Promotion Oliver Piestert

Promotion Oliver Piestert
Inaugural - Dissertation
zur
Erlangung der Doktorwürde
der
Fakultät für Chemie und Geowissenschaften
der Ruprecht-Karls-Universität
Heidelberg
vorgelegt von
Diplom-Chemiker Oliver Piestert
aus Frankfurt am Main
Tag der mündlichen Prüfung: 24.6.2005
Studium der Konformationsdynamik von HairpinOligonukleotiden durch
Einzelmolekülfluoreszenzspektroskopie
Gutachter: Prof. Dr. Markus Sauer
Prof. Dr. Jürgen Wolfrum
Zusammenfassung
Zusammenfassung
Die Molekularbiologie ist ein stark wachsender Bereich, in dem noch vieles
unerforscht
ist.
Gerade
die
Konformation
von
Proteinen
(Enzymen)
und
Nukleinsäuren hat einen starken Einfluss auf die Reaktivität. Daher besteht ein
großer Bedarf an neuen Methoden, um die Dynamik der Konformationsänderungen
aufzuklären. Will man die empfindliche Fluoreszenzmikroskopie dazu nutzen,
benötigt man Verfahren, die eine Änderung der Konformation bzw. Bindungsbildung
wie z. B. Proteinkomplex- oder
Substratbindungen durch eine Veränderung
messbarer spektroskopischer Parameter anzeigen. Ein Effekt, der dies ermöglicht, ist
FRET – Fluoreszenz Resonanz Energie Transfer, eine neue Methode ist PET –
Photoinduzierter Elektronen Transfer.
Im Rahmen dieser Arbeit konnte gezeigt werden, dass FRET und PET zwei
komplementäre
Techniken
zur
Verfolgung
der
Konformationsdynamik
von
Biopolymeren sind. Es konnten DNA-Hairpins synthetisiert werden und deren
Konformationsdynamik zwischen geschlossener und geöffneter Form mit Hilfe der
Einzelmolekülfluoreszenzspektroskopie direkt verfolgt werden.
Cy3
+ Gegensequenz
T
G
G
Cy5
G
Cy3
G
Cy5
T
T
T
Abbildung 1: Struktur eines FRET- DNA – Hairpin in geschlossener (links) und geöffneter Form (rechts) nach Hybridisierung an
die komplementäre Gegensequenz. Erniedrigt man die Stabilität des Hairpins durch eine Verringerung der Salzkonzentration,
so beobachtet man ein stetiges Öffnen und Schließen des Hairpins.
Die in der vorliegenden Arbeit untersuchten DNA–Hairpins sind einzelsträngige
DNA–Sequenzen, die eine Komplementarität an beiden Enden der Sequenz
aufweisen. Dadurch kommt es zur intramolekularen Hybridisierung, d.h. es bildet sich
A
Zusammenfassung
eine Stamm/Schleife-Struktur. Die komplementären Basen bilden den Stamm des
Hairpins, die restlichen Basen bilden den Loop.
Die DNA–Hairpins wurden unter unterschiedlichen Bedingungen vermessen, die
dazu führen, dass die geöffnete oder geschlossene Konformation stabil ist, oder dass
es zu thermisch induzierten Fluktuationen der Konformation kommt. Unter
Hochsalzbedingungen (200 mM KCl) ist der DNA-Hairpin in der geschlossenen Form
stabilisiert, unter Niedrigsalzbedingungen kommt es zu einer Destabilisierung des
doppelsträngigen Stammes und damit verbunden zu Konformationsfluktuationen. In
Gegenwart von Gegensequenz wird der DNA-Hairpin durch Hybridisierung mit der
komplementären Sequenz dauerhaft geöffnet.
Ziel der Arbeit war die direkte Verfolgung der Konformationsdynamik einzelner DNA
– Hairpins im Laserfokus. Spezielles Interesse galt hierbei der Bestimmung der
Assoziations- und Dissoziationsraten unter Berücksichtigung des PET als neue
Methode zur Bestimmung von konformativen Änderungen. Als Standartmethode zur
Bestimmung von konformativen Änderungen wurde FRET verwendet. FRET ist eine
Dipol-Dipol–Interaktion zweier Farbstoffe. Ein Farbstoff, der Donor, wird durch eine
Lichtquelle angeregt. Durch die Interaktion wird der zweite Farbstoff, der Akzeptor,
durch den Donor angeregt, der gleichzeitig wieder in den Grundzustand zurückfällt.
Da
diese
Interaktion
unter
anderem
abstandsabhängig
(1/r6)
ist,
können
Konformationsänderungen angezeigt werden.
In
Abbildung
2
sind
deutlich
die
Unterschiede
zwischen
den
einzelnen
Konformationen eines FRET-DNA-Hairpins zu sehen. Bei diesem Hairpin wurden
sowohl der Donor-, als auch der Akzeptorfarbstoff an den beiden Enden des Hairpins
angebracht, so dass im geschlossenen Zustand eine hohe Energietransfer-Effizienz
resultiert. Im geöffneten Zustand ist der Abstand zwischen Donor und Akzeptor so
groß, dass nur noch wenig Energie vom Donor auf den Akzeptor transferiert wird.
B
Zusammenfassung
a)
b)
60
c)
200
100
175
50
Intensität (10ms)
150
80
40
125
60
30
100
75
20
40
50
10
20
25
0
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
0
0
0
1
2
3
4
5
6
7
8
9
10
11
12
0
2
4
6
8
10
12
14
16
Zeit[s]
Abbildung 2: Fluoreszenzspuren einzelner FRET-DNA-Hairpins in unterschiedlichen Konformationen auf BSA - Streptavidin Oberflächen immobilisiert: a) FRET-Hairpin geschlossen mittels Salz (200mM KCl) stabilisierter Hairpin-Stamm, b) FRETHairpin mit destabilisiertem Stamm (ohne Salz) wodurch es zum Öffnen des Hairpins nach 8,5 Sekunden kommt. Der Zustand
des Random Coil dauert 3,5 Sekunden an, danach schließt sich der Hairpin. c) FRET-Hairpin, der durch Zugabe
komplementärer DNA dauerhaft offengehalten wird und einen DNA-Doppelstrang bildet. Anregung: 532 nm, Detektion: grün von
540 nm bis 600 nm, rot von 650 nm bis 700 nm.
Unter Hochsalzbedingungen ist der Hairpin geschlossen und der Abstand zwischen
Donor und Akzeptor ist optimal für einen effektiven Energieübertrag (Abb. 2a).
Erniedrigt man die Salzkonzentration, sieht man immer wieder Wechsel in der FRETEffizienz der Fluoreszenz – teilweise erhält man hauptsächlich Akzeptorfluoreszenz,
die anzeigt, dass der Hairpin geschlossenen ist, andererseits erhält man
donordominierte Fluoreszenz, die anzeigt, dass der Hairpin geöffnet ist (Abb. 2b).
Durch Zugabe von Gegensequenz wird der Hairpin dauerhaft geöffnet (Abb. 2c).
Bestimmt man die Zeiten, in denen der DNA-Hairpin offen ist, d.h. kein FRET
zwischen dem hier verwendeten Donor Cy3 und Akzeptor Cy5 stattfindet, kann die
Kinetik des Prozesses bestimmt und dadurch die Geschwindigkeitskonstante der
Öffnung des Hairpins berechnet werden.
C
Zusammenfassung
Data: Bin1_Counts1
Model: ExpDec1
Häufigkeit
10
Chi^2
R^2
= 3.77915
= 0.78956
y0
A
t0
0
±0
20.82515
1.28465
±1.54655
±0.13464
1
0
1
2
3
4
5
6
7
8
Zeit[s]
mit niedrigem FRET
Abbildung 3: Kinetik des Schließens des Hairpins. Histogrammiert wurden die Zeiten aus den Spuren, in denen der Hairpin
geöffnet ist also einen niedrigen FRET – Anteil aufweist (390 Spuren). Das Ergebnis wurde anschließend an ein
monoexponentielles, mathematisches Model angenähert.
Für das Schließen des Hairpins konnte hierbei eine Geschwindigkeitskonstante von
k = 1,3 ± 0,13 1/s bei 22°C bestimmt werden. Die Öffnungskinetik ist wesentlich
langsamer und konnte deshalb nur indirekt bestimmt werden, da diese von der
Photozerstörung überlagert ist. Die Geschwindigkeitskonstante der Öffnung des
Hairpins wurde deshalb über die Gleichgewichtskonstante aus der Schmelzkurve des
Hairpins im Ensemble errechnet. Sie beträgt k* = 10,8 ± 2 1/s. Vergleicht man dies mit
der Proteinfaltung, so verlaufen Konformationsänderungen an DNA-Hairpins um
einige Größenordnungen langsamer, was mit der Aufgabe der DNA als
Informationsspeicher zu dienen und der dafür notwendigen größeren Starrheit
erklärbar ist.
DNA–Hairpins auf Basis des Photoinduzierten Elektronen Transfer (PET) zeigen ein
wesentlich komplexeres Verhalten (Abb. 4).
D
Zusammenfassung
Intensität (50ms)
a)
b)
c)
160
160
160
140
140
140
120
120
120
100
100
100
80
80
80
60
60
60
40
40
40
20
20
0
0
0
50
100
150
200
250
20
0
300
5
0
10 15 20 25 30 35 40 45 50 55 60 65 70
0
20
40
60
80
100
120
140
160
180
200
Zeit [s]
Abbildung 4: Fluoreszenzspuren einzelner, immobilisierter PET-Hairpins unter verschiedenen Bedingungen. a) Unter Hochsalz
(200 mM KCl) und der damit verbundenen Stabilisierung des Stammes des Hairpins. Deutlich sind verschiedene
Konformationen zu sehen, die aufgrund von geringsten Abstandsänderungen zustande kommen und unterschiedliche
Interaktionsarten wie Endcapping, Interkalation und Furchbindung repräsentieren b) Der PET-Hairpin in reinem Tris – Puffer
ohne Salz zur Destabilisierung des Hairpinstammes. Deutlich sind wesentlich mehr Intensitätslevel zu sehen. Nach 50 s steigt
die Fluoreszenzintensität stark an, was ein Öffnen des Hairpins anzeigt. c) Fluoreszenzspur einer mit zum Loop
komplementären DNA – Sequenz, was zum Öffnen des PET – Hairpins führt. Deutlich ist der Anstieg der Fluoreszenzintensität
um das 4 fache im Vergleich zum geschlossenen Hairpin (Abb. 4a) zu erkennen.
Aufgrund der wesentlich stärkeren Abstandsabhängigkeit bei PET als FRET, sieht
man
kleinste
Änderungen
der
Konformation,
wie
z.B.
Interkalation
und
Furchenbindung. Dadurch ändert sich der Betrag des Überlappungsintegrals und das
Quenchverhalten
des
Farbstoffes
ändert
sich.
Autokorrelationen
der
Fluoreszenzintensität zeigen, dass der Farbstoff nur für Millisekunden bis
Mikrosekunden einen Komplex mit dem Quencher bildet und dann wieder dissoziiert.
Frühere Studien haben diese Fluktuationen als Öffnungs- und Schließungskinetik
interpretiert.
Im Rahmen dieser Arbeit konnten erstmals Einblicke in die Funktionsweise von DNAHairpin–Farbstoffkonstrukten gewonnen werden. Des Weiteren konnte gezeigt
werden, dass die entwickelte Technik ebenso erfolgreich für diagnostische
Anwendungen verwendet werden kann. So konnten bestimmte DNA – Sequenzen
spezifisch
bis
zu
einer
Konzentration
von
10-13
M
mit
Hilfe
der
Einzelmolekülspektroskopie durch Einschränkung der Konformationsdynamik nach
erfolgreicher Hybridisierung nachgewiesen werden (Abb. 5).
E
Zusammenfassung
20
10
0
ohne Gegensequenz
0
1
2
3
20
10
0
5
6
-14
1*10 MGegensequenz
0
Anzahl
Spots
4
1
2
3
10
0
4
5
6
-14
5*10 MGegensequenz
0
1
2
3
10
4
5
6
-13
1*10 MGegensequenz
0
0
1
2
3
10
4
5
6
-11
1*10 MGegensequenz
0
0
1
2
3
10
4
5
6
-11
5*10 MGegensequenz
0
0
1
2
3
4
5
6
Anzahl Photonen (x 1000)
Abbildung 5: Titration einzelner immoblisierter PET-DNA-Hairpins mit Gegensequenz. Es wurde eine Oberfläche für 5 min mit
unterschiedlichen Konzentrationen der DNA – Gegensequenz inkubiert und anschließend die Oberfläche abgescannt. Die auf
der Oberfläche erhaltenen fluoreszierenden Spots wurden analysiert und das Fluoreszenzintensitätshistogramm dargestellt. Bei
1 * 10
-14
-14
M und 5 * 10
M erhält man nur einen Peak mit einer Intensität von 0,75 kHz, der die geschlossenen DNA-Hairpins
repräsentiert. Erhöht man die Konzentration der DNA taucht ein weiterer Peak bei 2,25 kHz auf. Dieser zeigt die Anzahl
geöffneter DNA – Hairpins an.
Durch die Bestimmung der Konformation (geöffnet oder geschlossen) auf
Einzelmolekülebene konnten erstmals bestimmte Zielsequenzen im subpikomolaren
Bereich nachgewiesen werden. Die hohe Empfindlichkeit des Verfahrens ist für die
Behandlung von Patienten außerordentlich wichtig, da hierdurch der Nachweis
erbacht werden kann, ob es sich beispielsweise um einen Virus oder um ein
Bakterium handelt. PET-Hairpins erlauben aber nicht nur die Unterscheidung dieser
beiden Arten, sondern ermöglichen die genaue Bestimmung der Spezies. Durch die
F
Zusammenfassung
Identifikation bestimmter Gene mit Hilfe dieser Hairpins ist es sogar möglich,
Resistenzen gegenüber Antibiotika in kürzester Zeit zu detektieren und dadurch die
Behandlungsstrategie zu ändern. In letzter Zeit häufen sich die Fälle bei denen
Antibiotika ihren Dienst versagen. Oft ist es dann aber schon zu spät, um die
Medikamentation
anzupassen. Dies unterstreicht die Notwendigkeit nach neuen
Methoden zur Diagnose.
Aber es können nicht nur Krankheitserreger samt ihrer Eigenschaften nachgewiesen,
sondern auch genetisch bedingte Krankheiten erfasst werden, wie z.B. eine
Veranlagung zu Darmkrebs, wobei die Krankheit selbst noch nicht ausgebrochen
sein muss. Durch diesen Wissensvorsprung können geeignete Maßnamen zur
Behandlung ergriffen werden.
G
Abstract / Summary
Abstract / Summary
The molecular biology is a strong growing field in which a lot is still unexplored.
Especially the conformation of proteins (enzymes) and nucleic acids has a strong
influence on their reactivity. Thus, there exists a high demand for new methods for
the observation of conformational dynamics. In fluorescence spectroscopy, new
methods are needed that monitor the changes of conformation and reactians like
complex formation of proteins or substrate binding by a change of measurable
spectroscopic parameters. An effect that enables this and that is already used in
biology, is FRET – Fluorescence Resonance Energy Transfer. A new method is PET
– Photo-induced Electron Transfer.
In the context of this work, it could be shown that FRET and PET are two
complementary techniques for the determination of conformational changes of
biopolymers. DNA hairpins were synthesised and their conformation dynamics
between closed and open form could be shown by single molecule spectroscopy.
Cy3
+ complementary DNA
T
G
G
Cy5
G
Cy3
G
Cy5
T
T
T
Figure 1: Structure of a FRET DNA hairpin, closed (left) and open (right), after hybridisation to the complementary sequence. If
the stability of the hairpin is reduced by reduction of salt, a continuous opening and closing of the hairpin is observed.
DNA hairpins are single stranded DNA sequences that have a complementariity ends
of the sequence. Due to the resulting intra-molecular hybridisation the tribe of the
hairpin forms. The complementary bases form the stem and the remaining base pairs
form the loop of the hairpin.
H
Abstract / Summary
The hairpins were analysed under different conditions. The different conditions
caused a stable open or closed conformation or thermally induced fluctuations of the
conformation. Under high-salt conditions (200 mM KCl) the DNA hairpin is stabilised
in the closed form. Under low-salt conditions the double stranded tribe is destabilised
and conformational fluctuations can be seen. In the presence of complementary
sequence the DNA hairpin is permanently open due to the hybridisation with the
complementary sequence.
The intention of the work was the direct tracing of the conformation dynamics of
single DNA hairpins in the laser focus. A particular interest lay on the determination
of the association and dissociation rates in consideration of the newly developed
method
PET
(Photo-induced
Electron
Transfer)
for
the
determination
of
conformational changes.
For the determination of the conformational changes, the standard method FRET –
Fluorescence Resonance Energy Transfer – was used. FRET is a dipole-dipole
interaction between two dyes. One dye, the donor, is stimulated by a luminous
source. Due to the interaction, the second dye, the acceptor, is excited by the donor
that simultaneously falls back in its ground state. Since this interaction is dependent
of the distance (1/r6) amongst others, changes in the conformation can be shown.
In figure 2, the differences between the conformations of the FRET hairpins are
significant. The donor and the acceptor were coupled to the opposite ends of the
hairpin so that in the closed state a high energy transfer efficiency was achieved. In
the open state the distance between the donor and acceptor is significantly increased
so that the energy transfer is eliminated.
I
Abstract / Summary
a)
b)
60
c)
200
100
175
50
intensity (10ms)
150
80
40
125
60
30
100
75
20
40
50
10
20
25
0
0
1
2
3
4
5
6
7
8
9
0
0
10 11 12 13 14 15 16
0
1
2
3
4
5
6
7
8
9
10
11
0
12
2
4
6
8
10
12
14
16
time [s]
Figure 2: Fluorescence traces of single DNA hairpins in three states, immobilised on BSA-Streptavidine-surfaces. a) FRET
hairpins closed, with salt-stabilised (200 mM KCl) hairpin tribe. b) FRET hairpin with destabilised tribe (without salt) whereby the
hairpin opens after 8.5 seconds. The state of random coil lasts 3.5 seconds, afterwards the hairpin closes again. c) FRET
hairpin that is permanently opened by DNA which is complementary to the DNA loop and forms a double-stranded DNA.
Stimulation: 531 nm, detection: green from 540 nm to 600 nm, red from 650 nm to 700 nm.
Under high-salt conditions, the hairpin is closed and the distance between donor and
acceptor is ideal for an effective energy transfer (Fig. 2a). A decrease in the salt
concentration leads to changes in the FRET efficiency of the fluorescence again and
again – once there is mainly acceptor fluorescence which indicates that the hairpin is
closed, once there is donor dominated fluorescence which indicates that the hairpin
is open (Fig. 2b). By addition of complementary DNA the hairpin is permanently open
(Fig. 2c).
By determination of the times in which the DNA hairpin is open, i.e. no FRET occurs
between the donor Cy3 and the acceptor Cy5, the kinetics of these processes can be
determined and with it the rate constant of the opening of the hairpin.
Data: Bin1_Counts1
Model: ExpDec1
frequency
10
Chi^2
R^2
= 3.77915
= 0.78956
y0
A
t0
0
±0
20.82515
1.28465
±1.54655
±0.13464
1
0
1
2
3
4
5
6
7
8
time [s]
with low FRET
Figure 3: Kinetic of the closing of the hairpin. The histogram shows the time in witch the Hairpin is open (390 traces). The result
is fitted by a mono exponential decay.
J
Abstract / Summary
For the closing of the hairpin the rate constant of k = 1.3 ± 0.13 1/s at 22°C could be
determined. The opening kinetics is considerably slower and therefore could be
determined only indirectly because it is superposed by the photo destruction. The
rate constant of the opening of the hairpin is therefore calculated via the equilibrium
constant of the melting curve of the hairpin. It is k* = 10.8 ± 2 1/s. In comparison with
protein folding, changes in the conformation of DNA hairpins are much slower which
is associated with its function of storing genetic information which requires greater
rigidity.
DNA hairpins on PET (Photo-induced Electron Transfer) show a significantly more
complex behaviour (Fig. 4).
intensity(50ms)
a)
b)
c)
160
160
160
140
140
140
120
120
120
100
100
100
80
80
80
60
60
60
40
40
40
20
20
0
0
0
50
100
150
200
250
300
20
0
5
10 15 20 25 30 35 40 45 50 55 60 65 70
0
0
20
40
60
80
100
120
140
160
180
200
Zeit [s]
time [s]
Figure 4: Fluorescence traces of single, immobilized PET hairpins under diverse conditions. a) Stabilisation of the tribe of the
hairpin under high-salt conditions (200 mM KCl) different conformations can be seen. They are caused by slight changes in the
distance and represent different kinds of interactions like end capping, intercalation and groove binding. b) Destabilisation of the
hairpin tribe in pure Tris buffer without salt. There are several more intensity levels. After 50 seconds the intensity of the
fluorescence increases strongly that indicates an opening of the hairpin. c) Fluorescence trace of an open PET hairpin bound to
a DNA sequence complementary to the loop. The 4-fold increase of the fluorescence intensity in comparison to the closed
hairpin (Fig. 4a) is evident.
Thereby that PET has an intrinsic lower distance dependency compared to FRET,
also small changes in the conformation, like intercalation and groove binding, can be
detected. Thus, the value of the overlap integral of the quencher and the dye change.
Auto correlations of the fluorescence intensity show that the dye builds a complex
just for ms to µs, and then dissociates again. Former studies have taken these
fluctuations as opening and closing kinetics.
In line with this work, insights in the functionality of DNA-hairpin-dye constructs could
K
Abstract / Summary
be gained for the first time. Further it could be shown that this technique can be used
for diagnostic applications. Certain DNA sequences could be detected specifically up
to a concentration of 10−13 M by using single molecule spectroscopy (Fig. 5).
20
10
0
without complementary DNA
0
1
2
3
20
10
0
5
6
-14
1*10 Mcomplementary DNA
0
Anzahl
Spots
4
1
2
3
20
10
0
4
5
6
-14
5*10 Mcomplementary DNA
0
1
2
3
20
10
0
4
5
6
-13
1*10 Mcomplementary DNA
0
1
2
3
20
10
0
4
5
6
-11
1*10 Mcomplementary DNA
0
1
2
3
20
10
0
4
5
6
-11
5*10 Mcomplementary DNA
0
1
2
3
4
5
6
number of photons (x 1000)
Figure 5: Titration of immobilised PET DNA hairpins with complementary sequence. A surface was incubated for 5 minutes with
different concentrations of complementary DNA and afterwards was scanned. The spots got on the surface were analysed and
the bar chart/histogram of the fluorescence intensities was charted. At 1*10−
14
and 5*10−
14
there is just one peak at 0.75 kHz
witch represent the closed DNA Hairpins . With an increase of the DNA concentration a additional peak at 2.25 kHz appears.
This peak indicates that the DNA hairpin was opened.
With determination of the conformation (open / closed) on the single molecule level,
for the first time it is possible to detect specific genes one a sub pico molar level. The
high sensitivity can be exploited for diagnosos of infections in patients. The cause of
infections (bacterial or viral) can be determined. PET hairpins allow not only the
differentiation between bacterial and viral infection, but can also used to identify the
species. By identification of certain genes with help of these hairpins, it is even
L
Abstract / Summary
possible to detect resistance against antibiotics fast and consequently change
treatment. Lately, more and more antibiotics show no effect. Often then it is too late
to try another medication. This highlights the necessity of new methods of diagnosis.
But not only pathogens and their characteristics can be detected, but also hereditary
diseases can be detected, like e.g. a disposition for bowel cancer, thereby the illness
must not have come to term yet. By this head start in terms of knowledge suitable
measures can be taken for the medical treatment.
M
Inhaltsverzeichnis
1. Einleitung
1
2. Theoretische Grundlagen
6
2.1 Spektroskopie
6
2.1.1 Absorption
6
2.1.2 Emission
8
2.1.3 Quantenausbeute
10
2.1.4 Fluoreszenzlebensdauer
11
2.1.5 Fluoreszenzlöschung
12
2.1.5.1 Photoinduzierter Elektronen Transfer (PET)
14
2.1.6 FRET
16
2.1.7 Einzelmolekühlspektroskopie
18
2.2 Nukleotide und Nukleinsäuren
23
2.3 Glukoseoxidase
26
2.4 Fluoreszenz – Korrelations – Spektroskopie (FCS)
29
2.4.1 Theoretische Grundlagen der Korrelation
2.5 Kinetik
29
31
2.5.1 Reaktionen erster Ordnung
31
2.5.2 Reaktionen zweiter Ordnung
32
2.5.3 Arrheniusgleichung
32
2.5.4 Michaelis Menten Kinetik
33
3. Material und Methoden
35
3.1 Farbstoffe – Proben
35
3.2 Fluoreszenzspektrometer /Absorptionsspektometer
42
3.2.1 Einzelmolekülspektroskopie
42
3.3 Oberflächen
45
3.4 Photostabilität
47
3.5 Kontrollsystem
51
3.6 FCS
51
4. Ergebnisse und Diskussion
53
4.1 FRET – PET
53
4.2 Die intrinsische Fluoreszenz der Glucoseoxidase aus
Apergillus Niger
58
4.3 Untersuchung des FRET-Hairpins auf Einzelmolekülebene
70
4.4 PET – Hairpin
88
4.5 Vergleich des PET-Hairpins mit bekannten Strukturen
107
4.6 Fluktuationen des FRET-Systems
110
5. Ausblick
115
6. Literatur
119
Anhang
FRET-Hairpin in Tris-Puffer 200 mM KCl
FRET-Hairpin in Tris-Puffer 0 mM KCl
I
VI
FRET – Hairpin mit Gegensequenz geöffnet
XIII
PET-Hairpin in Tris-Puffer 200 mM KCl
XIV
PET-Hairpin in Tris-Puffer 0 mM KCl
XIX
PET-Hairpin mit Gegensequenz geöffnet
XXIV
FRET-Doppelstrang
XXVII
Stern – Volmer Plot von Flavin-Adenosin Dinucleotid
XXX
Einleitung
1. Einleitung
DNA wird oft als ein statisches Molekül betrachtet, dessen Aufgabe die
Informationsspeicherung ist. Jedoch muss die DNA an einer Reihe von funktionellen
Prozessen teilnehmen, wie Transkription, Replikation und Reparatur. Ein elementarer
Schritt bei all diesen Prozessen ist die Trennung der beiden DNA–Stränge. Obwohl
dieser Prozess so elementar ist, ist er bisher kaum untersucht worden. Dies liegt vor
allem an der Komplexität und der synthetisch schweren Fassbarkeit solcher
Systeme.
DNA–Hairpins
stellen
ein
Modelsystem
zur
Untersuchung
von
DNA
–
Oligonukleotiden dar.
Hairpins sind einzelsträngige Oligonukleotide, die aufgrund ihrer teilweisen
Komplementarität an den Enden hybridisieren und so einen Stamm ausbilden. Die
ungepaarten Nukleotide bilden den Loop.
Gibt man zu einem solchen System
Gegensequenz hinzu oder destabilisiert man den Hairpin durch Verringerung der
Salzkonzentration, so öffnet sich dieser.
Aus der Möglichkeit verschiedene Konformationen durch Zugabe komplementärer
DNA zu erhalten, wurde das Konzept der „Molecular Beacons“ von Tyagi et al.
entwickelt [Tyagi 1996]. Tyagi et al. verwendeten an einem Ende des Oligonukleotids
eine Vielzahl von verschiedenen Farbstoffe und am anderen den Quencher 4-(4´dimethylaminophenylazo)benzoesäure (DABCYL). Im geschlossenen Zustand wird
der Farbstoff durch den Quencher gelöscht. Wird der Gegenstrang des Stammes
durch Öffnung des Hairpins entfernt, so leuchtet der Farbstoff wieder. Diese Proben
erkennen Zielsequenzen mit hoher Spezifität. Die Schmelzkurven zeigen einen
deutlichen Unterschied zwischen Zielsequenz und einer Sequenz, die sich nur in
einem Nukleotied unterscheiden. Des Weiteren wurden „Molecular Beacons“ zur
Real-time Messung der in vitro Transkription genutzt. Dabei wird durch eine RNAPolymerase RNA synthetisiert, die dann sofort detektiert wurde. Dadurch konnten
Einblicke in die Funktionsweise von Transkriptionsfaktoren gewonnen werden, die
die RNA-Polymerase stimulieren [Lodish 2004].
Spezifische Gene zu detektieren und die Expession von RNA in Zellen zu lokalisieren
und in Lösungen zu quantifizieren, bietet die Möglichkeit für Fortschritte in der
Molekularbiologie, der Parasitologie, dem Medikamenten Screening und der
1
Einleitung
medizinischen Diagnose. Antibiotikaresistenzen fordern im zunehmenden Maße
neue Strategien in der Behandlung von Bakterienerkrankungen, besonders im
Bereich der Früherkennung.
Cy3
+ Gegensequenz
T
G
G
Cy5
G
Cy3
G
Cy5
T
T
T
Abbildung 1: Struktur eines FRET-DNA-Hairpins in geschlossener (links) und geöffneter Form (rechts) nach Hybridisierung an
die komplementäre Gegensequenz. Erniedrigt man die Stabilität des Hairpins durch eine Verringerung der Salzkonzentration,
so beobachtet man ein stetiges Öffnen und Schließen des Hairpins.
Deshalb ist es wichtig, die Funktionsweise von DNA-Hairpins zu verstehen. Durch
Einzelmolekülstudien müssen nicht die dynamischen Eigenschaften eines Hairpin
synchronisiert werden, sondern jedes Molekül wird individuell untersucht. Dadurch
ist es möglich, Konformationsänderungen unter Gleichgewichtsbedingungen zu
verfolgen und die Eigenschaften einzelner Moleküle zu bestimmen, um Informationen
über Inhomogenitäten zu erhalten.
Um Konformationsänderungen überhaupt detektieren zu können, wird in vielen
Studien FRET – Fluoreszenz Resonanz Energie Transfer – verwendet. FRET ist eine
Dipol-Dipol-Wechselwirkung zwischen zwei Farbstoffen. Ein Farbstoff, der Donor,
wird angeregt. Durch die spektrale Überlappung der Fluoreszenz des Donors mit
dem Absorptionsspektrum des 2. Farbstoffes, dem Akzeptor, kommt es durch das
elektrische Feld zum Energieübertrag. Der Akzeptor wird dadurch angeregt und der
Donor relaxiert. Diese Energieübertragung – FRET – ist stark abstandsabhängig
(~
6
1/Abstand ).
Eine andere Methode zur Bestimmung von Abstandesänderung ist PET –
Photoinduzierter Elektronentransfer. Bei PET wird der Farbstoff angeregt. Dabei
entstehen zwei SOMO – Orbitale. Durch einen Quencher kommt es zu einem
Elektronentransfer vom HOMO – Orbital des Quenchers zum niedrigsten SOMO –
2
Einleitung
Orbital des Farbstoffes. Der Farbstoff wird reduziert und der Quencher oxidiert. Es
kommt zu einer Löschung der Fluoreszenz. Damit das Elektron vom Quencher auf
den Farbstoff übertragen werden kann, müssen die Orbitale miteinander überlappen.
Dadurch ergibt sich eine sehr starke Abstandsabhängigkeit.
Erste Untersuchungen über Kinetiken des Öffnens und Schließens von Hairpins
wurden von Wallace et al. [Wallace 2001] mithilfe der FCS - Fluoreszenz Korrelations
Spektroskopie - durchgeführt. FCS ist eine Methode zur Ermittelung schneller
Änderungen der Fluoreszenzintensität. Dabei wird die Fluoreszenzintensität zum
Zeitpunkt t1, I(t1), mit der Fluoreszenzintensität zum Zeitpunkt t2, I(t2), multipliziert.
Durch Summation aller gleichen Zeitdifferenzen t1 – t2 lassen sich Aussagen über die
Kinetik der Änderung der Fluoreszenzintensität machen. FCS Lösungsmessungen
zeigten
eine
sehr
schnelle
Öffnungs-
und
Schließungskinetik
im
Mikrosekundenbereich. Ein Nachteil von FCS ist die geringe Beobachtungszeit von
wenigen Millisekunden. Fluktuationen im Sekundenbereich werden nicht erfasst.
Um langsamere Änderungen messen zu können, müssen die Proben auf geeigneten
Oberflächen immobilisiert werden. Dabei muss jede Art von Wechselwirkung des
Hairpins mit der Oberfläche minimiert werden. Es hat sich gezeigt, dass BSA (bovine
serum albumin) Oberflächen besonders zur Minimierung von Wechselwirkungen mit
DNA geeignet sind. Durch Biotinylierung einzelner BSA-Moleküle hat man die
Möglichkeit über Streptavidin weitere biotinylierte DNA – Proben zu immobilisieren
[Ha 1999].
Die Einzelmolekülspektroskopie bietet die Möglichkeit, Informationen über Individuen,
Verteilungen und zeitliche Veränderungen von Eigenschaften zu erhalten, die
anderenfalls verborgen bleiben. 1976 gelang es T. Hirschfeld als Erstem einzelne
Antikörper zu detektieren, die mit 80 –100 Fluoresceinfarbstoffen markiert waren
[Hirschfeld 1976]. R. Keller entwickelte anschießend die grundlegenden Methoden
zur Detektion einzelner fluoreszierender Moleküle. Mit Hilfe der hydrodynamischen
Fokussierung
gelang
ihm
schließlich
1990
die
Detektion
einzelner
Rhodaminfarbstoffe in wässriger Lösung [Dovichi 1983]. Es zeigte sich schnell, dass
die Möglichkeit, ein einzelnes fluoreszierendes Molekül zu detektieren, weniger von
der
empfindlichen
Detektion
als
von
der
effizienten
Unterdrückung
des
Hintergrundsignals abhängt. Durch den Einsatz geeigneter Bandfilter wird die
elastische Rayleigh-Streuung effizient unterdrückt. Die inelastische Raman-Streuung
wird durch ein geringes Detektionsvolumen von wenigen Femtolitern auf ein
3
Einleitung
Minimum reduziert, gleichzeitig wird die Anzahl von autofluoreszenten Molekülen im
Detektionsvolumen minimiert.
Abbildung 2: Anlage zur Messung einzelnen Molekülen auf Oberflächen.
Zur Steigerung des Signal-zu-Rausch (S/R) Verhältnisses etablierten Rigler und
Mitarbeiter Anfang der 90iger Jahre die konfokale Fluoreszenzmikroskopie zur
Detektion einzelner, frei diffundierender Moleküle in Lösung. Bei diesem Verfahren
wird ein Laserstrahl beugungsbegrenzt über ein Mikroskopobjektiv mit hoher
numerischer Apertur in die Probe fokussiert (Abb. 2). Typischerweise werden hierbei
Anregungsleistungen im Bereich von < 1 kW/cm2 (bei immobilisierten Molekülen) bis
zu einigen 100 kW/cm2 (bei frei diffundierenden Molekülen) verwendet. Das
Fluoreszenzlicht der Probe wird mit dem gleichen Objektiv gesammelt, räumlich mit
4
Einleitung
Hilfe einer Lochblende und spektral durch einen Bandpassfilter gefiltert und auf eine
hochempfindlichen
Halbleiterdetektor
abgebildet.
Das
resultierende
Beobachtungsvolumen liegt im Bereich von einem Femtoliter (10-15 L) [Rigler 1990].
Ziel dieser Arbeit war es, die Möglichkeiten der Einzelmolekülspektroskopie zu
nutzen, um die Kinetik von Hairpins zu verstehen. Gleichzeitig sollte der
Photoinduzierte Elektronentransfer (PET) als neue Methode zur Bestimmung von
Abstandsänderungen evaluiert und durch Vergleiche mit FRET als neue Methode
etabliert werden.
5
Theoretische Grundlagen
2. Theoretische Grundlagen
2.1 Spektroskopie
In der optischen Spektroskopie wird die Lichtaussendung elektronisch angeregter
Atome und Moleküle allgemein als Lumineszenz bezeichnet. Unter den vielfältigen
Anregungsmöglichkeiten führt die Anregung mittels Lichtbestrahlung zu der
sogenannten Photolumineszenz. Form und Lage der zugehörigen Absorptions- und
Emissionsspektren sind spezifisch für die untersuchten Atome und Moleküle und
geben Auskunft über deren Schwingungs- und Rotationszustände. Im Folgenden
sind die wichtigsten Grundlagen der Fluoreszenzspektroskopie zusammengefasst
[Lakowicz 1999].
2.1.1 Absorption
Absorption ist ein Ausdruck der Wechselwirkung zwischen dem π-System des
Farbstoffes und der elektromagnetischen Welle. Der Wechselwirkung liegt das
Resonanzverhalten der Oszillatoren in der Materie zugrunde. Quantenmechanisch
kann ein Elektron bei der Absorption von Licht der Wellelänge λ unter Aufnahme der
Energie ∆E aus dem elektronischen Singulettzustand S0 auf einen energetisch höher
gelegenen elektronischen Singulettzustand Sn, meist S1, übergehen. Die Energie des
Photons muss die Bohr’sche Resonanzbedingung erfüllen:
∆E= h⋅ν
[Gleichung 2.1.1.1]
6
Theoretische Grundlagen
wobei ν ist die Frequenz der Welle, h das Planck’sche Wirkungsquantum
(h = 6,626 *10-34 Js) ist. Für den sichtbaren Wellenlängenbereich von etwa 400 - 800
nm entspricht das einer Energie von 1,5 bis 3 eV. Damit es zu einer Absorption
kommt, muss das Dipolmoment des Farbstoffes parallel zum Vektor des elektrischen
Feldes ausgerichtet sein. Im Gegensatz zu Atomspektren sind bei Molekülen neben
elektronischen Übergängen zusätzlich Rotations- und Schwingungsübergänge zu
beobachten. Das führt dazu, dass man eine starke Verbreiterung der Spektrallinien
erhält. Ein Maß für die Stärke der Lichtabsorption durch ein Farbstoffmolekül ist der
Extinktionskoeffizient
ε.
Das
Bouguer-Lambert-Beer’sche
Gesetz
gibt
den
Zusammenhang zwischen Extinktionskoeffizient (ε), Absorption (Optische Dichte
(OD)), Schichtdicke (d) und Konzentration (c) wieder.
OD = log
I0
= ε *c*d
I
[Gleichung 2.1.1.2]
Dieses Gesetz gilt für monochromatisches, kollimiertes Licht und verdünnte
Lösungen. Die Schichtdicke wird, im Gegensatz zur SI Einheit m, in cm angegeben.
Der Extinktionskoeffizient ε ist proportional zur Übergangswahrscheinlichkeit P. Sie
gibt an, welcher Anteil aller absorbierten Lichtquanten zur elektronischen Anregung
führt und ist proportional zum Quadrat des Übergangsmomentes. Bei P = 1 bewirkt
jedes
absorbierte
Quant
einen
Übergang.
ε ist
auch
proportional
zum
Einfangquerschnitt a, der die Flächenausdehnung des chromophoren Systems
angibt:
aP ∝ε
[Gleichung 2.1.1.3 ]
Der maximale Extinktionskoeffizient eines Farbstoffes kann über εmax = 9·1019·P·a
abgeschätzt werden. Mit P = 1 und a = 10 nm2 (typischer Wert für Rhodamine) ergibt
sich ε zu 100000 l mol-1 cm-1. Für die meisten Rhodamine liegt der Wert für εmax
tatsächlich um 100000. Einige Cyaninfarbstoffe mit hohem Einfangquerschnitt
erreichen sogar Werte bis
250000 l mol-1 cm-1.
7
Theoretische Grundlagen
2.1.2 Emission
Moleküle in elektronisch angeregten Zuständen können unter Emission von
Photonen, d.h. Fluoreszenz in den energetisch günstigsten Zustand, den
Grundzustand S0, übergehen. Innerhalb von 10-15 s wird ein Molekül in ein höheres
Schwingungsniveau der elektronisch angeregten Zustände angeregt. Weil die
elektronische Anregung schneller erfolgt als eine Schwingung dauert (10-12 s),
bleiben die Kernabstände bei der Anregung gleich (Franck Condon-Prinzip). Meist
geschieht die Anregung in den ersten elektronisch angeregten Singulettzustand S1.
Selten finden auch Anregungen in höhere elektronische Singulettzustände (S2,
S3, ...) statt, die jedoch in Lösungen innerhalb von 10-12 s strahlungslos unter Abgabe
von Schwingungsenergie an Lösungsmittelmoleküle in die Boltzmann-Verteilung der
Schwingungszustände des S1-Zustandes übergehen. Von hier aus gibt es
verschiedene Möglichkeiten für das Molekül, wieder in den Grundzustand S0
überzugehen. Das Jablonski-Diagramm verdeutlicht diese Übergänge.
Sn
S5
S4
Tn
T5
S3
T4
IC
T3
S2
IC
T2
VR
ISC
S1
Ex
Ex
VR
IC
VR
F
VR
T1
ISC
P
VR
S0
Abbildung 2.1.2.1: Jablonski-Diagramm
8
Theoretische Grundlagen
Die strahlungslose Desaktivierung (Internal Conversion) des S1-Zustandes verläuft
analog zur obigen Sn→S1-Relaxation als isoenergetischer Übergang in RotationsSchwingungsniveaus von S0. Die Schwingungsenergie wird wiederum über
Wechselwirkung mit der Umgebung in Form von Wärme abgegeben.
Die für diese Arbeit wichtigste Relaxationsart ist die Fluoreszenz. Der S1Singulettzustand
geht
innerhalb
von
Nanosekunden,
entsprechend
dem
Übergangsmoment, in ein Rotations-Schwingungs-Niveau des Grundzustandes S0
über und sendet die überschüssige Energie als Photon (hν) aus. Als weiterer
Reaktionsweg ist das Intersystem Crossing (ISC) in einen Triplettzustand möglich.
Wegen der wegfallenden Paarungsenergie (Pauli-Prinzip) liegt der Triplettzustand
meist energetisch knapp unterhalb des entsprechenden Singulettzustandes. Der
Übergang ist damit energetisch günstig, allerdings ändert sich die Spinmultiplizität,
wodurch der Übergang formal „verboten“ ist. Ist das Molekül erst einmal im
Triplettzustand (T1), verweilt es dort oft sehr lange (≥ 10-6 s), weil alle weiteren
Reaktionen in den Singulettgrundzustand S0 führen und die Übergänge wiederum
„spinverboten“ sind. Außerdem ist die Energiedifferenz für T1→S0 wesentlich größer
als für S1→T1, was die Lebenszeit im Triplettzustand weiter verlängert. Es konkurriert
die strahlungslose Relaxation (IC), die wiederum Wärme erzeugt, mit der
Phosphoreszenz, bei der ein Photon emittiert wird. Das Emissionsspektrum ist
gegenüber
dem
Absorptionsspektrum
rotverschoben,
da
die
angeregten
Singulettzustände Sn (n=1, 2,…) durch strahlungslose Prozesse schnell in die
Rotations-Schwingungsenergie-Verteilung
des
S1-Zustandes
relaxieren,
von
welchem dann die Fluoreszenz in höhere Rotations-Schwingungs-Zustände des S0
erfolgen kann (Kasha-Regel). Daher haben die emittierten Photonen eine geringere
Energie als die Absorbierten und sind rotverschoben. Dieses Phänomen wird im
Allgemeinen als Stokes-Verschiebung bezeichnet [Park 2003].
9
Theoretische Grundlagen
2.1.3 Quantenausbeute
Die Quantenausbeute Q beschreibt das Verhältnis von emitierten zu absorbierten
Photonen. Wird ein Farbstoff angeregt, so muss dieser nicht unbedingt nur durch
Fluoreszenz abgeregt werden. Durch Internal Conversion können ebenfalls
angeregte Moleküle wieder in den Grundzustand gelangen. Die Quantenausbeute
beschreibt dieses Verhältnis.
Die einfachste Art und Weise die Quantenausbeute eines Farbstoffes zu bestimmen,
ist der Vergleich mit einem Farbstoff bekannter Quantenausbeute. Dazu wird ein
Fluoreszenzspektrum sowohl vom zu bestimmenden Farbstoff gemessen, als auch
von einem Farbstoff, dessen Quantenausbeute bekannt ist. Danach wird die
Fluoreszenzintensität über alle Wellenlängen summiert und konzentrationsgewichtet
ins Verhältnis setzten.
Q = Qs *
I ODs
*
I s OD
[Formel 2.1.3.1]
Durch Multiplikation mit der Quantenausbeute des Standards (Qs) erhält man die
Quantenausbeute.
Farbstoff
Quinine Sulfat
Lösungsmittel
0,1M Schwefelsäure
Anregungswel Temperatur Quantenausbeute
-lenlänge[nm]
[°C]
350
22
0,577
366
22
0,53
β-Carotin
1N Schwefelsäure
350
25
0,6
Fluorescein
0,1M Natronlauge
496
22
0,95
2-Aminopyridin 0,1N Schwefelsäure
285
0,6
0,13
Tryptophan
Wasser
280
Phenol
Wasser
275
Rhodamin 6G
Ethanol
488
Rodamin 101
Ethanol
450
23
0,14
0,94
25
1
Abbildung 2.1.3.2: Quantenausbeuten verschiedener Standards [Lakowicz 1999]
10
Theoretische Grundlagen
Die Quantenausbeute ist wellenlängenunabhängig. Viel stärker ändert sich die
Quantenausbeute mit der Temperatur. Durch Temperaturerhöhung bewegen sich die
Teilchen schneller, die Wahrscheinlichkeit, dass es zu einem Stoß zwischen
Farbstoff und Lösungsmittel kommt erhöht sich und damit steigt auch die
Stoßdesaktivierung.
2.1.4 Fluoreszenzlebensdauer
Die Fluoreszenzlebensdauer ist definiert als die durchschnittliche Zeit, die das
Molekül in angeregtem Zustand verbringt.
I (t ) = I 0 * e
−t
τ
[Formel 2.1.4.1]
I0 ist die Anfangsintensität und τ die Fluoreszenzlebensdauer, die charakteristisch für
jeden Farbstoff ist. T beschreibt die Zeit nach dem Laserpuls.
100
Fluoreszenzintensität
80
60
40
20
0
0
10
20
30
40
50
60
70
80
90
100
Zeit [ns]
Abbildung 2.1.4.2: Verteilung der Photonen bei einer Fluoreszenzlebensdauer von 10ns
11
Theoretische Grundlagen
In Abb. 2.1.4.2 ist ein typischer Verlauf der Funktion gezeigt. In diesem Beispiel
wurden 10 ns als Fluoreszenzlebensdauer angenommen.
2.1.5 Fluoreszenzlöschung
Eine Vielzahl von Substanzen löschen die Fluoreszenz. Einer der am besten
untersuchten Quencher ist Sauerstoff. Durch Stöße im angeregten Zustand kommt
es zum Intersystem Crossing und der Farbstoff geht in den Triplettzustand über.
Eine andere Gruppe von Quenchern sind Amine, die Komplexe mit dem Farbstoff
ausbilden. Wird dieser angeregt so kommt es zu einem Elektronen Transfer von dem
HOMO (highest occupied molecular orbital) des Amins in das niedrigste SOMOOrbital (single occupied molecular orbital) des Farbstoffes.
Farbstoff
Quensc her
Farbstoff
Quenscher
Abbildung 2.1.5.1: Funktionsweise des Quenchens durch Elektronentransfer mit Aminen (Donoren)
Für den Elektronentransfer müssen die Orbitale des Farbstoffes mit den Orbitalen
des Quenchers überlappen. Daraus resultiert eine stake Abstandsabhängigkeit. Sind
beide Moleküle weiter als 2 Å entfernt, kommt es nahezu keiner Wechselwirkung
mehr. Eine Ausnahme bilden die sogenannten „through – bond“ Wechselwirkungen.
Die Konzentrationsabhängigkeit des Quenchvorganges wird durch die Stern-VolmerGleichung beschrieben.
12
Theoretische Grundlagen
F0
= 1 + K D [Q]
F
[Formel 2.1.5.2]
F0 ist die Fluoreszenzintensität des Farbstoffes in Abwesenheit des Quenchers, F die
Fluoreszenzintensität in Anwesenheit des Quenchers, [Q] die Konzentration von
Quencher und KD die Komplexierungskonstante von Quencher und Farbstoff
[Lakowicz 1999].
12
11
10
9
8
F0/F
7
6
5
4
3
2
1
0
0
20
40
60
80
100
Konzentration Quencher [mM]
Abbildung 2.1.5.3: Verlauf des Quenchprozesses.
Trägt man das Verhältnis der Fluoreszenzintensitäten gegen die Konzentration des
Quenchers
auf,
so
erhält
man
eine
Gerade,
deren
Steigung
die
Komplexbildungskonstante widerspiegelt [Abb. 2.1.5.3]. In diesem Fall ist KD = 100
mol/l.
Farbstoffe werden auch durch Stoßdeaktivierung gelöscht, dynamische Löschung.
Dabei wird der Farbstoff im angeregten Zustand durch einen Stoßprozess in den
Grundzustand abgeregt. Im Gegensatz zum statischen Quenching ändert sich hierbei
die Fluoreszenzlebensdauer. Trägt man in einem Stern-Volmer-Plot das Verhältnis
der Fluoreszenzlebensdauer ohne Quenching zur Fluoreszenzlebensdauer mit
Quencher gegen die Konzentration des Löschmoleküls auf, so erhält man eine
Grade. (Formel 2.1.5.4)
13
Theoretische Grundlagen
F0 τ 0
=
= 1 + k qτ 0 [Q]
F
τ
Wobei
kq
[Q]
die
Geschwindigkeit
des
[Formel: 2.1.5.4]
Quenchprozesses
bei
der
Quencherkonzentration [Q] ist.
Generell kommen immer beide Mechanismen des Quenchings zum Tragen. Jedoch
verhalten sich die beiden Mechanismen bei Temperaturerhöhung unterschiedlich:
das Stoßquenching wird stärker und damit die Steigung größer, während bei
Komplexbildung das Quenching geringer wird.
2.1.5.1 Photoinduzierter Elektronen Transfer (PET)
Die Absorption eines Photons ändert die elektronischen Eigenschaften eines
Farbstoffes grundlegend. Ein Elektron wird aus dem HOMO (highest occupied
molecular orbital) durch ein Photon der entsprechenden Energie in das LUMO
(lowest unoccupied molecular orbital) angehoben. Dadurch ist der Farbstoff um den
Energiebeitrag des Photons E0,0 sowohl leichter oxidierbar als auch reduzierbar.
Bildet der Farbstoff einen Komplex mit einem elektronenreichen Quencher und wird
der Farbstoff angeregt, so kommt es zu einem Elektronentransfer von dem HOMO
des Amins in das niedrigste SOMO des Farbstoffes.
Dabei gibt es zwei verschiedene Kinetiken. Eine ist die Fluoreszenz mit einer
Geschwindigkeitskonstante die der der Fluoreszenzlebensdauer entspricht.
2
kcs=2π/h VDA 1/(4πλkBT)
1/2
2
exp[-(∆Gcs+λs) / 4λskBT]
[ Formel 2.1.5.1.1]
Die zweite Kinetik beschreibt die Geschwindigkeit des Elektronentransfers kcs. Diese
ist abhängig von der Wechselwirkungsmatrix VDA, einer Art Überlappungsintegral der
beiden Orbitale. ∆Gcs beschreibt den Energiegewinn durch den Elektronentransfer, λs
die Solvatationsenergie des Biradikals [Rehm 1969].
14
Theoretische Grundlagen
Abbildung 2.1.5.1.2: Reaktionsmechanismus des Quenchprozesses
Bestimmt wird diese Größe, indem man das Redoxpotential beider beteiligten Stoffe
bestimmt und die Wellenlänge des Emissionsmaximums.
Ered vs SCE
E0,0 [eV]
in CH3CN [V]
∆Gcs [eV]
mit Guanosin
R6G
-0.95
2.27
-0.07
Cy5
-0.88
1.88
+0.25
MR121
-0.48
1.85
-0.12
Abbildung 2.1.5.1.3: Einige Farbstoffe mit ihren Redoxpotentialen
Werden
die
Löschungsexperimente
Redoxpontentialmessungen
im
durchgeführt,
gleichen
kann
die
Lösungsmittel
wie
die
Solvatationsenergie
des
radikalischen Ionenpaares vernachlässigt werden und die freie Energie der
0
setzt sich zusammen aus Eox – Ered , der Redoxenergie E0,0 ,
Ladungstrennung ∆GCS
0
der Energie des Photons und der Coulombenergie der Ladungstrennung ∆Gcoul
.
15
Theoretische Grundlagen
2.1.6 FRET
Ein weiterer Prozess der im angeregten Zustand stattfindet ist der Fluoreszenz
Resonanz Energie Transfer FRET. Dieser Prozess findet immer dann statt, wenn das
Emissionsspektrum eines Farbstoffes (Donor) mit dem Absorptionsspektrum eines
zweiten Farbstoffes (Akzeptor) überlappt.
Fluoreszenzintensität bzw Absorption
C Fluoreszenz
Cy5 Absorption
100
80
60
40
20
0
500
550
600
650
700
750
Wellenlänge [nm]
Abbildung 2.1.6.1: Überlappung der Fluoreszenz des Donors (Cy3) mit der Absorption des Akzeptors (Cy5)
FRET ist eine Dipol-Dipol-Wechselwirkung, die Störungen der elektronischen
Struktur des Donors und Akzeptors hervorruft. Diese Störungen werden über das
elektrische Feld des Donors und Akzeptors vermittelt. Dadurch ergibt sich eine
Abstandsabhängigkeit:
k T (r) =
Die
Geschwindigkeitskonstante
1 ⎛ R0 ⎞
⎜ ⎟
τD ⎝ r ⎠
des
6
[Formel 2.1.6.2]
Energietransfers,
die
mit
der
Geschwindigkeitskonstante der Fluoreszenz konkurriert, ist abhängig von der
Fluoreszenzlebensdauer des Donors, dem Försterradius R0 und dem Abstand r
16
Theoretische Grundlagen
zwischen Donor und Akzeptor. Der Försterradius R0 ist der Abstand, bei dem die
Energietransfereffizienz 50% beträgt. Er spiegelt die spektrale Überlappung des
Emissionsspektrums des Donors mit dem Absorptionsspektrum des Akzeptors, die
Orientierung der beiden Dipolmomente zueinander, die Quantenausbeute des
Donors und den Brechungsindex des Mediums wider.
R0 =
9000(ln 10)κ 2 Φ D
128π 5 n 4 N
∞
∫
FD (ν )ε A (ν )
ν4
0
dν
[Formel 2.1.6.3]
ΦD ist die Quantenausbeute des Donors, n der Reflexionsindex des Medium, N die
Avogadrozahl, FD(ν) ist das Fluoreszenzspektrum des Donors, εA(ν) ist das
Absorptionsspektrum des Akzeptors und κ2 ist der Orientierungsfaktor der
Dipolmoment des Donors und Akzeptors zueinander.
Normalerweise liegt der Försterradius zwischen 30 und 60 Å.
1,0
R0 = 30 A
R0 = 60 A
FRET-Effizienz
0,8
0,6
0,4
0,2
0,0
0
20
40
60
80
100
120
140
Abstand zwischen DONOR - Akzeptor [A]
Abbildung 2.1.6.4: Änderung der FRET-Effizienz mit wachsendem Abstand
Abbildung 2.1.6.4 verdeutlicht, dass mit Hilfe von FRET Abstände zwischen 20 und
100 Å zu messen sind.
Die FRET-Effizienz lässt sich mit der folgenden Formel beschreiben.
17
Theoretische Grundlagen
E=
1
⎛ r ⎞
1 + ⎜⎜ ⎟⎟
⎝ R0 ⎠
6
[Formel 2.1.6.3]
E ist die FRET - Effizienz, R0 der Försterabstand und r der Abstand von Donor zu
Akzeptor.
2.1.7 Einzelmolekülspektroskopie
Der Vorteil der Einzelmolekülspektroskopie gegenüber der Fluoreszenzspektroskopie
im Ensemble ist die Beobachtung von individuellen Eigenschaften einzelner
Moleküle. Viele Gleichgewichtsschwankungen werden im Ensemble herausgemittelt,
eine Synchronisation ist nur schwer zu erreichen. Die Einzelmolekülspektroskopie
bietet jetzt die Möglichkeit, zeitliche Fluktuationen zu untersuchen. Molekulare
Prozesse wie Konformationsänderungen und Reaktionen können die Fluoreszenzintensität, Polarisation, Fluoreszenzwellenlänge und die Fluoreszenzlebensdauer
verändern.
Die Einzelmoleküldetektion in Lösung und bei Raumtemperatur ist kompliziert. Die
am weitesten verbreitete Technik zur Detektion einzelner Moleküle in Lösung ist die
konfokale Fluoreszenzmikroskopie [Nie 1994]. Hierbei wird der Laserstrahl über ein
Objektiv in das Innere einer Messlösung fokussiert und das Fluoreszenzsignal über
dasselbe Objektiv eingesammelt. Rayleighstreuung wird räumlich durch eine
Lochblende und Ramanstreuung spektral durch Filter vom Fluoreszenzlicht getrennt.
Das Objektiv fokussiert das Licht auf einen Punkt, sodass das Beobachtungsvolumen
auf 1 Femtoliter reduziert wird. Dadurch wird die Streuung des Lichts weiter minimiert
und die Anzahl autofluoreszenter Moleküle ist gering.
Das Objektiv ist im Prinzip eine Linse, die das Licht fokussiert. Die Abbésche
Auflösungsformel gibt die Grenzen dieses Prozesses wieder:
∆X ≈
λ
2n * sin α
[Formel 2.1.7.1]
18
Theoretische Grundlagen
λ ist die Wellenlänge des verwendeten Lichts und n * sin α ist die numerische
Appertur des Objektives, wobei α der Öffnungswinkel des Objektives ist. Der größte
technisch mögliche Apperturwinkel ist 70°. Daraus ergibt sich eine Auflösung von
200 nm lateral und 500 nm axial. Dies entspricht einem Volumen von 1/50 fl.
axial > 500 nm
lateral > 200 nm
lens
Abbildung 2.1.7.2: Anregungsvolumen der konfokalen Fluoreszenzspektroskopie
Das Objektiv ist nicht nur wichtig für die punktgenaue Anregung, sondern auch für die
Detektion der Fluoreszenz. Dafür ist ein möglichst großer Öffnungswinkel notwendig,
da die Fluoreszenz in alle Raumrichtungen abgegeben wird [Hell 2005].
19
Theoretische Grundlagen
Luft η =1
Glas η =1,5
Abbildung 2.1.7.3: Verteilung der Fluoreszenzphotonen eines Farbstoffes an der Glas - Luft - Grenze
Dabei ist die Emissionswahrscheinlichkeit anisotrop, aber trotzdem wird der Hauptteil
der Fluoreszenz in einem weiten Winkel in Richtung Glas abgegeben. Durch
Überschichtung mit Wasser wird dieser Effekt geringer und man detektiert dadurch
auch weniger Photonen [Axelrod 1989].
Bei der Diffusion eines Farbstoffes durch den Fokus kann dieser bis zu 1000
Photonen emittieren. 70% dieser Photonen können nicht detektiert werden, weil
diese nicht das Objektiv erreichen. Der Strahlteiler und der Filter haben eine
Transmission von 80%. Dadurch reduziert sich die Anzahl von Photonen die auf den
Detektor fallen auf 1/5. Deshalb ist es wichtig, Detektoren zu verwenden die jedes
Photon einzeln detektieren und eine möglichst große Anzahl von Parametern wie die
exakte Zeit, Wellenlänge und Polarisation liefern.
Als Detektor wird deshalb eine Halbleiterphotodiode verwendet [Abb. 2.1.7.4]. Sie
besteht aus einer p-Schicht, die mit dem Plus-Pol und einer n-Schicht die mit dem
Minus–Pol
verbunden
ist.
Die
Diode
ist
in
Sperrrichtung
geschaltet.
Im
Übergangsbereich zwischen P- und N-Schicht herrscht ein starkes Feld. Dadurch
kann das Licht Elektronen-Loch-Paare erzeugen und wird absorbiert. Durch die
angelegte Spannung wird das Elektron beschleunigt. Dieses stößt weitere Elektronen
heraus und es entsteht eine Elektronenlawine, die als elektrischer Strom detektiert
wird.
20
Theoretische Grundlagen
Abbildung 2.1.7.4: Aufbau eines Fluoreszenzdetektors
Eine solche Diode hat hervorragende Eigenschaften zur Detektion einzelner
Photonen. Selbst Fluoreszenzlebensdauern können bestimmt werden.
Die Detektionseffizienz ist bei 700 nm mit 70 % am größten, 300 nm vom Maximum
entfernt fällt sie fast auf 0% ab [Perkin Elmer].
Als Lichtquelle werden Laser oder Laserdioden verwendet. Das optisch aktive
Medium besteht aus der undotierten Schicht eines Halbleitermaterials, das zwischen
Schichten aus p- und n-dotiert Halbleitermaterialien eingebettet ist.
21
Theoretische Grundlagen
p-Dotiert
Abbildung 2.1.7.5: Aufbau einer Laserdiode (Pin-Diode)
Mit der Polung dieser pin-Diode in Vorwärtsrichtung werden Elektronen und Löcher in
die aktive Schicht injiziert. Elektronen besetzen Energieniveaus im Leitungsband,
Löcher (Defektelektronen) besetzen Energieniveaus im Valenzband. Durch die
Rekombination dieser Elektronen und Löcher wird wie in einer LED Licht emittiert.
Dadurch, dass sowohl die p- als auch n-dotierten Diodenbereiche einen geringeren
Brechungsindex haben als der undotierte Teil, kommt es zu Reflexion im
Grenzbereich. Ab einer halbleiterspezifischen Schwellwertstromstärke wird das
Strahlungsfeld so stark, dass die Rekombination überwiegend durch stimulierte
Emission geschieht, bevor spontane oder strahlungslose Prozesse wirksam werden
[Demtröder 1993]. Schickt man Strompulse überhalb der Schwellwertstromstärke
durch die Diode kommt es zu Laserpulsen die bis zu ps-Sekunden kurz sein können.
22
Theoretische Grundlagen
2.2 Nukleotide und Nukleinsäuren
Die Desoxyribonukleinsäure (DNA) ist der Träger der Erbinformation. Sie ist aus
einem Zuckerphosphatrückgrat aufgebaut, an dem verschiedene Nukleotide
angehängt sind. Die Nukleotide sind Derivate des Purins oder Pyrimidins. Die
wichtigsten sind Thymin (T), Adenin (A), Cytosin (C) und Guanin (G).
T
A
H
H
O
N
N
N
N
N
H
Zucker
N
N
O
Zucker
C
G
H
N
N
H
H
O
N
N
N
Zucker
N
Zucker
N
O
H
N
H
Abbildung 2.2.1: Basenpaarung der Nukleotide, Thymin (T) paart mit Adenin (A) und Cytosin (C) paart mit Guanin (G).
23
Theoretische Grundlagen
Die Purinbasen binden über das N9-Atom an das C1-Atom eines Zuckers, bei den
Pyrimidinbasen erfolgt die Bindung über das N1-Atom. In Ribonukleotiden, die
Bausteine der RNA, ist der Zucker die Pentose Ribose, in Desoxyribonucleotiden,
den Bausteinen der DNA, die 2´-Desoxyribose. Die einzelnen Nukleotide werden an
das 3´und 5´Ende über ein Phosphatmolekül gebunden und bilden so lange
Polymere.
Die Bestimmung der DNA-Struktur durch James Watson und Francis Crick im Jahre
1953 wird oft als Grundstein der modernen Molekularbiologie bezeichnet. Die
Watson-Crick-Struktur der DNA liefert nicht nur ein Modell für das zentrale Molekül
des Lebens, es klärt zusätzlich den molekularen Mechanismus der Vererbung und
der Synthese von Proteinen auf.
Abbildung 2.2.2: Aufbau der DNA nach Francis Crick und James Watson
24
Theoretische Grundlagen
Die DNA kommt nicht als Einzelstrang vor, sondern 2 Polynukleotidketten winden
sich um eine gemeinsame Achse und bilden eine Doppelhelix. Dabei sind die
Stränge antiparallel und jede bildet eine rechtsgängige Helix. Die Basen liegen im
Inneren der Helix und das Zucker-Phosphat-Gerüst verläuft an der Peripherie. Somit
wird die Abstoßung zwischen den geladenen Phosphatgruppen minimiert. Auf der
Oberfläche der Doppelhelix bilden sich dadurch zwei Arten von Furchen mit
unterschiedlicher Ausdehnung aus: die große und die kleine Furche. Jede Base in
der Doppelhelix ist über Wasserstoffbrückenbindungen mit einer Base im
Gegenstrang verbunden. Dabei können nur Adenine mit Tyminen und Guanosine mit
Cytosinen
eine
Basenpaarung
eingehen.
Dieses
Phänomen
nennt
man
komplementäre Basenpaarung.
Einzelsträngige DNA ist selten und kommt meist als Erbmaterial bei bestimmten
Viren vor. Im Gegensatz dazu kommt die RNA meist als Einzelstrang vor. Auch hier
paart Adenine mit Uracil, einem Tymin Derivat und Guanosine mit Cytosinen. Da kein
Gegenstrang vorhanden ist, erfolgt bei entsprechender Sequenz eine intramolekular
Basenpaarung. Es bilden sich Haarnadelstrukturen (Hairpins).
Abbildung 2.2.3: Aufbau eines DNA-Hairpins, oben der Einzelstrang, unten der Hairpin
Komplexere
Strukturen
entstehen,
wenn
die
Schleifen
miteinander
in
Wechselwirkung treten. Zahlreiche Untersuchungen haben gezeigt, dass dadurch
spezifische
Bindungsmöglichkeiten für kleine, organische Moleküle geschaffen
werden und Reaktionen an diesen Zentren stattfinden [Voet 2002].
25
Theoretische Grundlagen
2.3 Glukoseoxidase
Glukoseoxidase katalysiert die Oxidation von Glukose zu Glukonsäure und
Wasserstoffperoxid mit Hilfe von molekularem Sauerstoff.
COOH
CHO
OH
OH
O2 +
HO
HO
+ H2O2
OH
OH
OH
OH
CH2OH
CH2OH
Abbildung 2.3.1: Reaktionsgleichung der Oxidation von Glukose
Sie wird aus dem Schimmelpilz Aspergillus niger gewonnen. Dieser wird aufgrund
seiner dunklen Sporen auch Schwarzschimmel genannt. Diese dunklen Sporen des
Aspergillus niger sind sehr deutlich erkennbar. Er kommt weltweit im Erdboden vor.
Glukoseoxidase ist ein Homodimer mit jeweils 80 kDa und drei Untereinheiten:
Flavin-Adenosin-Dinukleotid, α-D-Mannose, N-Acetyl-D-Glucosamin.
26
Theoretische Grundlagen
Abbildung 2.3.2: Röntgenstruktur der Glukoseoxidase mit ihren drei Untereinheiten [pdb.org]
Das Flavin-Adenosin Dinukleotid [Abb. 2.3.2] zeigt eine starke Fluoreszenz bei
530 nm.
27
Theoretische Grundlagen
Abbildung 2.3.3: Struktur von Flavin-Adenosin Dinukleotid
Es liegt in zwei verschiedenen Formen vor [Tittmann 2000], einer oxidierten und
einer reduzierten Form. Die reduzierte Form wird leicht durch molekularen Sauerstoff
oxidiert.
O
O
H
N
N
HN
O
HN
N
H
N
O
N
N
R
R
FADH2
FAD
Abbildung 2.3.4: Reduziertes und oxidiertes Flavin-Adenosin Dinukleotid (FAD)
Das konjugierte Ringsystem von FAD kann ein oder zwei Elektronen aufnehmen,
wodurch das stabile Radikal Semichinon FADH. bzw. das vollständig reduzierte
Hydrochinon FADH2 gebildet wird. Die Aufgabe, die FAD im Stoffwechsel übernimmt,
ist die Elektronenaufnahme. Dadurch werden Substrate oxidiert und das FAD
reduziert. Dieses wird anschließend in einem zweiten Schritt wieder reversibel durch
molekularen Sauerstoff aufoxidiert und kann den nächsten Zyklus beginnen.
28
Theoretische Grundlagen
2.4 Fluoreszenz – Korrelations – Spektroskopie (FCS)
2.4.1 Theoretische Grundlagen der Korrelation
Korrelationsanalysen
können
verborgene
Informationen
aus
Signalen
herausrechnen. Dabei ist unter einer Korrelation im weitesten Sinne die
wechselseitige Beziehung oder Beeinflussung zweier Funktionen zu verstehen.
Mathematisch ähnelt eine Korrelation der Faltung oder Konvolution [Bronstein 1991].
Eine Funktion f(x) wird mit einer zweiten Funktion g(x), die in x verschoben ist,
multipliziert und über den gesamten Wertebereich gemittelt (aufsummiert bzw.
integriert).
G (τ ) = f ( x) ⊗ g ( x ) =
+∞
∫ f ( x´) * g ( x´+ x)dx´
[Formel 2.4.1.1]
−∞
Die Gleichung gibt das Faltungsintegral wider, wobei ⊗ die Faltungsoperation
kennzeichnet. Lediglich die Position von g(x) unterscheidet Korrelation und Faltung
voneinander. Wird g(x-x’) nach g(x’+x) verschoben, spricht man von Korrelation. Ist
die Abfragefunktion gleich der ursprünglichen, spricht man von einer Autokorrelation.
Sie gibt Auskunft über die Fluktuationen innerhalb einer Signalspur nach einer
verschobenen
Zeit
Kreuzkorrelation,
bei
τ.
Währenddessen
der
zwei
können
verschiedene
mittels
Funktionen
der
sogenannten
korreliert
werden,
Ähnlichkeiten von und Zusammenhang zwischen zwei Signalspuren untersucht
werden. Im Gegensatz dazu gibt die Autokorrelation zeitliche Veränderungen wieder.
G (τ ) =
1
Veff
1
1
t
C (1 +
t
1
)
tc 1 + K 2 tc
[Formel 2.4.1.2]
Der erste Faktor ist die durchschnittliche Anzahl von Molekülen im Fokus. Tc ist die
Diffusionszeit und K das Verhältnis von z-Ausdehnung zu xy-Ausdehnung des Fokus.
29
Theoretische Grundlagen
Hat
man
nicht
nur
reine
Diffusion,
sondern
auch
Änderungen
der
Fluoreszenzintensität durch Reaktionen, erhält man weitere Komponenten.
0,05
Amplitude Kinetik
0,04
Abklingzeit
G(τ)
0,03
0,02
Amplitude
Diffusion
Diffusionszeit
0,01
0,00
1E-6
1E-5
1E-4
1E-3
0,01
0,1
1
10
100
1000
Zeit [ms]
Abbildung 2.4.1.3: FCS-Kurve eines sich verändernden Moleküls.
Diese sind durch eine Amplitude und eine Abklingzeit gekennzeichnet. Wechselt der
Farbstoff
von
einem
hellen
Zustand
B
zu
einem
dunklen
D
mit
der
Geschwindigkeitskonstante kD, so gilt in der Fluoreszenzkorrelationsspektroskopie
folgende Formel [Schwille]:
kD
D
B
kB
Gtotal (τ ) = G diffusion (τ ) ⋅ X kinetik (τ )
X kinetik (τ ) = F ⋅ e
τk =
1
kD + kB
F=
kD
kD + kB
τ
τk
[Formel 2.4.1.4]
30
Theoretische Grundlagen
2.5 Kinetik
In der Kinetik wird die Geschwindigkeit chemischer Reaktionen untersucht. Im
Wesentlichen verfolgt man damit zwei Ziele: Man will eine Reaktion optimieren,
sodass sie schneller abläuft. Zu diesem Zweck können Temperatur, Druck oder
Lösungsmittel variiert werden. Durch Zugabe eines Katalysators können beachtliche
Steigerungen der Reaktionsgeschwindigkeit erzielt werden. Der zweite Grund
weshalb man sich mit der Kinetik einer Reaktion beschäftigt, sind Fragen des
Mechanismus.
2.5.1 Reaktionen erster Ordnung
Reaktionen erster Ordnung sind oft Zerfallsreaktionen. Die Substanz A reagiert bzw.
zerfällt zu Substanz B und C.
A→ B+C
Abbildung 2.5.1.1: Reaktionsgleichung einer Reaktion erster Ordnung
Das Geschwindigkeitsgesetz einer solchen Reaktion lautet:
−
d [ A] d [ B] d [C ]
=
=
= k[ A]
dt
dt
dt
Abbildung 2.5.1.2: Geschwindigkeit der Produktbildung
Die Geschwindigkeit mit der Substanz A zerfällt ist gleich der Geschwindigkeit mit der
Substanz B gebildet wird, ist gleich der Bildungsgeschwindigkeit von Substanz C und
dies ist gleich einer Geschwindigkeitskonstanten mal der Konzentration von A. Die
Geschwindigkeitskonstante ist nicht konzentrationsabhängig, aber sehr wohl von der
Temperatur abhängig.
31
Theoretische Grundlagen
Durch Integration dieser Formel erhält man ein Gesetzt, das die Eduktabnahme im
Verlauf der Zeit beschreibt.
[ A]t = [ A] 0 * e − kt
[Formel 2.5.1.3]
[A]t ist die Eduktkonzentration zum Zeitpunkt t, [A]0 ist die Ausgangskonzentration
des Eduktes und k die Geschwindigkeitskonstante. Eine Reaktion erster Ordnung
folgt einem monoexponentiellen Verlauf.
2.5.2 Reaktionen zweiter Ordnung
Reaktionen zweiter Ordnung haben dagegen ein komplexes Verhalten: Reaktionen
zweiter Ordnung sind bimolekulare Reaktionen, da ihre Geschwindigkeit proportional
zur Zahl der Stöße zwischen beiden Reaktionspartnern ist, die wiederum proportional
zu ihren jeweiligen Konzentrationen sind. Bei einer Reaktion 2. Ordnung bei der die
beiden Teilchen identisch sind gelten folgende Gesetze: (Abb. 2.5.1.3)
d [ A]
= −k[ A] 2
dt
[Formel 2.5.2.1]
[ A]t =
[ A]0
1 + kt[ A]0
2.5.3 Arrheniusgleichung
Bei den meisten Reaktionen nimmt die Geschwindigkeit mit der Temperatur zu.
Empirisch wurde gefunden, dass viele Reaktionen der Arrheniusgleichung folgen:
k = Ae
− Ea
RT
[Formel 2.5.3.1]
32
Theoretische Grundlagen
In dieser Gleichung ist A der präexponentielle Faktor, k die Gewschindigkeitskonstante, Ea die Aktivierungsenergie und T die Temperatur.
Die Aktivierungsenergie ist die Energie, die die Reaktanden besitzen müssen, damit
sie miteinander reagieren und Produkte bilden können. D.h. nicht jeder Stoß
zwischen
zwei
Reaktionspartnern
führt
zum
gewünschten
Produkt.
Der
Exponentialteil gibt den Anteil der Moleküle an, die die nötige Aktivierungsenergie
haben. Der präexponentieller Faktor kann als die Zahl der Stöße interpretiert werden,
die überhaupt stattfinden multipliziert mit einem Orientierungsfaktor.
2.5.4. Michaelis Menten Kinetik
Enzymatische Reaktionen haben oft ein Vorgleichgewicht. Das bedeutet, dass der
eigentlichen Reaktion eine weitere Reaktion vorgeschaltet ist, die aber wesentlich
schneller ist, als die eigentliche Reaktion.
E+S
ES
E+P
Abbildung 2.5.4.1: Mechanismus einer enzymatischen Reaktion
Das Enzym reagiert mit dem Substrat zum Enzym-Substrat-Komplex. Diese Reaktion
ist sehr schnell und reversibel. Danach folgt die relativ langsame Umsetzung des
Substrates zum Produkt. Diese Reaktion ist irreversibel. Michaelis und Menten haben
eine Gesetzmäßigkeit für solche Reaktionen beobachtet.
d [ P]
= k[ ES ]
dt
[Formel 2.5.4.2]
Die Geschwindigkeit der Produktbildung ist abhängig von der Enyzm-SubstratKonzentation. Dadurch, dass diese Reaktion sehr schnell im thermodynamischen
Gleichgewicht
ist,
kann
man
die
Enyzm-Substrat-Konzentation
über
die
Gleichgewichtskonstante errechnen.
33
Theoretische Grundlagen
K=
k hin [Pr odukte]
=
k rück
[ Edukte]
[Formel 2.5.4.3]
Umformung gibt die Michaelis-Menten-Gleichung:
d [ P ] k b [ E ]0 [ S ]
=
dt
Km + S
[Formel 2.5.4.4]
Hierbei ist kb die Geschwindigkeitskonstante der Bildung des Produktes aus dem
Enzymsubstratkomplex und Km, die Michaelis-Konstante, die Gleichgewichtskonstante des Vorgleichgewichtes.
34
Material und Methoden
3. Material und Methoden
3.1 Farbstoffe - Proben
In dieser Arbeit wurde PET - Photoinduzierter Elektronen Transfer und FRET –
Fluoreszenz Resonanz Energie Transfer - zur Aufklärung der Konformationsdynamik
von DNA – Hairpins verwendet.
Ein Farbstoff der sehr gut durch PET gequencht wird, ist MR 121 (K.H. Drexhage,
ATTO-TEC, Siegen, Deutschland). Er besitzt eine Komplexbildungskonstante von
110 M-1. Im Komplex zeigt er keine messbare Fluoreszenz. Darüber hinaus besitzt er
hervorragende
Absorptions-
und
Emissionseigenschaften.
Mit
einem
Absorptionsmaximum von 660 nm ist er sehr gut mit gepulsten Laserdioden
anzuregen.
Sein
Extinktionskoeffizient
von
80.000
l/mol*cm
und
seine
Quantenausbeute von 0,3 zusammen mit der sehr guten Photostabilität machen Ihn
zu einem hervorragenden Farbstoff für Messungen auf Einzelmolekülebene.
N
MR 121
N
O
N
COOH
Abbildung 3.1.1: Farbstoff MR 121
35
Fluoreszenzintensität bzw Absorption
Material und Methoden
100
Abs MR 121
MR 121 Fluoreszenz
80
60
40
20
0
200
300
400
500
600
700
800
Wellenlänge nm
Abbildung 3.1.2: Absorptions- und Fluoreszenzspektrum des Farbstoffes MR 121
Als Vergleichssystem wird das fast schon klassische FRET-Paar Cy3 / Cy5 (GE
Healthcare, United Kingdom) verwendet. Cy3 dient als Donor und hat ein
Extinktionskoeffizient von 150.000 l/mol*cm bei einer Wellenlänge von 550 nm. Damit
ist er sehr gut mit einem frequenzverdoppelten Nd:YAG anzuregen. Das
Emissionsmaximum liegt bei 570 nm. Cy5, der Akzeptor, hat sein Absorptionsmaximum bei 650 nm mit einem Extinktionskoeffizient von 250.000 l / mol cm.
Dadurch
hat
man
kaum
Direktanregung
des
Farbstoffes
durch
den
frequenzverdoppelten Nd:YAG. Das Emissionsmaximum liegt bei 670nm und ist um
100 nm weiter rot verschoben als die Emission des Donors und damit einfach zu
unterscheiden.
36
Material und Methoden
O3-S
Cy5
SO3-
N
N
COOH
SO3-
O3-S
Cy3
N
N
COOH
Abbildung 3.1.3: Struktur der Farbstoffe Cy5 und Cy3
Aus dem Emissionsspektrum des Donor und dem Absorptionsspektrum des
Akzeptors
wurde
zusammen
mit
den
Extinktionskoeffizenten
und
der
Quantenausbeute ein Försterradius von 53 Å berechnet.
37
Fluoreszenzintensität bzw Absorption
Material und Methoden
Cy3 Fluoreszenz
Cy5 Fluoreszenz
Abs Cy5
100
80
60
40
20
0
500
550
600
650
700
750
Wellenlänge [nm]
Abbildung 3.1.4: Fluoreszenz- und Absorptionsspektrum von Cy3 und Cy5
Daraus ergibt sich folgende FRET-Effizienz – Abstandsbeziehung.
1,0
FRET - Effizienz
0,8
0,6
0,4
0,2
0,0
0
20
40
60
80
100
120
140
Abstand [A]
Abbildung 3.1.5: FRET-Effizienz – Abstandsbeziehung
Untersucht werden die Farbstoffe an DNA. Dazu wird ein DNA-Hairpin verwendet.
Für den PET-Hairpin wird die DNA (IBA-Go, Göttingen, Deutschland) mit dem
Fluoreszenzfarbstoff (MR 121) markiert. Der FRET-Hairpin wurde markiert geliefert.
38
Material und Methoden
Amino – C6 Linker - CCCCATTTTTTTTTTTTTGGGGTTT – Biotin
Cy5 – CCCCATTTTTTTTTTTTT – Cy3 – GGGGTTT – Biotin
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
( PET)
( FRET)
(Gegensequenz)
Abbildung 3.1.6 Sequenzen der verwendeten DNA
Gekoppelt wird der Farbstoff an die DNA in Carbonatpuffer.
Carbonatpuffer 100mM pH = 8,5
840 mg
Natriumhydrogencarbonat (84 g/mol)
100 ml
Wasser
5g
Aktivkohle (Fluka, Buchs, Schweiz)
(Fluka, Buchs, Schweiz)
1 M Salzsäure
Das Natriumhydrogencarbonat wird abgewogen und in Wasser gelöst. Der
pH-Wert wird auf 8,5 mit Salzsäure eingestellt. Danach wird die Aktivkohle
hinzugegeben. Vor Gebrauch wird die Lösung steril gefiltert.
Vorschrift 3.1.7: Vorschrift zur Herstellung von Kopplungspuffer
Vor dem Koppeln wird der Farbstoff aktiviert.
Farbstoffaktivierung
O-(N-Succinimidyl)-N,N,N´,N´,-tetramethyluroniumtetrafluroborat (301 g/mol)
TSTU (Fluka, Buchs, Schweiz)
Farbstoff
1 µl
Diisopropyletylamin (Fluka, Buchs, Schweiz)
Aceton (Fluka, Buchs, Schweiz)
39
Material und Methoden
Der Farbstoff wird in wasserfreiem Aceton gelöst und das Aktivierungsreagenz
sowie die Base hinzugegeben. Die Lösung lässt man anschließend für 2h auf
dem Schüttler reagieren.
Vorschrift 3.1.8: Vorschrift zur Farbstoffaktivierung
Kopplung
40µl
Carbonatpuffer 100mM pH = 8,5
10 µl 100 pmol/µl DNA-Lösung
1µl
aktivierter Farbstoff
Die Reagenzien werden zusammen pepitiert und über Nacht geschüttelt.
Danach wird das Produkt von den Edukten mittels HPLC (Agilent, Karlsruhe,
Deutschland) getrennt. Als Säule wird eine Reversed-phase-Säule Hypersil –
Si (Knauer, Berlin, Deutschland) verwendet. Als Laufmittel wird eine 0,1 M
wässrige
Trietylammoniumacetat
Lösung
(A)
Trietylamoniumacetat Lösung mit 75% Acetonitril
bzw.
eine
0,1
M
und 25% Wasser (B)
verwendet.
Anschließend wird eine Step-Elution durchgeführt.
Zeit
Fluss
Eluent
0 min
2,5 ml/min
100% Laufmittel A;
5 min
2,5 ml/min
65% Laufmittel A; 35% Laufmittel B
34 min
2,5 ml/min
0% Laufmittel A; 100% Laufmittel B
60 min
2,5 ml/min
0% Laufmittel A; 100% Laufmittel B
0% Laufmittel B
Tabelle 3.1.9: Endpunkte der gefahrenen Gradienten
Das Produkt wird aufgefangen und anschließend zum Salzentzug über eine
Gelfiltrationssäule ( NAP-Säule, GE Healthcare, United Kingdom) von dem
Trietylamoniumacetat getrennt. Die Lösung wird daraufhin gefriergetrocknet.
Vorschrift 3.1.10: Vorschrift zur Koppelung von DNA und Farbstoff
40
Material und Methoden
2 M TEAA – Lösung
147 ml
Triethylamin (101 g/mol) (Fluka, Neu-Ulm, Deutschland)
120 ml
Eisessig (60 g/mol) (Merck, Darmstadt, Deutschland)
Wasser
500 ml Wasser werden vorgelegt und mit Eis gekühlt. Die Essigsäure wird
hinzugegeben. In mehreren Portionen wird das Triethylamin hinzugegeben.
Nach jeder Zugabe bildet sich eine 2. Phase auf der Oberfläche, die aber mit
der Zeit verschwindet. Die Lösung wird für 12h gerührt und anschließend der
pH-Wert auf 7,5 eingestellt.
Vorschrift 3.1.11: Vorschrift zur Herstellung einer 2M TEAA - Lösung
Laufmittel A
50 ml
2M TEAA-Lösung
950 ml
Wasser
Beide Lösungen werden zusammengegeben und für 12 h stehen gelassen.
Vorschrift 3.1.12: Vorschrift zur Herstellung von HPLC-Laufmittel A
Laufmittel B
50 ml
2M TEAA-Lösung
750 ml
Acetonitril (Serva, Heidelberg, Deutschland)
200 ml
Wasser
Alle Lösungen werden zusammengegeben und für 12 h stehen gelassen.
Vorschrift 3.1.13: Vorschrift zur Herstellung von HPLC-Laufmittel B
41
Material und Methoden
3.2 Fluoreszenzspektrometer /Absorptionsspektometer
Die
Quantenausbeuten
und
Schmelzkurven
werden
mit
Hilfe
des
Absorptionsspektrometers Cary 500 Scan (Varian, Palo Alto, USA) und des
Fluoreszenzspektrometers Cary Eclipse mit Multizellhalter und Peltierelement
(Varian, Palo Alto, USA) aufgenommen. Um ein geringes Probenvolumen zu haben
werden Suprasil-Halbmikroküvetten mit einem Füllvolumen von 800µl verwendet.
3.2.1 Einzelmolekülspektroskopie
In Abbildung 3.2.1.1 ist die Anlage gezeigt, die zur Messung einzelner Moleküle auf
Oberflächen verwendet wurde.
42
Material und Methoden
Abbildung 3.2.1.1: Anlage zur Messung einzelnen Molekülen auf Oberflächen
Sie besteht aus einem inversen, konfokalen Mikroskop (Axiovert 100TV, Zeiss), das
mit dem Piezo-Tisch PZT-Servo (Physik Instrumente (PI), Karlsruhe, Deutschland)
zur Änderung der x-y-Position ausgestattet ist. Als Anregungsquelle für die „roten“
Proben (MR 121) wird ein gepulster Diodenlaser mit einer Wellenlänge von 635 nm
und einer Repetitionsrate von 80 MHz verwendet (PDL 800-B, PicoQuant, Berlin,
Deutschland). Das Laserlicht wird in eine Glasfaser eingekoppelt, um ein
gaussähnliches Strahlprofil zu bekommen. Der Strahl wird durch ein Teleskop
aufgeweitet, bevor er ins Mikroskop eingekoppelt wird, nachdem er einen
Anregungsfilter (630DF10; Omega Optics, Brattleboro, USA) durchlaufen hat. Nach
dem Strahlteiler (645DMLP, Omega Optics, USA) wird das Licht durch ein
Mikroskopobjektiv (100x, NA = 1.4, Olympus, Tokyo, Japan) in die Probe fokusiert.
Das Fluoreszenzlicht wird mit dem selben Objektiv gesammelt und durch den
Strahlteiler vom Anregungslicht getrennt. Das Licht wird durch die Linsen im
43
Material und Methoden
Mikroskop fokusiert. Um bessere Bilder zu erhalten wird eine Lochblende von 100µm
eingesetzt.
Das Licht wird auf eine Single – Photon – Avalanche – Diode (AQR-14; EG&G
Optoelectronics, Kanada) fokusiert, die mit einem Emissionsfilter ( 680DF80; Omega
Optics, Brattleboro, USA) ausgestattet ist.
Die FRET-Proben werden mit einem frequenzverdoppeltem Nd:YAG 532nm
Compass 215M ( Coherent, Santa Clara, USA) angeregt. Als 1. Strahlteiler wird ein
560 DMLP (Omega Optics, USA) verwendet. Das verwendete Objektiv ist das selbe.
Nach der Lochblende wird dieses mal das Signal gesplittet und auf zwei APDs
fokusiert. Als Strahlteiler wird ein 645 DMLP (Omega Optics, USA) verwendet. Die
beiden Emissionsfilter sind ein 570 DF 60 und 675 DF 50 (beide Omega Optics,
USA)
Das Detektorsignal wird von einer Time-Correlated Single Photon Counting Interface
Card (TCSPC) (SPC-630; Becker & Hickl, Berlin, Deutschland) zusammen mit dem
Triggersignal weiterverarbeitet. Um die Delaytime zwischen den Detektoren und dem
Laserpuls zu kompensieren sind jeweils eine Delayunit (DG535, Stanford Research
Systems, Bell Electronics, Renton, Washington) zwischen den Detektoren und der
PC-Karte geschaltet.
Das Messprogramm zur Koordination der Datenacquisition, Tischbewegung und
Polarisationsmodulation wurde in LabView von Prof. Dr. Kenneth D. Weston
geschrieben. Die Daten werden im FIFO-mode der SPC630 aufgenommen, d.h.
jedes Photon wird mit seiner absoluten Ankunftszeit, der Zeit zwischen dem Start der
Messung und der Ankunft des Photons, und der mikroskopischen Zeit, der Zeit
zwischen dem Laserpuls und der Fluoreszenz, gespeichert. Die Karte arbeitet im
reversen Modus, d.h. das Detektorsignal startet den Zeitnehmer für die
mikroskopische Zeit und der Triggerpuls von dem darauffolgenden Laserpuls stoppt
ihn wieder.
Die Analysesoftware erlaubt die Bestimmung der Fluoreszenzintensität aus Kanal 1
und Kanal 2 sowie der Gesamtintensität, der spektralen Verteilung (F2 – Wert), der
aus dem Verhältnis der Intensität aus Kanal 2 zur Gesamtintensität berechnet wird,
sowie der Fluoreszenzlebensdauer aus Kanal 1 und 2 sowie aus beiden Kanälen
zusammen. Die Fluoreszenzlebensdauer wird über einen monoexponentiellen Fit der
maximalen Wahrscheinlichkeit bestimmt. Der MLE (Maximum Likelihood Estimator )
wird über Formel 3.4.1 bestimmt. [Soper 1994, Tellinghuisen 1993]
44
Material und Methoden
−1
mT
T
1 + ⎛⎜ e τ − 1⎞⎟ − m⎛⎜ e τ − 1⎞⎟
⎠
⎝
⎠
⎝
−1
m
= N −1 ∑ iN i
T
Zeitauflösung der Microtime
m
Zahl der Zeitintervalle (hier 64)
N
Zahl der Photonen
Ni
Zahl der Photonen im Zeitintervall i
[Formel 3.2.1.2]
i =1
Für diese Analyse werden die Photonen aus allen Pixel genommen, die in einem
Kreis von beliebigem Radius vorhanden sind. Es werden von dem Programm nur die
Stellen als ein Molekül erkannt, die mehr als eine bestimmte Anzahl von Photonen
haben.
Hat man die Oberfläche abgescannt, so kann man auf einzelne Spots klicken, von
denen nun Traces aufgenommen werden. Dabei fährt der Piezotisch an die
entsprechende Stelle der Oberfläche und es wird die Änderung der Fluoreszenz in
Abhängigkeit von der Zeit beobachtet. Für die Analyse dieser Spuren wurde ein
Programm geschrieben, das im Anhang zu sehen ist.
3.3 Oberflächen
Um die DNA auf der Oberfläche immobilisieren zu können und keine unspezifische
Adsorption zu haben, wurde eine BSA-Oberfläche hergestellt.
45
Material und Methoden
( T)
Fluorophore
Biotin
T A
Streptavidin
G
G
G
BSA
G
Mr121
T
T
T
Abbildung 3.3.1: Oberfläche zur Immobilisation von Molekülen
BSA-Oberfläche
10 mg
1 mg
BSA (Sigma-Aldrich Chemie GmbH, München, Deutschland)
BSA-Biotin (Sigma-Aldrich Chemie GmbH, München,
Deutschland)
1 mg
Streptavidin in 2 ml PBS (Roche, Basel, Schweiz)
2 ml
PBS über Aktivkohle gelagert und gefiltert
Die Oberfläche im Plasma reinigen und benetzen, das BSA und BSA-Biotin in
PBS lösen und in das Rack geben. 12h bei 4°C inkubieren lassen. 5 mal mit
PBS waschen und für 10 min die Streptavidinlösung einwirken lassen und
wieder 5 mal waschen. Danach kann die Probe immobilisiert werden.
Vorschrift 3.3.2: Vorschrift zur Herstellung von BSA-Oberflächen
46
Material und Methoden
PBS-Puffer
PBS-Puffertablette (Sigma-Aldrich Chemie GmbH, München,
1
Deutschland)
100 ml
Wasser
1
Aktivkohle (Fluka, Buchs, Schweiz)
Die PBS-Tablette wird in Wasser gelöst und Aktivkohle hinzugegeben. Vor
dem Gebrauch wird der Puffer steril filtriert damit kein Kohlestaub in der
Lösung ist, der das Licht stark streut.
Vorschrift 3.3.3: Vorschrift zur Herstellung von PBS-Puffer
3.4 Photostabilität
Zur Erhöhung der Photostabilität wird Glukoseoxidase zugegeben. Glukoseoxidase
stammt von Apergillus Niger, einem Pilz. Dieses Enzym oxidiert Zucker durch
molekularen Sauerstoff auf. Diese Reaktion wird genutzt um den Sauerstoff aus der
Lösung zu entfernen.
Glukoseoxidase 20x Stocklösung 1 ml in Tris mit Tween 20
1
mg Glukoseoxidase (Sigma-Aldrich Chemie GmbH, München,
Deutschland)
0,5
ml Tris 25 mM KCl über Aktivkohle gelagert und gefiltert
2
µl Katalase (Sigma-Aldrich Chemie GmbH, München, Deutschland)
4
µl 1M DTT-Lösung
0,5
ml Glycerin (Fluka, Buchs, Schweiz)
0,5
µl Tween 20 (Fluka, Buchs, Schweiz)
50
µl Natriumdithionit
47
Material und Methoden
Die Glukoseoxidase wird abgewogen und in Tris gelöst. Die Katalase, das
DTT, das Natriumdithionit und das Tween 10 werden hinzugegeben und die
Lösung wird homogenisiert. 0,5 ml Glycerin werden hinzugegeben und
vermischt. Die Lösung wird portioniert (50µl) und bei –20°C eingefroren.
Vorschrift 3.4.1: Vorschrift zur Herstellung von Glukoseoxidase 20x Stocksolution
Glukoselösung zur Verdünnung
0,1 g Glukose (Sigma-Aldrich Chemie GmbH, München, Deutschland)
0,9 ml PBS über Aktivkohle gelagert und gefiltert
100 µl Glycerin
10 µl 1M ß-Mercaptoetylamin-Lösung in PBS (77 g/mol)
Die Glukose wird in PBS gelöst und die ß-Mercaptoetylamin-Lösung wird
hinzugegeben. Am Ende wird das Glycerin hinzugegeben und alles bei –20 °C
eingefroren.
Vorschrift 3.4.2: Vorschrift zur Herstellung von Glukoselösung
1 M DTT-Lösung in PBS/TRIS
154
mg DTT (154 g/mol) (Fluka, Buchs, Schweiz)
1
ml PBS/Tris
Alles wird zusammengegeben und bei –20 °C eingefroren.
Vorschrift 3.4.3: Vorschrift zur Herstellung von 1 M DTT-Lösung
48
Material und Methoden
1 M ß-Mercaptoetylaminlösung in PBS/Tris
77
mg ß-Mercaptoetylamin (77 g/mol) (Sigma-Aldrich Chemie GmbH,
München, Deutschland)
1
ml PBS/Tris
Alles wird zusammengegeben und bei –20 °C eingefroren.
Vorschrift 3.4.4: Vorschrift zur Herstellung von 1 M ß-Mercaptoetylaminlösung
10 mM Tris – Puffer (100ml)
121 mg
Tris (121 g/mol) (Sigma-Aldrich Chemie GmbH, München,
Deutschland)
37,22 mg
EDTA (1 mM) 2 Na * 2H2O (372,2 g/mol) (Sigma-Aldrich Chemie
GmbH, München, Deutschland)
1M
Salzsäure (Fluka, Buchs, Schweiz)
25 mM KCl (74,55 g/mol): 186 mg
(Sigma-Aldrich Chemie GmbH,
München, Deutschland)
200 mM KCl (74,55 g/mol): 1,49 g (Sigma-Aldrich Chemie GmbH, München,
Deutschland)
Das Tris, EDTA und gegebenenfalls das Kaliumchlorid werden abgewogen
und in Wasser gelöst. Die Lösung wird mit HCl titriert bis es einen pH-Wert
von 7,5 hat, zur Lösung wird Aktivkohle hinzugegeben und autoklaviert. Vor
Gebrauch wird die Lösung steril gefiltert.
Vorschrift 3.4.5: Vorschrift zur Herstellung von 10 mM Tris-Puffer
49
Material und Methoden
Natriumdithionit
60
mg Natriumdithionit (174,1 g/mol)
(Sigma-Aldrich Chemie Gmbh,
München, Deutschland)
1
ml Tris 25 mM KCL über Aktivkohle gelagert und vor Gebrauch steril
filtriert
Das Natriumdithionit wird abgewogen und in Tris-Puffer gelöst.
Vorschrift 3.4.6: Vorschrift zur Herstellung von Natriumdithionit
Für die Untersuchung der Ursache der Fluoreszenz von Glukoseoxidase wird eine
Stocklösung verwendet.
Flavin-Adenosin Dinukleotid Stocklösung
3mg Flavin (829,5 g/mol)
(Sigma-Aldrich Chemie GmbH, München,
Deutschland)
1ml
Tris 25 mM KCL über Aktivkohle gelagert und vor Gebrauch steril
filtriert
Das Flavin wird abgewogen und in Tris-Puffer gelöst. Für die
Fluoreszenzmessungen wurden 8 µl dieser Lösung in 1 ml Tris 25 mM KCl
verdünnt.
Vorschrift 3.4.7: Vorschrift zur Herstellung von Flavin-Adenosin-Dinukleotid Lösung
Riboflavin (Vitamin B2)
1,4 mg
Riboflavin (Vitamin B2) 376,4 g/mol
(Sigma-Aldrich Chemie
GmbH, München, Deutschland)
1 ml
Tris 25 mM KCL über Aktivkohle gelagert und vor Gebrauch steril
filtriert
50
Material und Methoden
Das Riboflavin wird abgewogen und in Tris-Puffer gelöst
Vorschrift 3.4.8: Vorschrift zur Herstellung von Riboflavin Lösung
3.5 Kontrollsystem
Als Kontrollsystem für FRET wird ein DNA-Doppelstrang verwendet, mit der
folgenden Sequenz:
Biotin GGG GGG GGX1 AAA AAT CCC CAA AAA AAG GGG GGG G
CCC CCC CCT TTT TTX2 GGG GTT TTT TTC CCC CCC C
Abbildung 3.5.1: Sequenz des DNA-Doppelstrang
Diese beiden Sequenzen werden fertig gelabelt bei IBA (Göttingen, Deutschland)
gekauft.
3.6 FCS
Unter Fluoreszenz-Korrelations-Spektroskopie - FCS versteht man die Analyse der
zeitlichen
Fluktuationen
zweier
Fluoreszenzsignale.
Stammen
beide
Fluoreszenzsignale von einem Detektor - um eine bestimmte Korrelationszeit
zueinander verschoben – spricht man von Autokorrelation, stammen sie von zwei
verschiedenen Detektoren, spricht man von der Kreuzkorrelation. Charakteristische
Abklingkurven
bezüglich
in
der
Abhängigkeit
Fluoreszenz-Korrelations-Funktion
auftretenden
von
Triplettzustände
der
der
zu
Zeit.
Veränderungen
Korrelationen
charakterisieren
der
Informationen
Fluoreszenzintensitäten
werden
aber
liefern
auch
häufig
durchgeführt
Bindungsstudien
in
um
von
farbstoffmarkierten Liganden mit Proteinen werden untersucht.
51
Material und Methoden
Die erhaltenen Daten werden mit der Methode des logarithmischen Binnings
autokorreliert. Dabei wird die Spur gebinnt und jeder Wert mit dem nächsten Wert
multipliziert. Die Ergebnisse werden dann aufsummiert.
∞
G (t1 ) = ∑ I (t ) * I (t + 1)
[ Formel 3.6.1]
0
Wobei t1 die Binnzeit der Spur ist und I(t) die Intensität der Spur zum Zeitpunkt t.
Um die gesamte Autokorrelationskurve zu erhalten, wird nun das Binning der Kurve
variiert.
52
Ergebnisse und Diskussion
4. Ergebnisse und Diskussion
4.1 FRET – PET
PET - Photoinduzierter Elektronen Transfer und FRET - Fluoreszenz Resonanz
Energie Transfer sind zwei völlig verschiedene Methoden, um Abstandsänderungen
im Nanometerbereich zwischen zwei Punkten zu messen. Beide basieren auf dem
Phänomen der Fluoreszenz, aber die Mechanismen der Fluoreszenzänderung und
die Art der Änderung sind völlig verschieden.
Die beiden Methoden werden an einem Modellsystem, ein DNA – Hairpin, in dieser
Arbeit verglichen. Beide Systeme bestehen aus einem DNA Strang, der eine
Komplementarität aufweist, die zu einer intramolekularen Hybridisierung führt, die
den Stamm des Hairpins bilden. Dieser besteht aus 4 Guanosin – Cytosin –
Paarungen und einer Adenosin – Thymin Paarung. Die restlichen Basen bilden den
Loop. Dieser besteht wiederum aus 12 Thymidinen, die als Einzelstrang vorliegen.
Am 3´-Ende wird der Hairpin über einen Thymidin - Linker mit Hilfe von Biotin an
einer Streptavidinoberfläche immobilisiert.
Am 5´-Ende sitzt im Fall des PET-Hairpins der Farbstoff MR 121. Dieser wird von
den Guanosinen im Gegenstrang bei direktem Kontakt gelöscht. Der FRET-Hairpin
trägt am 5´Ende den Farbstoff Cy5 als Akzeptor und im Gegenstrang, am anderen
Ende des Stammes des Hairpins, ist der Donor Cy3 des FRET-Paares lokalisiert
[Abb. 4.1.1].
53
Ergebnisse und Diskussion
PET - Hairpin
FRET - Hairpin
( T) 12
( T) 12
Cy3
T
T
G
G
G
G
G
G
G
MR 121
G
Cy5
T
T
T
T
T
T
Abbildung 4.1.1: Aufbau des PET-Hairpins und des FRET-Hairpins
Gibt man zu dem Hairpin komplementäre Gegensequenz, so öffnet sich der Hairpin
und man erhält eine Änderung der Fluoreszenz. Dies funktioniert sowohl mit dem
FRET-Hairpin , als auch mit dem PET-Hairpin [Abb. 4.1.2].
Cy3
+ Gegensequenz
T
G
G
Cy5
G
Cy3
G
Cy5
T
T
T
Abbildung 4.1.2: Struktur eines FRET-DNA-Hairpins in geschlossener (links) und geöffneter Form (rechts) nach Hybridisierung
an die komplementäre Gegensequenz. Erniedrigt man die Stabilität des Hairpins durch eine Verringerung der
Salzkonzentration, so beobachtet man ein stetiges Öffnen und Schließen des Hairpins.
Deutlich ist eine Änderung zwischen der gequenchten und der ungequenchten
Konformation zu sehen. Im geschlossenen Zustand hat der FRET-Hairpin eine
54
Ergebnisse und Diskussion
Energietransfereffizienz von 80%. Wird er geöffnet, vergrößert sich der Abstand von
Donor zu Akzeptor, sodass es zu fast keinem Energietransfer mehr kommt. Bei dem
PET-Hairpin
wird
durch
das
Öffnen
des
Hairpins
die
Guanosin–
Farbstoffwechselwirkung verhindert und damit das Quenching aufgehoben. Es
kommt zu einem 3 bis 4-fachen Fluoreszenzanstieg.
PET tris Puffer 200mM KCl
FRET tris Puffer 200mM KCl
Freteffizienz bzw rel Fluoreszenzintensität
1,1
1,0
0,9
0,8
0,7
0,6
0,5
0,4
0,3
0,2
-10
0
10
20
30
40
50
60
70
80
90
Temperatur [°C]
Abbildung 4.1.3: Schmelzkurven des FRET und PET Hairpins in Tris-Puffer mit 200mM KCl
Die Schmelzkurven der beiden Hairpins zeigen zwei verschiedene Schmelzpunkte.
Der FRET-Hairpin öffnet sich bei 40°C, der PET-Hairpin hat einen Schmelzpunkt von
50°C. Dieser Unterschied rührt von der Wechselwirkung des PET-Farbstoffes mit
den Nukleotiden her. Für die Quenchung des Farbstoffes ist diese unerlässlich, für
das FRET-System ist keine Interaktion der Farbstoffe mit den Nukleotiden von Nöten.
55
Ergebnisse und Diskussion
N
MR 121
N
O
N
Nukleotide
Abbildung 4.1.4: Komplexbildung zwischen MR 121 und Guanosin
Der Farbstoff MR 121 ist so konstruiert, dass die π-π−Interaktion mit dem
Guanosinnukleotid
möglichst
ungestört
ist.
Auf
weitere
Gruppen
an
dem
aromatischen Grundgerüst wurde deshalb verzichtet.
Damit die zeitliche Konformationsdynamik nicht herausgemittelt wird, werden die
beiden Systeme mit Hilfe der Fluoreszenzeinzelmolekülspektroskopie untersucht. Um
Änderungen auf der Sekunden-Zeitskala sehen zu können, werden die Moleküle auf
einer geeigneten Oberfläche immobilisiert. Die Oberfläche wird mit der in Kapitel 3.2
beschriebenen Detektionsanlage aufgenommen. Bei der unten gezeigten Oberfläche
wird der FRET-Hairpin in Tris – Puffer mit 200 mM KCl vermessen, mit einer mittleren
Laserleistung von 10µW. Die Sammelzeit pro Pixel beträgt 1 ms. Die Größe des
Bildes beträgt 10 x 10 µm mit einer Auflösung von 200 x 200 Punkten. Die
Immobilisierung erfolgt über Biotin/Streptavidin. Eine Schicht aus BSA/BSA-Biotin
wird absorptiv auf die Oberfläche aufgebracht. An das Biotin bindet das Streptavidin
mit hoher Affinität. Da Streptavidin bis zu vier Biotinmoleküle binden kann, können
biotinylierte Proben auf diese Art und Weise an Streptavidin gebunden und dadurch
immobilisiert werden.
56
Ergebnisse und Diskussion
Abbildung 4.1.5: Der FRET-Hairpin immobilsiert auf der BSA-Oberfläche 10 x 10 µm, 50nm/Pixel, 5µW Anregungsleistung,
532nm
In Abbildung 4.1.5 sind deutlich mehrere Spots auf der Oberfläche zu sehen. Im
Ensemble ist eine 80% FRET-Effizienz zu sehen. Es ist zu erwarten, dass
hauptsächlich der Akzeptor Cy5 rot leuchtet. Deutlich ist aber nur grüne Fluoreszenz
zu sehen. Um zu klären, ob der Akzeptor überhaupt vorhanden ist, wird die gleiche
Stelle der Oberfläche nochmals vermessen. Diesmal wird der Akzeptor direkt
angeregt.
Abbildung 4.1.6: Der FRET-Hairpin immobilsiert auf der BSA-Oberfläche 10 x 10 µm, 50nm/Pixel, 5µW Anregungsleistung
Laserdiode 635nm
57
Ergebnisse und Diskussion
Die Oberfläche zeigt keine fluoreszierenden Spots. Eine Wiederholung der Messung
mit Anregung im grünen Spektralbereich zeigt das gleiche Muster auf der Oberfläche.
D.h. man hatte die ganze Zeit die gleiche Stelle der Oberfläche gescannt und man
sieht keinen FRET, da kein Akzeptor vorhanden ist.
Literaturstudien zeigten, dass Cy5 stark sauerstoffempfindlich ist. Wird der Farbstoff
in Gegenwart von Sauerstoff angeregt, so wird er schnell irreversibel oxidiert. Durch
Entfernung des Sauerstoffes wird Cy5 wesentlich photostabiler, hat aber dann
längere Triplets, d.h. man benötigt den Tripletlöcher β-Mercaptoethylamin (MEA). Der
im Wasser gelöste Sauerstoff wird durch das Enzym Glukoseoxidase entfernt
[Ha 2002]. Dieses Enzym oxidiert Glukose mit Hilfe von molekularem Sauerstoff zu
Glukonsäure auf. Erste Messungen zeigten, dass von der Glukoseoxidase selber
Fluoreszenz ausgeht. Daraufhin wurde die Fluoreszenz der Glukoseoxidase näher
untersucht.
4.2 Die intrinsische Fluoreszenz der Glukoseoxidase aus Apergillus Niger
Cy5 ist ein Farbstoff, der äußerst photolabil ist. Durch Entfernen von Sauerstoff kann
die
Photostabilität
erheblich
gesteigert
werden.
Dies
geschieht
indem
Glukoseoxidase den Sauerstoff zu Wasserstoffperoxid reduziert und anschließend
Glukose zu Glukonsäure oxidiert. Von der Glukoseoxidase geht selber Fluoreszenz
aus, so dass Messungen stark gestört werden (Abb. 4.2.1).
58
Ergebnisse und Diskussion
160
140
Intensität
120
100
80
60
40
20
0
500
550
600
650
700
750
800
Wellenlänge [nm]
Abbildung 4.2.1: Fluoreszenz der Glukoseoxidase, Anregung bei 450 nm
Die Röntgenstruktur von Glukoseoxidase aus Apergillus Niger offenbart die Ursache
der Fluoreszenz [Wohlfahrt 1999].
Abbildung 4.2.2: Röntgenstruktur der Glukoseoxidase mit ihren 3 Untereinheiten Flavin-Adenosin-Dinukleotid, α-D-Mannose, NAcetyl-D-Glucosamin
59
Ergebnisse und Diskussion
Glukoseoxidase ist ein Homodimer mit jeweils 80kDa und 3 Untereinheiten : FlavinAdenosin-Dinukleotid, α-D-Mannose, N-Acetyl-D-Glucosamin. Das Flavin-Adenosin
Dinukleotid ist für die Fluoreszenz verantwortlich.
220
200
180
160
Intensität
140
120
100
80
60
40
20
0
450
500
550
600
650
700
750
800
Wellenlänge [nm]
Abbildung 4.2.3: Fluoreszenz des Flavin-Adenosin-Dinukleotid (Anregung bei 450 nm).
Abbildung 4.2.4: Struktur von Flavin-Adenosin-Dinukleotid
60
Ergebnisse und Diskussion
Das
Flavin-Adenosin-Dinukleotid
[Tittmann 2000].
In
einer
liegt
oxidierten
in
zwei
und
in
verschiedenen
einer
Formen
vor
Form.
Als
reduzierten
Reduktionsreagenz wird Natriumdithionit [Kim 1995] verwendet.
O
O
H
N
N
HN
O
HN
N
H
N
O
N
N
R
R
FADH2
FAD
Abbildung 4.2.5: Reduziertes und oxidiertes Flavin-Adenosin-Dinukleotid (FAD)
Die Absorptions- und Fluoreszenzspektren dieser beiden Verbindungen sehen völlig
verschieden aus. Flavin-Adenosin-Dinukleotid zeigt vier Absorptionsmaxima bei
450 nm, 375 nm 265 nm, und 212 nm. Bei der reduzierten Form ist bei 450 nm und
375 nm keine Absorption festzustellen, wobei die Absorption bei 265 nm noch
vorhanden ist. Der Vergleich mit ATP zeigt, dass diese Absorptionsbande vom ATP
stammt. Die starke Absorption bei 315 nm stammt von Natriumdithionit, dass als
Reduktionsreagenz eingesetzt wurde.
Flavin oxidiert
Flavin + Dithionit
ox Flavin + ox Dithionit
Dithionit
2,5
Absorption
2,0
1,5
1,0
0,5
0,0
200
300
400
500
Wellenlänge[nm]
Abbildung 4.2.6: Oxidiertes und reduziertes Flavin
61
Ergebnisse und Diskussion
Die Fluoreszenzen der beiden Spezies unterscheiden sich ebenfalls. Das FAD zeigt
eine starke Fluoreszenz bei 530 nm, wobei die unterschiedlichen Absorptionen zu
gleichen Fluoreszenzspektren führen.
Fluoreszenz 450
Fluoreszenz 375
Fluoreszenz 265
Fluoreszenz 212
Abs
600
Intensiät/Absorption
500
400
300
200
100
0
200
300
400
500
600
700
800
Wellenlänge [nm]
Abbildung 4.2.7: Fluoreszenz bei verschiedenen Anregungswellenlängen
Die reduzierte Form des Flavin (FADH2) zeigt keine Fluoreszenz.
Flavin + Dithionit
Flavin + Dithionit
ox Flavin
ox Flavin
Absorption / Fluoreszenz
20
15
10
5
0
200
300
400
500
600
700
800
Wellenlänge [nm]
Abbildung 4.2.8: Absorptions- und Fluoreszenzspektrum von FAD und FADH2
Erstaunlich ist, wie oxidationsempfindlich das FADH2 ist. Gibt man zu einer FADLösung Natriumdithionit, so nimmt die Fluoreszenz schnell ab. Leitet man
62
Ergebnisse und Diskussion
anschließend Luft durch die Lösung, so steigt die Fluoreszenz wieder an und erreicht
nach wenigen Sekunden ihren ursprünglichen Wert.
Oxidationsempfindlichkeit von Flavin
Zugabe von Dithionit
Fluoreszenzintensität bei 530 nm
Anregung bei 450 nm
400
300
Luft wird durch
die Probe geleitet
200
100
0
0
2
4
6
8
10
Zeit [min]
Abbildung 4.2.9: Änderung der Fluoreszenzintensität in Abhängigkeit der Zeit. Anregung: 450 nm Detektion: 530 nm nach 1
min Zugabe von Natriumdithionit nach 4 min Durchleitung von Luft.
Der Vergleich von Glukoseoxidase mit dem Flavin-Adenosin-Dinukleotid zeigt, das
die Absorptionsspektren oberhalb von 300 nm exakt übereinstimmen. Der einzige
Unterschied ist die Proteinabsorption unterhalb 300 nm (Abb. 4.2.10).
2,4
2,2
Flavin ox
Flavin red
Glucoseoxidase ox
Glucoseoxidase red
2,0
1,8
Absorption
1,6
1,4
1,2
1,0
0,8
0,6
0,4
0,2
0,0
200
250
300
350
400
450
500
550
600
Wellenlänge[nm]
Abbildung 4.2.10: Vergleich der Absorptionsspektren von Flavin und Glukoseoxidase in der oxidierten und reduzierten Form
63
Ergebnisse und Diskussion
Durch Zugabe von Glukose zum Enzym wird das FAD reduziert, was sich in der
Abnahme der Absorption bei 375 nm und 450 nm zeigt. Eine vollständige Reduktion
ist aber nicht möglich. Erst durch Zugabe von Natriumdithionit kann die Absorption
völlig unterdrückt werden.
Glucoseoxidase
+ Katalase
+ Glucose
+ Dithionit
Absorption
2,0
1,5
1,0
0,5
0,0
200
300
400
500
600
700
800
Wellenlänge [nm]
Abbildung4.2.11: Vergleich der Absorptionsspektren von Glukoseoxidase mit verschiedenen Additiven
Das Fluoreszenzspektrum beider Verbindungen zeigt die gleiche Form der Kurve und
einen gleich großen Stokes-Shift.
180
Flawin
Glucoseoxidase
160
140
Intensität
120
100
80
60
40
20
0
450
500
550
600
650
700
750
800
Wellenlänge [nm]
Abbildung 4.2.12: Vergleich der Fluoreszenzspektren von Flavin und Glukoseoxidase in der oxidierten und reduzierten Form
64
Ergebnisse und Diskussion
Glucoseoxidase
+ Katalase
+ Glucose
+ Dithionit
180
160
140
Intensität
120
100
80
60
40
20
0
450
500
550
600
650
700
750
800
850
Wellenlänge [nm]
Abbildung 4.2.13: Fluoreszenz der Glukoseoxidase mit verschiedenen Additiven
Durch
die
Zugabe
von
Glukose
steigt
die
Fluoreszenz
an,
obwohl
die
Glukoseoxidase verdünnt wird. Nach 45 Minuten kontinuierlicher Abnahme der
Fluoreszenz nimmt diese wieder sprunghaft zu. Die Zugabe von weiterem Zucker
kann den Fluoreszenzanstieg nicht aufhalten. Das Enzym ist nicht mehr stabil.
240
Zugabe von Glucose
Intensität bei 525nm
220
200
180
160
140
0
5
10
15
20
25
30
35
40
45
50
Zeit [min]
Abbildung 4.2.14: Zeitliche Änderung der Fluoreszenz der Glukoseoxidase, Anregung: 450 nm Dedektion: 525 nm
65
Ergebnisse und Diskussion
Durch Zugabe von Natriumdithionit wird das Flavin in der Glukoseoxidase ebenfalls
reduziert. Dies ist erstaunlich, da das Flavin im Innern des Enzyms lokalisiert ist und
durch α-Helices abgeschirmt wird. Die Zugabe von Natriumdithionit inhibiert nicht die
Enzymreaktion. Die Zugabe von Katalase ändert die Zeit bis zum Fluoreszenzanstieg
nicht. Auch die Zugabe von Ascorbinsäure als Radikalfänger ändert nicht das
Verhalten der Glukoseoxidase. Offensichtlich ist die Zerstörung der Glukoseoxidase
durch das bei der Sauerstoffumsetzung gebildete Wasserstoffperoxid nicht der
limitierende Schritt, denn dann müsste sowohl zusätzliche Katalase als auch
Ascorbinsäure einen positiven Effekt haben. Auch der vollständige Umsatz des
Zuckers kann nicht der Grund sein, da eine Zufuhr von weiterem Zucker keinen
Einfluss hat. Der Anstieg der Fluoreszenz bei Zugabe von sowohl Zucker als auch
Ascorbinsäure und die Verzögerung des Anstieges der Fluoreszenz bei einem
erhöhten Glycerinanteil und der Zugabe von Tween 20 spricht für eine hydrophobe
Wechselwirkung der Glukoseoxidasen untereinander, die zu einer Clusterbildung
führt. Weshalb es zu einer Clusterbildung im Verlauf der Zeit kommt, ist nicht ganz
klar.
66
Ergebnisse und Diskussion
1000
800
600
400
200
0
200 µl Glucose
0
100
200
300
1000
800
600
400
200
0
500
400 µl Glucose
0
100
200
300
1000
800
600
400
200
0
400
500
400 µl Glucose (+ weitere Katalase)
0
Intensität bei 525 nm
400
100
200
300
800
600
400
200
0
400
500
400 µl Glucose (+ Dithionit)
0
100
200
300
1000
800
600
400
200
0
400
500
5% Glycerin + Dithionit
0
100
200
300
1000
800
600
400
200
0
400
500
5% Glycerin + Dithionit + Katalase
0
100
200
300
800
600
400
200
0
400
500
5% Glycerin + Dithionit + Ascorbinsäure
0
100
1000
800
600
400
200
0
200
300
400
500
400
500
17% Glycerin + Dithionit
+ 0,025Vol% Tween 20
0
100
200
300
Zeit [min]
Abbildung 4.2.15: Vergleich der Änderung der Fluoreszenz im Verlauf der Zeit unter verschiedenen Bedingungen
67
Ergebnisse und Diskussion
Einzelmolekülmessungen bestätigen, dass die Glukoseoxidase im Verlauf der Zeit
Cluster bildet.
Summe
grüner Kanal
rot Kanal
Intensiät
[Anzahl Photonen 1ms binning]
120
100
80
60
40
20
0
0
200
400
600
800
1000
Zeit [ms]
Abbildung 4.2.16: Einzelmolekülspur von Glukoseoxidase in Tris HCl – Puffer mit 25 mM KCl und 10 vol% Glycerin bei 100 µW
Anregungsleistung bei 532 nm
Obwohl die Absorption bei 532 nm sehr schlecht ist, sieht man einzelne Cluster
durch den Fokus diffundieren.
Intensiät
[Anzahl Photonen pro ms bin]
120
100
80
60
40
20
0
0
200
400
600
800
1000
Zeit [ms]
Abbildung 4.2.17: Einzelmolekülspur von Glukoseoxidase in Tris HCl – Puffer mit 25 mM KCl und 10 vol% Glycerin 40 µl
Dithionit bei 100 µW Anregungsleistung nach 5 h
68
Ergebnisse und Diskussion
Eine Erwärmung des Enzyms auf 35°C bewirkt keinen Anstieg der Fluoreszenz. Im
Gegenteil, die Aktivität der Glukoseoxidase wird erhöht, was eine Verringerung der
Fluoreszenzintensität
Fluoreszenz zur Folge hat.
22
20
18
16
14
12
10
8
6
0
500
1000
1500
2000
2500
3000
3500
4000
Zeit [min]
Abbildung 4.2.18: Fluoreszenz der Glukoseoxidase im Verlauf der Zeit bei 35 °C.
Die Messung der Quantenausbeute zeigt, weshalb die Glukoseoxidase so gute
Signale ergibt. Die Quantenausbeute von Vitamin B2 beträgt bis zu 80 %.
100
Quantenausbeute
80
60
40
20
0
150
200
250
300
350
400
450
500
550
Wellenlänge [nm]
Abbildung 4.2.19: Quantenausbeute von Vitamin B2
Im Enzym ist diese Quantenausbeute niedriger. Dies liegt hauptsächlich daran, dass
Flavin durch Tryptophan gequencht wird.
69
Ergebnisse und Diskussion
3,0
2,5
Lineare Regression für Data2_L:
Y=A+B*X
2,0
Parameter
Wert Fehler
-----------------------------------------------------------A
0,9365 0,01226
B
0,02379
3,32745E-4
------------------------------------------------------------
1,5
R
SD
N
P
-----------------------------------------------------------0,99795
0,03907
23
<0.0001
------------------------------------------------------------
1,0
-10
0
10
20
30
40
50
60
70
80
Konzentration Tryptophan [mM]
Abbildung 4.2.20: Stern -Volmer- Plot von Flavin-Adenosin-Dinukleotid mit Tryptophan
Zusammenfassend lässt sich sagen, dass nun klar ist, woher die Fluoreszenz der
Glukoseoxidase stammt. Es ist keine Verunreinigung des Enzyms, sondern ein
integraler Bestandteil, der für die Funktion des Enzyms unerlässlich ist. Des weitern
ist nun klar, wie diese Fluoreszenz zu unterdrücken ist, indem das Coenzym FlavinAdenosin-Dinukleotid durch das Reduktionsmittel Natriumdithionit in eine nicht
fluoreszente Formt umwandelt wird, die zugleich katalytisch aktiv den Sauerstoff
umsetzt. Dadurch ist die Nutzung der Glukoseoxidase für die Erhöhung der
Photostabilität von Cy5 möglich.
4.3 Untersuchung des FRET-Hairpins auf Einzelmolekülebene
Wendet man die Technik der Glukoseoxidase auf die Oberflächen mit den
immobilisierten FRET-Hairpins an, erhält man viele deutlich rot fluoreszierende Spots
(Abb. 4.3.1). Die Oberfläche hat eine Größe von 10 x 10 µm bei einer Auflösung von
50 nm/Pixel. Die Integrationszeit pro Pixel beträgt 1ms und wird mit einem
frequenzverdoppeltem Nd:YAG durchgeführt.
70
Ergebnisse und Diskussion
Abbildung 4.3.1: Auf BSA-Oberfläche immobilisierte FRET-Hairpins in Tris-Puffer 200 mM KCl, 10 x 10 µm, 50 nm/Pixel, 5 µW
532 nm
Das im Methodenteil beschriebene Verfahren zur Spoterkennung wird auf das
Fluoreszenzbild (Abb. 4.3.1) angewendet. Für die Analyse diese Bildes wurde jeder
helle Spot verwertet, der mindestens einen Pixel mit mehr als 10 Photonen hat. Aus
diesen Daten wird anschließend ein Histogramm über die Verteilung des F2-Wertes
erzeugt. Für die Berechnung des F2 – Wertes wird die Intensität aus Kanal 2 durch
die Gesamtintensität geteilt. Damit ist der F2 – Wert nichts anderes als die FRETEffizienz. Das Histogramm zeigt deutlich einen hohen Anteil von Molekülen, die
FRET zeigen. 70 % aller Moleküle haben einen F2-Wert der größer als 0,4 ist. Der
Mittelwert des F2-Wertes der roten Spezies ist 0,73 und der Mittelwert der grünen
Spezies 0,13.
7
6
Häufigkeit
5
4
3
2
1
0
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0,9
1,0
F2-Wert
Abbildung 4.3.2: Histogramm der Häufigkeit des F2-Wertes der Oberfläche 4.3.1
71
Ergebnisse und Diskussion
Unter diesen Bedingungen, d.h. in Gegenwart von 200mM KCl, erwartet man, dass
der DNA-Hairpin-Stamm so stabilisiert worden ist, dass keine Fluktuationen in der
Konformation auftreten. Deshalb kann man davon ausgehen, dass der Peak um 0,13
aus der Photozerstörung des Akzeptors hervorgeht. In Bezug auf die 100%-ige
Photozerstörung ohne die Glukoseoxidase ist, dies eine beachtliche Zunahme der
Photostabilität.
Um aber auch langsamerere Veränderungen der Fluoreszenz und damit die
Konformation des Hairpins verfolgen zu können, werden nicht nur Oberflächen
abgescannt, sondern man betrachtet die Fluoreszenzintensität eines einzelnen
Moleküls
in
Abhängigkeit
von
der
Zeit.
Dadurch
erhält
man
eine
Fluoreszenzintensitätsspur (Abb. 4.3.3):
60
Intensität (10ms)
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10 11 12 13
14 15 16
Zeit [s]
Abbildung 4.3.3: Einzelmolekülspur eines FRET-Hairpins in Tris Puffer 200 mM KCl 5 µW, 532 nm 10 ms Binning, nach 15,5
Sekunden tritt die Photozerstörung des Akzeptors ein.
Man sieht, dass die rote Fluoreszenzintensität im Mittel 30 Photonen pro 10 ms (3
kHz) beträgt. Im grünen Kanal erhält man mit 7 - 8 Photonen deutlich weniger Signal.
Daraus lässt sich ein F2-Wert von 0,8 berechnen. Das ist ein deutlich höherer Wert
als der aus der Oberfläche bestimmte. Dies liegt daran, dass beim „Spotpicken“ sehr
viele Pixel eine niedrige Fluoreszenzintensität haben und nur wenige Pixel im
Zentrum eine annähernd gleiche Fluoreszenzintensität aufweisen. Dadurch wird das
72
Ergebnisse und Diskussion
Signal-zu-Hintergrund-Verhältnis schlechter und der F2-Wert sinkt. Der F2-Wert von
0,8 ist jetzt exakt der gleiche Wert, der aus den Ensemble-Daten bestimmt wurde.
400
Häufigkeit
300
200
100
0
0,0
0,2
0,4
0,6
0,8
1,0
F2-Wert
Abbildung 4.3.4: Histogramm der Häufigkeit des F2-Wertes der Spur 4.3.3
Histogrammiert man die F2-Werte, erhält man wieder eine Verteilung. Eine zweite
Spezies ist nicht zu erkennen. F2-Wert Histogramme von reinen Farbstoffen sehen
ähnlich aus. Fluktuationen sind also nicht im Histogramm erkennbar. Entweder hat
man ein starres System oder die Fluktuationen finden im Submillisekundenbereich
statt und werden dadurch bei der verwendeten Intergrationszeit von 10 ms
herausgemittelt. Aus diesem Grund werden die Fluoreszenzintensitätsspuren im
FiFO-Mode aufgenommen. Dadurch hat man nicht nur die Möglichkeit die Spuren zu
generieren, sondern auch andere Analysemethoden wie die Autokorrelation (FCS)
auf die Daten anzuwenden (Abb. 4.3.5). Wallace et al. haben hierbei Fluktuationen
für DNA-Hairpins in Lösung im Mikrosekundenbereich gefunden [Wallace 2001].
Durch FCS ist es möglich, diese aus den Spuren sichtbar zu machen. Findet man
ähnliche Fluktuationen, ist dies ein Hinweis, dass Oberflächenwechselwirkungen die
Funktionsweise eines DNA – Hairpins nicht beeinträchtigen.
73
Ergebnisse und Diskussion
0,7
Model: ExpDec2
0,6
0,5
G(t)
0,4
Chi^2
R^2
= 0.00144
= 0.96094
y0
A1
t1
A2
t2
0.00319
0.33623
0.46879
0.23137
0.02019
±0.00595
±0.02743
±0.07781
±0.03225
±0.00708
0,3
0,2
0,1
0,0
1E-4
1E-3
0,01
0,1
1
10
100
1000
Zeit [ms]
Abbildung 4.3.5: Autokorrelation der Spur 4.3.3
Die Autokorrelation in Abbildung 4.3.5 zeigt, dass im Millisekundenbereich keine
Fluktuationsänderungen stattfinden. Der Fit der Daten zeigt zwei verschiedene
Fluktuationen bei 450 µs und bei 20 µs. Eine Aussage über die Art der Änderung gibt
die Autokorrelation nicht. Daher ist die Ursache unklar und es kann nur darüber
spekuliert werden. Auch ist unklar, ob es sich nur um die beiden verschiedenen
Fluktuationen handelt, die für den Fit angenommen werden, oder ob es noch andere
Veränderungen mit verschiedenen Ursachen gibt, die aber aufgrund der wenigen
Photonen innerhalb einer Spur nicht sicher aufgelöst werden können. Klar ist nur,
dass eine Fluktuation der FRET – Effizienz im hohen µs Bereich stattfindet.
Wird die Öffnungs- und Schließungskinetik des Hairpins in diesen Fluktuationen
wiedergegeben? Um diese Frage zu beantworten, muss man die Stabilität des
Hairpins verringern. Dies kann man auf verschiedene Weisen machen. Man kann die
Temperatur erhöhen, denaturierende Substanzen zugeben oder die Ionenstärke
verringern. Um diesen Effekt auf den Hairpin genauer zu verstehen, wird eine
Schmelzkurve des Hairpins unter zwei verschiedenen Bedingungen gemessen.
Einmal wird der Schmelzpunkt in reinem Tris-Puffer bestimmt und zum anderen mit
zusätzlich 200mM Kaliumchlorid (Abb. 4.3.6).
74
Ergebnisse und Diskussion
Schmelzkurven
1,0
200mM KCl
0mM KCl
Fret - Effizienz
0,8
0,6
0,4
0,2
0,0
0
10
20
30
40
50
60
70
80
Temperatur [°C]
Abbildung 4.3.6: Schmelzkurven des FRET-Hairpins in Hochsalz und Niedrigsalz
Deutlich ist der Unterschied in den Schmelztemperaturen zu sehen. Einmal liegt er
bei 28 °C und mit 200 mM KCL um 10 °C höher bei 38 °C. Setzt man die
Salzkonzentration herab, sollten vermehrt Fluktuationen aufgrund der Öffnung und
Schließung des Hairpins auftreten.
Die in Abbildung 4.3.7 dargestellte Oberfläche zeigt einen 10 x 10 µm Scan
immobilisierter DNA-Hairpins unter Niedersalzbedingungen mit einer Auflösung von
50 nm. Die Integrationszeit ist 1 ms bei 5 µW Anregungsleistung bei 532 nm.
Deutlich sind mehrere Spots zu sehen, die rot gefärbt sind, d.h. eine hohe FRETEffizienz aufzeigen.
75
Ergebnisse und Diskussion
Abbildung 4.3.7: Immobilisierte Hairpins in Tris-Puffer, 10 x 10 µm, 50 nm/Pixel, 5 µW, 532 nm, 1 ms Integrationszeit pro Pixel
Betrachtet man sich einige Spots genauer, so sieht man, dass immer wieder einzelne
Pixel keinen FRET zeigen. Meistens hat man mehrere rote Pixel und dann ein, zwei
manchmal bis zu 10 Pixel rein grüne Fluoreszenz. Offensichtlich ändert sich die
Konformation langsam im Verlauf der Zeit.
Abbildung 4.3.8: Immobilisierter Hairpin in Tris-Puffer, 10 x 10 µm, 50nm/Pixel, 5µW, 532nm, 1ms Integrationszeit pro Pixel
Analysiert man die Spots mit Hilfe von einem F2-Wert-Histogramm, so erhält man
wieder deutlich zwei verschiedene Spezies mit einem F2-Wert von 0,66 und 0,14.
76
Ergebnisse und Diskussion
7
6
Häufigkeit
5
4
3
2
1
0
0,0
0,2
0,4
0,6
0,8
1,0
F2-Wert
Abbildung 4.3.9: Histogramm der Häufigkeit der F2-Verteilung der Oberfläche von Abb. 4.3.7
Im Vergleich zur Oberfläche mit 200 mM KCl ist das Maximum des Peaks um 0,66
leicht grün verschoben (0,1) und asymmetrisch verbreitert. Diese Verschiebung
deutet an, dass die Stabilität des Hairpins deutlich verringert ist und das Öffnen und
Schließen des Systems erheblich öfter zu beobachten ist. Der Peak bei 0,13 bleibt
unverändert und repräsentiert die Moleküle, die nur einen Donor besitzen bzw. die
schnelle Photozerstörung des Akzeptors.
Auch
ohne
Anwesenheit
von
Kaliumchlorid
im
Medium
werden
Spuren
aufgenommen um konformative Änderungen im Verlauf der Zeit verfolgen zu können
(Abb. 4.3.10).
77
Ergebnisse und Diskussion
Fluoreszenzintensität pro 50 ms
[Anzahl Photonen]
250
200
150
100
50
0
0
1
2
3
4
5
6
7
8
9
10
11
12
Zeit [s]
Abbildung 4.3.10: Zeitlicher Verlauf der Fluoreszenzintensität des Donors Cy3 und Akzeptors Cy5 im FRET-Hairpin in TrisPuffer, 10 ms Binning, 5µW Anregungsleistung, 532nm
Am Anfang zeigt die Spur einen hohen FRET, d.h. der Hairpin ist geschlossen. Nach
2 s ändert sich die FRET – Effizienz, was auf eine Öffnung des Hairpins hinweist.
Nach weiteren 2,5 Sekunden ändert sich die Konformation wieder und der Hairpin
wird zum zweiten Mal für 0,1 s geöffnet. Nach weiteren 0,75 s öffnet sich der Hairpin
zum dritten Mal. Diesmal für 0,2 s. Nach insgesamt 11 s wird der Donor
photozerstört, da anschließend keine Donorfluoreszenz vorhanden ist. Um sicher zu
gehen, dass der Farbstoff wirklich gebleicht worden ist, wird die Spur noch weitere
40s beobachtet ( Nicht in der Grafik dargestellt).
Die meisten Spuren zeigen kurze Phasen des geöffneten Hairpins. Einige wenige
zeigen jedoch auch längere Phasen, in denen die FRET-Effizienz gering, d.h. der
Abstand zwischen den Farbstoffen groß ist (Abb. 4.3.10).
78
Ergebnisse und Diskussion
200
grüner Kanal
roter Kanal
Anzahl Photonen pro 50 ms
175
150
125
100
75
50
25
0
0
1
2
3
4
5
6
7
8
9
10
11
12
Zeit[s]
Abbildung 4.3.11: Zeitlicher Verlauf der Fluoreszenzintensität zweier Wellenlängenbereiche von FRET-Hairpin in Tris-Puffer, 10
ms Binning, 5µW Anregungsleistung, 532nm
Am Anfang zeigt die Spur einen hohen FRET. Nach 8,5 s ändert sich dies abrupt in
einen Zustand, der keinen FRET mehr aufweist – der Hairpin ist geöffnet. Nach
weiteren 2,5 Sekunden wechselt der Hairpin wieder zurück in seinen ursprünglichen
Zustand mit einer hohen FRET-Effizienz.
120
110
100
90
Häufigkeit
80
70
60
50
40
30
20
10
0
0,0
0,2
0,4
0,6
0,8
1,0
F2-Wert
Abbildung 4.3.12: Histogramm der Häufigkeit des F2-Wertes aus Spur 4.3.11
79
Ergebnisse und Diskussion
Auch das F2 – Wert Histogramm verdeutlicht diese beiden Zustände. Das
Histogramm enthält zwei Peaks bei 0,75 und bei 0,15, d.h. eine rein rote und rein
grüne Spezies. Die Abweichung der Werte von diesen beiden Maxima ist sehr
gering.
Histogrammiert man die Zeiten, in denen der Hairpin geschlossen ist, also einen
hohen FRET – Anteil aufweist, aus 390 Spuren, erhält man das Histogramm aus
Abb. 4.3.13. Es zeigt die Kinetik des Öffnens des Hairpins.
100
Model: ExpDec1
Chi^2
R^2
= 16.23764
= 0.95127
y0
A
t0
0
±0
97.87009
3.35396
±4.53357
±0.21805
Häufigkeit
10
1
0
5
10
15
20
25
30
35
40
45
Zeit [s]
mit hohem FRET
Abbildung 4.3.13: Histogramm der Häufigkeit der Zeiten indem der FRET-Hairpin geschlossen ist.
Für eine solche Kinetik erwartet man einen monoexponentiellen Abfall. Tatsächlich
sieht die Kurve eher nach einem bi- oder multiexponentiellen Abfall aus. Wie kommt
dieser Abfall zu stande? Die Spuren zeigen eine hohe FRET-Effizienz. Es kommt zur
Öffnung des Hairpins und dadurch zu niedriger FRET-Effizienz, der Hairpin schließt
sich wieder und man hat eine hohe FRET-Effizienz. Diese Phase wird aber jetzt
durch die Photozerstörung beendet und nicht durch das Öffnen des Hairpins. Der
Hairpin ist immer noch geschlossen. Nimmt man diese Zeiten aus der Statistik
heraus, verändert sich das Histogramm erheblich (Abb. 4.3.14).
80
Ergebnisse und Diskussion
Model: ExpDec1
Häufigkeit
10
Chi^2
R^2
= 2.33428
= 0.86141
y0
A
t0
0
±0
33.29168
0.16219
±2.52129
±0.01358
1
0,1
0,0
0,5
1,0
1,5
2,0
2,5
3,0
Zeit [s]
mit hohem FRET
ohne Photozerstörung
Abbildung 4.3.14: Histogramm der Häufigkeit der Zeiten, in demen der FRET-Hairpin geschlossen ist ohne Photozerstörung.
Betrachtet man das Histogramm für die Zeiten des geschlossenen Hairpins ohne
Photozerstörung, so nimmt die Steigung der Verteilung ab, obwohl der Prozess der
Photozerstörung eine Verkürzung der Zeiten zur Folge hat. Darüber hinaus zeigt die
Kurve kein exponentielles Verhalten. Lange Zeiten, in denen der Hairpin geschlossen
ist, sind überproportional vertreten.
Häufigkeit
10
1
0,1
0,1
1
Zeit [s]
mit hohem FRET
ohne Photozerstörung
Abbildung 4.3.15: Histogramm der Häufigkeit der Zeiten, in denen der FRET-Hairpin geschlossen ist.
81
Ergebnisse und Diskussion
D.h.
man
hat
keine
konstante
Geschwindigkeitskonstante,
sondern
eine
exponentielle Verteilung dieser Konstante. Dies ist nicht real, vor allem da die
meisten Spuren keine Fluktuationen zeigen, sondern die ganze Zeit geschlossen
sind. Deshalb ist die Photozerstörung der limitierende Faktor. Die Verteilung enthält
auch die Zeiten zwischen Start der Messung und dem Konformationswechsel. Beim
Start der Messung muss der Hairpin nicht unbedingt in offenem Zustand vorliegen.
Dieser willkürliche Start zusammen mit dem Konformationswechsel erklärt die
Verteilung im Histogramm. Eliminiert man auch diese Werte, so erhält man eine
nahezu leere Menge, aus der man keine Geschwindigkeitskonstante bestimmen
kann. Da die Geschwindigkeitskonstante der Photozerstörung offensichtlich kleiner
ist als die Geschwindigkeitskonstante der Öffnung des Hairpins kann man eine
untere Grenze der Öffnung des Hairpins festlegen.
Model: ExpDec1
Häufigkeit
10
Chi^2
R^2
= 9.03224
= 0.83634
y0
A
t0
0
±0
27.91735
8.61202
±2.05798
±0.89713
1
0,1
0
10
20
30
40
50
Zeit [s]
bis zur Photozustörung
Abbildung 4.3.16: Histogramm der Häufigkeit der Zeiten bis zur Photozerstörung des Akzeptors
Für die Photozerstörung erhält man einen Wert von k = 8,6 1/s. Erstellt man das
gleiche Histogramm für den geöffneten Hairpin, entfallen die o.a. Probleme, da diese
Zeiten wesentlich kürzer sind.
82
Ergebnisse und Diskussion
Data: Bin1_Counts1
Model: ExpDec1
Häufigkeit
10
Chi^2
R^2
= 3.77915
= 0.78956
y0
A
t0
0
±0
20.82515
1.28465
±1.54655
±0.13464
1
0
1
2
3
4
5
6
7
8
Zeit[s]
mit niedrigem FRET
Abbildung 4.3.17: Histogramm der Häufigkeit der Zeiten, in demen der FRET-Hairpin geöffnet ist
Als Geschwindigkeitskonstante für die Schließung des Hairpins erhält man k* = 1,3 ±
0,13 1/s. Mit Hilfe der Gleichgewichtskonstante aus der Schmelzkurve lässt sich die
Geschwindigkeitskonstante der Öffnung des Hairpins berechnen.
0,80
FRET-Effizienz Tris-Puffer 0mM KCl
0,75
0,70
0,65
FRET-Effizienz
0,60
0,55
0,50
0,45
0,40
0,35
0,30
0,25
0,20
10 15
20 25 30 35 40 45 50 55 60 65 70 75 80 85 90
Temperatur[°C]
Abbildung 4.3.18: Schmelzkurve des FRET-Hairpins
83
Ergebnisse und Diskussion
Die Messungen werden bei ~ 22 °C durchgeführt. Die Schmelzkurve ergibt eine
durchschnittliche FRET-Effizienz von 0,73. Betrachtet man die FRET – Effizienzen
bei 15 °C und 90 °C, so lässt sich der Anteil des geöffneten Hairpins herausrechnen.
Fret tris 0mM KCl 15°C
Fret tris 0mM KCl 90°C
Relative Fluoreszenzintensität
120
100
80
60
40
20
0
550
600
650
700
750
800
Wellenlänge
Abbildung 4.3.19: Fluoreszenzspektren des geöffneten und geschlossenen Hairpins
Im geschlossenen Zustand hat man eine FRET-Effizienz von 0,79. Der geöffnete
Hairpin zeigt eine FRET-Effizienz von 0,26. Der Anteil der geschlossen a und der
Anteil der offen b berechnet sich nach
a * 0,79 + b * 0,267 = 0,73
a +b =1
⇒ a * 0,79 + (1 − a ) * 0,26 = 0,73
0,53a = 0,47
a = 0,89
[Formel 4.3.20]
b = 0,11
D.h. der Hairpin ist unter diesen Bedingungen zu 89% geschlossen und zu 11%
geöffnet. Daraus lässt sich nun die Gleichgewichtskonstante berechnen:
K=
[Pr odukte]
[ Hairpin _ offen]
0,11
=
=
= 0,12
[ Edukte]
[ Hairpin _ geschlossen] 0,89
[Formel 4.3.21]
84
Ergebnisse und Diskussion
Aus der Gleichgewichtskonstante und der Schließungskinetik kann man jetzt die
Geschwindigkeitskonstante der Öffnung des Hairpins berechnen.
K=
k rück
k hin
1,3 1s
k
⇒ rück = k hin =
= 10,8 1s
K
0,12
[Formel 4.3.22]
Eine andere Möglichkeit den Hairpin zu öffnen, besteht in der Zugabe der
komplementären Gegensequenz. Die in Abbildung 4.3.23 dargestellte Oberfläche
zeigt einen 10 x 10 µm Scan mit einer Auflösung von 50 nm. Die Integrationszeit
beträgt 1 ms bei einer mittleren Anregungsleistung von 5 µW bei 532 nm.
Abbildung 4.3.23: Immobilisierter FRET-Hairpin mit Gegensequenz geöffnet, 200 x 200 Pixel, 50nm/Pixel, 5µW, 532 nm
Dabei ist deutlich zu sehen, dass nur noch der Donor leuchtet. Es findet aufgrund der
räumlichen Trennung kein Energietransfer zum Akzeptor statt (Abb. 4.3.23).
85
Ergebnisse und Diskussion
4,0
3,5
Häufigkeit
3,0
2,5
2,0
1,5
1,0
0,5
0,0
0,0
0,2
0,4
0,6
0,8
1,0
F2-Wert
Abbildung 4.3.24: Histogramm der Häufigkeit des F2-Wertes aus Oberfläche 4.3.19
Zur genaueren Analyse wurden die Spots wieder auf der Oberfläche durch das
Analyseprogramm
bestimmt
und
das
Ergebnis
im
Histogramm
dargestellt
(Abb. 4.3.24). Die Verteilung des F2-Wertes zeigt das Vorhandensein einer Spezies
mit einem F2-Wert von 0,1. Dieser geringe Wert zeigt, dass die beiden Farbstoffe so
weit auseinander liegen, dass es kaum noch zu einem Energieübertrag kommt.
Auch wenn man längere Zeit auf einem Spot verweilt, ändert sich die FRET-Effizienz
Anzahl Photonen (10ms)
nicht (Abb. 4.3.25).
80
60
40
20
0
0
2
4
6
8
10
12
14
16
Zeit [s]
Abbildung 4.3.25: Zeitliche Änderung der Fluoreszenz des FRET-Hairpins mit Gegensequenz, 200 x 200 Pixel, 50nm/Pixel, 5
µW, 532nm
Der Hairpin ist und bleibt die ganze Zeit offen bis zur Photozerstörung nach 15 s.
Auch Waschen der Oberfläche und Inkubation für 72 h in reinem Tris-Puffer zeigen
86
Ergebnisse und Diskussion
anschließend das gleiche Resultat. Das Histogramm zeigt eine enge Verteilung der
FRET-Effizienz um die 0,1 (Abb. 4.3.26).
250
Häufigkeit
200
150
100
50
0
0,0
0,2
0,4
0,6
0,8
1,0
F2 - Wert
Abbildung 4.3.26: Histogramm der Häufigkeit der FRET-Effizienz aus Spur 4.3.25
Die Autokorrelation der Daten aus Abb. 4.3.25 zeigt auch im hybridisierten Zustand
eine Fluktuationsdynamik im Mikrosekunden- bis Millisekundenbereich (Abb. 4.3.21),
die nicht auf das Öffnen bzw. Schließen des Hairpins zurückzuführen ist.
0,6
Data: Data1_B
Model: ExpDec3
0,5
0,4
G(t)
0,3
Chi^2
R^2
= 0.00044
= 0.98983
y0
A1
t1
A2
t2
A3
t3
0.00616
3.45782
0.00125
0.06378
2.17972
0.42585
0.00982
±0.00347
±0.47747
±0.00014
±0.00707
±0.78031
±0.06975
±0.00164
0,2
0,1
0,0
1E-3
0,01
0,1
1
10
100
Zeit [ms]
Abbildung 4.3.27: Autokorrelation der Spur 4.3.25
87
Ergebnisse und Diskussion
4.4 PET - Hairpins
Die erhaltenen Daten wurden in einem 2. Schritt mit denen des Elektron-TransferHairpins verglichen.
Auch diese Art von Hairpins besteht aus einem Stamm und einem Loop. An einem
Ende des Stammes ist der Farbstoff MR 121 am 5´-Ende lokalisiert, der durch die
Guanosine im gegenüberliegenden Strang gelöscht wird. An dem anderen Ende
schließt sich der Loop an den Stamm an, der, wie der FRET-Hairpin, aus 12
Thymidinen besteht.
( T) 12
T A
G
G
G
MR 121
G
T
T
T
Abbildung 4.4.1: Aufbau des PET-Hairpins
Auch dieser Hairpin trägt am 3´- Ende ein Biotin zur Verankerung auf der Oberfläche,
der über einen Thymidin–Linker mit dem Hairpin verbunden ist.
Der Hairpin wird wie die FRET-Hairpins in Tris-Puffer mit 200 mM KCl vermessen
(Abb. 4.4.2). Das Bild hat eine Größe von 400 x 400 Pixel mit einer Auflösung von 50
nm/Pixel. Die Integrationszeit pro Pixel beträgt 7 ms.
88
Ergebnisse und Diskussion
Abbildung 4.4.2: Immobilisierter PET-Hairpin in Tris-Puffer 200mM KCl, 10 x1 0 µm, 200 Pixel, 5 µW, 635nm
Obwohl die Fluoreszenz gequencht ist, sieht man noch Spots von einzelnen
Molekülen. Inhomogenitäten, vor allem zwischen verschiedenen Molekülen, aber
auch im Molekül selbst sind zu erkennen. Betrachtet man einzelne Moleküle
genauer, so sieht man sehr helle rote Pixel und manchmal sehr dunkle Pixel. Die
Grenzen zwischen Molekül und Oberfläche verwischen. Das System ist darauf
optimiert worden im geschlossenem Zustand nicht zu leuchten.
Abbildung 4.4.3: Immobilisierter PET-Hairpin in Tris-Puffer 200mM KCl, 10 x1 0 µm, 200 Pixel, 5 µW, 635nm
Die statistische Auswertung der Oberfläche zeigt eine mittlere Fluoreszenzintensität
von 400 Photonen pro Spot (Abb. 4.4.4).
89
Ergebnisse und Diskussion
5
4
Häufigkeit
3
2
1
0
0
50
100
150
200
250
300
350
400
450
500
550
600
Intensität
Abbildung 4.4.4: Spot – integrierte Photonenzahl des PET-Hairpins
Die Analyse weiterer Oberflächen zeigt, dass die Verteilung zu größeren Intensitäten
hin stark verbreitert ist, d.h. dass nicht nur eine Mittelung über 1 ms in jedem Pixel zu
kurz ist alle Fluktuationen herauszumitteln, sondern auch dass die Messzeit eines
Spots von einigen Sekunden zu kurz für eine Herausmittelung ist.
Die Fluoreszenzlebensdauer liegt bei 1,75 ns und weist, mit Ausnahme eines
Wertes, eine schmale Verteilung auf (Abb. 4.4.5).
4
Häufigkeit
3
2
1
0
1,5
2,0
2,5
3,0
Fluoreszenzlebensdauer
Abbildung 4.4.5: Häufigkeit der Fluoreszenzlebensdauer des PET-Hairpins
90
Ergebnisse und Diskussion
Betrachtet man die Fluoreszenz im Verlauf der Zeit, so sieht man, dass diese sich
Anzahl Photonen (50ms)
stark ändert (Abb. 4.4.6).
80
60
40
20
0
0
50
100
150
200
250
Zeit [s]
Abbildung 4.4.6: Zeitlicher Verlauf der Fluoreszenzintensität des PET-Hairpins
Die Spur in Abb. 4.4.6 zeigt mindestens 9 verschiedene Intensitätslevels. Nach 50 s
erscheint der 1. Wechsel der Intensität. Die Spur zeigt ein leicht verstärktes
Quenchverhalten.
Nach
weiteren
70
s
kommt
es
zum
2.
Wechsel
der
Fluoreszenzintensität. Dieser Zustand dauert nicht lange, denn nach 8 Sekunden
erhöht sich die Fluoreszenzintensität noch zwei Mal in kurzem Abstand und erreicht
ihr
Maximum,
das
mehr
als
doppelt
so
groß
ist
wie
die
minimale
Fluoreszenzintensität.
So starke und vor allem so viele Fluktuationen sind nicht erwartet worden und
machen eine genaue Auswertung der Daten schwierig.
91
Ergebnisse und Diskussion
0s bis 50 s
50s bis 120s
120s bis 128s
145s bis 170s
170s bis 197s
197s bis 219s
219s bis 235s
235s bis 276s
100
Anzahl Photonen
80
60
40
20
0
0
2
4
6
8
10
12
14
Zeit [ns]
Abbildung 4.4.7: Fluoreszenzabklingkurven der einzelnen Intensitätslevels des PET-Hairpins
Klar ist nur, dass die im Ensemble gemessenen Lebensdauern nur Mittelwerte aus
verschiedenen Lebensdauern sind, die aber so dicht beieinander liegen, dass sie
nicht aufgelöst werden können.
Die einzelnen Intensitätsabschnitte unterliegen einer starken Fluktuation.
0,6
0 bis 50s gefittet
50 bis 120s gefittet
128 bis 145s gefittet
145 bis 170s gefittet
170 bis 197s gefittet
197 bis 219s gefittet
219 bis 235s gefittet
235 bis 276s gefittet
0,5
G(t)
0,4
0,3
0,2
0,1
0,0
0,01
0,1
1
10
100
Zeit [ms]
Abbildung 4.4.8: Autokorrelation der einzelnen Intensitätslevels des PET-Hairpins
92
Ergebnisse und Diskussion
Die Autokorrelation der einzelnen Bereiche (Abb. 4.4.8) zeigt Fluktuationen im
Millisekunden- bis Mikrosekundenbereich.
tris 200 mM KCl
tris 0 mM KCL
1,0
0,8
0,6
0,4
0,2
-10
0
10
20
30
40
50
60
70
80
Temperatur [°C]
Abbildung 4.4.9: Schmelzkurven des PET-Hairpins in Tris-Puffer mit und ohne KCl
Verringert man die Salzkonzentration, so verringert sich auch der Schmelzpunkt. In
diesem Fall von 50°C auf 25°C (Abb. 4.4.9). Dadurch sollte man jetzt öfter Öffnungen
und wieder Schließungen des Hairpins beobachten können. Deshalb wird auch bei
diesem Hairpin die Messung in einem salzfreien Puffer wiederholt. Das Bild besteht
aus 200 x 200 Pixel mit einer Auflösung von 50 µm. Deutlich sind runde Spots zu
erkennen, die aber von der Intensitätsverteilung her sehr inhomogen sind und durch
das Quenching eine geringe Intensität aufweisen.
93
Ergebnisse und Diskussion
Abbildung 4.4.10: Oberfläche mit PET-Hairpin, Tris-Puffer, 200 x 200 Pixel, 50nm Auflösung, 5 µW, 635nm Anregung, 7
ms/Pixel
Einige Pixel in einem Spot sind wesentlich heller als andere. Es findet ein ständiger
Wechsel zwischen verschiedenen Konformationen statt.
Abbildung 4.4.11: Oberfläche mit PET-Hairpin, Tris-Puffer, 200 x 200 Pixel, 50nm Auflösung, 5 µW, 635nm Anregung, 7
ms/Pixel
Das Intensitätshistogramm der verschiedenen Spots spiegelt dieses Verhalten
deutlich wider (Abb. 4.4.11). Man erhält eine sehr breite Verteilung der
Fluoreszenzintensitäten um 350 Photonen mit einer Abweichung von 33 %. Dies ist
selbst für die Einzelmolekülspektroskopie sehr viel und zeigt die Inhomogenität der
Spots. Offensichtlich reicht die Zeit von mehreren Millisekunden nicht aus, diese
Inhomogenitäten herauszumitteln.
94
Ergebnisse und Diskussion
4,0
3,5
Häufigkeit
3,0
2,5
2,0
1,5
1,0
0,5
0,0
200
300
400
500
600
Fluoreszenzintensität
Abbildung 4.4.12: Histogramm der spot-integrierten Fluoreszenzintensitäten der Oberfläche 4.4.11
Da im Gegensatz zum FRET-Hairpin mit einer gepulsten roten Laserdiode gemessen
wird, erhält man auch Fluoreszenzlebensdauern.
5
Häufigkeit
4
3
2
1
0
1,0
1,5
2,0
2,5
3,0
Fluoreszenzlebensdauer
Abbildung 4.4.13: Histogramm der Fluoreszenzlebensdauer der Oberfläche 4.4.11
Das Maximum der Verteilung liegt bei 1,75 ns. Im Gegensatz zur Intensitätsverteilung
ist die Lebensdauerverteilung sehr schmal.
Die Beobachtung des Fluoreszenzverhaltens in Abhängigkeit mit der Zeit ergibt eine
ähnlich komplexe Spur wie der Hairpin unter Hochsalz, nur dass jetzt einige weitere
Intensitätslevel hinzugekommen sind, die eine hohe Fluoreszenzintensität aufweisen
(Abb.4.4.14).
95
Ergebnisse und Diskussion
140
Intensität (50ms)
120
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
Zeit [s]
Abbildung 4.4.14: Fluoreszenzspur des PET-Hairpins in Tris-Puffer, 5µW Anregungsleistung, 635nm, 50ms binning
Der Anfang der Spur ist ähnlich der Spur mit Hochsalz (Abb. 4.4.6). Etwa 8
verschiedene Intensitätslevel sind bis zur 50. Sekunde zu erkennen, die sich bis um
den Faktor 4 unterscheiden, aber alle eine Fluoreszenzlebensdauer von etwa 2 ns
haben. Danach kommen eine Reihe von Intensitätslevel, die im Durchschnitt um den
Faktor 3 bis 4 höher liegen, als die Intensitätslevel zuvor.
100
0 - 3s
3 - 6s
6 - 18s
25 - 32s
32 - 50s
51 - 52s
52 - 58s
58 - 64s
66 - 17s
rel. Anzahl Photonen
80
60
40
20
0
0
2
4
6
8
10
12
14
Zeit [ns]
Abbildung 4.4.15: Fluoreszenzabklingkurven des PET-Hairpins in Tris-Puffer, 5µW Anregungsleistung, 635nm
96
Ergebnisse und Diskussion
Diese Level zeigen eine lange Fluoreszenzlebensdauer um die 3 ns. Auch wenn die
Guanosine entfernt sind, so gibt es noch Cytosine, mit denen der Farbstoff eine
Wechselwirkung eingehen kann. Diese Wechselwirkung muss kein Quenchen sein.
Viele
Farbstoffe
haben
2
verschiedene
Quantenausbeuten
in
wässrigem
Lösungsmittel und organischen Lösungsmitteln wie Ethanol. Darüber hinaus kann
auch eine partielle Öffnung des Hairpins die Farbstoff - Guanosin Wechselwirkung
stören.
Für die unterschiedlichen Intensitätslevel im geschlossenen Zustand kommen
verschiedene Arten der Interaktion von Farbstoff und DNA in Frage.
Die klassische Interaktion von Farbstoff und DNA ist die Interkalation. Es wurden
viele
Farbstoffe
entwickelt,
um
DNA
anfärben
zu
können.
Viele
Röntgenstrukturanalysen von kurzen DNA – Oligomeren zeigen neben Interkalation
auch endcapping, aber es können sich auch Farbstoffe sowohl in die große als auch
in die kleine Furche legen. Man hat so 4 verschiedene Bindungsarten mit jeweils
einer eigenen Quantenausbeute und Fluoreszenzlebensdauer (Abb. 4.4.16).
MR 121
G
T
G
G
MR 121
MR 121
G
G
G
T
G
G
T
T
T
G
G
T
T
MR 121
G
G
T
T
T
T
G
G
MR 121
T
G
G
T
T
G
G
T
MR 121
G
G
T
T
T
Abbildung 4.4.16: Konformationen des PET-Hairpins
97
Ergebnisse und Diskussion
Die Spuren zeigen aber wesentlich mehr Intensitätslevel. Darüber hinaus dürften die
einzelnen Level keine Fluktuationen zeigen, außer den Fluktuationen, die aus der
Photophysik des Farbstoffes stammen. Dies ist aber nicht der Fall. Man sieht
Fluktuationen im µs bis ms Bereich (Abb. 4.4.17).
2,0
0 bis 3s gefittet
3 bis 6s gefittet
6 bis 18s gefittet
18 bis 26s gefittet
26 bis 33s gefittet
33 bis 51 gefittet
51 bis 58s gefittet
58 bis 64s gefittet
66 bis 71s gefittet
1,8
1,6
1,4
G(t)
1,2
1,0
0,8
0,6
0,4
0,2
0,0
1E-3
0,01
0,1
1
10
100
1000
Zeit [ms]
Abbildung 4.4.17: Autokorrelationen des PET-Hairpins in Tris-Puffer, 5µW Anregungsleistung, 635nm
Durch Zugabe einer DNA- Gegensequenz bestehend aus 30 Nukleotiden konnte
auch der Elektronen-Transfer-Hairpin geöffnet werden. Dadurch wird das Quenching
aufgehoben und man erhält eine Oberfläche mit sehr stark leuchtenden Spots.
Abbildung 4.4.18: Oberfläche mit PET-Hairpin mit Gegensequenz, Tris-Puffer, 200 x 200 Pixel, 50nm Auflösung, 5 µW, 635nm
Anregung, 7 ms/Pixel
98
Ergebnisse und Diskussion
Die genau Analyse der Oberfläche zeigt, dass die Durchschnittsintensität der Spots
bei etwa 1000 Photonen liegt. Bei den geschlossenen Hairpins sind es 300 Photonen
pro Spot. Dies entspricht einem 3-fachen Anstieg der Fluoreszenzintensität durch
das Öffnen des Hairpins, was in etwa auch dem Wert im Bulk entspricht.
50
45
40
35
Häufigkeit
30
25
20
15
10
5
0
200
400
600
800
1000 1200 1400
1600 1800 2000 2200
Fluoreszenzintensität
Abbildung 4.4.19: Histogramm der Fluoreszenzintensität der Oberfläche 4.4.18
Die Breite der Verteilung der Werte ist durch das Öffnen des Hairpins kleiner
geworden, wie man es für einen Farbstoff erwartet. Das zeigt, dass die
unterschiedlichen Intensitätslevel nicht von dem Farbstoff stammen, sondern von
verschiedenen Konformationen, die ein unterschiedliches Quenchingverhalten
haben.
Die Lebensdauer ist nochmals um 1,5 ns gestiegen und liegt jetzt bei 3,25 ns (Abb.
4.4.18).
99
Ergebnisse und Diskussion
20
Häufigkeit
15
10
5
0
0,0
0,5
1,0
1,5
2,0
2,5
3,0
3,5
4,0
4,5
5,0
Lebensdauer [ns]
Abbildung 4.4.20: Histogramm der Fluoreszenzlebensdauer der Oberfläche 4.4.18
Vergleicht man die unter verschiedenen Bedingungen gemessenen Spots, so sieht
man deutlich, dass der geschlossene Hairpin eine geringe Fluoreszenzintensität und
eine kurze Fluoreszenzlebensdauer hat. Durch Öffnung des Hairpins wird das
Quenchen aufgehoben, und sowohl die Fluoreszenzlebensdauer als auch die
Intensität erhöhen sich. Eine Unterscheidung ist einfach möglich (Abb. 4.4.21).
open
closed tris 0 mM KCl
closed tris 200 mM KCl
2000
Anzahl Photonen
1500
1000
500
0
1,0
1,5
2,0
2,5
3,0
3,5
4,0
4,5
5,0
Lebensdauer [ns]
Abbildung 4.4.21: Lebensdauer – Intensitäts- Schaubild des PET-Hairpins
Eine Änderung durch Salzentzug ist nicht so deutlich zu sehen wie bei dem FRETHairpin.
100
Ergebnisse und Diskussion
Durch Zugabe von Gegensequenz erhält man Spuren von geöffneten Hairpins
Anzahl Photonen (10ms)
(Abb. 4.4.22).
200
180
160
140
120
100
80
60
40
20
0
0
20
40
60
80
100
120
140
160
180
200
Zeit [s]
Abbildung 4.4.22: Fluoreszenzspur des mit Gegensequenz geöffneten Hairpins
Die Fluoreszenzlebensdauer ist mit 3,3 ns sehr lang. Die Fluoreszenzabklingkurve
zeigt einen monoexponetiellen Abfall (Abb. 4.4.23).
800
700
600
Häufigkeit
500
400
300
200
100
0
0
2
4
6
8
10
12
14
Zeit [ns]
Abbildung 4.4.23: Fluoreszenzabklingkurve des geöffneten Hairpins
101
Ergebnisse und Diskussion
Auch im geöffneten Zustand sind Fluktuationen in der Intensität zu beobachten, wie
die Autokorrelation in Abb. 4.4.24 zeigt.
0,08
y0
A1
t1
A2
t2
A3
t3
0,06
0,04
-0.00002
±0.00363
0.0066 ±0.02117
97.34925
±470.09228
0.00359
±0.02105
9.98363
±90.38189
0.02319
±0.01566
0.02476
±0.03014
G(t)
0,02
0,00
-0,02
-0,04
-0,06
0,01
0,1
1
10
100
1000
Zeit [ms]
Abbildung 4.4.24: Autokorrelationskurve des geöffneten Hairpins
Um zu bestimmen wie sensitiv das Verfahren zum Nachweis bestimmter
Zielsequenzen ist, werden die Hairpins mit Gegensequenz titriert. Dazu wird zur
Lösung über dem Hairpin die entsprechende Menge DNA zugegeben und sofort
gemessen.
102
Ergebnisse und Diskussion
20
10
0
ohne Gegensequenz
0
1
2
3
20
10
0
5
6
-14
1*10 MGegensequenz
0
Anzahl
Spots
4
1
2
3
20
10
0
4
5
6
-14
5*10 MGegensequenz
0
1
2
3
20
10
0
4
5
6
-13
1*10 MGegensequenz
0
1
2
3
20
10
0
4
5
6
-11
1*10 MGegensequenz
0
1
2
3
20
10
0
4
5
6
-11
5*10 MGegensequenz
0
1
2
3
4
5
6
Intensität in kHz
Schaubild 4.4.25: Titration des immoblisierten Hairpins mit Gegensequenz. Es wurde eine Oberfläche für 5 min mit
unterschiedlichen Konzentrationen von DNA – Gegensequenz inkubiert und anschließend die Oberflächen abgecannt. Die auf
der Oberfläche erhaltenen Spots wurden analysiert und das Fluoreszenzintensitätshistogramm dargestellt. Bei 1 * 10
-14
10
-14
und 5 *
erhält man nur einen Peak bei 0,75 kHz. Erhöht man die DNA Konzentration taucht ein weiterer Peak bei 2,25 kHz auf.
Dieser zeigt an, dass der DNA – Hairpin geöffnet worden ist.
Der Hairpin wird ab einer Konzentration von 5*10-14 M Gegensequenz leicht geöffnet,
ab 1*10-13 M sieht man deutlich, wie immer mehr Spotts eine Intensität von 2,2 kHz
annehmen und der Peak bei 0,5 kHz abnimmt.
Die Glaskammer, in der der Hairpin immobilisiert wird, hat eine Grundfläche von 0,6 x
0,6 cm. Bei der Immobilisierung ist die Kammer mit 400 µl PBS-Puffer gefüllt. Daraus
ergibt sich eine Oberfläche von 3 cm2. Bei ungefähr 100 Spots pro 400 µm2 ergibt
sich
eine
Hairpinmenge
von
1,3
Gegensequenzkonzentration von 3,3 * 10
-13
*
10-16
mol,
d.h.
ab
einer
M hat man ein Verhältnis von Hairpin zu
103
Ergebnisse und Diskussion
Gegensequenz von eins zu eins. Um einen Fluoreszenzanstieg zu sehen, muss man
einen 8-fachen Überschuss an Gegensequenz zugeben.
Zur Klärung des Ursprungs der Fluktuationen im Mikrosekundenbereich wurden FCS
– Löschungsexperimente von MR 121 mit Guanosin durchgeführt Abb. 2.4.26.
3,5
30
3,0
MR121 (0.54nM)
+ 1.88mM dGMP
+ 3.75mM dGMP
+ 7.5mM dGMP
+ 15mM dGMP
+ 30mM dGMP
G(τ)
6 -1
2,0
kass or kdiss(/10 s )
2,5
Dissoziation
Assoziation
25
1,5
1,0
20
15
10
5
0,5
0,0
0
1E-5
1E-4
1E-3
0,01
0,1
Zeit (ms)
1
10
100
0
5
10
15
20
25
30
Konzentration dGMP [mM]
Abbildung 2.4.26: FCS-Kurve und Kinetiken der Komplexbildung von MR 121 mit Guanosinmonophosphat
Diese Untersuchungen zeigen, dass die Kinetik der Komplexbildung zwischen MR
121 und Guanosinmonophosphat sehr schnell ist. Die Assoziationsrate ist
konzentrationsabhängig 1/ 30 ns bis 1 / 1 µs. Die Dissoziationskonstante ist nicht
konzentrationsunabhängig und liegt bei 1/100 ns. Die gleichen Experimente mit dem
PET –Hairpin ergeben eine um den Faktor 100 verlangsamte Kinetik. Darüber hinaus
zeigt der Fit, dass es mehrere Kinetiken im Mikrosekunden- bis Millisekundenbereich
gibt (Abb. 2.4.27). Der Grund für die Verlangsamung der Kinetik ist die geringe
Flexibilität der DNA.
104
Ergebnisse und Diskussion
0,05
Akin
tkin
N
tc1
Off
0,04
0.29669
0.00032
35
1.68268
0.00024
±0.03285
±0.00011
±0
±0
±0
G(τ)
0,03
0,02
0,01
0,00
1E-7
1E-6
1E-5
1E-4
1E-3
0,01
0,1
1
10
100
1000
Zeit [ms]
Abbildung 4.4.27: FCS-Kurve des PET-Hairpins. Die Kurve ist an eine biexponetille Funktion angepasst. Deutlich ist der
Unterschied zwischen der gemessenen Kurve und dem Modell zu sehen. Im Bereich zwischen 0,01 und 10 ms sind etliche
weitere Komponenten zu sehen.
Schaut man sich die Autokorrelationskurve in Abb. 4.4.27 an, so fällt eine Fluktuation
im 100 ns Bereich mit einer großen Amplitude auf. Die große Amplitude zeigt an,
dass die Hinreaktion wesentlich schneller ist als die Rückreaktion.
Zusätzlich zu dieser schnellen Fluktuation gibt es eine Reihe von weiteren Kinetiken,
die zwischen einer µs und einer ms stattfinden, die aber nicht mehr aufzulösen sind.
Die Kinetiken zeigen aber alle eine sehr kleine Amplitude. Das lässt auf eine schnelle
Rückreaktion im Vergleich zur Hinreaktion schließen.
khin
+
+
-
krück
+
+
-
τ
+
A
+
+
+
Abbildung 4.4.28: Amplituden und Zeiten verschiedener Komplexbildungen
Ist die Geschwindigkeitskonstante sowohl der Hin- als auch der Rückreaktion schnell,
so hat man in der Fluoreszenzkorrelationsspektroskopie eine geringe Zeit und eine
hohe Amplitude. Ist die Geschwindigkeitskonstante der Hinreaktion klein und die
Geschwindigkeitskonstante der Rückreaktion groß, so erhält man eine geringe
Korrelationszeit und eine geringe Amplitude (Abb. 4.4.28).
105
Ergebnisse und Diskussion
MR 121
G
T
G
G
MR 121
MR 121
G
G
G
T
G
G
T
T
T
G
G
T
T
MR 121
G
G
T
T
T
T
G
G
MR 121
T
G
G
T
T
G
G
T
MR 121
G
G
T
T
T
Abbildung 4.4.29: Konformationen des PET-Hairpins
Betrachtet man die Struktur eines Interkalators, so sieht man, dass er eine ähnliche
Struktur wie MR 121 hat.
106
Ergebnisse und Diskussion
4.5 Vergleich des PET-Hairpins mit bekannten Strukturen
Abbildung 4.5.1: Röntgenstruktur des Interkalators Cryptolepine
Die
Röntgenstruktur
des
Interkalators
Cryptolepine
[5-methyl-5h-indolo[3,2-
b]quinoline] zeigt die Wechselwirkung zwischen DNA – Basen und Farbstoff auf
[Lisgarten 2001]. Die einzelnen Nukleotide sind exakt parallel zueinander
angeordnet. Zwischen diesen Ebenen befindet sich parallel ausgerichtet der
Interkalator. Zustandekommen kann die Interkalation nur durch Parallelverschiebung
der Ebene des Interkalator gegen die Nukleotidebene. Bei Endkapping hat man eine
ähnliche Geometrie, es fehlt nur das zweite Nucteotidpaar. Dadurch kann sich der
Farbstoff aus einer halbkugelförmigen Richtungsverteilung an die DNA annähern und
ist damit wesentlich einfacher und schneller zu erreichen, als die Interkalation.
Deshalb sollte man zwei verschiedene Kinetikkonstanten für das Interkalieren und
Endcapping des Farbstoffes erhalten. Für das Interkalieren erwartet man eine
langsame Hinreaktion und eine nur leicht gehinderte Rückreaktion.
107
Ergebnisse und Diskussion
Im Gegensatz dazu erwartet man für Endkapping eine sehr schnelle Produktbildung
und eine normale Geschwindigkeit der Rückreaktion.
Abbildung 4.5.2: Röntgenstruktur des Groovebinders Distamycin
Die zweite Röntgenstruktur zeigt, dass der Groovebinder in der großen Furche
gebunden ist [Chen 1994]. MR 121 hat eine ganz andere Struktur als Groovebinder.
Trotzdem wird er hineinpassen. Das Distamycin liegt planar in der Furche. Eine
wesentliche Vorrausetzung damit MR 121 binden kann, denn das starre Grundgerüst
kann nicht verdrillt werden. Der Farbstoff liegt aber als Dimer in der Furche. Da aber
nur ein MR 121-Molekül an die DNA gekoppelt ist, fällt dieser Energiebeitrag weg.
Dadurch ist eine langsamere Geschwindigkeitskonstante der Hinreaktion zu
erwarten. Die Rückreaktion sollte schnell sein. Eine sterische Hinderung der
Reaktion ist nicht zu sehen.
108
Ergebnisse und Diskussion
Abbildung 4.5.3: Röntgenstruktur des Interkalators Netropsin
Auch hier ist der Farbstoff planar angeordnet [Goodsell 1994]. Der Abstand zu den
Nukleotiden ist gering. Im Gegensatz zum Distamycin, das in der großen Furche
bindet, liegt das Netropsin als Monomer vor. Auffallend ist aber die lange DNA –
Sequenz. Wesentlich kürzere Sequenzen, wie die des Hairpins, haben eine kaum
ausgeprägte kleine Furche. Deshalb sollte die Geschwindigkeit der Hinreaktion
gering sein. Die Rückreaktion ist kaum sterisch gehemmt und damit sicherlich
schnell.
Durch FCS konnte eine schnelle Reaktion aufgelöst werden, die eine hohe Amplitude
hat. Durch Betrachtung von Röntgenstrukturen von DNA – Doppelsträngen mit
Farbstoffen konnte diese Fluktuation dem Endcapping zugeordnet werden.
Desweiteren konnten mehrere Konformationen gefunden werden, die, wie die FCSKurve zeigt, eine langsame Hinreaktion und eine schnelle Rückreaktion haben, wie
das Interkalieren und Groovebinding.
109
Ergebnisse und Diskussion
4.6 Fluktuationen des FRET-Systems
Nachdem die Art der Fluktuationen im PET-Hairpin geklärt ist, bleibt nur noch eine
Frage offen: Woher kommen die Fluktuationen im FRET-Hairpin?
Um sicher zu gehen, dass sie nicht von der Öffnungskinetik des Hairpins stammen,
wird ein DNA-Doppelstrang-System konstruiert, das sich nicht öffnen kann bzw. das
sich nach dem Öffnen nicht mehr schließen kann.
Dazu wird die Sequenz des Stammes TCCCCA genommen. An dem T wird der
Farbstoff Cy5 gekoppelt und am T des Gegenstranges der Farbstoff Cy3. Um keine
weitere Wechselwirkung mit Guanosin zu erhalten, das zwar nur MR 121 quencht,
nicht aber Cy3 und Cy5, werden auf jeder Seite 6 Adenine hinzugefügt. Durch
Rechnungen mit dem Programm m-fold wird die Schmelztemperatur des Systems
ermittelt. Ohne weitere Nucteotiede würde die Schmelztemperatur 45°C betragen.
Durch weiteres Anhängen von Cytosinen auf beiden Seiten, kann die Sequenz weiter
stabilisiert werden. Die Ergebnisse der Rechnung mit m-fold sind in Abbildung 4.6.1
wiedergegeben.
16
Cy5
I
AAAAAATCCCCAAAAAAA
TTTTTTAGGGGTTTTTTT
I
Cy3
Verlängerung der Sequenz
14
12
10
Adenosin
Guanosin
8
6
4
2
0
40
45
50
55
60
65
70
75
80
85
90
95
Temperatur[°C]
Abbildung 4.6.1: Schmelztemperaturen bei Verlängerung des Stammes mit Adenosinen bzw. mit Guanosinen
110
Ergebnisse und Diskussion
Durch Anhängen von 8 Cytosinen ist die Schmelztemperatur von 45°C auf fast 80°C
gestiegen. Dadurch ist die Wahrscheinlichkeit zur Öffnung des Doppelstrangs sehr
gering.
Der DNA-Doppelstrang wird auf der Biotion-Streptavidin-Oberfläche immobilisiert und
anschließend vermessen. Die Oberfläche hat eine Größe von 10 x 10 µm bei einer
Auflösung von 50 nm. Die Integrationszeit pro Pixel beträgt 1ms.
Abbildung 4.6.2: Oberfläche mit einem FRET-DNA-Doppelstrang, 10 * 10 µm, 200 Pixel, 532nm Anregung, 1ms Integrationszeit
Man erkennt einige rote Spots auf der Oberfläche. In der Lösung über der Oberfläche
befindet sich keine DNA. Trotzdem bleiben die roten Spots auch noch nach 24h
erhalten. Das bedeutet, dass der Doppelstrang stabil ist und es nur sehr langsam zur
Ablösung des Gegenstranges kommt. Das F2-Wert-Histogramm zeigt zwei
verschiedene Spezies. Eine mit einem F2-Wert von 0,8 und eine andere mit einem
F2-Wert von 0,15.
111
Ergebnisse und Diskussion
14
12
Häufigkeit
10
8
6
4
2
0
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0,9
1,0
F2-Wert
Abbildung 4.6.3: F2-Wert Verteilung der Oberfläche 4.6.2
Verfolgt man die Fluoreszenz im Verlauf der Zeit, erhält man die folgende Spur:
50
Intensität (10ms)
40
30
20
10
0
0
5
10
15
20
25
30
35
40
Zeit [s]
Abbildung 4.6.4: Einzelmolekülspur des FRET-Doppelstranges
Bis zu Photozerstörung nach 42 s ist der DNA - Doppelstrang die ganze Zeit
geschlossen. Die beiden grünen Bursts stammen wahrscheinlich von der
Glukoseoxidase. Auffällig sind die verschiedenen Intensitätslevels, die in der roten
Spur zu sehen sind. Die Fluoreszenzintensität schwankt im Durchschnitt zwischen
112
Ergebnisse und Diskussion
3 kHz am Anfang und 2,5 kHz gegen Ende des Diagramms. Dies bedeutet eine
Änderung um 20%. Die Zeit bis zum Wechsel der Intensität ist sehr lange.
800
Haufigkeit
600
400
200
0
0,0
0,2
0,4
0,6
0,8
1,0
F2-Wert
Abbildung 4.6.5: F2-Wert Histogramm der Spur 4.6.4
Das F2-Wert-Histogramm zeigt eine breite Verteilung um 0,8. Diese Verbreiterung
kommt durch die Schwankungen der Intensität zustande.
Die Autokorrelation der Daten zeigt auch wieder Fluktuationen im Millisekunden- bis
Mikrosekundenbereich.
2,0
Model: ExpDec3
1,8
1,6
1,4
G(t)
1,2
1,0
Chi^2
R^2
= 0.00131
= 0.99962
y0
A1
t1
A2
t2
A3
t3
0.01652
31.97672
0.00029
0.06704
1.49012
0.14407
0.07059
±0.00586
±152.77794
±0.00203
±0.02691
±1.19985
±0.02714
±0.03214
0,8
0,6
0,4
0,2
0,0
1E-5
1E-4
1E-3
0,01
0,1
1
10
100
1000
10000
Zeit [ms]
Abbildung 4.6.6: Autokorrelation der Spur 4.6.4
113
Ergebnisse und Diskussion
Betrachtet man die Zeitskala auf der die Intensitätsschwankungen stattfinden, so sind
diese im gleichen Bereich wie die Intensitätsschwankungen bei dem PET-Hairpin.
Können diese Schwankungen nicht die gleiche Ursache haben, wie die
Intensitätsschwankungen und Fluktuationen des PET-Hairpins?
MR 121 wird durch Guanosin gelöscht - Cy3 und Cy5 nicht. Um solche
Schwankungen sehen zu können, müsste sich die Quantenausbeute von Cy3 und
Cy5 während der Interaktion mit der DNA ändern. Zur Klärung wird die
Quantenausbeute
in
Wasser
und
in
Ethanol
gemessen.
Die
konzentrationsbereinigten Spektren sind in Abbildung 4.6.7 dargestellt.
700
600
Ethanol
Wasser
Intensität
500
400
300
200
100
0
640
660
680
700
720
740
760
Wellenlänge [nm]
Abbildung 4.6.7: Fluoreszenzspektrum von Cy5 in Wasser und Ethanol
Bemerkenswert ist nicht nur der Blaushift des Fluoreszenzspektrums in Wasser,
sondern auch die Zunahme der Fluoreszenzintensität um 13 %. Das bedeutet, dass
sich
durch
Interkalation,
Endcapping
und
oder
Minor
Groovebinding
die
Fluoreszenzintensität ändert und dadurch die gleichen Autokorrelationszeiten
ergeben wie bei dem PET-Hairpin.
114
Ausblick
5. Ausblick
Im Rahmen dieser Arbeit konnte gezeigt werden, dass FRET – Fluoreszenz
Resonanz Energie Transfer und PET – Photoinduzierter Elektronen Transfer - zwei
komplementäre
Techniken
zur
Bestimmung
von
Abstandsänderungen
in
Biomolekülen sind. Es konnte gezeigt werden, dass PET-Hairpins gelöscht werden
und dadurch ein Öffnen und Schließen des Hairpins zu beobachten ist.
Diese Änderung der Konformation spielt sich im Sekundenbereich ab. Für die
Schließung des Hairpins konnte eine Geschwindigkeitskonstante von k = 1,3 ± 0,13
1
/s bei 22°C bestimmt werden. Die Öffnungskinetik ist wesentlich langsamer, sie
beträgt k* = 10,8 ± 2 1/s. In dieser langsamen Gesamtkinetik spiegelt sich die
Funktion als Informationsspeicher wider. Damit die Informationen gegen eine
Veränderung geschützt sind, ist die DNA ein starres Molekül, das die Information
gegen Veränderung schützt. Wird die Information benötigt, müssen die DNA-Stränge
separiert und getrennt gehalten werden. Deshalb ist die Rückreaktion auch ziemlich
langsam.
Bei der Untersuchung von DNA-Hairpins konnten zusätzliche, im Vergleich zur
Öffnung und Schließung des Hairpins, schnelle Fluktuationen gefunden werden.
Diese haben nichts mit dem Öffnen und Schließen des Hairpins zu tun, vielmehr sind
konformative Änderungen der Wechselwirkung von Farbstoff mit DNA die Ursache
für diese Veränderungen der Fluoreszenz. Diese sind wesentlich schneller als die
Konformationsänderungen der DNA (Öffnen/Schließen) und finden im Milli- bis
Mikrosekundenbereich statt. Vorherige Studien in Lösung, die eine maximale
Zeitauflösung bis in den Millisekundenbereich hatten, interpretierten diese Kinetik als
den Konformationswechsel des Hairpins. Der größte Unterschied zwischen
Lösungsmessungen und diesen Untersuchungen ist die Immobilisation der Proben.
Wechselwirkungen der Oberfläche mit dem Hairpin könnten die Kinetik beeinflussen.
Aber in beiden Fällen sieht man die schnellen Konformationswechsel des
Farbstoffes, die sich auf der gleichen Zeitskala abspielen. Des Weiteren hat
polarisationsmodulierte Anregung des Farbstoffes gezeigt, dass, wenn überhaupt
keine starken Wechselwirkungen vorhanden sein können. [Piestert]
115
Ausblick
Konformationsänderungen können mithilfe von FRET verfolgt werden.
In meiner
Arbeit konnte des Weiteren gezeigt werden, dass auch PET in der Lage ist
Konformationsänderungen aufzuzeigen. Der Vorteil von PET ist die starke
Abstandsabhängigkeit. Konformationsänderungen, vor allem in Proteinen, führen zu
wesentlich geringeren Abstandsänderungen, aber gerade die Konformation von
Proteinen ist wichtig zum Verständnis ihrer Funktion und Reaktivität. Grundsätzlich
kann jede Polypeptidkette in einer nahezu unbegrenzt großen Anzahl von
Konformationen vorliegen. Im Allgemeinen wird allerdings jedes Molekül eines
bestimmten Proteins die gleiche Konformation einnehmen. PET bietet nun aufgrund
der geringeren Abstandsabhängigkeit die Möglichkeit Konformationsänderungen und
Gleichgewichtsfluktuationen von Proteinen genauer zu untersuchen.
Mit Hilfe dieser Technik konnten nicht nur Fluktuationen untersucht, sondern auch
DNA bis zu einer Konzentration von 10-13 M nachgewiesen werden. Damit ist es
möglich,
spezifische
Gene
von
Krankheitserregern
nachzuweisen.
Für
die
Behandlung eines Patienten ist es außerordentlich wichtig zu wissen, ob er von
einem Virus oder von einem Bakterium befallen ist. PET-Hairpins erlauben aber nicht
nur die Unterscheidung dieser beiden Arten, sondern ermöglichen die genaue
Bestimmung der Spezies und durch Identifikation bestimmter Gene ist es sogar
möglich, Resistenzen gegenüber Antibiotika in kürzester Zeit nachzuweisen und
dadurch die Behandlungsstrategie zu wechseln. In letzter Zeit häufen sich die Fälle,
bei denen Antibiotika ihren Dienst versagen. Oft ist es dann aber schon zu spät, um
andere Mittel auszuprobieren. Dies unterstreicht die Notwendigkeit nach neuen
Diagnosemethoden.
Aber nicht nur Krankheitserreger können nachgewiesen werden, sondern auch
genetisch bedingte Krankheiten können erfasst werden, wie z.B. eine Veranlagung
zu Darmkrebs. Durch diesen Wissensvorsprung können rechtzeitig geeignete
Maßnamen ergriffen werden, um einen Ausbruch der Krankheit zu verhindern.
Des weiteren gibt es viele erst zum Teil verstandene Prozesse in der Natur, bei
denen
DNA-Doppelstränge
getrennt
werden.
Eine
sicherlich
interessante
Anwendung ist die Beobachtung der Öffnungs- und Schließungskinetik von
Polymerasen (Abb. 5.1).
116
Ausblick
Abbildung 5.1: Öffnung des DNA – Doppelstrangs durch die Polymerase
Die RNA-Polymerase T7 hat eine bestimmte Erkennungssequenz, an die sie bindet
und anschließend den DNA-Strang öffnet.
taatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatataccat
gtctggttctcatcat
Abbildung 5.2: Erkennunssequenz der RNA-Polymerase T7
Immobilisiert man die markierte RNA-Polymerase auf einer Oberfläche, so könnte
man nicht nur die Bindungskinetik der DNA und der Polymerase verfolgen, sondern
auch die Öffnung des Doppelstrangs und anschließend die Synthese der RNA,
wodurch schrittweise die Guanosine wieder im RNA-Gegenstrang eingebaut werden.
Danach löst sich die RNA von der DNA ab. Im letzten Schritt fällt die DNA von der
Polymerase ab. Durch Beobachtung auf Einzelmolekülebene könnten all diese
Prozesse beobachtet und deren Kinetik bestimmt werden.
Auch für diagnostische Anwendungen kann das System weiter optimiert werden. Je
größer
der
Unterschied
zwischen
gequenchtem
(geschlossenen)
und
ungequenchtem (geöffnetem) Zustand des Hairpins ist, desto sensitiver wird die
Diagnostik. Öffnen sich nur 1% aller Hairpins, da nicht mehr Gegensequenz
vorhanden ist und hat man einen 5-fachen Anstieg der Fluoreszenz, so erhält man
eine Erhöhung der Fluoreszenzintensität um 5%. Dies ist fast nicht mehr messbar.
Hat man dagegen einen 100-fachen Anstieg, würde sich die Fluoreszenzintensität
verdoppeln. Deshalb besteht ein Bedarf an Optimierung, um geringere Spuren
einfacher nachweisen zu können. Die Autokorrelation hat gezeigt, dass der Farbstoff
117
Ausblick
nur kurz mit den Nukleotiden in eine Wechselwirkung tritt, die aber notwendig ist, um
gelöscht zu werden. Deshalb muss der Farbstoff in die Konformation gebracht
werden, in der er gelöscht ist. Dies könnte man erreichen, indem man den C12-Linker
zwischen dem Farbstoff und der Ribose entfernt. Danach kommt es zu einer
permanenten Komplexbildung zwischen dem Farbstoff und dem Guanosin (Abb.5.3).
N
H 2N
O
R
N
NH
N
R
O
N
N
O
NH2
O
OH
O
N
-O
P
O
O
N
O
N
O
OH
Abbildung 5.3: Optimale Farbstoff – DNA Konformation
Dadurch wird nicht nur der Farbstoff wesentlich besser gelöscht, sondern auch die
Möglichkeit
einzunehmen
genommen,
und
unterschiedlich
dadurch
viele
stark
gequenchte
verschiedene
Konformationen
Intensitätsniveaus
auf
Einzelmolekülebene zu erzeugen, wodurch die Dateninterpretation wesentlich
erleichtert würde.
118
Literatur
6. Literatur
[Atkins 1990]
P. W. Atkins – Pysikalische Chemie; korrigierter
Nachdruck, 1990, der 1. Auflage 1987
[Axelrod 1989]
D. Axelrod, E.H. Hellen. “Emission of
fluorescence at an interface. In Fluorescence
microscopy of living cells in culture” D.L. Tayler,
Y.L. Wang, Eds.; Academic Press, Vol. Part B,
1989, 399.
[Boweb 2005]
M. E. Boweb, K. Weninger, J. Ernst, S. Chu, A.
T. Brunger „Single Molecule Studies of
Synaptotagmin and Complexin Binding to the
SNARE Complex” Biophys J. 2005, ASAP
[Chen 1994]
X. Chen, B. Ramakrishnan, S. T. Rao, M.
Sundaralingam, “Binding of two distamycin A
molecules in the minor groove of an alternating
B-DNA duplex”, The RCSB Protein Data Bank
(PDB), 1994, 159D, http://www.rcsb.org/pdb/
[Demtröder 1993]
Demtröder, Laserspektrroskopie Grundlagen
und Techniken, 4.Auflage, Springer
119
Literatur
[Dovichi 1983]
N. J. Dovichi, J. C. Martin, J. H. Jett, R. A.
Keller, Science, 1983, 219, 845-847
N. J. Dovichi, J. C. Martin, J. H. Jett, M. Trkula,
R. A. Keller, Anal. Chem., 1984, 56, 348-354
E. B. Shera, N. K. Seitzinger, L. M. Davis, R. A.
Keller, S. A. Soper, Chem. Phys. Lett., 1990,
174, 553-557
[Goodsell 1994]
D. S. Goodsell, M. L. Kopka, R. E. Dickerson,
“Refinement of netropsin bound to DNA: bias
and feedback in electron density map
interpretation” The RCSB Protein Data Bank
(PDB), 1994, 101d, http://www.rcsb.org/pdb/
[Ha 1999]
T.Ha, X. Zhuang, H. D. Kim, J. W. Orr, J. R.
Williamson, S. Chu „ Ligand-induced
conformational changes observed in single RNA
molecules“ Proc. Natl. Acad. Sci. USA, 1999,
96, 9077-9082
[Ha 2002]
T. Ha, I. Rasnik, W. Cheng, H. P. Babcock, G.
H. Gauss, T. M. Lohman, S. Chu Initiation and
re-initiation of DNA unwinding by Escherichia
coli Rep helicase, Nature, 2002, 419, 638-641.
[Heinlein 2003]
T. Heinlein, J. P. Knemeyer, O. Piestert, and M.
Sauer “Nucleobase-specific quenching of
fluorescent dyes in DNA-hairpins”
J. Phys. Che. m. B 2003, 107, 7957-7964.
[Hell 2005]
Toward Fluorescence Nanoscopy
S. W. Hell, Vortrag
120
Literatur
[Kim 1995]
Kim, J., Fuller, J.H., Kuusk, V., Cunane,
L., Chen, Z., Mathews, F.S., W.S.
McIntire,
J. Biol. Chem., 1995, 52, 31202-31209.
[Hirschfeld 1976]
T. Hirschfeld, Appl. Opt., 1976, 15, 2965-2966
[Lakowicz 1999]
J.R. Lakowicz
Principles of Fluorescence Spectroscopy
[Second Edition] 1999
[Lisgarten 2001]
J. N. Lisgarten, M. Coll, J. Portugal, C. W.
Wright, J. Aymami “Crystal Structure Of The
Complex Of Cryptolepine-D(Cctagg)2” The
RCSB Protein Data Bank (PDB), 2001, 1K9G,
http://www.rcsb.org/pdb/
[Lodish 2004]
H. Lodish, W H Freeman “Molecular Cell
Biology” 2004
[Marras 2004]
SAE Marras, B. Gold, F. R. Kramer, I.Smith, S.
Tyagi, “ Real-time measurment of in vitro
transcription” Nuc. Acids. Res , 2004, 32
[Nie 1994]
Nie, S., Chiu, D. T., and Zare, R. N., Science
1994, 266, 1018–21
[Park 2003]
Dissertation C.W. Park
[Rehm 1969]
Rehm, D., Weller, A. Kinetik und Mechanismus
der Elektronenübertragung bei der
Fluoreszenzlöschung in Acetonitril. Ber.
Bunsenges. Physik. Chem. 1969, 73, 834.
121
Literatur
[Perkin Elmer]
http://optoelectronics.perkinelmer.com/
content/RelatedLinks/photodiode,
%20phototransistor,
%20ired%20data%20book.pdf
[Piestert 2003]
O. Pistert, H. Barsch, V. Buschmann, T.
Heinlein, J.-P. Knemeyer, K. D. Weston, M.
Sauer „A Single-Molecule Sensitive DNA
Hairpin System Based on Intramolecular
Electron Transfer, Nano Letters, 2003, 3,7,979982
[Rigler 1990]
R. Rigler, J. Widengren, B. Klinge, C. Owman,
BioScience Vol. 3, 1990, 180
R. Rigler, U. Mets, J. Widengren, P. Kask, Eur.
Biophys. J., 22, 1993,169-175
Ü. Mets, R. Rigler, J. Fluoresc, 1994, 4, 259264
[Schwille]
Fluorescence Correlation Spectroscopy
P. Schwille, E.Haustein. Biophysics Textbook
Online (BTOL).
http://www.biophysics.org/education/schwille.pdf
[Tittmann 2000]
K. Tittmann, R. Golbik, S. Ghisla G. Hübner
J. Biol. Chem. 2000, (39), 10747-10754
[Twyman 2004]
Twyman, R. M. 2004. Principles of proteomics.
BIOS Scientific Publishers, New York
122
Literatur
[Tyagi1996]
Tyagi S and Kramer FR, Molecular beacons:
probes that fluoresce
upon hybridisation. Nature Biotechnology
1996,14, 303-308.
2 Tyagi S, Bratu DP and Kramer FR, Multicolour
molecular
beacons for allele discrimination. Nature
Biotechnology, 1998,16, 49-53.
3 S.A.E. Marras, and S. Tyagi, Multiplex
detection of
single-nucleotide variations using molecular
beacons. Genetic
Analysis: Biomolecular Engineering, 1999,14,
151-156.
4 Bonnet G, Tyagi S, Libchaber A and Kramer
FR, Thermodynamic
basis of the enhanced specificity of structured
DNA
probes. Proc Natl Acad Sci 96:6171±6176
(1999).
[Voet 2002]
D. Voet, J.G. Voet C.W. Pratt,
Lehrbuch der Biochemie, Wiley-VCH
[Wallace 2001]
M. Wallace, L. Ying, S. Balasubramanian, D.
Klenerman “ Non-Arrhenius kinetics for the loop
clusure of a DNA hairpin” Proc. Natl. Acad. Sci.
USA 2003, 98, 5584-5589.
123
Literatur
[Wohlfahrt 1999]
Wohlfahrt, G., Witt, S., Hendle, J., Schomburg,
D., Kalisz, H. M., Hecht, H. J.
http://www.rcsb.org/pdb/ : Research
Collaboratory for Structural Bioinformatics
(RCSB) 1CF3, 1999
124
Danksagung
Ich danke allen, die diese Arbeit durch ihre Unterstützung ermöglicht haben. Mein
besonderer Dank gilt:
Prof. Dr. Jürgen Wolfrum und Prof. Dr. Markus Sauer für die interessante
Themenstellung und ihre stetige Unterstützung,
Richard Parlitz für die anregenden Diskussionen biochemischer Problemstellungen
Dr. Volker Buschmann, Dr. Philip Tinnefeld und Dr. Jörg Enderlein für die Einführung in
die Welt der Einzelmolekülspektroskopie
Dr. Chris Bieler für viele hilfreiche Diskussionen chemischer Fragestellungen,
Prof. Dr. David Nesbitt und Jose Hodak für die Möglichkeit den Umgang mit RNA zu
erlernen.
Prof. Dr. Kenneth Weston und Dr. Dirk-Peter Herten für die Einführung in die LabViewProgrammierung und die Programmierung eines Teils des Messprogramms.
Hannes Barsch, Dr. Kyung-Tae Han, Mike Heilemann, Dr. Thomas Heinlein, Alexander
Kiel, Dr. Christian Müller, Dr. Hannes Neuweiler, Christian Roth, Pia Schlüter, Daniel
Siegberg und Katharina Stöhr für ihre freundliche Zusammenarbeit,
Meiner Eltern danke ich dafür, dass sie mir das Studium ermöglicht haben.
Anhang
Anzahl Photonen (10ms)
FRET-Hairpin in Tris-Puffer 200 mM KCl
60
40
20
0
0,0
0,5
1,0
1,5
2,0
3
4
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0
1
2
Anzahl Photonen (10ms)
Zeit [s]
80
60
40
20
0
0
1
2
3
4
5
Zeit [s]
I
Anzahl Photonen (10ms)
Anhang
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19 20
Anzahl Photonen (10ms)
Zeit [s]
40
30
20
10
0
0
1
2
3
4
5
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
5
10
15
20
25
30
35
40
Zeit [s]
II
Anzahl Photonen (10ms)
Anhang
50
40
30
20
10
0
0
1
2
3
4
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
3
4
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
Zeit [s]
III
Anzahl Photonen (10ms)
Anhang
60
50
40
30
20
10
0
0
1
2
3
4
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
Anzahl Photonen (10ms)
Zeit [s]
70
60
50
40
30
20
10
0
0
1
2
3
4
Zeit[s]
IV
Anzahl Photonen (10ms)
Anhang
40
30
20
10
0
0
1
2
3
4
5
6
Anzahl Photonen (10ms)
Zeit [s]
40
30
20
10
0
0
1
2
3
4
Anzahl Photonen (10ms)
Zeit [s]
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
Zeit [s]
V
Anhang
VI
Anhang
Anzahl Photonen (10ms)
FRET-Hairpin in Tris-Puffer 0 mM KCl
100
80
60
40
20
0
0,0
0,5
1,0
1,5
2,0
Anzahl Photonen (10ms)
Zeit[s]
100
90
80
70
60
50
40
30
20
10
0
0
2
4
6
8
10
12
14
16
18
Anzahl Photonen (10ms)
Zeit [s]
70
60
50
40
30
20
10
0
0,0
0,5
1,0
1,5
2,0
2,5
3,0
3,5
4,0
Zeit [s]
VII
Anzahl Photonen (10ms)
Anhang
100
90
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10
Anzahl Photonen (10ms)
Zeit [s]
40
30
20
10
0
0
1
2
3
4
5
6
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0,0
0,5
1,0
1,5
2,0
Zeit [s]
VIII
Anzahl Photonen (10ms)
Anhang
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10
11
12
13
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
3
4
5
6
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
3
4
Zeit [s]
IX
Anzahl Photonen (10ms)
Anhang
40
30
20
10
0
0
1
2
3
4
5
6
Anzahl Photonen (10ms)
Zeit [s]
100
90
80
70
60
50
40
30
20
10
0
0,0
0,2
0,4
0,6
0,8
1,0
1,2
1,4
1,6
1,8
2,0
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0,0
0,5
1,0
1,5
2,0
2,5
Zeit [s]
X
Anzahl Photonen (10ms)
Anhang
80
60
40
20
0
0
1
2
3
4
5
Anzahl Photonen (10ms)
Zeit [s]
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0
1
2
3
4
5
6
Zeit [s]
XI
Anhang
XII
Anhang
Anzahl Photonen (10ms)
FRET – Hairpin mit Gegensequenz geöffnet
60
40
20
0
0
5
10
15
20
25
30
Anzahl Photonen (10ms)
Zeit [s]
80
60
40
20
0
0
2
4
6
8
10
12
14
16
Anzahl Photonen (10ms)
Zeit [s]
80
60
40
20
0
0,0
0,5
1,0
1,5
2,0
2,5
3,0
3,5
Zeit [s]
XIII
Anzahl Photonen (10ms)
Anhang
60
40
20
0
0
1
2
3
4
5
6
7
Anzahl Photonen (10ms)
Zeit [s]
80
60
40
20
0
0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Anzahl Photonen (10ms)
Zeit [s]
100
90
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10 11
12 13 14
15 16
Zeit [s]
XIV
Anzahl Photonen (10ms)
Anhang
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
Anzahl Photonen (10ms)
Zeit [s]
120
110
100
90
80
70
60
50
40
30
20
10
0
0,0
0,2
0,4
0,6
0,8
1,0
Anzahl Photonen (10ms)
Zeit [s]
90
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Zeit [s]
XV
Anhang
XVI
Anhang
Anzahl Photonen (50ms)
PET-Hairpin in Tris-Puffer 200 mM KCl
180
160
140
120
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
75
Anzahl Photonen (50ms)
Zeit [s]
80
60
40
20
0
0
50
100
150
200
250
300
Anzahl Photonen (50ms)
Zeit [s]
120
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
45
50
Zeit [s]
XVII
Anzahl Photonen (10ms)
Anhang
80
60
40
20
0
0
2
4
6
8
10
12
14
16
18
20
10
12
14
16
18
Anzahl Photonen (50ms)
Zeit [s]
100
80
60
40
20
0
-2
0
2
4
6
8
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
2
4
6
8
Zeit [s]
XVIII
Anzahl Photonen (50ms)
Anhang
60
40
20
0
0
2
4
6
8
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
4
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19 20
Zeit [s]
XIX
Anzahl Photonen (50ms)
Anhang
120
100
80
60
40
20
0
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
4
5
6
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
4
5
Zeit [s]
XX
Anzahl Photonen (50ms)
Anhang
60
40
20
0
0
1
2
3
4
5
6
7
8
9
10
11
12
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
Anzahl Photonen (50ms)
Zeit [s]
60
40
20
0
0
1
2
3
4
Zeit [s]
XXI
Anhang
XXII
Anhang
Anzahl Photonen (50ms)
PET-Hairpin in Tris-Puffer 0 mM KCl
180
160
140
120
100
80
60
40
20
0
0
1
2
3
4
5
6
7
8
9
10
11
Anzahl Photonen (50ms)
Zeit [s]
140
120
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
Anzahl Photonen (50ms)
Zeit [s]
180
160
140
120
100
80
60
40
20
0
0
5
10
15
20
25
Zeit [s]
XXIII
Anzahl Photonen (50ms)
Anhang
150
140
130
120
110
100
90
80
70
60
50
40
30
20
10
0
0
5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100
Anzahl Photonen (50ms)
Zeit [s]
60
50
40
30
20
10
0
0
5
10
15
20
25
30
35
40
Anzahl Photonen (50ms)
Zeit [s]
80
70
60
50
40
30
20
10
0
0
5
10
15
20
25
30
35
40
45
50
55
Zeit [s]
XXIV
Anzahl Photonen (50ms)
Anhang
150
140
130
120
110
100
90
80
70
60
50
40
30
20
10
0
0
5
10
15
20
25
30
35
40
Anzahl Photonen (50ms)
Zeit [s]
90
80
70
60
50
40
30
20
10
0
0
10
20
30
40
50
60
70
80
90
100
Anzahl Photonen (50ms)
Zeit [s]
50
40
30
20
10
0
0
10
20
30
40
50
60
70
80
Zeit [s]
XXV
Anzahl Photonen (50ms)
Anhang
80
60
40
20
0
0
20
40
60
80
100
Anzahl Photonen (50ms)
Zeit [s]
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
45
Anzahl Photonen (50ms)
Zeit [s]
140
120
100
80
60
40
20
0
0
10
20
30
40
50
60
70
Zeit [s]
XXVI
Anzahl Photonen (50ms)
Anhang
180
160
140
120
100
80
60
40
20
0
0
10
20
30
40
50
60
70
80
90
100
Anzahl Photonen (50ms)
Zeit [s]
180
160
140
120
100
80
60
40
20
0
0
5
10
15
20
25
30
35
40
Anzahl Photonen (50ms)
Zeit [s]
500
400
300
200
100
0
0
1
2
3
4
5
6
Zeit [s]
XXVII
Anhang
XXVIII
Anhang
Anzahl Photonen (50ms)
PET-Hairpin mit Gegensequenz geöffnet
200
180
160
140
120
100
80
60
40
20
0
0
10
20
30
40
50
60
Anzahl Photonen (50ms)
Zeit [s]
200
180
160
140
120
100
80
60
40
20
0
0
20
40
60
80
100
120
140
160
180
200
Anzahl Photonen (50ms)
Zeit [s]
240
220
200
180
160
140
120
100
80
60
40
20
0
0
10
20
30
40
50
60
Zeit [s]
XXIX
Anzahl Photonen (50ms)
Anhang
400
300
200
100
0
0
2
4
6
8
10
12
Anzahl Photonen (50ms)
Zeit [s]
200
180
160
140
120
100
80
60
40
20
0
0
2
4
6
8
10
12
14
16
18
Anzahl Photonen (50ms)
Zeit [s]
200
180
160
140
120
100
80
60
40
20
0
0
10
20
30
40
50
Zeit [s]
XXX
Anzahl Photonen (50ms)
Anhang
220
200
180
160
140
120
100
80
60
40
20
0
0
10
20
30
40
50
Anzahl Photonen (50ms)
Zeit [s]
400
300
200
100
0
0
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Anzahl Photonen (50ms)
Zeit [s]
500
450
400
350
300
250
200
150
100
50
0
0
10
20
30
40
50
60
Zeit [s]
XXXI
Anhang
XXXII
Anhang
Anzahl Photonen (10ms)
FRET-Doppelstrang
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10
11
12
9
10
11
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19 20
Zeit [s]
XXXIII
Anzahl Photonen (10ms)
Anhang
60
50
40
30
20
10
0
0
2
4
6
8
10
12
14
16
18
20
22
Anzahl Photonen (10ms)
Zeit [s]
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
9
10
11
Zeit [s]
XXXIV
Anzahl Photonen (10ms)
Anhang
60
50
40
30
20
10
0
0
1
2
3
4
5
Anzahl Photonen (10ms)
Zeit [s]
50
40
30
20
10
0
0
1
2
3
4
5
6
7
8
Anzahl Photonen (10ms)
Zeit [s]
60
50
40
30
20
10
0
0
5
10
15
20
Zeit [s]
XXXV
Anhang
XXXVI
Anhang
Stern – Volmer Plot von Flavin-Adenosin
Dinucleotid
3,0
2,5
Lineare Regression für Data2_L:
Y=A+B*X
2,0
Parameter
Wert Fehler
-----------------------------------------------------------A
0,9365 0,01226
B
0,02379
3,32745E-4
------------------------------------------------------------
1,5
R
SD
N
P
-----------------------------------------------------------0,99795
0,03907
23
<0.0001
------------------------------------------------------------
1,0
-10
0
10
20
30
40
50
60
70
80
Konzentration Trp [mM]
Abbildung 1: Stern – Volmer Plot von Flavin-Adenosin Dinucleotid mit Tryptophan
3,0
2,5
2,0
1,5
1,0
-10
0
10
20
30
40
50
60
70
80
Konzentration Tyr [mM]
Abbildung 2: Stern – Volmer Plot von Flavin-Adenosin Dinucleotid mit Tyrosin
XXXVII
Anhang
3,0
2,5
2,0
1,5
1,0
-10
0
10
20
30
40
50
60
70
80
70
80
Konzentration Phe [mM]
Abbildung 3: Stern – Volmer Plot von Flavin-Adenosin Dinucleotid mit Phenylalanin
3,0
2,5
2,0
1,5
1,0
-10
0
10
20
30
40
50
60
Konzentration Ala [mM]
Abbildung 4: Stern – Volmer Plot von Flavin-Adenosin Dinucleotid mit Alanin.
XXXVIII
„Ich erkläre hiermit an Eides statt, dass ich die vorliegende Arbeit ohne unerlaubte Hilfe
durchgeführt habe.“
Heidelberg, Mai 2005
Oliver Piestert
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement