt die bisher in der Literaturdatenbank Ingenuity Pathway Analysis (Ingenuity Systems® , http://www.ingenuity.com) bekannten Interaktionen
zwischen den 13, zur post-transkriptionellen Genstilllegung ausgewählten Genen. Zur Rekonstruktion dieses Netzwerks wurden ausschließlich die direkten
Interaktionen der Gene verwendet. Diese Interaktionen beinhalten Aktivierung,
Expression, Phosphorylierung, Protein-DNA Interaktion, Protein-Protein Interaktion und Transkription. Grau hinterlegte Knoten entsprechen den zur Rekonstruktion vorgegebenen Genen, transparente Knoten den durch das Programm
65
3 Ergebnisse
Abbildung 3.10: Literaturnetzwerk der ausgewählten Gene. Nur direkte Interaktionen wurden gewählt. Aus: Ingenuity: IPA 6.3 - 1402 Build: 54960
66
3.10 Netzwerkrekonstruktion aus den genomweiten Expressionsanalysen
hinzugefügten Genen. Die Rekonstruktion von literaturbekannten Interaktionen
zwischen einzelnen Genen mit Hilfe des Ingenuity Pathway Analysis Systems
stellt kein vollständiges Bild aller literaturbekannten Interaktionen dar. Als Basis für Ingenuity dient eine manuell kurierte Literaturdatenbank, welche einen
Großteil der PubMed gelisteten Literatur enthält. In Abb. 3.10 ist eindeutig
die sehr zentrale Stellung der Gene ESR1 und TP53, sowie die enge Verknüpfung des ESR1 zu den in dieser Arbeit ausgewählten Genen zu erkennen. Die
Darstellung der literaturbekannten Interaktionen dient im Weiteren zur Validierung der konstruierten Netzwerkhypothese durch den „Nested Effects Model“
Algorithmus (Fröhlich et al. [2007, 2008]).
3.10 Netzwerkrekonstruktion aus den
genomweiten Expressionsanalysen
Die Rekonstruktion der Gen-Gen Interaktionsnetze erfolgte durch den „Nested
Effects Model“ Network Algorithm (s. Abschnitt 2.18) basierend auf den Veröffentlichungen von Fröhlich et al. [2007, 2008]. Für die Rekonstruktion wurden
aus den einzelnen globalen Expressionsanalysen jeweils die ersten 100 Gene der
statistischen Auswertung mit limma verwendet. Die Signifikanz der veränderten
Genexpression war für die Rekonstruktion der Interaktionen durch den NEMAlgorithmus nicht von Relevanz. Durch die Verwendung der gleichen Anzahl
deregulierter Gene für jedes Experiment wird eine Verzerrung der folgenden
statistischen Auswertung in Bezug auf Experimente mit vielen signifikant deregulierten Genen vermieden. Abb. 3.11 zeigt die grafische Visualisierung des
Gen-Interaktionsnetzwerks durch Berechnung der indirekten Effekte nach dem
Prinzip des „Nested Effects Model“ Network Algorithmus. Die Kanten zwischen
den einzelnen Knoten im Netzwerk sind anhand der Pfeilsymbole gerichtet, geben jedoch keine Auskunft über die Art der Interaktion (Expression, Transkription, Protein-Protein, Protein-DNA) oder den Effekt der Interaktion (aktivierend
oder inaktivierend). Durch Doppelpfeile miteinander verbundene Knoten sind
durch den Algorithmus nicht zu unterscheiden und demnach gleichwertig positioniert. Dabei ist deutlich zu erkennen, dass der Estrogenrezeptor ESR1 nicht,
wie in Abb. 3.1 beschrieben, als Eintrittspunkt für die estrogenabhängige Signaltransduktionskaskade dient. Vielmehr scheinen die Gene AKT2, CCNG2 und
XBP1 aufgrund der statistischen Analysen der Expressionsprofile nach post-
67
3 Ergebnisse
transkriptioneller Genstilllegung oberhalb des Estrogenrezeptors zu liegen und
damit einen direkten oder indirekten Einfluss auf dessen Aktivität zu besitzen.
3.11 Epistaseanalyse der kombinierten Silencing
Experimente
In der klassischen Epistaseanalyse wird ein Doppeldeletionsstrang des zu untersuchenden Organismus hergestellt und der auftretende Phänotyp dieser Doppeldeletion mit den beiden Phänotypen der korrespondierenden Einzeldeletionen
verglichen. Der synthetische Effekt definiert die epistatische Mutation (Avery
and Wasserman [1992]). Ein genomweites Expressionsprofil kann dabei weniger objektive Phänotypen, wie z. B. die Morphologie, zur Erkennung epistatischer Verbindungen ersetzen. Vergleicht man die globalen Expressionsprofile
einer kombinatorischen Behandlung von Zelllinien mit zwei siRNAs mit den globalen Expressionsprofilen der korrespondierenden Einzelbehandlungen, so kann
ein zuvor vorhergesagtes Gen-Gen Interaktionsnetzwerk durch die Betrachtung
der epistatischen Verknüpfungen validiert werden (Van Driessche et al. [2005]).
Zeigen in einem linearen Signaltransduktionsweg zwei separate Deletionen (in
diesem Fall post-transkriptionelle Genstilllegungen) zwei unterschiedliche Phänotypen, und der Phänotyp der Doppeldeletion ist einem dieser Phänotypen
ähnlicher, so ist der Phänotyp dieser Einzeldeletion epistatisch (Avery and Wasserman [1992], Zupan et al. [2003]).
Die Abbildungen 3.12 - 3.14 zeigen die Expressionsprofile der Epistaseanalyse
von drei kombinatorischen post-transkriptionellen Genstilllegungen mit den Expressionsprofilen der korrespondierenden Einzelbehandlungen grafisch in Form
von hierarchischen Clusteranalysen. Bei den Clusteranalysen wurden alle Gene,
die in mindestens einem der beiden Einzelsilencing Experimente eine signifikante Expressionsänderung gezeigt haben, verwendet. Die Werte der jeweiligen
Gene aus den korrespondierenden Experimenten wurden sukzessive zur Analyse hinzugefügt. Neben den hierarchischen Clusteranalysen wurden die Wahrscheinlichkeiten der Epistase durch zwei unterschiedliche Methoden berechnet
und neben den Clusteranalysen in Form von Dendrogrammen dargestellt. Für
diese statistischen Analysen wurde das Paket pvclust (Suzuki and Shimodaira
[2006]) in der Statistikumgebung R verwendet. Dabei entspricht die Höhe des
Dendrogramms der euklidischen Distanz der beiden Cluster. Die Werte für „au“
68
3.11 Epistaseanalyse der kombinierten Silencing Experimente
CCNG2
AKT2
XBP1
ESR1
BCL2
TMEM45B
STAT5B
STC2
FOXA1
AKT1
MAPK1
HSPB8
TP53
Abbildung 3.11: Inferriertes Netzwerk anhand des p-Wert Profils
69
3 Ergebnisse
1.74
Cluster dendrogram with AU/BP values (%)
1.35
14
au bp
edge #
12
0.58
8
−0.58
Height
−0.19
9
10
11
0.19
CCNG2
13
0.97
7
ESR1
−1.35
ESR1_CCNG2
CCNG2
ESR1
−1.74
(a) hierarchische Clusteranalyse der Epistaseanalyse
ESR1_CCNG2
100 100
1
−0.97
(b) Dendrogramm der Epistaseanalyse
Distance: euclidean
Cluster method: complete
Abbildung 3.12: Epistaseanalyse der post-transkriptionellen Genstilllegung von
ESR1 und CCNG2
(approximated unbiased probability sowie „bp“ (bootstrap probability) stellen
zwei Wahrscheinlichkeitsmaße dafür dar, dass die Gene, entsprechend den jeweiligen Abbildung, zusammen clustern (s. Abb. 3.12 - 3.14).
3.11.1 Epistaseanalyse von ESR1 und CCNG2
Abb. 3.12 zeigt die Epistaseanalyse des kombinatorischen Silencings von ESR1
und CCNG2, sowie der Einzelsilencings von ESR1 und CCNG2. Die hierarchische Clusteranalyse (Abb. 3.12 (a)) ergab eine deutliche Ähnlichkeit des globalen Expressionsprofils des Silencings von ESR1 und dem Expressionsprofil der
kombinatorischen Behandlung. Das Expressionsprofil von CCNG2 wies hingegen eine geringere Übereinstimmung mit dem Expressionsprofil des kombinatorischen Silencings auf. Die Wahrscheinlichkeitsmaße für die Bildung des Clusters
wie in der Abbildung dargestellt betrug 1 (Abb. 3.12 (b)), demnach ist ESR1
epistatisch auf CCNG2. Weiterhin ist in der Clusteranalyse zu erkennen, dass
Gene, die aufgrund des Silencings von CCNG2 repremiert wurden, im Falle des
Silencings von ESR1 aktiviert wurden. Gleiches galt für den umgekehrten Fall.
Daraus lässt sich ableiten, dass das Gen CCNG2 im Signaltransduktionsweg
oberhalb von ESR1 liegen muss.
70
3.11 Epistaseanalyse der kombinierten Silencing Experimente
Cluster dendrogram with AU/BP values (%)
13
1.74
au bp
edge #
0.97
ESR1
12
1.35
11
0.58
Height
−0.58
9
−0.19
10
0.19
−0.97
8
100 100
1
ESR1_MAPK1
MAPK1
ESR1
−1.74
(a) hierarchische Clusteranalyse der Epistaseanalyse
ESR1_MAPK1
MAPK1
−1.35
(b) Dendrogramm der Epistaseanalyse
Distance: euclidean
Cluster method: complete
Abbildung 3.13: Epistaseanalyse der post-transkriptionellen Genstilllegung von
ESR1 und MAPK1
3.11.2 Epistaseanalyse von ESR1 und MAPK1
Die Epistaseanalyse der Einzelsilencingexperimente der Gene ESR1 und
MAPK1, sowie dem korrespondierenden kombinatorischen Silencing ist in
Abb. 3.13 in Form einer hierarchischen Clusteranalyse dargestellt. Aus
Abb. 3.13 (a) ist deutlich zu erkennen, dass das Expressionsprofil der posttranskriptionellen Genstilllegung von MAPK1 dem Profil des kombinatorischen
Silencings ähnlicher ist, als das Expressionsprofil des ESR1 Silencings. Daraus
folgt, mit einem Wahrscheinlichkeitsmaß von 1 (Abb. 3.13 (b)), dass MAPK1
epistatisch auf ESR1 ist. In diesem Fall wurden Gene, die in Folge des Silencings
von ESR1 repremiert wurden, bei der post-transkriptionellen Genstilllegung von
MAPK1 aktiviert. Demnach wirkt ESR1 aktivierend auf MAPK1 und liegt daher oberhalb von MAPK1.
3.11.3 Epistaseanalyse von MAPK1 und STAT5B
Abb. 3.14 (a) zeigt die hierarchische Clusteranalyse zwischen den Silencingexperimenten der Gene MAPK1 und STAT5B, sowie der korrespondierenden
kombinatorischen Genstilllegung. Das Expressionsprofil des MAPK1 Silencings
entspricht dabei mehr dem Profil des kombinatorischen Silencings, woraus folgt,
71
3 Ergebnisse
Cluster dendrogram with AU/BP values (%)
2.35
1.74
2.30
0.97
MAPK1_STAT5B
STAT5B
MAPK1
−1.74
(a) hierarchische Clusteranalyse der Epistaseanalyse
MAPK1_STAT5B
−1.35
75 63
1
MAPK1
−0.97
Height
−0.58
2.15
−0.19
2.10
0.19
2.20
2.25
0.58
au bp
edge #
STAT5B
1.35
(b) Dendrogramm der Epistaseanalyse
Distance: euclidean
Cluster method: complete
Abbildung 3.14: Epistaseanalyse der post-transkriptionellen Genstilllegung von
MAPK1 und STAT5B
dass MAPK1 epistatisch auf STAT5B ist. Gene, die aufgrund des Silencings
von MAPK1 aktiviert werden, werden beim Silencing von STAT5B repremiert.
Demnach wirkt STAT5B inhibierend auf MAPK1. STAT5B liegt daher oberhalb
von MAPK1. Die Wahrscheinlichkeitsmaße des Clusters liegen, in Abhängigkeit
von der verwendeten Methode, bei 0.63 (bootstrap probability) bzw. 0.75 (approximated unbiased probability) (s. Abb. 3.14 (b)).
3.12 Genomweite Expressionsanalysen der
Behandlung mit endokrinen Substanzen
Neben den globalen Expressionsanalysen nach gezielter post-transkriptioneller
Genstilllegung von einzelnen Genen, oder nach kombinatorischem Silencing
von zwei Genen, wurden ebenfalls genomweite Expressionsanalysen nach Behandlung der Zellen mit endokrinen Substanzen durchgeführt. Dabei erfolgte
die Behandlung der Zellen mit 17β-Estradiol bzw. Tamoxifen anhand der in
Abschnitt 2.10 und 2.11 beschriebenen Vorschrift. Die Auswertung der cDNA
Microarrays erfolgte, analog zu den bereits erläuterten Expressionsanalysen, mit
Hilfe der Statistikumgebung R (vsn und limma, Huber et al. [2002], Smyth
[2004]).
72
3.12 Expressionsanalysen der Behandlung mit endokrinen Substanzen
Tabelle 3.11: Signifikant veränderte Expressionswerte nach 17β-Estradiol Behandlung
Gen Symbol
CCNG2
XBP1
HSPB8
p-Wert
1.77 × 10−3
4.76 × 10−3
1.30 × 10−2
FC
0.546
2.332
1.426
Legende: FC = fold change
3.12.1 Expressionsanalyse der 17β-Estradiol Behandlung
Durch die dreistündige Inkubation der MCF-7 Zellen mit 10 nM 17β-Estradiol
reagierten insgesamt 117 Gene mit einer signifikanten Änderung (p − W ert ≤
0.05) in ihrem Expressionsverhalten. Tabelle 3.11 zeigt die Expressionswerte
der zum Silencing ausgewählten Gene aus Abschnitt 3.1. Die Reduktion der
Expression von CCNG2 aufgrund der Behandlung mit 17β-Estradiol spiegelt die
in der Literatur bekannten Daten wider (Stossi et al. [2006]). Die Aktivierung
der Expression von XBP1 und HSPB8 durch eine gesteigerte Aktivierung des
ERα in Folge der Bindung von 17β-Estradiol wurde bereits in der Literatur
(Lacroix and Leclercq [2004], Sun et al. [2007], West et al. [2001]) ausführlich
beschrieben. Ein Vergleich der Expressionsprofile zwischen der Stimulation des
ERα mit 17β-Estradiol und der Inhibition des ERα durch Tamoxifen, bzw.
Silencing durch siRNA ist in den Abschnitten 3.13.2 und 3.13.3 erläutert.
3.12.2 Expressionsanalyse der Tamoxifen Behandlung
Die Behandlung der MCF-7 Zellen mit Tamoxifen anhand der in Abschnitt 2.11
beschriebenen Methode ergab bei 2937 Genen eine signifikante Veränderung
(p − W ert ≤ 0.05) der relativen mRNA Konzentration. Unter den signifikant
regulierten Genen befinden sich auch die in Tabelle 3.12 aufgeführten Gene. Das
Expressionsprofil der Tamoxifen Behandlung deckt sich in einem großen Bereich
mit dem Expressionsprofil der post-transkriptionellen Genstilllegung von ESR1
(s. Abschnitt 3.8.5 und 3.13.1). Das Profil der globalen Expressionsanalyse nach
einer Behandlung mit Tamoxifen wurde in den Abschnitten 3.13.1 und 3.13.2
mittels hierarchischer Clusteranalyse mit den Expressiosprofilen der Microarrayanalysen des ESR1 Silencings und nach ESR1 -Stimulation durch 17β-Estradiol
verglichen.
73
3 Ergebnisse
Tabelle 3.12: Signifikant veränderte Expressionswerte nach Tamoxifen Behandlung
Gen Symbol
CCNG2
XBP1
MAPK1
STC2
p-Wert
9.46 × 10−3
1.70 × 10−2
2.59 × 10−2
3.00 × 10−2
FC
1.471
0.675
0.844
1.158
Legende: FC = fold change
3.13 Vergleich der Expressionsanalysen durch
hierarchische Clusteranalysen
Ein Vergleich von globlen Expressionsprofilen kann mit Hilfe der hierarchischen
Clusteranalyse nach Eisen et al. visualisiert werden (Eisen et al. [1998]). Dabei
werden unter Verwendung von statistischen Algorithmen die Gene innerhalb von
globalen Expressionsprofilen anhand der Ähnlichkeit ihrer Expression angeordnet und in einem Dendrogramm grafisch dargestellt. Innerhalb eines Vergleichs
zwischen verschiedenen gloablen Expressionsanalysen werden stets die Gene in
der hierarchischen Clusteranalyse dargestellt, die in beiden Experimenten ein
signifikant verändertes Expressionsverhalten zeigen. Abb. 3.15 zeigt die hierarchische Clusteranalyse zwischen allen drei im Folgenden aufgeführten Experimenten. Zur Berechnungn dieser Clusteranalyse wurden alle Gene verwendet,
die in mindestens zwei der u. a. Experimenten signifikant differentiell exprimiert
waren. Die separate grafische Darstellung der hierarchischen Clusteranalysen der
nachfolgenden Vergleiche sind im Anhang Abb. A.18, Abb. A.19 und Abb. A.20
zu finden.
3.13.1 Vergleich ERα Silencing und Tamoxifen Behandlung
Die Behandlung von Patientinnen mit ER-positiven Mammakarzinomen sieht
in der Regel eine bis zu fünf Jahre dauernde adjuvante Therapie mit dem SERM
Tamoxifen vor. Durch den Einsatz von Tamoxifen wird versucht, die Bindung
des 17β-Estradiol an den ERα zu verhindern und damit die Signaltransduktionskaskaden der Proliferation und Migration zu unterbinden. Zumeist gelingt
die Inaktivierung des Estrogenrezeptor Signals durch diese Behandlung, jedoch
74
3.13 Hierarchische Clusteranalysen
stellt der Estrogenrezeptor Signalweg ein sehr komplexes und verzweigtes, regulatorisches System dar. Um die Unterschiede zwischen einer vollständigen
Inaktivierung des ERα durch gezieltes Silencing und einer Inhibition durch Tamoxifen darzustellen, wurden die globalen Expressionsanalysen dieser beiden
Experimente miteinander verglichen. Insgesamt wurden 45 Gene ermittelt, die
in beiden Experimenten eine signifikante Änderung in ihrer Expression zeigten.
