Arman PhD 2011 UB

Arman PhD 2011 UB

Dissertation

submitted to the

Combined Faculties for the Natural Sciences and for

Mathematics of the Ruperto-Carola University of Heidelberg,

Germany for the degree of

Doctor of Natural Sciences presented by

Dipl. Biol. Arman Allboje Samami born in Rasht, Iran

Oral examination: December 15

th

, 2011

Lowered sulfite reduction affects metabolism and seed composition in Arabidopsis thaliana

Referees: Prof. Dr. Rüdiger Hell

Prof. Dr. Thomas Rausch

Dedicated to my father.

یونغن نامز کی نتخومآ زا

نب هب دیاین شناد هک ینادب

یونشب نخس نوچ یشناد ره ز

نخس خاش هب یبای رادید وچ

(

ىدیشروخ ۳۹۷ ات ۳۱۹) ىسودرف

And when thou hearest any man of lore

Discourse, sleep not, increase thy wisdom's store;

But mark, while gazing at the boughs of speech,

How much the roots thereof are out of reach.

Ferdowsi (940 - 1020 CE)

Table of contents

Index of figures

…………………………………………………………………………………………………………...III

Index of tables…………………………………………………………………………………………………………….IV

Index of supplemental data

………………………………………………………………………………………….…IV

Table of abbreviations

…………………………………………………………………………………………………...V

Summary

………………………………………………………………………………………………………………….VII

Zusammenfassung

……………………………………………………………………………………………………..VIII

1

1.1

Introduction .......................................................................................................................................... 1

Importance of sulfur for life ............................................................................................................. 1

1.2

1.3

1.4

1.5

Sulfate uptake in plants .................................................................................................................. 2

Sulfate assimilatory reduction ......................................................................................................... 5

Sulfite reduction by SiR .................................................................................................................. 7

Arabidopsis sulfite reductase versus others.................................................................................... 8

1.6

1.7

SAT and OAS-TL complete sulfate assimilation ............................................................................. 9

Cysteine synthase complex regulates the last step of sulfate assimilation .................................... 10

1.8 Seeds contain storage compounds .............................................................................................. 11

1.8.1 Triacylglycerides as major lipid storage compounds in Arabidopsis seeds .......................... 13

1.8.2 Seed storage proteins ........................................................................................................ 15

1.9 Aims of the project ....................................................................................................................... 16

2

2.1

Material and methods ........................................................................................................................ 18

Technical equipment, materials and IT ......................................................................................... 18

2.1.1

2.1.2

2.1.3

2.1.4

2.1.5

Technical equipment .......................................................................................................... 18

Chemicals .......................................................................................................................... 20

Consumables ..................................................................................................................... 23

Kits .................................................................................................................................... 24

Enzymes ............................................................................................................................ 24

2.1.6 Primers .............................................................................................................................. 25

2.2

2.1.7 Software ............................................................................................................................ 27

Plant material and growth conditions ............................................................................................ 28

2.2.1

2.2.2

Plant material ..................................................................................................................... 28

Surface sterilization of seeds ............................................................................................. 28

2.2.3

2.2.3.1

2.2.3.2

2.2.3.3

2.2.3.4

2.2.4

2.2.5

2.2.6

2.2.7

2.2.8

Growth conditions .............................................................................................................. 28

Growth on soil .................................................................................................................... 28

Hydroponic cultures ........................................................................................................... 29

Growth of Arabidopsis under sterile conditions ................................................................... 30

Chemical complementation under sterile condidtions ......................................................... 30

Detection of phenotypic differences between sir1-1 and Col-0 plants ................................. 31

Pollen viability test ............................................................................................................. 31

Crossing of Arabidopsis thaliana lines sir1-1 and sir1-2 with SOX-OE and sox-k.o............. 32

Stress induction using sulfite .............................................................................................. 32

Stable transformation of Arabidopsis thaliana .................................................................... 32

2.3

2.3.1

2.3.2

Bacteriological methods ............................................................................................................... 33

Bacterial strains ................................................................................................................. 33

Preparation of competent cells for electroporation .............................................................. 33

2.3.3

2.3.4

Transformation of bacteria ................................................................................................. 33

Bacterial growth ................................................................................................................. 33

2.3.4.1 Plasmid isolation from E.coli ............................................................................................... 34

2.3.4.2 Glycerol stocks of bacteria .................................................................................................. 34

2.3.5 Growth of Agrobacterium tumefaciens ............................................................................... 34

2.4

2.4.1

Molecular Biology Methods .......................................................................................................... 34

Isolation of genomic DNA from Arabidopsis thaliana .......................................................... 34

2.4.2

2.4.3

2.4.4

Polymerase Chain Reaction ............................................................................................... 35

DNA gel electrophoresis .................................................................................................... 36

Cloning using endonucleases and ligase............................................................................ 36

2.5

2.5.1

Biochemical methods ................................................................................................................... 37

Purification of soluble proteins from Arabidopsis vegetative tissues ................................... 37

2.5.2

2.5.2.1

2.5.2.2

2.5.3

2.5.4

Purification of proteins from Arabidopsis generative tissues ............................................... 37

Purification of soluble proteins from seeds ......................................................................... 37

Purification of total proteins from seeds .............................................................................. 38

Protein quantification.......................................................................................................... 38

2-D gel electrophoresis of seed proteome .......................................................................... 39

2.5.4.1

2.5.4.2

2.5.4.3

2.5.5

2.5.5.1

2.5.5.2

2.5.5.3

2.5.5.4

2.5.6

2.5.6.1

Total seed protein extraction and 2-D electrophoresis ........................................................ 39

Protein staining and quantification ...................................................................................... 40

Protein identification ........................................................................................................... 40

Protein separation by electrophoresis and immunoblotting ................................................. 41

SDS-polyacrylamide gel electrophoresis ............................................................................ 41

Coomassie staining of protein ............................................................................................ 41

Protein transfer from SDS-gels to PVDF membranes ......................................................... 41

Immunological detection of proteins on PVDF membranes ................................................ 42

Activity Assays ................................................................................................................... 42

Determination of SiR activity .............................................................................................. 42

I

2.6

2.5.6.2 Determination of APR activity ............................................................................................. 43

Microscopic methods ................................................................................................................... 43

2.6.1

2.6.2

Silique and pollen imaging ................................................................................................. 43

Electron microscopy ........................................................................................................... 44

2.7

2.7.1

2.7.2

Metabolomics ............................................................................................................................... 45

Acidic extraction of metabolites .......................................................................................... 45

Determination of amino acids and other metabolites .......................................................... 45

2.7.3

2.7.4

2.7.5

2.7.6

2.7.7

2.7.7.1

2.7.8

2.7.9

Determination of thiols ....................................................................................................... 46

Determination of adenosines .............................................................................................. 47

Extraction, isolation and quantification of jasmonates, hydroxyjasmonic acid (12-OH-JA), and hydroxyjasmonic acid sulfate (12-HSO

4

-JA) ................................................................ 47

Isolation of lipids from Arabidopsis seeds for determination of total lipid content ................ 48

Lipid extraction for triacylglyceride determination ............................................................... 48

Determination of TAG levels in Arabidopsis seeds ............................................................. 49

In situ staining of starch ..................................................................................................... 49

Quantitative measurement of starch and soluble sugars .................................................... 50

2.7.9.1

2.7.9.2

2.7.9.3

2.7.10

Determination of sugars ..................................................................................................... 50

Starch determination .......................................................................................................... 50

Quantitative measurement of starch using peroxidase ....................................................... 51

Determination of sulfolipids ................................................................................................ 51

2.8

2.7.11 Quantification of leaf chlorophyll contents .......................................................................... 52

Transcriptomics ............................................................................................................................ 52

2.8.1

2.8.2

2.8.3

2.8.3.1 mRNA Isolation .................................................................................................................. 52

Examination of RNA degradation and determination of concentration ................................ 54

Quantitative real time-PCR ................................................................................................. 54 cDNA synthesis.................................................................................................................. 54

2.8.3.2

2.8.4 qRT-PCR ........................................................................................................................... 54

Microarray analysis ............................................................................................................ 55

2.8.4.1 Labeling, hybridization, staining and scanning.................................................................... 55

2.9

2.8.4.2 Normalization and data analysis ......................................................................................... 55

Principal component analysis (PCA) ............................................................................................ 56

2.10 Statistical Analyses ...................................................................................................................... 56

3

3.1

Results ................................................................................................................................................ 57

Complementation and stress induction of the T-DNA insertion lines sir1-1 and sir1-2................... 57

3.1.1

3.1.2

Genetic complementation of homozygous sir1-2 ................................................................ 57

Tissue-specific genetic complementation of sir1-1 ............................................................. 58

3.1.3 Chemical complementation of SiR mutant lines .................................................................. 60

3.2

3.1.4 Sulfite treatment of sir1-1 to assess stress resistance ........................................................ 62

Phenotypic and metabolic characterization of sir1-1 ..................................................................... 63

3.2.1

3.2.2

3.2.3

3.2.4

Growth-based phenotypic analysis of sir1-1 ....................................................................... 63

Determination of chlorophyll amounts in leaves.................................................................. 68

Determination of starch levels in leaves ............................................................................. 69

Metabolite changes in leaves of soil-grown plants .............................................................. 72

3.2.5

3.2.6

3.2.7

Determination of APR2 transcript and APR activity ............................................................ 75

Detection of sulfide ............................................................................................................ 76

3.2.7.1

3.2.7.2

Effects of sulfur availability on metabolites in vegetative tissues of hydroponically grown plants.

………………………………………………………………………………………………..76

Effects of sulfur availability on metabolites in leaves .......................................................... 77

Effects of sulfur availability on metabolites in roots ............................................................. 84

3.3

3.3.1

Whole transcriptome analysis of sir1-1 ......................................................................................... 89

Impact of SiR mutation on gene expression in wild-type and sir1-1 plants of same age...... 89

3.3.2

3.3.3

Impact of SiR mutation on gene expression in wild-type and sir1-1 of same developmental stage..

………………………………………………………………………………………………..91

Comparative transcriptomic analysis between wild-type and sir1-1 of wild-type-age and wild-

3.4

3.3.4 type-development .............................................................................................................. 93

Affected genes related to sulfolipids and jasmonic acid ...................................................... 96

Analysis of generative tissue in sir1-1........................................................................................... 98

3.4.1

3.4.2

Impact of SiR mutation on bolting time ............................................................................... 99

Silique characterization in sir1-1 and wild-type plants ....................................................... 100

3.4.3

3.4.4

3.4.5

3.4.6

3.4.7

3.4.8

Impact of SiR mutation on seed yield ............................................................................... 103

Impact of sulfur availability on seed yield of sir1-1 and wild-type plants ............................ 106

SiR transcript, protein and activity in sir1-1 seeds ............................................................ 108

Effects of decreased sulfite reduction on the sir1-1 seed composition .............................. 111

Effects of decreased sulfite reduction on the sulfur assimilatory reduction pathway in sir1-1 and wild-type seeds ......................................................................................................... 114

Effects of decreased sulfite reduction on the sir1-1 proteome........................................... 115

4

4.1

Discussion........................................................................................................................................ 120

Effects of SiR mutation on the whole genome and metabolites .................................................. 120

4.2 Effects of decreased sulfite reduction on the generative growth ................................................. 126

4.3 Effects of decreased sulfite reduction on the seed proteome ...................................................... 127

References

………..………………………………………………………………………………………………….…131

Supplemental data………………………………………………………………………………………………….…152

General statement

……………………………………………………………………………………………………….175

Acknowledgment

………………………………………………………………………………………………………..176

II

Index of figures

Fig. 1 Complementation of sir1-2 with SiR restores wild-type phenotype. ...................................... 58

Fig. 2 Complementation of sir1-1 with tissue-specific SiR expressing constructs. .......................... 60

Fig. 3 Chemical complementation of sir1-1 and sir1-2. ................................................................... 61

Fig. 4 sir1-1 is sensitive to sulfite stress. ........................................................................................ 63

Fig. 5 Rosette-based phenotypic analyses reveal contracted growth of sir1-1. .............................. 65

Fig. 6 On full media sir1-1 has a lower germination rate than wild-type. ......................................... 66

Fig. 7 sir1-1 has a lower germination rate than wild-type on deficient media. ................................. 67

Fig. 8 Total chlorophyll is decreased in sir1-1 leaves compared to wild-type. ................................ 69

Fig. 9 sir1-1 leaves have lower diurnal starch amount compared to wild-type leaves..................... 70

Fig. 10 sir1-1 can synthesize and degrade starch. ......................................................................... 71

Fig. 11 Metabolic analysis of soil-grown sir1-1 and wild-type plants. .............................................. 73

Fig. 12 Adenosine levels were changes in sir1-1 compared to wild-type plants. ............................ 74

Fig. 13 APR2 transcript and total APR activity is reduced in sir1-1 leaves. .................................... 75

Fig. 14 Sulfide detection in leaf tissue reveals no changes in sir1-1 compared to wild-type. .......... 76

Fig. 15 Thiol contents of soil- and hydroponically grown plants were similar. ................................. 77

Fig. 16 Leaf metabolic analysis of sir1-1 and WT plants grown hydoponically on +S. .................... 79

Fig. 17 Leaf metabolic analysis of sir1-1 and WT plants after transfer to -S. .................................. 80

Fig. 18 Leaf +S:-S ratios of wild-type and sir1-1 plants. ................................................................. 82

Fig. 19 PCA on WT and sir1-1 leaf metabolites from +S and -S conditions. ................................... 83

Fig. 20 Root metabolic analysis of sir1-1 and WT plants grown hydoponically on +S. ................... 85

Fig. 21 Root metabolic analysis of sir1-1 and WT plants after transfer to -S. ................................. 86

Fig. 22 Root +S:-S ratios of wild-type and sir1-1 plants. ................................................................. 87

Fig. 23 PCA on WT and sir1-1 root metabolites from +S and -S conditions. .................................. 88

Fig. 24 Altered gene expression in 7-week-old sir1-1 leaf compared to wild-type. ......................... 90

Fig. 25 Categorized altered genes in 7-week-old sir1-1 compared to wild-type. ............................. 91

Fig. 26 Altered gene expression in 10-week-old sir1-1 leaf compared to 7-week-old wild-type. ..... 92

Fig. 27 Categorized altered genes in 10-week-old sir1-1 compared to wild-type. ........................... 93

Fig. 28 Venn diagram shows unique and shared genes which were changed between and among

7-week-old wild-type, sir1-1 and 10-week-old sir1-1. ......................................................... 94

Fig. 29 Sulfolipids seemed to be unchanged in sir1-1 leaves. ........................................................ 97

Fig. 30 Jasmonic acid and 12-hydroxyjasmonic acid in leaves of wild-type and sir1-1 plants. ....... 98

Fig. 31 sir1-1 needs a longer period to start bolting. ....................................................................... 99

Fig. 32 sir1-1 has less siliques than wild-type. .............................................................................. 100

Fig. 33 sir1-1 siliques contain less seeds than wild-type siliques. ................................................ 102

Fig. 34 sir1-1 has more aborted pollen grains than the wild-type. ................................................ 103

Fig. 35 sir1-1 has lower seed yield with wild-type-like 100-seed-weight. ...................................... 105

Fig. 36 sir1-1 seed yield is negatively affected by sulfur deprivation to a higher degree than wildtype. ................................................................................................................................. 107

Fig. 37 SiR transcript and protein is reduced in sir1-1 vegetative and generative tissues ............ 110

Fig. 38 sir1-1 seeds contain higher protein amounts. ................................................................... 111

Fig. 39 sir1-1 seeds have more free amino acids compared to wild-type. .................................... 112

Fig. 40 sir1-1 seeds have less fat compared to wild-type. ............................................................ 113

Fig. 41 sir1-1 shows seed sugar and starch levels comparable to wild-type. ............................... 114

Fig. 42 Effects of SiR mutation on the sulfur assimilation and reduction pathway in seeds .......... 115

Fig. 43 2-D analysis of the seed proteome reveals changes in sir1-1........................................... 116

Fig. 44 Affected metabolic pathways in sir1-1 seeds. ................................................................... 119

III

Index of tables

Tab. 1 Affected gene sets due to SiR mutation are linked to DNA repair and stress. ..................... 95

Tab. 2 Polypeptides with changed abundance in sir1-1 seeds. .................................................... 118

Index of supplemental data

Suppl. data 1 Raw data of leaf metabolites of soil-grown sir1-1 and wild-type plants. .................. 152

Suppl. data 2 Raw data of leaf metabolites of sir1-1 and WT plants grown hydoponically on +S. 153

Suppl. data 3 Raw data of leaf metabolites of sir1-1 and WT plants after transfer to -S. .............. 154

Suppl. data 4 Raw data of root metabolites of sir1-1 and WT plants grown hydoponically on +S.155

Suppl. data 5 Raw data of root metabolites of sir1-1 and WT plants after transfer to -S. ............. 156

Suppl. data 6 In vitro detection of sulfide via HPLC using OAS-TL activity. .................................. 157

Suppl. data 7 In vitro detection of cysteine via HPLC using OAS-TL activity. ............................... 158

Suppl. data 8 399 genes that were altered in 7-week-old sir1-1 in comparison to wild-type of same age. ........................................................................................................................ 159

Suppl. data 9 721 genes that were altered in 10-week-old sir1-1 in comparison to wild-type of same size (7-week-old). ......................................................................................... 161

Suppl. data 10 Mutation-specific regulated genes in sir1-1. ......................................................... 165

Suppl. data 11 Constantly altered genes in all three groups. ........................................................ 166

Suppl. data 12

GSEA results for gene set ‘nucleobase, nucleoside and nucleic acid metabolic process’. ................................................................................................................. 167

Suppl. data 13

GSEA results for gene set ‘DNA metabolic process’. ........................................... 168

Suppl. data 14

GSEA results for gene set ‘DNA repair’. ............................................................... 169

Suppl. data 15

GSEA results for gene set ‘response to endogenous stimulus’. ........................... 170

Suppl. data 16

GSEA results for gene set response to ‘DNA damage stimulus’. ......................... 171

Suppl. data 17 Detailed information about LC-MS/MS protein identification. ................................ 172

IV

GR

GSH

GSH1

GST

HEPES

HPLC

HRP

IEF

IPG

IPTG

JA

Kan kDa

K m

Col-0

CSC

Cys

DAF

DEPC

DMSO dNTP

DTT

DW

EDTA

EGTA

ER

FW

GABA

GFP

Table of abbreviations

AcCoA

ADP

APR

APS

A.th.

AT

ATP

ATPS

BASTA

BCIP bp

BSA

CaMV

CHAPS acetyl-coenzymeA adenoseine diphospahte adenosine-5’-phosphosulfate reductase adenosine 5’-phosphosulfate

Arabidopsis thaliana

Arabidopsis thaliana adenosine triphosphate adenosine triphosphate sulfurylase glufosinate ammonium

5-bromo-4-chloro-3-indolyl phosphate toluidin salt basepairs bovine serum albumin cauliflower mosaic virus

3-[(3-Cholamidopropyl)dimethylammonio]-1propanesulfonte

Arabidopsis thaliana ecotype Columbia-0 cysteine synthase complex cysteine days after flowering diethylpyrocarbonate dimethyl sulfoxide deoxynucleotide solution mix

1,4-dithiothreitol dry weight ethylenediamine tetraacetic acid glycol-bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid edoplasmatic reticulum fresh weight

4-amino-butric acid green fluorescent protein glutathione reductase reduced glutathione

γ-glutamylcysteine ligase glutathione-S-transferase

4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid high performance liquid chromatography horse radish peroxidase isoelectric focusing immobilized pH gradient isopropyl-D-1-thiogalactopyranoside jasmonate kanamycin kilo Dalton

Michaelis constant

V

SQD

SSP

Suc

TAG

TAIR

TBS

TCA

T-DNA

TEMED

TES

Tris v/v

VPE

VSR

LC

MBB

MOPS

MS liquid chromatography monobromobimane

3-(N-morpholino)propanesulfonic acid

Murashige & Skoog n.a. n.d. not applicable not detected

NADPH nicotinamide adenine dinucleotide phosphate

OAS O-acetylserine

OAS-TL O-acetylserine(thiol)lyase

OD optical density

12-OH-JA hydroxyjasmonic acid

PAGE polyacrylamide gelelectrophoresis paraquat N,N′-dimethyl-4,4′-bipyridinium dichloride or methylviologen

PCA

PCR principal component analysis polymerase chain reaction

PLP

PMS

PMSF

PR

PVP pyridoxal 5’-phosphate phospahte buffered saline phenylmethanlsulphonylfluoride pathogenesis related polyvinylpyrolidone qRT-PCR quantitative realtime polymerase chain reaction

ROS reactive oxygen species rpm round per minute

SAT (serat) serine acetyltransferase

SDS

SiR

SOD

SOX sodiumdedocylsulfate sulfite reductase superoxide dismutase sulfite oxidase sulfoquinovose synthase seed storage protein sucrose triacylglyceride

The Arabidopsis information resource tris buffered saline trichloroacetic acid transferred DNA used for insertional mutagenesis

N,N,N',N'-Tetramethylethylenediamine

N-Tris(hydroxymethyl)methyl-2-aminoethanesulfonic Acid

2-amino-2-(hydroxymethyl)propane-1,3-diol volume per volume vacuolar processing enzyme vacuolar sorting receptor w/v

WT weight per volume wild-type

(4Fe-4S) iron-sulfur cluster type 4

VI

Summary

Sulfite reductase (SiR) plays an exclusive role in the assimilatory sulfur reduction pathway by catalyzing the reduction of sulfite to sulfide. The

T-DNA insertion mutant line sir1-1 shows lower amounts of SiR transcript, protein and lower activity in vegetative and generative tissues and is severely affected in growth. However, sir1-1 plants flower and set viable seeds, albeit later than wild-type plants and with lower yield. A

T-DNA insertion with even less SiR transcript (sir1-2) causes early seedling lethality.

It was found that sir1-1 is less tolerant to sulfite treatment. Death of sir1-2 plants and the severe growth phenotype of sir1-1 could be caused by the lack of reduced downstream products (cysteine, GSH) or/and the accumulation of toxic sulfite. Mutant plants could be partially complemented by cysteine and GSH. Despite the earlier observation of reduced flux of sulfur into cysteine and GSH the steady state concentration of sulfide was found to be unchanged in sir1-1. In addition to chlorosis observed in sir1-1 the contents of sugars and starch were reduced. The large scale quantification of metabolites in sir1-1 leaf and root compared to wild-type revealed that sir1-1 resides in a sulfur deprivation stage. However, the response of sir1-1 in leaves to sulfur deprivation was different from wild-type, whereas in roots the response of both sir1-1 and wild-type plants were similar.

The consequences of the severe changes in leaf growth and metabolism prompted the investigation of the transcriptome using Affymetrix arrays.

sir1-1 plants of the same age and the same size as compared wild-type revealed numerous changes in expression of several functional groups of genes. Gene set enrichment analysis revealed up-regulation of pathways related to DNA damage. In seeds of sir1-1 the transcription of the SiR gene and levels and activity of the SiR protein were even more reduced compared to leaves, resulting in severe effects on seed production. With respect to seed composition protein and free amino acid contents were increased while oil contents were decreased. The seeds were found to respond to this limitation of sulfate assimilation by comprehensive changes in their proteome. Precursors of sulfur-poor globulins accumulated but not the mature forms, while a sulfur-rich albumin decreased in content. Thus, reduced expression of sulfite reductase has profound consequences for primary metabolism of vegetative and generative organs.

VII

Zusammenfassung

Sulfite-Reductase (SiR) spielt eine exklusive Rolle in der assimilatorischen

Schwefelreduktion, indem sie die Reduktion von Sulfit zu Sulfid katalysiert. Die

T-DNA-Insertionsmutante sir1-1 hat weniger SiR-Transkript, -Protein und

-Aktivität sowohl in vegetativem als auch in generativem Gewebe und ist in ihrem Wachstum stark beeinträchtigt. Allerdings blühten die sir1-1-Pflanzen und produzierten Samen, wenn auch später als Wildtyppflanzen und in geringeren

Mengen. Eine T-DNA-Insertion, die noch weniger SiR-Transkription zulässt

(sir1-2), hat zu Folge, dass die Pflanzen bereits im Keimling-Stadium sterben.

Es wurde festgestellt, dass sir1-1-Pflanzen weniger tolerant gegenüber Sulfit-

Behandlung sind. Der Tod der sir1-2-Pflanzen und der schwerwiegende

Wachstumsphänotyp von sir1-1-Pflanzen könnten durch den Mangel der reduzierten Folgeprodukten (Cystein, GSH) und/oder die Anhäufung von toxischem Sulfit verursacht worden sein. Trotz früherer Beobachtung der reduzierten Flussrate von Schwefel zu Cystein und GSH war die Steady-state-

Konzentration von Sulfid in sir1-1 unverändert. Zusätzlich zur beobachteten

Chlorose in sir1-1 waren die Zucker- und Stärke-Mengen reduziert.

Umfangreiche Metabolitanalysen aus sir1-1-Blättern und -Wurzeln im Vergleich zum Wildtypen zeigten, dass sir1-1 sich in einem Zustand des Schwefelmangels befindet. Allerdings war die Reaktion der sir1-1-Pflanzen auf Schwefelentzug in

Blättern unterschiedlich von der der Wildtyp-Pflanzen, während die Reaktionen in den Wurzeln von sir1-1- und Wildtyp-Pflanzen ähnlich waren.

Die Folgen der gravierenden Veränderungen in Blattwachstum und

-Stoffwechsel veranlassten die Untersuchung des Transkriptoms mit Hilfe von

Affymetrix-Arrays. sir1-1-Pflanzen des gleichen Alters und der gleichen Größe im

Vergleich zum Wildtypen zeigten zahlreiche Veränderungen in der Expression von Genen aus mehreren funktionellen Gruppen. Gene set enrichment analysis zeigte eine Hochregulation der Signalwege, die im Zusammenhang mit DNA-

Schäden stehen. In sir1-1-Samen waren SiR-Transkript, -Protein und -Aktivität noch stärker reduziert als in den Blättern. Dies hatte schwere Auswirkungen auf die Samenproduktion. Die Zusammensetzung der Samen veränderte sich: Die

Menge der Proteine und der freien Aminosäuren wurde erhöht, während der

Ölanteil verringert wurde. Auf diese Einschränkung von Sulfatassimilation reagierten die sir1-1-Samen durch umfangreiche Änderungen in ihrem Proteom.

Vorstufen von schwefelarmen Globulinen sammelten sich an, nicht aber die reifen Formen, während die Menge eines schwefelreichen Albumins vermindert war. Die verringerte Expression von Sulfit-Reduktase hat tiefgreifende

Konsequenzen für den Primärmetabolismus in vegetativen und generativen

Organen.

VIII

Introduction

1 Introduction

1.1 Importance of sulfur for life

In higher plants sulfur is the most important macronutrient after carbon, phosphor and nitrogen. Sulfur is present in the oxidized and the reduced form and due to its redox potential, it plays as divalent anion a significant role in plant metabolism. Furthermore, oxidized sulfur is essential for proper function of several molecules, e.g. glucosinolates. The break-down of glucosinolates by myrosinases results in several biologically active molecules like isothiocyanates, thiocyanates, and nitriles (Graser et al.,

2001; Reichelt et al., 2002) which can protect plants against herbivores.

They also might have preventive functions against cancer in humans

(Schnug, 1993; Wittstock and Halkier, 2002). Hydrolysis of methylsulfinylalkyl glucosinolate results in sulforaphane (an isothiocyanate) that promotes apoptosis and cell cycle arrest in HT29 human colon cancer cells in vitro (Gamet-Payrastre et al., 2000). Another situation, in which an oxidized form of sulfur is utilized, are sulfolipids

(Schiff et al., 1993; Benning, 1998). However, most sulfur in plants is found in the reduced form due to the assimilatory sulfur reduction

pathway (1.2). Reduced sulfur is found in several coenzymes including

biotin, vitamin B1, coenzyme A, or in iron-sulfur clusters (Beinert et al.,

1997; Leustek and Saito, 1999). Reduced sulfur is also a component of cysteine and methionine which are essential for human nutrition.

Together with glycine and glutamic acid, cysteine builds the tripeptide glutathione (GSH). It can be seen as the transport form of (reduced) sulfur in plants and also has redox buffering functions. GSH is involved in detoxification of xenobiotica (Howden et al., 1995) and serves as a substrate in phytochelatin synthesis (Grill et al., 1989). Thiols’ sulfur is of nucleophile nature and serves as an electron donor in redox processes. Scontaining disulfide bridges play an important role in generating the tertiary and quaternary structure of proteins (Grill et al., 1989; Schröder et al., 1990; May et al., 1998; Noctor et al., 1998; Noctor and Foyer, 1998).

Anthropologic worldwide contribution to sulfur deposition in the atmosphere has been reduced in the last decades, especially in western

1

Introduction

Europe (McGrath et al., 2002), for example in United Kingdom, it was decreased from 70 kg per ha per year in the 1970’s to less than 10 kg per ha per year in the early 2000’s (Zhao et al., 2008). Hence, sulfur deficiency has become a problem and there is an increased need for sulfur fertilization. Multiple-cut grasses and especially Brassica crops are more susceptible to sulfur deficiency compared to other crops (Zhao et al.,

2008). Based on the versatile functions of sulfur in its reduced and oxidized form, sulfur deficiency causes growth retardation in plants. Also chlorophyll contents are reduced by sulfur deficiency (Burke et al., 1986;

Dietz, 1989; Imsande, 1998). Chlorosis appears in young leaves as a first symptom and later older ones also develop it (Freney et al., 1978). Sulfur nutrition influences protein quality and composition (Randall and

Wrigley, 1986). Due to the need of humans and animals for sulfurcontaining amino acids and the low levels of cysteine and methionine in seed proteins of crops, one of the biggest goals in nutrient biotechnology is to increase methionine levels via genetic engineering (Molvig et al., 1997).

Sulfur, carbon and nitrogen assimilation are tightly related to each other

(Hesse et al., 2003; Wang et al., 2003; Kopriva and Rennenberg, 2004;

Kopriva, 2006), so sulfur deficiency can cause inefficient nitrogen utilization. This could be proved when a sulfur-deficient grassland site was applied with sulfur and the nitrate leaching to drainage water was reduced up to 72% (Brown et al., 2000). Thus, sufficient sulfur availability for crops has at least two advantages: positive effects on yield and a benefit for the environment.

1.2 Sulfate uptake in plants

Like most microorganisms and some fungi, plants are autotrophic with regard to sulfur. Although 0.24% of the human body mass consists of sulfur (Steudel, 1998), neither humans nor animals are able to reduce sulfate to sulfide and therefore they are forced to take up reduced sulfur compounds via nutrition (Ravanel et al., 1998; Tabe and Higgins, 1998;

Noji and Saito, 2002).

2

Introduction

Sulfate is taken up from soil by proton/sulfate cotransporters located in the roots of plants (Mengel, 1991; Takahashi et al., 1997; Leustek et al.,

2000; Buchner et al., 2004). Some of these sulfate transporters are able to acclimate to the external sulfate supply and are regulated at the transcript level. In the model plant Arabidopsis thaliana, there are 14 sulfate transporters, which are classified in 5 groups according to their sequence homology (Clarkson and Hawkesford, 1993; Hawkesford and Smith, 1997;

Hell, 1997; Honda et al., 1998; Hawkesford and Wray, 2000; Saito, 2000;

Westerman et al., 2000; Hawkesford, 2003; Yoshimoto et al., 2003;

Yoshimoto et al., 2007).

Members of the first group of sulfate transporters (Sultr1) are exclusively expressed in the roots. Expression of Sultr1;1 and Sultr1;2 is induced by sulfate deficiency via O-acetylserine (OAS) and can be repressed via GSH.

They are additionally post-transcriptionally regulated and called highaffinity transporters because they allow the plant to react to reduced external sulfur availability (Smith et al., 1997; Saito, 2000; Maruyama-

Nakashita et al., 2004; Yoshimoto et al., 2007). Sultr1;1 has a K m

value of

3.6 ± 0.6 µM for sulfate and is expressed in root tips, root hairs, the root epidermis and in the root cortex (Takahashi et al., 2000).

Group 2 sulfate transporters are expressed in roots as well as in the leaves and have low affinity for sulfate: Sultr2;1 (K m

= 0.41 ± 0.07 mM) can be found in pericycle and xylem parenchyma of root cells and in the leaf phloem; Sultr2;2 (K m

= 1.2 mM) is expressed in the root phloem and in the bundle-sheath cells of leaves. Like Sultr1, members of the Sultr2 family are inducible by sulfur deficiency: increased mRNA levels of

Sultr2;1 in the roots, and Sultr2;2 in the leaves were measured when plants were exposed to sulfur withdrawal (Takahashi et al., 2000).

Sultr2;1 is involved in the translocation of sulfate into the siliques since it is located in the funiculus of Arabidopsis thaliana and therefore, it probably plays a role in modulating the sulfate status in seeds (Awazuhara et al., 2005).

The members of the Sultr3 family show no induction by sulfur deficiency.

Kataoka et al. (2004a) could show that Sultr3;1 is involved in sulfate transport between root and shoot. There are indications that group 3

3

Introduction sulfate transporters are involved in sulfate translocation within developing seeds (Zuber et al., 2010b).

Sultr4;1 and Sultr4;2 are located in the tonoplast membrane and are responsible for export of sulfate out of vacuoles. Recent evidence revealed that in Brassica oleracea Sultr4;1 transcription is induced when sulfur is not available (Koralewska et al., 2007). When it is suffering from sulfur withdraw, Sultr4;1 pumps sulfate out of vacuole to supply sulfate for whole plant via xylem elements in a symplastic manner. Sultr4;2 is expressed in roots at sulfur deficiency (Kataoka et al., 2004b). Sultr4;1 is shown to be involved in sulfate transport in developing seeds (Zuber et al.,

2010a).

Little is known about the Sultr5 family. Hesse et al. (2004) could show that Sultr5;1 transcript levels were increased in leaves and roots under sulfur-deficient conditions, and decreased again after sufficient sulfur had been applied. Analysis of MOT2 (molybdate transporter 2; previously annotated as Sultr5;1) fused to GFP indicated a vacuolar location of this carrier protein and it was concluded from mot2 T-DNA mutant that it is important for vacuolar molybdate export in the leaves and accumulation of molybdate in Arabidopsis seeds (Gasber et al., 2011). Sultr5;2 (now annotated as MOT1) has been reported to act as a high affinity molybdenum transporter rather than a sulfate transporter (Tomatsu et al.,

2007).

Translocators in xylem and phloem elements are responsible for longdistance transport of sulfate from roots where it is taken up to the leaf mesophyll cells for reduction (Saito, 2000). In the leaves, sulfate is transported into vacuoles via Sultr4 members for storage. Vacuoles can contain up to 99% of total cell sulfate (Rennenberg, 1984; Bell et al.,

1994).

The majority of sulfur assimilation steps take place in chloroplasts, so there must be transporters for its import into chloroplasts. However, no chloroplast-specific sulfate transporters have been identified yet

(Davidian and Kopriva, 2010). It has been suggested that this function could be carried out by phosphate-/triose-phosphate translocators

4

Introduction localized in the inner membrane of chloroplasts, or by proton-/sulfate symporters (Flügge et al., 1989; Leustek and Saito, 1999).

1.3 Sulfate assimilatory reduction

After uptake of sulfate its assimilation starts with an activation reaction resulting in adenosine 5’-phosphosulfate (APS) (Balharry and Nicholas,

1970; Renosto et al., 1993). This reaction is catalyzed by ATP sulfurylase

(ATPS; EC 2.7.7.4) whereby sulfate is coupled with a phosphate residue by

ATP cleavage which releases a pyrophosphate. ATPS reaction takes place in cytosol and plastids. It is likely that in Arabidopsis all isoforms encode plastidic enzymes. The cytosolic isoform could be derived from an alternative transcriptional start codon produced from one of these 4 genes

(Hatzfeld et al., 2000a). The physiological role of cytosolic ATPS remains unclear since the sulfite reduction to sulfide (next step of sulfur reduction pathway) is carried out in plastids. Rotte and Leustek (2000) speculated that APS produced in cytosol might be further activated via PAPS.

ATPS gene expression is induced upon sulfur deficiency (Logan et al.,

1996) and inhibited when nitrogen starvation accours (Reuveny et al.,

1980; Smith, 1980) or when GSH levels increase (Lappartient and

Touraine, 1996; Lappartient et al., 1999).

APS inhibits ATPS and therefore it must be metabolized quickly (Renosto et al., 1993; Schwenn, 1994; Hell, 1998; Hatzfeld et al., 2000a; Rotte and

Leustek, 2000). APS can either be directed into the sulfur reduction pathway or further activated (Lee and Leustek, 1998; Lillig et al., 2001;

Droux, 2004). In the latter pathway APS is phosphorylated to 3’phosphoadenosyl 5’-phosphosulfate (PAPS) by APS kinase (APK). There are 4 APKs in the cytosol and plastids (Lunn et al., 1990; Rotte and

Leustek, 2000; Mugford et al., 2009). PAPS serves as a sulfate donor for sulfotransferases (SOT) that catalyze sulfation of several molecules including glucosinolates, saccharides, proteins, flavonoids, and jasmonates. Due to the high number of substrates, multiple isoforms of

SOT can be found in plants (Klein and Papenbrock, 2004). PAPS can also be considered as an intermediary storage form of APS that can be (e.g.

5

Introduction upon oxidative stress) re-transformed to APS. This reaction step is catalyzed by 3'(2'),5'-diphosphonucleoside 3'(2')-phosphohydrolase

(DNPase; EC 3.1.3.7) (Peng and Verma, 1995).

The next possibility for metabolizing APS is its reduction to sulfite by

GSH-dependent double electron transfer to APS (Suter et al., 2000). This reaction is catalyzed by APS reductase (APR; EC 1.8.4.9). APR is located in plastids and exhibits a homodimer structure (Kopriva and Koprivova,

2004). One catalytic domain of APR is similar to the PAPS reductases of microorganisms and has a cysteine binding motif. The other carboxy terminal domain is homologous to the thioredoxin superfamily and serves as the acceptor of electron from GSH (Gutierrez-Marcos et al., 1996; Setya et al., 1996; Bick et al., 1998; Gao et al., 2000; Suter et al., 2000; Kopriva et al., 2002).

In Arabidopsis, there are 3 APR isoforms of which APR2 is the major form making up 80% of the total intracellular APR activity. APR is highly regulated in assimilatory sulfate reduction: APR2 transcript levels are reduced upon exposure to reduced sulfur compounds such as sulfide, cysteine, and GSH (Kopriva and Koprivova, 2004). APR expression is upregulated when plants are stressed with heavy metals, salinity, high light, or cold (Lee and Leustek, 1999; Kopriva et al., 2008; Queval et al., 2009).

APR is subjected to a diurnal rhythm whereas at day time its activity is higher than at night (Kopriva et al., 1999). Addition of sugars into plant media increased APR activity, too (Hesse et al., 2003).

Nitrogen deficiency causes a decrease of APR activity and exposure to amino acids or ammonium results in an increase of APR activity, highlighting the connection between sulfate and nitrogen assimilation

(Brunold and Suter, 1984; Koprivova et al., 2000).

Sulfite can be re-oxidized to sulfate through a reaction catalyzed by a molybdenum enzyme, sulfite oxidase (SOX) utilizing oxygen as an electron acceptor in the peroxisomes (Eilers et al., 2001; Hänsch et al.,

2006). Due to spatial separation, SOX rather protect plants against access to sulfur dioxide and is involved in sulfite detoxification, than in sulfur assimilation in plastids (Brychkova et al., 2007; Lang et al., 2007).

6

Introduction

1.4 Sulfite reduction by SiR

To convert sulfite into sulfide, sulfite reductase (SiR; EC 1.8.7.1) needs 6 electrons. In higher plants, these are provided by ferredoxins, whereas chemotrophic organisms utilize electrons from NADPH. SiR is the only single-copy gene in the assimilatory sulfate reduction pathway of

Arabidopsis (Bork et al., 1998; Nakayama et al., 2000). SiR has a bottleneck function in the assimilatory reduction pathway and is involved in regulation of sulfate assimilation and the control of sulfur flux (Khan et al., 2010). Plant SiR protein is soluble and exhibits a molecular mass of

65 kDa. SiR contains one siroheme and a (4Fe-4S) cluster as prosthetic groups (Krueger and Siegel, 1982; Nakayama et al., 2000). The physiological electron donor for SiR is an iron-containing protein called ferredoxin which carries one electron with a (2Fe-2S) cluster (Yonekura-

Sakakibara et al., 2000). Two interaction sites of ferredoxin are crucial for interaction with SiR: region 1 containing Glu-29, Glu-30, Asp-34 and region 2 including Glu-92, Glu-93, Glu-94 (Saitoh et al., 2006). The 1:1 stoichiometry of the transient electron transfer complex between ferredoxin and SiR (Akashi et al., 1999) and the high affinity of SiR for sulfite (K m

~10 µM) enable efficient sulfite reduction (Leustek and Saito,

1999). Since the electrons of PSI in photosynthetic cells are carried forward to ferredoxin, there is a connection between sulfate assimilation and photosynthesis.

SiR is exclusively located in plastids (Brunold and Suter, 1989), and for pea and maize, it has been shown that SiR interacts with the plastidic

DNA-protein complex named nucleoid (Sekine et al., 2007). Sekine et al.

(2002) suggested that SiR can regulate plastid nucleoid transcription via

DNA compaction: When SiR is not bound to nucleoids, plastidic DNA can relax and transcription occurs; addition of exogenous SiR, makes plastidic

DNA more compact resulting in repression of transcription. In plastids of heterotrophic tissues, regeneration of reduced ferredoxin is possible due to NADPH (Brühl et al., 1996; Leustek and Saito, 1999; Leustek et al.,

2000; Nakayama et al., 2000).

7

Introduction

SiR transcript levels increase when OAS is fed to nitrogen-deficient

Arabidopsis (Koprivova et al., 2000) or when methyl jasmonate is added

(Jost et al., 2005).

1.5 Arabidopsis sulfite reductase versus others

Sekine et al. (2007) compared the amino acid sequence homology of pea

SiR (PtSiR) to SiR of other organisms. PtSiR was similar to Nicotiana

tabaccum SiR (NtSiR, 91%), Arabidopsis thaliana SiR (AtSiR, 85%),

Oryza sativa SiR (OsSiR, 79%), and Zea mays SiR (ZmSiR, 79%).

Compared to E. coli and the red alga Cyanidioschyzon merolae, the similarity of PtSiR was lower: to the hemoprotein subunit (CysI) of E. coli

(EcCys, 48%), SiR A of C. merolae (CmSiRA, 59%), and SiR B (CmSiRB,

57%).

In E. coli, four cysteine ligands (Cys-434, Cys-440, Cys-479, and Cys-483) hold siroheme and (4Fe-4S) cluster within the active site of CysI (Crane et al., 1995). The observation that four basic amino acids (Arg-83, Arg-153,

Lys-215, and Lys-217) involved in the coordination of sulfite to the siroheme, are conserved in all SiRs gives rise to the statement that all SiRs of flowering plants are monophyletic in their origin (Sekine et al., 2007), and originated from cyanobacterial SiR (Kopriva et al., 2008).

Kopriva et al. (2008) also suggested that AtSiR and Arabidopsis nitrite reductase (AtNiR) have the same evolutionary origin due to their 19% identity. Phylogenetic analysis could reveal that both SiR and NiR arose from an ancient gene duplication in Eubacteria before primary endosymbiosis resulting in emergence of plastids. Also their functions are similar: NiR catalyzes an equivalent reduction step in nitrate assimilation, namely reduction of nitrite to ammonia, using ferredoxin as the donor of six electrons. Maize SiR changes substrate specificity from sulfite to nitrite, when its amino acid residue Arg-193 is converted into glutamate

(Nakayama et al., 2000). SiR from C. merolae exposes preferred substrate specificity for nitrite (Sekine et al., 2009). Endogenous NiR in Arabidopsis is not able to rescue the reduced activity of SiR in a SiR T-DNA insertion mutant (Khan et al., 2010).

8

1.6

Introduction

SAT and OAS-TL complete sulfate assimilation

Most sulfur-autotroph organisms incorporate reduced sulfur into cysteine

(Giovanelli et al., 1980; Schmidt and Jäger, 1992). Therefore, a distinct two-step reaction occurs (Rabeh and Cook, 2004; Wirtz and Droux, 2005;

Kopriva, 2006). In the first step, an acetyl residue of acetyl coenzyme A

(AcCoA) is transferred to the hydroxyl group of serine by serine acetyltransferase (SAT; Serat; EC 2.3.1.30). O-acetylserine (OAS) is the product of this first reaction step.

The Arabidopsis Genome Initiative (2000) identified 5 genes for SAT and

SAT-like isoforms located in several cell compartments. According to their position on 5 chromosomes of Arabidopsis, they were named SAT1 to

SAT5 (Noji et al., 1998; Hell et al., 2002). SAT1 and SAT3 are targeted to plastids and mitochondria, respectively, and SAT5 is localized in the cytosol (Bogdanova et al., 1995; Murillo et al., 1995; Howarth et al., 1997;

Kawashima et al., 2005). These three SATs are considered to be the major isoforms with K m

values for serine and AcCoA between 1 and 3 mM

(Davidian and Kopriva, 2010). Due to analysis of amino acid sequences,

SAT4 was considered to be targeted to plastids (Droux, 2004). However, it turned out that both SAT2 and SAT4 are located in the cytosol and have a

K m

value for serine between 40 and 120 mM (Noji et al., 1998; Kawashima et al., 2005; Watanabe et al., 2008b). Levels of SAT2 and SAT4 transcript are lower than the other three major isoforms

( eFP Browser: bbc.botany.utoronto.ca), however, after 4 days of sulfur deprivation, the mRNA amount of SAT2 and SAT4 was increased 2- and 45-fold, respectively, indicating that these isoforms may play a role upon sulfur starvation (Zimmermann et al., 2004; Kawashima et al., 2005).

The last reaction in the assimilation of sulfate into cysteine is carried out by O-acetylserine (thiol)lyase (OAS-TL; EC 2.5.1.47): by a β-elimination reaction of the acetyl moiety of the nitrogen and carbon containing skeleton of OAS by sulfide produced by SiR cysteine is formed (Bertagnolli and Wedding, 1977; Lunn et al., 1990).

Arabidopsis has 9 OAS-TL and OAS-TL-like isoforms belonging to the superfamily of β-substituting alanine synthases (Hatzfeld et al., 2000b).

There are three major isoforms, i.e. OAS-TL A1, OAS-TL B, and OAS-TL C

9

Introduction which were identified as true OAS-TLs (Wirtz et al., 2004) and are localized in the cytosol, the plastids and the mitochondria, respectively.

True OAS-TLs have been defined due to their ability to produce cysteine and to interact with SAT (Bogdanova and Hell, 1997; Droux et al., 1998;

Wirtz et al., 2001; Bonner et al., 2005; Heeg et al., 2008). OAS-TL A1,

OAS-TL B, and OAS-TL C contribute 50%, 40%, and 10%, respectively, to the total OAS TL activity in an Arabidopsis cell (Heeg et al., 2008;

Watanabe et al., 2008a). Heeg et al. (2008) suggested that the cytosol is the major compartment for cysteine synthesis. OAS-TL A1 shows highest activity there and also both OAS and sulfide can be transported to the cytosol: The volatile form af sulfide (H

2

S) can pass the plastidic membranes (Mathai et al., 2009) and OAS can leave the mitochondria, the major OAS synthesis compartment (Haas et al., 2008). Synthezised cysteine is the terminal product of sulfur assimilation and reduction pathway and can be used for the production of a variety of compounds

such as methionine, GSH and vitamines that contain reduced sulfur (1.1).

1.7 Cysteine synthase complex regulates the last step of sulfate assimilation

SAT and OAS-TL can form the cysteine synthase complex (CSC; Hell et al.,

2002) that acts as a regulatory complex (Wirtz and Hell, 2006). OAS-TLs from Haemophilus influenzae, Salmonella typhimurium and Arabidopsis

thaliana show a dimeric structure (Burkhard et al., 1998; Burkhard et al.,

1999; Bonner et al., 2005) and SATs from H. influenza and E. coli a dimer of trimers (Gorman and Shapiro, 2004; Pye et al., 2004). Similar arrangements for Arabidopsis mitochondrial and cytosolic SATs have been demonstrated (Wirtz et al., 2010).

It was suggested that in S. typhimurium, Spinacia oleracea, Nicotiana

tabaccum and Arabidopsis thaliana a decameric CSC exist consisting of two OAS-TL dimers interacting with a SAT hexamer (Kredich et al., 1969;

Droux et al., 1992; Wirtz and Hell, 2007; Heeg et al., 2008; Wirtz et al.,

2010).

10

Introduction

Bacterial and Arabidopsis SATs interact with OAS-TL via their C-terminus and consequently, a deletion of the C-terminus results in no more interaction within the CSC (Mino et al., 1999, 2000; Francois et al., 2006;

Wirtz and Hell, 2006).

While SAT within the CSC shows high activity and is stabilized due to

OAS-TL binding (Ruffet et al., 1994; Droux et al., 1998; Francois et al.,

2006), bacterial OAS-TL bound to SAT in the CSC exhibits only 40% remaining activity (Kredich, 1996; Mino et al., 2000) and plant OAS-TL is even inactivated when bound to SAT (Droux et al., 1998). It was shown that the binding of the C-terminus of SAT to the active site of the OAS-TL causes OAS-TL inactivation (Huang et al., 2005; Francois et al., 2006).

OAS competes with the C-terminus of SAT for the active site of OAS-TL

(Campanini et al., 2005; Huang et al., 2005) and therefore, high OAS concentration dissociates the CSC (Kredich et al., 1969; Droux et al.,

1998). On the contrary, sulfide stabilizes the CSC promoting synthesis of

OAS (Wirtz and Hell, 2006; Wirtz and Hell, 2007).

1.8 Seeds contain storage compounds

Plant seeds are of major industrial as well as economic interest.

Considering the exhaustion of fossil combustible materials as energy sources during the next century, the storage compounds and biomass of some plans could be utilized as biofuels and biomaterials. Indeed, plant oil is one of the most energy-rich and abundant forms of reduced carbon available in nature. Therefore, plants could be seen as possibly sustainable alternative substitutes for conventional diesel. There are also other application fields that show successful production of industrially interesting compounds via seed engineering, i.e. mucilage as a source of pectin (Willats et al., 2006), flavonoids as antioxidants for foods (Yilmaz,

2006), nutraceuticals and pharmaceuticals (Ramos, 2007) and enriched cellulose fibre yield and quality from cotton (Lee et al., 2007).

But seed production is also very important for animal feed and human nutrition. Seed genetic engineering is considered to be an attractive strategy to enhance seed yield and quality and to produce various

11

Introduction metabolites and proteins (Moise et al. 2005). Since cysteine and methionine are essential for human nutrition and they have to be

absorbed via nutrition (1.2), their over-accumulation was adjusted in

lupines and maize seeds (Tabe and Higgins, 1998). Enhanced amino acid transport from source to sink by overexpressing genes for Asn synthase or amino acid transporters increased the amount of endogenous seed proteins (Lam et al., 2003; Rolletschek et al., 2005). Hood et al. (2007) could increase the amounts of cellulase in maize seeds. Production of yellow-seeded Brassica genotypes led to higher oil contents and meal nutritional value (Marles et al., 2003). Rice plants were enabled to synthesize provitamin A in the endosperm (Ye et al., 2000). In rapeseed, enhanced levels of the saturated fatty acid lauric acid could be achieved

(Voelker et al., 1996).

Different plant species arouse interest depending on their major storage compounds: Most grain seeds have > 85% starch, whereas many oilseeds contain 50 to 70% oil, and some legumes such as soybeans include 40% of their seed dry weight as protein (Ruuska et al., 2002).

In many crops such as Pisum sativum, Vicia faba, wheat and maize, starch represents the most important storage compound. Therefore, and because of its importance for human nutrition, the corresponding biosynthetic pathway is well documented. Glucose-6-phosphate (G6P) is imported to the plastid from the cytosol and phosphoglucomutase transforms it into G1P. Next, production of ADP-glucose is catalyzed by

ADP-glucose pyrophosphorylase. ADP-glucose is the constituent of both amylose and amylopectin (Zeeman et al., 2002).

However, in oilseeds, starch is only transiently accumulated and its amount is reduced in mature Arabidopsis seeds (King et al., 1997; Baud et al., 2002). The role of starch in seeds is highly debated (Vigeolas et al.,

2004).

The role of sugar metabolism in the regulation of storage function is not understood, however, it is clear that sugar-sensing pathways interact with hormonal signaling (Varin et al., 1997; León and Sheen, 2003; Avonce et al., 2004). In legume seeds, the sucrose-to-hexose ratio is known to promote the synthesis of storage compounds, although the involved

12

Introduction molecular regulatory mechanisms are to date not fully understood (Weber et al., 2005). In Brassicaceae, the sucrose-to-hexose ratio remains a matter of debate. Also little is known about trehalose-6-phosphate.

Nonetheless, it is thought to play a crucial role in developing Arabidopsis embryos, but the regulatory mechanism involved is unknown (Gómez et al., 2006).

However, major focus in Arabidopsis seeds or rapeseed is on other storage

compounds, i.e. lipids (1.8.1) and storage proteins (1.8.2).

1.8.1

Triacylglycerides as major lipid storage compounds in Arabidopsis seeds

As a Brassicaceae, Arabidopsis thaliana is related to Brassica oilseed crops such as rapeseed, the world’s major oilseed crop. Therefore, and since one third of Arabidopsis seed is filled with storage oil and proteins, respectively, Arabidopsis is an optimal model organism to understand pathways related to storage compounds.

In mature Arabidopsis seeds, triacylglycerides (TAGs) represent the major oil component (Baud et al., 2002). TAGs are energy-rich carbon storage molecules. As mentioned above, Arabidopsis is an ideal model plant for these kinds of studies.

Two TAG precursors are synthesized in different compartments:

In the cytosol, dihydroxyacetone phosphate (DHAP) is converted to glycerol-3-phosphate (G3P) by glycerol-3-phosphate dehydrogenases

(G3PDH) providing the glycerol backbones for TAG synthesis (Baud and

Lepiniec, 2010). G3P can alternatively be synthesized by phosphorylation of glycerol by glycerol kinase. G3P seems to be the restrictive molecule in

TAG synthesis (Perry et al., 1999). Additional proof was given by the overexpression of a yeast gene encoding cytosolic G3PDH in Brassica

napus that increased G3P levels in seeds, and resulted in a 40% increase in the final lipid content of seeds (Vigeolas et al., 2007). In Brassicaceae, embryos have to import sucrose which is transformed to phosphoenolpyruvate (PEP) via the cytosolic glycolytic pathway. PEP is imported into the plastids, where it is transphosphoylated irreversibly to

13

Introduction pyruvate by plastidic pyruvate kinase (Andre et al., 2007; Baud et al.,

2007). In plastids, the oxidative decarboxylation of pyruvate by the pyruvate dehydrogenase complex (PDC) occurs producing CO

2

and AcCoA

(Johnston et al., 1997; Lutziger and Oliver, 2000; Lin et al., 2003).

For de novo synthesis of fatty acids, AcCoA and bicarbonate are transformed to malonyl-CoA by AcCoA carboxylase (ACC) in the plastids

(Turnham and Northcote, 1983; Harwood, 1996). This reaction is considered to be a key regulatory step in fatty acid biosynthesis (Thelen and Ohlrogge, 2002).

On the outer membrane of the chloroplast, fatty acids are then activated by long-chain AcCoA synthetases (LACS) forming CoA esters. They are then transported into the ER, where they join a larger AcCoA pool, or can be transformed to membrane phospholipids (Li-Beisson et al., 2010).

Assembly of TAG takes place in the ER. Several pathways interconnected with TAG biosynthesis have been described in maturing oilseeds (Bates et al., 2009). AcCoAs, as provided directly from de novo fatty acid synthesis and from other sources, are used for the sequential acylation of three fatty acids at positions sn-1, sn-2 and sn-3 of a G3P moiety (Kennedy, 1961; Cao and Huang, 1986, 1987). TAG can also interact with reactions related to phosphatidylcholine (PC), an important membrane lipid (Li-Beisson et al.,

2010).

After TAGs have been synthesized in the ER, they are stored in dedicated subcellular organelles, the oil bodies or oleosomes. TAGs in the oil bodies are surrounded by a phospholipid monolayer, whereby the phosphate groups are oriented towards the cytosol and the aliphatic chains towards the TAG lumen (Yatsu and Jacks, 1972). It is assumed that oil bodies arise from microdomains of the ER, however, the mechanisms of their biogenesis is controversially discussed (Murphy and Vance, 1999;

Robenek et al., 2004; Robenek et al., 2006). The lipid monolayer of oil bodies contains proteins making up 1–4% of the weight of these organelles

(Huang, 1992; Tzen and Huang, 1992; Tauchi-Sato et al., 2002). Among them, oleosins are the most abundant ones (Murphy, 1993). Covering the surface of oil bodies, oleosins improve the stability of these organelles by means of electronegative repulsion and steric hindrance, so that oil bodies

14

Introduction never coalesce or aggregate in the cells of mature seeds (Leprince et al.,

1998; Murphy and Vance, 1999; Siloto et al., 2006).

1.8.2

Seed storage proteins

A second major group of storage compounds in Arabidopsis seeds are the seed storage proteins (SSP). There are two predominant classes of SSPs stored in Arabidopsis seeds: legumin-type globulins, referred to as 12S globulin or cruciferin (Sjodahl et al., 1991; Li et al., 2007), and napin-type albumins, referred to as 2S albumin or arabin (Krebbers et al., 1988; van der Klei et al., 1993). Arabidopsis, ecotype Col-0, has four genes encoding

12S globulin precursors: CRA1 (S4; At5g44120), CRB (S3; At1g03880),

CRC (S1; At4g28520), and CRU2 (At1g03890) (Pang et al., 1988; Gruis et al., 2002; Gruis et al., 2004). 2S albumins contain two subunits, small and large, that are generated by cleavage of the precursor form and linked by disulfide bridges (Krebbers et al., 1988; Guerche et al., 1990). Five genes that encode 2S albumin precursors have been identified: At2S1

(At4g27140), At2S2 (At4g27150), At2S3 (At4g27160), At2S4 (At4g27170), and At2S5 (At5g54740).

Both groups of SSPs are synthesized on the rough ER as precursor forms and then transported into protein storage vacuoles (PSVs) by a vesiclemediated pathway, where they are converted into mature forms. PSVs are electron dense vacuolar compartments surrounded by the tonoplast, a lipid bilayer (Gillespie et al., 2005). Otegui et al. (2006) could show that

Arabidopsis exhibits a Golgi-dependent pathway for the transport of the storage proteins and their processing enzymes to the PSV. However, during Golgi trafficking, different cisternal domains are responsible for

SSPs and processing enzymes (Hillmer et al., 2001). Asn-specific endopeptidases (or vacuolar processing enzymes, VPEs) and aspartic proteases are chiefly involved in processing of SSPs. The VPE gene family in Arabidopsis has four genes: namely αVPE (At2g25940), βVPE

(At1g62710), γVPE (At4g32940), and δVPE (At3g20210) (Kinoshita et al.,

1995b, a; Kinoshita et al., 1999; Gruis et al., 2002). The vpe quadruple mutant of Arabidopsis showed alternatively processed forms of SSPs

15

Introduction cleaved at sites other than the conserved Asn residues targeted by VPEs, demonstrating that maturing seeds can tolerate variations in the protein content of PSVs (Gruis et al., 2004). Hence, VPE activity is not obligatory for processing of SSPs and probably, there are Asn-independent proteases

(e.g. aspartic protease; Hiraiwa et al., 1997).

Processing enzymes are concentrated in clathrin-coated vesicles reaching prevacuolar compartments called multivesicular bodies (MVBs).

In the PVS, the precursor forms of SSPs are converted into their respective mature forms via limited proteolysis at specific sites. Globulin proforms are converted into the disulfide-linked mature α- and β-polypeptides after proteolytic processing at a conserved Asn-Gly peptide bond by an asparaginyl endopeptidase (Barton et al., 1982). The more complex proteolytic processing of albumins implies the removal of three propeptide regions, resulting in two disulfide-linked mature polypeptides

(Krebbers et al., 1988). A conserved Asn residue seems to be involved in several proteolytic steps, however, it cannot be excluded that other aspartic endopeptidases may be involved in the processing of the propeptides (Krebbers et al., 1988; D'Hondt et al., 1993).

1.9 Aims of the project

Protein-rich seeds such as legume seeds are one of the major sources for human nutrition. Several attempts were made to enhance sulfurcontaining amino acids cysteine and methionine in such seeds. It is known, that lupine seeds are able to reduce sulfate to cysteine (Tabe and

Higgins, 1998). However, still little is known about the role of sulfate reduction in seeds of Arabidopsis: Cairns et al. (2006) could show that reduced sulfur in the form of GSH can be transported towards maturating seeds, at least to the funiculus. Mutation in GSH1 encoding the first enzyme of GSH biosynthesis, gamma-glutamyl-cysteine synthetase caused reduction in GSH amounts within the seeds compared to wild-type seeds, indicating that developing Arabidopsis seeds are able to synthesize GSH autonomously. Expression data from developing and mature seeds

(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi) also indicate that the

16

Introduction sulfur assimilation and reduction pathway is enabled. To investigate, whether SiR has an exclusive role in Arabidopsis seeds and exhibits a bottleneck effect, sir1-1 mutant is utilized.

Therefore, also seeds will be in the focus. Since SSPs contain cysteine and methionine, we are interested in finding out, if SiR mutation in seeds and reduction of sulfur flux in vegetative tissue effect SSP composition and quality. Therefore, seed proteome will be investigated with special respect to SSPs. Generative tissues will be characterized to figure out if restricted sulfite reduction affects seed yield and quality.

It is known that sir1-1 mimics a sulfur-deficient situation and that sulfurrelated genes are affected in leaf as well as in root (Khan et al., 2010). To investigate the assumed effects on other pathways related to sulfur metabolism and in general, we will perform a whole genome transcriptomic analysis.

Also, a large scale quantification of metabolites from leaf and root and under sulfur-efficient and sulfur-deficient conditions will be performed to investigate the changes in metabolic levels and to compare those to gene expression changes.

Transcriptomic analysis from leaf tissues, metabolomic analysis from vegetative tissues under internal sulfur starvation (mutation in sir1-1) and external sulfur withdrawal (-S), and investigation of seed proteome will enlighten important aspects of sulfur reduction in plants.

17

Material and methods

2 Material and methods

2.1 Technical equipment, materials and IT

2.1.1 Technical equipment

6890N gas chromatograph

Autoclave Sanoklav

GeneChip Hybridization Oven 640

GeneChip Scanner 3000 7G

Growth chambers

Heating block Thermostat HBT-2 132

Agilent, Waldbronn

Sanoklav, Bad Überkingen-

Hausen

Macherey-Nagel, Düren Chromabond-SiOH-column, 500 mg

Cooling / Heating block Thermostat

KBT-2 133

Electroporator MicroPulser

Fraction collector LKB FRAC-100

HLC, Bovenden

Bio-Rad, Munich

Pharmacia, Freiburg

Gel-Dokumentation Gel Jet Imager 2000 Intas, Göttingen

GeneChip Fluidics Station 450 Affymetrix, Santa Clara, CA

(USA)

Affymetrix, Santa Clara, CA

(USA)

Affymetrix, Santa Clara, CA

(USA)

Waiss, Gießen

HLC, Bovenden

Horizontal shaker The Belly Dancer

Incubation shaker Innova 4300

Incubation shaker Multitron

IPGphor system

Light Conditioning cabinet Percival

Intellus

LightCycler 480

MicroGrid II

Microscope Leica DM IRB

Mini-Protean III electrophoresis and blot system

NanoDrop 2000 spectrophotometer

Odyssey Infrared Imaging System

Stovall, Greensboro, NC

(USA)

New Brunswick Scientific,

Nürtingen

Infors, Bottmingen

GE Healthcare, Freiburg

CLF Laborgeräte GmbH,

Emersacker

Roche Applied Science,

Mannheim

Isogen Lifescience, De Meern

(Netherlands)

Leica, Bensheim

Bio-Rad, Munich

Peqlab, Erlangen

LI-COR Biosciences, Lincoln,

NE (USA)

18

Pegasus III time-of-flight mass spectrometer

Photometer UvikonXL

PlateReader Fluostar Optima

Material and methods

Leco Instruments, St. Joseph,

MI (USA)

Secoman, Kandsberg

BMG Labtechnologies,

Offenburg

Qiagen, Hilden Rotor-Gene Q

Q-TOF-Ultima Global equipped with a nano-ESI source coupled with a Cap LC nanoHPLC

Slidebooster

Waters Micromass, Saint

Quentin en Yvelines (France)

Advalytix, Munich

Spectral photometer LKB Ultraspec III Pharmacia, Freiburg

Stereomicroscope Leica MZ FLIII

Sterile bench Lamin Air 2448 and HB

2472

Ultrasonicator Sonoplus GM 70 with tip

UW 70

Ultrasound waterbath Transsonic 460

Leica, Bensheim

Heraeus Instruments,

Osterode

Bandelin Electronic, Berlin

Uvikon

®

900

Elma, Singen

Goebel Instrumentelle

Analytik GmbH, Au i.d.H.

HPLC-Systems:

W600 controller Waters, Milford (USA)

W600E pump multisolvent delivery Waters, Milford (USA) system

Column Nova-Pak

TM

C18 3,9 × 150 mm Waters, Milford (USA)

Column Nova-Pak

TM

C18 4,6 × 250 mm Waters, Milford (USA)

W717plus autosampler Waters, Milford (USA)

FP-920 fluorescence detector Jasco, Groß-Umstadt

2. ICS 1000

AS 50 autosampler

Column Ion Pak ® AS9-HC 2x250 mm

Column LiChroCART

®

125-4

LiChrospher

®

60 RP-select B (5 µm)

Column Eurospher 100-C18 (5 μm,

250 × 4 mm)

Centrifuges:

Dionex, Idstein

Dionex, Idstein

Dionex, Idstein

Merck, Darmstadt

Knauer, Berlin

19

Beckman J2-21 with JA-20 rotor or with SS-34 rotor

Biofuge pico

Megafuge 1.0 R with BS 4402/A Rotor

Microcentrifuge 5415C and 5417R

Sorvall RC5C with GSA Rotor

SpeedVac Alpha RVC cmc-1 with Alpha

2-4 Loc-1m

Material and methods

Beckman, Munich

DuPont, Bad Homburg

Heraeus Instruments,

Osterode

Heraeus Instruments,

Osterode

Eppendorf, Hamburg

DuPont, Bad Homburg

Christ, Osterode

Further devices corresponded to the usual laboratory equipment.

2.1.2 Chemicals

2-D SDS-PAGE Standards

2-log DNA ladder

AccQ-Tag

TM

Acid fuchsin

Agar

Agarose

Albumin fraction V (BSA)

Ampicillin

Ampholytes pH 3-10 for IEF

Ascorbic acid

Bacto trypton

Bacto yeast extract

Boric acid

Bovine serum albumine

5-bromo-4-chloro-3-indolyl phosphate

(BCIP)

Bromophenol blue

Carbicillin

Chloral hydrate

Bio-Rad, Hercules, CA (USA)

New England Biolabs, Beverly

(USA)

Waters, Milford (USA)

AppliChem, Karlsruhe

Fluka Biochemika, Fuchs

Serva, Heidelberg

Roth, Karlsruhe

Roth, Karlsruhe

Amersham, Braunschweig

AppliChem, Darmstadt

BD Biosciences, Heidelberg

BD Biosciences, Heidelberg

Merck, Darmstadt

Sigma-Aldrich, Steinheim

Roche, Mannheim

Feinchemie Kallies, Sebnitz

AppliChem, Darmstadt

Riedel-de Haën, Seelze

20

Material and methods

3-[(3-cholamidopropryl) dimethylammonio]-1propanesulfonate (CHAPS)

Coomassie Brilliant Blue G-250

Amersham Pharmacia Biotech,

Orsay (France)

L-Cysteine

Merck, Darmstadt or Bio-Rad,

Hercules, CA (USA)

Duchefa, Haarlem

DEAE-Sephadex A25

(Netherlands)

Amersham Pharmacia Biotech

AB, Uppsala (Sweden)

4',6-diamidino-2-phenylindole (DAPI) Calbiochem, La Jolla, CA (USA)

Diethylpyrocarbonate (DEPC)

Dimethyl sulfoxide (DMSO)

Dithiothreitol (DTT red

)

DNA loading buffer

Roth, Karlsruhe

Roth, Karlsruhe

AppliChem, Karlsruhe

Peqlab, Erlangen

Deoxynucleotide Solution Mix (dNTP) New England Biolabs, Beverly dNTPs (dATP, dGTP, dTTP, dCTP) for

(USA)

Invitrogen, Karlsruhe cDNA synthesis

ECL Advance Blocking Reagent GE Healthcare, Freiburg

Ethylene diaminetetraacetic acid

(EDTA)

Ethylene glycol tetraacetic acid

(EGTA)

Ethanol

Ethidium bromide

Formaldehyde

Formamid

Glufosinate ammonium (Basta)

Glutathione ethyl ether

Glycerol

Roth, Karlsruhe

AppliChem, Karlsruhe

Merck, Darmstadt

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

Merck, Darmstadt

Bayer Crop Science, Leverkusen

Sigma-Aldrich, Steinheim

Roth, Karlsruhe

Sigma-Aldrich, Steinheim Imidazole

Immobiline dry strip pH 3-10 NL,

24cm

Iodoacetamine

Isopropyl-D-1-thiogalactopyranoside

(IPTG)

Isopropanol

Kanamycin

Malachite green

Amersham Pharmacia Biotech,

Orsay (France)

Sigma-Aldrich, Steinheim

Duchefa, Haarlem

(Netherlands)

Roth, Karlsruhe

Duchefa, Haarlem

(Netherlands)

Fluka Biochemika, Seelze

21

Material and methods

Murashige Skoog (MS) incl. vitamins Duchefa, Haarlem

(Netherlands)

Magnesium chloride AppliChem, Karlsruhe

Magnesium sulfate

β-mercaptoethanol

Merck, Darmstadt

Merck, Darmstadt

MES

MOPS

Monobromobimane (MBB)

Micro agar

Nitroblue tetrazolium (NBT)

Nuclease free water

AppliChem, Karlsruhe

AppliChem, Karlsruhe

Invitrogen, Karlsruhe

Duchefa, Haarlem

(Netherlands)

Roche, Mannheim

Ambion, Austin, TX (USA)

O-acetylserine

Oil (mineral)

Orange G

Paraquat

Pharmalytes pH 3-10

Phenol

O-phenylene dihydrochloride

Phenylmethanesulphonylfluoride

(PMSF)

Phytagel

Polyvinylpolypyrrolidone (PVPP)

Bachem, Bubendorf

(Switzerland)

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

Amersham Pharmacia Biotech,

Orsay (France)

Fluka Biochemika, Seelze

Sigma-Aldrich, Steinheim

Serva, Heidelberg

Sigma-Aldrich, Steinheim

Serva, Heidelberg

Polyvinylpyrolidone 40,000 (PVP-40) Sigma-Aldrich, Steinheim

Potassium dihydrogenphosphate Fluka Biochemika, Seelze

Potassium hydrogenphosphate

Protease inhibitor mix

Protein Standard Mark12

TM

PVDF membrane

Rifampicillin

Rotiphorese

Roti

®

®

Gel 30

-Quant Bradford reagent

Fluka Biochemika, Seelze

Sigma-Aldrich, Steinheim

Invitrogen, Karlsruhe

AppliChem, Darmstadt

Duchefa, Haarlem

(Netherlands)

Roth, Karlsruhe

Roth, Karlsruhe

22

Silwet L-77

Sodium azide

Sodium chloride

Sodium dodecyl sulfate (SDS)

Sodium dithionite

Sodium pyrophosphate

Sodium succinate

Sodium sulfide

Sodium thiosulfate

Starch (soluble)

Sucrose, D+

TEMED

Material and methods

OSi Specialities, Danbury (USA)

AppliChem, Darmstadt

AppliChem, Karlsruhe

Fluka Biochemika, Seelze

Merck, Darmstadt

Merck, Darmstadt

Sima-Adrich, Steinheim

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

AppliChem, Darmstadt

Roth, Karlsruhe

TES (2-((tris(hydroxymethyl) methyl)amino) ethanesulfonic acid)

Thiourea

Triton-X 100

Tween-20

Urea

AppliChem, Darmstadt

AppliChem, Darmstadt

Sigma-Aldrich, Steinheim

Sigma-Aldrich, Steinheim

Gerbu, Heidelberg

All not listed chemicals were obtained in pro analysis grade from providers listed above or from AppliChem, Biomol, Boehringer-Ingelheim,

Riedel-de Haën or Sigma-Alrdich.

2.1.3 Consumables

384-well plate, white

96-well

Affymetrix array

Immobiline DryStrip, 24 cm

Microscope Slides

Membrane Desalting Filters

Miracloth

Roche, Applied Science, Mannheim

Greiner, Frickenhausen

Affymetrix, Santa Clara, CA (USA)

GE Healthcare, Freiburg

Marienfeld, Laude-Königshofen

Millipore, Eschborn

Calbiochem, La Jolla, CA (USA)

23

NAP5

TM

columns

Material and methods

Amersham, Braunschweig

Nitrocellulose transfer membrane AppliChem, Darmstadt

Protean IEF system electrode wigs Bio-Rad, Munich

ReadyStrip

TM

IPG strips Bio-Rad, Munich

Rotilabo aseptic filters (0,45 μm and 0,22 µM)

SILGUR-25 thin layer chromatography plate

Roth, Karlsruhe

Macherey-Nagel, Düren

Further consumables corresponded to usual laboratory equipment.

2.1.4 Kits

2-D Quant Kit

3' IVT Express Kit

GE Healthcare, Freiburg

Affymetrix, Santa Clara, CA (USA)

EXPRESS SYBR

®

GreenER™ qPCR

SuperMix Universal

Invitrogen, Karlsruhe

Hybridization Wash and Stain Kit Affymetrix, Santa Clara, CA (USA)

SensiMix™ SYBR No-ROX Kit

QIAEX II Gel Extraction Kit

®

QIAprep Spin Miniprep Kit

®

QIAquick PCR Purification Kit

®

Bioline, Luckenwalde

Qiagen, Hilden

Qiagen, Hilden

Qiagen, Hilden

Fermentas, St. Leon-Rot RevertAid™ H Minus First Strand cDNA Synthesis Kit

RNeasy Plant Mini Kit

®

RNase free DNAse Mini Kit

®

Serum Triglyceride Determination

Kit

SuperScript

®

VILO™ cDNA

Synthesis Kit

SuperScript

®

III First-Strand

Synthesis System for RT-PCR

SuperSignal West Dura Extended

Duration Substrate

Qiagen, Hilden

Qiagen, Hilden

Sigma-Aldrich, Steinheim

Invitrogen, Karlsruhe

Invitrogen, Karlsruhe

ThermoScientific, Rockford, IL

(USA)

2.1.5

α-Amylase

Enzymes

Sigma-Aldrich, Steinheim

24

α-Amyloglucosidase

BamHI

EcoRI-HF

Glucose oxidase

Glucose-6-phosphate dehydrogenase

Hexokinase

HindIII

Invertase

KpnI

NcoI

NotI-HF

Peroxidase (type VI)

Roche, Mannheim

Material and methods

Sigma-Aldrich, Steinheim

New England Biolabs, Beverly, MA (USA)

New England Biolabs, Beverly, MA (USA)

Sigma-Aldrich, Steinheim

Roche, Mannheim

New England Biolabs, Beverly, MA (USA)

Sigma-Aldrich, Steinheim

New England Biolabs, Beverly, MA (USA)

New England Biolabs, Beverly, MA (USA)

New England Biolabs, Beverly, MA (USA)

Sigma-Aldrich, Steinheim

Phosphoglucose isomerase Roche, Mannheim

Phusion ® High-Fidelity

DNA Polymerase

SalI

Finnzymes, New England Biolabs, MA

(USA)

New England Biolabs, Beverly, MA (USA)

T4 DNA Ligase

Taq DNA Polymerase

XhoI

New England Biolabs, Beverly, MA (USA)

New England Biolabs, Beverly, MA (USA)

New England Biolabs, Beverly, MA (USA)

XmaI New England Biolabs, Beverly, MA (USA)

2.1.6 Primers

Primers for qRT-PCR

Primer

1727

1728

1729

1730

1731

1732

2546

2547

1429

1430

569

570

Description

EFalfa_f

EFalfa_r ubiquitin_f ubiquitin_r proteinphosphatase_f proteinphosphatase_r

SiR_RT_f

SiR_RT_r sir-real-f sir-real-r

SIR_RT_PCR_for

SIR_RT_PCR_rev

Sequence

GATTGCCACACCTCTCACATTGCAG

GCTCCTTCTCAATCTCCTTACCAG

CCAAGGTGCTGCTATCGATCTGT

AGGTCCGAGCAGTGGACTCG

ATCGCTTCTCGCTCCAGTAATG

GACTATCGGAATGAGAGATTGC

TTGAAAAGGTTGGTCTGGACTAC

GGTGTTCCTCCTAGCCAAAC

ACTGCAATGGCTTGCCCAGCTTT

TCCCGCGCTCTGCCTCAGTTATT

ATCGACGTTTCGAGCTCCGG

GCAGGAGTGGAGACGGCTT

25

Primer

1981

432

605

606

1037

1038

1192

1193

1832

1833

1850

2098

2099

1166

1167

1168

1169

1170

1171

1172

1713

1714

1852

1853

1713

1714

1164

1165

1173

303

653

406

407

408

409

APR2_RT_fw

APR2_RT_rev

Sultr4;1f

Sultr4;1r

APR2_RT_fw

APR2_RT_rev

SAT1-f

SAT1-r

SAT2-f

SAT2-r

SAT3-f

SAT3-r

SAT4-f

SAT4-r

SAT5-f

SAT5-r oasA1_9E oasA1-3'neu

AtOAS-TLB-N

AtOAS-TLB-C

AtOAS-TLC-N

AtOAS-TLC-C

Primers for cloning

Primer

1772

1773

1774

1775

Description

P1.R-sp_fNot

P1.R-sp_rXma

SiR_fXma

SiR_rHindIII

Primers for sequencing

Primer

334

335

911

2344

2345

Description

M13 r

M13 u

Seq Primer middle_f

SiR_r_with promoter leaf spec promoter_SiR

Primers for genotyping

Description

SiR endogene for

GA_LB1

G_550A09_LP

G_550A09_RP

T-DNA sir1-2

SiR Gene specific

BASTA_for

BASTA_rev

SOX_f

SOX_r

SOX_r_exon

SOXcDNA_f

SOXcDNA_r

Material and methods

GATCGAACCCATTTGTCTCAGAGAC

TTCAACTTCTCCTCCTTTCTCTTCAACT

CACTTGACAATAGCAAGATCAGG

CTCTGTACGTATTGTAGACACAC

GATCGAACCCATTTGTCTCAGAGAC

TTCAACTTCTCCTCCTTTCTCTTCAACT

CACATGCCGAACCGGTAATAC

GGTGAATCTTCCGGTTTACAGAGA

ACGCTAAGGGAACTCATAAGTCAGA

TCTTCTCTTATAGCATCCCAAATAGGA

AATGGAACCCAGACCAAAACC

GCCCAAACATCATCGACTTCA

CTCTTCCAATGATTGTCTCCCG

CCTCTCGAAAGGAAACTCGTCA

TGGACACAGATCAAGGCGG

ATGAGAAAGAATCGTCGAATATAGATAGC

GGAATATCATCCGGTGCAGCAG

GTCATGGCTTCCGCTTCTTTC

TCAAGAGACAGAGCCGGAGTGA

CACAGCCCTTGACTACATTGTTCA

GTTTTGCTGATGGTTCGGA

GTACACCATAGGAGTTTTC

Sequence

GGCGGCCGCATTAGGTGTGATATCCCG

GGACCCGGGTGTTTTGGTTTATTTGATTTT

GGTCCCGGGATGTCATCGACGTTTCGA

GGAAGCTTTCATTGAGAAACTCCTTTGTA

Sequence

TTCACACAGGAAACAG

GTAAAACGACGGCCAGT

CAGACGTTTCAGCTTCATGGTG

GGAGCCTCTGTTAAAAGCTC

GTTCTTCCAAGGAAGAGATAAG

Sequence

CGCTTCTTCTGGCTAGCC

CCCATTTGGACGTGAATGTAGACAC

TCTTTGATTAAGCATGAAACATTG

AGGCGATTCAAAAAGCATCTC

ATATTGACCATCATACTCATTGC

TAGCACCAGCAAAAACTCACATAC

GACACCGCGCGCGATAATTTAT

CAAGCCGTTTTACGTTTGGAAC

TGTATCTCTCCATCAAGCA

GTCTTCACAGAAGAAACAC

CCTTAACGGAAATCCGTGATCC

AAATGGGGGCCCTTATAAGG

ATCCTCCACAGAGCAGATTGC

26

Material and methods

2.1.7 Software

CTC Combi PAL and PAL Cycle

Composer Software 1.5.0

EndNote X4

Fluostar Optima 1.30

Gel-Pro Express Media

CTC Analytics AG, Zwingen

(Switzerland)

Thomson Reuters, New York, NY (USA)

BMG Labtechnologies, Offenburg

Cybernetics, Silver Spring, USA

Intas GDS Application 1.51

JMP Genomics 4

Intas, Göttingen

SAS, Cary, NC (USA)

LightCycler

®

480 Software 1.0 Roche Applied Science, Mannheim

Millenium

32

Waters Waters, Milford MA, USA

Photoshop CS 8.0.1 Adobe Systems GmbH, Munich

Progenesis SameSpots 3.0 Nonlinear Dynamics, Newcastle upon

Tyne (UK)

Rotor-Gene

®

Q Series Software Qiagen, Hilden

SigmaPlot 8.0

SigmaPlot Enzyme Kinetic

Module

SigmaStat 3.0.1

Vector NTI 9

Zeiss LSM 510 Software

SPSS Inc., Munich

SPSS Inc., Munich

SPSS Inc., Munich

Invitrogen, Karlsruhe

Zeiss, Jena

Web based software tools and websites:

Brainarray eFP Browser

ExPASY http://brainarray.mbni.med.umich.edu/Brainarray/

Database/CustomCDF/genomic_curated_CDF.asp bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi http://web.expasy.org

Gene Investigator www.genevestigator.com

GSEA

MASCOT www.broadinstitute.org/gsea/index.jsp http://www.matrixscience.com

Primer calc

R

TAIR www.basic.northwestern.edu/biotools/oligocalc.htm www.r-project.org www.arabidopsis.org

27

2.2

Material and methods

Plant material and growth conditions

2.2.1 Plant material

For all experiments, Arabidopsis thaliana ecotype Col-0 (family:

Brassicaceae, order: Capparales, class: Dicotyledonae, subdivision:

Angiospermae) was used as the wild-type control. Focus of the studies in this work was on two T-DNA insertion lines for SiR (AT5G04590): sir1-1

(550A09) and sir1-2 (727B08) obtained from the GABI-Kat collection center (Khan et al., 2010).

2.2.2 Surface sterilization of seeds

Arabidopsis seeds were sterilized for growth on plates and hydroponic cultures as described in Meyer and Fricker (2000): Seeds were sterilized with 70% ethanol for 5 min., incubated then with 0.6% hypochloride, followed by five times washing with ddH

2

O.

2.2.3 Growth conditions

2.2.3.1 Growth on soil

Arabidopsis seeds were sowed on humid soil (Tonsubstrat from Ökohum,

Herbertingen) appended with 20% (v/v) vermiculite and stratified at 4 o

C in the dark for three days. Plants germinated in short day conditions

(8.5 h day light) at 50% relative humidity and a light intensity of

0.1 mmol m

-2 s

-1

. During the day the temperature was kept at 22 o

C and lowered to 18°C at night. Plants were pricked out after two weeks to individual pots and grown under short day conditions until the desired age. After seven weeks, Col-0 and sir1-1 plants were conveyed to long day condition (14 h of day light, same environmental parameters as in short day) for the propagation of seeds. For examination of seed production of

sir1-1 in the size of 7-wek-old wild-type, after 10 weeks sir1-1 were transported to long day condition. For analysis of growth plants were grown on short day condition.

28

Material and methods

2.2.3.2 Hydroponic cultures

Hydroponic cultures were established for the discovery of SiR transcript and protein in root tissue and for the application of sulfate deficiency and investigation of its effects on seed yield. Col-0 and sir1-1 seeds were

sterilized (2.2.2) and germinated in microcentrifuge tubes on AT medium

(2.2.3.3) as described in Tocquin et al. (2003). 56 microcentrifuge tubes

were placed into sterilized pipet tip boxes filled with 0.4 l of ½ Hoagland medium (see below). After two weeks, plants were transferred to pots with

6 l or 15 l of modified ½ Hoagland medium that was replaced every two weeks to provide optimal supply of nutrition. Plants were harvested after four weeks for detection of SiR transcript (2.8.3), SiR protein (2.5.5.4) and activity (2.5.6.1) in leaf and root tissues. For sulfate deficiency experiments, media were exchanged weekly due to reduced sulfur availability. The seeds were collected daily until seed production was ceased.

Modified ½ Hoagland medium:

Macroelements: Microelements (all without sulfate):

2.5 mM Ca(NO

3

)

2

2.5 mM KNO

3

40 μM Fe-EDTA

25 μM H

3

BO

3

0.5 mM MgSO

4

/ MgCl

2

2.25 μM MnCl

2

0.5 mM KH

2

PO

4

1.9 μM ZnCl

2

0.15 μM CuCl

2

0.05 μM (NH

4

)

6

Mo

7

O

24

For sulfate deficiency experiments MgSO

4

was replaced by MgCl

2

:

Full medium (500S): 0.5 mM MgSO

4

; 5S: 5 µM MgSO

4

and 495 µM

MgCl

2

; 2.5 µM MgSO

4

and 497.5 µM MgCl

2

.

The pH of all ½ Hoagland media was set to 5.8 with KOH.

29

Material and methods

2.2.3.3 Growth of Arabidopsis under sterile conditions

Seeds from Col-0, sir1-1 and sir1-2 were sterilized (2.2.2) and sowed on

Arabidopsis medium (AT medium; Haughn and Somerville, 1986).

AT-medium composition:

Macroelements: Microelements (all without sulfate):

51 μM Fe-EDTA 2 mM Ca(NO

3

)

2

× 4H

2

O

5 mM KNO

3

2 mM MgSO

4

/ MgCl

2

2.5 mM KH

2

PO

4

70 μM H

3

BO

14 μM MnCl

2

1 μM ZnSO

3

× 4H

2

4

/ ZnCl

2

O

0.5 μM CuSO

4

/ CuCl

2

0.2 μM NaMoO

4

10 µM NaCl

0.01 µM CoCl

2

For sulfur-deficient AT plates (2.2.3.4), the sulfate containing chemicals

were replaced by their chloride equivalents as indicated in the table above.

Solid medium for hydroponic cultures or agar plates was achieved by

addition of 0.6% (w/v) microagar (2.1.2). The pH of medium was adjusted

to 5.8 with KOH and then the medium was sterilized.

Stratification of seeds on plates was carried out for three days at 4°C in the dark. Afterwards, plates were incubated in Percival growth chambers under short day conditions. For germination rate experiments, the plants

were grown under long day conditions (2.2.3.1) on AT and MS plates

(2.1.2).

2.2.3.4 Chemical complementation under sterile condidtions

sir1-1 and sir1-2 were analyzed for chemical complementation on AT

plates (2.2.3.3) by addition of 1 mM of cysteine or glutathione ethyl ester

under normal and sulfur deficiency conditions. Col-0 was used as the

control. Seeds germinated under short day conditions (2.2.3.1) in

vertically arranged plates in Percival growth chambers.

30

2.2.4

Material and methods

Detection of phenotypic differences between sir1-1 and

Col-0 plants

The following morphological parameters for characterization of sir1-1 according to Boyes et al. (2001) were analyzed weekly and documented:

Rosette diameter was measured three times per plant; number of leaves per plant; and exposed leaf area. Documentation of plant growth/phenotype was performed with Canon Powershot 660 on a black velvet. The following settings for the camera were used: macro function,

2 sec light exposure, no flash in automatic mode. Images were rearranged and treated in the same way in Adobe Photoshop CS 8.0.1: Leaf area was selected via “Magic Wand” and the pixel number was noted from the

“Histogram” window and transferred to cm

2

. The data were plotted against time to gain a growth curve. Finally, fresh weight of leaves was determined at time point of harvest.

Also, total seed yield and the weight of 100 seeds per plant were determined. Dry weight of seeds was determined after incubation at 120°C for two days.

For investigation of silique development, wild-type and mutant plants

were grown under short day conditions (2.2.3.1): After flowering, the

length of siliques was measured daily (DAF, days after flowering) until the seeds matured. Finally, the silique was opened and the seeds within each silique were counted.

2.2.5 Pollen viability test

Plants were grown under short day conditions (2.2.3.1) for seven weeks and transferred to long day conditions (2.2.3.1) for bolting. After the

flowers were visible, the petals were removed and the pollen sacs taken off the stamen. Pollen were released from the sac by putting them on a microscope slide. Pollen viability test was performed with Alexander’s staining solution: 10 ml of 95% ethanol, 10 mg malachite green, 25 ml glycerol, 5 g phenol, 5 g chloral hydrate, 50 mg acid fuchsin, 5 mg orange

G, 2 ml glacial acetic acid, and 50 ml ddH

2

O according to Alexander

(1969). After staining the pollen in the solution, the slides were covered

31

Material and methods with a cover slip and held for a few seconds in fire. The staining solution was removed and samples were documented by light microscopy (2.6.1).

100 pollen per plant were counted and the percentage of viable pollen determined.

2.2.6 Crossing of Arabidopsis thaliana lines sir1-1 and sir1-2 with SOX-OE and sox-k.o.

Plants grown in short day conditions (2.2.3.1) for eight weeks were transferred to long day conditions (2.2.3.1) to induce bolting. Petals and

stamens of the maternal cross parent were removed and the anther of the paternal plant was used as pollen donor. Pollen was transferred by rubbing the anthers on the prepared, carefully wet-sprayed carpels.

Crosses were genotyped by PCR (2.4.2) in the F

1

and F

2 generation with

respective primers (2.1.6).

2.2.7 Stress induction using sulfite

For sulfite treatment of plants, leaf discs were die-cut from seven weeks old Col-0, sir1-1 and complemented sir1-1 (Kahn et al., 2010) plants

grown under short day conditions (2.2.3.1). As a developmental stage

control plant for sir1-1, 5-week-old Col-0 plants were grown under same conditions and implemented in this experiment. Leaf discs with 75 mm

diameter were allowed to float on 50% MS salt solution (2.1.2) in plates

with or without 50 mM Na

2

SO

3

, for 12 h under constant illumination

(0.1 mmol m

-2 s

-1

).

2.2.8 Stable transformation of Arabidopsis thaliana

Transformation of Arabidopsis was performed according to the floral dip method described by Clough and Bent (1998). Transformants for complementation studies were screened by spraying a 0.2 g/l glufosinate ammonium solution (BASTA

®

; 2.1.2) on four-leaf stage plants. The

treatment was repeated one week later.

32

Material and methods

2.3 Bacteriological methods

2.3.1 Bacterial strains

Following bacterial strains were used in this study: For cloning,

Escherichia coli strain XL-1 Blue (Stratagene) was used (recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac- [F’, proAB, lacIqlacZ∆M15::Tn10(Tet r )]; Bullock et al., 1987). Transformation of

Arabidopsis plants with AtSiR was carried out with Agrobacterieum

tumefaciens strain AGL1 (C58, RecA) with pTiBo542DT-DNA Ti plasmid.

2.3.2 Preparation of competent cells for electroporation

Bacteria were grown in 25 ml LB media (1% tryptone, 0.5% yeast extract,

1% NaCl, pH 7.0 with NaOH) overnight. 10 ml of this culture were transferred in 0.25 l of pre-warmed LB media and grown to an optical density (OD) at 600 nm of 0.8. Bacterial cells were cooled down on ice for

30 min and centrifuged at 650 g for 10 min at 4°C. The harvested bacterial sediment was washed twice in 0.25 l and 125 ml pre-sterilized ddH

2

O followed by two wash steps with 125 ml and 50 ml 10% glycerol.

Resuspended bacteria were frozen in liquid nitrogen in aliquots of 40 µl and stored at -80°C until transformation.

2.3.3 Transformation of bacteria

E.coli strains were transformed by electroporation at 2500V and 15µF and incubated in 1 ml LB medium for one hour at 37°C and 220 rpm. The bacterial suspension was plated on solid LB medium plate (1% tryptone,

0.5% yeast extract, 1% NaCl, 1% agar, pH 7.0 with NaOH) containing antibiotics (ampicillin, 0.1 mg/ml or kanamycin, 50 μg/ml) at 37°C.

2.3.4 Bacterial growth

Single colonies from E.coli were transferred into 1 ml LB medium for plasmid preparation or 4 ml of LB medium for the preparation of glycerol

33

Material and methods stocks. The culture was grown at 220 rpm in a horizontal shaker for 16 h at 37°C.

2.3.4.1 Plasmid isolation from E.coli

E. coli cells containing the plasmid were grown in 4 ml LB supplemented with the selective antibiotic for 16 h. The plasmid was extracted with a

Miniprep Kit

(2.1.4) according to manufacturer's protocol.

2.3.4.2 Glycerol stocks of bacteria

Bacteria were grown overnight in LB media containing selective antibiotics. 0.8 ml from the liquid culture was mixed with 0.2 ml of 80% glycerol, frozen in liquid nitrogen and stored at –80°C.

2.3.5 Growth of Agrobacterium tumefaciens

Agrobacterium tumefaciens was grown like E.coli but with the following modifications: Bacterial cultures were grown at 28°C for two days. After transformation, bacteria were incubated for 3 h at 28°C.

2.4 Molecular Biology Methods

2.4.1 Isolation of genomic DNA from Arabidopsis thaliana

Genomic DNA (gDNA) was isolated from 30 mg rosette leaf. According to

(Edwards et al., 1991), leaves were grinded and suspended in 0.4 ml

Edwards buffer (0.2 M Tris-HCL pH 7.5, 250 mM NaCl, 25 mM EDTA,

0.5% SDS) for 10 sec and incubated at room temperature (RT) for 10 min.

The mixture was centrifuged for 5 min at RT and 13,000 g. 0.3 ml of supernatant was transferred into a fresh tube and DNA was precipitated by addition of 0.3 ml isopropanol. After incubation at room temperature for 2 min, the solution was centrifuged at 13,000 g for 10 min and the supernatant discarded. The resulting sediment was washed in 0.7 ml of

34

Material and methods

70% ethanol, pelleted again at 13,000 g for 3 min. Ethanol was discarded and the DNA sediment was air-dried for at least 30 min and resolved in

25 µl TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA).

2.4.2 Polymerase Chain Reaction

5

6

7

2

3

4

Specific DNA fragments were amplified using the polymerase chain reaction (PCR) as described in Mullis et al. (1986).

Amplification of DNA for cloning in vectors was performed in a total volume of 25 µl in High Fidelity buffer (Fermentas) with final concentration of 2 µM for each primer, 0.2 mM for dNTPs using 2.5 U

Phusion High Fidelity DNA Polymerase (2.1.5) according to

manufacturer’s protocol. The optimal temperature for primer binding was

calculated using the Oligo Calc algorithm (2.1.7).

Plants were screened by PCR amplification of the respective fragment for complementation constructs or T-DNA insertion. The PCR reaction was performed in a total volume of 25 µl in 1 × Thermopol buffer (NEB) with

Taq DNA Polymerase (2.1.5). 1 - 2 µl of isolated gDNA (2.4.1) from the

plant of interest were added to the reaction as template.

A typical PCR program was set up as following:

Step Description Temperature Time

1 Initial denaturing 95°C 3 min

Denaturing

Annealing

Elongation

95°C

58 - 61°C

68°C

30 sec

30 sec

90 sec

Repeat 34 × steps 2-4

Final elongation

Hold

68°C

12°C

10 min

35

Material and methods

2.4.3 DNA gel electrophoresis

DNA fragments were separated by electrophoresis in 0.8% - 2% agarose gels. For preparation of gels, agarose was melted in 1× TBE buffer (90 mM

Tris-HCl pH 8.0, 90 mM boric acid, 0.5 mM EDTA). The melted agarose was cooled down to 45°C and ethidium bromide was added to a final concentration of 0.8 µg/ml.

DNA was mixed with loading buffer (0.25% bromophenol blue, 0.25% xylene cyanole, 40% glycerol) prior loading of the sample on the gel. 2-log

DNA ladder (2.1.2) served as a molecular weight standard. Separation of

DNA fragments was achieved by applying a voltage of 85 – 130 V for approximately 1 h, using 1× TBE as running buffer.

2.4.4 Cloning using endonucleases and ligase

DNA digestions:

The reaction contained 5 µg of plasmid. For DNA restriction, 10 U of

restriction enzymes from NEB (2.1.5) in 1× suitable restriction buffer and

a total volume of 25 μl according to manufacturer's protocols were used.

Restriction was implemented at 37°C for 2 h.

Extraction of DNA form agarose gels:

After separation by gel electrophoresis (2.4.3), DNA fragments of interest

were sliced out precisely of the agarose gels using a scalpel. The DNA was

extracted with the QUIAEX II Kit (2.1.4) according to the manufacturer's

protocol.

Ligation of DNA, desalting and transformation:

The concentration of DNA was determined with the NanoDrop 2000

spectrophotometer (2.1.1) and adjusted to 1:3 vector to insert ratio. The

ligation was performed in a total volume of 20 μl containing 1× ligation

buffer, 3 U of T4 DNA ligase (2.1.5), and fragments of DNA. The ligation

was carried out overnight at 14°C or for 1 h at RT. As a negative control, ligation without adding the insert was performed.

36

Material and methods

The whole ligation samples were desalted on Millipore filters (2.1.3)

floating on ddH

2

O for 30 min according to manufacturer’s protocol.

Competent cells (2.3.2) were transformed with 0.5 - 1.5 µl of desalted ligation sample before electroporation (2.3.3).

2.5 Biochemical methods

2.5.1 Purification of soluble proteins from Arabidopsis vegetative tissues

Soluble proteins were extracted from 0.1 g or 50 mg grinded leaf or root

tissues, respectively, from four weeks old plants (2.2.3.2) with 0.5 ml

extraction buffer (50 mM HEPES-KOH, pH 7.4, 10 mM KCl, 1 mM EDTA,

1 mM EGTA, 10% glycerin, 10 mM DTT, 0.5 mM PMSF) detection of SiR transcript (2.8.3), SiR protein (2.5.5.4) and activity (2.5.6.1). The extraction was achieved by shaking the samples for 15 min on ice. The cellular debris was removed by two centrifugation steps, each for 10 min at 25,000 g and 4°C.

2.5.2 Purification of proteins from Arabidopsis generative tissues

In order to optimize the extraction of proteins from mature seeds, different protein extraction methods were used:

2.5.2.1

Purification of soluble proteins from seeds

25 mg mature seeds were grinded and taken in 250 µl of protein extraction buffer (PEB; 0.1 M TES, 0.5 M NaCl, 1 mM EDTA, 1 mM PMSF,

2% β-mercaptoethanol). 250 µl and then 0.5 ml PEB were added successively and the samples were grinded again. The suspension was centrifuged at 13,000 g for 5 min. 250 µl of the supernatant was transferred to a fresh tube and 1 ml of precooled acetone (-20°C) was added to the sample. After 30 min of incubation on ice, the solution was centrifuged at 4°C with 13,000 g for 5 min. The supernatant was

37

Material and methods discarded, the sediment washed with 0.3 ml 80% acetone, and a centrifugation step (13,000 g, 2 min) followed. The supernatant was removed and the sediment was air-dried and afterwards resuspended in

SDS gel loading buffer (2.5.5.1).

2.5.2.2 Purification of total proteins from seeds

100 mg seeds were grinded at RT and 1 ml extraction buffer was added.

The protocol for extraction of proteins from vegetative tissues (2.5.1) was

used with minor modifications; following chemicals were added: 1%

Triton X-100, 2% SDS, and 15% glycerol (instead of 10%). The suspension was further grinded, poured into a fresh tube and centrifuged at RT with

13,000 g for 10 min. The supernatant was transferred into a new tube.

The second method was according to Higashi et al. (2006) without chemicals having been used for 2D gels like CHAPS and ampholine: 10 mg mature seeds were homogenized in liquid nitrogen and proteins were extracted on ice in 0.8 ml of thiourea/urea lysis buffer (7 M urea, 2 M thiourea, 65 mM DTT, protease inhibitor mix, 5% polyvinylpolypyrrolidone). The prepared buffer was stirred overnight at

50°C prior extraction. The protein extract was mixed for 3 min and centrifuged at 4°C for 15 min at 18,000 g. The supernatant was centrifuged as above and transferred to a new tube.

2.5.3 Protein quantification

Two methods for protein measurement were used parallelly to ensure correct resulting protein concentrations due to the different protein extraction buffers and their chemical component, including reductants, detergents, chaotropes and carrier ampholytes which could interact with protein quantification dyes like Coomassie in some protein assays.

The protein concentration was estimated after Bradford (1976) using

bovineserum albumin fraction V (BSA; 2.1.2) as standard. Each sample

was adequately diluted and 10 µl from sample dilution or standard were double or triple spotted in 96-well plates. 250 μl of 1:5 diluted Bradford

38

Material and methods reagent (2.1.2) were added into the wells containing sample dilutions.

After incubation for 10 min at RT, the absorbance was measured at

595 nm with the Fluostar plate reader (2.1.1) and protein sample concentrations were calculated by using the BSA standard calibration curve.

2-D Quant Kit (2.1.4) was used for quantification of protein amounts following the manufacturer’s instructions. BSA served as standard. The absorbance of standards and samples was read at 480 nm.

2.5.4 2-D gel electrophoresis of seed proteome

2.5.4.1 Total seed protein extraction and 2-D electrophoresis

Total proteins were extracted from 20 mg of mature seeds collected on four individual plants (2.2.3.1). Protein concentration was measured according to Bradford (1976). A constant volume (0.3 ml) of the protein extracts (around 0.4 mg of proteins) was used for isoelectrofocusing.

Proteins were separated in duplicates from the four biological seed samples using gel strips forming an immobilized non-linear pH 3 to 10 gradient (2.1.3). Strips were rehydrated in the IPGphor system (2.1.1) with the thiourea/urea lysis buffer containing 2% (v/v) Triton X-100, 20 mM

DTT and the protein extracts for 7 h at 20°C. IEF was performed at 20°C in the IPGphor system for 7 h at 50 V, 1 h at 300 V, 2 h at 3.5 kV and 7 h at

8 kV. Prior to the second dimension, the gel strips were equilibrated for 2

× 20 min in 2 × 0.1 l of equilibration solution containing 6 M urea, 30%

(v/v) glycerol, 2.5% (w/v) SDS, 0.15 M bis-Tris, and 0.1 M HCl. 50 mM

DTT was added to the first equilibration solution, and iodoacetamide (4%

[w/v]) was added to the second (Harder et al., 1999; Gallardo et al.,

2002). Proteins were separated in vertical polyacrylamide gels according to Gallardo et al. (2002).

39

Material and methods

2.5.4.2 Protein staining and quantification

Gels were stained with Coomassie Brilliant Blue G-250 (Bio-Rad, 2.1.2) according to Mathesius et al. (2001). Images were acquired with the

Odyssey Infrared Imaging System (2.1.1) at 700 nm with a resolution of

169 μm. Protein signals were quantified with the Progenesis SameSpots version 3.0 software (2.1.7) according to the instruction manual. For each gel, normalized spot volumes were calculated as the ratio of each spot volume to total spot volume in the gel (arbitrary unit). Eight gels (four biological replicates and two technical replicates for each biological replicate) were analyzed for Col-0 and sir1-1. Molecular masses (Mr) and isoelectric points (pI) were calculated according to the migration of 2-D

SDS-PAGE Standards proteins (2.1.2). All data were statistically analyzed using the Progenesis SameSpots version 3.0 software (ANOVA).

Differences with P values < 0.05 were defined as significant.

2.5.4.3 Protein identification

Spots were annotated using proteome reference maps previously established for Arabidopsis mature seeds (Zuber et al., 2010b). The identity of unknown spots was confirmed by nano-LC-MS/MS (2.1.1) as described by Gallardo et al. (2007). Detailed information about protein digestion, mass spectrometry data acquisition is provided in Suppl. data

17. Peak lists of precursor and fragment ions were matched to proteins in the NCBI non redundant database (January 2010, 10,274,250 sequences;

3,505,793,397 residues, taxonomy of Arabidopsis) using the MASCOT version 2.2 program (2.1.7). The MASCOT search parameters are described in Suppl. data 17. Matches with individual ion scores above 20 were considered to be true.

40

2.5.5

Material and methods

Protein separation by electrophoresis and immunoblotting

2.5.5.1 SDS-polyacrylamide gel electrophoresis

Protein separation upon their molecular weight was performed according to Laemmli (1970). Mini-Protean III system (2.1.1) was used with discontinuous gels consisting of a 4% acrylamide stacking gel (80 mM Tris pH 6.8, 0.065% (w/v) SDS, 0.026% crosslinker) and a 12.5% acrylamide separating gel (0.37 M Tris pH 8.8, 0.1% (w/v) SDS, 0.026% crosslinker).

The samples were spiked with 1/5 volume 5 × Laemmli buffer (0.1 M Tris pH 7.0, 5% SDS, 3.63 M β-mercaptoethanol, 20% glycerin, 0.01% bromophenol blue) prior loading and denatured for 3 min at 95°C.

Mark12 protein marker (2.1.2) served as molecular weight standard.

SDS PAGE was performed in running buffer (250 mM Tris pH 8.3, 1.92 M glycine, 1% (w/v) SDS) at a voltage of 85 V for 30 min followed by 120 V until the bromophenol blue front left the gel.

2.5.5.2 Coomassie staining of protein

After protein separation by SDS PAGE (2.5.5.1), the proteins were stained

in Coomassie staining solution (50% methanol, 1% acetic acid, 0.1%

Coomassie Brilliant Blue G-250) for 30 min on a horizontal shaker. The background of the gels was destained four times by incubation with

Coomassie destaining solution (20% ethanol, 10% acetic acid). Gels were documented by scanning after equilibration in water.

2.5.5.3 Protein transfer from SDS-gels to PVDF membranes

After separation of proteins by SDS-PAGE (2.5.5.1), they were transferred

to a polyvinylidenfluorid (PVDF) membrane according to Towbin et al.

(1979). Mini-Protean III chambers or PeqlabProtein chambers (2.1.1) were used for the transfer within blotting buffer (0.02 M Tris-HCl pH 8.0,

0.15 M glycine, 0.04% SDS, 20% methanol). Protein transfer was carried out for 2.5 h at 4°C at a current of 130 mA. After incubation of the membrane for 5 min with Ponceau staining solution (1% Ponceau S, 5%

41

Material and methods acetic acid), it was washed with ddH

2

O and immediately scanned. Finally, the membrane was destained with TBST buffer (0.01 M Tris-HCl pH 7.5,

0.15 M NaCl, 0.05% Tween-20).

2.5.5.4 Immunological detection of proteins on PVDF membranes

PVDF membrane was blocked for 1.5 h with either 5% BSA or 5% ECL advance block agent in TBST buffer (10 mM Tris-HCl pH 7.5, 0.15 M

NaCl, 0.05% Tween-20) and subsequently washed five times with TBST buffer. The washed membrane was incubated overnight at 4°C with αSiR serum from rabbit that was 1:3,000 diluted in TBST buffer with the respective blocking agent.

The PVDF membrane was washed five times with TBST buffer and subsequently incubated with the secondary antibody (1:10,000 diluted; goat α-rabbit IgG conjugated with horse radish peroxidase (HRP) in TBST buffer) for 1.5 h. The secondary antibody was detected with SuperSignal

West Dura Extended Duration Substrate (2.1.4) following manufacturer’s guidelines.

2.5.6 Activity Assays

2.5.6.1 Determination of SiR activity

The measurement of SiR activity was coupled to the cysteine synthesis of

OAS-TL (Khan et al., 2010). Therefore, the reaction mix was set up in a total volume of 0.1 ml containing 25 mM HEPES pH 7.8, 1 mM Na

2

SO

3

,

5 mM OAS, 10 mM DTT, 30 mM NaHCO

3

, 15 mM Na

2

S

2

O

4

, 5 mM paraquat, and 1 U of OAS-TL (EC 2.5.1.47; Wirtz et al., 2004). The reaction was started by addition of 59 µl protein extracts (2.5.1 and

2.5.2.1). The assay was performed at 25°C for 30 min as described by

Gaitonde (1967). The reaction was stopped by precipitation of the proteins via addition of 50 μl 20% trichloroacetic acid. Precipitated proteins were centrifuged at 4°C for 5 min at 20,000 g. 150 µl supernatant was added to a premixed 0.2 ml ninhydrine solution (17.5 mM ninhydrine in 25% (v/v)

42

Material and methods hydrochloric acid and 75% (v/v) acetic acid), and 0.1 ml 100% acetic acid.

The mixture was incubated for 10 min at 99°C and allowed to cool down on ice, followed by addition of 550 µl 100% ethanol.

The produced cysteine was determined photometrically by measuring the

OD at 560 nm.

2.5.6.2 Determination of APR activity

APR activity was measured as the production of radioactive sulfite

(Brunold and Suter, 1990). 10 µl of the protein extracts (2.5.1 and 2.5.2.1) were added to 240 µl of the reaction assay (0.1 M Tris-HCl pH 9.0, 0.8 M

MgSO

4

, 8 mM dithioerythritol (DTE), 75 mM [

35

S]APS (1 kBq/10 µl)) and incubated at 37°C for 30 min. 1 ml of 1 M triethanolamine (TEA) was added into 20 ml scintillation vials. After incubation, 0.1 ml of 1 M Na

2

SO

3 was added to the reaction, mixed and transferred into the prepared scintillation vials. 0.2 ml of 1 M H

2

SO

4

was added to the assay in the tubes and the assay was incubated overnight at RT. The bottom of the tubes was washed with 0.2 ml ddH

2

O into the vials. After adding 3 µl scintillation cocktail to the vials and mixing, the acid-volatile radioactivity formed in the presence of [

35

S]APS and DTE was measured.

2.6 Microscopic methods

2.6.1 Silique and pollen imaging

Siliques were carefully opened with forceps and imaged with a Leica MZ

FLII stereomicroscope equipped with a DFC 320 camera.

The prepared pollen after Alexander’s staining treatment (2.2.5) were analyzed with a Zeiss microscope LSM 510 and images were taken with a

25× or 40× lens.

43

Material and methods

2.6.2 Electron microscopy

Leaves were harvested from 7-week-old Col-0 and sir1-1 plants grown under short day condition (2.2.3.1) 1 h after light onset and after 16 h darkness. Harvested leaf material was cut into 1 mm on each side and transferred immediately to primary fixative (0.5% glutaraldehyde, 1.5% paraformaldehyde in 50 mM cacodylate buffer) at 4°C in exicator overnight. The samples were washed four times with 50 mM cacodylate buffer each 10 min at RT.

Secondary fixation was in 1% osmium tetroxide in 50 mM cacodylate buffer for 4 h at RT and the samples were washed twice in the same buffer as used in the primary and secondary fixative and twice in bidistilled water, each 10 min.

Tertiary fixation of specimens took place at 4°C overnight in 1% aqueous uranyl acetate which served both as fixative and stain and can markedly enhance membranes.

Samples were washed in bidistilled water 4 times, each for 10 min and dehydrated in graded acetone series of 25%, 50%, 70%, and 90%, each for

15 min. Final dehydration was performed in 100% acetone twice, each for

15 min.

Spurr

®

was used as an epoxy resin embedding medium. The infiltration series diluted in acetone were used: 25%, 50%, and 75%, each for 45 min and at the end 100% Spurr

®

was poured over the samples and those were incubated overnight at 4°C. Specimens were transferred into embedding

BEEM capsules with fresh Spurr

®

solution and polymerized at 60°C overnight.

Ultra-thin sections were cut and placed on grids. Samples were stained in uranyl acetate, followed by distilled water washes and lead citrate staining. Aqueous uranyl acetate/lead citrate post-stained sections were examined in a Philips CM10 transmission electron microscope operating at 80 kV.

44

Material and methods

2.7 Metabolomics

2.7.1 Acidic extraction of metabolites

Metabolites were extracted from 0.1 g or 20 mg grinded leaf or seed

(2.2.3.1). The metabolites were extracted in 0.5 ml of 0.1 M HCl on ice for

15 min. Cell debris was sedimented twice by centrifugation at 20,000 g and 4°C, for 5 min. The supernatant containing the soluble metabolites was transferred to a new microcentrifuge tube and subjected for further analysis.

2.7.2 Determination of amino acids and other metabolites

For amino acid determination, two techniques were suitable: GC-MS and

HPLC. As comparatively described in Allboje Samami et al. (submitted), extraction protocol for GC-MS used methanol to isolate soluble cell

constituents, whereas for HPLC diluted HCl (2.7.1) was used.

The first technique was an N-methyl-N-[trimethylsilyl]trifluoroacetamide and methoxyamine hydrochloride derivatization with ribitol as an internal standard, followed by gas chromatography/mass spectrometry analysis

(CTC Combi PAL and PAL cycle composer software version 1.5.0 (2.1.7), a

6890N gas chromatograph (2.1.1), and a Pegasus III time-of-flight mass spectrometer (2.1.1)) using on MDN-35 capillary column, 30-m length,

0.32-mm inner diameter, 0.25-mm film thickness at a flow rate of

1 ml/min as described by Lisec et al. (2006). This method was also used for large scale metabolite quantification.

The second technique was based on derivatization of amino acids with the fluorescent dye AccQ-Tag

TM

(2.1.2) in a volume of 50 μl containing 0.14 M borate buffer pH 8.8, 30 µg AccQ-Tag and 5 μl of the metabolite extract

(2.7.1) according to the manufacturer’s protocol. Derivatized amino acids

were separated by high-performance liquid chromatography using a

Nova-Pak

TM

C18, 3.9 × 150 mm column (2.1.1) as described in Hartmann et al. (2004). Derivatized and separated amino acid AccQ-Tag derivatives were detected with Jasco FP-920 fluorescence detector (2.1.1) at 395 nm after excitation with 250 nm. Quantification was performed using the

45

Material and methods

Waters LC control- and analysis software Millenium

32

(2.1.7).

Standardization was carried out by external standards for each individual amino acid.

2.7.3 Determination of thiols

25 μl of metabolite extract (2.7.1) was incubated with 270 µl of reduction

buffer (68 mM Tris pH 8.3, 0.34 mM DTT, 25 μl 0.08 M NaOH) for 1 h in the dark at RT. DTT could reduce the sulfhydryl group of thiols. Reduced thiols were derivatized by addition of 0.85 mM monobromobimane and the reaction was allowed to proceed for 15 min in the dark at RT. 705 µl of

5% acetic acid were added which stopped the reaction and stabilized the thiol-bimane-derivatives. Derivatized thiols were separated by reversed phase HPLC with a Nova-Pak

TM

C18, 4.6 × 250 mm column (2.1.1) as described in Wirtz and Hell (2003). Detection of separated thiolderivatives was achieved by using a Jasco FP-920 fluorescence detector

(2.1.1) at 480 nm after excitation with 380 nm and quantified using the

Millenium

32

software.

A new method for detection of sulfide was established after Fahey et al.

(1981), Newton et al. (1981), and Völkel and Grieshaber (1994): 25 mg of plant tissue (2.2.3.1) was grinded and homogenized in liquid nitrogen. To avoid transition of HS

-

to H

2

S which is volatile, the sample was directly derivatized by being introduced to 160 µl alkaline extraction buffer containing monobromobimane (145 µl extraction buffer containing

160 mM HEPES pH 8.0, 16 mM EDTA, 10 µl 1 M NaOH, 5 µl 0.1 M mBB).

The reaction set was shaken for 1 min and incubated for 30 min at RT in dark, whereby every 10 min the samples were shaken. After incubation, the reactions were centrifuged for 15 min at 4°C with 20,000 g. The supernatant was taken and mixed with 0.1 ml 65 mM methanesulfonic acid to stabilize mBB-derivatized products and afterwards with 740 µl

0.25% acetic acid and 12% methanol. The product was mixed and centrifuged for 60 min at 18°C with 20,000 g. Sulfide was separated from other thiols on a LiChroCART

®

125-4 LiChrospher

®

60 RP-select B (5µm) column (2.1.1) with a flow rate of 1.3 ml/min by increasing the

46

Material and methods hydrophobicity of the eluent A (0.25% acetic acid) by mixture with methanol (eluent B). Detection was performed as described for thiols.

2.7.4 Determination of adenosines

150 μl of metabolite extract (2.7.1) or standards were incubated with

770 µl of CP buffer (620 mM citric acid pH 4, 760 mM disodium hydrogen phosphate) and 80 µl of 45% chloroacetaldehyde for 10 min at 80°C. The incubation was allowed to cool down on ice to RT and sedimented at 20°C for 45 min with 20,000 g. The supernatant was transferred to HPLC vials.

Adenosine derivatives were separated by reversed phase HPLC with an

XTerra

TM

MS C18, 5 µm, 3 mm × 159 mm column (2.1.1). 1× TBAS

(5.7 mM TBAS, 30.5 mM potassium dihydrogen phosphate, pH 5.8) served as running buffer, acetonitrile:1× TBAS (2:1, v/v) as separation buffer. Metabolites were detected with a Jasco FP-920 fluorescence detector (2.1.1) at 410 nm after excitation with 280 nm and quantified using the Millenium 32 software.

2.7.5 Extraction, isolation and quantification of jasmonates, hydroxyjasmonic acid (12-OH-JA), and hydroxyjasmonic acid sulfate (12-HSO

4

-JA)

0.5 g of leaves (2.2.3.1) were frozen in liquid nitrogen, homogenized in a mortar and extracted with 10 ml 100% methanol. For quantification of jasmonate (JA), hydroxyjasmonic acid (12-OH-JA), and hydroxyjasmonic acid sulfate (12-HSO

4

-JA), appropriate amounts of internal standards were added to the extract: 0.1 µg of (

2

H

6

)JA, 0.1 µg of 2-(

2

H

3

)OAc-JA, and

250 ng of 12-HSO

4

-JA-(

2

H

3

)ME, respectively, were added to the extract.

The methanol extracts were purified by chromatographic steps as described in (Miersch et al., 2008) and the elute was evaporated and acetylated with 0.2 ml pyridine and 0.1 ml acetic acid anhydride overnight at 20°C and taken in ethyl acetate after passing a chromabond-SiOHcolumn, 0.5 g (2.1.1) whereas JA and 12-OH-JA could be eluted, 12-HSO

4

-

JA remained within the column and was eluted with methanol. Liquids

47

Material and methods were evaporated by addition of ethyl acetate and methanol extracts, containing JA and 12-OH-JA (E1), and 12-HSO

4

-JA (E2), respectively.

Derivatives were suspended in 100% methanol. JA and 12-OH-JA were dissolved using a column filled with 3 ml DEAE-Sephadex A25 (2.1.2)

(Ac

-form, methanol). The column was washed with 3 ml methanol. After washing with 3 ml 0.1 M acetic acid in methanol, eluents with 3 ml of 1 M acetic acid in methanol and 3 ml of 1.5 M acetic acid in methanol were collected and evaporated. Extract E2 was methylated with 0.2 ml ethereal diazomethane and evaporated. The final separation was performed by

HPLC with a Eurospher 100-C18 column (2.1.1) as described in Miersch et al. (2008).

2.7.6 Isolation of lipids from Arabidopsis seeds for determination of total lipid content

0.1 g of mature seeds was homogenized in liquid nitrogen and 1.5 ml of isopropanol was added to the seed powder. The suspensions were shaking for 16 h at 4°C, 100 rpm. The samples were centrifuged at 13,000 g for

10 min. Fresh tubes were weighted and their weights were noted; the suspensions were transferred to the new tubes. The tubes incubated for

8 h at 60°C to let the isopropanol evaporate. The remaining suspension contained the lipids. After weighting the tubes containing the lipids, the total lipid amount was determined by subtraction from the net weight of tubes.

2.7.7 Lipid extraction for triacylglyceride determination

20 - 30 mg of seeds were homogenized in liquid nitrogen and 1.5 ml 2:1 chloroform/methanol (v/v) was added to the tissue. Samples were homogenized with a steal bead using a tissue lyzer for 1 min at a frequency of 30Hz. Lipids were extracted on a rotating wheel at RT for 20 min.

Samples were centrifuged at 1200 g m for 10 min and 1 ml of the resulting supernatant was transferred to fresh tubes. The organic phase was mixed with 0.2 ml of 0.9% sodium chloride and centrifuged at 300 g for 5 min.

48

Material and methods

The aqueous solution was carefully discarded and 50 µl of the organic phase were transferred to a fresh tube and 10 µl of 1:1 Triton-X 100/ chloroform (v/v) were included. The reagents were mixed and the solvent was evaporated. The residue containing the hydrophobic contents of the seeds was resuspended in 50 µl ddH

2

O and used for determination of

triacylglyceride (TAG) levels (2.7.7.1).

2.7.7.1 Determination of TAG levels in Arabidopsis seeds

TAG levels were determined by separating triacylglycerides into one glycerol and three fatty acid molecules and measuring the glycerol using a calorimetric assay. The Serum Triglyceride Determination Kit (2.1.4) was

used for this assay. 4 µl of isolated triglycerides from seeds (2.7.7) were

transferred to a 96-well plate. In order to determine a blank value, 0.1 ml of Free Glycerol Reagent were added to each well and the plate was incubated at 37°C for 5 min. Free glycerol levels were measured at

540 nm. In a second reaction (assay), 0.1 ml of Triglyceride Reagent were added that contained lipase catalyzing the release of fatty acids from triacylglycerides. Plates were incubated at 37°C for 5 min and measured at

540 nm. TAG content was determined by subtracting the free glycerol

(blank) from the second measurement (assay).

2.7.8 In situ staining of starch

Leaves from 7-week-old soil-grown Col-0 and sir1-1 plants (2.2.3.1) were used for in situ staining of starch according to (Khan et al., 2010): Leaves were incubated for 2 h at 80°C in 80% ethanol, rinsed with water, stained for 10 min in Lugol’s iodine solution (5 g I

2

, 10 g KI dissolved in 85 ml water, and diluted 1:10 in water for staining), rinsed again, and photographed.

49

2.7.9

Material and methods

Quantitative measurement of starch and soluble sugars

Contents of starch, sucrose, glucose, and fructose were determined according to (Smith and Zeeman, 2006): 30 mg of leaf or 10 mg of seed tissues (2.2.3.1) were harvested, homogenized in liquid nitrogen, transferred to a tube containing 2 ml 80% ethanol and incubated in a boiling water bath for 3 min. Samples were centrifuged at RT with

13,000 g for 10 min to separate starch and sugars which were in the supernatant.

2.7.9.1 Determination of sugars

0.1 ml of supernatant was added to 0.9 ml of reaction buffer (0.1 M imidazole pH 6.9, 5 mM MgCl

2

, 2 mM NADP, 1 mM ATP) and 0.7 U of glucose-6-phosphate dehydrogenase (G6P-DH) grade II, from yeast

(Roche). The OD was measured at 334 nm against 1 ml reaction buffer

(blank) until the absorption remained constant. For measurement of glucose, 1.5 U of hexokinase (2.1.5) was added, for fructose determination,

3.5 U of phosphoglucose isomerase from yeast (2.1.5), and for measurement of sucrose, 2 µl of a saturated invertase solution (2.1.5), also until the absorption remained constant.

2.7.9.2 Starch determination

To quantify starch, ethanol was allowed to evaporate from the final

sediment (2.7.9). After that, the sediment was homogenized thoroughly

with 2 ml ddH

2

O. 0.5 ml of the homogenate was added to each of 3 tightly sealing screw-capped microcentrifuge tubes, heated to 100°C for 10 min to gelatinize starch granules. The samples were cooled to RT and 0.5 ml

0.1 M sodium acetate (pH 4.8) was added to each tube. 6 U of αamyloglucosidase and at least 0.5 U of α-amylase (2.1.5) were added to two of the tubes and a solution of equivalent volume and composition without the enzymes to the other tube (control samples). All samples were incubated at 37°C for 2 h. To remove particulate material, the tubes were

50

Material and methods spun down with 10,000 g for 5 min at RT. The enzymatic assay above

(Stitt et al., 1989) was used in which hexokinase and glucose 6-phosphate dehydrogenase were applied to convert glucose to 6-phosphogluconate with concomitant reduction of NADP to NADPH.

2.7.9.3 Quantitative measurement of starch using peroxidase

Starch was determined also via a second method according to Ebell (1969) and Eimert et al. (1995): 50 mg of leaf tissue (2.2.3.1) were grinded and extracted in 0.5 ml 80% ethanol at 80°C for 5 min. Samples were centrifuged at RT with 13,000 g for 5 min. Supernatant was discard and the sediment was dissolved in 0.5 ml 80% ethanol. This step was repeated three times in total and the samples were centrifuged at RT with 13,000 g for 10 min. Supernatant was discarded and the sediment was allowed to air-dry. The resulting sediment was resuspended in 0.2 ml 0.2 M KOH, and boiled for 30 min. The reaction was neutralized with 40 µl acetic acid.

An aliquot (0.1 ml) was digested with 0.5 U amyloglucosidase (2.1.5),

90 mM sodium acetate buffer, pH 4.8 for 1 h at 55°C in a total volume of

1 ml. The reaction was stopped by heating to 100°C for 5 min. The resulting glucose from 0.1 ml digested starch sample was measured by adding 37.5 µl of 0.04% O-phenylene dihydrochloride and 0.1 ml sodium acetate buffer containing 0.1 U of glucose oxidase and 0.1 U of peroxidase

(2.1.5). The reaction was carried out at 37°C for 30 min and stopped with

0.1 ml of 3 M HCl. The OD was measured at 492 nm. For quantification, a standard curve of 40 - 200 µg of soluble starch (2.1.2) was set which was treated like the extracted samples after resuspension in 0.2 ml 0.2 M

KOH.

2.7.10 Determination of sulfolipids

First, a SILGUR-25 thin layer chromatography (TLC) plate (2.1.3) was soaked in a 0.15 M ammonium sulfate solution for 30 min and after complete drying at RT, the plate was heated for 2.5 h at 120°C. For sulfolipids analysis, 0.2 g fresh leaf material from seven weeks old soil-

51

Material and methods grown sir1-1, Col-0 and sqd2 lines (2.2.3.1) were homogenized and extracted in 0.4 ml chloroform/methanol/formic acid (10:10:1) for

10 min. In parallel, the samples were mixed vigorously, and then centrifuged with 18,000 g at 4°C for 2 min. The entire supernatant was transferred into a fresh tube, followed by the addition of 0.2 ml of 1 M KCl and 0.2 M H

3

PO

4

. The mixture was centrifuged at RT for 1 min with

13,000 g and 50 µl of the lipids containing lower phase was spotted on activated pre-coated TLC plate. The TLC was performed with 0.1 l running buffer (90:30:8 acetone/toluene/water) for 60 min at RT. Afterwards,

TLC plates were dried at RT, sprayed with 50% H

2

SO

4

and incubated at

160°C for 15 min in order to visualize the lipids.

2.7.11 Quantification of leaf chlorophyll contents

30 mg leaf tissue of eight weeks old soil grown plants were grinded in liquid nitrogen and leaf pigments were extracted in 1 ml 80% (v/v) acetone for 15 min on ice. The cell vestige was centrifuged for 10 min at

18,000 g at 4°C. The supernatant was transferred to a fresh tube. The sediment was re-extracted in 1 ml 80% acetone as described above. The resulting supernatant was combined with the first supernatant and the absorbance of the total extract was determined (80% acetone as blank) at

645 nm and 663 nm. The following formulas were used for calculation of chlorophyll a and b contents as described in Mackinney (1941) and Arnon

(1949): c chla

= 12.7 × A

663 nm

- 2.69 × A

645 nm c chlb

= 22.9 × A

645 nm

- 4.68 × A

663 nm c chl

= c chla

+ c chlb

2.8 Transcriptomics

2.8.1 mRNA Isolation

Total RNA was extracted from 150 mg and either, 30 mg or 0.1 g frozen leaf, root and seed tissue, respectively. The grinded leaf or root tissues

52

Material and methods were extracted with RNeasy Plant Mini Kit and RNase free DNAse Kit

(2.1.4) according to manufacturer’s protocols. For RNA extraction from seeds, following protocol according to Chang et al. (1993) was used: The extraction buffer (0.1 M Tris-HCl, pH 8.0, 2% hexadecyltrimethylammonium bromide, 2% PVP-40, 25 mM EDTA, 2 M NaCl) was preheated in a water bath at 65°C. Before extraction, 0.1 ml

β-mercaptoethanol was added to 5 ml extraction buffer for each sample.

After combining the seed powder and the buffer, the homogenate was mixed for 1.5 min and incubated at 65°C for 10 min. The reaction set was centrifuged at RT and 6,000 g for 20 min. The supernatant was collected and combined with 5 ml of chloroform/isoamyl alcohol (24:1). The solution was mixed and the centrifugation step was repeated as described above. The whole supernatant was transferred to a fresh tube, 5 ml of 5 M

LiCl was added and RNA was precipitated overnight at 4°C. The samples were centrifuged with 6,000 g at 4°C for 30 min. The supernatant was removed and the sediment was resuspended in 0.6 ml resuspension buffer

(10 mM Tris-HCl, pH 8.0, 1 M NaCl, 0.5% SDS, 1 mM EDTA) which was preheated to 60°C. The solution was transferred to a fresh tube and incubated at 60°C until the sediment was resolved in buffer. 0.6 ml of chloroform/isoamyl alcohol (24:1) was added to the sample followed by centrifugation with 14,000 g at 20°C for 10 min. The supernatant was mixed with 0.5 ml of chloroform/isoamyl alcohol (24:1) in a new tube and centrifugation was repeated as previously described for 15 min. After centrifugation, the supernatant was transferred into a new tube with

1.2 ml ice-cold 100% ethanol and incubated for 1 h at -80°C to precipitate

RNA. After centrifugation at 13,000 g and 4°C for 30 min, the supernatant was discarded carefully and the sediment washed with ice-cold 70% ethanol and centrifuged twice at 13,000 g and like before for 10 min.

Sediment was dried at RT and resuspended in 50 µl RNase-free DEPCtreated water (2.1.2). For all treatments and buffers, DEPC-treated water was used. After RNA isolation, total RNA yield was measured with

NanoDrop 2000 spectrophotometer (2.1.1) as described in 2.8.2.

53

2.8.2

Material and methods

Examination of RNA degradation and determination of concentration

To examine the degree of degradation after RNA isolation, a 1% agarose gel was prepared with RNase-free reagents. RNA samples were denatured using formaldehyde/ formamide. To 10 μl of RNA sample buffer (0.5 µl of

0.8 µg/ml ethidium bromide, 0.5 µl 10× MOPS, 5 µl formamide, 1.75 µl formaldehyde, 1.7 µl 6x loading dye, 0.55 µl RNase-free water), 1.5 µl

(0.5 - 2 μg) of RNA sample were added and the samples were incubated for 10 min at 65°C, and 2 min on ice. After denaturation, samples were loaded onto the agarose gel and separated for at least 40 min. The quality of the RNA was determined visually by examination of the ratio between the respective ribosomal RNAs (25S, ~3.6 kb to 18S, ~1.9 kb), which should be 2:1 as sharp bands. No low molecular weight smear indicating total RNA degradation was observed. Since the mRNA represents only 1% of total cellular RNA it is not possible to directly examine its degradation status. The amount of RNA was determined spectophotometrically at 260 nm using the NanoDrop 2000 spectrophotometer (2.1.1). The ratios A

260 nm

/A

280 nm

and A

260 nm

/A

230 nm

were compared to estimate protein and polysaccharide impurities. The values should be between 1.8 and 2.1.

2.8.3 Quantitative real time-PCR

2.8.3.1 cDNA synthesis

cDNA from total RNA extract was synthesized with SuperScript

®

VILO™ cDNA Sythesis Kit or RevertAid™ H Minus First Strand cDNA Synthesis

Kit (2.1.4) according to manufacturer’s protocols using 1 µg of total RNA extract.

2.8.3.2 qRT-PCR

The qRT-PCR reaction was set up by one of the following systems: 10 ng cDNA with 1.6 pmol of each specific primer (2.1.6) were added into

54

Material and methods onefold EXPRESS Two-Step SYBR GreenER Universal mixture (2.1.4).

The reaction was performed in the LightCycler 480 (2.1.1) according to the

EXPRESS Two-Step SYBR GreenER protocol and evaluated with Light-

Cycler software 4.0 (2.1.7). For the second system, 10 ng cDNA and

2.5 pmol of each specific primer (2.1.6) were mixed with 6.25 µl SYBR solution from SensiMix™ SYBR No-ROX Kit (2.1.4). The reaction took place in the Rotor-Gene Q (2.1.1) according to the manufacturer’s protocol. For quantification, Rotor-Gene

®

Q Series Software (2.1.7) was used. In both systems, elongation factor 1a (EF1a, At5g60390) was used for normalization as reference gene (Zuber et al., 2010a). As additional reference genes, ubiquitin (At4g27960) and protein phosphatase

(At1g13320) were tested, which delivered same results. Each of at least three biological replicas was tested three times.

2.8.4 Microarray analysis

2.8.4.1 Labeling, hybridization, staining and scanning

250 ng total RNA were transferred into biotinylated aRNA using 3' IVT

Express Kit (2.1.4) according to manufacturer’s protocol: After cleanup,

15µg labeled aRNA was fragmented at 94°C for 35 min and then hybridized onto the arrays (2.1.3) for 16 h at 45°C and 60 rpm using

Hybridization Wash and Stain Kit (2.1.4) and GeneChip Hybridization

Oven 640 (2.1.1).

Arrays were washed and stained with GeneChip Fluidics Station 450 and scanned with GeneChip Scanner 3000 7G (2.1.1).

2.8.4.2 Normalization and data analysis

In total, nine arrays were processed, three for each group: 7-week-old

Col-0 as well as 7- and 10-week-old sir1-1 (2.2.3.1). Microarray data were analyzed using a commercial software package JMP Genomics, version 4

(2.1.7). Arrays were annotated using an Entrez Gene based custom CDF file from Brainarray (2.1.7); log2-transformed scores of all spot measures

55

Material and methods were then subjected to quantile normalization; identification of differentially expressed genes was carried out by mixed model ANOVA, taking group and probe_id as fixed effects and array_id as random.

Pathway analysis was performed after Subramanian et al. (2005) with pvalues smaller than 0.05 and false discovery rate (FDR) smaller than 0.75.

2.9 Principal component analysis (PCA)

Data normalization, visualization, and correlation analysis based on

Pearsson correlation were performed using R software (Ihaka and

Gentleman, 1996). Used script is from bioconductor.org (library: pcaMethods).

2.10 Statistical Analyses

Means of different data sets were analyzed for statistical significance using unpaired t-test or ANOVA test. Constant variance and normal distribution of data were checked with SigmaStat 3.0 (2.1.7) prior to statistical analysis. The Mann-Whitney rank sum test was used to analyze samples that did not follow normal Gaussian distribution. Asterisks in all figures indicate the significance: *, 0.05 ≥ p > 0.01; **, 0.01 ≥ p > 0.001; ***, p ≤ 0.001.

56

Results

3 Results

3.1 Complementation and stress induction of the

T-DNA insertion lines sir1-1 and sir1-2

Sulfite reductase (SiR, AT5G04590) is the only member of the sulfur assimilation pathway in Arabidopsis which is encoded by a single-copy gene (Bork et al., 1998). Two T-DNA insertion lines for SiR were identified and obtained from GABI-Kat collection center: sir1-1 (550A09) and sir1-2

(727B08). Previously, they had been characterized to a certain extent

(Khan, 2008; Khan et al., 2010). More detailed analyses were performed to find out whether the phenotype of SiR mutants results from reduced flux of sulfur into cysteine and GSH. Therefore, chemical

complementation of both mutant lines was carried out (3.1.2). Sulfite

toxicity may also be possible for the phenotype of SiR mutants. Sulfite is accumulated in sir1-1 (Khan et al., 2010) and is a toxic agent for cell compounds, e.g. DNA. In order to investigate the resistance of sir1-1 to sulfite, a sulfite stress test was performed (2.2.7). Genetic

complementation of sir1-2 (3.1.1) was required to demonstrate that the

effects observed in the mutant derive from the SiR mutation. Leaf- and root-specific complementation of sir1-1 was carried out to demonstrate

the importance of SiR in each of examined tissues (3.1.2).

3.1.1 Genetic complementation of homozygous sir1-2

For genetic complementation of the sir1-2 mutant, the SiR open reading frame fused to its plastidic transit peptide was amplified from a cDNA clone and resulted in the vector described in Khan et al. (2010).

Heterozygous sir1-2 plants were transformed (2.2.7) with this vector expressing the SiR cDNA with its plastidic transit peptide under the control of the constitutive 35S cauliflower mosaic virus promoter. After

BASTA

®

selection of the transformed plants, homozygous sir1-2 mutants were identified via PCR (2.4.2) using the primers 605 and 606 which results in a 1 kb PCR product indicating the wild-type allele, and the

57

Results primers 1037 and 1038 (2.1.6) resulting in a 0.6 kb PCR fragment

indicative for the sir1-2 mutants (Fig. 1B). Successful integration of

complementation vector was checked by using construct-specific primers

1192 and 1193 (2.1.6) producing a 1054 bp PCR product (Fig. 1A). The severe phenotype of sir1-2 was completely restored (Fig. 1C) by expression of SiR under control of the 35S promoter.

Fig. 1 Complementation of sir1-2 with SiR restores wild-type phenotype.

(A) Genomic DNA was extracted from leaves of 7-week-old wild-type (Col-0) and transformed sir1-2 plants and tested for construct allele by PCR. (B) Genomic DNA was extracted from leaves of 7-week-old wild-type (Col-0), complemented heterozygous

(het.) and homozygous (hom.) sir1-2 plants and tested for wild-type and T-DNA insertion allele by PCR. The absence of the wild-type allele specific product in hom. proved the homozygosity of the complemented sir1-2. (C) Growth phenotype of genetically complemented sir1-2 (right) was indistinguishable from wild-type (left). In contrast, homozygous sir1-2 plants died in two-leaf-stage (middle) of development.

3.1.2 Tissue-specific genetic complementation of sir1-1

A construct with leaf-specific soybean rubisco promoter (SRS1p,

Dhankher et al., 2002) was used for cloning of SiR after promoter.

Therefore, SiR was amplified as described in 3.1.1. For SiR amplification

the primers 1774 and 1775 were used to introduce restriction sites (2.1.6).

After ligation of SiR to the construct (2.4.4), a sequence containing SRS1 promoter, SiR, and SRS1 terminator was cut out using restriction enzymes

NotI and XhoI and introduced to Gateway

®

entry vector pENTR

TM

4 Dual

Selection (Invitrogen). Via a LR recombination reaction according to the supplier’s instructions (Invitrogen), the expression construct was introduced to vector pMDC123 containing a BASTA

®

resistance gene as marker (Curtis and Grossniklaus, 2003) for expression of SiR in leaves of

58

Results the mutant sir1-1. Seed setting homozygous sir1-1 plants were transformed with the leaf-specific construct (2.2.8). Seeds of transformed plants were sown on soil and sprayed with 0.2 g/l glufosinate ammonium solution (BASTA

®

; 2.1.2) on four-leaf stage plants (2.2.8). The treatment was repeated one week later.

For generation of a root-specific construct, promoter of a glycosyltransferase (At1g73160) from Arabidopsis (Vijaybhaskar et al.,

2008) was amplified from wild-type gDNA (2.4.1) with restriction site introducing primers 1772 and 1773 (2.1.6). SRS1p was removed from the leaf-specific SiR complementation construct via restriction enzymes NotI and XmaI (2.1.5) and the root-specific glycosyltransferase was ligated into the final construct. Plant were transformed and screened for positive transformants with BASTA

®

as described for leaf-specific promoter. For each complementation construct more than ten sir1-1 plants were tested via BASTA selection as positive, hence they contain the respective construct (Fig. 2). Expression of SiR in leaves could rescue the phenotype of the 7-week-old mutant fully, while SiR expression in roots did not change the growth phenotype of sir1-1. These results indicate that SiR expression in leaves is essential for proper growth of Arabidopsis while

SiR expression in roots seems to have a minor role. However, to make a more certain statement, the exclusive expression of construct in the respective tissue should be demonstrated.

59

sir1-1 + leaf-specific compl.

sir1-1 + root-specific compl.

Results

2 cm

Fig. 2 Complementation of sir1-1 with tissue-specific SiR expressing constructs.

Phenotype of 7-week-old sir1-1 plants (2.2.3.1) complemented (2.2.8) with leaf-specific construct (left). sir1-1 plants containing the root-specific construct (right) were not complemented.

3.1.3 Chemical complementation of SiR mutant lines

It is known that in Mycobacterium tuberculosis sirA gene encoding for sulfite reductase is essential for growth on oxidized sulfur. However, the mutant strain could be rescued by supply with reduced sulfur like sulfide or cysteine (Pinto et al., 2007). Preliminary complementation experiments for SiR mutants were performed in hydroponic cultures (sir1-1) or on standard AT media (sir1-2) with 1 mM GSH and 0.1 mM sulfide, however no cysteine was applied and since sir1-2 mutants were not able to grow, it was considered that accumulation of sulfite could cause their death, so

sir1-2 mutants were additionally grown in the absence of sulfate (Khan,

2008). Those experiments showed that the supplied sulfide or GSH could partially complement the sir1-1 phenotype and the seedling lethal phenotype of sir1-2 was also only partially rescued, when sulfate was absent.

The experiments were repeated to verify the observed results. Plants were grown under sterile conditions on AT media with addition of either 1 mM cysteine or 1 mM GSH ethyl ester (2.2.3.4). GSH ethyl ester was used because of its better permeability of the plasma membrane than GSH (Ito

60

Results et al., 2003; Meyer et al., 2007). Plants were transferred onto new AT media every second week under sterile conditions to avoid nutrition depletion. In the presence of sulfate (+S) and cysteine Col-0 plants grew better than on sole +S and they reached up to three-fold bigger size when

GSH was added (Fig. 3A). The exogenous supply of cysteine and GSH counteracted the retarded growth phenotype of sir1-1 mutants. This was not the case for sir1-2 mutants: while heterozygous sir1-2 plants grew normally on +S, homozygous sir1-2 plants died after the 2-leaf-stage as expected. The addition of GSH could not rescue the phenotype of these

sir1-2 plants and they died like on +S. Only when cysteine was provided could the lethal phenotype be rescued, but the plants never reached the wild-type size.

A

+S +GSH

+S +S +Cys

Col-0

sir1-1 sir1-2

B

Col-0

-S -S +Cys

1 cm

-S +GSH

sir1-1 sir1-2

1 cm

Fig. 3 Chemical complementation of sir1-1 and sir1-2.

(A) 7-week-old Col-0, sir1-1 and sir1-2 plants were grown under sterile conditions on AT media (2.2.3.4) containing sulfate as a source for oxidized sulfur (left), with addition of cysteine (middle) or GSH ethyl ether (right) as sources for reduced sulfur compounds.

(B) Conditions were as described for panel (A), except that sulfate was absent.

61

Results

Col-0, sir1-1 and sir1-2 plants were grown on sulfate-free AT media (-S) to avoid excessive sulfite accumulation in sir1-2 mutants (Fig. 3B). While on

-S+GSH Col-0 plants did not show the huge growth phenotype on

+S+GSH anymore, response of sir1-1 plants grown on -S was similar to those grown on +S. sir1-2 plants died at the same developmental stage when the oxidized sulfur resource was removed from growth media.

However, addition of cysteine or GSH could partially rescue the sir1-2 phenotype, and they were bigger in size compared to +S when oxidized sulfur was absent, but still 80 - 90% smaller than wild-type. These results suggest that both accumulation of sulfite and decrease of reduced sulfur compounds result in sir1-2 phenotype and most effective complementation occur by sulfate absence and cysteine supply, followed by -S+GSH.

3.1.4 Sulfite treatment of sir1-1 to assess stress resistance

Having shown that downstream metabolites of SiR like cysteine and GSH could rescue the sir1-1 phenotype, it was of interest to show if the accumulation of sulfite in sir1-1 (Khan et al., 2010) reduces sir1-1’s ability to defeat additional stress caused by sulfite. To assess this, 7-week-old wild-type and sir1-1 plants were subjected to sulfite stress as described in

2.2.7. As an additional control for the developmental stage, 5-week-old wild-type plants were used. To show that the observed effects are due to reduced SiR function, a sir1-1 complemented line was used, too. After 12 h of sulfite treatment, sir1-1 was severely affected and showed lesions while

all controls did not show remarkable damages (Fig. 4). High levels of toxic

sulfite in sir1-1 leaves and additionally, its reduced sulfur flux into cysteine and GSH impact the mutant negatively when it was forced to buffer excess of sulfite.

62

A

Results

B

C

Fig. 4 sir1-1 is sensitive to sulfite stress.

Leaf pieces of 7-week-old plants (2.2.3.1) were cut and allowed to float on 50% MS salt solution in plates without (left, control) or with 50 mM sulfite (right) for 12 h. 5-week-old wild-type plant served as a developmental stage control. Complemented sir1-1 showed that the observed damages are derived from the lack of SiR function.

3.2 Phenotypic and metabolic characterization of

sir1-1

3.2.1 Growth-based phenotypic analysis of sir1-1

Khan et al. (2010) previously reported that 6-week-old sir1-1 is reduced in size and pale when compared with wild-type plants of the same age. sir1-1 and wild-type plants were sowed on soil and grown under short day conditions (2.2.3.1) to investigate if sir1-1 could catch up wild-type in size and if so, at which stage. The growth was documented weekly (Fig. 5A).

sir1-1 showed more pale leaves. At week 11, when wild-type plants already set flowers, sir1-1 reached the size of 7- to 8-week-old wild-type plants and after 13 weeks it was close to wild-type plants of same age. After 11 weeks, the wild-type flowers were visible and after 13 weeks, the first wild-type leaves started the senescence program which led to reduced rosette diameter and leaf number (Fig. 5B and C). Determination of “total exposed leaf area” according to Boyes et al. (2001) showed that sir1-1 had less leaf surface exposed to light for photosynthesis (Fig. 5D). The reduction of leaf surface from week 11 to 13 may seem astonishing, it was however due to the overlaying of leaves in the rosette while they were

63

Results photographed. The second reason for decreasing leaf surface in wild-type plants was the above-mentioned senescence.

After realizing that sir1-1 was retarded in vegetative growth and could reach the wild-type size, it was important to quantify the germination.

Seeds of wild-type and sir1-1 plants were stratified for 2 to 3 days at 4°C and grown in growth chamber under long day conditions on MS plates as described in 2.2.3.3. First, the germination rate of wild-type and sir1-1 mutant plants was quantified by radicle appearance on full media consisting of MS with addition of 1% (w/v) sucrose. 3 experiments from different batches were performed; in all experiments sir1-1 germination rate was worse than that of the wild-type (Fig. 6). After germination, the growth of sir1-1 was slower compared to wild-type (Fig. 6D) as observed for soil-grown mutant plants (Fig. 5A).

64

Results

Fig. 5 Rosette-based phenotypic analyses reveal contracted growth of sir1-1.

(A) Top view of Col-0 and sir1-1 plants. (B) Rosette diameter, (C) leaf number, and (D) total exposed leaf area were measured weekly. sir1-1 grew slower and reached the size of 7- to 8-week-old wild-type plants after approx. 11 weeks. Plants were grown on soil under short day conditions (2.2.3.1); (n = 3), (means ± SEM).

65

A

120

100

80

60

40

20

0

MS (+sucrose), Exp. 1

C

120

100

80

60

40

20

0

1 2 3 4 5 6 14

Time (d)

MS (+sucrose), Exp. 3

1 2 3 5 7 14

Time (d)

D

1 d 2 d

Col-0

3 d

Results

MS (+sucrose), Exp. 2

B

120

100

80

60

40

20

0

1 2 3 4 5 6 14

Time (d)

Col-0

sir1-1

5 d 7 d

sir1-1

1 mm

Fig. 6 On full media sir1-1 has a lower germination rate than wild-type.

Seeds of Col-0 and sir1-1 were put on MS media with sucrose which was defined as full media. Plants were grown under sterile long day conditions (2.2.3.3). Experiment was repeated 3 times with seeds coming from different batches. (A) sir1-1 of this batch showed a very low germination rate. (B) and (C) sir1-1 plants had a lower germination rate, however not as severe as in experiment 1. (D) Germination of plants from experiment 3 was documented on days 1, 2, 3, 5 and 7 in growth chamber; (n = 3),

(means ± SEM).

Germination tests were repeated without sucrose on MS media (Fig. 7A), and on 0.6% agarose (2.2.3.3) without MS or sucrose (Fig. 7B) to exclude the triggering effect of exogenously supplied nutrition on germination rate. Here also, sir1-1 performed worse, so it could be assumed that independent from nutrient supply, sir1-1 seeds germinate worse than wild-type seeds.

66

Results

Fig. 7 sir1-1 has a lower germination rate than wild-type on deficient media.

Plants were grown under sterile long day conditions (2.2.3.3). (A) Seeds of Col-0 and

sir1-1 were put on MS media without sucrose and (B) only on agarose gel. sir1-1 plants had a lower germination rate. (D) and (E) To determinate the germination rate on

Miracloth tissue, the experiment was repeated 2 times with seeds coming from different batches. In both experiments sir1-1 showed lower germination rate than wild-type. (C) As a control, seeds were grown on Miracloth tissue with full media. (F) Germination of plants from experiment 1 were documented on days 1, 2, 3 and 5 in growth chamber; (n

≥ 3),

(means ± SEM).

67

Results

The germination tests were additionally performed on Miracloth tissues

(2.1.3) to exclude the potential effects of polymerization chemicals. Again,

sir1-1 had a lower germination rate than Col-0 when MS and sucrose were suitable for seeds (Fig. 7C) or when the experiments were carried out in their absence after imbibition in water (Fig. 7D and E). First wild-type radicles were visible at day 2, whilst sir1-1 radicles were first seen on day 3

(Fig. 7F). During the growth period of wild-type plants, the cotyledons were opened. This was not the case for sir1-1.

3.2.2 Determination of chlorophyll amounts in leaves

Due to the observed pale phenotype of sir1-1 leaves (Fig. 5A) and their reduced exposed leaf area (Fig. 5D), the chlorophyll content in sir1-1 leaves was analyzed. It was of interest to know whether the observed effects correlated with changing chlorophyll content. Total chlorophyll was extracted from 7-week-old wild-type and sir1-1 plants for photometric determination (2.7.11). Measurement of chlorophyll a and b content revealed a significant reduction in sir1-1, hence total chlorophyll was reduced (Fig. 8). Interestingly, reduction of chlorophyll is also observed when Arabidopsis plants suffer from sulfur withdrawal (Nikiforova et al.,

2005), a situation that is similar for sir1-1 plants since they have a decreased flux of sulfur into reduced sulfur compounds.

68

Results

1.4

1.2

Total chlorophyll

Chlorophyll a

Chlorophyll b

1.0

0.8

0.6

0.4

0.2

***

***

**

0

Col-0

sir1-1

Fig. 8 Total chlorophyll is decreased in sir1-1 leaves compared to wild-type.

Total chlorophyll was extracted from leaves of 7-week-old wild-type and sir1-1 plants for photometric determination. Chlorophyll a and be, hence, total chlorophyll were significantly decreased in sir1-1; (n = 3), (means ± SEM).

3.2.3 Determination of starch levels in leaves

Assuming impaired photosynthesis and reduced carbon content in sir1-1 leaves (Khan et al., 2010), starch levels were analyzed. In order to determine starch content, 7-week-old plants were harvested during day and night at indicated time points and starch was extracted and quantified according to 2.7.9.3. The measurement revealed that at all time points

sir1-1

had a lower starch contents (Fig. 9A). In sito staining of sink and source leaves which were harvested 3 h after onset of light showed a strong reduction of starch levels in sir1-1 mutant (Fig. 9B). To answer the question if starch synthesis and degradation occur or de-novo starch synthesis is inhibited, leaves of sir1-1 and wild-type plants were isolated and prepared for electron microscopy (2.6.2). Like wild-type plants, sir1-1 was able to synthesize starch during the light period (Fig. 10A) and the accumulated starch was degraded during the night (Fig. 10B) to provide soluble sugars when no photosynthesis occurs.

69

Results

70

A Col-0

sir1-1

5 µm

B

Col-0

sir1-1

1 µm

5 µm

Results

1 µm

Fig. 10 sir1-1 can synthesize and degrade starch.

Leaves of 7-week-old wild-type and sir1-1 plants were used for electron microscopy

(2.6.2). (A) Leaves of wild-type and sir1-1 plants 1 h after onset of light. (B) Leaves of wild-type and sir1-1 after 16 h of darkness. [Experiment was carried out in cooperation with Dr. Stefan Hillmer.]

71

Results

3.2.4 Metabolite changes in leaves of soil-grown plants

Having observed changes in the level of starch and knowing that also glucose, fructose and sucrose were reduced in sir1-1 leaves (Khan et al.,

2010), large scale metabolite quantification was performed to get more insight into the mutant’s response to reduced sulfide production. GC/MS analysis was used to quantify amino acids, sugars, alcohols and organic acids as described in Lisec et al. (2006) and 2.7.2.

55 metabolites were measured, of which 24 metabolites were significantly changed in sir1-1 mutants (Fig. 11). Steady state levels of detected amino acids in leaves of sir1-1 increase in comparison to wild-type. A complete list of measured metabolites is in Suppl. data 1. Metabolite quantification was carried out by Dr. Adriano Nunes-Nesi (MPI, Golm).

72

Results

Asparagine

Aspartic acid

Isoleucine

Phenylalanine

Proline

Threonine

Tyrosine

X-fold of wild-type

10.2

4.5

2.1

2.1

2.1

3.4

2.0

10.2

5.0

1.0

Galactinol

Glucose

1-O-methyl-alpha-Glucopyranoside

1,6-anhydro-beta-Glucose

Isomaltose

Maltitol

Maltose

Raffinose

Sucrose

Trehalose

Citric acid

Dehydroascorbic acid

Fumaric acid

Glycolic acid

Malic acid

Succinic acid

0.2

0.3

0.2

0.6

0.0

0.1

0.1

0.1

0.5

0.2

2.3

0.3

0.4

0.5

0.3

0.4

0.1

3-hydroxy-Pyridine 0.6

Fig. 11 Metabolic analysis of soil-grown sir1-1 and wild-type plants.

Soil-grown 7-to-8-week-old wild-type and sir1-1 plants were used for extraction of soluble metabolites which were detected via GC/MS as described in 2.7.2. Significantly changed metabolites are shown. Misc, miscellaneous; (n = 4), (p < 0.05).

73

Results

In sir1-1 leaves, asparagine (10.2-fold) and aspartic acid (4.5-fold) showed the highest changes compared to wild-type. Sugars and alcohols were also reduced. This was also the case for glucose and sucrose as previously reported (Khan et al., 2010). As a third major group, organic acids were reduced, with exception of citric acid. The deregulation of the tricarboxylic acid cycle (TCA cycle) prompted us to investigate metabolites related to

Fig. 12 Adenosine levels were changes in sir1-1 compared to wild-type plants.

7-week-old plants were used for extraction and quantification of adenosines. (A) SAM,

S-adenosyl methionine. (B) SHC, S-adenosylhomocysteine. (C) MTA, methylthio adenosine. (D) ADP, adenosine diphosphate. (E) APS, adenosine-

5′-phosphosulfate. (F)

ATP, adenosine triphosphate. (G) PAP, phosphoadenosine phosphate; (n = 3), (means ±

SEM).

74

Results this pathway more in detail. Adenosines were extracted and determined

(2.7.4). A deregulation of major compounds of adenosines was observed

(Fig. 12). Only S-adenosylhomocysteine was unaffected (Fig. 12B). ADP and ATP were down-regulated (Fig. 12D and F), in accordance with the changes in citrate, succinate, fumarate and malate (Fig. 11).

3.2.5 Determination of APR2 transcript and APR activity

Since APS accumulated in sir1-1 leaves (Fig. 12E) and APS reduction to sulfite via APS reductase (APR) is a critical step prior to SiR (Kopriva and

Koprivova, 2004), mRNA (2.9.1) was extracted from leaves of 7-week-old wild-type and sir1-1 plants to determine levels of APR2, the major APR isoform. cDNA synthesis (2.9.3.1) and qRT-PCR (2.9.3.2) were performed with the primers 1713 and 1714 (2.1.6). The APR2 transcript was downregulated by approx. 80% (Fig. 13A). Proteins were extracted from the same plants as above and APR activity was determined (2.5.6.2). Also, the activity of APR isoforms was reduced in sir1-1 leaves (Fig. 13B), indicating decreased sulfur reduction due to the lack of SiR activity (Fig. 37).

A B

1.4

8

1.2

1.0

7

6

5

*

0.8

0.6

4

3

0.4

0.2

**

2

1

0

0

Col-0

sir1-1

Col-0

sir1-1

Fig. 13 APR2 transcript and total APR activity is reduced in sir1-1 leaves.

Plants were grown on soil under short day conditions for 7 weeks for RNA and protein extraction. (A) mRNA was extracted from leaves and submitted to cDNA synthesis and qRT-PCR; (n = 3). (B) Proteins were extracted from leaves and APR activity was performed; (n

≥ 5), (means ± SEM). [APR activity was determined by Dr. Florian Haas.]

75

Results

3.2.6 Detection of sulfide

Sulfide was a metabolite of major interest since it is the direct product of the SiR, which is down-regulated in sir1-1 (Fig. 37). To quantify sulfide from leaf tissue, we established an extraction and detection method via

HPLC based on derivatization of sulfide with monobromobimane (2.7.3) and tested if the assumed evaluated signal was sulfide (Suppl. data 6). For that purpose, sulfide contents were extracted from approx. 25 mg leaf tissue and determined, in parallel to the sulfide standard (e.g., 100 pmol).

The sum of the levels was set as 100% (Fig. 14A). Same amounts of sulfide standard and leaf extract were mixed and detected. We gained a recovery rate of 101.6% ± 6.8 showing that the assumed sulfide peak represent indeed sulfide. Afterwards, we extracted sulfide from leaves of 7-week-old soil-grown wild-type and sir1-1 plants (2.7.3). No significant changes were observed in the steady-state level of sulfide in sir1-1 leaves compared to wild-type (Fig. 14B).

A

800

B

50

101.6%

± 6.8

100%

±

1.9

600

400

200

40

30

20

10

0 0

[Leaf] [Sulfide] [Leaf + sulfide] Col-0

sir1-1

Fig. 14 Sulfide detection in leaf tissue reveals no changes in sir1-1 compared to wild-type.

7-week-old plants were used for extraction and quantification of sulfide. (A) Recovery test proved that the peak of interest is sulfide and it could be measured. (B) Sulfide levels were unchanged in sir1-1 leaves; (n = 3), (means ± SEM).

3.2.7 Effects of sulfur availability on metabolites in vegetative tissues of hydroponically grown plants

In order to investigate the effects of sulfur availability on the metabolome of wild-type and sir1-1 plants, hydroponic cultures were used (2.2.3.2).

This system allows harvesting of root material for determination of

76

Results metabolites. First, thiols of soil- and hydroponically grown wild-type and

sir1-1

plants were analyzed to investigate if there were changes in metabolites due to different growth conditions. 6-week-old plants which were grown on soil or in hydroponic cultures and 7- to 8-week-old soilgrown plants were used for the analysis via HPLC (2.7.3). No significant changes were observed between the different ages of plants or the different growth systems, when cysteine levels (Fig. 15A) and GSH (Fig.

15B) were analyzed. However, differences were observed when comparing metabolite profiles from leaves of soil-grown plants (Fig. 11) with the results from hydroponic groups (Fig. 16), i.e. all significantly changed amino acids were accumulated in leaves of soil-grown sir1-1 compared to wild-type plants, whereas some amino acids were reduced in leaves of hydoponically grown sir1-1 in comparison to wild-type plants. The measurements showed that comparisons of results from hydroponic plants and soil-grown plants must be carried out very carefully. A complete list of measured metabolites from hydroponically grown plants is in Suppl. data 2 - 5. Metabolite quantification was carried out by Dr.

Adriano Nunes-Nesi (MPI, Golm).

Fig. 15 Thiol contents of soil- and hydroponically grown plants were similar.

Thiols were extracted from plants grown under short-day conditions, derivatized and quantified via HPLC. (A) Cysteine and (B) GSH levels were unchanged between the compared groups; (n = 3), (means ± SEM).

3.2.7.1 Effects of sulfur availability on metabolites in leaves

6-week-old wild-type and sir1-1 plants grown in hydroponic cultures were used to determine metabolites via GC/MS as described in 3.2.4. Plants

77

Results were grown on ½ Hoagland medium (2.2.3.2) with (+S) or without (-S) sulfate to investigate and compare the effects of sulfate on wild-type and

sir1-1

metabolites. 18 out of 52 detected metabolites from +S leaves showed significant changes when sir1-1 was compared to wild-type (Fig.

16). As mentioned above, the pattern of changed metabolites is slightly different when the results from two different growth conditions are compared. However, 2 proteinogenic amino acids were higher in sir1-1

(serine and valine). Guanidine, a product of protein metabolism and the functional group of arginine was elevated 9-fold in sir1-1. Additionally, a

1.8-fold increase in urea content indicated protein breakdown. This was supported by the 2.2-fold increase of polyamine putrescine which is produced during arginine degradation (Imai et al., 2004) and the increased expression of genes (array data) involved in arginine or putrescine breakdown (SPDS1, SPDS2, ADC1, ADC2 and ACL5) (Hanzawa et al., 2002; Imai et al., 2004). Also the non-proteinogenic amino acid

GABA (4-amino-butric acid) accumulated in leaves of sir1-1. The other amino acids were reduced in sir1-1. No statement can be made for histidine, arginine and leucine that were not detected. Less sugars and alcohols were affected than in soil-grown plants. Interestingly, neither glucose nor fructose were altered. Organic acids were disrupted indicating deregulation TCA cycle.

78

Results

Aspartic acid

GABA

Glutamic acid

Glycine

Methionine

Serine

Valine

X-fold of wild-type

0.4

1.6

0.5

0.4

0.4

1.6

2.3

9.0

5.0

1.0

1,4-lactone-Galactonic acid

Raffinose

Threonic acid

Xylose

Dehydroascorbic acid

2-methyl-Malic acid

Pyruvic acid

Succinic acid

0.6

8.3

0.7

0.7

0.4

3.2

0.4

0.5

0.1

Guanidine

Putrescine

Urea

9.0

2.2

1.8

Fig. 16

Leaf metabolic analysis of sir1-1 and WT plants grown hydoponically on +S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2. Significantly changed metabolites are shown. Misc, miscellaneous; (n = 4), (p < 0.05).

In order to induce sulfur deficiency, plants were transported from +S medium to S-deficient medium for 6 h and then harvested. Metabolites were extracted and determined. Under -S conditions, 28 of 59 detected metabolites were significantly changed in leaves of sir1-1 when they were compared to wild-type (Fig. 17). Amino acid levels were changed. Valine and tryptophan were elevated 1.6- and 2.4-fold, respectively. Proline and glycine were each reduced 70%. Organic acid levels were also changed.

Citric acid was increased by 5-fold in sir1-1 leaves, 2-methyl malic acid

3.4-fold and glyconic acid 1.8-fold. Glyconic acid is an intermediate of the glycine and the serine pathway, which is believed to be the primary substrate of photorespiration (Zelitch, 1973) and reduces the net rate of photosynthesis by photorespiration (Tolbert and Ryan, 1976). Sugars and alcohol levels were also changed: Fructose, glucose and sorbose were reduced by 60%, and trehalose by 70%. Raffinose and galactinol were strongly elevated, 3.8- and 6.3-fold, respectively. Arginine can be

79

Results processed via arginase to form urea and ornithine. The latter one was reduced by 30% and urea was increased 1.7-fold.

Microarry data revealed that a putative arginase (At4g08870) was more than 2-fold expressed in sir1-1; however, the data are from plants under normal conditions.

GABA

Glycine

Ornithine

Proline

Tryptophan

Valine

X-fold of wild-type

1.7

0.3

0.7

0.3

2.4

1.6

6.3

5.0

1.0

Fructose

Fucose

Galactinol

1,4-lactone-Galactonic acid

Glucoheptose

Glucose

Isomaltose

Lyxose

Melezitose

Raffinose

Sorbose

Trehalose

Citric acid

Dehydroascorbic acid

Glycolic acid

2-methyl-Malic acid

Pyruvic acid

Succinic acid

0.4

0.6

3.0

0.5

3.2

3.8

6.3

0.6

2.0

0.4

0.4

0.3

5.0

0.3

1.8

3.4

0.3

0.5

0.1

Guanidine

Shikimic acid

Spermidine

Urea

2.3

1.3

0.0

1.7

Fig. 17 Leaf metabolic analysis of sir1-1 and WT plants after transfer to -S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2. Significantly changed metabolites are shown. Misc, miscellaneous; (n = 4), (p < 0.05).

After discovering the responses of sir1-1 in comparison to wild-type under normal and -S conditions, it was of interest to investigate the metabolite ratios for wild-type as well as for sir1-1 plants when they were transferred

80

Results from +S to -S. Many amino acids were up-regulated and none downregulated in leaves when wild-type plants were subjected to external S deficiency; the same sulfur availability changes also caused an increase of this metabolite group in sir1-1 leaves, however only in 5 amino acids (Fig.

18). Also among sugars and alcohols there were members which were changed in -S, including glucose (0.2-fold of +S) or glycerol (1.5-fold of

+S). In sir1-1 none of them showed any change in +S:-S ratio. Changes of organic acids were not uniform. In both groups, some were changed, however never the same metabolites.

The +S:-S responses of wild-type and sir1-1 were compared with each other to figure out if the measured metabolites showed the same response to sulfur deficiency or not. Significantly different responses were marked with asterisks as indicated in 2.10. 15 of 23 (65.2%) changed metabolites showed different +S:-S responses when wild-type and sir1-1 were compared. Principal Component Analysis (PCA) was performed to detect the differences between data sets of wild-type and sir1-1 metabolites under +S and -S (Fig. 19). PCA revealed that metabolite data sets from wild-type plants (+S and -S) clustered more closely to each other. The same was the case for sir1-1 metabolite data sets when +S and -S were scored (Fig. 19A and B), meaning that in comparing wild-type and sir1-1 plants, leaf metabolome correlates rather endogenously after 6 h of sulfur deficiency than with change of environmental conditions.

81

Results

beta-Alanine

Alanine

Aspartic acid

GABA

Glutamic acid

Glutamine

Isoleucine

Phenylalanine

Serine

Threonine

Tyrosine

Valine

X-fold of +S:-S

Col-0

sir1-1

**

**

**

*

**

**

*

*

*

**

** n.s.

1.5

1.8

1.2

1.2

2.0

1.6

1.6

1.9

1.6

1.3

1.8

3.0

n.s.

*

** n.s.

**

* n.s.

** n.s.

n.s.

n.s.

n.s.

0.8

1.8

0.8

0.8

1.3

1.1

1.2

1.6

3.6

1.4

3.1

3.4

Erythritol

1,4-lactone-Galactonic acid

Glucose

Glycerol

**

**

**

*

1.1

1.3

0.2

1.5

n.s.

n.s.

n.s.

n.s.

0.8

1.4

0.1

0.4

Response

+S:-S ratio

Col-0/sir1-1 n.s.

**

* n.s.

* n.s.

*** n.s.

***

***

*

*

** n.s.

*

***

5.0

1.0

0.1

Benzoic acid

Citric acid

Malic acid

Succinic acid

* n.s.

n.s.

*

1.4

1.3

1.2

1.4

n.s.

**

* n.s.

1.2

3.7

1.9

1.3

n.s.

**

* n.s.

Guanidine

Octadecanoic acid

Putrescine

*

***

**

2.9

0.4

1.5

n.s.

*** n.s.

0.8

0.3

0.8

* n.s

**

Fig. 18 Leaf +S:-S ratios of wild-type and sir1-1 plants.

6-week-old wild-type and sir1-1 plants were used for extraction of soluble metabolites which were detected via GC/MS as described in 2.7.2. Metabolites are shown, when they were significantly changed at least in one line. Misc, miscellaneous; n.s., not significant; (n = 4), (p < 0.05).

82

A

Col-0

(+S)

Col-0

(-S)

B

sir1-1

(-S)

sir1-1

(+S)

Results

-S +S -S +S

Col-0

sir1-1

Fig. 19 PCA on WT and sir1-1 leaf metabolites from +S and -S conditions.

(A) Score plot of PC1and PC2 of leaf metabolite data from 6-week-old wild-type and

sir1-1 plants followed by PCA. (B) Cluster dendogram showing the relationship of leaf metabolite data sets; (n

5).

83

3.2.7.2 Effects of sulfur availability on metabolites in roots

Results

In order to measure the metabolome response in roots of wild-type and

sir1-1 plants, root metabolic profiling was performed according to 3.2.7.1.

The root material was taken from the same plants which were used for leaf metabolite extraction and detection. When comparing wild-type and sir1-1 grown constantly on +S media, 30 of 56 measured metabolites from roots were significantly changed (Fig. 20). Proteinogenic amino acids glycine

(1.3-fold), isoleucine (1.3-fold), alanine (1.6-fold) and serine (2.6-fold) were evaluated in sir1-1 roots and proline (0.4-fold), asparagine (0.5-fold) and glutamic acid (0.6-fold) were reduced. OAS, a cysteine precursor was also elevated (2.6-fold). Several sugars and alcohols were accumulated, including glycerol (2.2-fold), galactinol (1.9-fold) and erythrose (1.8-fold).

Maltose (0.7-fold) and glucoheptose (0.6-fold) were decreased. Organic acids showed perturbation. Like in leaves, urea and putrescine were accumulated indicating protein and amino acid breakdown in the roots of

sir1-1.

The sir1-1 root metabolome was compared to that of the wild-type after

6 h of sulfur withdrawal to investigate the root response. 20 of 55 evaluated metabolites were significantly changed. Serine and OAS were accumulated in the mutant when it was subjected to -S (Fig. 21). All sugars and alcohols were up-regulated, except for xylose. Also, all changed organic acids were elevated in sir1-1 roots when they were compared to the wild-type.

84

Results

beta-Alanine

Alanine

Asparagine

Aspartic acid

GABA

Glutamic acid

Glycine

Isoleucine

Phenylalanine

Proline

Serine

O-acetyl-Serine

Threonine

X-fold of wild-type

1.2

1.6

1.3

1.3

0.8

0.4

0.5

0.7

0.6

0.6

2.6

2.8

0.8

5.0

1.0

0.1

Erythrose

Galactinol

Galactonic acid

Glucoheptose

Glycerol

Glycerol-3-phosphate myo-Inositol

Maltose

Melezitose

Sucrose

2-oxo-Glutaric acid

Glycolic acid

Malic acid

Pyruvic acid

2.2

1.6

1.2

0.7

1.6

1.5

1.8

1.9

1.2

0.6

0.6

1.8

0.7

1.6

Urea

Octadecanoic acid

Putrescine

1.6

4.9

1.6

Fig. 20 Root metabolic analysis of sir1-1 and WT plants grown hydoponically on

+S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2. Significantly changed metabolites are shown. Misc, miscellaneous; (n = 4), (p < 0.05).

85

Results

Lysine

Serine

O-acetyl-Serine

Threonine

X-fold of wild-type

0.6

1.7

3.2

0.6

5.0

1.0

Erythritol

Galactinol

Glycerol

3-phosphate-Glycerol

Lactic acid

Maltose

Sorbose

Sucrose

Trehalose

Xylose

1.8

1.4

2.3

4.1

0.7

2.5

4.5

2.3

2.2

3.6

0.1

Benzoic acid

Citric acid

2-oxo-Glutaric acid

Pyruvic acid

1.7

2.3

2.0

1.8

4-hydroxy-Butyric acid

Nicotinic acid

2.0

0.4

Fig. 21 Root metabolic analysis of sir1-1 and WT plants after transfer to -S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2. Significantly changed metabolites are shown. Misc, miscellaneous; (n = 4), (p < 0.05).

As had been done for leaf metabolites (3.2.7.1), +S:-S responses of wild-type and sir1-1 for root metabolites were compared (Fig. 22): 13 of 37

(35.1%) changed metabolites showed different +S:-S responses when wildtype and sir1-1 were compared. Principal Component Analysis (PCA) was performed to investigate the differences between data sets of wild-type and sir1-1 metabolites under +S and -S (Fig. 23). PCA revealed that metabolite data sets from +S (wild-type and sir1-1) clustered more closely to each other and the same was true for -S metabolite data sets when wildtype and sir1-1 were scored (Fig. 23A). Results shown in dendogram supported this observation (Fig. 23B), meaning that when comparing wild-type and sir1-1, root metabolomes correlate with rather changed exogenous sulfur supply than genetic or metabolic guidelines. This is probably because roots are directly confronted with sulfur stress and have fewer options to adjust, hence, similar responses follow in wild-type and mutant plants.

86

Results

beta-Alanine

Alanine

Asparagine

Aspartic acid

GABA

Glutamic acid

Glutamine

Glycine

Isoleucine

Phenylalanine

Serine

O-acetyl-Serine

Threonine

Tyrosine

X-fold of +S:-S

Col-0

sir1-1

***

***

***

***

***

*

***

***

**

*

**

***

***

***

3.2

3.3

5.0

3.2

2.2

3.1

70.4

3.1

2.6

3.6

2.9

4.0

3.0

4.4

*

***

*

***

**

**

* n.s.

2.0

1.5

***

*

8.8

3.5

**

3.1

***

7.0

*** n.s.

66.4

4.2

1.7

3.8

1.9

4.6

2.3

4.0

Fructose

Fructose-6-phosphate

Galactinol

Glucose

Glucose-6-phosphate

Glycerol

Glycerol-3-phosphate myo-Inositol

Maltose

Melezitose

Sucrose

Trehalose

**

** n.s.

**

**

***

***

*** n.s.

* n.s.

2.8

1.3

n.s.

31.1

1.8

2.8

1.3

4.2

6.4

2.8

2.3

2.3

2.0

***

**

***

***

***

** n.s.

n.s.

*** n.s.

*

1.9

***

101.6

3.0

3.1

1.7

5.4

0.8

1.4

3.6

3.2

5.4

8.6

Citric acid

Fumaric acid

2-oxo-Glutaric acid

Glyceric acid

Malic acid

Pyruvic acid

Succinic acid

*

***

**

***

*

*** n.s.

1.2

1.9

3.7

2.5

2.4

2.9

2.7

*

*

**

**

2.5

**

2.3

*** n.s.

12.1

1.5

6.4

3.2

6.5

Response

+S:-S ratio

Col-0/sir1-1 n.s.

*

* n.s.

n.s.

** n.s.

n.s.

* n.s.

* n.s.

n.s.

n.s.

n.s.

n.s.

* n.s.

n.s.

n.s.

n.s.

n.s.

**

* n.s.

*

* n.s.

** n.s.

* n.s.

*

102

5.0

1.0

0.1

Nicotinic acid

Phosphoric acid

Putrescine

Uracil

***

**

***

**

6.2

1.9

3.8

2.7

***

*

* n.s.

5.5

2.8

4.1

2.6

n.s.

n.s.

n.s.

n.s.

Fig. 22 Root +S:-S ratios of wild-type and sir1-1 plants.

6-week-old wild-type and sir1-1 plants were used for extraction of soluble metabolites which were detected via GC/MS as described in 2.7.2. Metabolites are shown, when they were at least in one line significantly changed. Misc, miscellaneous; n.s., not significant; (n = 4), (p < 0.05).

87

A

Col-0

(-S)

sir1-1

(-S)

sir1-1

(+S)

Col-0

(+S)

Results

B

sir1-1

Col-0

sir1-1

Col-0

+S -S

Fig. 23 PCA on WT and sir1-1 root metabolites from +S and -S conditions.

(A) Score plot of PC1and PC2 of root metabolite data from 6-week-old wild-type and

sir1-1 plants followed by PCA. (B) Cluster dendogram showing the relationship of root metabolite data sets; (n = 6).

88

Results

3.3 Whole transcriptome analysis of sir1-1

Sulfur metabolism is highly inter-connected to both carbon and nitrogen metabolism (Hesse et al., 2003; Wang et al., 2003; Kopriva and

Rennenberg, 2004; Kopriva, 2006). Down-regulation of SiR as a key gene of the sulfur assimilation pathway caused a bottleneck effect in sir1-1 and affected expression of several genes involved in the assimilatory sulfate reduction pathway (Khan et al., 2010). The whole transcriptome was analyzed by microarray assuming a down-regulation of SiR could also have an effect on the regulation of genes from other pathways.

Transcriptome analysis was performed using the Affymetrix array

(2.9.4.1) in cooperation with Dr. Li Li and Maria Saile (ZMF, Mannheim).

Total RNA was extracted (2.9.1) from leaves of soil-grown 7-week-old wild-type and sir1-1 plants. As an additional group for wild-type-like developmental stage, 10-week-old sir1-1 plants were used according to the similar rosette diameter and leaf number (Fig. 5B and C). For each group, three plants were applied. For each sample, 250 ng RNA was reversetranscribed, biotinylated and labeled as aRNA (2.9.4.1). After purification,

15 µg of labeled aRNA was fragmented for 35 min. at 94 °C and then hybridized onto the arrays (2.9.4.1).

22,746 genes were assessed by the array. Only significantly (p < 0.05) changed genes were respected with 1 < 2log-fold-change > -1.

3.3.1 Impact of SiR mutation on gene expression in wild-type and sir1-1 plants of same age

399 genes (136 genes up-, 263 genes down-regulated) were altered in 7week-old sir1-1 compared with wild-type plants of the same age (Fig. 24 and Suppl. data 8). Almost all major pathways were affected (Fig. 25). The most important gene groups with a high number of changed members are listed: signaling (43), protein (40), stress (35), RNA (34), development

(22), hormone metabolism (20), secondary metabolism (10), nucleotide metabolism (10), cell (9), redox (8), lipid metabolism (4) and DNA (3).

Several genes could not be categorized and were summed up in not assigned (75) and miscellaneous (44). In S-assimilation, 5 genes were

89

Results altered and all were down-regulated in sir1-1: APS4 (-1.7-2log-fold), APR3

(-2.1), APR1 (-1.2), APR2 (-1.7) and SiR (-1.3).

90

Results

Fig. 25 Categorized altered genes in 7-week-old sir1-1 compared to wild-type.

399 genes were affected when wild-type and sir1-1 of same age (7 weeks) were compared; (p < 0.05; 1 < 2log-fold-change > -1).

3.3.2 Impact of SiR mutation on gene expression in wild-type and sir1-1 of same developmental stage

To investigate if the observed changes in small sir1-1 plants were due to the growth retardation or SiR dysfunction transcriptome of 10-week-old

sir1-1 mutants of wild-type size were compared to that of 7-week-old wildtype plants. 721 genes were changed (296 up- and 425 down-regulated) in

10-week-old sir1-1 mutants compared to 7-week-old wild-type (Fig. 26 and Suppl. data 9). Like the comparison of wild-type and sir1-1 of the same age, almost all major pathways were affected in mutant (Fig. 27): protein (70), RNA (63), transport, (54) secondary metabolism (43), stress

(36) cell wall (35), redox (24), development (24), lipid metabolism (23), hormone metabolism (23), amino acid metabolism (18), signaling (17), Nmetabolism (7), DNA (7), TCA / org. transformation (6), and a high number of other genes, most arranged in not assigned (141) and

91

Results miscellaneous (73). In S-assimilation 2 genes were changed: APK4 (1.5) and SiR (-1.3).

92

Results

93

Results changed genes unique to size, whereas there were 453 genes unique to age. Additionally, there were 21 genes that were shared among all three comparison groups (Suppl. data 11), indicating that external factors must be responsible for the expression of these genes and that all screened plants must be exposed to those factors. These factors could result from growth conditions, e.g.

sir1-1 (7W) vs.

sir1-1 (10W)

(999)

size

369

147

156

21

453

75 172

age

WT (7W) vs.

sir1-1 (7W; WT-age)

(399)

WT (7W) vs.

sir1-1 (10W; WT-size)

(721)

mutation

Fig. 28 Venn diagram shows unique and shared genes which were changed between and among 7-week-old wild-type, sir1-1 and 10-week-old sir1-1.

Comparative analysis of genes which were regulated in 7-week-old wild-type, 7-week-old

sir1-1 and 10-week-old sir1-1 revealed that 21 genes were regulated in all three groups.

75 genes were changed in sir1-1 due to mutation, 156 genes due to the size, and 453 genes due to the age; (p < 0.05; 1 < 2log-fold-change > -1).

94

Results

Among 75 mutation-specific genes, most (11) were related to RNA, DNA and nucleotide metabolism, while some belonged to amino acid and protein metabolism (9), stress (9), development and hormone metabolism

(6). Several other gene categories showed fewer numbers of affected members like secondary metabolism (4), transport (3) or signaling (2).

This strategy of identifying individual genes that were differentially regulated in mutant and wild-type plants can not detect metabolic pathways that are distributed among entire gene networks and are subtly regulated at the level of individual genes. Analysis of single genes, even if they are carefully arranged in metabolic categories, may miss important effects on pathways. Also, there are several statistically significant genes without any unifying biological theme. A high number of genes from one category does not necessarily result in up- or down-regulation of a related pathway, since the size of this certain category and its relation to connected pathways are not respected. To overcome these barriers, micro array data were submitted to a gene set enrichment analysis (GSEA) as described in Subramanian et al. (2005) and 2.8.4.2: Arrays were annotated using an Entrez Gene-based costum CDF file from Brainarray

(2.1.7). The significantly affected gene sets that are constantly changed in

sir1-1 compared to wild-type are all related to DNA processing and repair

(Tab. 1).

Tab. 1 Affected gene sets due to SiR mutation are linked to DNA repair and stress.

GSEA for comparison of sir1-1 (7- or 10-week-old) to wild-type revealed changes in pathway related to DNA metabolism and stress. Only gene sets were taken into consideration if they had an NES of same tendency (positive or negative for both comparisons). NES, normalized enrichment score; NP, normalized p-value, FDR, false discovery rate; (NP < 0.0.5; FDR < 0.75).

sir1-1 (10W) vs WT si r1-1 (7W) vs WT

Gene set NES NP FDR NES NP FDR

Nucleobase, nucleoside, nucleotide and nucleic acid metabolic process

DNA metabolic process

DNA repair

Response to endogenous stimulus

Response to DNA damage stimulus

1.479

1.709

1.865

1.865

1.839

0.018

0.012

0.002

0.002

0.000

0.741

0.090

0.021

0.041

0.016

1.523

1.620

1.495

1.520

1.500

0.010

0.004

0.040

0.037

0.038

0.440

0.402

0.497

0.423

0.504

For each gene set, the genes contributing to core enrichment were listed in

Suppl. data 12 - 16. As expected, the genes were all involved in pathways directed to nucleobase, nucleoside and nucleic acid metabolic process

95

Results

(Suppl. data 12), DNA metabolic process (Suppl. data 13), DNA repair

(Suppl. data 14), response to endogenous stimulus (Suppl. data 15) and response to DNA damage stimulus (Suppl. data 16).

3.3.4 Affected genes related to sulfolipids and jasmonic acid

Close investigation of the microarray data showed that both SQD

(sulfoquinovose synthase) genes were significantly down-regulated in

sir1-1 compared to wild-type, SQD1 (-0.49 2-log-fold) and SQD2 (-0.22 2log-fold). These genes are involved in sulfolipid biosynthesis: SQD1 transfers sulfite to UDP-glucose catalyzing UDP-sulfoquinovose production (Sanda et al., 2001) and SQD2 catalyzes the transfer of sulfoquinovose from UDP-sulfoquinovose to diacylglycerol. Since sulfite is accumulated in sir1-1 leaves (Khan et al., 2010) and surprisingly these genes are down-regulated, sulfolipids were determined from leaves of 7week-old wild-type and sir1-1 plants (2.7.10). Extracts from the sqd2 mutant (Yu et al., 2002) were used as a negative control, since commercial standards were not accessible. While no sulfolipids were detected in sqd2 mutant, there were clear signals in wild-type and sir1-1 plants (Fig. 29).

Sulfolipids seemed to be unchanged in sir1-1 compared to wild-type, probably to maintain the necessary composition of their photosynthetic plastidic membranes.

96

Results

Col-0 sir1-1 sqd

Fig. 29 Sulfolipids seemed to be unchanged in sir1-1 leaves.

Lipids from the leaves of 7-week-old wild-type, sir1-1 and sqd2 were extracted and analyzed via thin layer chromatography. The arrow indicates the position of sulfolipids.

MYB76 (0.61 2-log-fold), and MYB4 (-0.15 2-log-fold) were changed in

sir1-1. Yanhui et al. (2006) reported that these transcription factors respond to jasmonic acid stimulation. Also altered SQE3 (-0.84 2-logfold) was reported to respond to jasmonic acid related molecules (Devoto et al., 2005), also CEJ1 (-0.51 2-log-fold) (Nakano et al., 2006), DWARF4

(-0.25 2-log-fold), DHAR1 (1.19 2-log-fold) (Sasaki-Sekimoto et al., 2005), and AGP31 (1.46 2-log-fold) (Liu and Mehdy, 2007). These observations raised our interest to find out if jasmonic acid levels were changed in

sir1-1 mutant. Furthermore, accumulated sulfite (Khan et al., 2010), and

APS (Fig. 12E) indicated changes in PAPS level. PAPS can be converted from APS (Kopriva and Koprivova, 2004) and can be used for sulfonation of 12-hydroxyjasmonate into 12-hydroxyjasmonate sulfate, whereby PAP is formed (Gidda et al., 2003). Interestingly, PAP accumulated in sir1-1 leaves (Fig. 12G). However, we were not able to measure PAPS. To investigate whether jasmonate, 12-hydroxyjasmonate and

97

Results hydroxyjasmonate sulfate levels were changed, metabolites were extracted from leaves of 7-week-old wild-type, 7-week-old sir1-1 and 10-week-old

sir1-1 plants and quantified (2.7.5). The measurement revealed that 12hydroxyjasmonate was accumulated in 7-week-old sir1-1 plants and showed wild-type-like levels after reaching wild-type size (Fig. 30).

Unfortunately, we could not measure hydroxyjasmonate sulfate.

800

600

400

JA

12-OH-JA

*

200

0

Col-0

sir1-1

(WT age)

sir1-1

(WT size)

Fig. 30 Jasmonic acid and 12-hydroxyjasmonic acid in leaves of wild-type and

sir1-1 plants.

Metabolites were extracted from leaves of 7-week-old wild-type, 7-week-old sir1-1 and

10-week-old sir1-1.12-hydroxyjasmonate showed a higher level in 7-week-old sir1-1 compared to wild-type. JA, jasmonate; 12-OH-JA, 12-hydroxyjasmonate; (n = 3), (means

± SEM). [Metabolite determination was carried out by Dr. Bettina Hause, IPB, Halle.]

3.4 Analysis of generative tissue in sir1-1

Having gained insight into the sir1-1 transcriptome and metabolome in vegetative tissues, we were interested in the generative tissue. Although

sir1-1 is smaller than the wild-type, it can reach wild-type size (Fig. 5) with delayed growth, flower and set viable seeds, albeit with a lower germination rate (Fig. 6 and Fig. 7). Since sir1-1 plants accumulate sulfate and show a reduced sulfur flux through sulfur assimilation, we decided to investigate if these regulations in vegetative tissues of sir1-1 plants affect the generative tissues and if the seeds are able to reduce sulfate albeit SiR mutation.

98

Results

3.4.1 Impact of SiR mutation on bolting time

To investigate the time sir1-1 needs to start bolting, sir1-1 and wild-type plants were grown under short day conditions (2.2.3.1) for 7 weeks and subsequently transferred to long day conditions to induce budding. While wild-type plants bolted after 35 days, for sir1-1 it took 14 days longer (Fig.

31A). To allow sir1-1 longer vegetative growth and an increase of rosette size and mass, plants were grown for 11 weeks in short day chambers till

sir1-1 had reached the size of wild-type plants. Afterwards, the plants were transported into long day condition. After 2 days, all wild-type plants had bolted. After reaching the wild-type size in week 11, sir1-1 also reduced the bolting time from approx. 50 days to 14 days, however sir1-1 plants bolted much later than wild-type plants.

A

60

50

40

30

***

B

15

10

***

20

10

5

0

0

Col-0

sir1-1

Col-0

sir1-1

Fig. 31 sir1-1 needs a longer period to start bolting.

(A) After 7 weeks of growth on soil under short day conditions, sir1-1 and wild-type plants were transferred to long day condition growth chamber; (n

8). (B) After 11 weeks of growth under short day conditions, sir1-1 and wild-type plants were transported to long day condition growth chamber; (n

6), (means ± SEM).

99

3.4.2

Results

Silique characterization in sir1-1 and wild-type plants

To investigate the reduced seed number in sir1-1, siliques were analyzed.

Conditions for growth and seed production were as described in 3.4.2.

First, siliques of sir1-1 plants were counted and compared to the wildtype. sir1-1 had around one third of wild-type siliques and this was also visibly detectable (Fig. 32A and C). The number of side shoots was wildtype-like (Fig. 32B).

A

1000

800

600

400

200

0

1cm

<1cm

***

Col-0

sir1-1

B

16

14

12

10

8

6

4

2

0

Col-0

sir1-1

C

Col-0

sir1-1

5 cm

Fig. 32 sir1-1 has less siliques than wild-type.

Plants were grown on soil under short day conditions for 6 to 7 weeks and then transferred to long day conditions for seed production. (A) Numbers of siliques (

1 cm and < 1 cm) per wild-type and sir1-1 plant were determined. (B) Side shoots number of wild-type and sir1-1. (C) Phenotype of seed-setting wild-type and sir1-1 plants; (n

7),

(means ± SEM).

100

Results

One of the possible reasons for reduced seed yield could be the reduced silique size. Therefore, silique development was analyzed. Silique length of wild-type and sir1-1 plants was measured 1, 5, 7, 10, 14 days after flowering (daf) and when seeds turned mature (approx. 21 daf). sir1-1 was retarded in silique development until 14 daf, however at the end of silique development, it could reach the size of wild-type siliques (Fig. 33A). To uncover the number of seeds within siliques, they were opened and seeds were counted (2.6.1). sir1-1 siliques contained less seeds than the wildtype (Fig. 33B). The reduced seed number in sir1-1 siliques derived from an arrest of development in some seeds causing aborted seeds, which were randomly distributed along the silique (Fig. 33C and D).

Next, pollen viability of wild-type and sir1-1 plants was investigated. To distinguish between aborted and viable pollen grains, four wild-type and

sir1-1

plants were used, which were stained according to Alexander (1969) and documented (2.6.1). For each plant, 100 pollen grains were counted and their viability was calculated in percentage. While around 90% of wild-type pollen was viable, only 25% of sir1-1 pollen was viable (Fig. 34).

101

Results

102

Results

A

Col-0

B

100

80

60

40

20

0

***

Col-0

sir1-1 sir1-1

20 µm

Fig. 34 sir1-1 has more aborted pollen grains than the wild-type.

(A) Pollen grains were isolated from anthers after dehiscence and examined by differential staining of viable and aborted pollen grains. Arrows indicate aborted pollen grains that stained blue-green. Viable pollen grains are stained magenta-red. (B) 100 pollen grains were counted from each wild-type and sir1-1 plant to investigate the pollen viability; (n = 4 plants), (means ± SEM).

3.4.3 Impact of SiR mutation on seed yield

To characterize the seed yield of soil-grown wild-type and mutant plants, they were grown under short day conditions until week 6 to 7. Afterwards, the plants were transferred to long day conditions until seed maturation

(2.2.3.1). Total seed yield was harvested and weighted. In average, a wildtype plant produced 230 mg ± 20 seed, sir1-1 104 mg ± 17 per plant (Fig.

35B). To allow sir1-1 to set seeds at wild-type rosette size, plants were grown constantly under short day conditions and the seeds of short-day condition plants were analyzed. Both plant lines produced more seeds:

While wild-type produced 395 mg ± 27 seed per plants, sir1-1 remained under that level and produced 163 mg ± 17 seeds per plant (Fig. 35D), indicating that longer growth period under short day conditions increased seed yield. To assess whether weight of individual seeds was affected in

sir1-1

, a bulk of 100 seeds of wild-type and sir1-1 was determined in triplicate. There were no changes in weight of 1oo seeds between wild-type

(1.3 mg ± 0.05) and sir1-1 (1.3 mg ± 0.04; Fig. 35C). Knowing total seed weight of each plant and its 100-seed weight, it was possible to calculate

103

Results the numbers of seeds for each plant. To demonstrate the distribution of seed yield, plants were grouped according to the number of seeds per individual plant from 1 to > 20,000 seeds in 5000-seeds groups. The number of plants in each category was presented in percentage. While most wild-type plants (46%) yielded 15,000 to 20,000 seeds and 23% produced more than 20,000 seeds, 45% of sir1-1 plants produced 5000 to

10,000 seeds and 35% had less than 5000 seeds (Fig. 35A). To check if the balance between water content and storage compound was altered in

sir1-1

seeds, the dry weight of seeds was examined after two days at 80°C and compared to the fresh weight. There were no changes in dry weight between wild-type and sir1-1 seeds (Fig. 35D).

104

Results

A 50

40

30

20

10

Col-0

sir1-1

0

<5 5 - 10 10 -15 15 - 20

Seed number (x 1000)

>20

B C

300

250

200

150

100

50

***

1.5

1.0

0.5

0

0

Col-0

sir1-1

Col-0

sir1-1

D E

140

120

500

400

100

80

60

40

20

300

200

100

***

0 0

Col-0

sir1-1

Col-0

sir1-1

Fig. 35 sir1-1 has lower seed yield with wild-type-like 100-seed-weight.

Plants were grown on soil under short day conditions for 6 to 7 weeks and then transferred to long day conditions. Only the results shown in (E) were from plants grown constantly under short day conditions. (A) Number of mature seeds per wild-type and

sir1-1 plant were counted and categorized; (n

13). (B) Seed yield of wild-type and sir1-

1; (n

13). (C) 100-seed-weight of wild-type and sir1-1; (n

13). (D) For wild-type and

sir1-1 seeds the dry weight was determined as percentage of fresh weight. (n

5). (E)

Seed yield of wild-type and sir1-1 plants grown constantly in short day; (n

7), (means ±

SEM).

105

3.4.4

Results

Impact of sulfur availability on seed yield of sir1-1 and wild-type plants

Wild-type and sir1-1 plants were grown in hydroponic cultures under short day conditions until mature seeds were harvested. As a control group, plants were grown in hydroponic cultures containing ½ Hoagland with 500 µM sulfate (+) and the sulfur-deprived plants were grown on ½

Hoagland with 5 µM sulfate (-S) (2.2.3.2) to investigate the effects of sulfur withdrawal on seed quantity in sir1-1 compared to wild-type. Wildtype plants with sufficient sulfur supply produced 155 mg ± 45 seeds and with sulfur deficiency the yield was 113 mg ± 31 of seeds per plant (Fig.

36B). However, the reduction of seed yield was not of statistical significance. sir1-1 in +S hydroponic culture did not show significant differences (126 mg ± 47) to wild-type grown under the same condition.

Suffering from sulfur deficiency however, reduced the seed yield of sir1-1 significantly to 19 mg ± 3, indicating that sir1-1 is dependent on sulfur availability for seed production, more than the wild-type. Weight of 100 seeds was determined to investigate if inefficient sulfur supply had an impact on seed weight of wild-type and sir1-1. 100 seeds of wild-type plants produced in hydroponic cultures weighted 1.98 mg ± 0.04 and

1.84 mg ± 0.03 on +S and -S, respectively (Fig. 36C). There was an increase of seed quantity compared to that of soil-grown plants

(1.32 mg ± 0.05). sir1-1 also produced more heavy-weight seeds of

1.89 mg ± 0.05 compared to soil-grown seeds (1.32 mg ± 0.04). When sulfur availability was strongly reduced, in sir1-1 the 100-seed weight was significantly lowered to 1.58 mg ± 0.04, indicating that sulfur withdrawal affects seed weight and that these effect are more severe when SiR is mutated. Following the lines in 3.4.2, seed numbers were determined for each line and growth condition. 50% of wild-type plants grown on +S produced 10,000 to 15,000 seeds per plant, and 50% produced less than

5000 seeds (Fig. 36A). Under the same conditions, 43% of sir1-1 plants produced 5000 - 10,000 seeds, 43% less than 5000 and interestingly 14% had more than 15,000 seeds. In hydroponic culture, seed weight of sir1-1 elevates when compared with soil-grown sir1-1 (Fig. 35).

106

Results

A

120

100

80

60

40

20

Col-0 (+S)

sir1-1 (+S)

Col-0 (-S)

sir1-1 (-S)

0

<5 5 - 10 10 - 15

Seed number (x1000)

>15

B

250

200

150

*

***

100

50

0

Col-0

sir1-1

Col-0

sir1-1

+S -S

C

3.0

2.5

2.0

1.5

1.0

0.5

0

*

***

**

**

Col-0

sir1-1

Col-0

sir1-1

+S -S

Fig. 36 sir1-1 seed yield is negatively affected by sulfur deprivation to a higher degree than wild-type.

Plants were grown hydroponically on sulfur containing (+S) and sulfur-deficient (-S) under short day conditions until seeds were harvested. (A) Numbers of mature seeds per wild-type and sir1-1 plant on +S and -S were counted and categorized. (B) Seed yield of wild-type and sir1-1 on +S and -S. (C) 100-seed-weight of wild-type and sir1-1 on +S and

-S; (n

6), (means ± SEM).

107

Results

Growing on -S, the wild-type plants produced seeds of a quantity similar to sir1-1 plants grown on +S: 25% produced < 5000 seeds, 37% had 5000 to 10,000 seeds and 13% produced 15,000 to 20,000 seeds. On -S conditions, all sir1-1 plants had less than 5000 seeds.

3.4.5 SiR transcript, protein and activity in sir1-1 seeds

For sir1-1 leaves, it was shown that SiR was down-regulated at transcriptional, protein and activity levels (Khan et al., 2010). It was of major importance to investigate, if T-DNA insertion in the promoter region of SiR also causes a down-regulation of SiR transcript, hence, SiR protein amount and activity in seeds and roots of sir1-1. To confirm the observations for leaf tissue and determine SiR transcript in the wild-type and sir1-1 roots, mRNA was extracted (2.8.1) from pooled leaves and roots of at least eight 4-week-old plants grown in hydroponic cultures (2.2.3.2) and used for cDNA synthesis (2.8.3.1) and qRT-PCR (2.8.3.2) with primer pairs 2546 and 2547 (SiR) and 1727 and 1728 (elongation factor 1 α as reference gene; 2.1.6). SiR transcript was down-regulated in sir1-1 leaf

(Fig. 37A) and root tissue (Fig. 37B) to 47% ± 3 and 78% ± 1, respectively.

To assess, if transcript level reduction resulted in decrease of SiR protein amounts, proteins were extracted from pooled leaves and roots (2.5.1) from the same individuals above. 40 µg leaf and 20 µg root proteins were separated via SDS-PAGE (2.5.5.1) and SiR was detected by immunoblot using a specific antiserum (2.5.5.4). Loading was controlled by amido black staining. SiR protein levels were reduced in sir1-1 in both leaf and root tissues (Fig. 37C).

After confirming SiR down-regulation in sir1-1 leaves and showing the same for root tissues, we investigated SiR transcript in mature seeds of wild-type and sir1-1. To gain seeds, plants were grown on soil under short day conditions for 7 weeks and then transferred to long day conditions.

Seeds were collected and mRNA was extracted and used for cDNA synthesis and qRT-PCR as described above. In mature sir1-1 seeds only

5% ± 0.6 of SiR transcript remained compared to the wild-type (Fig. 37D).

108

Results

To investigate the consequences of Sir mutation for SiR protein expression and activity, proteins were extracted from seeds (2.5.2.1) and

SiR activity was measured (2.5.6.1). The SiR activity was reduced to an undetectable level (Fig. 37E). Also the immunological detection of SiR protein confirmed a strong reduction in seeds of sir1-1 (Fig. 37F).

109

Results

Fig. 37 SiR transcript and protein is reduced in sir1-1 vegetative and generative tissues

mRNA was extracted (2.8.1) from pooled leaves (A) and roots (B) of 4-week-old plants grown in hydroponic cultures (2.2.3.2) and used for cDNA synthesis (2.8.3.1) and qRT-

PCR (2.8.3.2); (n

≥ 7). (C) Proteins were extracted from pooled leaves and roots (2.5.1).

40 µg leaf and 20 µg root proteins were separated via SDS-PAGE (2.5.5.1) and SiR was detected by immunoblot using a specific antiserum (2.5.5.4). Loading was controlled by amido black staining. LC, loading control; (n

≥ 7). (D) mRNA was extracted from seeds of plants that were grown on soil under short day conditions for 7 weeks and then transferred to long day conditions. cDNA synthesis and qRT-PCR were performed. (E)

Proteins were extracted from mature seeds (2.5.2.1) and SiR activity was measured

(2.5.6.1); (n = 3). (F) Proteins were extracted from mature seeds (2.5.2.1). From left to right: 75,100, and 200 µg (four right lines) seed proteins were separated via SDS-PAGE

(2.5.5.1) and SiR was detected by immunoblot using a specific antiserum (2.5.5.4).

Loading was controlled by amido black staining. LC, loading control; (n = 3), (means ±

SEM).

110

3.4.6

Results

Effects of decreased sulfite reduction on the sir1-1 seed composition

To investigate the effects of the SiR mutation on the seed composition levels of proteins, amino acids and lipids were determined. Total proteins were extracted from mature seeds (2.5.2.2) and quantified (2.5.3). Seeds of sir1-1 contained more proteins compared to the wild-type (Fig. 38A).

Soluble proteins were extracted from mature seeds (2.5.2.1) and quantified as above. sir1-1 seeds showed a higher soluble protein content

(Fig. 38B).

A

500

400

300

**

B

100

80

60

*

200

40

100

20

0

0

Col-0

sir1-1

Col-0

sir1-1

Fig. 38 sir1-1 seeds contain higher protein amounts.

(A) Total proteins (2.5.2.2) and (B) soluble proteins (2.5.2.1) were extracted from mature seeds and the protein levels were determined (2.5.3); (n = 3), (means ± SEM).

It was known that cysteine levels were unchanged in sir1-1 seeds (Khan,

2008). Free amino acids were quantified and compared to the wild-type.

Mature seeds were used for the extraction of amino acids (2.7.1), which were detected by HPLC (2.7.2). Levels of free amino acids were increased in sir1-1 seeds (Fig. 39B). Aspartic acid (3.5-fold), glutamic acid (2.2-fold), histidine (1.9-fold), isoleucine (3-fold), phenylalanine (1.9-fold), tyrosine

(1.5-fold) and valine (3.1-fold) were significantly increased.

111

Results

Fig. 39 sir1-1 seeds have more free amino acids compared to wild-type.

(A) Amino acids were extracted from mature seeds (2.7.1) and their levels were determined via HPLC (2.7.2). (B) Sum of measured free amino acids in wild-type and

sir1-1 seeds; (n = 4), (means ± SEM).

Seeds are storage organs of plants and they have two major storage compounds: proteins and oil (Baud et al., 2008). Since an increase of protein amounts (Fig. 38) was observed and the seed weight was unchanged (Fig. 35), the lipid amount within the seeds of sir1-1 and wildtype was measured. Lipids were extracted (2.7.6) from mature seeds and their level was determined. While wild-type seeds contained

232 mg g

-1

± 9, sir1-1 had a significantly lower level of 140 mg g

-1

± 12 (Fig.

40A). In mature Arabidopsis seeds, almost all fatty acids are esterified to triacylglycerides (TAG) making up 90 - 95% of oil bodies (Ohlrogge and

Browse, 1995; Baud et al., 2002). The remaining compounds originate from diacylglycerides and membrane lipids (Li et al., 2006; Molina et al.,

2006). To investigate if the processing of oil compounds were changed in

sir1-1, the TAG amounts were determined (2.7.7.1). Therefore, fat was extracted from mature seed (2.7.7) and determined (2.7.7.1). While sir1-1 converted all its seed oil into TAG (141 mg g

-1

± 7; Fig. 40B), wild-type

112

Results seeds showed a TAG level of 203 mg g

-1

140 mg g

-1

± 16 corresponding to

88% of total seed fat.

A

300

B

250

250

200

200

150

**

150

*

100

100

50

50

0

0

Col-0

sir1-1

Col-0

sir1-1

Fig. 40 sir1-1 seeds have less fat compared to wild-type.

(A) Total lipids were extracted from mature seeds (2.7.6); (n

≥ 3). (B) TAG were extracted from mature seeds (2.7.7) and determined (2.7.7.1); (n = 4), (means ± SEM).

[Triacylglyceride quantification was carried out in cooperation with Allan Jones, DKFZ,

Heidelberg.]

Although hexoses and their products do not contribute much to the total weight of mature Arabidopsis seeds, they play an important role as energy sources provided for germinating seedlings or serve as a signal controlling seed metabolism (White and Benning, 2001). Therefore, levels of fructose, glucose, sucrose and starch were measured in mature sir1-1 and wild-type seeds (2.7.9). There were no significant changes in the amounts of measured sugars and starch (Fig. 41).

113

Results

Fig. 41 sir1-1 shows seed sugar and starch levels comparable to wild-type.

Fructose, glucose, sucrose and starch were extracted from mature seeds, and their levels were determined (2.7.9); (n = 4).

3.4.7 Effects of decreased sulfite reduction on the sulfur assimilatory reduction pathway in sir1-1 and wild-type seeds

To investigate whether the SiR mutation has an effect on the sulfur assimilation and reduction pathway, mRNA was extracted from mature seeds (2.8.1) and used for for cDNA synthesis (2.8.3.1) and qRT-PCR

(2.8.3.2) with primers listed in 2.1.6 under “Primers for qRT-PCR”.

Elongation factor 1 α (1727 and 1728), ubiquitin (1729 and 1730) and

protein phosphatase (1731 and 1732) were used as reference genes. The only significantly regulated genes were SiR, as shown before (Fig. 37D), and APR2, which was reduced to 50% of wild-type (Fig. 42). Attempts to detect APR activity in seeds failed (2.5.6.2). Down-regulation of the APR2 transcript was also observed for leaves (Fig. 13A), indicating that the sulfur reduction pathway was slowed down due to SiR dysfunction.

114

Results

Fig. 42 Effects of SiR mutation on the sulfur assimilation and reduction pathway in seeds

mRNA was extracted from seeds of plants that were grown on soil under short day conditions for 6 to 7 weeks and then transferred to long day conditions. cDNA synthesis

(2.8.3.1) and qRT-PCR (2.8.3.2) were performed; (n = 3).

3.4.8 Effects of decreased sulfite reduction on the sir1-1 proteome

Seed proteome was extracted, separated and analyzed by two-dimensional gel electrophoresis (2.5.4). 180 proteins were detected; out of them 44 were significantly changed in amount in sir1-1 (p < 0.05) (Fig. 43 and Tab.

2) and identified via nano-LC-MS/MS as described in Gallardo et al.

(2007) (Suppl. data 17) and reference maps (Zuber et al., 2010b). The most affected protein category was the storage proteins.

115

A pI 3 kDa

97.4

66.2

45.0

31.0

21.5

14.4

4 5 5.5

6 6.5

7 8

2 27

85

36

20

19

35

28

34

31

14

6

22

29

13

3

39

69

32

16

9

26

23

33

24

38

18

10

17

4

40

8

30

11

37

25

12

52

Results

9 10

1

B

Col-0

Col-0

sir1-1 sir1-1

Fig. 43 2-D analysis of the seed proteome reveals changes in sir1-1.

Seed proteins were extracted (2.5.4.1) from 20 mg of mature seeds collected on four plants. An equal amount (400 µg) of total protein extract was loaded on each gel. (A)

Coomassie-stained two-dimensional gel of total proteins from dry mature seeds of sir1-1.

The proteins indicated in green circles were decreased in amount; in red increased. (B)

The indicated portions of the gel are given in enlarged windows for a reduced protein

(left) and an accumulated protein (right). The labeled protein spots were identified by matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF) analysis or reference maps (Zuber et al., 2010b) (

Tab. 2

). 2-D gel experiments were carried out two times; (n = 4). [Experiments were carried out in cooperation with Dr. Karine Gallardo,

INRA, Dijon.]

116

Results

While in sir1-1 sulfur-poor precursors of globulin (At12S1 and 12S4) were

1.3- to 1.7-fold accumulated in amount, sulfur-rich albumin (At2S) was decreased in abundance by 4-fold. Due to accumulation of precursors and probably less processing of them, the globulin α-subunits were decreased in amount. A 1.5- to 2.2-fold increase of methionine synthase was observed, indicating changes in amino acid biosynthesis. Also, proteins from glycolysis/glyconeogenesis were accumulated: fructose-bisphosphate aldolase (1.7-fold), glyceraldehyde 3-phosphate dehydrogenase (1.3- to

1.5-fold) and endolase (1.5-fold), indicating changes in energy metabolism in the mutant seeds (Fig. 44). Also changes in stress-related enzymes were observed. Isocitrate dehydrogenase amount increased 1.7-fold and GSH Stransferase was reduced 1.5-fold.

Interestingly, oleosin 2, a storage protein surrounding the oil bodies in seeds of higher plants (Murphy, 1993) was down-regulated 1.8-fold.

117

Results

118

Results

119

Discussion

4 Discussion

4.1 Effects of SiR mutation on the whole genome and metabolites

The sir1-1 mutant is a useful tool to investigate the sulfate assimilatory reduction pathway. At first sight, one might think that sir1-1 plants do not really exhibit a behavior that could be seen as an adaptation to -S: Because

sir1-1 plants accumulate sulfate in leaves up to more than eight-times in comparison to the wild-type plants and also the levels of cysteine and GSH are not decreased (Khan et al., 2010, this study). However, sulfate accumulates in sir1-1 plants for at least two reasons: For one, due to the bottleneck effect in the sulfate assimilatory reduction pathway caused by the SiR mutation. Secondly, OAS that together with sulfide results in cysteine, accumulates due to reduced sulfide production in sir1-1. OAS is believed to have a signal function, whereby its accumulation causes upregulation of sulfate transporters (Smith et al., 1997; Hesse et al., 2004).

Also, measurement of incorporation of radioactively labeled sulfate into cysteine and GSH showed a dramatic decrease of flux in sulfate assimilation pathway in sir1-1 compared to wild-type plants (Khan et al.,

2010).

This leads to a phenotype reminiscent of sulfur-deficient plants, although oxidized sulfur is available. Hence, the decreased sulfur reduction capacity is primary accountable for the phenotype. Metabolome and transcriptome analyses revealed that several metabolites were changed in sir1-1 leaves grown under normal conditions in a manner that has been previously reported for long-term sulfate-deprived plants (Nikiforova et al., 2003;

Nikiforova et al., 2005): SAM levels were reduced significantly by more than 20%. This, and a reduced sulfur flux via the sulfate assimilatory reduction pathway cause accumulation of OAS, serine, and putrescine.

Also levels of chlorophyll a and b were decreased to less than 50% of wildtype levels. These changes were also observed, when plants were grown on

-S (Nikiforova et al., 2005). Nikiforova et al. (2003) reported that - similar

to sir1-1 when compared to wild-type on normal media - serine and OAS, aspartic acid, SAM, chlorophyll a and b; and methionine, threonic acid,

120

Discussion and xylose (0.81-, 0.89-, and 0.86-fold respectively, but not significantly) were down-regulated when Col-0 was transferred to -S.

There are also some reports that show changes in the transcriptome due to sulfur availability. We compared those with our microarray data and found similarities:

Arginine is reported to be strongly down-regulated upon sulfur deficiency

(Nikiforova et al., 2005). We could not detect arginine. However, there are indications for its breakdown, e.g. a putative arginase (At4g08870) was more than two 2log-fold induced in sir1-1 compared to wild-type.

Putrescine, a polyamine produced by arginine degradation (Imai et al.,

2004), was increased in sir1-1 leaves. There are several genes involved in the putrescine-related arginine breakdown pathway and some of them were up-regulated in sir1-1 leaves: SPD1, SPD2, ADC1, ADC2, and ACL5

(Hanzawa et al., 2002; Imai et al., 2004) indicating that arginine is also down-regulated.

Nikiforova et al. (2003) showed that hypo-sulfur stress causes downregulation of genes encoding accessory proteins of the electron transport.

We could observe changes in expression of ferredoxin genes when 7-weekold wild-type plants were compared with 10-week-old sir1-1 plants of same developmental stage: FED A (At1g60950) (-0.37 2-log-fold) and

ATFD1 (At1g10960) (-0.31) were down-regulated in 10-week-old sir1-1 plants significantly, while 7-week-old sir1-1 did not show different expression pattern of these genes. Interestingly, a third member of ferredoxin family ATFD3 (At2g27510) was up-regulated significantly in both, 7- and 10-week-old sir1-1 plants, in comparison to wild-type: 0.59 and 0.63 2-log-fold, respectively.

Nikiforova et al. (2003) reported down-regulation of the Rubiscoencoding genes under sulfur deficiency and affected energy assimilation in sulfur-starved plants. Compared to 7-week-old wild-type plants, in leaves of 10-week-old sir1-1, the nuclear rbcS gene (At1g67090) encoding the small subunit of Rubisco was down-regulated -0.43-2log-fold; however no significant changes were observed in 7-week-old sir1-1 when compared to wild-type plants of same age (-0.03). psbA (chloroplast gene encoding the

D1 protein of photosystem II) was down-regulated in 7-week-old sir1-1

121

Discussion plants compared to wild-type plants of same age (-0.83-2log-fold). These results support the notion that photosynthesis is affected in sir1-1 plants.

As mentioned above, it has been reported that chlorophyll contents were reduced in -S plants and our results show that on +S sir1-1 has reduced chlorophyll. Microarray data revealed that Lhcb1B1 (chlorophyll a/b binding; AT2G34430) and Lhcb3 (chlorophyll a/b binding; AT5G54270) were down-regulated in 10-week-old sir1-1 compared to 7-week-old wildtype plants of same size -0.32 and -0.52 2log-fold, respectively. However, smaller, 7-week-old sir1-1 did not show significant changes. Interestingly, there were also changes in the detected adenosine-derivate metabolites indicating affected photosynthesis and disturbed energy metabolism, i.e. reduction of glycolic acid indicating affected photorespiration.

Plastidic chaperons Cpn60α and Cpn60β play an important role in folding and assembly of proteins (e.g. Rubisco) and chloroplast division

(Goloubinoff et al., 1989b; Goloubinoff et al., 1989a; Suzuki et al., 2009).

Mutation of ptCpn60α abolished greening of plastids and resulted in an albino phenotype while a weaker mutation impairs plastid division, and reduced chlorophyll levels (Suzuki et al., 2009), leading to defects in plastid development and subsequently in development of the plant embryo and seedling (Apuya et al. 2001). Transgenic tobacco plants, which expressed antisense Cpn60β showed drastic phenotypic alterations including slow growth, delayed flowering, stunting and leaf chlorosis

(Zabaleta et al., 1994). Although our microarray studies were carried out on mature leaves, it was of interest to examine the expression for these plastidic chaperons. ptCpn60β (At1g55490) was up- (0.65-) and down-

(-0.73-2log-fold) regulated in 7- and 10-week-old sir1-1 plants, respectively, compared to 7-week-old wild-type plants. ptCpn60α

(At2g28000) was only significantly changed in 7-week-old sir1-1 (0.71-

2log-fold change) compared to same-age wild-type plants. It can be speculated about the altered ptCpn60α and β transcripts’ influence on the germination rate of sir1-1. However, the analysis must be performed on seeds and seedlings.

Transcriptome analysis showed that sir1-1 plants suffer from stress:

122

Discussion

Gene set enrichment analysis (GSEA) revealed up-regulation of pathways related to DNA repair in sir1-1 plants. One reason for induction of these stress-related genes could be the elevated sulfite (Khan et al., 2010), since sulfite has damaging effects on nucleic acids (Shosuke et al., 1989; Ito and

Kawanishi, 1991; Muller et al., 1997; Kawanishi et al., 2001; Alipazaga et al., 2008). It is also known that SiR binds to nucleoids in plastids and makes them more compact, hence less accessible for transcription factors

(Sekine et al., 2002). When plastidic DNA is not bound to SiR, it is in the loose form. It can be speculated that decreases in SiR enzyme in plastids causes DNA relaxation making it more vulnerable for sulfite. We observed a counteracting reaction of sir1-1 to reduce sulfite production: APR2 transcript was reduced, hence, the protein activity also was. Also the regulatory function of CSC probably triggers deceleration of sulfur reduction: It is known that in Arabidopsis cysteine has an inhibitory function on free SATs (Wirtz et al., 2010). To avoid overproduction of

OAS, sir1-1 plants maintained the cysteine levels. Since sulfide production is decreased in sir1-1, OAS can not be further metabolized to cysteine. This response saves nitrogen and carbon resources that would otherwise accumulate to high excess in the form of OAS. Therefore, growth and metabolic pathways are adjusted in the sir1-1 plants.

Arabidopsis has three ways to detoxify sulfite: First, sulfite reduction to sulfide via SiR; second, its incorporation in sulfolipids via SQD enzymes; and third, sulfide oxidation to sulfate. The latter one is carried out by

SOX, an enzyme located in peroxisomes of Arabidopsis (Hänsch et al.,

2006). There are no changes in sulfolipids from sir1-1 leaves. SOX expression in 7- and 10-week-old sir1-1 in comparison to wild-type was checked. The SOX (At3g01910) transcript was not significantly altered in any of the sir1-1 groups compared to wild-type. However, in leaves of 7week-old sir1-1 plants, SOX activity was increased more than 2-fold compared to the wild-type whereas immunological analysis revealed no changes of protein amount (Khan et al., 2010), suggesting posttranslational modifications. However, induction of the peroxisomal ABC

(ATP-binding cassette) transporter PXA1 (At4G39850) (0.5 2-log-fold) in

10-week-old sir1-1 compared to 7-week-old wild-type plants could indicate

123

Discussion sulfite transport to peroxisomes for oxidation. Little is known about peroxisomal transporters. For spinach peroxisomes, only one porin is known to be permeable for a variety of different inorganic and organic anions which could principally facilitate sulfate or sulfite transport

(Reumann et al., 1998). It has been acknowledged that the nature of the substrates handled by the different ABC transporters is less clear (Visser et al., 2007). The ultimate role of PXA1 and its potential involvement in sulfite transport to peroxisomes for oxidation reactions via SOX remain speculative. However, the fact that this ABC transporter was not significantly up-regulated in early stages of sir1-1 development (7 week) and its transcript was increased later on in sir1-1 plants (10 week), could derive from the accumulation of sulfite during the vegetative growth of the mutant. Seemingly, there are connections between sulfite accumulation and up-regulation of PXA1. However, sulfite detoxification reactions carried out by SOX have a side product, namely H

2

O

2

which also has been reported to cause DNA damage (Jornot et al., 1998) and induce DNA repair genes (Desikan et al., 2000).

Since conversion of sulfite into less toxic sulfate via SOX could potentially reduce the toxic effects of sulfite and probably rescue the sir1-1 phenotype partially or totally, we tried to cross sir1-1 with SOX over-expressing

Arabidopsis plants. Also, sir1-1 should be crossed with a sox-k.o. line to abolish the possibility of sulfite detoxification via oxidation. One would expect a more severe phenotype in the double mutant compared to sir1-1.

However, the attempts we made (4 times with at least 4 plants per line) remained without success in the F1 generation. We need to investigate whether the detected reduced pollen viability contributes to this phenomenon. Also the viability of female gametophytes in sir1-1 should be investigated. However, sir1-1 is able to self-polinate and sir1-1 could be crossed with cad2 mutant (A. Speiser, unpublished). More evaluative crossing studies are of demand, i.e. pollination between female and male sexual organs from sir1-1 and wild-type, respectively and pollination vice versa.

Interestingly, CYP85A2 (At3g30180) transcript was reduced (-0.77) in 10week-old sir1-1 plants compared to wild-type plants. In 7-week-old sir1-1,

124

Discussion its expression was comparable to wild-type plants. CYP85A1 (At5g38970) was not significantly altered in any of the mutant growth stages.

In Arabidopsis, CYP85A1 and CYP85A2 are two CYP85 proteins known to be involved in the final oxidation steps necessary for the biosynthesis of brassinolide (BR) and CYP85A1 catalyzes the last oxidative reactions that lead to the biosynthesis of BR (Nomura et al., 2005). BRs are phytohormones which affect germination, root growth, cell elongation, vascular differentiation, pollen tube growth, and stress tolerance

(Szekeres et al., 1996; Clouse and Sasse, 1998; Steber and McCourt, 2001;

Yamamoto et al., 2001; Müssig et al., 2003). Arabidopsis mutants defective in BR synthesis show common phenotypic features including dwarfism, curly leaves, reduced apical dominance, reduced fertility, and delayed senescence (Clouse et al., 1996; Kim et al., 2005).

CYP85A1 mRNA localization studies and GUS expression under a

CYP85A1 promoter showed that within the ovule the corresponding protein is mostly active in gametophytic cells (Perez-Espana et al., 2011).

T-DNA insertion lines defective in the activity of CYP85A1 exhibit a semisterile phenotype, suggesting a role for the corresponding enzyme acting at the gametophytic level. In regard to some similarities between

Arabidopsis BR mutants and sir1-1, it would be interesting to analyze the transcription levels of CYP85A1 and CYP85A2 in sir1-1 seeds.

As mentioned above, raffinose and galactinol accumulate in sir1-1 leaves compared to wild-type leaves, indicative for sulfur starvation. Knowledge of metabolic changes of raffinose and galactinol in Arabidopsis is rather limited, but they have been shown to accumulate under various kinds of stress: In wild-type leaves, treatment with 50 µM methylviologen (MV) induces expression of galactinol synthase 1 (GolS1), and increases the total activity of GolS as well as the levels of galactinol and raffinose

(Nishizawa et al., 2008). High intracellular levels of galactinol and raffinose in the GolS1- or GolS2-overexpressing Arabidopsis plants compared to wild-type correlate with increased tolerance to MV treatment and salinity or chilling stress. Galactinol and raffinose effectively protect salicylate from attack by hydroxyl radicals in vitro. The authors suggested that galactinol and raffinose may scavenge hydroxyl radicals may have a

125

Discussion novel function in protecting plant cells from oxidative damage caused by

MV treatment, salinity, or chilling. Interestingly, in leaves of 7- and 10week-old sir1-1 plants, the AtGolS1 (At2g47180) transcript is increased significantly 1.06 and 1.09 2log-fold, respectively, compared to 7-week-old wild-type plants. The high elevation of raffinose and galactinol, and upregulation of galactinol synthase 1 suggest stress in sir1-1 leaves during vegetative growth.

It is known than sir1-1 has an 8 times higher

35

SO

42-

uptake rate compared to wild-type and that no increase of sulfate uptake takes place in sir1-1 plants after 6 h of sulfur starvation (Haas, 2010). Therefore, it is astonishing that after 6 h of sir1-1 growth on -S there were similar responses at the metabolic level in roots compared to equally treated wildtype plants. In contrast to sir1-1, wild-type plants showed increased sulfate uptake on -S (Haas, 2010). These results indicate a metabolomeassociated answer independently from the regulation of sulfate uptake after short-term sulfate starvation.

4.2 Effects of decreased sulfite reduction on the generative growth

The next major aim of this project was to investigate if sulfate assimilation in Arabidopsis seeds is essential for their growth. Again, sir1-1 is a good tool, since the growth of sir1-1 siliques of plants is slower compared to that of wild-type plants. Also, sir1-1 plants set less seeds. We were interested to investigate where these effects derive from: the changed metabolism of the vegetative mother tissue or the reduced sulfate reduction within seeds?

We could demonstrate that in mature seeds sulfate assimilation and reduction takes place since we detected the transcript of all major genes involved in this pathway and it has been shown that sulfur assimilation occurs in developing seeds (eFP browser), too. We also demonstrate that

SiR protein shows activity in mature wild-type seeds and that SiR activity is strongly reduced to an undetectable level in seeds of sir1-1. Also at the transcript level, SiR is reduced to 7% of wild-type, a decrease much

126

Discussion stronger than in leaf and root. Taken together, sulfate assimilation occurs in developing and mature seeds. Like in vegetative tissues, sir1-1 shows strong reduction of SiR due to mutation. Also the APR2 transcript was down-regulated in mature seeds compared to wild-type seeds. To evaluate the role of maternal tissue supplying oxidized sulfur, the sulfate amounts of seeds were previously determined. There were no significant changes between sir1-1 and wild-type (Khan, 2008). Sulfate levels in seeds were comparable to those in leaves (approx. 10 nmol mg

-1

FW) while nitrate content is dramatically reduced in seeds (< 1 nmol mg

-1

FW) compared to leaves (80 nmol mg

-1

FW). Reduced nitrogen must be imported into the seeds, i.e. amino acids while sulfate needs to be reduced within the seeds.

Sulfate assimilation is necessary for GSH synthesis, since developing seeds need both endogenous GSH biosynthesis and maternal supply

(Cairns et al., 2006). Besides GSH production, in developing seeds sulfate assimilation is needed for cysteine synthesis to produce seed storage proteins.

Our results further demonstrate that intact sulfate assimilation is required for proper development and viability of pollen grains.

4.3 Effects of decreased sulfite reduction on the seed proteome

We were interested to investigate whether alterations in the sulfate assimilation pathway affects seed composition. Storage proteins are one major group of seed storage compounds in Arabidopsis. In sir1-1 seeds, the amount of proteins and amino acids were elevated indicating changes in protein synthesis. While sir1-1 vegetative tissues were persevered in a condition mimicking sulfate starvation, similar -S responses were observed in the sir1-1 seed proteome: Seed proteome of Arabidopsis plants grown under sulfur-deficient conditions revealed that 12S globulin precursors were accumulated compared to normally grown seeds (Higashi et al., 2006). 12S globulin precursors were accumulated and their fragmented and processed forms decreased in amount when the transport of sulfate in seeds was impaired (Zuber et al., 2010b).

127

Discussion

A similar abnormal accumulation of 12S globulin precursors was observed in Arabidopsis mutants lacking vacuolar processing enzymes (Gruis et al.,

2002; Shimada et al., 2003b; Gruis et al., 2004) or vacuolar sorting receptors (VSRs) (Shimada et al., 2003a) and in a rice mutant lacking protein disulfide isomerase (Takemoto et al., 2002).

In the sir1-1 proteome, we observed changes that were similar to the seed proteome upon sulfur deficiency: Precursors of globulins were accumulated, while their processed subunit fragments were decreased in amount. Investigation of amino acid composition of seed proteins revealed that Arabidopsis seed proteins contain in average 3.1% cysteine and methionine in total and 12.7 sulfur atoms. Until today, not all the proteins in seeds have been characterized and the evaluated seed proteins

(provided by Dr. Karine Gallardo, INRA, Dijon) contain only proteins that could be detected via MS/GC methods and/or reference protein maps.

Therefore, the contribution of each protein to the total seed proteome could not be determined. However, 12S globulins comprise around 80% of total SSPs in Arabidopsis and the percentage of cysteine and methionine in them is 2.9%. This makes the calculation of sulfur containing amino acids for seed proteins reliable. Globulins are not sulfur-rich SSPs. This could be a reason for their accumulation, as sulfate reduction and assimilation is inefficient in sir1-1, as well as in shoots, roots, and seeds.

One other explanation for the accumulation of their precursors could be the lack of available cysteine and methionine for biosynthesis of VPEs.

The calculation of their amino acid composition revealed that the four

VPEs contain in average 4.4% cysteine and methionine in total and 21.3 sulfur atoms, i.e. their sulfur content is more than average for seed proteins. Therefore, their protein expression could be down-regulated.

Under -S conditions, the transcript levels of VPEs were unchanged

(Higashi et al., 2006). VSRs can also be seen as sulfur-rich proteins: The average content of cysteine and methionine in seven isoforms is 7.5% and the VSRs have 47 sulfur atoms. Perhaps due to their high demand for reduced sulfur, their expression would be down-regulated, affecting transport of precursors from the ER via the Golgi to multivesicular bodies or/and protein storage vacuoles.

128

Discussion

Assuming, that high amounts of accumulated sulfate is transported from generative tissue into the sir1-1 seeds, the lack of sulfate for synthesis of sulfur amino acids may not be the rate-limiting aspect. Quantification of sulfate content of leaves before budding would be of interest. However, determination of sulfate and nitrate in sir1-1 seeds revealed no changes compared to wild-type seeds (Khan, 2008). Rather the lack of sulfate assimilation capacity in sir1-1 seeds could explain the reduction of sulfurrich proteins.

Interestingly, oleosin 2 was decreased 1.8-fold in the sir1-1 seed proteome compared to wild-type. Oleosins are the most abundant proteins in the lipid monolayer of oil bodies (Murphy, 1993).

Suppression of oleosin biosynthesis in seeds, increases the protein accumulation and decreases the lipid weight in an almost compensatory way, so that the total weight of seed protein and oil in combination remained constant (Siloto et al., 2006), a situation similar to sir1-1 seed composition. In Arabidopsis seeds, there are four genes encoding for oleosins. All oleosin proteins are free of cysteine. The oleosin 2 isoform is the one with the highest methionine content (4.5%), while the other three contain 2.6 to 2.9% methionine. The lack of reduced sulfur could be responsible for the down-regulation of this isoform. Interestingly, it was shown that germination rates were positively associated with oleosin levels, suggesting that defects in germination are related to oleosin deficiency (Shimada et al., 2008).

Among the non-storage proteins that were affected in the proteome of

sir1-1, fructose-bisphosphate aldolase, endolase, and glyceraldehyde 3phosphate dehydrogenase were accumulated. All three are involved in catalyzing reactions of glycolysis and gluconeogenesis. With respect to the reduction of oil content and unchanged NCS ratios in sir1-1 seeds (Khan,

2008), the detected up-regulation of these enzymes for synthesis or degradation of sugars could be a compensatory reaction of sir1-1 seeds.

A possibility to get more insight in the supplying role of maternal tissue for sir1-1 seeds, is a proteomic evaluation of seeds produced by hydroponically grown sir1-1 plants in comparison to wild-type plants.

129

Discussion

The sulfate levels of the hydroponically grown plants must be determined.

Since the assumed high sulfate amounts provided by the hydroponical system (500 µM) enhance seed production of sir1-1 plants to wild-type levels, it would be of major interest to compare the seed proteomes of wild-type and sir1-1 with the evaluated seed proteomes of soil-grown plants in this study. Indeed, the strong reduction of seed production in

sir1-1 grown under -S conditions, support the hypothesis that the high sulfate accumulation is required for sir1-1 to grow and develop and set viable seeds. The slower growth makes it possible for sir1-1 to produce the required metabolites before setting seeds.

130

References

References

Akashi, T., Matsumura, T., Ideguchi, T., Iwakiri, K.-i., Kawakatsu, T.,

Taniguchi, I., and Hase, T. (1999). Comparison of the electrostatic binding sites on the surface of ferredoxin for two ferredoxin-dependent enzymes, ferredoxin-NADP+ reductase and sulfite reductase. J Biol Chem

274, 29399-29405.

Alexander, M.P. (1969). Differential staining of aborted and nonaborted pollen. Stain Technol 44, 117-122.

Alipazaga, M.V., Moreno, R.G.M., Linares, E., Medeiros, M.H.G., and

Coichev, N. (2008). DNA damage by sulfite autoxidation catalyzed by cobalt complexes. Dalton Trans, 5636-5644.

Allboje Samami, A., Nunes-Nesi, A., Wirtz, M., and Hell, R.

Comparative analysis of amino acids from arabidopsis wild-type and mutant sir1-1 leaves by reverse-phase high-pressure liquid chromatography (HPLC) and gas chromatography-mass spectrometry

(GC-MS). In Sulfur metabolism in plants: mechanisms and application to food security, and responses to climate change, L.J. De Kok, M. Tausz,

M.J. Hawkesford, R. Höfgen, M.T. McManus, R.M. Norton, H.

Rennenberg, K. Saito, E. Schnug, and L. Tabe, eds, (submitted).

Andre, C., Froehlich, J.E., Moll, M.R., and Benning, C. (2007). A heteromeric plastidic pyruvate kinase complex involved in seed oil biosynthesis in Arabidopsis. Plant Cell 19, 2006-2022.

Arnon,

D.I. (1949). Copper enzymes in isolated chloroplasts. polyphenoloxidase in Beta vulgaris. Plant Physiol 24, 1-15.

Avonce, N., Leyman, B., Mascorro-Gallardo, J.O., Van Dijck, P.,

Thevelein, J.M., and Iturriaga, G. (2004). The Arabidopsis trehalose-6-P synthase AtTPS1 gene is a regulator of glucose, abscisic acid, and stress signaling. Plant Physiol 136, 3649-3659.

Awazuhara, M., Fujiwara, T., Hayashi, H., Watanabe-Takahashi, A.,

Takahashi, H., and Saito, K. (2005). The function of SULTR2;1 sulfate transporter during seed development in Arabidopsis thaliana.

Physiol Plantarum 125, 95-105.

Balharry, G.J.E., and Nicholas, J.D.J. (1970). ATP sulfurylase in spinach leaves. Biochim Biophys Acta 220, 513-524.

Barton, K.A., Thompson, J.F., Madison, J.T., Rosenthal, R., Jarvis,

N.P., and Beachy, R.N. (1982). The biosynthesis and processing of high molecular weight precursors of soybean glycinin subunits. J Biol

Chem 257, 6089-6095.

Bates, P.D., Durrett, T.P., Ohlrogge, J.B., and Pollard, M. (2009).

Analysis of acyl fluxes through multiple pathways of triacylglycerol synthesis in developing soybean embryos. Plant Physiol 150, 55-72.

Baud, S., and Lepiniec, L. (2010). Physiological and developmental regulation of seed oil production. Prog Lipid Res 49, 235-249.

Baud, S., Boutin, J.-P., Miquel, M., Lepiniec, L., and Rochat, C. (2002).

An integrated overview of seed development in Arabidopsis thaliana ecotype WS. Plant Physiol Bioch 40, 151-160.

Baud, S., Dubreucq, B., Miquel, M., Rochat, C., and Lepiniec, L.

(2008). Storage reserve accumulation in Arabidopsis: Metabolic and developmental control of seed filling. The Arabidopsis Book, e0113.

Baud, S., Wuillème, S., Dubreucq, B., De Almeida, A., Vuagnat, C.,

Lepiniec, L., Miquel, M., and Rochat, C. (2007). Function of

131

References plastidial pyruvate kinases in seeds of Arabidopsis thaliana. Plant J 52,

405-419.

Beinert, H., Holm, R.H., and Munck, E. (1997). Iron-sulfur clusters: nature’s modular, multipurpose structures. Science 277, 653-659.

Bell, C.S., Cram, W.J., and Clarkson, D.T. (1994). Compartmental analysis of

35

SO

4

2-

exchange kinetics in roots and leaves of a tropical legume

Macroptilium atropurpureum cv. Siratro. J Exp Bot 45, 879-886.

Benning, C. (1998). Biosynthesis and function of the sulfolipid sulfoquinovosyl diacylglycerol. Annu Rev Plant Phys 49, 53-75.

Bertagnolli, B.L., and Wedding, R.T. (1977). Purification and initial kinetic characterization of different forms of O-acetylserine sulfhydrylase from seedlings of two species of Phaseolus. Plant Physiol 60, 115-121.

Bevan, M., Bancroft, I., Bent, E., Love, K., Goodman, H., Dean, C.,

Bergkamp, R., Dirkse, W., Van Staveren, M., Stiekema, W.,

Drost, L., Ridley, P., Hudson, S.A., Patel, K., Murphy, G.,

Piffanelli, P., Wedler, H., Wedler, E., Wambutt, R.,

Weitzenegger, T., Pohl, T.M., Terryn, N., Gielen, J., Villarroel,

R., De Clerck, R., Van Montagu, M., Lecharny, A., Auborg, S.,

Gy, I., Kreis, M., Lao, N., Kavanagh, T., Hempel, S., Kotter, P.,

Entian, K.D., Rieger, M., Schaeffer, M., Funk, B., Mueller-Auer,

S., Silvey, M., James, R., Montfort, A., Pons, A., Puigdomenech,

P., Douka, A., Voukelatou, E., Milioni, D., Hatzopoulos, P.,

Piravandi, E., Obermaier, B., Hilbert, H., Dusterhoft, A.,

Moores, T., Jones, J.D., Eneva, T., Palme, K., Benes, V.,

Rechman, S., Ansorge, W., Cooke, R., Berger, C., Delseny, M.,

Voet, M., Volckaert, G., Mewes, H.W., Klosterman, S.,

Schueller, C., and Chalwatzis, N. (1998). Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of Arabidopsis thaliana.

Nature 391, 485-488.

Bick, J.A., Aslund, F., Chen, Y., and Leustek, T. (1998). Glutaredoxin function for the carboxyl-terminal domain of the plant-type 5’adenylylsulfate reductase. P Natl Acad Sci USA 95, 8404-8409.

Bogdanova, N., and Hell, R. (1997). Cysteine synthesis in plants: proteinprotein interactions of serine acetyltransferase from Arabidopsis

thaliana. Plant J 11, 251-262.

Bogdanova, N., Bork, C., and Hell, R. (1995). Cysteine biosynthesis in plants: isolation and functional identification of a cDNA encoding a serine acetyltransferase from Arabidopsis thaliana. FEBS Lett 358, 43-

47.

Bonner, E.R., Cahoon, R.E., Knapke, S.M., and Jez, J.M. (2005).

Molecular basis of cysteine biosynthesis in plants: structural and functional analysis of O-acetylserine sulfhydrylase from Arabidopsis

thaliana. J Biol Chem 280, 38803-38813.

Bork, C., Schwenn, J.D., and Hell, R. (1998). Isolation and characterization of a gene for assimilatory sulfite reductase from Arabidopsis thaliana.

Gene 212, 147-153.

Boyes, D.C., Zayed, A.M., Ascenzi, R., McCaskill, A.J., Hoffman, N.E.,

Davis, K.R., and Gorlach, J. (2001). Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13, 1499-1510.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.

132

References

Brown, L., Scholefield, D., Jewkes, E.C., Preedy, N., Wadge, K., and

Butler, M. (2000). The effect of sulphur application on the efficiency of nitrogen use in two contrasting grassland soils. J Agr Sci 135, 131-138.

Brühl, A., Haverkamp, T., Gisselmann, G., and Schwenn, J.D. (1996). A cDNA clone from Arabidopsis thaliana encoding plastidic ferredoxin: sulfite reductase. Biochim Biophys Acta 1295, 119-124.

Brunold, C., and Suter, M. (1984). Regulation of sulfate assimilation by nitrogen nutrition in the duckweed Lemna minor L. Plant Physiol 76,

579-583.

Brunold, C., and Suter, M. (1989). Localization of enzymes of assimilatory sulfate reduction in pea roots. Planta 179, 228-234.

Brunold, C., and Suter, M. (1990). Adenosine 5’-phosphosulfate sulfotransferase. In Methods in plant biochemistry, P. Lea, ed (London:

Academic Press), pp. 339–343.

Brychkova, G., Xia, Z., Yang, G., Yesbergenova, Z., Zhang, Z.,

Davydov, O., Fluhr, R., and Sagi, M. (2007). Sulfite oxidase protects plants against sulfur dioxide toxicity. Plant J 50, 696-709.

Buchner, P., Takahashi, H., and Hawkesford, M.J. (2004). Plant sulphate transporters: co-ordination of uptake, intracellular and longdistance transport. J Exp Bot 55, 1765-1773.

Bullock, W.O., Fernandez, J.M., and Short, J.M. (1987). XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with betagalactosidase selection. Biotechniques 5, 376–379.

Burke, J.J., Holloway, P., and Dalling, M.J. (1986). The effect of sulfur deficiency on the organisation and photosynthetic capability of wheat leaves. J Plant Physiol 125, 371-375.

Burkhard, P., Tai, C.H., Ristroph, C.M., Cook, P.F., and Jansonius,

J.N. (1999). Ligand binding induces a large conformational change in Oacetylserine sulfhydrylase from Salmonella typhimurium. J Mol Biol

291, 941-953.

Burkhard, P., Rao, G.S., Hohenester, E., Schnackerz, K.D., Cook, P.F.,

and Jansonius, J.N. (1998). Three-dimensional structure of Oacetylserine sulfhydrylase from Salmonella typhimurium. J Mol Biol

283, 121-133.

Cairns, N.G., Pasternak, M., Wachter, A., Cobbett, C.S., and Meyer,

A.J. (2006). Maturation of Arabidopsis seeds is dependent on glutathione biosynthesis within the embryo. Plant Physiol 141, 446-455.

Campanini, B., Speroni, F., Salsi, E., Cook, P.F., Roderick, S.L.,

Huang, B., Bettati, S., and Mozzarelli, A. (2005). Interaction of serine acetyltransferase with O-acetylserine sulfhydrylase active site: evidence from fluorescence spectroscopy. Protein Sci 14, 2115-2124.

Cao, Y.-z., and Huang, A.H.C. (1986). Diacylglycerol acyltransferase in maturing oil seeds of maize and other species. Plant Physiol 82, 813-820.

Cao, Y.-Z., and Huang, A.H.C. (1987). Acyl coenzyme A preference of diacylglycerol acyltransferase from the maturing seeds of Cuphea, maize, rapeseed, and Canola. Plant Physiol 84, 762-765.

Chang, S., Puryear, J., and Cairney, J. (1993). A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11, 113-116.

Clarkson, D.T., and Hawkesford, M.J. (1993). Molecular biological approaches to plant nutrition. In Plant nutrition - from genetic engineering to field practice, N.J. Barrow, ed (Dortrecht: Kluwer

Academic Publishers), pp. 23-33.

133

References

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant

J 16, 735-743.

Clouse, S.D., and Sasse, J.M. (1998). Brassinosteroids: essential regulators of plant growth and development. Annu Rev Plant Phys 49, 427-451.

Clouse, S.D., Langford, M., and McMorris, T.C. (1996). A brassinosteroidinsensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development. Plant Physiol 111, 671-678.

Crane, B.R., Siegel, L.M., and Getzoff, E.D. (1995). Sulfite reductase structure at 1.6 Å: evolution and catalysis for reduction of inorganic anions. Science 270, 59-67.

Curtis, M.D., and Grossniklaus, U. (2003). A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133,

462-469.

D'Hondt, K., Van Damme, J., Van Den Bossche, C., Leejeerajumnean,

S., De Rycke, R., Derksen, J., Vandekerckhove, J., and

Krebbers, E. (1993). Studies of the role of the propeptides of the

Arabidopsis thaliana 2S albumin. Plant Physiol 102, 425-433.

Davidian, J.C., and Kopriva, S. (2010). Regulation of sulfate uptake and assimilation--the same or not the same? Mol Plant 3, 314-325.

Desikan, R., Neill, S.J., and Hancock, J.T. (2000). Hydrogen peroxideinduced gene expression in Arabidopsis thaliana. Free Radical Bio Med

28, 773-778.

Devoto, A., Ellis, C., Magusin, A., Chang, H.-S., Chilcott, C., Zhu, T.,

and Turner, J. (2005). Expression profiling reveals COI1 to be a key regulator of genes involved in wound- and methyl jasmonate-induced secondary metabolism, defence, and hormone interactions. Plant Mol

Biol 58, 497-513.

Dhankher, O.P., Li, Y., Rosen, B.P., Shi, J., Salt, D., Senecoff, J.F.,

Sashti, N.A., and Meagher, R.B. (2002). Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase

-glutamylcysteine synthetase expression. Nat Biotechnol 20, 1140-

1145.

Dietz, K.-J. (1989). Recovery of spinach leaves from sulfate and phosphate deficiency. J Plant Physiol 134, 551-557.

Droux, M. (2004). Sulfur assimilation and the role of sulfur in plant metabolism: a survey. Photosynth Res 79, 331-348.

Droux, M., Martin, J., Sajus, P., and Douce, R. (1992). Purification and characterization of O-acetylserine (thiol) lyase from spinach chloroplasts.

Arch Biochem Biophys 295, 379-390.

Droux, M., Ruffet, M.L., Douce, R., and Job, D. (1998). Interactions between serine acetyltransferase and O-acetylserine (thiol) lyase in higher plants-structural and kinetic properties of the free and bound enzymes.

Eur J Biochem 255, 235-245.

Ebell, L.F. (1969). Specific total starch determinations in conifer tissues with glucose oxidase. Phytochemistry 8, 25-36.

Edwards, K., Johnstone, C., and Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis.

Nucleic Acids Res 19, 1349.

Eilers, T., Schwarz, G., Brinkmann, H., Witt, C., Richter, T., Nieder,

J., Koch, B., Hille, R., Hansch, R., and Mendel, R.R. (2001).

Identification and biochemical characterization of Arabidopsis thaliana

134

References sulfite oxidase. A new player in plant sulfur metabolism. J Biol Chem

276, 46989-46994.

Eimert, K., Wang, S.M., Lue, W.I., and Chen, J. (1995). Monogenic recessive mutations causing both late floral initiation and excess starch accumulation in Arabidopsis. Plant Cell 7, 1703-1712.

Fahey, R.C., Newton, G.L., Dorian, R., and Kosower, E.M. (1981).

Analysis of biological thiols: quantitative determination of thiols at the picomole level based upon derivatization with monobromobimanes and separation by cation-exchange chromatography. Anal Biochem 111, 357-

365.

Fait, A., Angelovici, R., Less, H., Ohad, I., Urbanczyk-Wochniak, E.,

Fernie, A.R., and Galili, G. (2006). Arabidopsis seed development and germination is associated with temporally distinct metabolic switches. Plant Physiol 142, 839-854.

Flügge, U.I., Fischer, K., Gross, A., Sebald, W., Lottspeich, F., and

Eckerskorn, C. (1989). The triose phosphate-3-phosphoglyceratephosphate translocator from spinach chloroplasts: nucleotide sequence of a full-length cDNA clone and import of the in vitro synthesized precursor protein into chloroplasts. EMBO J 8, 39-46.

Francois, J.A., Kumaran, S., and Jez, J.M. (2006). Structural basis for interaction of O-acetylserine sulfhydrylase and serine acetyltransferase in the Arabidopsis cysteine synthase complex. Plant Cell 18, 3647-3655.

Freney, J.R., Spencer, K., and Jones, M.B. (1978). The diagnosis of sulphur deficiency in wheat. Aust J Agr Res 29, 727-738.

Gaitonde, M.K. (1967). A spectrophotometric method for the direct determination of cysteine in the presence of other naturally occuring amino acids. Biochem J 104, 627-633.

Gallardo, K., Job, C., Groot, S.P., Puype, M., Demol, H.,

Vandekerckhove, J., and Job, D. (2002). Proteomics of Arabidopsis seed germination. A comparative study of wild-type and gibberellindeficient seeds. Plant Physiol 129, 823-837.

Gallardo, K., Firnhaber, C., Zuber, H., Hericher, D., Belghazi, M.,

Henry, C., Kuster, H., and Thompson, R. (2007). A combined proteome and transcriptome analysis of developing Medicago truncatula seeds: evidence for metabolic specialization of maternal and filial tissues.

Mol Cell Proteomics 6, 2165-2179.

Gamet-Payrastre, L., Li, P., Lumeau, S., Cassar, G., Dupont, M.A.,

Chevolleau, S., Gasc, N., Tulliez, J., and Terce, F. (2000).

Sulforaphane, a naturally occurring isothiocyanate, induces cell cycle arrest and apoptosis in HT29 human colon cancer cells. Cancer Res 60,

1426-1433.

Gao, Y., Schofield, O.M., and Leustek, T. (2000). Characterization of sulfate assimilation in marine algae focusing on the enzyme 5'adenylylsulfate reductase. Plant Physiol 123, 1087-1096.

Gasber, A., Klaumann, S., Trentmann, O., Trampczynska, A.,

Clemens, S., Schneider, S., Sauer, N., Feifer, I., Bittner, F.,

Mendel, R.R., and Neuhaus, H.E. (2011). Identification of an

Arabidopsis solute carrier critical for intracellular transport and interorgan allocation of molybdate. Plant Biol 13, 710-718.

Gidda, S.K., Miersch, O., Levitin, A., Schmidt, J., Wasternack, C., and

Varin, L. (2003). Biochemical and molecular characterization of a

135

References hydroxyjasmonate sulfotransferase from Arabidopsis thaliana. J Biol

Chem 278, 17895-17900.

Gillespie, J., Rogers, S.W., Deery, M., Dupree, P., and Rogers, J.C.

(2005). A unique family of proteins associated with internalized membranes in protein storage vacuoles of the Brassicaceae. Plant J 41,

429-441.

Giovanelli, J., Mudd, S.H., and Datko, A.H. (1980). Sulfur amino acids in plants. In The biochemistry of plants, B.J. Miflin, ed (New York:

Academic Press), pp. 453-505.

Goloubinoff, P., Gatenby, A.A., and Lorimer, G.H. (1989a). GroE heatshock proteins promote assembly of foreign prokaryotic ribulose bisphosphate carboxylase oligomers in Escherichia coli. Nature 337, 44-

47.

Goloubinoff, P., Christeller, J.T., Gatenby, A.A., and Lorimer, G.H.

(1989b). Reconstitution of active dimeric ribulose bisphosphate carboxylase from an unfolded state depends on two chaperonin proteins and Mg-ATP. Nature 342, 884-889.

Gómez, L.D., Baud, S., Gilday, A., Li, Y., and Graham, I.A. (2006).

Delayed embryo development in the ARABIDOPSIS TREHALOSE-6-

PHOSPHATE SYNTHASE 1 mutant is associated with altered cell wall structure, decreased cell division and starch accumulation. Plant J 46,

69-84.

Gorman, J., and Shapiro, L. (2004). Structure of serine acetyltransferase from Haemophilus influenzae Rd. Acta Crystallogr D 60, 1600-1605.

Graser, G., Oldham, N.J., Brown, P.D., Temp, U., and Gershenzon, J.

(2001). The biosynthesis of benzoic acid glucosinolate esters in

Arabidopsis thaliana. Phytochemistry 57, 23-32.

Grill, E., Loffler, S., Winnacker, E.L., and Zenk, M.H. (1989).

Phytochelatins, the heavy-metal-binding peptides of plants, are synthesized from glutathione by a specific gamma-glutamylcysteine dipeptidyl transpeptidase (phytochelatin synthase). P Natl Acad Sci USA

86, 6838-6842.

Gruis, D., Schulze, J., and Jung, R. (2004). Storage protein accumulation in the absence of the vacuolar processing enzyme family of cysteine proteases. Plant Cell 16, 270-290.

Gruis, D.F., Selinger, D.A., Curran, J.M., and Jung, R. (2002).

Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases. Plant Cell 14, 2863-2882.

Guerche, P., Tire, C., De Sa, F.G., De Clercq, A., Van Montagu, M., and

Krebbers, E. (1990). Differential expression of the Arabidopsis 2S albumin genes and the effect of increasing gene family size. Plant Cell 2,

469-478.

Gutierrez-Marcos, J.F., Roberts, M.A., Campbell, E.I., and Wray, J.L.

(1996). Three members of a novel small gene-family from Arabidopsis

thaliana able to complement functionally an Escherichia coli mutant defective in PAPS reductase activity encode proteins with a thioredoxinlike domain and “APS reductase” activity. P Natl Acad Sci USA 93, 13377-

13382.

Haas, F.H. (2010). Dual function of the cysteine cynthase complex in mitochondria from Arabidopsis thaliana (Dissertation, Heidelberg:

Ruperto-Carola University of Heidelberg).

136

References

Haas, F.H., Heeg, C., Queiroz, R., Bauer, A., Wirtz, M., and Hell, R.

(2008). Mitochondrial serine acetyltransferase functions as a pacemaker of cysteine synthesis in plant cells. Plant Physiol 148, 1055-1067.

Hänsch, R., Lang, C., Riebeseel, E., Lindigkeit, R., Gessler, A.,

Rennenberg, H., and Mendel, R.R. (2006). Plant sulfite oxidase as novel producer of H

2

O

2 - combination of enzyme catalysis with a subsequent non-enzymatic reaction step. J Biol Chem 281, 6884-6888.

Hanzawa, Y., Imai, A., Michael, A.J., Komeda, Y., and Takahashi, T.

(2002). Characterization of the spermidine synthase-related gene family in Arabidopsis thaliana. FEBS Lett 527, 176-180.

Harder, A., Wildgruber, R., Nawrocki, A., Fey, S.J., Mose Larsen, P.,

and Görg, A. (1999). Comparison of yeast cell protein solubilization procedures for two-dimensional electrophoresis. Electrophoresis 20,

826-829.

Hartmann, T., Honicke, P., Wirtz, M., Hell, R., Rennenberg, H., and

Kopriva, S. (2004). Regulation of sulphate assimilation by glutathione in poplars (Populus tremula x P. alba) of wild type and overexpressing

-glutamylcysteine synthetase in the cytosol. J Exp Bot 55, 837-845.

Harwood, J.L. (1996). Recent advances in the biosynthesis of plant fatty acids.

BBA-Lipid Met 1301, 7-56.

Hatzfeld, Y., Lee, S., Lee, M., Leustek, T., and Saito, K. (2000a).

Functional characterization of a gene encoding a fourth ATP sulfurylase isoform from Arabidopsis thaliana. Gene 248, 51-58.

Hatzfeld, Y., Maruyama, A., Schmidt, A., Noji, M., Ishizawa, K., and

Saito, K.

1163-1172.

-Cyanoalanine synthase is a mitochondrial cysteine cynthase-like protein in spinach and Arabidopsis. Plant Physiol 123,

Haughn, G.W., and Somerville, C. (1986). Sulfonylurea-resistant mutants of

Arabidopsis thaliana. Mol Gen Genet 204, 430-434.

Hawkesford, M.J. (2003). Transporter gene families in plants: the sulphate transporter gene family redundancy or specialization? Physiol Plantarum

117, 155-163.

Hawkesford, M.J., and Smith, F.W. (1997). Molecular biology of plant sulphate transporters. In Sulphur metabolism in higher plants.

Molecular, ecophysiological and nutritional aspects, W.J. Cram, L.J. De

Kok, I. Stulen, C. Brunold, and H. Rennenberg, eds (Leiden: Backhuys

Publ.), pp. 13-26.

Hawkesford, M.J., and Wray, J.L. (2000). Molecular genetics of sulphate assimilation. Adv. Bot. Res. 33, 159-223.

Heeg, C., Kruse, C., Jost, R., Gutensohn, M., Ruppert, T., Wirtz, M., and Hell,

R. (2008). Analysis of the Arabidopsis Oacetylserine(thiol)lyase gene family demonstrates compartment-specific differences in the regulation of cysteine synthesis. Plant Cell 20, 168-185.

Hell, R. (1997). Molecular physiology of plant sulfur metabolism. Planta 202,

138-148.

Hell, R. (1998). Molekulare Physiologie des Primärstoffwechsels von Schwefel in Pflanzen. (Aachen: Shaker).

Hell, R., Jost, R., Berkowitz, O., and Wirtz, M. (2002). Molecular and biochemical analysis of the enzymes of cysteine biosynthesis in the plant

Arabidopsis thaliana. Amino Acids 22, 245-257.

137

References

Hesse, H., Nikiforova, V., Gakiere, B., and Hoefgen, R. (2004).

Molecular analysis and control of cysteine biosynthesis: integration of nitrogen and sulphur metabolism. J Exp Bot 55, 1283-1292.

Hesse, H., Trachsel, N., Suter, M., Kopriva, S., von Ballmoos, P.,

Rennenberg, H., and Brunold, C. (2003). Effect of glucose on assimilatory sulphate reduction in Arabidopsis thaliana roots. J Exp Bot

54, 1701-1709.

Higashi, Y., Hirai, M.Y., Fujiwara, T., Naito, S., Noji, M., and Saito, K.

(2006). Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. Plant J 48, 557-571.

Hillmer, S., Movafeghi, A., Robinson, D.G., and Hinz, G. (2001).

Vacuolar storage proteins are sorted in the cis-cisternae of the pea cotyledon Golgi apparatus. J Cell Biol 152, 41-50.

Hiraiwa, N., Kondo, M., Nishimura, M., and Hara-Nishimura, I.

(1997). An aspartic endopeptidase is involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles of plants. Eur

J Biochem 246, 133-141.

Honda, C., Fujiwara, T., and Chino, M. (1998). Sulfate uptake in

Arabidopsis thaliana. J Plant Nutr 21, 601-614.

Hood, E.E., Love, R., Lane, J., Bray, J., Clough, R., Pappu, K., Drees,

C., Hood, K.R., Yoon, S., Ahmad, A., and Howard, J.A. (2007).

Subcellular targeting is a key condition for high-level accumulation of cellulase protein in transgenic maize seed. Plant Biotechnol J 5, 709-719.

Howarth, J.R., Roberts, M.A., and Wray, J.L. (1997). Cysteine biosynthesis in higher plants: a new member of the Arabidopsis thaliana serine acetyltransferase small gene-family obtained by functional complementation of an Escherichia coli cysteine auxotroph. Biochim

Biophys Acta 1350, 123-127.

Howden, R., Andersen, C.R., Goldsbrough, P.B., and Cobbett, C.S.

(1995). A cadmium-sensitive, glutathione-deficient mutant of

Arabidopsis thaliana. Plant Physiol 107, 1067-1073.

Huang, A.H.C. (1992). Oil bodies and oleosins in seeds. Annu Rev Plant Phys

43, 177-200.

Huang, B., Vetting, M.W., and Roderick, S.L. (2005). The active site of Oacetylserine sulfhydrylase is the anchor point for bienzyme complex formation with serine acetyltransferase. J Bacteriol 187, 3201-3205.

Ihaka, R., and Gentleman, R. (1996). R: A language for data analysis and graphics. J Comput Graph Stat 5, 299-314.

Imai, A., Matsuyama, T., Hanzawa, Y., Akiyama, T., Tamaoki, M., Saji,

H., Shirano, Y., Kato, T., Hayashi, H., Shibata, D., Tabata, S.,

Komeda, Y., and Takahashi, T. (2004). Spermidine synthase genes are essential for survival of Arabidopsis. Plant Physiol 135, 1565-1573.

Imsande, J. (1998). Iron, sulfur, and chlorophyll deficiencies: a need for an integrative approach in plant physiology. Physiol Plantarum 103, 139-

144.

Ito, H., Iwabuchi, M., and Ogawa, K.i. (2003). The sugar-metabolic enzymes aldolase and triose-phosphate isomerase are targets of glutathionylation in Arabidopsis thaliana: detection using biotinylated glutathione. Plant Cell Physiol 44, 655-660.

Ito, K., and Kawanishi, S. (1991). Site-specific fragmentation and modification of albumin by sulfite in the presence of metal ions or

138

References peroxidase/H2O2: role of sulfate radical. Biochem Bioph Res Co 176,

1306-1312.

Johnston, M.L., Luethy, M.H., Miernyk, J.A., and Randall, D.D. (1997).

Cloning and molecular analyses of the Arabidopsis thaliana plastid pyruvate dehydrogenase subunits. BBA-Bioenergetics 1321, 200-206.

Jornot, L., Petersen, H., and Junod, A.F. (1998). Hydrogen peroxideinduced DNA damage is independent of nuclear calcium but dependent on redox-active ions. Biochem J 335 ( Pt 1), 85-94.

Jost, R., Altschmied, L., Bloem, E., Bogs, J., Gershenzon, J., Hahnel,

U., Hansch, R., Hartmann, T., Kopriva, S., Kruse, C., Mendel,

R.R., Papenbrock, J., Reichelt, M., Rennenberg, H., Schnug, E.,

Schmidt, A., Textor, S., Tokuhisa, J., Wachter, A., Wirtz, M.,

Rausch, T., and Hell, R. (2005). Expression profiling of metabolic genes in response to methyl jasmonate reveals regulation of genes of primary and secondary sulfur-related pathways in Arabidopsis thaliana.

Photosynth Res 86, 491-508.

Kataoka, T., Hayashi, N., Yamaya, T., and Takahashi, H. (2004a). Rootto-shoot transport of sulfate in Arabidopsis. Evidence for the role of

SULTR3;5 as a component of low-affinity sulfate transport system in the root vasculature. Plant Physiol 136, 4198-4204.

Kataoka, T., Watanabe-Takahashi, A., Hayashi, N., Ohnishi, M.,

Mimura, T., Buchner, P., Hawkesford, M.J., Yamaya, T., and

Takahashi, H. (2004b). Vacuolar sulfate transporters are essential determinants controlling internal distribution of sulfate in Arabidopsis.

Plant Cell 16, 2693-2704.

Kawanishi, S., Hiraku, Y., and Oikawa, S. (2001). Mechanism of guaninespecific DNA damage by oxidative stress and its role in carcinogenesis and aging. Mutat Res-Rev Mutat 488, 65-76.

Kawashima, C.G., Berkowitz, O., Hell, R., Noji, M., and Saito, K.

(2005). Characterization and expression analysis of a serine acetyltransferase gene family involved in a key step of the sulfur assimilation pathway in Arabidopsis. Plant Physiol 137, 220-230.

Kennedy, E.P. (1961). Biosynthesis of complex lipids. Fed Proc 20, 934-940.

Khan, M.S. (2008). The role of sulfite reductase in assimilatory sulfate reduction in Arabidopsis thaliana (Dissertation, Heidelberg: Ruperto-

Carola University of Heidelberg).

Khan, M.S., Haas, F.H., Allboje Samami, A., Gholami, A.M., Bauer, A.,

Fellenberg, K., Reichelt, M., Hansch, R., Mendel, R.R., Meyer,

A.J., Wirtz, M., and Hell, R. (2010). Sulfite reductase defines a newly discovered bottleneck for assimilatory sulfate reduction and is essential for growth and development in Arabidopsis thaliana. Plant Cell 22, 1216-

1231.

Kim, T.-W., Hwang, J.-Y., Kim, Y.-S., Joo, S.-H., Chang, S.C., Lee, J.S.,

Takatsuto, S., and Kim, S.-K. (2005). Arabidopsis CYP85A2, a cytochrome P450, mediates the Baeyer-Villiger oxidation of castasterone to brassinolide in brassinosteroid biosynthesis. Plant Cell 17, 2397-2412.

King, S.P., Lunn, J.E., and Furbank, R.T. (1997). Carbohydrate content and enzyme metabolism in developing canola siliques. Plant Physiol 114,

153-160.

Kinoshita, T., Nishimura, M., and Hara-Nishimura, I. (1995a). The sequence and expression of the gamma-VPE gene, one member of a

139

References family of three genes for vacuolar processing enzymes in Arabidopsis

thaliana. Plant Cell Physiol 36, 1555-1562.

Kinoshita, T., Nishimura, M., and Hara-Nishimura, I. (1995b).

Homologues of a vacuolar processing enzyme that are expressed in different organs in Arabidopsis thaliana. Plant Mol Biol 29, 81-89.

Kinoshita, T., Yamada, K., Hiraiwa, N., Kondo, M., Nishimura, M.,

and Hara-Nishimura, I. (1999). Vacuolar processing enzyme is upregulated in the lytic vacuoles of vegetative tissues during senescence and under various stressed conditions. Plant J 19, 43-53.

Klein, M., and Papenbrock, J. (2004). The multi-protein family of

Arabidopsis sulphotransferases and their relatives in other plant species.

J Exp Bot 55, 1809-1820.

Kopriva, S. (2006). Regulation of sulfate assimilation in Arabidopsis and beyond. Ann Bot-London 97, 479-495.

Kopriva, S., and Koprivova, A. (2004). Plant adenosine 5’-phosphosulphate reductase: the past, the present, and the future. J Exp Bot 55, 1775-1783.

Kopriva, S., and Rennenberg, H. (2004). Control of sulphate assimilation and glutathione synthesis: interaction with N and C metabolism. J Exp

Bot 55, 1831-1842.

Kopriva, S., Patron, N., Keeling, P., and Leustek, T. (2008). Phylogenetic analysis of sulfate assimilation and cysteine biosynthesis in phototrophic organisms. In Sulfur metabolism in phototrophic organisms, R. Hell, C.

Dahl, and T. Leustek, eds (Dordrecht: Springer), pp. 33-60.

Kopriva, S., Muheim, R., Koprivova, A., Trachsel, N., Catalano, C.,

Suter, M., and Brunold, C. (1999). Light regulation of assimilatory sulphate reduction in Arabidopsis thaliana. Plant J 20, 37-44.

Kopriva, S., Buchert, T., Fritz, G., Suter, M., Benda, R., Schunemann,

V., Koprivova, A., Schurmann, P., Trautwein, A.X., Kroneck,

P.M., and Brunold, C. (2002). The presence of an iron-sulfur cluster in adenosine 5’-phosphosulfate reductase separates organisms utilizing adenosine 5’-phosphosulfate and phosphoadenosine 5’-phosphosulfate for sulfate assimilation. J Biol Chem 277, 21786-21791.

Koprivova, A., Suter, M., den Camp, R.O., Brunold, C., and Kopriva,

S. (2000). Regulation of sulfate assimilation by nitrogen in Arabidopsis.

Plant Physiol 122, 737-746.

Koralewska, A., Posthumus, F.S., Stuiver, C.E., Buchner, P.,

Hawkesford, M.J., and De Kok, L.J. (2007). The characteristic high sulfate content in Brassica oleracea is controlled by the expression and activity of sulfate transporters. Plant Biol 9, 654-661.

Krebbers, E., Herdies, L., De Clercq, A., Seurinck, J., Leemans, J.,

Van Damme, J., Segura, M., Gheysen, G., Van Montagu, M., and

Vandekerckhove, J. (1988). Determination of the processing sites of an Arabidopsis 2S albumin and characterization of the complete gene family. Plant Physiol 87, 859-866.

Kredich, N.M. (1996). Biosynthesis of cysteine. In Escherichia coli and

Salmonella typhimurium. Cellular and molecular biology., F.C.

Neidhardt, R. Curtiss, J.L. Ingraham, E.C.C. Lin, K.B. Low, B. Magasanik,

W.S. Reznikoff, M. Riley, M. Schaechter, and E. Umberger, eds

(Washington D.C.: ASM Press), pp. 514-527.

Kredich, N.M., Becker, M.A., and Tomkins, G.M. (1969). Purification and characterization of cysteine synthetase, a bifunctional protein complex, from Salmonella typhimurium. J Biol Chem 244, 2428-2439.

140

References

Krueger, R.J., and Siegel, L.M. (1982). Evidence for siroheme-Fe

2905 - 2909.

4

S

4 interaction in spinach ferredoxin-sulfite reductase. Biochemistry-US 21,

Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

Lam, H.M., Wong, P., Chan, H.K., Yam, K.M., Chen, L., Chow, C.M.,

and Coruzzi, G.M. (2003). Overexpression of the ASN1 gene enhances nitrogen status in seeds of Arabidopsis. Plant Physiol 132, 926-935.

Lang, C., Popko, J., Wirtz, M., Hell, R., Herschbach, C., Kreuzwieser,

J., Rennenberg, H., Mendel, R.R., and Hansch, R. (2007).

Sulphite oxidase as key enzyme for protecting plants against sulphur dioxide. Plant Cell Environ 30, 447-455.

Lappartient, A.G., and Touraine, B. (1996). Demand-driven control of root

ATP sulfurylase activity and SO

111, 147-157.

4

2-

uptake in intact Canola. Plant Physiol

Lappartient, A.G., Vidmar, J.J., Leustek, T., Glass, A.D., and

Touraine, B. (1999). Inter-organ signaling in plants: regulation of ATP sulfurylase and sulfate transporter genes expression in roots mediated by phloem-translocated compound. Plant J 18, 89-95.

Lee, J.J., Woodward, A.W., and Chen, Z.J. (2007). Gene expression changes and early events in cotton fibre development. Ann Bot-London

100, 1391-1401.

Lee, S., and Leustek, T. (1998). APS kinase from Arabidopsis thaliana: genomic organization, expression, and kinetic analysis of the recombinant enzyme. Biochem Bioph Res Co 247, 171-175.

Lee, S., and Leustek, T. (1999). The affect of cadmium on sulfate assimilation enzymes in Brassica juncea. Plant Sci 141, 201-207.

León, P., and Sheen, J. (2003). Sugar and hormone connections. Trends

Plant Sci 8, 110-116.

Leprince, O., van Aelst, A.C., Pritchard, H.W., and Murphy, D.J.

(1998). Oleosins prevent oil-body coalescence during seed imbibition as suggested by a low-temperature scanning electron microscope study of desiccation-tolerant and -sensitive oilseeds. Planta 204, 109-119.

Leustek, T., and Saito, K. (1999). Sulfate transport and assimilation in plants.

Plant Physiol 120, 637-644.

Leustek, T., Martin, M.N., Bick, J.-A., and Davies, J.P. (2000). Pathways and regulation of sulfur metabolism revealed through molecular and genetic studies. Ann Rev Plant Phys 51, 141-165.

Li-Beisson, Y., Shorrosh, B., Beisson, F., Andersson, M.X., Arondel,

V., Bates, P.D., Baud, S., Bird, D., DeBono, A., Durrett, T.P.,

Franke, R.B., Graham, I.A., Katayama, K., Kelly, A.A., Larson,

T., Markham, J.E., Miquel, M., Molina, I., Nishida, I., Rowland,

O., Samuels, L., Schmid, K.M., Wada, H., Welti, R., Xu, C.,

Zallot, R., and Ohlrogge, J. (2010). Acyl-lipid metabolism. The

Arabidopsis Book, e0133.

Li, Q., Wang, B.C., Xu, Y., and Zhu, Y.X. (2007). Systematic studies of 12S seed storage protein accumulation and degradation patterns during

Arabidopsis seed maturation and early seedling germination stages. J

Biochem Mol Biol 40, 373-381.

Li, Y., Beisson, F., Pollard, M., and Ohlrogge, J. (2006). Oil content of

Arabidopsis seeds: the influence of seed anatomy, light and plant-to-plant variation. Phytochemistry 67, 904-915.

141

References

Lillig, C.H., Schiffmann, S., Berndt, C., Berken, A., Tischka, R., and

Schwenn, J.D. (2001). Molecular and catalytic properties of

Arabidopsis thaliana adenylyl sulfate (APS)-kinase. Arch Biochem

Biophys 392, 303-310.

Lin, M., Behal, R., and Oliver, D.J. (2003). Disruption of plE2, the gene for the E2 subunit of the plastid pyruvate dehydrogenase complex, in

Arabidopsis causes an early embryo lethal phenotype. Plant Mol Biol 52,

865-872.

Lisec, J., Schauer, N., Kopka, J., Willmitzer, L., and Fernie, A.R.

(2006). Gas chromatography mass spectrometry-based metabolite profiling in plants. Nat Protoc 1, 387-396.

Liu, C., and Mehdy, M.C. (2007). A nonclassical arabinogalactan protein gene highly expressed in vascular tissues, AGP31, is transcriptionally repressed by methyl jasmonic acid in Arabidopsis. Plant Physiol 145, 863-874.

Logan, H.M., Cathala, N., Grignon, C., and Davidian, J.C. (1996).

Cloning of a cDNA encoded by a member of the Arabidopsis thaliana

ATP sulfurylase multigene family. Expression studies in yeast and in relation to plant sulfur nutrition. J Biol Chem 271, 12227-12233.

Lunn, J.E., Droux, M., Martin, J., and Douce, R. (1990). Localization of

ATP-sulfurylase and O-acetylserine(thiol)lyase in spinach leaves. Plant

Physiol 94, 1345-1352.

Lutziger, I., and Oliver, D.J. (2000). Molecular evidence of a unique lipoamide dehydrogenase in plastids: analysis of plastidic lipoamide dehydrogenase from Arabidopsis thaliana. FEBS Lett 484, 12-16.

Mackinney, G. (1941). Absorption of light by chlorophyll solutions. J Biol

Chem 140, 315-322.

Marles, M.A., Ray, H., and Gruber, M.Y. (2003). New perspectives on proanthocyanidin biochemistry and molecular regulation.

Phytochemistry 64, 367-383.

Maruyama-Nakashita, A., Nakamura, Y., Yamaya, T., and Takahashi,

H. (2004). Regulation of high-affinity sulphate transporters in plants: towards systematic analysis of sulphur signalling and regulation. J Exp

Bot 55, 1843-1849.

Mathai, J.C., Missner, A., Kugler, P., Saparov, S.M., Zeidel, M.L., Lee,

J.K., and Pohl, P. (2009). No facilitator required for membrane transport of hydrogen sulfide. P Natl Acad Sci USA 106, 16633-16638.

Mathesius, U., Keijzers, G., Natera, S.H., Weinman, J.J., Djordjevic,

M.A., and Rolfe, B.G. (2001). Establishment of a root proteome reference map for the model legume Medicago truncatula using the expressed sequence tag database for peptide mass fingerprinting.

Proteomics 1, 1424-1440.

May, M., Vernoux, T., Leaver, C., Van Montagu, M., and Inze, D.

(1998). Glutathione homeostasis in plants: implications for environmental sensing and plant development. J Exp Bot 49, 649-667.

McGrath, S.P., Zhao, F.J., and Blake-Kalff, M.M.A. (2002). History and outlook for sulphur fertilisers in Europe. In Proceeding of the international fertiliser society no. 497 (York: International Fertiliser

Society), 1-22.

Mengel, K. (1991). Ernährung und Stoffwechsel der Pflanze. (Jena: G. Fischer

Verlag).

142

References

Meyer, A.J., and Fricker, M.D. (2000). Direct measurement of glutathione in epidermal cells of intact Arabidopsis roots by two-photon laser scanning microscopy. J Microsc-Oxford 198, 174-181.

Meyer, A.J., Brach, T., Marty, L., Kreye, S., Rouhier, N., Jacquot, J.P.,

and Hell, R. (2007). Redox-sensitive GFP in Arabidopsis thaliana is a quantitative biosensor for the redox potential of the cellular glutathione redox buffer. Plant J 52, 973-986.

Miersch, O., Neumerkel, J., Dippe, M., Stenzel, I., and Wasternack, C.

(2008). Hydroxylated jasmonates are commonly occurring metabolites of jasmonic acid and contribute to a partial switch-off in jasmonate signaling. New Phytol 177, 114-127.

Mino, K., Yamanoue, T., Sakiyama, T., Eisaki, N., Matsuyama, A., and

Nakanishi, K. (1999). Purification and characterization of serine acetyltransferase from Escherichia coli partially truncated at the Cterminal region. Biosci Biotech Bioch 63, 168-179.

Mino, K., Yamanoue, T., Sakiyama, T., Eisaki, N., Matsuyama, A., and

Nakanishi, K. (2000). Effects of bienzyme complex formation of cysteine synthetase from Escherichia coli on some properties and kinetics. Biosci Biotech Bioch 64, 1628-1640.

Molina, I., Bonaventure, G., Ohlrogge, J., and Pollard, M. (2006). The lipid polyester composition of Arabidopsis thaliana and Brassica napus seeds. Phytochemistry 67, 2597-2610.

Molvig, L., Tabe, L.M., Eggum, B.O., Moore, A.E., Craig, S., Spencer,

D., and Higgins, T.J. (1997). Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus

angustifolius L.) expressing a sunflower seed albumin gene. P Natl Acad

Sci USA 94, 8393-8398.

Mugford, S.G., Yoshimoto, N., Reichelt, M., Wirtz, M., Hill, L.,

Mugford, S.T., Nakazato, Y., Noji, M., Takahashi, H., Kramell,

R., Gigolashvili, T., Flugge, U.I., Wasternack, C., Gershenzon,

J., Hell, R., Saito, K., and Kopriva, S. (2009). Disruption of adenosine-5’-phosphosulfate kinase in Arabidopsis reduces levels of sulfated secondary metabolites. Plant Cell 21, 910-927.

Muller, J.G., Hickerson, R.P., Perez, R.J., and Burrows, C.J. (1997).

DNA damage from sulfite autoxidation catalyzed by a nickel(II) peptide. J

Am Chem Soc 119, 1501-1506.

Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H.

(1986). Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Sym 51, 263-273.

Murillo, M., Foglia, R., Diller, A., Lee, S., and Leustek, T. (1995). Serine acetyltransferase from

Arabidopsis

thaliana can functionally complement the cysteine requirement of a cysE mutant strain of

Escherichia coli. Cell Mol Biol Res 41, 425-433.

Murphy, D.J. (1993). Structure, function and biogenesis of storage lipid bodies and oleosins in plants. Prog Lipid Res 32, 247-280.

Murphy, D.J., and Vance, J. (1999). Mechanisms of lipid-body formation.

Trends Biochem Sci 24, 109-115.

Müssig, C., Shin, G.-H., and Altmann, T. (2003). Brassinosteroids promote root growth in Arabidopsis. Plant Physiol 133, 1261-1271.

Nakano, T., Suzuki, K., Ohtsuki, N., Tsujimoto, Y., Fujimura, T., and

Shinshi, H. (2006). Identification of genes of the plant-specific

143

References transcription-factor families cooperatively regulated by ethylene and jasmonate in Arabidopsis thaliana. J Plant Res 119, 407-413.

Nakayama, M., Akashi, T., and Hase, T. (2000). Plant sulfite reductase: molecular structure, catalytic function and interaction with ferredoxin. J

Inorg Biochem 82, 27-32.

Newton, G.L., Dorian, R., and Fahey, R.C. (1981). Analysis of biological thiols: derivatization with monobromobimane and separation by reversephase high-performance liquid chromatography. Anal Biochem 114, 383-

387.

Nikiforova, V., Freitag, J., Kempa, S., Adamik, M., Hesse, H., and

Hoefgen, R. (2003). Transcriptome analysis of sulfur depletion in

Arabidopsis thaliana: interlacing of biosynthetic pathways provides response specificity. Plant J 33, 633-650.

Nikiforova, V.J., Kopka, J., Tolstikov, V., Fiehn, O., Hopkins, L.,

Hawkesford, M.J., Hesse, H., and Hoefgen, R. (2005). Systems rebalancing of metabolism in response to sulfur deprivation, as revealed by metabolome analysis of Arabidopsis plants. Plant Physiol 138, 304-

318.

Nishizawa, A., Yabuta, Y., and Shigeoka, S. (2008). Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol 147, 1251-1263.

Noctor, G., and Foyer, C.H. (1998). Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Phys 49, 249-279.

Noctor, G., Arisi, A., Jouanin, L., Kunert, K., Rennenberg, H., and

Foyer, C. (1998). Glutathione: biosynthesis, metabolism and relationship to stress tolerance explored in transformed plants. J Exp Bot

49, 623-647.

Noji, M., and Saito, K. (2002). Molecular and biochemical analysis of serine acetyltransferase and cysteine synthase towards sulfur metabolic engineering in plants. Amino Acids 22, 231-243.

Noji, M., Inoue, K., Kimura, N., Gouda, A., and Saito, K. (1998).

Isoform-dependent differences in feedback regulation and subcellular localization of serine acetyltransferase involved in cysteine biosynthesis from Arabidopsis thaliana. J Biol Chem 273, 32739-32745.

Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and

Yamaguchi, S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in

Arabidopsis. J Biol Chem 280, 17873-17879.

Ohlrogge, J., and Browse, J. (1995). Lipid biosynthesis. Plant Cell 7, 957-

970.

Otegui, M.S., Herder, R., Schulze, J., Jung, R., and Staehelin, L.A.

(2006). The proteolytic processing of seed storage proteins in Arabidopsis embryo cells starts in the multivesicular bodies. Plant Cell 18, 2567-2581.

Pang, P.P., Pruitt, R.E., and Meyerowitz, E.M. (1988). Molecular cloning, genomic organization, expression and evolution of 12S seed storage protein genes of Arabidopsis thaliana. Plant Mol Biol 11, 805-820.

Peng, Z., and Verma, D.P. (1995). A rice HAL2-like gene encodes a Ca

2+

sensitive 3’(2’),5’-diphosphonucleoside 3’(2’)-phosphohydrolase and complements yeast met22 and Escherichia coli cysQ mutations. J Biol

Chem 270, 29105-29110.

144

References

Perez-Espana, V.H., Sanchez-Leon, N., and Vielle-Calzada, J.P. (2011).

CYP85A1 is required for the initiation of female gametogenesis in

Arabidopsis thaliana. Plant Signal Behav 6, 321-326.

Perry, H.J., Bligny, R., Gout, E., and Harwood, J.L. (1999). Changes in

Kennedy pathway intermediates associated with increased triacylglycerol synthesis in oil-seed rape. Phytochemistry 52, 799-804.

Pinto, R., Harrison, J.S., Hsu, T., Jacobs, W.R., Jr., and Leyh, T.S.

(2007). Sulfite reduction in mycobacteria. J Bacteriol 189, 6714-6722.

Pye, V.E., Tingey, A.P., Robson, R.L., and Moody, P.C. (2004). The structure and mechanism of serine acetyltransferase from Escherichia

coli. J Biol Chem 279, 40729-40736.

Queval, G., Thominet, D., Vanacker, H., Miginiac-Maslow, M.,

Gakiere, B., and Noctor, G. (2009). H

2

O

2

-activated up-regulation of glutathione in Arabidopsis involves induction of genes encoding enzymes involved in cysteine synthesis in the chloroplast. Mol Plant 2, 344-356.

Rabeh, W.M., and Cook, P.F. (2004). Structure and mechanism of Oacetylserine sulfhydrylase. J Biol Chem 279, 26803-26806.

Ramos, S. (2007). Effects of dietary flavonoids on apoptotic pathways related to cancer chemoprevention. J Nutr Biochem 18, 427-442.

Randall, P.J., and Wrigley, C.W. (1986). Effects of sulfur supply on the yield, composition, and quality of grain from cereals, oilseeds, and legumes. Adv Cereal Sci Technol 8, 171-206.

Ravanel, S., Gakiere, B., Job, D., and Douce, R. (1998). The specific features of methionine biosynthesis and metabolism in plants. P Natl

Acad Sci USA 95, 7805-7812.

Reichelt, M., Brown, P.D., Schneider, B., Oldham, N.J., Stauber, E.,

Tokuhisa, J., Kliebenstein, D.J., Mitchell-Olds, T., and

Gershenzon, J. (2002). Benzoic acid glucosinolate esters and other glucosinolates from Arabidopsis thaliana. Phytochemistry 59, 663-671.

Rennenberg, H. (1984). The fate of excess sulfur in higher plants. Annu Rev

Plant Phys 35, 121-153.

Renosto, F., Patel, H.C., Martin, R.L., Thomassian, C., Zimmerman,

G., and Segel, I.H. (1993). ATP sulfurylase from higher plants: kinetic and structural characterization of the chloroplast and cytosol enzymes from spinach leaf. Arch Biochem Biophys 307, 272-285.

Reumann, S., Maier, E., Heldt, H.W., and Benz, R. (1998). Permeability properties of the porin of spinach leaf peroxisomes. Eur J Biochem 251,

359-366.

Reuveny, Z., Dougall, D.K., and Trinity, P.M. (1980). Regulatory coupling of nitrate and sulfate assimilation pathways in cultured tobacco cells. P

Natl Acad Sci USA 77, 6670-6672.

Robenek, H., Hofnagel, O., Buers, I., Robenek, M.J., Troyer, D., and

Severs, N.J. (2006). Adipophilin-enriched domains in the ER membrane are sites of lipid droplet biogenesis. J Cell Sci 119, 4215-4224.

Robenek, M.J., Severs, N.J., Schlattmann, K., Plenz, G., Zimmer, K.-

P., Troyer, D., and Robenek, H. (2004). Lipids partition caveolin-1 from ER membranes into lipid droplets: updating the model of lipid droplet biogenesis. FASEB J 18, 866-868.

Rolletschek, H., Hosein, F., Miranda, M., Heim, U., Gotz, K.P.,

Schlereth, A., Borisjuk, L., Saalbach, I., Wobus, U., and Weber,

H. (2005). Ectopic expression of an amino acid transporter (VfAAP1) in

145

References seeds of Vicia narbonensis and pea increases storage proteins. Plant

Physiol 137, 1236-1249.

Rotte, C., and Leustek, T. (2000). Differential subcellular localization and expression of ATP sulfurylase and 5'-adenylylsulfate reductase during ontogenesis of Arabidopsis leaves indicates that cytosolic and plastid forms of ATP sulfurylase may have specialized functions. Plant Physiol

124, 715-724.

Ruffet, M.L., Droux, M., and Douce, R. (1994). Purification and kinetic properties of serine acetyltransferase free of O-acetylserine(thiol)lyase from spinach chloroplasts. Plant Physiol 104, 597-604.

Ruuska, S.A., Girke, T., Benning, C., and Ohlrogge, J.B. (2002).

Contrapuntal networks of gene expression during Arabidopsis seed filling. Plant Cell 14, 1191-1206.

Saito, K. (2000). Regulation of sulfate transport and synthesis of sulfurcontaining amino acids. Curr Opin Plant Biol 3, 188-195.

Saitoh, T., Ikegami, T., Nakayama, M., Teshima, K., Akutsu, H., and

Hase, T. (2006). NMR study of the electron transfer complex of plant ferredoxin and sulfite reductase: mapping the interaction sites of ferredoxin. J Biol Chem 281, 10482-10488.

Sanda, S., Leustek, T., Theisen, M.J., Garavito, R.M., and Benning, C.

(2001). Recombinant Arabidopsis SQD1 converts UDP-glucose and sulfite to the sulfolipid head group precursor UDP-sulfoquinovose in vitro. J

Biol Chem 276, 3941-3946.

Sasaki-Sekimoto, Y., Taki, N., Obayashi, T., Aono, M., Matsumoto, F.,

Sakurai, N., Suzuki, H., Hirai, M.Y., Noji, M., Saito, K.,

Masuda, T., Takamiya, K.-I., Shibata, D., and Ohta, H. (2005).

Coordinated activation of metabolic pathways for antioxidants and defence compounds by jasmonates and their roles in stress tolerance in

Arabidopsis. Plant J 44, 653-668.

Schiff, S., Stern, A.I., Saidha, T., and Li, J. (1993). Some molecular aspects of sulfate metabolism in photosynthetic organisms. In Sulfur nutrition and assimilation in higher plants. Regulatory, agricultural and environmental aspects, L.J. De Kok, I. Stulen, H. Rennenberg, C.

Brunold, and W.C. Rauser, eds (The Hague: SBP Acad Publ.), 21-35.

Schmidt, A., and Jäger, K. (1992). Open questions about sulfur metabolism in plants. Annu Rev Plant Phys 43, 325-349.

Schnug, E. (1993). Physiological functions and environmental relevance of sulfur-containing secondary metabolites. In Sulfur nutrition and assimilation in higher plants, L.J. De Kok, I. Stulen, H. Rennenberg, C.

Brunold, and W.E. Rauser, eds (The Hague: SPB Acad. Publ.), pp. 179-

190.

Schröder, P., Lamoureux, G.L., Rusness, D.G., and Rennenberg, H.

(1990). Glutathione S-transferase activity in spruce needles. Pestic

Biochem Phys 37, 211-218.

Schwenn, J.D. (1994). Photosythetic sulphate reduction. Z Naturforsch C 49c,

531-539.

Sekine, K., Hase, T., and Sato, N. (2002). Reversible DNA compaction by sulfite reductase regulates transcriptional activity of chloroplast nucleoids. J Biol Chem 277, 24399-24404.

Sekine, K., Sakakibara, Y., Hase, T., and Sato, N. (2009). A novel variant of ferredoxin-dependent sulfite reductase having preferred substrate

146

References specificity for nitrite in the unicellular red alga Cyanidioschyzon merolae.

Biochem J 423, 91-98.

Sekine, K., Fujiwara, M., Nakayama, M., Takao, T., Hase, T., and Sato,

N. (2007). DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulfite reductase. FEBS J 274,

2054-2069.

Setya, A., Murillo, M., and Leustek, T. (1996). Sulfate reduction in higher plants: molecular evidence for a novel 5’-adenylylsulfate reductase. P Natl

Acad Sci USA 93, 13383-13388.

Shimada, T., Fuji, K., Tamura, K., Kondo, M., Nishimura, M., and

Hara-Nishimura, I. (2003a). Vacuolar sorting receptor for seed storage proteins in Arabidopsis thaliana. P Natl Acad Sci USA 100,

16095-16100.

Shimada, T., Yamada, K., Kataoka, M., Nakaune, S., Koumoto, Y.,

Kuroyanagi, M., Tabata, S., Kato, T., Shinozaki, K., Seki, M.,

Kobayashi, M., Kondo, M., Nishimura, M., and Hara-

Nishimura, I. (2003b). Vacuolar processing enzymes are essential for proper processing of seed storage proteins in Arabidopsis thaliana. J Biol

Chem 278, 32292-32299.

Shimada, T.L., Shimada, T., Takahashi, H., Fukao, Y., and Hara-

Nishimura, I. (2008). A novel role for oleosins in freezing tolerance of oilseeds in Arabidopsis thaliana. Plant J 55, 798-809.

Shosuke, K., Koji, Y., and Sumiko, I. (1989). Site-specific DNA damage induced by sulfite in the presence of cobalt(II) ion: Role of sulfate radical.

Biochem Pharmacol 38, 3491-3496.

Siloto, R.M.P., Findlay, K., Lopez-Villalobos, A., Yeung, E.C.,

Nykiforuk, C.L., and Moloney, M.M. (2006). The accumulation of oleosins determines the size of seed oilbodies in Arabidopsis. Plant Cell

18, 1961-1974.

Sjodahl, S., Rodin, J., and Rask, L. (1991). Characterization of the 12S globulin complex of Brassica napus. Evolutionary relationship to other

11-12S storage globulins. Eur J Biochem 196, 617-621.

Smith, A.M., and Zeeman, S.C. (2006). Quantification of starch in plant tissues. Nat Protoc 1, 1342-1345.

Smith, F.W., Hawkesford, M.J., Ealing, P.M., Clarkson, D.T., Vanden

Berg, P.J., Belcher, A.R., and Warrilow, A.G. (1997). Regulation of expression of a cDNA from barley roots encoding a high affinity sulphate transporter. Plant J 12, 875-884.

Smith, I.K. (1980). Regulation of sulfate assimilation in tobacco cells. Plant

Physiol 66, 877 - 883.

Steber, C.M., and McCourt, P. (2001). A role for brassinosteroids in germination in Arabidopsis. Plant Physiol 125, 763-769.

Steudel, R. (1998). Schwefel, Selen, Tellur, Polonium. In Chemie der

Nichtmetalle; mit Atombau, Molekülgeometrie und Bindungstheorie, Y.

Drozdova, ed (Berlin, New York: Walter de Gruyter), pp. 257-320.

Stitt, M., Lilley, R., Gerhardt, R., and Heldt, H.W. (1989). Metabolite levels in specific cells and subcellular compartments of plant leaves.

Method Enzymol 174, 518-552.

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert,

B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R.,

Lander, E.S., and Mesirov, J.P. (2005). Gene set enrichment

147

References analysis: a knowledge-based approach for interpreting genome-wide expression profiles. P Natl Acad Sci USA 102, 15545-15550.

Suter, M., von Ballmoos, P., Kopriva, S., den Camp, R.O., Schaller, J.,

Kuhlemeier, C., Schurmann, P., and Brunold, C. (2000).

Adenosine 5’-phosphosulfate sulfotransferase and adenosine 5'phosphosulfate reductase are identical enzymes. J Biol Chem 275, 930-

936.

Suzuki, K., Nakanishi, H., Bower, J., Yoder, D., Osteryoung, K., and

Miyagishima, S.-y. (2009). Plastid chaperonin proteins Cpn60alpha and Cpn60beta are required for plastid division in Arabidopsis thaliana.

BMC Plant Biol 9, 38.

Szekeres, M., Németh, K., Koncz-Kálmán, Z., Mathur, J.,

Kauschmann, A., Altmann, T., Rédei, G.P., Nagy, F., Schell, J.,

and Koncz, C. (1996). Brassinosteroids rescue the deficiency of CYP90, a cytochrome P450, controlling cell elongation and de-etiolation in

Arabidopsis. Cell 85, 171-182.

Tabe, L., and Higgins, T.J.V. (1998). Engineering plant protein composition for improved nutrition. Trends Plant Sci 3, 282-286.

Takahashi, H., Watanabe-Takahashi, A., Smith, F.W., Blake-Kalff, M.,

Hawkesford, M.J., and Saito, K. (2000). The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana. Plant J 23, 171-182.

Takahashi, H., Yamazaki, M., Sasakura, N., Watanabe, A., Leustek, T.,

Engler, J.A., Engler, G., Van Montagu, M., and Saito, K. (1997).

Regulation of sulfur assimilation in higher plants: a sulfate transporter induced in sulfate-starved roots plays a central role in Arabidopsis

thaliana. P Natl Acad Sci USA 94, 11102-11107.

Takemoto, Y., Coughlan, S.J., Okita, T.W., Satoh, H., Ogawa, M., and

Kumamaru, T. (2002). The rice mutant esp2 greatly accumulates the glutelin precursor and deletes the protein disulfide isomerase. Plant

Physiol 128, 1212-1222.

Tauchi-Sato, K., Ozeki, S., Houjou, T., Taguchi, R., and Fujimoto, T.

(2002). The surface of lipid droplets is a phospholipid monolayer with a unique fatty acid composition. J Biol Chem 277, 44507-44512.

The Arabidopsis Genome Initiative. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-

815.

Thelen, J.J., and Ohlrogge, J.B. (2002). Both antisense and sense expression of biotin carboxyl carrier protein isoform 2 inactivates the plastid acetyl-coenzyme A carboxylase in Arabidopsis thaliana. Plant J

32, 419-431.

Tocquin, P., Corbesier, L., Havelange, A., Pieltain, A., Kurtem, E.,

Bernier, G., and Perilleux, C. (2003). A novel high efficiency, low maintenance, hydroponic system for synchronous growth and flowering of Arabidopsis thaliana. BMC Plant Biol 3, 2.

Tolbert, N.E., and Ryan, F.J. (1976). Glycolate biosynthesis and metabolism during photorespiration. In CO

2

-metabolism and plant productivity, R.H.

Burris and C.C. Black, eds (Baltimore: University Press), pp. 141-159.

Tomatsu, H., Takano, J., Takahashi, H., Watanabe-Takahashi, A.,

Shibagaki, N., and Fujiwara, T. (2007). An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from soil. P Natl Acad Sci USA 104, 18807-18812.

148

References

Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. P Natl Acad Sci USA 76, 4350-4354.

Turnham, E., and Northcote, D.H. (1983). Changes in the activity of acetyl-

CoA carboxylase during rape-seed formation. Biochem J 212, 223-229.

Tzen, J., and Huang, A. (1992). Surface structure and properties of plant seed oil bodies. J Cell Biol 117, 327-335.

van der Klei, H., Van Damme, J., Casteels, P., and Krebbers, E. (1993).

A fifth 2S albumin isoform is present in Arabidopsis thaliana. Plant

Physiol 101, 1415-1416.

Varin, L., Marsolais, F., Richard, M., and Rouleau, M. (1997). Sulfation and sulfotransferases 6: biochemistry and molecular biology of plant sulfotransferases. FASEB J. 11, 517-525.

Vigeolas, H., Waldeck, P., Zank, T., and Geigenberger, P. (2007).

Increasing seed oil content in oil-seed rape (Brassica napus L.) by overexpression of a yeast glycerol-3-phosphate dehydrogenase under the control of a seed-specific promoter. Plant Biotechnol J 5, 431-441.

Vigeolas, H., Mohlmann, T., Martini, N., Neuhaus, H.E., and

Geigenberger, P. (2004). Embryo-specific reduction of ADP-Glc pyrophosphorylase leads to an inhibition of starch synthesis and a delay in oil accumulation in developing seeds of oilseed rape. Plant Physiol

136, 2676-2686.

Vijaybhaskar, V., Subbiah, V., Kaur, J., Vijayakumari, P., and Siddiqi,

I. (2008). Identification of a root-specific glycosyltransferase from

Arabidopsis and characterization of its promoter. J Bioscience 33, 185-

193.

Visser, W.F., van roermund, C.W.T., Ijlst, L., Waterham, H.R., and

Wanders, R.J.A. (2007). Metabolite transport across the peroxisomal membrane. Biochem J 401, 365-375.

Voelker, T.A., Hayes, T.R., Cranmer, A.M., Turner, J.C., and Davies,

H.M. (1996). Genetic engineering of a quantitative trait: metabolic and genetic parameters influencing the accumulation of laurate in rapeseed.

Plant J 9, 229-241.

Völkel, S., and Grieshaber, M.K. (1994). Oxygen dependent sulfide detoxification in the lugworm Arenicola marina. Mar Biol 118, 137-147.

Wang, R., Okamoto, M., Xing, X., and Crawford, N.M. (2003).

Microarray analysis of the nitrate response in Arabidopsis roots and shoots reveals over 1,000 rapidly responding genes and new linkages to glucose, trehalose-6-phosphate, iron, and sulfate metabolism. Plant

Physiol 132, 556-567.

Watanabe, M., Kusano, M., Oikawa, A., Fukushima, A., Noji, M., and

Saito, K. (2008a). Physiological roles of the β-substituted alanine synthase gene family in Arabidopsis. Plant Physiol 146, 310-320.

Watanabe, M., Mochida, K., Kato, T., Tabata, S., Yoshimoto, N., Noji,

M., and Saito, K. (2008b). Comparative genomics and reverse genetics analysis reveal indispensable functions of the serine acetyltransferase gene family in Arabidopsis. Plant Cell 20, 2484-2496.

Weber, H., Borisjuk, L., and Wobus, U. (2005). Molecular physiology of legume seed development. Annu Rev Plant Biol 56, 253-279.

Westerman, S., De Kok, L.J., Stuiver, C.E.E., and Stulen, I. (2000).

Interaction between metabolism of atmospheric H

2

S in the shoot and

149

References sulfate uptake by the roots of curly kale (Brassica oleracea). Physiol

Plantarum 109, 443-449.

White, J.A., and Benning, C. (2001). Genomic approaches towards the engineering of oil seeds. Plant Physiol Bioch 39, 263-270.

Willats, W.G.T., Knox, J.P., and Mikkelsen, J.D. (2006). Pectin: new insights into an old polymer are starting to gel. Trends Food Sci Tech 17,

97-104.

Wirtz, M., and Hell, R. (2003). Comparative biochemical characterization of

OAS-TL isoforms from Arabidopsis thaliana. In Sulfate transport and assimilation in plants, J.C. Davidian, D. Grill, L.J. De Kok, I. Stulen, M.J.

Hawkesford, E. Schnug, and H. Rennenberg, eds (Leiden: Backhuys

Publishers), pp. 355-357.

Wirtz, M., and Droux, M. (2005). Synthesis of the sulfur amino acids: cysteine and methionine. Photosynth Res 86, 345-362.

Wirtz, M., and Hell, R. (2006). Functional analysis of the cysteine synthase protein complex from plants: structural, biochemical and regulatory properties. J Plant Physiol 163, 273-286.

Wirtz, M., and Hell, R. (2007). Dominant-negative modification reveals the regulatory function of the multimeric cysteine synthase protein complex in transgenic tobacco. Plant Cell 19, 625-639.

Wirtz, M., Droux, M., and Hell, R. (2004). O-acetylserine (thiol) lyase: an enigmatic enzyme of plant cysteine biosynthesis revisited in Arabidopsis

thaliana. J Exp Bot 55, 1785-1798.

Wirtz, M., Berkowitz, O., Droux, M., and Hell, R. (2001). The cysteine synthase complex from plants. Mitochondrial serine acetyltransferase from Arabidopsis thaliana carries a bifunctional domain for catalysis and protein-protein interaction. Eur J Biochem 268, 686-693.

Wirtz, M., Birke, H., Heeg, C., Muller, C., Hosp, F., Throm, C., Konig,

S., Feldman-Salit, A., Rippe, K., Petersen, G., Wade, R.C.,

Rybin, V., Scheffzek, K., and Hell, R. (2010). Structure and function of the hetero-oligomeric cysteine synthase complex in plants. J Biol Chem

285, 32810-32817.

Wittstock, U., and Halkier, B.A. (2002). Glucosinolate research in the

Arabidopsis era. Trends Plant Sci 7, 263-270.

Yamamoto, R., Fujioka, S., Demura, T., Takatsuto, S., Yoshida, S.,

and Fukuda, H. (2001). Brassinosteroid levels increase drastically prior to morphogenesis of tracheary elements. Plant Physiol 125, 556-563.

Yanhui, C., Xiaoyuan, Y., Kun, H., Meihua, L., Jigang, L., Zhaofeng,

G., Zhiqiang, L., Yunfei, Z., Xiaoxiao, W., Xiaoming, Q.,

Yunping, S., Li, Z., Xiaohui, D., Jingchu, L., Xing-Wang, D.,

Zhangliang, C., Hongya, G., and Li-Jia, Q. (2006). The MYB transcription tactor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol Biol 60,

107-124.

Yatsu, L.Y., and Jacks, T.J. (1972). Spherosome membranes: half unitmembranes. Plant Physiol 49, 937-943.

Ye, X., Al-Babili, S., Kloti, A., Zhang, J., Lucca, P., Beyer, P., and

Potrykus, I. (2000). Engineering the provitamin A (β-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287,

303-305.

Yilmaz, Y. (2006). Novel uses of catechins in foods. Trends Food Sci Tech 17,

64-71.

150

References

Yonekura-Sakakibara, K., Onda, Y., Ashikari, T., Tanaka, Y., Kusumi,

T., and Hase, T. (2000). Analysis of reductant supply systems for ferredoxin-dependent sulfite reductase in photosynthetic and nonphotosynthetic organs of maize. Plant Physiol 122, 887-894.

Yoshimoto, N., Inoue, E., Saito, K., Yamaya, T., and Takahashi, H.

(2003). Phloem-localizing sulfate transporter, Sultr1;3, mediates redistribution of sulfur from source to sink organs in Arabidopsis. Plant

Physiol 131, 1511-1517.

Yoshimoto, N., Inoue, E., Watanabe-Takahashi, A., Saito, K., and

Takahashi, H. (2007). Posttranscriptional regulation of high-affinity sulfate transporters in Arabidopsis by sulfur nutrition. Plant Physiol 145,

378-388.

Yu, B., Xu, C., and Benning, C. (2002). Arabidopsis disrupted in SQD2 encoding sulfolipid synthase is impaired in phosphate-limited growth. P

Natl Acad Sci USA 99, 5732-5737.

Zabaleta, E., Oropeza, A., Assad, N., Mandel, A., Salerno, G., and

Herrera-Estrella, L. (1994). Antisense expression of chaperonin 60β in transgenic tobacco plants leads to abnormal phenotypes and altered distribution of photoassimilates. Plant J 6, 425-432.

Zeeman, S.C., Tiessen, A., Pilling, E., Kato, K.L., Donald, A.M., and

Smith, A.M. (2002). Starch synthesis in Arabidopsis. Granule synthesis, composition, and structure. Plant Physiol 129, 516-529.

Zelitch, I. (1973). Alternate pathways of glycolate synthesis in tobacco and maize leaves in relation to rates of photorespiration. Plant Physiol 51,

299-305.

Zhao, F.-J., Tausz, M., and De Kok, L. (2008). Role of sulfur for plant production in agricultural and natural ecosystems. In Sulfur metabolism in phototrophic organisms, R. Hell, C. Dahl, and T. Leustek, eds

(Dordrecht: Springer), pp. 425-444.

Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem,

W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol 136, 2621-2632.

Zuber, H., Davidian, J.C., Wirtz, M., Hell, R., Belghazi, M.,

Thompson, R., and Gallardo, K. (2010a). Sultr4;1 mutant seeds of

Arabidopsis have an enhanced sulphate content and modified proteome suggesting metabolic adaptations to altered sulphate compartmentalization. BMC Plant Biol 10, 78.

Zuber, H., Davidian, J.C., Aubert, G., Aime, D., Belghazi, M., Lugan,

R., Heintz, D., Wirtz, M., Hell, R., Thompson, R., and Gallardo,

K. (2010b). The seed composition of Arabidopsis mutants for the group 3 sulfate transporters indicates a role in sulfate translocation within developing seeds. Plant Physiol 154, 913-926.

151

Supplemental data

Supplemental data

Nam e Analyte

Alanine, beta- (3TMS)

Alanine, DL- (2TMS)

Asparagine, DL- (3TMS)

Aspartic acid, L- (3TMS)

Benzoic acid (1TMS)

Butyric acid, 4-amino- (3TMS)

Cellobiose, D- (1MEOX) (8TMS)

Citric acid (4TMS)

Dehydroascorbic acid dimer (TMS)

Erythritol (4TMS)

Fructose, D- (1MEOX) (5TMS)

Fucose, DL- (1MEOX) (4TMS)

Fumaric acid (2TMS)

Galactinol (9TMS)

Galactonic acid-1,4-lactone, D(-)- (4TMS)

Galacturonic acid, D- (1MEOX) (5TMS)

Glucoheptonic acid (7TMS)

Glucoheptose (1MEOX) (6TMS)

Glucopyranoside, 1-O-methyl-, alpha-D- (4TMS)

Glucose, 1,6-anhydro, beta-D- (3TMS)

Glucose, D- (1MEOX) (5TMS)

Glutamic acid, DL- (3TMS)

Glutamine, DL- (4TMS)

Glyceric acid, DL- (3TMS)

Glycerol (3TMS)

Glycine (3TMS)

Glycolic acid (2TMS)

Inositol, myo- (6TMS)

Isoleucine, L- (2TMS)

Isomaltose (1MEOX) (8TMS)

Lactic acid, DL- (2TMS)

Malic acid, DL- (3TMS)

Maltitol (9TMS)

Maltose, D- (1MEOX) (8TMS)

Melibiose (1MEOX) (8TMS)

Octadecanoic acid, n- (1TMS)

Phenylalanine, DL- (2TMS)

Phosphoric acid (3TMS)

Proline, L- (2TMS)

Psicose, D- (1MEOX) (5TMS)

Putrescine (4TMS)

Pyridine, 3-hydroxy- (1TMS)

Raf f inose (11TMS)

Rhamnose, DL- (1MEOX) (4TMS)

Salicylic acid (2TMS)

Serine, DL- (3TMS)

Spermidine (5TMS)

Succinic acid (2TMS)

Sucrose, D- (8TMS)

Threonine, DL- (3TMS)

Trehalose, alpha,alpha'-, D- (8TMS)

Tyrosine, DL- (3TMS)

Urea (2TMS)

Valine, DL- (2TMS)

Xylitol (5TMS)

Suppl. data 1 Raw data of leaf metabolites of soil-grown sir1-1 and wild-type plants.

Soil-grown 7-to-8-week-old wild-type and sir1-1 plants were used for extraction of soluble metabolites which were detected via GC/MS as described in 2.7.2.

Average SE t-test

Col-0

0.003

0.725

0.010

0.082

0.026

0.096

0.024

0.105

0.481

0.011

1.431

0.026

2.939

1.157

0.004

0.006

0.150

0.132

0.044

1.612

0.057

0.389

0.147

0.507

0.050

0.190

0.026

0.349

0.043

0.130

0.198

0.010

0.027

0.038

0.205

si r1-1

Col-0

si r1-1

0.005

0.000

0.001

1.412

0.099

0.371

0.125

0.010

1.385

0.022

0.099

0.001

0.009

0.023

0.001

0.105

0.012

0.006

0.009

0.236

0.033

0.097

0.001

0.273

0.003

0.371

0.015

0.069

0.005

0.016

0.001

0.022

0.016

0.001

0.082

0.002

3.468

0.239

0.019

0.009

1.366

0.372

0.052

0.044

0.015

0.002

0.008

0.001

0.392

0.140

0.119

0.013

#DIV/0!

0.002 nd

0.319

0.159

0.063

0.089

0.014

0.012

0.917

0.321

1.456

0.140

0.014

0.001

0.004

0.001

0.105

0.620

0.021

0.011

0.020

0.007

1.166

0.179

0.118

0.009

0.014

0.097

0.202

0.026

0.175

0.005

0.017

0.007

0.137

0.013

0.047

0.009

0.400

0.020

0.089

0.003

0.117

0.067

0.413

0.038

0.163

0.009

0.002

0.001

0.036

0.007

0.013

0.076

0.168

0.004

0.000

0.021

0.252

0.003

0.163

0.022

0.002

0.034

0.023

0.000

0.002

0.001

0.052

0.012

0.040

0.075

0.000

0.005

0.000

0.209

0.082

0.189

0.014

0.002

#DIV/0!

#DIV/0!

0.062

0.006

0.026

0.224

0.022

0.002

0.027

0.032

0.004

0.007

0.003

0.001

0.195

0.111

0.000

0.003

0.642

0.662

0.078

0.011

0.007

0.366

0.876

0.256

0.001

0.003

0.196

0.431

0.078

0.091

0.090

0.016

0.102

0.034

0.005

0.239

0.044

0.007

0.006

0.053

0.385

0.006

0.874

0.034

nd

0.059

0.006

0.816

0.048

1.102

0.098

0.076

0.028

0.015

0.126

0.021

nd

0.024

0.006

1.194

0.020

0.006

0.533

0.218

0.332

0.009

0.015

0.014

0.056

0.018

0.221

0.027

0.020

0.001

0.068

0.000

#DIV/0!

#DIV/0!

0.002

0.002

0.012

0.005

0.006

0.001

0.247

0.002

0.092

0.061

0.001

0.006

0.003

0.048

0.002

0.141

0.828

0.178

0.003

0.043

0.005

0.002

0.002

0.623

0.093

0.321

152

Supplemental data

Suppl. data 2 Raw data of leaf metabolites of sir1-1 and WT plants grown hydoponically on +S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2.

average

SE t-test

Meatabolite

Alanine, DL- (2TMS)

Ascorbic acid, L(+)- (4TMS)

Asparagine, DL- (3TMS)

Aspartic acid, L- (3TMS)

Benzoic acid (1TMS)

Butyric acid, 4-amino- (3TMS)

Citric acid (4TMS)

Dehydroascorbic acid dimer (TMS)

Erythritol (4TMS)

Fructose, D- (1MEOX) (5TMS)

Fumaric acid (2TMS)

Galactinol (9TMS)

Galactonic acid-1,4-lactone, D(-)- (4TMS)

Glucose, 1,6-anhydro, beta-D- (3TMS)

Glucose, D- (1MEOX) (5TMS)

Glutamic acid, DL- (3TMS)

Glutamine, DL- (4TMS)

Glutaric acid, 2-oxo- (1MEOX) (2TMS)

Glyceric acid, DL- (3TMS)

Glycerol (3TMS)

Glycine (3TMS)

Guanidine (3TMS)

Inositol, myo- (6TMS)

Isocitric acid, DL- (4TMS)

Isoleucine, L- (2TMS)

Lysine, L- (4TMS)

Malic acid, 2-methyl-, DL- (3TMS)

Malic acid, DL- (3TMS)

Maltose, D- (1MEOX) (8TMS)

Mannose, D- (1MEOX) (5TMS)

Methionine, DL- (2TMS)

Octadecanoic acid, n- (1TMS)

Palatinose (1MEOX) (8TMS)

Phenylalanine, DL- (2TMS)

Proline, L- (2TMS)

Psicose, D- (1MEOX) (5TMS)

Putrescine (4TMS)

Pyroglutamic acid, DL- (2TMS)

Pyruvic acid (1MEOX) (1TMS)

Raffinose (11TMS)

Serine, DL- (3TMS)

Succinic acid (2TMS)

Sucrose, D- (8TMS)

Threonic acid (4TMS)

Threonine, DL- (3TMS)

Trehalose, alpha,alpha'-, D- (8TMS)

Tryptophan, L- (3TMS)

Tyrosine, DL- (3TMS)

Urea (2TMS)

Valine, DL- (2TMS)

Xylose, D- (1MEOX) (4TMS)/Lyxose, D- (1MEOX) (4TMS)

0.00945

0.00009

0.00052

0.00062

0.01521

0.00006

0.00137

0.05118

0.00051

0.00240

0.02322

0.00044

0.00108

0.04721

0.00147

0.03024

0.00195

0.01211

0.00016

0.00007

0.00037

0.00052

0.00485

0.00021

0.00868

0.00028

0.00054

0.00027

0.01961

0.00046

0.00105

0.02673

0.00050

0.00522

0.01981

0.00020

0.00894

0.07747

0.00076

0.04072

0.00136

0.01588

0.00067

0.00019

0.00062

0.00093

0.01115

0.00014

0.00274

0.00036

0.00854

0.03128

0.00801

0.00140

0.00010

0.00097

0.00245

0.02104

0.00017

0.02825

0.00166

0.00126

0.00044

0.00008

Col-0

0.08041

sir1-1

0.07285

Col-0

0.00707

sir1-1

0.01357

0.00004

0.00060

0.00516

0.00003

0.00057

0.00215

0.00001

0.00019

0.00064

#DIV/0!

0.00011

0.00026

0.00051

0.00343

0.00161

0.00200

0.00075

0.00351

0.12133

0.00061

0.00556

0.00280

0.00073

0.00095

0.00454

0.12696

0.00006

0.00020

0.00020

0.00051

0.00005

0.00097

0.00928

0.00007

0.00063

0.00061

0.00014

0.00014

0.00382

0.01673

0.02804

0.00020

0.00702

0.02657

0.00401

0.00113

0.00004

0.00092

0.00688

0.00898

0.00149

0.03126

0.00125

0.00254

0.00051

0.00025

0.00022

0.00003

0.00121

0.00470

0.00097

0.00045

0.00002

0.00010

0.00025

0.00392

0.00002

0.00098

0.00038

0.00013

0.00004

0.00001

0.01328

0.00004

0.00119

0.01447

0.00140

0.00027

0.00001

0.00017

0.00447

0.00240

0.00023

0.00182

0.00018

0.00068

0.00027

0.00003

0.00156

0.00001

0.00007

0.00012

0.00057

0.00001

0.00014

0.01198

0.00003

0.00014

0.00482

0.00006

0.00024

0.00134

0.00016

0.00212

0.00012

0.00095

0.00002

0.00001

0.00003

0.00008

0.00053

0.00001

0.00196

0.00014

0.00035

0.00005

0.00225

0.00023

0.00020

0.00544

0.00020

0.00039

0.00267

0.00003

0.00184

0.00669

0.00017

0.00746

0.00021

0.00185

0.00058

0.00007

0.00020

0.00015

0.00175

0.00002

0.08600

0.00800

0.39040

0.76352

0.04062

0.61757

0.14486

0.77853

0.34531

0.02538

0.00017

0.18501

0.35611

0.09495

0.79006

0.00059

0.63189

#DIV/0!

0.90582

0.00149

0.27697

0.00870

0.09691

0.03566

0.19647

0.79811

0.77454

0.76415

0.18917

0.94110

0.01997

0.08691

0.10521

0.21099

0.09278

0.97438

0.00004

0.58017

0.00468

0.00174

0.00126

0.01233

0.20611

0.03284

0.09999

0.40472

0.19512

0.24603

0.03147

0.00628

0.02280

153

Supplemental data

Suppl. data 3 Raw data of leaf metabolites of sir1-1 and WT plants after transfer to

-S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2.

average

SE t-test

Meatabolite

Alanine, DL- (2TMS)

Asparagine, DL- (3TMS)

Aspartic acid, L- (3TMS)

Benzoic acid (1TMS)

Butyric acid, 4-amino- (3TMS)

Citric acid (4TMS)

Dehydroascorbic acid dimer (TMS)

Erythritol (4TMS)

Fructose, D- (1MEOX) (5TMS)

Fucose, DL- (1MEOX) (4TMS)

Fumaric acid (2TMS)

Galactinol (9TMS)

Galactonic acid-1,4-lactone, D(-)- (4TMS)

Glucoheptose (1MEOX) (6TMS)

Glucose, 1,6-anhydro, beta-D- (3TMS)

Glucose, D- (1MEOX) (5TMS)

Glutamic acid, DL- (3TMS)

Glutamine, DL- (4TMS)

Glutaric acid, 2-oxo- (1MEOX) (2TMS)

Glyceric acid, DL- (3TMS)

Glycerol (3TMS)

Glycine (3TMS)

Glycolic acid (2TMS)

Guanidine (3TMS)

Gulonic acid, 2-oxo-, DL- (1MEOX) (5TMS)

Inositol, myo- (6TMS)

Isoleucine, L- (2TMS)

Isomaltose (1MEOX) (8TMS)

Lyxose, D- (1MEOX) (4TMS)

Malic acid, 2-methyl-, DL- (3TMS)

Malic acid, DL- (3TMS)

Maltose, D- (1MEOX) (8TMS)

Melezitose (11TMS)

Methionine, DL- (2TMS)

Octadecanoic acid, n- (1TMS)

Ornithine, DL- (4TMS)

Phenylalanine, DL- (2TMS)

Proline, 4-hydroxy-, DL-, trans- (3TMS)

Proline, L- (2TMS)

Psicose, D- (1MEOX) (5TMS)

Putrescine (4TMS)

Pyroglutamic acid, DL- (2TMS)

Pyruvic acid (1MEOX) (1TMS)

Raffinose (11TMS)

Serine, DL- (3TMS)

Shikimic acid (4TMS)

Sorbose, D- (1MEOX) (5TMS)

Spermidine (5TMS)

Succinic acid (2TMS)

Sucrose, D- (8TMS)

Threonic acid (4TMS)

Threonine, DL- (3TMS)

Trehalose, alpha,alpha'-, D- (8TMS)

Tryptophan, L- (3TMS)

Turanose, D- (1MEOX) (8TMS)

Tyrosine, DL- (3TMS)

Urea (2TMS)

Valine, DL- (2TMS)

0.00062

0.08570

0.00010

0.00352

0.03666

0.00056

0.00251

0.05855

0.00457

0.00106

0.00173

0.00200

0.03088

0.00230

0.01509

0.00017

0.00014

0.00038

0.00075

0.00045

0.00768

0.02701

0.00185

0.00008

0.00023

0.00010

0.01164

0.00008

0.00016

0.00039

0.00632

0.00024

0.00244

0.00054

0.02697

0.00007

0.00407

0.04363

0.00019

0.00963

0.06087

0.00592

0.00043

0.00004

0.00101

0.02936

0.00180

0.01241

0.00006

0.00035

0.00031

0.00079

0.00074

0.01253

0.02676

0.00207

0.00025

0.00012

0.00033

0.01662

0.00008

0.00051

0.00031

0.00671

0.00016

0.00185

Col-0

0.15199

0.00112

0.00821

0.00073

0.00456

0.00203

0.00234

0.00080

0.00230

0.00029

0.13110

0.00266

0.00048

0.00072

0.00799

0.00554

0.01413

0.00419

0.00010

0.00091

0.00364

0.02769

0.00016

0.00049

0.00016

sir1-1

0.11737

0.00172

0.00771

0.00074

0.00790

0.01022

0.00067

0.00075

0.00093

0.00018

0.13113

0.01676

0.00029

0.00145

0.00473

0.00226

0.01260

0.00377

0.00008

0.00064

0.00289

0.00767

0.00030

0.00113

0.00019

Col-0

0.01711

0.00017

0.00080

0.00006

0.00037

0.00014

0.00018

0.00003

0.00031

0.00001

0.00704

0.00029

0.00002

0.00007

0.00111

0.00098

0.00126

0.00127

0.00002

0.00009

0.00044

0.00519

0.00002

0.00012

0.00001

sir1-1

0.01092

0.00029

0.00150

0.00007

0.00101

0.00152

0.00005

0.00005

0.00014

0.00002

0.01000

0.00180

0.00002

0.00016

0.00041

0.00044

0.00216

0.00104

0.00002

0.00011

0.00033

0.00107

0.00002

0.00011

0.00001

0.00003

0.01586

0.00000

0.00026

0.00550

0.00009

0.00063

0.00293

0.00027

0.00015

0.00018

0.00011

0.00195

0.00022

0.00093

0.00001

0.00004

0.00001

0.00009

0.00003

0.00059

0.00146

0.00013

0.00001

0.00001

0.00000

0.00172

0.00000

0.00004

0.00010

0.00057

0.00002

0.00023

0.00004

0.00257

0.00000

0.00065

0.00778

0.00003

0.00170

0.00387

0.00052

0.00007

0.00001

0.00010

0.00212

0.00018

0.00095

0.00001

0.00007

0.00003

0.00010

0.00009

0.00094

0.00134

0.00021

0.00002

0.00001

0.00002

0.00187

0.00001

0.00012

0.00005

0.00086

0.00002

0.00020

0.11708

0.00442

0.00116

0.45084

0.48105

0.00246

0.00284

0.64287

0.04426

0.00392

0.00006

0.00005

0.60886

0.11296

0.07171

0.00002

0.02983

0.12219

0.77690

0.90233

0.38950

0.00002

0.00019

0.00000

0.07844

0.82649

0.02301

0.45119

0.71440

0.03114

0.07711

0.01160

0.00137

0.11885

0.10026

0.77385

0.93933

0.01135

0.00031

0.00000

0.44947

0.00259

0.00051

0.99851

0.00002

0.00005

0.00173

0.09130

0.01220

0.55558

0.80584

0.45881

0.08406

0.20121

0.00361

0.00069

0.00303

0.07022

154

Supplemental data

Suppl. data 4 Raw data of root metabolites of sir1-1 and WT plants grown hydoponically on +S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2.

average

SE t-test

Meatabolite

Alanine, DL- (2TMS)

Asparagine, DL- (3TMS)

Aspartic acid, L- (3TMS)

Benzoic acid, 4-hydroxy- (2TMS)

Butyric acid, 4-amino- (3TMS)

Citric acid (4TMS)

Erythrose, D- (1MEOX) (3TMS)

Fructose, D- (1MEOX) (5TMS)

Fructose-6-phosphate (1MEOX) (6TMS)

Fucose, DL- (1MEOX) (4TMS)

Fumaric acid (2TMS)

Galactinol (9TMS)

Galactonic acid (6TMS)

Galactose, D- (1MEOX) (5TMS)

Glucoheptose (1MEOX) (6TMS)

Glucose, 1,6-anhydro, beta-D- (3TMS)

Glucose, D- (1MEOX) (5TMS)

Glucose-6-phosphate (1MEOX) (6TMS)

Glutamic acid, DL- (3TMS)

Glutamine, DL- (4TMS)

Glutaric acid, 2-oxo- (1MEOX) (2TMS)

Glyceric acid, DL- (3TMS)

Glycerol (3TMS)

Glycerol-3-phosphate, DL- (4TMS)

Glycine (3TMS)

Glycolic acid (2TMS)

Guanidine (3TMS)

Inositol, myo- (6TMS)

Inositol-1-phosphate, myo- (7TMS)

Isoleucine, L- (2TMS)

Kestose, 1- (11TMS)

Lyxose, D- (1MEOX) (4TMS) or Xylose, D- (1MEOX) (4TMS)

Malic acid, DL- (3TMS)

Malonic acid (2TMS)

Maltose, D- (1MEOX) (8TMS)

Melezitose (11TMS)

Methionine, DL- (2TMS)

Nicotinic acid (1TMS)

Octadecanoic acid, n- (1TMS)

Phenylalanine, DL- (2TMS)

Phosphoric acid (3TMS)

Proline, L- (2TMS)

Putrescine (4TMS)

Pyroglutamic acid, DL- (2TMS)

Pyruvic acid (1MEOX) (1TMS)

Serine, DL- (3TMS)

Serine, O-acetyl-, DL- (2TMS)

Succinic acid (2TMS)

Sucrose, D- (8TMS)

Threonine, DL- (3TMS)

Trehalose, alpha,alpha'-, D- (8TMS)

Tyrosine, DL- (3TMS)

Uracil (2TMS)

Urea (2TMS)

Valine, DL- (2TMS)

Col-0

sir1-1

Col-0

sir1-1

0.005626

0.008989

0.000234

0.001449

0.044934

0.000439

0.000210

0.000083

0.000022

0.023667

0.003945

0.002787

0.000316

0.000144

0.007559

0.000010

0.000016

0.000002

0.000002

0.068507

0.011259

0.006485

0.001041

0.000482

0.001941

0.002971

0.003185

0.000606

0.000360

0.767060

0.000038

0.000067

0.000005

0.000004

0.000738

0.000508

0.000826

0.000042

0.000224

0.192931

0.000056

0.000048

0.000003

0.000005

0.198539

0.000279

0.000284

0.000010

0.000009

0.744590

0.001500

0.001819

0.000091

0.000348

0.396551

0.000052

0.000098

0.000009

0.000017

0.036285

0.000156

0.000185

0.000005

0.000008

0.012254

0.000073

0.000066

0.000004

0.000003

0.161740

0.000094

0.000057

0.000007

0.000005

0.002110

0.001769

0.001410

0.000270

0.000058

0.222520

0.001639

0.001611

0.000163

0.000186

0.912702

0.000034

0.000024

0.000002

0.000004

0.053263

0.005068

0.002951

0.000651

0.000207

0.011292

0.000185

0.000149

0.000016

0.000015

0.147110

0.000149

0.000091

0.000008

0.000002

0.000051

0.000042

0.000120

0.000004

0.000050

0.148617

0.000414

0.000897

0.000055

0.000093

0.001210

0.000141

0.000219

0.000011

0.000025

0.016895

0.001039

0.001316

0.000089

0.000059

0.026426

0.000026

0.000047

0.000002

0.000005

0.004559

0.000150

0.000245

0.000042

0.000058

0.215697

0.002128

0.002625

0.000117

0.000174

0.039730

0.000024

0.000037

0.000002

0.000007

0.125539

0.000341

0.000429

0.000022

0.000016

0.008464

0.000110

0.000097

0.000021

0.000012

0.617913

0.000030

0.000024

0.000002

0.000003

0.107297

0.002597

0.001920

0.000140

0.000176

0.013132

0.000064

0.000171

0.000009

0.000059

0.139536

0.000085

0.000058

0.000007

0.000005

0.008608

0.000315

0.000497

0.000037

0.000056

0.021155

0.000176

0.000096

0.000009

0.000005

0.000014

0.000040

0.000017

0.000005

0.000002

0.002056

0.000176

0.000854

0.000028

0.000114

0.000174

0.000217

0.000166

0.000009

0.000009

0.002575

0.010935

0.012190

0.001627

0.001529

0.586421

0.000137

0.000059

0.000021

0.000007

0.006111

0.000163

0.000264

0.000015

0.000011

0.000275

0.015106

0.012649

0.001080

0.000554

0.070458

0.000143

0.000231

0.000011

0.000024

0.007535

0.002127

0.005461

0.000095

0.000653

0.000496

0.000025

0.000070

0.000002

0.000004

0.000002

0.000317

0.000264

0.000012

0.000017

0.029228

0.006264

0.009236

0.000630

0.000570

0.005741

0.001122

0.000913

0.000083

0.000027

0.037220

0.000027

0.000034

0.000002

0.000003

0.083392

0.000166

0.000171

0.000011

0.000006

0.713201

0.000027

0.000044

0.000004

0.000007

0.085779

0.000396

0.000640

0.000047

0.000065

0.012556

0.001016

0.001162

0.000069

0.000070

0.168442

155

Supplemental data

Suppl. data 5 Raw data of root metabolites of sir1-1 and WT plants after transfer to

-S.

6-week-old wild-type and sir1-1 plants were used to extract soluble metabolites which were detected via GC/MS as described in 2.7.2.

average

SE t-test

Meatabolite

Alanine, beta- (3TMS)

Alanine, DL- (2TMS)

Asparagine, DL- (3TMS)

Aspartic acid, L- (3TMS)

Benzoic acid (1TMS)

Butyric acid, 4-amino- (3TMS)

Butyric acid, 4-hydroxy- (2TMS)

Calystegine B2 (1MEOX) (4TMS)

Citric acid (4TMS)

Erythritol (4TMS)

Fructose, D- (1MEOX) (5TMS)

Fructose-6-phosphate, D- (1MEOX) (6TMS)

Fumaric acid (2TMS)

Galactinol (9TMS)

Glucose, D- (1MEOX) (5TMS)

Glucose-6-phosphate (1MEOX) (6TMS)

Glutamic acid, DL- (3TMS)

Glutamine, DL- (3TMS)

Glutaric acid (2TMS)

Glutaric acid, 2-oxo- (1MEOX) (2TMS)

Glyceric acid, DL- (3TMS)

Glycerol (3TMS)

Glycerol-3-phosphate, DL- (4TMS)

Glycine (3TMS)

Guanidine (3TMS)

Inositol, myo- (6TMS)

Isoleucine, L- (2TMS)

Lactic acid, DL- (2TMS)

Lysine, L- (4TMS)

Maleic acid (2TMS)

Malic acid, DL- (3TMS)

Maltose, D- (1MEOX) (8TMS)

Melezitose (11TMS)

Melibiose (1MEOX) (8TMS)

Nicotinic acid (1TMS)

Ornithine, DL- (4TMS)

Phenylalanine, DL- (2TMS)

Phosphoric acid (3TMS)

Putrescine (4TMS)

Pyroglutamic acid, DL- (2TMS)

Pyruvic acid (1MEOX) (1TMS)

Raffinose (11TMS)

Serine, DL- (3TMS)

Serine, O-acetyl-, DL- (2TMS)

Sorbose, D- (1MEOX) (5TMS)

Succinic acid (2TMS)

Sucrose, D- (8TMS)

Tagatose, D- (1MEOX) (5TMS)

Threonine, DL- (3TMS)

Trehalose, alpha,alpha'-, D- (8TMS)

Tryptophan, L- (3TMS)

Tyrosine, DL- (3TMS)

Uracil (2TMS)

Valine, DL- (2TMS)

Xylose, D- (1MEOX) (4TMS)

Col-0

sir1-1

0.000336

0.000258

Col-0

sir1-1

0.000035

0.000058

0.018750

0.013501

0.002187

0.001847

0.012467

0.009775

0.003275

0.000376

0.000751

0.001722

0.000141

0.002664

0.000214

0.000374

0.024546

0.020064

0.000050

0.000100

0.000125

0.000152

0.003445

0.007855

0.000014

0.000035

0.000903

0.001182

0.000030

0.001911

0.000005

0.000059

0.004547

0.000015

0.000009

0.000042

0.000876

0.001256

0.000001

0.000004

0.000088

0.000117

0.000158

0.000172

0.002825

0.004184

0.000070

0.000311

0.006850

0.008655

0.000215

0.000203

0.015673

0.020697

0.012986

0.009905

0.000147

0.000118

0.000549

0.001097

0.000107

0.000175

0.001181

0.002710

0.000318

0.000685

0.000015

0.000434

0.000027

0.000017

0.000675

0.000052

0.000900

0.001151

0.000030

0.000010

0.000852

0.004006

0.001413

0.001214

0.000030

0.000046

0.000036

0.000252

0.000016

0.000044

0.000115

0.000425

0.000023

0.000117

0.003204

0.005548

0.000134

0.000237

0.005000

0.004399

0.000873

0.000718

0.004312

0.015363

0.000625

0.000376

0.000482

0.000688

0.006104

0.012362

0.000172

0.000312

0.000883

0.000400

0.000027

0.000016

0.000251

0.000091

0.000342

0.000521

0.000775

0.000632

0.020326

0.033586

0.000614

0.001081

0.046034

0.039065

0.000414

0.000728

0.000265

0.000434

0.006152

0.010305

0.000100

0.000320

0.000614

0.000860

0.000858

0.001727

0.007898

0.017932

0.000198

0.000315

0.003417

0.002059

0.000849

0.003498

0.000470

0.000479

0.000728

0.000674

0.000075

0.000111

0.002997

0.002318

0.000045

0.000030

0.000580

0.002668

0.000035

0.000096

0.000287

0.000981

0.000070

0.000109

0.000393

0.003194

0.000063

0.000091

0.000103

0.000165

0.000440

0.003980

0.000036

0.000033

0.000154

0.000141

0.000006

0.000002

0.000029

0.000016

0.000029

0.000160

0.000036

0.000105

0.002064

0.010477

0.000052

0.000407

0.002266

0.008165

0.000050

0.000141

0.000100

0.000116

0.000354

0.001627

0.000007

0.000050

0.000060

0.000086

0.000078

0.000479

0.000733

0.004248

0.000038

0.000148

0.000203

0.000393

0.000396

0.000708

0.000033

0.000083

0.000035

0.000162

0.000011

0.000036

0.000288

0.000287

0.000004

0.000003

0.168958

0.164912

0.191580

0.351802

0.040063

0.308987

0.015739

0.000582

0.040229

0.057056

0.020431

0.380747

0.009583

0.007574

0.916286

0.701805

0.323880

0.272989

0.501578

0.243213

0.002629

0.047631

0.353823

0.085781

0.027887

0.061924

0.232467

0.003143

0.210289

0.568821

0.111881

0.001960

0.247491

0.780937

0.171083

0.163796

0.595592

0.027688

0.126519

0.003085

0.005236

0.251518

0.258384

0.501348

0.276485

0.028349

0.329396

0.016871

0.453981

0.017520

0.000371

0.088115

0.285905

0.149781

0.026860

156

Supplemental data

Suppl. data 6 In vitro detection of sulfide via HPLC using OAS-TL activity.

A reaction was carried out in 0.1 ml containing 0.1 mM HEPES, pH 7.5, 0.2 mM sulfide,

10 mM OAS, 5 mM DTT and 2 U OAS-TL A. Thereby, sulfide is converted in cysteine.

As a negative control reaction was immediately stopped with 50 µl trichloroacetic acid.

As a second negative control the reaction was carried out without enzyme. The reaction was stopped with 50 µl trichloroacetic acid after 15 min. An aliquot of 75 µl was subjected to sulfide derivatization (2.7.3), the second aliquot of 75 µl to cysteine derivatization (2.7.3 and Suppl. data 7).

900,00

20 pmol sulfide + OAS-TL (0 min.)

800,00

700,00

600,00

500,00

400,00

300,00

Sulfide

200,00

100,00

0,00

0,00 2,00 4,00 6,00 8,00 10,00 12,00 14,00 16,00 18,00 20,00 22,00 24,00 26,00 28,00

Minutes

30,00 32,00 34,00 36,00 38,00 40,00 42,00 44,00 46,00 48,00 50,00 52,00 54,00

900,00

800,00

700,00

600,00

500,00

20 pmol sulfide - OAS-TL (15 min.)

400,00

300,00

200,00

100,00

Sulfide

0,00

0,00 2,00 4,00 6,00 8,00 10,00 12,00 14,00 16,00 18,00 20,00 22,00 24,00 26,00 28,00

Minutes

30,00 32,00 34,00 36,00 38,00 40,00 42,00 44,00 46,00 48,00 50,00 52,00 54,00

500,00

400,00

300,00

200,00

100,00

900,00

800,00

700,00

600,00

20 pmol sulfide + OAS-TL (15 min.)

Sulfide

0,00

0,00 2,00 4,00 6,00 8,00 10,00 12,00 14,00 16,00 18,00 20,00 22,00 24,00 26,00 28,00

Minutes

30,00 32,00 34,00 36,00 38,00 40,00 42,00 44,00 46,00 48,00 50,00 52,00 54,00

157

1100,00

1000,00

900,00

800,00

700,00

600,00

500,00

400,00

300,00

200,00

100,00

0,00

-100,00

-200,00

0,00

Supplemental data

Suppl. data 7 In vitro detection of cysteine via HPLC using OAS-TL activity.

A reaction was carried out in 0.1 ml containing 0.1 mM HEPES, pH 7.5, 0.2 mM sulfide,

10 mM OAS, 5 mM DTT and 2 U OAS-TL A. Thereby, sulfide is converted in cysteine.

As a negative control reaction was immediately stopped with 50 µl trichloroacetic acid.

The reaction was carried out for 15 min and was stopped with 50 µl trichloroacetic acid.

An aliquot of 75 µl was subjected to sulfide derivatization (2.7.3 and Suppl. data 6), the second aliquot of 75 µl to cysteine derivatization (2.7.3).

20 pmol sulfide + OAS-TL (0 min.)

2,00 4,00 6,00 8,00

Cysteine

10,00 14,00 16,00 18,00 20,00 22,00 24,00 12,00

Minutes

1100,00

1000,00

900,00

800,00

700,00

600,00

500,00

400,00

300,00

200,00

100,00

0,00

-100,00

-200,00

0,00

20 pmol sulfide + OAS-TL (15 min.)

2,00 4,00 6,00 8,00

Cysteine

10,00 12,00

Minutes

14,00 16,00 18,00 20,00 22,00 24,00

158

Supplemental data

Suppl. data 8 399 genes that were altered in 7-week-old sir1-1 in comparison to wild-type of same age.

Only genes with p < 0.05 and 1 < 2log-fold-change > -1 were listed.

A t2g28790 ---

A t2g28890 P LL4

A t2g29120 A TGLR2.7

A t2g29350 SA G13

A t2g30140 ---

A t2g30600 ---

A t2g30610 ---

A t2g31880 ---

A t2g32160 ---

A t2g32680 A tRLP 23

A t2g33580 ---

A t2g33830 ---

A t2g33850 ---

A t2g35980 YLS9

A t2g36930 ---

A t2g37130 ---

A t2g37460 ---

A t2g37710 RLK

A t2g38400 A GT3

A t2g38470 WRKY33

A t2g38530 LTP 2

A t2g39030 ---

A t2g39210 ---

A t2g39310 JA L22

A t2g39330 JA L23

A t2g40010 ---

A t2g40100 LHCB 4.3

A t2g40750 WRKY54

A t2g41090 ---

A t2g41100 TCH3

A t2g41410 ---

A t2g42840 P DF1

A t2g43550 ---

A t2g43570 ---

A t2g46440 A TCNGC3

A t2g46600 ---

A t2g47130 ---

A t2g47180 A tGo lS1

A t3g01290 ---

A t3g01830 ---

A t3g04210 ---

A t3g07350 ---

A t3g08770 LTP 6

A t3g09260 P YK10

A t3g09270 A TGSTU8

A t3g10020 ---

A t3g11010

A t3g11340

A t3g11820

A tRLP 34

---

SYP 121

A t3g13580 ---

A t3g13610 ---

A t3g13950 ---

A t3g14600 ---

A t1g67810 SUFE2

A t1g67860 ---

A t1g67865 ---

A t1g67920 ---

A t1g70710 A TGH9B 1

A t1g70820 ---

A t1g71030 M YB L2

A t1g72040 ---

A t1g72260 THI2.1

A t1g72430 ---

A t1g72930 TIR

A t1g73330 A TDR4

A t1g73800 ---

A t1g73805 ---

A t1g74710 EDS16

A t1g74890 A RR15

A t1g75040 P R5

A t1g76130 A M Y2

A t1g76690 OP R1

A t1g76790 ---

A t1g76960 ---

A t1g79110 ---

A t1g80840 WRKY40

A t2g02100 LCR69

A t2g04030 CR88

A t2g04430 atnudt5

A t2g04450 A TNUDT6

A t2g05540 ---

A t2g13810 A LD1

A t2g14560 LURP 1

A t2g14610 P R1

A t2g15090 KCS8

A t2g15890 M EE14

A t2g17040 anac036

A t2g17840 ERD7

A t2g18660 EXLB 3

A t2g18680 ---

A t2g18690 ---

A t2g19970 ---

A t2g20490 NOP 10

A t2g21140 A TP RP 2

A t2g21650 M EE3

A t2g21660 CCR2

A t2g22400 ---

A t2g22500 UCP 5

A t2g23810 TET8

A t2g24600 ---

A t2g26400 A TA RD3

A t2g26440 ---

A t2g26560 P LA 2A

A t2g28190 CSD2

A t2g28400 ---

2.17

0.96

1.63

0.69

0.87

-1.30 7.0E-08

-0.19

-1.15 4.6E-07

0.27

-1.36 5.7E-03

-0.31

-1.00 3.8E-03

-1.05

-0.04

-0.82

0.25

-1.09

-0.49

-0.78

0.04

0.79

0.84

1.01 2.5E-07

1.07

1.2E-11

1.13 2.6E-04

1.9E-02 6.4E-04

2.9E-01 4.9E-09

6.4E-01 2.0E-02

1.9E-01 4.8E-05

8.2E-01 6.4E-07

1.7E-02 2.2E-16

8.9E-01 1.6E-04

1.28

1.4E-05

1.62

7.2E-11 7.7E-20

1.1E-01 8.9E-02 1.3E-03

0.14

-0.97

1.14

-0.27

-1.11

4.1E-01 1.4E-07 4.0E-09

-1.41 3.9E-06 2.4E-01 3.1E-08

0.04

1.71

1.67

9.5E-01 7.1E-03 8.4E-03

0.45

-0.93

-1.38

1.3E-01 2.5E-03 1.3E-05

0.33

-0.68

-1.02

0.53

0.25

-0.91

-1.32

1.2E-01 2.0E-03 8.2E-06

-1.45 4.6E-02

-1.56

1.7E-01

8.4E-04 4.5E-07

9.9E-11 1.8E-13

0.39

0.95

-2.21 -2.60

6.3E-01 6.9E-03 1.6E-03

-0.18

-1.13

1.8E-04 4.5E-01 1.2E-05

2.21

0.48

-1.74 5.7E-09

-0.15

0.98

1.13

7.0E-01

1.6E-01 2.1E-06

1.5E-02 5.4E-03

2.41

1.35

-1.06 3.3E-08 9.8E-04 8.5E-03

1.24

0.21

-1.03 3.4E-05

0.81 -0.65

-1.46

1.9E-01

4.5E-01 4.9E-04

2.8E-01 1.8E-02

-1.93

-0.19

0.06

0.82

1.99 3.6E-04

1.01 6.7E-03

9.1E-01 2.5E-04

5.4E-20 5.6E-25

-0.04

-1.13

-1.08

8.6E-01 2.0E-05 3.9E-05

0.07

-2.23

-2.31 8.6E-01 4.3E-07 2.1E-07

-2.96

-1.95

1.01 3.5E-24 6.0E-15 4.0E-06

0.01

-1.20

1.30

-0.81

-1.21 9.8E-01

-2.11 4.0E-02

1.7E-04

2.0E-01

1.6E-04

1.1E-03

0.97

-0.58

-1.81 -2.77

1.9E-01 1.6E-02 3.1E-04

0.46

1.03

1.6E-02 5.5E-02 3.1E-05

-1.78

-0.63

1.80

0.36

1.15

-1.44

1.7E-25

1.4E-11

6.0E-07 1.6E-15

1.2E-01 1.4E-08

2.32

1.25

-1.07 3.6E-05 2.1E-02 4.7E-02

0.57

-0.78

-1.35

3.0E-01

0.85

-0.34

-1.19

1.2E-05

1.6E-01 1.6E-02

6.4E-02 5.0E-09

1.08

-1.36

-1.05

-2.14 4.7E-04 6.3E-04 2.8E-10

0.01

1.37

5.3E-16 9.3E-01 3.6E-16

-0.64

0.54

-1.67

-0.48

1.18

2.4E-11 4.8E-09 8.6E-24

1.19 2.8E-09 5.7E-02 8.5E-06

2.99

0.56

1.59

1.88

-1.40

1.32

1.1E-14 2.9E-06 3.1E-05

1.4E-01 3.3E-06 7.0E-04

-0.51

0.50

1.01 6.4E-06

0.81

-1.02

-1.83

7.6E-06 5.3E-15

1.1E-01 4.0E-02 3.7E-04

0.40

-0.64

-1.03

1.7E-01 3.0E-02 5.8E-04

1.18

-0.09

-1.27 2.9E-04 7.8E-01 1.1E-04

0.32

-2.00

-2.32

3.9E-01 7.6E-07 2.0E-08

1.20

0.17

-1.03

5.1E-04 6.0E-01 2.6E-03

0.43

-0.60

-1.02

-1.40

1.26

0.57

0.23

1.97 3.6E-02

-1.02

1.6E-01 5.4E-02

1.3E-04

1.2E-03

3.9E-01 3.6E-03

4.6E-01 1.6E-03

-1.52

0.14

1.66 4.5E-09 5.5E-01 3.2E-10

0.39

-0.68

-1.07 3.4E-02 3.3E-04 8.0E-08

1.45

1.65

0.43

0.65

-1.02 4.6E-08

-1.00 9.3E-06

7.7E-02 5.8E-05

6.7E-02 5.1E-03

1.26

-1.23

-1.62

-0.11

-1.38 5.2E-05

0.06

0.07

1.29

1.69

2.3E-14

1.3E-13

7.0E-01 1.2E-05

6.3E-01 2.7E-15

7.0E-01 2.2E-14

0.92

-0.53

-1.44 4.8E-03

1.70

0.01

-1.69

7.1E-06

1.52

-0.44

-1.95 3.0E-04

0.91 -0.26

-1.17 2.8E-06

-1.45

0.47

1.91

1.6E-12

-2.38

-0.32

0.20

-1.45

2.06

-1.65

1.4E-17

3.5E-01

1.0E-01 1.8E-05

9.8E-01 7.8E-06

2.8E-01 5.5E-06

1.6E-01 7.7E-09

8.4E-03 8.5E-18

1.5E-01 1.0E-14

9.1E-10 1.3E-11

-0.38

-1.13

0.71

0.05

1.10

1.1E-02

1.18 7.3E-03

0.42

-0.90

-1.32 2.3E-04

1.68

0.33

-1.34

1.0E-08

6.1E-06 9.3E-11

9.0E-01 5.2E-03

3.0E-12 1.0E-19

2.1E-01 2.2E-06

0.78

1.83

1.04

1.8E-07 5.3E-22 4.8E-11

1.22

-0.10

-1.32

2.1E-05

-1.87

-0.79

1.08 6.2E-05

7.0E-01 4.7E-06

7.9E-02 1.7E-02

-1.62

0.50

0.56

-0.55

-1.07

-1.08

0.32

1.35

2.12 7.7E-02

-1.11

1.1E-01

1.39

1.5E-05

2.43

2.4E-01

5.9E-01 2.2E-02

1.1E-01 1.9E-03

1.7E-01 5.6E-08

1.4E-01 8.9E-03

-1.04

0.04

1.09

7.7E-17 6.5E-01 1.0E-17

0.88

-0.88

-1.76 4.8E-04 5.3E-04 2.3E-10

1.39

-0.26

-1.65 2.9E-04 4.8E-01 2.3E-05

1.10

-0.17

-1.28

1.4E-05

0.63

-0.98

-1.61 4.3E-02

4.7E-01 7.8E-07

1.9E-03 1.1E-06

1.85

0.84

-1.01 2.7E-08 6.4E-03 1.2E-03

-2.87

-0.61

2.25

1.6E-09 1.5E-01 7.9E-07

-0.78

0.50

1.28

1.5E-01 3.6E-01 2.1E-02

0.99

-0.60

-1.59 9.7E-02 3.1E-01 8.6E-03

0.94

-0.45

-1.38

1.6E-04 6.2E-02 1.0E-07

2.05

0.97

-1.07

2.8E-10 9.6E-04 3.0E-04

0.62

-0.72

-1.35

1.5E-02 5.1E-03 7.4E-07

0.04

0.05

1.09

-1.69

1.06

-1.74

9.4E-01 3.3E-02 4.0E-02

8.1E-01 5.2E-12 1.8E-12

1.09

-0.91 -2.00

1.4E-02 3.9E-02 1.5E-05

1.20

-0.43

-1.63 2.8E-06 7.7E-02 1.5E-09

-2.65

-1.49

1.16 5.9E-36 1.7E-20 3.5E-15

-1.98

-2.32

0.44

2.42

1.2E-12

0.01

2.32

3.2E-15

0.52

-0.67

-1.79

-0.65

-1.19

1.14

6.7E-02 3.0E-16

9.8E-01 2.8E-15

1.7E-01 8.2E-02 2.4E-03

2.0E-15 5.9E-04 1.8E-08

0.53

-1.08

-1.61 7.1E-02 3.6E-04 3.5E-07

-0.04

-1.60

-1.56

9.0E-01 1.9E-05 2.9E-05

0.31 -0.78

-1.09

1.1E-01 1.1E-04 1.9E-07

-0.68

0.52

0.42

1.09

1.1E-08 1.8E-04 2.6E-16

-1.45

-1.97

2.0E-01 5.9E-04 5.4E-06

1.15

-0.22

-1.37 7.3E-05

-1.15

-0.09

1.06 7.9E-08

4.3E-01 3.7E-06

6.5E-01 5.2E-07

(Table continues on following page.)

159

Supplemental data

Suppl. data 8

(Continued from previous page.)

A t3g15450 ---

A t3g15630 ---

A t3g15950 NA I2

A t3g16390 NSP 1

A t3g16430 JA L31

A t3g16450 ---

A t3g16460 ---

A t3g16470 JR1

A t3g17170 RFC3

A t3g17790 P A P 17

A t3g18080 B GLU44

A t3g18250 ---

A t3g19010 ---

A t3g19680 ---

A t3g19710 B CA T4

A t3g21520 ---

A t3g22120 CWLP

A t3g22231 P CC1

A t3g22600 ---

A t3g22740 HM T3

A t3g23110 A tRLP 37

A t3g23940 ---

A t3g25010 A tRLP 41

A t3g26210 CYP 71B 23

A t3g26830 P A D3

A t3g26960 ---

A t3g28210 P M Z

A t3g28220 ---

A t3g28270 ---

A t3g28290 A T14A

A t3g28540 ---

A t3g30775 ERD5

A t3g44350 anac061

A t3g44735 P SK1

A t3g44750 HDA 3

A t3g45860 ---

A t3g46900 COP T2

A t3g47340 A SN1

A t3g47480 ---

A t3g47540 ---

A t3g48090 EDS1

A t3g48100 A RR5

A t3g48360 B T2

A t3g48640 ---

A t3g48650 ---

A t3g49620 DIN11

A t3g50480 HR4

A t3g50770 ---

A t3g50930 B CS1

A t3g50950 ---

A t3g51660 ---

A t3g51860 CA X3

A t3g51920 CA M 9

A t3g52400 SYP 122

A t3g52430 P A D4

A t3g52580 ---

A t3g52720 A CA 1

A t3g53460 CP 29

A t3g54810 B M E3

A t3g55980 SZF1

A t3g56200 ---

A t3g56290 ---

A t3g56400 WRKY70

A t3g56710 SIB 1

A t3g57150 NA P 57

A t3g57260 B GL2

A t3g57550 A GK2

A t3g57700 ---

A t3g59930 ---

A t3g60420 ---

A t3g60540 ---

A t4g00700 ---

A t4g01870 ---

A t4g02380 SA G21

A t4g03450 ---

A t4g03510 RM A 1

A t4g04490 ---

A t4g04500 ---

A t4g04610 A P R1

A t4g05020 NDB 2

A t4g08300 ---

A t4g08850 ---

A t4g08870 ---

A t4g10500 ---

A t4g11280 A CS6

A t4g11310 ---

A t4g11890 ---

A t4g12470 ---

A t4g12600 ---

A t4g12720 NUDT7

A t4g13180 ---

A t4g13850 GR-RB P 2

A t4g14365 ---

A t4g14400 A CD6

A t4g17090 CT-B M Y

A t4g17470 ---

A t4g17670 ---

A t4g18440 ---

A t4g20780 ---

A t4g20830 ---

A t4g21830 A TM SRB 7

A t4g21990 A P R3

A t4g22490 ---

A t4g22530 ---

A t4g23140 CRK6

-3.88 -2.33

1.55

2.5E-11 1.3E-05 2.7E-03

-2.37

-1.32

1.05

4.1E-10 1.6E-04 2.2E-03

-1.14

0.25

1.39

2.4E-14 4.6E-02 2.9E-18

-0.76

1.30

2.06 7.9E-02 3.0E-03 6.3E-06

-0.82

0.69

1.51 8.2E-03 2.5E-02 3.3E-06

-1.29

0.30

1.58 5.6E-09 1.4E-01 6.9E-12

-0.96

0.40

1.36

4.8E-19 5.2E-06 1.2E-27

-1.62

0.70

2.32 4.5E-02 3.8E-01 4.6E-03

-0.80

0.27

1.07

1.3E-06 8.7E-02 8.4E-10

0.67 -0.46

-1.12

6.5E-10 6.5E-06 2.7E-19

-1.06

0.34

1.40 9.5E-06 1.4E-01 2.0E-08

1.07 -0.22

-1.29

1.2E-02 6.1E-01 2.9E-03

0.58

-0.71 -1.29

1.2E-02 2.2E-03 1.7E-07

0.79 -0.37

-1.16 4.6E-03 1.8E-01 5.2E-05

0.78

2.09

1.31 6.5E-04 8.6E-15 6.4E-08

0.39 -0.78

-1.18 3.0E-02 3.4E-05 3.9E-09

-2.19 -0.92

1.27

1.3E-04 9.5E-02 2.3E-02

0.47

-1.00

-1.47

4.0E-01 7.6E-02 9.8E-03

1.26

-1.66 -2.92 6.8E-03 4.6E-04 8.6E-09

-0.44

1.15

1.59

1.6E-01 4.7E-04 2.6E-06

0.65 -0.45

-1.09

1.6E-03 2.6E-02 3.9E-07

-1.27

0.10

1.38

1.3E-08 6.1E-01 1.4E-09

1.13 -0.22

-1.35

1.3E-02 6.2E-01 3.4E-03

0.35

-1.00

-1.35

2.3E-01 6.7E-04 8.4E-06

0.28 -0.83

-1.12

4.9E-01 4.4E-02 7.5E-03

0.71 -0.30

-1.01 2.0E-03 1.8E-01 1.9E-05

0.28 -0.78

-1.06

2.5E-01 1.6E-03 2.9E-05

-2.38 -0.64

1.75 2.7E-03 4.1E-01 2.6E-02

0.71

1.78

1.07 7.9E-03 1.6E-09 9.9E-05

-0.98

1.20

2.18

1.0E-01 4.7E-02 4.5E-04

1.39

0.20

-1.18 3.3E-05 5.3E-01 3.2E-04

0.30

1.56

1.26

3.0E-01 5.4E-07 3.2E-05

0.42 -0.84

-1.26

1.4E-01 3.9E-03 2.5E-05

0.47 -0.92

-1.39 9.7E-02 1.6E-03 4.0E-06

-0.59

0.73

1.32 7.4E-03 1.1E-03 3.1E-08

2.50

0.18 -2.32

3.1E-06 7.2E-01 1.3E-05

1.21

0.03

-1.18 3.8E-05 9.0E-01 6.0E-05

-3.54

-1.37

2.18

2.9E-17 7.5E-05 3.4E-09

1.05 -0.54

-1.58

1.9E-03 1.0E-01 5.9E-06

0.21

-1.18

-1.39

3.8E-01 3.6E-06 9.9E-08

0.24 -0.93

-1.18

2.5E-01 2.5E-05 2.5E-07

-0.23

-1.34

-1.11 5.5E-02 2.8E-18 1.7E-14

-3.03

-1.09

1.94

1.6E-17 1.7E-04 7.9E-10

0.32

-1.38

-1.70

1.3E-01 3.4E-09 3.5E-12

0.53 -0.94

-1.46 7.0E-03 5.1E-06 3.8E-11

-1.94 -0.77

1.17 5.7E-09 1.1E-02 1.8E-04

0.15

-1.30

-1.45

6.8E-01 6.0E-04 1.4E-04

1.48

0.33

-1.15 5.5E-04 4.3E-01 6.4E-03

1.26 -0.06

-1.32 4.4E-05 8.4E-01 2.1E-05

0.54 -0.49

-1.03 3.4E-02 5.1E-02 8.5E-05

0.77 -0.77

-1.54 2.2E-02 2.2E-02 1.2E-05

1.95

-0.13 -2.08 6.8E-04 8.2E-01 3.1E-04

1.07

0.06

-1.01 2.6E-15 6.0E-01 2.8E-14

1.43

0.03

-1.40 5.0E-07 9.1E-01 7.8E-07

0.44 -0.87

-1.31 3.6E-02 7.1E-05 1.4E-08

-1.03

0.04

1.07

1.1E-06 8.3E-01 4.5E-07

-0.19

-1.84

-1.66 9.2E-02 3.4E-28 2.3E-25

-1.34

-0.18

1.16

1.9E-07 4.5E-01 4.2E-06

1.27

0.10

-1.17 7.5E-05 7.5E-01 2.3E-04

1.02 -0.04

-1.07 2.8E-02 9.3E-01 2.2E-02

0.13

-1.43

-1.57

6.9E-01 3.8E-05 8.3E-06

1.15 -0.29

-1.44

1.9E-05 2.6E-01 2.1E-07

0.39 -0.92

-1.30

2.7E-01 9.5E-03 3.0E-04

1.03 -0.22

-1.25

2.1E-04 4.0E-01 9.5E-06

-0.54

0.51

1.05

1.9E-03 3.6E-03 2.3E-08

0.55

-1.03

-1.57

3.8E-01 1.0E-01 1.3E-02

0.17 -0.85

-1.02

2.1E-01 1.3E-08 5.2E-11

0.23 -0.86

-1.09

2.2E-01 1.1E-05 7.4E-08

-1.26 -0.24

1.02

1.0E-07 2.7E-01 9.0E-06

0.48

-1.22

-1.70

2.5E-01 4.8E-03 1.2E-04

0.35 -0.95

-1.30

1.5E-01 1.7E-04 7.0E-07

1.17 -0.46

-1.64 7.4E-03 2.8E-01 2.5E-04

0.22

-1.11 -1.33

6.2E-01 1.3E-02 3.3E-03

0.56 -0.86

-1.42 7.0E-03 6.6E-05 7.7E-10

0.59

-1.18

-1.77 2.3E-02 1.3E-05 7.9E-10

-1.23

0.12

1.35

5.2E-14 3.7E-01 9.2E-16

1.50 -0.05

-1.55

1.6E-06 8.7E-01 8.3E-07

1.18 -0.69

-1.87 2.2E-02

1.36

0.19

-1.17

1.9E-06

1.7E-01 3.6E-04

4.7E-01 3.1E-05

1.56

0.36

-1.20

1.2E-07 1.8E-01 2.5E-05

1.17

-0.11 -1.28 9.8E-24 1.7E-01 4.4E-26

0.90 -0.43

-1.33 3.9E-03 1.6E-01 3.6E-05

-0.99

0.24

1.23 2.4E-02 5.9E-01 5.7E-03

1.11 -0.94 -2.05 9.7E-02 1.6E-01 2.7E-03

0.73 -0.69

-1.42

5.1E-02 6.8E-02 2.5E-04

-0.82

0.36

1.18

3.1E-02 3.4E-01 2.2E-03

0.16

-1.62

-1.78

6.6E-01 1.9E-05 3.5E-06

-1.31

0.00

1.31

1.8E-10 1.0E+00 1.8E-10

-1.05

0.00

1.05

3.1E-05 9.8E-01 3.3E-05

1.20 -0.54

-1.74 3.7E-04 9.8E-02 6.8E-07

1.95

0.60

-1.35 5.6E-08 6.9E-02 8.2E-05

-0.09

1.00

1.09

5.5E-01 8.8E-10 5.9E-11

1.47 -0.92 -2.39 2.2E-04 1.8E-02 1.6E-08

0.75 -0.66

-1.40 4.4E-02 7.6E-02 2.4E-04

1.65

0.63

-1.03

8.2E-11 5.8E-03 1.3E-05

-1.14

0.49

1.63

1.2E-02 2.7E-01 4.2E-04

1.96

0.83

-1.13

6.5E-16 5.5E-05 1.1E-07

-1.28

-0.01

1.26 3.9E-04 9.7E-01 4.4E-04

0.51 -0.66

-1.17 2.0E-03 8.5E-05 1.5E-10

-0.21 -1.42

-1.21

5.1E-01 2.6E-05 2.8E-04

0.75 -0.83

-1.58 5.4E-03 2.0E-03 4.4E-08

1.65 -0.46

-2.10

2.3E-14 1.2E-02 2.4E-19

-2.37

-0.15

2.22

7.0E-19 4.7E-01 1.7E-17

0.34

-1.01 -1.35

2.2E-01 3.1E-04 3.1E-06

1.73 -0.57 -2.30 4.2E-04 2.3E-01 5.1E-06

A t4g23150 ---

A t4g23600 CORI3

A t4g23610 ---

A t4g23810 WRKY53

A t4g25100 FSD1

A t4g25630 FIB 2

A t4g26670 ---

A t4g27260 WES1

A t4g27280 ---

A t4g27440 P ORB

A t4g29030 ---

A t4g29410 ---

A t4g30140 ---

A t4g31700 RP S6

A t4g33050 EDA 39

A t4g34135 UGT73B 2

A t4g34150 ---

A t4g34390 XLG2

A t4g35180 LHT7

A t4g35770 SEN1

A t4g36500 ---

A t4g37370 CYP 81D8

A t4g37410 CYP 81F4

A t4g37790 HA T22

A t4g38550 ---

A t4g39030 EDS5

A t4g39670 ---

A t5g02490 ---

A t5g02940 ---

A t5g04590 SIR

A t5g04930 A LA 1

A t5g05300 ---

A t5g06870 P GIP 2

A t5g07440 GDH2

A t5g07580 ---

A t5g08620 STRS2

A t5g10380 RING1

A t5g10760 ---

A t5g13190 ---

A t5g13200 ---

A t5g13320 P B S3

A t5g14920 ---

A t5g17760 ---

A t5g18470 ---

A t5g19240 ---

A t5g22380 anac090

A t5g22440 ---

A t5g22920 ---

A t5g23010 M A M 1

A t5g23820 ---

A t5g23900 ---

A t5g24120 SIGE

A t5g24150 SQP 1

A t5g24160 SQE6

A t5g24210 ---

A t5g24420 ---

A t5g24660 LSU2

A t5g24780 VSP 1

A t5g25260 ---

A t5g25930 ---

A t5g26920 CB P 60G

A t5g27140 ---

A t5g27420 ---

A t5g28540 B IP 2

A t5g35735 ---

A t5g38900 ---

A t5g39670 ---

A t5g41740 ---

A t5g42050 ---

A t5g42830 ---

A t5g43780 A P S4

A t5g44070 CA D1

A t5g44130 FLA 13

A t5g44810 ---

A t5g46230 ---

A t5g47500 ---

A t5g48380 ---

A t5g48540 ---

A t5g49480 A TCP 1

A t5g51460 A TTP P A

A t5g52640 A THSP 90.1

A t5g52750 ---

A t5g52760 ---

A t5g52810 ---

A t5g54510 DFL1

A t5g54610 A NK

A t5g54860 ---

A t5g55450 ---

A t5g57220 CYP 81F2

A t5g58770 ---

A t5g59670 ---

A t5g60900 RLK1

A t5g61010 A TEXO70E2

A t5g61210 SNA P 33

A t5g62920 A RR6

A t5g63850 A A P 4

A t5g64000 SA L2

A t5g64120 --o rf111d ---

1.43 -0.70

-2.13

2.1E-04 6.2E-02 1.4E-07

-0.64

1.17

1.82

3.9E-01 1.2E-01 1.7E-02

0.61 -0.45

-1.06

1.9E-03 1.9E-02 2.8E-07

1.17

0.12

-1.05

1.6E-04 6.9E-01 6.0E-04

0.92 -0.40

-1.32 2.4E-04

-0.64

0.54

1.17 5.8E-05

1.0E-01 4.2E-07

5.4E-04 1.5E-11

-0.56

0.53

1.09

6.1E-06 2.1E-05 1.7E-14

-0.74

0.31

1.05 3.3E-06 3.9E-02 4.7E-10

0.56 -0.66

-1.23 6.5E-02 3.1E-02 1.1E-04

-1.57

-0.51

1.07 5.6E-05 1.7E-01 5.0E-03

-1.93

-0.19

1.74

1.9E-18 2.6E-01 2.8E-16

-1.08 -0.05

1.03

1.7E-12 7.2E-01 8.4E-12

-1.34 -0.07

1.27

1.1E-16 5.9E-01 1.2E-15

-1.10 -0.05

1.05 2.0E-05 8.3E-01 4.3E-05

1.67

0.05

-1.62

5.9E-11 8.2E-01 1.6E-10

1.99

0.17

-1.82 5.6E-03 8.1E-01 1.1E-02

1.49 -0.42

-1.91 2.0E-07 1.1E-01 1.8E-10

0.48 -0.55

-1.03 5.0E-04 8.4E-05 2.2E-11

0.74 -0.46

-1.20 4.8E-03 7.3E-02 9.7E-06

-3.52

-2.18

1.34

5.9E-15 7.1E-08 4.5E-04

1.18

-0.18

-1.35 5.3E-03 6.7E-01 1.5E-03

0.92

-1.09

-2.01 2.1E-02 6.5E-03 1.9E-06

-1.43

0.38

1.81

1.1E-04 2.9E-01 1.9E-06

0.55 -0.49

-1.04

1.3E-03 4.1E-03 1.6E-08

0.80 -0.48

-1.28

1.2E-03 4.7E-02 7.2E-07

0.37 -0.73

-1.11 9.9E-02 1.4E-03 3.8E-06

0.49

-1.29

-1.78 8.3E-02 1.2E-05 8.6E-09

1.01 -0.84

-1.86

1.4E-03 7.0E-03 3.7E-08

-1.50 -0.46

1.04 2.2E-07 8.6E-02 1.8E-04

0.03

-1.26

-1.29

8.7E-01 4.8E-11 2.2E-11

0.69 -0.39

-1.08 3.9E-04 3.7E-02 1.1E-07

0.70 -0.38

-1.08

6.1E-03 1.3E-01 3.7E-05

-2.42

-1.09

-1.16

-0.15

1.32

1.9E-06

1.01 1.0E-03

2.2E-02 6.2E-03

6.7E-01 3.9E-03

1.02

-0.01 -1.03 3.8E-04 9.6E-01 3.2E-04

-0.83

0.19

1.02

3.5E-13 4.6E-02 3.8E-17

1.14

-0.51 -1.66 3.0E-02 3.2E-01 1.9E-03

1.80

0.56

-1.24 2.9E-03 3.4E-01 3.8E-02

1.04 -0.08

-1.13 9.4E-05 7.4E-01 2.8E-05

1.77

0.85

0.71 -1.05

-1.11 -1.96 2.6E-03

-2.44

-1.24

1.20

1.7E-06

1.2E-06

4.1E-02 2.8E-03

1.2E-04

9.2E-03

3.6E-10

1.1E-02

0.30 -0.75

-1.05

1.5E-01 5.0E-04 2.5E-06

0.50

-1.30

-1.80 3.8E-02 4.5E-07 4.8E-11

0.87 -0.83

-1.70 4.8E-02 5.7E-02 1.8E-04

1.19 -0.07

-1.27 9.5E-04 8.3E-01 4.8E-04

-1.43

-0.19

1.24 3.4E-09 3.7E-01 1.6E-07

-2.67

-1.61

1.06

3.7E-10 4.6E-05 5.8E-03

0.47

1.59

1.11 4.5E-02 1.5E-09 7.4E-06

-2.32 -0.46

-1.11

0.03

1.85

1.14

1.2E-08

1.0E-10

2.1E-01 2.4E-06

8.5E-01 4.4E-11

0.64

-1.08

-1.73 2.5E-03 1.1E-06 1.3E-12

0.98

-0.18

-1.16 6.7E-04 5.1E-01 6.7E-05

-0.24

0.84

1.09 3.5E-02 1.2E-10 7.2E-15

0.80 -0.42

-1.22 5.6E-03 1.4E-01 3.9E-05

-2.00

0.43

2.43

1.4E-02 6.0E-01 3.2E-03

1.82

0.79

-1.03

2.9E-21 3.0E-07 1.7E-10

-3.30

0.96

4.25 5.3E-03 4.1E-01 3.9E-04

0.41 -0.66

-1.07 5.6E-03 1.9E-05 1.2E-10

0.73 -0.47

-1.20

2.1E-03 4.5E-02 1.5E-06

0.71 -0.71

-1.41 6.7E-04 6.4E-04 4.7E-10

-0.69

0.35

1.04

7.4E-13 3.9E-05 3.3E-21

0.93

-0.13

-1.06

1.1E-03 6.3E-01 2.2E-04

0.68 -0.36

-1.04

1.7E-02 2.0E-01 3.5E-04

1.65 -0.02

-1.67

9.1E-11 9.3E-01 6.2E-11

0.84 -0.39

-1.24 2.5E-02 2.9E-01 1.3E-03

0.80 -0.86

-1.65

2.1E-03 9.5E-04 3.8E-09

0.67 -0.37

-1.04

1.8E-03 7.3E-02 2.7E-06

1.91

0.82

-1.09 3.3E-08 1.0E-02 7.8E-04

0.34

-1.09

-1.43

2.5E-01 4.7E-04 7.2E-06

1.16 -0.54

-1.70

1.9E-06 1.8E-02 6.0E-11

0.40

-1.03

-1.43

1.7E-03 1.5E-12 7.9E-19

-0.38

-1.42

-1.04

3.1E-01 2.2E-04 5.7E-03

0.75 -0.35

-1.10

1.1E-06 1.6E-02 2.7E-11

0.86 -0.38

-1.24

1.6E-05 4.8E-02 4.2E-09

-1.19

-0.19

1.01

3.3E-11 2.3E-01 7.2E-09

0.58 -0.72

-1.30 2.3E-02 5.3E-03 1.6E-06

0.02

-1.34

-1.36

9.5E-01 1.3E-05 9.9E-06

2.27

0.85

-1.42 3.5E-07 4.1E-02 8.1E-04

0.17 -0.84

-1.01 4.7E-01 6.3E-04 5.0E-05

1.49

0.09

-1.39 2.3E-08 7.0E-01 1.2E-07

1.84

0.09

-1.75 9.8E-08 7.7E-01 3.3E-07

1.09

-1.20 -2.29 4.0E-03 1.5E-03 1.9E-08

0.03

-1.46

-1.49

9.1E-01 1.2E-05 8.0E-06

-1.85

0.00

1.85 2.9E-08 9.9E-01 2.8E-08

1.03 -0.97 -2.00 2.0E-02 2.8E-02 1.5E-05

0.55 -0.89

-1.44

1.6E-02 1.3E-04 7.7E-09

0.42

-1.06

-1.48

4.0E-01 3.9E-02 4.3E-03

0.73 -0.32

-1.05 2.2E-06 2.9E-02 1.7E-10

1.17 -0.68

-1.85 3.6E-05 1.2E-02 9.1E-10

0.42 -0.73

-1.14

1.1E-01 5.7E-03 2.4E-05

1.05 -0.39

-1.44 6.9E-04 1.9E-01 6.2E-06

1.14 -0.02

-1.16 4.6E-06 9.3E-01 3.2E-06

0.57 -0.46

-1.03

1.9E-02 6.0E-02 4.8E-05

0.17

-1.35

-1.52

3.4E-01 4.5E-11 6.2E-13

0.86 -0.24

-1.10

5.1E-06 1.8E-01 2.0E-08

0.88 -0.50

-1.39 3.4E-02 2.2E-01 1.1E-03

-1.68 -0.60

1.07

1.3E-07 4.0E-02 3.8E-04

0.21

1.27

1.06 3.9E-02 5.6E-21 5.0E-17

160

Supplemental data

Suppl. data 9 721 genes that were altered in 10-week-old sir1-1 in comparison to

wild-type of same size (7-week-old).

Only genes with p < 0.05 and 1 < 2log-fold-change > -1 were listed.

(Table continues on following page.)

1.09

1.25

0.16

1.8E-10 1.2E-12 2.7E-01

3.71

3.83

0.12

6.0E-21 1.1E-21 6.8E-01

1.33

1.09

-0.24 2.2E-09 4.0E-07 2.3E-01

-1.73

-1.09

0.63

3.0E-14 1.0E-07 1.1E-03

2.05

1.98

-0.06

1.4E-38 1.3E-37 4.6E-01

-1.53

-1.25

0.28

9.0E-12 6.1E-09 1.5E-01

1.5

1.54

0.03

7.0E-12 3.1E-12 8.7E-01

1.72

1.48

-0.23 3.2E-06 4.3E-05 5.0E-01

-1.58

-1.16

0.42

1.0E-04 3.5E-03 2.8E-01

2.55

2.77

0.22

1.5E-28 7.1E-31 1.4E-01

1.15

1.11 -0.04 9.8E-34 1.1E-32 4.7E-01

1.64

1.23

-0.42

1.5E-27 3.2E-20 7.1E-05

-3.26

-2.96

0.29

2.2E-13 7.9E-12 4.3E-01

1.12

1.32

0.2

1.9E-07 2.6E-09 3.2E-01

-1.07

-1.31 -0.24 2.6E-03 2.8E-04 4.9E-01

-1.17

-1.29

-0.12

1.8E-11 4.4E-13 4.2E-01

-1.48

-1.52

-0.04 9.3E-07 5.2E-07 8.9E-01

2.31

1.53

-0.78

7.5E-11 3.7E-06 1.3E-02

-1.26

-1.15

0.12

1.4E-09 2.2E-08 5.3E-01

-2.19

-2.03

0.17 2.3E-04 6.1E-04 7.7E-01

1.52

1.29

-0.23

1.8E-05 2.2E-04 4.9E-01

3.96

4.94

0.97

1.2E-15 2.6E-20 1.7E-02

-2.44

-2.72

-0.28 4.4E-27 5.2E-30 7.0E-02

1.09

1.4

0.31 2.4E-09 4.5E-13 6.0E-02

-1.61

-1.6

0.01 5.2E-24 6.5E-24 9.5E-01

1.6

1.36

1.13

1.16

-0.48 8.0E-07 3.2E-04

-0.2

1.9E-13 7.1E-11

1.2E-01

1.9E-01

2.6

1.75

-0.86

4.5E-11 2.1E-06 1.4E-02

-2.38

-1.7

0.68

1.7E-19 6.9E-13 1.0E-03

1.1

1.18

0.08

1.2E-11 9.7E-13 5.6E-01

1.11

1.2

0.08

1.27

1.47

0.21

1.1E-11 7.4E-13

1.0E-14 9.5E-18

5.5E-01

1.2E-01

-3.78

-2.83

0.95

2.0E-15 1.3E-10 1.6E-02

3.15

3.3

0.15 2.4E-39 8.9E-41 2.4E-01

1.12

1.07

-0.05

1.8E-12 1.1E-11 7.0E-01

-2.14

-2.9

-0.76 3.6E-08 2.4E-12 3.3E-02

-1.08

-1.1

-0.01 4.4E-10 2.9E-10 9.2E-01

1.66

1.73

0.07

2.9E-16 4.6E-17 6.8E-01

1.68

1.33

-0.35

7.5E-13 2.0E-09 8.1E-02

-1.16

-1.64

-0.48 2.6E-08 3.4E-13 1.4E-02

4.38

5 0.63 2.2E-20 1.3E-23 7.9E-02

-1.44

-1.17

0.27 9.8E-26 1.5E-20 4.5E-03

3.88

3.94

0.06

7.0E-16 3.3E-16 8.7E-01

-2.74

-1.8

0.94

2.3E-10 8.1E-06 1.5E-02

-1.34

-2.01 -0.67 2.0E-03 7.4E-06 1.2E-01

1.21

1.18

-0.03

4.2E-10 1.0E-09 8.4E-01

2.82

2.55

-0.27 5.5E-07 4.3E-06 6.1E-01

-1.46

-1.45

0.01 5.9E-14 7.5E-14 9.6E-01

-1.27

-1.17

0.11

1.7E-18 1.1E-16 3.5E-01

-1.11

-1.04

0.07 4.5E-09 2.9E-08 6.7E-01

-1.22

-1.07

0.15

1.3E-06 1.5E-05 5.2E-01

1.86

1.75

-0.11 8.5E-22 2.5E-20 4.2E-01

1.46

1.15

-0.31

3.1E-11 4.3E-08 1.0E-01

1.24

1.26

0.02

2.4E-15 1.1E-15 8.7E-01

1.31

1.05

-0.26 8.3E-09 1.7E-06 2.1E-01

2.53

2.48

-0.05 4.2E-05 5.9E-05 9.3E-01

1.28

1.2

-0.08

2.9E-31 1.6E-29 2.6E-01

1.06

1.31

0.25

1.9E-03 1.6E-04 4.5E-01

2.36

2.48

0.12

1.7E-24 9.0E-26 4.6E-01

-1.27

-1.49

-0.22 2.7E-08 2.6E-10 2.9E-01

-1.39

-1.23

0.16

1.8E-04 8.4E-04 6.5E-01

-1.17

-1.51 -0.34 8.9E-04 2.8E-05 3.2E-01

1.07

1.09

0.02

2.8E-21 1.1E-21 8.3E-01

-2.74

-2.39

0.36

1.4E-10 8.7E-09 3.4E-01

2.4

1.62

-0.79

8.8E-11 3.0E-06 1.7E-02

-1.22

-1.71 -0.49

1.6E-06 2.3E-10 4.1E-02

1.5

1.52

0.02

4.2E-11 2.7E-11 9.2E-01

1.28

1.65

0.37

4.3E-10 3.7E-14 4.1E-02

-1.27

-1.41

-0.15

5.6E-10 1.5E-11 4.2E-01

-1.02

-1.01

0.01 1.2E-07 1.5E-07 9.4E-01

-1.7

-1.21

0.49 3.2E-05 2.4E-03 2.1E-01

-1.08

-1.16

-0.08

4.8E-17 1.8E-18 4.6E-01

-1.54

-1.49

0.06

1.6E-15 8.1E-15 7.2E-01

1.28

1.04

-0.24 4.4E-07 2.5E-05 3.1E-01

-1.2

-1.25

-0.05 6.3E-04 3.8E-04 8.8E-01

1.47

1.74

0.27

8.7E-21 5.4E-25 2.0E-02

1.89

1.63

-0.27 5.6E-34 1.3E-29 4.3E-03

-1.29

-1.18

0.11

1.2E-16 7.5E-15 3.6E-01

1.05

1.25

-1.13

-1.13

0.19 5.0E-06

-0 1.9E-06

1.3E-07

1.8E-06

3.7E-01

9.9E-01

1.29

1.25

-0.04 3.4E-27 2.9E-26 5.8E-01

-1.82

-1.75

0.07

1.6E-16 9.6E-16 6.9E-01

-1.58

-1.48

0.09

3.2E-15 4.1E-14 5.7E-01

1.34

1.29

-0.04

1.7E-06 3.5E-06 8.6E-01

-1.27

-1.06

0.21

1.2E-13 7.8E-11 1.5E-01

1.42

1.34

-0.08 9.8E-08 4.0E-07 7.3E-01

-1.42

-1.11

0.31 5.1E-08 1.0E-05 2.0E-01

1.19

1.35

0.17 7.8E-04 1.5E-04 6.2E-01

2.12

1.34

-0.78

3.1E-14 1.2E-07 1.0E-03

1.15

1.28

0.13

1.5E-10 3.9E-12 4.2E-01

-1.71

-1.69

0.02

6.5E-11 9.3E-11 9.4E-01

-1.7

-1.86

-0.16

1.5E-14 2.6E-16 3.7E-01

-1.66

-1.21

0.45

7.1E-16 1.4E-10 8.3E-03

-1 -1.06

-0.05 4.2E-07 1.2E-07 7.7E-01

-1.31

-1.04

0.27 5.4E-09 1.6E-06 1.8E-01

-1.89

-1.71

0.18

1.2E-05 6.6E-05 6.5E-01

1.83

2.29

0.46 6.5E-32 1.2E-38 4.5E-06

1.06

1.22

0.16 9.4E-09 1.5E-10 3.5E-01

1.77

1.44

-0.33 7.2E-23 3.7E-18 1.3E-02

-1.49

-1.82

-0.33

8.0E-11 4.1E-14 9.7E-02

-1.59

-1.28

0.31 3.1E-20 1.1E-15 1.9E-02

-2.26

-2.9

-0.64

1.3E-07 1.1E-10 1.1E-01

-1.25

-1.04

0.21

1.7E-16 4.4E-13 8.5E-02

-1.72

-1.12

0.6 2.7E-05 4.7E-03 1.2E-01

1.63

1.52

-0.11 3.4E-04 7.9E-04 8.0E-01

A t5g18130 ---

A t5g17860 CA X7

A t5g16650 ---

A t5g17220 A TGSTF12

A t5g17300 ---

A t5g16570 GLN1;4

A t5g15230 GA SA 4

A t5g15350 ---

A t5g15190 ---

A t5g13930 TT4

A t5g14120 ---

A t5g13630 GUN5

A t5g12860 DiT1

A t5g12050 ---

A t5g11930 ---

A t5g10930 CIP K5

A t5g10770 ---

A t5g07920 DGK1

A t5g07990 TT7

A t5g08170 EM B 1873

A t5g07460 P M SR2

A t5g06510 NF-YA 10

A t5g06290 2-Cys P rx B

A t5g04950 NA S1

A t5g02760 ---

A t5g02200 FHL

A t5g02160 ---

A t5g01600 FER1

A t3g62950 ---

A t3g62960 ---

A t3g61990 ---

A t3g62030 ROC4

A t3g61580 ---

A t2g45470 FLA 8

A t3g60290 ---

A t3g60130 B GLU16

A t3g59140 A TM RP 14

A t5g54960 P DC2

A t5g54060 UF3GT

A t5g53120 SP DS3

A t5g53460 GLT1

A t5g53420 ---

A t5g52970 ---

A t5g52450 ---

A t5g52310 LTI78

A t5g50950 FUM 1

A t5g50800 ---

A t5g49890 CLC-C

A t5g49630 A A P 6

A t5g49360 ---

A t5g48880 P KT2

A t5g48900 ---

A t5g45490 ---

A t5g45680 FKB P 13

A t5g45380 ---

A t5g44340 TUB 4

A t5g44020 ---

A t5g43450 ---

A t5g42800 DFR

A t5g40890 A TCLC-A

A t5g39850 ---

A t5g39590 ---

A t5g39520 ---

A t5g38710 ---

A t5g37600 GSR 1

A t5g24490 ---

A t5g23240 ---

A t5g22860 ---

A t5g23020 IM S2

A t5g19120 ---

A t5g22300 GA P B

A t5g22290 anac089

A t5g18600 ---

A t5g18670 B M Y3

A t3g58120 B ZIP 61

A t3g57680 ---

A t3g57540 ---

A t3g56650 ---

A t3g56090 A TFER3

A t3g56060 ---

A t3g55760 ---

A t3g55610 P 5CS1

A t3g55330 P P L1

A t3g55120 TT5

A t3g54210 ---

A t3g53400 CP uORF46

A t3g52150 ---

A t3g50970 LTI30

A t3g51240 F3H

A t3g50740 UGT72E1

A t3g49940 LB D38

A t3g48720 ---

A t3g47800 ---

A t3g47860 ---

A t3g47295 ---

A t3g46780 P TA C16

A t3g46970 P HS2

A t4g39955 ---

A t4g39210 A P L3

A t4g38860 ---

A t4g38470 ---

A t4g37800 ---

A t4g37300 M EE59

A t4g37610 B T5

A t4g36010 ---

161

Supplemental data

Suppl. data 9

(Continued from previous page.)

A t4g00400 GP A T8

A t1g25550 ---

A t1g18620 ---

A t2g40610 A TEXP A 8

A t2g33450 ---

A t2g40460 ---

A t1g22160 ---

A t1g33970 ---

A t1g34040 ---

A t1g19150 LHCA 6

A t1g58290 HEM A 1

A t1g20693 HM GB 2

A t1g13650

A t3g12610

---

DRT100

A t1g69530 A TEXP A 1

A t1g72060 ---

A t1g32540 LOL1

A t1g66100 ---

A t3g14770 ---

A t3g19970 ---

A t3g13620 ---

A t3g52180 SEX4

A t2g34070 ---

A t3g27160 GHS1

A t3g13750 B GA L1

A t3g19030 ---

A t3g29590 A T5M A T

A t3g21055 P SB TN

A t3g27210 ---

A t3g23700 ---

A t3g23510 ---

A t3g13120 ---

A t3g16530 ---

A t3g14930 HEM E1

A t3g22060 ---

A t3g23050 IA A 7

A t3g23080 ---

A t3g19850 ---

A t3g27570 ---

A t3g16240 DELTA -TIP

A t3g25920 RP L15

A t3g26060 A TP RX Q

A t3g21560 UGT84A 2

A t3g14020 NF-YA 6

A t3g27690 LHCB 2.3

A t3g15650 ---

A t3g22840 ELIP 1

A t3g16150 ---

A t3g17510 CIP K1

A t3g14310 A TP M E3

A t3g15520 ---

A t3g22370 A OX1A

A t3g02380 COL2

A t3g06500 ---

A t3g02910 ---

A t3g08030 ---

A t3g10720 ---

A t4g35300 TM T2

A t4g34980 SLP 2

A t4g34590 GB F6

A t4g34760 ---

A t4g34230 A TCA D5

1.23

1.29

1.76

-1.24

1.33

1.44

1.53

0.21 3.0E-19 5.1E-23 4.2E-02

0.24 3.8E-20 3.3E-24 2.7E-02

1.76

0 5.7E-15 5.5E-15 9.9E-01

-1.6

-0.35 5.3E-05 4.6E-07 2.3E-01

1.35

0.02

1.6E-10 1.0E-10 9.2E-01

A t4g33666 ---

A t4g33960 ---

-2.5

A t4g32940 GA M M A -VP E 2.44

-2.46

-1.24

-1.77

-0.53

7.0E-16 6.3E-24 4.3E-05

2.38

0.05

1.8E-17 4.5E-17 8.3E-01

-0.06 7.9E-23 3.1E-22 7.4E-01

A t4g33040 ---

A t4g32340 ---

A t4g31870 A TGP X7

2.43

-1.33

1.07

2.28

-1.37

1.24

-0.15

-0.04 6.5E-06 3.8E-06

0.16

2.3E-31 1.3E-29

1.5E-09

2.6E-01

8.9E-01

1.5E-11 3.0E-01

A t4g31290 ---

A t4g30950 FA D6

A t4g27900 ---

A t4g27450 ---

A t4g27520 ---

A t4g26850 VTC2

A t4g25830 ---

A t4g25050 A CP 4

A t4g25080 CHLM

A t4g24780 ---

A t4g24120 YSL1

A t4g23880 ---

-1.87

-1.01

1.3

-1.17

1.33

1.46

-1.41

0.46

6.4E-10 1.0E-06 8.8E-02

-1.1 -0.08

1.4

-2.62

-2.27

-1.55

-1.46

1.3

1.03

0.08

-0.43

2.4E-11

0.1 9.2E-10

1.3E-12

9.2E-11

0.35

3.5E-19 3.7E-16

1.3E-04 2.6E-04

-0.03 3.8E-09 7.2E-09

5.2E-01

6.1E-01

1.2E-01

-1.26

-1.27

-0.01 7.1E-04 6.6E-04 9.8E-01

1.39

1.03

-0.36

5.3E-11 2.5E-07 5.5E-02

-1.7

-0.53

6.6E-13 2.4E-20 2.2E-04

-1.35

-1.42

-0.06 2.5E-07 8.5E-08 8.0E-01

-1.43

-1.39

0.04

3.1E-08 7.1E-08 8.5E-01

8.3E-01

8.8E-01

1.9E-11 4.1E-07 2.4E-02

A t4g23990 CSLG3

A t4g23820 ---

A t4g23400 P IP 1;5

A t4g22870 ---

A t4g21280 P SB QA

A t4g20870 FA H2

A t4g18930 ---

A t4g18480 CHLI1

A t4g18360 ---

A t4g12420 SKU5

A t4g12280 ---

A t4g11600 A TGP X6

A t4g09820 TT8

A t4g09020 ISA 3

A t4g09010 A P X4

A t4g05590 ---

A t4g05070 ---

A t4g04955 A TA LN

A t4g04020 ---

A t4g03110 ---

A t4g01480 A tP P a5

A t4g01610 ---

A t4g01080 ---

A t4g01310 ---

A t4g00360 CYP 86A 2

1.72

-2.13

3.11

-1.26

1.48

-1.25

2.06

1.29

1.59

1.39

-1.81

-1.34

-1.36

-0.02 4.8E-05 3.8E-05 9.5E-01

3.6

-1.5

-0.25

2.1E-06 3.3E-08 3.2E-01

-1.08

-1.05

1.54

-1.1

1.09

1.13

-1.82

-1.54

2.3

1.11

1.64

-0.33

0.32

0.49

2.5E-17 1.6E-20 9.5E-02

0.03 7.6E-07

0.06

0.04

1.7E-12 2.4E-09

1.3E-08 7.2E-07

1.7E-15

1.4E-06

2.8E-16

0.15 7.5E-06 6.5E-05

1.6E-26 2.0E-27

0.29 2.6E-05 3.2E-04

1.1E-01

3.4E-01

8.8E-01

6.9E-01

5.6E-01

5.8E-01

4.9E-01

0.24

6.7E-15 4.4E-17 2.6E-01

-0.18

3.9E-11 4.3E-09 2.9E-01

0.05 9.4E-08 4.6E-08 8.6E-01

1.77

2.5

0.73

1.4E-20 2.0E-29 1.6E-06

-1.41

-1.45

-0.04

2.2E-14 6.1E-15 7.7E-01

1.54

1.15

-0.38 3.3E-32 2.1E-24 5.4E-06

-1.91

-1.56

1.59

1.76

1.9

0.36

0.18

1.73

-0.17

3.5E-18

3.7E-18

5.1E-19

4.0E-14 4.0E-02

1.7E-20

5.7E-17

2.2E-01

2.9E-01

-1.37

-1.78

-0.41 1.4E-09

2.41

2.01

-0.4

1.3E-13 4.3E-02

1.6E-31 1.4E-26 2.4E-03

1.32

1.04

-0.28

1.4E-09 6.2E-07 1.6E-01

1.42

-1.29

1.6

-1.18

0.18 3.0E-03 9.0E-04

0.11

1.2E-11 2.6E-10

7.0E-01

5.0E-01

-1.08

-1.52

-0.44 6.5E-03 1.7E-04 2.5E-01

-1.36

-1.2

-1.6

-1.25

-1.4

-1.4

2.23

2.62

-1.55

-1.38

-1.65

-1.43

-4.09

-3.56

-1.63

-1.56

2.24

2.43

-1.48

-1.44

1.48

1.64

-1.27

-1.09

1.05

1.33

-1.79

-1.74

2.36

2.25

-1.68

-1.34

-1.4

-1.13

2.25

-1.44

-1.24

-1.33

-1.15

1.01

1.01

0.17

1.3E-06 1.6E-05 5.3E-01

0.35

8.0E-13 3.3E-09 6.6E-02

-0 5.9E-05 5.7E-05 9.9E-01

-1.79

-1.67

-1.34

-1.06

1.14

0.12

0.28

1.6E-05 4.7E-05

7.9E-11 7.1E-08

7.7E-01

1.2E-01

1.07

-0.08

6.2E-19 2.0E-17 4.3E-01

2.35

1.02

1.99

1.33

2.71

2.82

-0.36

2.0E-31 7.9E-27 4.7E-03

0.31 4.3E-18 2.0E-24 8.5E-04

0.11 5.7E-37 3.7E-38 3.6E-01

-1.31

-1.47

-0.16 2.3E-04 4.5E-05 6.5E-01

-1.09

-1.18

-0.08 8.0E-05 2.5E-05 7.5E-01

1.46

1.57

0.11 2.8E-09 2.7E-10 6.0E-01

-1.57

-1.09

0.48

1.4E-18 8.9E-12 7.8E-04

-1.15

-1.48

-0.33

1.9E-02 2.8E-03 5.0E-01

-2.27

-2.36

-0.09

9.4E-10 2.8E-10 7.9E-01

-1.34

-1.87

-0.53 3.6E-04 1.4E-06 1.4E-01

-1.41

-1.43

-0.03

1.1E-25 3.6E-26 7.7E-01

-1.71

-1.79

-0.08

1.8E-02 1.3E-02 9.1E-01

-1.37

-2.09

-0.73

2.7E-10 8.7E-18 2.5E-04

1.54

1.27

-0.27

2.7E-17 1.1E-13 6.4E-02

1.42

1.26

-0.16 2.2E-20 9.5E-18 1.6E-01

0.38 4.0E-45 3.3E-50 2.4E-06

0.17

0.22

0.54 4.3E-28 2.2E-24 2.9E-02

0.07 3.2E-05 6.8E-05 8.4E-01

0.19 2.7E-08 2.7E-09 6.0E-01

0.04 3.7E-05 5.8E-05 9.0E-01

0.16

1.2E-11 2.9E-13 4.1E-01

0.18

4.7E-14 1.6E-11 2.0E-01

-1.24

-1.55

-0.31 6.4E-12 6.6E-16 4.6E-02

-1.61

-1.45

0.16

1.5E-10 4.1E-09 4.6E-01

-1.22

-2.21 -0.99 2.0E-07 2.0E-16 1.3E-05

-1.51

-1.13

0.38

4.9E-16

-1.03

-1.84

-0.81 4.2E-07

-1.27

-1.2

-1.9

-1.25

4.6E-11 1.3E-02

1.9E-15 4.2E-05

0.07 5.4E-03 8.3E-03

0.66

2.9E-15 1.0E-08

8.8E-01

1.2E-03

-1.03

-1.44

-0.42 2.0E-06 3.0E-10 4.2E-02

1.25

1.09

-0.16

8.6E-17 3.7E-14 1.8E-01

-2.91

-2.8

0.11 1.0E-06 2.3E-06 8.4E-01

-1.7

-1.54

0.16

1.3E-09 2.2E-08 5.2E-01

-1.39

-1.47

-0.08 3.5E-06 1.1E-06 7.7E-01

1.66

1.28

-0.38 5.4E-09 2.8E-06 1.4E-01

0.28

7.6E-13 3.3E-17 2.8E-02

0.05

1.4E-02 1.7E-02 9.5E-01

-0.1

1.1E-44 2.8E-43 2.1E-01

2.68

2.22

2.3

2.2

-0.38 2.3E-06 3.7E-05

-0.03

8.6E-17 1.5E-16

4.7E-01

9.0E-01

-1.59

-1.68

-0.09

1.0E-16 6.5E-18 5.4E-01

0.34

0.27

1.4

-0.85

1.6E-09 6.1E-05 1.2E-02

0.2

0.18

5.8E-12

4.1E-13

1.5E-05 4.3E-04

2.9E-12 3.3E-09

1.3E-13

2.9E-10 3.8E-01

7.7E-11 2.5E-01

3.5E-01

1.2E-01

3.6E-11 2.2E-01

1.4E-03 5.3E-03

-0 3.2E-09 3.3E-09

6.6E-01

9.9E-01

-2.12

-2.02

-1.34

-1.8

0.1 2.8E-13 1.7E-12

-0.46 2.0E-05 3.6E-08

6.9E-01

1.2E-01

(Table continues on following page.)

A t3g10740 A SD1

A t3g04720 P R4

A t3g05690 NF-YA 2

A t3g05730 ---

A t3g08920 ---

A t3g01500 CA 1

A t3g01480 CYP 38

A t3g11630 ---

A t3g16370 ---

A t1g01620 P IP 1C

A t1g44000 ---

A t1g20450 ERD10

A t1g20440 COR47

A t1g27950 LTP G1

A t1g77760 NIA 1

A t1g77450 anac032

A t1g77490 TA P X

A t1g29670 ---

A t1g52190 ---

A t1g74810 B OR5

A t1g76520 ---

A t1g67910 ---

A t1g73655 ---

A t1g73700 ---

A t1g66390 M YB 90

A t1g52880 NA M

A t1g74670 ---

A t1g63940 M DA R6

A t1g73920 ---

A t1g69870 ---

A t2g41730 ---

A t2g43500 ---

A t2g43750 OA SB

A t1g43790 TED6

A t1g21500 ---

A t1g29070 ---

A t1g02640 B XL2

A t1g06000 ---

A t1g12200 ---

A t1g07320 RP L4

A t1g19630 CYP 722A 1

A t1g04800 ---

A t1g32990 P RP L11

A t1g12940 A TNRT2.5

A t1g20190 A TEXP A 11

A t1g20010 TUB 5

A t1g48600 CP uORF31

-1.54

-1.15

0.39

1.4E-26 2.0E-19 1.3E-04

-1.55 -2.46

-0.91 4.7E-03 1.4E-05 8.9E-02

2.37

2.59

0.21 4.2E-16 7.0E-18 3.6E-01

-1.83

-1.89 -0.06

1.6E-02 1.3E-02 9.4E-01

-1.43

-1.19

0.24 6.7E-08 4.3E-06 3.1E-01

-1.67

-2.14 -0.47

1.8E-02 2.8E-03 5.0E-01

-1.59

-1.35

0.24

3.9E-13 1.5E-10 1.9E-01

-1.24

-1.28 -0.04 2.5E-09 9.7E-10 8.3E-01

-1.94 -2.29 -0.35

1.2E-03 1.7E-04 5.5E-01

-2.46

-2.2

0.26

1.6E-05 9.4E-05 6.3E-01

-1.07

-1.24

-0.17

1.3E-09 8.2E-12 2.6E-01

1.9

1.18 -0.72

1.1E-10 1.6E-05 6.0E-03

1.14

1.15

0.01 7.0E-08 6.0E-08 9.7E-01

-1.67

-1.64

0.03

1.2E-09 1.9E-09 9.2E-01

-2.71 -2.47

0.24

2.0E-17 1.5E-15 3.4E-01

2.02

1.27 -0.75

3.4E-13 5.4E-07 1.7E-03

-1.18

-1.28

-0.1

1.1E-08 1.1E-09 6.0E-01

-2.23

-2.11

0.12 3.4E-04 6.5E-04 8.4E-01

-1.8

-1.89 -0.09

1.7E-02 1.2E-02 9.0E-01

1.73

2.08

0.35 6.3E-05 2.4E-06 3.9E-01

1.86

1.58 -0.27

1.3E-14 7.1E-12 1.7E-01

-1.09

-1.13 -0.04

8.4E-11 2.2E-11 7.7E-01

-1.14

-1.55

-0.41 3.7E-09 8.5E-14 2.0E-02

1.18

1.18

0 4.2E-22 3.5E-22 9.7E-01

2.89

2.89

0 3.2E-32 3.1E-32 9.9E-01

1.53

1.35

-0.19 2.7E-07 4.2E-06 5.0E-01

-3.59 -3.58

0.01 3.9E-10 4.2E-10 9.9E-01

-1.23

-1.07

0.16

1.3E-05 1.3E-04 5.4E-01

-1.58

-1.6 -0.02

6.2E-15 3.5E-15 9.0E-01

1.77

1.49 -0.28

1.2E-13 6.8E-11 1.7E-01

1.97

1.41 -0.56

1.7E-03 2.3E-02 3.6E-01

2.23

2.16 -0.07

1.2E-28 8.9E-28 5.9E-01

-1.43

-1.44

-0 3.0E-37 2.6E-37 9.6E-01

-1.2

-1.07

0.13

1.0E-03 3.1E-03 7.2E-01

-2.01

-1.81

0.2

1.5E-06 1.1E-05 6.1E-01

-1.89

-1.92 -0.03

4.9E-14 2.6E-14 8.9E-01

-2.43

-1.57

0.87

1.5E-10 9.6E-06 1.0E-02

1.33

1.09 -0.24

4.1E-09 6.6E-07 2.3E-01

1.42

1.2 -0.23

3.8E-11 8.3E-09 2.3E-01

-1.43

-1.63

-0.2

5.1E-06 3.1E-07 4.9E-01

1.14

1.02

-0.12 2.4E-26 2.3E-23 8.8E-02

-1.43

-1.26

0.17 2.5E-03 7.4E-03 7.1E-01

-1.18

-1.16

0.01 3.7E-07 4.5E-07 9.6E-01

1.68

1.67

-0.01 1.5E-07 1.7E-07 9.7E-01

-1.37

-1.92 -0.55 2.7E-05 2.1E-08 8.0E-02

-1.52

-1.11

0.41 2.0E-07 8.4E-05 1.3E-01

-1.04

-1.43 -0.38 5.3E-07 8.9E-11 4.8E-02

A t1g79700 ---

A t1g28370 ERF11

A t1g14290 SB H2

A t1g01720 A TA F1

A t1g76180 ERD14

A t1g30500 NF-YA 7

A t1g80920 J8

A t1g65930 ---

A t1g22570 ---

A t1g64510 ---

A t1g37130 NIA 2

A t1g35680 ---

A t1g80130 ---

A t1g56170 NF-YC2

A t1g77920 ---

A t1g74970 RP S9

A t1g48350 ---

A t1g68670 ---

A t1g70810 ---

A t1g73040 ---

A t1g72830 NF-YA 3

A t1g49500 ---

A t1g11210 ---

A t1g11260 STP 1

A t1g15410 ---

A t1g62710 B ETA -VP E

A t1g28600 ---

A t1g10760 SEX1

A t1g20850 XCP 2

A t1g11700 ---

A t1g14700 P A P 3

A t1g64970 G-TM T

-1.93

-1.37

0.56

1.6E-21 2.5E-14 3.1E-04

1.97

1.33 -0.64 3.0E-04 1.3E-02 2.2E-01

-1.73

-1.85

-0.12

9.7E-10 1.2E-10 6.3E-01

1.14

1.02

-0.12

9.1E-08 1.1E-06 5.4E-01

1.41

1.05 -0.36

1.3E-17 3.6E-12 6.7E-03

1.62

1.49

-0.12

2.1E-19 1.2E-17 3.6E-01

-1.63

-1.31

0.31

1.1E-22 7.6E-18 1.1E-02

-1.35

-1.54

-0.19

4.5E-21 2.8E-24 7.6E-02

1.01

1.36

0.35

1.4E-09 3.7E-14 2.1E-02

-1.5

-1.47

0.03

7.4E-10 1.3E-09 9.0E-01

-1.53

-2.17 -0.64 2.5E-07 8.3E-12 2.1E-02

-1.41 -1.26

0.15 4.7E-09 8.8E-08 4.9E-01

2.67

2.32 -0.35

1.9E-13 3.7E-11 2.5E-01

1.04

1.07

0.02

8.0E-15 3.0E-15 8.3E-01

1.97

1.75 -0.23

2.1E-17 5.4E-15 2.2E-01

-1.26

-1.04

0.22

2.1E-10 5.8E-08 2.0E-01

-1.11 -1.02

0.1 2.1E-07 1.5E-06 6.3E-01

-1.66

-1.45

0.22 6.4E-05 4.3E-04 5.9E-01

1.82

1.47 -0.35

3.2E-12 3.9E-09 1.2E-01

1.48

1.43 -0.05

6.1E-14 2.4E-13 7.6E-01

1.25

1.67

0.41 5.9E-09 4.0E-13 3.4E-02

-4.07 -4.06

0.01 4.6E-17 5.2E-17 9.8E-01

1.47

1.29

-0.18 8.9E-06 7.9E-05 5.6E-01

-2.19

-2.19

-0 2.8E-13 2.7E-13 1.0E+00

1.72

1.47 -0.25 3.0E-24 2.1E-20 3.5E-02

2.91

2.75

-0.16 8.2E-30 2.9E-28 3.3E-01

2.38

1.8 -0.58 3.6E-25 1.5E-18 4.3E-04

1.48

1.84

0.36

1.7E-16 2.7E-21 1.3E-02

-1.75

-1.04

0.71 2.4E-05 9.2E-03 7.2E-02

1.97

1.23 -0.74

2.7E-16 8.7E-09 2.3E-04

-1.09

-1.32 -0.24 5.4E-07 3.5E-09 2.4E-01

1.76

1.08 -0.68

4.1E-32 1.5E-19 8.0E-11

A t1g64900 CYP 89A 2

A t1g64780 A TA M T1;2

A t1g75750 GA SA 1

A t1g75690 ---

A t1g23870 A TTP S9

A t2g17500 ---

A t1g78630 emb1473

A t1g54160 NF-YA 5

A t2g38820 ---

A t2g05710 ---

A t2g11810 M GDC

A t2g28720 ---

A t2g22240 M IP S2

A t2g28630 KCS12

A t2g22190 ---

A t2g04780 FLA 7

1.13

1.23

2.02

1.09

1.35

1.15

1.17 -0.85

-1.49

-2.01 -0.51 1.9E-05 3.6E-08 1.2E-01

-2.07

-2.14 -0.07

1.6E-11 4.8E-12 7.9E-01

-1.34

-1.16

0.18 4.8E-26 2.5E-22 3.6E-02

2.08

1.32 -0.76

9.8E-12 2.6E-06 4.9E-03

-1.4

-1.15

0.26

5.0E-10 1.4E-07 2.0E-01

1.16

1.42

0.26

1.1E-18 2.3E-23 1.3E-02

-1.47

-1.45

0.02

7.5E-12 1.2E-11 9.2E-01

1 -0.09

1.4

1.18

0.1 6.8E-07 8.6E-08

0.04

0.03

1.4E-19 8.1E-10 2.8E-06

1.6E-10 2.2E-09

1.8E-11 5.7E-12

4.8E-16 1.7E-16

6.2E-01

5.6E-01

8.0E-01

8.2E-01

1.71

1.03 -0.69

1.1E-09 8.9E-05 7.0E-03

-1.55

-1.95

-0.4

3.4E-16 3.2E-21 9.5E-03

1.5

1.38

-0.12

1.8E-23 1.8E-21 2.7E-01

-1.82

-1.25

0.57

1.9E-05 2.5E-03 1.5E-01

A t2g40400 ---

A t2g40435 ---

A t2g36970 ---

A t2g21970

A t2g36380 P DR6

A t2g36050 OFP 15

A t2g21210 ---

A t2g03600 A TUP S1

A t1g02205 CER1

A t1g22770 GI

-1.5

-1.51 -0.01 7.7E-22 5.4E-22 9.3E-01

1.59

1.63

0.04 7.8E-09 3.6E-09 8.6E-01

1.39

1.3 -0.09

1.1E-07 5.3E-07 7.0E-01

02. Sep 2.05

1.09 -0.97

2.9E-16 5.6E-07 6.6E-06

1.3

-1.08

1.16

-1.59

1.19

1.67

-1.03

1.3

-1.07

1.53

0.37

0.05

0.52

0.34

1.7E-06 3.2E-09

1.7E-08 6.4E-08

-2.21 -2.46 -0.25 4.5E-29 4.0E-32 5.0E-02

0.13 4.9E-20

5.1E-19

5.3E-14

1.4E-22

1.4E-01

7.6E-01

1.7E-01

1.6E-11 2.3E-04

4.1E-19 9.9E-03

162

Supplemental data

Suppl. data 9

(Continued from previous page.)

A t1g54740 ---

A t1g09240 NA S3

-1.43

-1.64

-0.22

1.8E-09

1.45

1.03

1.8E-11

-0.42 6.7E-06 9.7E-04

3.1E-01

1.7E-01

A t1g09200 ---

A t1g78820 ---

A t1g78860 ---

A t1g03310 DB E1

A t1g03220 ---

A t1g12090 ELP

A t2g25080 A TGP X1

A t1g61800 GP T2

A t1g09350 A tGo lS3

A t1g10070 A TB CA T-2

A t1g55760 ---

A t2g17710 ---

A t1g04680 ---

A t1g09750 ---

A t1g22890 ---

A t1g08630 THA 1

A t2g17280 ---

A t1g67360 ---

A t1g27030 ---

A t1g03870 FLA 9

A t1g03495 ---

A t1g62510 ---

A t1g62560 FM O GS-OX3

A t1g51400 ---

A t2g36790 UGT73C6

A t2g36630 ---

A t2g18230 A tP P a2

A t2g18300 ---

A t2g20670 ---

A t2g10940 ---

A t2g16660 ---

A t2g15620 NIR1

A t2g18050 HIS1-3

A t2g18700 A TTP S11

A t2g45170 A TA TG8E

A t2g02130 LCR68

A t2g45180 ---

A t2g39050 ---

A t2g06850 EXGT-A 1

A t2g28900 A TOEP 16-1

A t2g29290 ---

A t2g29490 A TGSTU1

A t2g29420 A TGSTU7

A t2g26980 CIP K3

A t2g41250 ---

A t2g41380 ---

A t2g38540 LP 1

A t2g47700 ---

A t2g47890 ---

A t2g47880 ---

A t2g35290 ---

A t2g24090 ---

A t2g46220 ---

A t2g14890 A GP 9

A t2g25900 A TCTH

A t2g19810 ---

A t2g19860 HXK2

A t2g02930 A TGSTF3

A t2g47000 A B CB 4

A t2g29090 CYP 707A 2

A t2g28950 A TEXP A 6

A t2g29980 FA D3

A t2g34620 ---

A t2g39220 P LP 6

A t2g38140 P SRP 4

A t2g37770 ---

A t2g44130 ---

A t2g23000 scpl10

A t2g22990 SNG1

A t2g34720 NF-YA 4

A t2g34660 A TM RP 2

A t2g33800 ---

A t2g32690 GRP 23

A t2g26690 ---

A t2g42220 ---

A t2g26400 A TA RD3

A t1g28330 DYL1

A t1g73330 A TDR4

A t1g57630 ---

A t1g48920 A TNUC-L1

A t5g62920 A RR6

A t5g55450 ---

A t5g52810 ---

A t5g48540 ---

A t5g44130 FLA 13

A t5g44070 CA D1

A t5g42830 ---

A t5g24120 SIGE

A t5g23010 M A M 1

A t5g18470 ---

A t5g13320 P B S3

A t5g04590 SIR

A t3g60420 ---

A t3g56200 ---

A t3g52720 A CA 1

A t3g50480 HR4

A t3g48640 ---

A t3g48100 A RR5

A t3g47540 ---

A t4g39670 ---

A t4g37370 CYP 81D8

A t4g22530 ---

A t4g20830 ---

-1.21

-1.18

-1.78

-1.91

0.04

-0.13

1.1E-05

5.8E-14

1.9E-05

2.9E-15

8.9E-01

5.1E-01

-3.61 -3.78

-0.17 4.4E-29 2.4E-30

1.09

1.2

0.11 1.9E-28

4.1E-01

6.9E-31 9.3E-02

-2.04

-2.21

-0.17 2.4E-32

-1.42

-1.13

0.3

1.1E-34

1.0E-02 4.0E-02

1.0E-01

5.8E-01

-1.57

2.37

1.76

1.24

1.26

-1.44

-1.64

-1.84

-1.23

-2.24

1.57

-1.6

1.73

1.23

1.24

-1.18

-1.39

-1.1

0.46

1.3E-20

1.92

-0.45 3.0E-24

1.7E-13 3.8E-04

3.1E-19 7.1E-03

1.42

-0.34 7.5E-09 1.3E-06 2.2E-01

2.14

0.89

1.7E-04 1.7E-09 5.6E-03

1.39

0.13 2.5E-26 4.5E-29 9.6E-02

2.29

2.07

-0.22

1.3E-17 1.4E-15 2.9E-01

-1.36

-1.38

-0.02 4.8E-04 4.0E-04 9.6E-01

-2.18

-1.3

0.88 4.0E-06 4.0E-03 4.9E-02

-1.59

-1.68

-0.09

1.3E-20 7.7E-22 5.0E-01

1.28

1.11

1.49

1.16

0.21 4.9E-17 2.7E-20 8.9E-02

0.05 2.7E-25 2.0E-26 5.0E-01

2.81

1.58

-1.11

3.43

1.94

1.68

-1.5

-0.39 2.3E-02 2.4E-03 4.1E-01

3.59

-1.92

-1.26

1.28

1.77

-0.87 2.2E-27

0.1 1.8E-05 5.8E-06

0.15

0.67

6.4E-13

2.4E-18 2.3E-06

1.1E-13

9.0E-10 2.0E-05

0.49 3.4E-05

7.7E-01

7.0E-01

1.8E-02

4.1E-08 9.7E-02

-1.08

-1.05

1.33

1.25

0.03

-0.08

1.1E-04

1.4E-02

1.7E-04

2.1E-02

9.1E-01

8.8E-01

1.4

2.12

1.45

1.23

0.05

-0.89

2.8E-17

1.4E-15

5.5E-18 7.2E-01

1.5E-07 7.3E-05

-2.17

-2.49

-0.32

-3.73

-2.84

0.89

2.1E-11

3.3E-15

1.3E-13 2.6E-01

1.2E-10 2.3E-02

-2.04

-2.04

-0.01 2.1E-02 2.1E-02 9.9E-01

-2.13

-1.47

0.66

2.6E-11 8.2E-07 1.9E-02

-1.6

-2.12

-0.52

5.5E-11 8.2E-16 1.6E-02

2.2

2.8

0.6

4.3E-13 1.1E-17 2.1E-02

-1.57

-2.02

-0.46

1.1E-16 2.1E-22 3.0E-03

-1.06

-1.04

-1.49

-1.36

-1.21

-1.15

1.13

1.17

0.02 2.8E-07 4.7E-07

0.12

2.1E-04 6.2E-04

0.06 5.0E-05

0.04 3.6E-06

1.1E-04

1.8E-06

9.0E-01

7.5E-01

8.2E-01

8.6E-01

-3.34

-3.37

-0.03

1.9E-05 1.6E-05 9.6E-01

1.28

1.98

0.7

1.2E-18 1.5E-29 1.6E-08

-1.24

-1.55

-0.31 1.0E-08 8.6E-12

1.94

1.28

-0.66 9.8E-05 8.4E-03

1.1E-01

1.7E-01

1.57

1.04

-0.53 3.6E-06 1.5E-03 9.7E-02

-1.09

-1.48

-0.39 5.0E-24 3.2E-32 2.3E-06

-2.09

1.41

-2.2

-0.12 8.0E-36 1.9E-37 2.3E-01

1.01

-0.4

2.8E-10 1.6E-06 4.6E-02

-1.46

-1.15

-1.15

-1.08

1.05

1.5

2.1

2.52

0.31 4.5E-03 2.4E-02

0.07

1.0E-15

0.45

1.0E-09

1.7E-14

5.4E-01

5.3E-01

1.7E-15 4.1E-03

0.42 9.3E-26 1.3E-30 2.3E-03

1.47

1.42

-0.05 4.8E-05 8.2E-05 8.8E-01

-1.1

-1.06

0.04 5.4E-05 9.1E-05 8.9E-01

-0.2 7.4E-09 1.4E-10 3.7E-01

0.61 9.8E-05 7.6E-03 1.8E-01

0.65

5.6E-16 2.8E-10 4.6E-03

0.17 3.7E-07 3.2E-08 5.6E-01

0 1.2E-33 9.9E-34 9.6E-01

-0.2 9.2E-07 2.0E-08 3.6E-01

1.53

1.11

1.21 -0.32 4.2E-03 2.2E-02 5.4E-01

1.11

0 2.7E-09 2.6E-09 9.9E-01

-1.16

-1.3

-0.13 2.5E-02 1.3E-02 7.9E-01

-1.7

-1.45

0.25 5.6E-03 1.7E-02 6.8E-01

-2.16

-1.96

0.2 4.7E-07 3.7E-06 6.1E-01

1.04

1.04

-1.34

-1.02

1.43

-2.13

1.03

-1.7

-0

0.32

1.1E-16 1.1E-16 1.0E+00

3.7E-11 1.0E-07 7.4E-02

-0.39 2.4E-07

0.43

1.0E-04

1.7E-08 3.3E-06

1.2E-01

2.1E-01

1.09

1.24

-2.26

-1.84

0.16

8.4E-10

0.42 4.8E-26

9.1E-12 3.1E-01

7.1E-21 4.4E-03

1.13

1.49

-1.24

-1.67

1.07

1.04

-1.15

-1.7

-0.06

0.08

-0.03

2.7E-14

3.9E-15

2.2E-13

8.9E-11 8.4E-10

1.9E-15

6.4E-01

-0.46 6.4E-09 2.2E-05 5.0E-02

6.2E-01

8.7E-01

-1.57

-2.04

-0.47

1.5E-06 2.0E-09 1.2E-01

-1.61

-1.58

0.02 3.0E-07 4.0E-07 9.4E-01

0.32

-0.32

-2 -2.32

3.9E-01 7.6E-07 2.0E-08

1.08

1.4 5.7E-02 6.6E-09 1.2E-12

0.04

1.71

1.67

9.5E-01 7.1E-03 8.4E-03

0.65

-1.23

-1.89 2.0E-02 2.7E-05 1.6E-09

0.04

0.17

1.1

1.05

7.2E-01 3.6E-14 1.8E-13

-1.35

-1.52

3.4E-01 4.5E-11 6.2E-13

0.42

-1.06

-1.48

4.0E-01 3.9E-02 4.3E-03

0.03

-1.46

-1.49

9.1E-01 1.2E-05 8.0E-06

0.02

-1.34

-1.36

9.5E-01 1.3E-05 9.9E-06

-0.38

-1.42

-1.04

3.1E-01 2.2E-04 5.7E-03

0.4

-1.03

-1.43

1.7E-03 1.5E-12 7.9E-19

0.34

-1.09

-1.43

2.5E-01 4.7E-04 7.2E-06

0.64

-1.08

-1.73 2.5E-03 1.1E-06 1.3E-12

0.47

0.5

1.59

-1.3

1.11 4.5E-02 1.5E-09 7.4E-06

-1.8 3.8E-02 4.5E-07 4.8E-11

0.85

-1.11

-1.96 2.6E-03 1.2E-04 3.6E-10

0.03

-1.26

-1.29

8.7E-01 4.8E-11 2.2E-11

0.48

-1.22

0.13

-1.43

-1.7

-1.57

2.5E-01 4.8E-03 1.2E-04

6.9E-01 3.8E-05 8.3E-06

-0.19

-1.84

-1.66 9.2E-02 3.4E-28 2.3E-25

0.15

-1.3

-1.45

6.8E-01 6.0E-04 1.4E-04

0.32

-1.38

-0.23

-1.34

-1.7

1.3E-01 3.4E-09 3.5E-12

-1.11 5.5E-02 2.8E-18 1.7E-14

0.21

-1.18

-1.39

3.8E-01 3.6E-06 9.9E-08

0.49

-1.29

-1.78 8.3E-02 1.2E-05 8.6E-09

0.92

-1.09

-2.01 2.1E-02 6.5E-03 1.9E-06

0.34

-1.01

-1.35

2.2E-01 3.1E-04 3.1E-06

-0.21

-1.42

-1.21

5.1E-01 2.6E-05 2.8E-04

(Table continues on following page.)

A t5g08400 ---

A t4g37240 ---

A t5g27350 SFP 1

A t5g26570 A TGWD3

A t5g25190 ---

A t5g25350 EB F2

A t5g66820 ---

A t5g65870 A TP SK5

A t5g65280 GCL1

A t5g64860 DP E1

A t5g64680 ---

A t5g64240 A tM C3

A t5g63180 ---

A t5g60800 ---

A t5g60950 COB L5

A t5g59780 M YB 59

A t5g58960 GIL1

A t5g58070 TIL

A t5g57760 ---

A t5g50160 FRO8

A t5g48790 ---

A t5g47560 TDT

A t5g47550 ---

A t5g47240 atnudt8

A t5g46330 FLS2

A t5g45950 ---

A t5g43750 ---

A t5g41900 ---

A t5g39860 P RE1

A t5g37780 CA M 1

A t5g22580 ---

A t5g19250 ---

A t5g22390 ---

A t5g16380 ---

A t5g13240 ---

A t5g11420 ---

A t5g10300 M ES5

A t5g05960 ---

A t5g03120 ---

A t5g03350 ---

A t3g63140 CSP 41A

A t3g62700 A TM RP 10

A t3g61210 ---

A t3g58990 ---

A t3g57450 ---

A t3g57040 A RR9

A t3g57240 B G3

A t3g55500 A TEXP A 16

A t4g13850 GR-RB P 2

A t4g11890 ---

A t4g03450 ---

A t4g01870 ---

A t1g19250 FM O1

A t1g20823 ---

A t3g11340 ---

A t3g11010 A tRLP 34

A t3g28290 A T14A

A t3g28270 ---

A t3g13610 ---

A t3g19710 B CA T4

A t3g30775 ERD5 o rf111d ---

A t3g26210 CYP 71B 23

A t3g22740 HM T3

A t3g01290 ---

A t3g16390 NSP 1

A t1g01560 A TM P K11

A t1g19050 A RR7

A t1g35230 A GP 5

A t1g52410 TSA 1

A t1g64380 ---

A t1g75040 P R5

A t1g33960 A IG1

A t1g36370 SHM 7

A t1g55960 ---

A t1g15520 P DR12

A t1g22400 UGT85A 1

A t1g56060 ---

A t1g02820 ---

A t1g02850 B GLU11

A t1g74890 A RR15

A t1g14870 ---

A t2g47180 A tGo lS1

A t2g21660 CCR2

A t2g04450 A TNUDT6

A t2g04430 atnudt5

A t2g35980 YLS9

A t2g22500 UCP 5

A t1g10340 ---

A t1g09080 B IP 3

A t1g03850 ---

A t1g30900 ---

A t2g13810 A LD1

A t2g14610 P R1

A t2g38400 A GT3 nad9 ccb452

---

--rpl32 ycf3

---

---

A t4g15680 ---

A t4g15660 ---

A t4g14440 HCD1

A t1g73500 M KK9

A t1g30250 ---

A t1g30260 ---

-0.09

1 1.09

5.5E-01 8.8E-10 5.9E-11

0.16

-1.62

-1.78

6.6E-01 1.9E-05 3.5E-06

0.59

-1.18

-1.77 2.3E-02 1.3E-05 7.9E-10

0.22

-1.11 -1.33

6.2E-01 1.3E-02 3.3E-03

0.68

-1.04

-1.72 7.4E-02 7.5E-03 1.8E-05

0.04

-1.12

-1.16

8.4E-01 1.1E-08 4.7E-09

-0.04

-1.6

-1.56

9.0E-01 1.9E-05 2.9E-05

0.53

-1.08

-1.61 7.1E-02 3.6E-04 3.5E-07

-0.98

1.2

2.18

1.0E-01 4.7E-02 4.5E-04

0.71

1.78

1.07 7.9E-03 1.6E-09 9.9E-05

0.52

-1.45

-1.97

2.0E-01 5.9E-04 5.4E-06

0.78

2.09

1.31 6.5E-04 8.6E-15 6.4E-08

0.3

1.56

0.21

1.27

0.35

-0.44

1.15

1.26

-1 -1.35

1.59

3.0E-01 5.4E-07 3.2E-05

1.06 3.9E-02 5.6E-21 5.0E-17

2.3E-01 6.7E-04 8.4E-06

1.6E-01 4.7E-04 2.6E-06

0.05

-1.69

-1.74

8.1E-01 5.2E-12 1.8E-12

-0.76

1.3

2.06 7.9E-02 3.0E-03 6.3E-06

0.53

-1.19

-1.72

1.1E-02 8.9E-08 9.2E-13

0.46

-1.29

-1.75 3.9E-02 8.0E-08 7.6E-12

-0.09

-1.84

-1.75

7.9E-01 1.9E-07 5.7E-07

-0.94

1.36

2.29

1.5E-01 4.0E-02 6.9E-04

-0.2

-1.33

-1.14

2.8E-01 1.7E-10 2.0E-08

0.39

-2.21

-2.6

6.3E-01 6.9E-03 1.6E-03

0.3

-1.87

-2.17

4.1E-01 1.8E-06 6.0E-08

0.39

0.02

-1.4

-1.4

-1.79

-1.42

2.1E-03 2.1E-18 3.3E-24

8.7E-01 3.2E-20 1.6E-20

0.37

-1.18

-1.55

2.3E-01 2.8E-04 3.3E-06

-0.38

-1.69

-1.3

2.3E-01 1.0E-06 1.0E-04

0.11 -1.55

-1.66

5.1E-01 2.6E-14 1.3E-15

0.08

-1.14

-1.22

7.1E-01 2.1E-06 4.7E-07

0.87

2.24

1.38

1.1E-02 2.0E-09 8.3E-05

0.25

-1.32

-1.56

1.7E-01 9.9E-11 1.8E-13

0.67

-1.7 -2.37

3.6E-01 2.0E-02 1.5E-03

0.04

1.09

1.06

9.4E-01 3.3E-02 4.0E-02

0.56

1.88

1.32

1.4E-01 3.3E-06 7.0E-04

0.07 -2.23

-2.31 8.6E-01 4.3E-07 2.1E-07

-0.04

-1.13

-1.08

8.6E-01 2.0E-05 3.9E-05

0.2

-1.45

-1.65

3.5E-01 9.1E-10 1.3E-11

0.81 -1.02

-1.83

1.1E-01 4.0E-02 3.7E-04

0.42

-1.04

-1.46

9.1E-02 4.8E-05 5.2E-08

0.13

-1.18

-1.32

6.8E-01 3.4E-04 7.8E-05

-0.17

-1.35

-1.18

6.1E-01 1.1E-04 6.3E-04

0.56

-1.07

-1.63

1.3E-01 4.8E-03 3.2E-05

0.01

-1.2

-1.21 9.8E-01 1.7E-04 1.6E-04

0.97

-1.81 -2.77

1.9E-01 1.6E-02 3.1E-04

0.78

1.83

1.04

1.8E-07 5.3E-22 4.8E-11

0.44

1.04

0.59

1.6E-04 2.5E-14 9.6E-07

0.57

1.22

0.65 8.2E-07 1.7E-18 3.8E-08

-0.82

-1.12 -0.29

1.5E-03 2.7E-05 2.5E-01

-0.79

-1.06 -0.27 4.9E-04 5.6E-06 2.2E-01

-0.9

-1.51 -0.62 8.5E-04 1.0E-07 1.9E-02

-0.81

-1.1

-0.3 5.7E-03 2.1E-04 3.0E-01

-0.73

-1.19 -0.45 3.0E-03 4.0E-06 6.3E-02

0.9

1.03

0.13

1.6E-07 4.1E-09 3.9E-01

-0.91 -1.52

-0.61 1.7E-04 3.9E-09 9.4E-03

-0.38

-1.04 -0.66

1.8E-01 4.6E-04 2.4E-02

0.47

1.01

0.54

9.1E-06 4.5E-16 5.9E-07

-0.44

-1.05

-0.6

1.8E-02 1.9E-07 1.5E-03

-0.71 -1.34 -0.63 8.9E-05 1.9E-11 4.1E-04

0.81

1.25

0.44

1.2E-06 4.5E-12 5.2E-03

-0.77

-1.44 -0.67

1.4E-02 1.1E-05 3.1E-02

-0.57

-1.08

-0.51 1.2E-03 8.7E-09 3.0E-03

0.85

1.04

0.19

1.0E-16 3.8E-21 2.1E-02

0.9

1.22

0.32 4.8E-06 3.7E-09 9.0E-02

0.87

1.39

0.52 3.8E-03 8.7E-06 8.0E-02

0.46

1.12

0.66 7.7E-05 4.1E-16 5.0E-08

0.41

1.15

0.73 6.8E-06 3.6E-22 5.5E-13

-0.68

-1.12 -0.45 4.2E-06 3.5E-12 1.7E-03

-0.98

-1.44 -0.46 8.3E-02 1.2E-02 4.1E-01

-0.62

-1.43

-0.81 3.0E-04 3.0E-13 4.1E-06

-0.52

-1.02

-0.51 2.0E-02 1.1E-05 2.2E-02

0.71

1.22

0.97

1.21

0.51 2.9E-03

0.24 2.6E-03

1.1E-06 3.0E-02

2.1E-04 4.4E-01

0.93

1.27

0.34

1.0E-06 2.4E-10 5.3E-02

-0.48

-1.22 -0.74

1.0E-03 3.9E-13 1.2E-06

0.61

1.2

0.6

1.1E-05 2.3E-14 1.5E-05

-0.87

-1.12 -0.25

3.0E-12 6.8E-17 2.0E-02

-0.23

-1.02 -0.79 6.3E-02 1.7E-12 7.6E-09

-0.78

-1.08

-0.3 3.4E-03 7.6E-05 2.5E-01

0.69

1.48

0.79

3.4E-01 4.1E-02 2.7E-01

-0.59

-1.01 -0.42

2.9E-13 1.1E-24 3.5E-08

-0.81 -1.06 -0.25 6.2E-02 1.6E-02 5.7E-01

-0.63

-1.2 -0.57 6.5E-03 8.5E-07 1.3E-02

-0.72

-1.37 -0.65 9.0E-05 1.6E-11 3.6E-04

-0.97

-1.14

-0.17

6.1E-10 2.5E-12 2.2E-01

0.69

1.05

0.36 3.8E-09 5.5E-16 7.4E-04

-1.3

-2.13 -0.84 9.8E-02 7.3E-03 2.8E-01

-0.79

-1.14 -0.35

1.3E-03 6.7E-06 1.4E-01

-0.78

-1.74 -0.96

4.1E-03 4.4E-09 5.0E-04

0.63

1.04

0.4

1.1E-10 7.2E-20 9.3E-06

-0.89

-1.13 -0.24 2.3E-20 3.0E-26 1.3E-03

-0.96

-1.31 -0.34 3.6E-03 1.1E-04 2.9E-01

0.83

1.11

0.28

3.1E-04 2.7E-06 2.0E-01

-0.53

-1.41 -0.89 9.8E-02 2.3E-05 6.0E-03

-0.55

-1.36

-0.8

1.1E-01 1.5E-04 2.1E-02

-0.99

-1.85 -0.87 7.8E-02 1.2E-03 1.2E-01

-0.6

-1.05 -0.45

1.4E-04 7.4E-10 3.5E-03

0.92

1.24

0.32

3.5E-17 5.2E-24 3.9E-04

-0.97

-1.28

-0.31 2.0E-13 6.7E-19 5.6E-03

0.64

1.4

0.76 2.3E-02 2.4E-06 7.2E-03

-0.42

-1.3 -0.88

4.8E-01 2.9E-02 1.3E-01

-0.4

-1.04 -0.64

1.1E-02 1.9E-09 7.9E-05

-0.83

-1.61 -0.78

2.1E-02 1.6E-05 2.9E-02

-0.93

-1.17 -0.24

6.1E-04 2.5E-05 3.7E-01

163

Supplemental data

Suppl. data 9 (Continued from previous page.)

A t3g50210 ---

A t3g48990 ---

A t3g48420 ---

A t3g47380 ---

A t3g45160 ---

A t4g39260 GR-RB P 8

A t4g39640 GGT1

A t4g39330 CA D9

A t4g38840 ---

A t4g32870 ---

A t4g30660 ---

A t4g30650 ---

A t4g29950 ---

A t4g30110 HM A 2

A t4g29190 ---

A t4g26400 ---

A t4g24510 CER2

A t4g22950 A GL19

A t4g21910 ---

A t4g19530 ---

A t4g18970 ---

A t4g18390 ---

A t4g13770 CYP 83A 1

A t4g12080 ---

A t4g12030 ---

A t4g10380 NIP 5;1

A t4g04840 A TM SRB 6

A t4g04830 A TM SRB 5

A t4g03060 A OP 2

A t4g02530 ---

A t4g00300 ---

A t1g16720 HCF173

A t1g18590 SOT17

0.95

1.27

0.32

1.6E-09 5.0E-14 2.3E-02

-0.78

-1.02

-0.24 2.9E-07 1.8E-10 9.1E-02

-0.87

-1.12

-0.25

1.1E-07 8.1E-11 1.0E-01

-0.53

-1.08

-0.55 5.3E-05 2.8E-13 2.5E-05

-0.84

-1.04

-0.2 9.9E-02 4.3E-02 7.0E-01

0.6

1.51

0.9 3.5E-03 7.6E-11 2.3E-05

-0.87

-1.35

-0.48 4.2E-03 1.7E-05 1.1E-01

-0.94

-1.16

-0.22 4.4E-02 1.3E-02 6.3E-01

-0.98

-1.59

-0.61 3.5E-09 2.8E-17 8.1E-05

-0.31

-1.05

-0.74 2.6E-02 2.3E-11 4.3E-07

0.54

1.41

0.87 2.0E-03 1.4E-12 1.6E-06

0.8

1.49

0.7 5.9E-03 9.8E-07 1.6E-02

-0.78

-1.37

-0.58 7.7E-06 1.6E-12 5.9E-04

-0.3

-1.08

-0.78 9.7E-02 3.8E-08 3.2E-05

0.48

1.13

0.65

1.6E-05 2.4E-17 2.1E-08

-0.72

-1.03

-0.31 5.7E-13 4.4E-20 4.1E-04

-0.86

-1.11 -0.24 3.3E-03 2.2E-04 4.0E-01

0.82

1.43

0.61 2.5E-03 5.6E-07 2.3E-02

0.53

1.31

0.77

1.8E-03 1.2E-11 1.1E-05

-0.9

-1.58

-0.68 4.7E-03 2.3E-06 3.1E-02

-0.91

-1.29

-0.38 2.4E-03 3.0E-05 2.0E-01

0.81

1.08

0.28 8.2E-24 8.5E-32 4.3E-06

0.83

0.95

1.4

1.17

0.58 3.2E-06

0.23

4.2E-10

9.2E-13 7.9E-04

2.0E-13 9.3E-02

0.4

1.34

0.94

2.2E-01 8.5E-05 4.9E-03

0.94

1.55

0.6

1.7E-07 1.4E-14 4.3E-04

-0.77

-1.01 -0.24

1.1E-01 3.9E-02 6.2E-01

-0.92

-1.39

-0.46 2.3E-03 9.8E-06 1.2E-01

0.75

-0.92

1.71

0.96

1.1E-03 3.3E-11 4.7E-05

-1.3

-0.38 6.4E-05 6.6E-08 8.7E-02

-0.34

-1.02

-0.67

1.7E-01 8.7E-05 7.5E-03

-0.83

-1.12

-0.29

1.1E-11 4.5E-17 7.3E-03

0.95

1.34

0.39 6.4E-07 4.1E-11 2.8E-02

A t1g66970 SVL2

A t1g20696 HM GB 3

A t1g56300 ---

A t1g69480 ---

A t3g11170 FA D7

-0.85

-1.21 -0.36 2.8E-06 3.6E-10 3.8E-02

1 1.15

0.15

2.5E-15 3.3E-18 1.4E-01

0.56

1.5

0.95 2.7E-07 2.9E-25 7.3E-15

0.99

1.07

0.08

9.3E-15 3.6E-16 4.7E-01

-0.82

-1.15

-0.33

1.1E-03 1.0E-05 1.8E-01

A t1g66150 TM K1

A t3g22200 P OP 2

-0.81

0.72

A t3g13790 A TB FRUCT1 -0.92

-1.14

1.11

-1.4

-0.33 4.6E-03 9.8E-05

0.39 7.4E-09

-0.47

9.2E-16 6.7E-04

1.8E-02 4.8E-04

2.4E-01

2.2E-01

A t3g21870

A t3g23910

A t3g13520

A t3g15095

CYCP 2;1

---

A GP 12

A t3g23790 ---

---

A t3g26290 CYP 71B 26

A t3g20470 GRP 5

A t3g29240 ---

A t3g23570 ---

A t3g17820

A t3g16670

A t3g01550

A t1g02360

A t1g20620

A t1g29500

A t1g29660

A t1g29430 ---

A t1g68440 ---

A t1g76450 ---

A t1g73830 B EE3

A t1g51500 CER5

A t1g19440

A t1g19450

A t1g21910

A t1g63420

A t1g01120

A t1g50040

A t1g32640

A t1g15550

GLN1.3

---

A t3g06070 ---

A t3g06770 ---

A t3g07010 ---

A t3g02170 LNG2

A t3g10190 ---

A t3g03640 B GLU25

P P T2

---

CA T3

---

---

KCS4

---

---

A t1g21440 ---

A t1g53520 ---

A t1g07610 M T1C

A t1g18710 A tM YB 47

A t1g14280 P KS2

---

KCS1

---

M YC2

GA 3OX1

-0.97

-1.11

-0.14

1.2E-05 9.0E-07 5.2E-01

0.81

1.1

0.29

8.3E-14 5.9E-20 2.0E-03

-0.72

-1.17

-0.45

2.0E-01 4.1E-02 4.2E-01

0.73

1.01

0.28

1.1E-07 5.6E-12 2.7E-02

0.45

1.1

0.65

1.6E-03 8.1E-12 9.2E-06

0.58

1.09

0.51 2.4E-04 2.4E-10 1.1E-03

1

-0.94

-0.55

0.69

1.26

-1.04

-1.03

1.05

0.26

-0.1 1.9E-04 4.2E-05

-0.48 2.6E-02 6.2E-05 5.4E-02

0.37

9.9E-14

1.8E-06

2.9E-18 2.2E-02

6.7E-01

1.3E-11 7.0E-03

0.57

1.28

0.7 5.0E-03 8.5E-09 6.6E-04

-0.77

-1.64

-0.87

1.1E-01 9.5E-04 7.3E-02

-0.55

-1.08

-0.53

7.1E-02 5.8E-04 8.3E-02

-0.64

-0.72

-0.7

0.81

-0.27

-1.18

-1.11 -0.39

-1.21

1.06

-1.12

-0.54 3.2E-02

-0.51 2.4E-03 6.9E-07 2.7E-02

0.26

-0.85

9.1E-10

1.3E-04

1.8E-02 3.8E-04

4.4E-14 3.0E-02

2.1E-01 1.2E-06

7.1E-02

2.0E-01

1.4E-04

-0.44

-1.42

-0.98

1.7E-01 2.2E-05 2.5E-03

-0.57

-1.35

-0.77 3.7E-05 3.0E-16 8.7E-08

0.39

1.17

0.79 9.9E-02 2.4E-06 1.0E-03

-0.63

-1.07

-0.45 2.7E-03 9.4E-07 3.0E-02

-0.86

-1.3

-0.44 9.5E-02 1.2E-02 3.9E-01

-0.43

-0.72

-0.84

-0.56

-0.71

-1.04

-1.28

-1.08

-1.17

-0.61 2.2E-02

-0.56 7.9E-06

-0.23 8.7E-07

-0.62 8.9E-03 2.3E-07 3.9E-03

-1.1 -0.39 5.9E-06

1.9E-07

9.7E-13

1.7E-09

1.2E-03

4.1E-04

1.5E-01

7.1E-11 9.3E-03

-0.39

-1.14

-0.75 3.5E-04 1.5E-17 3.0E-10

-0.64

-1.35

-0.71 6.7E-06 4.0E-16 7.4E-07

-0.25

-1.17

-0.92

5.4E-01 6.1E-03 3.1E-02

0.31

-0.98

-0.89

0.61

-0.83

1.28

-1.04

-1.65

1.2

-1.46

0.98

2.4E-01 4.5E-06 3.4E-04

-0.06 9.5E-05 4.0E-05 8.1E-01

-0.76 4.4E-04 3.3E-09 2.5E-03

0.59 8.0E-02 8.0E-04 9.0E-02

-0.64 3.8E-03 1.2E-06 2.5E-02

0.69

1.02

0.33

1.5E-04 9.7E-08 6.3E-02

-0.62

-1.43

-0.81

2.1E-01 4.1E-03 9.7E-02

-0.26

-1.05

-0.79

1.2E-01 1.1E-08 7.7E-06

0.43

1.22

0.79

3.9E-01 1.6E-02 1.1E-01

-0.54

-1.26

-0.72 3.5E-05 3.1E-16 9.5E-08

A t1g65860 FM O GS-OX1 0.52

A t1g74950 TIFY10B 0.38

1.11

1.03

0.59 7.2E-02

0.64

2.1E-04 4.2E-02

4.3E-01 3.7E-02 1.9E-01

A t1g34760 GRF11 -0.87

-1.16

-0.28

1.3E-06 9.8E-10 9.3E-02

A t1g16410 CYP 79F2

A t1g10740 ---

A t1g03020 ---

A t1g05680 ---

A t2g42580 TTL3

A t2g24850 TA T3

A t2g17120 LYM 2

A t1g78970 LUP 1

A t1g61740 ---

A t1g09560 GLP 5

A t1g10020 ---

A t1g23030 ---

A t1g23090 A ST91

A t1g04040 ---

A t2g07698 ---

A t2g07707 ---

A t2g07718 ---

A t2g28840 ---

A t2g46650 CB 5-C

A t2g43100 ---

0.7

-0.82

-0.81

1.03

-0.88

0.78

0.68

1.42

-1.19

-1.15

1.49

-1.07

1.26

1.45

0.72 5.0E-03

-0.37

-0.34

0.46

1.2E-13

1.2E-03 8.0E-06

9.1E-02

1.1E-07 4.2E-03

3.1E-21 1.5E-04

1.6E-02

-0.19 3.8E-03 5.4E-04

0.47 2.6E-02 4.6E-04

1.6E-01

4.5E-01

5.3E-01

-0.3

-1.27

-0.97

6.2E-01 3.5E-02 1.1E-01

-0.6

-1.14

-0.54

1.5E-03 2.0E-08 4.1E-03

-0.63

-1.07

-0.44 4.6E-02 8.5E-04 1.5E-01

0.82

1.08

0.27

1.0E-16 3.6E-23 8.5E-04

-0.53

-1.21 -0.68

1.4E-02 1.7E-07 1.9E-03

-0.54

-1.11 -0.57

2.1E-02 5.9E-06 1.4E-02

-0.5

-1.13

-0.63 7.4E-02 1.1E-04 2.7E-02

-0.63

-1.05

-0.42

3.5E-11 6.2E-21 2.1E-06

-1 -1.58

-0.58 8.9E-03 5.8E-05 1.2E-01

0.68

1.57

0.88 2.5E-07 2.8E-21 2.0E-10

0.6

1.03

0.44

6.1E-07 1.7E-14 1.8E-04

0.84

1.05

0.22 4.6E-09 2.2E-12 9.1E-02

0.82

1.25

0.43

1.7E-05 8.3E-10 1.9E-02

1.7E-01

0.77 9.9E-03 2.9E-07 4.0E-03

A t2g46330 A GP 16

A t2g44920 ---

A t2g44740 CYCP 4;1

A t2g39420 ---

A t2g39470 P P L2

A t2g30860 A TGSTF9

A t2g23130 A GP 17

A t2g30520 RP T2

A t2g30770 CYP 71A 13

-0.92

-1.34

-0.42 4.4E-03 5.4E-05 1.9E-01

-1 -1.13

-0.14

3.9E-16 7.0E-19 1.6E-01

-0.89

-1.11 -0.22 4.6E-08 6.6E-11 1.4E-01

0.92

1.03

0.11 9.8E-03 3.9E-03 7.5E-01

-0.78

-1.09

-0.31

1.1E-04 1.9E-07 1.1E-01

0.69

1.26

0.57 9.6E-03 5.9E-06 3.1E-02

-0.76

-1.67

-0.91 2.6E-03 1.7E-09 3.7E-04

-0.94

-1.07

-0.13

7.2E-13 3.3E-15 2.4E-01

-0.35

-1.19

-0.84

2.9E-01 4.8E-04 1.2E-02

164

Supplemental data

Suppl. data 10 Mutation-specific regulated genes in sir1-1.

Genes were categorized and listed, when they were altered in the same manner in 7- and 10-week-old sir1-1 plants (both up- or down-regulated), but remained unchanged during sir1-1 development; (p < 0.05; 1 < 2log-fold-change > -1).

Locus Gene title Category

AT3G30775 ERD5 (EARLY RESPONSIVE TO DEHYDRATION 5); PROLINE

DEHYDROGENASE

AT2G13810 ALD1 (AGD2-LIKE DEFENSE RESPONSE PROTEIN1); CATALYTIC

AT3G22740 HMT3; HOMOCYSTEINE S-METHYLTRANSFERASE

AT3G19710 BCAT4 (BRANCHED-CHAIN AMINOTRANSFERASE4)

AT2G38400 AGT3 (ALANINE:GLYOXYLATE AMINOTRANSFERASE 3)

AT1G36370 SHM7 (SERINE HYDROXYMETHYLTRANSFERASE 7); CATALYTIC/

GLYCINE HYDROXYMETHYLTRANSFERASE

AT5G44130 FLA13 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 13

PRECURSOR)

AT1G35230 AGP5 (ARABINOGALACTAN-PROTEIN 5)

AT4G03450 ANKYRIN REPEAT FAMILY PROTEIN

AT1G10340 ANKYRIN REPEAT FAMILY PROTEIN

AT1G02820 LATE EMBRYOGENESIS ABUNDANT 3 FAMILY PROTEIN / LEA3 amino acid metabolism amino acid metabolism amino acid metabolism amino acid metabolism + secondary metabolism amino acid metabolism

C1-metabolism cell w all cell w all cell cell development

FAMILY PROTEIN

AT1G28330 DYL1 (DORMANCY-ASSOCIATED PROTEIN-LIKE 1)

AT4G22530 EMBRYO-ABUNDANT PROTEIN-RELATED development development

AT2G35980 YLS9 (YELLOW-LEAF-SPECIFIC GENE 9)

AT3G13610 OXIDOREDUCTASE, 2OG-FE(II) OXYGENASE FAMILY PROTEIN

AT5G13320 PBS3 (AVRPPHB SUSCEPTIBLE 3) development

DNA

AT1G22400 UGT85A1; UDP-GLYCOSYLTRANSFERASE/ CIS-ZEATIN O-BETA-D-

GLUCOSYLTRANSFERASE

AT5G44070 CAD1 (CADMIUM SENSITIVE 1) hormone metabolism hormone metabolism metal handling

AT2G47180 ATGOLS1 (ARABIDOPSIS THALIANA GALACTINOL SYNTHASE 1) minor CHO metabolism

AT2G04450 ATNUDT6 (ARABIDOPSIS THALIANA NUDIX HYDROLASE nucleotide metabolism

HOMOLOG 6); ADP-RIBOSE DIPHOSPHATASE nucleotide metabolism AT2G04430 ATNUDT5 (ARABIDOPSIS THALIANA NUDIX HYDROLASE

HOMOLOG 5); HYDROLASE

AT1G20823 ZINC FINGER (C3HC4-TYPE RING FINGER) FAMILY PROTEIN

AT4G11890 PROTEIN KINASE FAMILY PROTEIN

AT1G48920 ATNUC-L1; NUCLEIC ACID BINDING / NUCLEOTIDE BINDING

AT1G30900 VACUOLAR SORTING RECEPTOR, PUTATIVE protein protein protein protein

AT1G03850 GLUTAREDOXIN FAMILY PROTEIN

AT1G64380 AP2 DOMAIN-CONTAINING TRANSCRIPTION FACTOR, PUTATIVE redox

RNA

AT5G62920 ARR6 (RESPONSE REGULATOR 6); TRANSCRIPTION REGULATOR/

TWO-COMPONENT RESPONSE REGULATOR

AT3G48100 ARR5 (ARABIDOPSIS RESPONSE REGULATOR 5); TRANSCRIPTION

REGULATOR/ TWO-COMPONENT RESPONSE REGULATOR

RNA

RNA

AT1G19050 ARR7 (RESPONSE REGULATOR 7)

AT1G74890 ARR15 (RESPONSE REGULATOR 15); TRANSCRIPTION

REGULATOR

AT4G13850 GR-RBP2 (GLYCINE-RICH RNA-BINDING PROTEIN 2); ATP BINDING /

RNA BINDING / DOUBLE-STRANDED DNA BINDING / SINGLE-

STRANDED DNA BINDING

AT2G21660 CCR2 (COLD, CIRCADIAN RHYTHM, AND RNA BINDING 2); RNA

RNA

RNA

RNA

RNA

AND DNA BINDING

AT5G24120 SIGE (SIGMA FACTOR E); DNA BINDING / DNA-DIRECTED RNA

POLYMERASE/ SIGMA FACTOR/ TRANSCRIPTION FACTOR

RNA

AT5G04590 SIR; SULFITE REDUCTASE (FERREDOXIN)

AT5G42830 TRANSFERASE FAMILY PROTEIN

AT3G16390 NSP1 (NITRILE SPECIFIER PROTEIN 1)

S-assimilation secondary metabolism secondary metabolism + hormone metabolism secondary metabolism AT5G23010 MAM1 (METHYLTHIOALKYLMALATE SYNTHASE 1); 2-

ISOPROPYLMALATE SYNTHASE/ METHYLTHIOALKYLMALATE

SYNTHASE

AT5G52810 ORNITHINE CYCLODEAMINASE/MU-CRYSTALLIN FAMILY PROTEIN secondary metabolism

AT1G52410 TSA1 (TSK-ASSOCIATING PROTEIN 1)

AT1G01560 ATMPK11

AT1G09080 BIP3; ATP BINDING

AT3G50480 HR4 (HOMOLOG OF RPW8 4)

AT3G47540 CHITINASE, PUTATIVE

AT1G75040 PR5 (PATHOGENESIS-RELATED GENE 5)

AT2G14610 PR1 (PATHOGENESIS-RELATED GENE 1)

AT1G57630 DISEASE RESISTANCE PROTEIN (TIR CLASS), PUTATIVE

AT3G11010 ATRLP34 (RECEPTOR LIKE PROTEIN 34); KINASE

AT1G73330 ATDR4; PEPTIDASE INHIBITOR

AT1G33960 AIG1 (AVRRPT2-INDUCED GENE 1); GTP BINDING

(Table continues on following page.)

signalling signalling stress stress stress stress stress stress stress stress stress

1.4

-1.4

-1.7

-2.0

-2.0

-1.3

-1.4

1.1

-2.3

-1.0

-1.8

-1.8

-1.5

-1.2

1.3

-1.2

1.6

1.3

1.0

-1.8

-1.1

-1.2

-1.8

1.1

-1.6

-1.2

-1.1

-1.5

-1.1

1.1

-1.0

-1.5

-1.4

-1.1

-1.7

-1.0

1.1

-2.2

-1.4

-1.8

-1.2

-1.0

-1.1

1.6

-1.2

1.1

2.1

1.8

-1.4

-1.1

-1.1

-1.6

1.1

-1.1

-1.4

-1.3

-1.3

-1.3

-1.3

-1.3

1.0

-1.7

-1.6

1.1

1.9

-1.1

-1.3

-1.1

1.3

1.6

1.3

-1.7

-1.3

-1.4

2.1

1.1

-1.5

1.4

-1.2

-1.2

-1.3

-1.2

-2.2

-1.8

-1.2

-1.1

1.7

-1.9

-1.5

2.3

-1.7

-1.3

-1.5

-1.4

-2.6

-2.8

-1.9

-1.6

1.7

-2.2

165

Supplemental data

Suppl. data 10

(Continued from previous page.)

AT3G52720 ACA1 (ALPHA CARBONIC ANHYDRASE 1)

AT1G15520 PDR12 (PLEIOTROPIC DRUG RESISTANCE 12); ATPASE

AT3G56200 AMINO ACID TRANSPORTER FAMILY PROTEIN

AT2G22500 UCP5 (UNCOUPLING PROTEIN 5); BINDING

TCA / org. transformation transport transport transport

AT4G37370 CYP81D8; ELECTRON CARRIER/ HEME BINDING / IRON ION BINDING / misc

MONOOXYGENASE/ OXYGEN BINDING

AT3G26210 CYP71B23; ELECTRON CARRIER/ HEME BINDING / IRON ION BINDING misc

AT1G02850 BGLU11 (BETA GLUCOSIDASE 11); CATALYTIC

AT5G18470 CURCULIN-LIKE (MANNOSE-BINDING) LECTIN FAMILY PROTEIN

AT4G20830 FAD-BINDING DOMAIN-CONTAINING PROTEIN

AT1G19250 FMO1 (FLAVIN-DEPENDENT MONOOXYGENASE 1); FAD BINDING /

NADP OR NADPH BINDING

AT5G55450 PROTEASE INHIBITOR/SEED STORAGE/LIPID TRANSFER PROTEIN

(LTP) FAMILY PROTEIN

AT3G11340 UDP-GLUCORONOSYL/UDP-GLUCOSYL TRANSFERASE FAMILY

PROTEIN

AT1G55960 ---

AT2G26400 ATARD3 (ACIREDUCTONE DIOXYGENASE 3)

AT5G48540 33 KDA SECRETORY PROTEIN-RELATED

AT3G60420 ---

AT3G48640 ---

AT4G39670 GLYCOLIPID BINDING / GLYCOLIPID TRANSPORTER

AT4G01870 TOLB PROTEIN-RELATED

AT3G28290 AT14A

AT3G28270 ---

ORF111D ORF111D

AT3G01290 BAND 7 FAMILY PROTEIN

AT1G56060 ---

AT1G14870 --misc misc misc misc misc misc not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned

-1.5

-1.6

-1.8

-1.3

2.2

1.1

1.1

-1.7

-1.4

-2.3

-1.4

-1.7

-1.7

-1.7

-2.4

-1.3

1.4

-1.8

-1.2

-1.7

-1.7

-1.6

-1.6

-1.8

-2.0

-1.0

2.2

-1.3

-1.4

-1.0

-1.8

-1.2

-1.4

-1.0

-1.1

-1.1

-1.6

-1.3

-1.1

1.2

1.8

1.3

-1.7

-1.6

-1.7

-1.4

-2.0

-1.3

-1.2

-1.4

Suppl. data 11 Constantly altered genes in all three groups.

Interfacing genes were categorized and listed, when they were altered in 7- and 10week-old sir1-1 and 7-week-old wild-type plants; (p < 0.05; 1 < 2log-fold-change > -1).

Locus Gene title

AT5G06870 PGIP2 (POLYGALACTURONASE INHIBITING PROTEIN 2)

AT2G17840 ERD7 (EARLY-RESPONSIVE TO DEHYDRATION 7)

AT4G35770 SEN1 (SENESCENCE 1)

AT5G14920 GIBBERELLIN-REGULATED FAMILY PROTEIN

AT3G47340 ASN1 (GLUTAMINE-DEPENDENT ASPARAGINE SYNTHASE 1)

AT3G48360 BT2 (BTB AND TAZ DOMAIN PROTEIN 2)

AT1G23390 KELCH REPEAT-CONTAINING F-BOX FAMILY PROTEIN

AT1G09070 SRC2 (SOYBEAN GENE REGULATED BY COLD-2)

AT5G22920 ZINC FINGER (C3HC4-TYPE RING FINGER) FAMILY PROTEIN

AT2G21650 MEE3 (MATERNAL EFFECT EMBRYO ARREST 3)

AT1G52040 MBP2 (MYROSINASE-BINDING PROTEIN 2)

AT1G66760 MATE EFFLUX FAMILY PROTEIN

AT3G22600 PROTEASE INHIBITOR/SEED STORAGE/LIPID TRANSFER PROTEIN

(LTP) FAMILY PROTEIN

AT1G64360 ---

AT1G76960 ---

AT2G05540 ---

AT2G18690 ---

AT3G07350 ---

AT3G15450 ---

AT3G15630 ---

AT5G52760 HEAVY-METAL-ASSOCIATED DOMAIN-CONTAINING PROTEIN

Category

cell w all development development hormone metabolism protein protein protein protein protein

RNA secondary metabolism transport misc not assigned not assigned not assigned not assigned not assigned not assigned not assigned not assigned

-1.1

1.3

-2.2

-1.2

-1.4

-1.1

-1.1

1.3

-1.6

1.6

1.3

-1.1

-1.7

1.2

1.3

-2.0

-1.1

-1.5

-2.3

-1.3

-1.2

-2.4

2.3

-3.5

-2.4

-3.5

-3.0

-2.3

2.4

-2.7

3.0

-1.1

-2.4

1.3

2.8

2.4

-3.0

1.1

-2.7

-3.9

-2.4

1.1

1.3

-1.1

1.3

1.2

2.2

1.9

1.2

-1.1

1.1

-1.4

2.4

1.4

-2.9

-1.7

-1.1

1.0

-2.1

1.2

1.6

1.0

-2.3

166

Supplemental data

Suppl. data 12 GSEA results for gene set

‘nucleobase, nucleoside and nucleic acid metabolic process

’.

Genes from the significantly affected gene set ‘nucleobase, nucleoside and nucleic acid metabolic process’ between sir1-1 (7-week-old) vs. wild-type and sir1-1 (10-week-old) were listed. Redundant genes were highlighted in italic.

Locus Gene Description

Nucleobase, nucleoside, nucleotide and nucleic acid m etabolic process

sir1-1 (7W) vs WT

AT1G77470 RFC3 replication factor C subunit 3 116 1.045

AT3G57610 ADSS

AT2G01170 BAT1

AT2G34710 PHB

AT5G61770 PPAN

AT3G48190 ATM

AT2G31970 RAD50

AT1G73960 TAF2

AT2G29680 CDC6 adenylosuccinate synthetase bidirectional amino acid transporter 1 homeobox-leucine zipper protein ATHB-14

Peter Pan-like protein serine/threonine-protein kinase

DNA repair protein RAD50

TBP-associated factor 2 cell division control 6

797

1010

1166

1477

1519

1765

2225

2332

0.526

0.462

0.430

0.378

0.371

0.339

0.290

0.279

AT5G44740 POLH

AT5G42540 XRN2

AT4G02460 PMS1

AT5G44750 REV1

AT4G09140 MLH1

AT1G54390 ING2

AT3G18524 MSH2

AT2G42120 POLD2

AT5G62810 PEX14

AT2G45640 SAP18

AT2G34520 RPS14

AT3G22880 DMC1

AT1G20693 HMGB2

AT1G09815 POLD4

AT3G51880 HMGB1

AT2G24490 RPA2

AT2G36010 E2F3

DNA polymerase eta subunit

5'-3' exoribonuclease 2

DNA mismatch repair protein PMS2

DNA repair protein REV1

DNA mismatch repair protein MLH1

PHD finger protein-like protein

DNA mismatch repair protein Msh2

DNA polymerase delta subunit 2 peroxin 14 histone deacetylase complex subunit SAP18 small subunit ribosomal protein S14 meiotic recombination protein DMC1-like protein high mobility group B2 protein

DNA polymerase delta subunit 4 high mobility group protein B1 replicon protein A2

E2F transcription factor 3

3676

3977

4760

4764

5101

5297

5494

5514

2571

2594

2818

2900

2974

3275

3339

3552

3642

0.189

0.174

0.140

0.140

0.126

0.119

0.112

0.111

0.259

0.257

0.242

0.236

0.231

0.213

0.209

0.196

0.191

0.450

0.467

0.476

0.491

0.507

0.510

0.487

0.500

0.497

0.499

0.501

0.510

0.096

0.178

0.213

0.248

0.270

0.304

0.326

0.332

0.354

0.368

0.392

0.405

0.424

0.443

sir1-1 (10W) vs WT

AT1G20693 HMGB2 high mobility group B2 protein

AT5G58760 DDB2

AT2G01170 BAT1

DNA damage-binding protein 2 bidirectional amino acid transporter 1

AT5G44750 REV1

AT5G62810 PEX14

AT3G51880 HMGB1

AT2G42120 POLD4

DNA repair protein REV1 peroxin 14 high mobility group protein B1

DNA polymerase delta subunit 2

AT1G08600 ATRX

AT1G73960 TAF2

AT2G31970 RAD50

AT4G26840 SUMO1

AT5G61770 PPAN

AT3G48190 ATM

AT1G77470 RFC3

AT1G54390 ING2

AT5G44740 POLH

AT4G09140 MLH1

AT3G05210 ERCC1

AT4G02460 PMS1

DEAD-like helicase domain-containing protein

TBP-associated factor 2

DNA repair protein RAD50 small ubiquitin-related modifier 1

Peter Pan-like protein serine/threonine-protein kinase replication factor C subunit 3

PHD finger protein-like protein

DNA polymerase eta subunit

DNA mismatch repair protein MLH1

DNA excision repair protein ERCC-1

DNA mismatch repair protein PMS2

86

675

839

1108

1455

1510

1531

1868

1898

2161

2229

2277

2590

3019

3126

3318

3638

3720

3895

0.318

0.347

0.364

0.388

0.414

0.424

0.451

0.467

0.478

0.116

0.142

0.182

0.213

0.233

0.267

0.302

0.481

0.496

0.505

0.400

0.396

0.363

0.356

0.350

0.320

0.281

0.273

0.257

1.521

0.685

0.615

0.544

0.471

0.460

0.457

0.233

0.228

0.218

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

167

Supplemental data

Suppl. data 13 GSEA results for gene set

‘DNA metabolic process’.

Genes from the significantly affected gene set ‘DNA metabolic process’ between sir1-1

(7-week-old) vs. wild-type and sir1-1 (10-week-old) were listed. Redundant genes were highlighted in italic.

Locus Gene Description

DNA m etabolic process

sir1-1 (7W) vs WT

AT1G77470 RFC3

AT3G48190 ATM

AT2G31970 RAD50

AT2G29680 CDC6 replication factor C subunit 3 serine/threonine-protein kinase

DNA repair protein RAD50 cell division control 6

AT5G44740 POLH

AT5G42540 XRN2

AT4G02460 PMS1

AT5G44750 REV1

AT4G09140 MLH1

AT3G18524 MSH2

AT2G42120 POLD2

AT3G22880 DMC1

AT1G20693 HMGB2

DNA polymerase eta subunit

5'-3' exoribonuclease 2

DNA mismatch repair protein PMS2

DNA repair protein REV1

DNA mismatch repair protein MLH1

DNA mismatch repair protein Msh2

DNA polymerase delta subunit 2 meiotic recombination protein DMC1-like protein high mobility group B2 protein

AT1G09815 POLD4

AT3G51880 HMGB1

AT2G24490 RPA2

AT1G08600 ATRX

AT3G20475 MSH5

DNA polymerase delta subunit 4 high mobility group protein B1 replicon protein A2

DEAD-like helicase domain-containing protein

DNA mismatch repair protein MSH5

sir1-1 (10W) vs WT

AT1G20693 HMGB2

AT5G58760 DDB2

AT5G44750 REV1

AT3G51880 HMGB1 high mobility group B2 protein

DNA damage-binding protein 2

DNA repair protein REV1 high mobility group protein B1

AT1G09815 POLD4

AT1G08600 ATRX

AT2G31970 RAD50

AT4G26840 SUMO1

AT3G48190 ATM

AT1G77470 RFC3

AT5G44740 POLH

AT4G09140 MLH1

AT3G05210 ERCC1

AT4G02460 PMS1

DNA polymerase delta subunit 4

DEAD-like helicase domain-containing protein

DNA repair protein RAD50 small ubiquitin-related modifier 1 serine/threonine-protein kinase replication factor C subunit 3

DNA polymerase eta subunit

DNA mismatch repair protein MLH1

DNA excision repair protein ERCC-1

DNA mismatch repair protein PMS2

2974

3339

3552

4760

4764

5101

5297

5494

5728

6089

116

1519

1765

2332

2571

2594

2818

2900

0.521

0.546

0.576

0.547

0.576

0.585

0.600

0.614

0.624

0.625

0.207

0.216

0.273

0.303

0.344

0.395

0.434

0.478

0.231

0.209

0.196

0.140

0.140

0.126

0.119

0.112

0.104

0.091

1.045

0.371

0.339

0.279

0.259

0.257

0.242

0.236

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

2590

3019

3318

3638

3720

3895

86

675

1108

1510

1531

1868

2161

2229

0.320

0.281

0.257

0.233

0.228

0.218

1.521

0.685

0.544

0.460

0.457

0.400

0.363

0.356

0.552

0.569

0.589

0.604

0.631

0.651

0.197

0.259

0.311

0.353

0.412

0.449

0.483

0.527

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

168

Supplemental data

Suppl. data 14 GSEA results for gene set

‘DNA repair’.

Genes from the significantly affected gene set ‘DNA repair’ between sir1-1 (7-week-old) vs. wild-type and sir1-1 (10-week-old) were listed. Redundant genes were highlighted in italic.

Locus Gene Description

DNA repair

sir1-1 (7W) vs WT

AT1G77470 RFC3 replication factor C subunit 3

AT3G48190 ATM

AT2G31970 RAD50

AT5G44740 POLH

AT4G02460 PMS1

AT5G44750 REV1

AT4G09140 MLH1

AT3G18524 MSH2 serine/threonine-protein kinase

DNA repair protein RAD50

DNA polymerase eta subunit

DNA mismatch repair protein PMS2

DNA repair protein REV1

DNA mismatch repair protein MLH1

DNA mismatch repair protein Msh2

sir1-1 (10W) vs WT

AT1G20693 HMGB2 high mobility group B2 protein

AT5G58760 DDB2

AT5G44750 REV1

DNA damage-binding protein 2

DNA repair protein REV1

AT3G51880 HMGB1

AT1G08600 ATRX

AT2G31970 RAD50

AT4G26840 SUMO1 high mobility group protein B1

DEAD-like helicase domain-containing protein

DNA repair protein RAD50 small ubiquitin-related modifier 1

AT3G48190 ATM

AT1G77470 RFC3

AT5G44740 POLH

AT4G09140 MLH1

AT3G05210 ERCC1

AT4G02460 PMS1 serine/threonine-protein kinase replication factor C subunit 3

DNA polymerase eta subunit

DNA mismatch repair protein MLH1

DNA excision repair protein ERCC-1

DNA mismatch repair protein PMS2

116

1519

1765

2571

2818

2900

2974

3339

1.045

0.371

0.339

0.259

0.242

0.236

0.231

0.209

0.269

0.301

0.378

0.408

0.460

0.519

0.576

0.613

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

2590

3019

3318

3638

3720

3895

86

675

1108

1510

1868

2161

2229

0.320

0.281

0.257

0.233

0.228

0.218

1.521

0.685

0.544

0.460

0.400

0.363

0.356

0.625

0.650

0.678

0.700

0.733

0.760

0.240

0.323

0.390

0.445

0.492

0.537

0.591

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

169

Supplemental data

Suppl. data 15 GSEA results for gene set

‘response to endogenous stimulus’.

Ge nes from the significantly affected gene set ‘response to endogenous stimulus’ between sir1-1 (7 week-old) vs. wild-type and sir1-1 (10-week-old) were listed.

Redundant genes were highlighted in italic.

Locus Gene Description

Response to endogenous stim ulus

sir1-1 (7W) vs WT

AT1G77470 RFC3 replication factor C subunit 3

AT3G48190 ATM

AT2G31970 RAD50

AT5G44740 POLH

AT4G02460 PMS1

AT5G44750 REV1

AT4G09140 MLH1

AT3G18524 MSH2 serine/threonine-protein kinase

DNA repair protein RAD50

DNA polymerase eta subunit

DNA mismatch repair protein PMS2

DNA repair protein REV1

DNA mismatch repair protein MLH1

DNA mismatch repair protein Msh2

sir1-1 (10W) vs WT

AT1G20693 HMGB2 high mobility group B2 protein

AT5G58760 DDB2

AT5G44750 REV1

DNA damage-binding protein 2

DNA repair protein REV1

AT3G51880 HMGB1

AT1G08600 ATRX

AT2G31970 RAD50

AT4G26840 SUMO1 high mobility group protein B1

DEAD-like helicase domain-containing protein

DNA repair protein RAD50 small ubiquitin-related modifier 1

AT3G48190 ATM

AT1G77470 RFC3

AT5G44740 POLH

AT4G09140 MLH1

AT3G05210 ERCC1

AT4G02460 PMS1 serine/threonine-protein kinase replication factor C subunit 3

DNA polymerase eta subunit

DNA mismatch repair protein MLH1

DNA excision repair protein ERCC-1

DNA mismatch repair protein PMS2

116

1519

1765

2571

2818

2900

2974

3339

1.045

0.371

0.339

0.259

0.242

0.236

0.231

0.209

0.269

0.301

0.378

0.408

0.460

0.519

0.576

0.613

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

2590

3019

3318

3638

3720

3895

86

675

1108

1510

1868

2161

2229

0.320

0.281

0.257

0.233

0.228

0.218

1.521

0.685

0.544

0.460

0.400

0.363

0.356

0.625

0.650

0.678

0.700

0.733

0.760

0.240

0.323

0.390

0.445

0.492

0.537

0.591

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

170

Supplemental data

Suppl. data 16

GSEA results for gene set response to ‘DNA damage stimulus’.

Ge nes from the significantly affected gene set ‘response to DNA damage stimulus’ between sir1-1 (7 week-old) vs. wild-type and sir1-1 (10-week-old) were listed.

Redundant genes were highlighted in italic.

Locus Gene Description

Response to DNA dam age stim ulus

sir1-1 (7W) vs WT

AT1G77470 RFC3 replication factor C subunit 3

AT3G48190 ATM

AT2G31970 RAD50

AT5G44740 POLH

AT4G02460 PMS1

AT5G44750 REV1

AT4G09140 MLH1

AT3G18524 MSH2 serine/threonine-protein kinase

DNA repair protein RAD50

DNA polymerase eta subunit

DNA mismatch repair protein PMS2

DNA repair protein REV1

DNA mismatch repair protein MLH1

DNA mismatch repair protein Msh2

sir1-1 (10W) vs WT

AT1G20693 HMGB2 high mobility group B2 protein

AT5G58760 DDB2

AT5G44750 REV1

DNA damage-binding protein 2

DNA repair protein REV1

AT3G51880 HMGB1

AT1G08600 ATRX

AT2G31970 RAD50

AT4G26840 SUMO1 high mobility group protein B1

DEAD-like helicase domain-containing protein

DNA repair protein RAD50 small ubiquitin-related modifier 1

AT3G48190 ATM

AT1G77470 RFC3

AT5G44740 POLH

AT4G09140 MLH1

AT3G05210 ERCC1

AT4G02460 PMS1 serine/threonine-protein kinase replication factor C subunit 3

DNA polymerase eta subunit

DNA mismatch repair protein MLH1

DNA excision repair protein ERCC-1

DNA mismatch repair protein PMS2

116

1519

1765

2571

2818

2900

2974

3339

1.045

0.371

0.339

0.259

0.242

0.236

0.231

0.209

0.269

0.301

0.378

0.408

0.460

0.519

0.576

0.613

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

2590

3019

3318

3638

3720

3895

86

675

1108

1510

1868

2161

2229

0.320

0.281

0.257

0.233

0.228

0.218

1.521

0.685

0.544

0.460

0.400

0.363

0.356

0.625

0.650

0.678

0.700

0.733

0.760

0.240

0.323

0.390

0.445

0.492

0.537

0.591

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

171

Supplemental data

Suppl. data 17 Detailed information about LC-MS/MS protein identification.

This table includes detailed information about protein digestion, mass spectrometry, data acquisition, MASCOT search parameters, peptide sequences and scores.

D at ab ank

NCBInr 20100104 (10274250 sequences; 3505793397 residues) t axonomy: Arabidopsis t haliana (t hale cress) (62387 sequences)

sear ch p ar amet er s

Type of search : M S/ M S Ion Search

Enzyme : Trypsin

Variable modif icat ions : Carbamidomet hyl (C),Oxidat ion (M )

M ass values : M onoisot opic

Prot ein M ass : Unrest rict ed

Pept ide M ass Tolerance : ± 0.1 Da

Fragment M ass Tolerance: ± 0.2 Da

M ax M issed Cleavages : 2

Inst rument t ype : ESI-QUAD-TOF

val i d at i o n:

signif icant score > 35 (f or prot eins) at least t wo dif f erent pept ides if a single pept ide score > 50 and at least 5 consecut ive y or b ions

sp o t s p r o t e i n a c c e ssi o n p r o t e i n d e sc r i p t i o n

2 2

gi|15238686 AT5G17920 ATMS1; 5met hylt et rahydropt eroylt riglut amat ehomocyst eine S-met hylt ransf erase/ copper ion binding / met hionine synt hase mascot -22

2 4

mascot -24

2 9

gi|15235321 AT4G28520 CRU3 (CRUCIFERIN 3); nut rient reservoir

[ Arabidopsis t haliana] gi|62319667 AT5G44120 legumin-like prot ein [ Arabidopsis t haliana] gi|166676 12S st orage prot ein CRA1 [ Arabidopsis t haliana] gi|13430632 AT3G24170 put at ive glut at hione reduct ase [ Arabidopsis t haliana] mascot -29

3 1

gi|14916970 RecName: Full=ATP synt hase subunit alpha, mit ochondrial

% c o v e r a g e

3

2

10

4

2

16

sc o r e

> 3 5

59

M W P i

84304 6.09

m / z m a ss

( e x p ) se q u e n c e

437.7249 873.4352 R.VTNEGVQK.A

139

50

49

35

212

58199

13066

52592

53807

6.53

9.8

7.68

6.36

1070.6124 2139.2102 K.ALGVDTVPVLVGPVSYLLLSK.A

668.9776 1335.9406 K.ISYVVQGTGISGR.V

672.4567 1342.8988 K.TNANAQINTLAGR.T

596.8552 1191.6958 R.CTDNLDDPSR.A + Carbamidomet hyl (C)

672.4567 1342.8988 K.TNANAQINTLAGR.T

549.3806 1096.7466 R.VVGPNEVEVR.Q

55011 6.23

438.8233 875.6320 R.QMSLLLR.R + Oxidat ion (M)

513.8898 1025.7650 K.AVDSLVPIGR.G

522.3795 1042.7444 R.TGSIVDVPAGK.A

608.9190 1215.8234 R.VVDAMGVPIDGK.G + Oxidat ion (M)

621.9212 1241.8278 K.SVHEPMQTGLK.A + Oxidat ion (M)

625.9326 1249.8506 R.AAELTNLFESR.I

642.4627 1282.9108 K.QPQYAPLPIEK.Q

665.9969 1329.9792 K.TTIAIDTILNQK.Q

mascot -31

3 5

mascot -35

3 8

gi|166702

glyceraldehyde 3-phosphat e dehydrogenase

A subunit [ Arabidopsis t haliana]

27 321 gi|15218564 AT1G72680 cinnamyl-alcohol dehydrogenase, put at ive

[ Arabidopsis t haliana] gi|15235321 AT4G28520 CRU3 (CRUCIFERIN 3); nut rient reservoir

[ Arabidopsis t haliana] gi|166706 cyst olic glyceraldehyde-3-phosphat e dehydrogenase [ Arabidopsis t haliana] mascot -38

1

gi|15236992 AT4G27140 2S seed st orage prot ein 1 / 2S albumin st orage prot ein / NWMU1-2S albumin 1 [ Arabidopsis t haliana] mascot -01

10

mascot -10

9

gi|15238686 ATMS1; 5met hylt et rahydropt eroylt riglut amat ehomocyst eine S-met hylt ransf erase/ copper ion binding / met hionine synt hase gi|15235321 AT4G28520 CRU3 (CRUCIFERIN 3); nut rient reservoir

[ Arabidopsis t haliana] gi|18403467 AT3G22640 PAP85; nut rient reservoir [ Arabidopsis t haliana] gi|999396 mascot -09

b l c

gi|15238686 AT5G17920 heat -shock Prot ein [ Arabidopsis t haliana]

ATMS1; 5met hylt et rahydropt eroylt riglut amat ehomocyst eine S-met hylt ransf erase/ copper ion binding / met hionine synt hase gi|15235321 AT4G28520 CRU3 (CRUCIFERIN 3); nut rient reservoir

[ Arabidopsis t haliana] mascot -blc

9

2

6

18

19

5

3

2

4

3

140

57

51

56

375

186

94

50

119

63

37652 7

38646 6.67

58199 6.53

417.3119 832.6092 K.VAINGFGR.I

464.8549 927.6952 K.IIQVVSNR.N

519.4218 1036.8290 K.AVALVLPNLK.G

627.9145 1253.8144 K.TFAEEVNAAFR.D

693.0063 1383.9980 R.AAALNIVPTSTGAAK.A

729.0142 1456.0138 R.VVDLADIVANNWK.-

814.5616 1627.1086 K.DSPLDIIAINDTGGVK.Q

917.6056 1833.1966 K.GILDVCDEPLVSVDFR.C + Carbamidomet hyl (C)

519.3497 1036.6848 R.MLAGSVTGGTK.I + Oxidat ion (M)

601.4197 1200.8248 K.ISPANLNLGMR.M + Oxidat ion (M)

714.0314 1426.0482 K.IYPNIEVIPIQK.I

668.9727 1335.9308 K.ISYVVQGTGISGR.V

36963

19001

84304 6.09

526.3665 1050.7184 K.AVNEYKEAK.A

548.8864 1095.7582 K.YLFAGVVDGR.N

591.3597 1180.7048 K.GVTAFGFDLVR.G

634.4049 1266.7952 R.GNASVPAMEMTK.W + 2 Oxidat ion (M)

706.4406 1410.8666 K.GGIGVIQIDEAALR.E

729.5172 1457.0198 R.IPSSEEIADRVNK.M

904.0234 1806.0322 K.GMLTGPVTILNWSFVR.N + Oxidat ion (M)

692.4202 2074.2388 K.ALAGQKDEALFSANAAALASR.R

1070.6869 2139.3592 K.ALGVDTVPVLVGPVSYLLLSK.A

58199 6.53

1155.7069 2309.3992 K.LNLPILPTTTIGSFPQTVELR.R

770.8144 2309.4214 K.LNLPILPTTTIGSFPQTVELR.R

668.9803 1335.9460 K.ISYVVQGTGISGR.V

1030.6011 2059.1876 R.YVIEQGGLYLPTFFTSPK.I

55029 6.64

1016.0882 2030.1618 R.TFLAGEENLLSNLNPAATR.V

79986

84304

58199

6.34

5.63

4.97

6.09

6.53

417.3119

764.5178

832.6092 R.IGINGFGR.I

718.0004 1433.9862 R.AASFNIIPSSTGAAK.A

426.3240 850.6334 R.KIYQTAK.H

669.4429 1336.8712 R.LQGQHQPMQVR.K + Oxidat ion (M)

738.4383 1474.8620 R.QEEPDCVCPTLK.Q + 2 Carbamidomet hyl (C)

1527.0210 K.GIVDSEDLPLNISR.E

904.0057 1805.9968 K.GMLTGPVTILNWSFVR.N + Oxidat ion (M)

1070.6683 2139.3220 K.ALGVDTVPVLVGPVSYLLLSK.A

1030.5747 2059.1348 R.YVIEQGGLYLPTFFTSPK.I

(Table continues on following page.)

172

Supplemental data

Suppl. data 17 (continued from previous page.)

16

gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] gi|18403467 AT3G22640 PAP85; nut r ient r eser voir [ Ar abidopsis t haliana] gi|16215 cat alase [ Ar abidopsis t haliana]

12

14

4

5

224

197

89

81

58199 6.53

55029 6.64

56849 6.75

51685 6.8

668.8804 1335.7462 K.ISYVVQGTGISGR.V

927.5294 1853.0442 R.VTSVNSYTLPILEYVR.L

1030.5781 2059.1416 R.YVIEQGGLYLPTFFTSPK.I

1035.5786 2069.1426 R.ALPLEVISNGFQISPEEAR.K

814.4564 1626.8982 R.LAQITVPVNNPGNYK.D

895.5007 1788.9868 K.EVLSTSFNVPEELLGR.L

1016.0629 2030.1112 R.TFLAGEENLLSNLNPAATR.V

1036.5876 2071.1606 R.IPSGVTNFITNTNQTVPLR.L

523.2981 1044.5816 K.SLLEEDAIR.L

762.4562 1522.8978 R.LGPNYLQLPVNAPK.C

460.2548 918.4950 R.IGAPAMTSR.G + Oxidat ion ( M) gi|15236375 AT4G13930 SHM4 ( ser ine hydr oxymet hylt r ansf er ase 4) ; cat alyt ic/ glycine hydr oxymet hylt r ansf er ase/ pyr idoxal phosphat e binding [ Ar abidopsis t haliana] mascot - 16

12

gi|15219584 AT1G03890 cupin f amily pr ot ein [ Ar abidopsis t haliana] 7

759.4113 1516.8080 K.NAVFGDSSALAPGGVR.I

gi|166678 12S st or age pr ot ein CRB [ Ar abidopsis t haliana]

12

4

138

133

99

49644 5.47

420.7626 839.5106 R.AVPVDVIK.A

598.7861 1195.5576 K.ASYGVNEEEAK.R

720.4398 1438.8650 R.ISTLNSLNLPVLR.L

694.3517 1386.6888 K.TNENAQVNTLAGR.T

50612 6.77

738.7344 2213.1814 R.GLPLEVITNGYQISPEEAKR.V

808.7634 2423.2684 R.VFDQEISSGQLLVVPQGFSVMK.H + Oxidat ion ( M)

52592 7.68

1035.5640 2069.1134 R.GLPLEVITNGFQISPEEAR.R

gi|166676 12S st or age pr ot ein CRA1 [ Ar abidopsis t haliana] gi|1107497 AT5G40420 oleosin t ype2 [ Ar abidopsis t haliana] 15 80

7

3

68

58

21125

56849

9.13

6.75

505.2293 1008.4440 R.GQGQYEGDR.G

563.7734 1125.5322 R.MADAVGYAGQK.G + Oxidat ion ( M)

589.3143 1176.6140 R.TVPEQLEYAK.R

58199 6.53

1030.5453 2059.0760 R.YVIEQGGLYLPTFFTSPK.I

1035.5640 2069.1134 R.ALPLEVISNGFQISPEEAR.K

993.0142 1984.0138 R.EGNFDLVGNNFPVFFIR.D

gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] cat alase [ Ar abidopsis t haliana] gi|16215 mascot - 12

13

gi|15229231 AT3G04120 GAPC1 ( GLYCERALDEHYDE- 3- PHOSPHATE

DEHYDROGENASE C SUBUNIT 1) ; glycer aldehyde- 3- phosphat e dehydr ogenase

( phosphor ylat ing) / glycer aldehyde- 3phosphat e dehydr ogenase [ Ar abidopsis t haliana] gi|15231715 AT3G52930 f r uct ose- bisphosphat e aldolase, put at ive

[ Ar abidopsis t haliana] gi|15219721 AT1G04410 malat e dehydr ogenase, cyt osolic, put at ive

[ Ar abidopsis t haliana] gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] gi|15220051 AT1G80090 CBS domain- cont aining pr ot ein [ Ar abidopsis t haliana] mascot - 13

14

gi|15218869 AT1G65930 isocit r at e dehydr ogenase, put at ive / NADP+ isocit r at e dehydr ogenase, put at ive

[ Ar abidopsis t haliana]

26

15

9

2

3

30

284

183

76

64

36891 6.62

38516 6.05

35548 6.11

58199 6.53

400.7482 799.4818 K.VVISAPSK.D

406.2542 810.4938 K.VLPALNGK.L

417.2307 832.4468 R.IGINGFGR.I

455.7321 909.4496 K.AATYDEIK.K

464.7944 927.5742 K.KVVISAPSK.D

495.7600 989.5054 K.AIKEESEGK.L

519.7797 1037.5448 K.AATYDEIKK.A

614.3421 1226.6696 R.VVDLIVHMSKA.- + Oxidat ion ( M)

717.8760 1433.7374 R.AASFNIIPSSTGAAK.A

1086.5190 2171.0234 K.GILGYTEDDVVSTDFVGDNR.S

415.2061 828.3976 K.YYEAGAR.F

531.2592 1060.5038 R.NLNAMNQLK.T + Oxidat ion ( M)

744.9029 1487.7912 K.GILAADESTGTIGKR.L

777.0735 2328.1987 R.TVPAAVPAIVFLSGGQSEEEATR.N

1165.1191 2328.2236 R.TVPAAVPAIVFLSGGQSEEEATR.N

409.2212 816.4278 K.SQAAALEK.H

472.2766 942.5386 R.LSVPVSDVK.N

825.5084 1649.0022 K.VLVVANPANTNALILK.E

668.8698 1335.7250 K.ISYVVQGTGISGR.V

54 43757 6.87

668.3659 1334.7172 R.TLLFTAATSTPGR.E

gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] gi|166676 12S st or age pr ot ein CRA1 [ Ar abidopsis t haliana]

13

8

12

3

565

185

85

76

75

45717 6.13

58199 6.53

52592 7.68

19348 6.79

42731 5.85

471.7362 941.4578 K.LTMTFEGK.D + Oxidat ion ( M)

528.8093 1055.6040 R.ATDAVIKGPGK.L

560.2625 1118.5104 K.CATITPDEGR.V + Car bamidomet hyl ( C)

634.3323 1266.6500 R.LIDDMVAYALK.S + Oxidat ion ( M)

644.3771 1286.7396 K.LITPFVELDIK.Y

452.5674 1354.6804 K.TIEAEAAHGTVTR.H

678.3552 1354.6958 K.TIEAEAAHGTVTR.H

717.8230 1433.6314 R.AFADASMNTAYEK.K + Oxidat ion ( M)

854.8873 1707.7600 K.VANPIVEMDGDEMTR.V + 2 Oxidat ion ( M)

899.4431 1796.8716 K.GGETSTNSIASIFAWTR.G

1021.4985 2040.9824 R.DTYLNTEEFIDAVAAELK.E

621.8503 1241.6860 R.GVLQGNAMVLPK.Y + Oxidat ion ( M)

668.8660 1335.7174 K.ISYVVQGTGISGR.V

697.3374 1392.6602 K.TNENAMISTLAGR.T + Oxidat ion ( M)

927.5026 1852.9906 R.VTSVNSYTLPILEYVR.L

1035.5488 2069.0830 R.ALPLEVISNGFQISPEEAR.K

518.7484 1035.4822 R.FEGQGQSQR.F

596.7548 1191.4950 R.CTDNLDDPSR.A + Car bamidomet hyl ( C)

1035.5488 2069.0830 R.GLPLEVITNGFQISPEEAR.R

454.2408 906.4670 K.YLPNICK.I + Car bamidomet hyl ( C)

756.3920 1510.7694 R.AVSLQGQHGPFQSR.K

712.9164 1423.8182 K.VVGTQAPVQLGSLR.A

gi|15236995 AT4G27150 2S seed st or age pr ot ein 2 / 2S albumin st or age pr ot ein / NWMU2- 2S albumin 2 gi|15241945 AT5G28840 GME ( GDP- D- MANNOSE 3' ,5' - EPIMERASE) ; gi|18423187 AT5G50600

GDP- mannose 3,5- epimer ase/ NAD or NADH binding / cat alyt ic [ Ar abidopsis t haliana]

At HSD1 ( hydr oxyst er oid dehydr ogenase 1) ; binding / cat alyt ic/ oxidor educt ase

[ Ar abidopsis t haliana] gi|166678 12S st or age pr ot ein CRB [ Ar abidopsis t haliana] mascot - 14

19

gi|21537178 xylose isomer ase [ Ar abidopsis t haliana]

4

4

16

59

51

39062 5.92

458.7545 915.4944 R.IMDIPGVR.S + Oxidat ion ( M)

466.7532 931.4918 R.GACLALTAR.R + Car bamidomet hyl ( C)

50612 6.77

1029.5382 2057.0618 R.GLPLEVITNGYQISPEEAK.R

gi|15227987 AT2G36530 LOS2; copper ion binding / phosphopyr uvat e hydr at ase [ Ar abidopsis t haliana] gi|15225787 AT2G33070 NSP2 ( NITRILE SPECIFIER PROTEIN 2)

[ Ar abidopsis t haliana] gi|1550740 GDP- associat ed inhibit or [ Ar abidopsis t haliana]

11

13

4

182

133

100

37

53642 5.54

47689 5.54

51182 5.5

49813 5.49

572.3127 1142.6108 K.NLDEVIELAK.E

672.8741 1343.7336 K.ILEEGSLSELVR.K

682.8348 1363.6550 K.NGGIAPGGFNFDAK.L

745.3558 1488.6970 R.DIAPDGTTLEESNK.N

757.3527 1512.6908 R.EGYQTLLNTDMGR.E + Oxidat ion ( M)

951.4442 1900.8738 K.VSSAKQELAEMIFQSAM.- + 2 Oxidat ion ( M)

775.4531 1548.8916 K.AVGNVNNIIGPALIGK.D

942.9858 1883.9570 K.LAMQEFMILPVGAASFK.E + 2 Oxidat ion ( M)

1003.0338 2004.0530 K.VTAAVPSGASTGIYEALELR.D

482.7721 963.5296 R.SVFASAVVGK.H

507.7826 1013.5506 R.GGAGLEVVQGK.V

630.3099 1258.6052 K.LGEEEETPSIR.G

654.3708 1306.7270 K.LLTPVEQGPTPR.S

972.4933 1942.9720 R.STDVLHSLGAYISSPATPK.L

536.7748 1071.5350 K.VPATPMEALK.S + Oxidat ion ( M)

582.7845 1163.5544 K.VSGVTSEGETAK.C

mascot - 19

(Table continues on following page.)

173

Supplemental data

Suppl. data 17 (continued from previous page.)

2 6

gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] gi|166678 12S st or age pr ot ein CRB [ Ar abidopsis t haliana] gi|15232888 AT3G02360 6- phosphogluconat e dehydr ogenase f amily pr ot ein [ Ar abidopsis t haliana] gi|34222076 AT3G21380 At 3g21380 [ Ar abidopsis t haliana] mascot - 26

2 7

gi|15240946 AT5G01300 phosphat idylet hanolamine- binding f amily pr ot ein [ Ar abidopsis t haliana] mascot - 27

2 8

gi|75309952 AT1G54870 RecName: Full=Glucose and r ibit ol dehydr ogenase homolog 1

14

8

5

4

10

24

207

88

65

54

58199 6.53

50612 6.77

53544 7.02

49249

424.2994 846.5842 R.CVGVSVAR.Y + Car bamidomet hyl ( C)

621.8536 1241.6926 R.GVLQGNAMVLPK.Y + Oxidat ion ( M)

668.8712 1335.7278 K.ISYVVQGTGISGR.V

697.3439 1392.6732 K.TNENAMISTLAGR.T + Oxidat ion ( M)

927.5353 1853.0560 R.VTSVNSYTLPILEYVR.L

942.4949 1882.9752 K.IDVQLAQQLQNQQDSR.G

559.3494 558.3421 R.LSALR.G

694.3503 1386.6860 K.TNENAQVNTLAGR.T

1029.5734 2057.1322 R.GLPLEVITNGYQISPEEAK.R

508.2790 1014.5434 K.AGSPVDQTIK.T

822.4565 1642.8984 R.NAELANLLVDPEFAK.E

934.4749 1866.9352 R.GTPSATQPPGSAQPTGSAGAK.K

197 17812 5.34

897.4401 1792.8656 K.GLPEGYSGNEDQTTGIR.E

gi|15235321 AT4G28520 CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana] gi|1526422 gi|8778288

LEA pr ot ein in gr oup 5 [ Ar abidopsis t haliana]

F14D16.30 [ Ar abidopsis t haliana]

7

6

7

164

138

94

85

31368 6.11

58199 6.53

26810 5.46

38913 9.49

471.8138 941.6130 R.GLALQLAEK.G

590.8221 1179.6296 K.NFGSEVPMKR.A + Oxidat ion ( M)

602.8659 1203.7172 R.VVDEVVNAFGR.I

608.3864 1214.7582 R.VALITGGDSGIGR.A

627.3625 1252.7104 K.GNASLLDYTATK.G

792.4485 1582.8824 K.EGSSIINTTSVNAYK.G

424.2493 846.4840 R.CVGVSVAR.Y + Car bamidomet hyl ( C)

668.9099 1335.8052 K.ISYVVQGTGISGR.V

1030.6102 2059.2058 R.YVIEQGGLYLPTFFTSPK.I

780.9399 1559.8652 K.GGPAAVMQSAATTNIR.G + Oxidat ion ( M)

554.2886 1106.5626 R.AEFQEEQAR.V

835.4980 1668.9814 R.IDSGLDLQNLIPSER.I

mascot - 28

15

gi|166678 12S st or age pr ot ein CRB [ Ar abidopsis t haliana]

13 gi|15226403 AT2G28490 cupin f amily pr ot ein [ Ar abidopsis t haliana] gi|15220526 AT1G05510 unknown pr ot ein [ Ar abidopsis t haliana] gi|15235321 AT4G28520 gi|15221082 AT1G48130

CRU3 ( CRUCIFERIN 3) ; nut r ient r eser voir

[ Ar abidopsis t haliana]

ATPER1; ant ioxidant / t hior edoxin per oxidase

[ Ar abidopsis t haliana] gi|30694455 AT5G44120 CRA1 ( CRUCIFERINA) ; nut r ient r eser voir gi|15219584 AT1G03890

[ Ar abidopsis t haliana] cupin f amily pr ot ein [ Ar abidopsis t haliana]

5

21

4

16

2

5

337

178

171

67

67

50

50612 6.77

55670 5.83

27276 6.22

58199 6.53

24066 6.12

41007 6.62

487.2622 972.5098 R.CSGFAFER.F + Car bamidomet hyl ( C)

633.6906 1898.0500 K.INVETAQQLQNQQDNR.G

996.1343 1990.2540 R.FVIEPQGLFLPTFLNAGK.L

1011.6068 2021.1990 K.QNNIFNGFAPEILAQAFK.I

475.7651 949.5156 K.DKPSFDNK.Y

631.8578 1261.7010 R.YFAFCQIASR.T + Car bamidomet hyl ( C)

637.9009 1273.7872 R.VSVGDVFWIPR.Y

639.4229 1276.8312 R.LIGLEYIVTEK.L

684.4334 1366.8522 R.EVDIKPVESVPR.V

746.9013 1491.7880 R.QCLIYDGPDANAR.L + Car bamidomet hyl ( C)

817.9868 1633.9590 K.GGFLFMPGVPEAIQR.Q + Oxidat ion ( M)

668.9134 1335.8122 K.ISYVVQGTGISGR.V

697.4176 1392.8206 K.TNENAMISTLAGR.T + Oxidat ion ( M)

430.2737 858.5328 K.TADLPSKK.G

446.7398 891.4650 R.NMDEVLR.A + Oxidat ion ( M)

532.8301 1063.6456 R.ALDSLLMASK.H + Oxidat ion ( M)

621.3832 1240.7518 K.LSFLYPSTTGR.N

518.7761 1035.5376 R.FEGQGQSQR.F

40 49644 5.47

417.2452 832.4758 R.CAGVTVAR.I + Car bamidomet hyl ( C)

463.2640 924.5134 R.MFQLAGSR.T + Oxidat ion ( M)

549.8165 1097.6184 R.ENQLDQVPR.M

mascot - 15

2 1

gi|166678 AT1G03880 12S st or age pr ot ein CRB [ Ar abidopsis t haliana] mascot - 21

3 64 50612 6.77

996.1442 1990.2738 R.FVIEPQGLFLPTFLNAGK.L

174

General statement

I declare that I am the sole author of this submitted dissertation and that I did not make use of any sources or help apart from those specifically referred to. Experimental data or material collected from or produced by other persons is made easily identifiable.

I also declare that I did not apply for permission to enter the examination procedure at another institution and that the dissertation is neither presented to any other faculty, nor used in its current or any other form in another examination.

________________________ ________________________

City, Date Arman Allboje Samami

175

Acknowledgment

First of all, I would like to thank Prof. Dr. Rüdiger Hell for giving me the possibility to work in his group and for his great supervision. His great teaching raised my interest for molecular biology of plants during my studies. During my PhD he remained an inspiring source for me with his new ideas and motivating input. I would also like to thank him for his support in many matters beyond the lab and university.

My thanks are also extended to Dr. Markus Wirtz for critical reading and fast correction of my thesis and the valuable discussions. He never hesitated to share his lab skills and huge knowledge about sulfur in plants and was helpful whenever he could.

I am thankful to our cooperation partners who contributed to this thesis which would not be in this final shape without their kind support: Dr.

Karine Gallardo, Dr. Hélène Zuber, Delphine Héricher (INRA, Dijon; for seed proteome analysis); Dr. Li Li and Maria Saile (ZMF, Mannheim; for microarray analysis); Dr. Stefan Hillmer, Stephanie Gold (COS,

Heidelberg; for electron microscopy); Dr. Bettina Hause, Prof. Dr. Claus

Wasternack (IPB, Halle; for jasmonate measurement); Dr. Adriano

Nunes-Nesi (MPI, Golm; for large scale metabolite quantification); Allan

Jones (DKFZ, Heidelberg; not only for TAG measurement or language correction of my thesis, but for being a good and supportive friend during our whole study time in Heidelberg - high five!).

Many thanks also go to all the members of Hell group for creating a friendly and work promoting atmosphere. I also like to thank current and former colleague who have become friends of mine; together we had a great time also outside the lab in the real world: Eric Lister, Anna Speiser,

Dr. Florian Haas, Dr. Achim Boltz and Dr. Corinna Wolf. Thanks also go to Lili Hocke for her help during her practical course, and Michael Schulz for excellent technical assistance.

I would also like to thank my friends for their support and sharing a great time.

I am greatly thankful to my great family, specially my little sister for her positive support and kindness. My greatest thanks are extended to my father who always believed in me, encouraged me and made my education possible. I would like to thank Sara for her endless love reaching me no matter how far away we are from each other.

176

Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement