Dissertation Stephan Meinke

Dissertation Stephan Meinke
Dissertation
submitted to the
Combined Faculties for the Natural Sciences and for Mathematics
of the Ruperto-Carola University of Heidelberg, Germany
for the degree of
Doctor of Natural Sciences
presented by
Diplom-Biochemiker Stephan Meinke
born in: Hamburg
Oral-examination: _______________
Regulation of human lymphocytes by
SLAM-related receptors
Referees: PD Dr. U. Klingmüller
Prof. Dr. C. Watzl
Acknowledgements
First of all I thank Prof. Dr. Carsten Watzl. Thank you for your excellent supervision,
and your helpful discussions. Your motivating optimism and your enthusiasm for
scientific issues supported me very much.
Furthermore I highly appreciate that PD Dr. Ursula Klingmüller agreed to represent
this work in the Faculty of Natural Science of the University Heidelberg.
I also express my gratitude towards Dr. Guido Wabnitz our cooperation partner in the
T cell project. Thank you very much for your productive ideas, practical advice and
for providing crucial reagents.
Then I want to thank all past and present members of the Watzllab-crew: Philipp
Eissmann, Johanna Endt, Sabrina Hoffmann, Doris Urlaub, Maren Claus, Kristine
Kohl, Stefanie Margraf-Schönfeld, Ewelina Miczka, Sabine Wingert, Birgitta
Messmer, Mina Sandusky, Patrick Rämer, Rauf Bhat, André Cohnen, Stephan
Gütgemann, and Wolfgang Merkt. Thank you for fruitful discussions, for all you
taught me, and for your friendship. You helped me to keep my spirits up and made
me feel at home in the lab.
I also thank the following cooperation partners that contributed to parts of this work:
Dr. David Nutt, formerly at the Interdisciplinary Center for Scientific Computing, for
his calculations on the NTB-A structure; Dr. Matthias Konstandin, formerly at the
department of cardiology, for recruiting the patients and collecting the blood samples;
and the group of PD Dr. Thomas Giese at the Institute for immunology for performing
quantitative RT-PCR on our mRNA samples.
In addition, I thank all members of our institute who were involved in the recruitment
of blood donors, collection of blood samples and isolation of T cells.
Furthermore I also thank all the other members of the institute who readily supported
me when I asked for help or advice.
Finally, there are also persons from my private life I like to thank: My parents, my
sister and my brother and all my friends for their backup.
Thank you very much!
TABLE OF CONTENTS
I
Summary......................................................................................................................1 Zusammenfassung.......................................................................................................3 1 Introduction.............................................................................................................5 1.1 T lymphocytes and natural killer cells ..............................................................5 1.1.1 Innate and adaptive immunity ...................................................................5 1.1.2 Natural killer cells and T lymphocytes .......................................................5 1.1.3 Activation of T cells ...................................................................................6 1.1.4 Functions of T cells ...................................................................................8 1.1.5 T cell memory..........................................................................................10 1.1.6 Activation of NK cells...............................................................................10 1.1.7 Functions of NK cells...............................................................................12 1.2 The SLAM family of immunoglobulin like receptors .......................................14 1.2.1 SLAM-related receptors ..........................................................................14 1.2.2 Expression and functions of the SRR 2B4, NTB-A and CRACC.............15 1.2.3 XLP, a severe immune disorder caused by defective SRR signaling .....18 1.2.4 Molecular mechanisms of SLAM-related receptor signaling ...................20 2 Aims of the Thesis ................................................................................................26 3 Materials and methods .........................................................................................27 3.1 Materials ........................................................................................................27 3.1.1 Mouse monoclonal antibodies.................................................................27 3.1.2 Rabbit polyclonal antibodies....................................................................28 3.1.3 Secondary antibodies..............................................................................28 3.1.4 Bacteria ...................................................................................................28 3.1.5 Buffers .....................................................................................................28 3.1.6 Cells (eukaryotic).....................................................................................30 3.1.7 Enzymes..................................................................................................31 3.1.8 Kits ..........................................................................................................31 3.1.9 Oligonucleotides......................................................................................32 3.1.10 Plasmids................................................................................................33 3.1.11 Reagents ...............................................................................................34 3.1.12 siRNA ....................................................................................................35 3.2 Patients ..........................................................................................................35 3.3 Methods .........................................................................................................35 3.3.1 Molecular biology ....................................................................................35 TABLE OF CONTENTS
II
3.3.2 Cell biology..............................................................................................37 3.3.3 Protein biochemistry................................................................................42 3.3.4 Statistical analysis ...................................................................................43 4 Results..................................................................................................................44 4.1 The molecular basis for the homophilic NTB-A interaction ............................44 4.1.1 Mutational analysis of the homophilic NTB-A interaction ........................44 4.1.2 Introducing complementary mutations to create a heterophilic pair of
NTB-A mutants........................................................................................47 4.2 Early events in SLAM-related receptor signaling ...........................................50 4.2.1 Association of SAP with 2B4 is dispensable for receptor phosphorylation .
................................................................................................................50 4.2.2 EAT-2 recruitment to 2B4 is dependent on the presence of SAP ...........52 4.2.3 NTB-A-phosphorylation is also independent of SAP association............52 4.2.4 EAT-2 does not bind to NTB-A in the absence SAP ...............................52 4.2.5 2B4 phosphorylation is also SAP-independent in the cell line YTS ........53 4.2.6 Establishing a method for knockdown of protein expression in primary .....
NK cells ...................................................................................................54 4.2.7 SAP is the relevant adapter molecule for 2B4 and NTB-A-triggered
cytotoxicity...............................................................................................56 4.3 Functions of NTB-A and CRACC in T cells....................................................57 4.3.1 Co-stimulation through NTB-A and CRACC induces cytokine production ..
................................................................................................................60 4.3.2 Co-stimulation with the anti-CRACC antibody is specific ........................62 4.3.3 CRACC is expressed on memory T cells and activated T cells ..............63 4.3.4 CRACC co-stimulation is no positive feedback mechanism to enhance
proliferation..............................................................................................65 4.3.5 Co-stimulation through CRACC induces proliferation in CD4 and CD8positive cells ............................................................................................67 4.3.6 CRACC and NTB-A do not enhance cytotoxicity ....................................68 4.3.7 CRACC is expressed on CD28-negative T cells .....................................69 5 Discussion ............................................................................................................71 5.1 Mutational analysis of the homophilic interaction of NTB-A...........................71 5.2 Early events in SLAM-related receptor signaling ...........................................73 5.2.1 Phosphorylation of 2B4 and NTB-A is independent of SAP....................73 TABLE OF CONTENTS
III
5.2.2 The cytotoxic response to 2B4 and NTB-A engagement is mediated by
SAP and not EAT-2 .................................................................................75 5.2.3 Association of EAT-2 with 2B4 and NTB-A is SAP dependent ...............77 5.2.4 An altered model of activating 2B4 and NTB-A signaling........................78 5.3 The functions of CRACC and NTB-A in T cells..............................................78 5.3.1 Co-stimulatory features of NTB-A ...........................................................78 5.3.2 CRACC like NTB-A is a co-stimulatory receptor .....................................80 5.3.3 CRACC, a co-stimulatory receptor expressed on proliferating T cells ....81 5.3.4 CRACC, a co-stimulatory receptor on memory T cells............................82 5.3.5 A possible role for CRACC in chronic inflammatory diseases.................83 6 References ...........................................................................................................85 7 Abbreviations......................................................................................................101 8 Publications ........................................................................................................103 SUMMARIES
1
Summary
The six members of the SLAM-related receptor family are expressed on many cell
types of the immune system and play a role in fine-tuning of immune responses. In
this study we investigated the SLAM-related receptors 2B4, NTB-A and CRACC.
2B4 and NTB-A are activating receptors on human natural killer (NK) cells. 2B4 binds
to CD48, NTB-A is homophilic. The molecular basis for the homophilic NTB-A
interaction has been identified by crystal structure analysis, but the results have not
been tested in functional assays. Using mutational analysis we could show that the
residues H54 and S90 are very important for functional homophilic interaction
between two NTB-A molecules, whereas the residues E37 and Q88 are not.
After binding to their ligands 2B4 and NTB-A recruit the two adapter molecules SAP
and EAT-2. Although many elements of 2B4 and NTB-A signaling have been
described, the early events in their signal transduction are not fully understood. In
this study we could show that in human natural killer cells the phosphorylation of 2B4
and NTB-A takes place independently of SAP. However, both receptors need the
presence of SAP to trigger cytotoxic responses. The adapter EAT-2 does not bind to
the phosphorylated receptors in the absence of SAP. This leads to the conclusion
that SAP association with the receptors is the crucial prerequisite for further signaling
events, including the recruitment of EAT-2.
CRACC is an activating receptor on NK cells triggering cytotoxicity and enhancing
cytokine production. The receptor is also expressed on a subset of CD8-positive and
few CD4-positive T cells, but the function of CRACC on these cells is unknown. In
this study we describe CRACC as co-stimulatory receptor on T cells. Simultaneous
engagement of the T cell receptor and CRACC induces expression of activation
markers, proliferation and cytokine production. T cell-mediated cytotoxicity is not
enhanced by engagement of CRACC. We found that CRACC is expressed mainly on
CD8-positive memory T cells, and its expression is induced on CD8-positive T cells
by activation. Therefore we suggest that CRACC co-stimulation supports the
expansion of activated cells and facilitates the re-activation of memory T cells.
Furthermore we could detect CRACC expression on CD4-positive, CD28-negative T
cells in patients with unstable angina pectoris. This population appears in patients
with chronic inflammatory diseases and amplifies the inflammatory process. We
SUMMARIES
2
suggest that CRACC co-stimulation could be involved in the continuous activation of
these cells, and therefore is a possible therapeutical target.
SUMMARIES
3
Zusammenfassung
Die SLAM verwandten Rezeptoren sind eine Rezeptorfamilie, deren sechs Mitglieder
auf vielen verschiedenen Zelltypen des Immunsystems vorkommen, wo sie an der
Feinabstimmung von Immunantworten beteiligt sind. In dieser Arbeit wurden die
SLAM verwandten Rezeptoren 2B4, NTB-A und CRACC untersucht.
2B4 und NTB-A sind aktivierende Rezeptoren auf natürlichen Killerzellen (NK-Zellen)
des Menschen. 2B4 bindet an CD48, NTB-A ist homophil. Die molekulare Grundlage
für die homophile Interaktion von NTB-A wurde durch Kristallstrukturanalyse
aufgeklärt, aber die Ergebnisse wurden noch nicht in Experimenten funktionell
bestätigt.
Durch
Mutationsexperimente
konnten
wir
zeigen,
dass
die
Aminosäurereste H54 und S90 für die homophile Interaktion eine sehr wichtige Rolle
spielen, während die Reste E37 und Q88 weniger wichtig sind.
Im aktivierten Zustand rekrutieren die Rezeptoren 2B4 und NTB-A die beiden
Adaptermoleküle
SAP
und
EAT-2.
Obwohl
schon
viele
Elemente
der
Signaltransduktion durch 2B4 und NTB-A beschrieben wurden, sind viele der
Ereignisse am Beginn der Signalweiterleitung ungeklärt. Wir konnten zeigen, dass in
humanen NK-Zellen die Phosphorylierung von 2B4 und NTB-A unabhängig von SAP
stattfindet. Um eine zytotoxische Reaktion auszulösen, sind beide Rezeptoren
allerdings auf SAP angewiesen. Das Adaptermolekül EAT-2 zeigt in Abwesenheit
von SAP keine Bindung an die phosphorylierten Rezeptoren. Das führt zu dem
Schluss, dass die Assoziation von SAP mit den phosphorylierten Rezeptoren die
unerlässliche Voraussetzung für weitere Signaltransduktionsschritte ist, so auch für
die Bindung von EAT-2 an die Rezeptoren.
CRACC ist ein aktivierender NK-Zellrezeptor, der Zytotoxizität und Zytokinproduktion
auslöst. Außerdem wird dieser Rezeptor von einem Teil der CD8-positiven und
wenigen CD4-positiven T-Zellen exprimiert, wobei seine Funktion auf diesen Zellen
nicht bekannt ist. In dieser Arbeit zeigen wir, dass CRACC ein kostimulatorischer
Rezeptor auf T-Zellen ist. Eine gleichzeitige Stimulation von T-Zellrezeptor und
CRACC
führt
zur
Expression
von
Aktivierungsmarkern,
Proliferation
und
Zytokinproduktion. Auf die Zytotoxizität von T-Zellen hat die Aktivierung von CRACC
keinen verstärkenden Einfluss. Wir konnten zeigen, dass CRACC hauptsächlich auf
CD8-positiven Gedächtnis-T-Zellen exprimiert wird, und dass seine Expression auf
CD8-positiven T Zellen durch Aktivierung induziert wird. Deshalb vermuten wir, dass
SUMMARIES
4
Kostimulation von CRACC die Vermehrung von aktivierten T-Zellen begünstigt und
die Reaktivierung von Gedächtnis T-Zellen erleichtert.
Außerdem konnten wir eine Expression von CRACC auf CD4-positiven, CD28negativen T Zellen von Patienten mit instabiler Angina pectoris feststellen. Diese
Zellpopulation tritt bei Patienten mit chronischen entzündlichen Erkrankungen auf
und verstärkt die Entzündungsprozesse. Wir vermuten, dass Kostimulation durch
CRACC an der fortdauernden Aktivierung dieser Zellen beteiligt sein könnte und
deshalb ein mögliches Ziel für neue therapeutische Ansätze darstellt.
INTRODUCTION
5
1 Introduction
1.1
T lymphocytes and natural killer cells
1.1.1 Innate and adaptive immunity
The mammalian immune system has developed a variety of different cell types that
are involved in the detection and clearance of pathogens. These cells are divided into
two groups termed cells of the innate and the adaptive immune system. Cells of the
innate immune system are regulated by germ line encoded receptors recognizing
common structures expressed by pathogens or signals that are induced by
pathogens. Therefore cells of the innate immunity can react immediately upon
encounter of pathogens. Cells of the adaptive part allow the immune system to react
to a multitude of molecular structures by receptors that are generated through rearrangement of germ line encoded segments. These receptors are expressed in a
clonal fashion, and cells bearing a specific receptor for the encountered pathogen
have to undergo proliferation before they can mount an effective immune response.
Thus, the innate immune system serves as a first line of defense keeping pathogens
under control, until they can be cleared by an adaptive response.
1.1.2 Natural killer cells and T lymphocytes
Natural killer (NK) cells and T cells are representatives of the innate and the adaptive
part of the immune system, respectively. Both develop from a common bipotential
progenitor in the bone marrow (1) and share some properties despite their
classification into innate and adaptive immune cells. T cell progenitors migrate to the
thymus, where the genetic recombination of the T cell receptor gene and selection of
T cells takes place. NK cells develop in the bone marrow.
The majority of lymphocytes in peripheral blood are T cells, whereas only 5 to 15 %
are NK cells. T cells that emerge from the thymus are called naïve T cells, because
they have not encountered their specific antigen yet. These naïve cells constantly recirculate through secondary lymphoid organs like spleen, gut or mucosa-associated
lymphoid tissues and lymph nodes, where they screen antigen-presenting cells for
their specific antigen (2).
NK cells are also present in secondary lymphoid organs; about 5 % of lymphocytes in
lymph nodes are NK cells. Other non-lymphoid tissues like lung and liver are also
frequented by NK cells (1, 3).
INTRODUCTION
6
While T cells can be identified by expression of the T cell receptor, human NK cells
have been defined as T cell receptor-negative cells expressing CD56. Recently the
receptor NKp46 has been described to be a more specific NK cell marker, as it is
expressed on human and murine NK cells (4, 5).
1.1.3 Activation of T cells
T cells are characterized by the clonal expression of unique T cell receptors (TCR)
that allow them to recognize specific peptide antigens. Recognition of the antigen
leads to T cell activation. To be recognized by the TCR the antigenic peptides have
to be bound by specialized glycoproteins called major histocompatibility complex
(MHC) molecules. Polymorphy and polygeny of the MHC molecules ensure that a
large variety of peptides can be presented to T cells. There are two types of MHC
molecules that present antigen from different sources. Peptides derived from proteins
in the cytosol are presented on the cell surface by MHC class I molecules, which are
expressed on all nucleated cells. MHC class I-bound peptides are recognized by
cytotoxic T cells expressing the co-receptor CD8. This enables them to detect
intracellular pathogens like viruses and eliminate the infected cells. So-called
antigen-presenting cells like macrophages or B cells take up antigens from
extracellular pathogens and present antigenic peptides bound to MHC class II
molecules. The peptides derived from extracellular antigens are loaded onto the
MHC class II molecules in vesicular compartments. MHC class II-bound peptides are
recognized by T cells expressing the co-receptor CD4. Therefore these T cells can
provide help to antigen-presenting cells that have taken up antigen from extracellular
pathogens.
The TCR consists of several proteins. A heterodimer formed by α- and β-chain
recognizes the specific antigen presented by MHC molecules. This variable part is
different on each T cell clone. The constant TCR component is the CD3 complex that
mediates signal transduction of the TCR. It consists of one γ chain, one δ chain, two ε
chains, and two ζ chains. The antigen specificity of the α- and β-chain is determined
through random rearrangement of germ line encoded segments, which takes place
during T cell development in the thymus. This recombination process allows
generation of a vast number of TCR specificities. As the recombination process is
random, the receptors can be specific for any possible peptide, including peptides
derived from self-proteins. To prevent autoimmunity T cells expressing receptors that
bind to self-antigens are deleted in the thymus. Because not all possible
INTRODUCTION
7
autoantigens are expressed in the thymus, activation of naïve T cells that have not
been deleted in the thymus has to be controlled in the periphery.
One mechanism of activation control is the strong dependency on a second signal in
addition to TCR engagement (6, 7). Only very strong TCR signals are able to fully
activate naïve T cells and induce proliferation and differentiation (8, 9). The costimulatory signal allows full activation of T cells at lower thresholds. The absence of
a co-stimulatory signal during engagement of the TCR on naïve T cells normally
results in anergy (10, 11). The co-stimulatory signals are provided only by specialized
antigen-presenting cells like mature dendritic cells or B cells (12). The encounter of
naïve T cells with antigen-presenting cells takes place in secondary lymphoid organs
like lymph nodes, spleen or Peyer's patches in gut associated lymphoid tissue. The
activation of antigen-presenting cells and expression of co-stimulatory ligands are
induced by signals from the innate part of the immune system.
The interaction of the receptor CD28 on T cells with CD80 (B7.1) or CD86 (B7.2) on
antigen-presenting cells is generally regarded as the primary co-stimulatory pathway,
although other co-stimulatory pathways exist. The most important effects of CD28 costimulation are the stabilization of interleukin-2 (IL-2) mRNA and expression of the
IL-2 receptor α-chain, which associates with the β and γ-chain to form the highaffinity IL-2 receptor (13, 14). Stimulation through IL-2 is crucial for T cell
proliferation. Thus, co-stimulation of T cells triggers a positive feedback loop,
enabling autocrine induction of proliferation. During this clonal expansion naïve T
cells differentiate into effector T cells. The effector T cells leave the secondary
lymphoid organs and are guided by chemokines to the site of infection. Effector
functions of these cells can be triggered by engagement of the T cell receptor without
co-stimulation.
The original notion was that a co-stimulatory receptor activates a distinct signaling
pathway, which is needed as a second signal besides TCR signaling (15). Therefore
the co-stimulating effect of CD28 was regarded as an independent signal that
complements the TCR signal. In the meantime it has become evident that CD28
signaling rather enhances TCR signals than contributing qualitatively different signals
(16). This is supported by the identification of many other receptors with costimulatory ability that do not use the same signaling pathways as CD28. These costimulatory receptors belong to a variety of different families (17): Another costimulatory receptor from the CD28-family is ICOS; other receptors like 4-1BB, OX40
INTRODUCTION
8
and CD27 belong to the tumor necrosis factor (TNF)-family; there are co-stimulatory
members of the immunoglobulin superfamily like CD2 or the SLAM-related receptors
SLAM, 2B4, NTB-A and CD84; furthermore integrins, tetraspanins, members of the T
cell immunoglobulin and mucin domain (TIM)-family and receptors from the superfamily with scavenger receptor cystein-rich domains have been found to have costimulatory properties. The circumstances, under which any of these co-stimulatory
receptors gain importance, still need to be investigated.
Activation of CD8-positive T cells seems to be controlled by a further mechanism,
possibly because an autoimmune reaction of CD8-positive cells can cause serious
damage due to their cytotoxic potential. It has been shown that they need stronger
co-stimulation than CD4-positive cells (18). Activated CD4-positive T cells can
stimulate dendritic cells to increase the expression level of co-stimulatory molecules
on their surface, thus providing support for the activation of CD8-positive T cells (18).
Because the CD4-positive T cells must recognize different peptides presented by the
same antigen-presenting cell for enhancing the co-stimulation, the risk of activating
self-reactive CD8-positive T cells is further reduced.
Because proliferation of activated T cells is enhanced by a positive feedback-loop,
the proliferative response must be controlled by inhibitory mechanisms. One of these
mechanisms is the down-regulation of CD28 expression on activated T cells (19).
This down-regulation interrupts the co-stimulatory signals. In addition, activated cells
express the inhibitory receptor CTLA-4. CTLA-4 binds to the same ligands on
antigen-presenting cells as CD28, but with higher affinity. Thus the expression of
CTLA-4 limits the proliferative response of activated T cells (20). By these means the
positive feedback loop of autocrine IL-2 secretion, which is triggered by costimulation, is interrupted in a T cell intrinsic manner.
1.1.4 Functions of T cells
T cells are among the most versatile cells of the immune system fulfilling a variety of
functions. The CD8-positive T cells that make up about one third of periphal blood T
cells are capable of eliminating infected cells. They can induce apoptosis of those
cells via the release of perforin and granzymes from intracellular granules or via the
engagement of apoptosis-inducing death receptors on the target cell by Fas ligand or
TRAIL.
About two thirds of peripheral blood T cells express CD4 and shape and coordinate
innate and adaptive immune responses through secretion of cytokines and
INTRODUCTION
9
expression of membrane associated proteins. They can differentiate into a variety of
effector subsets with different functions depending mainly on the cytokines present in
the microenvironment during their activation. Five different effector phenotypes of
CD4-positive T cells have been characterized (21). There are four different types of
helper T cells named T helper (Th) 1, 2 or 17 and follicular helper T (Tfh) cells. A fifth
group of CD4-positive effector T cells are regulatory T cells (Treg). In the immature
effector stage, where activated CD4-positive cells still have the potential to develop
into any of these effector cell types, they are called Th0 cells. Th1 cells are
characterized by their production of the cytokine interferon-γ (IFN-γ) and are involved
in cellular immunity against intracellular pathogens. Development of Th1 cells is
induced by IL-12, which can be secreted by macrophages or dendritic cells, and
IFN-γ secreted by NK cells or other T cells. Th2 cells secrete IL-4, IL-5 and IL-13.
They play a pivotal role in the humoral immune response against helminths and other
extracellular pathogens. A polarization towards Th2 effector development is mediated
by IL-4. Besides promotion of Th1 or Th2 responses, the cytokines IFN-γ and IL-4
suppress the differentiation of the respective counterpart. The name Th17 cells was
coined after their production of IL-17. They also release IL-22 and are important for
the clearance of extracellular bacteria and fungi, especially at mucosal surfaces. In
vitro their development can be induced by transforming growth factor-β (TGF-β) in
combination with the pro-inflammatory cytokines IL-6, IL-21 and IL-23. Tfh cells
regulate and promote B cell responses in B cell follicles and need IL-21 for their
development. Treg cells play a crucial role in the maintenance of immune tolerance
and the prevention of autoimmunity, as they can suppress T cell mediated immune
responses.
A minority of T cells named γδ T cells expresses a TCR generated from different
germ line encoded fragments. The TCR of these cells are of lower variability and can
bind to certain phosphorylated non-peptide-antigens. These antigens are often of
bacterial origin, therefore γδ T cells seem to play a role in antibacterial immune
responses. There is also a rare T cell subset termed natural killer T cells. They
display a limited TCR diversity and recognize glycolipids bound to CD1d. Activated
NKT cells can shape innate and adaptive immune responses by secretion of IFN-γ
and IL-4. Because of their restricted variability in antigen recognition γδ T cells and
NKT cells are considered part of the innate immune system.
INTRODUCTION
10
1.1.5 T cell memory
One hallmark of adaptive immunity is the improved immune response upon reencounter of pathogens. This immunological memory is established by the
development of memory cells during an adaptive immune response. Upon encounter
with specific antigen the proliferation of activated T cells gives rise to large numbers
of effector cells that are needed for clearance of the infection. After accomplishment
of their task these cells are removed by several mechanisms (22). One is the
deprivation of cytokines that renders the activated effector cells susceptible to
apoptosis. Another mechanism is the re-stimulation induced cell death that occurs
when already activated cells are stimulated through their TCR during the contraction
phase of an immune response. The re-stimulated cells then also undergo apoptosis.
Some of the activated T cells differentiate into memory cells. These cells are more
resistant to apoptosis and are not affected by the mechanisms of deletion. According
to the current model, memory cells circulate in the periphery and maintain their
numbers through homeostatic proliferation. In a simple approach, memory cells can
be divided into central memory cells that re-circulate through secondary lymphoid
organs like naïve T cells, and effector memory cells that stay in the periphery (23,
24). Recent reports suggest that the bone marrow provides a niche, where memory
cells are maintained (25-27).
The improved immune response upon re-infection is based on several factors (28).
Memory T cells specific for the respective antigens of the pathogen are more
frequent than antigen-specific naïve T cells during the first infection. This gives the
secondary response a broader basis. Furthermore, memory T cells can more rapidly
acquire effector functions, which reduces the time-span needed to mount the
secondary response. In addition, effector memory T cells circulate in the periphery
and can act directly upon encounter of pathogen at the site of infection. Therefore
memory T cell responses are stronger and faster than the T cell response against
newly encountered pathogens.
1.1.6 Activation of NK cells
In contrast to T cells the activation of NK cells is not dependent on the specificity of
one receptor, but is regulated by the interplay of activating and inhibitory germ line
encoded receptors (29).
Inhibitory receptors on human NK cells are members of the family of killer cell
immunoglobulin-like receptors (KIR) or members of the C-type lectin-like NKG2-
INTRODUCTION
11
family that form heterodimers with CD94 (30). KIR bind to MHC class I molecules,
but their specificity is not dependent on the MHC-bound peptide, although the
peptide contributes to KIR binding (31). Specificity of KIR is determined by the
allotype of the MHC molecules. NKG2/CD94 heterodimers recognize the nonclassical MHC molecule HLA-E, which presents peptides derived from the leader
peptides of other MHC molecules. The concept of NK cell inhibition by MHC
molecules is called the detection of 'missing self' (32, 33). Down-regulation of MHC
class I molecules is a common mechanism used by viruses to avoid recognition by T
cells (34), and tumor cells often lose MHC expression completely (35). In contrast to
healthy cells, these cells become susceptible to NK cell-mediated lysis, because they
fail to provide sufficient inhibitory signals.
The inhibitory receptors seem to be expressed on NK cells in a rather random
manner. In all human individuals NK cells can be found that express only KIR that
recognize MHC allotypes not expressed in the respective individual or no inhibitory
receptor at all. This led to the question how NK cell self-tolerance is ensured,
because activation of these cells could not be controlled by expression of MHC
molecules on healthy cells. Based on the finding that human NK cells expressing no
inhibitory receptor are hypo-responsive to stimulation, a model of NK cell 'education'
during their development was proposed (36). In this model developing NK cells can
only become fully functional if they receive signals through inhibitory receptors.
Recent reports show that the strength of inhibitory receptor signaling during NK cell
development determines their cytotoxic potential. Experiments with murine NK cells
showed that their cytotoxic potential increased with the number of different inhibitory
receptors that were engaged during NK cells development (37, 38).
The activating receptors expressed on NK cells are more heterogeneous than the
inhibitory receptors and not all ligands are known (29). Some of the receptors bind to
molecules that are expressed ubiquitously, also on healthy cells, e.g. the members of
the SLAM-related receptor family 2B4, NTB-A and CRACC that will be discussed
below (39). The ligands for the C-type lectin-like receptor NKG2D are MHC class Irelated chain (MIC) proteins A and B and the UL16-binding proteins (ULBP), which
are expressed after DNA damage or viral infection (40, 41). The recently described
ligand for NKp30 B7-H6 seems to be expressed only on tumor cells (42). For other
activating NK cell receptors an interaction with viral ligands on infected cells has
been reported, e.g. NKp44 and NKp46, which recognize viral hemagglutinins (43,
INTRODUCTION
12
44). Finally, NK cells express the low affinity Fc receptor CD16 (FcγRIII), which links
NK cell function to adaptive immunity. When antibodies bind to antigens on the
surface of a cell, they can be recognized by NK cells via CD16 resulting in elimination
of the cell expressing the antigen.
NK cells are also regulated by cytokines. IFN-α or β, IL-12, IL-15 and IL-18 activate
NK cells (45). Cytokine-activated NK cells can produce cytokines in turn, and they
display increased cytotoxicity due to higher perforin content of their lytic granules,
increased expression of Fas-ligand and lower thresholds for activation through
activating receptors (46, 47). IL-2 is also able to stimulate NK cell proliferation,
cytotoxicity and to some extent cytokine secretion (48). This may happen in the
lymph nodes, where NK cells could be stimulated by IL-2 produced by activated T
cells (49). NK cell functions can be inhibited by TGF-β, which is produced by
regulatory T cells (50-52).
Besides the control through inhibitory receptors, autoreactivity of NK cells can be
limited by the need for at least two activating signals, similar to co-stimulation in T
cells. One of these signals can be cytokine stimulation. IL-2-activated NK cells react
to stimulation of any activating receptor. In contrast, resting NK cells cannot be
activated by engagement of only one single type of receptor with the exception of
CD16. It has been shown that engagement of pair-wise combinations of activating
receptors is needed to trigger a response in resting cells (47).
1.1.7 Functions of NK cells
Natural killer cells play an important role in the control of infected or transformed cells
(53). Due to the detection of 'missing self', viral or stress-induced ligands they can
eliminate potentially dangerous cells. This is mainly mediated by direct cellular
cytotoxicity, as they can induce apoptosis in target cells via the release of perforin
and granzymes. Similar to cytotoxic T cells, they can also induce apoptosis by
engagement of Fas or TRAIL receptors. The elimination of infected cells by NK cell
possibly improves adaptive T cells responses, because dendritic cells can take up
antigens from apoptotic NK cell targets and present them to T cells (54). The
cytotoxic activity of NK cells seems to have also regulatory aspects. It has been
shown that human NK cells can lyse immature dendritic cells, which implies that NK
cells influence dendritic cell homeostasis (55). NK cells could also control
inflammatory responses by deletion of over-activated macrophages, as it has been
shown that activated macrophages are susceptible to NK cell cytotoxicity (56).
INTRODUCTION
13
The second important function of NK cells is the production and secretion of
cytokines. The main cytokines produced by NK cells are IFN-γ, TNF-α and
granulocyte-macrophage colony-stimulating factor (GM-CSF) (57). With their
cytokine secretion NK cells not only activate cells of the innate immune system like
macrophages, they can also shape the adaptive immune response (58, 59). IFN-γ
and TNF-α secreted by NK cells, as well as yet-to-be-defined contact dependent
signals, promote the maturation of dendritic cells that in turn can activate T cells and
NK cells (55, 60). IFN-γ also drives the differentiation of activated CD4-positive T
cells towards a Th1 response (61).
Two distinct subsets of human NK cells have been described that are specialized for
one of the two effector functions. A small population of NK cells has a low cytotoxic
potential, but can produce high amounts of cytokines. These cells can be identified
by high expression levels of the NK cell marker CD56 and lack of the receptor CD16.
The majority of NK cells shows lower expression of CD56, expresses CD16 and is
more cytotoxic (1).
A specialized subset of NK cells is found in the human uterus during pregnancy and
is therefore called uterine NK cells or uNK cells. Although they contain high amounts
of granules, these NK cells are less cytotoxic and seem to have mainly regulatory
functions in the decidua (62, 63). Because these cells produce angiogenic factors like
angiopoietins 1 and 2, these cells are likely to play a role in vascularization of the
decidua (64).
A recently identified NK cell subset in mucosa associated lymphoid tissue has been
shown to be essential for mucosal homeostasis (65). These NK cells are not
proficient at the classical NK cell functions cytotoxicity and IFN-γ production. Because
these cells produce IL-22, a cytokine that plays a role in the maintenance of mucosal
epithelia, they have been named NK-22 cells (66).
The crucial role of NK cells in the immune system is demonstrated by the severe
symptoms of patients with a rare NK cell deficiency (67). These patients suffer from
recurring viral and bacterial infections despite the presence of T and B cells that can
mount an adaptive immune response. This underscores that immunity is mediated by
the interplay between the innate and adaptive immune system.
INTRODUCTION
1.2
14
The SLAM family of immunoglobulin like receptors
1.2.1 SLAM-related receptors
The family of SLAM-related receptors (SRR) is part of the immunoglobulin (Ig)
receptor super-family. The family comprises six members, namely SLAM (CD150),
2B4 (CD244), NTB-A (Ly108 in mice), CRACC (CS1, CD319), CD84, and Ly-9
(CD229), which are expressed on cells of the hematopoietic lineage (39, 68, 69). The
SRR genes are located on the long arm of chromosome 1 in humans (1q21-24), and
on mouse chromosome 1 (1H2) with a similar organization in both species (39). The
homology in sequence and organization of the gene loci implies that SRR genes
arose from one common ancestor gene through gene duplication. All SRR are type I
transmembrane receptors with an extracellular part consisting of one N-terminal
V-type Ig-domain and one membrane-proximal C2-type Ig-domain (fig. 1). An
exception is Ly-9, which contains four Ig-domains in the order of IgV-IgC2-IgV-IgC2.
The size of the intracellular domain of SRR varies between 70 and 180 amino acids.
With the exception of 2B4 all SRR are homophilic (70-75). 2B4 binds to CD48, a
glycosylphosphatidylinositol-anchored membrane protein that is widely expressed on
cells of the immune system and is also part of the Ig receptor super-family (76, 77).
The cytosolic part of SRR contains two to four tyrosine-based signaling motifs that
become phosphorylated upon receptor engagement and are the basis for SRR
signaling (39, 78) (fig. 1). The tyrosine of these motifs is embedded in a consensus
sequence TxYxxV/I, where x represents any amino acid. These motifs have been
termed immunoreceptor tyrosine-based switch motifs (ITSM), because they can
recruit different signaling molecules that promote activating or inhibitory signals (79).
ITSM can bind a group of adapter molecules that consists of SLAM-associated
protein (SAP, SH2D1A) and Ewings sarcoma-Fli1-activated transcript 2 (EAT-2,
SH2D1B) in humans. In mice exists a third member, EAT-2-related transducer (ERT,
SH2D1C), but the ERT gene in humans is only a pseudogene (80, 81). These
adapter molecules are small, comprising one Src homolgy 2 (SH2) domain and a
short C-terminal extension. The importance of SRR and SAP function in immunity is
underscored
by
the
finding
that
the
severe
immune
disorder
X-linked
lymphoproliferative disease (XLP) is caused by the absence or dysfunctionality of
SAP.
The mediators of inhibitory signaling that can bind to phosphorylated ITSM are the
tyrosine-phosphatases SHP-1 and 2, and the inositol-phosphatase SHIP (79, 82-84).
INTRODUCTION
15
Figure 1: The family of SLAM-related receptors and their ligands
Depicted are the six members of the SLAM-related receptor family with their cytoplasmic tails
containing the immunoreceptor tyrosine-based switch motifs (ITSM). The respective ligands are
shown on the opposing cell surface. Picture by courtesy of Claus et al. (39).
1.2.2 Expression and functions of the SRR 2B4, NTB-A and CRACC
The expression of SRR is heterogeneous on different immune cells and no SRR
shows expression confined to only one cell type. In addition, SLAM and CD84 are
expressed on hematopoietic stem cells, and 2B4 is found on multipotent progenitor
cells (85, 86). Despite the differences in expression pattern on cells of different
functions the common role of the SRR family can be described as fine-regulation of
immune responses.
2B4 (CD244)
2B4 is expressed on NK cells, γδ T cells, monocytes, basophils, eosinophils and
some thymocytes (87-90). On human T cells the expression is confined to
approximately 50 % of the CD8-positive T cells. 2B4-positive T cells display a
memory cell phenotype, and 2B4 expression can be induced on human and murine
CD8-positive cells by in vitro activation.
Its function has first been described on murine and human NK cells as a receptor
triggering cytotoxicity and IFN-γ production after engagement of its ligand CD48 (88,
91-94). The ubiquitous expression of the 2B4 ligand CD48 on cells of hematopoietic
origin suggests that a main function of 2B4 on NK cells is the immunosurveillance of
INTRODUCTION
16
other immune cells. Down-regulation of MHC class I molecules on transformed cells
renders these cells susceptible to 2B4-triggered NK cell cytotoxicity.
Other findings indicate that under certain circumstances human 2B4 can also play an
inhibitory role on NK cells. At early stages of NK cell development the expression of
activating receptors precedes the expression of inhibitory receptors and the cells gain
their cytotoxic potential. In these precursor cells 2B4 has been shown to fulfill
inhibitory functions ensuring self-tolerance of these cells (95). Similarly, in NK cells
isolated from human lymph nodes engagement of 2B4 reduced IFN-γ production
(96). A third NK cell population with inhibitory 2B4 signaling in humans are decidual
NK cells during pregnancy (62, 97). The inhibitory function of 2B4 in these cases
could be caused by a reduced expression of the adapter SAP (62), which is
supported by the report that 2B4 mediates inhibitory signals in XLP patients with
defective SAP (98).
The role of 2B4 on NK cells in mice has been the issue of controversial discussion.
The first notion that 2B4 is an activating receptor on murine NK cells was challenged
by the finding that mouse NK cells showed a decreased cytotoxicity against certain
CD48-expressing tumor cells compared to their CD48-negative counterparts.
Blocking of 2B4-CD48 interactions with antibodies abolished this difference (99, 100).
Experiments using 2B4 KO mice pointed in the same direction. These mice showed
an increased clearance of injected tumor cells compared to wild type mice, when the
tumor cells expressed CD48 (99, 100). The inhibitory signal mediated by 2B4 in
these experiments seemed to be independent of SAP, as the same results were
obtained with NK cells from SAP KO mice (99). Interestingly, the 2B4 KO phenotype
shows some gender specificities: In experiments with metastatic melanoma cells only
male 2B4 KO mice show a better rejection of CD48-positive tumor cells, while female
mice fail to reject both CD48-positive and CD48-negative cells. Although the rejection
is NK cell dependent, this defect in female KO mice is not NK cell intrinsic, as NK cell
cytotoxicity is not impaired in vitro (101). However, a recent report again supported
the notion from early experiments that murine 2B4 is an activating receptor. In vitro
and in vivo experiments using different tumor cell lines as target cells demonstrated
that CD48 expression enhances lysis of these targets. Similar to the situation in the
human system, this activating 2B4 signal was only turned into an inhibitory signal in
SAP KO mice (102).
INTRODUCTION
17
The reason for the conflicting results regarding activating or inhibitory properties of
2B4 in mice is unclear. However, a recent study provided a possible explanation for
this discrepancy. It has been shown that the engagement of human and murine 2B4
has activating or inhibitory effects depending on the expression level of the receptor,
the extent of receptor cross-linking and the expression levels of the adapter SAP
(103). Antibody-mediated Cross-linking of 2B4 on cells with low surface expression of
the receptor led to activation. In contrast, cells with high expression levels of 2B4
were inhibited, when the receptor was cross-linked. This inhibitory signaling was
changed to an activating signal, when less receptor molecules on these cells were
engaged. In cells expressing high levels of both 2B4 and SAP the effect of strong
receptor cross-linking was also activating.
In human T cells 2B4 has been described as a co-stimulator enhancing proliferation
and cytotoxicity of antigen-specific CD8-positive T cells (104, 105). Interestingly, in a
study showing that NK cells can enhance antigen-specific proliferation of T cells 2B4
on NK cells served as ligand for CD48 on T cells (106).
On human eosinophils cross-linking of 2B4 elicited cytokine secretion and eosinophilmediated cytotoxicity (90).
NTB-A (Ly108)
Human NK cells, T cells and B cells express the SRR called NK, T and B cell antigen
(NTB-A) (84). In addition NTB-A has also been found on eosinophils (90, 107). In
mice the expression of the NTB-A homolog Ly108 on NK cells is strain dependent
(108). Therefore the function of NTB-A on NK cells has mainly been investigated in
human cells. NTB-A engagement on NK cells induces cytotoxicity and production of
IFN-γ and TNF-α (70, 71, 84). The analysis of NTB-A functions in NK cells from XLP
patients showed that in the absence of functional SAP the cytotoxic response was
not only reduced, but rather inhibited, while IFN-γ production was intact (70, 84).
On human T cells NTB-A has been shown to have a co-stimulatory potential inducing
proliferation and IFN-γ production when engaged simultaneously with the TCR (109).
As IFN-γ promotes development of CD4-positive cells into Th1 helper type cells, it
was assumed that NTB-A plays a role in shaping of Th1 immune responses. This
was supported by experiments with mice injected with NTB-A-Fc-fusion proteins that
are thought to block homophilic interaction of Ly108, the murine NTB-A homolog.
Treated mice displayed a reduced Th1 cytokine-induced isotype switch to IgG2a and
IgG3. Furthermore the injection of fusion proteins delayed the onset of experimental
INTRODUCTION
18
autoimmune encephalomyelitis, a Th1-mediated model for human multiple
sclerosis (109). However, mice with a defective Ly108 gene displayed impaired Th2
responses characterized by a loss of IL-4 production and intact IFN-γ secretion (107).
Further experiments will be needed to solve this issue.
The phenotype of mice with defective Ly108 revealed another function of the
receptor in innate immunity. The mice showed increased susceptibility to bacterial
infections, which was due to an impaired generation of reactive oxygen species in
neutrophils (107).
Another finding that sheds a light onto NTB-A function is the connection of a
polymorphism in the Ly108 gene to the autoimmune disease systemic lupus
erythematosus in mice. The lupus-associated Ly108 allele may be linked with
modified signaling responses of T cells in lupus-susceptible mice (110). Additionally,
the normal Ly108 gene has been reported to sensitize immature B cells to deletion
and RAG re-expression, whereas the lupus-associated allele did not (111). Therefore
NTB-A seems to have a function in the regulation of T and B cell responses and the
maintenance of self-tolerance.
CRACC (CS1, CD319)
The CD2-like receptor activating cytotoxic cells (CRACC) is expressed on NK cells, a
subset of CD8-positive T cells and on few CD4-positive T cells. Despite its name it is
also expressed on activated B cells and mature dendritic cells (112, 113). On NK
cells CRACC has been described as an activating receptor triggering cytotoxicity
(112, 114, 115) and enhancing IFN-γ production (115). CRACC-mediated NK cell
cytotoxicity was not impaired in XLP patients or SAP KO mice (112, 115), because
CRACC signaling seems to be mediated only by EAT-2 (114, 115). Cross-linking of
CRACC on human B cells has been reported to induce proliferation and expression
of cytokines, but did not induce antibody production (116).
1.2.3 XLP, a severe immune disorder caused by defective SRR signaling
XLP or Duncan's disease was first characterized by an inappropriate immune
response to Epstein-Barr virus (EBV) infection (117). EBV belongs to the human
γ-herpesvirus family and infects mature B cells. Infected B cells proliferate and some
undergo transformation. These lymphoblasts are readily detected and eliminated in
normal immunocompetent individuals (118). Although latent EBV infected B cells
persist for life, they are kept under control by cytotoxic lymphocytes (119). EBV
INTRODUCTION
19
infection is widespread in humans. In children under the age of 10 the infection is
often asymptomatic and about 50 % of infections above that age result in infectious
mononucleosis (120).
In contrast, up to 60 % of XLP patients develop a fatal fulminant infectious
mononucleosis after EBV infection leading to death within 1 or 2 months. Other
manifestations of the disease are hypogammaglobulinemia and lymphoproliferative
disorders, mainly of B lymphocytes. The disease manifests usually about the age of
five and the mortality rate is close to 100 % at the age of 20 (78, 121). The disease is
caused by mutations in the gene encoding SAP (122, 123). The defects in
lymphocyte function that lead to the pathogenesis of XLP are not fully understood,
but in recent years several findings have shed a light on the underlying mechanisms.
The development of lymphocytes seems to be not impaired by SAP deficiency, as
the numbers of NK, T and B cells are normal in XLP patients. Only the subset of NKT
cells does not develop in these patients (124, 125). Whether the absence of these
cells contributes to the pathophysiology of XLP is not known.
The humoral immune response is generally impaired in XLP patients. Their number
of memory B cells is very low and no class-switch immune response is observed
after
booster
vaccinations
(126,
127),
which
explains
the
reported
hypogammaglobulinemia. Recent studies revealed that these defects in antibody
production are due to impaired T cell function (128).
NK cells from XLP patients display impaired cytotoxic responses (129-131). In
addition EBV-specific cytotoxic CD8-positive T cells are lower in frequency and show
reduced cytotoxicity against autologous EBV-infected B cells (129, 132). Recent
studies gave a possible explanation for this impairment of the cytotoxic immune
response: EBV-infected B cells show an up-regulated expression of CD48, the ligand
for 2B4 (133). Two studies could show that the cytotoxic response of CD8-positive T
cells from XLP patients against EBV-infected cells is strongly impaired by defective
2B4 signaling (134, 135). 2B4 and NTB-A-mediated cytotoxicity is also impaired in
NK cells from XLP patients (84, 98, 136-138). The failure to control proliferation of
EBV-infected B cells surely contributes to the massive expansion of the lymphocyte
population observed in XLP patients after EBV infection.
An animal model of XLP could be created by generation of SAP KO mice, which
display similar immune defects like XLP patients (139-141). SAP KO mice also have
normal numbers of NK, T and B cells, but lack the NKT subset (124, 125).
INTRODUCTION
20
Because mice are not susceptible to EBV infection, the SAP KO mice were infected
with lymphocytic choriomeningitis virus (LCMV), murine γ-herpesvirus-86 or non-viral
pathogens like Toxoplasma gondii or Listeria major. This makes the results less
comparable to the findings in XLP patients. These mice could clear acute infections
but succumbed to chronic infections because of an overwhelming response mediated
by CD8-positive T cells (140). In acute infections the observed numbers of activated
T cells were increased and the response of CD4-positive T cells was altered to
increased IFN-γ production and reduced IL-4 and IL-10 secretion (140, 141). This
skewing from a Th2 to a Th1 response is accompanied by low antibody production
after infection (140-142).
Similar to the findings in XLP patients, the defective humoral immune response of
SAP KO mice seems to be caused by impaired T cell function. CD4-positive T cells in
these mice develop into effector cells that express molecules capable to provide T
cell help to B cells, but fail to interact with B cells effectively (143). One reason for the
inefficient T cell help has been shown to be a reduced duration of T-B cell contact in
germinal centers of SAP-deficient mice (144). The SRR that play a role in these
processes have not been identified yet.
In summary the pathophysiology of XLP is caused by a complex dysregulation of
immune responses and illustrates the dependence of immune function on fine-tuning
mechanisms provided by SRR.
1.2.4 Molecular mechanisms of SLAM-related receptor signaling
2B4-mediated signaling
Of all SRR the molecular mechanisms of 2B4 signaling have been examined best
(fig. 2). Upon the engagement of 2B4 by antibodies or CD48 expressing target cells
the receptor is recruited to lipid rafts and its ITSM are phosphorylated by Src-family
kinases (145, 146). Lipid raft domains are rich in kinases (147) and the Src-family
kinase Lck is one possible candidate that can phosphorylate 2B4 (137). Raft
recruitment has been shown to be essential for the phosphorylation of 2B4 (145).
Phosphorylated ITSM of 2B4 can recruit the adapter molecules SAP and EAT-2 (83,
148, 149).
INTRODUCTION
21
Figure 2: The model of 2B4 signal transduction
A: Early signaling events in 2B4-mediated lymphocyte activation B: A possible mechanism for 2B4mediated inhibitory signals in the absence of functional SAP, e.g. in XLP patients. See text for details.
Picture by courtesy of Claus et al. (39).
SAP can associate with all four ITSM of 2B4, but it has been shown that interaction
with the membrane proximal ITSM is sufficient for 2B4 signaling (82). Only little is
known about the function of the adapter protein EAT-2 (148). Both adapter molecules
are about 15 kDa in size and consist of one single SH2-domain and a small Cterminal tail (148, 150, 151). The C-terminal part of human EAT-2 contains one
tyrosine residue, but no phosphorylation of EAT-2 has been observed (152).
ITSM-bound SAP mediates signal transduction by recruiting the Src-family kinase
FynT (153, 154) (fig. 2A). The basis for interaction between FynT and SAP was not
clear until SAP was crystallized in complex with a phosphorylated ITSM and FynT.
The structure revealed that FynT binds to SAP in an unusual SH2-SH3-domain
interaction involving the residue arginine-87 on SAP (155). This interaction is
essential for SAP function, as mutations of R87, which have been found in XLP
patients, completely abolish 2B4 signaling (156, 157). Binding of FynT to SAP has
been reported to increase the kinase activity of FynT, probably by preventing
conformational changes into an inactive state (154, 158). FynT can also
phosphorylate 2B4 (82), but there are contradicting reports whether 2B4 can be
phosphorylated independently from SAP-mediated FynT recruitment (98, 102, 114,
156). The importance of SAP for 2B4 signaling becomes evident in XLP patients
where 2B4-mediated cytotoxicity is abolished (98, 137, 138). Furthermore, 2B4
signaling is also abolished in SAP and Fyn KO mice (102).
INTRODUCTION
22
Findings in the murine system suggested that EAT-2 and the closely related ERT
could have inhibitory functions there (81). This hypothesis was challenged by the
finding that the receptor CRACC that recruits EAT-2, but not SAP mediates activating
signals in murine NK cells (115). The function as an inhibitory counterpart to SAP
was also excluded by the finding that the inhibitory effects of SRR observed in SAP
KO mice were also present in mice lacking all three adapters SAP, EAT-2 and ERT
(108). This led to the conclusion that EAT-2 mediates activating signals through SRR
in murine NK cells.
The activating function of EAT-2 in human NK cells could be comparable to the
murine protein. However, there may be differences between humans and mice. In
contrast to human EAT-2, the murine protein carries two tyrosine residues in its Cterminal part that can be phosphorylated (81). Interestingly, a mutated form of murine
EAT-2 that could not be phosphorylated failed to mediate the activating signaling of
CRACC (115), but also the inhibitory effects that have been reported (81).
As mentioned above, 2B4 can mediate inhibitory rather than activating functions in
the absence of SAP (62, 95-98). This can be explained by recruitment of molecules
mediating negative signals. The binding of the phosphatases SHIP, SHP-1 and
SHP-2 to the phosphorylated third ITSM of 2B4 has been reported (82, 83) (fig. 2B).
Under normal conditions these molecules can be displaced by SAP due to
competitive binding. Thus negative signaling is suppressed and activating signaling
pathways dominate. This model assumes that 2B4 can be phosphorylated in the
absence of SAP. It is unclear if 2B4 is still recruited to lipid rafts in the absence of
SAP. Interestingly, the 2B4 ITSM can also be phosphorylated by the kinase Csk that
can associate with 2B4 as well (82). Csk is known to inhibit the activity of Src-family
kinases (159), which could be another mechanism of negative signaling mediated by
2B4.
Another adapter protein that can bind to phosphorylated 2B4 is 3BP2, which has
been reported to associate with the fourth ITSM (160) (fig. 2A). Phosphorylated 3BP2
interacts with the signaling molecules Vav-1, LAT and PLC-γ (160, 161). A recent
report could show that association of 3BP2 with 2B4 is dependent on SAP,
explaining why 3BP2-mediated signal transduction cannot compensate for the
absence of SAP in XLP (162).
Stimulation of 2B4 leads to phosphorylation of LAT, Vav-1, PLC-γ, c-Cbl, Grb2 and
SHIP (146, 156, 163). These molecules then propagate the signal further, initiating
INTRODUCTION
23
the effector functions. PLC-γ cleaves phosphatidylinositol 4,5-bisphosphate (PI4,5P2)
into inositol 1,4,5-trisphosphate (IP3) and 1,2-diacyl-glycerol (DAG). IP3 induces the
release of Ca2+ from intracellular stores leading to a rise in intracellular Ca2+
concentration, whereas DAG activates the protein kinase C (PKC) and the Ras
pathways. The Ca2+ release by PLC-γ is necessary for the secretion of cytotoxic
granules and its importance for 2B4 signaling is shown by the finding that inhibition of
PLC-γ abrogates 2B4-mediated cell lysis (114). LAT, Grb2 and Vav-1 signals are
involved in activation of the mitogen activated protein kinase (MAPK) pathway, which
is shown by increased phosphorylation of ERK after 2B4 engagement (160).
The signaling of 2B4 is also regulated on the level of protein expression. The
expression of SAP observed in freshly isolated, i.e. resting NK cells is low and
increases after activation of these cells through IL-2 or IL-12, thus resulting in
enhanced 2B4 signaling (164). Engagement of the 2B4 receptor leads to downmodulation of its surface expression by receptor internalization, and the expression
of 2B4 is reduced by inhibitory action at an ets-element in the promoter of its gene
(165, 166). These negative feedback mechanisms are likely to limit excessive 2B4mediated NK cell activation.
NTB-A-mediated signaling
Signaling through the receptor NTB-A is less well examined (fig. 3). Similar to 2B4
the engagement of NTB-A leads to receptor phosphorylation and association of SAP
and EAT-2 (84, 109, 152). A study using different inhibitors of signaling pathways
could show that NTB-A signaling is strongly dependent on actin reorganization, Srcfamily kinases and PLC-γ (152). In the same study it has been shown that EAT-2
associates with the membrane proximal ITSM, whereas SAP binds to the C-terminal
ITSM (fig. 3A). A mutant receptor that could bind only SAP was unable to trigger NK
cell cytotoxicity, while its counterpart that could bind only EAT-2 triggered a cytotoxic
response. Furthermore NK cells with a shRNA-mediated SAP knockdown were
reported to show a normal cytotoxic, but an impaired IFN-γ response after NTB-A
stimulation (152). These results suggested that SAP mediates the signal for cytokine
production, whereas EAT-2 transduces the signal leading to a cytotoxic response.
However, these findings do not match the observation that NTB-A-mediated
cytotoxicity is impaired in XLP NK cells and IFN-γ production is not (84). This
difference could be due to alterations of NK cell development in the absence of SAP.
INTRODUCTION
24
Figure 3: The model of NTB-A signaling
A: SAP and EAT-2 initiate different activating signaling pathways. B: A possible mechanism for
inhibitory NTB-A signaling in the absence of SAP, e.g. in XLP patients. See text for details. Picture by
courtesy of Claus et al. (39).
Similar to 2B4, NTB-A has also been reported to interact with the phosphatases
SHP-1 and 2 (fig. 3B). While SHP-1 was found in complex with NTB-A regardless of
its phosphorylation state, SHP-2 associated after pervanadate treatment (84). As for
the 2B4 receptor, this might be the basis of negative signaling by NTB-A in the
absence of functional SAP expression as reported for NK cells from XLP patients.
CRACC-mediated signaling
CRACC is phosphorylated after ligation and recruits the adapter EAT-2, which
promotes CRACC phosphorylation through a Src-family kinase (114). There are
contradicting results concerning the ability of human CRACC to recruit SAP (112,
114, 167). However, SAP is dispensable for CRACC signaling, as NK cells from XLP
patients show no reduction in CRACC-mediated cytotoxicity (112). Although CRACC
association with 3BP2 has not been observed (160), the CRACC signal causes
phosphorylation of PLC-γ1 and 2, Akt and c-Cbl. The phosphorylation of Vav-1 and
SHIP is increased to a lesser extent (114). Like 2B4 and NTB-A, CRACC has been
shown to have the ability to recruit mediators of negative signaling. SHP-1 and 2,
SHIP and Csk have been reported to bind to phosphorylated peptides of one CRACC
ITSM (115).
INTRODUCTION
25
CRACC signaling in mice seems to be similar to human CRACC. In mice CRACC
phosphorylation has been shown to be independent of SAP, EAT-2 and ERT
expression, and no association of SAP has been found (115). Like human XLP NK
cells, the NK cells from SAP KO mice show no reduction in CRACC-mediated
cytotoxicity (115). The importance of EAT-2 for CRACC signaling has been
demonstrated by the finding that EAT-2 KO NK cells display no CRACC-mediated
cytotoxicity, while SAP and ERT were dispensable. Interestingly, the absence of
EAT-2 turned CRACC into an inhibitory receptor (115). This suggests that the
function of CRACC can be switched from activating to inhibitory as a regulatory
mechanism depending on the expression level of its pivotal adapter molecule. This is
similar to the inhibitory function of 2B4 during NK cell development (95).
AIMS OF THE THESIS
26
2 Aims of the Thesis
SLAM-related receptors are expressed on a variety of different cells of the innate and
the adaptive immune system. Their general function can be described as fine-tuning
of immune responses. 2B4, NTB-A and CRACC are expressed on NK cells and to
some extent on T cells. The general aim of this thesis was to further elucidate the
signaling mechanisms of 2B4 and NTB-A in human NK cells and to investigate the
function of CRACC on T cells.
First we wanted to define amino acid residues in the extracellular part of NTB-A that
are important for the homophilic interaction of two NTB-A molecules. To this end we
generated NTB-A mutants and tested their ability to trigger NK cell cytotoxicity.
The second aim was to answer the unresolved questions about the early events in
2B4 and NTB-A signaling. For this purpose we wanted to investigate the early
signaling events in NK cell lines with RNA interference-mediated SAP knockdown in
comparison to cells with normal SAP expression. To extend our research to primary
cells we also planned to establish a method for the knockdown of protein expression
in primary human NK cells.
Third, CRACC is an activating receptor on NK cells, but its function on T cells has not
been investigated yet. As other SRR have been shown to have co-stimulatory
properties, we investigated whether this was also true for CRACC. CRACC is not
expressed on the whole T cell population, we therefore also wanted to further
characterize the CRACC-positive subset.
MATERIALS AND METHODS
27
3 Materials and methods
3.1
Materials
3.1.1 Mouse monoclonal antibodies
Name
Conjugate
Source, Reference
Control IgG, MOPC21
-, PE
Sigma, Taufkirchen, Germany
anti-2B4, C1.7
-
Immunotech, Marseille, France
anti-CCR7
PE-Cy7
BD Biosciences, San Jose, CA, USA
anti-CD3, OKT3
-
ATCC, Manassas, VA, USA
anti-CD3, SK7
PE-Cy7
BD Biosciences
anti-CD4
FITC
Becton Dickinson Immunocytometry
Systems, San Jose, CA, USA
anti-CD4, SK3
PerCP
BD Biosciences
anti-CD8
PerCP
BioLegend, San Diego, CA, USA
anti-CD25, SA3
FITC
BD Biosciences
anti-CD28
-
BD Pharmingen, Heidelberg, Germany
anti CD28
FITC
BD Biosciences
anti-CD45RA
APC
BD Biosciences
anti-CD69
PE
BioLegend
anti-CRACC, CS1-4
-
Stark et al., 2005 (168)
anti-CRACC, 162.1
- ,PE
BioLegend
anti-Interferon-γ
FITC
BioLegend
anti-IL-2
PE
BD Biosciences
anti-NKG2D, 149810
PE
R&D Systems, Minneapolis, USA
anti-NKp30, p30-15
-
Byrd et al., 2007(169)
anti-NTB-A, MAB 1908
-
R&D Systems
anti-NTB-A, NT-7
-, PE
Flaig et al., 2004 (71), BioLegend
anti-phospho-tyrosine, 4G10
biotin
Upstate cell signaling solutions,
Charlottesville, VA, USA
anti-SAP, SAP 23.1.5
-
Eissmann et al., 2005 (82)
MATERIALS AND METHODS
28
3.1.2 Rabbit polyclonal antibodies
Name
Source, Reference
anti-2B4
Watzl, et al., 2000, (146)
anti-Actin
Sigma
anti-EAT-2
Pineda Antibody Service, Berlin, Germany,
(152)
anti-Fyn
Cell Signaling Technologies, Danvers, USA
anti-NTB-A
Pineda Antibody Service, (152)
3.1.3 Secondary antibodies
Name
Conjugate
Source, Reference
goat anti-mouse IgG
HRPO
Jackson ImmunoResearch Laboratories,
West Grove, PA, USA
goat anti-mouse IgG
PE
Jackson ImmunoResearch Laboratories
goat anti-mouse IgG
-
Dianova, Hamburg, Germany
goat anti-rabbit IgG
HRPO
Santa Cruz Biotechnology, Heidelberg,
Germany
3.1.4 Bacteria
E. coli strain
used for
Source
TOP10
amplification of plasmids
Invitrogen, Carlsbad, CA, USA
Stbl3
amplification of plasmids prone Invitrogen
to homologous recombination
3.1.5 Buffers
DNA-sample buffer (6 x):
TAE (10 x), Invitrogen
0.25 % (w/v)
Bromphenol Blue
0.25 % (w/v)
Xylene Cyanol FF
30 % (v/v)
glycerol in H2O
MATERIALS AND METHODS
Triton X-100-lysis buffer:
Reducing sample buffer (5 x):
29
150 mM
NaCl
20 mM
Tris-HCl, pH 7.4
10 % (v/v)
glycerol
0.5 % (v/v)
Triton X-100
2 mM
EDTA
10 mM
NaF
1 mM
PMSF
1 mM
Na-orthovanadate (for studies
on protein phosphorylation)
10 % (w/v)
SDS
50 % (v/v)
glycerol
25 % (v/v)
2-mercaptoethanol
0.1 % (w/v)
Bromphenol Blue
0.3125 mM
Tris-HCl, pH 6.8
24 mM
Tris
129 mM
glycin
20 % (v/v)
methanol
137 mM
NaCl
8.1 mM
Na2HPO4
2.7 mM
KCl
1.5 mM
KH2PO4
1x
PBS
0.05 % (v/v)
Tween 20
1x
PBS
0.05 % (v/v)
Tween 20
0.5 M
NaCl
MOPS buffer (20 x), Invitrogen
Western blot transfer buffer:
PBS (pH 7.4):
PBST:
PBST/NaCl:
MATERIALS AND METHODS
Blocking Buffer for western blot:
HBS 2x (pH 7.0)
FACS-buffer (low protein)
FACS-buffer (high protein)
30
1x
PBST
5 % (w/v)
nonfat dry milk powder, Saliter,
Obergünzburg
54.6 mM
HEPES
274 mM
NaCl
3 mM
Na2HPO4
1x
PBS
2 % (v/v)
fetal calf serum, PromoCell
1x
PBS
5 % (v/v)
fetal calf serum
0.5 % (w/v)
bovine serum albumin (BSA)
3.1.6 Cells (eukaryotic)
All culture media, fetal calf serum (FCS), non-essential amino acids and sodium
pyruvate were purchased from Gibco (Invitrogen, Carlsbad, CA); donor horse serum
was from Biochrom (Berlin, Germany), human serum from PromoCell (Heidelberg,
Germany), PHA-P from Sigma and purified human IL-2 from Hemagen Diagnostics
(Columbia, USA). If not indicated otherwise all cells were grown with 10 % (v/v) FCS
and 1 % (v/v) penicillin/streptomycin (Gibco, Invitrogen).
Cell type
Origin
Culture Medium
721.221
EBV-transformed, human B cell line
IMDM
BA/F3
murine pre-B cell line
RPMI, 50 µM 2mercaptoethanol
HEK 293T
human embryonic kidney cell line
DMEM
JY
EBV-transformed, human B cell
lymphoblastoid cell line
RPMI, 50 µM 2mercaptoethanol
NK92 C1
human NK cell line from malignant
non-Hodgkin lymphoma
Alpha MEM, 12.5 % (v/v)
FCS, 12.5 % (v/v) donor
horse serum, 2mercaptoethanol
MATERIALS AND METHODS
31
P815
murine mastocytoma cell line
IMDM
Phoenix ampho
human embryonic kidney cell line,
packaging cell line for amphotropic
retrovirus
DMEM
primary human
NK cells
isolated from peripheral blood
mononuclear cells (PBMC) by
negative selection
IMDM, 10 % (v/v) human
serum, 10 % (v/v) nonessential amino acids,
10 % (v/v) sodium
pyruvate, 100 IU/ml IL-2
primary human
T cells
isolated from PBMC by negative
selection
RPMI
YTS
Human leukemic NK-like cell line
IMDM, 12.5 % (v/v) FCS,
2-mercaptoethanol
3.1.7 Enzymes
Name
Use
Source
alkaline phosphatase, calf
intestine (CIP)
dephosphorylation of
DNA fragments
New England Biolabs,
Frankfurt, Germany
Deep Vent DNA polymerase
mutagenesis PCR
New England Biolabs
restriction endonucleases
cutting of DNA
New England Biolabs
Taq DNA polymerase
PCR
New England Biolabs
T4 DNA ligase
DNA ligation
New England Biolabs
All enzymes were used in buffers provided by the manufacturer.
3.1.8 Kits
DNA Fragment Purification
Gel Extraction Kit, Qiagen, Hilden, Germany
Isolation of human NK cells
NK cell negative isolation kit, Invitrogen (formerly
Dynal, Oslo, Norway)
Isolation of human T cells
Pan T cell isolation kit II, CD4+ T cell isolation Kit
II, CD8+ T cell isolation kit, Miltenyi Biotech,
Bergisch Gladbach, Germany
Plasmid DNA purification
Plasmid MiniPrep, MidiPrep or MaxiPrep Kit,
Qiagen
Transfection of human NK cells
Human macrophage nucleofector kit, Lonza,
Basel, Switzerland
Transfection of human T cells
Human T cell nucleofector kit, Lonza
MATERIALS AND METHODS
32
3.1.9 Oligonucleotides
Primers for sequencing and DNA amplification
Name
Sequence (5’ – 3’)
H1
TCGCTATGTGTTCTGGGAAA
M13R
GGAAACAGCTATGACCAT
NTB-A 850R
CACTGAAACATACTCTAG
pSM2 Mlu f
ACGCGTGCTGTTGACAGTGAG
pSM2 Cla r
ATCGATTCCGAGGCAGTAGGC
Sp6
TTTAGGTGACACTATAG
T7
TAATACGACTCACTATAGGG
Primers for mutagenesis
Name
Sequence (5’ – 3’)
NTBA E26A upper
GAGTTTCCTGCAGGAGCGAAGGTCAACTTCATC
NTBA E26A lower
GATGAAGTTGACCTTCGCTCCTGCAGGAAACTC
NTBA K27A upper
GTTTCCTGCAGGAGAGGCGGTCAACTTCATCACTTG
NTBA K27A lower
CAAGTGATGAAGTTGACCGCCTCTCCTGCAGGAAAC
NTBA E37A upper
CTTGGCTTTTCAARGCAACATCTCTTGCCTTC
NTBA E37A lower
GAAGGCAAGAGATGTTGCATTGAAAAGCCAAG
NTBA E47A upper
CTTCATAGTACCCCATGCAACCAAAAGTCCAGAAAT
NTBA E47A lower
GATTTCTGGACTTTTGGTTGCATGGGGTACTATGAA
NTBA K49A upper
GTACCCCATGAAACCGCAAGTCCAGAAATCCAC
NTBA K49A lower
GTGGATTTCTGGACTTGCGGTTTCATGGGGTAC
NTBA E52A upper
AAACCAAAAGTCCAGCAATCCACGTGACTAATC
NTBA E52A lower
GATTAGTCACGTGGATTGCTGGACTTTTGGTTT
NTBA K62A upper
CTAATCCGAAACAGGGAGCGCGACTGAACTTCACC
NTBA K62A lower
GGTGAAGTTCAGTCGCGCTCCCTGTTTCGGATTAG
NTBA K92A upper
GCCCAGATATCCACAGCGACCTCTGCAAAGCTG
NTBA K92A lower
CAFGCTTTGCAGAGGTCCGTGTGGATATCTGGGC
NTB-A H54A upper
CAAAAGTCCAGAAATCGCCGTGACTAATCC
NTB-A H54A lower
GTTTCGGATTAGTCACGGCGATTTCTGGAC
NTB-A Q88A upper
GGCTCTTACAGAGCCGCGATATCCACAAAGAC
MATERIALS AND METHODS
33
Primers for mutagenesis, continued
Name
Sequence (5’ – 3’)
NTB-A Q88A lower
GAGGTCTTTGTGGATATCGCGGCTCTGTAAGAG
NTB-A S90A upper
CTTACAGAGCCCAGATAGCCACAAAGACCTCTG
NTB-A S90A lower
CTTTGCAGAGGTCTTTGTGGCTATCTGGGCTCT
NTB-A L34E upper
CAACTTCATCACTTGGGAGTTCAATGAAACATCTC
NTB-A L34E lower
GATGTTTCATTGAACTCCCAAGTGATGAAGTTGACC
NTB-A L34K upper
CAACTTCATCACTTGGAAGTTCAATGAAACATCTC
NTB-A L34K lower
GATGTTTCATTGAACTTCCAAGTGATGAAGTTGACC
NTB-A T32E upper
GAAGGTCAACTTCATCGAGTGGCTTTTCAATGAAAC
NTB-A T32E lower
GATGTTTCATTGAAAAGCCACTCGATGAAGTTGACC
NTB-A T32K upper
GAAGGTCAACTTCATCAAGTGGCTTTTCAATGAAAC
NTB-A T32K lower
GATGTTTCATTGAAAAGCCACTTGATGAAGTTGACC
3.1.10 Plasmids
Name
Use
Source, Generation
pBABE NTB-A wt and
mutants
stable expression of NTB-A
in cell lines
Insertion via Xho I-Not I
pCR2.1 NTB-A wt
template for mutagenesis
PCR
TOPO-TA cloning
pCR2.1-TOPO
cloning of PCR products
Invitrogen
phCMV-GALVenv
envelope plasmid for virus
production
a gift from K. Weber,
University Hospital
Hamburg-Eppendorf
pLVTHM shSAP/shCD4
lentiviral vectors for stable
shRNA delivery in primary
cells
Addgene, Cambridge,
MA, USA, Insertion via
Mlu I-Cla I
pMD2.G
envelope plasmid for virus
production
Addgene, Cambridge,
MA, USA
pMOW NTB-A wt and
mutants
stable expression of NTB-A
in cell lines
Insertion via Xho I-Not I
pSHAGMAGIC2_shSAP/shCD4
stable knockdown of SAP or
CD4 in cell lines
Biocat, Heidelberg,
Germany
MATERIALS AND METHODS
34
psPAX2
packaging plasmid for viral
particles
Addgene, Cambridge,
MA, USA
pWPXL siNKG2D
stable knockdown of
NKG2D in primary cells
a gift from C. Kalberer,
University Hospital Basel,
Switzerland
3.1.11 Reagents
Agarose
Gibco, Paisley, Scotland
Ampicillin
Roth, Karlsruhe, Germany
Brefeldin A
Fluka, Buchs, Switzerland
BSA
Serva, Heidelberg, Germany
BigDye Terminator v1.1 cycle
Applied Biosystems, Foster City, CA, USA
Chromium-51, as sodium chromate
Hartmann Analytik, Braunschweig
Desoxyribonucleotide trisphosphate mix
Invitrogen
DNA ladder (100 bp and 1 kb)
Invitrogen
Ethidiumbromide
Roth, Karlsruhe, Germany
recombinant human IL-2
NIH cytokine repository
recombinant human IL-15
R&D Systems, Minneapolis, USA
Kanamycin
Roth
LB broth
Invitrogen
Lipofectamine
Invitrogen
LSM solution
PAA, Pasching, Germany
Phaseolus vulgaris hemagglutinine
Sigma
Polybrene
Sigma
Polyvinylidene difluoride membrane
Millipore, Billerica, USA
Precision Plus Protein Standard
BioRad, Hercules, CA, USA
Protein G agarose
Invitrogen
Puromycin
Sigma
RetroNectin
TAKARA, Otsu, Japan
Saponin
Sigma
Streptavidin-HRPO
Jackson ImmunoResearch Laboratories
SuperSignal West Pico and Dura
Thermo
MATERIALS AND METHODS
35
TrypLE Express
Invitrogen
Vybrant CFDA SE Cell tracer Kit
Molecular Probes, Leiden, The
Netherlands
X-ray films
Perbio/Pierce, Rockford, IL, USA
3.1.12 siRNA
Name
Source
control siRNA (Non-targeting siRNA #1)
Thermo scientific,
(Dharmacon)
siCRACC (ON-TARGETplus SMARTpool, SLAMF7)
Thermo scientific
siSAP (Hs_SH2D1A_3) 3’-AlexaFluor647
Qiagen
siEAT-2 (Hs_SH2D1B_1) 3’-AlexaFluor647
Qiagen
3.2
Patients
The blood samples used in this study were from patients presenting with unstable
angina pectoris at University Hospital Heidelberg. Patients gave their written
informed consent under a protocol approved by the institutional review board in
accordance with the declaration of Helsinki.
3.3
Methods
3.3.1 Molecular biology
Agarose gel-electrophoresis
The DNA solution was mixed with DNA sample buffer before loading onto the gel.
1 % or 2 % gels were used depending on the size of the fragments (TAE, agarose,
0.00001 % Ethidiumbromide). The correct size of the DNA fragment was controlled
using a DNA ladder.
DNA sequencing
Sequencing reactions were set up with the ABI Big Dye sequencing mix v1.1
according to manufacturer’s instructions. The following primers were used: T7 and
M13R for pCR2.1, NTB-A850R for the middle part of NTB-A constructs and H1 and
Sp6 for pLVTHM. After sequencing the DNA was precipitated with ethanol,
solubilized in water and analyzed on an ABI Prism 310 Genetic Analyzer.
MATERIALS AND METHODS
36
Enzymatic cutting of DNA
Between 1 and 2 µg of DNA were incubated with 2 U of the respective restriction
endonucleases for at least 1h at 37°C. Conditions of the reaction were set according
to the manufacturer’s instructions. The DNA fragments were separated by agarose
gel electrophoresis.
Extraction of DNA fragments from agarose gels
Agarose slices containing DNA fragments were excised from the gel and DNA was
extracted with the Qiagen gel extraction kit following the manufacturer’s instructions.
Isolation of plasmid DNA
Bacteria were grown in 1 x LB medium with the appropriate antibiotic at 37°C over
night. After harvesting the bacteria by centrifugation at 6000 x g for 5 min or 10 min,
depending on culture size, DNA was isolated using Mini, Midi or MaxiPrep DNA
isolation kit from Qiagen according to the manufacturer’s instructions.
Ligation of DNA fragments
Insert and vector DNA were mixed at ratios ranging from 10 to 1 to 3 to 1 in ligation
buffer (New England Biolabs). The mixture was incubated with 2 U T4 DNA ligase for
1 h at room temperature and used for the transformation of competent bacteria.
mRNA expression analysis
About 1 x 106 cells were lysed in MagNA Pure LC lysis buffer (Roche, Mannheim,
Germany), frozen at -70° C and quantitative RT-PCR was performed by our
cooperation partners, the group of Thomas Giese, Institute for Immunology,
Heidelberg, using SEARCH LC primers.
Polymerase chain reaction (PCR)
PCR was used to amplify the shRNA-coding DNA fragments from pSHAG-MAGIC2vectors or to insert point mutations into DNA. The conditions were fit to the respective
needs. Amplified DNA fragments were cloned into pCR2.1-TOPO following the
manufacturer’s instructions. After mutagenesis PCR template DNA was removed
using the endonuclease Dpn I and PCR products were directly used for
transformation of bacteria. All mutations were confirmed by DNA sequencing.
MATERIALS AND METHODS
37
Transformation of bacteria
Chemically competent bacterial strains were used. The transformation was carried
out according to the manufacturer’s instructions. Transformed bacteria were grown
on LB-Agar plates at 37 °C for overnight under selection with the appropriate
antibiotic.
3.3.2 Cell biology
Cell culture
All cells were grown at 37°C and 5 % CO2 in a humidified incubator under sterile
conditions. Cell lines were split on a regular basis every two to three days. Cell
culture flasks were exchanged every two weeks. Cells were frozen in FCS containing
10 % DMSO at -75°C and stored in liquid nitrogen. Cell lines were thawed on a
regular basis. FCS, donor horse serum and human serum were heat inactivated by
incubation at 56°C for 30 min prior to use.
Cell stimulation
Cell mixing
7 to 10 x 107 cells of each type were resuspended at 1 x 105 cells/µl in IMDM,
supplemented with 10 % FCS and pre-chilled on ice. Equal numbers of effector and
target cells were mixed, centrifuged for 1 min at 400 x g, 4°C and incubated on ice for
10 min. Samples were then stimulated at 37°C for the appropriate time. Samples
were pelleted by centrifugation at 400 x g for 5 min and 4°C, supernatant was
aspirated and cells were lysed. For the time point 0 min effector and target cells were
kept on ice separately and mixed immediately before lysis.
Plate bound antibodies
96-well flat bottom plates were coated overnight by incubation with goat anti-mouse
IgG at a concentration of 7 µg/ml in PBS, using 50 µl per well. Plates were washed
twice with PBS containing 0.5 % BSA (w/v) and then incubated for 1 h at 37°C with
the appropriate antibodies for stimulation diluted in PBS containing 0.5 % BSA, again
using 50 µl per well. Plates were washed again and 2 x 105 T cells in 50 µl medium
were added to each well. T cell contact to the antibody-coated surface was
intensified by centrifugation for 2 min at 400 x g, and cells were kept under normal
culture conditions for 6 h, 48 h or 72 h, depending on the experimental readout.
MATERIALS AND METHODS
38
PHA-P-stimulation
Peripheral blood T cells were stimulated by adding PHA-P to the culture medium at a
concentration of 2 µg/ml. After 18 h the cells were washed twice with culture medium
and then cultured in medium containing 100 IU/ml IL-2. The IL-2-containing medium
was renewed every two days.
Cell lysis
Pelleted cells were resuspended in ice-cold Triton X-100 lysis buffer supplemented
with 1 mM PMSF and if necessary 1 mM sodium orthovanadate and incubated on ice
for 20 min. Lysates were clarified by centrifugation for 15 min at 20000 x g and 4°C.
Chromium release assays
Cell lines were grown to mid log phase, IL-2 activated primary NK cells were used at
3-4 weeks age, PHA-P-activated T cells were used 7 to 10 days after stimulation and
were deprived of IL-2 for 24 h before the assays. The assay medium was IMDM,
supplemented with 10 % FCS (v/v) and 1 % (v/v) Penicillin/Streptomycin in all
assays. For assays with primary NK cells IL-2 was added to a final concentration of
100 IU/ml.
5 x 105 target cells were labeled in 100 µl medium with 100 µCi 51Cr (3.7 MBq) for 1 h
at 37°C. Cells were washed twice in medium and resuspended at a concentration of
5 x 104 cells/ml in medium. Effector and labeled target cells were mixed in 96-well Vbottom plates with a final volume of 200 µl per well. 5000 target cells/well were used
in all assays. When different effector/target ratios (E/T) were used, the effector cells
were plated in serial dilutions before the labeled target cells were added.
Maximum release was determined by incubation of target cells in 1 % Triton X-100.
For spontaneous release, targets were incubated without effector cells in medium
alone. All samples were done in triplicates. Plates were incubated for 4 h or 16 h at
37°C, 5 % CO2. Supernatant was harvested and
51
Cr release was measured in a
gamma counter. Percent specific release was calculated as ((experimental release –
spontaneous release) / (maximum release – spontaneous release)) x 100.
In redirected lysis assays of NK cells against the target cell line P815 the antibodies
were added to the effector cells to a final concentration of 0.5 µg/ml before the target
cells were added. In redirected lysis assays with T cells as effector cells the anti-CD3
antibody was used in a serial threefold dilution starting at a final assay concentration
of 1 ng/ml, while the final concentration of co-stimulatory antibodies was 0.5 µg/ml.
MATERIALS AND METHODS
39
Flow-cytometry
Surface staining
Surface staining of cells was performed in 96-well V-bottom plates. About 2 x 105
cells were resuspended in 50 µl FACS-buffer containing 10 µg/ml of the respective
primary antibody and incubated on ice for 20 min. Antibodies directly conjugated to a
fluorophore were used at appropriate dilutions and cells were incubated in the dark to
protect the fluorophore. After washing with FACS-buffer cells stained with unlabeled
antibodies were resuspended in 50 µl PE-conjugated goat-anti-mouse IgG secondary
antibody diluted 1:200 in FACS-buffer. Cells were incubated on ice for 20 min in the
dark, washed again and resuspended in FACS-buffer. If necessary, cells were fixed
in FACS-buffer containing 2 % formaldehyde.
For fluorescence-activated cell sorting 1 to 3 x 106 cells were stained and all steps
were carried out under sterile conditions.
Intracellular staining
All steps for intracellular staining of cells were carried out at room temperature. Cells
were fixed for 5 min in 4 % paraformaldehyde solution and permeabilized by
incubation in high protein FACS-buffer containing 0.5 % (w/v) saponin for 5 min.
Fixed and permeabilized cells were resuspended in 50 µl FACS-buffer with saponin
containing the fluorophore-conjugated antibodies in appropriate dilutions and
incubated in the dark for 20 min. To wash the cells, 150 µl of FACS-buffer with
saponin were added and the cells were incubated for 5 min, before they were
pelleted and resuspended in FACS-buffer.
CFDA-staining
Cells were harvested by centrifugation for 7 min at 400 x g and residual medium was
carefully removed. PBS containing CFDA at a concentration of 0.5 µmol/ml was used
to resuspend the cells to a density of 4 x 106 cells/ml. After incubation for 30 min at
37°C, 5 % CO2 the labeling reaction was stopped by adding an excess of culture
medium.
Staining of blood samples
50 µl blood were incubated with antibodies in appropriate dilutions for 20 min at 4°C
in the dark. Samples were fixed and erythrocytes were lysed by addition of 2 ml BD
FACS
lysing
solution
(BD
Biosciences).
After
incubation
for
10 min
at
MATERIALS AND METHODS
40
room temperature in the dark cells were pelleted by centrifugation and resuspended
in PBS.
Flow-cytometric analysis
Samples were analyzed on a BD FACScan, BD FACSCalibur or BD LSR 2 and
results were evaluated using the FlowJo Software from Tree Star or FACS DiVa from
BD.
Isolation of lymphocytes
Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats or whole
blood using density centrifugation over LSM solution.
Polyclonal NK cells were purified from PBMC by negative selection using a NK cell
negative isolation kit, according to the manufacturer’s instructions. NK cells were
between 90 % and 99 % NKp46+, CD3- and CD56+, as confirmed by flow cytometry.
After isolation the cells were resuspended in culture medium containing 1 µg/ml
PHA-P and 5 ng/ml recombinant human IL-15, mixed with irradiated JY cells (5 x 105
cells/ml) and plated in 96-well round bottom plates at densities ranging from 1x106 to
2 x 106 cells/ml. Growing cell cultures were expanded 1:1 with culture medium.
Peripheral blood T cells were purified from PBMC with negative selection kits either
for total, CD8-positive or CD4-positive T cells. T cells were then resuspended in
culture medium at a density of 3 x 106 cells/ml and cultured in appropriate culture
flasks.
Transfection of primary lymphocytes
Primary lymphocytes were transfected using the nucleofection technology (Lonza).
5 x 106 T cells per sample were transfected with 1 or 2 pmol of siRNA, according to
the manufacturer’s instructions. After nucleofection cells were taken up in AIM V
medium (Gibco) supplemented with 10 % FCS.
Primary NK cells were transfected after one week of culture. 2 to 3 x 106 cells per
sample were transfected with 1 or 2 pmol of siRNA using the Nucleofector solution
for human macrophages and the nucleofection program X-01, following the
manufacturer’s instructions at all other steps.
MATERIALS AND METHODS
41
Viral transduction
Retroviral transduction of cell lines
Retroviral gene transfer was done using the packaging cell line Phoenix ampho. At
day one Phoenix cells were plated in a small tissue culture flask at a density of
1 x 106 cells in 4 ml medium and grown for 24 h. Cells were transfected with the
respective plasmid using Lipofectamin according to the manufacturer’s instructions.
After transfection cells were grown for 12 h to 18 h. The medium was exchanged for
the appropriate medium for the cells that were to be transduced and Pheonix cells
were kept in culture for 24 h. Supernatant containing the viral particles was harvested
and cleared by centrifugation. 0.5 x 106 cells to be transduced were resuspended in
the supernatant supplemented with 5 µg/ml polybrene. Transduction was carried out
as spinfection by centrifugation for 1.5 h at 1350 x g and 30°C. Spinfection was done
in 12 well plates and cells were afterwards grown over night. The medium was
exchanged the next day by pelleting cells and resuspending them in fresh medium.
After culturing infected cells for one day puromycin was added at concentrations
between 0.5 and 2 µg/ml to select for transduced cells. Transduced cells were
expanded and if necessary further enriched by FACS.
Lentiviral transduction of NK cells
Viral vectors were produced in HEK 293T cells transfected with transfer vector,
packaging plasmid and envelope plasmid at a ratio of 7.5 / 3.75 / 1 by calcium
phosphate precipitation. To do so DNA was diluted in sterile water and 2 M calcium
chloride solution was added to a concentration of 244 mmol/l. An equal volume of 2x
HBS was added to the DNA solution and mixed by bubbling vigorously. The mixture
was added dropwise to the HEK 293T cells. 12 h later the medium was exchanged
and cells were grown for 24 h. Then the medium was collected, cleared from cells by
centrifugation and filtered through 0.45 µm pore size filters.
Various transduction protocols have been tested. The virus was concentrated by
ultra-centrifugation and used at MOI ranging from 10 – 20 for spinfection or the
collected medium was used to concentrate the virus on RetroNectin-coated plates
following the manufacturer’s instructions. The transduction efficiency was measured
by flow-cytometry.
MATERIALS AND METHODS
42
3.3.3 Protein biochemistry
Homology modeling
The three dimensional structure of NTB-A was modeled using the web-based
PHYRE software (http://www.sbg.bio.ic.ac.uk/~phyre/) (170).
Immunoprecipitation
Cell lysates from cell mix experiments were precleared by incubation with 20 µl of a
50 % slurry of recombinant protein G agarose in PBS for 30 min at 4°C. During this
and all following incubations the samples were gently agitated. Protein G agarose
was removed by centrifugation (1 min at 3500 x g and 4°C) and lysates were
consecutively incubated with 2 µg of control antibody and 2 µg of specific antibody,
each coupled to 20 µl of a 50 % slurry of recombinant protein G agarose in PBS.
Incubations were for 1 h at 4°C. These steps were repeated, when more than one
precipitation was done from the same lysate. Samples were washed three times with
ice-cold lysis buffer and residual buffer was removed using a Hamilton syringe.
Samples were frozen at -20°C until they were analyzed by SDS-PAGE and western
blot.
SDS-polyacrylamid gel-electrophoresis (SDS-PAGE)
After adding reducing sample buffer, samples were boiled for 5 min at 95°C, cooled
on ice and centrifuged for 1 min at 20000 x g. Samples to a maximal volume of 25 µl
and 5 µl of Precision Plus Protein Standard (BioRad) were loaded on 10 % or 12 %
NuPage gels (Invitrogen) and separated for 1 h 15 min at 150 V in 1 x MOPS buffer.
Western blot
After SDS-PAGE proteins were transferred to a polyvinylidene difluoride (PVDF)
membrane (Millipore) for 1.5 h at 200 mA in western blot transfer buffer. PVDF
membranes were activated with methanol and rinsed with transfer buffer prior to use.
After western blotting, membranes were incubated for 1 h at room temperature in
blocking buffer and washed for at least 3 times in PBST. Membranes were incubated
with the primary antibody in PBST containing 5 % (w/v) BSA for 1 h at room
temperature or overnight at 4°C. The membrane was washed at least three times
with PBST/NaCl and incubated with the appropriate horseradish-peroxidase (HRPO)conjugated secondary antibody or HRPO-conjugated streptavidin for 1 h at room
temperature. Secondary antibodies were diluted 1:5 000-1:40 000 in blocking buffer.
After incubation with the secondary antibody, the membrane was extensively washed
MATERIALS AND METHODS
43
with PBST and developed using either SuperSignal West Pico or Dura and X-Ray
films.
3.3.4 Statistical analysis
Statistical analysis was performed using Prism 4.0 (GraphPad Software, Inc., San
Diego, CA, USA).
RESULTS
44
4 Results
4.1
The molecular basis for the homophilic NTB-A interaction
4.1.1 Mutational analysis of the homophilic NTB-A interaction
At the beginning of this work the molecular basis for the homophilic interaction of two
NTB-A molecules was unknown. To find amino acid residues that contribute to the
binding of two NTB-A molecules to each other, a possible structure of the
extracellular part of NTB-A was predicted using homology modeling. Based on the
model structure eight charged amino acid residues were chosen for mutational
analysis: glutamate-26 (E26), lysine-27 (K27), glutamate-37 (E37), glutamate-47
(E47), lysine-49 (K49), glutamate-52 (E52), lysine-62 (K62) and lysine-92 (K92). The
residues E26, K27, E47, K49, E52 and K92 are located on the side of the IgV-domain
that is most distant to the plasma membrane. They form an alternating pattern of
positive and negative charges that seemed to be a likely candidate for an interface
based on electrostatic forces. We hypothesized that the four positive charges of the
lysine residues could be located opposite to the negative charges of the glutamate
residues of the second NTB-A in the homodimer and vice versa. The residues E37
and K62 are located at the other side of the IgV-domain and were chosen to cover a
greater part of the IgV-domain. The crystal structure of the homodimer of human
NTB-A published during the course of this work confirmed the predicted position of
these residues (fig. 4A).
Site directed mutagenesis was performed to replace the selected amino acids with
alanine. The mutated receptors were then stably expressed in the cell line BA/F3, a
murine B cell line that lacks ligands for activating human NK cell receptors and is
therefore a poorly lysed target cell line. Expression of the wild type form of human
NTB-A makes the cells susceptible to recognition and lysis by human NK cells.
Mutations that diminish capacity of binding to the wild type receptor are supposed to
result in a reduced lysis of cells. To compare the lysis of BA/F3 cells induced by
NTB-A-mutants to lysis induced by the wild type receptor,
51
Cr-release assays with
IL-2-activated primary human NK cells were performed (fig. 4B).
RESULTS
45
Figure 4: The charged residues at the edge of the homophilic interaction site do not contribute
to the binding of two NTB-A receptors.
A: The structure of the NTB-A-homodimer with a selection of amino acid side chains. The highlighted
amino acid residues were mutated to alanine to test their relevance for the interaction. B: BA/F3 cells
stably transfected with wild type NTB-A or one of the mutated receptors were used as target cells in a
51
4 h Cr-release assay with IL-2-activated primary NK cells at different effector to target (E/T) ratios.
GFP-transfected BA/F3 cells were used as negative control. The specific lysis is plotted as mean of
triplicates ± SD. C: Similar expression levels of the transfected receptors were confirmed by flowcytometry. The mutation of lysine 49 to alanine (K49A) disrupts the binding of the antibody NT-7.
Therefore the clone MAB 1908 was used (lower row). The gray histograms represent staining with an
unspecific control antibody. One representative experiment of three is shown.
None of the eight mutations resulted in a reduced lysis of the respective BA/F3 cells.
Similar expression levels of the wild type and the NTB-A mutants were confirmed by
flow-cytometry (fig. 4C). The mutant NTB-A K49A could not be stained with the antiNTB-A antibody NT-7. But expression of the mutant receptor could be detected using
a different antibody clone (3C, lower row). This led to the conclusion that the epitope
recognized by antibody clone NT-7 is located around lysine-49.
Because no difference between the lysis of wild type and the NTB-A mutants was
detectable, we concluded that none of the eight amino acids contributes strongly to a
functional NTB-A-dimerization. At that time-point the crystal structure of the human
NTB-A-homodimer was published by Cao et al. (171). The structure showed that all
RESULTS
46
selected residues except E37 were indeed located outside the homophilic interface
(fig. 4A).
Based on the structure of the crystallized NTB-A-homodimer Cao et al. defined ten
amino acid residues (F30, L34, E37, S39, F42, H54, T56, R86, Q88 and S90) on
each IgV-domain, which form the interface between interacting NTB-A molecules.
They tested their hypothesis with a series of mutagenesis studies, substituting
alanine for each of the ten amino acids. Ectodomains of NTB-A containing the single
amino acid mutations were then recombinantly expressed in bacteria, refolded,
purified and assessed for their dimerization in gel filtration analysis, apart from the
F42A mutant that could not be refolded. With the exception of the mutation of serine39 all mutants showed a decreased ability to form dimers in solution (171).
As the mutation of E37 showed no decrease in our functional experiments, we
wanted to confirm the contribution of other residues of these ten to functional
interaction of NTB-A molecules. We chose the three residues, histidine-54 (H54),
glutamine-88 (Q88) and serine-90 (S90) (fig. 5A) whose mutation to alanine had a
strong effect on dimerization in the gel filtration experiments reported by Cao et al.
(171). Single mutants of the three residues to alanine were generated and H54 and
S90 were both exchanged in a double mutant. The mutant NTB-A receptors were
stably expressed in BA/F3 cells. Susceptibility of these cells to NTB-A-triggered
cytotoxicity was tested in
51
Cr-release assays with primary IL-2-activated NK cells
(fig. 5B). While the lysis of NTB-A Q88A-expressing cells was similar to lysis of cells
expressing the wild type receptor, the H54A and S90A mutants displayed a
diminished lysis. The mutation S90A showed a stronger effect on the interaction with
wild type NTB-A than H54A. The double mutation H54A S90A did not reduce the
lysis to a level lower than the S90A single mutation, which is only slightly above the
lysis of BA/F3 cells expressing GFP instead of any activating ligand. Similar
expression levels of NTB-A on the BA/F3 cells were confirmed by flow-cytometry
(fig. 5C). Molecular modeling based on the crystal structure and energy calculations
performed by David Nutt, our cooperation partner in bioinformatics, confirmed that
our mutations did not disrupt the overall domain structure.
RESULTS
47
Figure 5: Mutations of the residues histidine-54, glutamine-88 and serine-90 have different
impact on NTB-A function
A: The amino acid residues histidine-54 (H54), glutamine-88 (Q88) and serine-90 (S90) are
highlighted in the structure of the NTB-A-homodimer. To test their functional relevance for the
homophilic interaction of NTB-A each of the three was mutated to alanine in a single mutation and
H54 and S90 in one double mutant. B: BA/F3 cells stably transfected with wild type NTB-A or one of
51
the mutated receptors were used as target cells in 4 h Cr-release assays with IL-2-activated primary
NK cells at different E/T ratios. GFP-transfected BA/F3 cells were used as negative control. In the left
diagram the effects of the three single mutants are compared, in the right diagram the double mutant
is compared to the respective single mutants. The specific lysis is plotted as mean of triplicates ± SD.
Two representatives of five experiments with NK cells from nine donors are shown. C: Similar
expression levels of the transfected receptors were confirmed by flow-cytometry. The gray histograms
represent staining with an unspecific control antibody.
From these results we conclude a grading in the contributions of the amino acid
residues at the interface to the stability of the NTB-A-homodimer. Q88 and E37 have
only a small influence on the receptor interaction, as their mutation did not lead to
functional consequences. The hydrophobic interactions of H54 have a stronger
relevance for dimerization, but the most important of all residues analyzed was S90,
whose mutation almost totally abrogated NTB-A function.
4.1.2 Introducing complementary mutations to create a heterophilic pair of
NTB-A mutants
The homophilic interaction of NTB-A makes it difficult to investigate the early events
in the signaling processes after NTB-A engagement. Because there is continual
engagement of NTB-A between neighboring cells in cultures of NTB-A-expressing
cells, it is impossible to obtain cells expressing NTB-A in a completely unstimulated
RESULTS
48
state. To overcome this impediment we attempted to generate NTB-A mutants with
complementary mutations that would render the receptors self-incompatible, but
enable them to bind to each other, turning the homophilic NTB-A into a pair of
heterophilic mutants.
Based on energy calculations and molecular modeling on the crystal structure of the
NTB-A-homodimer our cooperation partner in bioinformatics predicted that the two
amino acid residues threonine-32 and leucine-34 could be used for that purpose.
These residues are located opposite each other in the homophilic interface (fig. 6A).
Replacing one of the residues with lysine or glutamate would introduce a charge, but
leave the overall structure of the IgV-domain intact.
Figure 6B illustrates the concept taking the mutation T32K as example. The positively
charged lysine was supposed to reduce the binding to wild type receptor (fig. 6B, left
panel) and to prevent dimerization with another NTB-A T32K molecule due to
repulsive electrostatic forces (fig. 6B, middle panel). In the complementary mutant
L34E a negatively charged glutamate residue is placed opposite the lysine and could
promote receptor binding through attractive electrostatic forces (fig. 6B, right panel).
We would expect NK cells expressing NTB-A T32K to lyse target cells expressing
NTB-A L34E and spare target cells expressing NTB-A T32K. Lysis of target cells
expressing wild type NTB-A would be reduced.
To test this concept we generated four NTB-A mutants T32E, T32K, L34E and L34K
and expressed them stably in the cell line BA/F3. To obtain NK cell lines expressing
only the mutant receptors, we expressed the wild type receptor or the mutants stably
in the NTB-A-deficient NK cell line NKL4- that has been derived from the cell line NKL
by repeated fluorescence-activated cell sorting (152). The expression levels of
NTB-A on all cell lines were analyzed by flow-cytometry (fig. 6C). As expected, only
expression of the wild type receptor enabled the NKL cells to lyse wild type NTB-Aexpressing BA/F3 cells. NKL4- cells expressing the mutant receptors showed equally
low cytotoxicity against BA/F3 cells expressing GFP or wild type NTB-A (fig. 6D).
However, the complementary mutants did not rescue the interaction in the expected
way. Target cells expressing one NTB-A mutant were poorly lysed regardless
whether the NKL4- expressed the complementary mutant or the same mutant
(fig. 6E).
RESULTS
49
Figure 6: Introducing complementary mutations into NTB-A to create a heterophilic receptor
pair
A: The positions of the two amino acid residues threonine-32 and leucine-34 in the NTB-A-NTB-A
interface. By mutating the opposing amino acids to charged residues lysine and glutamate it was
attempted to create a heterophilic pair of NTB-A mutants. B: An example to illustrate the expected
effects of one mutation on the interaction with wild type NTB-A, a receptor with the identical mutation
and the complementary mutant. C: All four possible mutations were generated and stably transfected
4into the NTB-A-deficient cell line NKL and BA/F3 cells. Similar expression levels were determined by
flow-cytometry. The gray histograms represent staining with an unspecific control antibody.
4D: Cytotoxicity of the transfected NKL against BA/F3 cells expressing wild type NTB-A.
4E: Cytotoxicity of transfected NKL against BA/F3 cells expressing the identical and complementary
51
mutants. Cytotoxicity was tested in a 16 h Cr-release assay at different E/T ratios F: To confirm the
4cytotoxic potential of the transfected NKL cells, a 16 h redirected lysis assay against P815 cells was
performed in the presence of control IgG or anti-NKG2D (αNKG2D) antibodies. Depicted are
means ±SD of triplicates. The experiments shown are representatives of two, in case of E including all
mutants and their complementary counterpart.
RESULTS
50
To exclude the possibility that the NKL4- cells lost their cytotoxic potential during the
retroviral transduction and the following selection process, we measured NKG2Dmediated lysis in a redirected lysis assay (fig. 6F). The NKL4- cells expressing the
wild type or the different mutants of NTB-A were still able to lyse target cells, but only
at a low level. All
51
Cr-release assays had to be conducted for 16 h, because no
considerable lysis could be observed after the usual 4 h incubation.
The attempt to create a heterophilic pair of NTB-A mutants by replacing the residues
T32 and L34 with charged residues was unsuccessful, because these mutations only
prevent the homophilic interaction, but obviously do not fit into a heterophilic
interface.
4.2
Early events in SLAM-related receptor signaling
4.2.1 Association
of
SAP
with
2B4
is
dispensable
for
receptor
phosphorylation
Receptor phosphorylation is one of the first events in SLAM-related receptor
signaling. For SLAM it has been shown that SAP can bind to the unphosphorylated
receptor and mediate receptor phosphorylation by recruitment of the Src-kinase FynT
(150). Unphosphorylated 2B4 and NTB-A do not bind SAP (82, 152). Therefore
phosphorylation of both receptors is thought to be a signaling event preceding the
association of SAP. On the contrary SAP KO mice show no phosphorylation of 2B4
after engagement, although the expression of Src-kinases is not disturbed (102).
To investigate the function of SAP in these early signaling events, we made use of
NK92 cells with a stably down-regulated SAP expression mediated by retroviral
shRNA delivery (NK92 shSAP). These cells show a defect in 2B4-mediated
cytotoxicity compared to control cells expressing an shRNA against CD4 (NK92
shCD4) while lysis mediated by the natural cytotoxicity receptor NKp30 was
unaltered (fig. 7A). To test whether the signal is already impaired at the level of
receptor phosphorylation, the two knockdown cell lines were stimulated by incubation
with the cell line 721.221, an EBV-transformed B cell line which expresses CD48, the
ligand for 2B4. Unstimulated and stimulated cells were lysed and 2B4 was
immunoprecipitated from the lysates. Immunoprecipitates were then analyzed by
western blotting (fig. 7B).
RESULTS
51
Figure 7: The effect of SAP-knockdown in NK92 cells on signaling of 2B4 and NTB-A
To study the impact of a SAP-knockdown on NK cell signaling, NK92-C1 cells stably expressing a
small hairpin RNA against SAP (shSAP) or CD4 (shCD4) mRNA (as negative control) were analyzed.
51
A: The two knockdown cell lines were used as effector cells in a redirected Cr-release assay against
P815 cells in the presence of IgG control antibody or antibodies against the receptors NKp30 and 2B4
at different E/T ratios. Data is shown as mean ± SD of triplicates. The results are from one
representative experiment out of four. B: For analysis of receptor signaling equal numbers of the two
cell lines were mixed with 721.221 cells and lysed at the indicated time-points. After a control
immunoprecipitation with an unspecific antibody (IP: IgG) 2B4 was immunoprecipitated from the
lysates. The immunoprecipitates were analyzed by western blotting. Membranes were probed with
anti-phospho-tyrosine antibodies to detect receptor phosphorylation and re-probed with antibodies
against 2B4 (upper panels). Antibodies against SAP and EAT-2 were used to detect co-precipitated
molecules on the same membrane (lower panels). C: Whole cell lysates were blotted and probed with
antibodies to confirm the reduced SAP levels in the NK92 shSAP cells. D: The two knockdown cell
lines were used as effector cells in a redirected 51Cr-release assay against P815 cells in the presence
of IgG control antibody or antibody against NTB-A at different E/T ratios. Data is shown as mean ± SD
of triplicates. The results are from one representative experiment out of four. E: After a control
immunoprecipitation with an unspecific antibody (IP: IgG) NTB-A was immunoprecipitated from the
same lysates as in B. Immunoprecipitates were analyzed by western blotting. Membranes were
probed with anti-phospho-tyrosine antibodies to detect receptor phosphorylation and re-probed with
antibodies against NTB-A (upper panels). Co-precipitation of SAP and EAT-2 was detected as in B
(lower panels). The blots shown are representatives of at least three cell mix experiments.
The membranes were probed with anti-phospho-tyrosine antibody to detect ITSMphosphorylation and re-probed with anti-2B4 antibody. Phosphorylation of 2B4 was
increased after stimulation in control and SAP-knockdown cells (6B, upper panel).
Because the extent of 2B4-phosphorylation was not diminished in shSAP cells, we
conclude that phosphorylation of 2B4 is independent of SAP association. The core
RESULTS
52
function of SAP-mediated FynT recruitment is not the enhancement of ITSM
phosphorylation.
4.2.2 EAT-2 recruitment to 2B4 is dependent on the presence of SAP
In the same experiments the association of the adapter molecules SAP and EAT-2
with the immunoprecipitated receptor was analyzed (6B, lower panels). In the control
cells SAP was absent from the low-level phosphorylated receptor in unstimulated
cells and was recruited to the activated, highly phosphorylated receptor. In the cells
with reduced SAP expression level no association of SAP with 2B4 could be
detected, although the SAP-knockdown was not complete, as shown by western blot
analysis of whole cell lysates (fig. 7C). In contrast to SAP, receptor-bound EAT-2 was
already detectable in unstimulated control cells and accumulated after stimulation.
Surprisingly, EAT-2 did not bind to the receptor in the knockdown cells, neither in the
unstimulated nor the stimulated state, even though its expression level remained
unchanged by the SAP knockdown (fig. 7C). The 721.221 cells used to stimulate the
NK92 cells in the cell mix assay do not express SAP or EAT-2 (152). Therefore the
total amount of detected protein must come from the NK92 cells.
4.2.3 NTB-A-phosphorylation is also independent of SAP association
We also investigated the role of SAP in early NTB-A signaling in the NK92 shSAP
cells with stably reduced SAP expression.
When testing the NTB-A-mediated cytotoxicity of the shSAP cells in comparison to
the control cells, a decreased lysis was observed (fig. 7D). To analyze NTB-A
phosphorylation in the absence of SAP both cell lines were stimulated by coincubation with 721.221 cells and NTB-A was immunoprecipitated. Western blot
analysis of the immunoprecipitates revealed a similar picture as for 2B4. Coincubation with the target cells induced an increase in NTB-A phosphorylation in
control cells and SAP-knockdown cells (fig. 7E, upper panel). As it has been shown
that there is no background-phosphorylation of NTB-A in the 721.221 cell line (152),
we can exclude that some of the phosphorylated NTB-A comes from the target cells
used in the cell mix.
4.2.4 EAT-2 does not bind to NTB-A in the absence SAP
Analysis of the co-precipitated adapter molecules showed that in contrast to 2B4 the
background-phosphorylation of NTB-A in unstimulated control cells was sufficient to
recruit EAT-2 and SAP. The association increased with receptor phosphorylation
RESULTS
53
(fig. 7E, lower panel). In cells with reduced SAP expression we could also detect
SAP and EAT-2 bound to the low-level phosphorylated receptor in unstimulated cells,
but instead of accumulating at highly phosphorylated NTB-A after stimulation neither
SAP, nor EAT-2 were detectable in the immunoprecipitate (fig. 7E, lower panel).
Similar to the observations made with 2B4 these results show a dependency of
EAT-2-receptor association on the simultaneous binding of SAP to the receptor.
4.2.5 2B4 phosphorylation is also SAP-independent in the cell line YTS
To exclude that the observed effect is specific for the NK92 cell line, we generated a
stable reduction of SAP expression in the NK-like cell line YTS by retroviral delivery
of shRNA against SAP (YTS shSAP), while an shRNA against CD4 served as control
(YTS shCD4). The reduction of 2B4-mediated cytotoxicity observed in the NK92
shSAP cells could be confirmed with the YTS shSAP cells (fig. 8A, left panel).
NTB-A-mediated lysis by YTS shSAP was also reduced to a small extent compared
to control cells (fig. 8A, right panel).
To investigate, if the early events in 2B4 signaling were affected in the same way as
in the NK92 shSAP cells, YTS shSAP and YTS shCD4 cells were stimulated by coincubation with BA/F3 cells expressing CD48. Unstimulated and stimulated cells
were lysed and 2B4 was immunoprecipitated from the lysates. Receptor
phosphorylation, co-precipitation and expression levels of adapter molecules were
analyzed by western blotting (fig. 8B). As observed in the NK92 cells the reduction of
SAP expression did not lead to a reduction of 2B4 phosphorylation. Association of
SAP with the highly phosphorylated receptor after stimulation could be detected in
the control cells, but was not found in shSAP cells. In contrast to the results obtained
with the NK92 cells, EAT-2 could not be detected in the immunoprecipitates, possibly
because of a lower expression level in the YTS cells.
RESULTS
54
Figure 8: The effect of SAP-knockdown in YTS cells on signaling of 2B4 and NTB-A
YTS cells stably expressing a small hairpin RNA against SAP (shSAP) or CD4 (shCD4) mRNA (as
negative control) were analyzed. A: The two knockdown cell lines were used as effector cells in a 4 h
51
Cr-release assay against BA/F3 cells expressing GFP, CD48 or NTB-A at different E/T ratios. Data
is shown as mean ± SD of triplicates. One representative experiment out of three is shown. B: For
analysis of receptor signaling equal numbers of the two cell lines were mixed with BA/F3 cells
expressing CD48 and lysed at the indicated time-points. After a control immunoprecipitation with an
unspecific antibody (IP: IgG) 2B4 was immunoprecipitated from the lysates. The immunoprecipitates
of anti-2B4 antibody (left panel) and whole cell lysates (right panel) were analyzed by western blotting.
Membranes were probed with anti-phospho-tyrosine antibodies to detect receptor phosphorylation and
re-probed with an antibody against 2B4. Antibodies against SAP and EAT-2 were used to detect coprecipitated molecules and confirm the reduced SAP expression in shSAP cells. Re-probing with antiactin antibody served as loading control for the lysates. EAT-2 could not be detected in the
immunoprecipitates. The blots shown are representatives of at least three cell mix experiments.
4.2.6 Establishing a method for knockdown of protein expression in primary
NK cells
The results obtained with the two cell lines show a dependency of 2B4 and NTB-A
signaling on the presence of SAP. A similar defect in 2B4 and NTB-A-mediated
cytotoxicity has been observed in NK cell from XLP patients lacking functional SAP
(84, 98, 136-138). On the contrary, it has been reported that NTB-A-mediated
cytotoxicity was still intact in NK cell lines, when SAP but not EAT-2 recruitment was
abrogated by ITSM mutation (152). This led to the conclusion that the NTB-A signal
that triggers a cytotoxic response is dependent on EAT-2, and the defect observed in
XLP patients may be due to disturbances in NK cell development in the absence of
functional SAP. As we observed that EAT-2 recruitment to SRR was dependent on
SAP, our results supported the notion that SAP is the crucial adapter molecule for
RESULTS
55
both 2B4 and NTB-A. Therefore we wanted to confirm these findings in primary NK
cells.
To knockdown SAP in primary NK cells we wanted to use a lentiviral vector
expressing the same shRNA used for the RNA-interference in the cell lines. We
cloned the shRNA sequences into the vector pLVTHM, a vector that contains a GFP
gene as marker for transduced cells. As a positive control for transduction the vector
pWPXL siNKG2D was used, a vector for RNA interference against NKG2D that also
contains GFP as reporter gene (172). Primary IL-2-activated NK cells were
transduced and GFP expression was detected by flow-cytometry. GFP-positive cells
could be detected after transduction with each vector and the effect of RNA
interference with NKG2D expression could be detected by staining the pWPXL
siNKG2D-transduced cells for NKG2D (fig. 9A). But the transduction efficiency
reached with either vector was low, ranging from 4 to 5 %, reaching a maximum of
10 % in one experiment with pLVTHM shSAP (fig. 9A). This efficiency is far too small
to obtain sufficient cell numbers for functional assays.
Figure 9: Lentiviral transduction of primary NK cells compared to nucleofection
A: IL-2-activated primary NK cells were transduced with the lentiviral vectors pWPXL siNKG2D or
pLVTHM shSAP. Both vectors contain GFP as marker gene for transduced cells and code for small
hairpin RNA against the receptor NKG2D or SAP, respectively. 12 or 15 days after transduction,
respectively, the percentage of transduced cells was determined by flow-cytometry. The downregulation of NKG2D expression on cells transduced with pWPXL siNKG2D was confirmed by staining
with an anti-NKG2D antibody. The numbers give the percentage of cells in the depicted gates. The
plots show the results of the most successful experiments. B: IL-2-activated primary NK cells were
transfected with Alexa647-labeled siRNA against SAP or unlabeled control siRNA (gray histogram)
using nucleofection. 20 h later the cells were washed twice and analyzed by flow-cytometry.
Thus, we decided to test, whether a transient transfection with siRNA was a more
suitable tool. Using nucleofection technology we transfected primary IL-2 activated
NK cells with fluorescence-labeled siRNA against SAP and analyzed the transfection
efficiency 20 h later by flow-cytometry (fig. 9B). The greatest part of the NK cells was
positive for fluorescence of the labeled siRNA. Therefore we chose to reduce SAP or
EAT-2 expression in primary NK cells by transient transfection with siRNAs.
RESULTS
56
4.2.7 SAP is the relevant adapter molecule for 2B4 and NTB-A-triggered
cytotoxicity
To confirm the results obtained with the cell lines and to elucidate the role of EAT-2,
primary IL-2-activated NK cells were transfected with siRNA against SAP, EAT-2 or
both. 48 h after transfection expression levels of the two adapter molecules were
analyzed by western blotting of cell lysates (fig. 10A). The expression of SAP and
EAT-2 was strongly reduced in cells transfected with the respective siRNA. To
exclude unspecific side effects of the siRNA on the investigated signaling events
equal expression of FynT was confirmed in the lysates (fig. 10A) and expression
levels of 2B4 and NTB-A were confirmed by flow-cytometry (fig. 10B).
Figure 10: 2B4 and NTB-A-mediated cytotoxicity are impaired after SAP-knockdown, but not
after EAT-2-knockdown in primary NK cells
IL-2-activated primary NK cells were transfected with control siRNA, siRNA against SAP, against
EAT-2 or both. A: The knockdown was confirmed 48 h later by western blotting of whole cell lysates.
B: Equal expression levels of 2B4, NTB-A and NKG2D 48 h after transfection were confirmed by flowcytometry. C: The functional consequence of the decreased expression of the adapter molecules was
51
tested in a 4 h Cr-release assay against P815 cells in the presence of control antibody, or antibodies
against 2B4, NTB-A or NKG2D. Results shown are from four independent experiments. Plotted is the
specific lysis at an E/T ratio of 5/1 corrected by subtracting the lysis observed in the presence of
control antibody for each experiment. The bars represent the mean value. Statistical significance of
the reduced lysis compared to control siRNA-transfected cells was calculated using one-way ANOVA
and Dunnett’s post test (* indicates p < 0.05).
RESULTS
57
To assess the influence of SAP and EAT-2 on the signaling of 2B4 and NTB-A in
primary NK cells, cytotoxicity of transfected cells against the target cell line P815 was
measured in the presence of antibodies against each of the two receptors, or NKG2D
as a positive control (fig. 10C).
The specific lysis was lower for 2B4 and NTB-A, when SAP expression was reduced.
In contrast, a decreased expression level of EAT-2 did not result in a reduction of
lysis. The lysis obtained with the double knockdown cells was diminished to a similar
level as observed with the SAP knockdown cells. NKG2D-mediated lysis was not
affected by the down-regulation of either adapter molecule. These effects of the
knockdown were observed in all experiments performed with NK cells from different
donors. However, the reduction of 2B4-mediated lysis was only statistically significant
for the double knockdown and NTB-A-mediated lysis was only significantly reduced
in the SAP single knockdown.
The analysis of receptor phosphorylation in primary cells was not possible, because
the numbers of transfected NK cells were not sufficient.
The results obtained with primary NK cells confirm that SAP and not EAT-2 is the
main mediator of signal transduction leading to cytotoxic responses after 2B4 or
NTB-A engagement.
4.3
Functions of NTB-A and CRACC in T cells
Co-stimulation of T cells through NTB-A and CRACC induces activation and
proliferation
For the receptors SLAM, CD84, 2B4 and NTB-A it has been shown that their
engagement can enhance proliferation of T cells stimulated via their T cell receptor
(73, 104, 109, 173-175). To test whether the receptor CRACC, which is expressed on
a subset of T cells (fig. 11), has also co-stimulatory potential on these cells,
peripheral blood T cells were stimulated with different combinations of plate-bound
antibodies.
Figure 11: CRACC is expressed on a subset of T cells
Freshly isolated peripheral blood T cells were stained for CD4, CD8 and CRACC and analyzed by
flow-cytometry. Results for two donors are shown to represent variability of the CRACC-positive
subsets. The gray histograms represent staining with an unspecific control antibody.
RESULTS
58
Figure 12: Co-stimulation of T cells through CRACC and NTB-A induces expression of
activation markers
Peripheral blood T cells were stimulated with plate-bound antibodies. The plates were pre-coated with
goat-anti-mouse-IgG antibody. Anti-CD3 antibody (αCD3) was used at a sub-stimulatory concentration
of 0.01 µg/ml, alone or in combination with control antibody (IgG) at 10 µg/ml or co-stimulatory
antibodies against CRACC (αCRACC), NTB-A (αNTB-A) and CD28 (αCD28) in concentrations of
0.1 µg/ml, 1 µg/ml and 10 µg/ml. αCRACC, αNTB-A and αCD28 were also tested without αCD3 at a
concentration of 10 µg/ml. After 48 h the cells were harvested and stained for CD69 (upper panels),
CD25 (lower panels) and CD8 (left panels) or CD4 expression (right panels). The symbols represent
different donors; the bars show the mean of all four donors. The mean values obtained for the costimulation with CRACC were compared to value for αCD3 + IgG stimulation using one-way ANOVA
and Dunnett’s post test. Asterisks indicate statistical significance: * p < 0.05, ** p < 0.01.
T cells used for the investigation of proliferation were labeled with CFDA prior to
stimulation. The antibody against the T cell receptor component CD3 was used at a
concentration too low to induce proliferation by itself and was mixed with an
unspecific control antibody or antibodies against CRACC, NTB-A or CD28 at three
different concentrations. These antibodies were also tested without anti-CD3
antibody.
After 48 h of stimulation the unlabeled T cells were harvested, stained for the early
activation marker CD69 or CD25 (the IL-2-receptor α-chain) and CD8 or CD4 and
analyzed by flow-cytometry (fig. 12). Without simultaneous stimulation of the T cell
RESULTS
59
receptor neither of the antibodies showed stimulatory capacity. Co-stimulation with
anti-CRACC antibody led to a small increase of CD69 expression on CD8-positive
cells and a more prominent increase on CD4-positive cells compared to the
expression on cells stimulated with anti-CD3 and control antibody. CD25 was also
induced through CRACC co-stimulation on both T cell subsets. The increase was
more distinct than the effect on CD69 expression, although no statistical significance
could be determined for the CD4-positive subset. NTB-A was as effective as the
classical co-stimulatory receptor CD28 on both subsets. Nearly all CD8-positive T
cells became positive for CD69 and CD25 after co-stimulation with anti-NTB-A
already at the lowest concentration of 0.1 µg/ml.
Figure 13: Co-stimulation of T cells through CRACC and NTB-A induces proliferation
Peripheral blood T cells were labeled with CFDA and stimulated with plate-bound antibodies as
described for fig. 12. After 72 h the cells were harvested, stained for CD8 (left panel) or CD4
expression (right panel) and analyzed by flow-cytometry. The percentage of proliferating cells was
determined based on CFDA-dilution. The symbols representing different donors correspond to the
symbols used in fig. 12; the bars show the mean of all four donors. The mean values obtained for the
co-stimulation with CRACC were compared to value for αCD3 + IgG stimulation using one-way
ANOVA and Dunnett’s post test. Asterisks indicate statistical significance: * p < 0.05, ** p < 0.01.
After 72 h of stimulation the proliferation of T cells from the CD8- or the CD4-positive
subset was analyzed by flow-cytometry (fig. 13). None of the antibodies induced
proliferation in the absence of T cell receptor stimulation. Co-stimulation with antiCRACC antibody induced proliferation in a dose-dependent manner, matching the
observations on activation marker expression. The effect of the lowest concentration
(0.1 µg/ml) was not statistically significant compared to the proliferation induced by
anti-CD3 in combination with unspecific control antibody. At higher concentrations
(1 or 10 µg/ml) the percentage of proliferating cells was significantly increased, both
in the CD8 and CD4-positive subset, even though the response to co-stimulation of
RESULTS
60
CRACC showed a high variability between donors in the CD4-positive subset. Similar
to the induction of activation markers, the proliferation induced by co-stimulation
through NTB-A or CD28 was equally high. The percentage of proliferating cells
reached its maximum already at the lowest concentrations.
These results show that CRACC and NTB-A have a co-stimulatory potential to
activate T cells and elicit a proliferative response. The effect of co-stimulation through
CRACC is possibly less prominent, because CRACC expression is restricted to a
smaller subset of T cells.
4.3.1 Co-stimulation through NTB-A and CRACC induces cytokine production
To study the effect of co-stimulation through NTB-A and CRACC on the production of
cytokines, peripheral blood T cells were stimulated with plate-bound antibody against
CD3 at sub-optimal concentration in combination with an unspecific control antibody
or antibodies against CRACC, NTB-A or CD28 for 6 h. Afterwards cells were lysed
and mRNA levels of the cytokines IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p40, IL-13, IL-17,
IL-18, TNF-α, TGF-β, and IFN-γ were determined in relation to GAPDH-mRNA by
quantitative RT-PCR. Where detectable, the expression pattern of cytokine mRNA
showed no qualitative, but only quantitative differences between the three costimulators. IL-2, TNF-α and IFN-γ-mRNAs were strongly expressed after costimulation through CD28 (fig. 14A). NTB-A-mediated co-stimulation also increased
IL-2 and IFN-γ-mRNA levels, but to a far lesser extent; and co-stimulation with
CRACC led only to a very slight, but significant elevation of IFN-γ-mRNA.
To investigate cytokine production at the level of protein expression, peripheral blood
T cells were stimulated for 48 h with plate-bound antibodies as described for the
analysis of activation markers or proliferation. Brefeldin A was added to the cultures
4 h before analysis to inhibit exocytosis of cytokines. Expression of IL-2, IFN-γ,
TNF-α and CD4 or CD8 were analyzed by intracellular staining and flow-cytometry.
IL-2 production was detected in CD4-positive cells co-stimulated with anti-CRACC
and anti-NTB-A antibodies, although the variability between cells from different
donors was high (fig. 14B). Similar to the results obtained for proliferation, the
percentage of positive cells after CRACC-mediated co-stimulation was lower
compared to that after co-stimulation of NTB-A. The observed levels of IL-2-positive
cells were similar after NTB-A- and CD28-mediated co-stimulation. The induction of
IFN-γ production in CD8-positive cells was only marginal after CRACC co-stimulation.
RESULTS
61
Figure 14: Co-stimulation of T cells through CRACC and NTB-A induces cytokine production
A: Peripheral blood T cells were stimulated with plate-bound antibodies. The plates were coated as
described for fig. 12. Control antibody (IgG) or co-stimulatory antibodies against CRACC (αCRACC),
NTB-A (αNTB-A) and CD28 (αCD28) were used at concentrations of 10 µg/ml. After 6 h the cells were
harvested and mRNA expression of IL-2, TNF-α and IFN-γ relative to GAPDH-mRNA was determined
by quantitative RT-PCR. The graph shows the mean of three experiments ± SD. The values obtained
from the cells co-stimulated with αCRACC or αNTB-A were compared to the control cells with paired ttest. * The increased levels of IL-2-mRNA and IFN-γ-mRNA after NTB-A-co-stimulation (p = 0.041,
each) and the increased level of IFN-γ-mRNA after CRACC-co-stimulation (p = 0.032) were
considered statistically significant. B – D: The cytokine production was also analyzed at the level of
protein expression. Peripheral blood T cells were stimulated as described for fig. 12. Brefeldin A was
added to the cultures for the last 4 h. Cells were harvested, fixed and permeabilized. After staining
with the respective antibodies cells were analyzed by flow-cytometry. B: IL-2 expression in CD4positive cells. C: IFN-γ expression in CD8-positive (left panel) and CD4-positive cells. D: TNF-α
expression in CD8-positive cells. The symbols representing different donors correspond to the
symbols used in fig. 12 and 12; the bars show the mean of all four donors. The mean values obtained
for the co-stimulation with CRACC were compared to value for αCD3 + IgG stimulation using one-way
ANOVA and Dunnett’s post test. Asterisks indicate statistical significance: * p < 0.05, ** p < 0.01.
RESULTS
62
The effect of CRACC co-stimulation was more visible in CD4-positive cells, although
without statistical significance (fig. 14C). NTB-A-mediated co-stimulation resulted in
IFN-γ expression in both T cell subsets. TNF-α production of CD8-positive cells could
also be detected after NTB-A co-stimulation and to a small extent after CRACC costimulation, but only the value obtained with the highest anti-CRACC antibody
concentration was statistically significant (fig. 14D).
These results show that co-stimulation through NTB-A or CRACC is also able to
induce production of the cytokines IL-2, TNF-α and IFN-γ in CD4 and CD8-positive T
cells. Again, the effect of co-stimulation through CRACC is limited by the size of the
subset expressing the receptor.
4.3.2 Co-stimulation with the anti-CRACC antibody is specific
To exclude the possibility that the small effects observed after co-stimulation of
CRACC were due to an unspecific interaction of the anti-CRACC antibody, we
investigated, whether co-stimulation with another anti-CRACC clone led to similar
results. The clone CS1-4 used in previous experiments and the clone 162.1 (112)
were tested at different concentrations in combination with anti-CD3 antibody in suboptimal concentration. After 48 h the stimulated peripheral blood T cells were
analyzed by flow-cytometry for CD69 and IFN-γ expression (fig. 15).
Figure 15: Comparison of the stimulation by two different anti-CRACC antibodies
Peripheral blood T cells were stimulated with plate-bound antibodies. The plates were pre-coated with
goat-anti-mouse-IgG antibody. Anti-CD3 antibody (αCD3) was used at a sub-stimulatory concentration
of 0.01 µg/ml, alone or in combination with increasing concentrations (0.01 µg/ml, 0.05 µg/ml,
0.1 µg/ml, 1 µg/ml, 5 µg/ml and 10 µg/ml) of the two antibody clones against CRACC: CS1-4, the one
used in previous experiments, and 162.1. After 44 h Brefeldin A was added to the cultures. 4 h later
the cells were harvested, fixed and permeabilized. Flow-cytometry was performed after staining for
CD69, IFN-γ and CD8.
RESULTS
63
Both antibodies could induce CD69 expression, but clone 162.1 had a stronger effect
with a different dose response. At 0.1 µg/ml the percentage of positive cells had its
maximum and decreased with increasing 162.1 concentrations. While co-stimulation
with CS1-4 failed to induce IFN-γ production in the experiment shown in figure 15,
clone 162.1 was able to induce production of IFN-γ with the same dose response
observed for CD69 expression. Therefore we conclude that the co-stimulation
through CRACC is a specific effect.
4.3.3 CRACC is expressed on memory T cells and activated T cells
The limited effects observed after co-stimulation of CRACC are possibly due to the
small size of the T cell subset expressing the receptor. To further characterize this
subset, naïve and memory T cells were screened for expression of CRACC. These
subsets can be defined by the expression of CCR7 and the CD45 isoform CD45RA
(23). Naïve T cells express both molecules, central memory T cells express CCR7
and CD45RO instead of RA, effector memory T cells are negative for CCR7 and
CD45RA with the exception of a minor subset of effector memory T cells that reexpresses the CD45RA isoform. Freshly isolated peripheral blood T cells were
analyzed by flow-cytometry for expression of these markers, CD4, CD8 and CRACC
(fig. 16A). Naïve T cells neither of the CD4 nor the CD8-positive subset did express
CRACC. CD8-positive cells of all memory cell types showed CRACC expression,
while CD4-positive effector memory cells showed only a slight increase in CRACC
staining. This is corresponding to the expression pattern on CD4 and CD8-positive T
cells (fig. 11 and (112)).
Because the expression of CRACC is restricted to memory cells, we wanted to test
whether activation of T cells induces CRACC expression. To this end freshly isolated
peripheral blood T cells were unspecifically stimulated with PHA-P and then kept in
culture with IL-2 for one week. During this time CRACC expression on CD4 and CD8positive cells was monitored by flow-cytometry (fig. 16B). Three days after stimulation
there was a strong increase in CRACC-positive cells in the CD8-positive subset and
after one week all CD8-positive cells expressed CRACC. The CRACC expression on
CD4-positive cells changed only marginally.
RESULTS
64
Figure 16: CRACC is expressed on memory T cells and activated T cells
A: Freshly isolated peripheral blood T cells were analyzed by flow-cytometry after staining with a
control antibody or anti-CRACC antibody in combination with antibodies against CD4, CD8, CD45RA,
and CCR7. According to their expression of CD45RA and CCR7 the cells were classified as naïve T
+
+
+
cells (CD45RA , CCR7 ), central memory T cells (CD45RA , CCR7 ), and CD45-positive and negative
effector T cells (CCR7 ). The expression of CRACC was determined on each subset among CD4positive T cells (left panel) and CD8-positive T cells (right panel). The light gray histograms represent
the staining of the control antibody of the respective subset. The results shown are representative for
8 experiments. B: To study the expression of CRACC on activated T cells, freshly isolated peripheral
blood T cells were stimulated with 2 µg/ml PHA-P overnight, then washed and cultured in medium
containing 100 IU/ml of recombinant IL-2. At the indicated time-points cells were stained for CD4, CD8
6
and CRACC. Gray histograms represent staining with a control antibody. C: 10 PHA-P-activated T
cells were lysed at the indicated time-points to examine expression of the adapter molecule EAT-2 by
western blotting of whole cell lysates. Anti-actin blot served as loading control. The blot shown is
representative for five experiments. D: CFDA-labeled peripheral blood T cells were stimulated with
plate-bound anti-CD3 and anti-CD28 antibodies as described for fig. 12 at a concentration of
0.01 µg/ml for both antibodies. After 72 h cells were harvested, stained for CD8 and CRACC and
analyzed by flow-cytometry.
CRACC signaling is dependent on the adapter molecule EAT-2 (114) and in murine
CD4-positive T cells, which do not express EAT-2, CRACC has been shown to act as
inhibitory receptor (115). Therefore we studied the expression of EAT-2 in PHA-Pactivated T cells by western blotting of lysates at different time-points after
RESULTS
65
stimulation (fig. 16C). Stimulation of T cells increased the expression of EAT-2 over
the whole time-span investigated.
To study whether CRACC up-regulation is correlated to proliferation of T cells,
CFDA-labeled cells stimulated with plate-bound antibodies against CD3 and CD28 as
described for previous experiments, were analyzed for expression of CRACC on
CD8-positive cells by flow-cytometry (fig. 16D). All cells that had undergone cell
division expressed CRACC. In the population of cells that had not divided CRACC
expression was only detected on a subset.
From these findings we conclude that CRACC is mainly expressed on activated,
proliferating and memory T cells of the CD8-positive subset.
4.3.4 CRACC co-stimulation is no positive feedback mechanism to enhance
proliferation
The expression of a further co-stimulatory receptor on activated and proliferating
cells could function as a positive feedback mechanism. Through homophilic
interaction between CRACC molecules on neighboring cells proliferation of activated
T cells could be enhanced. A similar effect has been shown for the interaction of 2B4
and CD48 or SLAM on neighboring T cells (104, 174). To investigate if T cell
proliferation was altered in the absence of CRACC and to further confirm the
specificity of CRACC-mediated co-stimulation, freshly isolated peripheral blood T
cells were transfected with control siRNA or siRNA against CRACC.
Because CRACC expression is up-regulated after stimulation and siRNA is diluted in
proliferating cells, the attempt to silence CRACC could be difficult. We tested, how
efficiently CRACC expression could be reduced by transient transfection with siRNA
in activated cells. The efficiency of the siRNA-mediated suppression of CRACC
expression was monitored by flow-cytometry after stimulating the transfected T cells
with PHA-P (fig. 17A). To quantify the expression level of CRACC, the relative
fluorescence index (RFI) was calculated from the mean fluorescence intensity of
CRACC-staining in relation to the mean fluorescence intensity of staining with control
antibody.
RESULTS
66
Figure 17: Knockdown of CRACC in T cells
Freshly isolated peripheral blood T cells were transfected with control siRNA or a mixture of four
siRNAs against CRACC. A: Transfected T cells were activated with 2 µg/ml PHA-P overnight, then
washed and cultured in medium containing 100 IU/ml recombinant IL-2. At the indicated time-points
cells were stained for CD4, CD8 and CRACC and analyzed by flow-cytometry. The graph shows the
relative fluorescence index (RFI) of CRACC-staining on CD8-positive T cells. The RFI was calculated
from
the
mean
fluorescence
intensities
(MFI)
using
the
following
formula:
RFI(CRACC) = (MFI(CRACC) – MFI(control antibody)) / MFI(control antibody)
B: T cells transfected with the indicated siRNA were stained with CFDA and stimulated with platebound antibodies as described for fig. 12. The concentrations of the co-stimulatory antibodies were
0.1 µg/ml, 1 µg/ml and 10 µg/ml for anti-CRACC antibody CS1-4 and 0.01 µg/ml, 0.1 µg/ml and
1 µg/ml for anti-CRACC antibody 162.1 and anti-CD28 antibody. After 72 h cells were harvested,
stained for CD8 and analyzed by flow-cytometry. The percentage of proliferating cells was determined
by CFDA-dilution. The bars represent the mean values ±SD of three experiments.
The expression of CRACC was reduced in the cells transfected with anti-CRACC
siRNA compared to control siRNA-treated cells for three days after stimulation. This
difference was moderate during the first two days after stimulation, but became very
prominent on the third day, when the expression level reached its maximum on
control cells. The expression of CRACC on stimulated cells treated with siRNA
against CRACC was reduced, but not completely abrogated.
As CRACC knockdown observed in PHA-P-activated cells lasted about three days,
we investigated, whether the reduction of CRACC expression resulted in a distinct
effect in proliferation assays. Peripheral blood T cells transfected with siRNA and
labeled with CFDA were stimulated with plate-bound antibodies for 72 h similar to
previous experiments. Proliferation of CD8-positive T cells was analyzed by flowcytometry (fig. 17B). Co-stimulation with anti-CRACC antibody CS1-4 induced only
very weak proliferation in T cells of the donors tested and no difference between
control cells and CRACC knockdown cells was detectable. Co-stimulation with the
antibody clone 162.1 was more effective. Here, the percentage of proliferating cells
was slightly reduced in the CRACC knockdown cells, but the reduction was not
RESULTS
67
statistically significant. When co-stimulated via CD28, cells treated with either siRNA
proliferated equally well.
This leads to the conclusion that CRACC co-stimulation between activated T cells is
no positive feedback mechanism, although we cannot exclude completely that
remaining CRACC is still sufficient to enhance proliferation.
4.3.5 Co-stimulation through CRACC induces proliferation in CD4 and CD8positive cells
In the initial experiments CD4 and CD8-positive T cells were used in the mixture that
is found in peripheral blood. Although the CD4-positive subset expresses CRACC to
a very small extent compared to the CD8-positive T cells (fig. 16), the activation and
proliferation induced through CRACC co-stimulation was similar in both subsets
(figs. 11 and 12). To answer the question, whether this was due to activation of the
small proportion of CRACC-positive CD4 memory cells or to a stimulatory effect of
activated CD8-positive memory cells, the co-stimulation experiments were repeated
with separately purified CD4 and CD8-positive cells, and a mixture of these cells.
Figure 18: Separation of CD4 and CD8-positive cells reduces the effect of CRACC-mediated costimulation
CD4 and CD8-positive T cells were isolated separately from peripheral blood. The purity of the cells
was greater than 97 % as determined by flow-cytometry. The cells were labeled with CFDA and
stimulated with plate-bound antibodies as described for fig. 12. CD4 and CD8-positive cells were
either stimulated alone or in a mixture consisting to 75 % of CD4-positive cells. The anti-CRACC
antibody was used at concentrations of 0.1 µg/ml, 1 µg/ml and 10 µg/ml, the anti-CD28 antibody at
concentrations of 0.01 µg/ml, 0.1 µg/ml and 1 µg/ml. After 72 h cells were harvested, stained for CD8
and analyzed by flow-cytometry. The percentage of proliferating cells was determined by CFDAdilution. The graph shows representative data from one of three experiments.
After 72 h proliferation of CFDA-labeled cells was analyzed by flow-cytometry
(fig. 18). CRACC co-stimulation induced proliferation of CD4-positive cells stimulated
RESULTS
68
alone, but the percentage of proliferating cells almost doubled, when CD8-positive
cells were present in the culture. CD8-positive T cells showed also an increased
proliferation after CRACC co-stimulation in the presence of CD4-positive cells. This
led to the conclusion that CRACC co-stimulation acts on CRACC-positive cells in
both T cell subsets, but is accompanied by a mutual enhancement of proliferation,
possibly by secretion of cytokines or interaction of co-stimulatory receptors on
neighboring cells.
4.3.6 CRACC and NTB-A do not enhance cytotoxicity
The main function of activated CD8-positive effector T cells is cytotoxicity. Because
NTB-A and CRACC trigger cytotoxicity in NK cells, it could be possible that they have
a similar function in cytotoxic T cells. To test this hypothesis PHA-P-activated T cells
were used as effector cells in redirected lysis 51Cr-release assays against the cell line
P815 in the presence of antibody against CD3 in different concentrations, alone or in
combination with control antibody or antibodies against NTB-A or CRACC at constant
concentrations (fig. 19). CD3-mediated lysis of target cells was maximal at
concentrations of anti-CD3 antibody greater than 333 pg/ml and decreased in a
concentration-dependent manner. There was no change in cytotoxicity against the
target cells, when the T cell receptor was stimulated together with NTB-A or CRACC.
Figure 19: CRACC and NTB-A do not enhance T cell-mediated cytotoxicity
Peripheral blood T cells were stimulated with 2 µg/ml PHA-P overnight, then washed and cultured in
medium containing 100 IU/ml of recombinant IL-2 for nine days. After 24 additional hours in culture
51
without IL-2 the activated cells were used as effector cells in a 4 h redirected lysis Cr-release assay
against P815 cells in the presence of anti-CD3 antibody (αCD3) in a serial dilution, alone or in
combination with a control antibody or antibodies against NTB-A (αNTB-A) or CRACC (αCRACC) at
constant concentrations. The E/T ratio was 10/1. Specific lysis of target cells is plotted as mean of
triplicates ± SD. One representative experiment out of five is shown.
RESULTS
69
4.3.7 CRACC is expressed on CD28-negative T cells
CRACC is expressed on antigen-presenting cells like mature dendritic cells and
activated B cells (112, 113). In the presence of CD80 or CD86, the ligands for the
most important co-stimulatory receptor CD28, CRACC may be dispensable or have a
modulating function. But it is likely that co-stimulation through CRACC gains more
importance, where CD28-mediated co-stimulation is not possible, namely in CD28negative T cells. In humans CD28-negative cells accumulate in the T cell pool with
ageing (176). This T cell population is mainly CD8-positive in healthy individuals and
displays a limited T cell receptor repertoire (177). These cells are cytotoxic, but their
proliferative response to antigenic stimulation or CD3-stimulation is decreased (178,
179). In the peripheral blood of patients with chronic inflammatory diseases the
frequency of CD4-positive T cells lacking CD28 expression is often increased
compared to healthy donors (180-182). It is assumed that these cells are involved in
perpetuation and amplification of the inflammatory process (183). Due to expression
of perforin and granzyme B these cells may even be able to cause direct tissue
damage (184). Several receptors normally expressed on NK cells have been found
on cells of the CD28-negative subset, e.g. KIR or NKG2D in rheumatoid arthritis
(185, 186).
As the stimulation of these cells occurs independently of CD28, we hypothesize that
co-stimulation via CRACC could play a role in chronic inflammatory diseases like it
has been postulated for NKG2D co-stimulation in rheumatoid arthritis (186). To give
this hypothesis a basis, we investigated if CRACC is expressed on CD4-positive
CD28-negative T cells.
Blood samples of five patients suffering from unstable angina pectoris (aged between
52 and 87 years) were analyzed for expression of CD3, CD4, CD28 and CRACC by
flow-cytometry. T cells were gated based upon size and granularity and CD3
expression. CRACC and CD28 expression were then studied on the CD4-positive
and the CD4-negative T cells, which were considered to belong to the CD8-positive
subset (fig. 20). T cells from patients 1 and 2 showed a normal expression pattern of
CD28. The majority of cells in the CD4-positive subset was CD28-positive, while the
CD4-negative subset of patient 2 contained a distinct population of CD28-negative
cells. CRACC expression was only marginal on CD4-positive cells of these patients.
RESULTS
70
Figure 20: CRACC is expressed on CD4-positive CD28-negative T cells
Blood samples were obtained from five patients suffering from unstable angina pectoris. Samples
were stained with antibodies against CD3, CD4, CD28 and CRACC and analyzed by flow-cytometry. T
cells were gated based upon size and granularity and CD3 expression. CD28 and CRACC-staining
are shown for CD4-positive T cells (upper row) and CD4-negative T cells, which are considered to be
mainly CD8-positive cells (lower row). The numbers in the plots show the percentage of cells in the
respective quadrant.
In the T cell population of patients 3 to 5 CD4-positive CD28-negative subsets were
detectable. The T cells in these subsets showed distinct expression of CRACC, in
contrast to the CD28-positive cells.
CD28-negative T cells were also found in the CD4-negative T cell compartments of
all patients, consistent with the finding of age dependent accumulation of CD8positive CD28-negative cells (176). These cells expressed CRACC, but CRACCexpression was not confined to CD28-negative cells in the CD4-negative population.
The expression of CRACC on the population of CD28-negative CD4-positive T cells
in all patients tested supports the hypothesis that co-stimulation through CRACC
could be one mechanism by which these cells are constantly activated in chronic
inflammatory diseases of the vascular system.
DISCUSSION
71
5 Discussion
5.1
Mutational analysis of the homophilic interaction of NTB-A
The X-ray analysis of crystallized NTB-A ectodomain homodimers implied that the
molecular basis for the interaction are hydrophobic contacts in the center of the
molecular interface and eleven possible hydrogen bonds. Ten amino acid residues
located in the IgV-domain on each molecule are involved. These residues form an
interface with roughly two-fold symmetry (171). To confirm these findings Cao et al.
performed dimerization studies with recombinantly expressed mutants of the NTB-A
ectodomain. In gel filtration experiments all single mutants of these ten residues
impaired the formation of dimers.
In this study the effect of several mutations on the function of NTB-A was
investigated. The functional readout was cytotoxicity of wild type NTB-A-expressing
NK cells induced by NTB-A mutants on the target cells. These functional assays are
more suitable to estimate the contributions of single residues to the homophilic
interactions in the physiological situation for some reasons. In contrast to NTB-A
ectodomains expressed in bacteria as used by Cao et al., the NTB-A molecules
expressed on eukaryotic cells are membrane-bound and glycosylated. This could
have an influence on the binding properties of the receptors. Furthermore the
functional assays can help to value the contributions of single residues. The strength
of receptor interaction has to overcome a threshold to activate the NK cell. If a
mutation has only a small effect on binding affinity, the receptor interaction may still
be strong enough to trigger a response. If the mutated residue contributed strongly to
receptor affinity, the mutant receptor cannot bind and does not elicit a cellular
reaction.
Four of the ten residues that are involved in the interaction in the crystal structure
were tested. The residue E37 was among the residues we chose for analysis, before
the crystal structure was published. The other three residues, H54, Q88 and S90,
were selected because their mutation had a strong effect in the gel filtration
experiments reported by Cao et al.. In our functional assays the mutations E37A and
Q88A did not impair receptor function. The mutation H54A reduced the cytotoxic NK
cell response, whereas S90A almost completely abrogated NTB-A-mediated
cytotoxicity (figs. 3 and 4). Single mutations to alanine of seven residues that do not
DISCUSSION
72
contribute to the interaction in the crystal structure did not disturb the functional
interaction (fig. 4).
Comparing these results with the mutational analysis performed by Cao et al. one
has to keep the differences in experimental setups in mind: First, Cao et al.
investigated the affinity between two mutant receptors, whereas we studied the
binding between mutant and wild type receptor. The interaction between two mutant
NTB-A molecules is weaker than the one between one mutant and a wild type
molecule due to the two-fold symmetry of the interface. In the first case contact is lost
at two positions compared to only one point in the second case. Second, as
mentioned before, the strength of the interaction has to overcome a certain threshold
to trigger a cytotoxic response in the NK cell. Therefore small changes in receptor
affinity are not detectable in our system. Residues that can be mutated without
reducing the strength of interaction below this threshold are considered to contribute
only little to the homophilic interaction. Third, because we investigated the
interactions in a cellular system, our experimental setup resembles much more the
circumstances, under which NTB-A interaction occurs in vivo. Therefore our results
allow better conclusions about the importance of the four residues for the homophilic
interaction under physiological conditions.
Taking these points into account we conclude that the contributions of the residues
E37 and Q88 to the homophilic interaction of NTB-A are smaller than those of H54
and S90. The finding that in case of the mutation S90A removal of only one hydrogen
bond results in such a strong loss of affinity shows that the specificity of the
homophilic interaction is very subtle.
This may be one reason why our attempts to create a heterophilic NTB-A mutant pair
failed. Because the simulation of receptor association is not feasible, the modeling for
the complementary mutants was done by a more simple approach. In a model of the
interacting receptors based on the crystal structure the two opposing residues were
replaced with a pair of residues with opposite charge. Then the conformational
changes that are likely to result from this substitution were calculated based on free
energies. The results predicted that the mutations would not disrupt the overall
structure of the interacting receptors. The conformational changes resulting from the
different properties of the substituted residues seemed to be only small. Based on
the calculations, an interaction between the complementary mutants could be
possible. However, this approach cannot predict the behavior of this mutant pair in
DISCUSSION
73
solution, let alone whether the mutant pair would associate in a heterophilic
interaction between cells.
As expected, the mutations effectively prevented the binding to wild type NTB-A or
mutants of the same type. No cytotoxic response could be observed, when NK cells
and target cells expressed the respective combination of receptors. However, the
expression of the complementary mutants on NK cells and target cells did also not
result in a cytotoxic response (fig. 6). This finding suggests that the heterophilic
interaction that seemed possible in the model is not functional under the
experimental circumstances.
Another critical point was that the NTB-A-deficient cells used for expression of the
mutant receptors displayed a very weak cytotoxic potential (fig. 6). Under these
circumstances the interaction between the complementary mutants may have been
only too weak to overcome the activation threshold of these NK cells.
5.2
Early events in SLAM-related receptor signaling
5.2.1 Phosphorylation of 2B4 and NTB-A is independent of SAP
The early events after binding of 2B4 to its ligand CD48 that have been shown to be
important for activating 2B4 signals are recruitment to lipid rafts (145),
phosphorylation of the ITSM by Src-family kinases (145, 146), association of adapter
molecule SAP (138, 149) and recruitment of the Src-kinase FynT (153, 154, 156).
FynT then propagates the signal by phosphorylation of several signaling molecules,
like PLC-γ or Vav-1 (146, 156). In the absence of SAP, e.g. during NK cell
development or in XLP patients, 2B4 has been shown to mediate inhibitory signals. A
possible explanation for this finding is that phosphatases like SHP-1 and 2 can
associate with the phosphorylated receptor (82, 83). Because of their lower affinity
they are displaced by SAP under normal conditions. When the amount of SAP is not
sufficient to prevent the binding of phosphatases, they can counteract activating
signals by dephosphorylation of signaling molecules.
For the receptor SLAM it has been proposed that FynT phosphorylates the ITSM
after binding to SAP, because SAP can already associate with the unphosphorylated
receptor (150). 2B4 can also be phosphorylated by FynT (82), but contradicting
results have been reported regarding the role for SAP in 2B4 phosphorylation. One
theory is that 2B4 is phosphorylated independently of SAP. This notion is supported
by two findings. First, inhibition of tyrosine phosphatases by pervanadate treatment
DISCUSSION
74
could induce 2B4 phosphorylation in NK cells from XLP patients lacking functional
SAP (98). Second, SAP showed no association with unphosphorylated 2B4, which
excludes the possibility that SAP-mediated recruitment of FynT leads to 2B4
phosphorylation (82). On the contrary, there are reports supporting the notion that the
presence of SAP is crucial for 2B4 phosphorylation. Human 2B4 expressed in HEK
293 cells was not phosphorylated unless SAP or EAT-2 were co-transfected (114).
This resembles results obtained with murine 2B4. Engagement of murine 2B4 did not
induce receptor phosphorylation in the absence of SAP (102, 156).
In our experiments we used human SAP knockdown NK cell lines and stimulated
them by co-incubation with target cells expressing CD48, the ligand of 2B4. The
knockdown of SAP was not complete, but sufficient to impair receptor function. In
addition we could not detect any 2B4-bound SAP in the knockdown cells. Therefore
we conclude that the reduction of SAP expression was strong enough to reveal
differences between signaling in control and knockdown cells. Our results showed
that the phosphorylation of 2B4 took place independently of SAP association (fig. 7).
This confirms the results reported for pervanadate treatment of human NK cells, but
in an experimental setup more similar to the physiological situation. As we
investigated signaling in an NK cell line, we can assume that kinases involved in 2B4
phosphorylation in the physiological context were present in the system, which is not
the case in non-lymphoid HEK 293 cells that have been used in the co-transfection
experiments (114). This makes it likely that the reported differences for human 2B4
were caused by different experimental setups. As we used an NK cell line and
stimulated 2B4 with its ligand expressed on target cells, our setup reflects the
physiological situation better than the reported experiments. Therefore we conclude
that in human NK cells the phosphorylation of 2B4 is mediated independent of the
presence of SAP. The dependency of 2B4 phosphorylation on SAP in the murine
system may reflect differences between species.
Previous reports have suggested that EAT-2 could mediate receptor phosphorylation
in the absence of SAP, based on findings in transfected HEK 293 or COS-7 cells
(114, 148). This possibility is excluded by our finding that EAT-2 recruitment is SAP
dependent (figs. 7 and 8), which will be discussed below.
Based on the results obtained in this study we propose that the early events in 2B4
signaling happen in the following order: Engagement of 2B4 by CD48 leads to
clustering of the receptor in lipid rafts. Src-family kinases that reside in the lipid rafts
DISCUSSION
75
phosphorylate the ITSM of 2B4 allowing SAP to bind to the receptor. In the following
step the kinase FynT associates with ITSM-bound SAP and can perform its crucial
function by phosphorylating molecules that activate the down-stream signaling
pathways. In the absence of SAP the phosphorylated ITSM can recruit phosphatases
like SHP-1 and 2, which could then inhibit signaling by dephosphorylation of signaling
molecules.
In this model SAP plays no role in signaling before receptor phosphorylation. It has
been reported that 2B4 must associate with lipid rafts in order to become
phosphorylated (145). According to our model there should be no difference in raft
recruitment of 2B4 between control and SAP knockdown cells in our experiments. It
would be interesting to investigate whether this is the case. The analysis could be
done by isolation of lipid rafts from stimulated cells using sucrose gradient
centrifugation and comparing the amount of 2B4 in the raft fractions from the two cell
lines.
The early events in NTB-A signaling have been less well described. Similar to 2B4,
NTB-A is phosphorylated after engagement and SAP and EAT-2 associate with the
phosphorylated receptor, but do not bind unphosphorylated NTB-A (84, 109, 152).
In this study we could show that phosphorylation of NTB-A after receptor
engagement was comparable in control and SAP knockdown cells (fig. 7). This
implies that phosphorylation of NTB-A is also independent of SAP. The course of
signaling events seems to be the same for NTB-A and 2B4. First, the receptor is
phosphorylated independently of SAP. Then the adapter molcule binds to
phosphorylated ITSM and starts the signaling cascade.
5.2.2 The cytotoxic response to 2B4 and NTB-A engagement is mediated by
SAP and not EAT-2
Although much is known about the role of SAP in SRR signaling, the function of
EAT-2 remains unclear. Up till now, no binding partner has been identified that is
recruited to phosphorylated receptors by EAT-2. In transfection experiments the
over-expression of EAT-2, like SAP, has been shown to induce the phosphorylation
of co-transfected receptors CD84, SLAM, Ly-9 and 2B4 (148, 187, 188). This finding
led to notion that EAT-2 may also be involved in recruitment of kinases to the
receptors. This put up the question whether SAP and EAT-2 mediate the same or
different signaling pathways. Experiments with NK cells from XLP patients that lack
functional SAP pointed to different roles for each adapter. 2B4 and NTB-A-mediated
DISCUSSION
76
cytotoxicity are both impaired in these NK cells despite the presence of EAT-2 (84,
98, 136-138). The fact that EAT-2 cannot compensate for the defective SAP makes it
very likely that the two adapter molecules do not have interchangeable functions.
Our results are in line with the previous reports about the role of SAP for 2B4mediated cytotoxicity in NK cells. The SAP knockdown in the cell lines NK92 and
YTS and in primary IL-2-activated NK cells led to decreased cytotoxic responses
upon 2B4 engagement (figs. 6, 7 and 9). This confirms the dependency of 2B4mediated cytotoxicity on SAP association. Our finding that EAT-2 knockdown in
primary cells did not impair cytotoxicity triggered by 2B4 (fig. 9) supports the notion
that EAT-2 mediates signaling pathways different from those mediated by SAP.
A recent report proposed a model for the different roles of SAP and EAT-2 in
signaling through NTB-A in human NK cells. Eissmann et al. found that SAP and
EAT-2 bind to different ITSM of NTB-A (152). Mutational analysis revealed that
EAT-2 binds the membrane proximal ITSM, while SAP associates with the C-terminal
ITSM. When the EAT-2-binding ITSM was mutated, NTB-A-mediated cytotoxicity was
abrogated, while mutation of the SAP-binding ITSM left the cytotoxic response intact.
Furthermore, they reported that NTB-A-mediated cytotoxicity was unaffected by SAP
knockdown in the human NK cell lines NKL and NK92. However, the production of
IFN-γ after NTB-A stimulation was reduced in the SAP knockdown NK92 cells (152).
This led to the model that the two adapters mediate different cellular responses to
NTB-A engagement independently of each other. However, this model does not fit
the observations made with NK cells from XLP patients. These cells showed
impaired cytotoxicity, but normal IFN-γ production (84). Eissmann et al. speculated
that the findings in XLP NK cells could be due to alterations of NK cell development
in the absence of SAP.
The results obtained in this study contradict the model proposed by Eissmann et al..
We found a reduction of NTB-A-mediated cytotoxicity after SAP knockdown in the
cell lines NK92 and YTS and in primary IL-2-activated NK cells (figs. 6, 7 and 9). This
excludes the possibility that this finding is based on cell line specific peculiarities. At
the moment we have no conclusive explanation why NTB-A-mediated cytotoxicity of
the NK92 cell line was not affected by SAP knockdown in the reported experiments.
We used the same knockdown vectors and tested the cells in the same experimental
settings. The only obvious difference was that NTB-A-mediated cytotoxicity of our
control cells was lower compared to the results reported by Eissmann et al. (152).
DISCUSSION
77
Maybe these differences are due to instability of immortalized cell lines during
passaging and the selection process of transduced cells. As we could also confirm
our findings in primary cells from different donors, we conclude that our results reflect
the physiological situation better. Our findings also match the results reported for
XLP NK cells. This strongly suggests that NTB-A-mediated cytotoxicity in human NK
cells is dependent on SAP. The reduced cytotoxicity after NTB-A-engagement
observed in XLP NK cells is therefore unlikely to be the result of impaired NK cell
development in the absence of SAP.
Furthermore, EAT-2 knockdown in primary cells had no significant impact on
cytotoxicity mediated by NTB-A (fig. 10). This finding excludes the possibility that
EAT-2 functions as mediator of signaling pathways leading to cytotoxicity after
NTB-A engagement. Thus we conclude that SAP mediates the main signal triggering
cytotoxic responses by recruitment of FynT. The function of EAT-2 could be the
initiation of yet unknown signaling pathways leading to effects not connected with the
immediate cytotoxic response.
5.2.3 Association of EAT-2 with 2B4 and NTB-A is SAP dependent
The existence of two different adapter molecules, SAP and EAT-2, that can bind to
phosphorylated SRR suggested that each could trigger a different signaling pathway.
Our findings contradict this theory of independent signaling of SAP and EAT-2. We
observed that recruitment of EAT-2 to phosphorylated 2B4 or NTB-A is impaired in
cells with reduced SAP expression (fig. 7). The dependency of EAT-2 association on
SAP could explain why EAT-2 does not compensate for SAP in XLP patients,
although its activating function has been clearly demonstrated in SAP-independent
CRACC signaling (114). Phosphorylated ITSM in CRACC only recruit EAT-2 and not
SAP, which implies that EAT-2 can also recruit activating signaling molecules.
However, in over-expression experiments EAT-2 association with 2B4 has been
found in both the human and the murine system when SAP was not co-transfected
(114, 148). This association could be an artifact due to high expression levels of
EAT-2 in the transfected cells. It is possible that EAT-2 has a lower affinity to
phosphorylated 2B4 or NTB-A than to CRACC. Therefore binding of EAT-2 to 2B4 or
NTB-A could only be detected, if the expression level of EAT-2 is high enough or if
SAP facilitates its recruitment.
An unresolved question is, how SAP can support the association of EAT-2 with
phosphorylated ITSM, as a direct interaction between the two molecules has not
DISCUSSION
78
been found (152). Additionally, no interaction partner that binds both molecules has
been identified, besides phosphorylated SRR. Maybe the binding of SAP to one
phosphorylated ITSM induces conformational changes in the cytoplasmatic tail of the
receptor that make EAT-2 association easier. A further possibility is that SAP does
not even have to be associated with the receptor, because the mutation of the SAPbinding ITSM of NTB-A has been shown to have no effect on EAT-2 association with
the other ITSM (152).
5.2.4 An altered model of activating 2B4 and NTB-A signaling
Taking together the findings of this study we propose the following model for the
early events in 2B4 and NTB-A signaling: Engagement of the receptors leads to
recruitment to kinase-rich lipid rafts (which remains to be shown for NTB-A) where
they become phosphorylated by Src-family kinases. The phosphorylated ITSM can
be bound by SAP. ITSM-bound SAP then enables binding of the adapter molecule
EAT-2 to phosphorylated 2B4 or NTB-A by means yet to be defined. The essential
step is that SAP also recruits FynT through direct interaction, which activates
signaling pathways by phosphorylation of downstream effector molecules.
To test this model further experiments will be necessary. It would be interesting to
investigate, which signaling pathways are affected by EAT-2 knockdown in NK cells.
Changes in tyrosine phosphorylation patterns after receptor stimulation could give
clues about the involved molecules. This would help to identify binding partners of
EAT-2, because at the moment there is no antibody available that is able to coimmunoprecipitate EAT-2-associated proteins. This could be due to the small size of
EAT-2, as it might be not accessible for antibodies when it is embedded in a complex
with other signaling molecules. It might be worth trying to use a tagged EAT-2construct to get access to this signaling complex. When the signaling pathways
mediated by EAT-2 are identified, it would be interesting to investigate whether these
pathways are impaired in the absence of SAP. If this is the case, the dependency of
EAT-2 on SAP could be confirmed.
5.3
The functions of CRACC and NTB-A in T cells
5.3.1 Co-stimulatory features of NTB-A
T cells are activated through signaling of their antigen-specific TCR. Normally, full T
cell activation after engagement of the TCR is dependent on co-stimulatory signals.
CD28 is regarded as the primary receptor for T cell co-stimulation. Its ligands CD80
DISCUSSION
79
and CD86 are expressed on antigen-presenting cells like mature dendritic cells or B
cells (12). However, in the last years an increasing number of other molecules has
been reported to have co-stimulatory properties. Among these are the SRR SLAM,
2B4, CD84 and NTB-A (73, 109, 173, 174, 187). In contrast, CD229 another member
of this receptor family has been shown to have an inhibitory effect on T cell activation
(189).
In this study our aim was to investigate whether CRACC is also a co-stimulatory
receptor on T cells. Because NTB-A has already been described as a co-stimulatory
SRR on human T cells, we used co-stimulation of NTB-A mainly as a second positive
control besides CD28. In contrast to CRACC, NTB-A is expressed on all T cells,
which allows co-stimulation of the whole T cell population via NTB-A. Thus, the
observed effects were more distinct than the effects of CRACC co-stimulation.
Simultaneous stimulation of TCR and NTB-A with plate-bound antibodies has been
reported to induce T cell proliferation and IFN-γ production (109). Our experiments
using the same experimental approach could complete the picture of the costimulatory properties of NTB-A. We could show that NTB-A co-stimulation induces
expression of the activation markers CD69 and the IL-2-receptor α-chain (CD25), as
well as IL-2 production (figs. 12 and 14). The induction of TNF-α production in T cells
(fig. 14) has not been shown before and is another feature this study adds to the
known properties of NTB-A. The finding that NTB-A does not contribute to T cellmediated cytotoxicity (fig. 19) is also new. It suggests that NTB-A co-stimulation is
less important for effector functions, but plays mainly a role in the mediation of
proliferative T cell responses.
The effect of NTB-A co-stimulation was similar to the effect of CD28 co-stimulation in
the experiments with readout after 48 or 72 h. The enormous difference in the
strength of co-stimulation was only obvious in the levels of cytokine mRNA
expression after 6 h, where CD28 co-stimulation exceeded the effects of NTB-A by
far (fig. 14). This implies that the kinetic of NTB-A co-stimulation is slower. Because
we observed only quantitative and no qualitative differences between cytokine mRNA
levels after CD28 or NTB-A expression, we conclude that NTB-A does not induce the
production of a distinct cytokine pattern.
A very recent study proposed a role for NTB-A co-stimulation not in the activation
and expansion of naïve cells that was investigated in our study, but in controlling the
removal of activated T cells (190). Snow et al. could show that re-stimulation-induced
DISCUSSION
80
cell death, a mechanism that is involved in the contraction of the T cell pool after
infection, is dependent on NTB-A and SAP. To mimic the events during the
contraction phase they stimulated T cells, cultivated them for at least one week in the
presence of IL-2 and then re-stimulated the cells with antibodies. They found that
knockdown of SAP or NTB-A reduced the rate of apoptosis after re-stimulation. The
model they propose is that NTB-A-mediated co-stimulation of activated T cells
enhances the TCR-mediated signal leading to an activation level that induces
apoptosis. This 'over-activation' is an interesting model how a co-stimulatory receptor
could be involved in shutting down of immune responses. It would be interesting to
see whether other co-stimulatory SRR have also pro-apoptotic functions on activated
T cells, or if this phenomenon is specific for NTB-A.
5.3.2 CRACC like NTB-A is a co-stimulatory receptor
In this study we investigated if CRACC has also co-stimulatory properties.
Simultaneous stimulation of the TCR and CRACC by plate-bound antibodies induced
expression of CD69 and CD25, furthermore, production of IL-2 and proliferation
(figs. 11-13). By the use of two different anti-CRACC antibody clones we excluded
that the observed co-stimulation was the result of unspecific antibody interaction
(fig. 15). Because the size of the CRACC-expressing T cell population was small and
varied between donors (fig. 11), the observed effects were not as prominent as the
effects obtained with NTB-A or CD28 co-stimulation.
Besides IL-2, the cytokine that is crucial for T cell proliferation, CRACC co-stimulation
induced production of the two pro-inflammatory cytokines IFN-γ and TNF-α (fig. 13).
As our analysis of cytokine mRNA showed only small changes after CRACC
stimulation, it is hard to say whether CRACC induces the production of a distinct
cytokine pattern. We cannot exclude that CRACC co-stimulation participates in
shaping the cytokine response in vivo.
While SLAM and 2B4 also enhance TCR-mediated cytotoxicity (91, 191), we
observed no influence of CRACC on the cytotoxic response of T cells (fig. 19). Thus,
we conclude that the co-stimulatory function of CRACC mainly induces proliferation
and cytokine expression.
Stimulation of cells by cross-linking surface receptors with plate-bound antibodies is
a suitable method to investigate receptor function in a defined setting, but is different
to the receptor-ligand interaction between cells in vivo. Therefore we point out that
our results have not been confirmed in a more physiological setting yet. However,
DISCUSSION
81
antigen-presenting cells, like mature dendritic cells or activated B cells, express
CRACC (112, 113). That makes it likely that co-stimulatory CRACC-CRACC
interactions take place during contact of T cells to antigen-presenting cells in vivo.
Therefore we propose that CRACC should be regarded as co-stimulator of T cell
activation.
5.3.3 CRACC, a co-stimulatory receptor expressed on proliferating T cells
Our results show, that CRACC expression is induced on activated and proliferating
CD8-positive T cells (fig. 16). This resembles the expression pattern that has been
reported for SLAM, which is expressed on activated T cells of both CD4 and CD8positive subsets (174, 191-193). Expression of a further co-stimulatory receptor could
be a positive feedback mechanism to amplify the expansion of activated T cells
during the early phase of an immune response. The co-stimulatory engagement of
the homophilic receptor can take place between CRACC on the antigen-presenting
cell and CRACC on the T cell or between CRACC on neighboring proliferating T
cells. This feature bears also resemblance to the homophilic SLAM, which can also
be induced on antigen-presenting cells (194, 195). This expression of co-stimulatory
molecules on the progeny of activated T cells could also compensate for stimulationinduced down-modulation of CD28 expression. The transient loss of CD28 is thought
to be a regulatory mechanism limiting the further activation of T cells (19). Delivery of
secondary co-stimulatory signals through SLAM or CRACC could then fine-tune the
activation of T cells by modulating strength and duration of stimulation. In our
experiments T cells with a knockdown of CRACC expression showed no reduction in
proliferation after CD28 co-stimulation (fig. 17). On the one hand, this could be due to
the incomplete knockdown of CRACC. Maybe the remaining CRACC could still
contribute sufficient co-stimulation. On the other hand, it could be possible that
CRACC-mediated enhancement of proliferation gains importance at later stages of
the expansion phase. This could explain, why we have observed no difference during
the first three days of activation.
Recently, it has been reported that CRACC expression is also induced upon
activation in murine T cells from both the CD4 and the CD8-positive subset. But in
contrast to our findings in human T cells, CRACC has been shown to have an
inhibitory impact on TCR-mediated T cell activation the murine system (115). This is
possibly due to the lack of the adapter protein EAT-2 in murine T cells, because
CRACC is an activating receptor on murine NK cells that normally express EAT-2,
DISCUSSION
82
but is turned into an inhibitory on NK cells of EAT-2 KO mice (114, 115). Therefore it
is likely that CRACC has a function in controlling the expansion of activated T cells in
mice. Whether CRACC or EAT-2 KO mice have a defect in T cell proliferation control
during an infection has not been reported.
In this study we have shown that human T cells express EAT-2 (fig. 16). Based on
the findings in human NK cells (114), we suggest that the co-stimulatory CRACC
signaling is mediated by the recruitment of this adapter. However, it is possible that
CRACC fulfills a dual function in T cell activation in humans: After stimulation
CRACC and EAT-2 expression are up-regulated and enhance T cell activation. At a
later stage of T cell activation a down-regulation of EAT-2 could turn the CRACC
signals from activating into inhibitory signals to limit proliferation. This mechanism
would function like the expression of the inhibitory receptor CTLA-4 on activated T
cells (20). In both cases the ligands expressed on the antigen-presenting cell are not
changed, but their effect on the T cells changes.
To prove this hypothesis the inhibitory signaling of CRACC in the absence of EAT-2
has to be shown for human T cells. A possible way to do that is to test the outcome
of CRACC stimulation after knockdown of EAT-2 expression by RNA interference.
Furthermore, the time course of EAT-2 expression in activated cells T cells has to be
analyzed further.
One possibility we have not tested in this study is whether the induction of CRACC
on proliferating T cells plays a role in the interaction between NK and T cells. CRACC
engagement triggers NK cell-mediated cytotoxicity. In mice NK cells have been
shown to eliminate activated CD4-positive T cells, when inhibitory receptors were
blocked (196). Because activated T cells with their strong proliferative potential bear
a special risk of developing lymphomas, they must be controlled tightly. Downregulation of MHC molecules is a phenomenon observed in transformed cells (35). If
loss of MHC molecules occurs on activated T cells, no inhibitory signal can
counteract the CRACC-mediated NK cell cytotoxicity, and the cells can be
eliminated. Therefore CRACC expression on activated T cells could also be a
mechanism that facilitates the control of proliferative disorders.
5.3.4 CRACC, a co-stimulatory receptor on memory T cells
It has been a generally accepted paradigm in immunology that memory T cell
responses are independent of CD28 co-stimulation. Re-activation of T cells was
thought to be mediated solely through TCR signaling (197). This paradigm was
DISCUSSION
83
challenged by recent studies investigating the memory response to viral infection in
mice. Proliferation of adoptively transferred memory CD8 T cells in response to viral
infection was found to be impaired in hosts that lacked both CD80 and CD86 (198,
199). These results suggest that co-stimulatory signals are necessary for an optimal
response of CD8-positive memory cells to viral re-challenge in mice.
We have found in this study that human memory T cells express the co-stimulatory
receptor CRACC (fig. 16). The strongest expression was seen on CD8-positive
memory cells. The expression of additional co-stimulatory receptors could lower the
threshold needed for activation through TCR stimulation. This would facilitate the
mounting of a strong proliferative response to antigenic re-challenge, assuming that
human memory T cells are likewise dependent on co-stimulation. In this case
activated T cells that differentiate into memory cells would maintain CRACC
expression to facilitate re-activation.
5.3.5 A possible role for CRACC in chronic inflammatory diseases
In contrast to mice, humans and non-human primates accumulate a pool of CD8positive CD28-negative cells with ageing (176, 200, 201). The loss of CD28
expression seems to result from repeated TCR-mediated activation and homeostatic
proliferation (200, 202). The T cell receptor repertoire of these cells is limited (177).
These cells are cytotoxic, and they show an impaired proliferative response to
antigenic stimulation or CD3-stimulation (178, 179). Their appearance is linked to
immune senescence and has also been observed in chronic viral infections, e.g. with
cytomegalovirus or HIV (203, 204). CD4-positive T cells lacking CD28 expression are
scarce in healthy individuals, but are often found in the peripheral blood of patients
with chronic inflammatory diseases, like rheumatoid arthritis, inflammatory vascular
complications or multiple sclerosis (180-182). It is assumed that these cells are
involved in perpetuation and amplification of the inflammatory process (183). This
notion is supported by the observation that the size of this T cell subset correlates
with severity of the disease (180). As these diseases are often linked to
autoimmunity, it has been speculated that this subset represents constantly
stimulated autoreactive cells. In most studies, however, these cells could not be
stimulated with typical autoantigens, but responded to some viral antigens or heat
shock proteins (183).
CD4-positive CD28-negative T cells display a phenotype similar to cytotoxic
lymphocytes: In rheumatoid arthritis several receptors normally expressed on NK
DISCUSSION
84
cells, like KIR or NKG2D, have been found on cells of the CD28-negative subset
(185, 186). Due to expression of perforin and granzyme B these cells may even be
able to cause direct tissue damage (184). Very recently, a report showed that costimulation of CD4-positive CD28-negative T cells from patients with rheumatoid
arthritis through the 'NK receptors' NKG2D, 2B4 and DNAM-1 led to IFN-γ production
and degranulation of lytic granules (205). Interestingly, none of the three receptors
had co-stimulatory properties when triggered alone, but two receptors triggered
simultaneously could enhance TCR-mediated responses.
In this study we have shown that CD28-negative cells of both subsets show a distinct
expression of CRACC (fig. 20). In the CD4-positive subset CRACC expression was
mostly confined to the CD28-negative cells. This fits to the notion that these CD4 T
cells have acquired a phenotype more similar to CD8-positive effector cells with lytic
granules and receptors normally found on CD8-positive cells like 2B4 and NKG2D.
The expression of co-stimulatory receptors like CRACC could reduce their threshold
of activation. Facilitated activation of these cells could be one of the driving forces of
chronic inflammation. Therefore we conclude that CRACC-mediated co-activation of
CD4-positive CD28-negative T cells is likely to play a role in chronic inflammatory
diseases. Further studies will have to investigate how CRACC expression is induced
in these cells, which cellular responses are triggered by CRACC co-stimulation in
these cells and how these are connected to disease development and progression. It
would be interesting to test, whether blocking of CRACC interactions or inhibition of
CRACC signaling could dampen the exaggerated pro-inflammatory activity of the
CD4-positive CD28-negative T cells. Based on these studies, new therapeutic
approaches targeting CRACC may be possible.
REFERENCES
85
6 References
1.
Colucci, F., M. A. Caligiuri, and J. P. Di Santo. 2003. What does it take to
make a natural killer? Nat Rev Immunol 3:413-425.
2.
Picker, L. J., J. R. Treer, B. Ferguson-Darnell, P. A. Collins, D. Buck, and L.
W. Terstappen. 1993. Control of lymphocyte recirculation in man. I. Differential
regulation of the peripheral lymph node homing receptor L-selectin on T cells
during the virgin to memory cell transition. J Immunol 150:1105-1121.
3.
Westermann, J., and R. Pabst. 1992. Distribution of lymphocyte subsets and
natural killer cells in the human body. Clin Investig 70:539-544.
4.
Walzer, T., S. Jaeger, J. Chaix, and E. Vivier. 2007. Natural killer cells: from
CD3(-)NKp46(+) to post-genomics meta-analyses. Curr Opin Immunol 19:365372.
5.
Walzer, T., M. Blery, J. Chaix, N. Fuseri, L. Chasson, S. H. Robbins, S.
Jaeger, P. Andre, L. Gauthier, L. Daniel, K. Chemin, Y. Morel, M. Dalod, J.
Imbert, M. Pierres, A. Moretta, F. Romagne, and E. Vivier. 2007. Identification,
activation, and selective in vivo ablation of mouse NK cells via NKp46. Proc
Natl Acad Sci U S A 104:3384-3389.
6.
Jenkins, M. K., C. A. Chen, G. Jung, D. L. Mueller, and R. H. Schwartz. 1990.
Inhibition of antigen-specific proliferation of type 1 murine T cell clones after
stimulation with immobilized anti-CD3 monoclonal antibody. J Immunol
144:16-22.
7.
Gonzalo, J. A., T. Delaney, J. Corcoran, A. Goodearl, J. C. Gutierrez-Ramos,
and A. J. Coyle. 2001. Cutting edge: the related molecules CD28 and
inducible costimulator deliver both unique and complementary signals required
for optimal T cell activation. J Immunol 166:1-5.
8.
Viola, A., and A. Lanzavecchia. 1996. T cell activation determined by T cell
receptor number and tunable thresholds. Science 273:104-106.
9.
Kundig, T. M., A. Shahinian, K. Kawai, H. W. Mittrucker, E. Sebzda, M. F.
Bachmann, T. W. Mak, and P. S. Ohashi. 1996. Duration of TCR stimulation
determines costimulatory requirement of T cells. Immunity 5:41-52.
10.
Bachmann, M. F., K. McKall-Faienza, R. Schmits, D. Bouchard, J. Beach, D.
E. Speiser, T. W. Mak, and P. S. Ohashi. 1997. Distinct roles for LFA-1 and
CD28 during activation of naive T cells: adhesion versus costimulation.
Immunity 7:549-557.
11.
Chai, J. G., S. Vendetti, I. Bartok, D. Schoendorf, K. Takacs, J. Elliott, R.
Lechler, and J. Dyson. 1999. Critical role of costimulation in the activation of
naive antigen-specific TCR transgenic CD8+ T cells in vitro. J Immunol
163:1298-1305.
12.
Collins, M., V. Ling, and B. M. Carreno. 2005. The B7 family of immuneregulatory ligands. Genome Biol 6:223.
13.
Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene.
Curr Opin Immunol 7:333-342.
REFERENCES
86
14.
Cerdan, C., Y. Martin, M. Courcoul, C. Mawas, F. Birg, and D. Olive. 1995.
CD28 costimulation regulates long-term expression of the three genes (alpha,
beta, gamma) encoding the high-affinity IL2 receptor. Res Immunol 146:164168.
15.
Bretscher, P., and M. Cohn. 1970. A theory of self-nonself discrimination.
Science 169:1042-1049.
16.
Acuto, O., and F. Michel. 2003. CD28-mediated co-stimulation: a quantitative
support for TCR signalling. Nat Rev Immunol 3:939-951.
17.
Leitner, J., K. Grabmeier-Pfistershammer, and P. Steinberger. 2010.
Receptors and ligands implicated in human T cell costimulatory processes.
Immunol Lett 128:89-97.
18.
Andreasen, S. O., J. E. Christensen, O. Marker, and A. R. Thomsen. 2000.
Role of CD40 ligand and CD28 in induction and maintenance of antiviral CD8+
effector T cell responses. J Immunol 164:3689-3697.
19.
Linsley, P. S., J. Bradshaw, M. Urnes, L. Grosmaire, and J. A. Ledbetter.
1993. CD28 engagement by B7/BB-1 induces transient down-regulation of
CD28 synthesis and prolonged unresponsiveness to CD28 signaling. J
Immunol 150:3161-3169.
20.
Schwartz, R. H. 1992. Costimulation of T lymphocytes: the role of CD28,
CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy. Cell
71:1065-1068.
21.
Zhou, L., M. M. Chong, and D. R. Littman. 2009. Plasticity of CD4+ T cell
lineage differentiation. Immunity 30:646-655.
22.
Krammer, P. H., R. Arnold, and I. N. Lavrik. 2007. Life and death in peripheral
T cells. Nat Rev Immunol 7:532-542.
23.
Sallusto, F., D. Lenig, R. Forster, M. Lipp, and A. Lanzavecchia. 1999. Two
subsets of memory T lymphocytes with distinct homing potentials and effector
functions. Nature 401:708-712.
24.
Jameson, S. C., and D. Masopust. 2009. Diversity in T cell memory: an
embarrassment of riches. Immunity 31:859-871.
25.
Mazo, I. B., M. Honczarenko, H. Leung, L. L. Cavanagh, R. Bonasio, W.
Weninger, K. Engelke, L. Xia, R. P. McEver, P. A. Koni, L. E. Silberstein, and
U. H. von Andrian. 2005. Bone marrow is a major reservoir and site of
recruitment for central memory CD8+ T cells. Immunity 22:259-270.
26.
Becker, T. C., S. M. Coley, E. J. Wherry, and R. Ahmed. 2005. Bone marrow
is a preferred site for homeostatic proliferation of memory CD8 T cells. J
Immunol 174:1269-1273.
27.
Tokoyoda, K., S. Zehentmeier, A. N. Hegazy, I. Albrecht, J. R. Grun, M.
Lohning, and A. Radbruch. 2009. Professional memory CD4+ T lymphocytes
preferentially reside and rest in the bone marrow. Immunity 30:721-730.
28.
Kaech, S. M., E. J. Wherry, and R. Ahmed. 2002. Effector and memory T-cell
differentiation: implications for vaccine development. Nat Rev Immunol 2:251262.
29.
Lanier, L. L. 2008. Up on the tightrope: natural killer cell activation and
inhibition. Nat Immunol 9:495-502.
REFERENCES
87
30.
Long, E. O. 2008. Negative signaling by inhibitory receptors: the NK cell
paradigm. Immunol Rev 224:70-84.
31.
Rajagopalan, S., and E. O. Long. 1997. The direct binding of a p58 killer cell
inhibitory receptor to human histocompatibility leukocyte antigen (HLA)-Cw4
exhibits peptide selectivity. J Exp Med 185:1523-1528.
32.
Karre, K., H. G. Ljunggren, G. Piontek, and R. Kiessling. 1986. Selective
rejection of H-2-deficient lymphoma variants suggests alternative immune
defence strategy. Nature 319:675-678.
33.
Ljunggren, H. G., and K. Karre. 1985. Host resistance directed selectively
against H-2-deficient lymphoma variants. Analysis of the mechanism. J Exp
Med 162:1745-1759.
34.
Tortorella, D., B. E. Gewurz, M. H. Furman, D. J. Schust, and H. L. Ploegh.
2000. Viral subversion of the immune system. Annu Rev Immunol 18:861-926.
35.
Garrido, F., F. Ruiz-Cabello, T. Cabrera, J. J. Perez-Villar, M. Lopez-Botet, M.
Duggan-Keen, and P. L. Stern. 1997. Implications for immunosurveillance of
altered HLA class I phenotypes in human tumours. Immunol Today 18:89-95.
36.
Anfossi, N., P. Andre, S. Guia, C. S. Falk, S. Roetynck, C. A. Stewart, V.
Breso, C. Frassati, D. Reviron, D. Middleton, F. Romagne, S. Ugolini, and E.
Vivier. 2006. Human NK cell education by inhibitory receptors for MHC class I.
Immunity 25:331-342.
37.
Brodin, P., T. Lakshmikanth, S. Johansson, K. Karre, and P. Hoglund. 2009.
The strength of inhibitory input during education quantitatively tunes the
functional responsiveness of individual natural killer cells. Blood 113:24342441.
38.
Brodin, P., K. Karre, and P. Hoglund. 2009. NK cell education: not an on-off
switch but a tunable rheostat. Trends Immunol 30:143-149.
39.
Claus, M., S. Meinke, R. Bhat, and C. Watzl. 2008. Regulation of NK cell
activity by 2B4, NTB-A and CRACC. Front Biosci 13:956-965.
40.
Gasser, S., S. Orsulic, E. J. Brown, and D. H. Raulet. 2005. The DNA damage
pathway regulates innate immune system ligands of the NKG2D receptor.
Nature 436:1186-1190.
41.
Eagle, R. A., and J. Trowsdale. 2007. Promiscuity and the single receptor:
NKG2D. Nat Rev Immunol 7:737-744.
42.
Brandt, C. S., M. Baratin, E. C. Yi, J. Kennedy, Z. Gao, B. Fox, B. Haldeman,
C. D. Ostrander, T. Kaifu, C. Chabannon, A. Moretta, R. West, W. Xu, E.
Vivier, and S. D. Levin. 2009. The B7 family member B7-H6 is a tumor cell
ligand for the activating natural killer cell receptor NKp30 in humans. J Exp
Med 206:1495-1503.
43.
Arnon, T. I., M. Lev, G. Katz, Y. Chernobrov, A. Porgador, and O.
Mandelboim. 2001. Recognition of viral hemagglutinins by NKp44 but not by
NKp30. Eur J Immunol 31:2680-2689.
44.
Mandelboim, O., N. Lieberman, M. Lev, L. Paul, T. I. Arnon, Y. Bushkin, D. M.
Davis, J. L. Strominger, J. W. Yewdell, and A. Porgador. 2001. Recognition of
haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK
cells. Nature 409:1055-1060.
REFERENCES
88
45.
Walzer, T., M. Dalod, S. H. Robbins, L. Zitvogel, and E. Vivier. 2005. Naturalkiller cells and dendritic cells: "l'union fait la force". Blood 106:2252-2258.
46.
Newman, K. C., and E. M. Riley. 2007. Whatever turns you on: accessory-celldependent activation of NK cells by pathogens. Nat Rev Immunol 7:279-291.
47.
Bryceson, Y. T., M. E. March, H. G. Ljunggren, and E. O. Long. 2006. Synergy
among receptors on resting NK cells for the activation of natural cytotoxicity
and cytokine secretion. Blood 107:159-166.
48.
Trinchieri, G. 1989. Biology of natural killer cells. Adv Immunol 47:187-376.
49.
Fehniger, T. A., M. A. Cooper, G. J. Nuovo, M. Cella, F. Facchetti, M.
Colonna, and M. A. Caligiuri. 2003. CD56bright natural killer cells are present
in human lymph nodes and are activated by T cell-derived IL-2: a potential
new link between adaptive and innate immunity. Blood 101:3052-3057.
50.
Laouar, Y., F. S. Sutterwala, L. Gorelik, and R. A. Flavell. 2005. Transforming
growth factor-beta controls T helper type 1 cell development through
regulation of natural killer cell interferon-gamma. Nat Immunol 6:600-607.
51.
Ghiringhelli, F., C. Menard, M. Terme, C. Flament, J. Taieb, N. Chaput, P. E.
Puig, S. Novault, B. Escudier, E. Vivier, A. Lecesne, C. Robert, J. Y. Blay, J.
Bernard, S. Caillat-Zucman, A. Freitas, T. Tursz, O. Wagner-Ballon, C.
Capron, W. Vainchencker, F. Martin, and L. Zitvogel. 2005. CD4+CD25+
regulatory T cells inhibit natural killer cell functions in a transforming growth
factor-beta-dependent manner. J Exp Med 202:1075-1085.
52.
Smyth, M. J., M. W. Teng, J. Swann, K. Kyparissoudis, D. I. Godfrey, and Y.
Hayakawa. 2006. CD4+CD25+ T regulatory cells suppress NK cell-mediated
immunotherapy of cancer. J Immunol 176:1582-1587.
53.
Cerwenka, A., and L. L. Lanier. 2001. Natural killer cells, viruses and cancer.
Nat Rev Immunol 1:41-49.
54.
Vivier, E., E. Tomasello, M. Baratin, T. Walzer, and S. Ugolini. 2008.
Functions of natural killer cells. Nat Immunol 9:503-510.
55.
Piccioli, D., S. Sbrana, E. Melandri, and N. M. Valiante. 2002. Contactdependent stimulation and inhibition of dendritic cells by natural killer cells. J
Exp Med 195:335-341.
56.
Nedvetzki, S., S. Sowinski, R. A. Eagle, J. Harris, F. Vely, D. Pende, J.
Trowsdale, E. Vivier, S. Gordon, and D. M. Davis. 2007. Reciprocal regulation
of human natural killer cells and macrophages associated with distinct immune
synapses. Blood 109:3776-3785.
57.
Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, and T. P. SalazarMather. 1999. Natural killer cells in antiviral defense: function and regulation
by innate cytokines. Annu Rev Immunol 17:189-220.
58.
Cooper, M. A., T. A. Fehniger, and M. A. Caligiuri. 2001. The biology of human
natural killer-cell subsets. Trends Immunol 22:633-640.
59.
Moretta, A. 2002. Natural killer cells and dendritic cells: rendezvous in abused
tissues. Nat Rev Immunol 2:957-964.
60.
Degli-Esposti, M. A., and M. J. Smyth. 2005. Close encounters of different
kinds: dendritic cells and NK cells take centre stage. Nat Rev Immunol 5:112124.
REFERENCES
89
61.
Martin-Fontecha, A., L. L. Thomsen, S. Brett, C. Gerard, M. Lipp, A.
Lanzavecchia, and F. Sallusto. 2004. Induced recruitment of NK cells to lymph
nodes provides IFN-gamma for T(H)1 priming. Nat Immunol 5:1260-1265.
62.
Vacca, P., G. Pietra, M. Falco, E. Romeo, C. Bottino, F. Bellora, F. Prefumo,
E. Fulcheri, P. L. Venturini, M. Costa, A. Moretta, L. Moretta, and M. C.
Mingari. 2006. Analysis of natural killer cells isolated from human decidua:
Evidence that 2B4 (CD244) functions as an inhibitory receptor and blocks NKcell function. Blood 108:4078-4085.
63.
Tabiasco, J., M. Rabot, M. Aguerre-Girr, H. El Costa, A. Berrebi, O. Parant, G.
Laskarin, K. Juretic, A. Bensussan, D. Rukavina, and P. Le Bouteiller. 2006.
Human decidual NK cells: unique phenotype and functional properties -- a
review. Placenta 27 Suppl A:S34-39.
64.
Kalkunte, S., C. O. Chichester, F. Gotsch, C. L. Sentman, R. Romero, and S.
Sharma. 2008. Evolution of non-cytotoxic uterine natural killer cells. Am J
Reprod Immunol 59:425-432.
65.
Malmberg, K. J., and H. G. Ljunggren. 2009. Spotlight on IL-22-producing NK
cell receptor-expressing mucosal lymphocytes. Nat Immunol 10:11-12.
66.
Cella, M., A. Fuchs, W. Vermi, F. Facchetti, K. Otero, J. K. Lennerz, J. M.
Doherty, J. C. Mills, and M. Colonna. 2009. A human natural killer cell subset
provides an innate source of IL-22 for mucosal immunity. Nature 457:722-725.
67.
Biron, C. A., K. S. Byron, and J. L. Sullivan. 1989. Severe herpesvirus
infections in an adolescent without natural killer cells. N Engl J Med 320:17311735.
68.
Veillette, A., and S. Latour. 2003. The SLAM family of immune-cell receptors.
Curr Opin Immunol 15:277-285.
69.
Veillette, A. 2006. Immune regulation by SLAM family receptors and SAPrelated adaptors. Nat Rev Immunol 6:56-66.
70.
Falco, M., E. Marcenaro, E. Romeo, F. Bellora, D. Marras, F. Vely, G.
Ferracci, L. Moretta, A. Moretta, and C. Bottino. 2004. Homophilic interaction
of NTBA, a member of the CD2 molecular family: induction of cytotoxicity and
cytokine release in human NK cells. Eur J Immunol 34:1663-1672.
71.
Flaig, R. M., S. Stark, and C. Watzl. 2004. Cutting edge: NTB-A activates NK
cells via homophilic interaction. J Immunol 172:6524-6527.
72.
Mavaddat, N., D. W. Mason, P. D. Atkinson, E. J. Evans, R. J. Gilbert, D. I.
Stuart, J. A. Fennelly, A. N. Barclay, S. J. Davis, and M. H. Brown. 2000.
Signaling lymphocytic activation molecule (CDw150) is homophilic but selfassociates with very low affinity. J Biol Chem 275:28100-28109.
73.
Martin, M., X. Romero, M. A. de la Fuente, V. Tovar, N. Zapater, E.
Esplugues, P. Pizcueta, J. Bosch, and P. Engel. 2001. CD84 functions as a
homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion
is mediated by Ig-like domain 1. J Immunol 167:3668-3676.
74.
Kumaresan, P. R., W. C. Lai, S. S. Chuang, M. Bennett, and P. A. Mathew.
2002. CS1, a novel member of the CD2 family, is homophilic and regulates NK
cell function. Mol Immunol 39:1-8.
REFERENCES
90
75.
Romero, X., N. Zapater, M. Calvo, S. G. Kalko, M. A. de la Fuente, V. Tovar,
C. Ockeloen, P. Pizcueta, and P. Engel. 2005. CD229 (Ly9) lymphocyte cell
surface receptor interacts homophilically through its N-terminal domain and
relocalizes to the immunological synapse. J Immunol 174:7033-7042.
76.
Brown, M. H., K. Boles, P. A. van der Merwe, V. Kumar, P. A. Mathew, and A.
N. Barclay. 1998. 2B4, the natural killer and T cell immunoglobulin superfamily
surface protein, is a ligand for CD48. J Exp Med 188:2083-2090.
77.
Latchman, Y., P. F. McKay, and H. Reiser. 1998. Identification of the 2B4
molecule as a counter-receptor for CD48. J Immunol 161:5809-5812.
78.
Ma, C. S., K. E. Nichols, and S. G. Tangye. 2007. Regulation of cellular and
humoral immune responses by the SLAM and SAP families of molecules.
Annu Rev Immunol 25:337-379.
79.
Shlapatska, L. M., S. V. Mikhalap, A. G. Berdova, O. M. Zelensky, T. J. Yun,
K. E. Nichols, E. A. Clark, and S. P. Sidorenko. 2001. CD150 association with
either the SH2-containing inositol phosphatase or the SH2-containing protein
tyrosine phosphatase is regulated by the adaptor protein SH2D1A. J Immunol
166:5480-5487.
80.
Latour, S., and A. Veillette. 2004. The SAP family of adaptors in immune
regulation. Semin Immunol 16:409-419.
81.
Roncagalli, R., J. E. Taylor, S. Zhang, X. Shi, R. Chen, M. E. Cruz-Munoz, L.
Yin, S. Latour, and A. Veillette. 2005. Negative regulation of natural killer cell
function by EAT-2, a SAP-related adaptor. Nat Immunol 6:1002-1010.
82.
Eissmann, P., L. Beauchamp, J. Wooters, J. C. Tilton, E. O. Long, and C.
Watzl. 2005. Molecular basis for positive and negative signaling by the natural
killer cell receptor 2B4 (CD244). Blood 105:4722-4729.
83.
Tangye, S. G., S. Lazetic, E. Woollatt, G. R. Sutherland, L. L. Lanier, and J. H.
Phillips. 1999. Cutting edge: human 2B4, an activating NK cell receptor,
recruits the protein tyrosine phosphatase SHP-2 and the adaptor signaling
protein SAP. J Immunol 162:6981-6985.
84.
Bottino, C., M. Falco, S. Parolini, E. Marcenaro, R. Augugliaro, S. Sivori, E.
Landi, R. Biassoni, L. D. Notarangelo, L. Moretta, and A. Moretta. 2001. NTBA [correction of GNTB-A], a novel SH2D1A-associated surface molecule
contributing to the inability of natural killer cells to kill Epstein-Barr virusinfected B cells in X-linked lymphoproliferative disease. J Exp Med 194:235246.
85.
Kiel, M. J., O. H. Yilmaz, T. Iwashita, O. H. Yilmaz, C. Terhorst, and S. J.
Morrison. 2005. SLAM Family Receptors Distinguish Hematopoietic Stem and
Progenitor Cells and Reveal Endothelial Niches for Stem Cells. Cell 121:11091121.
86.
Zaiss, M., C. Hirtreiter, M. Rehli, A. Rehm, L. A. Kunz-Schughart, R.
Andreesen, and B. Hennemann. 2003. CD84 expression on human
hematopoietic progenitor cells. Exp Hematol 31:798-805.
87.
Mathew, P. A., B. A. Garni-Wagner, K. Land, A. Takashima, E. Stoneman, M.
Bennett, and V. Kumar. 1993. Cloning and characterization of the 2B4 gene
encoding a molecule associated with non-MHC-restricted killing mediated by
activated natural killer cells and T cells. J Immunol 151:5328-5337.
REFERENCES
91
88.
Garni-Wagner, B. A., A. Purohit, P. A. Mathew, M. Bennett, and V. Kumar.
1993. A novel function-associated molecule related to non-MHC-restricted
cytotoxicity mediated by activated natural killer cells and T cells. J Immunol
151:60-70.
89.
Romero, X., D. Benitez, S. March, R. Vilella, M. Miralpeix, and P. Engel. 2004.
Differential expression of SAP and EAT-2-binding leukocyte cell-surface
molecules CD84, CD150 (SLAM), CD229 (Ly9) and CD244 (2B4). Tissue
Antigens 64:132-144.
90.
Munitz, A., I. Bachelet, S. Fraenkel, G. Katz, O. Mandelboim, H. U. Simon, L.
Moretta, M. Colonna, and F. Levi-Schaffer. 2005. 2B4 (CD244) is expressed
and functional on human eosinophils. J Immunol 174:110-118.
91.
Valiante, N. M., and G. Trinchieri. 1993. Identification of a novel signal
transduction surface molecule on human cytotoxic lymphocytes. J Exp Med
178:1397-1406.
92.
Boles, K. S., H. Nakajima, M. Colonna, S. S. Chuang, S. E. Stepp, M. Bennett,
V. Kumar, and P. A. Mathew. 1999. Molecular characterization of a novel
human natural killer cell receptor homologous to mouse 2B4. Tissue Antigens
54:27-34.
93.
Kubin, M. Z., D. L. Parshley, W. Din, J. Y. Waugh, T. Davis-Smith, C. A.
Smith, B. M. Macduff, R. J. Armitage, W. Chin, L. Cassiano, L. Borges, M.
Petersen, G. Trinchieri, and R. G. Goodwin. 1999. Molecular cloning and
biological characterization of NK cell activation-inducing ligand, a
counterstructure for CD48. Eur J Immunol 29:3466-3477.
94.
Nakajima, H., M. Cella, H. Langen, A. Friedlein, and M. Colonna. 1999.
Activating interactions in human NK cell recognition: the role of 2B4-CD48.
Eur J Immunol 29:1676-1683.
95.
Sivori, S., M. Falco, E. Marcenaro, S. Parolini, R. Biassoni, C. Bottino, L.
Moretta, and A. Moretta. 2002. Early expression of triggering receptors and
regulatory role of 2B4 in human natural killer cell precursors undergoing in
vitro differentiation. Proc Natl Acad Sci U S A 99:4526-4531.
96.
Morandi, B., R. Costa, M. Falco, S. Parolini, A. De Maria, G. Ratto, M. C.
Mingari, G. Melioli, A. Moretta, and G. Ferlazzo. 2005. Distinctive lack of CD48
expression in subsets of human dendritic cells tunes NK cell activation. J
Immunol 175:3690-3697.
97.
Kopcow, H. D., D. S. Allan, X. Chen, B. Rybalov, M. M. Andzelm, B. Ge, and
J. L. Strominger. 2005. Human decidual NK cells form immature activating
synapses and are not cytotoxic. Proc Natl Acad Sci U S A 102:15563-15568.
98.
Parolini, S., C. Bottino, M. Falco, R. Augugliaro, S. Giliani, R. Franceschini, H.
D. Ochs, H. Wolf, J. Y. Bonnefoy, R. Biassoni, L. Moretta, L. D. Notarangelo,
and A. Moretta. 2000. X-linked lymphoproliferative disease. 2B4 molecules
displaying inhibitory rather than activating function are responsible for the
inability of natural killer cells to kill Epstein-Barr virus-infected cells. J Exp Med
192:337-346.
99.
Mooney, J. M., J. Klem, C. Wulfing, L. A. Mijares, P. L. Schwartzberg, M.
Bennett, and J. D. Schatzle. 2004. The murine NK receptor 2B4 (CD244)
REFERENCES
92
exhibits inhibitory function independent of signaling lymphocytic activation
molecule-associated protein expression. J Immunol 173:3953-3961.
100.
Lee, K. M., M. E. McNerney, S. E. Stepp, P. A. Mathew, J. D. Schatzle, M.
Bennett, and V. Kumar. 2004. 2B4 acts as a non-major histocompatibility
complex binding inhibitory receptor on mouse natural killer cells. J Exp Med
199:1245-1254.
101.
Vaidya, S. V., S. E. Stepp, M. E. McNerney, J. K. Lee, M. Bennett, K. M. Lee,
C. L. Stewart, V. Kumar, and P. A. Mathew. 2005. Targeted disruption of the
2B4 gene in mice reveals an in vivo role of 2B4 (CD244) in the rejection of
B16 melanoma cells. J Immunol 174:800-807.
102.
Bloch-Queyrat, C., M. C. Fondaneche, R. Chen, L. Yin, F. Relouzat, A.
Veillette, A. Fischer, and S. Latour. 2005. Regulation of natural cytotoxicity by
the adaptor SAP and the Src-related kinase Fyn. J Exp Med 202:181-192.
103.
Chlewicki, L. K., C. A. Velikovsky, V. Balakrishnan, R. A. Mariuzza, and V.
Kumar. 2008. Molecular basis of the dual functions of 2B4 (CD244). J
Immunol 180:8159-8167.
104.
Kambayashi, T., E. Assarsson, B. J. Chambers, and H. G. Ljunggren. 2001.
Cutting edge: Regulation of CD8(+) T cell proliferation by 2B4/CD48
interactions. J Immunol 167:6706-6710.
105.
Lee, K. M., S. Bhawan, T. Majima, H. Wei, M. I. Nishimura, H. Yagita, and V.
Kumar. 2003. Cutting Edge: The NK Cell Receptor 2B4 Augments AntigenSpecific T Cell Cytotoxicity Through CD48 Ligation on Neighboring T Cells. J
Immunol 170:4881-4885.
106.
Assarsson, E., T. Kambayashi, J. D. Schatzle, S. O. Cramer, A. von Bonin, P.
E. Jensen, H. G. Ljunggren, and B. J. Chambers. 2004. NK cells stimulate
proliferation of T and NK cells through 2B4/CD48 interactions. J Immunol
173:174-180.
107.
Howie, D., F. S. Laroux, M. Morra, A. R. Satoskar, L. E. Rosas, W. A.
Faubion, A. Julien, S. Rietdijk, A. J. Coyle, C. Fraser, and C. Terhorst. 2005.
Cutting edge: the SLAM family receptor Ly108 controls T cell and neutrophil
functions. J Immunol 174:5931-5935.
108.
Dong, Z., M. E. Cruz-Munoz, M. C. Zhong, R. Chen, S. Latour, and A.
Veillette. 2009. Essential function for SAP family adaptors in the surveillance
of hematopoietic cells by natural killer cells. Nat Immunol 10:973-980.
109.
Valdez, P. A., H. Wang, D. Seshasayee, M. van Lookeren Campagne, A.
Gurney, W. P. Lee, and I. S. Grewal. 2004. NTB-A, a new activating receptor
in T cells that regulates autoimmune disease. J Biol Chem 279:18662-18669.
110.
Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, X. H.
Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, Jr., L. Morel, and E. K.
Wakeland. 2004. Association of extensive polymorphisms in the SLAM/CD2
gene cluster with murine lupus. Immunity 21:769-780.
111.
Kumar, K. R., L. Li, M. Yan, M. Bhaskarabhatla, A. B. Mobley, C. Nguyen, J.
M. Mooney, J. D. Schatzle, E. K. Wakeland, and C. Mohan. 2006. Regulation
of B cell tolerance by the lupus susceptibility gene Ly108. Science 312:16651669.
REFERENCES
93
112.
Bouchon, A., M. Cella, H. L. Grierson, J. I. Cohen, and M. Colonna. 2001.
Activation of NK cell-mediated cytotoxicity by a SAP-independent receptor of
the CD2 family. J Immunol 167:5517-5521.
113.
Boles, K. S., and P. A. Mathew. 2001. Molecular cloning of CS1, a novel
human natural killer cell receptor belonging to the CD2 subset of the
immunoglobulin superfamily. Immunogenetics 52:302-307.
114.
Tassi, I., and M. Colonna. 2005. The Cytotoxicity Receptor CRACC (CS-1)
Recruits EAT-2 and Activates the PI3K and Phospholipase C{gamma}
Signaling Pathways in Human NK Cells. J Immunol 175:7996-8002.
115.
Cruz-Munoz, M. E., Z. Dong, X. Shi, S. Zhang, and A. Veillette. 2009.
Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2,
on natural killer cell function. Nat Immunol 10:297-305.
116.
Lee, J. K., S. O. Mathew, S. V. Vaidya, P. R. Kumaresan, and P. A. Mathew.
2007. CS1 (CRACC, CD319) induces proliferation and autocrine cytokine
expression on human B lymphocytes. J Immunol 179:4672-4678.
117.
Purtilo, D. T., C. K. Cassel, J. P. Yang, and R. Harper. 1975. X-linked
recessive progressive combined variable immunodeficiency (Duncan's
disease). Lancet 1:935-940.
118.
Tan, L. C., N. Gudgeon, N. E. Annels, P. Hansasuta, C. A. O'Callaghan, S.
Rowland-Jones, A. J. McMichael, A. B. Rickinson, and M. F. Callan. 1999. A
re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus
carriers. J Immunol 162:1827-1835.
119.
Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson. 1998. EBV
persistence in memory B cells in vivo. Immunity 9:395-404.
120.
Sawyer, R. N., A. S. Evans, J. C. Niederman, and R. W. McCollum. 1971.
Prospective studies of a group of Yale University freshmen. I. Occurrence of
infectious mononucleosis. The Journal of infectious diseases 123:263-270.
121.
Engel, P., M. J. Eck, and C. Terhorst. 2003. The SAP and SLAM families in
immune responses and X-linked lymphoproliferative disease. Nat Rev
Immunol 3:813-821.
122.
Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, J. M.
Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, R. Pavitt, J. Wilkinson, M.
Leversha, E. Huckle, C. J. Shaw-Smith, A. Dunham, S. Rhodes, V. Schuster,
G. Porta, L. Yin, P. Serafini, B. Sylla, M. Zollo, B. Franco, D. R. Bentley, and et
al. 1998. Host response to EBV infection in X-linked lymphoproliferative
disease results from mutations in an SH2-domain encoding gene. Nat Genet
20:129-135.
123.
Nichols, K. E., D. P. Harkin, S. Levitz, M. Krainer, K. A. Kolquist, C. Genovese,
A. Bernard, M. Ferguson, L. Zuo, E. Snyder, A. J. Buckler, C. Wise, J. Ashley,
M. Lovett, M. B. Valentine, A. T. Look, W. Gerald, D. E. Housman, and D. A.
Haber. 1998. Inactivating mutations in an SH2 domain-encoding gene in Xlinked lymphoproliferative syndrome. Proc Natl Acad Sci U S A 95:1376513770.
124.
Nichols, K. E., J. Hom, S. Y. Gong, A. Ganguly, C. S. Ma, J. L. Cannons, S. G.
Tangye, P. L. Schwartzberg, G. A. Koretzky, and P. L. Stein. 2005. Regulation
REFERENCES
94
of NKT cell development by SAP, the protein defective in XLP. Nat Med
11:340-345.
125.
Pasquier, B., L. Yin, M. C. Fondaneche, F. Relouzat, C. Bloch-Queyrat, N.
Lambert, A. Fischer, G. de Saint-Basile, and S. Latour. 2005. Defective NKT
cell development in mice and humans lacking the adapter SAP, the X-linked
lymphoproliferative syndrome gene product. J Exp Med 201:695-701.
126.
Masucci, M. G., R. Szigeti, I. Ernberg, M. Bjorkholm, H. Mellstedt, G. Henle,
W. Henle, G. Pearson, G. Masucci, E. Svedmyr, B. Johansson, and G. Klein.
1981. Cell-mediated immune reactions in three patients with malignant
lymphoproliferative diseases in remission and abnormally high Epstein-Barr
virus antibody titers. Cancer Res 41:4292-4301.
127.
Sakamoto, K., J. K. Seeley, T. Lindsten, J. Sexton, J. Yetz, M. Ballow, and D.
T. Purtilo. 1982. Abnormal anti-Epstein Barr virus antibodies in carriers of the
X-linked lymphoproliferative syndrome and in females at risk. J Immunol
128:904-907.
128.
Ma, C. S., N. J. Hare, K. E. Nichols, L. Dupre, G. Andolfi, M. G. Roncarolo, S.
Adelstein, P. D. Hodgkin, and S. G. Tangye. 2005. Impaired humoral immunity
in X-linked lymphoproliferative disease is associated with defective IL-10
production by CD4+ T cells. J Clin Invest 115:1049-1059.
129.
Harada, S., T. Bechtold, J. K. Seeley, and D. T. Purtilo. 1982. Cell-mediated
immunity to Epstein-Barr virus (EBV) and natural killer (NK)-cell activity in the
X-linked lymphoproliferative syndrome. Int J Cancer 30:739-744.
130.
Argov, S., D. R. Johnson, M. Collins, H. S. Koren, H. Lipscomb, and D. T.
Purtilo. 1986. Defective natural killing activity but retention of lymphocytemediated antibody-dependent cellular cytotoxicity in patients with the X-linked
lymphoproliferative syndrome. Cell Immunol 100:1-9.
131.
Sullivan, J. L., K. S. Byron, F. E. Brewster, and D. T. Purtilo. 1980. Deficient
natural killer cell activity in x-linked lymphoproliferative syndrome. Science
210:543-545.
132.
Rousset, F., G. Souillet, M. G. Roncarolo, and J. P. Lamelin. 1986. Studies of
EBV-lymphoid cell interactions in two patients with the X-linked
lymphoproliferative syndrome: normal EBV-specific HLA-restricted cytotoxicity.
Clinical and experimental immunology 63:280-289.
133.
Nichols, K. E., C. S. Ma, J. L. Cannons, P. L. Schwartzberg, and S. G.
Tangye. 2005. Molecular and cellular pathogenesis of X-linked
lymphoproliferative disease. Immunol Rev 203:180-199.
134.
Dupre, L., G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A.
Aiuti, and M. G. Roncarolo. 2005. SAP controls the cytolytic activity of CD8+ T
cells against EBV-infected cells. Blood 105:4383-4389.
135.
Sharifi, R., J. C. Sinclair, K. C. Gilmour, P. D. Arkwright, C. Kinnon, A. J.
Thrasher, and H. B. Gaspar. 2004. SAP mediates specific cytotoxic T-cell
functions in X-linked lymphoproliferative disease. Blood 103:3821-3827.
136.
Benoit, L., X. Wang, H. F. Pabst, J. Dutz, and R. Tan. 2000. Defective NK cell
activation in X-linked lymphoproliferative disease. J Immunol 165:3549-3553.
137.
Nakajima, H., M. Cella, A. Bouchon, H. L. Grierson, J. Lewis, C. S. Duckett, J.
I. Cohen, and M. Colonna. 2000. Patients with X-linked lymphoproliferative
REFERENCES
95
disease have a defect in 2B4 receptor-mediated NK cell cytotoxicity. Eur J
Immunol 30:3309-3318.
138.
Tangye, S. G., J. H. Phillips, L. L. Lanier, and K. E. Nichols. 2000. Functional
requirement for SAP in 2B4-mediated activation of human natural killer cells
as revealed by the X-linked lymphoproliferative syndrome. J Immunol
165:2932-2936.
139.
Wu, C., K. B. Nguyen, G. C. Pien, N. Wang, C. Gullo, D. Howie, M. R. Sosa,
M. J. Edwards, P. Borrow, A. R. Satoskar, A. H. Sharpe, C. A. Biron, and C.
Terhorst. 2001. SAP controls T cell responses to virus and terminal
differentiation of TH2 cells. Nat Immunol 2:410-414.
140.
Czar, M. J., E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen,
A. Sher, C. S. Duckett, R. Ahmed, and P. L. Schwartzberg. 2001. Altered
lymphocyte responses and cytokine production in mice deficient in the Xlinked lymphoproliferative disease gene SH2D1A/DSHP/SAP. Proc Natl Acad
Sci U S A 98:7449-7454.
141.
Yin, L., U. Al-Alem, J. Liang, W. M. Tong, C. Li, M. Badiali, J. J. Medard, J.
Sumegi, Z. Q. Wang, and G. Romeo. 2003. Mice deficient in the X-linked
lymphoproliferative disease gene sap exhibit increased susceptibility to murine
gammaherpesvirus-68 and hypo-gammaglobulinemia. J Med Virol 71:446455.
142.
Crotty, S., E. N. Kersh, J. Cannons, P. L. Schwartzberg, and R. Ahmed. 2003.
SAP is required for generating long-term humoral immunity. Nature 421:282287.
143.
Kamperschroer, C., D. M. Roberts, Y. Zhang, N. P. Weng, and S. L. Swain.
2008. SAP enables T cells to help B cells by a mechanism distinct from Th cell
programming or CD40 ligand regulation. J Immunol 181:3994-4003.
144.
Qi, H., J. L. Cannons, F. Klauschen, P. L. Schwartzberg, and R. N. Germain.
2008. SAP-controlled T-B cell interactions underlie germinal centre formation.
Nature 455:764-769.
145.
Watzl, C., and E. O. Long. 2003. Natural killer cell inhibitory receptors block
actin cytoskeleton-dependent recruitment of 2B4 (CD244) to lipid rafts. J Exp
Med 197:77-85.
146.
Watzl, C., C. C. Stebbins, and E. O. Long. 2000. NK cell inhibitory receptors
prevent tyrosine phosphorylation of the activation receptor 2B4 (CD244). J
Immunol 165:3545-3548.
147.
Simons, K., and D. Toomre. 2000. Lipid rafts and signal transduction. Nat Rev
Mol Cell Biol 1:31-39.
148.
Morra, M., J. Lu, F. Poy, M. Martin, J. Sayos, S. Calpe, C. Gullo, D. Howie, S.
Rietdijk, A. Thompson, A. J. Coyle, C. Denny, M. B. Yaffe, P. Engel, M. J. Eck,
and C. Terhorst. 2001. Structural basis for the interaction of the free SH2
domain EAT-2 with SLAM receptors in hematopoietic cells. Embo J 20:58405852.
149.
Poy, F., M. B. Yaffe, J. Sayos, K. Saxena, M. Morra, J. Sumegi, L. C. Cantley,
C. Terhorst, and M. J. Eck. 1999. Crystal structures of the XLP protein SAP
reveal a class of SH2 domains with extended, phosphotyrosine-independent
sequence recognition. Mol Cell 4:555-561.
REFERENCES
96
150.
Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L.
Notarangelo, R. Geha, M. G. Roncarolo, H. Oettgen, J. E. De Vries, G.
Aversa, and C. Terhorst. 1998. The X-linked lymphoproliferative-disease gene
product SAP regulates signals induced through the co-receptor SLAM. Nature
395:462-469.
151.
Thompson, A. D., B. S. Braun, A. Arvand, S. D. Stewart, W. A. May, E. Chen,
J. Korenberg, and C. Denny. 1996. EAT-2 is a novel SH2 domain containing
protein that is up regulated by Ewing's sarcoma EWS/FLI1 fusion gene.
Oncogene 13:2649-2658.
152.
Eissmann, P., and C. Watzl. 2006. Molecular Analysis of NTB-A Signaling: A
Role for EAT-2 in NTB-A-Mediated Activation of Human NK Cells. J Immunol
177:3170-3177.
153.
Latour, S., G. Gish, C. D. Helgason, R. K. Humphries, T. Pawson, and A.
Veillette. 2001. Regulation of SLAM-mediated signal transduction by SAP, the
X-linked lymphoproliferative gene product. Nat Immunol 2:681-690.
154.
Chan, B., A. Lanyi, H. K. Song, J. Griesbach, M. Simarro-Grande, F. Poy, D.
Howie, J. Sumegi, C. Terhorst, and M. J. Eck. 2003. SAP couples Fyn to
SLAM immune receptors. Nat Cell Biol 5:155-160.
155.
Latour, S., R. Roncagalli, R. Chen, M. Bakinowski, X. Shi, P. L. Schwartzberg,
D. Davidson, and A. Veillette. 2003. Binding of SAP SH2 domain to FynT SH3
domain reveals a novel mechanism of receptor signalling in immune
regulation. Nat Cell Biol 5:149-154.
156.
Chen, R., F. Relouzat, R. Roncagalli, A. Aoukaty, R. Tan, S. Latour, and A.
Veillette. 2004. Molecular dissection of 2B4 signaling: implications for signal
transduction by SLAM-related receptors. Mol Cell Biol 24:5144-5156.
157.
Davidson, D., X. Shi, S. Zhang, H. Wang, M. Nemer, N. Ono, S. Ohno, Y.
Yanagi, and A. Veillette. 2004. Genetic evidence linking SAP, the X-linked
lymphoproliferative gene product, to Src-related kinase FynT in T(H)2 cytokine
regulation. Immunity 21:707-717.
158.
Simarro, M., A. Lanyi, D. Howie, F. Poy, J. Bruggeman, M. Choi, J. Sumegi,
M. J. Eck, and C. Terhorst. 2004. SAP increases FynT kinase activity and is
required for phosphorylation of SLAM and Ly9. Int Immunol 16:727-736.
159.
Davidson, D., M. Bakinowski, M. L. Thomas, V. Horejsi, and A. Veillette. 2003.
Phosphorylation-dependent regulation of T-cell activation by PAG/Cbp, a lipid
raft-associated transmembrane adaptor. Mol Cell Biol 23:2017-2028.
160.
Saborit-Villarroya, I., J. M. Del Valle, X. Romero, E. Esplugues, P. Lauzurica,
P. Engel, and M. Martin. 2005. The Adaptor Protein 3BP2 Binds Human
CD244 and Links this Receptor to Vav Signaling, ERK Activation, and NK Cell
Killing. J Immunol 175:4226-4235.
161.
Jevremovic, D., D. D. Billadeau, R. A. Schoon, C. J. Dick, and P. J. Leibson.
2001. Regulation of NK cell-mediated cytotoxicity by the adaptor protein 3BP2.
J Immunol 166:7219-7228.
162.
Saborit-Villarroya, I., A. Martinez-Barriocanal, I. Oliver-Vila, P. Engel, J.
Sayos, and M. Martin. 2008. The adaptor 3BP2 activates CD244-mediated
cytotoxicity in PKC- and SAP-dependent mechanisms. Mol Immunol 45:34463453.
REFERENCES
97
163.
Bottino, C., R. Augugliaro, R. Castriconi, M. Nanni, R. Biassoni, L. Moretta,
and A. Moretta. 2000. Analysis of the molecular mechanism involved in 2B4mediated NK cell activation: evidence that human 2B4 is physically and
functionally associated with the linker for activation of T cells. Eur J Immunol
30:3718-3722.
164.
Endt, J., P. Eissmann, S. C. Hoffmann, S. Meinke, T. Giese, and C. Watzl.
2007. Modulation of 2B4 (CD244) activity and regulated SAP expression in
human NK cells. Eur J Immunol 37:193-198.
165.
Sandusky, M. M., B. Messmer, and C. Watzl. 2006. Regulation of 2B4
(CD244)-mediated NK cell activation by ligand-induced receptor modulation.
Eur J Immunol 36:3268-3276.
166.
Mathew, S. O., S. V. Vaidya, J. R. Kim, and P. A. Mathew. 2007. Human
natural killer cell receptor 2B4 (CD244) down-regulates its own expression by
reduced promoter activity at an Ets element. Biochem Biophys Res Commun
355:483-487.
167.
Tovar, V., J. del Valle, N. Zapater, M. Martin, X. Romero, P. Pizcueta, J.
Bosch, C. Terhorst, and P. Engel. 2002. Mouse novel Ly9: a new member of
the expanding CD150 (SLAM) family of leukocyte cell-surface receptors.
Immunogenetics 54:394-402.
168.
Stark, S., R. M. Flaig, M. Sandusky, and C. Watzl. 2005. The use of trimeric
isoleucine-zipper fusion proteins to study surface-receptor-ligand interactions
in natural killer cells. J Immunol Methods 296:149-158.
169.
Byrd, A., S. C. Hoffmann, M. Jarahian, F. Momburg, and C. Watzl. 2007.
Expression analysis of the ligands for the Natural Killer cell receptors NKp30
and NKp44. PLoS ONE 2:e1339.
170.
Bennett-Lovsey, R. M., A. D. Herbert, M. J. Sternberg, and L. A. Kelley. 2008.
Exploring the extremes of sequence/structure space with ensemble fold
recognition in the program Phyre. Proteins 70:611-625.
171.
Cao, E., U. A. Ramagopal, A. Fedorov, E. Fedorov, Q. Yan, J. W. Lary, J. L.
Cole, S. G. Nathenson, and S. C. Almo. 2006. NTB-A receptor crystal
structure: insights into homophilic interactions in the signaling lymphocytic
activation molecule receptor family. Immunity 25:559-570.
172.
Baeriswyl, V., A. Wodnar-Filipowicz, and C. P. Kalberer. 2006. The effect of
silencing NKG2D through RNA interference on receptor functions in
interleukin-2-activated human natural killer cells. Haematologica 91:15381541.
173.
Aversa, G., C. C. Chang, J. M. Carballido, B. G. Cocks, and J. E. de Vries.
1997. Engagement of the signaling lymphocytic activation molecule (SLAM)
on activated T cells results in IL-2-independent, cyclosporin A-sensitive T cell
proliferation and IFN-gamma production. J Immunol 158:4036-4044.
174.
Cocks, B. G., C. C. Chang, J. M. Carballido, H. Yssel, J. E. de Vries, and G.
Aversa. 1995. A novel receptor involved in T-cell activation. Nature 376:260263.
175.
de la Fuente, M. A., P. Pizcueta, M. Nadal, J. Bosch, and P. Engel. 1997.
CD84 leukocyte antigen is a new member of the Ig superfamily. Blood
90:2398-2405.
REFERENCES
98
176.
Fagnoni, F. F., R. Vescovini, M. Mazzola, G. Bologna, E. Nigro, G. Lavagetto,
C. Franceschi, M. Passeri, and P. Sansoni. 1996. Expansion of cytotoxic
CD8+ CD28- T cells in healthy ageing people, including centenarians.
Immunology 88:501-507.
177.
Schwab, R., P. Szabo, J. S. Manavalan, M. E. Weksler, D. N. Posnett, C.
Pannetier, P. Kourilsky, and J. Even. 1997. Expanded CD4+ and CD8+ T cell
clones in elderly humans. J Immunol 158:4493-4499.
178.
Azuma, M., J. H. Phillips, and L. L. Lanier. 1993. CD28- T lymphocytes.
Antigenic and functional properties. J Immunol 150:1147-1159.
179.
Topp, M. S., S. R. Riddell, Y. Akatsuka, M. C. Jensen, J. N. Blattman, and P.
D. Greenberg. 2003. Restoration of CD28 expression in CD28- CD8+ memory
effector T cells reconstitutes antigen-induced IL-2 production. J Exp Med
198:947-955.
180.
Martens, P. B., J. J. Goronzy, D. Schaid, and C. M. Weyand. 1997. Expansion
of unusual CD4+ T cells in severe rheumatoid arthritis. Arthritis Rheum
40:1106-1114.
181.
Liuzzo, G., J. J. Goronzy, H. Yang, S. L. Kopecky, D. R. Holmes, R. L. Frye,
and C. M. Weyand. 2000. Monoclonal T-cell proliferation and plaque instability
in acute coronary syndromes. Circulation 101:2883-2888.
182.
Markovic-Plese, S., I. Cortese, K. P. Wandinger, H. F. McFarland, and R.
Martin. 2001. CD4+CD28- costimulation-independent T cells in multiple
sclerosis. J Clin Invest 108:1185-1194.
183.
Thewissen, M., V. Somers, N. Hellings, J. Fraussen, J. Damoiseaux, and P.
Stinissen. 2007. CD4+CD28null T cells in autoimmune disease: pathogenic
features and decreased susceptibility to immunoregulation. J Immunol
179:6514-6523.
184.
Nakajima, T., S. Schulte, K. J. Warrington, S. L. Kopecky, R. L. Frye, J. J.
Goronzy, and C. M. Weyand. 2002. T-cell-mediated lysis of endothelial cells in
acute coronary syndromes. Circulation 105:570-575.
185.
Yen, J. H., B. E. Moore, T. Nakajima, D. Scholl, D. J. Schaid, C. M. Weyand,
and J. J. Goronzy. 2001. Major histocompatibility complex class I-recognizing
receptors are disease risk genes in rheumatoid arthritis. J Exp Med 193:11591167.
186.
Groh, V., A. Bruhl, H. El-Gabalawy, J. L. Nelson, and T. Spies. 2003.
Stimulation of T cell autoreactivity by anomalous expression of NKG2D and its
MIC ligands in rheumatoid arthritis. Proc Natl Acad Sci U S A 100:9452-9457.
187.
Tangye, S. G., K. E. Nichols, N. J. Hare, and B. C. van de Weerdt. 2003.
Functional requirements for interactions between CD84 and Src homology 2
domain-containing proteins and their contribution to human T cell activation. J
Immunol 171:2485-2495.
188.
Tangye, S. G., B. C. van de Weerdt, D. T. Avery, and P. D. Hodgkin. 2002.
CD84 is up-regulated on a major population of human memory B cells and
recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol
32:1640-1649.
189.
Martin, M., J. M. Del Valle, I. Saborit, and P. Engel. 2005. Identification of
Grb2 as a novel binding partner of the signaling lymphocytic activation
REFERENCES
99
molecule-associated protein binding receptor CD229. J Immunol 174:59775986.
190.
Snow, A. L., R. A. Marsh, S. M. Krummey, P. Roehrs, L. R. Young, K. Zhang,
J. van Hoff, D. Dhar, K. E. Nichols, A. H. Filipovich, H. C. Su, J. J. Bleesing,
and M. J. Lenardo. 2009. Restimulation-induced apoptosis of T cells is
impaired in patients with X-linked lymphoproliferative disease caused by SAP
deficiency. J Clin Invest 119:2976-2989.
191.
Henning, G., M. S. Kraft, T. Derfuss, R. Pirzer, G. de Saint-Basile, G. Aversa,
B. Fleckenstein, and E. Meinl. 2001. Signaling lymphocytic activation molecule
(SLAM) regulates T cellular cytotoxicity. Eur J Immunol 31:2741-2750.
192.
Mehrle, S., S. Frank, J. Schmidt, I. G. Schmidt-Wolf, and A. Marten. 2005.
SAP and SLAM expression in anti-CD3 activated lymphocytes correlates with
cytotoxic activity. Immunol Cell Biol 83:33-39.
193.
Browning, M. B., J. E. Woodliff, M. C. Konkol, N. T. Pati, S. Ghosh, R. L. Truitt,
and B. D. Johnson. 2004. The T cell activation marker CD150 can be used to
identify alloantigen-activated CD4(+)25+ regulatory T cells. Cell Immunol
227:129-139.
194.
Bleharski, J. R., K. R. Niazi, P. A. Sieling, G. Cheng, and R. L. Modlin. 2001.
Signaling lymphocytic activation molecule is expressed on CD40 ligandactivated dendritic cells and directly augments production of inflammatory
cytokines. J Immunol 167:3174-3181.
195.
Kruse, M., E. Meinl, G. Henning, C. Kuhnt, S. Berchtold, T. Berger, G.
Schuler, and A. Steinkasserer. 2001. Signaling lymphocytic activation
molecule is expressed on mature CD83+ dendritic cells and is up-regulated by
IL-1 beta. J Immunol 167:1989-1995.
196.
Lu, L., K. Ikizawa, D. Hu, M. B. Werneck, K. W. Wucherpfennig, and H.
Cantor. 2007. Regulation of activated CD4+ T cells by NK cells via the Qa-1NKG2A inhibitory pathway. Immunity 26:593-604.
197.
Boesteanu, A. C., and P. D. Katsikis. 2009. Memory T cells need CD28
costimulation to remember. Semin Immunol 21:69-77.
198.
Borowski, A. B., A. C. Boesteanu, Y. M. Mueller, C. Carafides, D. J. Topham,
J. D. Altman, S. R. Jennings, and P. D. Katsikis. 2007. Memory CD8+ T cells
require CD28 costimulation. J Immunol 179:6494-6503.
199.
Fuse, S., W. Zhang, and E. J. Usherwood. 2008. Control of memory CD8+ T
cell differentiation by CD80/CD86-CD28 costimulation and restoration by IL-2
during the recall response. J Immunol 180:1148-1157.
200.
Vallejo, A. N. 2005. CD28 extinction in human T cells: altered functions and
the program of T-cell senescence. Immunol Rev 205:158-169.
201.
Ortiz-Suarez, A., and R. A. Miller. 2002. A subset of CD8 memory T cells from
old mice have high levels of CD28 and produce IFN-gamma. Clin Immunol
104:282-292.
202.
Chiu, W. K., M. Fann, and N. P. Weng. 2006. Generation and growth of
CD28nullCD8+ memory T cells mediated by IL-15 and its induced cytokines. J
Immunol 177:7802-7810.
REFERENCES
100
203.
Almanzar, G., S. Schwaiger, B. Jenewein, M. Keller, D. Herndler-Brandstetter,
R. Wurzner, D. Schonitzer, and B. Grubeck-Loebenstein. 2005. Long-term
cytomegalovirus infection leads to significant changes in the composition of
the CD8+ T-cell repertoire, which may be the basis for an imbalance in the
cytokine production profile in elderly persons. J Virol 79:3675-3683.
204.
Effros, R. B., R. Allsopp, C. P. Chiu, M. A. Hausner, K. Hirji, L. Wang, C. B.
Harley, B. Villeponteau, M. D. West, and J. V. Giorgi. 1996. Shortened
telomeres in the expanded CD28-CD8+ cell subset in HIV disease implicate
replicative senescence in HIV pathogenesis. AIDS 10:F17-22.
205.
Fasth, A. E., N. K. Bjorkstrom, M. Anthoni, K. J. Malmberg, and V. Malmstrom.
2010. Activating NK-cell receptors co-stimulate CD4(+)CD28(-) T cells in
patients with rheumatoid arthritis. Eur J Immunol 40:378-387.
ABBREVIATIONS
101
7 Abbreviations
APC
allophycocyanin
BSA
bovine serum albumin
CCR
chemokine receptor
CD
cluster of differentiation
CFDA
carboxyfluorescin diacetate
CRACC
CD2-like receptor activating cytotoxic cells
DMSO
dimethylsulfoxide
DNA
desoxyribonucleic acid
E. coli
Escherichia coli
E/T
effector to target ratio
EAT-2
Ewings sarcoma virus activated transcript 2
EBV
Epstein-Barr virus
EDTA
ethylenediaminetetraacetic acid
ERT
EAT-2 related transducer
FACS
fluorescence-activated cell sorting
FCS
fetal calf serum
FITC
fluorescin isothiocyanate
GAPDH
glycerolaldehydephosphate dehydrogenase
GFP
green fluorescent protein
HRPO
horseradish peroxidase
IFN
interferon
Ig
immunoglobulin
IL
interleukin
ITAM
immunoreceptor tyrosine-based activation motif
ITIM
immunoreceptor tyrosine-based inhibition motif
ITSM
immunoreceptor tyrosine-based switch motif
IU
international units
KIR
killer cell immunoglobulin-like receptor
KO
knockout
LSM
lymphocyte separation medium
ABBREVIATIONS
102
MHC
major histocompatibility complex
MOI
multiplicity of infection
mRNA
messenger RNA
NK
natural killer
NTB-A
natural killer, T cell, B cell antigen
PBMC
peripheral blood mononuclear cells
PBS
phosphate-buffered saline
PCR
polymerase chain reaction
PE
phycoerythrin
PerCP
peridinin chlorophyll protein complex
PHA-P
Phaseolus vulgaris hemagglutinin protein
PLC
phospholipase C
PMSF
phenylmethylsulfonyl fluoride
PVDF
polyvinylidene difluoride
RNA
ribonucleic acid
SAP
SLAM associated protein
SDS
sodium dodecyl sulfate
SDS-PAGE
SDS-polyacrylamide gel-electrophoresis
shRNA
small hairpin RNA
siRNA
small interfering RNA
SLAM
signaling lymphocyte activation molecule
SRR
SLAM-related receptor(s)
TAE
Tris-acetate-EDTA buffer
TCR
T cell receptor
TGF
transforming growth factor
TNF
tumor necrosis factor
wt
wild type
XLP
X-linked lymphoproliferative disease
The single letter code was used to describe amino acid residues.
PUBLICATIONS
103
8 Publications
Endt, J., P. Eissmann, S. C. Hoffmann, S. Meinke, T. Giese, and C. Watzl. 2007.
Modulation of 2B4 (CD244) activity and regulated SAP expression in human NK
cells. Eur J Immunol 37:193-198.
Claus, M., S. Meinke, R. Bhat, and C. Watzl. 2008. Regulation of NK cell activity by
2B4, NTB-A and CRACC. Front Biosci 13:956-965.
S. Meinke, C. Böhm, S. Durlanik and C. Watzl. The activating receptors 2B4 and
NTB-A, but not CRACC are subject to ligand-induced down-regulation on human
natural killer cells, in submission
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Related manuals

Download PDF

advertising