Innerhalb dieser 45 Gene zeigten jedoch 13 Gene eine gegenläufige Expressi-
Tabelle 3.13: Gegenläufig exprimierte Gene nach ESR1 Silencing und Tamoxifen
Behandlung
Gen Symbol
STC2
HIST1H2BD
FHL2
KPNA2
SEMA3C
DEK
ABAT
AGR2
SNX24
MGC21644
GDAP1
TGFB2
TXNRD1
p-Wert (ESR1 )
6.11 × 10−8
1.77 × 10−4
5.89 × 10−4
6.39 × 10−4
4.11 × 10−3
4.99 × 10−3
6.71 × 10−3
8.04 × 10−3
9.44 × 10−3
2.49 × 10−2
3.49 × 10−2
3.98 × 10−2
4.60 × 10−2
FC (ESR1 )
0.262
2.343
0.534
0.527
0.589
0.617
0.599
0.638
0.654
0.651
0.690
0.699
0.701
p-Wert (TAM)
3.00 × 10−2
3.63 × 10−2
2.10 × 10−2
4.14 × 10−2
2.22 × 10−2
2.22 × 10−2
2.43 × 10−2
3.54 × 10−2
1.10 × 10−2
2.24 × 10−2
4.51 × 10−2
1.25 × 10−2
2.22 × 10−2
FC (TAM)
1.158
0.885
1.388
1.121
1.178
1.227
1.162
1.304
1.384
1.204
1.171
1.477
1.192
Legende: FC = fold change, ESR1 = Silencing ESR1, TAM = Tamoxifen.
on in beiden Experimenten (Tabelle 3.13). Bei 12 dieser gegenläufig regulierten
Gene kam es im Fall der Tamoxifen Behandlung zu keiner Reduktion in der
Expression, jedoch im Fall des ESR1 Silencings. Die vergleichende Darstellung
der beiden Expressionsprofile ist in Form einer hierarchischen Clusteranalyse
(Eisen et al. [1998]) in Abb. A.18 aufgeführt. Abb. A.18 und Abb. 3.15 zeigen
deutlich die Abspaltung der 13 gegenläufig exprimierten Gene innerhalb der
hierarchischen Clusteranalyse.
75
3 Ergebnisse
3.13.2 Vergleich Estrogenrezeptorstimulation mit
17β-Estradiol und Tamoxifen Behandlung
Abb. A.19 zeigt die hierarchische Clusteranalyse der Expressionsprofile nach
dreistündiger 17β-Estradiol Stimulation (s. Abschnitt 3.7.1) und der Behandlung mit dem SERM Tamoxifen (s. Abschnitt 3.7.2). Vergleichend zeigen 38
Gene eine signifikante Expressionsänderung in beiden Experimenten. Aus der
hierarchischen Clusteranalyse ist jedoch eindeutig ersichtlich, dass ein Teil der signifikant veränderten Gene im gleichen Maße von 17β-Estradiol und Tamoxifen
beeinflusst wurden. Tabelle 3.14 zeigt die Liste dieser 15 Gene. Die nicht erfolgte Repression einzelner Gene, deren Expression vom Estrogenrezeptor abhängig
sind, kann damit erklärt werden, dass Tamoxifen lediglich den Bereich des ERα
blockiert, der mit der Aktivierungsfunktion 2 (AF-2) interagiert und somit nicht
die ligandenunabhängige transkriptionelle Aktivität über die Aktivierungsfunktion 1 (AF-1) des ERα beeinflusst (Robertson [2002]). Von besonderem Interesse
ist in diesem Fall das Gen FHL2, welches für einen induzierbaren Koaktivator
des AP-1 (Jun) codiert (Morlon and Sassone-Corsi [2003]). Die Expression dieses
Gens wurde durch die Behandlung von Tamoxifen nicht repremiert, jedoch durch
die post-transkriptionelle Genstilllegung des ERα (s. Tabelle 3.13). Gleichzeitig
war eine Aktivierung der Expression durch die Stimulation mit 17β-Estradiol
zu verzeichnen (s. Tabelle 3.14).
3.13.3 Vergleich Estrogenrezeptorstimulation mit
17β-Estradiol und ERα Silencing
Abb. A.20 zeigt die hierarchische Clusteranalyse der Experimente für das Silencing des ERα durch RNA Interferenz und der Stimulation des ERα durch
Applikation von 17β-Estradiol. Die klar gegensätzlichen regulatorischen Effekte in Folge der jeweiligen Experimente sind deutlich aus der Clusteranalyse
ersichtlich. Dabei zeigte das Gen TGFB2 in beiden Experimenten eine verringerte Expression. TGFB2 codiert für den „transforming growth factor, beta 2“
und stellt einen molekularen Biomarker für die antiproliferativen Effekte von
Tamoxifen und dessen Derivaten dar (Buck et al. [2008]). Die Expression von
TGFB2 wird durch den Einfluss von Tamoxifen erhöht, jedoch nicht durch ein
Silencing des ERα bzw. die Stimulation des ERα mit 17β-Estradiol beeinflusst
(s. Abschnitt 3.13.1 und 3.13.2).
76
3.14 Connectivity Map Vergleich
Tabelle 3.14: Gleichartig regulierte Gene nach ESR1 -Stimulation und Tamoxifen
Behandlung
Gen Symbol
FHL2
MXD1
C12orf41
SLC25A25
ULK1
SNX24
RHOBTB1
KIAA0182
ITGA6
DLG5
SH3BP5
EXOC2
SBDS
FOSL2
ZNF185
p-Wert (E2)
1.40 × 10−3
4.76 × 10−3
4.95 × 10−3
4.95 × 10−3
1.65 × 10−2
1.68 × 10−2
1.68 × 10−2
2.13 × 10−2
2.39 × 10−2
2.60 × 10−2
2.63 × 10−2
2.96 × 10−2
3.05 × 10−2
3.61 × 10−2
4.04 × 10−2
FC (E2)
1.930
1.698
1.455
1.530
1.593
1.419
1.353
1.402
1.324
1.447
1.427
1.334
1.536
1.341
1.338
p-Wert (TAM)
2.10 × 10−2
3.23 × 10−2
2.39 × 10−2
3.19 × 10−2
2.22 × 10−2
1.10 × 10−2
1.15 × 10−2
2.22 × 10−2
2.22 × 10−2
2.22 × 10−2
2.41 × 10−2
2.43 × 10−2
2.22 × 10−2
9.99 × 10−3
4.04 × 10−2
FC (TAM)
1.388
1.331
1.196
1.131
1.293
1.384
1.323
1.236
1.336
1.223
1.181
1.163
1.208
1.423
1.224
Legende: FC = fold change, E2 = 17β-Estradiol, TAM = Tamoxifen.
3.14 Connectivity Map Vergleich
Die in den Abschnitten 3.8.5, 3.12.1 und 3.12.2 aufgeführten genomweiten Expressionsanalysen nach Silencing von ERα, bzw. Behandlung mit den endokrinen Substanzen 17β-Estradiol und Tamoxifen, können durch einen Datenabgleich mit der Connectivity Map Datenbank (http://www.broad.mit.edu/cmap)
validiert werden. Die Connectivity Map Datenbank enthält die Expressionsprofile von ca. 550 Genexpressionsanalysen (Stand: Juni 2008) von in vitro kultivierten humanen Zellen nach Behandlung mit reaktiven Substanzen (Lamb
[2007], Lamb et al. [2006]). Die gemessenen Expressionsprofile aus den posttranskriptionellen Genstilllegungen werden, getrennt nach überexprimierten und
repremierten mRNAs, mit den Expressionsprofilen der einzelnen Behandlungen
mit reaktiven Substanzen statistisch verglichen und durch einen Algorithmus
mit einem Ähnlichkeitswert versehen. Bei einer größtmöglichen Ähnlichkeit des
Expressionsprofils eines Silencing Experimentes mit dem Expressionsprofil eines
Behandlungsexperimentes aus der Datenbank wird ein Ähnlichkeitswert nahe 1
77
3 Ergebnisse
CTSL
CTSH
MB
1.74
SEC14L4
RAC1
SCRN2
DST
NPEPL1
OKL38
AP1S1
JARID1B
TXNIP
PSCD2
BTG1
KYNU
NELL2
HIST1H2BD
FAM107B
TGFB2
CCNG2
RNF43
BAMBI
SGCG
C14orf4
TLE1
ANKRD50
EPHA4
C12orf41
SH3BP5
EXOC2
ZNF185
RHOBTB1
ITGA6
KIAA0182
DLG5
SBDS
DSU
HEY2
NAB2
LRRFIP2
ZNF703
HOP
ULK1
MXD1
SLC25A25
FOSL2
SNX24
FHL2
FKBP4
MYB
KLF4
HSPB8
INCENP
C17orf72
FARP1
GREB1
ABAT
KPNA2
TXNRD1
GDAP1
SEMA3C
AGR2
MGC21644
DEK
SLC7A5
STC2
XBP1
0.97
0.58
0.19
−0.19
−0.58
−0.97
−1.35
−1.74
TAM
ESR1
E2
PRSS23
MOAP1
CXCL12
NPY1R
TRUB1
CALCR
1.35
Abbildung 3.15: Hierarchische Clusteranalyse der genomweiten Expressionsanalysen nach Stimulation des ERα, nach Silencing von ESR1 und Tamoxifen Behandlung
angegeben. Das Experiment mit der größtmöglichen Verschiedenheit wird mit
einem Ähnlichkeitswert nahe -1 versehen. Die Tabellen 3.15 - 3.17 zeigen Ausschnitte aus den Datenabgleichen mit der Connectivity Map Datenbank. Der
angegebene Rang ist dabei ein Maß für die relative Positionierung des jeweiligen Experiments.
Anhand des durch den „Nested Effekts Model“ Algorithmus errechneten Netzwerks, dargestellt in Abb. 3.11 auf Seite 69, wurden die Gene AKT2, CCNG2
sowie XBP1 anhand ihrer Expressionsprofile nach post-transkriptioneller Genstilllegung oberhalb vom Estrogenrezeptor positioniert. Daher wurden für diese
genannten Gene ebenfalls Vergleiche der jeweiligen Expressionsprofile mit der
Connectivity Map Datenbank errechnet. Die Tabellen 3.18 - 3.20 zeigen die
Auflistungen dieser Vergleiche. Durch den Abgleich der gemessenen Expressionsprofile mit den Einträgen der Connectivity Map Datenbank kann eine indirekte
Validierung des errechneten Gen-Interaktionsnetzwerks erfolgen.
78
3.14 Connectivity Map Vergleich
3.14.1 Connectivity Map Vergleich ESR1 Silencing
Tabelle 3.15 zeigt den Vergleich des Expressionsprofils nach posttranskriptoneller Genstilllegung des ERα mit den gespeicherten Expressionsprofilen nach Behandlung mit unterschiedlichen Substanzen aus der
Connectivity Map Datenbank. Das Expressionsprofil des ESR1 Silencing zeigte
die größte Übereinstimmung mit dem Expressionsprofil nach einer Behandlung von MCF-7 Zellen mit 10 nM Wortmannin, einem Inhibitor der PI3K
(Creemer et al. [1996]). Die PI3K ist in die nicht-genomische Aktivität des
Estrogenrezeptors involviert (Björnstrom and Sjöberg [2005]) und vermittelt die
schnellen regulatorischen Einflüsse der Estrogenbindung (s. Abschnitt 1.4.2).
Des weiteren zeigte das Expressionsprofil des ESR1 Silencing eine sehr hohe
Ähnlichkeit zu dem Expressionsprofil nach Behandlung von MCF-7 Zellen mit
dem SERM Fulvestrant (Buzdar [2004], Robertson [2004]). Die geringste Ähnlichkeit, und demnach einen Wert nahe -1, war zwischen dem Expressionsprofil
nach Silencing des Estrogenrezeptors und einer Stimulation mit Estradiol und
Genistein zu verzeichnen. Genistein, einem Sekundärmetabolit aus Pflanzen
(aus Leguminosen, Papilionoiden, Rosaceen etc.), wird eine leicht estrogene
Wirkung zugeschrieben (Hsieh et al. [1998]). Aus den gezeigten Daten ist
eindeutig erkennbar, dass eine post-transkriptionelle Genstilllegung in MCF7
Zellen ein sehr ähnliches Expressionsprofil wie nach einer Behandlung mit
einem spezifischen PI3K Inhibitor, bzw. einem SERM ergibt. Umgekehrt ist das
gemesssene Experssionsprofil maximal unterschiedlich zu einem Expressionsprofil nach Stimulation der MCF-7 Zellen mit dem Steroidhormon Estradiol.
3.14.2 Connectivity Map Vergleich ESR1 Stimulation mit
17β-Estradiol
Der Vergleich des gemessenen Expressionsprofils nach Stimulation des ESR1
mit 17β-Estradiol und der Connectivity Map Datenbank ist in Tabelle 3.16 aufgeführt. Demnach zeigte das Expressionsprofil die größte Übereinstimmung mit
der Behandlung mit 10 nM Estradiol in MCF-7 Zellen aus der Connectivity Datenbank. Des Weiteren wurde eine sehr große Übereinstimmung mit der Behandlung von MCF-7 mit 10 µM Genistein (s. Abschnitt 3.14.1, Hsieh et al. [1998])
und dem Phytoalexin Resveratrol gefunden. Resveratrol gehört zur Gruppe der
79
3 Ergebnisse
Tabelle 3.15: Vergleich des Expressionsprofils nach post-transkriptioneller Genstilllegung von ESR1 mit den Datenbankeinträgen der Connectivity Map
Datenbank.
Rang
2
3
8
9
449
450
451
452
Substanz
Wortmannin
Fulvestrant
Wortmannin
Resveratrol
Dosis
10 nM
1 µM
1 µM
10 µM
Zelllinie
MCF7
MCF7
MCF7
MCF7
score
0.99
0.989
0.941
0.928
Genistein
alpha-Estradiol
Estradiol
Estradiol
10 µM
10 nM
100 nM
10 nM
MCF7
MCF7
MCF7
MCF7
-0.709
-0.719
-0.801
-0.82
Hydroxystilbene, kommt u. a. in Weinreben vor und ist hauptsächlich als ein
durch Pilzinfektionen induzierbarer Abwehrstoff von Bedeutung. Gehm et al.
konnten eine agonistische Interaktion des Estrogenrezeptors mit Resveratrol in
MCF-7 Zellen nachweisen (Gehm et al. [1997]). Der maximale Unterschied zu
dem Expressionsprofil nach Stimulation des ESR1 mit 17β-Estradiol zeigten
die Experimente nach Behandlung mit den beiden SERM Fulvestrant und Tamoxifen (s. Abschnitt 3.16). Dieser Abgleich mit der Connectivity Datenbank
validiert plattformübergreifend das gemessene Expressionsprofil der Stimulation
des ERα mit 17β-Estradiol.
Tabelle 3.16: Vergleich des Expressionsprofils nach Stimulation des ESR1 mit 17βEstradiol mit den Datenbankeinträgen der Connectivity Map Datenbank.
Rang
1
2
4
12
429
451
452
453
80
Substanz
Dosis Zelllinie
Estradiol
10 nM MCF7
Phenanthridinon 51 µM MCF7
Genistein
10 µM MCF7
Resveratrol
50 µM MCF7
score
1
0.882
0.824
0.763
Tamoxifen
Fulvestrant
Fulvestrant
Fulvestrant
-0.459
-0.909
-0.945
-1
1 µM
1 µM
1 µM
10 nM
MCF7
MCF7
MCF7
MCF7
3.14 Connectivity Map Vergleich
3.14.3 Connectivity Map Vergleich ESR1 Inhibition mit
Tamoxifen
Die in Tabelle 3.17 angegebenen Daten zeigen den Vergleich der globalen Expressionsanalyse nach Behandlung der MCF-7 Zellen mit 100 nM Tamoxifen
(s. Abschnitt 2.11) und der Connectivity Map Datenbank. Der größte Ähnlichkeitswert wurde dabei mit den Behandlungen von MCF-7 Zellen mit den Substanzen Vorinostat, Genistein und Fulvestrant errechnet. Die Wirkungsweise
von Genistein und Fulvestrant wurden bereits in Abschnitt 3.14.1 und 3.14.2
beschrieben. Vorinostat, ein Histon-Deacetylase Hemmer, ist zur Behandlung
des cutanen T-Zelllymphoms zugelassen, vermittelt eine Hyperacetylierung der
Histone und damit einen kontrollierten Eintritt von Tumorzellen in die Apoptose
(Xu et al. [2006]). Den kleinsten Ähnlichkeitswert, und demnach die maximale Verschiedenheit der globalen Expressionsanalyse nach Tamoxifenbehandlung
der MCF-7 Zellen, wurde für die Behandlung von MCF-7 Zellen mit Estradiol errechnet (s. Tabelle 3.17). Die Expressionsanalysen, denen die Einträge der
Connectivity Map Datenbank zugrunden liegen, beruhen auf Behandlungen der
Zellen mit den verschiedenen angegebenen Substanzen über einen Zeitraum von
6 Stunden. Die Expressionsanalyse nach Behandlung der MCF7 Zellen mit Tamoxifen in dieser Arbeit wurde nach einem Einwirkungszeitraum von 24 Stunden
erstellt. Daraus ist zu erklären, dass ein Vergleich dieser Expressionsanalyse mit
den Einträgen der Connectivity Map Datenbank keinen direkten Bezug zu einer
Behandlung mit Tamoxifen aufführt. Dennoch entsprach das genomweite Profil
einer gezielten Pertubation des Estrogenrezeptors.
3.14.4 Connectivity Map Vergleich AKT2 Silencing
Tabelle 3.18 listet die Ergebnisse der vergleichenden Analyse des Expressionsprofils nach post-transkriptioneller Genstilllegung von AKT2 und den Expressionsprofilen der Connectivity Map auf. Das Expressionsprofil des AKT2 Silencings zeigte dabei eine sehr hohe Übereinstimmung zu den Expressionsprofilen
nach Behandlung von MCF7 Zellen mit den Selektiven Estrogenrezeptor Modulatoren Fulvestrant (Buzdar [2004], Robertson [2004]) und Tamoxifen (Osborne
and Schiff [2005]), bzw. der Behandlung mit Inhibitoren der Phosphatidylinositol 3-Kinase Wortmannin (Creemer et al. [1996]) und LY-294002 (Vlahos et al.
81
3 Ergebnisse
Tabelle 3.17: Vergleich des Expressionsprofils nach Inhibition des ESR1 mit Tamoxifen mit den Datenbankeinträgen der Connectivity Map Datenbank
Rang
14
15
17
22
408
435
441
452
Substanz
Vorinostat
Genistein
Fulvestrant
Imatinib
Dosis
10 µM
10 µM
1 µM
10 µM
Zelllinie
MCF7
MCF7
MCF7
MCF7
score
0.691
0.688
0.663
0.636
Estradiol
alpha-Estradiol
alpha-Estradiol
alpha-Estradiol
100 nM
10 nM
10 nM
10 nM
MCF7
MCF7
MCF7
MCF7
-0.512
-0.671
-0.688
-0.915
[1994]). Diese Ergebnisse deckten sich mit den in 3.14.1 dargestellten Ergebnissen des Connectivity Map Vergleichs nach Silencing von ESR1. Analog zu dem
Expressionsprofil nach Silencing des Estrogenrezeptors, zeigte das Silencing von
AKT2 eine maximale Verschiedenheit zu den Expressionsprofilen von MCF7
Zellen nach Behandlung mit dem Steroidhormon Estradiol und dem Isoflavon
Genistein aus der Connectivity Map Datenbank (s. Abschnitt 3.14.1).
Tabelle 3.18: Vergleich des Expressionsprofils nach post-transkriptioneller Genstilllegung von AKT2 mit den Datenbankeinträgen der Connectivity Map
Datenbank
Rang
13
15
28
40
407
430
450
453
82
Substanz
Wortmannin
Fulvestrant
LY-294002
Tamoxifen
Dosis
10 nM
10 nM
10 µM
1 µM
Zelllinie
MCF7
MCF7
MCF7
ssMCF7
score
0.824
0.8
0.695
0.505
alpha-Estradiol
Estradiol
Genistein
Estradiol
10 nM
10 nM
10 µM
100 nM
MCF7
ssMCF7
MCF7
MCF7
-0.538
-0.701
-0.957
-1
3.14 Connectivity Map Vergleich
3.14.5 Connectivity Map Vergleich CCNG2 Silencing
Anhand des Expressionsprofils der post-transkriptionellen Genstilllegung von
CCNG2 wurde das Gen durch die statistische Analyse des NEM Algorithmus
oberhalb des Estrogenrezeptors innerhalb des rekonstruierten Netzwerks positioniert (s. Abb. 3.11). Tabelle 3.19 listet den Vergleich des Expressionsprofils mit den Epxressionsprofilen der Connectivity Map Datenbank auf. Dabei
zeigte das Expressionsprofil die größten Übereinstimmungen mit den Expressionsprofilen nach Behandlung von MCF7 Zellen mit Substanzen, die direkt
den Estrogenrezeptor beeinflussen (Resveratrol und Fulvestrant), bzw. Substanzen, die als PI3K-Inhibitoren bekannt sind (LY-294002 und Wortmannin). Die
wenigsten Übereinstimmungen zeigten sich mit den Expressionsprofilen nach
endokriner Stimulation des Estrogenrezeptors mit Estradiol, bzw. Genistein.
Diese Ergebnisse stehen im Einklang mit den Ergebnissen des Connectivity
Map Vergleichs nach post-transkriptioneller Stilllegung des Estrogenrezeptors
(s. Abschnitt 3.14.1).
Tabelle 3.19: Vergleich des Expressionsprofils nach post-transkriptioneller Genstilllegung von CCNG2 mit den Datenbankeinträgen der Connectivity
Map Datenbank
Rang
3
37
38
45
432
440
450
451
Substanz
Dosis
Resveratrol
10 µM
Fulvestrant
1 µM
LY-294002
10 µM
Wortmannin 10 nM
Estradiol
Genistein
Estradiol
Genistein
10 nM
1 µM
10 nM
10 µM
Zelllinie
MCF7
ssMCF7
MCF7
MCF7
score
0.885
0.628
0.628
0.606
MCF7
MCF7
MCF7
MCF7
-0.67
-0.703
-0.857
-0.898
3.14.6 Connectivity Map Vergleich XBP1 Silencing
Der Vergleich des Expressionsprofils nach XBP1 Silencing und den Einträgen
der Connectivity Map Datenbank sind in Tabelle 3.20 dargestellt. Analog zu den
bereits beschriebenen Vergleichen in den Abschnitten 3.14.1, 3.14.3, 3.14.4 und
83
3 Ergebnisse
Tabelle 3.20: Vergleich des Expressionsprofils nach post-transkriptioneller Genstilllegung von XBP1 mit den Datenbankeinträgen der Connectivity Map
Datenbank
Rang
12
38
63
66
396
404
428
436
Substanz
Resveratrol
Fulvestrant
Wortmannin
LY-294002
Dosis
50 µM
1 µM
10 nM
10 µM
Zelllinie
MCF7
MCF7
MCF7
MCF7
score
0.635
0.524
0.482
0.476
Genistein
Estradiol
Estradiol
Genistein
1 µM
MCF7
10 nM ssMCF7
100 nM MCF7
1 µM
MCF7
-0.502
-0.529
-0.663
-0.741
3.14.5 zeigte das Expressionsprofil die größten Ähnlichkeiten mit den Expressionsprofilen nach Behandlungen von MCF7 Zellen mit Inhibitoren des Estrogenrezeptors (Resveratrol und Fulvestrant), bzw. PI3K-Inhibitoren (Wortmannin und LY-294002). In Einklang mit den bereits beschriebenen Vergleichen
(3.14.1, 3.14.3, 3.14.4 und 3.14.5), stellte sich das Expressionsprofil von XBP1
als besonders gering korreliert mit den Expressionsprofilen aus der Connectivity
Map Datenbank nach Behandlungen der Zellen mit direkten Stimulatien des
Estrogenrezeptors (Estradiol und Genistein) dar.
84
4 Diskussion
Nach der Präsentation der gemessenen Daten im vorangegangenen Kapitel soll
das hier folgende Kapitel einen Überblick über die erlangten Ergebnisse, sowie
Diskussionen für Anwendungen in der Zukunft bieten. Dazu erfolgt eine ausführliche Interpretation der Messdaten sowie eine Darlegung und Diskussion
der Zusammenhänge.
4.1 Validierung der konstruierten
Netzwerkhypothese
Durch den „Nested Effects Model“ Algorithmus (Fröhlich et al. [2007, 2008])
wurde anhand einer statistischen Analyse der globalen Expressionsanalysen nach
post-transkriptioneller Genstilllegung von insgesamt 13 Genen das in Abb. 3.11
(Seite 69) dargestellte Gen-Interaktionsnetzwerk rekonstruiert. Die Kanten zwischen den einzelnen Knoten entsprechen dabei direkten, sowie indirekten Verbindungen zwischen den Genen. Die Richtung der Effekte ist durch die Pfeilspitze
angezeigt. Der Effekt der Interaktion (aktivierend oder deaktivierend) kann im
Fall des verwendeten Algorithmus nicht dargestellt werden. Eine Kante zwischen
zwei Knoten stellt keine zwingende Notwendigkeit einer direkten Interaktion
dieser beiden Gene dar. Die Ausgabe der statistischen Analyse durch den NEM
Algorithmus erfolgt in Form eines transitiv reduzierten Graphen mit gerichteten
Kanten. Dabei werden indirekte Kanten zwischen zwei Knoten sukzessive entfernt, sofern die Interaktion zwischen diesen beiden Knoten durch andere Kanten
erklärt werden kann. Schlussendlich erfolgt durch den Netzwerkalgorithmus eine
Einstufung der 13 Gene in Bezug auf ihre relative Lage in diesem gerichteten,
transitiv reduzierten Graph zueinander (anhand der Betrachtung gemessenen
Expressionsprofile). Die Validierung des rekonstruierten Netzwerks kann dabei
85
4 Diskussion
durch einen Abgleich mit literaturbekannten Interaktionen, durch Epistaseanalyse von kombinatorischen Genstilllegungen und durch Vergleich der gemessenen
Expressionsprofile mit Expressionsprofilen der Connectivity Map Datenbank erfolgen.
4.1.1 Vergleich mit literaturbekannten Interaktionen
In Abschnitt 3.9 wurden die in der Literaturdatenbank Ingenuity Pathway Analysis (Ingenuity Systems® , http://www.ingenuity.com) bekannten direkten Interaktionen zwischen den 13 zur post-transkriptionellen Genstilllegung ausgewählten Genen grafisch in Form eines Interaktionsnetzwerks dargestellt. Durch
einen sukzessiven Vergleich des Netzwerks der literaturbekannten Interaktionen
mit dem rekonstruierten Netzwerk können die inferierten Interaktionen, und
damit der NEM Algorithmus, validiert werden. Im Folgenden werden die jeweiligen Interaktionen der Gene im NEM-Netzwerk (Abb. 3.11) durch Vergleich
mit Literaturdaten (Abb. 3.10) erläutert und diskutiert.
Einfluss von XBP1 bzw. CCNG2 auf die Expression von ESR1 Gomez
et al. [2007] haben den Einfluss von XBP1 auf die Expression von ESR1 sowie
die Überexpression in Antiestrogen-resistenten Tumoren beschrieben. Die Expression von XBP1 korreliert mit einem Verlust der Sensitivität der Zellen gegenüber den antiproliferativen Effekten von Antiestrogenen (Gomez et al. [2007].
Zusätzlich ist die Expression von XBP1 in Antiestrogen-resistenten Brustkrebszelllinien erhöht (Gu et al. [2002]), was folgern läßt, dass die Resistenz von
Estrogenrezeptor positiven Mammakarzinomen gegenüber antiestrogener Therapie (z. B. mit Tamoxifen) von der Expression dieses Gens begünstigt wird.
XBP1 aktiviert die ligandenunabhängige Aktivität des Estrogenrezeptors durch
Interaktion mit der Aktivierungs Funktion-1 des ERα (Ding et al. [2003]), welche
durch eine Behandlung mit Tamoxifen nicht blockiert wird. Durch diesen Zusammenhang und aufgrund der Tatsache, dass die Expression von XBP1 einen
direkten Einfluss auf die Expression von ESR1 ausübt, stellt dieses Gen ein bereits neu diskutiertes therapeutisches Ziel, vornehmlich bei der Behandlung von
Antiestrogen-resistenten Mammakarzinomen, dar. Die Relevanz von XBP1 als
mögliches therapeutisches Ziel lässt sich durch die oberhalb von ESR1 liegende
Positionierung des Gens im inferierten Netzwerk bestätigen.
86
4.1 Validierung der konstruierten Netzwerkhypothese
Aufgrund der Ähnlichkeit der Expressionsprofile in Folge des Silencings der Gene CCNG2 und XBP1, sind diese beiden Gene durch die statistische Analyse
mit dem NEM Algorithmus nicht voneinander zu unterscheiden. Daher erfolgt
im vorhergesagten Netzwerk eine Verknüpfung mit einem Doppelpfeil. Die Positionen der beiden Gene sind folglich untereinander austauschbar. Der reprimierende Effekt von ESR1 auf die Expression von CCNG2 wurde bereits von Stossi
et al. [2006] nachgewiesen und konnte im Rahmen dieser Arbeit durch die Stimulation des ESR1 durch 17β-Estradiol experimentell bestätigt werden (s. 3.12.1).
Gleichzeitig konnte bei Inhibition des Estrogenrezeptors durch eine Behandlung
mit Tamoxifen die reprimierende Wirkung von ESR1 auf CCNG2 aufgehoben
werden (s. Abschnitt 3.12.2). Eine Interpretation des inferierten Netzwerks aus
Abb. 3.11 zeigt jedoch deutlich einen Einfluss von CCNG2 auf die Expression von ESR1 anhand der genomweiten Expressionsprofile. Die Auswirkungen
des Silencings von CCNG2 führen zu einer eindeutigen Repression von ESR1.
Anhand der hier aufgezeigten Daten kann demnach ein aktivierender Effekt
der Expression von CCNG2 auf die ESR1 Expression beschrieben werden (s.
Abb. 4.1). Bisher wurde lediglich der inaktivierende Effekt der ESR1 Expression auf die Expression von CCNG2 beschrieben (Stossi et al. [2006]). Der hier
dargestellte neue Effekt der Aktivierung von ESR1 durch die Expression von
CCNG2 überwiegt in den Experimenten dabei den bereits in der Literatur bekannten inaktivierenden Effekt der ESR1 Expression auf die Expression von
CCNG2. Daher erfolgte anhand der statistischen Auswertung eine Positionierung von CCNG2 oberhalb des Estrogenrezeptors.
E2
E2
ER
ER
CCNG2
Abbildung 4.1: Aus den Ergebnissen erstelltes Modell der Aktivierung der ESR1
Expression durch CCNG2. Die Inaktivierung von CCNG2 durch
den aktivierten Estrogenrezeptor (Stossi et al. [2006]) ist ebenfalls
gezeigt.
87
4 Diskussion
Verknüpfung zwischen AKT2 und ESR1 Im inferierten Netzwerk aus
Abb. 3.11 wurde das Gen ESR1 oberhalb von AKT2 positioniert und wird
demnach direkt oder indirekt reguliert. Sun et al. [2001] konnten zeigen, dass
konstitutiv aktiviertes AKT2 die transkriptionelle Aktivität von ESR1 unterstützt. Stoica et al. [2003a] und Campbell et al. [2001] konnten ebenfalls eine
Aktivierung des Estrogenrezeptors durch den PI3K/AKT Signaltransduktionsweg darstellen. Dabei aktiviert AKT2 ausschließlich die estrogenunabhängige
Funktion des Estrogenrezeptors (Aktivierung der AF-2 (s. Abb. 1.5)). Die posttranskriptionelle Genstilllegung von AKT2 führte zur Repression von ESR1 (s.
Tabelle 3.6). Diese bisher in der Literatur dargestellten Zusammenhänge konnten korrekt durch den NEM Algorithmus anhand der globalen Expressionsprofile
rekonstruiert werden.
Interaktion zwischen ESR1 und BCL2 van ’t Veer et al. [2002] und Park
et al. [2002] konnten zeigen, dass die Expression von BCL2 positiv mit der
Expression des Estrogenrezeptors korreliert. Teixeira et al. [1995] postulierten
einen Mechanismus, in dem das estrogenabhängig exprimierte Proto-Onkogen
BCL2 an der Entwicklung von therapeutisch resistenten Mammakarzinomen
beteiligt ist. Durch die statistische Analyse der genomweiten Expressionsanalysen nach post-transkriptioneller Genstilllegung wurde das Gen BCL2 unterhalb
des Estrogenrezeptors positioniert, was im Einklang mit den Daten aus der
Literaturdatenbank Ingenuity steht und damit die vorhergesagte Verknüpfung
bestätigt.
Verknüpfung zwischen BCL2 und TMEM45B Das Gen TMEM45B wurde
in globalen Genexpressionsanalysen von Mammakarzinomen als dereguliert in
Abhängigkeit des Lymphknotenstatus gefunden (Daten nicht gezeigt). In der
Literatur sind jedoch keine Informationen zu den Funktionen dieses Gens beschrieben (Nemeth et al. [2007]). Folglich beinhaltet die Ingenuity Pathway Datenbank keine Einträge zu diesem Gen. Das Interaktionsnetzwerk aus Literaturdaten enthält dieses Gen demnach nicht (s. Abb. 3.10). Die durch den NEM
Algorithmus vorhergesagte Interaktion der Gene BCL2 und TMEM45B kann
hier nur postuliert werden. Die Robustheit und Stabilität des NEM Algorithmus
wurden anhand der korrekten Rekonstruktion der bisher diskutierten Interaktionen sowie auf statistischer Ebene in Fröhlich et al. [2007, 2008] gezeigt. Durch
den Algorithmus vorhergesagte neue Interaktionen (Abb. 3.11), die bisher nicht
88
4.1 Validierung der konstruierten Netzwerkhypothese
durch Literaturdaten belegt wurden, können daher als sehr wahrscheinlich angesehen werden.
Einfluss von BCL2 auf STAT5B Die Kante zwischen den Genen BCL2 und
STAT5B aus den beiden Netzwerken zeigt in entgegengesetzte Richtungen. Nach
den Angaben des Netzwerks aus den Daten der Ingenuity Pathway Datenbank
hat STAT5B einen Einfluss auf die Expression von BCL2 (Kelly et al. [2003]).
Diese Interaktion wurde lediglich in Mäusen beobachtet und kann daher nicht
zur Validierung von Gen-Interaktionen in einem humanen Zellsystem herangezogen werden. Die gezeigte Interaktion stellt jedoch eine, aufgrund der gemessenen
Daten, statistisch stabile Kante dar.
Interaktion von STAT5B mit STC2 Eine direkte Interaktion des Gens
STAT5B mit STC2 kann im Falle des literaturgestützten Netzwerks aus der
Ingenuity Pathway Datenbank nicht bestätigt werden. Vielmehr kann eine Verbindung dieser Gene über zwei intermediäre Gene ARRB2 und HSP90 erklärt
werden. Gleichzeitig steht HSP90 in Interaktion mit dem Estrogenrezeptor (Jiang et al. [2004]). Demnach wird die abwärts von STAT5B liegende Position von
STC2 durch einen Vergleich mit Literaturdaten unterstützt. Eine Erklärung von
vorhergesagten Interaktionen innerhalb des postulierten NEM Netzwerks über
Gene bzw. Proteine, die nicht im Rahmen der Experimente post-transkriptionell
stillgelegt wurden, ist möglich. Die vorhergesagten Interaktionen werden aufgrund der statistischen Analyse der beeinflussten Gene eines jeden einzelnen Silencings vorhergesagt. Daher entspricht eine Kante zwischen zwei Genen nicht
notwendig einer direkten Interaktion dieser beiden Gene. Vielmehr weist ein Expressionsprofil eines weiter oben liegenden Genes im NEM Netzwerk auf einen
Einfluss auf das Expressionsprofil eines weiter abwärts liegenden Genes.
Interaktion von STC2 und FOXA1 Eine direkte Verknüpfung zwischen
STC2 und FOXA1 konnte mit einer Netzwerkrekonstruktion durch Ingenuity nicht dargestellt werden. Aufgrund der oben angegebenen Zusammenhänge
innerhalb des rekonstuierten Netzwerks und den Eigenschaften des NEM Algorithmus kann auch hier die Verknüpfung dieser beiden Gene über zusätzliche
Zwischenpunkte (ST C2 → ARRB2 → HSP 90 → T P 53 → HistonH3 →
F OXA1) anhand von Literaturdaten erklärt werden.
89
4 Diskussion
Verknüpfung von FOXA1 und AKT1 Die Gene FOXA1 und AKT1 sind
im literaturbasierten Netzwerk aus Ingenuity über das Histon H3 miteinander
verknüpft. Jedoch wurde die Interaktion zwischen AKT1 und dem Histon H3
lediglich in Mäusen beschrieben (He et al. [2003]) und kann demnach nicht für
einen Vergleich in humanen Zellsystemen verwendet werden. Auch diese Kante
zwischen den Genen FOXA1 und AKT1 stellt eine statistisch stabile Kante dar.
Interaktion von AKT1 und MAPK1 bzw. TP53 Die Analyse der genomweiten Expressionsdaten durch den NEM Algorithmus sagt eine statistisch stabile Verbindung zwischen den Genen AKT1 und MAPK1 vorher (s.
Abb. 3.11). Dabei liegt AKT1 oberhalb von MAPK1. Beide Gene sind Bestandteil des nicht-genomischen Signaltransduktionswegs des Estrogenrezeptors (s.
Abschnitt 1.4.2) und demnach gemeinsam unterhalb von ESR1 anzusiedeln.
Eine direkte Interaktion dieser beiden Gene konnte durch das literaturbasierte Netzwerk aus Ingenuity nicht dargestellt werden, jedoch kann ein indirekter
Weg über AKT 1 → Hsp90 → P P 2A → M AP K1 beschrieben werden (s.
Abb. 3.10).
Knoten, die durch einen Doppelpfeil im NEM Netzwerk miteinander verbunden sind, können durch den Algorithmus nicht voneinander unterschieden werden und sind daher gleich zu gewichten. Folglich kann bei einem Vergleich
mit dem literaturunterstützen Netzwerk aus Ingenuity eine Interaktion zwischen AKT1 und TP53 über die Kanten AKT 1 → Hsp90 → T P 53 und
AKT 1 → Hsp70 → T P 53 dargestellt werden.
Interaktion von MAPK1 und TP53 bzw. HSPB8 Aufgrund der Bedingungen des NEM Algorithmus sind die Positionen der Gene MAPK1 sowie TP53
nicht voneinander zu unterscheiden und demnach miteinander durch einen
Doppelpfeil verbunden. Daher muss sowohl eine Interaktion zwischen MAPK1
und HSPB8 als auch zwischen TP53 und HSPB8 diskutiert werden.
Das Protein HSPB8 (HSP22) selbst ist nicht im literaturbasierten Netzwerk
aus Ingenuity verzeichnet, befindet sich aber laut einer weiteren Analyse
mit Ingenuity in der Familie der Heatshock-Proteine HSP22/HSP40/HSP90.
HSP90 selbst steht direkt in Verbindung mit TP53, bzw. über das Gen PP2A
indirekt mit MAPK1. Folglich konnten auch in diesem Fall die Kanten, die
durch den NEM Algorithmus verhergesagt wurden, durch Vergleiche mit den
90
4.1 Validierung der konstruierten Netzwerkhypothese
literaturbekannten Interaktionen bestätigt werden.
Neben der Validierung des „Nested Effects Model“ Algorithmus auf theoretischer Ebene durch die Verwendung von Simulationsdaten (Fröhlich et al. [2007,
2008]), konnten durch die oben diskutierten Validierungen die Funktionalität des
Algorithmus bei der Verwendung von biologischen Messdaten bestätigt werden.
Aufgrund der Vorhersage von bereits bekannten Interaktionen bzw. Einflüssen
einzelner Gene untereinander durch die statistische Analyse der aufgezeichneten Daten stellt die ausgearbeitete Methodik ein sehr robustes Werkzeug für die
Rekonstruktion von Gen-Interaktionsnetzwerken dar.
Einige der im rekonstruierten Netzwerk dargestellten Interaktionen konnten
durch einen Vergleich mit den Literaturdaten über intermediäre Gene erklärt
werden. Dies ist auf die transitive Reduktion des rekonstruierten Interaktionsnetzwerks zurückzuführen, bei der alle zusätzlichen Kanten zwischen Genen entfernt werden, sofern die entfernte Kante über direkte Kanten erklärt werden
können.
4.1.2 Validierung durch Epistaseanalysen
Durch spezielle statistische Analysen von genomweiten Expressionsprofilen nach
Microarrayanalysen können, basierend auf die Prinzipien der klassischen Epistaseanalyse (Avery and Wasserman [1992]), Beziehungen zwischen einzelnen
Genen ermittelt (Van Driessche et al. [2005]) und dadurch ein Interaktionsnetzwerk rekonstruiert werden (Zupan et al. [2003]). In dieser Arbeit diente
die Methode der Epistaseanalyse zur Überprüfung der vorhergesagten Kanten
im, durch den NEM Algorithmus rekonstruierten, Gen-Interaktionsnetzwerk (s.
Abb. 3.11). Neben dem Vergleich mit dem durch Ingenuity rekonstruierten Netzwerk, bietet die Epistaseanalyse eine zweite und unabhängige Möglichkeit der
Validierung des vorhergesagten Netzwerks.
In Abschnitt 3.11 sind die Ergebnisse der Epistaseanalyse der kombinatorischen
post-transkriptionellen Genstilllegungen von CCNG2 und ESR1, ESR1 und
MAPK1 sowie MAPK1 und STAT5B aufgeführt. Die Analysen aller drei Experimente ergaben eine eindeutige Übereinstimmung mit der Aussage des rekonstruierten Gen-Interaktionsnetzwerks in Abb. 3.11. Die relative Reihenfolge
der jeweiligen Gene aus den kombinatorischen Genstilllegungen konnte bestätigt
werden. Aus den Ergebnissen ging eindeutig hervor, dass CCNG2 oberhalb von
91
4 Diskussion
ESR1 liegt. Ebenso konnte die Position von MAPK1 unterhalb des Estrogenrezeptors und von STAT5B durch eine Epistaseanalyse der Expressionsprofile der
kombinatorischen Genstilllegungen bestätigt werden (s. 3.11).
Zusätzlich konnte der neu postulierte aktivierende Effekt der Expression von
CCNG2 auf die Expression des Estrogenrezeptor aus 4.1.1 durch die Epistaseanalyse bestätigt werden. Dieser aktivierende Effekt überwiegt den in Stossi
et al. [2006] gezeigten inaktivierenden Einfluss des aktivierten Estrogenrezeptors auf die Expression von CCNG2. Sowohl die Netzwerkrekonstruktion als
auch die Epistaseanalyse ergaben eine Positionierung von CCNG2 oberhalb des
Estrogenrezeptors.
4.2 Validierung der Expressionsprofile durch
Connectivity Map Vergleich
Durch einen Vergleich der gemessenen Expressionsprofile nach selektivem Silencing der 13 in Abschnitt 3.8 aufgeführten Gene mit den Datenbankeinträgen
der Connectivity Map Datenbank (s. Abschnitt 3.14, Lamb [2007], Lamb et al.
[2006]), konnten die experimentell ermittelten Daten plattformübergreifend validiert werden.
Der Vergleich bietet eine sehr potente und einfache Möglichkeit der plattformübergreifenden Validierung von genomweiten Expressionsprofilen. Besonders
geeignet war diese Methode aufgrund der Tatsache, dass der Großteil der unterschiedlichen Experimente in MCF-7 Zellen durchgeführt wurde, was zu einer
sehr guten Vergleichbarkeit zu den hier durchgeführten Experimenten führte.
Dazu wurden die Einträge der Connectivity Map Datenbank verwendet, um
die Expressionsprofile der Stimulation- bzw. Inhibitionsexperimente nach der
Behandlung mit 17β-Estradiol bzw. Tamoxifen qualitativ zu überprüfen. Weiterhin wurden alle Expressionprofile der Gene, die im rekonstruierten NEM
Netzwerk oberhalb des Estrogenrezeptors liegen, mit den Profilen der Connectivity Map Datenbank verglichen. Dabei wurden sehr hohe Übereinstimmungen
zwischen den Expressionsprofilen nach Stimulation des Estrogenrezeptors mit
17β-Estradiol bzw. der Inhibition mit Tamoxifen und den Expressionsprofilen
der korrespondierenden Experimente der Connectivity Map Datenbank erzielt
(s. 3.14). Die durchgeführten Vergleiche mit den in der Connectivity Map Datenbank verzeichneten Genexpressionsprofilen (basierend auf Affymetrix High
92
4.3 Einfluss endokriner Substanzen auf die globale Genexpression
Throughput Array (HTA)) zeigten alle große Übereinstimmungen mit den korrespondierenden Experimenten dieser Arbeit.
Zusätzlich wurden die Expressionsprofile der Silencingexperimente von AKT2,
CCNG2 und XBP1 mit den Connectivity Map Datenbankeinträgen verglichen.
Durch den NEM Algorithmus wurden diese Gene oberhalb des Estrogenrezeptors angesiedelt. Demnach ist eine starke Korrelation zu den Expressionsprofilen,
die nach einer Behandlung mit antiestrogenen Therapeutika gemessen wurden,
zu erwarten. Entsprechend wird eine maximale Verschiedenheit zu den Expressionsprofilen nach Stimulation des Estrogenrezeptors erwartet. Die Ergebnisse
in 3.14 bestätigten eindeutig diese Erwartungen. Die durchgeführten Analysen
lassen einen qualitativen Vergleich der aufgezeichneten Expressionsprofile mit
den Expressionsprofilen aus der Connectivity Map Datenbank zu. Eine Überprüfung der relativen Position der Gene innerhalb des rekonstruierten Netzwerks
ist durch diesen Vergleich nicht möglich.
4.3 Einfluss endokriner Substanzen auf die globale
Genexpression
Nach Behandlung der MCF-7 Zellen mit 17β-Estradiol bzw. Tamoxifen und
anschließender globaler Genexpressionsanalyse konnten die jeweiligen Expressionsprofile mit dem globalen Expressionsprofil nach post-transkriptioneller Genstilllegung von ESR1 durch hierarchische Clusteranalysen verglichen werden (s.
Abschnitt 3.13). Dadurch konnten die spezifischen Einflüsse auf die Expression
analysiert und mögliche Gemeinsamkeiten sowie Unterschiede dargestellt werden. Zusätzlich zeigte das Gen TGFB2 nur bei der Behandlung der MCF-7
Zellen mit Tamoxifen eine Überexpression. Diese Beobachtung deckte sich mit
den Informationen aus der Literatur (Buck et al. [2008]), wonach eine Überexpression von TGFB2 nach Therapie mit Tamoxifen erfolgt und als molekularer Marker für die korrekte Wirkung von Tamoxifen angesehen wird. Bei einer
gezielten Stilllegung von ESR1 bzw. einer Stimulation des Estrogenrezeptors
mit 17β-Estradiol war hingegen eine signifikante Repression von TGFB2 zu
verzeichnen. Tamoxifen blockiert die AF-2 Domäne des Estrogenrezeptors (s.
Abb. 1.5) durch Bindung an die Ligand Binding Domain, ohne eine Konformationsänderung des Estrogenrezeptors zu vermitteln. Durch diese Blockade
wird die ligandenabhängige Aktivität des Estrogenrezeptors unterdrückt. Die
93
4 Diskussion
ligandenunabhängige Aktivität (vermittelt über AF-1, s. Abb. 1.5) wird durch
eine Therapie mit Tamoxifen nicht beeinflusst. Hingegen führt ein Silencing des
Estrogenrezeptors zum Verlust der ligandenabhängigen, als auch der ligandenunabhängigen Funktion des Estrogenrezeptors. Daraus ist der Unterschied im
Expressionsverhalten des Gens TGFB2 bei Inhibition bzw. Silencing des Estrogenrezeptors begründet. Dieses Ergebnis zeigte, dass die Wirkungsweise von
Tamoxifen auf Mammakarzinomzellen innerhalb von in vitro als auch in vivo
Experimenten vergleichbar ist. Gleichzeitig wurde ein klarer Unterschied der
Wirkung auf das globale Expressionsprofil zwischen der partiellen Inhibition
des Estrogenrezeptors durch Tamoxifen und dem gezielten Silencing des Estrogenrezeptors aufgezeigt.
Tamoxifen wird als „Selektiver Estrogen Rezeptor Modulator“ bei der Behandlung von post-menopausalen Frauen mit ER-positiven Mammakarzinomen therapeutisch eingesetzt. Dabei ist die selektive Modulierung bzw. Blockierung des
Estrogenrezeptors von großer Bedeutung. Durch die Blockierung der Ligandenbindetasche im Estrogenrezeptor (AF-2, s. Abb. 1.5) werden die Einflüsse des
17β-Estradiol auf die Proliferation und Migration der Zellen unterbunden. Die
wichtigen kardioprotektiven (Barrett-Connor and Grady [1998]) und osteosynthetischen (Riggs et al. [1998]) Funktionen der Estrogene werden dabei nicht
beeinflusst. Ein selektives Silencing des Estrogenrezeptors deaktiviert, neben
den ligandenabhängigen Funktionen des Estrogenrezeptors, auch die ligandenunabhängigen Funktionen des Estrogenrezeptors, woraus die gleichgerichteten
Effekte in der Expression einiger Gene bei einer Stimulation des Estrogenrezeptors mit 17β-Estradiol und der Behandlung der MCF-7 Zellen mit Tamoxifen
zu erklären sind. Der gleiche Effekt, in diesem Fall jedoch unterschiedliche Regulationen bei der Expression einiger Gene, ist bei dem Vergleich des ESR1
Silencings und der Tamoxifenbehandlung zu erkennen. Dort zeigten 13 Gene
eine gleichgerichtete differentielle Expression beim Silencing des ESR1 und der
Tamoxifenbehandlung (s. 3.13.1 und Tabelle 3.13). Ein Vergleich dieser Schnittmenge aus Tabelle 3.13 und den gleichartig regulierten Genen nach ESR1 Stimulation und Tamoxifen Behandlung aus Tabelle 3.14 ergibt eine Schnittmenge von zwei Genen, FHL2 und SNX24. Das Gen SNX24 ist derzeit lediglich
als „sorting nexin 24“ annotiert und nicht weiter in der Literatur beschrieben.
Einige Sorting Nexine (z. B. SNX1 ) wurden mit der Progression und Agressivität von Tumoren (Nguyen et al. [2006]), sowie einem Einfluss auf den EGFR
Signaltransduktionsweg assoziiert (Gullapalli et al. [2004]). Demnach kann ein
94
4.4 Vorschlag neuer therapeutischer Ziele
Zusammenhang zwischen der Expression von SNX24 und der Progression von
Brustkrebs, bzw. der Wirkung von Tamoxifen postuliert werden.
Die Überexpression von FHL2, einem transkriptionellen Koaktivator des Onkoproteins JUN (AP-1, Morlon and Sassone-Corsi [2003]), wurde bereits mit
Brustkrebs (Gabriel et al. [2006]) und anderen Krankheiten (Johannessen et al.
[2006]) assoziiert. Analog zu Coser et al. [2003] konnte eine Induktion der FHL2
Expression durch eine gezielte Stimulation des ERα mit 17β-Estradiol gezeigt
werden (s. Abschnitt 3.13). Durch die Interaktion von FHL2 mit JUN ist das
Gen eng mit der ERE-unabhängigen genomischen Aktivität des Estrogenrezeptors verbunden.
4.4 Vorschlag neuer therapeutischer Ziele
Eines der Ziele der experimentellen Arbeiten dieser Dissertation war die Prädiktion neuer therapeutischer Ziele für die Behandlung von estrogenabhängigen Mammakarzinomen. Die durchgeführten Experimente führten anhand der
beschriebenen Methoden zur Rekonstruktion eines Interaktionsnetzwerks von
Mammakarzinom-relevanten Genen, die zu Beginn aller Arbeiten anhand der
in Abschnitt 3.1 beschriebenen Kriterien ausgewählt wurden. Aus der Fachliteratur sind genaue Beschreibungen des Estrogenrezeptor Signaltransduktionswegs sowie der Wirkung von 17β-Estradiol bekannt und ausführlich beschrieben
(Björnstrom and Sjöberg [2005], Dudek and Picard [2008], Klinge [2001], Levin
[2005], Marino et al. [2006], Nilsson and Gustafsson [2000], Nilsson et al. [2001],
O’Lone et al. [2004], Osborne and Schiff [2005]). Aus allen Literaturdaten geht
grundsätzlich hervor, dass der Estrogenrezeptor, aktiviert durch die Bindung
von 17β-Estradiol, als Startpunkt für eine genomische bzw. nicht-genomische
transkriptionelle Aktivierung von Zielgenen gilt (s. Abschnitt 1.4). Durch die
Rekonstruktion eines Gen-Interaktionsnetzwerks (Abb. 3.11) aufgrund von gezielten post-transkriptionellen Genstilllegungen und anschließender genomweiter
Expressionsanalyse wurden eindeutig Gene identifiziert, die einen Einfluss auf
die Expression und damit die Aktivität des Estrogenrezeptors haben. Ausgehend
von der Theorie, dass eine Inhibition des Estrogenrezeptors zu einer Repression der Estrogenrezeptoraktivität, und damit zu einem verminderten Tumorwachstum führt, können Gene, die durch den NEM Algorithmus oberhalb des
Estrogenrezeptors positioniert wurden, potentiell als neue therapeutische Ziele
95
4 Diskussion
diskutiert werden. Demnach stellen die Gene AKT2, CCNG2 sowie XBP1 potentielle Kandidaten für einen therapeutischen Ansatzpunkt dar.
CCNG2 (cyclin G2) ist in den Zellzyklus involviert und ist demnach ubiquitär exprimiert. Die Inhibition von CCNG2 führte zwar zu einer Repression der
ESR1 Expression, jedoch ist die Expression von CCNG2 mit einer Inhibition des Zellzyklus korreliert (Arachchige Don et al. [2006]). Bisher ist nur der
Einfluss der ESR1 Expression auf die Expression von CCNG2 in der Literatur
bekannt (Stossi et al. [2006], s. Abschnitt 3.12.1). Die in den Experimenten gemessene Feedbackschleife ist derzeit in der Literatur nicht beschrieben. Trotz des
reprimierenden Einflusses des CCNG2 Silencings auf die Expression von ESR1
bietet sich CCNG2, aufgrund seiner zentralen Stellung im Zellzyklus, nicht als
therapeutisches Ziel an. Eine Inhibition von CCNG2 würde wahrscheinlich zu
einer Beschleunigung des Zellzyklus in allen Zellen führen.
Anhand der statistischen Auswertung der gemessenen genomweiten Expressionsprofile mit dem NEM Algorithmus wurde AKT2 ebenfalls oberhalb des Estrogenrezeptors positioniert und kann somit als potentielles therapeutisches Ziel
diskutiert werden. In der Literatur wird eine Inhibition des PI3K/AKT Signaltransduktionsweges zur Therapie verschiedener Tumorerkrankungen diskutiert
(Bellacosa et al. [2005], Fresno Vara et al. [2004], Hill and Hemmings [2002]).
Dabei wird AKT2 u. a. die Aktivierung von verschiedenen Zellüberlebensmechanismen (Testa and Bellacosa [2001]) sowie der Zellzyklusprogression und dem
Zellwachstum (Blume-Jensen and Hunter [2001]) zugeschrieben. Demnach stellt
dieser sehr gut beschriebene PI3K/Akt Signaltransduktionsweg ein potentielles therapeutisches Ziel dar, gegen welches bereits Therapeutika (Wortmannin
und LY294002) verfügbar sind (Fresno Vara et al. [2004]). Ein therapeutischer
Effekt des AKT2 Silencings wurde bereits im Vergleich des gemessenen Expressionsprofils mit den Einträgen der Connectivity Map Datenbank (s. Abb. 3.14.4)
durch eine sehr große Ähnlichkeit zu einer Behandlung mit Wortmannin bzw.
LY294002 bestätigt. Beide PI3K Inhibitoren befinden sich derzeit in der präklinischen Studienphase. AKT2 aktiviert ausschließlich die ligandenunabhängige
Aktivierungsfunktion-2 des Estrogenrezeptors, welche nicht durch eine Bindung
von Tamoxifen an die „Ligand Binding Domain“ des Estrogenrezeptors blockiert
wird (Stoica et al. [2003a]). Durch eine Inhibition von AKT2 in Kombination
mit einer Tamoxifenbehandlung ist eine verbesserte Inhibition des Estrogenrezeptors und damit eine Verringerung der Tumorprogression zu erwarten.
Durch Auswertung der Expressionsdaten mittels des NEM Algorithmus wurde
96
4.4 Vorschlag neuer therapeutischer Ziele
E2
E2
ER
ER
AIB1
F
L2
FH
J
mRNA
AP1
Promoter
Gen
(a) Schematische Darstellung der ERE-unabhängigen genomischen
Aktivität des ESR1
E2
E2
Inhibitor
ER
ER
AIB1
F
L2
FH
J
mRNA
AP1
Promoter
Gen
(b) Schematische Darstellung mit Inhibition des transkriptionellen
Kofaktors FHL2
Abbildung 4.2: Schematische Darstellungen der ERE-unabhängigen genomischen
Aktivität des ESR1 ohne FHL2 Inhibition (a) und mit Inhibition
(b). Estrogen-aktivierter ER vermittelt die Bindung von Koaktivatorkomplexen (AIB1) an weitere Transkriptionsfaktoren (z. B. Fos
(F) und Jun (J)) zur Aktivierung der Transkription an Promotoren
ohne ERE-Sequenzen (AP1)
das Gen XBP1 oberhalb von ESR1 positioniert und stellt demnach ein weiteres
potentielles Ziel für eine Inhibition der Aktivität des Estrogenrezeptors dar. Der
Vergleich des Expressionsprofils nach post-transkriptioneller Genstilllegung von
XBP1 mit der Connectivity Map Datenbank zeigte große Übereinstimmungen
mit den Behandlungen von MCF-7 Zellen mit Inhibitoren des Estrogenrezeptors
(Resveratrol und Fulvestrant) bzw. mit Inhibitoren des PI3K/Akt Signaltransduktionwegs (Wortmannin und LY294002). In der Literatur wird XBP1 ebenfalls bereits als mögliches Ziel einer Therapie von Tumorerkrankungen diskutiert
(Koong et al. [2006]), was zur Entwicklung eines ersten potentiellen Inhibitors
geführt hat (Tashiro et al. [2007]).
Durch den Vergleich der globalen Expressionsanalysen nach Behandlung der
97
4 Diskussion
MCF-7 Zellen mit 17β-Estradiol bzw. Tamoxifen und dem Silencing des Estrogenrezeptors mittels hierarchischer Clusteranalyse, wurde das Gen FHL2 als
potentielles therapeutisches Ziel ermittelt. Das Gen wird durch den aktivierten Estrogenrezeptor, sowie durch die Behandlung mit Tamoxifen überexprimiert (s. Tabelle 3.14). In Folge des ERα Silencings kommt es zu einer Repression von FHL2 (s. Tabelle 3.13). FHL2 codiert für einen transkriptionellen
Kofaktor des AP-1 (Morlon and Sassone-Corsi [2003]) und ist demnach eng an
der ERE-unabhängigen genomischen Aktivität des Estrogenrezeptors beteiligt.
Durch Zusammenlagerung verschiedener Transkriptionsfaktoren mit dem dimerisierten und aktiverten Estrogenrezeptor wird die Transkription verschiedener
Zielgene aktiviert (Abb. 4.2(a)). Eine Störung der Zusammenlagerung der Transkriptionsfaktoren könnte demnach zu einer Minimierung bzw. Inhibition der
Transkription führen. Aufgrund der hier ermittelten Messdaten kann demnach
FHL2 als ein potentielles neues Ziel für eine adjuvante Therapie von estrogenabhängigen Mammakarzinomen postuliert werden. Abb. 4.2(b) zeigt die schematische Darstellung einer möglichen Wirkung eines FHL2 Inhibitors. Durch die
Inhibition würde eine Störung der Ausbildung des aktiven Transfektionskomplexes erfolgen, was schlussendlich zu einem Ausbleiben der mRNA Synthese
führen würde. FHL2 wurde ebenfalls in Prostatageweben als transkriptioneller Kofaktor eines ligandenaktivierten Transkriptionsfaktors, in diesem Fall des
Androgenrezeptors, beschrieben (Muller et al. [2000]). In Prostatakrebs ist der
Androgenrezeptor, vergleichbar zum Estrogenrezeptor in Brustkrebs, in die Progression der Erkrankung involviert (Suzuki et al. [2003] und stellt demnach ein
therapeutisches Ziel der adjuvanten Hormontherapie bei Patienten mit Prostatakarzinomen dar.
Problematisch bei einer Inhibition von FHL2 könnte die Expression dieses Gens
im Myokardmuskel (Chan et al. [1998]) sein. Eine Inhibition von FHL2 könnte demnach zur Ausbildung von Myokardanomalien führen und dadurch die
Leistung des Herzens negativ beeinflussen. Da FHL2 durch die Wirkung von
17β-Estradiol in Mammakarzinomen überexprimiert wird, würde eine Inhibition vermehrt die Aktivität von FHL2 innerhalb des Tumors beeinflussen. Die
gewebeübergreifende Expression von möglichen therapeutischen Zielen stellt ein
grundsätzliches Problem einer Inhibition dieser Ziele dar. Herceptin, ein monoklonare Antikörper gegen HER2/neu, wird in der Therapie von metastasierenden Mammakarzinomen eingesetzt (Baselga et al. [2005], Gonzalez-Angulo et al.
[2006], Vogel et al. [2002]), trotz einer bekannten Expression von HER2/neu im
98
4.4 Vorschlag neuer therapeutischer Ziele
Myokardmuskel (Olayioye et al. [2000]). In diesen Fällen ist eine sorgfältige Abwägung aller positiven sowie negativen Effekte notwendig.
Die hier diskutierten Ergebnisse zeigen, dass die erarbeitete Methodik der gezielten post-transkriptionellen Genstilllegung und genomweiter Expressionsanalyse
für die Rekonstruktion von Interaktionsnetzwerken eine geeignete Plattform zur
Vorhersage potentieller neuer therapeutischer Ziele darstellt. Besonders im Fall
von ligandenaktivierten Transkriptionsfaktoren können durch diese Methodik
neue Erkenntnisse in den Interaktionen von einzelnen Genen erlangt werden,
was die Möglichkeit einer detaillierten Evaluierung neuer therapeutischer Ziele
bietet. Die Prädiktion von FHL2 als potentielles therapeutisches Ziel zeigt, dass
die Methodik nicht nur auf Fragestellungen in Mammakarzinomen angewendet
werden kann, sondern auch Gültigkeit für weitere Tumorentitäten besitzt.
99
A Anhang
A.1 Qualitätskontrolle isolierter total und
amplifizierter RNA
Abbildung A.1: total RNA Probe hoher Integrität
Abbildung A.2: amplifizierte RNA Probe hoher Integrität
101
A Anhang
A.2 Graphen der selektiven mRNA Reduktion
AKT2
1.4
1.2
1
0.8
0.6
0.4
0.2
T2
_M
oc
k
AK
T2
_K
4
AK
T2
_K
3
AK
T2
_K
2
AK
T2
_K
1
AK
T2
_7
_2
AK
T2
_7
_1
AK
T2
_6
_2
AK
AK
T2
_6
_1
0
Abbildung A.3: Selektive Reduktion der mRNA Konzentration von AKT2
102
A.2 Graphen der selektiven mRNA Reduktion
BCL2
1.4
1.2
1
0.8
0.6
0.4
0.2
BC
L2
_1
2_
1
BC
L2
_1
2_
2
BC
L2
_9
_1
BC
L2
_9
_2
BC
L2
_K
1
BC
L2
_K
2
BC
L2
_K
3
BC
L2
_K
4
BC
L2
_M
oc
k
0
Abbildung A.4: Selektive Reduktion der mRNA Konzentration von BCL2
CCNG2
1.4
1.2
1
0.8
0.6
0.4
0.2
C
C
N
G
2_
C
1_
C
1
N
G
2
_1
C
C
_2
N
G
2
_2
C
C
_1
N
G
2_
C
2_
C
2
N
G
2
_3
C
C
_1
N
G
2_
3_
C
C
2
N
G
2_
C
K1
C
N
G
2_
C
K2
C
N
G
2_
C
K3
C
N
G
2_
C
K4
C
N
G
2_
C
K5
C
N
G
C
2_
C
K6
N
G
2_
M
oc
k
0
Abbildung A.5: Selektive Reduktion der mRNA Konzentration von CCNG2
103
A Anhang
ESR1
1.2
1
0.8
0.6
0.4
0.2
R
1_
M
oc
k
1_
K4
ES
R
ES
R
ES
ES
1_
K3
1_
K2
R
1_
K1
R
2
R
1_
2-
ES
1
R
1_
2-
ES
2
R
1_
1-
ES
ES
ES
1
R
1_
1-
0
Abbildung A.6: Selektive Reduktion der mRNA Konzentration von ESR1
FOXA1
1.2
1
0.8
0.6
0.4
0.2
A1
_3
_2
FO
X
A1
_K
1
FO
X
A1
_K
2
FO
X
A1
_K
3
FO
X
A1
_K
FO
4
X
A1
_M
oc
k
FO
X
A1
_3
_1
FO
X
A1
_2
_2
FO
X
FO
X
A1
_2
_1
0
Abbildung A.7: Selektive Reduktion der mRNA Konzentration von FOXA1
104
A.2 Graphen der selektiven mRNA Reduktion
HSPB8
1.2
1
0.8
0.6
0.4
0.2
H
SP
B8
_5
_1
H
SP
B8
_5
_2
H
SP
B8
_6
_1
H
SP
B8
_6
_2
H
SP
B8
_K
1
H
SP
B8
_K
2
H
SP
B8
_K
3
H
SP
B8
_K
H
4
SP
B8
_M
oc
k
0
Abbildung A.8: Selektive Reduktion der mRNA Konzentration von HSPB8
MAPK1
1.4
1.2
1
0.8
0.6
0.4
0.2
-2
PK
1_
K
M
1
A
PK
1_
K
M
2
A
PK
1_
K
M
3
A
PK
1_
M
K
A
4
PK
1_
M
oc
k
M
A
M
A
PK
1_
2
-2
M
A
PK
1_
2
-1
PK
1_
1
M
A
PK
1_
1
M
A
-1
0
Abbildung A.9: Selektive Reduktion der mRNA Konzentration von MAPK1
105
2_
ST 1_ 1
C
2_
ST 1_
2
C
2_
ST 2_ 1
C
2_
ST 2_ 2
C
2_
ST 3_
1
C
2_
3
ST _ 2
C
2_
ST K 1
C
2_
ST K 2
C
2_
ST K 3
C
2_
ST K 4
C
2_
ST K 5
C
ST 2_K
C
2_ 6
M
oc
k
ST
C
ST
AT
5
ST B _
AT 1_
1
5
ST B _
AT 1_
2
5
ST B _
AT 2_
1
5
ST B _
AT 2_
2
5
ST B _
AT 3_
5B 1
ST _3
AT _2
5
ST B _
AT K1
5
ST B _
AT K2
5
ST B _
AT K3
5
ST B _
AT K4
5
ST B _
K5
A
ST T5
AT B _
5B K6
_M
oc
k
A Anhang
STAT5B
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Abbildung A.10: Selektive Reduktion der mRNA Konzentration von STAT5B
STC2
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Abbildung A.11: Selektive Reduktion der mRNA Konzentration von STC2
106
A.2 Graphen der selektiven mRNA Reduktion
TMEM45B
1.4
1.2
1
0.8
0.6
0.4
0.2
TM
EM
45
B_
TM
2_
1
EM
45
B_
TM
2_
2
EM
45
B_
TM
3_
1
EM
45
B_
3_
TM
2
EM
45
B_
TM
K1
EM
45
B_
TM
K2
EM
45
B_
TM
K3
EM
TM
45
EM
B_
45
K4
B_
K1
_M
oc
k
0
Abbildung A.12: Selektive Reduktion der mRNA Konzentration von TMEM45B
TP53
1.4
1.2
1
0.8
0.6
0.4
0.2
TP
53
_1
-1
TP
53
_1
-2
TP
53
_2
-1
TP
53
_2
-2
TP
53
_K
1
TP
53
_K
2
TP
53
_K
3
TP
53
_K
4
TP
53
_M
oc
k
0
Abbildung A.13: Selektive Reduktion der mRNA Konzentration von TP53
107
A Anhang
XBP1
1.2
1
0.8
0.6
0.4
0.2
4
P1
_M
oc
k
XB
P1
_K
3
XB
P1
_K
XB
P1
_K
2
1
XB
P1
_K
XB
P1
_4
_2
XB
P1
_4
_1
XB
P1
_3
_2
XB
XB
P1
_3
_1
0
Abbildung A.14: Selektive Reduktion der mRNA Konzentration von XBP1
CCNG2 und ESR1
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
CCNG2
ES
C
R
1_
2-
2/
C
C
N
G
2_
3
-1
N
ES
G
2_
R
31/
2
C
C
N
ES
G
2_
R
1/
K
C
1
C
N
ES
G
2_
R
1/
K
2
C
C
N
ES
G
2_
R
1/
K
C
3
ES
C
N
R
G
1/
2_
C
K
C
4
N
G
2_
M
oc
k
-2
1/
C
R
1_
2-
2/
C
ES
R
1_
1-
ES
ES
R
1_
1-
1/
C
C
C
N
G
2_
2
N
G
2_
2
-1
ESR1
Abbildung A.15: Parallele Reduktion der mRNA Konzentration von CCNG2 und
ESR1
108
A.2 Graphen der selektiven mRNA Reduktion
ESR1 und MAPK1
1.2
1
0.8
ESR1
0.6
MAPK1
0.4
0.2
K1
_2
R
-2
1/
M
AP
K1
ES
_K
R
1/
1
M
AP
K1
ES
_K
R
1/
2
M
AP
K1
ES
_K
R
1/
3
M
AP
K1
_K
4
1
ES
ES
R
1_
2-
2/
M
AP
K1
_2
-
2
1/
M
AP
K1
_1
-
ES
ES
ES
R
1_
2-
2/
M
AP
R
1_
1-
R
1_
1-
1/
M
AP
K1
_1
-
1
0
Abbildung A.16: Parallele Reduktion der mRNA Konzentration von ESR1 und
MAPK1
MAPK1 und STAT5B
1.2
1
0.8
0.6
0.4
MAPK1
STAT5B
0.2
M
A
M
A
PK
1_
1
-1
/S
PK
TA
1_
T5
1M
B_
2/
A
S
1PK
TA
1
1_
T
5B
2M
1/
A
_1
S
PK
-2
TA
1_
T5
2B_
2/
S
3T
1
M
A
A
T
PK
5B
_3
1/
S
-2
TA
M
A
T
PK
5B
1/
_K
S
M
1
TA
A
T5
PK
B_
1/
S
K2
M
TA
A
T5
PK
B_
1/
M
K3
S
A
TA
PK
T5
1/
S
B_
TA
K4
T5
B_
M
oc
k
0
Abbildung A.17: Parallele Reduktion der mRNA Konzentration von MAPK1 und
STAT5B
109
A Anhang
A.3 Hierarchische Clusteranalysen
NPEPL1
TXNIP
SCRN2
DST
RNF43
OKL38
CTSH
SEC14L4
RAC1
PSCD2
MB
CTSL
1.35
0.97
0.58
0.19
−0.19
−0.58
−0.97
−1.35
−1.74
TAM
ESR1
BTG1
JARID1B
AP1S1
FAM107B
NELL2
HIST1H2BD
STC2
FHL2
KPNA2
TGFB2
SNX24
AGR2
TXNRD1
GDAP1
MGC21644
DEK
ABAT
SEMA3C
MOAP1
PRSS23
XBP1
NPY1R
CXCL12
CALCR
GREB1
TRUB1
C17orf72
FARP1
1.74
Abbildung A.18: Hierarchische Clusteranalyse der genomweiten Expressionsanalyse nach ESR1 Silencing und nach Tamoxifen Behandlung
110
A.3 Hierarchische Clusteranalysen
DLG5
C12orf41
SH3BP5
KIAA0182
ZNF185
EXOC2
SBDS
SLC25A25
RHOBTB1
ITGA6
SNX24
FOSL2
1.74
MXD1
ULK1
FHL2
0.58
ZNF703
CXCL12
NPY1R
DSU
HEY2
TRUB1
NAB2
LRRFIP2
MOAP1
HOP
PRSS23
XBP1
BAMBI
TGFB2
KYNU
SGCG
CCNG2
C14orf4
0.97
0.19
−0.19
−0.58
−0.97
−1.35
−1.74
TAM
E2
TLE1
ANKRD50
EPHA4
FAM107B
RNF43
1.35
Abbildung A.19: Hierarchische Clusteranalyse der genomweiten Expressionsanalyse nach Stimulation des ERα und nach Tamoxifen Behandlung
111
A Anhang
FAM107B
1.74
RNF43
TGFB2
1.35
FKBP4
FHL2
0.97
CXCL12
NPY1R
0.58
MYB
0.19
KLF4
INCENP
−0.19
SNX24
HSPB8
−0.58
MOAP1
TRUB1
−0.97
SLC7A5
−1.35
PRSS23
−1.74
E2
ESR1
XBP1
Abbildung A.20: Hierarchische Clusteranalyse der genomweiten Expressionsanalyse nach ESR1 -Silencing und Stimulation des ERα
112
Literaturverzeichnis
Agarwal, M. L., Taylor, W. R., Chernov, M. V., Chernova, O. B., and Stark,
G. R. (1998). The p53 network. J Biol Chem, 273(1):1–4. 42
Albertoni, M., Shaw, P. H., Nozaki, M., Godard, S., Tenan, M., Hamou, M. F.,
Fairlie, D. W., Breit, S. N., Paralkar, V. M., de Tribolet, N., Van Meir, E. G.,
and Hegi, M. E. (2002). Anoxia induces macrophage inhibitory cytokine-1
(MIC-1) in glioblastoma cells independently of p53 and HIF-1. Oncogene,
21(27):4212–9. 43
Ali, S. and Coombes, R. C. (2002). Endocrine-responsive breast cancer and
strategies for combating resistance. Nat Rev Cancer, 2(2):101–12. 3, 4, 5
Arachchige Don, A. S., Dallapiazza, R. F., Bennin, D. A., Brake, T., Cowan,
C. E., and Horne, M. C. (2006). Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest. Exp Cell Res, 312(20):4181–204. 96
Avery, L. and Wasserman, S. (1992). Ordering gene function: the interpretation
of epistasis in regulatory hierarchies. Trends Genet, 8(9):312–6. 68, 91
Badve, S., Turbin, D., Thorat, M. A., Morimiya, A., Nielsen, T. O., Perou, C. M.,
Dunn, S., Huntsman, D. G., and Nakshatri, H. (2007). FOXA1 expression in
breast cancer–correlation with luminal subtype A and survival. Clin Cancer
Res, 13(15 Pt 1):4415–21. 1
Barrett-Connor, E. and Grady, D. (1998). Hormone replacement therapy, heart
disease, and other considerations. Annu Rev Public Health, 19:55–72. 94
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116(2):281–97. 12, 14
Baselga, J., Carbonell, X., Castaneda-Soto, N. J., Clemens, M., Green, M.,
Harvey, V., Morales, S., Barton, C., and Ghahramani, P. (2005). Phase II
study of efficacy, safety, and pharmacokinetics of trastuzumab monotherapy
administered on a 3-weekly schedule. J Clin Oncol, 23(10):2162–71. 7, 98
113
Literaturverzeichnis
Beatson, G. (1896). On the treatment of inoperable cases of carcinoma of the
mammary. Suggestions for a new method of treatment with illustrative cases.
Lancet, 2(104-107):162–165. 5
Bellacosa, A., Kumar, C. C., Di Cristofano, A., and Testa, J. R. (2005). Activation of AKT kinases in cancer: implications for therapeutic targeting. Adv
Cancer Res, 94:29–86. 96
Bennin, D. A., Don, A. S., Brake, T., McKenzie, J. L., Rosenbaum, H., Ortiz,
L., DePaoli-Roach, A. A., and Horne, M. C. (2002). Cyclin G2 associates
with protein phosphatase 2A catalytic and regulatory B’ subunits in active
complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
J Biol Chem, 277(30):27449–67. 52
Berridge, M., Tan, A., McCoy, K., and Wang, R. (1996). The biochemical and
cellular basis of cell proliferation assays that use tetrazolium salts. Biochemica, 4:14–19. 28
Björnstrom, L. and Sjöberg, M. (2002). Signal transducers and activators of
transcription as downstream targets of nongenomic estrogen receptor actions.
Mol Endocrinol, 16(10):2202–14. 39
Björnstrom, L. and Sjöberg, M. (2005). Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol
Endocrinol, 19(4):833–42. 7, 8, 9, 10, 39, 40, 79, 95
Block, G. E., Jensen, E. V., and Polley, T. Z. (1975). The prediction of hormonal
dependency of mammary cancer. Ann Surg, 182(3):342–52. 1
Blume-Jensen, P. and Hunter, T. (2001). Oncogenic kinase signalling. Nature,
411(6835):355–65. 96
Bohnsack, M. T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a
RanGTP-dependent dsRNA-binding protein that mediates nuclear export of
pre-miRNAs. RNA, 10(2):185–91. 13
Bouras, T., Southey, M. C., Chang, A. C., Reddel, R. R., Willhite, D., Glynne,
R., Henderson, M. A., Armes, J. E., and Venter, D. J. (2002). Stanniocalcin
2 is an estrogen-responsive gene coexpressed with the estrogen receptor in
human breast cancer. Cancer Res, 62(5):1289–95. 61
114
Literaturverzeichnis
Buck, M. B., Coller, J. K., Murdter, T. E., Eichelbaum, M., and Knabbe, C.
(2008). TGFbeta2 and TbetaRII are valid molecular biomarkers for the antiproliferative effects of tamoxifen and tamoxifen metabolites in breast cancer
cells. Breast Cancer Res Treat, 107(1):15–24. 76, 93
Bulavin, D. V., Saito, S., Hollander, M. C., Sakaguchi, K., Anderson, C. W.,
Appella, E., and Fornace, A. J., J. (1999). Phosphorylation of human p53 by
p38 kinase coordinates N-terminal phosphorylation and apoptosis in response
to UV radiation. EMBO J, 18(23):6845–54. 45
Buzdar, A. U. (2004). Fulvestrant: a new type of estrogen receptor antagonist for
the treatment of advanced breast cancer. Drugs Today (Barc), 40(9):751–64.
79, 81
Campbell, R. A., Bhat-Nakshatri, P., Patel, N. M., Constantinidou, D., Ali,
S., and Nakshatri, H. (2001). Phosphatidylinositol 3-kinase/AKT-mediated
activation of estrogen receptor alpha: a new model for anti-estrogen resistance.
J Biol Chem, 276(13):9817–24. 88
Caplen, N. J., Parrish, S., Imani, F., Fire, A., and Morgan, R. A. (2001). Specific
inhibition of gene expression by small double-stranded RNAs in invertebrate
and vertebrate systems. Proc Natl Acad Sci U S A, 98(17):9742–7. 1, 22
Carroll, J. S., Liu, X. S., Brodsky, A. S., Li, W., Meyer, C. A., Szary, A. J.,
Eeckhoute, J., Shao, W., Hestermann, E. V., Geistlinger, T. R., Fox, E. A.,
Silver, P. A., and Brown, M. (2005). Chromosome-wide mapping of estrogen
receptor binding reveals long-range regulation requiring the forkhead protein
FoxA1. Cell, 122(1):33–43. 40, 63
Castagnetta, L. A., Lo Casto, M., Granata, O. M., Polito, L., Calabro, M.,
Lo Bue, A., Bellavia, V., and Carruba, G. (1996). Estrogen content and
metabolism in human breast tumor tissues and cells. Ann N Y Acad Sci,
784:314–24. 6
Chan, K. K., Tsui, S. K., Lee, S. M., Luk, S. C., Liew, C. C., Fung, K. P., Waye,
M. M., and Lee, C. Y. (1998). Molecular cloning and characterization of
FHL2, a novel LIM domain protein preferentially expressed in human heart.
Gene, 210(2):345–50. 98
Charpentier, A. H., Bednarek, A. K., Daniel, R. L., Hawkins, K. A., Laflin, K. J.,
Gaddis, S., MacLeod, M. C., and Aldaz, C. M. (2000). Effects of estrogen
on global gene expression: identification of novel targets of estrogen action.
Cancer Res, 60(21):5977–83. 41, 61
115
Literaturverzeichnis
Chiu, S. K., Hsu, M., Ku, W. C., Tu, C. Y., Tseng, Y. T., Lau, W. K., Yan,
R. Y., Ma, J. T., and Tzeng, C. M. (2003). Synergistic effects of epoxy- and
amine-silanes on microarray DNA immobilization and hybridization. Biochem
J, 374(Pt 3):625–32. 29
Cidlowski, J. A. and Muldoon, T. G. (1978). The dynamics of intracellular estrogen receptor regulation as influenced by 17β-estradiol. Biol Reprod, 18(2):234–
46. 55
Claessens, F. and Gewirth, D. T. (2004). DNA recognition by nuclear receptors.
Essays Biochem, 40:59–72. 7
Clauss, I. M., Chu, M., Zhao, J. L., and Glimcher, L. H. (1996). The basic
domain/leucine zipper protein hXBP-1 preferentially binds to and transactivates CRE-like sequences containing an ACGT core. Nucleic Acids Res,
24(10):1855–64. 41
Conzone, S. D. and Pantano, C. G. (2004). Glass slides to DNA microarrays.
Materials Today, 7(3):20–26. 29
Coser, K. R., Chesnes, J., Hur, J., Ray, S., Isselbacher, K. J., and Shioda,
T. (2003). Global analysis of ligand sensitivity of estrogen inducible and
suppressible genes in MCF7/BUS breast cancer cells by DNA microarray.
Proc Natl Acad Sci U S A, 100(24):13994–9. 95
Creemer, L. C., Kirst, H. A., Vlahos, C. J., and Schultz, R. M. (1996). Synthesis and in vitro evaluation of new wortmannin esters: potent inhibitors of
phosphatidylinositol 3-kinase. J Med Chem, 39(25):5021–4. 79, 81
Daoud, S. S., Munson, P. J., Reinhold, W., Young, L., Prabhu, V. V., Yu, Q.,
LaRose, J., Kohn, K. W., Weinstein, J. N., and Pommier, Y. (2003). Impact of
p53 knockout and topotecan treatment on gene expression profiles in human
colon carcinoma cells: a pharmacogenomic study. Cancer Res, 63(11):2782–
93. 45
DeRisi, J., Penland, L., Brown, P. O., Bittner, M. L., Meltzer, P. S., Ray, M.,
Chen, Y., Su, Y. A., and Trent, J. M. (1996). Use of a cDNA microarray to
analyse gene expression patterns in human cancer. Nat Genet, 14(4):457–60.
1, 28
Ding, L., Yan, J., Zhu, J., Zhong, H., Lu, Q., Wang, Z., Huang, C., and Ye, Q.
(2003). Ligand-independent activation of estrogen receptor alpha by XBP-1.
Nucleic Acids Res, 31(18):5266–74. 86
116
Literaturverzeichnis
Dudek, P. and Picard, D. (2008). Genomics of signaling crosstalk of estrogen
receptor alpha in breast cancer cells. PLoS ONE, 3(3):e1859. 95
Duong, V., Boulle, N., Daujat, S., Chauvet, J., Bonnet, S., Neel, H., and Cavailles, V. (2007). Differential regulation of estrogen receptor alpha turnover and transactivation by Mdm2 and stress-inducing agents. Cancer Res,
67(11):5513–21. 41
Dutertre, M. and Smith, C. L. (2000). Molecular mechanisms of selective estrogen receptor modulator (SERM) action. J Pharmacol Exp Ther, 295(2):431–7.
56
Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. (1998). Cluster
analysis and display of genome-wide expression patterns. Proc Natl Acad Sci
U S A, 95(25):14863–8. 74, 75
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl,
T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in
cultured mammalian cells. Nature, 411(6836):494–8. 14
Esseghir, S., Kennedy, A., Seedhar, P., Nerurkar, A., Poulsom, R., Reis-Filho,
J. S., and Isacke, C. M. (2007). Identification of NTN4, TRA1, and STC2 as
prognostic markers in breast cancer in a screen for signal sequence encoding
proteins. Clin Cancer Res, 13(11):3164–73. 1, 41
Farach-Carson, M. C. and Davis, P. J. (2003). Steroid hormone interactions with
target cells: cross talk between membrane and nuclear pathways. J Pharmacol
Exp Ther, 307(3):839–45. 10
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello,
C. C. (1998). Potent and specific genetic interference by double-stranded
RNA in Caenorhabditis elegans. Nature, 391(6669):806–11. 1, 12
Fliss, A. E., Benzeno, S., Rao, J., and Caplan, A. J. (2000). Control of estrogen
receptor ligand binding by Hsp90. J Steroid Biochem Mol Biol, 72(5):223–30.
9
Fresno Vara, J. A., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C., and
Gonzalez-Baron, M. (2004). PI3K/Akt signalling pathway and cancer. Cancer
Treat Rev, 30(2):193–204. 96
117
Literaturverzeichnis
Fröhlich, H., Fellmann, M., Sueltmann, H., Poustka, A., and Beissbarth, T.
(2007). Large scale statistical inference of signaling pathways from RNAi and
microarray data. BMC Bioinformatics, 8:386. 1, 34, 35, 37, 63, 67, 85, 88, 91
Fröhlich, H., Fellmann, M., Sueltmann, H., Poustka, A., and Beissbarth, T.
(2008). Estimating Large Scale Signaling Networks through Nested Effect
Models with Intervention Effects from Microarray Data. Bioinformatics. 1,
34, 35, 37, 63, 67, 85, 88, 91
Gabriel, B., Fischer, D. C., Orlowska-Volk, M., zur Hausen, A., Schule, R.,
Muller, J. M., and Hasenburg, A. (2006). Expression of the transcriptional
coregulator FHL2 in human breast cancer: a clinicopathologic study. J Soc
Gynecol Investig, 13(1):69–75. 95
Gaub, M. P., Bellard, M., Scheuer, I., Chambon, P., and Sassone-Corsi, P.
(1990). Activation of the ovalbumin gene by the estrogen receptor involves
the fos-jun complex. Cell, 63(6):1267–76. 10
Gehm, B. D., McAndrews, J. M., Chien, P. Y., and Jameson, J. L. (1997).
Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist
for the estrogen receptor. Proc Natl Acad Sci U S A, 94(25):14138–43. 80
Glass, C. K. and Rosenfeld, M. G. (2000). The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev, 14(2):121–41. 9
Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., Bloomfield, C. D., and Lander, E. S. (1999). Molecular classification of cancer:
class discovery and class prediction by gene expression monitoring. Science,
286(5439):531–7. 1
Gomez, B. P., Riggins, R. B., Shajahan, A. N., Klimach, U., Wang, A., Crawford,
A. C., Zhu, Y., Zwart, A., Wang, M., and Clarke, R. (2007). Human Xbox binding protein-1 confers both estrogen independence and antiestrogen
resistance in breast cancer cell lines. FASEB J, 21(14):4013–27. 41, 60, 86
Gonzalez-Angulo, A. M., Hortobagyi, G. N., and Esteva, F. J. (2006). Adjuvant
therapy with trastuzumab for HER-2/neu-positive breast cancer. Oncologist,
11(8):857–67. 7, 98
Gosden, J. R., Middleton, P. G., and Rout, D. (1986). Localization of the human
oestrogen receptor gene to chromosome 6q24—-q27 by in situ hybridization.
Cytogenet Cell Genet, 43(3-4):218–20. 7
118
Literaturverzeichnis
Gottlicher, M., Heck, S., and Herrlich, P. (1998). Transcriptional cross-talk, the
second mode of steroid hormone receptor action. J Mol Med, 76(7):480–9. 10
Gschwind, A., Fischer, O. M., and Ullrich, A. (2004). The discovery of receptor
tyrosine kinases: targets for cancer therapy. Nat Rev Cancer, 4(5):361–70. 7
Gu, Z., Lee, R. Y., Skaar, T. C., Bouker, K. B., Welch, J. N., Lu, J., Liu, A., Zhu,
Y., Davis, N., Leonessa, F., Brunner, N., Wang, Y., and Clarke, R. (2002).
Association of interferon regulatory factor-1, nucleophosmin, nuclear factorkappaB, and cyclic AMP response element binding with acquired resistance
to Faslodex (ICI 182,780). Cancer Res, 62(12):3428–37. 86
Gullapalli, A., Garrett, T. A., Paing, M. M., Griffin, C. T., Yang, Y., and Trejo,
J. (2004). A role for sorting nexin 2 in epidermal growth factor receptor
down-regulation: evidence for distinct functions of sorting nexin 1 and 2 in
protein trafficking. Mol Biol Cell, 15(5):2143–55. 94
Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNAdirected nuclease mediates post-transcriptional gene silencing in Drosophila
cells. Nature, 404(6775):293–6. 13
He, Z., Ma, W. Y., Liu, G., Zhang, Y., Bode, A. M., and Dong, Z. (2003).
Arsenite-induced Phosphorylation of Histone H3 at Serine 10 Is Mediated by
Akt1, Extracellular Signal-regulated Kinase 2, and p90 Ribosomal S6 Kinase
2 but Not Mitogen- and Stress-activated Protein Kinase 1. J Biol Chem,
278(12):10588–93. 90
Hill, M. M. and Hemmings, B. A. (2002). Inhibition of protein kinase B/Akt.
implications for cancer therapy. Pharmacol Ther, 93(2-3):243–51. 96
Hoffman, W. H., Biade, S., Zilfou, J. T., Chen, J., and Murphy, M. (2002).
Transcriptional repression of the anti-apoptotic survivin gene by wild type
p53. J Biol Chem, 277(5):3247–57. 43
Howell, A., Cuzick, J., Baum, M., Buzdar, A., Dowsett, M., Forbes, J. F.,
Hoctin-Boes, G., Houghton, J., Locker, G. Y., and Tobias, J. S. (2005). Results of the ATAC (Arimidex, Tamoxifen, Alone or in Combination) trial
after completion of 5 years’ adjuvant treatment for breast cancer. Lancet,
365(9453):60–2. 6
119
Literaturverzeichnis
Hsieh, C. Y., Santell, R. C., Haslam, S. Z., and Helferich, W. G. (1998). Estrogenic effects of genistein on the growth of estrogen receptor-positive human
breast cancer (MCF-7) cells in vitro and in vivo. Cancer Res, 58(17):3833–8.
79
Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A., and Vingron, M.
(2002). Variance stabilization applied to microarray data calibration and to
the quantification of differential expression. Bioinformatics, 18 Suppl 1:S96–
104. 33, 57, 72
Hutvagner, G., McLachlan, J., Pasquinelli, A. E., Balint, E., Tuschl, T., and Zamore, P. D. (2001). A cellular function for the RNA-interference enzyme Dicer
in the maturation of the let-7 small temporal RNA. Science, 293(5531):834–8.
13
Jakacka, M., Ito, M., Weiss, J., Chien, P. Y., Gehm, B. D., and Jameson, J. L.
(2001). Estrogen receptor binding to DNA is not required for its activity
through the nonclassical AP1 pathway. J Biol Chem, 276(17):13615–21. 10
Jiang, Y., Liu, Y. E., Goldberg, I. D., and Shi, Y. E. (2004). Gamma synuclein,
a novel heat-shock protein-associated chaperone, stimulates ligand-dependent
estrogen receptor alpha signaling and mammary tumorigenesis. Cancer Res,
64(13):4539–46. 89
Johannessen, M., Moller, S., Hansen, T., Moens, U., and Van Ghelue, M. (2006).
The multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell
Mol Life Sci, 63(3):268–84. 95
Kahlert, S., Nuedling, S., van Eickels, M., Vetter, H., Meyer, R., and Grohe, C.
(2000). Estrogen receptor alpha rapidly activates the IGF-1 receptor pathway.
J Biol Chem, 275(24):18447–53. 12
Kannan, K., Amariglio, N., Rechavi, G., and Givol, D. (2000). Profile of gene
expression regulated by induced p53: connection to the tgf-beta family. FEBS
Lett, 470(1):77–82. 43
Kelly, J., Spolski, R., Imada, K., Bollenbacher, J., Lee, S., and Leonard, W. J.
(2003). A role for stat5 in CD8(+) T cell homeostasis. J Immunol, 170(1):210–
7. 89
120
Literaturverzeichnis
Klijn, J. G., Blamey, R. W., Boccardo, F., Tominaga, T., Duchateau, L., and
Sylvester, R. (2001). Combined tamoxifen and luteinizing hormone-releasing
hormone (LHRH) agonist versus LHRH agonist alone in premenopausal advanced breast cancer: a meta-analysis of four randomized trials. J Clin Oncol,
19(2):343–53. 7
Klinge, C. M. (2001). Estrogen receptor interaction with estrogen response
elements. Nucleic Acids Res, 29(14):2905–19. 1, 95
Klinge, C. M., Blankenship, K. A., Risinger, K. E., Bhatnagar, S., Noisin, E. L.,
Sumanasekera, W. K., Zhao, L., Brey, D. M., and Keynton, R. S. (2005).
Resveratrol and estradiol rapidly activate MAPK signaling through estrogen
receptors alpha and beta in endothelial cells. J Biol Chem, 280(9):7460–8.
10, 39
Koch-Institut, R. (2008). Krebs in Deutschland 2003 - 2004. Häufigkeiten und
Trends. 6. Überarbeitete Auflage. 2, 3
Koong, A. C., Chauhan, V., and Romero-Ramirez, L. (2006). Targeting XBP-1
as a novel anti-cancer strategy. Cancer Biol Ther, 5(7):756–9. 97
Kumar, R., Johnson, B. H., and Thompson, E. B. (2004). Overview of the
structural basis for transcription regulation by nuclear hormone receptors.
Essays Biochem, 40:27–39. 7
Lacroix, M. and Leclercq, G. (2004). About GATA3, HNF3A, and XBP1, three
genes co-expressed with the oestrogen receptor-alpha gene (ESR1) in breast
cancer. Mol Cell Endocrinol, 219(1-2):1–7. 41, 60, 61, 73
Lamb, J. (2007). The Connectivity Map: a new tool for biomedical research.
Nat Rev Cancer, 7(1):54–60. 77, 92
Lamb, J., Crawford, E. D., Peck, D., Modell, J. W., Blat, I. C., Wrobel, M. J.,
Lerner, J., Brunet, J. P., Subramanian, A., Ross, K. N., Reich, M., Hieronymus, H., Wei, G., Armstrong, S. A., Haggarty, S. J., Clemons, P. A., Wei,
R., Carr, S. A., Lander, E. S., and Golub, T. R. (2006). The Connectivity
Map: using gene-expression signatures to connect small molecules, genes, and
disease. Science, 313(5795):1929–35. 77, 92
Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P.,
Radmark, O., Kim, S., and Kim, V. N. (2003). The nuclear RNase III Drosha
initiates microRNA processing. Nature, 425(6956):415–9. 13
121
Literaturverzeichnis
Lee, Y., Jeon, K., Lee, J. T., Kim, S., and Kim, V. N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J, 21(17):4663–
70. 13
Levin, E. R. (2005). Integration of the extranuclear and nuclear actions of
estrogen. Mol Endocrinol, 19(8):1951–9. 95
Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell,
88(3):323–31. 42
Lian, Z., De Luca, P., and Di Cristofano, A. (2006). Gene expression analysis
reveals a signature of estrogen receptor activation upon loss of Pten in a mouse
model of endometrial cancer. J Cell Physiol, 208(2):255–66. 41
Liou, H. C., Boothby, M. R., Finn, P. W., Davidon, R., Nabavi, N., Zeleznik-Le,
N. J., Ting, J. P., and Glimcher, L. H. (1990). A new member of the leucine
zipper class of proteins that binds to the HLA DR alpha promoter. Science,
247(4950):1581–4. 41
Losel, R. and Wehling, M. (2003). Nongenomic actions of steroid hormones. Nat
Rev Mol Cell Biol, 4(1):46–56. 10
Mackay, A., Jones, C., Dexter, T., Silva, R. L. A., Bulmer, K., Jones, A., Simpson, P., Harris, R. A., Jat, P. S., Neville, A. M., Reis, L. F. L., Lakhani, S. R.,
and O’Hare, M. J. (2003). cDNA microarray analysis of genes associated with
ERBB2 (HER2//neu) overexpression in human mammary luminal epithelial
cells. Oncogene, 22(17):2680–2688. 1
Marino, M., Acconcia, F., and Ascenzi, P. (2005). Estrogen receptor signalling:
bases for drug actions. Curr Drug Targets Immune Endocr Metabol Disord,
5(3):305–14. 10
Marino, M., Acconcia, F., Bresciani, F., Weisz, A., and Trentalance, A. (2002).
Distinct nongenomic signal transduction pathways controlled by 17betaestradiol regulate DNA synthesis and cyclin D(1) gene transcription in HepG2
cells. Mol Biol Cell, 13(10):3720–9. 10
Marino, M., Galluzzo, P., and Ascenzi, P. (2006). Estrogen signaling multiple
pathways to impact gene transcription. Curr Genomics, 7(8):497–508. 95
Markowetz, F., Bloch, J., and Spang, R. (2005). Non-transcriptional pathway
features reconstructed from secondary effects of RNA interference. Bioinformatics, 21(21):4026–32. 1, 34, 35
122
Literaturverzeichnis
Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R., and Tuschl, T.
(2002). Single-stranded antisense siRNAs guide target RNA cleavage in RNAi.
Cell, 110(5):563–74. 14
Martinez, J. and Tuschl, T. (2004). RISC is a 5’ phosphomonoester-producing
RNA endonuclease. Genes Dev, 18(9):975–80. 14
McKenna, N. J. and O’Malley, B. W. (2002). Combinatorial control of gene
expression by nuclear receptors and coregulators. Cell, 108(4):465–74. 9
Meister, G. and Tuschl, T. (2004). Mechanisms of gene silencing by doublestranded RNA. Nature, 431(7006):343–9. 12
Mirza, A., McGuirk, M., Hockenberry, T. N., Wu, Q., Ashar, H., Black, S.,
Wen, S. F., Wang, L., Kirschmeier, P., Bishop, W. R., Nielsen, L. L., Pickett,
C. B., and Liu, S. (2002). Human survivin is negatively regulated by wildtype p53 and participates in p53-dependent apoptotic pathway. Oncogene,
21(17):2613–22. 43
Morley, P., Whitfield, J. F., Vanderhyden, B. C., Tsang, B. K., and Schwartz,
J. L. (1992). A new, nongenomic estrogen action: the rapid release of intracellular calcium. Endocrinology, 131(3):1305–12. 10
Morlon, A. and Sassone-Corsi, P. (2003). The LIM-only protein FHL2 is a
serum-inducible transcriptional coactivator of AP-1. Proc Natl Acad Sci U S
A, 100(7):3977–82. 76, 95, 98
Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L.,
Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of
ribonucleoproteins containing numerous microRNAs. Genes Dev, 16(6):720–8.
13
Muller, J. M., Isele, U., Metzger, E., Rempel, A., Moser, M., Pscherer, A.,
Breyer, T., Holubarsch, C., Buettner, R., and Schule, R. (2000). FHL2, a novel
tissue-specific coactivator of the androgen receptor. EMBO J, 19(3):359–69.
98
Nemeth, A. L., Medveczky, P., Toth, J., Siklodi, E., Schlett, K., Patthy, A.,
Palkovits, M., Ovadi, J., Tokesi, N., Nemeth, P., Szilagyi, L., and Graf, L.
(2007). Unconventional translation initiation of human trypsinogen 4 at a
CUG codon with an N-terminal leucine. A possible means to regulate gene
expression. FEBS J, 274(6):1610–20. 88
123
Literaturverzeichnis
Nguyen, L. N., Holdren, M. S., Nguyen, A. P., Furuya, M. H., Bianchini, M.,
Levy, E., Mordoh, J., Liu, A., Guncay, G. D., Campbell, J. S., and Parks,
W. T. (2006). Sorting nexin 1 down-regulation promotes colon tumorigenesis.
Clin Cancer Res, 12(23):6952–9. 94
Nilsson, S. and Gustafsson, J. A. (2000). Estrogen receptor transcription and
transactivation: Basic aspects of estrogen action. Breast Cancer Res, 2(5):360–
6. 95
Nilsson, S., Makela, S., Treuter, E., Tujague, M., Thomsen, J., Andersson, G.,
Enmark, E., Pettersson, K., Warner, M., and Gustafsson, J. A. (2001). Mechanisms of estrogen action. Physiol Rev, 81(4):1535–65. 7, 8, 95
Nykänen, A., Haley, B., and Zamore, P. D. (2001). ATP requirements and small
interfering RNA structure in the RNA interference pathway. Cell, 107(3):309–
21. 14
Oh, D. S., Troester, M. A., Usary, J., Hu, Z., He, X., Fan, C., Wu, J., Carey,
L. A., and Perou, C. M. (2006). Estrogen-regulated genes predict survival in
hormone receptor-positive breast cancers. J Clin Oncol, 24(11):1656–64. 1
Olayioye, M. A., Neve, R. M., Lane, H. A., and Hynes, N. E. (2000). The ErbB
signaling network: receptor heterodimerization in development and cancer.
EMBO J, 19(13):3159–67. 99
O’Lone, R., Frith, M. C., Karlsson, E. K., and Hansen, U. (2004). Genomic
targets of nuclear estrogen receptors. Mol Endocrinol, 18(8):1859–75. 1, 9, 95
Osborne, C. K. (1998). Tamoxifen in the treatment of breast cancer. N Engl J
Med, 339(22):1609–18. 6
Osborne, C. K. and Schiff, R. (2005). Estrogen-receptor biology: continuing
progress and therapeutic implications. J Clin Oncol, 23(8):1616–22. 6, 81, 95
Park, S. H., Kim, H., and Song, B. J. (2002). Down regulation of bcl2 expression in invasive ductal carcinomas is both estrogen- and progesterone-receptor
dependent and associated with poor prognostic factors. Pathol Oncol Res,
8(1):26–30. 1, 39, 88
Pasqualini, J. R., Chetrite, G., Blacker, C., Feinstein, M. C., Delalonde, L.,
Talbi, M., and Maloche, C. (1996). Concentrations of estrone, estradiol, and
estrone sulfate and evaluation of sulfatase and aromatase activities in pre- and
postmenopausal breast cancer patients. J Clin Endocrinol Metab, 81(4):1460–
4. 5
124
Literaturverzeichnis
Perou, C. M., Jeffrey, S. S., van de Rijn, M., Rees, C. A., Eisen, M. B., Ross,
D. T., Pergamenschikov, A., Williams, C. F., Zhu, S. X., Lee, J. C., Lashkari, D., Shalon, D., Brown, P. O., and Botstein, D. (1999). Distinctive gene
expression patterns in human mammary epithelial cells and breast cancers.
Proc Natl Acad Sci U S A, 96(16):9212–7. 1
Philips, A., Teyssier, C., Galtier, F., Rivier-Covas, C., Rey, J. M., Rochefort,
H., and Chalbos, D. (1998). FRA-1 expression level modulates regulation of
activator protein-1 activity by estradiol in breast cancer cells. Mol Endocrinol,
12(7):973–85. 10
Picotto, G., Massheimer, V., and Boland, R. (1996). Acute stimulation of intestinal cell calcium influx induced by 17 beta-estradiol via the cAMP messenger
system. Mol Cell Endocrinol, 119(2):129–34. 10
Porter, W., Saville, B., Hoivik, D., and Safe, S. (1997). Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol,
11(11):1569–80. 10
Prives, C. and Hall, P. A. (1999). The p53 pathway. J Pathol, 187(1):112–26.
42
Razandi, M., Alton, G., Pedram, A., Ghonshani, S., Webb, P., and Levin, E. R.
(2003). Identification of a structural determinant necessary for the localization
and function of estrogen receptor alpha at the plasma membrane. Mol Cell
Biol, 23(5):1633–46. 12
Riggs, B. L., Khosla, S., and Melton, L. J., r. (1998). A unitary model for
involutional osteoporosis: estrogen deficiency causes both type I and type II
osteoporosis in postmenopausal women and contributes to bone loss in aging
men. J Bone Miner Res, 13(5):763–73. 94
Robertson, J. F. (2002). Estrogen receptor downregulators: new antihormonal
therapy for advanced breast cancer. Clin Ther, 24 Suppl A:A17–30. 76
Robertson, J. F. (2004). Selective oestrogen receptor modulators/new antioestrogens: a clinical perspective. Cancer Treat Rev, 30(8):695–706. 79, 81
Romero-Ramirez, L., Cao, H., Nelson, D., Hammond, E., Lee, A. H., Yoshida,
H., Mori, K., Glimcher, L. H., Denko, N. C., Giaccia, A. J., Le, Q. T., and
Koong, A. C. (2004). XBP1 is essential for survival under hypoxic conditions
and is required for tumor growth. Cancer Res, 64(17):5943–7. 41
125
Literaturverzeichnis
Rosenfeld, M. G. and Glass, C. K. (2001). Coregulator codes of transcriptional
regulation by nuclear receptors. J Biol Chem, 276(40):36865–8. 8
Russo, J. and Russo, I. H. (1994). Toward a physiological approach to breast
cancer prevention. Cancer Epidemiol Biomarkers Prev, 3(4):353–64. 3
Sabbah, M., Courilleau, D., Mester, J., and Redeuilh, G. (1999). Estrogen
induction of the cyclin D1 promoter: involvement of a cAMP response-like
element. Proc Natl Acad Sci U S A, 96(20):11217–22. 10
Saceda, M., Lippman, M. E., Chambon, P., Lindsey, R. L., Ponglikitmongkol,
M., Puente, M., and Martin, M. B. (1988). Regulation of the estrogen receptor
in MCF-7 cells by estradiol. Mol Endocrinol, 2(12):1157–62. 9, 55
Saceda, M., Lippman, M. E., Lindsey, R. K., Puente, M., and Martin, M. B.
(1989). Role of an estrogen receptor-dependent mechanism in the regulation
of estrogen receptor mRNA in MCF-7 cells. Mol Endocrinol, 3(11):1782–7.
55
Sagara, Y., Mimori, K., Yoshinaga, K., Tanaka, F., Nishida, K., Ohno, S., Inoue, H., and Mori, M. (2004). Clinical significance of Caveolin-1, Caveolin-2
and HER2/neu mRNA expression in human breast cancer. Br J Cancer,
91(5):959–65. 1
Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. (1995). Quantitative
monitoring of gene expression patterns with a complementary DNA microarray. Science, 270(5235):467–70. 1, 28
Schena, M., Shalon, D., Heller, R., Chai, A., Brown, P. O., and Davis, R. W.
(1996). Parallel human genome analysis: microarray-based expression monitoring of 1000 genes. Proc Natl Acad Sci U S A, 93(20):10614–9. 28
Schmitt, M., Bausero, P., Simoni, P., Queuche, D., Geoffroy, V., Marschal, C.,
Kempf, J., and Quirin-Stricker, C. (1995). Positive and negative effects of
nuclear receptors on transcription activation by ap-1 of the human choline
acetyltransferase proximal promoter. J Neurosci Res, 40(2):152–64. 10
Schwabe, J. W., Chapman, L., Finch, J. T., and Rhodes, D. (1993). The crystal
structure of the estrogen receptor DNA-binding domain bound to DNA: how
receptors discriminate between their response elements. Cell, 75(3):567–78. 9
126
Literaturverzeichnis
Schwarz, D. S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P. D.
(2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell,
115(2):199–208. 14
Shalon, D., Smith, S. J., and Brown, P. O. (1996). A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe
hybridization. Genome Res, 6(7):639–45. 28
Simpson, E., Rubin, G., Clyne, C., Robertson, K., O’Donnell, L., Jones, M., and
Davis, S. (2000). The role of local estrogen biosynthesis in males and females.
Trends Endocrinol Metab, 11(5):184–8. 5
Simpson, E. R. and Davis, S. R. (2001). Minireview: aromatase and the regulation of estrogen biosynthesis–some new perspectives. Endocrinology,
142(11):4589–94. 5
Simpson, E. R., Mahendroo, M. S., Means, G. D., Kilgore, M. W., Hinshelwood,
M. M., Graham-Lorence, S., Amarneh, B., Ito, Y., Fisher, C. R., Michael,
M. D., and et al. (1994). Aromatase cytochrome p450, the enzyme responsible
for estrogen biosynthesis. Endocr Rev, 15(3):342–55. 6
Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire,
W. L. (1987). Human breast cancer: correlation of relapse and survival with
amplification of the HER-2/neu oncogene. Science, 235(4785):177–82. 7
Slamon, D. J., Godolphin, W., Jones, L. A., Holt, J. A., Wong, S. G., Keith,
D. E., Levin, W. J., Stuart, S. G., Udove, J., Ullrich, A., and et al. (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer.
Science, 244(4905):707–12. 7
Smyth, G. K. (2004). Linear models and empirical bayes methods for assessing
differential expression in microarray experiments. Stat Appl Genet Mol Biol,
3:Article3. 33, 57, 72
Stewart, B. W. and Kleihues, P. (2003). World Cancer Report. IARCPress. 2
Stoica, G. E., Franke, T. F., Moroni, M., Mueller, S., Morgan, E., Iann, M. C.,
Winder, A. D., Reiter, R., Wellstein, A., Martin, M. B., and Stoica, A. (2003a).
Effect of estradiol on estrogen receptor-alpha gene expression and activity can
be modulated by the ErbB2/PI 3-K/Akt pathway. Oncogene, 22(39):7998–
8011. 88, 96
127
Literaturverzeichnis
Stoica, G. E., Franke, T. F., Wellstein, A., Czubayko, F., List, H. J., Reiter, R.,
Morgan, E., Martin, M. B., and Stoica, A. (2003b). Estradiol rapidly activates
Akt via the ErbB2 signaling pathway. Mol Endocrinol, 17(5):818–30. 39
Stossi, F., Likhite, V. S., Katzenellenbogen, J. A., and Katzenellenbogen, B. S.
(2006). Estrogen-occupied estrogen receptor represses cyclin G2 gene expression and recruits a repressor complex at the cyclin G2 promoter. J Biol Chem,
281(24):16272–8. 8, 40, 73, 87, 92, 96
Sun, M., Paciga, J. E., Feldman, R. I., Yuan, Z., Coppola, D., Lu, Y. Y., Shelley,
S. A., Nicosia, S. V., and Cheng, J. Q. (2001). Phosphatidylinositol-3-OH
Kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced
by estrogen receptor alpha (ERalpha) via interaction between ERalpha and
pi3k. Cancer Res, 61(16):5985–91. 88
Sun, X., Fontaine, J. M., Bartl, I., Behnam, B., Welsh, M. J., and Benndorf,
R. (2007). Induction of Hsp22 (HspB8) by estrogen and the metalloestrogen cadmium in estrogen receptor-positive breast cancer cells. Cell Stress
Chaperones, 12(4):307–19. 41, 61, 73
Suzuki, H., Ueda, T., Ichikawa, T., and Ito, H. (2003). Androgen receptor involvement in the progression of prostate cancer. Endocr Relat Cancer, 10(2):209–
16. 98
Suzuki, R. and Shimodaira, H. (2006). Pvclust: an R package for assessing the
uncertainty in hierarchical clustering. Bioinformatics, 22(12):1540–2. 68
Takekawa, M., Adachi, M., Nakahata, A., Nakayama, I., Itoh, F., Tsukuda, H.,
Taya, Y., and Imai, K. (2000). p53-inducible wip1 phosphatase mediates a
negative feedback regulation of p38 MAPK-p53 signaling in response to UV
radiation. EMBO J, 19(23):6517–26. 45
Tan, M., Wang, Y., Guan, K., and Sun, Y. (2000). PTGF-beta, a type beta
transforming growth factor (TGF-beta) superfamily member, is a p53 target
gene that inhibits tumor cell growth via TGF-beta signaling pathway. Proc
Natl Acad Sci U S A, 97(1):109–14. 43
Tashiro, E., Hironiwa, N., Kitagawa, M., Futamura, Y., Suzuki, S., Nishio, M.,
and Imoto, M. (2007). Trierixin, a novel Inhibitor of ER stress-induced XBP1
activation from Streptomyces sp. 1. Taxonomy, fermentation, isolation and
biological activities. J Antibiot (Tokyo), 60(9):547–53. 97
128
Literaturverzeichnis
Teixeira, C., Reed, J. C., and Pratt, M. A. (1995). Estrogen promotes chemotherapeutic drug resistance by a mechanism involving Bcl-2 proto-oncogene
expression in human breast cancer cells. Cancer Res, 55(17):3902–7. 40, 88
Testa, J. R. and Bellacosa, A. (2001). AKT plays a central role in tumorigenesis.
Proc Natl Acad Sci U S A, 98(20):10983–5. 96
Tijsterman, M., Ketting, R. F., and Plasterk, R. H. (2002). The genetics of
RNA silencing. Annu Rev Genet, 36:489–519. 12
Ullu, E., Tschudi, C., and Chakraborty, T. (2004). RNA interference in protozoan parasites. Cell Microbiol, 6(6):509–19. 12
Umayahara, Y., Kawamori, R., Watada, H., Imano, E., Iwama, N., Morishima,
T., Yamasaki, Y., Kajimoto, Y., and Kamada, T. (1994). Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1
enhancer. J Biol Chem, 269(23):16433–42. 10
Van Driessche, N., Demsar, J., Booth, E. O., Hill, P., Juvan, P., Zupan, B.,
Kuspa, A., and Shaulsky, G. (2005). Epistasis analysis with global transcriptional phenotypes. Nat Genet, 37(5):471–7. 68, 91
van ’t Veer, L. J., Dai, H., van de Vijver, M. J., He, Y. D., Hart, A. A., Mao, M.,
Peterse, H. L., van der Kooy, K., Marton, M. J., Witteveen, A. T., Schreiber,
G. J., Kerkhoven, R. M., Roberts, C., Linsley, P. S., Bernards, R., and Friend,
S. H. (2002). Gene expression profiling predicts clinical outcome of breast
cancer. Nature, 415(6871):530–6. 1, 88
Vlahos, C. J., Matter, W. F., Hui, K. Y., and Brown, R. F. (1994). A specific
inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1benzopyran-4-one (LY294002). J Biol Chem, 269(7):5241–8. 81
Vogel, C. L., Cobleigh, M. A., Tripathy, D., Gutheil, J. C., Harris, L. N., Fehrenbacher, L., Slamon, D. J., Murphy, M., Novotny, W. F., Burchmore, M., Shak,
S., Stewart, S. J., and Press, M. (2002). Efficacy and safety of trastuzumab
as a single agent in first-line treatment of HER2-overexpressing metastatic
breast cancer. J Clin Oncol, 20(3):719–26. 7, 98
Wagner, A. (2001). How to reconstruct a large genetic network from n gene
perturbations in fewer than n(2) easy steps. Bioinformatics, 17(12):1183–97.
1
129
Literaturverzeichnis
Wagner, A. (2002). Estimating coarse gene network structure from large-scale
gene perturbation data. Genome Res, 12(2):309–15. 1
Wagner, A. (2004). Reconstructing pathways in large genetic networks from
genetic perturbations. J Comput Biol, 11(1):53–60. 1
Ward, H. W. (1973). Anti-oestrogen therapy for breast cancer: a trial of tamoxifen at two dose levels. Br Med J, 1(5844):13–4. 6
Waterhouse, P. M., Wang, M. B., and Lough, T. (2001). Gene silencing as an
adaptive defence against viruses. Nature, 411(6839):834–42. 12
Webb, P., Lopez, G. N., Uht, R. M., and Kushner, P. J. (1995). Tamoxifen
activation of the estrogen receptor/AP-1 pathway: potential origin for the
cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol, 9(4):443–
56. 10
West, M., Blanchette, C., Dressman, H., Huang, E., Ishida, S., Spang, R., Zuzan,
H., Olson, J. A., J., Marks, J. R., and Nevins, J. R. (2001). Predicting the
clinical status of human breast cancer by using gene expression profiles. Proc
Natl Acad Sci U S A, 98(20):11462–7. 1, 41, 73
Xiong, Y., Hannon, G. J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D.
(1993). p21 is a universal inhibitor of cyclin kinases. Nature, 366(6456):701–4.
43
Xu, W., Ngo, L., Perez, G., Dokmanovic, M., and Marks, P. A. (2006). Intrinsic
apoptotic and thioredoxin pathways in human prostate cancer cell response
to histone deacetylase inhibitor. Proc Natl Acad Sci U S A, 103(42):15540–5.
81
Yager, J. D. and Davidson, N. E. (2006). Estrogen carcinogenesis in breast
cancer. N Engl J Med, 354(3):270–82. 5
Yarden, Y. and Sliwkowski, M. X. (2001). Untangling the ErbB signalling network. Nat Rev Mol Cell Biol, 2(2):127–37. 7
Zhang, D. and Trudeau, V. L. (2006). Integration of membrane and nuclear
estrogen receptor signaling. Comp Biochem Physiol A Mol Integr Physiol,
144(3):306–15. 9
Zupan, B., Demsar, J., Bratko, I., Juvan, P., Halter, J. A., Kuspa, A., and
Shaulsky, G. (2003). GenePath: a system for automated construction of genetic networks from mutant data. Bioinformatics, 19(3):383–9. 68, 91
130
Abbildungsverzeichnis
1.1
1.2
1.3
1.4
1.5
1.6
1.7
1.8
2.1
2.2
2.3
2.4
3.1
3.2
3.3
3.4
3.5
3.6
3.7
Schätzung der altersspezifischen Inzidenz in Deutschland 2004 .
Altersstandardisierte Inzidenz und Mortalität in Deutschland
1980-2004 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Schematischer Aufbau der Brustdrüse . . . . . . . . . . . . . . .
Schematischer Aufbau eines Milchgangs im Querschnitt . . . . .
Organisation der funktionellen Domänen des ERα . . . . . . . .
Bindung des ERα an die DNA . . . . . . . . . . . . . . . . . . .
Schematische Darstellung der verschiedenen Aktivitäten im ERαSignalweg . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Mechanismus der RNA Interferenz . . . . . . . . . . . . . . . .
Spaltung des Tetrazoliumsalzes WST-1 . . . . . . . . . . . . . .
Ausschnitt aus einem Fluorogramm mit identifzierten Signalen .
Schematische Darstellung der Quantifizierung der Fluoreszenzsignale . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Grundidee des NEM-Algorithmus . . . . . . . . . . . . . . . . .
Schematisch Darstellung der Zusammenhänge der Gene im Estrogenrezeptor Signalweg . . . . . . . . . . . . . . . . . . . . . . .
Selektive Reduktion der mRNA Konzentration von TP53 in HeLa
Validierung der genomweiten Expressionsanalyse nach TP53 Silencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Lebensfähigkeit der Zellen nach Transfektion mit unterschiedlichen siRNA Konzentrationen (AKT1 und AKT2 ) . . . . . . . .
Lebensfähigkeit der Zellen nach Transfektion mit unterschiedlichen siRNA Konzentrationen (FOXA1 und HSPB8 ) . . . . . .
Selektive Reduktion der mRNA Konzentration von AKT1 . . .
Relative Expressionsniveaus von ESR1 nach Behandlung mit
17β-Estradiol . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2
3
4
5
8
9
11
14
28
33
33
34
40
42
44
46
46
48
55
131
Abbildungsverzeichnis
3.8
3.9
3.10
3.11
3.12
3.13
3.14
3.15
4.1
4.2
Relative Expressionsniveaus von ESR1 nach Behandlung mit Tamoxifen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Hierarchische Clusteranalyse der post-transkriptionellen Genstilllegungen und der gemessenen Effekte . . . . . . . . . . . . . . .
Literaturnetzwerk der ausgewählten Gene . . . . . . . . . . . .
Inferriertes Netzwerk anhand des p-Wert Profils . . . . . . . . .
Epistaseanalyse von ESR1 und CCNG2 . . . . . . . . . . . . .
Epistaseanalyse von ESR1 und MAPK1 . . . . . . . . . . . . .
Epistaseanalyse von MAPK1 und STAT5B . . . . . . . . . . . .
Hierarchische Clusteranalyse E2, ESR1 -Silencing, Tamoxifen . .
56
59
66
69
70
71
72
78
Modell der Aktivierung des Estrogenrezeptors durch CCNG2 . .
Schematische Darstellungen der ERE-unabhängigen genomischen
Aktivität des Estrogenrezeptors . . . . . . . . . . . . . . . . . .
97
A.1 total RNA Probe hoher Integrität . . . . . . . . . . . . . . . . .
A.2 amplifizierte RNA Probe hoher Integrität . . . . . . . . . . . . .
A.3 Selektive Reduktion der mRNA Konzentration von AKT2 . . .
A.4 Selektive Reduktion der mRNA Konzentration von BCL2 . . . .
A.5 Selektive Reduktion der mRNA Konzentration von CCNG2 . . .
A.6 Selektive Reduktion der mRNA Konzentration von ESR1 . . . .
A.7 Selektive Reduktion der mRNA Konzentration von FOXA1 . . .
A.8 Selektive Reduktion der mRNA Konzentration von HSPB8 . . .
A.9 Selektive Reduktion der mRNA Konzentration von MAPK1 . .
A.10 Selektive Reduktion der mRNA Konzentration von STAT5B . .
A.11 Selektive Reduktion der mRNA Konzentration von STC2 . . . .
A.12 Selektive Reduktion der mRNA Konzentration von TMEM45B .
A.13 Selektive Reduktion der mRNA Konzentration von TP53 . . . .
A.14 Selektive Reduktion der mRNA Konzentration von XBP1 . . . .
A.15 Reduktion der mRNA Konzentration von CCNG2 und ESR1 . .
A.16 Reduktion der mRNA Konzentration von ESR1 und MAPK1 . .
A.17 Reduktion der mRNA Konzentration von MAPK1 und STAT5B
A.18 Hierarchische Clusteranalyse ESR1 gegen Tamoxifen . . . . . .
A.19 Hierarchische Clusteranalyse ESR1 -Stimulation gegen Tamoxifen
A.20 Hierarchische Clusteranalyse ESR1 gegen ESR1 -Stimulation . .
101
101
102
103
103
104
104
105
105
106
106
107
107
108
108
109
109
110
111
112
132
87
Tabellenverzeichnis
2.1
2.2
Verwendete TaqMan-Assays . . . . . . . . . . . . . . . . . . . .
Verwendete siRNA von Qiagen und Dharmacon . . . . . . . . .
20
20
3.1
3.2
3.3
3.4
Ausgewählte Gene für die post-transkriptionelle Genstilllegung .
Resultate TP53 Knockdown HeLa . . . . . . . . . . . . . . . . .
Zusammenfassung der post-transkriptionellen Genstilllegungen .
Zusammenfassung der kombinatorischen post-transkriptionellen
Genstilllegungen . . . . . . . . . . . . . . . . . . . . . . . . . . .
Zusammenfassung der genomweiten Expressionsprofile . . . . . .
Expressionswerte einzelner Gene nach AKT2 Silencing . . . . .
Expressionswerte einzelner Gene nach CCNG2 Silencing . . . .
Expressionswerte einzelner Gene nach ESR1 Silencing . . . . . .
Expressionswerte einzelner Gene nach kombinatorischem
ESR1 /MAPK1 Silencing . . . . . . . . . . . . . . . . . . . . . .
Expressionswerte einzelner Gene FOXA1 Silencing . . . . . . .
Signifikant veränderte Expressionswerte nach 17β-Estradiol Behandlung . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Signifikant veränderte Expressionswerte nach Tamoxifen Behandlung . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Gegenläufig exprimierte Gene nach ESR1 Silencing und Tamoxifen Behandlung . . . . . . . . . . . . . . . . . . . . . . . . . . .
Gleichartig regulierte Gene nach ESR1 -Stimulation und Tamoxifen Behandlung . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vergleich ESR1 Silencing mit Connectivity Map Daten . . . . .
Vergleich ESR1 -Stimulation mit Connectivity Map Daten . . .
Vergleich ESR1 -Inhibition mit Connectivity Map Daten . . . .
Vergleich AKT2 -Silencing mit Connectivity Map Daten . . . . .
Vergleich CCNG2 -Silencing mit Connectivity Map Daten . . . .
Vergleich XBP1 -Silencing mit Connectivity Map Daten . . . . .
38
43
51
3.5
3.6
3.7
3.8
3.9
3.10
3.11
3.12
3.13
3.14
3.15
3.16
3.17
3.18
3.19
3.20
54
58
60
61
61
62
63
73
74
75
77
80
80
82
82
83
84
133
Abkürzungsverzeichnis
µ . . . . . . . . . . . . . . . . . micro
◦C
. . . . . . . . . . . . . . . . Grad Celsius
Abb. . . . . . . . . . . . . . Abbildung
AF-1 . . . . . . . . . . . . . Activation Function 1
AF-2 . . . . . . . . . . . . . Activation Function 2
AP-1 . . . . . . . . . . . . . Activator Protein 1
ATP . . . . . . . . . . . . . . Adenosintriphosphat
ca. . . . . . . . . . . . . . . . . circa
cAMP . . . . . . . . . . . . cyclisches Adenosinmonophosphat
cDNA . . . . . . . . . . . . complementary DNA
DBD . . . . . . . . . . . . . DNA Binding Domain
DMSO . . . . . . . . . . . Dimethylsulfoxid
DNA . . . . . . . . . . . . . Desoxyribonukleinsäure
dsRNA . . . . . . . . . . . double stranded RNA
DTT . . . . . . . . . . . . . 1,4-Bis(sulfanyl)butan-2,3-diol
E2 . . . . . . . . . . . . . . . . 17β-Estradiol
EDTA . . . . . . . . . . . . Ethylendiamintetraacetat
EGF . . . . . . . . . . . . . . Epidermal Growth Factor
ER . . . . . . . . . . . . . . . Estrogenrezeptor
ERα . . . . . . . . . . . . . . Estrogenrezptor alpha
ERβ . . . . . . . . . . . . . . Estrogenrezeptor beta
ERE . . . . . . . . . . . . . . Estrogen Response Elements
FBS . . . . . . . . . . . . . . Fetal Bovine Serum
FC . . . . . . . . . . . . . . . Fold Change
g . . . . . . . . . . . . . . . . . Gramm; Erdbeschleunigung
135
Abkürzungsverzeichnis
GEO . . . . . . . . . . . . . Gene Expression Omnibus
ggf. . . . . . . . . . . . . . . . gegebenenfalls
h . . . . . . . . . . . . . . . . . Stunden
ICD . . . . . . . . . . . . . . International Classification of Diseases
l . . . . . . . . . . . . . . . . . . Liter
LBD . . . . . . . . . . . . . . Ligand Binding Domain
LH . . . . . . . . . . . . . . . luteinisierendes Hormon
LHRH . . . . . . . . . . . . Luteinizing-Hormone-Releasing hormone
M . . . . . . . . . . . . . . . . Mol
M . . . . . . . . . . . . . . . . molar
m . . . . . . . . . . . . . . . . milli
MCF . . . . . . . . . . . . . Michigan Cell Foundation
miRNA . . . . . . . . . . . micro RNA
miRNP . . . . . . . . . . . micro Ribonuclear Particle
n . . . . . . . . . . . . . . . . . nano
NEM . . . . . . . . . . . . . Nested Effects Model
PBS . . . . . . . . . . . . . . Phosphate Buffered Saline
PCR . . . . . . . . . . . . . Polymerase Chain Reaction
qRT-PCR . . . . . . . . quantitative realtime PCR
rasiRNA . . . . . . . . . . repeat-associated RNA
RISC . . . . . . . . . . . . . RNA Induced Silencing Complex
RNA . . . . . . . . . . . . . Ribonukleinsäure
RNAi . . . . . . . . . . . . . RNA Interferenz
RNI . . . . . . . . . . . . . . RNA Integritry Number
SDS . . . . . . . . . . . . . . Sodium Dodecylsulfatae
SERM . . . . . . . . . . . . Selective Estrogen Receptor Modulator
siRNA . . . . . . . . . . . . small interferening RNA
Sp-1 . . . . . . . . . . . . . . Stimulating Protein 1
SSC . . . . . . . . . . . . . . Standard Saline Citrate
U . . . . . . . . . . . . . . . . . Units
u. a. . . . . . . . . . . . . . . unten angegeben
UTR . . . . . . . . . . . . . Untranslated Region
v/v . . . . . . . . . . . . . . . volume per volume
136
Die hier vorgelegte Dissertation habe ich eigenständig und ohne unerlaubte Hilfe
angefertigt. Die Dissertation wurde in der vorgelegten oder in ähnlicher Form
noch bei keiner anderen Institution eingereicht. Ich habe bisher keine erfolglosen
Promotionsversuche unternommen.
Heidelberg, den 26.08.2008
Mark Fellmann
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising