Wag2007a

Wag2007a
Microbial Perspectives
of the Methane Cycle in Permafrost Ecosystems
in the Eastern Siberian Arctic
– Implications for the Global Methane Budget –
Habilitationsschrift
eingereicht an der
Mathematisch-Naturwissenschaftlichen Fakultät
der Universität Potsdam
von
Dr. Dirk Wagner
Potsdam, Januar 2007
Gekürzte Fassung der Habilitationsschrift
elektronisch veröffentlicht auf dem
Publikationsserver der Universität Potsdam:
http://opus.kobv.de/ubp/volltexte/2007/1543/
urn:nbn:de:kobv:517-opus-15434
[http://nbn-resolving.de/urn:nbn:de:kobv:517-opus-15434]
Die vollständige Fassung befindet sich als gedruckte Ausgabe im Bestand der
Universitätsbibliothek Potsdam.
Dr. rer. nat. Dirk Wagner
Alfred-Wegener-Institut für Polar- und Meeresforschung
Forschungsstelle Potsdam
Telegrafenberg A43
14473 Potsdam
E-Mail: [email protected]
Home Address
Thaerstraße 57
14469 Potsdam
3
PREFACE
This thesis (Habilitation) highlights the findings of several years of research work in
permafrost environments of the Siberian Arctic. The studies were carried out to gain
insights into the carbon dynamics of tundra wetlands – mainly the methane fluxes –
and the contribution of the microbial processes and communities to the terrestrial
methane cycle. Furthermore, the response of microorganisms to the environmental
conditions of permafrost was investigated. Field research and sampling were carried
out during eight expeditions to the Lena Delta and Cape Mamontov Klyk at the
Laptev Sea coast. Experiments and analytical work was mainly accomplished at the
Alfred Wegener Institute for Polar and Marine Reseach (AWI), Research Unit
Potsdam. The study was financed through the AWI Research Program MARCOPOLI,
and by the Bundesministerium für Bildung und Forschung (BMBF) and by the
Deutsche Forschungsgemeinschaft (DFG) through the following projects:
•
BMBF project: Russian-German Cooperation: SYSTEM LAPTEV SEA 2000:
“Balance of Trace Gas Fluxes and Processe Studies within the Methane Cycle
in Permafrost Regions” (03G0534) by E.-M. Pfeiffer
•
BMBF project: Russian-German Cooperation: SYSTEM LAPTEV SEA 2000 –
Synthesis: “Terrestrial Dynamics in the Laptev Sea Region” (03G0534) by
H.-W. Hubberten
•
BMBF project: Process Studies on Permafrost Dynamics in the Laptev Sea:
„Microbial Processes in Permafrost: Anaerobic Microbial Carbon
Decomposition“ (03G0589) by E.-M. Pfeiffer with the assistance of E. Spieck,
and D. Wagner
•
DFG project „Tolerance Limits of Methanogenic Life in Terrestrial Permafrost“
(WA 1554/1-1 and WA 1554/1-2) within the priority program „Mars and the
Terrestrial Planets“ by D. Wagner
The thesis is composed of three parts: In the first part (chapters 1 and 2) an
Introduction of the research topic and an Overview of the different studies, their
present status and my personal contribution to each publication is given.
The second part, which is organized in four thematic chapters (3-6) comprises
fourteen research article relevant to the topic of the thesis. Eleven articles were
published or are in press in peer-reviewed international journals, complemented by
three submitted manuscripts. I am the first author of five papers. To the other articles
4
(two of them are two-authored papers), I have made essential contributions in the
form of text passages, field work, data sets or interpretations. The references of the
Introduction and Synthesis are summarized with those of the publications at the end
of the thesis, in order to avoid statement of the same references several times.
The thesis is terminated with a third part (chapters 7 and 8), in which the most
important findings and conclusions are summarised. In the Synthesis the results of
the publications to the microbially driven carbon dynamics and the tolerance of the
microorganisms to extreme environmental condition are combined with other studies
from permafrost regions and discussed in the scope of its significance for the global
methane budget. Finally, the Conclusions derived from the studies are presented.
5
Contents
Methane Cycle in Permafrost Ecosystems
Contents
Abstract…...……………………………………………………………............
8
Zusammenfassung…………………………………………………………....
10
1 General Introduction…………………………….…………………………….
12
1.1
Significance of Permafrost Ecosystems for the Global Methane
Budget…………..…..……………………….……………………………
Astrobiological Aspects of Permafrost Environments….…….….…...
Objectives and Research Strategy……….……………..……………..
Study Area…………..…………………….……………………………...
Expeditions…….………………………………………………………….
12
15
16
18
21
2 Overview of the Publications……….…………..…..…………….…………
24
3 Methane Release from Siberian Tundra Environments……….………..
29
1.2
1.3
1.4
1.5
3.1
3.2
3.3
Methane Emission from Siberian Arctic Polygonal Tundra: Eddy
Covariance Measurements and Modeling……………………..……..
Effect of Microrelief and Vegetation on Methane Emission from wet
Polygonal Tundra, Lena Delta, Northern Siberia………..……………
Land Cover Classification of Tundra Environments in the Arctic
Lena Delta Based on Landsat 7 ETM+ Data and its Application for
Upscaling of Methane Emissions…………………..…………………..
4 Permafrost Ecosystems and Their Microbial Processes...………….…
4.1
4.2
4.3
4.4
6
Element Redistribution Along Hydraulic and Redox Gradients of
Low-Centered Polygons, Lena Delta, Northern Siberia…….………..
Microbial Controls on Methane Fluxes from a Polygonal Tundra of
the Lena Delta, Siberia…………………………………………………..
Abundance, Distribution and Potential Activity of Methane
Oxidizing Bacteria in Permafrost Soils from the Lena Delta,
Siberia…………………………………………………...………………...
Methanogenic Activity and Biomass in Holocene Permafrost
Deposits of the Lena Delta, Siberian Arctic and its Implication for
the Global Methane Budget……………………………………………..
29
44
63
77
77
85
96
105
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure in Permafrost Ecosystems ……….....
5.1
5.2
5.3
Characterization of Microbial Community Composition of a Siberian
Tundra Soil by Fluorescence in situ Hybridization.............................
Methane Fluxes in Permafrost Habitats of the Lena Delta: Effects
of Microbial Community Structure and Organic Matter
Quality………..……………………………………………………………
Methanogenic Communities in Permafrost-affected Soils of the
Laptev Sea Coast, Siberian Arctic, Characterized by 16S rRNA
Gene Fingerprints….……….……………………………………………
6 Methanogenic Archaea as Model Organisms for Life in Extreme
Habitats and Their Astrobiological Relevance…...………………………
6.1
6.2
6.3
6.4
Microbial Life in Terrestrial Permafrost: Methanogenesis and
Nitrification in Gelisols as Potentials for Exobiological Processes….
Simulation of Freezing Thawing Cycles in a Permafrost Microcosm
for Assessing Microbial Methane Production under Extreme
Conditions…………………………………………………………………
Stress Response of Methanogenic Archaea from Siberian
Permafrost Compared to Methanogens from Non-permafrost
Habitats…..…………………………………………………….………….
Survival of Methanogenic Archaea from Siberian Permafrost Under
Simulated Martian Thermal Conditions..............................................
7 Synthesis…...…………………….……….…………………………………….
7.1
7.2
7.3
7.4
Introduction…….……………………….………………………………...
Methane Release from Tundra Environments of the Lena Delta…...
Microbial Processes and Communities Involved in the Arctic
Methane Cycle……………...……….………………….........................
Survival of Methanogenic Archaea under Extreme Environmental
Conditions……...……………………………………………..…..………
Contents
117
117
126
135
146
146
160
167
180
190
190
191
198
204
8 Conclusions…….…………………………………………………….…...…...
210
9 References……….……………………………………………………………..
212
Acknowledgements……………………………………………………………
237
Appendix…………………………………………………………….…………..
238
Correspondence for the Publications under Revision……………………….
List of Oral and Poster Presentations…………………………………………
238
242
7
Abstract
Methane Cycle in Permafrost Ecosystems
Abstract
The Arctic plays a key role in Earth’s climate system as global warming is predicted
to be most pronounced at high latitudes and because one third of the global carbon
pool is stored in ecosystems of the northern latitudes. In order to improve our
understanding of the present and future carbon dynamics in climate sensitive
permafrost ecosystems, the present study concentrates on investigations of microbial
controls of methane fluxes, on the activity and structure of the involved microbial
communities, and on their response to changing environmental conditions. For this
purpose an integrated research strategy was applied, which connects trace gas flux
measurements to soil ecological characterisation of permafrost habitats and
molecular ecological analyses of microbial populations. Furthermore, methanogenic
archaea isolated from Siberian permafrost have been used as potential keystone
organisms for studying and assessing life under extreme living conditions.
From 1998 to 2005, eight expeditions to the Lena Delta were carried out. Field work
and sampling of different permafrost soils and sediments were mainly accomplished
on Samoylov Island, central Lena Delta. In particular, the objectives of the study
were: (1) to measure and balance methane fluxes from tundra environments, (2) to
determine the soil ecological properties, (3) to gain more insights into the control
functions of microorganisms, (4) to improve the knowledge of the abundance and
biodiversity of microbial communities, and (5) to determine tolerance limits of
methanogens under extreme living conditions.
Long-term studies on methane fluxes were carried out since 1998. These studies
revealed considerable seasonal and spatial variations of methane emissions for the
different landscape units ranging from 0 to 362 mg m-2 d-1. For the overall balance of
methane emissions from the entire delta, the first land cover classification based on
Landsat images was performed and applied for an upscaling of the methane flux data
sets. The regionally weighted mean daily methane emissions of the Lena Delta (10
mg m-2 d-1) are only one fifth of the values calculated for other Arctic tundra
environments. The calculated annual methane emission of the Lena Delta amounts
to about 0.03 Tg. The low methane emission rates obtained in this study are the
result of the used remotely sensed high-resolution data basis, which provides a more
realistic estimation of the real methane emissions on a regional scale. Soil
temperature and near soil surface atmospheric turbulence were identified as the
driving parameters of methane emissions. A flux model based on these variables
explained variations of the methane budget corresponding to continuous processes
of microbial methane production and oxidation, and gas diffusion through soil and
plants reasonably well. The results show that the Lena Delta contributes significantly
to the global methane balance because of its extensive wetland areas.
8
Methane Cycle in Permafrost Ecosystems
Abstract
The microbiological investigations showed that permafrost soils are colonized by high
numbers of microorganisms. The total biomass is comparable to temperate soil
ecosystems. Activities of methanogens and methanotrophs differed significantly in
their rates and distribution patterns along both the vertical profiles and the different
investigated soils. The methane production rates varied between 0.3 and 38.9 nmol
h-1 g-1, while the methane oxidation ranged from 0.2 to 7.0 nmol h-1 g-1. Phylogenetic
analyses of methanogenic communities revealed a distinct diversity of methanogens
affiliated to Methanomicrobiaceae, Methanosarcinaceae and Methanosaetaceae,
which partly form four specific permafrost clusters.
The results demonstrate the close relationship between methane fluxes and the
fundamental microbiological processes in permafrost soils. The microorganisms do
not only survive in their extreme habitat but also can be metabolic active under in situ
conditions. It was shown that a slight increase of the temperature can lead to a
substantial increase in methanogenic activity within perennially frozen deposits. In
case of degradation, this would lead to an extensive expansion of the methane
deposits with their subsequent impacts on total methane budget.
Further studies on the stress response of methanogenic archaea, especially
Methanosarcina SMA-21, isolated from Siberian permafrost, revealed an unexpected
resistance of the microorganisms against unfavourable living conditions. A better
adaptation to environmental stress was observed at 4 °C compared to 28 °C. For the
first time it could be demonstrated that methanogenic archaea from terrestrial
permafrost even survived simulated Martian conditions. The results show that
permafrost methanogens are more resistant than methanogens from non-permafrost
environments under Mars-like climate conditions. Microorganisms comparable to
methanogens from terrestrial permafrost can be seen as one of the most likely
candidates for life on Mars due to their physiological potential and metabolic
specificity.
9
Zusammenfassung
Methane Cycle in Permafrost Ecosystems
Zusammenfassung
Die Arktis spielt eine Schlüsselrolle im Klimasystem unserer Erde aus zweierlei
Gründen. Zum einen wird vorausgesagt, dass die globale Erwärmung in den hohen
Breiten am ausgeprägtesten sein wird. Zum anderen ist ein Drittel des globalen
Kohlenstoffs in Ökosystemen der nördlichen Breiten gespeichert. Um ein besseres
Verständnis der gegenwärtigen und zukünftigen Entwicklung der Kohlenstoffdynamik
in klimaempfindlichen Permafrostökosystemen zu erlangen, konzentriert sich die
vorliegende Arbeit auf Untersuchungen zur Kontrolle der Methanflüsse durch
Mikroorganismen, auf die Aktivität und Struktur der beteiligten Mikroorganismengemeinschaften und auf ihre Reaktion auf sich ändernde Umweltbedingungen. Zu
diesem Zweck wurde eine integrierte Forschungsstrategie entwickelt, die
Spurengasmessungen mit boden- und molekularökologischen Untersuchungen der
Mikroorganismengemeinschaften verknüpft. Ferner sind methanogene Archaeen aus
Permafrostböden isoliert worden, um sie als Modellorganismen für die Untersuchungen des mikrobiellen Lebens unter extremen Lebensbedingungen zu verwenden.
Von 1998 bis 2005 wurden acht Expeditionen in das sibirische Lenadelta
durchgeführt. Die Feldarbeiten und die Beprobung unterschiedlicher Permafrostböden und -sedimente wurden hauptsächlich auf der Insel Samoylov im zentralen
Lenadelta durchgeführt. Die Zielsetzungen der vorliegenden Untersuchung im Detail
waren: (1) die Methanfreisetzung aus Tundren zu messen und zu bilanzieren; (2) die
bodenökologischen Kenngrößen zu bestimmen; (3) detaillierte Einblicke in die
Funktionen der am Methanumsatz beteiligten Mikroorganismen zu erlangen; (4) die
Abundanz und Biodiversität der Mikroorganismengemeinschaften zu untersuchen
und (5) Toleranzgrenzen methanogener Archaeen unter extremen Lebensbedingungen zu ermitteln.
Langzeitmessungen zu den Methanflüssen werden seit 1998 durchgeführt. Diese
Untersuchungen zeigten beträchtliche saisonale und räumliche Schwankungen der
Methanemissionen auf, die zwischen 0 und 362 mg m-2 d-1 für die untersuchten
Landschaftseinheiten schwankten. Für die Bilanzierung der Methanemissionen für
das gesamte Delta wurde erstmals eine Klassifikation der unterschiedlichen
Landschaftseinheiten anhand von Landsat-Aufnahmen durchgeführt und für eine
Hochrechnung der Methandaten genutzt. Die Mittelwerte der regional gewichteten
täglichen Methanemissionen des Lenadeltas (10 mg m-2 d-1) sind nur ein Fünftel so
hoch wie die berechneten Werte für andere arktische Tundren. Die errechnete
jährliche Methanemission des Lenadeltas beträgt demnach ungefähr 0,03 Tg. Die
geringen Methanemissionsraten dieser Studie können durch den bisher noch nicht
realisierten integrativen Ansatz, der Langzeitmessungen und Landschaftsklassifizierungen beinhaltet, erklärt werden. Bodentemperatur und oberflächennahe
10
Methane Cycle in Permafrost Ecosystems
Zusammenfassung
atmosphärische Turbulenzen wurden als die antreibenden Größen der
Methanfreisetzung identifiziert. Ein Modell, das auf diesen Variablen basiert, erklärt
die Veränderungen der Methanflüsse gemäß der dynamischen mikrobiellen
Prozesse und der Diffusion von Methan durch den Boden und die Pflanzen
zutreffend. Die Ergebnisse zeigen, dass das Lenadelta erheblich zur globalen
Methanemission aufgrund seiner weitreichenden Feuchtgebiete beiträgt.
Die mikrobiologischen Untersuchungen zeigten, dass Permafrostböden durch eine
hohe Anzahl von Mikroorganismen besiedelt wird. Die Gesamtbiomasse ist dabei mit
Bodenökosystemen gemäßigter Klimate vergleichbar. Die Stoffwechselaktivitäten
von methanogenen Archaeen und methanotrophen Bakterien unterschieden sich
erheblich in ihrer Rate und Verteilung im Tiefenprofil sowie zwischen den
verschiedenen untersuchten Böden. Die Methanbildungsrate schwankte dabei
zwischen 0,3 und 38,9 nmol h-1 g-1, während die Methanoxidation eine Rate von 0,2
bis 7,0 nmol h-1 g-1 aufwies. Phylogenetische Analysen der methanogenen Mikroorganismengemeinschaften zeigten eine ausgeprägte Diversität der methanogenen
Archaeen auf. Die Umweltsequenzen bildeten vier spezifische Permafrostcluster aus,
die den Gruppen Methanomicrobiaceae, Methanosarcinaceae und Methanosaetaceae zugeordnet werden konnten.
Die Ergebnisse zeigen, dass die Methanfreisetzung durch die zugrunde liegenden
mikrobiologischen Prozesse im Permafrostboden gesteuert wird. Die beteiligten
Mikroorganismen überleben nicht nur in ihrem extremen Habitat, sondern zeigten
auch Stoffwechselaktivität unter in-situ-Bedingungen. Ferner konnte gezeigt werden,
dass eine geringfügige Zunahme der Temperatur zu einer erheblichen Zunahme der
Methanbildungsaktivität in den ständig gefrorenen Permafrostablagerungen führen
kann. Im Falle der Permafrostdegradation würde dieses zu einer gesteigerten
Freisetzung von Methan führen mit bisher unbekannten Auswirkungen auf das
Gesamtbudget der Methanfreistzung aus arktischen Gebieten.
Weitere Untersuchungen zur Stresstoleranz von methanogenen Archaeen –
insbesondere des neuen Permafrostisolates Methanosarcina SMA-21 - weisen eine
unerwartete Widerstandsfähigkeit der Mikroorganismen gegenüber ungünstigen
Lebensbedingungen auf. Eine bessere Anpassung an Umweltstress wurde bei 4°C
im Vergleich zu 28°C beobachtet. Zum ersten Mal konnte gezeigt werden, dass
methanogene Archaeen aus terrestrischem Permafrost unter simulierten
Marsbedingungen unbeschadet überleben. Die Ergebnisse zeigen, dass
methanogene Archaeen aus Permafrostböden resistenter gegenüber Umweltstress
und Marsbedingungen sind als entsprechende Mikroorganismen aus Habitaten, die
nicht durch Permafrost gekennzeichnet sind. Mikroorganismen, die den Archaeen
aus terrestrischen Permafrosthabitaten ähneln, können als die wahrscheinlichsten
Kandidaten für mögliches Leben auf dem Mars angesehen werden.
11
1 General Introduction
Methane Cycle in Permafrost Ecosystems
1 General Introduction
1.1 Significance of Permafrost Ecosystems for the Global Methane Budget
A better understanding of the terrestrial component of the global carbon cycle has
become policy imperative, both nationally and worldwide. The Kyoto Protocol
recognizes the role of terrestrial systems as carbon sinks and sources. Terrestrial
and sub-marine permafrost is identified as one of the most vulnerable carbon pools in
the Earth system (Osterkamp, 2001; Zimov et al., 2006). About one third of the global
soil carbon is preserved in northern latitudes (Gorham, 1991), mainly in huge layers
of frozen ground, which underlay around 24% of the exposed land area of the
northern hemisphere (Zhang et al., 1999; Figure 1.1). This carbon reservoir plays a
major role in the global carbon cycle, which is highlighted by currently observed
climate changes in the Arctic (IPCC, 2001; Figure 1.2) and by climate models that
predict significant changes in temperature and precipitation in the Northern
Hemisphere (Kattenberg et al., 1996; Smith et al., 2002).
Figure 1.1: Permafrost distribution in the northern hemisphere (UNEP/GRID-Arendal and Landsat,
2000).
12
Methane Cycle in Permafrost Ecosystems
1 General Introduction
Global warming could result in a degradation of permafrost area up to 25% until 2100
(Anisimov et al. 1999). Thawing of permafrost could release large quantities of
greenhouse gases into the atmosphere (Nelson 2003), thus further increasing global
warming and transforming the Arctic tundra ecosystems from a carbon sink to a
carbon source (Oechel et al. 1993). However, the processes of carbon release, their
spatial distribution and their climate dependency are not yet adequately quantified
and understood.
Figure 1.2: The figure shows the difference in surface temperatures between the periods 1995
through 2004 and “normal” temperatures at the same locations, defined to be the average over the
interval 1940 to 1980 highlighting the immense warming of high north latitudes (modified after Robert
A. Rohde, data source: Hansen et al., 2001; Rayner, 2000; Reynolds et al., 2002).
The world-wide wetland area has a size of about 5.5 x 106 km2 (Aselman and
Crutzen, 1989). About half of it is located in high-latitudes of the northern hemisphere
(> 50°N). The atmospheric input of methane from tundra soils of this region has been
estimated between 17 and 42 Tg CH4 yr-1 (Whalen and Reeburgh, 1992; Cao et al,
1996; Joabsson and Christensen, 2001), corresponding to about 25 % of the
methane emission from natural sources (Fung et al. 1991). Model calculations
suggest that methane currently emitted from Arctic permafrost environments may
enhances the greenhouse effect with a portion of approx. 20 % (Wuebbles and
Hayhoe, 2002).
In the last decades, numerous studies on methane fluxes were focused on tundra
environments in Northern America and Scandinavia (e.g. Svensson and Rosswall,
1984; Whalen and Reeburgh, 1988; Bartlett et al., 1992; Liblik et al., 1997; Reeburgh
et al., 1998; Christensen et al., 2000). Since the political changes in the former Soviet
Union in the early nineties, the large permafrost areas of Russia were integrated into
13
1 General Introduction
Methane Cycle in Permafrost Ecosystems
the circum-arctic flux studies (e.g. Christensen et al., 1995; Samarkin et al. 1999;
Panikov and Dedysh, 2000; Tsuyuzaki et al., 2001). All these studies reveal temporal
and spatial variability of methane fluxes, ranging between –1.9 and 360 mg CH4 m-2
d-1. To understand these dramatic fluctuations, some studies focused on the
environmental conditions and soil characteristics, comprising the water table position,
soil moisture and temperature, type of substrate and vegetation as well as availability
of organic carbon (e.g. Torn and Chapin, 1993; Vourlitis et al., 1993; Bubier et al.,
1995; Oberbauer et al., 1998; Joabsson et al., 1999; Yavitt et al., 2000). These
factors influence the methane dynamics of tundra environments. Although 80 to 90%
of total methane emissions originate from microbial activity (Ehhalt and Schmidt,
1978), only a few investigations dealt with methane production and methane
oxidation caused by basically microbiological processes in the course of carbon
dynamics (Slobodkin et al., 1992; Vecherskaya et al., 1993; Samarkin et al., 1994;
Schimel and Gulledge, 1998; Segers, 1998; Frenzel and Karofeld, 2000; Wagner et
al., 2001).
Microbial methane production (methanogenesis) is one of the most prominent
microbiological processes during the anaerobic decomposition of organic matter.
Methanogenesis is solely driven by a small group of strictly anaerobic organisms
called methanogenic archaea, which belong to the kingdom Euryarchaeota (Garcia et
al, 2000). They can be found either in temperate habitats like paddy fields (Grosskopf
et al., 1998a), lakes (Jurgens et al., 2000; Keough et al., 2003), freshwater sediments
(Chan et al., 2005) and the gastrointestinal tract of animals (Lin et al., 1997), or in
extreme habitats such as hydrothermal vents (Jeanthon et al., 1999), hypersaline
habitats (Mathrani & Boone, 1995) or permafrost soils and sediments (Kobabe et al.,
2004). In cold environments two main pathways of energy-metabolism dominate: (i)
the reduction of CO2 to CH4 using H2 as a reductant and (ii) the fermentation of
acetate to CH4 and CO2 (Conrad, 2005). However, only a few psychrophilic (coldadapted) strains of methanogenic archaea have been described so far (Simankova et
al., 2003; Cavicchioli, 2006).
The biological oxidation of methane by methane oxidizing (methanotrophic) bacteria,
which represent very specialized Proteobacteria, is the major sink for methane in
terrestrial habitats. They are using methane as the sole carbon source, while energy
is gained by the oxidation of CH4 to CO2. Between 43 and 90% of the methane
produced in the soil is oxidised before reaching the atmosphere (Frenzel et al., 1990;
Le Mer & Roger 2001, van Bodegom et al., 2001). Methanotrophic bacteria are
common in almost all environments, where they can survive under unfavourable
living conditions by the formation of spores.
Since methanogenic archaea and methane oxidizing bacteria are sensitive to
temperature variations, methane fluxes from tundra environments are expected to
14
Methane Cycle in Permafrost Ecosystems
1 General Introduction
increase with temperature rise (Hassol, 2004). This response would imply a positive
feedback to climate change from permafrost methane sources.
Although the metabolism of both groups of microorganisms is well studied, little is
known about their impact on carbon fluxes in Arctic environments, about the role of
microbial diversity for the functioning and stability of the system and about the
reaction of these microorganisms to changing environmental conditions. Hence, the
knowledge on current trace gas fluxes, their control by the microbial communities,
and their reaction to environmental change is crucial for understanding current
carbon dynamics and the prediction of the future development of permafrost
environments as a source of greenhouse gases.
1.2 Astrobiological Aspects of Permafrost Environments
Apart from the global relevance of permafrost as a large carbon reservoir, this
extreme environment is also of particular interest in the scope of astrobiological
research as an analogue for extraterrestrial permafrost habitats, which is a common
phenomenon in our solar system.
Terrestrial permafrost is characterised by extreme environmental conditions, such as
sub-zero temperatures, aridity, and long-lasting levels of back-ground radiation as a
result of an accumulation over geological time scales. Despite these harsh
conditions, terrestrial permafrost is colonized by high numbers of chemoorganotrophic bacteria as well as microbes such as methanogenic archaea (Shi et
al., 1997). Because of the specific adaptations of methanogens to conditions like on
early Earth (e.g. no oxygen, no or less organic compounds) and their phylogenetic
origin, they are considered as one of the most probable model organisms for life in
extraterrestrial permafrost such as on Mars.
In our solar system Mars is considered as one of the most similar planets to Earth
(Goldsmith and Owen, 1980), even if Mars is characterized by extreme coldness and
dryness today. Various paleo-climate models of the early Mars showed that prior to
3.8 Ga, Mars was characterised by moderate temperatures, the presence of liquid
water and an anoxic atmosphere comparable to those conditions on early Earth
(Durham et al., 1989; McKay et al., 1992), where the evolution of microorganisms
had already started (Schopf, 1993). Assuming that early life developed on Mars as
well, Martian life must have adapted to drastically changing environmental conditions
or became extinct, whereas living conditions remained suitable for life on Earth. The
present Mars is characterized by extreme dryness, permafrost and a temperature
regime which ranges between –123°C and +20°C. One possibility for survival of
Martian microorganisms might be the presence of subsurface lithoautotrophic
ecosystems like deep sediments. Comparable environments exist in polar regions on
earth, described e.g. in Antarctic ice cores of several thousand meter depth (Abyzov
15
1 General Introduction
Methane Cycle in Permafrost Ecosystems
et al., 1998) and in Siberian permafrost cores of about 50 meter depth (Gilichinsky et
al., 1993), where microorganisms exist independently of photosynthetic energy
production. These microorganisms derive their energy by chemical reactions,
oxidizing H2S, CH4 or reduced nitrogen compounds. Compared to these ecosystems,
an adaptation of life on Mars in combination with a retreat in niches under the surface
does not seem any longer impossible.
One of the most important biophysical requirements for life is water. Actually, the
mid- to low-latitudes of Martian surface at present may include up to 10 wt% of water
(Feldman et al., 2002). Furthermore, the current mission of the European Space
Agency (ESA) Mars Express has for the first time demonstrated the presence of
methane in the Martian atmosphere (Formisano, 2004). On Earth methane is formed
by methanogenic archaea from carbon dioxide and hydrogen, which are also
compounds of the Martian atmosphere (Krasnopolsky and Feldman, 2001). Further
data obtained by Mars Express showed that surface water or ice and methane gas
are concentrated in the same regions of the Martian atmosphere (European Space
Agency, 2004). This finding may have important implications for the possibility that
microbial life, possibly similar to methanogenic archaea on Earth, could exist on
Mars. To evaluate the hypothesis of present life on Mars, the tolerance of
methanogenic archaea to extreme environmental conditions and their response to
Martian thermo-physical conditions is under focus of astrobiologycal research.
1.3 Objectives and Research Strategy
The main objective of this thesis is to fill fundamental gaps in our knowledge on
carbon dynamics in Arctic permafrost ecosystems and the involved microbial
communities. In particular, the study focuses on the microbial controls of methane
fluxes as well as on the activity and structure of the archaeal and methanotrophic
communities and their response to changing environmental conditions. For this
purpose an integrated research strategy was applied, which connects trace gas flux
measurements to soil ecological characterisation of the different habitats and
microbiological/molecular ecological analyses of microbial communities. Furthermore,
methanogenic archaea isolated from Siberian permafrost have been used as
potential keystone organisms for studying life under Martian permafrost conditions.
To achieve the objectives, the following topics have been identified and specific
approaches have been chosen for detailed analyses:
1. Balance of methane emissions: The quantification of the methane fluxes
from tundra environments and their seasonal variability provides the basis for
any balance of this important greenhouse gas. To study methane fluxes on the
ecosystem scale and to identify the main biological and physical parameters
which control trace gas fluxes from permafrost environments, high-resolution
16
Methane Cycle in Permafrost Ecosystems
1 General Introduction
eddy covariance measurements were established on Samoylov Island
(chapter 3.1). Closed chambers were used to study the importance of the
vegetation for the transport of methane from the soils to the atmosphere
(chapter 3.2). The results of the trace gas flux studies have been used in
combination with a land cover classification to estimate the methane emission
for the entire Lena Delta (chapter 3.3). In order to be able to study the effect of
climatic change on carbon dynamics, long-term studies on methane fluxes
have been carried out on Samoylov Island since 1998. The evaluations of
these data are still under progress.
2. Microbial processes of the methane cycle: For the understanding of the
annual and seasonal variability of the methane fluxes, the habitat properties
and the microbial processes were characterized for different soil profiles at
representative localities. As one of the main controlling factors for the
microbial methane production and oxidation the redox potential was
determined and redox sensitive elements (Mn, Fe, P) were analysed along a
transect from the elevated rim to the depressed center of the polygon (chapter
4.1). The activity of the involved microorganisms were analysed under in situ
conditions at the same sites (chapter 4.2). Special emphasis was placed on
the abundance and potential activity of methanotrophs as the only sink for
methane in permafrost ecosystems (chapter 4.3). For the prediction of the
future contribution of permafrost environments to the global methane budget,
the activity and biomass in perennially frozen ground was studied (chapter
4.4). On basis of the obtained data, a conceptional model was developed
which shows the proportion of the different processes responsible for the
methane fluxes in the active layer and its changes during the season (chapter
7.3).
3. Microbial community structure: Carbon mineralization in tundra
environments is carried out exclusively by highly specialized microorganisms
such as methanogenic archaea and methane oxidizing bacteria. To estimate
the impact of global warming on these microorganisms and for the prediction
of their reaction under changing environmental conditions, a detailed
knowledge of the structure and composition of the microbial communities is
needed. The population of active microorganisms was characterized by
fluorescence in situ hybridisation (FISH) and by phospholipid (PLFA, PLEL)
profiling for the main study site (chapters 5.1 and 5.2). On basis of these data
the composition of the methanogenic community was studied by 16S rRNA
gene fingerprints in three different permafrost soils (chapter 5.3)
4. Microbial life under extreme conditions: Permafrost in polar regions is
characterized by extreme environmental condition. In order to preserve their
viability the microorganisms had to develop strategies to resist salt stress,
17
1 General Introduction
Methane Cycle in Permafrost Ecosystems
physical damage by ice crystals and long-lasting background radiation. From
the astrobiological point of view, terrestrial permafrost is considered to be a
model for Martian permafrost and methanogenic archaea are suitable model
organisms for studying life under Martian conditions (chapter 6.1). For the
investigation of the methane formation within the active layer, which is
characterized by large gradients in temperature and geochemistry during the
annual freezing thawing cycles, a permafrost microcosmos was developed
(chapter 6.2). Methanogenic archaea isolated from Siberian permafrost were
used to study their tolerance limits under unfavourable living conditions
(chapter 6.3) and their survival under simulated Martian conditions (chapter
6.4). The results showed that methanogenic archaea from permafrost can be
seen as one of the most likely candidates for life on Mars (chapter 7.4).
1.4 Study Area
Samoylov Island (Siberia), the main study site of this thesis, is located within the
Lena Delta, which represents the largest delta of the circum-arctic land masses. The
Lena Delta is located at the Laptev Sea coast between the Taimyr Peninsula and the
New Siberian Islands (Figure 1.3).
The delta occupies an area of about 29,000 km2 (Schneider, 2005) and is
characterized by a network of smaller and larger rivers and channels as well as more
than 1500 islands. The delta can be divided into three geomorphologically different
terraces (Are and Reimnitz, 2000; Schwamborn et al., 2002): (i) the oldest terrace
was formed in the middle to late Pleistocene and is fragmentarily exposed (30–55 m
a.s.l.) in the southern part of the delta. The terrace consists of ice-complexes
containing fine-grained silty sediments with a high content of segregated ice. The icecomplex moreover includes enormous layers of organic-rich material and less
decomposed peaty material, (ii) Arga Island, the western part of the delta (20–30 m
a.s.l.) is characterized by coarse-grained sandy sediments and an abundant of deep
lakes, which were formed in the late Pleistocene to late Holocene, (iii) the eastern
terrace formed since the early Holocene is the currently still active part of the Lena
Delta. This terrace is covered by several modern flood plains (1–12 m a.s.l.). The
landscape of the delta is characterized by the patterned ground of ice-wedge
polygons in different development stages (Müller, 1997). The entire delta is situated
in the zone of continuous permafrost with a thickness of about 500–600 m (Zhang et
al., 1999).
18
Methane Cycle in Permafrost Ecosystems
1 General Introduction
Figure 1.3: Map showing the Lena Delta (red cycle) located at the Laptev Sea coast between the
Taymyr Peninsula and the New Siberian Islands (modified after Indo-European Documentation
Center, The University of Texas at Austin).
Samoylov is a representative island in the active and youngest part of the Lena Delta
and covers an area of about 5 km2 (Figure 1.4 A and 1.4 B). The western coast of the
island is characterized by modern accumulation processes (fluvial and aeolian
sedimentation). Three flood plains can be distinguished (e.g. Figure 1.4 C), which
differ in their flooding frequency and vegetation coverage. The texture of
accumulated sediments is dominated by the sand fraction (fine to medium).
The soil of the flood plain site in the north of the island is classified as Typic
Aquorthel, according to the US Soil Taxonomy (Soil Survey Staff, 2003). The
periodically flooding (once a year) of the site causes a water level near the soil
surface. Therefore, the soil is anoxic with the exception of the upper soil horizon (Ah).
The vegetation is dominated by Arctophila fulva. This plant is chracterized by a large
aerenchyma, which is responsible for the oxygen transport into the rhizosphere.
In contrast to the floodplain site, the eastern coast of Samoylov is dominated by
erosion processes, which form an abrasion coast. This part is composed of middle to
early Holocene deposits, which cover about 70% of the total area of the island. Most
studies on trace gas fluxes (CH4 and CO2) and microbial processes and community
structures were carried out within this terrace, which is dominated by active ice
wedges with low-centered polygons (Figure 1.4 D). The topography is determined by
this patterned ground and shows a distinct micro-relief of polygon rims and polygon
centers (Figure 1.5).
19
1 General Introduction
Methane Cycle in Permafrost Ecosystems
Figure 1.4: The Lena Delta (A) with the location of the investigation area on Samoylov Island (B;
72°22’N / 126°29’E) and a view from the helicopter on the long-term study sites (C, D).
Soil and vegetation characteristics show great variation over small distances owing to
the geomorphological situation of the polygonal tundra (Fiedler et al., 2004; Kutzbach
et al., 2004). The soils of the this site are characterized by very homogeneously
spread soil units: the polygon rims are dominated by Glacic Aquiturbels, whereas the
prevalent soil type of the polygon depressions are Typic Historthels. The peaty soils
of the polygon depression are characterized by a water level near the soil surface
and the predominantly anaerobic accumulation of organic matter. The drier soils of
the polygon rim show a distinctly deeper water level, lower accumulation of organic
matter and pronounced cryoturbation properties. The vegetation of the polygon rim is
dominated by the dwarf shrub Dryas punctata and the mosses Hylocomium
splendens and Timmia austriaca, whereas the polygon depression is dominated by
hydrophytes like various Carex species and different moss species (e.g. Limprichtia
revolvens, Meesia longiseta). In August, the thaw depth of the soils amounted to 30
and 45 cm in the rim and in the depression, respectively.
The dry continental Arctic climate of the southern Lena Delta with the Island
Samoylov is characterized by a low mean annual air temperature (-14.8 °C) and a
summer precipitation of about 200 mm (HMCR, 2004). The winter season lasts nine
20
Methane Cycle in Permafrost Ecosystems
1 General Introduction
months, from the end of September to the end of May (Tavg = -30 °C, Tmin = -48 °C)
with insufficient light (polar night) and heavy snowstorms (140 km h-1, Wein 1999).
The summer period of almost 12 weeks is characterized by warm temperatures
(Tavg = 7 °C, Tmax = 18 °C) and by permanent light (polar day).
Figure 1.5: Cross-section of a typical low-center ice-wedge polygon on Samoylov Island. The photos
show the typical soils for the polygon rim and center, respectively, on the main study site (photos L.
Kutzbach, AWI).
1.5
Expeditions
From 1998 to 2005, eight expeditions to the Lena Delta and the Laptev Sea coast
were carried out. Most of the investigations presented in this study were
accomplished in the context of the expeditions to Samoylov Island, Lena Delta.
Additional studies on methanogenesis were done in the framework of the expedition
LENA-ANABAR 2003 on Cape Mamontov Klyk (Figure 1.6).
The accomplished work during the different expeditions focused on various aspects
of the methane cycle in permafrost environments ranging from habitat characteristics
to microbial diversity and function. In the following the main research programs of the
individual expeditions are briefly presented:
During the first expedition LENA DELTA 1998 (Rachold and Grigoriev, 1999)
the long-term study site for methane flux measurements was established on
Samoylov Island. This site is located in an area of low-centered ice-wedge
polygons, which are typical patterned ground for the Siberian Arctic. Each five
21
1 General Introduction
Methane Cycle in Permafrost Ecosystems
stainless steel frames were permanently installed as a base for the closed
chamber flux measurements and a catwalk was built, in order to protect the
study area against influences during the measurements (chapter 3).
The main objectives of the expedition LENA 1999 (Rachold and Grigoriev,
2000) were the analyses of methane emission from permafrost soils for the
main vegetation period and the plant-mediated transport of methane to the
atmosphere. These investigations are still on-going. Furthermore, the soils of
the long-term study site were classified according to the US Soil Taxonomy
(Soil Survey Staff, 1998) and samples for geochemical and physical
characterization had been taken (chapters 3 and 4).
Figure 1.6: Geographical map of the Laptev Sea coast with the location of the study sites.
22
In the course of the expeditions LENA 2000 (Rachold and Grigoriev, 2001)
and LENA 2001 (Pfeiffer and Grigoriev, 2002), the microbial processes of
methane production and oxidation were studied under field conditions within
the active layer of the long-term study site. Moreover, during LENA 2001
expedition the first drilling campaign was accomplished with the main focus on
Holocene permafrost deposits on Samoylov Island (chapters 4 and 5).
A second drilling campaign foccusing on Late Pleistocene permafrost deposits
was carried out during the expedition LENA 2002 (Grigoriev et al., 2003) on
Kurungnakh Island (manuscript in preparation). Furthermore, samples for
studying methane oxidation were taken on Samoylov Island (chapter 4).
Methane Cycle in Permafrost Ecosystems
1 General Introduction
In the scope of the expedition LENA-ANABAR 2003 (Schirrmeister et al.,
2004) soil samples for studying the diversity of the methanogenic community
were taken from Cape Mamontov Klyk and from Samoylov Island (chapter 5).
The expedition LENA 2004 (Wagner and Bolshiyanov, 2006) was the first
campaign within the scope of the DFG project Tolerance Limits of
Methanogenic Life in Terrestrial Permafrost (WA 1554/1-1) contributing to
astrobiological research. Different stress experiments were carried out and
samples for further studies on the response of methanogenic archaea under
simulated Martian conditions had been taken (chapter 6).
During the expedition LENA 2005 (Schirrmeister and Wagner, 2007), field
experiments were devoted to the activity, diversity and stability of the methane
producing and oxidizing communities were accomplished and samples for
further molecular ecological analyses of both groups of microorganisms had
been taken (chapter 4).
23
2 Overview of the Publications
Methane Cycle in Permafrost Ecosystems
2 Overview of the Publications
In the following chapters (3-6) recently published results to the microbial methane
cycle in permafrost ecosystems in the Eastern Siberian Arctic are presented in form
of altogether fourteen publications. The manuscripts were arranged into four thematic
chapters as followed:
Chapter 3: Methane Release from Siberian Tundra Environments
This chapter shows published results of the long-term analyses of methane emission
from polygonal tundra and the contribution of the plant-mediated transport of
methane from the soil to the atmosphere.
3.1 Wille C., Kutzbach L., Sachs T., Wagner D. and Pfeiffer E.-M. (2007) Methane
emission from Siberian Arctic polygonal tundra: eddy covariance measurements
and modeling. Global Change Biology, submitted.
The paper was mainly written and compiled by Wille under the assistance of the
coauthors. The concept of this study was developed by Kutzbach and Pfeiffer.
Wagner coordinated the fieldwork during the expeditions LENA-ANABAR 2003
and LENA 2004 and contributed with valuable discussion about the effect of the
microbial processes on the methane fluxes.
3.2 Kutzbach L., Wagner D. and Pfeiffer E.-M. (2004) Effects of microrelief and
vegetation on methane emission from wet polygonal tundra, Lena Delta,
Northern Siberia. Biogeochemistry 69, 341-362.
The paper was mainly written and compiled by Kutzbach under the assistance of
the coauthors. The concept of this study was developed by Wagner (90%) and
partially interpreted (20%). Pfeiffer contributed with valuable discussion to the
interpretation of the results.
3.3 Schneider J., Grosse G. and Wagner D. (2007) Land cover classification of
tundra environments in the Arctic Lena Delta based on Landsat 7 ETM+ data and
its application for upscaling of methane emissions. Remote Sensing of
Environment, submitted.
The paper was mainly written and compiled by Schneider in the scope of her
diploma thesis under the assistance of the coauthors. The concept of this study
24
Methane Cycle in Permafrost Ecosystems
2 Overview of the Publications
was developed by Wagner (80%) and partial interpreted (20%). Grosse assisted
during the processing of the satellite images (40%) and contributed with valuable
discussion to the interpretation of the classification.
Chapter 4: Permafrost Ecosystems and Their Microbial Processes
Publications in this chapter describe the microrelief and soils of low-center ice-wedge
polygons, which are typical patterned ground in the Siberian Arctic. The different soils
as the habitat for the microorganisms were geochemically and physically
characterized. Furthermore, the microbial processes of methane production and
oxidation were studied by activity measurements under in situ conditions and cell
counting.
4.1 Fiedler S., Wagner D., Kutzbach L. and Pfeiffer E.-M. (2004) Element
redistribution along hydraulic and redox gradients of low-centered polygons,
Lena Delta, Northern Siberia. Soil Science Society of America Journal 68, 10021011.
The paper was mainly written by Fiedler under the assistance of Wagner (text
20%, illustrations 40%, interpretation 30%). Furthermore, Wagner carried out the
redox measurements and the sampling during the expeditions LENA 1999 and
2000, and provided geochemical and physical analyses (60%). Kutzbach
provided data on soil and vegetation characteristics. Pfeiffer was leader of the
project.
4.2 Wagner D., Kobabe S., Pfeiffer E.-M. and Hubberten H.-W. (2003a) Microbial
controls on methane fluxes from a polygonal tundra of the Lena Delta, Siberia.
Permafrost and Periglacial Processes 14, 173-185.
Wagner was responsible for the field laboratory and carried out most of the field
work (80%). Furthermore, text and compilation of the data (100%), figures
(100%) and interpretation (80%). Coauthors were partly involved in the field work
and assisted in the interpretation of the data.
4.3 Liebner S. and Wagner D. (2007) Abundance, Distribution and Potential Activity
of Methane Oxidizing Bacteria in Permafrost Soils from the Lena Delta, Siberia.
Environmental Microbiology 9, 107-117.
The paper was mainly written and compiled by Liebner in the scope of her PhD
project under the supervision of Wagner. Furthermore, Wagner contributed with
25
2 Overview of the Publications
Methane Cycle in Permafrost Ecosystems
the description and sampling of the floodplain soil during the expedition LENA
2002, geochemical data (10%) and the interpretation of the data (30%).
Wagner D., Gattinger A., Embacher A., Pfeiffer E.-M., Schloter M. and Lipski A.
(2007) Methanogenic activity and biomass in Holocene permafrost deposits of
the Lena Delta, Siberian Arctic and its implication for the global methane budget.
Global Change Biology, accepted #.
Wagner was responsible for the sample preparation, geochemical, physical and
microbial analyses as well as text (90%), illustration (100%) and interpretation
(80%). Gattinger provided total lipid extractions and PLEL analyses, text (10%),
interpretation (20%) and statistics (90%). Lipski carried out PLFA analyses.
Embacher was responsible for organic matter analyses and Pfeiffer for the
permafrost drilling during the expedition LENA 2001. Schloter contributed with
valuable discussion to the interpretation of the results.
Chapter 5: Microbial Community Structure in Permafrost Ecosystems
Publications in this chapter report studies on the abundance and biodiversity of
microbial communities involved in the anaerobic decomposition of organic carbon in
different permafrost ecosystems. The microbial communities were phenotypical and
genotypical characterized by culture-independent methods.
5.1 Kobabe S., Wagner D. and Pfeiffer E.-M. (2004) Characterization of microbial
community composition of a Siberian tundra soil by fluorescence in situ
hybridization. FEMS Microbiology Ecology 50, 13-23.
The paper was mainly written and compiled by Kobabe in the scope of her PhD
project under the supervision of Pfeiffer. Wagner initiated this study (100%),
advised the field work during the expedition LENA 2001 (80%) and significantly
contributed to the discussion of the results (40%).
5.2 Wagner D., Lipski A., Embacher A. and Gattinger A. (2005) Methane fluxes in
permafrost habitats of the Lena Delta: effects of microbial community structure
and organic matter quality. Environmental Microbiology 7, 1582-1592.
Wagner was responsible for the field work, analyses of the microbial activity, text
(80%), illustrations (75%), and interpretation (80%). Gattinger provided total lipid
__________
# since the submission of the thesis the paper is published in Global Change Biology 13, 1089-1099 (2007)
26
Methane Cycle in Permafrost Ecosystems
2 Overview of the Publications
extractions and PLEL analyses, text (20%) and interpretation (20%). Lipski
carried out PLFA analyses and illustration (25%). Embacher was responsible for
organic matter analyses.
5.3 Ganzert L., Jurgens G., Münster U. and Wagner D. (2006) Methanogenic
communities in permafrost-affected soils of the Laptev Sea coast, Siberian Arctic,
characterized by 16S rRNA gene fingerprints. FEMS Microbiology Ecology #, doi:
10.1111/j.1574-6941.2006.00205.x 59
The paper was written, compiled and illustrated by Ganzert (50%) and Wagner
(50%). The concept of this study was developed by Wagner (70%). Activity
measurements and DNA-based analyses were performed by Ganzert. Jurgens
and Münster provided the phylogenetic trees.
Chapter 6: Methanogenic Archaea as Model Organisms for Life in Extreme
Habitats and Their Relevance for Astrobiological Research
Publications in this chapter deal with methanogenic archaea from Siberian
permafrost as model organisms for possible life in extraterrestrial permafrost like on
Mars. The tolerance against different environmental stress (low temperature, high
salinity, radiation, starvation, desiccation) was tested. Furthermore, the survival of
methanogenic archaea from permafrost and non-permafrost habitats was analysed
under simulated Martian thermo-physical conditions.
6.1 Wagner D., Spieck E., Bock E. and Pfeiffer E.-M. (2001) Microbial life in
terrestrial permafrost: Methanogenesis and nitrification in gelisols as potentials
for exobiological processes. In: Horneck, G. & Baumstark-Khan, C. (eds.):
Astrobiologie-the quest for the conditions of life, Springer-Verlag Berlin, 143-159.
The paper was mainly written and compiled (90%) as well as illustrated (60%) by
Wagner. Results on methanogenesis were provided by Wagner, while results on
nitrification were delivered by Spieck. Bock and Pfeiffer contributed with valuable
discussion.
6.2 Wagner D., Wille C., Kobabe S. and Pfeiffer E.-M. (2003b) Simulation of freezing
thawing cycles in a permafrost microcosm for assessing microbial methane
production under extreme conditions. Permafrost and Periglacial Processes 14,
367-374.
__________
# the paper is now published in FEMS Microbiology Ecology 59, 476-488 (2007)
27
2 Overview of the Publications
Methane Cycle in Permafrost Ecosystems
The paper was mainly written and compiled (90%) as well as illustrated (60%) by
Wagner. The field measurements on methane emission as well as the methane
production activity was analysed by Wagner. Wille was responsible for the
technical realization of the permafrost microcosms, text (10%) and illustration
(40%). Kobabe provided the preliminary test sequence with the microcosm and
Pfeiffer contributed with valuable discussion.
6.3 Morozova D. and Wagner D. (2007) Stress response of methanogenic Archaea
from Siberian permafrost compared to methanogens from non-permafrost
habitats. FEMS Microbiology Ecology #, awaiting acceptance.
The paper was mainly written and compiled by Morozova in the scope of her PhD
project under the supervision of Wagner. Wagner initiated this study (100%), was
mainly involved in the enrichment and isolation of methanogenic archaea from
Siberian permafrost soils (70%) and significantly contributed to the discussion of
the results (30%).
6.4 Morozova D., Möhlmann D. and Wagner D. (2006) Survival of methanogenic
archaea from Siberian permafrost under simulated Martian thermal conditions.
Origin of Life and Evolution of Biospheres*, doi: 10.1007/s11084-006-9024-7.
The paper was mainly written and compiled by Morozova in the scope of her PhD
project under the supervision of Wagner. Wagner was mainly involved in the
enrichment and isolation of methanogens from permafrost soils (70%) and
significantly contributed to the discussion of the results (30%). Möhlmann made
the Mars simulation facility available.
__________
# since the submission of the thesis the paper is published in FEMS Microbiology Ecology 61, 16-25 (2007)
* the paper is now published in Origin of Life and Evolution of Biospheres 37, 189-200 (2007)
28
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
3 Methane Release from Siberian Tundra Environments
Global Change Biology, submitted
3.1
Methane emission from Siberian Arctic polygonal tundra: eddy covariance
measurements and modeling
C. WILLE1*#, L. KUTZBACH1#, T. SACHS1, D. WAGNER1 AND E.-M. PFEIFFER2
1
Alfred Wegener Institute for Polar and Marine Research, Research Department Potsdam, Telegrafenberg A45,
14473 Potsdam, Germany, 2Institute of Soil Science, University Hamburg, Allende-Platz 2, 20146 Hamburg
* corresponding author: Christian Wille, tel +49 3834 86 4185, fax +49 3834 86 4185,
e-mail [email protected]
#
present address: Institute for Botany and Landscape Ecology, Ernst-Moritz-Arndt University of Greifswald,
Grimmer Strasse 88, 17487 Greifswald
Abstract
Eddy covariance measurements of methane flux were carried out in an arctic tundra
landscape in the central Lena River Delta at 72 °N. The measurements covered the
seasonal course of mid-summer to early winter in 2003 and early spring to mid-summer in
2004, including the periods of spring thaw and autumnal freeze back. The study site is
characterized by very cold and deep permafrost and a continental climate with a mean
annual air temperature of -14.7 °C. The surface is characterized by wet polygonal tundra,
with a pronounced micro-relief consisting of depressed water-logged and raised moist to
dry sites. We found relatively low fluxes of typically 30 mg CH4 m-2 d-1 during midsummer and identified soil temperature and near-surface turbulence as the driving
parameters of methane emission. A model based on these variables explained variations
of methane flux corresponding to continuous processes of microbial methane generation
and oxidation, and diffusion through soil and plants reasonably well. Transitory processes
related to spring thaw and turbulence- and pressure-induced ebullition were estimated to
contribute about 10 % to the measured flux. The relationship found between methane flux
and soil temperature was extrapolated to estimate the methane emission during the winter.
Based on this estimate, the annual methane flux was 3 g m-2. This is low compared to
values reported for similar ecosystems. Reason for this were thought to be (a) the very
low permafrost temperature in the study region, (b) the sandy soil texture and low bioavailability of nutrients in the soils, and (c) the high surface coverage of moist to dry
micro-sites. The methane emission accounted for about 13 % of the annual ecosystem
carbon balance. Considering the global warming potential of methane, the methane
emission turned the tundra into an effective source of greenhouse gases.
Keywords: methane, eddy covariance, tundra, carbon balance
Introduction
Approximately 24 % of the Northern Hemisphere’s exposed land area is underlain by permafrost
(Zhang et al., 1999). These permafrost affected landscapes store about one third of the global organic
29
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
carbon pool near the surface (Gorham, 1991). Because of the high sensitivity of high-latitude
ecosystems to climate changes, as well as their large proportion of the earth surface, these landscapes
are critically important for the Earth System, in particular for the global carbon cycle (Chapin et al.,
2000).
Arctic tundra environments account for 13-15 % of the global organic soil carbon pool (Post et
al., 1982) and are estimated to form the largest single source of methane, contributing about 20 % of
the annual natural emissions (Fung et al., 1991; Cao et al., 1996; Christensen et al., 1996). With the
growing concern about climate change and the need to quantify emissions on a large scale, the
greenhouse gas (GHG) budget of arctic wetlands have come into the focus of attention. Because
methane has a 23-fold global warming potential compared to carbon dioxide (time horizon of 100
years; Houghton et al., 2001), it has a strong influence on the GHG budgets of these landscapes
(Friborg et al., 2003; Corradi et al., 2005). Furthermore, global climate models rely on predictions of
future GHG concentrations, which require the ability to accurately model sinks and sources of
methane as a powerful greenhouse gas.
However, there is still much uncertainty about the source strength and the driving forces of
methane flux of tundra landscapes. Existing studies of high latitude methane fluxes were mostly based
on the closed-chamber technique. Due to the high temporal and spatial variability of methane fluxes
(Christensen et al., 1995; Christensen et al., 2000; Wagner et al., 2003; Kutzbach et al., 2004), this
technique alone does not give reliable information on landscape scale fluxes. In addition, during
chamber measurements the soil surface is isolated from the atmosphere so that the coupling of
atmosphere and methane emission can not be studied. The eddy covariance technique provides nonintrusive spatially integrated flux data at the landscape scale. However, to our knowledge only three
studies reported eddy covariance methane flux data from arctic tundra ecosystems, namely Fan et al.
(1992) from Alaska, Friborg et al. (2000) from Greenland, and Hargreaves et al. (2001) from Finland.
Here, we present the first eddy covariance methane flux data from a Siberian Arctic tundra
landscape. The objective of this study was to quantify the methane emission over the full course of the
“active” season from early spring to early winter, to analyze the contribution of different parts of the
vegetation period, particularly spring thaw and soil re-freeze, to identify the biological and physical
parameters which control the methane fluxes, and to estimate the annual methane emission. Together
with the fluxes of carbon dioxide, which were measured concurrently and analyzed elsewhere
(Kutzbach, 2006), a complete picture of the GHG budget of the tundra was gained.
Material and methods
Study site
The investigation site was located on Samoylov Island in the Lena River Delta at 72° 22’N, 126° 30’E
(Fig. 1). The Lena River Delta is located in the zone of continuous permafrost with permafrost depths
of 500 - 600 m (Zhang et al., 1999; NSIDC, 2003) and permafrost temperatures between -11 and -13
°C (Kotlyakov and Khromova, 2002). Samoylov Island is situated in the southern central part of the
river delta, approximately 120 km south of the Arctic Ocean. The central delta region has a dry
continental arctic climate, which is characterized by very low temperatures and low precipitation. The
30-year (1961-1999) averages of annual air temperature and precipitation measured at the
meteorological station in Tiksi about 110 km east of Samoylov Island are -13.6 °C and 319 mm,
respectively (ROSHYDROMET, 2004). Data from the meteorological station on Samoylov Island
from the period 1999-2005 showed a mean annual air temperature of -14.7 °C and a highly variable
total summer precipitation (rain) between 72 and 208 mm (mean 137 mm; Boike and Wille, 2006).
The polar night lasts from November 15 to January 28, and the polar day from May 7 to August 7. The
snow melt typically starts at around the beginning of June and the growing season typically lasts from
the middle of June to the middle of September. During spring, summer and autumn, the weather in the
30
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
central delta region is characterized by the rapid change between the advection of arctic cold and moist
air masses from the north and continental warm and dry air masses from the south.
Fig. 1 Overview map of the investigation area. Left: Vegetation zones in the Arctic (modified after
UNEP/GRID-Arendal, CAFF 1996). Right: Satellite image of the Lena River Delta (Landsat 7 ETM+ GeoCover
2000, NASA); the location of the investigation area Samoylov Island is marked by a white square.
The flux measurements were carried out on the eastern part of Samoylov Island (Fig. 2), which is
characterized by wet polygonal tundra. It represents the Late-Holocene river terrace which is one of
the main geomorpholocical units in the Lena River Delta, occupying about 65 % of the total delta area
(Grigoriev, 1993; Are and Reimnitz, 2000). The elevation of the eastern part of Samoylov Island
ranges from 10 to 16 m a.s.l. During the annual spring flood only the low lying lakes in the southeastern part of the island are flooded. The macro-relief of the island is level with slope gradients < 0.2
%. Larger elevation differences up to 2.5 m occur only along the shorelines of the large lakes.
However, the surface of the terrace is structured by a regular micro-relief with elevation differences of
up to 0.5 m within a few meters distance, which is caused by the genesis of low-centered ice wedge
polygons (Washburn, 1979; French, 1996; Meyer, 2003). In the depressed polygon centers, drainage is
impeded by the underlying permafrost, hence the soils are water-saturated and small ponds frequently
occur. In contrast, the elevated polygon rims are characterized by a moderately moist water regime.
The typical soil types are Typic Historthels in the polygon centers and Glacic or Typic Aquiturbels at
the polygon rims (Soil Survey Staff, 1998). The vegetation in the polygon centers and at the edge of
ponds is dominated by hydrophytic sedges (Carex aquatilis, Carex chordorrhiza, Carex rariflora) and
mosses (e.g. Limprichtia revolvens, Meesia longiseta, Aulacomnium turgidum). The vegetation on
polygon rims is dominated by mesophytic dwarf shrubs (e.g. Dryas octopetala, Salix glauca), forbs
(e.g. Astragalus frigidus) and mosses (e.g. Hylocomium splendens, Timmia austriaca). For more
information on soil types and vegetation of the polygonal tundra on Samoylov Island see Pfeiffer et al.
(2002), Kutzbach et al. (2003, 2004), and Fiedler et al. (2004). Aerial photography in July 2003 and
subsequent surface classification showed that the surface fraction taken by elevated dry sites (polygon
rims) and depressed wet sites (polygon centers and troughs) in the area surrounding the flux tower was
about 60 % and 40 %, respectively (Wille, 2004; Schneider et al., 2006).
During the last years, Samoylov Island has been the focus of several studies in the field of
microbiology, soil science, and surface-atmosphere fluxes of carbon, energy and water (Hubberten et
al., 2006). Since 1998, meteorology and soil data has been measured nearly continuously on a
monitoring site on the southern part of the island and has been used in studies of the energy and water
balance of the permafrost soils (Boike et al., 2003; Boike and Wille, 2006). Since 1999, fluxes of
methane have been measured on the same monitoring site using the closed-chamber technique and
31
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
investigated with respect to the driving soil and vegetation parameters (Wagner et al., 2003; Kutzbach
et al., 2004). For the assessment of the microbial activity as the driver of methane fluxes, process
studies of methane production and oxidation and molecular-biological studies of the microbial
community structure were carried out (Kobabe et al., 2004; Wagner et al., 2005; Liebner and Wagner,
2006; Ganzert et al., 2006). Finally, a high-resolution time series of the fluxes of energy, water, and
carbon dioxide over a full growing season, measured concurrently with the here described methane
fluxes, were presented by Kutzbach (2006).
Fig. 2 Satellite and aerial images of the investigation site. Left: CORONA satellite image of Samoylov Island
taken during the spring flood in June 1964. Right: Aerial image of the central part of Samoylov Island, taken in
July 2003. The position of the micrometeorological tower is marked by (+).
Experimental set-up
Eddy covariance measurements of methane flux were carried out in the periods 19 July -22 October
2003 (96 days), and 31 May - 21 July 2004 (52 days). The eddy covariance system was set up at a
central position of the eastern part of Samoylov Island (Fig. 2). Wet polygonal tundra of the river
terrace extended for 600 m around the tower, with several large lakes protruding into the periphery of
the otherwise relatively homogeneous fetch area. The wind vector and sonic temperature were
measured with a three-dimensional sonic anemometer (Solent R3, Gill Instruments Ltd., UK) which
was mounted on top of a 3 m aluminum tower. The effective measurement height was 3.65 m. From a
sample intake 15 cm below the anemometer measurement point, the sample air was pulled at a rate of
20 L min-1 through a CO2/H2O gas analyzer (LI-7000, LI-COR Inc., USA), a membrane gas dryer
(PD-200T-48SS, Perma Pure Inc., USA), and the methane gas analyzer, all of which were housed in a
temperature regulated case at the foot of the tower. The methane gas analyzer was a tunable diode
laser spectrometer (TGA100, Campbell Scientific Inc., USA). The concentrations of methane, carbon
dioxide, and water vapor were output as an analog signal and digitized by the anemometer at a rate of
20 Hz. Data was logged using a laptop PC running the software EdiSol (J. Massheder, Univ. of
Edinburgh, UK).
The tower was equipped with additional instruments for the measurement of air temperature and
relative humidity (MP103A, ROTRONIC AG, Switzerland), incoming and outgoing solar and infrared
radiation (CNR1, Kipp and Zonen B.V., The Netherlands), and barometric pressure (RPT410, Druck
Messtechnik GmbH, Germany). Measurements of the water level were carried out at 3 points in the
vicinity of the flux tower at intervals of 1 - 3 days. Precipitation, snow height, and soil temperature
data was taken from the long-term monitoring station, which is situated about 700 m south-west of the
flux tower (Boike and Wille, 2006). The thaw depth was measured by probing the soil with a steel rod
32
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
at 150 regularly spaced grid points near the long-term monitoring station at intervals of 3 to 7 days
(Kutzbach et al., 2004a).
Data processing
Analysis of raw data and calculation of turbulent fluxes were done using the software EdiRe (R.
Clement, University of Edinburgh, UK). The averaging interval for the calculation of fluxes was set to
60 minutes. This is twice the value commonly used in flux studies. However, choosing such a long
averaging interval was necessary to increase the signal-to noise ratio of the correlation calculation,
which was frequently low due to the relatively low methane emission and high wind velocities. Two
coordinate rotations were performed on the wind components measured by the sonic anemometer, so
that the mean transverse and vertical wind components were reduced to zero for each averaging period
(McMillen, 1988). The mean absolute value of the angle of the second rotation was 1.0 ± 0.9 degrees;
hence the error introduced to turbulent fluxes by the rotation should be well below 10 % for most
measurements (Foken & Wichura, 1996). For each averaging period, the time lag between wind and
methane concentration measurements was determined and removed from the concentration time series.
Before the calculation of fluxes, a recursive high pass filter with a filter constant of 10 s (cut-off
wavelength 63 s) was applied to the methane concentration time series. This effectively removed
strong signal intensities at wavelengths > 50 s in the spectra of the methane concentration signal which
were attributed to the effects of instrument drift and instationary conditions. A correction was applied
to the calculated methane flux to account for the mismatch of the frequency spectrum of the turbulent
flux and the spectral response of the measurement system. In detail, the correction compensated for
the effects of the spectral response of the gas analyzer, the separation of the anemometer and gas
analyzer sampling points, the gas sampling through the tube, and the detrending filter (Moore et al.,
1986; Moncrieff et al., 1997). On average, 41 % were added to the calculated flux, of which typically
about 23 % and 13 % were related to the effect of the spectral response of the gas analyzer and the
strong high pass filtering of the methane concentration data, respectively.
The calculated flux data was screened thoroughly. The cross correlation function of vertical wind
and methane concentration was used to determine if the measurement was disturbed by excessive
noise. Data points were discarded if any peaks in the cross correlation function greater than the flux
peak occurred. The standard deviation of the cross correlation function at time shifts between 100 and
200 seconds was used to estimate the measurement error. This method accounts for the gaussian error
of the individual measurements as well as the uncertainty in the stationarity during the averaging
period (Kormann et al., 2001). On average, the error calculated using this method was 1.3 mg CH4 m-2
d-1. Finally, the data was screened using an integral turbulence characteristics test (Foken & Wichura,
1996). In 2003, altogether 34 % of the measurements were rejected using the criteria named above.
This value is similar to data coverage rates of studies of ecosystem fluxes of carbon dioxide, for
instance in the EUROFLUX network (Falge et al., 2001). In 2004, due to technical problems during
the first half of the measurement campaign the rejection rate was about 72 %.
A footprint analysis following Schuepp et al. (1990) was carried out for the assessment of the
fetch area size of the flux measurements. The 80 % cumulative footprint, i.e. the upwind distance from
which 80 % of the observed methane flux originated, was on average 508 m during the combined
measurement periods. The point of origin of the maximum contribution to the measured flux was on
average 113 m.
Flux modeling
In order to identify the factors which control the methane flux, the relationship between the flux and
environmental variables was studied. Because the time scale of interest was a full year, daily averages
of all data were used rather than the measured hourly data. As a first step, the Pearson coefficient of
correlation between methane flux and environmental variables was calculated. Variables which
showed a strong correlation or had been identified by previous studies as important drivers of methane
flux were studied more closely and included in a modeling approach similar to the one conducted by
33
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
Friborg et al. (2000). The underlying idea of this approach is the existence of an ecosystem reference
flux which is associated with a set of average environmental variables. The actual flux is then a
product of the reference flux and a regulation factor specific for each environmental variable. Hence,
the general form of the equation used for fitting measured data to environmental variables was
FCH4 = FCH4,ref b((T-Tref)/10) ƒ1(X1) ƒ2(X2)…
(1)
In equation (1) FCH4 is the time series of methane flux, and FCH4,ref is the reference flux determined
through the fit process. The first exponential term with b as fit parameter is the flux regulation factor
for soil temperature T and is based on the well-described dependency of soil microbiological activity
on temperature (e.g. Conrad, 1989). The terms f(X) describe the regulation of the flux by
environmental variables X, where f can be a linear or exponential function term. For the fit process, a
weighting factor of 1/(σFCH4)2 was applied to the methane flux, where σFCH4 is the daily mean of the
errors of the hourly flux data points.
Results
Meteorological conditions
The summer and autumn of 2003 were characterized by above-average temperatures and precipitation
(Fig. 3). Advection of warm continental air from the south leads to unusually high temperatures during
the middle of July, at the beginning of August and during large parts of September. This leads to a
considerable delay of the freeze-back of the soils. The daily average soil temperature measured at 0.15
m depth at a semi-moist micro-site reached a maximum of 7.6 °C on 7 August. From there it declined
slowly until the isothermal state of the thawed layer was reached and re-freeze of the soil began on 30
September. At the end of the measurement campaign the soil temperature at 0.15 m depth was around
-1 °C. Soil thaw depth was 0.3 m at the beginning of measurements in 2003 and reached a maximum
of 0.48 m at the beginning of September. No measurements of thaw depth could be carried out after
September 30 due to the freezing of the top soil layer. However, the temperature profile measurements
showed that the soil was not completely frozen until after the middle of November. At 168 mm, the
total amount of rainfall during the measurement period was exceptionally large. A great part of the
rainfall occurred within one week at the end of July (94 mm), which caused the water table in the
investigated polygons close to the eddy tower to rise well above the soil surface. Following a slow
decrease, the water level stayed within ± 1 cm of the soil surface after the end of August. Snow started
to accumulate at the beginning of October. By the end of the measurement campaign, the snow cover
had reached a height of 0.15 - 0.25 m in the polygon centers and just a few centimeters on the polygon
rims. The daily average wind speed over the measurement campaign 2003 was 4.7 m s-1. There was no
single predominant wind direction; however, wind directions east-north-east, south, and south-west
occurred more frequently than other directions (data not shown).
When methane flux measurements started on 31 May 2004, the ground at the eddy tower site was
completely covered with snow. The snow height had already started to decrease but was still 0.4 - 0.5
m in the polygon centers and about 0.1 m on the polygon rims. The daily average air temperature was
in the range -5 to -2 °C, and the soil temperature in 15 cm depth was -10 °C. The snow thaw period
started on 8 June with the occurrence of the first significant rainfall and the air and soil temperatures
reaching 0 °C. The snow height decreased rapidly, and the polygon rims were largely free of snow
after 2 days. Snow thaw in the polygon centers continued until 18 June. Towards the end of the snow
thaw, the thaw of the soils and of polygon ponds and lakes started. Thawing of polygon ponds lasted
until about 25 June, and the thaw depth of the soils increased by about 5 cm per week. At the end of
the measurement campaign, daily average air and soil temperatures (15 cm depth) were around 8 °C
and 2 °C respectively, and the soil thaw depth had reached about 30 cm (linear extrapolation from
measurements). The water table in the polygon centers was generally higher than in 2003 and never
34
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
fell below the soil surface. The total rainfall up to 21 July was 60 mm. The average wind speed of the
measurement period in 2004 was 4.7 m s-1. Unlike 2003, there was a clear dominance of easterly
winds, followed by winds from north-westerly directions (data not shown).
Methane flux
Fig. 3 Data of measurement campaigns 19 July - 22 October 2003 and 31 May - 21 July 2004. (a) daily averages
of air temperature at 2 m above ground and soil temperature at a semi-moist micro-site at 0.15 m depth, (b) daily
sum of precipitation (rain only), and water table with respect to soil surface in a depressed polygon center, (c)
daily average of snow height in a depressed polygon center, and soil thaw depth, (d) daily average of wind speed
from sonic anemometer at 3.65 m above ground, (e) hourly methane flux as measured by eddy covariance. Air
temperature data before 19 July 2003 and 31 May 2004 was taken from the long-term monitoring station.
The long-term variations of methane flux roughly followed the variations in soil temperature.
However, there were great short-term variations in flux which partly correlated with wind speed.
During days with strong wind, the methane flux could rise by a factor of 3 compared to fluxes
measured during calm periods directly before and after, as for instance on 10 August 2003 (Fig. 3). In
the first week of measurements in 2003, methane fluxes were on average 23 mg m-2 d-1. During the
35
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
following cold and rainy period, the fluxes dropped markedly but subsequent warming and further
thawing of soils lead to the highest fluxes of on average 30 mg m-2 d-1 being measured during the
second week of August. From the middle of August until 10 September, the methane flux stayed at a
high level of on average 20 mg m-2 d-1. Afterwards, methane fluxes started to decrease slowly. Also
variations in flux decreased. No marked influence of the freezing of the top soil layer at the end of
September on the methane flux was visible. Average fluxes measured during the first week of October
and during the last week of measurements, when snow had accumulated on the ground, were 13 and 7
mg m-2 d-1, respectively.
Table 1 Pearson coefficient for correlation between CH4 flux and environmental parameters during the
combined measurement period 2003-2004
soil temperature
friction velocity
thaw depth
water table
depth (m)
r
r
r
r
0.15
0.52
0.67
0.22
-0.07
The average methane flux measured during the thaw period up to 18 June was 10 mg m-2 d-1.
However, the variation in the flux data during this time was large. Low flux values of about 4 mg m-2
d-1 occurred frequently throughout this period, but at the beginning of the snow melt methane fluxes of
about 30 mg m-2 d-1 were repeatedly measured. The high variability of the fluxes continued until about
28 June. After this date, the fluxes stabilized at a low level and increased slowly, following the
increase of soil temperature. The average flux until the end of measurements on 21 July was 14 mg m-2
d-1.
Table 2 Input and model parameters for the combined period 2003-2004 using equation 2
Tref
u*ref
a
b
c
(°C)
(m s-1)
(mg m-2 d-1)
1.35
0.28
14.44 ± 0.11
3.14 ± 0.10
11.88 ± 1.03
R2
0.75
The analysis of methane flux data and environmental data showed a strong correlation
between methane flux and friction velocity and soil temperature (Table 1). A good agreement (R2 =
0.75; cf. Table 2) with measured data of the combined period 2003-2004 was found when the daily
mean methane flux was modeled using the equation
FCH4 = a b((T-Tref)/10) c(u*-u*ref)
(2)
where T is the soil temperature at a semi-moist micro-site at 0.15 m depth, u* is the friction velocity,
and Tref and u*ref are the mean values of the respective variables during the measurement period. There
was only a very weak correlation between methane flux and thaw depth or water table position, and
expanding the model to include these variables did not improve the fit. Measured fluxes and those
modeled by equation (2) agree reasonably well over the whole range of measured flux values (Fig. 4),
however, there is a relatively large number of residuals > 5 mg m-2 d-1, i.e. where the model
significantly underestimates the measured fluxes. This is better illustrated by Figure 5 which shows
the time series of measured and modeled daily methane flux. Significant underestimation of the
measured data by the model correlated with events of increased wind speed after calm periods (e.g. 9
and 19 August 2003, 25 September 2003) and with events of very low air pressure values near or
below 100 kPa (e.g. 27 August, 6 September, and 13 October 2003, 27 June 2004, air pressure data not
shown). The model also strongly underestimated methane fluxes on days with a mean wind speed of
more than 7 m s-1, and during the thaw period.
By gap-filling the measurements using equation 2, the cumulative methane emission over the
combined measurement periods was calculated to be 2.4 g m-2.
36
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
Discussion
Drivers of methane flux
The combined measurement periods covered a whole vegetation period from spring thaw to refreeze
of the soils and thus the most active period of methane emission. The wide range of environmental
conditions covered allowed a detailed study of the driving forces of the methane flux. One of the two
important parameters controlling methane emission was the soil temperature. The dependence of
methane flux on soil temperature followed an exponential function. This reflects the fundamental
dependence of (soil) microbiological activity on temperature and was confirmed by numerous studies
of methane emission using closed chamber or eddy covariance techniques (e.g. Nakano et al., 2000;
Christensen et al., 2001; Hargreaves et al., 2001).
Fig. 4 Modeled flux (equation 2) versus measured mean daily methane flux (N = 135). The error bars are daily
means of standard deviations of hourly flux data points.
The turbulence in the near-surface boundary layer was the second important driving factor of the
methane flux in the polygonal tundra. Hargreaves et al. (2001) found a close relation between
momentum flux and methane emission, but only for short periods up to one day. No other study was
found to report a similar effect. There are two explanations for a dependence of methane flux on
turbulence. One possible way of action of turbulence is to increase the fraction of methane which is
bypassed around the oxidation process. The regulation of methane emissions by the balance of
methane generation and oxidation in the soil was studied and described for wetland ecosystems by
many authors (e.g. Panikov et al., 2001; Wagner et al., 2003). The bypass around the oxidation
process is realized via plant-mediated transport of methane from deep soil layers directly to the
atmosphere (e.g. Schütz et al., 1991). Using the chamber technique, methane transport via Carex
aquatilis was shown to account for between 27 and 66 % of overall methane emissions at the
polygonal tundra on Samoylov Island (Kutzbach et al., 2004). The same study suggested that diffusion
across the dense root exodermes was the limiting factor of the gas transport. Increased turbulence
could accelerate the gas exchange between the above-surface part of plants and the atmosphere, cause
higher concentration gradients across the root exodermes and thus enhance diffusion across this
interface. Increased turbulence could also lead to a better aeration of upper soil layers and dense moss
layers. The result is a higher concentration gradient in the soil, leading to a higher diffusive flow of
methane and hence a decrease of the fraction of methane oxidized by bacteria. These processes could
be characterized as continuous, i.e. they should be consistent and proportional to the turbulence
measured near the surface.
37
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
Another possible way of action of turbulence is the triggering of ebullition of small methane
bubbles from water-logged vegetated areas or little ponds. Hargreaves et al. (2001) observed ebullition
during periods of high wind speed following calm spells. Ebullition of small methane bubbles could
also be caused by a sharp decline of air pressure. This mechanism has been suggested by other
authors, e.g. Frolking and Crill (1994), and was observed during a detailed study of methane emission
from lakes on Samoylov Island in 2002 (Spott, 2003). However, both effects are probably not
continuous, because the ebullition of bubbles is thought to happen much faster than their generation by
methanogenesis. Due to this transitory nature of ebullition, increased methane emission associated
with ebullition events can not be expected to be adequately described by the model used in this study.
This is supported by the underestimation of measured fluxes by the model observed on days of
increased wind speed after calm periods and on occasions of very low air pressure. By integrating the
large positive residuals of the model fit, the contribution of ebullition to methane emission during the
combined measurement period is estimated to be 10 %.
Fig. 5 Time series of measured and modeled daily averaged CH4 fluxes during the periods 19 July - 22 October
2003 and 31 May - 21 July 2004. The error bars are daily means of standard deviations of hourly flux data
points.
Many studies identified the thaw depth of soils as an important predictor of methane emission,
spatially and temporally (e.g. Friborg et al., 2000; Tsuyuzaki et al., 2001; van Huissteden et al., 2005).
In our study, the thaw depth was only weakly correlated with methane flux and, when added as an
additional variable, did not improve the performance of flux model based on soil temperature in 0.15
m depth and friction velocity. This indicates that during the warm period the majority of the methane
emitted originated from the upper soil layers. Process studies showed that microbial methane
production rates in soils of Samoylov Island at in-situ summer temperatures were between 5 and 20
times greater in the top of the active layer compared to the bottom (Wagner et al., 2003). At the same
time, it was shown that the microorganisms in deep soil layers are cold-adapted and have a high
potential activity at temperatures close to 0 °C (Liebner and Wagner, 2006; Wagner et al., 2006).
Hence, the small contribution of deep soil layers to methane emissions can not be explained by the
strong temperature gradient in the thawed soil, but is more likely caused by a substrate limitation of
microbial activity. This is supported by Wagner et al. (2005) who reported a decreasing bioavailability
of soil organic carbon with increasing depth in soils of Samoylov Island.
The water table position is another environmental variable which was identified by many studies
as a main factor controlling methane emission (e.g. Friborg et al., 2000; Suyker et al., 1996). This was
explained with the regulation of the methane production/oxidation balance through the ratio of the
aerobic/anaerobic soil column depth. In the spatial domain, this regulation was also observed at our
study site: Concurrent measurements of methane emissions by the closed-chamber technique showed
that the methane fluxes from water logged polygon centers were larger by a factor of 8-10 compared
to emissions from elevated, moderately moist polygon rims at any time during the measurement
campaigns 2003 and 2004 (unpublished data). However, temporally, no significant influence of water
38
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
table on methane flux was detected, despite great variations of water table position during both years.
This can be explained with respect to the two micro-sites prevalent in our study area: Firstly, in the
polygon rims, the water table was always well below the soil surface, so the ratio of aerobic/anaerobic
soil column was always high. Furthermore, process studies have shown that oxidation activity in these
soils is greatest near the aerobic-anaerobic interface where the substrate provision is at its optimum
(Liebner and Wagner, 2006). Hence, the methane flux from polygon rim areas did not respond
strongly to variations of water table position, which is confirmed by the results of the closed-chamber
measurements. Secondly, despite the variations in water table position, in most of the polygon centers
the water table was distinctly above the soil surface during both measurement periods, so the change
of water table position could not influence the methane production/oxidation balance significantly.
However, extreme draught could lower the water level below the soil surface in many polygon centers
and lead to increased oxidation and overall decreased methane flux. This “on-off switch” effect
(Christensen et al., 2001) was observed for single polygon center sites on Samoylov Island during the
dry summer of 1999 (Wagner et al., 2003; Kutzbach et al., 2004).
Seasonal dynamics of methane flux
Despite the low data coverage during spring 2004, a description of the processes during the thaw
period can be given with reasonable confidence. Large methane fluxes were measured on several
occasions during the first days of snowmelt (8-13 June 2004), which indicate the release of methane
from the snow cover during the metamorphosis and settling of snow which is associated with the
initial stages of the thaw process (Boike et al., 2003). Furthermore, during a period with strong wind
directly after the snow thaw (18-21 June 2004), fluxes were observed which equalled those measured
during the midsummer period of 2003. These large fluxes were very likely caused by the escape of
methane trapped in ice covers of ponds and lakes which continued to thaw until at least 25 June 2004.
Hargreaves et al. (2001) observed methane emissions in the range of maximum summer emissions
during the thaw period in a Finnish mire which were associated with visible ebullition from thawing
ice layers.
The average methane emission of the polygonal tundra on Samoylov Island during the “warm”
months July, August, and September was 15.7, 22.3 and 15.2 mg m-2 d-1, respectively. These values
are lower compared to methane emissions reported by other eddy covariance flux studies from arctic
wetlands. Friborg et al. (2000) reported methane fluxes of typically 50 mg m-2 d-1 during August from
a north-east Greenland fen (74°N). Hargreaves et al. (2001) reported a mean methane emission of 38
mg m-2 d-1 during August from a Finnish mire (69°N). At these two sites, with 75 % and 70 %
respectively, the surface area coverage of wet micro-sites was considerably larger compared to
Samoylov Island. There exist numerous flux studies based on the closed-chamber method. However,
when comparing results, the different scales covered by the measurements must be taken into
consideration. Sites for chamber measurements are usually chosen to represent vegetation/soil-classes
with contrasting properties so as to embrace the full range of emission values of the ecosystem.
Without information on surface area coverage of the different classes, simple averages of flux values
have to be used for comparison. The geographically closest study was conducted by Nakano et al.
(2000) near Tiksi, about 120 km south-east of Samoylov Island, and reported a mean flux of 23 mg m2 -1
d from a tundra site during July and August. This compares very well with the fluxes observed on
Samoylov Island. The same study reported methane emissions of on average 140 mg m-2 d-1 from a
floodplain of the Kolyma River (68.5°N) during July and August. Generally, flux studies from far
north-east Siberia reported significantly higher methane emission. Tsuyuzaki et al. (2001) measured
emissions of on average 105 mg m-2 d-1 in a north-east Siberian marshland near the Kolyma River
(69°N) during July and August. Van Huissteden et al. (2005) studied emissions from a river terrace
polygonal tundra of the Indigirka River floodplain (71°N), and reported an average flux of 103 mg m-2
d-1 in July. Corradi et al. (2005) measured the methane emission of tussock tundra in the floodplain of
the Kolyma River (69°N) during July-September and reported a mean flux of 196 mg m-2 d-1.
39
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
There are a number of reasons which could explain the differences in methane emission observed.
Soil temperature regime, vegetation cover, hydrology and texture of soils, as well as bio-availability of
nutrients play an important role in determining microbial activity in the soil and the gas exchange
between soils and the atmosphere. The tundra soils at our study site are characterized by a sandy
texture. Sand is known to be an unfavourable habitat for microbes (e.g. Wagner et al., 1999).
Furthermore, the availability of nutrients is limited because the organic matter in the soils is only
weakly decomposed, and there is no input of organic carbon by recent flooding. These conditions
appear to impede microbial methane production at our study site compared to other sites in north-east
Siberia.
During autumn and early winter, the methane emission of the tundra on Samoylov Island
decreased slowly, drastic changes in response to the refreeze of the top soil layer were not observed.
Similar observations were made by Hargreaves et al. (2001), who linked the continuing emission of
methane through the frozen top soil layer to vascular plants which, although senescent, kept providing
a pathway for diffusion from deeper soil layers to the atmosphere. Kutzbach et al. (2004) showed that
transport of methane through Carex aquatilis was driven by diffusion only, not by pressure-induced
convection processes which would depend on the phenological status of the plant tissues. Moreover,
also the accumulation of snow after the middle of October showed no marked influence on the
methane flux. Both these findings are supported by the work of Corradi et al. (2005), who observed
substantial emission of carbon dioxide from a north-east Siberian tundra during April, despite the
completely frozen ground and a snow layer of about 0.6 m depth. Also, Panikov and Dedysh (2000)
concluded from their study of cold season methane fluxes in a west Siberian peat bog that snow cover
represented a passive layer only and gas flux into the atmosphere was controlled by production in the
soil. However, the dependence of methane flux on turbulence observed during snow-free periods is
expected to decrease with increasing snow cover, due to de-coupling of the turbulence from the soil
surface and vegetation. Though, owing to the lack of data, this hypothesis could not be verified.
Similarly, due to a lack of data, methane emissions during winter, i.e. during the period of
completely frozen soils and low sub-zero soil temperatures are uncertain. Many studies have stressed
the importance of cold season fluxes in boreal wetlands. The contribution of cold season flux to the
annual flux was reported to be 4-21 % at a Minnesota peatland at 47 °N (Dise, 1992), 3.5-11 % at a
west Siberian peat bog at 57 °N (Panikov and Dedysh, 2000), 5-33 % at Finnish bogs and fens at 6265 °N (Alm et al., 1999), and 23 % at a Finnish mire at 69 °N (Hargreaves et al., 2001). However,
there exist few studies in permafrost regions which address the question of winter fluxes. Whalen and
Reeburgh (1988) observed episodic methane emission from moss sites during winter which accounted
for about 40 % of the annual flux, but which they attributed to physical processes during the soil
freeze rather than microbial activity. Laboratory experiments have shown only recently that
methanogenesis takes places in soils at sub-zero temperatures. Rivkina et al. (2004) reported
methanogenesis in Siberian permafrost samples at temperatures down to -16.5 °C and concluded that
the freezing of sediments is not a barrier to microbial activity. In a similar experiment, Wagner et al.
(2006) detected methanogenesis in soil samples of Samoylov Island at a temperature of -6 °C. Hence,
it is assumed that the relationship between soil temperature and methane emission based on the
measurements in 2003-2004 can be extrapolated for the estimation of winter CH4 emission. A similar
approach was chosen by Corradi et al. (2005), who used a Lloyd-Taylor function (Lloyd and Taylor,
1994) based on data from the period July-October for the estimation of winter soil respiration. Using
the soil temperature record from 0.15 m depth and equation 2, but omitting the u*-term because of the
expected de-coupling of methane flux and turbulence by the snow cover, the cumulative flux of the
period 23 October 2003 - 30 May 2004 (221 days) was estimated to be 0.6 g m-2 (Fig. 6). Based on
this value, the integrated emission of the cold season October-May was 0.9 mg m-2, and its
contribution to the annual emission was 30 %. This estimate is at the upper end of the range of results
discussed above. The reason for the large contribution of the cold period at the Samoylov Site is the
seasonal distribution of fluxes. During summer, methane emission from the tundra of Samoylov Island
is generally low, while substantial emission continues well into early winter. Considering this
40
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
observation, the method of estimating cold season flux as the product of measured winter flux and
number of days with sub-zero air temperature, as used e.g. by Panikov and Dedysh (2000), appears to
be too simple and is likely to systematically underestimate the contribution of the cold season to the
annual flux.
Annual carbon fluxes and GHG budget
Using the estimate of cold season flux, the annual methane flux of the tundra ecosystem during the
period July 2003 – July 2004 was calculated to be 3.0 g m-2. This value corresponds to 43-58 % of the
annual emissions reported for ecosystems at similar latitudes. Hargreaves et al. (2001) gives a estimate
of 5.5 g m-2 for a Finnish mire at 69 °N, and Reeburgh et al. (1998) reported 5.2 g m-2 for wet tundra
sites within the Alaskan Kuparuk River basin at 69 °N. Friborg et al. (2000) reported a value of 3.7 g
m-2 for a tundra site on Greenland (74 °N) for the period June-August, compared to a value of 1.6 g m2
for the same period at Samoylov Island. As discussed with respect to seasonal fluxes, there are many
reasons which could explain the differences between annual fluxes observed. We hypothesize that the
main reasons for the low annual flux observed are the low temperature and the low bio-availability of
nutrients in the tundra soils of Samoylov Island.
Fig. 6 Record of soil temperature at 0.15 m depth (dashed line) and cumulative methane flux (black line) for the
period July 2003 - July 2004. The period with modeled data is shaded.
Measurement and modeling of the fluxes of carbon dioxide showed that the tundra was an annual
sink of -72 g CO2 m-2 during the period July 2003 - July 2004 (Kutzbach, 2006). Thus the overall
carbon balance of the tundra was -17.4 g C m-2, and the methane emission accounted for about 13 % of
the ecosystem carbon balance. A similar value of 19 % was given by Friborg et al. (2003) for a west
Siberian peat bog, which had a carbon exchange about five times as high as the tundra on Samoylov
Island. The high value of 25 % reported by Corradi et al. (2005) for a north-east Siberian tussock
tundra was due to the high methane emission (10 g C m-2 during 60 days in summer) compared to a
moderate annual carbon uptake of -38 mg C m-2. Considering the global warming potential of methane
compared to carbon dioxide (factor 23 per unit C mass for a time horizon of 100 years; Houghton,
2001), the greenhouse gas balance of the tundra in units of CO2-C equivalents was +32 g Cequiv m-2.
Thus, although the methane emission had only a small influence on the tundra’s capacity as a carbon
sink, it turned the tundra into an effective source of greenhouse gases. This was also observed for
other Siberian wetlands (Friborg et al., 2003; Corradi et al., 2005).
41
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
According to the ACIA (2004) climate model predictions, for the Lena River Delta an increase of
annual air temperature of about 5 °C and an increase of summer precipitation of about 20 % is
expected. A prediction of the response of the GHG source strength of the tundra to climate change is
beyond the scope of this work. However, based on the climate model predictions and field
observations the attention should be drawn to nonlinear effects in ecosystem response to climate
change. During the summer of 2003, which was characterized by above average temperatures and
precipitation, strong surface runoff and thermo-erosion were observed on Samoylov Island (Kutzbach,
2006; Boike and Wille, 2006). These processes lead to dry up of large areas which will certainly have
a large influence on the GHG budget of the tundra. Hence, nonlinear processes must be taken into
consideration in GHG budget models, especially in ice-rich permafrost ecosystems in north Siberia.
Conclusions
• The study site in the Lena River Delta is one of the most northern sites where methane emissions on
a landscape scale have been investigated using the eddy covariance technique, following Greenland
(Friborg et al., 2000). Furthermore, the study delivered the longest high-resolution time series of
methane emission from a tundra ecosystem, covering one active season including spring thaw and
autumn freeze back during two consecutive years.
• The methane emission at the wet polygonal tundra studied was low regarding daily summer fluxes
(typically 30 mg CH4 m-2 d-1) as well as the annual flux (3 g CH4 m-2). Reason for this were thought
to be (a) the very low permafrost temperature in the study region, (b) the sandy soil texture and low
bio-availability of nutrients in the soils, and (c) the genesis of ice wedge polygons which lead to a
strong spatial heterogeneity in soil and vegetation properties and to a high surface coverage of moist
to dry micro-sites (> 50 %).
• The soil temperature and near-surface atmospheric turbulence were identified to be the main
environmental variables controlling methane emission. A model based on these variables explained
the variations of methane flux corresponding to continuous processes of microbial methane
generation and oxidation, and diffusion through soil and plants reasonably well. Transitory
processes related to spring thaw and turbulence- and pressure induced ebullition could not be
modeled but were estimated to contribute about 10 % to the measured flux.
• The relationship between methane flux and soil temperature found during the period spring - early
winter was extrapolated to estimate the methane emission during the winter when no measurements
where performed. This approach has been used for the modeling of soil respiration CO2 fluxes of
tundra in north-east Siberia (Corradi et al., 2005). Recent findings on methanogenesis in permafrost
soils at low sub-zero temperatures suggest that this approach should also be applicable to the
modeling of winter methane fluxes. At 30 %, the modeled contribution of the winter period to the
annual flux is very large. This is explained by the long cold period (October-May), in combination
with generally moderate summer fluxes and continuing strong emission during the slow re-freeze of
water-saturated tundra soils in early winter.
• By using the eddy covariance technique and measuring over a full active flux period, a more
complete picture of the environmental variables controlling methane emissions in polygonal tundra
was gained. Most importantly, with the identification of the near surface turbulence as a main flux
driver, the close coupling of the soil and atmosphere systems became evident. The variables soil
thaw depth and water table position, which were often identified as (spatial) flux predictors by short
term flux studies using the closed-chamber technique were found to have only small effect in the
temporal domain. These facts highlight the need for season-long measurement campaigns for a
sound evaluation of the driving parameters of methane fluxes.
• During the period July 2003 - July 2004, the overall carbon balance of the tundra was -17.4 g C m-2,
and the methane emission accounted for about 13 % of the ecosystem carbon balance. Considering
the global warming potential of methane compared to carbon dioxide, the greenhouse gas balance of
42
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
the tundra in units of CO2-C equivalents was +32 g Cequiv m-2. Thus, although the methane emission
had only a small influence on the tundra’s capacity as a carbon sink, it turned the tundra into an
effective source of greenhouse gases.
Acknowledgements
We would like to thank the members of the joint Russian-German field expeditions in 2003 and 2004, namely
Waldemar Schneider, Günther Stoof, Lars Heling, as well as our Russian partners Dmitry Yu. Bolshianov
(Arctic and Antarctic Research Institute, St. Petersburg), Mikhail N. Grigoriev (Permafrost Institute, Yakutsk),
Alexander Y. Derevyagin (Moscow State University), Dmitri V. Melnitschenko (Hydro Base Tiksi), Alexander
Y. Gukov (Lena Delta Reserve) and their colleagues at the respective institutes.
43
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
Biogeochemistry 69: 341–362, 2004.
# 2004 Kluwer Academic Publishers. Printed in the Netherlands.
3.2 Effect of microrelief and vegetation on methane
emission from wet polygonal tundra, Lena Delta,
Northern Siberia
LARS KUTZBACH1,*, DIRK WAGNER1 and EVA-MARIA PFEIFFER2
1
Alfred Wegener Institute Foundation for Marine and Polar Research, Research Unit Potsdam, P.O.B.
600149, D-14401 Potsdam, Germany; 2Institute of Soil Science, University of Hamburg, Allende-Platz 2,
D-20146 Hamburg, Germany; *Author for correspondence (e-mail: [email protected]; phone:
þ49-331-288-2142)
Received 20 May 2003; accepted in revised form 4 September 2003
Key words: Aerenchyma, Carex aquatilis, Methane emission, Microrelief, Plant-mediated gas transport,
Polygonal tundra
Abstract. The effect of microrelief and vegetation on methane (CH4) emission was investigated in a wet
polygonal tundra of the Lena Delta, Northern Siberia (72.37N, 126.47E). Total and plant-mediated CH4
fluxes were measured by closed-chamber techniques at two typical sites within a low-centred polygon.
During the study period, total CH4 flux averaged 28.0 5.4 mg m2 d1 in the depressed polygon centre
and only 4.3 0.8 mg m2 d1 at the elevated polygon rim. This substantial small-scale spatial variability of CH4 emission was caused by strong differences of hydrologic conditions within the microrelief
of the polygon, which affected aeration status and organic matter content of the soils as well as the
vegetation cover. Beside water table position, the vegetation cover was a major factor controlling CH4
emission from polygonal tundra. It was shown that the dominant vascular plant of the study area, Carex
aquatilis, possesses large aerenchyma, which serve as pathways for substantial plant-mediated CH4
transport. The importance of plant-mediated CH4 flux was strongly influenced by the position of the
water table relative to the main root horizon. Plant-mediated CH4 transport accounted for about twothirds of the total flux in the wet polygon centre and for less than one-third of the total flux at the moist
polygon rim. A clipping experiment and microscopic-anatomical studies suggested that plant-mediated
CH4 transport via C. aquatilis plants is driven only by diffusion and is limited by the high diffusion
resistance of the dense root exodermes.
Introduction
Northern wetlands play an important role within the global methane (CH4) cycle.
Recent estimates of the CH4 source strength of northern wetlands, including tundra,
range between 17 and 42 Tg CH4 yr1 or from 3.5 to 8.5% of the total atmospheric
budget (Whalen and Reeburgh 1992; Christensen 1993; Harriss et al. 1993, Roulet
et al. 1994; Cao et al. 1996).
Anticipating global warming by an enhanced greenhouse effect, high-latitude
ecosystems are expected to warm more rapidly and to a greater extent than the rest
of the biosphere (Maxwell 1997; Intergovernmental Panel on Climate Change
2001). To assess the effects of climatic change on the sensitive arctic ecosystems
44
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
342
with regard to CH4 emission and possible feedbacks to the atmospheric system, it is
important to improve the understanding of how the CH4 emission is controlled by
the involved environmental variables, soil processes, and microbial communities.
CH4 emission from arctic wetlands results from the complex interaction between
production, consumption, and transport of CH4. These processes are governed by a
set of interrelated environmental factors, including microbial community structure,
climatic conditions, soil properties, and vegetation characteristics.
The vegetation occupies a central position in this complex system. Plants can
have both enhancing and attenuating effects on CH4 emission. Through the aerenchyma of vascular plants, oxygen is transported from the atmosphere to the
rhizosphere, thus stimulating CH4 oxidation in otherwise anoxic soil horizons
(Van der Nat and Middelburg 1998; Popp et al. 2000). In opposite direction, the
aerenchyma are a major pathway for CH4 transport from the anoxic horizons to
the atmosphere, bypassing the oxic/anoxic interface in the soil, where CH4 oxidation is prominent (Sebacher et al. 1985; Holzapfel-Pschorn et al. 1986; Schütz
et al. 1991). Furthermore, the vegetation provides the substrates for methanogenesis as decaying plant material and fresh root exudates (Whiting and Chanton
1992; Joabsson et al. 1999). Most studies demonstrated that the enhancing effects
of vegetation on CH4 emission exceed the attenuating effects (e.g., Torn and
Chapin 1993; Sorrell and Boon 1994; Thomas et al. 1996; King et al. 1998), but
several other studies reported converse results (Grünfeld and Brix 1999; RouraCarol and Freeman 1999).
Most studies on the effect of the vegetation on CH4 emission from boreal and
arctic ecosystems have been conducted in North America (e.g. Whiting and
Chanton 1992; Morrissey et al. 1993; Torn and Chapin 1993; Schimel 1995;
Waddington et al. 1996; Kelker and Chanton 1997; King et al. 1998). Despite an
increasing number of studies on CH4 fluxes from the vast wetlands of Siberia
published in the last decade (Panikov et al. 1993; Christensen et al. 1995; Samarkin
et al. 1999; Nakano et al. 2000; Wagner et al. 2003), only one investigation on the
effect of vegetation on CH4 emission from Siberian tundras has been reported so far
(Tsuyuzaki et al. 2001).
This paper examines the effect of microrelief and vegetation on the small-scale
variability of CH4 emission from arctic wet polygonal tundra of the Lena Delta,
Northern Siberia. Research focused on the plant-mediated CH4 emission via individual culms of Carex aquatilis Wahlenb., the dominant vascular plant species
of the examined tundra landscape. In detail, the purposes of this study were:
. to investigate the effects of microrelief and soil characteristics on the total
(soil þ plant-mediated) CH4 flux from wet polygonal tundra;
. to assess the amount of plant-mediated CH4 flux via the aerenchyma of C.
aquatilis and its contribution to the total CH4 flux;
. to examine the response of plant-mediated CH4 flux to differing microtopography and hydrologic conditions;
. to get further information about the mechanism of gas transport through C.
aquatilis.
45
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
343
Study site
Within the scope of the joint Russian–German project ‘System Laptev Sea 2000’,
an expedition was undertaken in August 1999 to the Lena Delta, Northern Siberia
(Rachold and Grigoriev 2000). Field work was conducted on Samoylov, a typical
island of the central part of the delta (72.37N, 126.47E). The Lena Delta with an
area of 28,000 km2 is one of the largest deltas in the world. It is located in the zone
of continuous permafrost. The climate is true-arctic, continental, and characterised
by very low temperatures and low precipitation. The mean annual temperature is
10.28C, and the mean annual precipitation amounts to 140 mm (Müller 1997).
The topography of the Lena Delta is flat, but well-structured by a prominent microrelief caused by the development of low-centred ice-wedge polygons. The depressed centres of these polygons are surrounded by elevated rims, which are
situated above the ice-wedges. The polygon centres contribute about 45% and the
rims about 55% to the total area of the polygonal tundra in the study area.
The investigation sites of this study were located within a typical low-centred
polygon with a diameter of about 20 m. One investigation site was established in the
polygon centre and the other at the polygon rim. Distance between these two sites
was 10 m. The soil surface at the polygon rim was about 0.5 m higher than in the
polygon centre. Wooden boardwalks were set up to minimise disturbance of the
soils during investigations.
Methods
Characterisation of vegetation and soils
The vegetation of the polygonal tundra was investigated according to the phytosociological approach of Braun-Blanquet (1964). The plant communities of the
elevated rim and the depressed centre of the polygon were described at plots of
2 m2. Vascular plants were identified using Polunin (1959), mosses and lichens
were identified by means of a reference herbarium provided by M.P. Zhurbenko and
I.V. Czernyadeva (Komarov Botanical Institute, St. Petersburg). Species dominance
was estimated as the percentage of basal area that was covered by the species.
The soils of the two study sites were described and sampled in small pits.
Texture, colour, and quantity of roots in individual soil horizons were surveyed
according to Schoeneberger et al. (1998). Redox status was characterised by means
of a-a0 -dipyridyl solution (Soil Survey Staff 1998), which was sprayed on freshly
broken surfaces of field-wet soils. The reagent complexes ferrous iron to a complex
which has a distinctive red colour. By proving the presence of soluble reduced iron
ions, a positive a-a0 -dipyridyl test indicates watersaturated and anoxic soil conditions. Bulk density, content of organic carbon and total nitrogen of soil samples
were determined in the laboratory according to Schlichting et al. (1995). Soils were
classified according to US Soil Taxonomy (Soil Survey Staff 1998) and the Russian
system of Elovskaya (1987).
46
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
344
Figure 1. Design of different CH4 flux chambers. (a) Total flux chamber, (b) plant-mediated transport
chamber. Legend: 1, steel base with water-filled channel (permanently installed); 2, PVC top (removable); 3, syringe; 4, septum; 5, glass vessel; 6, tubing; 7, membrane pump; 8, cap with septum; 9,
glass bottle; 10, rubber stopper with central channel; 11, soil.
Simultaneously to the CH4 flux measurements described below, soil conditions
were recorded at each site as follows: depth of permafrost table was measured by
driving a steel rod into the unfrozen soil until the hard frozen sediments were
encountered. Water table was measured in perforated plastic pipes, which were
installed in the soil active layer. Soil temperatures were recorded automatically at
soil depths of 15 and 30 cm by thermistor probes (Campbell Scientific, Type 107)
and a datalogger (Campbell Scientific Inc., CR10X).
CH4 flux measurements
Three CH4 flux experiments were conducted in August 1999:
(1) To provide a comparison between total (soil þ plant-mediated) CH4 flux and
plant-mediated CH4 flux, these fluxes were simultaneously determined by two
different types of closed-chamber techniques. Measurements were conducted
daily at midday during the period 9 August – 1 September (21 measurement
days). At each site, three total-flux chambers (Figure 1(a)) and nine plant flux
chambers (Figure 1(b)) were installed closely to each other within an area of
2 m 1 m. Since C. aquatilis was the only aerenchymatous plant with a relevant dominance at the study site, examination of plant-mediated CH4 transport was restricted to C. aquatilis.
47
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
345
(2) In the period 7–10 August, seven additional total-flux chambers were used at
the investigated polygon (overall eight chambers in the centre and five at the
rim). Obtained total CH4 fluxes were related to areal densities of Carex culms,
which were determined by counting the culms on the area that was covered by
the chambers.
(3) To get further information about the mechanism of plant-mediated CH4
transport by C. aquatilis, a clipping experiment was conducted: at midday of 26
August, plant-mediated CH4 fluxes through eight plants in the polygon centre
were measured before and after clipping plants at the base of the culms 5 cm
above the soil surface.
The total-flux chambers consisted of permanently installed bases of stainless
steel and removable tops made of 6 mm thick, transparent PVC plates (Figure 1(a)).
The chamber bases had the dimensions 0.5 m 0.5 m 0.15 m and isolated 0.25 m2
of soil surface. The walls of the bases were inserted carefully in pre-cut grooves in
the soil to a depth of 0.15 m at well-drained sites and 0.05 m at waterlogged sites,
respectively. The chamber tops had the dimensions 0.5 m 0.5 m 0.05 m. For
sample drawing, the chamber tops were sealed to the bases by a water-filled
channel running around the top of each base. Air volume inside the chambers
ranged from 12.5 l to 37.5 l depending on water table position. Flow-through circulation was provided by a small membrane pump connected with the chambers by
Tygon1 tubing. After 30 min deployment, gas samples were taken by means of
glass vessels, which were integrated in the gas circulation system and could be
sealed by taps.
For determination of plant-mediated CH4 flux, special closed chambers were
used, in which single culms of C. aquatilis could be enclosed (Figure 1(b)). The
chambers were 0.5-l and 1.0-l glass bottles with a rubber septum put in the cap. In
the bottom of the bottle was a hole, in which a rubber stopper could be fitted. For
sample drawing, a rubber stopper with a hole drilled out and slit down the side was
wrapped around the base of an individual plant culm. The chamber was then placed
over the plant and onto the rubber stopper, sealing the system. After 30–60 min
deployment 5-ml samples of the headspace gas were withdrawn through the septum
with a gas-tight syringe and transferred into 10-ml glass tubes filled with saturated
sodium chloride solution and sealed with rubber stoppers and twisted caps. The
saturated sodium chloride solution prevented microbial activity and minimised
solution processes of gases (Heyer and Suckow 1985).
In parallel to the deployment of chambers, ambient air was sampled directly
above the soil surface. The CH4 concentration of ambient air was used as an
estimate for initial CH4 concentrations in the chambers. To prove the reasonability
of this estimation and the linearity of CH4 accumulation with time, a series of test
experiments (n ¼ 6 for each chamber type) were performed. Samples were drawn
from the chambers at four points in time after sealing, at t1 ¼ 10 min, t2 ¼ 20 min,
t3 ¼ 30 min, and t4 ¼ 60 min. The accumulation of CH4 with time was analysed by
least-square linear regression. During all tests, CH4 accumulation was profoundly
linear (r > 0.998). Comparing the slopes of the linear regression lines with the
48
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
346
two-point lines between ambient air and final chamber concentration, revealed an
error of 5% introduced by applying the simplified two-point method.
Irregular release of CH4 by bubbling was considered to be unlikely at the investigated tundra site because the water table was below the soil surface and the soil
is densely vegetated. Under these conditions, the main gas transport process is
diffusion, either through the soil pore system or via the aerenchyma of the wetland
plants (Holzapfel-Pschorn et al. 1986; Chanton and Dacey 1991; Schütz et al.
1991).
Gas chromatography
CH4 concentrations in samples were analysed within 12 h of collection with a gas
chromatograph (Chrompack, GC 9003) in the field laboratory. CH4 was separated
on a PoraPLOT Q capillary column (100/120 mesh, 20 m, Chrompack) operating at
80 8C with helium as carrier gas and was detected by a flame ionisation detector.
The gas chromatograph was calibrated with standard gases. Measurement accuracy
was 2% for CH4 concentrations of 10 ppm. Sample concentrations ranged between
1.7 and 28 ppm.
Calculations
CH4 concentration measurements obtained from samples which were stored in
glass tubes filled with NaCl solution were corrected for the systematic underestimation of CH4 concentrations introduced by the partition of CH4 between the
aqueous and the gaseous phase as follows:
Ccorr ¼ Corig Corig VH þ Corig VNaCl
;
Corig VH
ð1Þ
where Ccorr is the corrected CH4 concentration value, and Corig is the CH4 concentration measured originally in the headspace above the NaCl solution in the tube.
b is the solubility of CH4 in saturated sodium chloride solution (0.00867 ml ml1 at
20 8C; Yamamoto et al. 1976; Seibt et al. 2000). VH is the volume of the headspace,
and VNaCl is the volume of the NaCl solution. Since VH and VNaCl were equal (5 ml)
in our experimental setup, Equation (1) can be rewritten as:
Ccorr ¼ Corig ð1 þ Þ ¼ Corig 1:00867:
ð2Þ
CH4 fluxes were calculated from the increase of CH4 concentration in the enclosures using the following equation:
F¼
Ct Ca p V M
RT
t
ð3Þ
where F is the mass flux of CH4, Ct is the measured volume/volume CH4 concentration in the chamber after the respective deployment time t, and Ca is the CH4
49
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
347
Table 1. Vegetation composition in the depressed centre of a low-centred polygon, Samoylov, Lena
Delta.
Vascular plants stratum (height 30 cm)
Moss- and lichen stratum (height 5 cm)
Species
Dominance1
Species
Dominance1
Total
30%
Total
95%
Carex aquatilis
C. rariflora
Arctagrostis latifolia
Caltha palustris
Cardaminopsis tenuifolia
Saxifraga cernua
Luzula confusa
Equisetum variegatum
Pedicularis sudetica
Polygonum viviparum
Salix glauca
S. reptans
25%
3%
þþ
þ
þ
þ
r
r
r
r
r
r
r
Limprichtia revolvens
Meesia longiseta
Calliergon megalophyllum
Drepanocladus exannulatus
Calliergon giganteum
Meesia triquetra
Abietinella abietina
Aulacomnium palustre
A. turgidum
Campylium stellatum
Cinclidium latifolium
Cirriphyllum cirrosum
Tomentypnum nitens
25%
20%
20%
15%
5%
5%
þþ
þþ
þþ
þþ
þþ
þþ
þ
1
þþ: domianance 0.5–1.0%; þ: dominance <0.5%; r: sporadic.
concentration of ambient air, which served as an estimate of initial CH4 concentration
in the chambers. M is the molecular weight of CH4, p is the barometric pressure, and
V is the volume of the chamber. T is the air temperature (K), and R is the universal gas
constant.Total CH4 fluxes were referred to the area of soil surface from which the gas
is emitted into the total-flux chamber. Estimated plant-mediated CH4 flux on an areal
basis was calculated by multiplying the average flux from Carex culms (n ¼ 9 at each
site) by the average areal density of Carex culms in the total-flux chambers (n ¼ 3 at
each site).
Anatomical studies of C. aquatilis
For anatomical characterisation of the aerenchyma of C. aquatilis, cross-sections of
rhizomes, roots, and shoots of C. aquatilis were dissected with a razor blade. The
sample pieces were dehumidified in an ascending ethanol sequence and then dried in
a critical point dryer (BAL-TEC, CPD 030). They were coated with an approximately
50 nm thick gold film (BAL-TEC, SCD 050) and examined with a scanning electron
microscope (Phillips, XL-20) at an accelerating voltage of 15 keV.
Results
Vegetation composition of the low-centred polygon
The vegetation at the study sites, in the polygon centre (Table 1) as well as at the
polygon rim (Table 2), was composed of two strata: a moss/lichen layer of about
50
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
348
Table 2. Vegetation composition at the summit of the elevated rim of a low-centred polygon, Samoylov,
Lena Delta.
Vascular plants stratum (height: 20 cm)
Moss- and lichen stratum (height: 5 cm)
Species
Dominance1
Species
Dominance1
Total
30%
Total
95%
Carex aquatilis
Dryas octopetala
Astragalus frigidus
Salix glauca
S. reptans
Lagotis glauca
Luzula confusa
L. nivalis
Poa arctica
Pyrola rotundifolia
Trisetum sibiricum
Polygonum viviparum
Saxifraga hirculus
Koeleria asiatica
Papaver radicatum
Saxifraga cernua
Stellaria sp.
8%
6%
3%
3%
1%
þþ
þþ
þþ
þþ
þþ
þþ
þ
þ
r
r
r
r
Hylocomium splendens
Timmia austriaca
Climacium dendroides
Distichium cappilaceum
Tomentypnum nitens
Sanionia uncinata
70%
7%
2%
2%
2%
1%
Peltigera aphtosa
Stereocaulon alpinum
Cetraria laevigata
Dactylina arctica
Flavocetraria cucullata
Peltigera sp.
Cladonia pyxidata
5%
2%
1%
1%
1%
1%
þþ
1
þþ: dominance 0.5–1.0%; þ: dominance <0.5%; r: sporadic.
5 cm height and a vascular plant layer of 20–30 cm height. Whereas the total
coverage of the moss/lichen layer was high with 95%, the total coverage of vascular
plants was rather small with maximal 30%. The dominating vascular plant species
at both sites was the sedge C. aquatilis. Its dominance was 25% in the polygon
centre and 8% at the polygon rim. The density of C. aquatilis averaged
240 culms m2 in the centre and 72 culms m2 at the rim. The vegetation in the
polygon centre (Table 1) could be assigned to the phytosociological association
Meesio triquetris–Caricetum stantis (Matveyeva 1994). The vegetation at the
polygon rim (Table 2) was considered to be a transient type between the associations M. triquetris–C. stantis and Carici arctisibiricae–Hylocomietum alaskinii.
The latter was described as the typical ‘zonal’ association for Northern Siberia by
Matveyeva (1994). Despite the over-all dominance of C. aquatilis, a pronounced
vegetation zonation along the microtopographical gradient could be observed regarding species composition and dominance ratios. Most of the species that grew
on the rim were not found in the polygon centre and vice versa. While the vegetation of the polygon centre was composed exclusively of hydrophytes like C.
aquatilis and the mosses Limprichtia revolvens and Meesia longiseta, at the
polygon rim mesophytes like the dwarf shrub Dryas octopetala and the mosses
Hylocomium splendens and Timmia austriaca had high dominances.
51
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
349
Soil conditions
Soil conditions varied greatly between plots at the elevated polygon rim and the
depressed polygon centre (Table 3). The soils in the polygon centre were characterised by permafrost-induced waterlogging, predominantly reducing conditions
in the pedon, anaerobic accumulation of organic matter, a sandy texture of the
mineral soil, and the absence of cryoturbation. They were classified as Typic
Historthels according to US Soil Taxonomy and as Permafrost Peat-Gleys according to the Russian system. By contrast, the soils of the polygon rim were
characterised by a distinctly deeper water table, oxic conditions in the top soil,
lower content of organic matter, a loamy soil texture, and pronounced cryoturbation
properties. These soils were classified as Typic Aquiturbels (US Soil Taxonomy)
and Permafrost Turf Gleys (Russian system), respectively. The main root horizon of
the Typic Historthels of the polygon centre was situated in the water saturated soil
zone with reducing conditions (OeBg, 11–26 cm, Table 3(a)). In the OeBg horizon,
C. aquatilis had produced a dense mat of thick rhizomes, coarse perennial roots and
a mass of fine branching roots. In the Typic Aquiturbels of the polygon rim, the
main root horizon was situated in the oxic top soil (Ajj, 0–15 cm) while rooting
density in the deeper horizons with reducing conditions was low (Table 3(b)).
During August 1999, permafrost table and water table did not show high temporal variation. In the Typic Historthel of the polygon centre, the permafrost table
dropped gradually from 33.5 to 37.5 cm below soil surface, and the water table
ranged between 0 and 4.5 cm below soil surface (Figure 2(b)). In the Typic Aquiturbel of the polygon rim, the permafrost table dropped from 36 to 40 cm below soil
surface, and the water table was always situated directly (about 1 cm) above the
permafrost table (Figure 3(b)). The soil temperature varied substantially during the
study period. In the polygon centre, soil temperature 15 cm below soil surface
ranged between 1.6 and 6.7 8C and averaged 3.6 1.3 8C; temperature at 30 cm
depth averaged 2.0 0.7 8C (Figure 2(c)). At the polygon rim, soil temperature at
15 cm depth ranged between 2.6 8C and 7.68C and averaged 4.7 1.4 8C; temperature at 30 cm depth averaged 3.4 1.0 8C (Figure 3(c)).
CH4 fluxes
The strongly differing soil conditions at the centre and the rim of the polygon were
reflected by the total (soil þ plant-mediated) CH4 fluxes. During the study period,
total CH4 flux averaged 28.0 5.4 mg CH4 m2 d1 in the polygon centre and only
4.3 0.8 mg CH4 m2 d1 at the polygon rim (Table 4). Within each site, temporal
variability of total CH4 flux was relatively low with only a few outliers (Figures
2(a) and Figure 3(a)).
Plant-mediated CH4 flux via culms of C. aquatilis was of higher importance in
the polygon centre than at the polygon rim. At the polygon centre, the estimated
proportion of plant-mediated CH4 flux ranged between 37 and 102% and averaged
66 20% of the total emission (Figure 2(a), Table 4). At the polygon rim it ranged
52
Soil typea
(US and Russian Tax.)
Horizonb
Depth (cm)
Textureb
Munsell colourc
Reduc.
conditionsd
Rootse
Bulk Densityf
(g cm3)
Org. Cf (%)
C/Nf
(a) Typic Historthel
(Permafrost Peat Gley)
Oi
OeBg
Bg
Bf
0–11
11–26
26–31
31–64
(Peat)
(Peat)þ sand
Sand
Sandy loam
n.d.
10YR2/2
2,5Y4/4
10YR3/2
No
Yes
Yes
Yes
1vf,f
3vf,f,m
2vf,f,m
0
0.4
0.6
0.82
n.d.
22.1
12.6
2.1
4.2
43
35
>100
30
(b) Typic Aquiturbel
(Permafrost Turf Gley)
Ajj
Bjjg1
Bjjg2
Bjjg3
Bjjf
0–15
15–18
18–32
32–46
46–90
Loamy sand
Sandy loam
Loam
Loam
Loam
2,5Y3/2
2,5YR3/2
10YR3/1
10YR3/1
10YR3/1
No
No
Yes
Yes
Yes
3vf,2f,m
2vf,f,1m
2vf,f,1m
1vf,f
0
1.06
1.21
1.23
1.35
n.d.
1.8
2.2
3.4
2.3
3.0
21
21
25
22
20
Methane Cycle in Permafrost Ecosystems
350
Table 3. Selected properties of the soils at the investigation sites. (a) Typic Historthel in the depressed polygon centre, (b) Typic Aquiturbel at the elevated rim of the
low-centred polygon.
a
53
3 Methane Release from Siberian Tundra
Classification according to Soil Survey Staff (1998) and – in parentheses – Elovskaya (1987).
Soil horizon and texture designations according to Soil Survey Staff (1998).
c
Soil colours were determined using the Munsell1 Soil Color Chart.
d
Reducing soil conditions were detected by the a-a0 -dipyridyl test (Soil Survey Staff 1998). A positive test indicates reducing and anoxic soil conditions by proving the
presence of soluble ferrous iron.
e
Root quantification codes according to Schoeneberger et al. (1998): 1, few; 2, common; 3, many; vf, very fine; f, fine; m, medium.
f
Laboratory analyses were conducted according to Schlichting et al. (1995).
b
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
351
Figure 2. CH4 fluxes and soil conditions in the centre of a low-centred polygon, Lena Delta, Northern
Siberia, August 1999. (a) Total CH4 flux (grey columns) and estimated plant-mediated CH4 flux (white
columns). Each total flux column represents the average of fluxes from three 0.25-m2-plots. Estimated
plant-mediated CH4 flux on an areal basis was calculated by multiplying the average flux from individual
C. aquatilis culms (n ¼ 9) by the average areal density of C. aquatilis culms in the total-flux chambers
(n ¼ 3). (b) Depth of water table (triangles) and permafrost table (circles) measured from soil surface. (c)
Soil temperature at depths of 15 cm (filled squares) and 30 cm (open squares).
between 12 and 39% and averaged only 27 9% of the total emission (Figure 3(a),
Table 4).
Total CH4 fluxes were strongly dependent on areal density of C. aquatilis culms.
A positive correlation between culm density and total CH4 flux was found for the
plots in the polygon centre. The respective least-square regression line was described by the linear function: CH4 emission ¼ 0.23 mg CH4 d1ċculm density
54
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
352
Figure 3. CH4 fluxes and soil conditions at the rim of a low-centred polygon, Lena Delta, Northern
Siberia, August 1999. (a) Total CH4 flux (grey columns) and estimated plant-mediated CH4 flux (white
columns). Each total flux column represents the average of fluxes from three 0.25-m2-plots. Estimated
plant-mediated CH4 flux on an areal basis was calculated by multiplying the average flux from individual
C. aquatilis culms (n ¼ 9) by the average areal density of C. aquatilis culms in the total-flux chambers
(n ¼ 3). (b) Depth of water table (triangles) and permafrost table (circles) measured from soil surface. (c)
Soil temperature at depths of 15 cm (filled squares) and 30 cm (open squares).
30.39 mg CH4 d1 m2 (r ¼ 0.88, p ¼ 0.004, n ¼ 8). By contrast, a negative correlation between these variables was observed for the plots at the polygon rim. The
respective regression line was described by the linear function: CH4 emission ¼
0.04 mg CH4 d1ċ culm density þ 6.92 mg CH4 d1 m2 (r ¼ 0.97, p ¼ 0.006,
n ¼ 5).
55
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
353
Table 4. Total CH4 flux and portion of plant-mediated CH4 transport in wet polygonal tundra.
Measurements were conducted in August 1999 on Samoylov Island (72.23N, 126.29E), Lena Delta,
Northern Siberia.
Site
Centre
Rim
Total flux (mg m2 d1)a
Estimated portion of plant transport (%)b
Min
Max
Mean
n
Min
Max
Mean
n
19.2
2.8
47.2
6.0
28.0 5.4
4.3 0.8
21
20
37
12
102
38
66 20
27 9
20
14
a
Total (soil þ plant-mediated) CH4 flux was measured by three closed chambers at each site with a
footprint of 0.25 m2. The given values are minimums, maximums, means and standard deviations of daily
means. n is number of measurement days.
b
Plant-mediated CH4 transport was measured by means of nine glass vessels at each site in which single
Carex culms could be enclosed. The portion of plant-mediated CH4 flux on an areal basis was estimated
by multiplying the average flux through individual Carex culms by the average density of Carex culms in
the total-flux chambers and setting the resulting value in relation to the total flux. The given values are
minimums, maximums, means and standard of daily means. n is number of measurement days.
Table 5. Effect of clipping culms on plant-mediated CH4 transport via C.
aquatilis. CH4 fluxes through eight individual culms were measured before
and after clipping 5 cm above the soil surface. The experiment was
conducted at midday of 26 August.
No.
CH4 flux before
clipping (mg d1)
CH4 flux after
clipping (mg d1)
Quotient after=
before clipping
1
2
3
4
5
6
7
8
0.051
0.073
0.027
0.076
0.051
0.069
0.037
0.057
0.041
0.067
0.031
0.076
0.044
0.061
0.042
0.061
0.80
0.91
1.14
1.00
0.87
0.89
1.13
1.08
Mean
0.98 0.13
Clipping the culms 5 cm above the soil surface did not alter the amount of plantmediated CH4 flux by C. aquatilis significantly (Table 5).
Aerenchyma in vegetative organs of C. aquatilis
Extensive air spaces or lacunae (=aerenchyma) were observed in all vegetative
organs of C. aquatilis by scanning electron microscopy (Figure 4). In particular, the
extent of the lacunae in the fine roots of C. aquatilis was remarkable (Figure 4(a)):
With the exception of a few regular arranged radial cell lines and the radial cell
walls, the complete root cortex parenchyma was disintegrated and transformed into
a large aerenchyma. The large aerenchyma was separated from the rhizosphere by a
56
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
354
Figure 4. Transverse sections of vegetative organs of C. aquatilis Wahlenb. observed by scanning
electron microscopy. (a) fine root, (b) rhizome, (c) culm (built up of nested leave sheaths). Legend: ae,
aerenchyma; cc, central cylinder; ep, epidermis; ex, exodermis; hy, hypodermis; me, mesenchyme; rh,
rhizodermis; vb, vascular bundle.
57
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
355
dense exodermis, which was built up of compactly packed hexagonal cells with
thickened cell walls. In the rhizomes, lacunae were observed in the inner cortex
(Figure 4(b)). They were less regular arranged and not as extensive as in the roots.
In the leaves sheaths that build up the culms, large lacunae were observed that were
embedded in the parenchyma and were arranged very regularly between the vascular bundles (Figure 4(c)).
Discussion
Influence of microrelief and soil conditions on CH4 fluxes
Many tundra ecosystems are characterised by a complicated horizontal structure
(Chernov and Matveyeva 1997). Cryogenic processes in permafrost soils lead to the
formation of patterned ground with often a pronounced microrelief (French 1996). In
the typical polygonal tundra of the central Lena Delta, the microrelief elements of the
low-centred polygons and the respective soil and vegetation types are repeated in
regular cyclic intervals of 10–30 m. Thus, soil conditions, vegetation characteristics,
and consequently CH4 fluxes in polygonal tundra are highly variable on the small
scale (decimetres to metres) but rather homogenous on the large scale of (102 to 104
metres). In order to quantify CH4 emission from tundra ecosystems on the regional
scale, it is necessary to characterise the small-scale variability of CH4 emission.
During our study, CH4 emission was 6–7 times greater in the depressed polygon
centre than emission at the elevated polygon rim. In the Typic Historthel of the
polygon centre, a high water table, anoxic conditions in most of the pedon, and high
organic matter contents in the anoxic horizons stimulated CH4 production. CH4
emission was much lower at the polygon rim since in the Typic Aquiturbel of the
polygon rim the water table was lower, organic matter contents in the anoxic horizons
were less, and oxic horizons were more extensive (Table 3). Our results show the
importance of the microrelief and the variability of hydrologic conditions as key
control factors on CH4 emissions from tundra soils in agreement with other CH4 flux
studies (e.g., Svensson and Rosswall 1984; Morrissey and Livingston 1992; Moore
and Roulet 1993; Waddington et al. 1996; Grünfeld and Brix 1999). The water table
position determines the relative extent of oxic and anoxic horizons within soils and
consequently the ratio between CH4 production and CH4 oxidation, the fundamental
microbial processes of the CH4 cycle. Beside this direct effect, the water table
position influences CH4 fluxes indirectly by affecting soil genesis and vegetation
composition, which are important additional control factors on CH4 fluxes.
The CH4 fluxes observed in our study were of the same order of magnitude, albeit
slightly lower, as CH4 fluxes reported by other investigators from polygonal tundra in
Alaska (Morrissey and Livingston 1992; Christensen 1993) and Northern Siberia
(Christensen et al. 1995; Samarkin et al. 1999). Wagner et al. (2003) measured total
CH4 fluxes during the complete summer season 1999 at the same low-centred
polygon that we chose for our investigations. They observed much higher and more
variable CH4 emissions in the polygon centre during July (93 22 mg CH4 m2 d1),
58
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
356
when the water table was distinctly above the soil surface, than in August
(25 7 mg CH4 m2 d1), when the water table was located a few centimetres below
the soil surface. This decrease of CH4 emission was associated by an increase of CH4
oxidation activity in the soils. The effect of the water table position on CH4 emissions
from wetlands can be compared with an on–off switch (Christensen et al. 2001).
When the water table falls below the soil surface, microbial CH4 oxidation is drastically increased and CH4 emission is reduced. A narrow oxic soil zone can have a
high capacity for CH4 oxidation (Whalen et al. 1996).
During our study, temporal variability of CH4 emission was low because the
main control factors, water table position and thaw depth, were almost constant
during the study period. Temporal fluctuations of soil temperature (Figures 2(c) and
3(c)) appeared to have only a minor effect on CH4 emission. This is in accordance
with studies of Svensson and Rosswall (1984), Christensen (1993), and Nykänen
et al. (1998). These authors found that CH4 emission correlates with soil temperature only at inundated sites, where the water table is distinctly above the soil
surface. If the water table is positioned below the soil surface and CH4 oxidation
gains importance, soil temperature is not expected to show a direct effect on CH4
emission. CH4 production has a stronger temperature response with reported Q10
values of 2.7–20.5 by comparison with CH4 oxidation with Q10 values of only 1.2–
2.1 (e.g., Svensson and Rosswall 1984; King and Adamsen 1992; Dunfield et al.
1993; Moosavi and Crill 1998), but the upper soil horizons, where CH4 oxidation
occurs, are more exposed to temperature changes than the subsurface horizons of
methanogenesis. Thus, it can be assumed that the effect of soil temperature fluctuations on microbial CH4 production is compensated by the temperature effect on
CH4 oxidation (Christensen 1993; Whalen et al. 1996).
Effects of vegetation on CH4 fluxes
Numerous studies demonstrated the importance of the vegetation as a major control
factor on CH4 emissions from wetlands (e.g., Schütz et al. 1991; Whiting and Chanton
1992; Grünfeld and Brix 1999; Joabsson et al. 1999; Roura-Carol and Freeman 1999).
Tsuyuzaki et al. (2001) found that CH4 emission from grassy marshlands near the
Kolyma River in the tundra/taiga transition zone of North-east Siberia was strongly
dependent on the vegetation type. At our study site, the strongly differing hydrological
conditions within the microrelief of the polygonal tundra caused substantial differences in vegetation cover between the rim and the centre of the polygon. These
vegetation differences had a direct effect on the small-scale variability of CH4 emission. Sites in the polygon centre with high densities of C. aquatilis culms emitted
distinctly more CH4 than sites at the polygon rim with low densities of C. aquatilis. The
enhancing effect of C. aquatilis on CH4 emission is due to the capability of its aerenchyma to serve as conduits for plant-mediated CH4 transport. Plant-mediated CH4
transport accounted for about two-thirds of the total flux in the polygon centre and for
less than one-third of the total at the polygon rim. It is assumed that C. aquatilis plants
can have an additional positive effect on CH4 emission by providing fresh substrates
59
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
357
for the methanogenesis as described for several vascular plants by other investigators
(Schütz et al. 1991; Whiting and Chanton 1992; Joabsson et al. 1999).
The influence of C. aquatilis on CH4 fluxes has to be valued separately for the
different microrelief elements of the low-centred polygon. Total CH4 flux
(soil þ plant flux) was positively correlated to areal density of C. aquatilis culms at
sites in the polygon centre, while no such relationship could be found at the sites at
the polygon rim. At the polygon rim, the presence of C. aquatilis culms appeared to
have even a small attenuating effect on the total CH4 flux. Previous studies showed
that the influence of vascular plants can differ substantially between different sites.
Some authors found significant positive correlations between CH4 emission and
plant biomass (Morrissey and Livingston 1992; Whiting and Chanton 1992) or
culm density (Christensen 1993; Schimel 1995). At other sites, a negative effect of
vascular plants on CH4 emission was confirmed (Grünfeld and Brix 1999; RouraCarol and Freeman 1999). At these sites and likewise at our study site at the
polygon rim, the stimulation of rhizospheric CH4 oxidation by vascular plants
appeared to have a greater effect on CH4 emission than the enhancing effects, that
is, plant-mediated CH4 transport and the supply of substrates for methanogenesis.
The plant-mediated proportion of the total CH4 emission from the polygon centre
(about 2/3) lay in the same range as results obtained by Schimel (1995) for arctic
wet meadow tundra in Alaska, which was characterised by a water table below the
soil surface. In inundated tundra wetlands of Alaska, the proportion of plantmediated CH4 transport was reported to be considerably higher with 90–98% of the
total flux (Morrissey and Livingston 1992; Whiting and Chanton 1992; Torn and
Chapin 1993). Our results and the comparison with other wetland studies suggest
that the effect of plant-mediated CH4 flux is substantially affected by water table
position. The effect of plant-mediated CH4 transport is greatest with a high water
table and the bulk of roots growing in anoxic soil horizons (Waddington et al.
1996). The lower the water table, the less roots grow within the anoxic CH4enriched soil horizons and can serve as conduits for CH4 transport to the atmosphere. The better the pore system of a soil is aerated, the bigger is the portion of
CH4 that diffuses via the soil pores to the atmosphere. It has to be considered, that
diffusion velocity of CH4 is 104 times higher in air than in water (Schachtschabel
et al. 1998). The dense root exodermes of C. aquatilis have an even higher diffusion
resistance than water (Končalová 1990). Thus, a substantial CH4 diffusion from the
pore waters into the root aerenchyma through the exodermes only happens when a
high CH4 concentration gradient between pore waters and root aerenchyma is
present and the diffusion via the soil pore system is hampered by water saturation.
Mechanism of gas transport via C. aquatilis
The microscopic-anatomical studies showed that large aerenchyma are present in
the vegetative organs of C. aquatilis that can act as pathways of facilitated diffusion
for CH4 produced in anoxic soil horizons. Many monocotyledonous wetland plants
develop aerenchyma as adaptation to soil waterlogging. The internal air spaces
60
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
358
provide a conduit for oxygen from the atmosphere to the roots and for CH4 in the
opposite direction. Particularly, the CH4 transport processes in large emergent and
floating wetland plants like Phagmites australis, Typha latifolia, or Nuphar lutea
are thoroughly investigated (e.g., Große et al. 1991; Tornbjerg et al. 1994; Armstrong et al. 1996). In these plants, gas transport by pressure-induced convection
could be verified. The exact mechanism of plant-mediated CH4 flux through smaller
monocotyledonous plants as sedges and grasses is more uncertain, although it was
addressed by several studies in the last decade (Morrissey et al. 1993; Schimel
1995; Kelker and Chanton 1997; King et al. 1998).
The results of our clipping experiment suggest that plant-mediated CH4 transport
via C. aquatilis plants is driven only by facilitated diffusion. A pressure-induced
active transport should have broken down after clipping. Furthermore, the experiment
indicated that diffusion was not limited by the diffusion resistance of the aboveground portion of Carex plants but rather by a high diffusion resistance at the
transition between the rhizosphere and the root aerenchyma. This conclusion was
backed by the microscopic-anatomical studies of Carex roots: dense exodermes, that
were built up of compactly packed hexagonal cells with thick cell walls, separated
the root aerenchyma from the rhizosphere. Such exodermes act as effective diffusion
barriers and reduce oxygen loss into the rhizosphere as well as CH4 infiltration into
the root aerenchyma (Končalová 1990; Schütz et al. 1991). In contrast to our results,
Morrissey et al. (1993) and Schimel (1995) observed that the CH4 release from arctic
Carex-dominated wetlands was limited by the above-ground portion of the plant, that
is, by stomatal control. On the other hand, Kelker and Chanton (1997) observed no
clear and enduring increase of CH4 flux after clipping sedges in a boreal fen and
concluded that plant-mediated gas transport through Carex plants had to be regulated
below ground, as is common among most other plant species (Armstrong 1979;
Chanton and Dacey 1991). The different results between studies can be due to
differences in factors other than leaf or root resistance, such as plant phenology, CH4
concentration in pore waters of the respective soil, microclimate, or root uptake
controlled by soil temperature (Morrissey et al. 1993). These factors should be
considered in a more detailed continuative study to improve the understanding of
plant-mediated CH4 transport by C. aquatilis in tundra ecosystems.
Perspectives
A multi-year study on the seasonal and interannual variability of CH4 emission is in
progress at the described polygonal tundra. Longer time series are needed to accurately quantify the impacts of environmental controls on CH4 emission, as water
table, soil temperature, thaw depth, or plant phenology. Beside the moist and wet
soils, which were investigated in the presented study, polygonal ponds are an important landscape feature of polygonal tundra. The CH4 dynamics of theses ponds
shall be studied in detail in the future. The relative areal extent of the ponds and the
different soils shall be evaluated by the analysis of high-resolution remote sensing
data to allow a reasonable regional quantification of CH4 emission by upscaling.
61
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
359
Conclusions
The presented study points out the high small-scale spatial variability of CH4 fluxes
in the polygonal tundra of the Lena Delta, Northern Siberia. The pronounced microrelief of polygonal tundra induces strongly differing hydrologic conditions within
short distances that affect aeration status and organic matter content of soils as well as
the vegetation cover. CH4 emission is controlled by all these interdependent factors in
a complex way. Beside water table position, the vegetation cover is of great importance in controlling CH4 emission from polygonal tundra. It was shown that the
dominant vascular plant of the study area, C. aquatilis, possesses large aerenchyma,
which serve as pathways for substantial plant-mediated CH4 transport. The importance of plant-mediated CH4 flux is strongly influenced by the position of the
water table relative to the main root horizon. Plant-mediated CH4 transport accounted
to about two-thirds of the total flux in the polygon centre and to less than one-third of
the total flux at the polygon rim. The effect of plant-mediated CH4 transport is
greatest with a high water table and the bulk of roots growing in anoxic soil horizons.
A clipping experiment and microscopic-anatomical studies suggested that plantmediated CH4 transport via C. aquatilis plants is driven only by diffusion and is
limited by the high diffusion resistance of the dense root exodermes.
Acknowledgements
We thank the Russian–German parties of the expedition Lena 1999 (Holger Becker,
Alexander Vlasenko, Björn Schulz, Anja Kurchatova) for the pleasant team work in
the field. Special thanks go to Marco Schmidt at the Institute of General Botany,
University of Hamburg, for assistance with the electron scanning microscopy,
Susanne Kopelke and Professor Horst Wiechmann at the Institute of Soil Science,
University of Hamburg, for providing support in the laboratory and advice in the
planning of this work, and the staff of the Alfred Wegener Institute, Research Unit
Potsdam, for making the expedition to the Lena Delta possible. We appreciate
helpful comments on this manuscript from Christian Wille and the two reviewers.
This work was conducted within the framework of the German–Russian joint
project ‘System Laptev Sea 2000’ (03G0534G), which was financed by the German
Federal Ministry of Education and Research.
62
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
Remote Sensing of Environment, submitted
3.3
Land cover classification of tundra environments in the Arctic
Lena Delta based on Landsat 7 ETM+ data and its application for
upscaling of methane emissions
Julia Schneider#, Guido Grosse§, Dirk Wagner*
Alfred Wegener Institute for Polar and Marine Research, Research Unit Potsdam, D-14473, Potsdam, Germany
present affiliation: University of Greifswald, Institute of Botany and Landscape Ecology, D-17487, Greifswald,
Germany
§
present affiliation: Geophysical Institute, University of Alaska, Fairbanks, USA
*corresponding author: [email protected], Tel. +49331 2882159, FAX +493312882137
#
Abstract
The Lena River Delta, situated in Northern Siberia, is the largest arctic delta. Since natural deltas
are characterised by complex geomorphological patterns and ecosystems, high-resolution
information on the distribution and extend of the delta environments is necessary for an accurate
spatial quantification of biogeochemical processes as the emission of greenhouse gases from tundra
soils. In this study, the first land cover classification for the entire Lena Delta based on Landsat 7
ETM+ images was conducted and used for the quantification of methane emissions from the delta
ecosystems on the regional scale. Nine land cover classes of aquatic and terrestrial ecosystems in the
clearly wetland dominated Lena Delta could be defined by this classification approach. The use of
the high-resolution land cover maps for regional upscaling of methane emissions reduces the error
potential of the upscalings.
Keywords: Land cover classification; Methane emission; Upscaling; Tundra environments; Lena
River Delta
1. Introduction
Beside carbon dioxide and water vapour, the atmospheric trace gas methane is one of the most
important greenhouse gases. Methane is chemically very reactive and more efficient in absorbing
infrared radiation than carbon dioxide. Its contribution to the radiative forcing from pre-industrial to
present time is estimated with about 20 % of all greenhouse gases (IPCC, 2001; Le Mer & Roger,
2001).
Methane has a wide variety of natural and anthropogenic sources (Wuebbles & Hayhoe, 2002).
Although the major sources of atmospheric methane are known, the quantification of the methane
emissions from these sources is difficult due to high spatial and temporal variability (IPCC, 2001).
The most important natural sources are wetlands (Bartlett & Harriss, 1993; Wuebbles & Hayhoe,
2002). They cover about 4-6 % of the Earth’s surface (Mitsch et al., 1994). 28 % of these wetlands are
located in the high latitudes north of 60°N in the Arctic and Subarctic climate zone (Matthews &
Fung, 1987). Wetlands emit about 100 Tg methane annually, or about 20 % of overall global
emissions of 450-550 Tg a-1 (Matthews, 2000). Estimates of the methane emissions of the arctic and
subarctic wetlands range between 10 and 39 Tg a-1, or between 2.2 and 8.6 % of the overall global
methane emissions (Bartlett & Harriss, 1993; Bartlett et al., 1992).
Biogene methane emissions from wetlands are determined by two different microbial processes:
methane production and methane oxidation (Cao et al., 1998; Wagner et al., 2003). The major
controlling factors of both processes are the availability of oxygen, temperature, amount and quality of
63
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
organic matter, vegetation, and pH (Bartlett et al., 1992; Morrissey & Livingston, 1992; Christensen et
al., 1995; Whalen et al., 1996; MacDonald et al., 1998; Wagner et al., 2005). These factors are of high
temporal and spatial variability within the active layer of permafrost soils and thus also are the CH4
emissions.
For the calculation of the global methane emission often a simple multiplication of mean
emission rates from small individual study sites by the area of the ecosystem (Panikov et al., 1993;
Harriss et al., 1993), or by the global wetland area is conducted (Matthews & Fung, 1987; Bartlett &
Harriss, 1993). These calculations do not consider small-scale spatial variations like complex
vegetation patterns or variations in soil moisture.
Optical remote sensing is a direct method for the observation of Earth’s surface. The multispectral
data of the Landsat-7 ETM+ sensor have proven potential for classification of vegetation, geological
structures, and soils. These are also major factors determining the methane emission from the arctic
tundra (Bartlett et al., 1992; Gross et al., 1990; Morrissey & Livingston, 1992; Christensen et al.,
2000). The strong correlation between methane emissions and the prevailing vegetation cover and soil
moisture is vital for the land cover classification focusing on the quantification of methane emission
from tundra wetlands. Extensive field knowledge of the individual land cover classes in the
investigation area allows the upscaling of the methane emission rates from individual study sites to the
entire study regions considering the influencing factors in this biogeochemical process.
Although land cover classifications are a standard application of remote sensing data, recent and
high-resolution land cover maps are still lacking for large Arctic regions. Within the last 15 years,
some studies on land cover classifications utilizing remote sensing data with different thematic focus
have been conducted in Alaska and Canada (Ferguson, 1991; Gross et al., 1990; Joria & Jorgenson,
1996; Muller et al., 1999; Stow et al., 1998; Brook & Kenkel, 2002). Land cover classifications of
Arctic investigation areas in Russia are rare and most of them have been done in the last years (Rees et
al., 2003; Takeuchi et al., 2003; Virtanen et al., 2004; Grosse et al., 2006).
Our study applying remote sensing techniques for the quantification of methane emission focuses
on the tundra region of the Lena Delta in Arctic Siberia. The purposes of this study were: (i) to classify
the land cover of the Lena Delta with regard to its methane emission rates based on the Landsat-7
ETM+ satellite data; (ii) to determine the spatial distribution and coverage of the various land cover
classes; (iii) to balance the methane emissions of the individual land cover classes and of the Lena
Delta in total. The methane flux data were inferred from long-term closed chamber measurements.
2. Study area
The study area is the Lena Delta, located in Northern Siberia at the Laptev Sea coast between the
Taimyr Peninsula and the New Siberian Islands. Occupying an area of about 29.000 km², it is the
largest delta in the Arctic and one of the largest in the world. The delta is characterised by a network
of small and large rivers and channels, and more than 1000 islands. The Lena Delta can be divided
into three geomorphologically different terraces and active floodplain levels (Are & Reimnitz, 2000;
Schwamborn et al., 2002; Fig. 1). The active floodplain and the first terrace (1-12 m a.s.l.) are the
youngest parts of the Lena Delta. The first terrace was formed during the middle Holocene and mainly
occupies the eastern part of the Lena Delta. It is characterised by the patterned ground of ice-wedge
polygons. The second terrace (11-30 m a.s.l.), formed between the late Pleistocene and early Holocene
age, occupies about 23 % of the delta and differs from other terrace levels in sedimentological
composition, geomorphological habit, and the character of the vegetation cover. The second terrace is
characterised by sandy sediments with low ice content. The polygonal microrelief is less expressed;
thermokarst-lake assemblages are typical. The third terrace (30-60 m a.s.l.) is the oldest terrace in the
Lena Delta. It is not a fluvial-deltaic deposition but an erosional remnant of a Late Pleistocene
accumulation plain of fine-grained, organic- and ice-rich sediments in front of the Chekanovsky and
Kharaulakh mountain ridges in the southern zone of the study area (Schirrmeister et al., 2003). The
surface of the third terrace is characterised by polygonal ground and thermokarst processes.
The Lena Delta is covered by tundra vegetation of various types. Major components are grasses,
sedges, mosses, lichens, and dwarf shrubs.
64
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
The region is characterised by an Arctic continental climate with low mean annual air
temperatures of –13°C, a mean temperature in January of –32°C, and a mean temperature in July of
6.5°C. The mean annual precipitation is low and amounts to about 190 mm (WWIS, 2004). The Lena
Delta is located in the zone of continuous permafrost with a thickness of about 500-600 m
(Romanovskii & Hubberten, 2001). The thickness of active layer is usually in the range of 30-50 cm
during summer.
122°E
124°E
126°E
128°E
130°E
74°N
74°N
Laptev Sea
73°N
73°N
0
10 20
40
60
80
100
Kilometers
Lena
72°N
72°N
122°E
124°E
first terrace plus modern floodplains
126°E
128°E
second terrace
130°E
third terrace
Fig. 1. Map of the geomorphological units of the Lena Delta according to Schwamborn (2002).
The island Samoylov, situated in the central delta (72°22' N, 126°29' E), is the main study site for
the methane emission measurements in the Lena Delta since 1998. Samoylov covers an area of about
5 km² and is representative for the first terrace and the floodplains. The western part of Samoylov is
formed by recent fluvial and aeolian processes. Three floodplain levels can be distinguished by
inundation frequency and vegetation cover. The sediments are characterised by fine to coarse sands.
The middle Holocene deposits of the first terrace cover about 3 km² in the eastern part of Samoylov.
This area is dominated by active ice-wedge formation, low-center polygons and small thermokarst
ponds. The vegetation and soil patterns are complex due to high lateral variability of the polygonal
microrelief with polygon rims and polygon depressions.
3. Materials and methods
3.1. Image data and processing
The study was based on the land cover classification of three Landsat-7 ETM+ satellite images.
The acquisition dates are 27 July 2000 (path 131, row 8 and 9) and 26 July 2001 (path 135, row 8),
both dates which are within the main vegetation period. ERDAS Imagine software was used to carry
out all image processing tasks. In addition to the ETM+ satellite imagery, we acquired and utilized
numerous other ancillary data for determination of typical land cover classes and field training sites:
vegetation field data, soil information, field and aerial photography.
The three Landsat-7 images were rectified using ground control points from three already
orthorectified Landsat-7 ETM+ images (August 2000, path 130, row 9; July 2001, path 133, row 8
and 9) and by applying a first-order polynominal transformation. The scenes were resampled to
30 m x 30 m pixels using the nearest neighbour approach. The RMS error was less than 1 pixel, while
the base imagery has a horizontal accuracy of approximately 50 m. To minimize the effects of the
65
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
atmosphere, sun illumination geometry, and instrument calibration on the image data, a radiometric
and image-based atmospheric correction was applied (Chavez, 1996). As a result the image digital
numbers (DN) were converted to reflectance values and the radiometric differences between the three
scenes due to atmospheric conditions were lowered. The reflectance images are more appropriate for
land cover analysis than DN images (Huang et al., 1998). Finally, the three scenes were projected to
UTM Zone 52 with the geodetic datum WGS 1984 and a mosaic of the Lena Delta was composed.
Image classifications were conducted using both unsupervised and supervised techniques. Cloud
cover was identified by an unsupervised classification and masked out from the image mosaic. The
unsupervised classification was also used to identify spectrally similar areas and possible training sites
for the supervised classification. Nevertheless, most of the spectral classes determined in the
unsupervised classification did not represent homogeneous land cover classes. Therefore, a supervised
classification was carried out using the spectral bands 1-5 and 7 (VIS, NIR, SWIR). For the supervised
classification, the minimum distance algorithm was used, because it can be more effective than the
often used maximum likelihood algorithm when the number of training sites per class is limited
(Richards & Jia, 1999). Ancillary data, like local thematic maps, field knowledge, and aerial and field
photography, were used to select the training areas for each class. This process resulted in 34 training
areas for 10 land cover classes. A detailed accuracy assessment (Story & Congalton, 1986; Congalton,
1991) was not obtained for the land cover classification of the Lena Delta area, as necessary area-wide
independent data is not available for this large region. Nevertheless, a first assessment with field
photographs and new field knowledge from a Lena Delta expedition in summer 2005 indicates a good
accuracy of the classification result. A quantitative accuracy assessment is planned using hyperspectral
Chris-Proba data and field spectrometry conducted during this and subsequent expeditions.
Fig. 2. Supervised classification of the Lena delta (detailed section with Samoylov Island in the right
center). Colour code: dark blue = water; light blue = shallow water; dark green = wet sedges and
mosses dominated tundra; light green = moist sedges and mosses dominated tundra; yellow = mainly
non-vegetated areas; gray = dry to moist dwarf shrubs dominated tundra; red = dry grasses and dwarf
shrubs dominated tundra; light brown = dry sandy mosses, sedges and dwarf shrubs dominated tundra;
violet = dry grasses dominated tundra; pink = dry tussock tundra.
3.2. Methane emission measurements and upscaling
The methane emission rates of individual study sites were determined by closed chamber
measurements. The measurements were carried out within the scope of long-term investigations of the
trace gas emissions in the Lena Delta during the years 1999 to 2006. Methane concentrations were
determined with a gas chromatograph in the field laboratory (Wagner et al., 2003).
66
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
Currently, long-term measurements (more than 1 month) of methane emissions in the Lena Delta
have been conducted on polygonal tundra sites and sites located on the lower floodplain vegetated by
dwarf willows or cotton grass. The results for all other classes depend either on calculations based on
the methane emission rates which have been measured in a shorter period, or on estimations derived
from the literature. For moist and dry habitats the measurements continued less than 1 month. For the
dry habitats we used methane emission rates measured by Kutzbach & Kurchatova (2002) in the Lena
Delta. We also have assumed that emission rates of all dry classes are equal because all of these
classes have the dry substrate in common. The characteristics of the non-vegetated areas point to very
low methane emission rates, so we assume that it is nearly zero. This assumption is confirmed by a
measurement of Kutzbach & Kurchatova (2002) at a sandy deflation cliff in the delta. The shallow
water study sites appear either as a vegetated site with high emission rates (e.g. vegetated lake
margins) or as a non-vegetated site with very low methane emission rates. It was not possible to
separate these two habitat types properly with the available methods. To avoid miscalculations, we do
not include the methane emissions of this land cover class into the balance of the methane emissions
of the Lena Delta area.
The different habitat types of the class water bodies (e.g. rivers, lakes, and coastal waters) result
in variations of the methane emission potential within the class. The area covered by the land cover
class water bodies is nearly 8900 km². The lakes > 1 ha occupy around 2800 km² of the Lena Delta
(Morgenstern, 2005), or about 31.5 % of the open water area. We used only the methane emission
rates of the lakes to determine the balance of the methane emission of the Lena Delta. Due to lacking
measurements of the methane emission rates of thermokarst lakes in the Lena Delta, we assumed that
the rates are as high as those of the lakes in Alaska north of 68°N measured by Morrissey and
Livingston (1992).
Table 4 shows the methane emission rates we used for the calculation of the methane emissions
of the Lena Delta. These are the mean values measured in July; only the rates for the land cover class
moist to dry dwarf shrub-dominated tundra have been measured in June.
We used equation (1) for the calculation of the daily methane emissions of the Lena Delta. There, n is
the number of land cover classes, Ai is the area of the individual classes and Edi is the daily methane
emission rate for each class.
n
Ed= ∑ AiEdi
(1)
i=1
We used equation (2) for the calculation of the annual methane emissions of the Lena Delta area,
where n is the number of land cover classes, Ai is area of the individual classes and Edi is the methane
emission rate of each class within the period from June to October.
n
Ea= ∑ AiEai
(2)
i=1
4. Results
4.1. Supervised classification
Nine land cover classes characterised by their vegetation, surface moisture, and topography plus
one cloud mask class could be defined for the Lena Delta area:
Water bodies (WB): water bodies include the open water of lakes, rivers, streams and coastal
waters.
Shallow water (SW): this class consists of recurrent or steadily shallow inundated areas: a)
shallow coastal waters, shallow waters of riverbanks, and mainly barren sand bars, or b) shallow parts
of lakes and rivers with typical vegetation of sedges and hydrophilic grasses.
67
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
Mainly non-vegetated areas (NV): barren or partially vegetated areas on active river bars, along
the coast line, or deflation cliffs. These sites are mostly sandy and vary in soil moisture.
Wet sedge- and moss-dominated tundra (WT): sites with water-saturated substrate and a nearly
continuous cover of sedges, especially Carex aquatilis, and other hydrophilic graminoids growing in
shallow water (e.g. Eriophorum scheuchzeri) or mosses.
Moist grass- and moss-dominated tundra (MT): areas are characterised by moist tundra on poorly
drained soils and a continuous vegetation cover of grasses, mosses and dwarf shrubs (Betula nana,
Salix spp.).
Dry moss-, sedge- and dwarf shrub-dominated tundra (DMSD): well drained sites with sand as
predominant substrate, found often close to cliffs. The vegetation cover can vary: there are sites
dominated by sedges, and cotton grass and mosses as dominant vegetation with isolated occurring
lichens and dwarf shrubs, other sites are dominated by dwarf shrubs and lichens.
Moist to dry dwarf shrub-dominated tundra (DMD): this class is dominated by dwarf shrubs and
is found on moist to dry sites. It occupies large areas of the lower floodplain and is dominated by
dwarf willows; on moist sites cotton grass occurs. Seasonal inundations of these areas result in a high
content of nutrients in the soils and a dense vegetation cover.
Dry grass-dominated tundra (DG): this cover type occurs predominantly on the lower floodplain,
the substrates are mostly dry and temporary moist after the inundation. The areas are characterised by
grasses (e.g. Deschampsia brevifolia), some sites are only sparsely vegetated.
Dry tussock tundra (DT): this land cover class is characteristic for dry, very well-drained sites of
upper slopes and pingos. The vegetation cover consists of Eriophorum vaginatum tussocks.
Cloud mask: clouds and cloud shadows.
WT
MT
WB
NV
SW
MDD
DMSD
DG
DT
Fig. 3. Percentage of surface coverage and area estimates of the land cover classes in the Lena delta,
based on the original resolution (30m*30m) of the LANDSAT-7 ETM+ images.
The land cover classification reflects the different river terraces and floodplains of the Lena Delta.
A detailed image of the classification of a part of the Lena Delta is shown in Figure 2.
Nearly 1/3 of the total area of the Lena Delta is occupied by water bodies (WB, 30.6 %). Together
with the land cover classes SW (5.5 %), WT (28.5 %) and MT (7.5 %) this amount to 72.1 % of the
Lena Delta area, indicating the dominance and importance of wetland areas for the delta ecosystem.
The composition and distribution of land cover classes varies for the three main river terraces. In
contrast to the first and the third terrace, the second terrace is dominated by classes indicating mainly
dry conditions. Area estimates for each land cover class are given in Figure 3.
68
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
4.2. Upscaling of methane emissions: case study for the land cover class wet sedge- and mossdominated tundra
Within the scope of this study the most detailed measurements were done for the land cover class
wet sedge- and moss-dominated tundra (WT). There are several reasons for concentrating on detailed
and systematic investigation of methane emissions from this class. First, from our previous
measurement campaigns we know that this extent land cover class is the most important source of
methane in the Lena Delta. Second, extensive ancillary data about the soil composition, soil moisture,
soil physics, vegetation, microrelief, and microbiology are available for the systematic investigation of
the determining factors for methane emission. This allows the investigation of small-scale
heterogeneities of these parameters and their influence on the methane emission from this individual
land cover class. The land cover class wet sedge-and moss-dominated tundra (WT)consists of
polygonal microrelief and lakes of different sizes with high emission rates in wet polygon centers, and
lower emission rates from drier polygon rims, open water ponds, and the vegetated lake margins. For
this class we used methane emission rates measured at habitat-scale (Table 1). The weighted
calculation shows that methane emission rates of this class range from 10.8 to 23.2 mg CH4 m-2d-1,
with a mean at 16.8 mg CH4 m-2d-1
Table 1
Habitat types of the land cover class wet sedge- and moss-dominated tundra and the belonging daily
methane emission rates in the months June to October. The percentage of habitat type cover was
determined by aerial image analysis of key sites on the first delta terrace.
Habitat type
Methane emission (mg CH4 m-2d-1)
Cover %
Very wet sites
7.8
Dry sites
62.2
Water
15.2
Overgrown
water
14.8
Mean
Min
Max
Mean
Min
Max
Mean
Min
Max
Mean
Min
Max
June
54.1
13.7
89.4
2.5
0.7
4.6
4.1
2.0
7.9
40.3
25.6
59.9
July
93.7
60.3
119.6
4.7
3.3
6.2
4.1
2.0
7.9
40.3
25.6
59.9
August
44
32.9
72.6
6.1
3.1
11.4
7.9
3.3
15.7
48.1
31.9
67.1
September
17.9
7
25.8
2.1
0.6
4
4.1
2.0
7.9
40.3
25.6
59.9
October
11.2
2.3
25.3
1.7
0.7
3.9
4.1
2.0
7.9
40.3
25.6
59.9
Table 2
Methane emissions of the land cover class wet sedge- and moss-dominated tundra in the months June
to October (weighted calculation).
Wet sedge- and mossMethane emission (mg CH4 m-2d-1)
dominated tundra
June
July
August
September
October
Mean
12.32
16.75
15.4
9.28
8.46
Minimum
5.63
10.79
9.6
4.97
4.7
Maximum
19.79
26.16
24.83
14.51
14.43
Temporal variations during the vegetation period are another central objective of long-term
investigation of methane emissions in the Lena Delta. While methane emission rates for the polygon
rims and centers have been determined in the field in the period from June to October, the rates for the
open water and vegetated rims of lakes have been determined only in July and August. For the
estimation of methane emission for the land cover class wet sedge- and moss-dominated tundra we
69
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
used the July methane emission rates for missing periods. The maximum, mean and minimum values
of the methane emissions from each of the habitats are summarised in Table 1. Based on these
assumptions, we calculated the methane emission rates for the different months for this land cover
class; they are listed in Table 2. The fast increase of emissions in June, the maximum in July, and the
following slow decrease of methane emission rates are obvious.
4.3 Upscaling of methane emissions in the Lena Delta
The daily methane emission rates vary strongly among the individual land cover classes. While
the highest amounts are emitted by the class moist to dry dwarf shrub-dominated tundra, followed by
the moist grass- and moss-dominated tundra, the lowest rates are emitted by the “dry” classes. The
land cover classes wet sedge- and moss-dominated tundra and moist grass- and moss-dominated
tundra represent the wetlands of the Lena Delta. The methane emission rate of the wetlands is
16.8 mg CH4 m-2d-1 (weighted calculation).
Table 3 shows the results of the calculation of the daily methane emissions in the Lena Delta
(after equation 1). Upscaling is based on the original resolution (30m x 30m) of the land cover
classification.
Table 3
Methane emission rates of individual land cover classes used for the calculation of the methane
emission of the Lena delta and the daily methane emission of each class in July
Methane emission
Land cover class
Area (km²)
(mg m-2d-1)
(106g d-1)
Wet sedge- and moss-dominated tundra
8277
16.81
139.1
Moist grass- and moss-dominated tundra
2173
17.21
37.4
Open water
8894
- lakes (> 1ha)
2805
3.12
8.7
- rivers, coastal waters and lakes < 1ha
6089
0
0
Mainly non-vegetated areas
1697
0
0
Shallow water
1590
0
0
1
Moist to dry dwarf shrubs-dominated tundra
1832
58.4
Dry moss-, sedge- and dwarf shrub-dominated tundra
& Dry grass-dominated tundra & Dry tussock tundra
4573
0.43
Total
29036
10.1
1
2
107
1.8
294
3
Mean values measured in the Lena Delta, Assumption after Morrissey & Livingston (1992), Assumption
after Kutzbach & Kurchatova (2002)
In comparison to the daily methane emission rates, the annual emission rates are of higher
importance for the calculation of the methane emissions of the Lena Delta area. Due to our
measurements in early winter (Oct. 2003), we assume that the methane emission in winter is about
zero. Within the scope of our study, our calculations could only determine temporal trends of methane
emissions for the class wet sedge- and moss-dominated tundra (Table 2). The methane emissions of
the class wet sedge- and moss-dominated tundra for the period from June-October amounts to
1907 mg CH4 m-2. Based on this calculation, we tested different assumptions regarding the length of
the vegetation period. Assuming that the length of the vegetation period is 120 days, the methane
70
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
emission of the land cover class wet sedge- and moss-dominated tundra is 2010 mg CH4 m-2,
compared to 1675 mg CH4 m-2 for a vegetation period of 100 days. Therefore, in the first case the
calculated methane emission is 5.4 % higher and in the second case 12.2 % lower than
1907 mg CH4 m-2. This calculation confirmed our decision to use the calculated trend and not the
assumptions of the length of the vegetation period for further investigations.
The calculation of the methane emissions from all other land cover classes during the vegetation
period is based on the ratio of the methane emissions of each individual land cover class and the
methane emission of the class wet sedge- and moss-dominated tundra (equation 2).
Table 4 shows the results of the upscaling for the individual land cover classes and for the Lena
Delta. The upscaling for the Lena Delta is a weighted calculation using the methane emission rates of
the individual classes. The highest amounts of methane are emitted by the classes wet sedge- and
moss-dominated tundra (15.8 x 109 g CH4 per year) and moist to dry dwarf shrub-dominated tundra
(12.1 x 109 g CH4 per year), followed by moist grass- and moss-dominated tundra (4.2 x 109 g CH4).
Although the share of the land cover classes dry tundra with different vegetation cover in the total area
of the Lena Delta is relatively large, the contribution of these classes to the total methane emission of
the delta is low (0.2 x 109 g CH4 per year).
Table 4
Annual methane emissions of the individual land cover classes and their total methane emission in the
Lena delta
Area
Methane
Land cover class
Methane
(km²)
emission
emission
(mg m-2a-1)
(106g)
1906.9
8277
15783.4
Wet sedge- and moss-dominated tundra
1952.3
2173
4242.3
Mainly non-vegetated areas
0
1697
0
Shallow waters
0
1590
0
6628.7
1832
12143.8
44.1
4573
201.7
352.7
2805
989.3
Other (lakes < 1ha, rivers, streams, coastal waters)
n.a.
n.a.
n.a.
Total
1149
29036
33360.5
Moist grass- and moss-dominated tundra
Moist to dry dwarf shrub-dominated tundra
Dry moss-, sedge- and dwarf shrub-dominated
tundra &
Dry grass-dominated tundra & Dry tussock tundra
Open water (only lakes > 1ha)
n.a. = not analysed
5. Discussion
5.1. Land cover classification
Whalen & Reeburgh (1990), Bartlett et al. (1992) and Christensen et al. (2000) have used land
cover classifications for the upscaling of methane emissions within their studies. Heikkinen et al.
(2004) did an upscaling of methane and carbon dioxide emissions for the catchment of the Lek
Vorkuta River, East European Russia. All these balances of methane and carbon dioxide are based on
land cover classifications with only five to six land cover classes.
A common method for a general land cover classification of large heterogeneous datasets is the
automatic unsupervised classification based on a chain algorithm and the subsequent labelling of land
71
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
cover classes with real land cover features (Joria & Jorgenson, 1996; Stow et al., 1998; Cihlar, 2000).
Such unsupervised classifications with a very large number of classes proved unsuitable for the land
cover classification of wetlands with a focus on methane balancing, as usually only a limited number
of measurement sites are available. Furthermore, the classes obtained with such an approach are
ecologically very heterogeneous and thus unsuitable for site-upscaling. Thus, we used a supervised
classification approach based on a relatively small number of classes for the classification of the Lena
Delta. We obtained the best results with the supervised minimum distance algorithm using nine
classes. The Landsat 7 derived classes reflect especially the local soil moisture and vegetation
conditions, both are important parameters for the methane emissions of a site (MacDonald et al., 1998;
Wagner et al., 2003; Kutzbach et al., 2004). Therefore, the land cover classes could be related to
locally measured methane emissions.
Within this study we used class area calculations based on the land cover classification of a
Landsat 7 image mosaic from July 2000 and 2001. This mosaic provides a snapshot of the midsummer situation in the highly dynamic environment of the Lena Delta. Seasonal variations, e.g. like
changes in vegetation cover density, soil moisture, and the annual inundation of the floodplain levels
during the spring flood, are not considered.
Commonly, three types of potential errors for a land cover classification are distinguished (Felix
& Binney, 1989). The first possible error is misclassification that describes the discrepancy between a
classification-derived and the field-observed land cover. The second is the cutpoint error, where the
field-observed land cover is a transition zone between two land cover classes with similar
characteristics. The third possible error is the wrong or incomplete description of the land cover
classes. To a certain amount, all these types of errors occur in our classification. Cutpoint errors occur
mostly among the spectrally similar classes wet sedge- and moss-dominated tundra and moist grassand moss-dominated tundra, which predominantly differ in their soil moisture. On the other hand,
there is almost no misclassification between the class open water and all other classes. Considering the
moderate quality of ancillary data for some areas of the large Lena Delta, we assume that there are
misclassification errors between some of the vegetation classes. Some of the class descriptions will
need modification. These errors are currently not quantifiable unless further ground truth is done in the
Lena Delta.
Nevertheless, we were able to classify the land cover of the Lena Delta regarding the balance of
the methane emission despite the described problems. This land cover classification is the first
encompassing the entire Lena Delta at high-resolution. The total number of the classes of our land
cover classification is nine.
Based on some general Russian thematic maps, fieldwork experience, and general knowledge of
the landscape structure and field photographs we assume that the classification of the Lena Delta has a
good accuracy.
5.2. Case study for the land cover class wet sedge- and moss-dominated tundra
The Lena Delta is characterised by small-scaled heterogeneity of vegetation cover, soils and
water balance. These factors have a direct effect on the methanogenesis and on the amount of the
emitted methane. The most detailed balance of methane emissions could be realised for the land cover
class wet sedge- and moss-dominated tundra. These sites mostly appear as polygonal tundra and cover
large areas of the Lena Delta. In this study, we demonstrated that the drier habitats of polygon rims
dominate the polygonal tundra, covering nearly 62 % of these sites. These results are confirmed by the
study of Kutzbach et al. (2004). More than 50 % of the area of their study site was covered by polygon
rims.
In the following, we compare the emission rates of the different habitats (polygon rims, polygon
centers, lakes and vegetated lake margins) of the land cover class wet, sedge- and moss-dominated
tundra with the results of methane measurements of other studies. Bartlett et al. (1992) and
Christensen et al. (1995) measured less methane emission for dry tundra sites of polygonal tundra than
in this study. Heikkinen et al. (2004) reported nearly the 8-fold amount of methane emission of a
thermokarst lake in northeast Russia comparing to the amounts measured in the Lena delta. Further
investigations on methane emissions from lakes have been done by Kling et al. (1992) in Alaska and
by Zimov et al. (1997) in Siberia. The mean daily methane emission rates of the polygonal lakes of the
72
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
Lena Delta are noticeably lower than the methane emissions of the polygonal lakes of other study
sites. The importance of lakes for the methane emissions from tundra and the global methane
emissions is not yet sufficiently clarified. According to Semiletov et al. (1996), the limnic ecosystems
of the tundra are one of the most important recent methane sources to the atmosphere. Morrissey &
Livingston (1992) determined that lakes have a considerably lower methane emission potential than
other habitats in the tundra. Bartlett et al. (1992) suggest a close connection between methane
emissions and the size of the lakes. Small lakes (less than 10 km²) emit significantly more methane
than the large lakes (more than 10 km²). In contrary, Kling et al. (1992) reported in their study that
there is no correlation between the methane emission of a lake and its size, depth, or its latitudinal
location. However, the importance of the vegetated lake margins for the methane balance of the tundra
is well known. The mean daily methane emissions estimated by Bartlett et al. (1992) and Morrissey &
Livingston (1992) amount double the methane emissions of vegetated lake margins in our study.
Differences in methane emissions between these studies appear largely due to differences in the
location of the study sites. The study site of Morrissey & Livingston (1992) was located south of 71°N
(the most southern sampling area at 68°35'N), while the site of Bartlett et al. King et al. (1998)
determined a correlation between temperature and plant mediated transport of methane in the
vegetated lake margins. The results of King et al. (1998) probably explain why the methane emissions
of vegetated lake margins found by Bartlett et al. (1992) and Morrissey and Livingston (1992) were
higher than the results of this study. The mean daily methane emission rate of wet polygon centers in
the Lena Delta is 93.7 mg CH4 m-2d-1. About one third more was measured by Bartlett et al. (1992) at
wet meadow sites, and nearly half of this amount by Christensen et al. (1995) at wet tundra sites. Both
sites are comparable to the sites in the Lena Delta because these sites are also characterised by water
saturated soils and vegetation of Carex spp. and Eriophorum spp. The measurements in the Lena Delta
and those of Whalen & Reeburgh (1990) at wet tundra sites are highly consistent. The methane
emissions reported by Nakano et al. (2000) for water saturated sites in the tundra are much higher than
the methane emissions in our study. Differences between the measurements appear also due to the
different length of the investigation period. If the study period is short, the methane emissions strongly
reflect the weather conditions (Christensen, 1993). The methane emission rates in this study have been
measured during field trips of several weeks since 1998. Summarizing, the measured methane
emissions from the various habitats of the land cover class moist grass- and moss-dominated tundra in
the Lena Delta are similar to those reported from analogous areas in the high latitudes.
The mean daily methane emission of the class wet sedge- and moss-dominated tundra amounts to
16.8 mg CH4 m-2d-1. The high emission rates of the wet polygon centers are not reflected in the
emission of this class due to the low percentage (7.8 %) of the area of this class. In contrast, the low
methane emissions of the drier habitats and lakes have a strong influence on the methane emission of
this class.
Generally, the length of the measurement period is an important factor for the quality and the
applicability of measured methane emission rates for temporal and spatial upscaling. Most of the
previous studies were conducted during July-August only (Whalen & Reeburgh, 1990; Bartlett et al.,
1992; Martens et al., 1992; Christensen et al., 1995). Some provide only imprecise information about
the investigation period (Morrissey & Livingston, 1992; Nakano et al., 2000; Takeuchi et al., 2003).
This also results in difficulties when comparing these methane emission rates to our long-term multiannual measurements of the class wet sedge- and moss-dominated tundra. A study by Christensen et
al. (2000) covering an investigation period from the middle of June to the end of August is an
exception. Their study covers the high-Arctic Zackenberg Valley in Greenland, which strongly differs
in climatic and substrate conditions to the sites in the Lena Delta. In Zackenberg Valley, the fast
increase of the emissions at the beginning of the vegetation period is missing and the methane
emission is nearly zero mg CH4 m-2d-1 in June. Methane emission rates throughout the year are
considerably lower than in the Lena Delta.
5.3. Upscaling of methane emissions in the Lena Delta
The small-scaled heterogeneity in vegetation and soil moisture and, thus, in methane emission
could be analysed only within the land cover class wet sedge- and moss-dominated tundra. The
coverage of this class in the Lena Delta is 28.5 % and the percentage of methane emission is 47.3 %
73
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
(Fig. 4). The small-scaled mosaic of the class moist grass- and moss-dominated tundra could not be
investigated with the same level of detail. The coverage of this class in the Lena Delta is 7.5 % and the
percentage of methane emission is about 12.7 % (Fig. 4). Further investigations of small-scaled and
seasonal variability of methane emissions within the class moist to dry dwarf shrub-dominated tundra
are necessary. In this study, this land cover class emits 36.4 % of the methane in the Lena Delta but
covers only 6.3 % of the delta (Fig. 4). Because the class shallow water could not be separated into its
different habitat types, it was not included in the methane balance of the Lena Delta. Its influence on
the overall methane emission of the delta seems to be negligible because large parts of the class
consist of low-emission sites (non-vegetated shallow water).
Furthermore, the methane emission rates of large lakes and rivers in the Lena Delta are estimated
to be low. The results of the studies by Heikkinen et al. (2004) and Whalen & Reeburg (1990) show,
that the arctic rivers and thermokarst lakes are important methane sources. In comparison, the study of
CH4 in the surface arctic waters of the Lena Delta by Semiletov et al. (1996) shows that the rivers and
coastal waters are not the significant factors in the present methane budget of the Lena Delta area. The
mean daily methane emissions of lakes in Alaska (Whalen & Reeburgh, 1990) and in European Russia
(Heikkinen et al., 2004) were at least 7-fold of the methane emission reported in our study. Kling et al.
(1992) estimated an average methane emission of 5.76 mg CH4 m-2d-1 for Kuparuk River in Alaska
and Heikkinen et al. (2004) 9.9 mg CH4 m-2d-1 for Lek Vorkuta River, which is higher than the
methane emissions in the Lena Delta. At these study sites, the methane emissions of lakes and rivers
play an important role in the balance of methane emissions. Although the open water habitats cover
30 % of the Lena Delta, their total share on the methane emission is only 3 % (Fig. 4).
The mean daily methane emissions (0.4 mg CH4 m-2d-1) of dry sites in the Lena Delta are low as
well. According to Heikkinen et al. (2004), the methane emission rates of the dry sites are in general
very low or negative. In the Lek Vorkuta catchment they estimated methane emissions between -8.1
and 10.5 mg CH4 m-2d-1 and an average emission around zero. The dry sites cover nearly a quarter of
the delta area, and the methane emission amounts to only 0.6 % of the total Lena Delta emission
(Fig. 4).
WT
MT
WB
MDD
DMSD, DG, DT
Fig. 4. Percentage of methane emissions of individual land cover classes based on the total methane
emission of the Lena Delta
The mean daily methane emission of the Lena Delta is 10.1 mg CH4 m-2d-1. This value is about
20 % of the value for the arctic tundra calculated by Whalen & Reeburgh (1990) (52 mg CH4 m-2d-1).
The mean daily methane emissions of the wetlands in the Lena Delta amount to 16.8 mg CH4 m-2d-1.
That is below the range of 40 to 50 mg CH4 m-2d-1 estimated by Christensen et al. (1995) for northern
74
Methane Cycle in Permafrost Ecosystems
3 Methane Release from Siberian Tundra
wetlands. Earlier estimations have been much higher, for example the estimation by Matthews & Fung
(1987) of about 200 mg CH4 m-2d-1.
The methane emissions presented here are based on measurements in the period from June to
October. We did not measure during the whole winter time. We assume that the methane emission
during the cold season is nearly zero due to the low temperatures. This assumption is based on
measurements in October, which show the methane emission rates decreasing to zero (Ganzert et al.
2004). The discussion about the amount of methane emitted in winter is still ongoing. Winter methane
fluxes have been estimated only in North America and West Siberia (Whalen & Reeburgh, 1988; Dise,
1992; Melloh & Crill, 1996; Panikov & Dedysh, 2000). The reported winter emission rates amounted
from about 4 to 41 % of the annual methane fluxes. Zimov et al. (1997) demonstrated that methane is
produced in arctic lakes under ice during winter. The gas is largely released to the atmosphere from
holes in the ice during winter or during water column circulation after the spring ice melt. According
to Zimov et al. (1997), the north Siberian lakes could release about 75 % of their annual methane
emission during winter. Christensen et al. (1995) underline, that the methane emissions in winter are
not well investigated and may contribute significantly to the total emission of permafrost
environments.
The results of a study by Worthy et al. (2000) in the Hudson Bay Lowland correspond to our
assumptions. The largest emissions occur in the months July and August. The emissions drop off in
September and become very weak in October. The emissions become observable again in June and are
around zero or negative in the winter period.
Although the conditions of the study site of Reeburgh et al. (1998) are comparable to our site, the
results of the methane emission measurements are incomparable. Their study site is the catchment of
the Kuparuk River in North Alaska. It has a size of 26000 km² and is situated north of 68°N. They
estimated that the class wet tundra of the Kuparuk catchment emitted 5171 mg CH4 m-2a-1. This is
nearly threefold of the methane emissions of the class wet sedge- and moss-dominated tundra in the
Lena Delta. The methane emissions of the lakes and dry sites in the Lena Delta are significantly lower
than those of the Kuparuk catchment and this reflects in the mean annual methane emissions, the
emissions of the Lena Delta (1149 mg CH4 m-2a-1) are half of the emissions of the Kuparuk River
catchment (2390 mg CH4 m-2a-1).
The annual methane emission of the Lena Delta amounts to about 0.03 Tg. The emissions
presented here most probably underestimate the annual gas release since we did not include emissions
from lakes < 1 ha and rivers due to lacking base data, nor possible emissions during the winter. Further
investigations of the small-scaled heterogeneity of the vegetation cover and soil moisture have to be
done. A comparison of the annual methane emission of the Lena Delta with those of other study sites
is difficult due to lacking upscaling efforts of the methane emissions from measurement sites to larger
study areas (Whalen & Reeburgh, 1988; Morrissey & Livingston, 1992; Christensen, 1993;
MacDonald et al., 1998; Christensen et al., 2000).
6. Conclusions
The results of this study show that remote sensing and supervised image classification are
powerful tools for the upscaling of local methane emission measurements in high-latitude landscapes.
The supervised classification of the Landsat 7 ETM+ images is particularly suitable for detection of
ecosystems in the Lena Delta. The methane emission of tundra environments is influenced by
numerous factors, e.g. microrelief, soil moisture, temperature, amount and quality of organic matter,
thickness of active layer, availability of oxygen and nutrients, and vegetation. Tundra land cover type
is directly or indirectly influenced by these parameters, enabling the correlation of local methane
measurements with land cover classes and the upscaling of emission rates to the entire Lena Delta.
The applied supervised minimum distance classification was very effective with the few ancillary data
that were available for training site selection. The three main river terraces of the Lena Delta were
found to have different associations of land cover classes. The first terrace is characterised by wet sites
and lakes, the second appear to be drier and differ also in vegetation and the third terrace is
characterised by moist sites. Accordingly, the first terrace has the highest methane emission potential.
There is a strong variation in between the individual land cover classes regarding the methane
75
3 Methane Release from Siberian Tundra
Methane Cycle in Permafrost Ecosystems
emissions. The methane emissions of the classes in the Lena Delta are within the currently known
natural range of emissions from tundra habitats. Taking our multi-scale approach into account, the
methane source strength of certain tundra wetland types is expected to be lower than calculations
based on coarser scales. This study is the first attempt to assess the methane emission of the Lena
Delta based on satellite data and field measurements. Despite the uncertainties, the results suggest that
the Lena Delta contributes significantly to the global methane emission because of its extensive
wetland areas.
The approach we used for the balance of methane emission can contribute to the improvement of
the recent global balance of methane emissions and there is still large potential for intensifying
research in terms of validation of methane measurements for different land cover types and varying
habitats in them.
Acknowledgments
The authors wish to thank the Russian-German field parties during several expeditions to the
Lena Delta since 1998. Special thanks go to all our Russian partners, in particular Dimitry Yu.
Bolshiyanov (Arctic Antarctic Research Institute), Alexander Yu. Dereviagin (Moscow State
University), Mikhail N. Grigoriev (Permafrost Institute Yakutsk), Dmitri V. Melnitschenko (Hydro
Base Tiksi) and Alexander Yu. Gukov (Lena Delta Reserve).
76
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
4 Permafrost Ecosystems and their Microbial Processes
4.1
1
Element Redistribution along Hydraulic and Redox Gradients of
Low-Centered Polygons, Lena Delta, Northern Siberia
S. Fiedler,* D. Wagner, L. Kutzbach, and E.-M. Pfeiffer
ABSTRACT
processes (Brown, 1967; Tedrow, 1977; Tarnocai and
Zoltai, 1978; Washburn, 1979). During winter, ice wedges
crack, releasing contraction tension. During spring, melt
water seeps into these cracks, eventually freezing and
continuing the process. Expansion of the surface layer
is caused by increasing surface temperatures during
summer, which leads to a typical microrelief. Some parts
are elevated (polygon rim and slope ⫽ microhigh),
whereas others are depressed (polygon center ⫽ microlow). Upturning of permafrost strata by plastic deformation leads to transport of the solid soil phase. This process is reflected by twisted and mixed soil horizons as
well as buried organic matter (Bockheim and Tarnocai,
1998) (Fig. 1). It is generally agreed cryoturbation is the
dominant pedogenetic process of the polar regions (Van
Vliet-Lanoë, 1991; Bockheim et al., 1999, 2003). However, in addition to twisted layers, continuous bands of
Fe can also be found. These features follow the buckling
surface regularly and indicate element transport via liquid phase is an important pedogenetic process within
the polygons (Fig. 1).
Although arctic studies have added to an understanding of arctic soils (Feustel et al., 1939; Tedrow et al.,
1958; Gersper et al., 1980; Rieger, 1983; Bliss, 1997;
Korotaev, 1986), investigations in element translocation
processes are still scarce. Results are predominantly of
descriptive nature lacking pedogenetic information. To
provide a better understanding of element translocation
processes as a key to arctic soil genesis, a typical catena
of polygonic soils along the island of Samoylov in the
Lena Delta (Siberia) was investigated. The objective of
this investigation was to identify and expound on the
principal of element redistribution processes. It was hypothesized that within polygons (i) recent element redistribution via liquid phase caused by mobilization, transport, and immobilization processes was taking place and
that (ii) these processes led to depletion and accumulation zones in the solid phase of polygonic soils. The
controlling factors of these processes (iii) are hydraulic
and redox gradients between microhighs and microlows.
Wetland soils affected by permafrost are extensive in subarctic and
arctic tundra. However, this fact does not imply these soils have been
sufficiently investigated. In particular, studies of element translocation
processes are scarce. This study was conducted (i) to determine the
relationship between water and redox regimes in wetland soils in
the Siberian tundra, and (ii) to investigate their influence on the
distribution of redox sensitive and associate elements (Mn, Fe, P).
Major geomorphic units were chosen (microhigh, polygon rim and
slope; microlow, polygon center) from two low-centered polygons in
the Lena Delta. Within polygons, redox potential, permafrost, and
water level were measured during summer in 1999 and 2000 and
(related) compared with element distribution. Manganese, Fe, and P
accumulations were preferentially observed in aerobic microhighs.
Anaerobic conditions in the microlows lead to a mobilization of Mn,
Fe, and P. The elements migrate via water and are immobilized at
the microhigh, which acts as an oxidative barrier. The element pattern,
indicating an upward flux via water along redox gradients, is explained
by higher evapotranspiration from soils and vegetation of the microhighs (Typic Aquiturbel) compared with soils and vegetation of the
microlows (Typic Historthel). However, in further research this upward transport should be validated using labeled elements.
S
oils in subarctic and arctic tundra affected by permafrost occupy a total area of 1.5 ⫻ 109 km2 (Harris
et al., 1993). Permafrost soils represent the largest group
of natural wetlands, which are an important source of
the greenhouse gases methane and carbon dioxide
(Aselmann and Crutzen, 1989; Christensen et al., 1995).
They are C sinks (Bliss, 1997) as well, storing about
30% of the global soil organic C (SOC) (Michaelson et
al., 1996). With respect to the predicted global temperature increase, it is assumed these soils can switch from
sinks to sources of C (Grulke et al., 1990; Oechel et al.,
1993). Therefore, recent studies primarily deal with C
budgets, especially with the microbial processes of methane production and methane oxidation (Wagner et al.,
2001a, 2003). In addition, permafrost soils are of special
interest for current astrobiological research. Permafrost
areas and the Mars surface have shown similar morphological structures, which suggest their development is
based on comparable processes (Wagner et al., 2001b).
The typical patterned ground in permafrost regions is
composed of recurrent symmetrically formed ice wedge
polygons that have emerged from annual freeze–thaw
MATERIALS AND METHODS
Environmental Setting of the Study Sites
Samoylov island (72⬚ 22⬘ N Latitude, 126⬚ 28⬘ E Long.) in
the Lena River Delta (approximately 32000 km2, Are and
S. Fiedler, Univ. of Hohenheim, Inst. of Soil Science and Land Evaluation, D-70593 Stuttgart, Germany; D. Wagner, and L. Kutzbach, Alfred
Wegener Institute, Foundation for Polar and Marine Research, Telegrafenberg A43, 14473 Potsdam, Germany; E.-M. Pfeiffer, Institute
of Soil Science, Allende-Platz 2, 20146 Hamburg, Germany. Received
31 Dec. 2002. *Corresponding author ([email protected]).
Abbreviations: subscript [d], dithionite citrate bicarbonate extractable; Db, bulk density; Dpd, ␣-␣-dipyridil; EH, oxidation–reduction
(redox) potential; Fet, total iron; Kcal, calcium lactate acetate extractable K; MC, matrix color; Mnt, total manganese; Nt, total nitrogen;
subscript [o], ammonium oxalate extractable; subscript [p], Na-pyrophosphate extractable; Pcal, calcium lactate acetate extractable phosphorus (⫽plant available); PG1, Polygon 1; PG2, Polygon 2; Pt, phosphorus; SOC, soil organic carbon.
Published in Soil Sci. Soc. Am. J. 68:1002–1011 (2004).
 Soil Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
1002
77
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
FIEDLER ET AL.: ELEMENT REDISTRIBUTION ALONG TWO GRADIENTS
1003
Fig. 1. Cross-section of a typical low-center polygon (Lena Delta, Northern Siberia).
Reimnitz, 2000) covers an area of approximately 1200 ha
(Fig. 2) and portrays the active and youngest (approximately
8000–9000 yr) part of the delta (Schwamborn et al., 2002).
Maximum altitude above mean sea level is 12 m, representing
the oldest part of the island. Shore sites with elevations of
about 4 m above mean sea level are the lowest areas. Geomorphology of the island can be structured as follows (Akhmadeeva et al., 1999): the western part is characterized by recent
depositional processes (sandy fluvial and aeolian sediments)
and the eastern part is dominated by erosion processes that
have formed an abrasion coast. Due to changes in river levels,
four terraces were formed. Investigations were performed on
the Middle-Holocene terrace, which was dominated by active
ice wedge growth with low and high centered polygons and
thermokarst lakes.
Two major topographic units (microhigh ⫽ rim, microlow ⫽
center) of two low-centered polygons (Polygon 1 ⫽ PG1, Polygon 2 ⫽ PG2) were selected. In addition, the middle transect
position polygon slope (⫽ microhigh) of one of the selected
polygons was analyzed (PG1, Fig. 1). Depending on its position, a variety of wet arctic tundra vegetation grows on Samoylov from mossy tundra to wet fen and flooded sedges in the
center of the polygons (Kutzbach, 2000).
Well-defined climatic distinctions between seasons are characteristic for the Lena Delta, which belongs to the continental
area of the Arctic. Winter lasts 9 mo (end of September–end
of May, Tmin ⫽ ⫺30⬚C January), is characterized by insufficient
light (polar night) and severe snowstorms (140 km h⫺1, Wein,
1999). During the arctic summer of almost 12 wk, temperatures
are above freezing point (Tmax ⫽ 7⬚C July). Mean annual air
Fig. 2. The investigation site on the island Samoylov. (a) Map showing the location of the Lena Delta, and (b) location of the study area on
the island Samoylov.
78
Methane Cycle in Permafrost Ecosystems
1004
4 Permafrost Ecosystems and Microbial Processes
SOIL SCI. SOC. AM. J., VOL. 68, MAY–JUNE 2004
temperature is ⫺12⬚C, and mean annual precipitation amounts
to 190 mm. Approximately 25% of the annual precipitation
is snow (⬍10 mm precipitation per month). Relative humidity
is usually high (approximately 90%), and the annual evapotranspiration averages at 100 mm.
The investigations were performed during the summer of
1999 and 2000 within the framework of the joint cooperative
Russian-German research project “Laptev Sea System 2000”
(Pfeiffer et al., 2000; Wagner et al., 2001a). More details of
the study sites have been described by Rachold and Grigoriev
(1999, 2000, 2001).
Field Methods
Every second day, thaw depth of the soil (active layer) and
water levels were determined. Thaw depth was measured by
pushing a steel rod into the soil until permafrost was encountered. Water table depths were measured in a series of slotted
wells (polyvinylchloride, 6-cm i.d.). Redox potential (EH) was
measured using Pt electrodes (90% Pt, 10% Ir, diameter of
wires ⫽ 0.5 mm, wire length ⫽ 10 mm) as described by Fiedler
(1997). Transects (from rim to center of polygon) along the
two investigated polygons were equipped with a set of 30 Pt
electrodes installed at a depth of 5 cm and directly above the
permafrost. An Ag/AgCl electrode was used as a reference cell
(Farrell et al., 1991). A data-logger (Delta-T-Devices LTD,
Burwell, Cambridge, UK) was used for automatic readings at
hourly intervals. Measurements were performed during summer (Period 1 ⫽ 29 June –2 Sept. 1999, Period 2 ⫽ 1 Aug.–21
Aug. 2000), the time with the highest biological activity. Redox
data were corrected for the potential of the standard hydrogen
electrode by adding 215 mV (10⬚C) to experimental readings.
In addition, anaerobic conditions (presence of Fe2⫹) were
verified in field using the ␣-␣-dipyridyl (Dpd) test (Bartlett
and James, 1995) during the soil description. Soil solution at
different depths (polygon rim 14, 27, 39 cm; polygon center
9, 15 cm below surface) was collected three times during each
measurement period by suction lysimeters. Manganese and
Fe concentrations were determined by atomic absorption spectroscopy (AAS, Varian SpectrAA-200, Mulgrave Victoria,
Australia).
Soil Characterization
Soil classification was determined according to U.S. Soil
Taxonomy (Soil Survey Staff, 1999) and the World Reference
Base of Soil Resources (ISSS-ISRIC-FAO, 1998). Microhighs
were dominated by Typic Aquiturbels (Gleyi-Turbic Cryosols), whereas the prevalent soil type of the microlows was
Typic Historthel (Gleyi-Histic Cryosol). Bulk density was
measured using undisturbed soil cores (100 cm3, Schlichting
et al., 1995, Method 5.3.1.1). Standard soil analyses were performed on the fine-earth fraction (⬍2 mm): particle-size distribution (Schlichting et al., 1995, Method 5.4.1.3), pH (CaCl2)
(Schlichting et al., 1995, Method 5.4.5.1.2), and total carbon
(Ct, dry combustion, Leco CN-2000, Leco Instruments GmbH,
Krefeld, Germany). In all soils investigated, SOC was equivalent to Ct. Plant available potassium (Kcal), and phosphorus
(Pcal) were determined by extraction with 0.1 M calcium lactate
plus 0.1 M calcium acetate plus 0.3 M acetic acid (CAL,
Schüller, 1969). Potassium in the extract was analyzed using
flame emission spectroscopy (Elex 6361, Eppendorf, Hamburg, Germany). Determination of P was done by the molybdenum blue method of John (1970). Phosphorus was measured
as molybdate-phosphate complex at ε ⫽ 880 nm using a spectrophotometer (Zeiss PL2DL, Germany). Pedogenetic oxides
were extracted by dithionite citrate bicarbonate (Mnd, Fed,
Schlichting et al., 1995, Method 5.5.5.3) (Mehra and Jackson,
1960) and ammonium oxalate (Mno, Feo, Schlichting et al.,
1995, Method 5.5.5.2) (Schwertmann, 1964), and analyzed by
atomic absorption spectrometry. The portion of organically
bound Mnp and Fep was extracted by Na-phyrophosphate at
pH 10 (von Zezschwitz et al., 1973). Total element analysis
(Mnt, Fet, Pt) was performed with X-ray fluorescence (Siemens
SRS-200, Bruker AXS, Karlsruhe, Germany).
Calculation
Element masses per total soil volume of the active layer
were calculated as follows (Sommer et al., 1997):
兺 冢xiDb yi
n
Mx ⫽
i
i⫽1
100 ⫺ cfi
10 000
冣
Mx is the mass of P, Fe, or Mn in the pedon fine-earth (kg
m⫺2 profile depth⫺1); Xi is P, Fe, or Mn content (⬍2 mm) in
horizon i (g kg⫺1 fine-earth); N is the number of horizons to
profile depth; Db is bulk density (g m⫺3); Yi is the thickness
of the horizon i (cm); Cfi is the coarse fraction (⬎2 mm) of
the horizon i (vol.%).
RESULTS AND DISCUSSION
Water Level and Permafrost Table
The two investigated polygons were characterized by
very flat relief (⌬height, PG1 ⫽ 37, PG2 ⫽ 22 cm over
a distance of approximately 600 cm) (Fig. 4). According
to Boike (1997) and Boike et al. (1998), seasonal hydrology can be described as follows: at the beginning of
snowmelt, water flows laterally from microhighs to microlows. This leads to a supersaturation zone in the
polygon center (water table ranged from ⫹10 to ⫺5 cm
below surface, Fig. 3), which lasts until freezing in autumn. On the contrary, the water table of microhighs
rapidly drops to the permafrost table from spring to
summer (0 to ⫺40 cm below surface).
The ground thaws rapidly until mid-June (after 18
June, Julian day 169) after which thaw rates are somewhat slower (Fig. 3). Thickness of the active layer varies
from year to year in response to climatic conditions.
Within the polygons, permafrost is deepest under the
rim at the end of measurement periods (August 1999
vs. 2000, 44 vs. 38 cm) and most shallow in the polygon
center (35 vs. 28 cm below surface). Maximum thaw
depth was reached at the beginning of September. Summer in 1999 was warm and dry (August, average air
temperature ⫽ 7.8⬚C, Tmin ⫽ 0.6⬚C, Tmax ⫽ 23⬚C,
precipitation ⫽ 11.1 mm), while the same period in 2000
was characterized by lower temperature (average ⫽
5.5⬚C, Tmin ⫽ 2.5⬚C, Tmax ⫽ 10.5⬚C) and higher precipitation (20 mm). For both measurement periods, high
evapotranspiration favored by continuous and strong
winds was presumed.
Redox Regime
Pronounced differences in soil moisture characteristics depending on topography were coupled with regular
patterns of redox conditions (Fig. 4). Permanently submerged microlows showed strongly reducing conditions
without an intrapedon redox gradient (topsoil approxi-
79
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
FIEDLER ET AL.: ELEMENT REDISTRIBUTION ALONG TWO GRADIENTS
1005
Fig. 3. Permafrost and water table of the low-center Polygon 1 (measurement period ⫽ 6 June to 1 Sept. 1999).
mately ⫺50 mV, just above the permafrost table approximately ⫺90 mV). Microhighs were distinguished into an
oxidative layer at a depth of 5 cm below surface (approximately 300–400 mV) and a reductive layer near the
permafrost (approximately 180–0 mV) (⫽ intrapedon
upward gradient of EH). Abrupt EH changes could be
observed from microlows to microhighs (⫽ interpedon
gradient of EH). These changes were only registered in
the upper soil zone (5 cm). Measurements near the
permafrost table indicated uniform reducing conditions
in all microtopographical units. The slope had a transient position and was dominated by higher EH fluctuations than other positions (Fig. 4c).
The redox conditions must be regarded as a result
Fig. 4. Relationship between topography and redox regime. The oxidation-reduction values distribution in form of box plots (see legend) (a)
Polygon 1 and (c) Polygon 2. Cross section through studied low-center polygons with morphological units and installation depths (points
filled in black) of the lower electrodes (directly above the permafrost table), (b) Polygon 1 (day of installation 28 June 1999), (d) Polygon
2 (day of installation 30 July 2000).
80
Methane Cycle in Permafrost Ecosystems
1006
4 Permafrost Ecosystems and Microbial Processes
SOIL SCI. SOC. AM. J., VOL. 68, MAY–JUNE 2004
of microbial processes, which can be demonstrated by
methane dynamics. Under anoxic conditions, as in the
polygon center and permafrost boundary of the polygon
rim, C decomposition in the course of microbial methane formation by strictly anaerobic organisms (methanogenic archaea) dominates. Within overlying oxic horizons so-called methane-oxidizing bacteria use the energy
of transforming CH4 to CO2. The relationship between
redox potential and involved microbial processes gives
reason for methane fluxes in the Lena Delta being
largely dependent on topographic position (Kutzbach
2000; Wagner et al., 2003). The latter authors noticed
higher methane emission from the polygon center
(25–75 mg CH4 d⫺1 m⫺2) than from the rim (up to 6 mg
CH4 d⫺1 m⫺2). While descriptive reports of EH from permafrost soil studies are numerous (Bleich and Stahr,
1978), EH measurements within cryogenic soils are rare.
Limited information is available on EH measurements
over a longer period than a couple of hours (Clark and
Ping, 1997). However, single measurements of other
studies have shown similar trends. Beyer et al. (1995)
registered EH values (after 12 h of installation) between
600 mV (topsoil) and approximatley 200 mV (18 cm
below surface) in two Histosols within Antarctica.
Mueller (1997) indicated that, at the slope of a comparably wet polygon in the Lena Delta, EH values were
approximately 130 mV in the zone near the permafrost
table (immediately after installation). The oxidation–
reduction potential data presented here tended to be
lower than those in both of the latter studies, which
can easily be explained by the different measurement
durations. It is well known that single EH measurements
can lead to false conclusions (Böttcher and Strebel,
1988). In this study, high daily fluctuations (⌬EH ⫽ 200
mV) as well as the synchronous decrease of EH (polygon
center near the permafrost table 200 → ⫺100 mV) were
observed in the first 5 d after installation followed by
relatively constant values.
Soil Properties and Element Distribution
All soils exhibited typical properties of alluvial soils
(in this case, fluvial ⬎⬎ aeolian sedimentation): (i) high
amounts of sand and silt, (ii) noticeable changes in texture and (iii) irregular C contents from one horizon to
another (Table 1). The two polygons showed a high
spatial variability of C content, which has been documented by numerous studies in polar regions (Brown,
1967; Beyer et al., 2000; Bockheim et al., 2003). Carbon/N
ratios of rim horizons ranged from 14 to 16 (PG2) and
from 21 to 24 (PG1). Values of center horizons ranged
from 24 to 25 (PG2) and from 35 to 42 (PG1). Higher
ratios of the anoxic center profiles coincided with a
higher C accumulation (PG1 ⫽ 17 kg SOC m⫺2) compared with oxic rim profiles (11 kg SOC m⫺2).
Investigated polygons were nutrient-limited (input ⬍⬍
biorecycling) and adhere to findings of Alexander and
Schell (1973) and Haag (1974) in Alaska and Canada.
The contents of plant available P only amounted to half
of the content in soils investigated by Mueller (1997) in
the same area. The storage of Pcal ranged between 5 g m⫺2
(microhighs) and 2.4 g m⫺2 (microlows) in this study.
Potatssium contents were comparable in both studies.
In general, K stock was higher on microhighs (22 g m⫺2)
compared with the microlows (15 g m⫺2). Low temperature and insufficiency of N (Nt ranged from 0.2 to 6 g
kg⫺1, Table 1) and P (P ranged from 2 to 30 mg kg⫺1)
led to restricted production of phytomass. According to
Kutzbach (2000), phytomass amounted to 1100 ⫾ 40 g m⫺2
(dry mass) in the center and 420 ⫾ 50 g m⫺2 on the
polygon rim. Development of dense root systems is characteristic for tundra vegetation and indicates adaptation
to a restricted nutrient supply and saturated/reducing
conditions (McCown, 1978).
Total Mn and Fe within the active layer ranged from
208 to 920 mg Mn kg⫺1 and 17 to 30 g Fe kg⫺1 soil in
the rim of PG1 vs. 320 to 430 mg Mn kg⫺1 and 17 to
27 g Fe kg⫺1 of PG2; values in the center of PG1 ranged
from 225 to 400 mg Mn kg⫺1 and 14 to 19 g Fe kg⫺1
compared with 215 to 321 mg Mn kg⫺1 and 16 to 18 g
Fe kg⫺1 in PG2 (Table 1). A parallel trend of Mnt as
well as Fet and dithionite-extractable Mn and Fe (Mnd,
Fed) was recognized. Manganese and Fe accumulated
above the water table, in unsaturated well-drained horizons, which can be inferred by higher values of Fed and
Mnd (10.7 g Fe kg⫺1, 443 mg Mn kg⫺1 in Bjjg1, PG1)
(Table 1). In contrast, Mnt, Fet, and Mnd, Fed was lowest
in the very poorly drained active layer at the polygon
center (3.7 g Fed kg⫺1, ⬍50 mg Mnd kg⫺1 in Bg, PG1).
Along the microrelief, a stepwise decline of the portion
of organic-bound Fe and Mn within A and O horizons
from the center (PG1, Fep/Mnp 苲 0.4 g kg⫺1/63 mg kg⫺1)
to the slope (Fep/Mnp 苲 0.7 g kg⫺1/150 mg kg⫺1) to the
rim (Fep/Mnp 苲 2 g kg⫺1/200 mg kg⫺1) was observed.
Additionally, with exception of the Typic Aquiturbel
at the rim of PG2, a weak element enrichment in the
permafrost fringe occurred (PG1, polygon center, Bg ⫽
15.2 vs. Bf ⫽ 19.7 g Fet kg⫺1).
All soils contained redoximorphic features corresponding to element distribution reflected by distinct
redox states. Soils on the rim were hydromorphic with
brownish, Mn- and Fe-enriched horizons above bluegreyish Fe-impoverished subsoil horizons close to the
permafrost table. The Dpd test indicated oxic conditions
over great depths (PG1/PG2, 32/33cm below surface).
In polygon center soils, the typical blue-greyish color
(2.5Y 4/4) indicated reducing conditions just below the
surface (PG1/PG2, 26/22cm below surface) (Table 1).
Mechanisms of Element (Matter) Redistribution
Downward-Translocation
Element redistribution via solid soil phase was observed only within microhighs. These geomorphic units
were characterized by twisted and mixed soil horizons
(Turbel, Fig. 1). Cryoturbation plays an important role
in mixing surface organic matter into the subsoil (Bockheim and Tarnocai, 1998; Bockheim et al., 1999, 2003).
Based on radiocarbon dating (Mueller, 1997), the maximum age of buried organic matter at a 1-m depth was
dated between 1530 and 1570 yr. It can be assumed that
81
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
1007
FIEDLER ET AL.: ELEMENT REDISTRIBUTION ALONG TWO GRADIENTS
Table 1. Selected soil properties of the study sites.†
Texture
Horizon‡
Depth
Polygon
Ajj
Oe1
Oe2
Bf1
Bf2
Bf3
Bf4
Polygon
Oi
Ajj
Oi
Bg
Oef
Dpd
Db
Sand
Silt
Clay
pH
SOC
Nt
Pt
Fet
g kg⫺1
CaCl2
g kg⫺1
Polygon 1 (location: 72ⴗ22.2ⴕN, 126ⴗ28.5ⴕE
rim Gleyi-Turbic Cryosol§/Typic Aquiturbel¶ (altitude ⫽ 12.7 m above mean sea level)
0–8
2.5YR 3/2
0.91
770
164
66
5.6
19
0.9 0.53
17.5
⫺15
2.5YR 3/2
1.20
705
234
61
6.3
16
0.7 0.52
16.8
⫺18
2.5YR 3/2
1.21
596
302
102
6.2
22
1.0 0.63
30.0
⫺24
10YR 3/1
1.22
457
412
132
5.4
34
1.4 0.62
23.4
⫺28
10YR 3/1
1.24
527
362
110
5.4
20
0.8 0.56
21.9
⫺32
10YR 3/1
§⫹
1.3
784
143
73
5.3
4
0.2 0.47
22.5
⫺46
10YR 3/1
#⫹
1.35
436
428
136
5.5
23
1.0 0.62
21.1
⫺90
10YR 3/1
6.0
30
1.5 0.60 22.5
slope Gleyi-Turbic Cryosol§/Typic Aquiturbel¶ (altitude ⫽ 12.6 m above mean sea level)
0–10
0.7
n.d.
n.d.
n.d.
n.d.
236
4.2 0.66
15.6
⫺21
10YR 2/2
0.93
n.d.
n.d.
n.d.
5.3
12
2.9 0.51
15.8
⫺27
2.5Y 4/4
1.14
871
88
410
6.2
12
0.6 0.46
15.3
⫺38
10YR 3/2
#⫹
1.00
673
255
72
4.9
25
0.8 0.54
19.2
⫺44
2.5Y 4/4
#⫹
1.3
946
330
21
5.6
4
0.2 0.42
14.2
⫺80
10YR 3/2
705
228
67
4.6
23
0.6 0.51 18.3
center Gleyi-Histic Cryosol†/Typic Historthel‡ (altitude ⫽ 12.3 m above mean sea level)
0–11
0.4
n.d.
n.d.
n.d.
5.0
221
5.1 0.65
14.2
⫺26
10YR 2/2
#⫹
0.6
n.d.
n.d.
n.d.
4.8
126
3.6 0.60
19.8
⫺31
2.5Y 4/4
#⫹
0.82
859
100
41
4.8
21
0.2 0.45
15.2
⫺64
10YR 3/2
635
297
68
5.1
42
1.4 0.54 19.7
Polygon 2 (72ⴗ22.22ⴕN, 126ⴗ28.54ⴕE)
rim Gleyi-Turbic Cryosol§/Typic Aquiturbel¶ (altitude ⫽ 12.7 m above mean sea level)
0–8
10YR 3/1
1.20
833
129
38
6.0
25
1.5 0.55
17.4
⫺11
10YR 3/1
1.2
777
176
47
5.7
20
1.3 0.56
18.9
⫺19
10YR 2/2
1.34
772
202
27
4.4
14
0.9 0.50
18.2
⫺22
5Y 3/1
1.3
742
199
59
4.3
19
1.3 0.55
18.9
⫺33
5Y 4/1
††⫹
1.26
664
255
81
4.9
19
1.3 0.59
23.2
⫺49
5Y 4/1
††⫹
1.3
310
589
101
5.3
22
1.5 0.63
26.9
⫺66
5Y 4/1
††⫹
458
407 135
6.2
32
2.0 0.58 21.2
center Gleyi-Histic Cryosol†/Typic Historthel‡ (altitude ⫽ 12.5 m above mean sea level)
0–14
0.3
n.d.
n.d.
n.d.
4.7
216
6.4 0.67
20.3
⫺22
7.5YR 2/0 ††⫹
0.9
793
166
41
4.5
45
1.8 0.50
17.7
⫺27
10YR 2/1
††⫹
1.1
858
96
46
4.5
19
0.8 0.40
13.4
⫺31
7.5YR 3/0 ††⫹
0.80
310
589
101
4.5
30
1.2 0.47
15.9
⫺57
10YR 3/1 ††⫹
0.96
691
241
68
4.4
30
1.3 0.55 18.6
cm
Polygon
Ajj1
Ajj2
Bjjg1
Bjjg2
Bjjg3
Bjjg4
Bjjg5
Bjjf
Polygon
Oi
A
B(jj)g1
B(jj)g2
B(jj)g3
B(jj)f
Polygon
Oi
A
Bg
Bf
MC
Fed
Feo
Fep
Mnt
g cm⫺3
Mnd
Mnp
mg kg⫺1
4.2
4.4
10.7
6.0
5.3
10.2
3.2
3.7
1.3
1.2
5.6
3.4
2.9
1.3
1.5
2.0
0.5
0.3
1.0
1.4
1.1
0.2
0.9
1.0
326
324
920
295
306
208
252
265
122
152
443
67
67
⬍50
⬍50
⬍50
69
56
75
26
46
15
16
41
1.1
4.2
3.4
12.4
3.2
5.3
2.2
1.4
1.0
1.6
1.1
2.0
0.9
0.6
0.3
1.2
0.2
2.1
338
326
310
305
216
237
170
110
118
150
⬍50
⬍50
180
115
66
76
⬍15
38
1.8
5.0
3.7
6.0
2.7
1.9
1.4
3.4
1.6
2.7
1.0
1.6
400
325
225
317
280
133
⬍50
119
272
126
⬍15
75
4.6
4.2
4.8
5.2
5.8
8.6
2.7
1.2
1.8
2.9
2.8
4.6
5.6
1.7
0.3
0.5
1.2
1.3
1.4
1.7
0.7
329
354
319
379
428
383
623
114
139
87
129
155
126
290
50.2
50.6
72.6
128
107
105
323
8.1
4.8
3.1
3.3
4.6
5.7
2.6
1.4
1.9
3.0
2.1
1.5
0.7
0.8
1.2
919
321
215
234
230
603
97
37
19
18
187
118
41.1
32.3
20
† MC ⫽ matrix color; Dpd ⫽ ␣-␣-Dipyridil-test (⫹) ⫽ positive, day of description; Db ⫽ bulk density; Feo ⫽ ammonium oxalate extractable iron; Fep,
Mnp ⫽ pyrophosphate extractable iron and manganese; n.d. ⫽ not determined; italic letters ⫽ horizons in the range of permafrost.
‡ Horizon nomenclature according to Soil Survey Staff (1999).
§ Soil classification according to ISSA-ISRIC-FAO (1998).
¶ Soil classification according to Soil Survey Staff (1999).
# 22 Aug. 1999.
†† 19 Aug. 2000.
buried and twisted organic layers (Fig. 1) which now
are parts of the perennial frozen layer were once close
to the surface. Cryoturbation of organic and mineral
material into the subsoils results in a relative enrichment
of elements and organic matter (Fig. 5a). The sedimentation layers within the polygon center were not deformed, which was indicated by their horizontal orientation (Orthel).
A weak element enrichment at the permafrost fringe
was recorded in all geomorphic units. This suggested a
downward migration of ions (solutional phase) via gravitation to the contact with the frozen ground (Fig. 5b).
Lundin and Johnsson (1994) also found a similar movement of mass flow by thermal gradients during the snowmelt. Boike (1997) and Boike et al. (1998) found up to
9% of liquid water in permafrost (⫺12⬚C) on the Taymyr
Peninsula (Siberia). Overduin and Young (1997) explained the element enrichment by cumulative effect of
solute exclusion over a repeated freeze–thaw cycles,
and to the accumulation of solutes through convective
transport of soil water to the freezing front due to ice
lens formation.
82
Upward-Translocation
The lateral upward-translocation of water-soluble elements in continental climates was described by Arndt
and Richardson (1989), and was generalized by Sommer
and Schlichting (1997). This translocation process affecting the entire catena was restricted to a very flat relief.
The driving factor was the upward gradient of the water
potential between microlows and microhighs. This gradient occurred during summer and was principally caused
by higher evapotranspiration from soils of the microhighs (higher surface/volume ratio) compared with soils
of the microlows. In addition, vegetation on microhighs
acts as a large water pump resulting in a lowering of
the water table (Richardson et al., 2001). Furthermore,
it can be assumed the gradient was additionally supported by higher proportions of fine macro- and mesopores at the rim (PG1, in a depth of 28 cm ⫽ 37%)
compared with the polygon center (in a depth of 31 cm ⫽
20%) (Kutzbach, 2000). When soils are dry the matrix
potential increases and the soil water moves via capillary
transporting solutes (Richardson et al., 2001). The latter
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
1008
SOIL SCI. SOC. AM. J., VOL. 68, MAY–JUNE 2004
Fig. 5. Model of different kinds of element redistribution within low-center polygons.
process can be reconstructed using the contents of K.
Potassium can easily be leached in soils with poor clay
contents, because its bondage to organic matter is negligible (Schachtschabel et al., 1998). Consequently, water
soluble K can migrate along water potentials resulting
in a higher K storage in microhighs (PG1, polygon rim,
22 g m⫺2) than in the microlows (15 g m⫺2). The results
are supported by many other studies, which focused on
the upward-translocation of salts (Kellog, 1934; Douglas
and Tedrow, 1960; Whittig and Janitzky, 1963; Wiegand
et al., 1966; MacLean and Pawluck, 1975; Hallsworth et
al., 1982) and gypsum (Steinwand and Richardson, 1989)
within very flat geomorphic units.
Parallel to K, an upward-translocation of redox-sensitive elements (Mn, Fe) was also recorded. Migration of
these elements is coupled to changes in valence caused
by electron transfer. Thus, redox (and hydraulic) gradiTable 2. Absolute mass based on active layer (g m2) of soils studied.†
Pt
PG1,
320
PG1,
212
PG1,
101
PG2,
360
PG2,
101
Fet
Fed
Feo
Fep
Mnt
Mnd
polygon rim Gleyi-Turbic Cryosol‡/Typic Aquiturbel§
11 730
2 896
1 146
435
179
46
polygon slope Gleyi-Turbic Cryosol‡/Typic Aquiturbel§
6 967
2 355
630
296
128
47
polygon center Gleyi-Histic Cryosol‡/Typic Historthel§
3 032
682
341
355
56
24
polygon rim Gleyi-Turbic Cryosol‡/Typic Aquiturbel§
13 850
3 905
2 408
774
232
78
polygon center Gleyi-Histic Cryosol‡/Typic Historthel§
3 373
960
564
258
81
35
Mnp
20
37
23
56
20
† Pt, Fet, Mnt ⫽ total phosphorus, iron, manganese; Fed, Mnd ⫽ dithionite
citrate bicarbonate extractable iron and manganese, Feo ⫽ ammonium
oxalate extractable iron; Fep, Mnp ⫽ pyrophosphate extractable iron
and manganese.
‡ Soil classification according to ISSA-ISRIC-FAO (1998).
§ Soil classification according to Soil Survey Staff (1999).
ents control the element redistribution within low-centered polygons. Continuous redox measurements demonstrated strong redox gradients, which lead to an
upward element transport along these gradients. After
element mobilization in the reducing center and, subsequent, upward transport along EH gradients via capillary
rise, immobilization processes occurred in the oxic microhighs. The latter can be explained by an abrupt
change in the redox environment (Fig. 4). Consequently,
in both polygons, a higher absolute element mass was
calculated in the well-drained microhighs (PG1 rim/
slope; Fet ⫽ 11.7/7 kg m⫺2, Fed ⫽ 2.9/2.3 kg m⫺2, Feo ⫽
1.1/0.6 kg m⫺2) compared with the microlows (Fet ⫽ 3
kg m⫺2, Fed ⫽ 0.7 kg m⫺2, Feo ⫽ 0.3 kg m⫺2, Table 2).
On the contrary, the liquid phase of the center profiles
was characterized by higher Mn and Fe concentrations
than that of the rim profiles (approximately 4 mg Mn
L⫺1 soil solution, approximately 2.9 mg Fe L⫺1, vs. approximately 1.2 mg Mn L⫺1, and 0.2 mg Fe L⫺1, Table 3).
The Fe accumulation at the polygon rim was visible in
as continuous Fe-band, which regularly followed the
buckling surface (Fig. 1). This element accumulation
due to upward migration from bottom of the drainage
way to a slightly higher elevation along the adjacent slope
was referred to in the literature as edge effect (Steinwand
and Richardson, 1989; Sommer and Schlichting, 1997).
Similar research (Everett and Parkinson, 1977; Everett
and Brown, 1982) described an upward Fe translocation
along a microcatena (Cryaquept–Cryofibrist) of Alaskan tundra soils. Researchers observed an Fe accumulation solely in microhighs and explained this phenomenon by Fe flux via groundwater combined with a redox
83
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
1009
FIEDLER ET AL.: ELEMENT REDISTRIBUTION ALONG TWO GRADIENTS
Table 3. Characterization of soil solution (Polygon 1[PG1]).
Sampling date
7 July 1999
Position
Rim
Rim
Rim
Center
Center
Depth
cm
14
27
36
9
15
Fe
n.d.†
0.09
0.20
n.d.
4.27
Mn
n.d.
0.13
0.63
n.d.
4.89
14 July 1999
21 July 1999
7 Aug. 2000
14 Aug. 2000
21 Aug. 2000
Fe
Fe
Fe
Mn
Fe
Mn
Fe
Mn
0.06
1.98
2.74
1.35
2.65
0.07
0.11
0.41
10.43
0.49
0.05
1.61
3.07
8.24
2.59
0.08
0.19
0.54
0.36
0.43
0.07
1.66
2.81
9.74
2.65
0.12
0.10
0.27
0.33
0.41
Mn
0.20
0.67
1.51
4.28
2.24
n.d.
0.14
0.38
n.d.
0.71
Mn
mg L⫺1
n.d.
0.08
0.79
0.09
1.92
0.42
n.d.
1.71
2.16
0.57
† not determined.
gradient (oxic conditions in microhighs, anoxic conditions in microlows).
Soil P exists in forms of organic P, the fixed mineral
P, and orthophosphate (ortho-P). Fixed mineral form
of ortho-P is bound to Al and Fe oxides/hydroxides
(Gunary et al., 1965). The transformation of fixed mineral P into soluble ortho-P is controlled by redox processes (Vepraskas and Faulkner, 2001). As a consequence of reducing conditions in the polygon center, P
bound to Fe was mobilized, transported, and immobilized in microhighs. Thus, Fe as well as P storage was
higher in microhighs (PG1, 11.7 kg Fet m⫺2, 320 mg Pt
m⫺2) than in microlows (PG1, 3 kg Fet m⫺2, 101 mg Pt
m⫺2) (Table 2).
In addition to the interpedon (center to rim, Fig. 5d),
an intrahorizon/pedon upward-translocation (Fig. 5c) was
assumed. Distribution of pedogenetic oxides at the polygon rims are typical for gleyzation processes (Schlichting,
1973) and are in agreement with observed EH gradients.
The transmission zone of an oxic/anoxic environment,
verified by the use of Dpd, was characterized by enrichment of Mn and Fe (Table 1).
More frequent than upward transport of the liquid
phase, the ionic migration during refreezing of the active
layer in autumn (Fig. 5e) was described in literature
(Chuvilin et al., 1998a, 1998b). Controlling factors of
this mechanism are temperature gradients (Hinkel and
Outcalt, 1994) that promote upward moisture and ionic
transfers. As a result of decreasing air temperature in
autumn, the heat flux is directly outward, cooling the
active layer from above. A downward-moving freezing
front evolves, which is delayed by increases in soil water
contents or by water transport to the freezing front
(Boike, 1997). Consequently, the polygon rim with
lower water content and latent heat initially freezes
somewhat faster than the water saturated polygon center. Thus, an upward water and ionic transport from the
saturated center to the frozen polygon rim via unfrozen
water films is enforced.
tion as well as liquid phase translocation, accompanied
by element redistribution, is a result of the complex
interplay of thermal, hydraulic, and redox gradients.
The strongly varying soil-climatic conditions within the
microrelief of polygons determine the direction of gradient (downward vs. upward). Importance of the different
transport processes could not be differentiated.
Element redistribution along redox gradients, a phenomenon of which scarce information is provided in
literature, was examined. Topography was closely linked
to hydrology and the oxidation–reduction environment.
Within the microrelief, each unit corresponded via solution fluxes with other units. This linkage was a fundamental part of the catena concept, based on the principles
of mobilization, transport and immobilization (Sommer
and Schlichting, 1997). Based on saturated/reducing conditions, soils in depressions were deemed as mobilization
areas. Element transport was due to (hydro)geochemical gradients. Immobilization of elements was caused
by drastic changes in environmental conditions (anaerobic to aerobic milieu). For future research, this upward
transport should be validated using radioactive labeled
elements. Although the presented study adds to the
understanding of element redistribution processes in
arctic soils, it does not imply these soils have been sufficiently investigated. All relevant factors of redistribution should be correlated, depending on seasonal and
annual range of the permafrost table. This presupposes
a long-term investigation to monitor climate, water balance, redox conditions and element migration.
ACKNOWLEDGMENTS
CONCLUSIONS
The authors thank M. Sommer, H. Jungkunst, and P.P.
Overduin for helpful comments and critical review of the
manuscript as well as Susanne Kopelke for technical assistance. Furthermore, the authors thank the Alfred Wegener
Institute for Polar and Marine Research for organization, logistic and financial support of the expeditions ‘Lena 1999’ and
‘Lena 2000’. The research was partly financed by the German
Ministry of Science and Technology (System Laptev-See
2000, 03G0534G).
Low-centered polygons are one kind of a typical form
of pattern ground in the arctic tundra, which can be divided
topographically into microhighs (rims and slopes of the
polygon) and microlows (polygon center). The controlling factors of their formation are cryogenetic processes
reflected by twisted and mixed soil horizons within elevated parts of the relief. This solid soil phase transloca-
Akhmadeeva, I., H. Becker, K. Friedrich, D. Wagner, E.-M. Pfeiffer,
W. Quass, M. Zhurbenko, and E. Zöller. 1999. Investigation site
‘Samoylov’. p. 19–21. In V. Rachold (ed.) Expeditions in Siberia
in 1998. Rep. on Polar Res. 315. Alfred-Wegener-Institut, Bremerhaven, Germany.
Alexander, V., and D.M. Schell. 1973. Seasonal and spatial variation
84
REFERENCES
The original version of the professorial dissertation contains on pp. 85 - 95 the
article:
Wagner D., Kobabe S., Pfeiffer E.-M. and Hubberten H.-W. (2003a) Microbial
controls on methane fluxes from a polygonal tundra of the Lena Delta, Siberia.
Permafrost and Periglacial Processes 14, 173-185.
Published online in Wiley InterScience (http://www.interscience.wiley.com).
DOI: 10.1002/ppp.443
[http://dx.doi.org/10.1002/ppp.443]
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Environmental Microbiology (2007) 9(1), 107–117
doi:10.1111/j.1462-2920.2006.01120.x
4.3
1
Abundance,
distribution and potential activity of
methane oxidizing bacteria in permafrost soils from
the Lena Delta, Siberia
Susanne Liebner* and Dirk Wagner
Alfred Wegener Institute for Polar and Marine Research,
Research Department Potsdam, Telegrafenberg A43,
14473 Potsdam, Germany.
Summary
The methane oxidation potential of active layer profiles of permafrost soils from the Lena Delta, Siberia,
was studied with regard to its respond to temperature, and abundance and distribution of type I and
type II methanotrophs. Our results indicate vertical
shifts within the optimal methane oxidation temperature and within the distribution of type I and type II
methanotrophs. In the upper active layer, maximum
methane oxidation potentials were detected at 21°C.
Deep active layer zones that are constantly exposed
to temperatures below 2°C showed a maximum
potential to oxidize methane at 4°C. Our results indicate a dominance of psychrophilic methanotrophs
close to the permafrost table. Type I methanotrophs
dominated throughout the active layer profiles but
their number strongly fluctuated with depth. In contrast, type II methanotrophs were constantly abundant through the whole active layer and displaced
type I methanotrophs close to the permafrost table.
No correlation between in situ temperatures and the
distribution of type I and type II methanotrophs was
found. However, the distribution of type I and type II
methanotrophs correlated significantly with in situ
methane concentrations. Beside vertical fluctuations,
the abundance of methane oxidizers also fluctuated
according to different geomorphic units. Similar
methanotroph cell counts were detected in samples
of a flood plain and a polygon rim, whereas cell
counts in samples of a polygon centre were up to 100
times lower.
Received 3 May, 2006; accepted 11 July, 2006. *For correspondence.
E-mail [email protected]; Tel. (+49) 331 288 2200; Fax
(+49) 331 288 2137.
Introduction
The Arctic is of major interest in the context of global
climatic change for two reasons. First, one-third of the
global carbon pool is stored in northern latitudes (Post
et al., 1982), mainly in huge layers of frozen ground,
termed permafrost, which cover around 24% of the
exposed land area of the Northern Hemisphere (Zhang
et al., 1999). Second, the Arctic is observed to warm more
rapidly and to a greater extent than the rest of the earth
surface (IPCC, 2001). Serreze and colleagues (2000)
refer to evidence of increased plant growth and northward
migration of the tree line and conclude that permafrost
has warmed in Alaska and Russia.
Northern wetlands such as the Lena Delta in north-east
Siberia are significant natural sources of methane
(Friborg et al., 2003; Smith et al., 2004; Corradi et al.,
2005). As a consequence of the harsh winter climate,
decomposition processes in northern wetlands are
inhibited leading to an accumulation of organic matter.
The organic matter is partly decomposed under watersaturated, anaerobic conditions during the short summer
period. The terminal step in the anaerobic decomposition
of organic matter is the microbial formation of methane
(methanogenesis). Several studies estimated the
methane source strength of northern wetlands, including
tundra, to range from 17 to 42 Tg CH4 year-1 (Whalen and
Reeburgh, 1992; Cao et al., 1996; Joabsson and Christensen, 2001; Wagner et al., 2003). This corresponds to
about 25% of the methane release from natural sources
(Fung et al., 1991).
Global warming could thaw 25% of the permafrost area
by 2100 (Anisimov et al., 1999), exposing huge amounts
of currently fixed organic carbon to aerobic as well as
anaerobic decomposition processes. Also, higher temperatures are likely to reinforce methanogenesis and
therefore increase the methane source strength of Arctic
wetlands (Wuebbles and Hayhoe, 2002). Additional
methane would have a positive feedback on the atmospheric warming process because methane is both on a
mass and a molecule level 23 times more effective as a
greenhouse gas than CO2 (IPCC, 2001).
The biological oxidation of methane by methane oxidizing (methanotrophic) bacteria, which belong to the
© 2006 The Authors
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
96
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
2 S. Liebner and D. Wagner
0
10
20
Rimt1
Rimt2
Centret1
Centret2
Floodplain
30
40
0
2
4
6
8
10
12
14
16
18
Temperature [°C]
0
10
20
30
40
Rim
Centre
Floodplain
50
Results
a
50
Depth [cm]
a- (type II methanotrophs) and g- (type I methanotrophs)
Proteobacteria, is the major sink for methane in terrestrial
habitats. Between 43% and 90% of the methane produced in the soil is oxidized before reaching the atmosphere (Roslev and King, 1996; Le Mer and Roger, 2001).
Hence, it is crucial to investigate methanotrophic communities and their response to global change in particular in
climatic sensitive regions like the Lena Delta.
Our study determines abundance and distribution of
methanotrophic bacteria within morphologically characteristic sites on Samoylov Island. Samoylov Island is located
in the central part of the Lena Delta and is representative
for the polygonal tundra, which is typical for the patterned
ground of permafrost. We will also give insights into how
the extreme environmental conditions of Siberian permafrost influence potential methane oxidation rates. Particularly, the temperature response of potential methane
oxidation rates in soils from the Lena Delta was investigated as temperature is the most extreme parameter in
permafrost soils and it is known that low temperatures
induce processes of microbial adaptation and specialization (Georlette et al., 2004).
50
100
600
800
b
1000
CH4 concentration [nmol g-1 (dw)]
Soil characteristics
The microrelief of the polygonal tundra, which results from
annual freezing and thawing processes, determines steep
environmental gradients in particular within the active
layer (seasonally thawed layer) of permafrost. Three sites
were investigated in this study: a polygon rim, a polygon
centre and a flood plain soil. Temperature and methane
gradients through the active layer profiles of the three
sampling sites were determined during the sampling
periods and are shown in Fig. 1. In the uppermost 5 cm
mean temperature values reached up to 5–12°C in the
polygon rim and centre, and 18°C in the flood plain. In all
profiles, temperatures decreased rapidly to almost 0°C in
25–40 cm depth close to the permafrost table. Temperatures in the uppermost soil layers fluctuated at greater
amplitude than in layers close to the permafrost table,
where they remained constantly around 0°C.
The methane concentration profiles of the polygon rim
and the flood plain showed a steep gradient between the
upper and the deeper active layer. Within both profiles,
methane concentrations increased rapidly from around
50 nmol g-1 (dw) in the uppermost 18 cm to 140–
180 nmol g-1 (dw) close to the permafrost table. Compared with the flood plain and the polygon rim, the
methane concentrations in the polygon centre were up to
10 times higher and did not show a vertical gradient.
Additional soil properties of the three sites are summarized in Table 1. The organic carbon content did not
Fig. 1. Vertical profiles of (a) in situ temperatures and (b) in situ
methane concentrations in the active layer of a polygon rim, a
polygon centre and a flood plain soil on Samoylov Island, Lena
Delta. Temperatures represent mean values (n = 3) measured
around noon (11 AM to 1 PM) on 21st July (t1) and 2nd August 2005
(t2) (polygon rim and polygon centre) and on 22nd July 2002
(flood plain). Methane concentrations represent mean values
(n = 3) of active layer cores sampled around noon on 22nd July
2005 (polygon rim and polygon centre) and on 22nd July 2002
(flood plain).
exceed 3.0% and 3.1%, respectively, in the polygon rim
and the flood plain but reached up to 16.1% in the polygon
centre. In contrast to the polygon rim, which was dominated by sandy material, the flood plain mainly consisted
of silty material. The grain size fraction of the polygon
centre could not be determined due to its high content of
organic soil matter.
Cell numbers
Total and methanotroph cell counts were determined for
all sites. Additionally, cell counts of Bacteria were determined for the polygon rim and the polygon centre. All cell
numbers are shown in Fig. 2. Cell counts of Bacteria and
methanotrophs relative to total cell counts (TCC) are summarized in Table 2.
Within the upper active layer profiles (0–10 cm), TCC
were highest in the polygon rim [20.1 ¥ 108 cells g-1 (dw)].
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
97
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Oxidizing bacteria from the Lena Delta, Siberia 3
Table 1. Selected soil properties of a polygon rim, a polygon centre and a flood plain soil on Samoylov Island, Lena Delta.
Grain size fraction (%)
Depth
(cm)
H2O content
(%)
Rim
0–6
6–11
11–18
18–25
25–32
32–38
Centre
0–5
5–10
10–15
15–20
20–25
25–30
Flood plain
0–5
5–9
9–18
18–35
35–40
40–52
Corg
(%)
N
(%)
Clay
Silt
Sand
26.2
15.7
24.1
24.8
25.2
16.6
3.0
2.1
2.3
2.0
1.2
2.8
0.2
0.1
0.1
0.1
0.0
0.1
2.4
2.3
1.7
10.0
3.0
0.5
10.6
9.1
17.5
45.7
11.1
21.5
87.0
88.5
80.7
44.3
85.9
78.1
85.7
77.3
80.6
73.4
58.9
68.5
15.5
15.1
16.1
7.3
2.2
4.7
0.7
0.4
0.4
0.2
0.2
0.2
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
–a
30.1
31.9
28.3
35.4
32.4
31.8
3.1
1.1
2.2
2.8
2.4
1.7
0.4
0.2
0.3
0.4
0.3
0.2
11.1
20.2
18.3
20.2
20.4
17.6
64.8
61.4
63.5
62.7
55.6
67.7
24.2
18.4
18.2
17.1
24.0
14.7
a. Was not determined due to the high content of organic soil matter.
Total cell counts were in the same range in the polygon
centre and in the flood plain [3.7 ¥ 108, respectively,
5.1 ¥ 108 cells g-1 (dw)]. Close to the permafrost table,
TCC were similar in all sites and ranged between
1.7 ¥ 108 cells g-1 (dw) in the polygon rim and 0.2 ¥ 108
cells g-1 (dw) in the polygon centre.
Cell numbers detected with probe EUB338, which identified members of the domain Bacteria, were 5–10 times
Table 2. Ratio of type I to type II methanotrophs and cell counts of
Bacteria and methanotrophs relative to TCC of a polygon rim, a
polygon centre and a flood plain soil on Samoylov Island, Lena Delta.
0
10
20
Relative to TCC (%)
(mean ⫾ SD)
30
40
Depth [cm]
50
a
0
0
8
5x10
1x10
9
9
2x10
2x10
9
10
20
30
40
50
b
0
0
8
8
8
4x10
2x10
8
6x10
8x10
10
20
30
Rim
Centre
Flood Plain
40
50
0
7
2x10
7
4x10
7
6x10
7
8x10
c
8
1x10
-1
Cell counts [cells g (dw)]
Fig. 2. (a) Total, (b) Bacteria and (c) methanotroph cell counts of a
polygon rim, a polygon centre and a flood plain soil on Samoylov
Island, Lena Delta.
Depth
(cm)
Rim
0–6
6–11
11–18
18–25
25–32
32–38
Centre
0–5
5–10
10–15
15–20
20–25
25–30
Flood plain
0–5
5–9
9–18
18–35
35–40
40–52
Ratio
Type I/Type II
MOBa (%)
Bacteria
MOBa
56.9/43.1
88.5/11.5
60.3/39.7
95.6/4.4
50.0/50.0
⬍ d.l./100.0
30.5 ⫾ 7.3
58.1 ⫾ 4.5
55.9 ⫾ 9.6
72.4 ⫾ 18.5
56.2 ⫾ 2.1
37.2 ⫾ 8.5
1.2 ⫾ 0.2
12.7 ⫾ 1.2
11.0 ⫾ 5.0
17.3 ⫾ 2.9
14.6 ⫾ 3.5
1.7 ⫾ 1.1
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
49.3 ⫾ 8.6
72.3 ⫾ 2.9
38.5 ⫾ 1.4
14.9 ⫾ 1.6
16.2 ⫾ 3.7
57.3 ⫾ 10.7
0.2 ⫾ 0.1
1.9 ⫾ 0.8
0.5 ⫾ 0.3
0.2 ⫾ 0.1
1.4 ⫾ 0.3
0.7 ⫾ 0.5
93.7/6.3
69.5/30.5
64.5/35.5
84.9/15.1
38.3/61.7
25.8/74.2
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
a. Methane oxidizing bacteria.
n.d., not determined.
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
98
16.1 ⫾ 3.8
6.4 ⫾ 1.1
9.3 ⫾ 2.3
10.8 ⫾ 2.6
12.1 ⫾ 2.7
9.5 ⫾ 4.7
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
4 S. Liebner and D. Wagner
Distribution of type I and type II methanotrophs
The vertical distribution of type I and type II methanotrophs was determined for the polygon rim and the flood
plain soil (Fig. 3). Within both profiles, type I methanotrophs dominated through the active layer but their
abundance strongly fluctuated with depth. Type II methanotrophs were less abundant than type I methanotrophs
and their cell numbers fluctuated less with depth. Type II
methanotrophs displaced type I methanotrophs close to
the permafrost table. The relative abundance of type I and
type II to total methanotroph cells (Table 2) resulted in a
significant sigmoidal correlation (Boltzmann model) with
the methane concentrations in situ for both profiles (rim:
r 2 = 0.993, c2 = 28.99, n = 6; flood plain: r 2 = 0.819,
c2 = 26.98, n = 6). A correlation between distribution of
type I and type II methanotrophs and in situ temperatures
could not be detected.
Potential methane oxidation rates
Incubation experiments (based on 14CH4) were carried out
at 0, 4, 12, 21, 28 and 38°C with soil slurries of the
polygon rim and the polygon centre. Another incubation
experiment (based on the linear regression of CH4 in the
headspace determined by gas chromatography) was
carried out with soil slurries of the flood plain at 0, 4, 12
and 21°C.
The potential to oxidize methane at different incubation
temperatures was similar in samples of the polygon rim
and the flood plain soil. Maximum rates of around
50 nmol g-1 (dw) day-1 were detected in samples of both
sites. There was a clear shift of the temperature optimum
from 21°C in upper active layer zones to 4°C in deeper
active layer zones in both profiles (Fig. 4). In samples of
0
10
20
30
40
Depth [cm]
higher in the polygon rim than in the polygon centre. They
varied between 6.1 ¥ 108 (0 and 6 cm) and 0.7 ¥ 108 cells
g-1 (dw) (32–38 cm) in the polygon rim and between
1.8 ¥ 108 (0 and 5 cm) and 0.1 ¥ 108 cells g-1 (dw) (25–
30 cm) in the polygon centre. Hence, their contribution to
TCC was 30.5–72.4% at the polygon rim and 14.9–72.3%
at the polygon centre.
Methanotroph cell counts were highest in the polygon
rim where they ranged between 1.0 ¥ 108 (6 and 11 cm)
and 3.0 ¥ 106 cells g-1 (dw) (32–38 cm). Methanotroph
cell counts in the polygon rim accounted for 1.7–17.3% to
the TCC. Methanotroph cell counts of the polygon centre
were two orders of magnitude lower than in the polygon
rim and in the flood plain and accounted for only 0.2% to
at most 1.9% to TCC. In the flood plain, cell counts of
methanotrophs varied between 5.0 ¥ 107 (0 and 5 cm)
and 8.0 ¥ 106 cells g-1 (dw) (40–52 cm) and accounted for
6.4–16.1% to TCC.
Permafrost table
50
0
7
7
7
a
7
2x10 4x10 6x10 8x10 1x10
8
0
10
20
30
Type I MOB
Type II MOB
40
50
0
2x10
7
4x10
7
b
7
6x10
-1
Cell counts [g (dw)]
Fig. 3. Vertical distribution of type I and type II methanotrophic
bacteria through the active layer of (a) a polygon rim and (b) a
flood plain soil on Samoylov Island, Lena Delta.
the polygon rim and the flood plain, the potential methane
oxidation rates per gram dry weight of deep soil layers at
4°C were similar to those of upper layers at 21°C. Based
on the cell counts determined by fluorescence in situ
hybridization (FISH) and on the potential oxidation rates
measured at various incubation temperatures, the potential methane oxidation rates per methanotroph cell and
day were calculated. At 4°C the potential methane oxidation rates per methanotroph cell detected near the permafrost table exceeded cell activities in the other horizons by
one order of magnitude (Fig. 4). Independently of the
temperature, cell activities increased by 50–150% compared with upper soil layers at 25 cm in the polygon
rim and at 40 cm in the flood plain. Lowest rates
[⬍ 23 nmol g-1 (dw) d-1] through the active layer profiles
were detected at 0°C at both sites and at 38°C in samples
of the polygon rim (Fig. 4). Soil horizons with the highest
abundance of methanotrophs did not show any temperature response (polygon rim: 6–11 cm and 18–25 cm; flood
plain: 5–40 cm). In these horizons the methane oxidation
potential did not change significantly at the different incubation temperatures. The methane oxidizing potential
through the entire active layer of the polygon centre was
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
99
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Oxidizing bacteria from the Lena Delta, Siberia 5
CH4 oxidation rate [nmol cell-1 d-1]
0
2x10-6
0
4x10-6
0
6x10-6
2x10-6
4x10-6
6x10-6
38°C
28°C
10
20
30
a
40
0
10
20
30
40
50
0
60
b
0
10
20
30
40
50
60
21°C
12°C
c
d
4°C
0°C
e
f
21°C
12°C
g
h
4°C
0°C
10
20
30
40
Depth [cm]
0
10
20
30
40
0
10
20
30
40
50
60
0
10
20
30
40
50
60
j
i
0
10
20
30
40
50
60
0
10
20
30
40
50
60
CH4 oxidation rate [nmol g-1 (dw) d-1]
Fig. 4. Potential methane oxidation rates at different incubation temperatures of soil slurries of (a–f) a polygon rim (0–38°C) and (g–j) a flood
plain soil (0–21°C) on Samoylov Island, Lena Delta.
about two orders of magnitude lower than in samples of
the rim and the flood plain (data not shown).
Discussion
Soil ecosystems of the Siberian Arctic are characterized
by small-scale variations both within the microrelief of the
polygonal tundra and within vertical profiles of the active
layer. Within the active layer, temperature is the most
extreme environmental factor with a distinct gradient from
the surface to the permafrost table.
At different sites examined in this study, the potential to
oxidize methane of soil horizons close to the permafrost
table was greatest at 4°C. The methane oxidation potentials per methanotroph cell near the permafrost table was
significantly higher compared with both the cell activities
near the surface at the same temperature (4°C) but also
compared with cell activities in the same depth at different
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
100
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
Oxidizing bacteria from the Lena Delta, Siberia 7
a more efficient carbon assimilation of type I methanotrophs (Hanson and Hanson, 1996). Several studies investigated differences in substrate affinities of type I and type
II methanotrophs but so far the results do not consistently
show one or the other group to clearly prefer either highor low-substrate concentrations. According to studies on
rice field soils, type I methanotrophs seem to out-compete
type II at very low in situ methane concentrations
(Henckel et al., 2000) and type II methanotrophs are
strongly related to soil porewater methane concentrations (Macalady et al., 2002), which indicates a higher
substrate affinity of type I compared with type II
methanotrophs. Other studies (Horz et al., 2002; Knief
and Dunfield, 2005; Knief et al., 2006) show members of
the type II group as the most oligotrophic methanotrophs.
They suggest that type II methanotrophs might be responsible for atmospheric methane consumption. According to
our results based on methane concentrations higher than
atmospheric but lower than in high-affinity environments,
type I methanotrophs dominate in particular in the upper
active layer. A dominance of type I methanotrophs in
active layers of Siberian permafrost soils from the Lena
Delta was already suggested by Wagner and colleagues
(2005) who used marker fatty acid analysis to distinguish
between type I and type II methanotrophs.
Differences between the methanotrophic communities
could not only be shown with respect to active layer depth
but also with respect to different geomorphic units.
Polygon rim and flood plain seem to provide favourable
conditions for methane oxidizing bacteria. Cell counts
between 107 and 108 per gram dry soil even exceed cell
counts of methanotrophs in temperate soils located in
Europe by at least one order of magnitude (Horz et al.,
2002; Eller et al., 2004). We have to consider, though, that
cell counts in these studies were obtained by the most
probable number and not by direct cell counting. The
highest activity of methanotrophs in the flood plain soil
compared with the other two sites studied could result
from its high proportion of silt and clay material. The
surface area and the amount of negative charges determine the sorptive activity for microorganisms and nutrients (Stotzky, 1966; Heijnen et al., 1992). Hence, clay and
silt support availability and uptake of substrates.
Significant cell numbers of methanotrophs were
detected in deep soil layers that are, according to Fiedler
and colleagues (2004), exposed to reduced in situ
conditions. This is consistent with methane oxidation
potentials observed under in situ conditions near the permanently frozen ground of a polygon rim also located on
Samoylov Island (Wagner et al., 2005). Methane oxidation
can occur under microaerophilic (Bodegom et al., 2001)
and oxygen-limiting conditions (Roslev and King, 1996).
Besides, root exoderms can provide oxygen in deep
active layer zones and can therefore prevent methano-
trophs from oxygen deprivation. Hence, methanotrophs in
deep and reduced soil layers should be equally accounted
for in models on methane fluxes.
In contrast to polygon rim and flood plain soil, potential
oxidation rates and cell counts indicate unfavourable
conditions for the methanotrophic community within the
polygon centre despite significantly higher methane
concentrations. A hampered process of methane oxidation in the polygon centres is in accordance with significantly higher methane emission rates from the centre of
ice-wedge polygons compared with the rim (Wagner et al.,
2003; Kutzbach et al., 2004). The unfavourable conditions
for methanotrophs in the polygon centre may result from
constant water saturation supplemented by a lack of
oxygen input.
Conclusions and prospects
We could show that abundance, distribution and ecophysiology of methane oxidizing bacteria in permafrost
affected soils from the Lena Delta are determined by
microrelief as well as environmental gradients within the
active layer. Because the microbial methane oxidation is
an essential part of models on methane emissions from
wetlands (Walter and Heimann, 2000), these models
should consider small-scale variations within the methanotrophic community as observed in our study. However,
until now, methane oxidation rates in these models are
based on general parameters like Michaelis–Menten
kinetics (Km) and Q10-values but differences in substrate
affinities and enzyme kinetics of methanotrophs as well as
spatial fluctuations of their cell numbers are not
considered. Although our study gives a first insight into the
importance of these small-scale variations within the
active layer, further studies are needed to supply reliable
input data for modelling of methane fluxes.
In addition to abundance and distribution, changes
within the methanotrophic community composition need
to be studied. Cavigelli and Robertson (2001) suggested
influences of the change of the microbial community composition on the function of a terrestrial ecosystem in the
context of denitrification. It is likely that shifts within the
methane oxidizing community composition will affect its
function as a sink for methane as the group of methane
oxidizers forms the physiologically ‘narrowest’ group of all
trace gas processors. This allows for a clear demonstration of ecosystem-level influences (Schimel and Gulledge,
1998).
Finally, we should aim at understanding the stability of
the methanotrophic community in soils from the Lena
Delta in the context of global change. For this purpose it is
necessary to extend the usage of molecular tools and to
combine our data with an analysis of the diversity of the
seasonally active methanotrophic ‘keyplayers’.
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
101
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
8 S. Liebner and D. Wagner
Experimental procedure
Fixation of cells for hybridization
Study site and soil properties
2
With an area of about 32 000 km the Lena Delta is the
second largest delta in the world (Are and Reimnitz, 2000).
It is located in the zone of continuous permafrost and
characterized by arctic continental climate with a mean
annual air temperature of -11.9°C over the 2001–2003
period and a mean precipitation during the same period of
about 233 mm (measured by the Russian weather station
Stolb Island). Our study site is located in the youngest
and presently most active part of the delta on Samoylov
Island (N 72°22, E 126°28). Detailed descriptions of the
geomorphology of Samoylov Island and the whole delta
were given previously by Schwamborn and colleagues
(2002). Samoylov Island covers an area of only 1200 ha
with the highest elevation at 12 m above sea level. The
island is dominated by the typical permafrost pattern of lowcentred ice-wedge polygons covering at least 70% of the
island area. The soils in the Lena Delta are entirely frozen
for at least 8 months every year leaving only a shallow
active layer of about 20–50 cm unfrozen during the summer
months.
Expeditions to Samoylov Island were carried out in
summers 2002 and 2005 in the frame of the Russian-German
cooperation ‘System Laptev Sea 2000’. Samoylov was
defined with respect to different characteristic geomorphic
units. Exemplarily, a polygon rim, a polygon centre and a
flood plain soil were chosen for sampling. We defined our
sampling sites according to soil horizons following Schoeneberger and colleagues (2002). These soil horizons are
characterized according to soil genesis, physical and chemical parameters. Given that bacteria are associated with
mineral and organic soil particles (Christensen et al., 1999), it
is reasonable to assign microbial communities to soil
horizons. It is noteworthy that cryoturbation, a common phenomenon in permafrost affected soils hampering a static view
on active layer profiles, is negligible through all our studied
profiles.
The two profiles at the rim and at the centre of a lowcentred polygon were located in the eastern part of the island.
The distance between these two profiles was approximately
7 m and the difference in elevation between the rim and the
depressed centre was approximately 0.4 m. At the time of
sampling (July 2005) the standing water level was in a depth
of approximately 38 cm at the rim and at approximately
10 cm above the surface of the polygon centre. The permafrost table was in a depth of 38 cm at the polygon rim and in
a depth of 30 cm at the polygon centre. The third profile was
located on a flood plain in the northern part of the island. At
this location, annual flooding leads to a continuing accumulation of fluvial sediments. At the time of sampling (July 2002)
the permafrost table was in a depth of 54 cm. Soil samples
were taken horizontally stepwise, stored in Nalgene boxes,
frozen immediately after sampling and transported to
Germany for further processing. In situ methane concentrations and temperatures were determined in the field according to Wagner and colleagues (2005). Additional soil
characteristics (grain size fraction, content of organic carbon,
nitrogen and water) were analysed according to Schlichting
and colleagues (1995).
Fresh soil samples of each horizon were fixed according to
Pernthaler and colleagues (2001). Subsamples (0.5 ml) were
fixed with 1.5 ml freshly prepared 4% paraformaldehyde/
phosphate-buffered saline (PBS) solution (pH 7.2–7.4) for
4–5 h at 4°C. Fixed samples were diluted with 0.1% sodium
pyrophosphate in distilled water to obtain 100–300 cells
(total) per microscopic field of view (63 ¥ 100 objective). The
dilution was treated with mild sonication using an MS73
probe (Sonoplus HD70; Bandelin, Berlin, Germany) at a
setting of 20 s to separate cells from soil particles. As a result
of the comparatively much higher background fluorescence
of soil particles observed after hybridization on membrane
filters (own observations) the dispersed soil samples were
spotted on gelatine-coated Teflon-laminated slides (Zarda
et al., 1997) with 10 wells. Replicates of 10 ml of fixed and
dispersed soil sample and 2 ml of 0.2% sodium dodecyl
sulfate (SDS) were dropped onto each well resulting in full
coverage of the well. Slides were dried at 45°C for 15 min and
dehydrated in 50%, 80% and 96% ethanol.
Fluorescence in situ hybridization (FISH) and DAPI
staining
The FISH method was used directly in soil samples because
extraction of bacterial cells from soil is difficult to perform due
to the exclusion of bacteria associated with soil particles
(Christensen et al., 1999).
All oligonucleotide probes used in this study were purchased from Interactiva (Ulm, Germany). They were all
labelled with the cyanine dye Cy3. Probes for the domain
Bacteria and the families Methylococcaceae (type I methanotrophs) and Methylocystaceae (type II methanotrophs) were
used. Probe names, details and references are summarized
in Table 3. For in situ hybridization, a 10 ml aliquot of hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl; pH 8.0, 0.02%
SDS), formamide in concentrations according to Table 3, and
30 ng ml-1 of probe were dropped onto each well. The slides
were transferred to an equilibrated 50 ml polypropylene top
tube and incubated at 46°C for 120 min. Slides were then
washed at 48°C for 10 min in washing buffer (20 mM TrisHCl; pH 8.0, 5 mM EDTA, 0.01% SDS w/v and 225 mM NaCl
according to a formamide concentration of 20% in the hybridization buffer). Afterwards they were washed in ice-cold
double distilled water for a few seconds and quickly dried in
an air stream. Subsequently, 10 ml of 4′6-Diaminodino-2phenylindole (DAPI, 1 mg ml-1 working solution) was dropped
onto each well and incubated in the dark at room temperature
for 10–15 min. Slides were then washed in ice-cold doubledistilled water and allowed to air-dry. Finally, slides were
embedded in Citiflour AF1 antifadent (Plano; Wetzlar,
Germany) and covered with a coverslip.
Determination of cell counts
Microscopy was carried out with a Zeiss Axioskop 2 equipped
with filters 02 (DAPI), 10 (FLUOS, DTAF) and 20 (Cy3), a
mercury-arc lamp and an AxioCam digital camera. The counting was done manually. For each hybridization approach and
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
102
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Oxidizing bacteria from the Lena Delta, Siberia 9
Table 3. rRNA-targeted oligonucleotide probes used for FISH.
Probe
Target group
Target sitea
FAb (%)
Reference
EUB338
EUB338 II
EUB338 III
NON338
Ma450
Mg705
Mg84
Domain Bacteria
Domain Bacteria
Domain Bacteria
Control probe complementary to EUB338
Type II MOBc
Type I MOBc
Type I MOBc
16S
16S
16S
16S
16S
16S
16S
0–50
0–50
0–50
n.d.
20
20
20
Amann and colleagues (1990)
Daims and colleagues (1999)
Daims and colleagues (1999)
Wallner and colleagues (1993)
Eller and colleagues (2001)
Eller and colleagues (2001)
Eller and colleagues (2001)
rRNA (338)
rRNA (338)
rRNA (338)
rRNA
rRNA (450)
rRNA (705)
rRNA (84)
a. Escherichia coli numbering.
b. Percentage (v/v) of formamide in the hybridization buffer.
c. Methane oxidizing bacteria.
n.d., not determined.
sample at least 800 DAPI stained cells were counted on 30
randomly chosen counting squares. Microscopy was carried
out using 63 ¥ 100 magnification giving an area of
3.9204 ¥ 10-2 mm2 per counting square. Using FISH, only
cells with a sufficient number of ribosomes are detected
(Amann et al., 1995). The number of these cells was calculated by counting probe-specific positive signals relatively to
DAPI counts. Counting results were always corrected by
subtracting signals obtained with the probe NON338. Unspecific cell counts were in the range of 3.53 ¥ 105-2.7 ¥ 106
cells g-1 (dw). For calculating the number of cells per cubic
centimetre of slurry (bacterial counts per volume, BCv), the
mean count of bacteria per counting area (B), the microscope
factor (area of sample spot/area of counting field, M), the
dilution factor (D) and the volume of the fixed sample used for
hybridization (V) were determined and arranged in the
equation:
BCv = B M D V -1
(1)
Finally, the bacterial counts per millilitre of slurry were
converted into cells per gram of soil (dw) according to the
equation:
BCw = BCv (1 + WC/100) D
(2)
where BCw are the cells per gram of soil (dw), WC is the water
content of the slurries and D is the density of the dried soil.
Potential methane oxidation rates
The methane oxidation rates of the polygon rim and the
polygon centre were determined in incubations without headspace via the conversion of 14CH4–14CO2 modified according
to Iversen and Blackburn (1981). Before the tracer experiment, thoroughly homogenized subsamples (160 g) of each
soil horizon were mixed with autoclaved tap water at the ratio
of 1:1 (w/v) and incubated in 1 l glass bottles at 4°C with 3%
CH4. The slurries were shaken continuously at 120 rpm and
CH4 concentrations were determined daily using gas
chromatography. Subsequent radiotracer analysis was compared according to incubations with and without headspace.
Incubations without headspace: three replicates per slurry
and temperature were distributed to 5 ml Hungate tubes and
sealed with butyl-rubber stoppers and screw caps leaving no
gas bubbles inside the tube. Anaerobically stored 14CH4 tracer
(Fa. Amersham) was injected. Replicates were incubated at
six different temperatures, namely 0, 4, 12, 21, 28 and 38°C,
for 13 h at methane concentrations between 50 and
1200 nmol g-1(dw) according to the methane concentrations
determined in situ. Incubations with headspace: three replicates per slurry were distributed to 16 ml Hungate tubes
leaving 3 ml of headspace and 14CH4 tracer was injected.
Replicates were incubated for 72 h to allow sufficient tracer to
dissolve into the sample. Near surface samples were incubated at 21°C and near permafrost samples were incubated
at 4°C, because previous tests had shown that maximum
activities were detected at these temperatures at the according depths. Methane oxidation rates (MOR) were calculated
as nanomoles of CH4 oxidized per gram dry weight (dw) and
day according to the equation:
MOR = [CH4] a/(A t)
(3)
where [CH4] is the sediment concentration of methane in
nmol cm-3 dry volume (dv), a are the counts recovered as
14
CO2, A are the counts recovered as (remaining) 14CH4 and
t is the incubation time (days). Rates are based on three
replicates and were corrected according to five blanks for
each temperature running the same analysis. The potential
methane oxidation rates in incubations without headspace
were comparable to those in incubations with headspace
(data not shown) so that we could exclude possible oxygen
deficits limiting the process of methane oxidation in incubations without headspace.
The potential methane oxidation of the flood plain profile
was determined by gas chromatography with the aid of difluoromethane (CH2F2) inhibiting the process of methane oxidation (Krueger et al., 2002). Thoroughly homogenized
subsamples (30 g per horizon) were divided into three replicates, filled into sterile serum bottles (120 ml), mixed with
autoclaved tap water at the ratio of 1:1 (w/w) and vortexed for
20 s. The slurries were incubated over night at 0, 4, 12 and
21°C. The supernatant was decanted and the bottles were
closed with a screw cap containing a septum. Subsequently,
methane concentrations between 50 and 200 nmol g-1 (dw)
were adjusted according to the methane concentrations
determined in situ and the samples were again incubated at
the accordant temperature. The methane concentration in the
headspace was determined twice per day for a period of
6 days. Afterwards, the bottles were evacuated and again
incubated as described but additionally with CH2F2
(8000 ppm). Gas analysis was carried out as described
below. Potential methane oxidation rates were calculated
from the linear regression of methane concentrations in the
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
103
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
10 S. Liebner and D. Wagner
headspace taking into account methane production rates in
samples incubated with CH2F2.
MOR = -MORwith_inhibitor + MORwithout_inhibitor
(4).
Gas analysis
Gas analysis was carried out with a gas chromatograph
(Agilent 6890, Fa. Agilent Technologies) equipped with a Carbonplot capillary column (Ø 0.53 mm, 30 m length) and a
flame ionization detector (FID). Oven as well as injector temperature was 45°C. The temperature of the detector was
250°C. Helium served as carrier gas.
Acknowledgements
The authors acknowledge T. Treude and I. Müller (Max Planck
Institute for Marine Microbiology) for introducing us into the
radiotracer experiment as well as J. Harder (Max Planck
Institute for Marine Microbiology) for helpful discussions and
H. Lantuit, T. Sachs and C. Wille (Alfred Wegener Institute for
Polar and Marine Research) for critical reading of the manuscript. Also, we want to thank the crew of the Expedition LENA
2005, in particular Waldemar Schneider for logistic and Günter
‘Molo’ Stoof for technical support (both Alfred Wegener Institute for Polar and Marine Research). Finally, we thank all our
Russian partners, in particular Dimitry Yu. Bolshiyanov (Arctic
Antarctic Research Institute), Alexander Yu. Dereviagin
(Moscow State University), Mikhail N. Grigoriev (Permafrost
Institute Yakutsk), Dmitri V. Melnitschenko (Hydro Base Tiksi)
and Alexander Yu. Gukov (Lena Delta Reserve).
References
Amann, R., Binder, B.J., Olson, R.J., Chisholm, S.W.,
Devereux, R., and Stahl, D.A. (1990) Combination of 16S
rRNA-targeted oligonucleotide probes with flow cytometry
for analyzing mixed microbial populations. Appl Environ
Microbiol 56: 1919–1925.
Amann, R., Ludwig, W., and Schleifer, K.H. (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. FEMS Microbiol Rev 59: 143–
169.
Anisimov, O.A., Nelson, F.E., and Pavlov, A.V. (1999) Predictive scenarios of permafrost development under conditions of global climate change in the XXI century. Earth
Cryology 3: 15–25.
Are, F., and Reimnitz, E. (2000) An overview of the Lena
River Delta settings: geology, tectonics, geomorphology,
and hydrology. J Coastal Res 16: 1083–1093.
Bodegom, P.V., Stams, F., Mollema, L., Boeke, S., and Leffelaar, P. (2001) Methane oxidation and the competition for
oxygen in the rice rhizosphere. Appl Environ Microbiol 67:
3586–3597.
Cao, M., Marshall, S., and Gregson, K. (1996) Global carbon
exchange and methane emission from natural wetlands:
application of a process-based model. J Geophys Res 101:
14399–14414.
Cavicchioli, R. (2006) Cold-adapted archaea. Nature 4: 331–
343.
Cavigelli, M.A., and Robertson, G.P. (2001) Role of denitrifier
diversity in rates of nitrous oxide consumption in a terrestrial ecosystem. Soil Biology Biochem 33: 297–310.
Christensen, T.R., Jonasson, S., Havstroem, M., and Livens,
F.R. (1999) Carbon cycling and methane exchange in
Estuarine tundra ecosystems. AMBIO 28: 239–244.
Corradi, C., Kolle, O., Walter, K., Zimov, S.A., and Schulze,
E.D. (2005) Carbon dioxide and methane exchange of a
north-east Siberian tussock tundra. Global Change Biology
11: 1–16.
Daims, H., Bruehl, A., Amann, R., Schleifer, K.H., and
Wagner, M. (1999) The domain specific probe EUB338 is
insufficient for the detection of all Bacteria, development
and evaluation of a more comprehensive probe set. Syst
Appl Microbiol 22: 434–444.
Davidson, E.A., Janssens, I.A., and Luo, Y. (2006) On the
variability of respiration in terrestrial ecosystems: moving
beyond Q10. Global Change Biology 12: 154–164.
Eller, G., Stubner, S., and Frenzel, P. (2001) Group-specific
16 rRNA targeted probes for detection of type I and type II
methanotrophs by fluorescence in situ hybridisation. FEMS
Microbiol Lett 198: 91–97.
Eller, G., Krüger, M., and Frenzel, P. (2004) Comparing field
and microcosm experiments: a case study on methanoand methylotrophic bacteria in paddy soil. FEMS Microbiol
Ecol 51: 279–291.
Fiedler, S., Wagner, D., Kutzbach, L., and Pfeiffer, E.M.
(2004) Element redistribution along hydraulic and Redox
gradients of low-centred polygons, Lena Delta, Northern
Siberia. Soil Sci Soc Am 68: 1002–1011.
Friborg, T., Soegaard, H., Christensen, T.R., Lloyd, C.R., and
Panikov, N. (2003) Siberian wetlands: where a sink is a
source. Geophys Res Lett 30: 2129.
Fung, I., John, J., Lerner, J., Matthews, E., Prather, M.,
Steele, L.P., and Fraser, P.J. (1991) Three-dimensional
model synthesis of the global methane cycle. J Geophys
Res 96: 13033–13065.
Georlette, D., Blaise, V., Collins, T., D’Amico, S., Gratia, E.,
Hoyoux, A., et al. (2004) Some like it cold: biocatalysis
at low temperatures. FEMS Microbiol Rev 28: 25–42.
Hanson, R.S., and Hanson, T.E. (1996) Methanotrophic
bacteria. Microbiol Rev 60: 439–471.
Heijnen, C.E., Hok-A-Hin, C.H., and Van Veen, J.A. (1992)
Improvements to the use of bentonite clay as a protective
agent increasing survival levels of bacteria introduced into
soil. Soil Biology Biochem 24: 533–538.
Henckel, T., Roslev, P., and Conrad, R. (2000) Effects of O2
and CH4 on presence and activity of the indigenous methanotrophic community in rice field soil. Environ Microbiol 2:
666–679.
Horz, H.P., Raghubanshi, A.S., Heyer, J., Kammann, C.,
Conrad and Dunfield, P.F. (2002) Activity and community
structure of methane-oxidising bacteria in a wet meadow
soil. FEMS Microbiol Ecol 41: 247–257.
IPCC (2001) Climate Change 2001: The Scientific Basis.
Contribution of Working Group I to the Third Assessment
Report of the Intergovernmental Pand on Climate Change.
Cambridge: Cambridge University Press.
Iversen, N., and Blackburn, H. (1981) Seasonal rates of
methane oxidation in anoxic marine sediments. Appl
Environ Microbiol 41: 1295–1300.
© 2006 The Authors, Environmental Microbiology
Journal compilation © 2006 Society for Applied Microbiology and Blackwell Publishing Ltd
104
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
Global Change Biology, accepted #
4.4
1
Methanogenic activity and biomass in Holocene permafrost deposits of the
Lena Delta, Siberian Arctic and its implication for the global methane
budget
D. WAGNER1*, A. GATTINGER2, A. EMBACHER3, E.-M. PFEIFFER1#, M. SCHLOTER3
AND A. LIPSKI4
1
Alfred Wegener Institute for Polar and Marine Research, Research Department Potsdam, Telegrafenberg A45,
14473 Potsdam, Germany, 2Technical University of Munich, Chair of Soil Ecology, 85758 Oberschleissheim,
3
GSF-National Research Center for Environment and Health, Institute of Soil Ecology, Ingolstädter Landstraße
1, 85764 Neuherberg, Germany, 4University Osnabrueck, Department of Microbiology, 49069 Osnabrück,
Germany
* corresponding author: Dirk Wagner, tel +49 331 288 2159, fax +49 331 288 2137, e-mail
[email protected]
#
present address: Institute of Soil Science, University Hamburg, Allende-Platz 2, 20146 Hamburg
Abstract
Permafrost environments within the Siberian Arctic are natural sources of the climate
relevant trace gas methane. In order to improve our understanding of the present and
future carbon dynamics in high latitudes we studied the methane concentration, the
quantity and quality of organic matter, and the activity and biomass of the methanogenic
community in permafrost deposits. For these investigations a permafrost core of
Holocene age was drilled in the Lena Delta (72°22 N, 126°28 E). The organic carbon of
the permafrost sediments varied between 0.6 and 4.9 % and was characterized by an
increasing humification index with permafrost depth. A high CH4 concentration was
found in the upper 4 m of the deposits, which correlates well with the methanogenic
activity and archaeal biomass (expressed as PLEL concentration). Even the incubation of
core material at –3 °C and –6 °C with and without substrates showed a significant CH4
production (range: 0.04 – 0.78 nmol CH4 h-1 g-1). The results indicated that the methane
in Holocene permafrost deposits of the Lena Delta originated from modern
methanogenesis by cold-adapted methanogenic archaea. Microbial generated methane in
permafrost sediments is so far an underestimated factor for the future climate
development.
Keywords: methane, methanogenesis, psychrophiles, phospholipid biomarker, methane
release, permafrost deposits
Introduction
Northern wetlands play an important role within the global methane cycle. Methane is chemically very
reactive and more efficient in absorbing infrared radiation than carbon dioxide. Estimates of the
methane emissions of arctic and sub-arctic wetlands range between 10 and 39 Tg a-1, or between 2.2
and 8.6 % of the global methane emission (Bartlett & Harriss 1993; Cao et al. 1998). Methane as a
powerful greenhouse gas contributes to about 20 % of the global warming (IPCC, 2001).
Permafrost, which occurs mainly in polar and sub-polar regions, occurs within about 25 % of the
___
# since the submission of the thesis the paper is published in Global Change Biology 13, 1089-1099 (2007)
105
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
land surface (Zhang et al. 1999). It can be divided into three temperature depth zones which
characterize typical living conditions: (i) the active layer with an extreme temperature regime from
about +15°C to –35°C, (ii) the correlated upper permafrost sediments (0.5-20 m thickness) with
smaller seasonal temperature variation of about 0 °C to -15 °C above the zero annual amplitude and
(iii) the deeper permafrost sediments which are characterized by a stable temperature regime of about
–5 °C to –10 °C (French 1996).
A considerable amount of organic carbon is stored in the upper permafrost layers, indicating that
the extreme Arctic climate condition reduces the organic carbon decomposition rate more than the net
primary production rate (Oechel et al. 1997). The positive temperature trend in the Russian Arctic
favours warming and thawing of terrestrial permafrost (Richter-Menge 2006). The degradation of
permafrost and the associated release of climate relevant trace gases, as a consequence of an
intensified turnover of organic carbon and from ancient methane reservoirs, represent a potential risk
with respect to future global warming. At this point, the functioning of microbial communities and
their reaction on changing environmental conditions are not adequately understood, neither the
potential methane releases from frozen sediments are adequately quantified.
In general, temperature is one of the most important variables regulating the activity of
microorganisms. The potential of growth as well as the molecular, physiological and ecological
aspects of microbial life at low temperatures have been investigated in many studies (e.g. Russel &
Hamamoto 1998; Gounot 1999; Cavicchioli 2006). Certain key processes of the methane cycles are
carried out exclusively by highly specialized microorganisms such as methanogenic archaea and
methane oxidizing bacteria. The microbial methane production (methanogenesis) in the active layer of
permafrost is the terminal step during the anaerobic decomposition of organic matter, while the
methane oxidation is the primary sink for methane in Arctic wetlands (Wagner et al. 2005). With
recent findings it becomes evident that methanogenic archaea and methane oxidizing bacteria also
exist in permafrost soils, with numbers comparable to those in moderate soil environments (Kobabe et
al. 2004; Liebner & Wagner 2006).
However, there are only few studies investigating the geochemistry and microbiology of
permafrost deposits, mainly in Siberia and Canada. Direct bacterial counts in the order of 107 to 108
were reported for permafrost deposits from Northeast Siberia (Rivkina et al. 1998). Furthermore, Shi
et al. (1996) found viable bacteria in permafrost sediments up to 3 million years in age in the KolymaIndigirka lowlands. Most of the isolated bacteria showed mesophilic growth characteristics. In
contrast, the minimum temperature for growth of permafrost bacteria was recently calculated with –20
°C (Rivkina et al. 2000). Furthermore, molecular life markers and low numbers of methanogens were
found in the Mallik gas hydrate production research well (Colwell et al. 2005; Mangelsdorf et al.
2005). However, methanogenic activity could not be detected in the permafrost sediments by using
radiolabelled 14C-substrates.
So far there is no proof for recent methanogenic activities in permafrost deposits. The main
objective of this study was to identify the vertical position and quantify the methanogenic activity
along a Holocene permafrost core from the Siberian Lena Delta, and correlate this activity with biotic
and abiotic factors. A polyphasic cultivation-independent approach was used based on geochemical
and microbiological methods to identify the origin of permafrost borne methane. As direct cultivation
of methanogenic archaea from cold environments is limited to only very few species, we used
etherlipids, which are a unique component of the archaeal cell membrane, as biomarkers to quantify
methanogens along the permafrost core.
Material and methods
Investigation area
Within the scope of long-term studies on carbon dynamics in the Siberian Arctic, the LENA 2001
expedition was carried out by the Alfred Wegener Institute for Polar and Marine Research. The Lena
106
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
Delta lies at the Laptev Sea coast between the Taimyr Peninsula and the New Siberian Islands.
Continuous permafrost, which occurs throughout the investigation area extends to depths of about
100-300 m (Yershov 1998). It is characterised by an arctic continental climate with low mean annual
air temperature of -14.7 °C (Tmin = -48 °C, Tmax = 18 °C) and low summer precipitation of < 198 mm.
The study site, Samoylov Island (72°22 N, 126°28 E) with the Russian-German Research Station
Samoylov, is located in the active part of the Lena Delta (Hubberten et al. 2006). This part of the delta
was formed during the Holocene with an age of about 9,300 years BP. Further details of the study site
were described previously by Wagner et al. (2003a).
Permafrost drilling and preparation
During summer 2001 a permafrost core of 850 cm length was drilled in the depression of a lowcentered ice-wedge polygon on Samoylov Island. The drilling was carried out with a portable gasoline
powered permafrost corer without using any drilling fluid to avoid microbiological contamination of
the permafrost samples. A mixing of the permafrost sediments was not be observed due to the frozen
state of the core material. The individual core segments, which were up to 50 cm in length, were
placed immediately after removal from the corer into plastic bags and stored at about –8 °C in the
permafrost cellar of the Research Station Samoylov. After drilling of the core the borehole
temperature was monitored with a string of 9 thermistors. The cores were transported in frozen
conditions in insulated containers with cool packs to Potsdam, Germany. During the transport the
temperatures in the containers were monitored by micro data loggers. The storage temperature in the
Potsdam laboratory was –22 °C.
Core segments were split along their axis into two halves under aseptic conditions with a diamond
saw in an ice laboratory at –22 °C. Afterwards, one half of the core was cleaned with a sterile knife for
lithological and geocryologically descriptions. Subsequently, one half was cut into segments of about
10-30 cm length according the lithology and the geocryology. Small pieces (approx. 10 g) of each subsample were taken for analysing the methane concentration in the frozen sediments. The remaining
material of each sub-sample was thawed at 4 °C and homogenized under anoxic and sterile conditions
for analysis of the sediment properties and the microbial activities and biomarkers. Sub-samples for
the different analyses were filled into sterile plastic Nalgene boxes. Separated samples were used
directly for the experiments (e.g. methane production, biomarker analysis) or were refrozen for later
analyses at –22 °C. The second half of the core is kept as an archive in the ice core storage at the
Alfred Wegener Institute.
Sediment properties
Grain-size distribution was analysed on bulk sediment samples for each segment, on average every 20
cm. The sediments were oxidised using a 5 % H2O2 solution to remove organic matter from each
sample. The gravel (> 2 mm) and sand (0.063–2.0 mm) fractions were determined by wet sieving. The
remaining silt (0.002–0.063) and clay (< 0.002 mm) material were separated by sedimentation in
ammoniac water (10 ml NH3 in 100 l deionised water). From the dry weight of gravel, sand, silt and
clay, the weight percentages of the bulk dry sediment were calculated for each fraction.
Radiocarbon dating was carried out for three selected samples (289, 557 and 843 cm depth) with
the Accelerator Mass Spectrometer (AMS) facility at the Leibniz Laboratory for Radiometric Dating
and Stable Isotope Research, University of Kiel, Germany. Standard calibration techniques (Stuiver et
al. 1998) were used to express the sediment ages in calendar years before the present. A more detailed
description of the equipment and method was given by Nadeau et al. (1997, 1998).
The total carbon (TC) and total nitrogen (TN) contents were determined with an automatic
element analyser (Elementar VARIO EL III). The total organic carbon (TOC) content was measured
on corresponding samples after HCl (10%) acid digestion to remove the carbonate on the same
analyser (Elementar VARIO EL III). Based on TOC and TN values, the C/N ratio was calculated.
Analytical precision is ± 5% for element analyses.
107
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
The humification index, a criterion for organic matter quality, was determined in the water
extractable fraction of organic carbon as described in Wagner et al. (2005). In brief, the obtained
aqueous extracts from frozen soil samples were subjected to optical measurements (UV absorption and
fluorescence emission intensity). Dissolved organic matter differs in fluorescence behaviour in
accordance to its molecular complexity. Humified carbon is characterized by highly substituted
aromatic structures and condensed unsaturated systems. While their fluorescence emission lie in
longer wavelengths, fresh and low humified organic matter fluoresce in the shorter wavelengths
(Senesi et al. 1989). To quantify the humification of dissolved carbon we measured the fluorescence
emission intensity in 1nm steps between 300-480nm with an excitation wavelength of 254nm (Cary
Eclipse F-4500, Varian®). Summarized intensities between 435-480 nm (upper quartile of the whole
spectrum recording emission of more humified carbon) were divided by summarized intensities
between 300-345 nm (lower quartile of the whole spectrum recording emission of less humified
carbon), resulting in an dimensionless humification index (Zsolnay 2003). The higher the humification
index, the more the organic carbon in the samples is humified. All extracts were adjusted to pH 2 since
pH influences the fluorescence of organic molecules in solution (Zsolnay et al. 1999).
Vertical profiles of sediment CH4 concentrations were obtained from each segment by extracting
CH4 from sediment pore water by thaw small frozen core material (approx. 10 g) in saturated NaCl
solution. The samples were then placed in glass jars and sealed gas tight with black rubber stoppers.
The thawed samples were shaken and the CH4 headspace concentration was analysed with gas
chromatography.
CH4 production
The CH4 production of permafrost sediments were analysed for each segment without any additional
methanogenic substrate, or with acetate, and hydrogen as an energy source. Fresh sediments (20 g)
were weighed in 100-ml glass jars and closed with a screw cap containing a septum. The samples were
evacuated and flushed with ultra pure N2. Afterwards the samples were supplemented with 6 ml sterile
and anoxic tap water for analysing methane production without substrate addition. In the case of
potential CH4 production 6 ml of acetate solution (10 mM) or sterile and anoxic tap water in
combination with H2/CO2 (80:20 v/v, pressurized 150 kPA) were added as substrates. Three replicates
were used for each segment. The incubation temperature was 5 °C. CH4 production was measured
daily over a period of one week by sampling the headspace using a Hamilton gastight syringe. CH4
production rates were calculated from the linear increase in CH4 concentration.
Methane production at sub-zero temperature
The CH4 production at sub-zero temperatures was analysed in samples from the upper part of the
permafrost core (45-63 cm depth). The homogenized material (10 g) was directly weighed in 25-ml
glass jars and closed with a screw cap containing a septum. The further preparation of the samples
followed the description to the potential methane production activity. The prepared soil samples were
incubated at –3 °C and –6 °C for 14 and 21 days, respectively.
Methane analysis
Gas analysis were performed with an Agilent 6890 gas chromatograph equipped with a Carbonplot
capillary column (Ø 0.52 mm, 30 m) and a flame ionization detector (FID). Helium was used as the
carrier gas. The injector, oven and detector temperatures were set at 45 °C, 45 °C and 250 °C,
respectively. All gas sample analyses in the various experiments were done after calibration of the gas
chromatograph with standard gases. After calibration the analytical reproducibility is > 98.5%. Details
of CH4 analysis were described previously in Wagner et al. (2003b).
Determination of phospholipids fatty acids (PLFA) and phospholipids etherlipids (PLEL)
Lipids were extracted from the freshly homogenized material from selected segments using an
equivalent of about 30 g of dry weight, according to the Bligh-Dyer method (Zelles & Bai 1993). The
108
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
resulting lipid material was fractionated into neutral lipids, glycolipids and phospholipids on a silicabonded phase column (SPE-SI; Bond Elute, Analytical Chem International, CA, USA) by elution with
chloroform, acetone and methanol, respectively. An aliquot of the phospholipid fraction equivalent to
10 g soil dry weight (dw) was taken for phospholipid fatty acid (PLFA) analysis. After mild alkaline
hydrolysis, the lipid extract was separated into OH-substituted ester-linked PLFA, non-OH substituted
ester-linked PLFA and non saponifiable lipids following procedures described in Zelles & Bai (1993).
The fraction of unsubstituted ester-linked PLFA was reduced to dryness under nitrogen and dissolved
in 100 µl hexane supplemented with nonadecanoic methyl ester as internal standard. The analyses of
the fatty acid methyl ester (FAME) extracts were performed by GC-MS as described in Lipski &
Altendorf (1997). The position of double bonds of monounsaturated fatty acids was determined by
analysing the dimethyl disulfide (DMDS) adducts (Nichols et al. 1986). The fraction of nonsaponifiable lipids was cleaved during acidic alkaline hydrolysis and the resulting non-ester-linked
PLFA were separated into OH-substituted non-ester-linked PLFA (UNOH) and non-OH substituted
non-ester-linked PLFA (UNSFA). Separation of the non-ester-linked PLFA, derivatization and
measurement were performed according to Gattinger et al. (2002). Another aliquot of the phospholipid
fraction equivalent to 20.0 g soil dw was used for phospholipid etherlipid (PLEL) analysis according
to the method described by Gattinger et al. (2003). After the formation of ether core lipids, etherlinked isoprenoids were released following cleavage of ether bonds with HI and reductive
dehalogenation with Zn in glacial acetic acid. The resulting isoprenoid hydrocarbons were dissolved in
100 µl internal standard solution (nonadecanoic methyl ester) and subjected to GC/MS analysis at
operating conditions described elsewhere (Gattinger et. al. 2003). PLFA/PLEL concentrations are
expressed in nmol g-1 dry weight (dw).
Statistical analysis
Statistical analyses such as descriptive statistics and analysis of variance (ANOVA) were performed
with SPSS software package release 12.0 (SPSS Inc., Chicago, USA). The Kolmogorov-Smirnow test
was used to assess distribution fitting. The definition of the four core units was based on the results of
a Constrained Incremental Sum of Squares (CONISS) cluster analysis of the grain size data (using
ZONE software version 1.2).
Results
Abiotic characteristics of the permafrost sediments
On basis of the grain size distribution and the subsequent CONISS analyses the permafrost core was
separated into four units (I – IV). The further description of the results and the later discussion
followed this classification.
The grain size analyses showed that gravel continuously decreased from the top to the bottom of
the core (4.9 – 0.2 %). For the three other fractions (sand, silt and clay) a clear change between the
different units was recognized. The average value of the sand fraction is highest in the Units II and IV
(U-I = 48.2 %, U-II = 62.3 %, U-III = 42.6 %, U-IV = 68.2 %), while the highest values for silt (U-I =
36.4 %, U-II = 28.7 %, U-III = 44.7 %, U-IV = 24.9 %) and clay (U-I = 10.5 %, U-II = 7.6 %, U-III =
11.8 %, U-IV = 6.7 %) were determined in the Units I and III (Fig. 1a). A steep temperature gradient
was observed in the permafrost core, which ranged between +10 °C (near surface) and -11.5 °C at 800
cm depth. The median values were -1.9, -9.4, -12.8 and -11.5 °C, for Units I to IV, respectively (Fig.
1b). The total organic carbon content (TOC) followed a depth gradient with median values between
4.2 and 1.3 % for Units I to IV, respectively, but with significant variations within the vertical profile
(Fig. 1c). A depth-dependent relationship can also be seen from the humification index (HIX) and the
C/N ratio. The HIX and C/N ratio are both descriptors for organic matter quality. The lowest HIX
values were found in Unit I (on average 5.1) which corresponded with the highest C/N ratios (23.0).
109
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
HIX was highest in unit IV (on average 9.4) in accordance to a relatively low C/N ratio of 15.7 (Fig.
1d, 1e).
a
b
c
d
e
0
unit I
100
200
depth [cm]
300
2330 ± 25
unit II
8824 ± 179
unit III
400
500
600
gravel
sand
silt
clay
700
800
0
20
unit IV
9334 ± 101
40
60
80
100 -15 -10 -5
0
5
10
0
1
texture [%]
2
3
4
5
6
0
3
TOC [%]
temperature [°C]
temperature [°C]
TOC [%]
6
9
12
0
HIX
10
20
30
C/N ratio
Fig. 1 Abiotic parameters of the Holocene permafrost deposits from Samoylov Island, Lena Delta (Siberian
Arctic). (a) sediment texture, (b) bore hole temperature and calendar years of selected sediment layers, (c) total
organic carbon content (TOC), (d) humification index (HIX, dimensionless) and (e) C N ratio. Calendar years
(BP) of selected sediment layers are denoted in graph (b). Unit I to IV based on CONISS (constrained
incremental sum of squares) analysis of the different grain size fractions.
Methane concentrations and potential methanogenic activities
Methane was detected in all samples of the permafrost core. Highest concentrations were observed in
Units I (281.5 nmol g-1) and II (236.1 nmol g-1). In Unit III, low values, ranging between 3.5 and 19.1
nmol g-1 were detected, while only traces in the bottom zone of the core were found (0.4 – 1.9 nmol
g-1; Fig. 2a).
a
b
d
c
0
unit I
100
200
unit II
depth [cm]
300
400
500
unit III
600
700
unit IV
800
0
150
300
0,00
0,03
0,10 0,15
0,00
0,03
0,06
0,5
0,00
0,03
0,06
0,8 1,6
-1
CH4 [nmol g-1]
CH4 production [nmol h-1 g-1]
Fig. 2 Vertical profiles of methane concentration (a) and methane production rates determined at 5°C without
any additional substrate (b) as well as with acetate (c) or hydrogen (d) as methanogenic substrates. Unit I to IV
based on CONISS analysis of the different grain size fractions.
110
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Methanogenic activity was determined at 5 °C with and without methanogenic substrates in
selected sediment samples representative for the different core units. Methane production could be
determined only in the two upper units (I, II), while in the lower two units (III, IV) no methane
formation was detected before and after addition of methanogenic substrates (Fig. 2b-d). The methane
production rates analysed in Unit I, were generally higher than in Unit II. In any case, the highest
activity was observed in about 125 cm sediment depth, which corresponded on the highest
concentration of methane (Fig. 2a-d).
Table 1 AMS radiocarbon dating, calendar years and δ13C values of the organic carbon fraction from selected
permafrost sediments of Samoylov Island
Reference
number
KIA20719
KIA20720
KIA20721
Depth
[cm]
289
557
843
14
Unit
C age
[years BP]
2306 ± 30
7970 ± 56
8295 ± 50
II
III
IV
Calendar age
[years BP]
2330 ± 25
8824 ± 179
9334 ± 101
δ13C
[‰]
-24.39 ± 0.06
-24.63 ± 0.04
-23.06 ± 0.03
BP = years before the present
The incubation of permafrost samples from 45–63 cm depth at sub-zero temperatures with acetate
and hydrogen as methanogenic substrates indicated a relatively high methane production rate under
permafrost temperature conditions (Fig. 1b, 3). At a temperature of –3 °C a significant increase in
methane production was found, which rose linearly to headspace concentrations of about 1000 ppm
(with acetate) and 2500 ppm (with hydrogen) during 300 h after the initiation of the experiment. At a
temperature of –6 °C methanogenesis was lower. However, after a lag phase of about 300 h a
significant increase to 200 ppm (with acetate) and 500 ppm (with hydrogen) within 200 h was
observed. The calculated activity of methanogenic archaea with hydrogen reached values of 0.78 ±
0.31 nmol CH4 h-1 g-1 and 0.14 nmol CH4 h-1 g-1 at an incubation temperatures of –3 °C and –6 °C,
respectively. This was 2.5 and 3.5 times higher compared to the activity with acetate (0.31 ± 0.04
nmol CH4 h-1 g-1 and 0.04 ± 0.01 nmol CH4 h-1 g-1) at the corresponding temperatures.
2500
a
2000
1500
1000
CH4 [ppm]
500
0
600
b
400
200
0
0
100
200
300
400
500
Time [h]
Fig 3 Methanogenesis in permafrost soils at sub-zero temperatures. Soil samples were incubated at –3 (a) and –
6°C (b) with hydrogen (circles) or acetate (squares) as a substrate (means ± SE, n = 3).
111
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
Microbial biomarkers
Significant amounts of microbial biomarkers (bacterial and archaeal) were detected in sediment
samples across all depth units (Fig. 4). Generally, microbial biomarkers were greatest in Unit I and
lowest in Unit IV. Concentrations of total biomarker (PLFA, UNSFA, UNOH and PLEL) varied
between 3.9 and 66.2 nmol g-1. Biomarker concentrations of ester-linked PLFA (EL-PLFA) ranged
between 0.7 and 43.5 nmol g-1 and for archaeal PLEL, between 0.03 and 5.4 nmol g-1. Archaeal PLEL
accounted for 4.1 % of total biomarker in Unit I and for 0.7 % in Unit IV.
Compilation of relevant data sets
The statistical analyses illustrate the relationships between organic matter quantity (TOC) and quality
(HIX), methanogenic microorganisms (PLEL concentration) and activity, and the detected methane
concentration in the permafrost sediments for the different core units (Fig. 5).
In Unit I five different PLEL derived isoprenoids were detected. In contrast, all other units
contained only 1-3 different PLEL side chains. These chains were much lower concentrated (Fig. 5a).
Furthermore, in the same unit the PLEL side chain i20:1, characteristic for Methanosarcina spp.
(Gattinger et. al. 2002), accounted for 15.8 % of total PLEL. In the other core units this compound
was only detectable in trace amounts. Unit I also showed the highest activity of methanogenic archaea
(Fig. 5b and c). A positive correlation was found between the organic carbon content (TOC) and
methane production activity with acetate (r = 0.541, P = 0.01) and with hydrogen (r = 0.532, P =
0.01), and with methane content (r = 0.434, P = 0.01) in the sediment. The correlation between the
amount of TOC and the humification index (HIX) was negative (r = -0.535, P = 0.01).
a
b
c
d
0
unit I
100
200
unit II
depth [cm]
300
400
500
unit III
600
700
unit IV
800
0
15
30
45
60
75
0
10 20 30 40 50
-1
total biomarker
[nmol g-1]
EL- PLFA
[nmol g-1]
0
1
2
5,4
0
2
4
6
8
10
-1
PLEL
[nmol g-1]
% PLEL
Fig. 4 Lipid biomarker profiles within the Holocene permafrost deposits of Samoylov Island, Lena Delta
(Siberian Arctic). (a) total biomarker, (b) ester-linked phospholipid fatty acids (EL-PLFA), (c) phospholipid
ether lipids (PLEL) and (d) percentage of PLEL on total biomass. Unit I to IV based on CONISS analysis of the
different grain size fractions.
Discussion
Our results show significant amounts of methane in the first four meters of frozen sediments (Unit I
and II, Late Holocene, 5000 yr BP until today) and only trace amounts of methane in the bottom
section of the core (Unit III and IV; Middle Holocene, 9000 – 5000 yr BP; and Early Holocene, 11500
– 9000 yr BP). Different amounts of methane in different aged permafrost deposits from north-eastern
Eurasia were also reported by Rivkina & Gilichinsky (1996). They detected methane in modern
112
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
(Holocene) and old permafrost deposits (Middle and Early Pleistocene, 1.8 – 0.78 mill. yr BP), but not
in Late Pleistocene ice complexes (ice rich permafrost, 130000 – 11500 yr BP). They concluded from
their findings that methane can not diffuse through permafrost sections. If methane is unable to diffuse
through permafrost from deeper deposits, it must be either be entrapped during the deposition of the
sediments or originate from recent methanogenesis in the frozen ground.
The investigation of phospholipids shows a vertical profile with the same trend as the methane
concentration. Specifically, significant amounts of phospholipids were determined in the upper Late
Holocene deposits (Unit I, II), which correlates (r = 0.632, P = 0.05) with the highest amount of
methane in the permafrost section. In contrast, the biomarker concentrations in the Middle and Early
Holocene permafrost sediments (Unit III, IV) drastically decreased to values below 10 nmol g-1
sediment, which corresponds with the detected traces of methane.
I
A
I
A
II
B
II
B
II
B
B
III
C
III
C
B
IV
C
IV
Unit
A
i20:0
i20:1
i40:0x
i40:0
i40:0-cy
III
IV
a
1
2
3
C
b
4
c
0.0 0.2 0.4 0.6 0.8 1.0 1.2
0.0 0.2 0.4 0.6 0.8 1.0 1.2
CH4 production
[nmol h-1 g-1]
CH4 production
[nmol h-1 g-1]
PLEL composition
[nmol g-1]
I
A
I
A
II
A
II
B
II
B
III
B
III
B
III
C
IV
B
IV
B
IV
C
Unit
A
d
100
200
CH4 [nmol g-1]
300
e
0
1
2
3
TOC [%]
4
5
Unit differences
I
0
Unit differences
I
f
0
4
8
12
HIX
Fig. 5 Relationship between archaeal biomarkers (a), methane production activities with acetate (b) and
hydrogen (c), methane concentration (d), organic matter quantity (TOC) and quality (HIX) for the different core
units of the Holocene permafrost deposits. Different capitals indicate differences at the significance level of P =
0.05.
Phospholipid fatty acids (PLFA) are molecular biomarkers for the domains of Bacteria and
Eukarya. Phospholipid etherlipids (PLEL) are indicators for the domain Archaea. Phospholipids are
compounds of the cell membranes that rapidly degraded after cell death (Harvey et al. 1986, White et
al. 1979). They are regarded as appropriate biomarkers for viable microorganisms (e.g. Ringelberg et
al. 1979; Zelles 1999). The detection of biomarkers for viable microorganisms does not necessarily
indicate their activity status. Enclosed in deep permafrost deposits, they can represent completely or
partially inactive or dormant microorganisms (Colwell et al. 2005). A further possibility is that the
113
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
detected PLFA and PLEL are well preserved remains of ancient microbes. However, the positive
correlation of methane concentration with viable bacteria and archaea gives us the first strong
evidence of recent methanogenesis under in situ conditions in permafrost deposits.
The analyses of methane production revealed activity only in permafrost layers with significant
concentrations of both methane and microbial (particularly archaeal) biomarkers. Although the activity
in Unit I was higher compared to Unit II (both Late Holocene), which was also still characterized by
high concentrations of methane, an important finding from the activity analyses is that no methane
production was detectable in the bottom part of the permafrost section (Unit III, IV) characterized only
by traces of methane. This was also the case after addition of acetate or H2/CO2 as energy and carbon
source. This indicates the absence of methanogenesis does not depend on deficiency of methanogenic
substrates in the Middle and Early Holocene deposits. Methane was only found in permafrost
sediments with a considerable amount of viable microorganisms and verifiable methane production
activity.
In Unit I (32-194 cm depth), archaeal biomass expressed as PLEL concentration, was highest and
even exceeded values that were reported previously for the active layer at a related permafrost site
(Wagner et al. 2005). In the present core, archaeal biomarkers accounted for 5.2 % of total
phospholipids in the upper section and for 2.3 % of the entire profile. In addition, methanogenic PLEL
chains (i20:1), indicative for Methanosarcina spp. (Gattinger et al. 2002), were detected in significant
amounts only in Unit I. This finding was confirmed by isolates from the same study site identified as
members of the genus Methanosarcina, which are characterized by extreme tolerance against various
stress conditions (D. Morozova and D. Wagner, data under publication). This supports the hypothesis
that Methanosarcina-like cells are better protected against damage caused by environmental stresses
compared to other methanogens due to their typical formation of cell aggregates.
Although, only a few psychrophilic strains of methanogenic archaea have been isolated so far
(Simankova et al. 2003; Cavicchioli 2006), there are some indications of methanogenic activity in cold
permafrost environments (Kotsyurbenko et al. 1993; Wagner et al. 2003; Ganzert et al. 2006).
However, this study actually revealed methane production under in situ permafrost temperature
conditions of down to -6 °C. The methane production rate with acetate or hydrogen at sub-zero
temperatures was only 10 times lower compared with the activity in the active layer of a permafrost
soil from the same study site (Wagner et al. 2005). This indicates a tolerance of permafrost
methanogens to their cold environment. This assumption is also supported by the finding of Ganzert et
al. (2006) who reported increasing methane production activity close to the permafrost table at low in
situ temperature conditions. The zone of high methane concentrations in the permafrost deposits was
characterized by in situ temperatures between approx. -2 and -9 °C. This is the same temperature range
used in the incubation experiments.
One prerequisite for any metabolic activity in frozen permafrost sediments is the availability of
unfrozen water. The Late Holocene permafrost deposits at the study site were characterized by a
sediment texture of loamy sand with a relatively high content of silt and clay. In permafrost soils with
a prominent part of fine textured material, liquid water has been observed at temperatures down to -60
°C (Ananyan 1970). Biologically, the most important feature of unfrozen water in permafrost is the
ability to transfer ions and nutrients (Ostroumov & Siegert 1996).
Additionally, the quality of organic carbon is a limiting factor in the microbial metabolism
process. Our results reveal a high organic carbon content (on average 2.4 %) for the Holocene
permafrost deposits. However, the quantity of organic matter in permafrost ecosystems provides no
information on the quality, which determines the availability of organic compounds as energy and
carbon sources for microorganisms (Hogg 1993; Bergmann et al. 2000). For this purpose qualitative
parameters like the humification index (HIX) or the C/N ratio can give suitable information with
regard to microbial metabolism. Wagner et al. (2005) demonstrated that the availability of organic
carbon in permafrost soils decreased with increasing HIX. This is in agreement with the present study.
It was shown for the permafrost sequence the HIX increased continuously with depth. At the same
time the C/N ratio and the organic carbon content decreased with permafrost depth. In both cases, this
114
Methane Cycle in Permafrost Ecosystems
4 Permafrost Ecosystems and Microbial Processes
significantly correlates with the HIX. Consequently, at this point we can summarize that the zone with
significant concentrations of methane and activity of methanogenic microorganisms is characterized
by the highest concentration of high quality organic carbon.
In contrast to the results of the soil-ecological variables (methane production activity, PLEL
biomarker concentration, TOC, HIX), we do not achieve any ideas for a possible entrapment process
of methane during sedimentation from data of paleoclimate research (Andreev et al., 2004; Andreev
and Klimanov, 2005).
In the Early Holocene to approx. 8800 yr BP, the environmental conditions were relatively stable
in comparison to the Late Holocene (5000 yr BP until today). This was shown by climate
reconstruction based on pollen and chironomid records from the Lena Delta (Andreev et al., 2004).
They determined the Holocene climate optimum between 10300 to 9200 yr BP, which was
characterized by warmer (up to 3°C) and wetter conditions than the present day. Between 9200 and
6000 yr BP, the climate was still relatively warm but more unstable concerning the temperature. From
the climate reconstruction, it can be concluded that the environmental conditions during the Early
Holocene until 8800 yr BP were favourable for methanogenic archaea and methanogenesis. The
absence of methane in the permafrost sediments from this period indicates that the likely produced
methane was emitted to the atmosphere before it could be entrapped by freezing of the sediments. It
can be expected that under more unstable conditions methane production is low or no methanogenesis
occurred. However, the highest methane concentrations were detected in sediments (< 8800 yr BP
until present) deposited under such conditions, indicating an accumulation of the methane over longer
periods by in situ activity. This gives us evidence for the prediction that the methane concentration
profile rather depends on in situ activity of methanogenic archaea than on the inclusion of methane
during sedimentation processes.
More than 20 percent of the terrestrial Arctic is characterized by ice rich permafrost (Zhang et al.
1999). Large areas, mainly dominated by continuous permafrost, exist in Siberia with thicknesses up
to 900 m (Yershov 1998). The present study revealed considerable parts of these cold habitats as
recent sites of methane production, probably catalyzed by specific cold-adapted methanogenic
archaea. This increasing reservoir of climate relevant trace gases becomes of major importance against
the background of global warming which could result from a thawing of permafrost area up to 25%
until 2100 (Anisimov et al. 1999) and subsequent disposal of the methane reservoirs into the
atmosphere. Today, more than 75 x 106 t a-1 permafrost sediments are eroded at the Laptev Sea coast
(Rachold et al. (2000), from which a theoretical methane release of about 100 t CH4 a-1 can be
calculated. These quantities are not considered in regional and global greenhouse gas balances and
modeling. This is of particular importance as our results reveal a substantial increase of the microbial
methane production in the frozen ground, if the permafrost temperature arises from -6 °C to -3 °C.
Conclusions
This work shows for the first time that microorganisms, particularly methanogenic archaea, do not
only survive in permafrost habitats but also can be metabolic active under in situ conditions. Due to
the sub-zero experiments and the in situ temperatures of permafrost sediments, we can conclude that
the methanogenic community is dominated by psychrotolerant or even psychrophilic microorganisms.
Despite this adaptation to cold environments, we show that a slight increase of the temperature can
lead to a substantial increase of methanogenic activity. In case of degradation, this would lead to an
extensive expansion of the methane deposits with their subsequent impacts on total methane emission.
A future in-depth characterization of the metabolism of these cold-adapted methanogens will reveal
biotic and abiotic factors which influence the methanogenic activity of these organisms.
The results further show that methane in permafrost, which originates from modern
methanogenesis, represents contribution thus so far a not considered to the global methane budget. The
methane is released to the atmosphere by permafrost degradation in form of thermokarst or coastal
115
4 Permafrost Ecosystems and Microbial Processes
Methane Cycle in Permafrost Ecosystems
erosion processes, which is an ongoing process in Arctic regions. Although the change of permafrost
by global warming is examined in the framework of different international projects (e.g. ACD: Arctic
Coastal Dynamics, CALM: Circumpolar Active Layer Monitoring), these investigations should be
linked more strongly with microbiological process studies and biodiversity research. Thus a
contribution could be made to understand the role of permafrost in the global system and possible
feedbacks by material fluxes and greenhouse gas emissions.
Acknowledgements
The authors wish to thank the Russian-German field parties during the LENA 2001 expedition, especially
Christian Wille and Günter “Molo” Stoof (Alfred Wegener Institute for Polar and Marine Research) for their
assistance with the drilling device. Furthermore, we want to thank Dmitri V. Melnitschenko (Hydro Base Tiksi)
and Waldemar Schneider (Alfred Wegener Institute for Polar and Marine Research) for logistic support during
the expedition. Finally, we thank Ulrike Herzschuh for helpful discussion with regard to the grain size
interpretation and William R. Bolton for critical reading of the manuscript (both Alfred Wegener Institute for
Polar and Marine Research). The study is part of the German-Russian project The Laptev Sea System
(03G0534G), which was funded by the German Ministry of Education and Research (BMBF) and the Russian
Ministry of Research and Technology.
116
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure in Permafrost Ecosystems
FEMS Microbiology Ecology 50 (2004) 13–23
www.fems-microbiology.org
5.1
1
Characterisation of microbial community composition
of a Siberian tundra soil by fluorescence in situ hybridisation
Svenja Kobabe
a
a,*
, Dirk Wagner a, Eva-Maria Pfeiffer
b
Alfred Wegener Institute for Polar and Marine Research, Telegrafenberg A45, 14473 Potsdam, Germany
b
Institute of Soil Science, University of Hamburg, Allende-Platz 2, 20146 Hamburg, Germany
Received 11 March 2004; received in revised form 7 May 2004; accepted 13 May 2004
First published online 31 May 2004
Abstract
The bacterial community composition of the active layer (0–45 cm) of a permafrost-affected tundra soil was analysed by fluorescence in situ hybridisation (FISH). Arctic tundra soils contain large amounts of organic carbon, accumulated in thick soil layers
and are known as a major sink of atmospheric CO2 . These soils are totally frozen throughout the year and only a thin active layer is
unfrozen and shows biological activity during the short summer. To improve the understanding of how the carbon fluxes in the
active layer are controlled, detailed analysis of composition, functionality and interaction of soil microorganisms was done. The
FISH analyses of the active layer showed large variations in absolute cell numbers and in the composition of the active microbial
community between the different horizons, which is caused by the different environmental conditions (e.g., soil temperature, amount
of organic matter, aeration) in this vertically structured ecosystem. Universal protein stain 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF) showed an exponential decrease of total cell counts from the top to the bottom of the active layer (2.3 109 –
1.2 108 cells per gram dry soil). Using FISH, up to 59% of the DTAF-detected cells could be detected in the surface horizon, and
up to 84% of these FISH-detected cells could be affiliated to a known phylogenetic group. The amount of FISH-detectable cells
decreased with increasing depth and so did the diversity of ascertained phylogenetic groups.
Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Fluorescence in situ hybridisation; Community composition; Active layer
1. Introduction
Arctic tundra soils contain large amounts of organic
carbon, accumulated in thick layers of soil organic
matter [1,2] and are known as a major sink of atmospheric CO2 during the Holocene [3,4]. The reason for
the accumulation of organic material is a reduced microbial decomposition of organic matter due to the extreme climatic conditions. Generally, this decomposition
is slow and incomplete with high moisture and low
temperature [5]. Arctic tundra soils are totally frozen
throughout the year and only a thin active layer is nonfrozen and shows biological activity during the short
summer. In this extreme environment microorganisms
*
Corresponding author. Tel.: +49-331-2882-142.
E-mail address: [email protected] (S. Kobabe).
have to be capable of withstanding low temperature and
repeated freezing–thawing cycles. Due to the underlying
ice shield large part of the soils is waterlogged and decomposition of organic matter takes place under anaerobic conditions. The final step in the process of
anoxic decomposition of complex organic matter is
methanogenesis. Therefore, tundra soils are one of the
most important sources in the budget of atmospheric
methane (CH4 ), which is the second significant greenhouse gas after carbon dioxide [6]. Tundra wetlands are
estimated to emit between 20 and 40 Tg yr 1 CH4 [7]. It
accounts for 20% of global methane emission [8].
The large carbon pool in the northern latitudes together with a predicted climate warming [9] leads to
speculations about a possible feedback effect on global
climate changes by increased decomposition of organic
matter and possible increased methane emission [9,10].
117
5 Microbial Community Structure
14
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
For a better prediction of how such changes in environmental conditions may affect the carbon pool, a detailed knowledge of composition, functionality and
interaction of microorganisms involved in the carbon
cycle is important.
In general, the number, diversity, and activity of soil
organisms are influenced by soil organic matter properties (e.g., content, availability), soil texture, pH,
moisture, temperature, aeration, and other factors [11].
Soil is a heterogeneous environment and soil aggregates,
soil pores, and root environments (rhizosphere) provide
numerous niches for different soil microbial communities. Because of the complex vertical structure of the soil
and the physical and chemical differences between the
horizons it is not possible to deduce a subsurface community structure from analysing surface soils. Deeper
layers may contain microbial communities, which are
specialised for their environment and differ from surface
communities [12,13].
Cultivation-based methods usually fail to give a
complete picture of the composition of complex communities [14–16]. Molecular, i.e., cultivation-independent techniques could give complementary insight into
complex environments. The FISH method is based on
the detection of rRNA. Because the rRNA content is
associated with the metabolic state of the organism
[17–19], FISH results are influenced by the activity of
the cells [20–25]. Although FISH signals cannot directly
be translated to cell activity status it is approved that
there is a positive relationship between bacterial metabolic rates and the capacity to detect the active cells [26].
In ecological studies it could be an advantage to describe
the composition of the more active, and hence ecologically relevant part of the community instead of the total
existent population.
The aim of this study was to characterise the population of active microorganisms in the whole active layer
of a permafrost-affected soil, by using FISH without
previous cultivation.
2. Materials and methods
2.1. Study site and soil conditions
The investigation site is located on Samoylov (N
72°22, E 126°28), a typical island of the central part of
the Lena Delta, Siberia. Detailed description of the
geomorphologic situation of the island and the whole
delta was given previously [27–29]. With an area of
about 32,000 km2 , the Lena Delta is the second largest
delta in the world. It is situated in the continuous permafrost zone. The mean annual air temperature in the
period 2001–2003, measured by a Russian weather station on Stolb Island, which is approximately 8 km away
from Samoylov Island, was )11.9 °C; mean annual
118
Methane Cycle in Permafrost Ecosystems
precipitation in the same period was about 233 mm [30].
The landscape of the delta is dominated by a microrelief
of ice-wedge polygons, which develop due to annual
freeze–thaw cycles. The soils are totally frozen for at
least eight months every year and only a shallow active
layer of about 20–50 cm is unfrozen during the summer
months. Predominant landscape formations are lowcentred polygons where the flat central parts are surrounded by raised rims. The investigated soils in the
polygon centres are characterised by a water level near
the soil surface, which, together with the cold climate
conditions, leads to an accumulation of organic matter
and formation of peat layers. The mainly anaerobic
decomposition of soil organic matter generates high
CH4 production and emission rates from these sites.
Mean flux rates of 53.2 8.7 mg CH4 m 2 d 1 were
measured for the polygon centres for the period between
the end of May and the beginning of September 1999
[27].
The soil in the centre of a typical polygon was described and sampled in August 2001. At this time the
thaw depth of the active layer was up to 45 cm with the
water table 18 cm below the surface. The vegetation in
the polygon centres site was composed of a moss/lichen
layer (total coverage 95%) and a vascular plant layer
(total coverage 30%). The latter was dominated by the
sedge, Carex aquatilis [31]. For soil description and
sampling, a vertical soil profile was dug. Four different
peaty, sandy loam textured soil horizons were distinguished. They were covered by a horizon consisting of
weakly decomposed organic material. Subsamples for
physio-chemical soil characteristics and biological
analyses were taken in a horizontal way subsequently
after the horizons were identified. Samples for biological
analyses were placed into 250 ml Nalgene boxes, which
were locked with a seal tape to prevent oxygen contamination of the samples. To ensure detailed investigation of the soil, horizons with a thickness of more
than 10 cm were subdivided and subsamples were taken.
Soil properties (Table 1, Fig. 1) were described according to Schoeneberger et al. [32] and laboratory analyses
were done according to Schlichting et al. [33]. The soil
was classified as Typic Historthel according to US Soil
Taxonomy [34].
The active layer is subject to great temperature variations between the different horizons. Automatic soil
temperature measurements were started in 1998 using
Thermistor Soil Temperature Probes 107 (Campbell
Scientific Ltd.). The temperature sensors were installed
in different depths between soil surface and permafrost
table [35]. The average, minimum and maximum temperatures in August for three years are given (Table 2).
During summer the upper soil horizons had not only a
higher average temperature, compared to the deeper
horizons. They were also exposed to a strong diurnal
fluctuation, decreasing with depth. The minimum winter
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
15
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
Table 1
Selected soil physico-chemical characteristics of the investigated Typic Historthela
Horizonb
Depth (cm)
Oi
0–5
5–10
10–17
17–20
20–23
23–30
30–35
35–40
40–45
Soil textureb (%)
Sand
A
Bg 1
Bg 2
Bg 3
77
76
69
68
65
60
Silt
15
18
26
27
29
33
Textural classb
Munsell
colorc
Rootsb
Reducing soil
conditionsd
–
–
–
Sandy
Sandy
Sandy
Sandy
Sandy
Sandy
n.d.
n.d.
n.d.
10YR 2/1
2,5Y 4/4
10YR 3/2
10YR 3/2
10YR 4/2
10YR 4/2
Many
Many
Many
Many
Common
Few
Few
None
None
No
No
No
Yes
Yes
Yes
Yes
Yes
Yes
Clay
8
6
5
5
6
7
loam
loam
loam
loam
loam
loam
a
Soil classification was done according to US Soil Taxonomy Soil Survey Staff [34].
Classifications were done according to Schoeneberger et al. [32].
Soil colour determination was done according to the Munsell soil colour charts [72].
d
Reducing soil conditions were detected by using a–a0 -Dipyridil test. Soil Survey Staff [34].
b
c
while the deeper horizons were frozen for 9–10 months
in the year.
2.2. Sample preparation for cell counts
Fig. 1. Vertical profile of selected soil properties and EUBmix counts
relative to total bacterial cell numbers. (a) Average soil temperature in
August, (b) N content, (c) C/N ratio, (d) C content, and (e) fraction of
TBC detected with probe EUBmix. C and N contents were measured
using Vario EL III elemental analyzer (Elementar Analysensysteme,
Germany).
temperature measured was )37 °C at a depth of 7 cm
and increased up to )29 °C at a depth of 42 cm. The
upper soil above 23 cm depth was frozen for 8 months,
Subsamples for cell counts by 5-(4,6-dichlorotriazin2-yl)aminofluorescein (DTAF) staining and FISH were
frozen immediately after sampling and were transported
to Germany. After transportation they were thawed at
3 °C. Immediately after thawing subsamples of 1gram
were either fixed directly in ethanol (96%) or in a freshly
prepared, 4% paraformaldehyde/phosphate-buffered saline (PBS) solution (pH 7.2) for 4 h at 5 °C. The paraformaldehyde-fixed samples were then washed with PBS
and stored in ethanol–PBS (1:3) at )20 °C. Before application to slides, we diluted the samples with 0.1%
sodium pyrophosphate in distilled water to obtain 100–
200 cells per microscopic field of view. The dilution was
dispersed by mild sonication with an MS73 probe (Sonopuls HD70; Bandelin, Berlin, Germany) at a setting
of 20 for 30 s. Dispersed soil samples were spotted on
gelatin-coated (0.1% gelatine, 0.01% KCr(SO4 )2 ) Teflonlaminated slides with ten wells. Twenty ll of fixed and
dispersed soil sample were dropped onto each well, allowed to air dry, and dehydrated by serial immersion of
the slides in 50%, 80%, and 96% ethanol. The FISH
method was used directly in soil smears because
Table 2
August temperatures in different soil depths of the investigated Typic Historthel
Depth (cm)
Temperature (°C) in August (avg. min./max.)
7
13
23
32
42
4.2
2.4
1.7
0.9
0.3
1998
1999
0.7/12.8
0.8/5.3
0.0/3.2
0.4/1.7
)0.6/0.6
5.1
3.6
–
1.9
0.9
2001
1.8/11.1
)0.6/8.6
–
)1.6/3.2
0.4/4.1
4.2
–
–
2.2
1.2
0.8/11.4
–
–
1.3/4.0
0.6/2.1
–, No temperature was determined due to broken temperature sensor.
119
5 Microbial Community Structure
16
Methane Cycle in Permafrost Ecosystems
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
extraction of bacterial cells from soil is difficult to perform due to the exclusion of bacteria associated with soil
particles [25].
2.3. Non-selective staining of all cells (DTAF staining)
Before the slides were prepared for FISH, they were
stained with the universal protein stain DTAF. Freshly
prepared stain solution consisted of 2 mg of DTAF
dissolved in 10 ml of phosphate buffer (0.05M Na2 HPO4
with 0.85% NaCl, pH 9 [36]). The staining procedure
was done as described by Bloem et al. [37]. A drop of
stain solution was given on each well with dried soil film
and incubated for 30 min at room temperature. After
staining the slides were washed three times for 20 min
each with phosphate buffer (pH 9). Finally they were
passed through four water bathes each for a few seconds
and air-dried.
2.4. Fluorescence in situ hybridisations and probe description
All oligonucleotide probes used in this study were
purchased from Interactiva (Ulm, Germany). They were
labelled with the cyanine dyes Cy3 or Cy5. Probes for
the domains Bacteria and Archaea and specific probes
for different phylogenetic groups of Bacteria were used.
All probe sequences, formamide concentrations in hybridisation buffer, NaCl concentrations in washing
buffer, and references are summarised in Table 3. For
each hybridisation the bacterial probe EUBmix was
used together with one specific probe marked with a
different dye. Therefore, the target cells of the group
specific probes were marked with three different dyes.
In situ hybridisations with probes HGC69a and
LGCmix were done on ethanol-fixed samples, while
paraformaldehyde-fixed soil samples were used for
probing gram-negative bacteria. Probe NON338 was
used as a negative control for the ethanol-fixed as well as
the paraformaldehyde-fixed samples. In situ hybridisations were performed similarly as described elsewhere
[38,39]. A 10 ll aliquot of hybridisation buffer (0.9 M
NaCl, 20 mM Tris–HCl; pH 8.0), 0.02% sodium dodecyl
sulfate (SDS), formamide in concentrations as given in
Table 3, and 30 ng/ll of probe was placed on each well.
The slides were transferred to an equilibrated 50 ml
polypropylene top tube [24] and incubated at 46 °C for
90 min. Slides were then washed at 48 °C for 10 min in
washing buffer (20 mM Tris–HCl, pH 8.0), 5 mM
EDTA, 0,01% SDS w/v, NaCl concentration as given in
Table 3. Afterwards they were washed in ice-cold double-distilled water for a few seconds and quickly dried in
an air stream. Finally slides were mounted in Citifluor
AF1 antifadent (Plano; Wetzlar, Germany) and covered
with a coverslip.
2.5. Microscopy and quantification
A Zeiss LSM 510 scanning confocal microscope
equipped with an Ar ion laser (488 nm), and two HeNe
lasers (543 and 633 nm) was used to record optical
sections. Image handling was done with the LSM510
software (version 2.3). Small fluorescent pieces of the
soil matrix hindered an automatic detection with our
Table 3
rRNA-targeted oligonucleotide probes used for hybridisation
Probe
Target group
Sequence (50 –30 ) of probe
Target sitea
FAb (%)
NaClc (mM)
Reference
EUB338
EUB338 II
EUB338 III
NON338
Domain Bacteria
Domain Bacteria
Domain Bacteria
Control probe complementary
to EUB338
Domain Archaea
a-subclass of Proteobacteria
b-subclass of Proteobacteria
c-subclass of Proteobacteria
Cytophaga–Flavobacterium
cluster of CFB-phylum
Same as CF319A
Gram-positive bacteria with
high GC content
Gram-positive bacteria with low
GC content
Same as LGC354A
Same as LGC354A
GCTGCCTCCCGTAGGAGT
GCAGCCACCCGTAGGTGT
GCTGCCACCCGTAGGTGT
ACTCCTACGGGAGGCAGC
16S (338)
16S (338)
16S (338)
16S
0-35
0-35
0-35
0-35
80-900
80-900
80-900
80-900
[73]
[74]
[74]
[75]
GTGCTCCCCCGCCAATTCCT
GGTAAGGTTCTGCGCGTT
GCCTTCCCACTTCGTTT
GCCTTCCCACATCGTTT
TGGTCCGTGTCTCAGTAC
16S
16S
23S
23S
16S
(915)
(968)
(1027)
(1027)
(319)
20
35
35
35
35
225
80
80
80
80
[39]
[76]
[77]
[77]
[77]
TGGTCCGTATCTCAGTAC
TATAGTTACCACCGCCGT
16S (319)
23S (1901)
35
25
80
159
[77]
[78]
TGGAAGATTCCCTACTGC
16S (354)
35
80
[79]
TGGAAGATTCCCTACTGC
TGGAAGATTCCCTACTGC
16S (354)
16S (354)
35
35
80
80
[79]
[79]
ARC915
ALF968
BET42a
GAM42a
CF319A
CF319B
HGC69a
LGC354A
LGC354B
LGC354C
– , Probes marked with the same amount of are applied in equimolar mixtures.
Escherichia coli numbering.
b
Percentage (vol/vol) of formamide in the hybridisation buffer.
c
Percentage (vol/vol) of NaCl in the washing buffer.
a
120
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
17
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
equipment, as was described, e.g., by Daims et al. [40],
therefore the counting was done manually. For each
hybridisation approach at least 1000 DTAF-stained
cells were counted on at least 10 randomly chosen fields.
For each horizon the rate of bacteria detectable by
FISH (cells containing a sufficient number of ribosomes
[16]) was calculated by counting EUBmix-positive signals relative to DTAF-counts on PFA-fixed samples.
These calculations were corrected for samples with high
proportions of gram-positive bacteria, according to
Friedrich et al. [41]. This was done by adding the
amount of bacteria detected by probes HGC69a and
LGCmix in the ethanol-fixed samples to the EUBmix
counts.
Group-specific cell counts were performed with
DTAF-stained soil samples simultaneously hybridised
with Cy5-labelled EUBmix and the respective groupspecific Cy3-labelled probe. This procedure enabled a
threefold staining of the target-cells. This was important
because background signals of non-bacterial soil particles often hinder clearly convincing results in soil samples, when using a single fluorescent probe [42].
Quantification of specific cells was done relative to the
number of EUBmix-hybridised cells. Counting results
were always corrected by subtracting signals obtained
with the probe NON338.
For calculating the number of cells per gram of soil
(BC), the mean count of bacteria per counting area (B),
the microscope factor (area of the sample spot/area of
counting field), (M) the dilution factor (D) and the
weight of fixed sample used for hybridisation (W) were
determined
and
arranged
in
the
equation
BC ¼ B M D W 1 .
3. Results and discussion
Total bacterial cell numbers (TBC) in the soil, determined by DTAF staining, ranged from 1.2 to
23.0 108 cells g 1 . These numbers were comparable to
TBCs found in other arctic soils [43], and peat [44] and
soils of other regions [45]. As shown in Table 4 and
Fig. 1, TBC were highest (23.0 108 cells g 1 ) in the
uppermost 5 cm layer of the soil and decreased with
depth. In the deepest investigated horizon (40–45 cm)
1.2 108 cells g 1 were detected. It corresponds to 10%
of the TBC detected in the surface horizon. TBC decreased
exponentially
with
increasing
depth
(r2 ¼ 0:9711), with the exception in the horizon between
17 and 20 cm soil depth, where cell counts in the same
order as in the layer above were retrieved (Table 4).
Total cell counts for the deepest sample of the active
layer were in the same range as other studies found
below the permafrost table in continuously frozen sediments in Russia using acridine orange [46], DTAF
staining [47], or direct visual microscopic counting [48].
Not only the total cell numbers, but also the fraction
of cells detectable with probe EUBmix, which identified
members of the domain Bacteria, decreased by depth
from 59% to around 30% (Table 4). This decrease in the
fraction of detectable bacteria was due to a strong exponential decrease (r2 ¼ 0:963) of absolute EUBmix
counts from 13.6 to 0.4 108 cells g 1 (Fig. 2). There
were only a few studies to compare our data. The soil
samples in which Zarda et al. [49] and Christensen et al.
[25] found 41% or only 5% of the TBC with probe
EUB338, were from the upper 10 cm of soils located in
the temperate zone. A more comparable environment
could be the Siberian peat samples investigated by Dedysh et al. [44], in which up to 65% of TBC were found
with EUB 338. These results indicate that the extreme
low temperatures in the investigated tundra soil did not
lead to lower amounts of active bacteria than that from
other soils. The high amounts of active bacteria found in
our investigation of tundra soil as well as by Dedysh in
the peat samples could be attributed to the very high
content of organic matter, especially in the upper horizons. It is accepted and shown in other studies that
Table 4
Total bacterial numbers in different horizons of the soil analysed after DTAF staining and relative percentage of hybridised cells with specific probes
Sample
depth
(cm)
Total cell counts
(cells/g [108 ])
(mean SD)
0–5
5–10
10–17
17–20
20–23
23–30
30–35
35–40
40–45
23.0 7.8
13.8 3.3
9.2 2.9
10.4 3.2
5.5 2.1
3.7 1.5
2.6 0.7
2.0 0.7
1.2 0.5
% of DTAF cells (mean SD) detected with specific probesa
EUBmix
ALF968
BET42a
CF mix
GAM42a
HGC69a
LGCmix
ARC915
59 12
52 7
52 10
47 16
34 6
28 6
27 10
28 5
33 8
1.3 1.2
0.5 0.9
5.5 2.2
1.1 1.3
2.1 1.5
2.8 3.5
0.4 0.9
0.2 0.6
3.8 1.8
11.7 3.2
6.3 1.2
11.9 2.4
9.5 0.8
4.7 1.0
3.4 1.0
5.2 0.4
5.5 0.8
2.9 2.0
8.4 5.6
3.4 3.2
5.1 5.1
0.4 1.0
0.0 0.0
1.1 1.1
0.0 0.0
0.0 0.0
0.0 0.0
3.3 0.7
9.8 2.1
3.2 1.2
2.9 0.8
5.6 2.5
0.0 0.0
0.1 0.9
0.2 0.5
0.0 0.0
4.3 2.3
7.5 2.3
10.0 4.4
12.6 3.2
10.8 5.8
4.7 3.3
0.1 0.1
2.2 1.2
4.9 2.4
5.7 2.0
1.0 1.0
7.7 7.1
3.1 2.6
3.2 2.2
0.4 0.8
0.4 0.8
1.2 1.8
0.1 0.4
0.5 0.7
22.4 30.0
9.9 23.3
5.2 11.1
7.2 16.6
2.6 5.8
0.9 2.4
8.1 19.3
1.0 1.8
% Affiliated
Eubacteriab
34.7
29.0
44.0
31.9
28.5
12.2
17.2
15.2
12.2
a
Percent detection compared to DTAF. Numbers have been corrected by subtracting NON338 counts. Probe names are abbreviations of those
shown in Table 1.
b
Results obtained from the addition of counts with all above named specific probes without probe ARC 915.
121
5 Microbial Community Structure
18
Methane Cycle in Permafrost Ecosystems
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
Fig. 2. Vertical profile of absolute numbers of bacteria detected with different probes in the investigated Typic Historthel. All data correspond to 1 g
soil (dry weight). Probe names and target groups are explained in Table 3. Note the different x-axis range of the first diagram. Classification of the soil
profile in different horizons is given on the left of the DTAF/EUBmix profile.
carbon availability is the most important limiting factor
for microbial growth in soil [50–53]. Its possible influence on the activity of cells and hence on their ribosome
content enhanced the detectability by FISH. Therefore
the decreased EUB detection found in the deeper soil
horizons could be attributed to the lower C content in
122
these horizons. The EUB detection rates throughout the
soil profile showed a very strong correlation to Corg
content (R2 ¼ 0:951, p ¼< 0:0001, N ¼ 9) (Fig. 1(d) and
(e)). Considering the low temperatures, at which mesophilic organisms show a drastic decrease of metabolic
activity, the EUBmix amounting of the TBC number in
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
the deeper horizons indicated the existence of psychrophilic or at least psychrotrophic organisms.
In contrast to the distribution observed for the domain Bacteria, none of the individual major phylogenetic
groups showed a clear exponential decrease of cell
numbers with depth. Notably, the highest abundance of
the gram-positive Bacteria with a high G + C content,
the a-Proteobacteria, and the c-Proteobacteria was
found in horizons below the top 5 cm. However, all
groups showed much higher abundances in the upper
part of the profile and a significant reduction in cell
numbers in depths below 23 cm. Apparent differences
among the individual bacterial groups were the amount
of cell numbers and their distribution in soil profile
(Fig. 2). This can be explained by different habitat requirements for the bacterial groups as well as positive
and negative influences among bacterial species.
For example, the Cytophaga–Flavobacterium cluster
(CF group) of CFB phylum (Cytophaga–Flavobacterium–Bacteroides phylum) was found in the amount between 2.0 108 and 0.5 108 cells g 1 in the upper 17
cm of soil. Most of the known members of this group
are organotrophic, aerobic bacteria that are specialised
in the degradation of complex macromolecules like
proteins, pectin or cellulose [54,55]. The influence of
water level and organic matter on the abundance of the
Cytophaga–Flavobacterium group was obvious. In the
aerobic upper 17cm layer of the soil, the top 5 cm layer
containing the highest amount of organic matter had the
highest amount of cells of Cytophaga–Flavobacterium
group whereas in the anaerobic zone, below the water
table at 18 cm, nearly no cells were detected. This major
difference in cell abundance between the aerobic and
anaerobic horizons was not found for the other phylogenetic groups. For the high G + C group, cell counts
were nearly equal (approximately 1 108 cells g 1 ) in
the horizons between 0 and 20 cm whereas the grampositive Bacteria with low G + C content showed a more
varying distribution in the upper 20 cm layer with cell
numbers between 1.3 and 0.3 108 g 1 .
The abundances of the phylogenetic groups as illustrated in Fig. 2 led to the different compositions of active
Bacteria in the horizons as shown in Fig. 3. With our set
of probes for major phyla within the domain Bacteria
we could affiliate between 12.2% and 44.0% of the total
DTAF counts (Table 4). In the upper 23 cm layer this
ratio was between 28.5% and 44%, which means that at
least in the upper horizons the majority (55–84%) of the
FISH-detectable Bacteria could be affiliated to a known
phylogenetic group. In the upper part of the soil, a more
diverse composition of active Bacteria than in the lower
horizons was found. Two dominant groups and at least
two other groups with relevant cell numbers were found
in each horizon. For example, in the upper 5 cm the bProteobacteria group was dominant (20% of all EUBcounts could be assigned to this phylogenetic group),
19
Fig. 3. Vertical profile of probe-specific counts relative to EUB-counts
(percentages) in the Typic Historthel. Probe names are abbreviations
of those shown in Table 3.
followed by the Cytophaga–Flavobacterium group
(14%). Three other groups were found in ratios between
6% and 10%. The b-Proteobacteria and high G + C
groups were the dominant throughout the soil profile. A
direct comparison of the data with other studies was not
possible due to the above-mentioned restriction of other
FISH studies to the surface layer. Significant decrease in
the diversity of the soil microbial communities with
depth were also detected in other studies by using
phospholipids fatty acid (PFLA) analysis or terminal
restriction fragment length polymorphism (TRFLP)
analysis [13,53,56]. The decrease of the amount of EUBdetected cells detectable by specific probes in depths
below 23 cm suggested that a larger portion of species
did not fit into the phylogenetic groups detected with
our probes. However, the reason is most likely a lower
activity of cells in deeper horizons and hence a lower
rRNA content, which is not high enough for a detectable signal of the phylogenetic group probes. This assumption is supported by the observation that the signal
intensity of the EUBmix probe decreased in deeper soil
horizons.
The greater diversity and activity of cells in the upper
horizons can be explained by higher temperatures and
better substrate supply. In the upper layers the high root
density may contribute, in addition to the high C content, to higher activity. While the upper 23 cm showed a
high root density, only few roots were found between 23
and 35 cm, and none below 35 cm. The rhizosphere is
known as a highly active soil compartment. Microbial
activity and growth are stimulated through the release of
compounds such as amino acids and sugars in plant root
exudates [57]. Therefore microbial communities associated with the rhizosphere are often more active in relation to the microorganisms in bulk soil [58]. In addition
to better substrate provision in the rhizosphere, another
123
5 Microbial Community Structure
20
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
effect, which could influence bacterial composition in the
rhizosphere, is the transport of oxygen from the atmosphere to the roots through the aerenchyma. This
transport is described for many wetland plants as adaptation to anaerobic soil conditions [59–61]. At the
investigated soil site the large aerenchyma of Carex
aquatilis serve as pathways for gas transport [31]. The
presence of oxygen in the rhizosphere could enable the
existence of aerobic species in an environment, which is
anaerobic on the macroscopic scale. Altogether, the
decrease of temperature, aeration, and substrate supply
with depth leads to reduced activity of cells and
eliminates those unable to withstand these harsher
conditions.
Quantification of the domain Archaea was more difficult and showed higher standard deviations than that
of the domain Bacteria. This was due to a strong formation of aggregates, as shown in Fig. 3. The basic requirement for the counting method is a homogeneous
distribution of cells on each well. Cell counts are illustrated in Fig. 2, but one should keep in mind the statistical problems related with these data. Most Archaea
were found in the Oi-horizon between 5 and 10 cm. The
number of approximately 3.0 108 cells g 1 means that
22% of all DTAF cell counts could be assigned to the
domain Archaea (Table 3). Also, the cell numbers from
10 to 23 cm were higher than in the upper 5 cm.
In the following, the cell counts retrieved by Arc915
were discussed as cell counts of methanogens. For justification, the subsamples of the upper 17 cm, where
high amounts of cells were detected by probe Arc915,
were additionally hybridised with probe MER 1, which
is specific for 16SrRNA of methanogens [62]. Nearly the
same number of cells hybridised with Arc915 as with
MER1. Additionally, methane activity measurements
(unpublished data) show a high methane production in
the depth of 5–17 cm, where high numbers of Arc915
cells were found.
Soil depth, at which most methanogens were found,
was a zone with changing oxygen conditions, which was
above the water level during sampling time and not in
the anaerobic zone of the profile. Oxygen content in this
horizon is not optimal for methane production since
methanogens are regarded as strictly anaerobic organisms [63] and can only survive in anaerobic microhabitats of this horizon. Other soil investigations also found
methanogens in oxic soil horizons [64–66]. Wagner and
Pfeiffer [64] demonstrated that aerobic and facultative
anaerobic microflora in soil enable methane activity in
the presence of oxygen in microscale anoxia. The reason
why the methanogens seem to favour the upper horizons
despite the suboptimal oxygen rates could be related to
the better substrate provision in these horizons. The
upper horizons of the Typic Historthel provide a high
content of organic carbon and high cell numbers of
Eubacteria, which convert high-weight macromolecules
124
Methane Cycle in Permafrost Ecosystems
to the substrates that can be used by the methanogens.
Other studies also found a strong influence of the
amount [67] and the quality [68] of fresh organic carbon
in soil on the amount and activity of methanogens.
Despite its high amount of organic matter, nearly no
Archaea were found in the uppermost 5 cm. This upper
layer is less compact and therefore better vented than
the layers below and did not provide enough anaerobic
microhabitats.
It should be noted that soils are spatiotemporal heterogeneous environments. Therefore the results of this
study reflect the situation at the sampling point in the
low-centred polygon at the time of sampling. In order to
draw broader conclusions about the ecological situation
in low-centred polygons further samplings at different
times are necessary. Due to the time-consuming analysis
only one profile was examined but attention was paid to
that the characteristics of this polygon were typical for
the surrounding landscape. This study can thus provide
only an early insight into community structure in polygonal tundra soils.
4. Conclusions
This study reveals the first analysis of the composition of an active community from tundra soil. By use of
FISH we have shown that differences in soil parameters,
like C content, water content, and root existence, caused
differences in the composition of bacterial communities
among the horizons of the Typic Historthel. For some
phylogenetic groups such as the Cytophaga–Flavobacterium group, the most influential parameters were
identified. Despite all differences in the requirements of
the specific groups, which influence their abundances in
soil, the total diversity and quantity of active cells was
strongly related to the content of organic matter, an
effect that was noted in soils of polygonal tundra also by
other researchers [69,70]. Nevertheless, despite the harsh
environmental conditions in the deeper horizons directly
above the permafrost, there is evidence for high amount
of cells (4 107 cells g 1 ) with at least minimal activity.
Even in the deeper parts of the active layer at least a
minimal turnover of organic matter, by probably psychrophilic organisms, can therefore be expected.
Using the described protocol for FISH, this technique
was successfully used to describe the composition of
active bacterial community of arctic soil. By applying
three different dyes, every positive target cell was stained
at least with two different dyes, which enabled a clear
discrimination between bacterial cells and non-bacterial
soil particles (Fig. 4). The relatively high standard deviation of cell counts obtained for some groups is attributed to the heterogeneity of soil. However, the
deviations were in the same order as in other studies of
sediment [71] and soil [49]. To better resolve the effect of
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure
S. Kobabe et al. / FEMS Microbiology Ecology 50 (2004) 13–23
21
Fig. 4. Confocal laser scanning microscope (CLSM) images showing DTAF staining and in situ hybridisation of bacteria in a soil sample from the
top 5 cm. Both pictures show identical microscopic fields, displayed in different artificial colours. (a) Hybridisation with probe EUBmix-Cy5 (red),
additional all cells were stained with DTAF (blue). Due to double staining the target Bacteria cells appear purple. (b) Additional hybridisation with
probe CFmix-Cy3 (green). Target Cytophaga–Flavobacterium cells appear yellow, due to threefold staining. Some of them were marked with yellow
circles. The scale bars represent 10 lm.
different community compositions on the carbon conversion, future investigations will combine community
analyses with investigations of substrate conversion in
different soil horizons.
Acknowledgements
We thank the Russian–German field parties during
the expedition 2001 for the enjoyable cooperation in the
field. We thank Ute Bastian, Christine Flemming (Alfred Wegener Institute, Research Unit Potsdam), and
Susanne Kopelke (Institute of Soil Science, University
of Hamburg) for providing laboratory assistance. We
also thank Dr. Otto Baumann (Department of Zoophysiology, University of Potsdam) for extensive introduction into CLSM handling and providing microscope
time. Special thanks to Lars Kutzbach for many fruitful
discussions and to Christian Wille for critical reading of
the manuscript.
This study is part of the German–Russian project The
Laptev Sea System (03G0534G), which was supported
by the German Ministry of Education and Research
(BMBF) and the Russian Ministry of Research and
Technology.
References
[1] Post, W.M., Emanuel, W.R., Zinke, P.J. and Stangenberger, A.G.
(1982) Soil carbon pools and world life zones. Nature 298, 156–
159.
[2] Oechel, W.C. and Billings, W.D. (1992) Effects of Global Change
on the Carbon Balance of Artic Plants and Ecosystems. In: Arctic
Ecosystems in a Changing Climate. An Ecophysiological Perspective (Chapin, F.S., Ed.). Academic, San Diego, CA.
[3] Smith, L.C., MacDonald, G.M., Velichko, A.A., Beilman, D.W.,
Borisova, O.K., Frey, K.E., Kremenetski, K.V. and Sheng, Y.
(2004) Siberian peatlands a net carbon sink and global methane
source since the early holocene. Science 303, 353–356.
[4] Gorham, E. (1991) Northern peatlands: role in the carbon
cycle and probable responses to climatic warming. Ecol. Appl.
1, 182–195.
[5] Nadelhoffer, K.J., Giblin, G.R., Shaver, G.R. and Linkins, A.E.
(1992) Microbial Processes and Plant Nutrient Availability in
Arctic Soils. In: Arctic Ecosystems in a Changing Climate. An
Ecophysiological Perspective (Chapin, F.S., Ed.). Academic, San
Diego, CA.
[6] Khalil, M.A.K. and Rasmussen, R.A. (1983) Sources, sinks, and
seasonal cycles of atmospheric methane. J. Geophys. Res. 88,
5131–5144.
[7] Christensen, T.R., Jonasson, S., Havstr€
om, M. and Livens, F.R.
(1999) Carbon cycling and methane exchange in Eurasian tundra
ecosystems. AMBIO 28, 239–244.
[8] Fung, I., John, J., Lerner, J., Matthews, E., Prather, M., Steele,
L.P. and Fraser, P.J. (1991) Three dimensional model synthesis of
the global methane cycle. J. Geophys. Res. 96, 13033–13065.
[9] IPCC (Intergovernmental Panel of Climate Change) (1990)
Scientific Assessment. Cambridge University Press, Cambridge.
[10] Christensen, T. (1991) Arctic and sub-Arctic soil emissions:
possible implications for global climate change. Polar Record
27, 205–210.
[11] Chen, G., Zhu, H. and Zhang, Y. (2003) Soil microbial activities
and carbon and nitrogen fixation. Res. Microbiol. 154, 393–398.
[12] Zyvangtsev, D. (1994) Vertical Distribution of Microbial Communities in Soils. In: Beyond the Biomass (Ritz, K., Dighton, J.
and Giller, K., Eds.), pp. 29–37. Wiley, West Sussex, UK.
[13] Blume, E., Bischoff, M., Reichert, J., Moorman, T., Konopka, A.
and Turco, R. (2002) Surface and subsurface community structure
and metabolic activity as a function of soil depth and season.
Appl. Soil Ecol. 592, 1–11.
[14] Skinner, F.A., Jones, P.C.T. and Mollison, J.E. (1952) A
comparison of a direct- and a plate-counting technique for the
quantitative estimation of soil microorganisms. J. Gen. Microbiol.
6, 261–271.
[15] Wagner, M., Amann, R., Lemmer, H. and Schleifer, K.-H. (1993)
Probing activated sludge with oligonucleotides specific for
125
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
Environmental Microbiology (2005) 7(10), 1582–1592
doi:10.1111/j.1462-2920.2005.00849.x
5.2
1
Methane
fluxes in permafrost habitats of the Lena Delta:
effects of microbial community structure and organic
matter quality
Dirk Wagner,1* André Lipski,2 Arndt Embacher3 and
Andreas Gattinger3
1
Alfred Wegener Institute for Polar and Marine Research,
Telegrafenberg A43, 14469 Potsdam, Germany.
2
Universität Osnabrück, Abteilung Mikrobiologie, 49069
Osnabrück, Germany.
3
GSF-National Research Center for Environment and
Health, Institute of Soil Ecology, Ingolstädter Landstraße
1, 85764 Neuherberg, Germany.
Summary
For the understanding and assessment of recent and
future carbon dynamics of arctic permafrost soils the
processes of CH4 production and oxidation, the community structure and the quality of dissolved organic
matter (DOM) were studied in two soils of a polygonal
tundra. Activities of methanogens and methanotrophs differed significantly in their rates and distribution patterns among the two investigated profiles.
Community structure analysis showed similarities
between both soils for ester-linked phospholipid fatty
acids (PLFAs) and differences in the fraction of unsaponifiable PLFAs and phospholipid ether lipids. Furthermore, a shift of the overall composition of the
microbiota with depth at both sites was indicated by
an increasing portion of iso- and anteiso-branched
fatty acids related to the amount of straight-chain
fatty acids. Although permafrost soils represent a
large carbon pool, it was shown that the reduced
quality of organic matter leads to a substrate limitation of the microbial metabolism. It can be concluded
from our and previous findings first that microbial
communities in the active layer of an Arctic polygon
tundra are composed by members of all three
domains of life, with a total biomass comparable to
temperate soil ecosystems, and second that these
microorganisms are well adapted to the extreme temperature gradient of their environment.
Received 18 January, 2005; accepted 2 May, 2005. *For correspondence. E-mail [email protected]; Tel. +49 331 288 2159;
Fax +49 331 288 2137.
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd
126
Introduction
More than 14% of the global terrestrial carbon is accumulated in soils and sediments of Arctic permafrost environments (Post et al., 1982). Due to this carbon reservoir,
tundra environments play a major role in the global carbon
cycle, which is highlighted by current observed climate
changes in the Arctic (IPCC, 2001) and by climate models
that predict significant changes in temperature and precipitation in the Northern Hemisphere (Kattenberg et al.,
1996; Smith et al., 2002). The atmospheric input of methane from tundra soils of high latitudes has been estimated
between 17 and 42 Tg CH4 year-1 (Cao et al., 1996;
Christensen et al., 1996), corresponding to about 25% of
the methane release from natural sources (Fung et al.,
1991). Particularly, the degradation of permafrost and the
associated release of climate relevant trace gases, like
CH4 and CO2 from intensified microbial turnover of organic
carbon, represent a potential environmental hazard.
Permafrost, which particularly occurs in the Northern
Hemisphere, covers more than 25% of the Earth’s land
surface (Zhang et al., 1999). These environments, which
are under the influence of cryogenic processes, are characterized by patterned ground phenomena (Kessler and
Werner, 2003). Low-centred ice-wedge polygons with a
distinct microrelief (depressed centre, elevated rim) are
one of the typical patterned grounds in tundra environments of northern Siberia. The microrelief affects the
hydrological conditions as well as the organic matter contents and consequently the microbial processes.
The seasonal freezing and thawing leads to an extreme
temperature regime in the upper active layer of permafrost. In spite of the extreme habitat conditions permafrost
is colonized by high numbers of microorganisms including
representatives of Archaea, Bacteria and Eukarya (Spirina and Fedorov-Davydov, 1998). In wet tundra soils
methanogenesis is the terminal step during the anaerobic
decomposition of organic matter, while the oxidation of
methane by methanotrophic bacteria is the only sink for
methane in these wetlands.
Generally, each habitat shows a characteristic composition of the microbial community, depending on the environmental conditions (Sundh et al., 1997; Gattinger et al.,
2002a; Knief et al., 2003). Only few studies deal with
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
Effects of microbial communities on CH4 fluxes in permafrost 1583
ecosystem-scale differences in methanogenic and methanotrophic communities concerning trace gas dynamics
(Dunfield et al., 1993; Valentine et al., 1993; Steudler
et al., 1996). Previous analysis of methane emission from
polygonal tundra of the Lena Delta showed that the mean
flux rate from the polygon depression was about 10 times
higher compared with the CH4 fluxes from the elevated
polygon rim. These differences on the ecosystem level
could be attributed to the different activity of the involved
methanogenic and methanotrophic microflora as well as
of the plant-mediated CH4 transport (Wagner et al.,
2003a; Kutzbach et al., 2004).
For the understanding and assessment of the recent
and future carbon dynamic especially in sensitive highlatitude permafrost environments and the possible feedback to the atmospheric carbon budget the microbial
processes have to be associated with the microbial
community structure and functioning. The purpose of this
study was to link methane production and oxidation activity with microbial community characteristics and the quality of dissolved organic matter in two different soils of a
typical low-centred polygon. Special emphasis was given
to the quantity and quality of water-extractable organic
carbon (WEOC) and its function as a substrate for microorganisms. For community analysis of the polygon microbiota, we employed the polar lipid assay on samples from
two soil profiles within the active layer of permafrost. The
analyses included the determination of phospholipid fatty
acids (PLFAs) and phospholipid ether lipids (PLELs) to
enable detection of members of all three domains of the
biosphere (Bacteria, Archaea and Eukarya).
Results
Soil characteristics
The microrelief formation of low-centred ice-wedge polygons leads to a small-scale variability in soil characteristics of the study site (Table 1).
The soils of the depressed polygon centre were dominated by Typic Historthels, whereas the prevalent soil type
of the elevated polygon rim was classified as Glacic Aquiturbel. The thawing depth of both soils varied between 30
and 50 cm respectively. The peaty soil of the polygon
centre was characterized by a water level near the soil
surface and a soil texture of silty sand along with anaerobic accumulation of organic matter. Accordingly, large
amounts of total organic carbon (TOC) and WEOC were
determined, ranging between 36 and 183 mg g-1 and
between 337 and 2239 mg g-1 dry weight (dw) respectively. The soils of the polygon rim were characterized by
a soil texture of silty and loamy sand, pronounced cryoturbation properties, a distinctly lower water level causing
oxic conditions in the top soil and a reduced organic
matter accumulation. This is reflected by comparatively
lower contents of TOC (21–33 mg g-1) and WEOC (238–
309 mg g-1).
Analysis of the quality of WEOC revealed an increasing
humification index (HIX) with increasing soil depth of the
polygon centre. At the same time the bioavailable waterextractable organic carbon (BWEOC) content decreased
(Fig. 1). Statistical analysis showed that both parameters
were negatively correlated (r = -0.84) at the significance
level P < 0.01.
Table 1. Selected soil properties of the depressed polygonal centre and of the elevated polygonal rim.
Horizon
Depth
(cm)
Polygon centre (Typic
Oi1
0–5
Oi2
5–10
Ajj1
10–15
Ajj2
15–20
Bg1
20–23
Bg2
23–30
Bg2
30–35
Bg3
35–40
Bg3
40–45
CH4
concentration
(mmol g-1)
Historthel)
0.15
13.19
24.37
70.50
n.d.
163.24
328.87
541.71
n.d.
Polygon rim (Glacic Aquiturbel)
Ajj
0–5
0.40
Bjjg1
5–12
0.29
Bjjg2
12–20
35.26
Bjjg2
20–27
65.75
Bjjg2
27–35
153.51
Bjjg3
35–42
224.71
Bjjg3
42–49
478.74
T
(∞C)
H2O
content (%)
pH
TOC
(mg g-1)
N
(%)
C/N
WEOC
(mg g-1)
Sand
(%)
Silt
(%)
Clay
(%)
7.5
5.8
4.0
2.7
1.2
0.4
n.d.
n.d.
n.d.
72.2
67.4
60.7
64.5
60.3
55.0
52.2
52.6
47.9
n.d.
7.9
7.4
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
183
138
137
93
70
47
36
43
49
0.51
0.43
0.36
0.23
0.19
0.16
0.15
0.18
0.22
37.0
33.1
38.3
41.5
37.6
28.6
24.6
24.1
22.6
995
2239
663
349
416
337
440
413
490
79.0
73.3
78.8
76.6
75.7
69.2
67.7
64.6
59.9
18.6
24.0
18.6
15.4
18.2
25.9
27.0
29.1
33.4
2.4
2.8
2.6
7.9
6.1
5.0
5.3
6.4
6.8
6.4
5.0
4.0
3.4
2.4
1.7
1.0
30.1
27.5
26.2
29.2
25.8
26.1
28.4
n.d.
n.d.
7.9
6.7
6.8
n.d.
n.d.
21
20
24
30
24
27
33
0.12
0.11
0.14
0.09
0.07
0.15
0.18
17.8
17.3
17.1
17.3
16.5
17.3
18.1
n.d.
238
309
n.d.
294
270
n.d.
85.7
74.3
68.0
63.7
56.5
59.3
43.7
10.4
20.6
25.8
30.3
34.5
34.0
43.8
3.9
5.0
6.3
6.0
9.1
6.7
12.5
Horizon nomenclature and soil classification according to Soil Survey Staff (1998); T, in situ temperature; TOC, total organic carbon; WEOC,
water-extractable organic carbon; n.d., not detected.
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
127
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
1584 D. Wagner, A. Lipski, A. Embacher and A. Gattinger
BWEOC [%]
40
50
60
PLEL concentration [nmol g-1]
70
80
90
0
0
1
2
3
4
0
2
4
6
A
BWEOC
HIX
10
20
r = –0.84**
(P < 0.01)
30
B
PLEL
CH4 production
CH4 oxidation
10
Soil depth [cm]
Soil depth [cm]
8
0
20
30
frozen ground
40
40
1
2
3
4
0.0
5
0.4
0.8
1.2
1.6
Rate [nmol
Humification index (HIX)
0
2
h-1
g-1]
4
6
8
Fig. 1. Vertical profiles of bioavailable water-extractable organic carbon (BWEOC) and humification index (HIX, dimensionless) for the
polygon centre. Bioavailable water-extractable organic carbon and
HIX were negatively correlated at the significance level P < 0.01.
Cross hatch indicates the frozen ground.
Fig. 2. Vertical profiles of CH4 production and oxidation under in situ
conditions as well as phospholipid ether lipid (PLEL) concentrations
for a low-centred ice-wedge polygon determined in July/August 2001.
A. Polygon rim.
B. Polygon centre.
CH4 production and oxidation
PLELs could be obtained, when substrates like acetate or
hydrogen were added to the soil samples, as shown for
the polygon centre (Fig. 3). In general, the potential CH4
production rates were significantly higher compared with
the activity under in situ conditions and reached values
between 0.7 and 10.4 nmol CH4 h-1 g-1 with acetate and
0.8–14.3 CH4 h-1 g-1 with hydrogen.
PLEL concentration [nmol g-1]
0
1
2
3
4
5
6
7
8
0
5
Soil depth [cm]
The microbial CH4 production and oxidation activity in the
soil of the polygonal rim (Glacic Aquiturbel) was much
lower and showed another distribution than those appearing in the soil of the polygon centre (Typic Historthel). No
CH4 production was found in the upper soil layers (0–8 cm
depth) of the elevated rim, which were dry and well aerated. The activity in the anoxic horizons (Bjjg) showed
values from 0.3 to 1.3 nmol CH4 h-1 g-1. The highest CH4
production was detected at the boundary to the frozen
ground at an in situ temperature of about 1∞C (Fig. 2A,
Table 1). The oxidation capacities in the same profile varied between 0.2 and 0.9 nmol CH4 h-1 g-1. The highest
oxidation rates were observed in the soil layer between
23 and 31 cm depth, where significant CH4 production
prevails. In contrast, the highest CH4 production in the
polygon centre was found in the top layer (5.7 nmol CH4
h-1 g-1), which decreased within the vertical profile and
reached the lowest activity within the bottom zone with
0.2–0.3 nmol CH4 h-1 g-1 (Fig. 2B). The CH4 oxidation
capacity was determined for the whole profile, which varied between 4.1 and 7.0 nmol CH4 h-1 g-1, except for the
boundary to the frozen ground, where no CH4 oxidation
was detectable.
Methanogenic activity and concentration of archaeal
PLELs followed the same trend in the polygon centre
(Fig. 2B). However, no overall consistency between the
CH4 production under in situ conditions and PLEL concentration was found in the polygon rim (Fig. 2A). A better
correlation between methanogenic activity and archaeal
10
15
20
PLEL
activity with acetate
activity with hydrogen
25
30
0
2
4
6
8
10
12
14
16
CH4 production rate [nmol h-1 g-1]
Fig. 3. Comparison of phospholipid ether lipid (PLEL) concentrations
and potential CH4 production after addition of acetate (20 mM) and
hydrogen (v:v; 80:20) as methanogenic substrates for the polygon
centre. Cross hatch indicates the frozen ground.
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
128
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
Effects of microbial communities on CH4 fluxes in permafrost 1585
est percentages of this PLFA were detected at 10–15 cm
soil depth for the polygon centre (zone of maximum plant
root growth) with 10.4% and in the first 5 cm of the polygon rim with 9.2%.
A shift of the overall composition of the microbiota with
depth at both sites was indicated by an increasing portion
of iso- and anteiso-branched fatty acids related to the
amount of straight-chain fatty acids. The ratio of 4.7 of
straight-chain to iso- and anteiso-branched fatty acids at
0–5 cm depths for the centre sample and of 7.2 for the
rim sample decreased to a ratio of 2.3 and 2.1, respectively, at the bottom of both soil profiles (Table 2).
Phospholipid ether lipid-derived isoprenoids (biomarker
for archaea) were detected in all samples and were highest in the soil depths 5–10 cm (4.0 nmol g-1) for the polygon centre and 20–27 cm (3.8 nmol g-1) for the polygon
rim (Table 2). Most of the samples contained only the two
ubiquitous archaeal markers phytane and biphytane (i20:0
and i40:0). Only in the soil depth 5–10 cm from the polygon centre the side-chain i20:1 was found (data not
shown), indicating the presence of acetoclastic methanogens (Gattinger et al., 2002a). The PLEL biomarker in
relation to the total phospholipid concentration increased
in both vertical profiles with increasing soil depth and
reached a maximum of 3.4% near the bottom layer of the
centre and 3.6% in 20–27 cm soil depth of the rim
(Table 2).
Phospholipid biomarker
In the polygon centre concentration of total phospholipid
biomarker (PLFA + PLEL) ranged between 15.2 and
851.6 nmol g-1 dw (Table 2). The highest values were
found in the depth between 5 and 10 cm, in contrast
to the polygon rim, where highest concentration of
total phospholipid biomarker was between 20 and
27 cm soil depths. In the polygon rim total phospholipid
biomarker concentration varied between 20.5 and
105.5 nmol g-1 dw.
For comparison of microbial community composition,
PLFA and PLEL data were subjected to principal component analysis (PCA; Fig. 4). The profiles of ester-linked
PLFAs, which are the dominating fraction of phospholipids, were similar for the centre and rim samples (Fig. 4A).
In contrast, the fraction of the unsaponifiable PLFAs and
the PLEL fraction showed different profiles for rim and
centre samples (Fig. 4B). The most important phospholipid biomarkers responsible for this separation were the
anteiso-branched unsaponifiable PLFAs (UNSFA-ant), the
straight-chain unsaponifiable PLFAs (UNSFA-nor) and
the a-hydroxylated unsaponifiable PLFAs (UNOH-a)
(Table 2). While the UNSFA-nor and the UNOH-a fractions were more abundant in the centre profile, the
UNSFA-ant fraction dominated the unsponifiable PLFA
fraction of the polygon rim.
The marker lipid for the type I methanotrophic family
Micrococcaceae, cis-8-hexadecenoic acid (16:1Dcis8),
was clearly detectable in both soils and showed its maximum concentration from 5 to 10 cm and from 20 to 27 cm
depth in the polygon centre and rim respectively (Table 2).
Cis-10-octadecenoic acid (18:1Dcis10), which is a marker
lipid for the family Methylocystaceae (type II), was not
detected in the polygon centre but at low concentrations
in the upper two horizons (0–5 cm and 5–12 cm) of the
polygon rim.
The fungal marker 18:2Dcis9,12 (Frostegard and Bååth,
1996) was detected in all investigated samples. The high-
A 6
B
R1
R4
R5
C3
C1
R3
C7
C8
-2
PC 2 (23.1%)
PC 2 (13.9%)
R6
R7
C4
1
-1
0
PC 1 (24.4%)
5
10
R-6
C-7
C-8
C-9
C-5
C-6
C-4
R-1
R-2
-2
-4
C6
R-3
0
-3
C5
C9
-5
Fig. 4. Principal component (PC) diagram of
ester-linked phospholipid fatty acids (A), as well
as unsaponifiable phospholipids and phosphoether lipids (B). The numerals 1–9 designate
the different sampling depths (R, polygon rim;
C, polygon centre).
R-7
R-4
R-5
2
R2
2
-6
-10
Permafrost, a common phenomenon in the Siberian Arctic, is controlled by climatic factors and characterized by
extreme terrain conditions and landforms (Wagner et al.,
2001). The seasonal unfrozen part of permafrost (active
layer, approximately 0.5 m thickness at the study site) is
subjected to freezing and thawing cycles during the year
with an extreme surface temperature from about 25∞C to
-45∞C. In geological timescales cryogenic processes lead
4
3
C2
Discussion
C-3
C-1
C-2
-5
-4 -3 -2 -1
0
1
2
3
4
5
PC 1 (32.4%)
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
129
Sample
ID
Depth
(cm)
PLFA + PLEL
(nmol g-1)
Non-ester-linked PLFA
PLEL
16:1Dcis8
(nmol g-1)
18:1Dcis10
(nmol g-1)
Straight/
iso + anteiso
Total
(nmol g-1)
UNSFA-nor
(nmol g-1)
UNSFA-ant
(nmol g-1)
UNOH-a
(nmol g-1)
Total
(nmol g-1)
(%)
Polygon centre (Typic Historthel)
C1
0–5
26.3
C2
5–10
851.6
C3
10–15
250.3
C4
15–20
83.5
C5
20–23
39.0
C6
23–30
23.4
C7
30–35
54.0
C8
35–40
53.0
C9
40–45
15.2
24.5
830.6
231.6
65.9
25.8
16.9
41.3
38.7
8.0
0.1
4.4
1.0
0.3
0.1
0.1
0.2
0.1
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
4.7
4.6
4.3
3.4
3.1
2.6
2.7
2.5
2.3
1.5
17.0
17.5
17.5
12.2
5.9
11.3
12.4
6.8
1.3
6.7
9.3
3.0
5.4
3.1
4.7
2.7
3.9
0.0
0.5
0.6
0.8
0.6
0.0
0.2
0.5
0.2
0.0
3.4
1.9
6.3
2.2
1.5
1.7
5.0
0.7
0.3
4.0
1.2
0.2
1.0
0.6
1.4
1.8
0.4
1.0
0.5
0.5
0.2
2.6
2.4
2.6
3.4
2.7
Polygon rim (Glacic Aquiturbel)
R1
0–5
40.7
R2
5–12
20.5
R3
12–20
24.7
R4
20–27
105.5
R5
27–35
42.3
R6
35–42
60.9
R7
42–49
53.6
33.4
17.6
18.7
82.4
32.3
50.4
38.2
0.2
0.1
0.1
0.6
0.2
0.5
0.3
0.2
0.1
0.0
0.0
0.0
0.0
0.0
7.2
5.7
3.7
2.6
2.3
2.5
2.1
7.2
2.9
5.8
19.3
9.0
10.3
13.7
0.1
0.0
0.1
0.0
0.1
0.5
0.0
2.2
1.7
2.5
3.8
3.5
3.5
2.9
0.3
0.1
0.4
1.7
0.5
0.6
1.1
0.1
0.03
0.3
3.8
1.0
0.3
1.7
0.1
0.2
1.1
3.6
2.4
0.4
3.1
Subgroups of the non-ester-linked phospholipid fatty acids (PLFAs) were the unsubstituted (UNSFA) and hydroxy-substituted fatty acids (UNOH). Subgroups of UNSFA were named according to
their functional groups: ‘-ant’ (anteiso-branching), ‘-nor’ (normal straight chain), ‘-uns’ (unsaturations). UNOH subgroups were named according to the position of the hydroxy group in the fatty
acid molecule (‘a’ or ‘mid’ position). ‘ant/iso’ describes the molar ratio of anteiso- to iso-branched ester-linked PLFAs and ‘unsat/sat’ the molar ratio of unsaturated to saturated ester-linked PLFAs.
Methane Cycle in Permafrost Ecosystems
Total
(nmol g-1)
5 Microbial Community Structure
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
Ester-linked PLFA
1586 D. Wagner, A. Lipski, A. Embacher and A. Gattinger
130
Table 2. Concentrations of selected phospholipid biomarker (PLFA and PLEL).
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure
Effects of microbial communities on CH4 fluxes in permafrost 1587
to the formation of patterned grounds like the low-centred
ice-wedge polygons of the investigation area in the Lena
Delta. During the summer period soils within these polygons are also showing a large temperature gradient along
their depths profiles, which is one of the main environmental factors influencing the microbial community in permafrost soils. The presented results revealed differences
between the microrelief elements of the investigated polygon (elevated rim and depressed centre) in CH4 fluxes,
the microbial community structure and soil characteristics
on the ecosystem scale (centimetres to metres).
Activities of methanogens and methanotrophs differed
significantly in their rates and distribution patterns among
the two investigated permafrost profiles. While the CH4
production and oxidation in the polygon rim showed the
typical activity patterns as known from other hydromorphic soils (Krumholz et al., 1995), which means no or less
activity in the dry and oxic upper horizons and increasing
rates in the anoxic bottom layers, this is not the case in
the polygon centre. Here the highest CH4 production
occurred in the upper soil horizons with a redox potential
of about -50 mV, as shown in former studies at the same
investigation site (Fiedler et al., 2004). This is not the
appropriate redox regime for CH4 production. However, it
was shown that a complex community composed by aerobic and facultative anaerobic microorganisms together
with a certain soil matrix enables CH4 production under
oxic conditions (Wagner et al., 1999). Integrated analyses
of phospholipid biomarker revealed soil layers with a good
relationship between the concentrations of archaeal
PLELs as well as total phospholipid biomarker (indicator
for microbial biomass) and CH4 production under in situ
conditions but there were other zones in the profiles without any correlation between both parameters (Fig. 2).
Nevertheless, a stronger relationship was observed when
archaeal PLEL concentration was compared with potential CH4 production, as shown for the polygon centre. This
finding indicates a substrate limitation for methanogenesis although organic carbon is highly accumulated in permafrost soils. Subsequent organic matter analyses
revealed a decrease of BWEOC along with an increasing
HIX with increasing soil depth. Accordingly, WEOC
showed the highest values in the soil horizons of highest
methanogenesis and archaeal PLEL concentration
(Tables 1 and 2).
CH4 oxidation capacities followed the curve of CH4 production in the polygon rim, whereas in the centre CH4
oxidation capacities were relatively high within the whole
profile with exception of the bottom layer. The signature
PLFA 18:1Dcis10 for the two methanotrophic genera
Methylosinus and Methylocystis of the a-Proteobacteria
was detected only in the polygon rim at 0–12 cm soil
depth. In contrast, the PLFA 16:1Dcis8 indicative for the
genera Methylomonas, Methylomicrobium, Methylosa-
rcina and Methylosphaera (Bowman et al., 1993; 1997;
Wise et al., 2001) was in accordance with the CH4
oxidation capacities in both soils. In situ labelling of
corresponding samples with 13C-enriched CH4 supported
our findings and revealed a significantly higher incorporation of labelled carbon into PLFAs belonging to type I
methanotrophs (U. Zimmermann and A. Gattinger,
unpublished results), all of them belonging to the group
of g-Proteobacteria. Furthermore, cell numbers of gProteobacteria determined by FISH were closely correlated with the CH4 oxidation profile in the polygon centre
(Kobabe et al., 2004). The activity of methanotrophic bacteria in the bottom layer of permafrost soils can be
explained by high substrate affinity of type I methanotrophs (Hanson and Hanson, 1996) and by the plantmediated transport of O2 into the rhizosphere (Kutzbach
et al., 2004).
The high variability of environmental conditions within
the polygon is reflected by the large differences in CH4
emission from the different areas of this microrelief
obtained by long-term studies since 1998. For example,
in 1999 the mean flux rate of the polygon centre measured
from the end of May to the beginning of September was
53.2 mg CH4 m-2 day-1, while the dryer rim part showed a
mean value of 4.7 mg CH4 m-2 day-1 (Wagner et al.,
2003a). The reason for this large spatial variability in CH4
emission can be explained by the activity patterns of
methanogens and methanotrophs, which are interacting
with complex microbial communities. These showed differences in biomasses and structures between polygon
rim and centre as revealed in the presented study by
detailed phospholipid profiling. UNSFA-nor, UNSFA-ant
and UNOH-a were identified as three of most responsible
PLFAs for separation into the two major groups ‘rim samples’ and ‘centre samples’ according to PCA. UNSFA-nor
occur, for example, in high concentrations in fermentative
bacteria such as Clostridia (Gattinger et al., 2002b) and
in moderate concentrations in methanogens isolated from
the investigation site as shown by 13C-acetate labelling
experiments (D. Wagner and A. Gattinger, unpublished
results). UNSFA-ant were found in high concentrations in
Cytophaga sp., whereas UNOH-a were determined in
Alcaligenes sp. and Flavobacterium sp. (Zelles, 1999).
Although permafrost environments are characterized by
extreme temperature conditions, the CH4 emissions from
these ecosystems (219–329 kg C ha-1 a-1; calculated
from Wagner et al., 2003a) are in the same range compared with boreal (190–480 kg C ha-1 a-1; Martikainen
et al., 1995) or temperate fens (11–293 kg C ha-1 a-1;
Augustin et al., 1996). The maximal values for microbial
biomass (total phospholipid biomarker concentrations) of
105.5 and 851.6 nmol g-1 dw for the polygon rim and centre, respectively, are significantly higher than in arable
soils (35.2–59.4 nmol g-1, Zelles, 1999; Gattinger et al.,
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
131
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
1588 D. Wagner, A. Lipski, A. Embacher and A. Gattinger
2002a), rice paddies (44.7–90.9 nmol g-1 dw, Bai et al.,
2000) and boreal Swedish peatlands (0.2–7.0 nmol g-1
wet peat, Sundh et al., 1997). The maximum value of
851.6 nmol g-1 determined in the polygon centre is within
the range of a landfill cover soil studied by Börjesson and
colleagues (2004).
The function of the cell membranes especially at low
temperatures is highly dependent on the fluidity of the
membrane (Ratledge and Wilkinson, 1988). There are
several mechanisms known for the adaptation of the
membrane fluidity under cold conditions. These are
increases of the proportion of anteiso-branched to isobranched fatty acids or of unsaturated to saturated fatty
acids, because anteiso-branched fatty acids and unsaturated fatty acids have significantly lower melting points
than their iso-branched and saturated analogues
(Kaneda, 1991). At the study site the mean anteiso/iso
ratio was 1.2 for the polygon centre and the rim respectively. Furthermore, the mean unsaturated/saturated ratio
was 1.4 for the polygon centre and 1.6 for the rim. These
ratios were significantly higher than those from esterlinked PLFAs determined for temperate soil microbial
communities, which showed anteiso/iso ratios from 0.3 to
0.9 and unsaturated/saturated ratios from 0.1 to 0.5 (calculated from data of Zelles and Bai, 1994).
These findings along with the determined CH4 production and oxidation activities, which were independent of
the temperature gradient in the active layer, show an
adaptation of the microbial community to the low permafrost temperatures. This is also in accordance with the
determination of high cell numbers of 1.2 ¥ 108 cells per
gram of soil in the boundary layer to the permafrost in the
polygon centre, which had a relatively constant temperature regime of 1∞C (Kobabe et al., 2004). In the same
study only a minor part of the Eubacteria (EUB)-positive
staining cells could be identified in the bottom layers by
the common FISH probes, which shows on the one hand
that a large part of species did not fit into the phylogenetic
groups detected with used FISH probes and on the other
hand it indicates probably a large number of unknown
organisms in permafrost soils.
Although the fungal PLFA 18:2Dcis9,12 occurs also in
a few bacterial species (see Zelles, 1997), one can
assume the presence of fungi (Domain Eukarya) for the
investigated soils. Hence it can be concluded that microbial communities in the active layer of an Arctic polygon
tundra are composed by members of all three domains of
life (Archaea, Bacteria and Eukarya) yielding a total biomass comparable to temperate soil ecosystems (Zelles,
1999; Bai et al., 2000; Gattinger et al., 2002a). At the
same time the composition of the microbial communities
and the activities of methanogens and methanotrophs are
mainly influenced by the microrelief formed by cryogenic
processes, which leads to different microenvironments.
The permafrost environment forces the adaptation of the
microbial communities to low temperature conditions with
a significant proportion of unknown species. Although the
total amount of organic carbon in the depressed centre is
significantly higher compared with the elevated rim, the
methanogenesis is substrate limited because of a
decreasing bioavailability of organic carbon within the soil
profile. This is an important finding for modelling and calculating trace gas fluxes from permafrost environments,
because the known models consider only the total carbon
amount. Further integrative analyses are planed for
detailed functioning analysis and forecasting of the development of permafrost environments under changing climate conditions.
Experimental procedure
Study site
Within the framework of the Russian–German cooperation
‘System Laptev Sea 2000’ an expedition to Northern Siberia
was carried out in summer 2001 (Pfeiffer and Grigoriev,
2002). The study site Samoylov Island (N 72∞22, E 126∞28)
lies within the active and youngest part (about 8500 years)
of the Lena Delta, which is one of the largest deltas in the
world with an area of 32 000 km-2 (Are and Reimnitz, 2000).
It is located at the Laptev Sea coast between the Taimyr
Peninsula and the New Siberian Islands in the zone of continuous permafrost. The Lena Delta is characterized by an
arctic continental climate with low mean annual air temperature of -14.7∞C (Tmin = -48∞C, Tmax = 18∞C) and a low mean
annual precipitation of 190 mm.
Soil and vegetation characteristics vary in rapid succession
at the investigation site due to the patterned ground of lowcentred ice-wedge polygons, which were formed by the
annual freezing–thawing cycles. Accordingly, one investigation profile was located in the depressed polygonal centre
and the other one at the elevated polygonal rim. The distance
between the two investigated soils was about 10 m. The soil
surface of the polygon depression was about 0.5 m below the
surface of the elevated rim part. Further details of the study
site were described previously by Wagner and colleagues
(2003a).
Soil properties
Vertical profiles of soil CH4 concentrations were obtained
from both the elevated rim and the depression centre of the
polygon by extracting CH4 from soil pore water by injection
of 5 ml of water into saturated NaCl solution, shaking the
solution and subsequently analysing the CH 4 headspace
concentration with gas chromatography. Soil temperature
measurements (Greisinger GTH 100/2 equipped with Ni-CrNi temperature sensor) were carried out during the experiments of CH4 production and oxidation under in situ
conditions (5 cm increments from 0 to 40 cm soil depth).
The investigated soils were classified according to the US
Soil Taxonomy (Soil Survey Staff, 1998). Soil properties were
described during sampling (horizontal stepwise) according to
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
132
Methane Cycle in Permafrost Ecosystems
5 Microbial Community Structure
Effects of microbial communities on CH4 fluxes in permafrost 1589
Schoeneberger and colleagues (2002) and soil chemical and
physical analyses were performed according to Schlichting
and colleagues (1995). Samples were filled into 250 ml Nalgene boxes and transported in frozen conditions to Germany.
Further details of the sample procedure were described elsewhere (Kobabe et al., 2004).
CH4 production and oxidation
The CH4 production and oxidation capacity of the soils were
analysed in summer (July to August) 2001. The CH4 production was studied considering the in situ soil temperature gradient and different methanogenic substrates like H2 and
acetate (CH4 production potential). Fresh soil material (20 g)
from different soil horizons was weighed into 100 ml glass
jars and closed with a screw cap containing a septum. The
samples were evacuated and flushed with ultrapure N2 (in
situ CH4 production). In the case of analysing the CH4 production potential fresh soil material was supplied with 6 ml of
acetate solution (10 mM) or with sterile and anoxic tap water
in combination with H2/CO2 (80:20 v/v, pressurized 150 kPa)
as methanogenic substrates. The CH4 oxidation capacity
was studied considering the in situ CH4 concentration and
the natural soil temperature gradient. Fresh soil material
(5 g, well homogenized) from different soil horizons was
weighed into 50 ml glass jars and closed with a screw cap
with septum. The samples were supplied with about
2000 p.p.m. CH4 (corresponding to about 800 mmol CH4 l-1
pore water) in synthetic air. The prepared soil samples were
restored for incubation in the same layers of the soil profile
from which the samples had been taken. Three replicates
were used for each layer. Gas samples were taken every
24 h for CH4 production and every 12 h for CH4 oxidation out
of the jars headspace with a gastight syringe. CH4 production and oxidation rates were calculated from the linear
increase or decrease in CH4 concentration analysed by gas
chromatography.
quantified for dissolved organic carbon using catalytic high
temperature combustion (680∞C) with a Shimadzu® TOC
5050A analyser. Non-organic carbon was removed by acidification and purging the samples with pure O 2 for 2 min
before measurement. The WEOC concentrations were
referred to weighted soil mass (dry matter) and expressed as
mg C g-1 dry matter.
Water-extractable organic carbon quality was quantified
using optical measurements (UV absorption and fluorescence emission intensity). The fluorescence emission intensity was measured between 300 and 480 nm with an
excitation wavelength of 254 nm (Cary Eclipse F-4500,
Varian®). Before measurement, soil extracts were adjusted to
pH 2, due to the influence on soil pH on fluorescence of
organic molecules (Zsolnay et al., 1999). Based on the fact
that highly substituted aromatic structures and condensed
unsaturated systems fluoresce in the longer wavelength and
fresh, non-humified organic matter fluoresce in the shorter
wavelength (Senesi et al., 1989), the HIX was calculated by
dividing the upper quartile (435–480 nm) of the whole spectrum through the lower quartile (300–345 nm). The higher the
(dimensionless) HIX, the more dissolved organic carbon in
the samples is humified (Zsolnay, 2003).
Bioavailable water-extractable organic carbon was quantified mixing 5 ml of WEOC extract with 2 ml of nutrient solution
(1 ml of NH4NO3 + 1 ml of K2HPO4, each at a concentration
of 1 g l-1) in Teflon vessels. After adding 30 ml of soil inherent
inoculum (reference culture, obtained from the supernatant
of a suspension of 50 g of pooled sample from rim and centre
soil – each horizon in equal amounts – with 50 ml of drinking
water) the closed vessels were incubated in the dark at room
temperature for 7 days. Bioavailable water-extractable
organic carbon was calculated by subtraction of WEOCday 0 –
WEOCday 7 and expressed in percentage of the initial
WEOCday 0. For further descriptions as well as for advantages
and disadvantages of this method see Marschner and Kalbitz
(2003)
CH4 analysis
Lipid extraction of soil samples
CH4 concentrations were determined with a gas chromatograph (Chrompack GC 9003) in the field laboratory. The
instrument was equipped with a Poraplot Q (100/120 mesh,
20 m) capillary column and a flame ionization detector (FID).
Details of CH4 analysis were described previously (Wagner
et al., 2003b).
Lipids were extracted from a fresh soil sample equivalent to
a dry weight of 50 g, according to the Bligh-Dyer method as
described elsewhere (Zelles and Bai, 1993). The resulting
lipid material was fractionated into neutral lipids, glycolipids
and phospholipids on a silica-bonded phase column (SPESI; Bond Elute, Analytical Chem International, CA, USA) by
elution with chloroform, acetone and methanol respectively.
Total and water-extractable organic carbon
Total organic carbon was analysed with an element analysator (Elementar Vario EL) using dried and homogenized soil
samples. Before analysis the samples were treated with HCl
(10%) at 80∞C for carbonate removal.
The WEOC was quantified with a batch extraction method.
Frozen soil samples were extracted with a 10 mM CaCl2
solution using a soil:extractant ratio (w/w) of 1:10 and shaking
for 10 min in an overhead shaker. Subsequently, the suspensions were centrifuged for 15 min (4000 r.p.m.) and the
supernatants were filtered through 0.45 mm polycarbonate
filters (Millipore, Eschborn, Germany). Filtered solutions were
Determination of PLFAs and PLELs
Both assays are based on the determination of phospholipid
side-chains. An aliquot of the phospholipid fraction equivalent
to 12.5 g of soil dw was taken for PLFA analysis. After mild
alkaline hydrolysis, the lipid extract was separated into OHsubstituted ester-linked PLFAs, non-OH-substituted esterlinked PLFAs and unsaponifiable lipids following procedures
described elsewhere (Zelles and Bai, 1993).
The fraction of unsubstituted ester-linked PLFAs was
reduced to dryness under nitrogen and dissolved in 100 ml of
hexane supplemented with nonadecanoic methyl ester as
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
133
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
1590 D. Wagner, A. Lipski, A. Embacher and A. Gattinger
internal standard. The analyses of the fatty acid methyl ester
(FAME) extracts were performed by GC/MS as described
previously (Lipski and Altendorf, 1997). The position of double bonds of monounsaturated fatty acids was determined by
analysing the dimethyl disulfide (DMDS) adducts (Nichols
et al., 1986). Quantification of 16:1Dcis8 and 18:1Dcis10 (signature PLFAs for methanotrophic bacteria; Bowman et al.,
1993) was based on the abundance of characteristic ions of
their DMDS adducts.
The fraction of unsaponifiable lipids was cleaved during
acidic alkaline hydrolysis and the resulting non-ester-linked
PLFAs were separated into OH-substituted non-esterlinked PLFAs (UNOH) and non-OH-substituted non-esterlinked PLFAs (UNSFA). Separation of the non-ester-linked
PLFAs, derivatization and measurement were performed
according to Gattinger and colleagues (2002b). Subgroups
of UNSFA were named according to their functional groups:
‘-ant’ (anteiso-branching), ‘-nor’ (normal straight chain), ‘-uns’
(unsaturations). The positions of double bonds were given
from the carboxyl group of the fatty acid molecule according
to the recommendations of the IUPAC-IUB Commission on
biochemical nomenclature (IUPAC-IUB Commission on biochemical nomenclature, 1977). Another aliquot of the phospholipid fraction equivalent to 25.0 g of soil dw was used for
PLEL analysis according to Gattinger and colleagues (2003).
After the formation of ether core lipids, ether-linked isoprenoids were released following cleavage of ether bonds
with HI and reductive dehalogenation with Zn in glacial acetic
acid. The resulting isoprenoid hydrocarbons were dissolved
in 100 ml of internal standard solution (nonadecanoic methyl
ester) and subjected to GC/MS analysis at operating conditions described elsewhere (Gattinger et al., 2003). PLFA/
PLEL concentrations are expressed in nmol g-1 dw.
Statistical analysis
Statistical analyses were carried out using Systat 10. Concentrations of the individual PLFAs and PLELs were subjected to PCA to elucidate major variation patterns.
Functional subgroups of UNSFA and UNOH were included
(see Zelles, 1999) in the PCA data set to ease interpretation
of the PCA result as both fractions were compiled by 20–40
different single compounds (data not shown). There was no
significant influence on the PCA results, if single compounds
of UNSFA and UNOH or their functional subgroups were
used.
Acknowledgements
The authors wish to thank the Russian–German field parties
(Ekaterina Abramova, Dimitry Bolshiyanov, Svenja Kobabe,
Anja Kurchatova, Lars Kutzbach, Eva Pfeiffer, Günter ‘Molo’
Stoof and Christian Wille) during the expedition Lena 2001.
Special thanks go to Dmitri Melnitschenko (Hydro Base Tiksi)
and Waldemar Schneider (Alfred Wegener Institute for Polar
and Marine Research) for logistic support during the expedition. The study is part of the German–Russian project The
Laptev Sea System (03G0534G), which was funded by the
German Ministry of Education and Research (BMBF) and
the Russian Ministry of Research and Technology.
References
Are, F., and Reimnitz, E. (2000) An overview of the Lena
River Delta settings: geology, tectonics, geomorphology,
and hydrology. J Coastal Res 16: 1083–1093.
Augustin, J., Merbach, W., Schmidt, W., and Reining, E.
(1996) Effect of changing temperature and water table on
trace gas emission from minerotrophic mires. J Appl Bot
70: 45–51.
Bai, Q., Gattinger, A., and Zelles, L. (2000) Characterisation
of microbial consortia in paddy rice soil by phospholipid
analysis. Microbiol Ecol 39: 273–281.
Börjesson, G., Sundh, I., and Svensson, B. (2004) Microbial
oxidation of CH4 at different temperatures in landfill cover
soils. FEMS Microbiol Ecol 48: 305–312.
Bowman, J.P., Sly, L.I., Nichols, P.D., and Hayward, A.C.
(1993) Revised taxonomy of the methanotrophs: description of Methylobacter gen. nov., emendation of Methylococcus, validation of Methylosinus and Methylocystis species,
and a proposal that the family Methylococcaceae includes
only the group I methanotrophs. Int J Syst Bacteriol 43:
735–753.
Bowman, J.P., McCammon, S.A., and Skerratt, J.H. (1997)
Methylosphaera hansonii gen. nov., sp. nov., a psychrophilic, group I methanotroph from Antarctic marine-salinity,
meromictic lakes. Microbiology 143: 1451–1459.
Cao, M., Marshall, S., and Gregson, K. (1996) Global carbon
exchange and methane emissions from natural wetlands:
application of a process-based model. J Geophys Res
101(D9): 14399–14414.
Christensen, T.R., Prentice, I.C., Kaplan, J., Haxeltine, A.,
and Sitch, S. (1996) Methane flux from northern wetlands
and tundra: an ecosystem source modelling approach. Tellus 48B: 651–660.
Dunfield, P., Knowles, R., Dumont, R., and Moore, T.R.
(1993) Methane production and consumption in temperate
and subarctic peat soils: response to temperature and pH.
Soil Biol Biochem 25: 321–326.
Fiedler, S., Wagner, D., Kutzbach, L., and Pfeiffer, E.-M.
(2004) Element redistribution along hydraulic and redox
gradients of low-centred polygons, Lena Delta, Northern
Siberia. Soil Sci Soc Am J 68: 1002–1011.
Frostegard, A., and Bååth, E. (1996) The use of phospholipid
fatty acid analysis to estimate bacterial and fungal biomass
in soil. Biol Fert Soils 22: 59–65.
Fung, I., John, J., Lerner, J., Matthews, E., Prather, M.,
Steele, L.P., and Fraser, P.J. (1991) Three-dimensional
model synthesis of the global methane cycle. J Geophys
Res 96D: 13033–13065.
Gattinger, A., Ruser, R., Schloter, M., and Munch, J.C. (2002a)
Microbial community structure varies in different soil zones
of a potato field. J Plant Nutr Soil Sci 165: 421–428.
Gattinger, A., Schloter, M., and Munch, J.C. (2002b) Phospholipid etherlipid and phospholipid fatty acid fingerprints
in selected euryarchaeotal monocultures for taxonomic
profiling. FEMS Microbiol Lett 213: 133–139.
Gattinger, A., Günthner, A., Schloter, M., and Munch, J.C.
(2003) Characterisation of Archaea in soil ecosystems by
polar lipid analysis. Acta Biotechnol 23: 21–28.
Hanson, R.S., and Hanson, T.E. (1996) Methanotrophic bacteria. FEMS Microbiol Rev 2: 439–471.
© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1582–1592
134
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
5.3
1
Methanogenic communities in permafrost-a¡ected soils of the
Laptev Sea coast, Siberian Arctic, characterized by16S rRNA gene
¢ngerprints
Lars Ganzert1, German Jurgens2, Uwe Münster3 & Dirk Wagner1
1
Alfred Wegener Institute for Polar and Marine Research, Potsdam, Germany; 2Department of Applied Chemistry and Microbiology, Division of
Microbiology, University of Helsinki, Helsinki, Finland; and 3Tampere University of Technology, Institute of Environmental Engineering and
Biotechnology, Tampere, Finland
Correspondence: Dirk Wagner, Alfred
Wegener Institute for Polar and Marine
Research, Telegrafenberg A43, D-14469
Potsdam, Germany; Tel.: 149 331 288 2159;
fax: 149 331 288 2137; e-mail:
[email protected]
Received 8 May 2006; revised 13 July 2006;
accepted 14 July 2006.
DOI:10.1111/j.1574-6941.2006.00205.x
Editor: Max Häggblom
Keywords
archaea; methanogenic diversity; 16S rRNA
gene; DGGE; methane; permafrost soils.
Abstract
Permafrost environments in the Arctic are characterized by extreme environmental
conditions that demand a specific resistance from microorganisms to enable them
to survive. In order to understand the carbon dynamics in the climate-sensitive
Arctic permafrost environments, the activity and diversity of methanogenic
communities were studied in three different permafrost soils of the Siberian
Laptev Sea coast. The effect of temperature and the availability of methanogenic
substrates on CH4 production was analysed. In addition, the diversity of
methanogens was analysed by PCR with specific methanogenic primers and by
denaturing gradient gel electrophoresis (DGGE) followed by sequencing of DGGE
bands reamplified from the gel. Our results demonstrated methanogenesis with a
distinct vertical profile in each investigated permafrost soil. The soils on Samoylov
Island showed at least two optima of CH4 production activity, which indicated a
shift in the methanogenic community from mesophilic to psychrotolerant
methanogens with increasing soil depth. Furthermore, it was shown that CH4
production in permafrost soils is substrate-limited, although these soils are
characterized by the accumulation of organic matter. Sequence analyses revealed
a distinct diversity of methanogenic archaea affiliated to Methanomicrobiaceae,
Methanosarcinaceae and Methanosaetaceae. However, a relationship between the
activity and diversity of methanogens in permafrost soils could not be shown.
Introduction
Arctic tundra wetlands are an important source of the
climate-relevant greenhouse gas methane (CH4). The estimated methane emissions from these environments varies
between 20 and 40 Tg year 1 CH4, which corresponds to up
to 8% of the global warming (Cao et al., 1996; Christensen
et al., 1999). The degradation of organic matter is slow, and
large amounts of organic carbon have accumulated in these
environments as a result of the extreme climate conditions
with long winters and short summers (Gorham, 1991), and
the wet conditions in the soils during the vegetation period.
Arctic wetlands could therefore be significant for the development of the Earth’s climate, because the Arctic is observed
to heat up more rapidly and to a greater extent than the rest
of the world (Hansen et al., 2005). In particular, the melting
of permafrost and the associated release of climate-relevant
trace gases driven by intensified microbial turnover of
FEMS Microbiol Ecol xx (2006) 1–13
organic carbon represent a potential environmental hazard
(IPCC, 2001). However, the control mechanisms of methane
production, oxidation and emission from tundra environments are still not completely understood.
Permafrost relates to permanently frozen ground with a
shallow surface layer of several centimetres (the active layer)
that thaws only during the short summer period. The
seasonal freezing and thawing of the active layer, with
extreme soil temperatures varying from about 118 1C to
35 1C, leads to distinct geochemical gradients in the soils
(Fiedler et al., 2004). During the short arctic summer,
permafrost soils also show a large temperature gradient
along their depth profiles, and this is one of the main
environmental factors that influence the microbial communities in these extreme habitats (Kotsyurbenko et al., 1993;
Wagner et al., 2003). Water is another important factor for
microbial life in these environments. The seasonal thawing
of the upper permafrost promotes water saturation of the
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
135
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
2
soils, leading to anaerobic degradation of complex organic
matter to simple compounds, such as acetate, H2, CO2,
formate and methanol, by fermentative bacteria. These
compounds serve as substrates for methanogenic archaea,
which are responsible for the production of CH4 (Garcia
et al., 2000).
Methanogenic archaea, which belong to the kingdom
Euryarchaeota, are ubiquitous in anoxic environments. They
can be found both in moderate habitats such as rice paddies
(Grosskopf et al., 1998a), lakes (Jurgens et al., 2000; Keough
et al., 2003) and freshwater sediments (Chan et al., 2005), as
well as in the gastrointestinal tract of animals (Lin et al.,
1997) and in extreme habitats such as hydrothermal vents
(Jeanthon et al., 1999), hypersaline habitats (Mathrani &
Boone, 1995) and permafrost soils and sediments (Kobabe
et al., 2004).
Several studies have revealed the presence of methanogens
in high-latitude peatlands by finding sequences of 16S rRNA
gene and methyl coenzyme M reductase (mcrA) genes
affiliated with Methanosarcinaceae, Methanosaetaceae,
Methanobacteriaceae and Methanomicrobiales (Galand
et al., 2002; Basiliko et al., 2003; Galand et al., 2003;
Kotsyurbenko et al., 2004; Hj et al., 2005). It has recently
been shown using FISH and phospholipid analyses that the
active layer of Siberian permafrost is colonized by high
numbers of bacteria and archaea with a total biomass
comparable to that of temperate soil ecosystems (Kobabe
et al., 2004; Wagner et al., 2005).
The present investigation is part of a long-term study on
carbon dynamics and microbial communities in permafrost-affected environments in the Lena Delta, Siberia
(Hubberten et al., 2006). The overall purpose of this study
was a basic characterization of the methanogenic communities in different extreme habitats of the Laptev Sea coast
using both physiological and molecular ecological methods.
DNA was extracted from the active layer of three vertical
permafrost profiles and analysed by PCR with primers
specific for 16S rRNA genes of methanogenic archaea and
by denaturing gradient gel electrophoresis (DGGE) followed
by sequencing of DNA bands reamplified from the gels. In
addition, the potential methane production was analysed
under various temperature and substrate conditions.
Materials and methods
Study sites and sample collection
Soil samples were collected at various sites on the Laptev Sea
coast, northeast Siberia during two Russian–German expeditions in 2002 and 2003. The investigation sites were
located in the Lena River Delta on Samoylov Island
(72122 0 N, 126128 0 E) and in the Lena–Anabar lowland on
the Nuchcha Dzhiele river near Cape Mamontovy Klyk
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
136
L. Ganzert et al.
(73136 0 N, 117120 0 E). Both study sites are located in the
zone of continuous permafrost and are characterized by an
Arctic continental climate with a mean annual air temperature of 14.7 1C (Tmin = 48 1C, Tmax = 18 1C) and a mean
annual precipitation of about 190 mm. Further details of the
study sites can be found in Schwamborn et al. (2002) and
Wagner et al. (2003).
Soil and vegetation characteristics show great variation
over small distances owing to the geomorphological situation of the study sites (Fiedler et al., 2004; Kutzbach et al.,
2004). Two sites were chosen for sampling on Samoylov
Island, a floodplain (FP) and a polygon centre (PC). The
floodplain was characterized by recent fluvial sedimentation, whereas the polygon centre was characterized by peat
accumulation with interspersed sand layers. The vegetation
at the floodplain site was dominated by Arctophila fulva. In
the polygon centre, typical plants were Sphagnum mosses,
Carex aquatilis and lichens. The sampling site at Cape
Mamontovy Klyk (MAK) was located in a small low-centre
polygon plain. The vegetation here differed from that of the
polygon centre on Samoylov Island and was dominated by
Eriophorum spp., Carex aquatilis, some Poaceae and mosses.
For soil sampling, vertical profiles were arranged and
samples were taken from defined soil horizons for physicochemical (e.g. CH4 concentration, dissolved organic carbon
and total organic carbon contents) and microbiological (e.g.
potential CH4 production, DNA-based analyses) analyses.
The samples for microbiological analyses were placed in
250-mL sterile Nalgene boxes, which were immediately
frozen at 22 1C. For detailed investigations, horizons with
a thickness of more than 10 cm were divided and subsamples
were taken. Continuous cooling at 22 1C was guaranteed
for the sample transport from the Lena Delta (Siberia) to
Potsdam (Germany). Samples were thawed at 4 1C and used
directly for the analyses, or subsamples were separated and
refrozen for later analyses at 22 1C.
Soil properties
The investigated soils were classified according to US Soil
Taxonomy (Soil Survey Staff, 1998). The depth of the
permafrost table was measured by driving a steel rod into
the unfrozen soil until frozen ground was encountered. The
water table was measured in perforated plastic pipes that
were installed in the active layer. Soil temperature measurements (a Greisinger GTH 100/2 equipped with a Ni–Cr–Ni
temperature sensor) were carried out in each horizon before
soil sampling.
Vertical profiles of soil CH4 concentrations were obtained
by extracting CH4 from fresh soil samples by adding 10 g of
soil to saturated NaCl solution, shaking the solution, and
subsequently analysing the CH4 headspace concentration
with gas chromatography.
FEMS Microbiol Ecol xx (2006) 1–13
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
3
Methanogenic communities in permafrost-affected soils
Dissolved organic carbon (DOC) was extracted from
various horizons of the soil profiles. Fresh soil material
(9 g) was taken from each horizon, weighed into glass jars
(50 mL) and mixed with 45 mL of distilled water. The bottles
were closed and shaken for 1 h in the dark. Afterwards, the
suspension was filtered (0.45-mm mesh, Gelman Science)
and the clear solution was inactivated by the addition of
sodium azide. The DOC analysis was carried out with an
Elementar High-TOC-II. Total organic carbon (TOC) and
total nitrogen (TN) were analysed with an element analysator (Elementar Vario EL) using dried and homogenized
soil samples. Prior to analysis the samples were treated with
HCl (10%) at 80 1C for carbonate removal.
CH4 production rates
The influence of temperature, as well as of different substrates (no substrate, methanol or H2/CO2), on microbial
CH4 production was determined for each horizon. The
substrates were chosen according to previous results obtained for the same study site, which showed that hydrogen
is more important than acetate for methanogenesis in
permafrost soils (Wagner et al., 2005), while no information
is available on the importance of methanol as a methanogenic substrate in permafrost environments. Under anoxic
conditions, 30-mL glass bottles were filled with 10 g of soil
material, and 3 mL of sterile water was added. All bottles
were sealed with sterile butyl rubber stoppers. In the case of
methanol as additional substrate, 0.1 mL of 1 M methanol
stock solution was added to reach a final methanol concentration of about 30 mM. Afterwards, all jars were flushed
with N2/CO2 (80 : 20 v/v). For growth with hydrogen,
samples were flushed a second time with H2/CO2 (80 : 20 v/
v, pressurized to 150 kPa). Three replicates were used for the
different experiments. The incubation temperatures were
5 1C and 18 1C. CH4 production was measured daily over a
period of one week by sampling the headspace using a
Hamilton gastight syringe. Gas analysis were performed
with an Agilent 6890 gas chromatograph equipped with a
Carbonplot capillary column (f 0.52 mm, 30 m) and a
flame ionization detector (FID). Helium was used as carrier
gas. The injector, oven and detector temperatures were set at
45, 45 and 250 1C, respectively. CH4 production rates were
calculated from the linear increase in CH4 concentration.
Samples were dried after incubation at 55 1C, and the
methane production was calculated to the dry weight.
DNA extraction and PCR amplification
DNA was extracted directly from 0.75 g of soil material using
an UltraCleanTM Soil DNA Isolation Kit (Mo Bio Laboratories Inc.), following the manufacturer’s instructions. The
quality and quantity of DNA were controlled on 0.8%
agarose gels with SYBR Gold staining.
FEMS Microbiol Ecol xx (2006) 1–13
16S rRNA gene fragments with a length of approximately
350 bp were amplified using PCR with the primer pair
GC_357F-691R specific for methanogens (Watanabe et al.,
2004). The 50-mL PCR mixture contained 1 PCR reaction
buffer, 0.25 mM of each dNTP, 2 mM MgCl2, 0.4 mM of each
primer, 2.5 U HotStarTaq DNA Polymerase (Qiagen) and
1–3 mL of DNA template, depending on the quality and
quantity of extracted DNA. In some cases, extracted DNA
from permafrost soils was diluted 10-fold. PCR was performed using an iCycler Thermal Cycler (Bio-Rad). The
amplification conditions consisted of an initial activation
step for the HotStarTaq at 94 1C for 10 min, followed by 35
cycles of 94 1C for 60 s, 53 1C for 60 s and 72 1C for 2 min,
with a final elongation step of 8 min at 72 1C. PCR products
were checked on 2% agarose gels stained with SYBR Gold
(Molecular Probes).
Denaturing gradient gel electrophoresis and
sequencing
All samples were separated on 8% polyacrylamide gels in
1 TAE buffer using a D-Code System (Bio-Rad). The
denaturing gradient ranged from 30 to 60% (100% denaturant consisted of 7 M urea and 40% (v/v) deionized
formamide). The gels were run at 60 1C, at a constant
voltage of 100 V for 14 h. After electrophoresis, the gels were
stained for 30 min with SYBR Gold (1 : 10 000 dilution) and
visualized under UV light using a GeneFlash system (Syngene).
DNA bands that appeared sharp and clear in the gel were
cut out with a sterile scalpel and were transferred to sterile
0.5-mL Eppendorf tubes. DNA was eluted overnight in
30 mL of sterile milliQ water at 4 1C. Reamplified products
with the expected migration in a new DGGE gel were
reamplified again without GC clamp. After purification,
using a QIAquick PCR Purification Kit (Qiagen), the DNA
bands were sequenced. Sequencing was done by AGOWA
GmbH (Berlin, Germany) with forward and reverse primers.
Phylogenetic analysis
Sequences were compared with those in the GenBank
database using the BLAST (www.ncbi.nlm.nih.gov/blast) and
FASTA3 (www.ebi.ac.uk) tools in order to find and include in
the analysis all closest relatives. The phylogenetic analysis of
partial 16S rRNA gene sequences was performed using the
ARB software package (www.arb-home.de; Ludwig et al.,
2004) and RAXML-IV (Stamatakis et al., 2005). The ARB_EDIT
tool of the ARB was used for automatic sequence alignment,
and the sequences were then corrected manually. A 50%
invariance criterion for the inclusion of individual nucleotide sequence positions in the analysis was used to avoid
possible treeing artifacts during construction of the ‘backbone’ trees. ‘Backbone’ trees were inferred using an
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
137
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
4
L. Ganzert et al.
algorithm of the RAXML-IV program with 685, 625 and 602
informative nucleotide positions for Methanosarcinaceae,
Methanosaetaceae and Methanomicrobiales/Rice cluster II
trees, respectively. Next, ‘backbone’ trees were exported back
to ARB and the partial sequences of the DGGE bands were
added to the trees using the parsimony addition tool of the
ARB program package. The partial 16S rRNA gene sequences
of the DGGE bands obtained in this study are available in
the EMBL/GenBank/DDBJ database under accession numbers AM259179–AM259207.
Results
Soil environmental conditions
The physicochemical soil properties of the investigated sites
showed a large vertical gradient and high small-scale variability in dependence of microrelief of the different permafrost soils (Table 1).
The soil of the polygon centre on Mamontovy Klyk was
classified as a Typic Aquiturbel. The water level reached
about 1 cm below the soil surface and the perennially frozen
ground started at 44 cm. The comparable centre soil on
Samoylov Island was a Typic Historthel, with a water table
near the soil surface and the permafrost beginning at 33 cm
depth. Both soils are characterized by peat accumulation,
with extremely high contents of organic carbon in the upper
soil layers ( 4 18%) which decrease with increasing depth of
the active layer.
The floodplain soil on Samoylov Island was classified as a
Typic Aquorthel. The water table was near the soil surface
and the permafrost started at 54 cm depth. In contrast to the
other two permafrost soils, the floodplain soil on Samoylov
Island was characterized by a silty soil texture with organic
carbon contents between 0.8 and 3.1%.
The DOC concentration varied between 4.7 and
12.8 mg L 1 on Samoylov Island polygon centre and between
2.7 and 7.8 mg L 1 on Samoylov Island floodplain. The CH4
concentration increased with increasing soil depth and
showed values from 0.15 to 541.71 mmol g 1 and from
0.002 to 0.411 mmol g 1 in the polygon centre and floodplain, respectively.
In general, the active layer of permafrost was characterized by a strong temperature gradient from top to bottom,
which ranged from 6 to 1 1C in the polygon centre on
Mamontovy Klyk, and from 17.8 to 0.8 1C and from 7.5 to
0.4 1C, respectively, for the two investigated soils on Samoylov Island.
Table 1. Selected soil properties of the investigated permafrost soils
Sample ID
Horizon
Depth (cm)
Polygon centre (Typic Aquiturbel ), Mamontovy Klyk
221
Oi1
0–6
222
Oi2
6–12
223
Bjjg1
12–17
224
Bjjg2
17–22
225
Bjjg3
22–29
226
Bjjg4
29–36
227
Bjjg5
36–44
Floodplain (Typic Aquorthel ), Samoylov Island
6941
Ai
0–5
6942
Ajj
5–9
6943
Bg1
9–18
6944
Bg2
18–20
6945
Bg3
20–35
6946
Bg4
35–40
6947
Bg5
40–52
Polygon centre (Typic Historthel ), Samoylov Island
6968
Oi1
0–5
6969
Oi2
5–10
6970
Ajj1
10–15
6971
Ajj2
15–20
6972
Bg1
20–23
6973
Bg2
23–30
6974
Bg2
30–35
6975
Bg3
35–40
6976
Bg3
40–45
T ( 1C)
6
5
4
3
2
2
1
CH4 conc. (mmol g 1)
DOC (mg L 1)
TOC (%)
TN (%)
39.4
28.1
11.2
14.1
7.6
5.5
4.5
1.42
1.23
0.73
0.90
0.52
0.40
0.27
ND
ND
17.8
14.2
8.8
ND
4.0
1.9
0.8
0.004
0.004
0.002
ND
0.035
0.114
0.411
4.5
3.8
2.7
4.4
7.8
4.9
4.8
3.1
1.1
2.2
3.0
2.5
2.0
0.8
0.4
0.2
0.3
ND
0.4
0.3
0.2
7.5
5.8
4.0
2.7
1.2
0.4
o 0.4
o 0.4
o 0.4
0.15
13.19
24.37
70.50
ND
163.24
328.87
541.71
ND
11.7
8.8
4.7
9.5
ND
11.9
12.8
ND
ND
18.3
13.8
13.7
9.3
7.0
4.7
3.6
4.3
4.9
0.51
0.43
0.36
0.23
0.19
0.16
0.15
0.18
0.22
Horizon nomenclature and soil classification according to Soil Survey Staff (1998).
T, in situ temperature; DOC, dissolved organic carbon; TOC, total organic carbon; TN, total nitrogen; ND, not determined.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
138
FEMS Microbiol Ecol xx (2006) 1–13
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
5
Methanogenic communities in permafrost-affected soils
Temperature and substrate effect on
methanogenesis
The CH4 production of the three different soils showed
significant differences in the rate of activity and vertical
distribution (Fig. 1). In general, the activity in each profile
was higher with hydrogen or methanol as additional substrate than it was without any substrate. Furthermore, the
CH4 production was much higher at 18 1C than at 5 1C.
The highest CH4 production rate within the centre soil
(Typic Aquiturbel) on Mamontovy Klyk was found with
hydrogen as substrate, followed by methanol as substrate.
Without any substrate addition, only a limited activity was
detectable (Fig. 1a and b). The activity was highest in the
two upper horizons, and decreased with increasing soil
depth.
The activity pattern of the other two studied sites on
Samoylov Island was different from that for Mamontovy
Klyk. The floodplain soil (Typic Aquorthel) showed two
maxima of CH4 production, one in the upper soil horizon
and a second in the zone with the highest root density at a
depth between 20 and 35 cm (Fig. 1c and d). Here, the
highest activity was measured in the upper soil horizon with
methanol, while the CH4 production rates in all other
horizons were higher with hydrogen as substrate.
The soil (Typic Historthel) of the polygon centre on
Samoylov Island was characterized by the highest CH4
production taking place in the upper soil horizons. This
was also observed for the comparable soil on Mamontovy
Klyk (Fig. 1e and f). However, in contrast to the latter soil,
high activity also occurred in the polygon centre on Samoylov Island in the bottom zone of the active layer close to the
Fig. 1. Vertical profiles of CH4 production for
the three study sites at 5 1C (left column) and
18 1C (right column) without any substrate as
well as with hydrogen and methanol as additional methanogenic substrates. (a and b) Typic
Aquiturbel (polygon centre on Mamontovy
Klyk); (c and d) Typic Aquorthel (floodplain on
Samoylov Island); and (e and f) Typic Historthel
(polygon centre on Samoylov Island). Dashed
lines indicate the permafrost tables.
FEMS Microbiol Ecol xx (2006) 1–13
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
139
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
6
L. Ganzert et al.
permafrost table with a temperature near to the freezing
point of water. With the exception of the bottom horizon,
where the highest CH4 production occurred with methanol,
the preferred substrate in all other horizons was hydrogen.
The effect of increasing temperature was different for the
three sites, as well as in the vertical profile of each soil.
Compared with the CH4 production at 5 1C on Mamontory
Klyk, CH4 production at 18 1C was about three times higher,
that in the floodplain soil on Samoylov Island was at least 10
times higher, and that in the polygon-centre soil on Samoylov Island was at least two times higher. In general, the
methane production activity in the upper part of the active
layer of all soils rose after the increase of temperature more
strongly than it did within the bottom part of the profiles
near the permafrost table.
DGGE analysis of permafrost soil samples
Three permafrost sites on the Laptev Sea coast were compared with regard to variation in the community structure
of methanogenic archaea from the top to the bottom of the
investigated soil profiles. DGGE profiles showed up to nine
well-defined bands per depth, and a shift within the vertical
profiles of Samoylov Island polygon centre (Typic Historthel)
and Mamontovy Klyk polygon centre (Typic Aquiturbel). In
the polygon centre on Samoylov Island (Typic Historthel),
the number of DNA bands increased to a depth of 23 cm
(zone of highest root density) and then decreased again (Fig.
2a). The number of bands in the polygon-centre soil on
Mamontovy Klyk was constant to a depth of 22 cm, with
about four DNA bands in each lane (Fig. 2b). Most DNA
bands were observed in the middle of the profile (22–29 cm
soil depth) and this number decreased with increasing soil
(a)
depth, as was also observed for the soil of the polygon centre
on Samoylov Island (Fig. 2a). Interestingly, the floodplain on
Samoylov Island showed a completely different pattern. Here,
the number of bands did not decrease with increasing depth
(Fig. 2c). Even the soil horizon close to the permafrost table
showed a diversity of methanogens comparable with the
highest diversity in the middle of the two other profiles.
Besides the number of bands, the distribution pattern
showed distinct differences, particularly within the vertical
profiles of the polygon-centre soils on Samoylov Island (soil
depth 20–23 cm compared with the bottom of the active
layer) and Mamontovy Klyk (the first horizon in comparison with the bottom of the active layer).
Some DGGE bands were found only in certain horizons,
such as PC 6970a (Methanosarcinaceae), PC 6943a, MAK
221a and MAK 221b (all Methanomicrobiaceae). Beside
these unique bands, some other bands that did not occur
throughout the whole soil profile could also be seen. For
example, DGGE bands corresponding to MAK 224a
(Methanomicrobiaceae) were found only in the middle of
the soil profile at a depth of 6–29 cm, and bands corresponding to MAK 225b (Methanosarcinaceae) were found only in
the deeper regions of the soil profile.
Phylogenetic analysis of permafrost sequences
A total of 36 DGGE bands from three soil profiles were
sequenced. Eight sequences were excluded from further
analysis because of their short ( o 200 nucleotides) length.
All sequences can be differentiated at the genus level.
Twenty-eight sequences of 16S rRNA gene fragments obtained from the investigated permafrost environments fell
within known euryarchaeotal lineages belonging to the
(b)
(c)
Fig. 2. DGGE profiles of 16S rRNA genes amplified from permafrost community DNA obtained from various horizons (thickness in centimetres from top
to bottom) of the active layer. (a) Typic Historthel (polygon centre on Samoylov Island); (b) Typic Aquiturbel (polygon centre on Mamontovy Klyk); and (c)
Typic Aquorthel (floodplain on Samoylov Island). Selected bands marked with arrows and sample IDs were used for sequence analyses.
c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
140
FEMS Microbiol Ecol xx (2006) 1–13
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
7
Methanogenic communities in permafrost-affected soils
major methanogenic groups Methanosarcinaceae (11 sequences, 98–99% homology over 312–316 nucleotides;
including three, which were 100% identical), Methanosaeta
(two sequences with 97% homology over 308 nucleotides),
and Methanomicrobiales (12 sequences, 91–99% homology
over 300–321 nucleotides), and three sequences fell within
(97% similarity) an as yet uncultivated archaea lineage
named Rice cluster II (Fig. 3a and b).
Sequences affiliated to Methanosarcinaceae and Methanomicrobiaceae were found in all studied soil profiles, whereas
ARS1-c53, AJ308911, rice straw, 724
AS08-23, AF225653, rice field soil, 749
S15-15, AJ236496, anoxic rice field soil, 733
FP6941a, AM259179, permafrost, floodplain, 327
S30-21, AJ236522, anoxic rice field soil, 712
Methanosarcina thermophila, M59140, 1406
Gap-A34, AF399343, rice field soil, Philippines, 722
AS01-22, AF225624, rice field soil, 745
DGGE-band ArcSval_14, AJ749963, Arctic wetland enrichment, 152
DGGE-band ArcSval_11, AJ749960, Arctic wetland, 152
FP6947c, AM259187, permafrost, floodplain, 208
MAK225a, AM259204, permafrost, polygon center, 318
MAK222a, AM259201, permafrost, polygon center, 328
Permafrost
PC6974a, AM259196, permafrost, polygon center, 311
PC6970a, AM259190, permafrost, polygon center, 325
cluster I
MAK225b, AM259205, permafrost, polygon center, 325
Green Bay, ARF3, AF293014, freshwater ferromanganous micronodule, 920
ACE2_A, AF142977, Antarctic maritime lake and fjord, 916
EHB216, AF374284, UK brackish and marine estuary, 1008
Methanosarcina lacustera, AF432127, anoxic lake sediment, 1372
HTA-B3, AF418927, freshwater reservoir, 920
MRR17, AY125692, rice root, 751
ARR34, AJ227945, rice roots, 737
EtOH8, Y18071, washed rice roots, 729
HTA-C1, AF418929, freshwater reservoir, 917
PC6971a, AM259191, permafrost, polygon center, 314
AS01-17, AF225619, rice field soil, 747
Methanosarcina vacuolata, U20150, 1292
SAGMA-O, AB050220, deep subsurface, Africa, 840
EtOH9, Y18072, washed rice roots, 729
ARR28, AJ227940, rice roots, 737
ArcN7, AF395424, acetate-enriched culture, 1059
Shen-A34, AF399313, rice field soil, China, 709
Methanosarcina siciliae, U20153, 1372
308A, AF276445, St. Lawrence River sediment, 879
S15-7, AJ236488, anoxic rice field soil, 736
ABS4, Y15387, anoxic flooded rice paddy soil, 704
ST1-13, AJ236464, anoxic rice field soil, 798
AS00-27, AF225596, rice field soil, 755
E30-6, AJ244302, anoxic rice field soil, 714
1A, AF276441, St. Lawrence River sediment, 881
Methanosarcina barkeri, M59144, 1439
S30-26, AJ236524, anoxic rice field soil, 715
RS300-9, AY063634, rice field soil, 761
Methanosarcina acetivorans, AE010299 AE010754, 1483
Methanosarcina mazeii, AF028691, 1467
Methanosarcina barkeri, AF028692, 1473
PC6968a, AM259188, permafrost, polygon center, 210
LMA134, U87515, sediment freshwater lake, 824
LMA126, U87516, sediment freshwater lake, 857
Methanolobus taylorii, U20154, 1411
Methanococcoides burtonii, X65537, 1472
Methanosaeta concilii, X16932, 1471
0.05
Fig. 3. Phylogenetic trees illustrating the affiliation of methanogenic 16S rRNA gene sequences reamplified from DGGE bands. The sequences
recovered from permafrost belong to Methanosarcinaceae (a), and Methanomicrobiales together with Rice cluster II (b). The ‘backbone’ trees are based
on maximum likelihood analysis of the dataset made with RAxML-IV, and partial sequences of the permafrost DGGE bands (shown in bold) were added
to these trees using the parsimony addition tool of the ARB program package. The scale bar represents 0.05 changes per nucleotide. Identification of the
bands is shown in Fig. 2. Clone name, accession number, environment and length of each sequence are indicated.
FEMS Microbiol Ecol xx (2006) 1–13
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
141
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
8
L. Ganzert et al.
Methanomicrobiales
Permafrost
cluster II
Methanospirillum and relatives
Permafrost
cluster III
Methanoculleus/Methanogenium and relatives
Rice cluster I
Rice cluster II
Permafrost cluster IV
Halobacteria
Fig. 3. Continued.
sequences associated with Methanosaeta were found only in
the floodplain and in the polygon centre on Samoylov
Island, but not in the polygon centre of Cape Mamontovy
Klyk.
c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
142
Discussion
Our results showed differences in the CH4 production
activities and the biodiversity patterns of methanogenic
FEMS Microbiol Ecol xx (2006) 1–13
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
9
Methanogenic communities in permafrost-affected soils
archaea in the investigated permafrost soils. Activities of
methanogenic archaea differed significantly in their rates
and distributions among the different soils. While the CH4
production rates in the active layer on Mamontovy Klyk
decreased with increasing soil depth, the two other sites on
Samoylov Island showed at least two activity optima. The
highest activity occurred in the upper soil horizons, which
are characterized by in situ temperatures of up to 17.8 1C.
The second optimum of methane production was found in
the middle or bottom part of the active layer in both soils on
Samoylov Island. In the floodplain soil, the highest activity
was detected in a horizon constantly exposed to temperatures below 4 1C, which indicates the dominance of methanogens that must be well adapted to the cold conditions
observed close to the permafrost table. Here, the second
activity optimum correlates with the zone of the highest root
density and amount of DOC. It is well known that plants can
supply root exudates consisting of low-molecular-weight
organic compounds, which can serve as a substrate for
methanogens (Chanton et al., 1995; Ström et al., 2003).
However, the extraordinarily high CH4 production rates in
the upper layer of Mamontovy Klyk correlates with the high
amount of organic carbon in these horizons.
The addition of different substrates led to an increase in
the potential CH4 production in all horizons of all sites. This
effect was not confined to horizons with a low content of
organic carbon, but could also be observed in horizons with
a high amount of organic carbon. Wagner et al. (2005)
reported that the humification of soil organic matter
increased with increasing soil depth. This was shown to be
reciprocally correlated with the amount of bioavailable
organic carbon. A reduced quantity and quality of organic
matter in permafrost soils could lead to a substrate-limited
methanogenesis.
The potential CH4 production at 5 1C was distinctly
different from that at 18 1C. A higher incubation temperature resulted in a marked increase of the methanogenic
activity in almost all investigated soil horizons. It is noteworthy that the effect of higher temperature on the activity
was larger in the upper soil horizons with higher in situ
temperatures than in the bottom of the active layer with
lower in situ temperatures. Hence, taking into consideration
the physiological studies, we can conclude that the activity
of methanogenic archaea in permafrost soils depends on the
quality of soil organic carbon, and our results show that
methanogens in deep active-layer zones might be better
adapted to low temperatures.
Only a few psychrophilic strains of methanogenic archaea
have been described so far (Simankova et al., 2003; Cavicchioli, 2006). However, our results indicate a shift in the
methanogenic community from mesophilic to psychrotolerant or psychrophilic methanogens with increasing soil
depth. Similar results have been obtained from permafrost
FEMS Microbiol Ecol xx (2006) 1–13
soils on Samoylov Island in the context of the methaneoxidizing community (Liebner & Wagner, 2006). An important requirement for microorganisms to adapt to cold
environmental conditions is constantly low in situ temperatures over a long period of time (Morita, 2000). This is the
case in the bottom zone of the active layer close to the
perennially frozen ground. A prerequisite for prokaryotes to
adapt to low temperatures is that their cell membranes
should maintain fluidity. This effect was shown in a related
study, carried out for the centre profile on Samoylov Island,
which revealed an increase of branched-chain fatty acids in
relation to the amount of straight-chain fatty acids with
increasing active-layer depth (Wagner et al., 2005).
The DGGE pattern of the investigated permafrost soils
showed differences within the depth profile and between the
different sites. The number of DNA bands at the floodplain
site on Samoylov Island remained fairly constant through
the whole profile. While the temperature drastically decreased with soil depth, the carbon (DOC and TOC) and
nitrogen concentrations in the profile remained relatively
constant. These geochemical profiles can be explained by the
fact that the floodplain is periodically flooded by the Lena
River. Thus the vegetation is regularly buried by the accumulation of new sediments, which causes the even distribution of organic matter in the profile. Galand et al. (2003)
reported that vegetation characterizing microsites in a
studied boreal fen influences the microbial communities in
layers with significant methane production. The similarity
of the community pattern for the whole soil profile of the
floodplain can probably be attributed to the regular sedimentation at this site, but a significant relationship between
this pattern and the methane production as reported by
Galand et al. (2003) was not determined. This is in accordance with studies in Arctic wetlands in Spitzbergen, which
found that methane fluxes depend more on the temperature
and thaw depth than on the archaeal community structure
(Hj et al., 2005).
In contrast to the profile for the floodplain site, the
polygon-centre profiles for Mamontovy Klyk and on Samoylov Island showed a variety of diversity patterns. These
soils were characterized by humus accumulation in the
upper part of the active layer, with decreasing organic matter
content in the underlying mineral soils. However, the
number of bands increased until the zone with the highest
root density, but started to decrease in the deeper zones of
the active layer. The presence of root exudates (Chanton
et al., 1995; Ström et al., 2003), as discussed earlier with
regard to the methane production activity, seems also to
affect the diversity of the methanogenic archaea in permafrost soils. Among the differences in the number of detected
DNA bands within the various horizons of the vertical
profiles, different band patterns indicated differences in the
community structure of methanogens, particularly in the
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
143
5 Microbial Community Structure
10
polygon-centre profiles on Mamontovy Klyk and on Samoylov Island. These differences refer to the bottom zone of
the active layer compared with horizons, which lie further
above in the respective profiles. A depth-related change of
the methanogenic community was also observed in northern peatlands (Galand et al., 2005).
The results of the DGGE analysis indicate changes of the
methanogenic community within the vertical soil profiles.
Some DGGE bands appeared throughout the whole profile,
while others were specific for distinct active-layer depths.
Moreover, the band pattern showed distinct differences
between specific horizons. On one hand this indicates the
presence of methanogenic archaea that can exist under
different environmental conditions (temperature, substrate,
geochemistry), which are changing within the depth of the
active layer. On the other hand, it indicates the presence of
methanogens that can exist only under defined environmental conditions. Some sequences, for example those
affiliated to Methanosarcinaceae (PC 6974a, MAK 225a),
were detected only in the cold zones ( o 3 1C) of the active
layer.
Our results indicate the presence of hydrogenotrophic,
acetotrophic and methylotrophic methanogens in the investigated permafrost soils. Sequences were affiliated with
the families of Methanomicrobiaceae, Methanosarcinaceae
and Methanosaetaceae, while members of the family Methanobacteriaceae, as shown in other studies on archaeal
diversity in northern peatlands (Hj et al., 2005; Juottonen
et al., 2005), could not be detected. One reason could be the
inhomogeneous distribution of microorganisms in soil
depending on the distribution of usable organic carbon
(Wachinger et al., 2000). Species of Methanomicrobiaceae
can grow only with hydrogen, formate and alcohols (except
methanol), Methanosarcinaceae can grow with all methanogenic substrates except formate, and members of Methanosaetaceae grow exclusively with acetate as energy source
(Hedderich & Whitman, 2005). An important finding is
the detection of hydrogenotrophic methanogens in permafrost environments, because several studies have shown that
acetate is more important as a substrate in cold than in
temperate environments (Chin & Conrad, 1995; Wagner &
Pfeiffer, 1997). However, a related study at the polygoncentre site on Samoylov Island showed that the potential
methane production in all horizons was lower with acetate
as substrate compared with the activity after hydrogen
amendment (Wagner et al., 2005). Acetate is likely to be
available only to habitats with a significant portion of
polysaccharides, which is not the case in Arctic peatlands
(Kotsyurbenko et al., 2004). Only representatives of the
genera Methanosarcina and Methanosaeta are able to use
acetate as a substrate. In particular, Methanosarcina species
prefer methanol as carbon and energy source, although
methanogenesis via acetate and hydrogen represents the
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
144
Methane Cycle in Permafrost Ecosystems
L. Ganzert et al.
main pathway of methane production in most environments
(Conrad, 2005). The significance of methanol, which is
derived from pectin or lignin (Schink & Zeikus, 1982), for
methanogenesis in permafrost environments was verified by
this study for the floodplain site on Samoylov Island.
However, unknown methanogenic archaea could make a
contribution to hydrogenotrophic methanogenesis at low
temperatures. An indication for this assumption is the
presence of sequences affiliated with the order Methanomicrobiales that could be detected in deeper layers of all studied
sites. One of the few known psychrophilic H2using methanogens that belongs to this group of methanogens is
Methanogenium frigidum (Franzmann et al., 1997), which
was isolated from an Antarctic sediment.
Detailed phylogenetic analysis showed that two DGGE
bands belonging to Methanosaetaceae branched very close to
each other (data not shown). Both were extracted from
relatively deep and cold (0.4–0.8 1C) soil horizons on
Samoylov Island, but had different CH4 production rates.
The closest relatives of these sequences have been detected in
environments with different physicochemical characteristics, such as rice-field soils (Lueders & Friedrich, 2000;
Ramakrishnan et al., 2001), lake sediments (Banning et al.,
2005), and an acidic bog lake (Chan et al., 2002).
Four of the Methanosarcina-like permafrost sequences
(FP6941a, FP6947c, PC6971a and PC6968a) were clustered
with cultivated methanogens (e.g. Methanosarcina barkeri)
and among numerous environmental sequences with the
closest relatives from rice-field soils (Lueders & Friedrich,
2000), freshwater environments (Stein et al., 2002) and
Arctic wetland (Hj et al., 2005; Fig. 3a). The remaining
seven sequences (two of them, FP6945a and MAK226a, were
100% identical to MAK225b) form a cluster with the closest
relative sequences ARF3 from Green Bay, recovered from a
ferromanganous micronodule (Stein et al., 2001), FP6947c,
and sequences ArcSval_11 and ArcSval_14 from Arctic wetland (Hj et al., 2005). Sequences in this Permafrost cluster I
were recovered mainly from cold layers ( o 4 1C) of the
medium-depth horizons (6–36 cm) of all the studied sites.
Similar results were obtained for the Methanomicrobialeslike permafrost sequences. Six of them were distributed
among numerous environmental sequences with closest
relatives recovered from rice roots (Lehmann-Richter et al.,
1999), PC6976a and FP6943a; acidic bog lake (Chan et al.,
2002), MAK221a; freshwater lake (Jurgens et al., 2000),
FP6944a; geothermal aquifer GAB-A01 (Kimura et al.,
2005), FP6946a; and LDS16 from Lake Dagow sediment
(Glissman et al., 2004), MAK221b (Fig. 3b). Permafrost
cluster II, which consists of three sequences from the floodplain and the polygon centre of Samoylov Island, is closely
(97–98%) related to sequences Dg2003_D_97 from Lake
Stechlin sediment (Chan et al., 2005) and MRR42 from rice
roots. Sequences were obtained from soil horizons of
FEMS Microbiol Ecol xx (2006) 1–13
5 Microbial Community Structure
Methane Cycle in Permafrost Ecosystems
11
Methanogenic communities in permafrost-affected soils
various depths (from 5 to 40 cm) and various temperatures
(from o 0.4 1C to 14.2 1C). Three sequences (PC6972a,
PC6969a and MAK224a) from polygon-centre soils (depth
5–23 cm, temperatures from 1.2 to 5.8 1C) form Permafrost
cluster III, related (with about 98% similarity) to sequences
recovered recently from rice rhizosphere (Lu & Conrad,
2005). Three other permafrost sequences (MAK224b,
MAK227a and FP6947a) recovered from polygon-centre
and floodplain soils (depth 17–56 cm) form Permafrost
cluster IV, related (with about 97% similarity) to Rice cluster
II (Grosskopf et al., 1998b). The first representative of Rice
cluster II – clone R17 – was found in a peat bog (Hales et al.,
1996), but now this cluster consists of about 20 environmental sequences recovered from a broad range of environments (Ramakrishnan et al., 2001; Stein et al., 2002).
The sequences that can be assigned to specific permafrost
clusters, might possibly include methanogenic archaea,
which are adapted to their extreme habitat by special
physiological characteristics. This assumption is supported
by the fact that pure cultures of Methanosarcina-like species
isolated from permafrost soils of the same study site are
more persistent to unfavourable environmental conditions
(e.g. subzero temperatures, high salinity, dryness) than
those from non-permafrost environments (D. Morozova
and D. Wagner, pers. comm.). However, further studies that
address the activity, diversity and physiological characteristics of methanogenic archaea in permafrost environments
should be undertaken.
In conclusion, this study provides the first results concerning the methanogenic communities in three different
permafrost soils of the Laptev Sea coast. It has demonstrated
methanogenesis with a distinct vertical profile in each
studied soil. The results show that CH4 production is
regulated more by the quality of soil organic carbon than
by the in situ temperature. We can also say that methanol is
an important substrate in these habitats, as indicated by
activity tests and by the presence of methylotrophic methanogens. The phylogenetic analysis revealed a distinct diversity of methanogens in the active layer of all study sites, with
species belonging to the families Methanomicrobiaceae,
Methanosarcinaceae and Methanosaetaceae. There were no
restrictions of the detected families to specific depths or
sites. Only sequences of Methanosaetaceae could not be
detected in the polygon-centre soil of Mamontovy Klyk.
Out of the 28 sequences, 16 sequences form four specific
permafrost clusters. We hypothesize, albeit somewhat speculatively, that these clusters are formed by methanogenic
archaea characterized by specific adaptation processes to the
harsh permafrost conditions. However, a relationship between the activity and the diversity of methanogens in
permafrost soils could not be shown. Molecular ecological
analysis of the microbial permafrost communities in combination with process studies on CH4 production, oxidation
FEMS Microbiol Ecol xx (2006) 1–13
and emission will be able to improve our understanding of
the future carbon dynamics in climate-sensitive permafrost
environments.
Acknowledgements
The authors wish to thank all Russian and German colleagues for enjoyable fieldwork and perfect logistics during the
expeditions in 2002 and 2003. We also want to thank Uta
Zimmermann (Institute of Soil Science, University of Hamburg) for the sampling and description of the Cape Mamontovy Klyk site, and Mashal Alawi (Biocenter Klein
Flottbek, University of Hamburg) for sharing first experiences with DGGE analysis on permafrost samples. Special
thanks go to Leone Montonen (Department of Applied
Chemistry and Microbiology, University of Helsinki) for
stimulating discussion and critical reading of the manuscript, and to Alexandros Stamatakis (Institute of Computer
Science, Greece) for help with RAxML software. This
study is part of the German–Russian project System LaptevSee (03G0534G), which was supported by the German
Ministry of Education and Research (BMBF) and the
Russian Ministry of Research and Technology. It was also
partly funded by the Academy of Finland under the project
number 53709.
References
Banning N, Brock F, Fry JC, Parkes RJ, Hornibrook ER &
Weightman AJ (2005) Investigation of the methanogen
population structure and activity in a brackish lake sediment.
Environ Microbiol 7: 947–960.
Basiliko N, Yavitt JB, Dees PM & Merkel SM (2003) Methane
biogeochemistry and methanogen communities in two
northern peatland ecosystems, New York State. Geomicrobiol J
20: 563–577.
Cao M, Marshall S & Gregson K (1996) Global carbon exchange
and methane emissions from natural wetlands: application of a
process-based model. J Geophys Res 101: 14399–14414.
Cavicchioli R (2006) Cold-adapted archaea. Nat Rev Microbiol 4:
331–343.
Chan OC, Wolf M, Hepperle D & Casper P (2002) Methanogenic
archaeal community in the sediment of an artificially
partitioned acidic bog lake. FEMS Microbiol Ecol 42: 119–129.
Chan OC, Claus P, Casper P, Ulrich A, Lueders T & Conrad R
(2005) Vertical distribution of the methanogenic archaeal
community in Lake Dagow sediment. Environ Microbiol 7:
1139–1149.
Chanton JP, Bauer JE, Glaser PA, Siegel DI, Kelly CA, Tyler SC,
Romanowicz EH & Lazrus A (1995) Radiocarbon evidence for
the substrates supporting methane formation within northern
Minnesota peatlands. Geochem Cosmochim Acta 59:
3663–3668.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
145
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms for Life in
Extreme Habitats and Their Astrobiological Relevance
6.1
1
Microbial Life in Terrestrial Permafrost:
Methanogenesis and Nitrification in Gelisols
as Potentials for Exobiological Processes
Dirk Wagner, Eva Spieck, Eberhard Bock and Eva-Maria Pfeiffer
The comparability of environmental and climatic conditions of the early Mars and
Earth is of special interest for the actual research in astrobiology. Martian surface and
terrestrial permafrost areas show similar morphological structures, which suggests that
their development is based on comparable processes. Soil microbial investigations of
adaptation strategies of microorganisms from terrestrial permafrost in combination
with environmental, geochemical and physical analyses give insights into early stages
of life on Earth. The extreme conditions in terrestrial permafrost soils can help to understand the evolution of life on early Mars and help searching for possible niches of
life on present Mars or in other extraterrestrial permafrost habitats [1, 2].
9.1 Permafrost
Permafrost Soils
Soils and
and Active
Active Layer
Layer
In polar regions huge layers of frozen ground are formed - termed permafrost - which
are defined as the thermal condition, in which soils and sediments remain at or below
0 °C for two or more years in succession. Terrestrial permafrost, which underlay more
than 20% of the world‘s land area, is above all controlled by climatic factors and characterized by extreme terrain condition and landforms. On Earth the permafrost thickness can reach several hundreds of meters, e.g., in East Siberia (Central Yakutia) about
600-800 m. During the relatively short period of arctic/antarctic summer only the
surface zone of permafrost sediments thaws. This uppermost part of the permafrost
(active layer) includes the so called Gelisols [3], which contains permafrost in the
upper 100 cm soil depth. Gelisols are characterized by gelic material that have the
evidence of cryoturbation and ice segregation. Permafrost soils may be cemented by ice
which is typical for the Arctic regions, or, in the case of insufficient interstitial water,
may be dry like the Antarctic polar deserts.
Permafrost can be divided into three temperature regimes (Fig. 9.1), which characterize the extreme living conditions: (i) The surface near upper active layer (0.2-2.0 m
thickness) is subjected to seasonal freezing and thawing with an extreme temperature
regime from about +15 °C to −35 °C, (ii) the correlated upper, perennially frozen
permafrost sediments (10-20 m thickness) with smaller seasonal temperature variation
of about 0 °C to −15 °C above the zero annual amplitude and (iii) the deeper permafrost sediments which are characterized by a stable temperature regime of about −5 °C
to −10 °C [4].
146
Methane Cycle in Permafrost Ecosystems
144
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
Fig. 9.1 Scheme
Scheme of temperature amplitude
amplitude in
in permafrost
permafrost sediments
sediments(according
(accordingtotoFrench
French[4],
[4],
modified).
modified)
The main Gelisol-forming processes in permafrost landscapes are cryopedogenesis,
which include freezing and thawing, frost stirring, mounding, fissuring and solifluction. The repeating cycles of freezing and thawing leads to cryoturbation features (frost
churning) that includes irregular, broken or involuted horizons and an enrichment of
organic matter and other inorganic compounds, especially along the top of the permafrost table. As a result of cryopedogenesis many Gelisols are influenced by a strong
micro-relief (patterned ground, Fig. 9.2). The type of patterned ground has effects on
soil formation and soil properties.
Ice wedge polygons for example of the Siberian lowlands (Fig. 9.3-A) which are
typical for high arctic, are characterized by two different soil conditions: The Gelisols
of the polygon center (Historthels) are water saturated and have a large amount of
organic matter due to the accumulation under anaerobic conditions (Fig. 9.3-B). The
Gelisols of the polygon border (Aquiturbels) show evidence of cryoturbation in more
or less all horizons of the active layer (Fig. 9.3-C). These soils drain into the polygon
center, which leads to dryer conditions in the upper layer of the border.
These examples demonstrate that the Gelisols of the active layer and upper permafrost sediments are the zone with active physico-chemical processes under extreme
conditions. Therefore, microbial life in permafrost soils and sediments is influenced by
extreme gradients of temperature, moisture and chemical properties. However, deeper
permafrost layers characterize living conditions, which have been stable for long periods of time and microbial life is preserved (see Chap. 8, Gilichinsky).
147
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
145
9.2 Microbial
Microbial Life
Life under
underExtreme
ExtremeConditions
Conditions
Over 80% of the Earth’s biosphere - including the polar regions - is permanently cold.
Most natural environments have a temperature regime colder than 5 °C. Temperature is
one of the most important parameters regulating the activity of microorganisms because it controls all metabolic activity of living cells [5]. The temperature in the upper
zone of the cryolithosphere (active layer and upper permafrost sediments) ranged between –50 °C to +30 °C [6]. Especially permafrost soils are characterized by extreme
variation in temperature. Previously the potential of growth as well as the molecular,
physiological and ecological aspects of microbial life at low temperatures were investigated [7, 8]. Many microorganisms are able to survive in cold permafrost sediments,
but this adaptation can be a tolerance or a preference. According to Morita [9] bacteria
can be described by their temperature range of growth: psychrophiles (Tmin <0 °C, Topt
≤15 °C, Tmax ≤20 °C), psychrotrophs (Tmin ≤0 °C, Topt ≥15 °C, Tmax ≤35 °C) and
mesophiles (Topt 25-40 °C). The minimum temperature for growth of bacteria was
recently reported with –20 °C [10], whereas the minimum temperature for enzyme
activity was –25 °C [11].
The seasonal variation of soil temperature influences also the availability of pore
water. The presence of unfrozen water is an essential biophysical requirement for the
survival and activity of microorganisms in permafrost. Temperature below zero stands
for an increasing loss of water. At the same time freezing of water leads to an increase
of salt content in the remaining pore solution. However, in clayey permafrost soils
liquid water was analyzed at temperatures up to –60 °C [12]. The most important
feature of this water is the possible transfer of ions and nutrients [13]. Furthermore,
McGrath et al. [14] showed that the intercellular water in fossil bacteria from permafrost soils was not crystallized as ice even at an extreme temperature of –150 °C.
For studying microbial life under extreme conditions it is also necessary to consider
whether and where these conditions are changing or stable in a permafrost profile. The
seasonal variation in soil temperature, particularly freeze-thaw cycles in the active
layer, results in drastic changes of other environmental conditions like salinity, soil
pressure, changing oxygen conditions (anoxic, microaerophilic, oxic) and nutrient
availability. Therefore, besides the physico-chemical conditions of permafrost, the
physiological properties of microorganisms are relevant for the adaptation to extreme
conditions. On account of this potential, they developed strategies to resist salt stress,
physical damage by ice crystals and background radiation [15]. Survival could be also
possible by anabiosis (dormant stage of life) or by reduced metabolic activity in unfrozen waterfilms (see Chap. 8, Gilichinsky).
9.3 Microbial Key Processes
Processes
Terrestrial permafrost is colonized by high numbers of chemoorganotrophic bacteria as
well as microbes like methanogenic archaea and nitrifying bacteria [16-18], which are
highly specialized organisms. They are characterized by litho-autotrophic growth
148
Methane Cycle in Permafrost Ecosystems
146
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
A
B
C
Fig. 9.2
9.2 Permafrost
Permafrost structures.
structures. A:
A: Lena
Lena Delta,
Delta, Russian
Russian Arctic
Arctic (April
(April 1999,
1999, photo
photo W.
W.Schneider,
Schneider,
AWI); B:
Haskard
Highlands,
Antarctica
(December
1994,
photo
W.-D.
Hermichen,
B:
Highlands, Antarctica (December 1994, photo W.-D. Hermichen,AWI);
AWI);C:
C:
Mars,
Northern
Hemisphere
(May
1999,
photo
NASA).
Mars, Northern Hemisphere (May 1999, photo NASA).
149
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
147
A
B
C
Fig. 9.3 Landscape and soils of polygon tundra,
tundra, Lena
Lena Delta/Siberia.
Delta/Siberia. A:
A: Low-centered
Low-centered polypolygons; B: Typic
Historthel
of
the
polygon
center;
C:
Glacic
Aquiturbel
of
Typic Historthel of the polygon center; C: Glacic Aquiturbel of the
the polygon
polygon border
border
(photos
(photos L.
L. Kutzbach,
Kutzbach, AWI).
AWI).
150
Methane Cycle in Permafrost Ecosystems
148
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
gaining energy by the oxidation of inorganic substances. Carbon dioxide can be used as
the only carbon source. Lithoautotrophic growth is an important presumption for longterm survival [19] of microbes in extreme environments like terrestrial permafrost or
maybe on other planets of our Solar System.
9.3.1
9.3.1
Methanogenesis
Methanogenesis
Responsible for the biogenic methane production (methanogenesis) is a small group of
microorganisms called methanogenic archaea [20]. Methanogenesis represents the
terminal step in carbon flow in many anaerobic habitats, including permafrost soils,
marshes and swamps, marine and freshwater sediments, flooded rice paddies and geothermal habitats. Although methanogens are widely spread in nature they show an extremely specialized metabolism. They are able to converse only a limited number of
substrates (e.g., hydrogen, acetate, formate, methanol, methyl- amines) to methane. In
permafrost soils two main pathways of energy-metabolism dominate: (i) the reduction
of CO2 to CH4 using H2 as a reductant and (ii) the fermentation of acetate to CH4 and
CO2. In the case of CO2-reduction organic carbon is not necessary for growth of
methanogenic archaea [21].
At present, 68 species of methanogenic archaea are known including common genera like Methanosarcina, Methanobacterium and Methanococcus. Phylogenetically,
they are classified as ARCHAEA [22], a group of microbes that are distinguished from
BACTERIA by some specific characteristics (e.g., cell wall composition, coenzymes).
They show a high adaptability at extreme environmental conditions like temperature,
salinity and oxygen. Besides the mesophilic species, also thermophilic methanogens are
known (see Chap. 11, Stetter). In newer times, more attention has been paid on the
search for psychrophilic strains since many of methanogenic habitats belong to cold
climates [23]. A lot of methanogens (e.g., Methanogenium cariaci, Methanosarcina
thermophila) are able to adapt to high salinity by the accumulation of compatible
solutes to equalize the external and internal osmolarity [24]. Although, they are regarded as strictly anaerobic organisms without the ability to form spores or other resting stages, they are found in millions of years old permafrost sediments [25] as well as
in other extreme habitats like aerobic desert soils [26] and hot springs [27].
Because of the specific adaptations of methanogenic archaea to conditions like on
early Earth (e.g., no oxygen, no or less organic compounds), they are considered to be
one of the initial organisms from the beginning of life on Earth.
9.3.2
9.3.2
Nitrification
Nitrification
Nitrifying bacteria play a main role in the global nitrogen cycle by the transformation
of reduced nitrogen compounds. Two groups of distinct organisms - the ammonia and
nitrite oxidizers - are responsible for the oxidation of ammonia to nitrite and further to
nitrate [28]. The genera of ammonia oxidizers have the prefix nitroso- whereas the
nitrite oxidizers start with nitro-. The best known nitrifiers are Nitrosomonas and
Nitrobacter. Up to now, 5 genera of ammonia oxidizers (with 16 species) and 4 genera
of nitrite oxidizers (with 8 species) have been described [29, 30]. Phylogenetically,
151
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
149
ammonia and nitrite oxidizers are affiliated to different subclasses of the Proteobacteria with the exception of Nitrospira (and maybe Nitrospina), which belong to a separate phylum [31, 32]. Although Nitrosomonas and Nitrobacter are usually the most
isolated nitrifiers, they are not obligatelly the most abundant ones in a given habitat.
For example, organisms of the genus Nitrospira seem to have a higher ecological
importance than previously assumed since they were recognized as dominant nitrite
oxidizers in several aquatic habitats (reviewed by Spieck and Bock [33]). These bacteria are the phylogenetic most ancient nitrifiers since they belong to a deep branching
phylum. Here, a high diversity of new species was detected recently.
Nitrifiers exist in most aerobic environments where organic matter is mineralized
(soils, compost, fresh- and seawater, waste water). In general, cell growth is slow with
regard to the poor energy sources but can be adapted to changing environmental conditions. Especially for Nitrobacter, mixotrophic and heterotrophic growth with organic
compounds is an alternative to the oxidation of nitrite. Nitrifiers are also active in low
oxygen and anaerobic environments like sewage disposal systems and marine sediments
where they are able to act as denitrifiers [34]. Although they form no endospores, they
can survive long periods of starvation and dryness. Therefore, nitrifying bacteria were
also detected in e.g., antarctic soils [35], natural stones [36], heating systems [32] as
well as in subsurface sediments in a depth of 260 m [37]. Especially ammonia oxidizers form dense cell clusters, where cells are embedded in a dense layer of EPS (extracellular polymeric substances). These microcolonies may protect the cells against
stress factors like dryness. Another protecting mechanism is the production or accumulation of compatible solutes (e.g., trehalose, glycine betaine or sucrose, see Chap.
12, Kunte et al.). Due to salt stress and dryness an increasing amount of compatible
solutes was found in cells of Nitrobacter [38].
9.4 Methods
Methods for
for Analogue
Analogue Studies
Studiesof
ofMicrobial
MicrobialProcesses
Processes
in
in Terrestrial
Terrestrial and
and Extraterrestrial
ExtraterrestrialHabitats
Habitats
Increased attention has been paid on the processes of methanogenesis and nitrification
in the last decades, because the involved bacteria [39] influence the global climate by
the generation and transfer of climate-relevant trace gases like methane and gaseous
nitrogenous oxides (NO, N2O, NO2). Recently, these microorganisms are also important in the area of astrobiology research because of their adaptation ability to extreme
location-conditions and consequently for the search of extraterrestrial lives of particular interest.
In order to understand the described microbial key-processes in permafrost soils, it
is necessary to know the microbial community which is involved in methanogenesis
and nitrification. The most important members of this community are those archaea/bacteria, which are metabolic active under such extreme conditions in the soils.
To learn about these microbes and their adaptation strategies, they must be isolated and
characterized. For quantitative aspects, bacterial cell numbers and microbial biomass
have to be determined using classical microbiological and modern molecular biological techniques.
152
Methane Cycle in Permafrost Ecosystems
150
9.4.1
9.4.1
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
Methanogenic
andand
Nitrifying
Populations
Methanogenic
Nitrifying
Populations
A polyphasic approach is needed to reveal the diversity, population dynamics and
ecological significance of bacteria in permafrost soils and sediments. Enrichment and
isolation of microorganisms is necessary for taxonomical and ecophysiological characterization of microbial populations in order to understand their adaptation strategies
and potential to extreme environmental conditions.
Traditionally, cell numbers of methanogenic archaea and nitrifying bacteria were
quantified by the most probable number (MPN) technique in selective chemolithoautotrophic media [28, 40]. The highest dilution serves as initial inoculum for cultivation studies like identification and characterization of the relevant bacteria. Viable
methanogens and nitrifiers were detected in the Kolyma-Indigirka Lowland in northeast
Siberia by Russian and German scientists [41]. The bacteria occurred in high cell numbers in the upper layers and in decreasing numbers in more ancient deposits. MPN
counts of methanogenic archaea varied between 2.0 x 102 and 2.5 x 107 cells g-1. Soina
et al. [42] detected mesophilic nitrifying bacteria with 2.5 x 102 cells g-1 soil in a depth
of 28 m. Lebedeva and Soina [17] found nitrifying bacteria in geological horizons up
to 3 millions of years in a depth of 60 m. With increasing age of the sediments, psychrotrophic nitrifiers were found to be replaced by psychrophilic ones, although the
permafrost communities are dominated by psychrotrophs [43]. Nevertheless, psychrophilic bacteria have a significant part in the microbial community in cold environments
like permafrost soils [44]. The investigations of the methanogenic community on Taimyr Peninsula [45] and in the Lena Delta [46] gave hints for the adaptation to the low
in situ temperatures. However, isolation of psychrophilic methanogens and nitrifiers
from permafrost soils seems to be more complicated than in other physiological defined groups like acetogenic [47] and methane-oxidizing bacteria [48] as well as clostridia [49]. Cultivation at 5 °C of the slow growing microbes is hindered by prolonged
lag-periods, which amounted to 2 - 14 months in the case of nitrite oxidizers [50].
Therefore, the organisms had to be incubated at higher temperatures of e.g., 17 °C. So
far, there was only one methanogenic archaea isolated from Ace Lake/Antarctica,
which showed psychrophilic growth characteristics [51].
In order to obtain pure cultures for physiological characterization (e.g., determination of the temperature optima) isolation of typical bacteria is required. This can be
done by serial dilution in liquid growth media or deep-agar tubes (Agar-shakes), plating on agar plates under aerobic or anaerobic conditions and is also possible by percoll
density gradient centrifugation [52]. However, separation of aggregated cells is problematically and requires further treatment. Identification of isolates and enriched organisms was performed by traditional light and electron microscopy with genusspecific morphology and ultrastructure as criteria. Classified by their spiral cell shape,
the ammonia oxidizers isolated from soil samples taken during the expedition “Beringia“ in 1991 and 1992 were identified as members of the genus Nitrosospira (or Nitrosovibrio). Among nitrite oxidizers, Nitrobacter was identified by its pleomorphic
morphology and a polar cap of intra-cytoplasmic membranes [50]. In surface samples
which were taken during the expedition “Lena 1999“ [46], the coexistence of Nitrobacter and Nitrospira in enrichment cultures was demonstrated by their typical morphology (Fig 9.4) of pleomorphic short rods (with a diameter of 0.8 µm) respectively
spiral rods (with a diameter of 0.2 µm).
153
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
151
Fig. 9.4
oxidizing
medium
from
the the
active
layerlayer
of a permafrost
soil
9.4 Enriched
Enrichedbacteria
bacteriaininnitrite
nitrite
oxidizing
medium
from
active
of a permafrost
(Samoylov/Lena
Delta)
with
a
morphology
similar
to
Nitrospira
respectively
Nitrobacter.
Negasoil (Samoylov/Lena Delta) with a morphology similar to Nitrospira respectively Nitrobacter.
tive
staining
was performed
with uranyl
Magnification
20 300×.20300x.
Negative
staining
was performed
with acetate.
uranyl acetate.
Magnification
Since the isolated organisms may not be the ecologically relevant ones, the development of new detection strategies was necessary to monitor the enrichment procedure. Modern microscopic techniques like CLSM (confocal laser scanning microscopy)
in combination with fluorescent dyes enable specific or unspecific labeling of viable
cells. In Fig. 9.5 an unspecific labeling of bacteria probably belonging to the genus
Nitrospira is presented. Here, the organisms were affiliated by the formation of characteristic cell clusters. Like many ammonia oxidizers the Nitrospira-like bacteria were
aggregated to micro-colonies.
New molecular techniques were developed for the detection of ecological relevant
bacteria without cultivation [53, 54]. Fluorescence in situ hybridization (FISH) using
population-specific gene probes targeting 16S rRNA enables direct microscopic enumeration of single cells (Fig. 9.6). Demanding low amounts of cell material, such
methods are well suited for methanogenic archaea and nitrifying bacteria. Molecular
16S rDNA sequence analysis is required for phylogentic affiliation of new isolates.
An immunological approach for the identification of nitrite as well as ammonia
oxidizers was developed by Bartosch et al. [55] and Pinck et al. [56]. They used monoclonal and polyclonal antibodies, respectively, recognizing the key-enzymes of these
functional groups of bacteria as phylogenetic marker. Nitrite oxidizers enriched from
permafrost sediments were identified immunologically as members of the genus Nitrobacter [55]. These nitrifiers originated from sediments with an age of 40 000 years.
Further on, in the active layer of a permafrost soil from Samoylov Island/Lena Delta
nitrite oxidizers of the genus Nitrospira were detected by Hartwig [57]. Depending on
the substrate concentration, Nitrospira together with Nitrobacte (0.2 g NaNO2 l-1) or
Nitrobacter alone (2 g NaNO2 l-1) could be enriched. Both genera of nitrite oxidizers
could be distinguished in Western blot analysis by different molecular masses of the βsubunit of their nitrite oxidizing systems (Fig. 9.7). This protein of Nitrobacter has a
molecular mass of 65 kDa, whereas in Nitrospira 46 kDa were determined [55].
Phospholipid analysis in microbial ecology is a further method to study the biomass,
population structure, metabolic status and activity of natural communities [59]. Specific groups of microorganisms (like the nitrite oxidizers) contain characteristic phospholipid ester-linked fatty acids (PLFA), whereas methanogenic archaea are characterized by ether-linked glycerolipids [60]. Lipid biomarkers are important for the detec154
Methane Cycle in Permafrost Ecosystems
152
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
tion of single taxons. Such a characteristic new fatty acid (11-methyl-palmitate) was
recently found in Nitrospira moscoviensis [61].
9.4.2
9.4.2
In situ
situActivity
Activity
The activity of microorganisms depends not only on their own physiological capability
but is influenced also by habitat-qualities like the grain size or the availability of nutrients. That is why, besides the characterization of the microflora, their activity in
Fig. 9.5 With
With DAPI
DAPI (4,6-diamidino-2-phenylindol)
(4,6-diamidino-2-phenylindol) stained
stained micro-colony
micro-colonyofof Nitrospira-like
Nitrospira-like
bacteria
(arrow),
enriched
from
the
active
layer
of
a
permafrost
soil
(Samoylov/Lena
Delta).Delta).
Bar
bacteria (arrow), enriched from the active layer of a permafrost soil (Samoylov/Lena
=Bar
25=µm.
(photo
C.
Hartwig,
University
of
Hamburg).
25 µm (photo C. Hartwig, University of Hamburg).
Fig. 9.6 Confocal microscopy
microscopy of
of archaea
archaeafrom
fromthe
thefamily
familyMethanomicrobiales
Methanomicrobialesenriched
enrichedfrom
from
permafrost
Delta/Siberia).
TheThe
culture
was grown
with Hwith
v:v)
at
10
°C.
2/CO2H(80:20,
permafrostsoils
soils(Lena
(Lena
Delta/Siberia).
culture
was grown
/CO
(80:20,
v:v)
at
2
2
The
hybridization
was
carried
out
with
the
oligonucleotide
probe
MG1200
[54]
(photo
S.
Ko10°C. The hybridization was carried out with the oligonucleotide probe MG1200 [54] (photo
babe,
AWI).AWI).
S. Kobabe,
155
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
153
Fig. 9.7 Immunoblot of an enrichment
enrichment culture
culture derived
derived from
from permafrost
permafrost soil
soil using
usingmonoclonal
monoclonal
antibodies
-subunit of
antibodies recognizing
recognizingthe
the ββ-subunit
of the
the nitrite-oxidizing
nitrite-oxidizingsystem.
system.The
Thevalues
valuesononthe
theleft
leftare
are
molecular
kDa.
A:
pure
culture
ofof Nitrospira
moscoviensis,
B:
enrichment
culture
molecular masses
masses inin
kDa.
A:
pure
culture
Nitrospira
moscoviensis,
B:
enrichment
culture
-1
using
using 0.2
0.2ggNaNO
NaNO22ll-1(modified
(modifiedfrom
fromBartosch
Bartoschetetal.al.[58]).
[58]).
the natural habitat is of importance for the understanding of life under extreme conditions. There are different methods for analyzing in situ activities, i.e. determination of
concentration gradients [62], flux measurements [63] and assay of activity in soil samples [64]. A new technique for the determination of nitrification rates in situ is the
introduction of microelectrodes (e.g., for ammonia and nitrate). These sensors make it
possible to monitor metabolic reactions in the nitrogen cycle [65].
The activity of methanogenic archaea can be followed by the measurement of the
metabolic end product CH4 over a period of time. Methane generation takes place only
under anaerobic conditions in the permafrost soils and sediments, for example in the
water saturated soils of the polygon center. In situ rates of methanogenesis can only be
obtained if the anaerobic food chain is not affected by the experimental procedure
because methanogenesis depends on the substrates produced by other microorganisms.
The in situ methane production can be investigated by incubation of soil samples from
permafrost sites. Figure 9.8 shows the in situ methane production in dependence from
the natural temperature gradient of a permafrost soil. For this investigation, fresh soil
material was used. The prepared soil samples were re-installed in the same layers of the
soil profile from which the samples had been taken [46].
The influence of soil texture on the activity of microorganisms can be examined by
incubation experiments with model soils of a different grain size [66]. Changing temperature and pressure conditions as well as the impact of different substrates on microbial activity can be studied in special simulation experiments with undisturbed soil
samples (see 9.4.4).
To estimate the nitrifying activity in permafrost sediments, the potential activity of
soil bacteria was determined under optimal laboratory conditions. For that purpose,
soil samples were taken from drill cores and transferred to the laboratory under sterile
156
Methane Cycle in Permafrost Ecosystems
154
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
temperature [°C]
0
2
4
6
8
10
0
depth [cm]
5
10
CH4
temperature
15
polygon centre
20
0
10
20
30
40
CH4 production rate [nmol h-1 g-1]
Fig. 9.8 Vertical
situ
methane
production
andand
soil soil
temperature
for a for
permafrost
soil
Verticalprofile
profileofofinin
situ
methane
production
temperature
a permafrost
of
center.
soilthe
ofpolygon
the polygon
center.
conditions. In the active layer and in sediments with an age of 40 000 years the nitrifying activity was higher at 28 °C in comparison to 17 °C, whereas in more ancient deposits (0.6-1.8 million of years and 2.5-3 million of years) the bacteria preferred lower
temperatures of 17 °C (Lebedeva, pers. comm.).
Further investigations about nitrifying bacteria in permafrost sediments included
measurements of ammonia, nitrite and nitrate as substrates respectively products of
nitrification. Janssen [50] determined the concentrations of these nitrogen compounds
in the soil samples by high-performance-liquid chromatography. The profiles showed
that nitrite and nitrate were always found in the ppm range in sediments up to 150 000
years and occasionally in deeper layers. Ammonia concentrations amounted up to 100
ppm with increasing amounts in sediments with an age of 1-5 millions years. Nitrite
and nitrate correlated with the presence of nitrifying bacteria although nitrifiers were
also detected in samples without these nitrogen salts. The detection of the chemical
unstable metabolic intermediate nitrite in correlation with the presence of viable ammonia oxidizers gave first evidence of modern microbial activity in permanently frozen
sediments.
9.4.3
9.4.3
Isotopic
Carbon
Fractionation
via Microbial
Processes
IsotopicAnalysis:
Analysis:
Carbon
Fractionation
via Microbial
in
Permafrost
Processes in Permafrost
It is well known that microbial processes tend to fractionate the C-isotopes of organic
matter in soils and sediments by favoring the lighter 12C-carbon over the heavier 13Ccompounds. Methanogenesis for example leads to the strongest C-discrimination in
nature with the result that soil organic matter will be enriched with 13C-carbon (e.g.,
157
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
9 Microbial Life in Terrestrial Permafrost: Methanogenesis and Nitrification
155
δ13C-values of about –16‰ to –22‰) while the product of anaerobic decay - methane
- will be depleted with 13C (values of about –60‰ [67]). In anaerobic zones of permafrost soils with methane production the soil organic matter showed an absolute enrichment of 13C-carbon of about 3.7‰ to 8.3‰ [45, 68]. Therefore, isotope-related
analysis in combination with the microbial studies may be a powerful tool to search for
traces of microbial life in extraterrestrial habitats, even if the applicability for extraterrestrial environments could not be examined until now sufficiently [69].
9.4.4 Simulation
Simulation Experiments
9.4.4
Experiments
The influence of environmental conditions on the activity and survival of microorganisms could be investigated by simulation experiments with bacterial cultures and with
undisturbed soil material.
Thawing and freezing processes influence not only the soil temperature regime but
also the availability of liquid water, the pressure conditions and the salinity of pore
water. They produce also granular, platy and vesicular soil structure in the surface near
horizons and a massive structure in the subsurface zones. Undisturbed soil samples
(soil cores of different size) save the structure, pore system and stratification of the
natural soil, which influence the interaction between microbes and soil matrix. Simulation of freeze-thaw cycles can help to understand: how will the microbial population
be influenced by the natural permafrost system and by the interaction of the combined
parameters?
The viability of the permafrost microflora under the environmental conditions of
Martian atmosphere can be investigated by simulation experiments in special ice laboratories (Alfred Wegener Institute for Polar and Marine Research, AWI) and in a special Martian simulator (German Aerospace Center, DLR). Natural soil material and
pure cultures of bacteria isolated from terrestrial permafrost habitats can be exposed to
extreme cold temperatures (–60 °C), lower pressure (560 Pa), higher background
radiation (UV 200 nm), drier soil moisture conditions and varying ice contents in
comparison with well known terrestrial permafrost.
9.5 Conclusion
Conclusion and
and Future
Future Perspectives
Perspectives
Microbial life in permafrost soils depends on available water (see Chap. 5, Brack). If
inorganic compounds like hydrogen as well as ammonia or nitrite are present as substrates, conditions are favorable for the growth of methanogenic archaea and nitrifying
bacteria. Since cell synthesis is carried out by the assimilation of carbon dioxide there
is no further need for organic material. This mineralic basis resembles the situation on
mars (e.g., C, H, O, N, P, K, Ca, Mg and S, reviewed by Horneck [70]). Lithoautotrophic bacteria are well investigated and ubiquitous distributed organisms on Earth. They
survived even in terrestrial permafrost for several millions of years [41]. Here, they
demonstrate the residue of the autochthon population within the paleosoils which was
enclosed during deposition of fresh sediments. The frozen microorganisms in the
deeper permafrost sediments are thought to have not evolved significantly during the
158
Methane Cycle in Permafrost Ecosystems
156
6 Methanogenic Archaea as Model Organisms
D. Wagner et al.
past several million years because it was not necessary to adapt to their environment
[16]. In contrast, the microbes living in the active layer and the transition permafrost
sediments are influenced by extreme changes of live-decisive environmental conditions. Preserving their viability in such an extreme environment they had to develop
different strategies to resist desiccation, freezing processes and nutrient-lack. The isolation and characterization of methanogenic archaea and nitrfying bacteria from permafrost soils should clarify the possible growth characteristic (psychrophile and psychrotroph) and ecological significance of these microbes.
The data obtained from future research on living conditions and adaptation strategies of microorganisms in terrestrial permafrost soils should be compared with the
postulated environmental conditions on early Mars [1, 71]. They were characterized by
liquid water, a moderate climate and a postulated biosphere which had been dominated
by anaerobic processes and diversification of anaerobic organisms. Furthermore, the
comparative system studies will serve for understanding the modern Mars cryosphere
and other extraterrestrial permafrost habitats. This knowledge represents an essential
basis for the understanding of the origin of life and the environmental development on
extreme habitats.
Acknowledgements. The authors thank Dr V. Rachold and W. Schneider (Alfred Wegener Institute for Polar and Marine Research, Potsdam) for organization and logistic
support of the expedition “Lena 1999” as well as Dr. D.A. Gilichinsky (Institute of
Soil Science and Photosynthesis, Pushchino) for the leadership of the expedition
“Beringia”. The research was partly founded by the German Ministry of Science and
Technology (System Laptev-See 2000, 03G0534G).
159
The original version of the professorial dissertation contains on pp. 160 - 166 the
article:
Wagner D., Wille C., Kobabe S. and Pfeiffer E.-M. (2003b) Simulation of freezing
thawing cycles in a permafrost microcosm for assessing microbial methane
production under extreme conditions. Permafrost and Periglacial Processes 14,
367-374.
Published online in Wiley InterScience (http://www.interscience.wiley.com).
DOI: 10.1002/ppp.468
[http://dx.doi.org/10.1002/ppp.468]
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
#
FEMS Microbiological Ecology, revised manuscript, awaiting acceptance
6.3
Stress response of methanogenic archaea from Siberian permafrost
compared to methanogens from non-permafrost habitats
Daria Morozova & Dirk Wagner
Alfred Wegener Institute for Polar and Marine Research, Potsdam, Germany
Correspondence: Daria
Morozova, Alfred Wegener
Institute for Polar and Marine
Research, Telegrafenberg
A43, D-14473 Potsdam,
Germany; Tel.: +49 331 288
2200, fax: +49 331 288 2137,
e-mail:
[email protected]
Keywords
methanogenic archaea,
permafrost, low temperature,
stress response, life on Mars
Abstract
We examined the survival potential of methanogenic
archaea exposed to different environmental stress
conditions such as low temperature (down to -78.5 °C), high
salinity (up to 6 M NaCl), starvation (up to 3 months), longterm freezing (up to 2 years), desiccation (up to 25 days)
and oxygen exposure (up to 72 hours). The experiments
were conducted with methanogenic archaea from Siberian
permafrost and were complemented by experiments on wellstudied methanogens from non-permafrost habitats. Our
results indicate a high survival potential of a methanogenic
archaeon from permafrost when exposed to the extreme
conditions tested. In contrast, these stress conditions were
lethal for methanogenic archaea isolated from nonpermafrost habitats. A better adaptation to stress was
observed at a low temperature (4 °C) compared to a higher
one (28 °C). Given the unique metabolism of methanogenic
archaea in general and the long-term survival and high
tolerance to extreme conditions of methanogens
investigated in this study, methanogenic archaea from
permafrost should be considered as primary candidates for
possible subsurface Martian life.
Introduction
Permafrost on Earth, which covers around 24 % of the land surface, is a significant natural
source of methane (Fung et al., 1991; Wagner et al., 2003, Smith et al. 2004). The processes
responsible for the formation of methane in permafrost soils are primarily of biological origin,
carried out by methanogenic archaea, a small group of strictly anaerobic chemolithotrophic
organisms. They can grow with hydrogen as an energy source and carbon dioxide as the
only carbon source. In addition to this specific metabolism methanogens are able to convert
only a limited number of organic substrates (acetate, formate, methanol, methylamines) to
methane (Conrad, 2005). Methanogenic archaea are widespread in nature and highly
___
# since the submission of the thesis the paper is published in FEMS Microbiology Ecology 61, 16-25 (2007)
167
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
abundant in extreme environments tolerating low/high temperatures (permafrost, hot
springs), extreme salinity (saltern ponds) and low/high pH (solfataras, soda lakes). In
addition to mesophilic species, thermophilic and hyperthermophilic methanogens have also
been identified (Stetter et al., 1990; Garcia et al., 2000). Recently, more attention has been
paid to the isolation of psychrophilic strains since a number of methanogenic habitats are
located in cold climates (Gounot, 1999). So far, only a few strains (e.g. Methanococcoides
burtonii, Methanogenium frigidum, Methanosarcina spec.) have been isolated from cold
habitats (Franzmann et al., 1992; Franzmann et al., 1997, Simankova et al., 2003). Although
the metabolism of methanogenic archaea was studied in different environments (Shuisong &
Boone, 1998; Garcia et al., 2000; Eicher, 2001; Lange & Ahring, 2001), only few studies
focussed on the ecology of the methanogenic archaea exposed to the permafrost’s harsh
environmental conditions like sub-zero temperatures, low water activity and low nutrient
availability (Vishnivetskaya et al., 2000; Høj et al., 2005, Ponder et al., 2005, Ganzert et al.,
2006).
Furthermore, permafrost is in the main focus of extraterrestrial research in astrobiology,
because it is a common phenomenon in our solar system. Evidence of cryotic systems on
present-day Mars (patterned ground, glaciers and thermokarst) has been found by Mars
Express. The possibility of extant or extinct life on Mars has been fueled by the recent U.S.
Mars Exploration Rover Opportunity discovery that liquid water most likely exists on Mars
(Christensen et al., 2004; Klingelhofer et al., 2004) and findings from the Planetary Fourier
Spectrometer onboard of Mars Express, as well as ground–based observations, indicating
that methane currently exists in the Martian atmosphere (Formisano et al., 2004).
Considering the short lifetime of methane, this trace gas could only originate from active
volcanism – which has not yet been observed on Mars – or from biological sources. There is
evidence that prior to 3.8 Ga ago, when terrestrial life arose, environmental conditions on
Mars were most likely similar to those on early Earth (Carr, 1989; Durham et al., 1989;
Wharton et al., 1989; McKay & Davis, 1991; McKay et al., 1992; Carr, 1996). If life had also
emerged on Mars, it either subsequently adapted to the drastically changed environment or it
became extinct. One possibility for survival of Martian microorganisms could be in
lithoautotrophic subsurface ecosystems such as deep sediments near the polar ice caps and
in permafrost regions. In the light of this assumption, methanogens from terrestrial
permafrost habitats could be considered as analogues for probable extraterrestrial
organisms.
The objective of this study was to characterize the potential stress response of
methanogenic archaea from Siberian permafrost exposed to different extreme environmental
conditions. In particular, high salinity, low temperature, starvation, desiccation and exposure
to oxygen were studied. Particular emphasis was placed on Methanosarcina spec. SMA-21
isolated from the active layer of permafrost. Previous studies had shown that this archaeon
exhibit a high survival potential under simulated Martian conditions (Morozova et al., 2006).
In comarison, two methanogens from non-permafrost habitats have been used. The study
will contribute to an improved understanding of extraterrestrial life, if present, especially with
regards to possible protected niches on present-day Mars.
Materials and methods
Microbial cultures
Permafrost samples were obtained from Samoylov Island (N 72°22, E 126°28), located within
the central part of the Lena Delta, Siberia. A detailed description of the geomorphologic
situation of the island and the whole delta was given previously (Schwamborn et al., 2002;
Wagner et al., 2003). To enrich and isolate methanogenic archaea the bicarbonate-buffered,
168
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
oxygen-free OCM culture medium was used, prepared according to Boone et al. (1989). The
cultures were grown under an atmosphere of H2/CO2 (80/20, v/v) as substrate. Cultures were
incubated at 4 °, 10 ° and 28 °C.
Methanosarcina spec. SMA-21 (isolated from permafrost sediments sampled in summer
2002 from Siberian permafrost, Russia) grew well at 28 °C and more slowly at low
temperatures (4 °C and 10 °C). The strain appeared as irregular cocci, 1-2 µm in diameter.
Large cell aggregates were regularly observed. Methanobacterium spec. MC-20 from nonpermafrost sediments from Mangalia, Romania was isolated at 28 °C. The cells were rodshaped, 1-2 µm in width and a maximum of 8 µm in length. Methanosarcina barkeri DSM
8687, originating from a peat bog in Northern Germany (Maestrojuan et al., 1992), was
obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ;
Braunschweig, Germany).
Salt stress experiments at different temperatures
The effect of salt shock on methanogenic archaea was studied using the Methanosarcina
spec. SMA-21, as well as Methanobacterium spec. MC-20 and Methanosarcina barkeri,
which were used as reference organisms. An aliquot of 5 ml of each culture grown to a cell
density of 108 cells ml-1 was supplemented with anaerobic salt solution and incubated at 4 °C
and 28 °C for up to 3 months. The selected NaCl end concentrations were 0 M, 0.1 M, 0.2 M,
0.3 M, 0.4 M, 1.0 M, 3.0 M and 6 M (saturated). Sterilized cultures (2 h at 121 °C)
supplemented with 0.4 M and saturated salt solution were used as negative controls. The cell
numbers and activities were measured as described below.
After having been stored in concentrated salt solution for just over 3 months, the 5 ml
aliquot of each culture was placed into the fresh OCM medium and supplemented with the
appropriate substrates (H2/CO2 for Methanosarcina SMA-21 and Methanobacterium MC-20;
methanol for Methanosarcina barkeri). Survival was calculated according to cell count and
activity measurements. All the experiments were done in triplicate.
Freezing experiments
Cultures of Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina barkeri
grown to a cell density of 108 cells ml-1 were divided into two portions; one portion was
immediately frozen at -78.5 °C, and the other one was cold shocked at 10 °C for 2 h before
being frozen at -78.5 °C. For each portion, an aliquot of 1 ml was removed just before
freezing. After storage at -78.5 °C for 24 h, the frozen cells were thawed at room
temperature. Cell numbers were calculated before and after the freezing as described below.
After thawing, aliquots were placed under anaerobic conditions in 25 ml glass flasks,
supplemented with 10 ml of fresh OCM medium and appropriate substrates (H2/CO2 for
Methanosarcina SMA-21 and Methanobacterium MC-20; methanol for Methanosarcina
barkeri). The flasks were sealed with a screw cap containing a septum and incubated at 28
°C. The activities were measured as described below.
In addition, Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina
berkeri grown at 28 °C to a cell density of 108 cells ml-1 were slowly frozen (0.2 °C min-1) to 20 °C. Initial methane production rates were measured before freezing and compared to
those obtained after thawing for samples held at –20 °C for a period of 1 to 2 years. Once the
samples were thawed, an aliquot of 5 ml of each culture was placed into the fresh OCM
medium and supplemented with the appropriate substrates. Survival was calculated as
described below. All the experiments were done in triplicate.
169
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Starvation experiments at different temperatures
Cultures of Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina barkeri
grown to a cell density of 108 cells ml-1 were harvested by centrifugation (10 min at 15000 g),
washed twice, resuspended in PBS (Phosphate Buffered Saline), and divided into six
portions. For each portion, an aliquot of 1 ml was placed in a 25 ml glass flask,
supplemented with 10 ml of a MM mineral medium without any carbon source (Boone et al.,
1989) and stored for 1, 2 and 3 months at 4 °C and 28 °C. Having been stored without
substrates, the 1 ml aliquots of each culture were then placed into the fresh OCM medium,
supplemented with the appropriate substrates and incubated at 28 °C. Survival was
calculated as described below. All the experiments were done in triplicate.
Desiccation experiments
The effect of desiccation on methanogenic archaea was studied using the strains of
Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina barkeri. An aliquot
of each culture grown to a cell density of 108 cells ml-1 was placed onto microscope cover
slips (1 ml per cover slip) and allowed to dry completely. For some experiments glass beads
(1.0 g, 1 mm diameter) were added to cell suspension. Cover slips were stored anaerobically
at 28 °C for 2, 5, 7 and 25 days. Cells were rehydrated by placing the cover slip in 2 ml of the
appropriate growth medium for 30 min at room temperature. The resulting cell suspensions
were placed under anaerobic conditions into 25 ml glass flasks, supplemented with 10 ml of
the fresh OCM medium and appropriate substrates. The flasks were sealed with a screw cap
containing a septum and incubated at 28 °C. Survival was determined as described below.
All the experiments were done in triplicate.
Oxygen exposure experiments
The oxygen sensitivity of methanogenic archaea was investigated using the permafrost strain
Methanosarcina SMA-21 and non-permafrost strain Methanobacterium MC-20. An aliquot of
the culture grown to a cell density of 108 cells ml-1 was placed onto microscope cover slips (1
ml per cover slip) and exposed to aerobic conditions. The cover slips were stored at room
temperature for 1, 3, 24, and 72 hours. Than cell suspensions were placed under anaerobic
conditions into 25 ml glass flasks, supplemented with 10 ml of the fresh OCM medium and
H2/CO2. The flasks were sealed with a screw cap containing a septum and incubated at
28 °C. The activities and cell numbers before and after oxygenation were detected as
described below. The oxygen sensitivity of Methanosarcina barkeri was investigated
previously (Zhilina, 1972; Kiener and Leisinger, 1983; Fetzer et al., 1993).
Methane analysis
The activity of the methanogenic archaea was calculated based on the linear increase of the
CH4 concentration in the headspace. The methane concentration was measured by gas
chromatography. The gas chromatograph (Agilent 6890, Fa. Agilent Technologies) was
equipped with a Carbonplot capillary column (Ø 0.53 mm, 30 m length) and a flame
ionisation detector (FID). Both the oven and the injector temperature were 45 °C. The
temperature of the detector was 250 °C. Helium served as the carrier gas. All the gas sample
analyses were done following calibration with standards of the respective gases.
170
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Cell counts determination
Cell numbers were calculated by Thoma cell counts and by fluorescence in situ hybridization
(FISH) using the universal oligonucleotid probe for Archaea (ARC915 Cy3). For microscopic
performance a Zeiss Axioskop 2 equipped with filters 02 (DAPI), 10 (FLUOS, DTAF) and 20
(Cy3), a mercury-arc lamp and an AxioCam digital camera for recording visualization of cells
was used. The counting was done manually. For each hybridisation approach and sample at
least 800 DAPI stained cells were counted on 30 randomly chosen counting squares.
Microscopic performance was carried out using a magnification of 63 x 100 giving an area of
3.9204 x 10-2 mm2 per counting square.
3000
2500
no NaCl
0.1 M NaCl
0.2 M NaCl
0.3 M NaCl
0.4 M NaCl
-1
CH4 [nmol ml ]
2000
1500
1000
500
0
a
0 20 40 60 80 100
b
0 20 40 60 80 100
c
0 20 40 60 80 100
Time [h]
Fig. 1. Methane production of the permafrost strain Methanosarcina SMA-21 (a), and the reference
organisms Methanobacterium MC-20 (b) and Methanosarcina barkeri (c), incubated with varying salt
concentrations at 28° C (means ± standard error, n=3).
Statistical analyses
Significant differences between the three replicates used in the different stress experiments
were analyzed using the Student’s t-test (Wardlaw, 1985).
Results
Effect of salt stress on methanogenic archaea
Salt tolerance was assessed in the permafrost strain Methanosarcina SMA-21 and the nonpermafrost organisms Methanobacterium MC-20 and Methanosarcina barkeri using NaCl salt
solutions at different concentrations as an osmolite. High methane production of
Methanosarcina SMA-21 was observed at all salt concentrations. The methane production of
Methanobacterium MC-20 and the Methanosarcina barkeri was significantly different when
exposed to different concentrations (Fig. 1).
The highest activity of Methanosarcina SMA-21 was detected in samples incubated with
0.3 and 0.4 M NaCl (18.14 ± 2.81 and 17.98 ± 2.51 nmol CH4 h-1 ml-1, respectively), which
was similar to the activity in the samples which had no salt added. The methane production
rate at low salt concentrations (0.1 M and 0.2 M) was about a half as high as in the samples
with no additional salt (Fig. 1). In contrast, increasing salt concentrations lead to a gradual
decrease in the methane production of the Methanobacterium MC-20 and Methanosarcina
171
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
NaCl concentration [M]
barkeri. Thus, the methane production rate of the non-permafrost organism
Methanobacterium MC-20, incubated with 0.4 M NaCl (1.72 ± 0.18 nmol CH4 h-1 ml-1), was
one order of magnitude lower compared to the samples with no additional salt, which had a
methane production of 17.13 ± 1.72 nmol CH4 h-1 ml-1. The methane production rates of
Methanosarcina barkeri, incubated with 0.4 M NaCl, decreased from 29.8 ± 2.3 to 0.85 ±
0.16 nmol CH4 h-1 ml-1.
Higher methane production at low incubation temperature was observed in all
Methanosarcina SMA-21 samples at all salt concentrations tested (Fig. 2). Moreover, a
significant activity of Methanosarcina SMA-21 was observed even in cultures incubated in
the saturated NaCl solution at 4 °C and 28 °C (Fig. 2). Based on the cell counts and on the
methane production measured at different incubation temperatures, the methane production
rates per cell and per hour were calculated. At 4 °C the methane production rates detected
per methanogenic cell (0.1 ± 0.0 x 10-7 nmol CH4 h-1 cell-1) were five times higher than the
methanogenic activity at 28 °C (0.027 ± 0.0 x 10-7 nmol CH4 h-1 cell-1).
4°C
28°C
6.0
no NaCl 28°C
3.0
1.0
0
0,00
0,02
0,04
-1
5
10
15
-1
CH4 [nmol h ml ]
Fig. 2. Methane production rates of the Methanosarcina SMA-21 incubated in a concentrated salt
solution (1-6 M NaCl) at 4° C and 28° C (means ± standard error, n=3).
In contrast, the methane production rates of Methanosarcina barkeri and
Methanobacterium MC-20 under salt saturated conditions were not very significant at 28 °C
(0.01 ± 0.002 and 0.003 ± 0.0001 nmol CH4 h-1 ml-1 respectively), but they were still higher
than those at 4°C (0.002 ± 0.0001 and 0.0014 ± 0.0001 nmol CH4 h-1 ml-1 respectively) [Fig.
3]. Any viable cells were detected. No methane production was observed in the sterilized
cultures.
When the cells were transferred to a fresh OCM medium after incubation under salt
saturated conditions for a period of 3 months, methane production rates of Methanosarcina
SMA-21 observed after one week were similar to those under standard growth conditions.
Thus, the methane production rates per cell calculated for the recovering samples (1.4 ± 0.04
x 10-7 nmol CH4 h-1 cell-1) were comparably to the samples which had no salt added (1.9 ±
0.06 x 10-7 nmol CH4 h-1 cell-1) Conversely, no methane production was detectible after reincubation of Methanobacterium MC-20 and Methanosarcina barkeri (data not shown).
172
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Ms. spec.
SMA-21
Mb. spec.
MC-20
4°C
28°C
Ms. barkeri
0,00
0,01
0,02
0,03
-1
0,04
-1
CH4 [nmol h ml ]
Fig. 3. Methane production rates of Methanosarcina barkeri, Methanobacterium MC-20 and
Methanosarcina SMA-21 incubated in a saturated salt solution at two different temperatures.
CH4 [nmol ml-1]
1000
800
600
400
200
0
Ms. spec. SMA-21 control
Ms. spec. SMA-21 non cs
Ms. spec. SMA-21 cs
1600
1200
800
400
0
Ms. barkeri control
Ms. barkeri non cs
Ms. barkeri cs
1600
1200
800
400
0
Mb. spec. MC-20 control
Mb. spec. MC-20 non cs
Mb. spec. MC-20 cs
0
20
40
60
80
100
120
140
Time [h]
Fig. 4. Methane production of Methanosarcina SMA-21, Methanosarcina barkeri and Methanobacterium MC-20 after freezing for 24 h at -78.5°C for cold shocked (cs) and non-cold-shocked (non
cs) cultures in comparison to untreated control samples (means ± standard error, n=3).
Freezing tolerance
The methanogenic strains Methanosarcina SMA-21, Methanobacterium MC-20 and
Methanosarcina barkeri showed significant differences in their ability to survive freezing at 78.5 °C for 24 h. Highest survival was seen in the Methanosarcina SMA-21. The average cell
numbers of this archaeon decreased from 4.37± 1.4x108 cells ml-1 at the beginning of the
experiment to 3.89 ± 0.6x108 cells ml-1 at the end of freezing, giving a survival rate of 89.5 %.
In comparison, only 1 % of Methanobacterium MC-20 and 0.8 % of Methanosarcina barkeri
survived incubation at -78.5 °C. The decrease in cell numbers correlated well with the
methane production rates of the cultures. The activity of Methanosarcina SMA-21 measured
173
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
before freezing (10.87 ± 1.22 nmol CH4 h-1 ml-1) was only two times higher than the activity
after the experiment (5.57 ± 0.67 nmol CH4 h-1 ml-1), while the methane production rates of
the reference organisms Methanobacterium MC-20 and Methanosarcina barkeri decreased
drastically after the experiment (Fig. 4). In particular, the methane production rates of the
Methanobacterium MC-20 after freezing (0.21 ± 0.07 nmol CH4 h-1 ml-1) were two orders of
magnitude lower than those before the experiment (19.53 ± 1.59 nmol CH4 h-1 ml-1), while the
activity of the Methanosarcina barkeri was three orders of magnitude lower.
The potential of Methanosarcina barkeri to survive freezing at -78.5 °C was slightly
higher when the culture was exposed to a temperature of 10 °C for 2 h prior to freezing (precooling). The cultures transferred to 10° C had a survival rate of 1.4 % and a methane
production rate of 0.06 ± 0.01 nmol CH4 h-1 ml-1. In contrast, a positive effect of preincubation at 10 °C on the ability to survive freezing at -78.5 °C was not seen for the
Methanosarcina SMA-21 or the Methanobacterium MC-20 strains.
Most striking is that the Methanosarcina SMA-21 showed high survival rates and
methane production of 9.01 ± 0.5 nmol CH4 h-1 ml-1 after two-years freezing at -20 °C. The
measured methane production rates prior to freezing were 10.58 ± 0.8 nmol CH4 h-1 ml-1. No
methane production was detected in either reference organism after just one year of
exposure to -20 °C.
Temperature dependent starvation tolerance
Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina barkeri were
tested for their ability to survive substrate limiting conditions at different incubation
temperatures. The Methanosarcina SMA-21 showed a high survival potential following the
starvation experiment. Significant methane production of Methanosarcina SMA-21 was
observed even in the cultures that had starved for 3 months (1.25 ± 0.01 and 3.55 ± 0.56
nmol CH4 h-1 ml-1 for cultures at 28 °C and 4 °C, respectively). Methane production rates
were higher at 4 °C than these at 28 °C (Fig. 5). The different activities at different incubation
temperatures correlated well with the viable cell numbers of this methanogenic archaeon.
The average cell numbers of Methanosarcina SMA-21 after 3 months of starvation
decreased from 6.1 ± 2.6x108 to 3.28 ± 1.9x107 cells ml-1 at 4 °C and from 9.2 ± 2.8x108 to
6.2 ± 2.3x105 at 28 °C. Thus, survival potential of Methanosarcina SMA-21 at 4 °C was ten
times higher than at 28 °C (Fig. 5).
In contrast, there was no survival of any cells of Methanobacterium MC-20 and
Methanosarcina barkeri after 1 month of starvation, regardless of the incubation temperature.
This was in accordance with the lack of any methane formation after re-incubation of
Methanobacterium MC-20 and Methanosarcina barkeri (Fig. 5).
Desiccation tolerance
The survival of the strains after desiccation was evaluated for up to 25 days of treatment. In
general, the presence of glass beads strongly reduced the inhibitory effect of desiccation on
survival. Survival and methane production rates for all the methanogenic strains
(Methanosarcina SMA-21, Methanobacterium MC-20 and Methanosarcina barkeri) were
higher with glass beads than without. However, Methanosarcina SMA-21 from permafrost
showed significant differences in their desiccation resistance than did the reference
organisms from non-permafrost habitats. The Methanosarcina SMA-21 was found to resist
25 days of desiccation without loss of activity and cultivability (Fig. 6). The average cell
numbers of the Methanosarcina SMA-21 decreased from 2.3 ± 0.8x108 to 1.8 ± 0.4x108 cells
ml-1, equivalent to a cell survival rate of 77.5%. The methane production rates decreased
174
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
slightly from 10.46 ± 2.34 nmol CH4 h-1 ml-1 to 5.23 ± 1.7 nmol CH4 h-1 ml-1. Survival and
methane production rates of both non-permafrost strains (Methanobacterium MC-20 and
Methanosarcina barkeri) were drastically reduced after desiccation (Fig. 6). When tested for
this ability, cells of the reference cultures were no longer able to grow after desiccation of 25
days.
1000
10
10
-1
1E-3
0,1
1E-5
0,01
1E-7
1E-9
Survival [N/No]
1
-1
CH4 [nmol h ml ]
0,1
1E-3
1E-11
0,0
0,5
1,0
1,5
2,0
2,5
3,0
Starvation [months]
Fig. 5. Methane production rates (dark symbols) and cell survival rates (open symbols) of starved cells
of Methanosarcina barkeri (up-looking triangles), Methanobacterium MC-20 (upside down-looking
triangles) and Methanosarcina SMA-21 at 4 °C (circles) and 28 °C (squares) [means ± standard error,
n=3].
10
1
1
0,1
0,01
1E-4
1E-5
1E-3
Survival [N/No]
-1
1E-3
CH4 [nmol h ml ]
0,01
-1
0,1
1E-6
1E-7
1E-4
1E-8
0
5
10
15
20
25
Desiccation [days]
Fig. 6. Methane production rates (dark symbols) and cell survival rates (open symbols) of desiccated
cells of Methanosarcina barkeri (up-looking triangles), Methanobacterium MC-20 (upside down-looking
triangles) and Methanosarcina SMA-21 (circles) [means ± standard error, n=3].
Oxygen sensitivity
The oxygen sensitivity of the Methanosarcina SMA-21 permafrost strain was examined by
175
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
determining cell viability and methane production following oxygenation. There was good
agreement between these parameters. As shown in Fig. 7, exposure to oxygen for 1 to 3 h
resulted in no significant effect on the cultivability and activity of the permafrost
microorganism. The viability of Methanosarcina SMA-21 appeared to be only slightly affected
by exposure to oxygen for 24 h, with a survival rate of 85 %. The calculated methanogenic
activity decreased slightly from 11.47 ± 1.23 nmol CH4 h-1 ml-1 to 6.46 ± 0.9 nmol CH4 h-1 ml-1.
However, the survival potential of the permafrost strain was reduced after prolonged oxygen
exposure. After 72 h of exposure, 90 % the Methanosarcina SMA-21 cells had died. In
contrast, 100 % of the Methanobacterium MC-20 cells had died after 24 h exposure to
oxygen. No methane production was detected. These results were compared with a previous
study investigating the survival potential of the Methanosarcina barkeri (Kiener and Leisinger,
1983). For this strain, exposure to oxygen for 10 to 30 h had no effect on cell numbers. A
decrease in cell numbers and methane production was observed only after 48 h exposure to
oxygen.
1
10
-1
0,1
0,01
0,01
Survival [N/No]
0,1
-1
CH4 [nmol h ml ]
1
1E-3
1E-3
1E-4
-10
0
10
20
30
40
50
60
70
1E-4
80
Incubation under oxic conditions [h]
Fig. 7. Oxygen sensitivity (methane production rates, dark symbols and cell survival rates, open
symbols) of Methanosarcina SMA-21 (means ± standard error, n=3).
Discussion
Different strains of methanogens, which include representatives from permafrost and nonpermafrost habitats, exhibit marked differences in their stress tolerance. The methanogenic
archaeon Methanosarcina SMA-21 from permafrost showed high resistance to high salinities,
extremely low temperatures, desiccation, the presence of oxygen, and starvation. The stress
tolerance of Methanosarcina SMA-21 was even higher at low incubation temperatures. In
contrast, the reference organisms from non-permafrost habitats were sensitive to the
extreme conditions tested. High cell numbers of reference strains were killed without lag
upon exposure to these stress factors.
Terrestrial permafrost provides an opportunity to obtain microorganisms that have
exhibited long-term exposure to cold temperatures, freeze-thaw cycles, starvation, aridity,
and high levels of long-lasting back-ground radiation resulting from accumulation over
geological time scales. In spite of the unfavorable living conditions, permafrost is colonized
by high numbers of viable microorganisms (102-108 cells per g-1), including fungi, yeasts,
algae and bacteria as well as highly specialized organisms like methanogenic archaea
176
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
(Vishnivetskaya et al., 2000, Kobabe et al., 2004, Wagner et al., 2005). Seasonal variations
in soil temperatures, particularly freeze-thaw cycles in the active layer, result in drastic
changes in other environmental conditions such as water availability, salinity, soil pressure,
desiccation, changing oxygen conditions, and the availability of nutrients. The permafrost
microbial community, described as a “community of survivors” (Friedmann, 1994), has to
resist this combination of extreme conditions as well as their extreme fluctuations. The high
survival rates of methanogenic archaeon from permafrost compared to non-permafrost
strains under the investigated stress conditions suggest that these microorganisms have
developed ways to cope with stress which have to include repair of damaged DNA and cell
membranes, and the maintenance of other vital functions needed to sustain cell viability. Our
results indicate a higher resistance of the methanogenic archaeon Methanosarcina SMA-21
to increased salinity and lack of nutrients at low temperatures. An incubation temperature of
+4 °C correlates well with in situ temperatures of the active layer of permafrost, fluctuating in
summer months from 0 °C to about +10 °C. It remains to be determined if freeze protection
mechanisms overlap with tolerance mechanisms, which protect against various other
stresses such as desiccation, starvation or high salt concentration (Berry &d Foegeding,
1997; Macario et al., 1999; Cleland et al., 2004; Georlette et al., 2004).
Methanosarcina SMA-21 from Siberian permafrost was shown to be well adapted to a
wide range of salt concentrations. Higher methane production rates, which were determined
for Methanosarcina SMA-21 incubated with 0.3-0.4 M NaCl compared to the 0.1-0.2 M salt
concentrations, indicate better adaptation to a rapid increase in osmolarity, which occurs
while freezing of the active layer of permafrost. Again, the ability to resist the stress factor, in
this case high salinity, was enhanced by low incubation temperatures. Furthermore,
Methanosarcina SMA-21 cells remained to stay viable after three months incubation under
salt saturated conditions. In contrast, increasing salinity leads to reduced activity of the
reference organisms Methanobacterium MC-20 and Methanosarcina barkeri originated from
non-permafrost sediments. The methane production of Methanosarcina barkeri and
Methanobacterium MC-20 was marginal under salt saturated conditions and did not appear
to be favourably influenced by low temperatures (Fig. 3). Also no viable cells of these strains
could be detected after prolonged salt stress.
The salt tolerance could be associated with cold tolerance, a possibility which was also
postulated by Vishnivetskaya (2000) and Gilichinsky (2003) and which is confirmed by the
present results. Methanosarcina SMA-21 showed excellent survival of more than 70 % of the
cells following freezing at -78.5 °C. Pre-conditioning to cold temperatures (cold shock),
known to increase the resistance to freezing of many microorganisms due to the expression
of cold-responsive genes and cryoprotectant molecules (Kim & Dunn, 1997; Wouters et al.,
2001; Georlette, 2004; Weinberg et al., 2005), does not increase the freezing tolerance of
Methanosarcina SMA-21. This correlates well with the resistance of this strain to a two-year
exposure at -20°C without any pre-conditioning. Both results suggest that this strain is
already adapted to sub-zero environments. Generally, all the cell components must be
adapted to the cold to enable an overall level of cellular protection that is sufficient for
survival and growth (Cavicchioli, 2006).
Starvation tolerance experiments with two different incubation temperatures were
conducted to evaluate the ability of methanogenic archaea from permafrost and nonpermafrost habitats to survive prolonged periods of nutrient limitation associated with the
freezing of the active layer in permafrost habitats. Starvation stress was very efficient in
reducing the survival potential of the reference strains. While the non-permafrost archaea
(Methanosarcina barkeri and Methanobacterium MC-20) ceased to exist after one month of
starvation, Methanosarcina SMA-21 maintained high survival rates even after being starved
for 3 months. The slow metabolism rates of organisms in cold environments could be
177
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
important for successful adaptation to starvation conditions since this adaptation requires
protein synthesis, the most energy demanding process in the cell (Thomsson et al., 2005).
Prolonged desiccation stress was lethal for non-permafrost strains, whereas
Methanosarcina SMA-21 survived for at least 25 days. Surprisingly, this methanogenic
archaeon was able to produce methane immediately following rehydration, which indicates
efficient repair mechanisms. The experiment was done at room temperature; colder
temperatures might slow the rate of desiccation damage and lead to even longer survival
periods. The survival and potential methane production of Methanosarcina SMA-21 was
even higher in the presence of glass beads, which probably provided partial mechanical
protection of methanogens against desiccation. This observation was the same, regardless if
the methanogens were obtained from a DSMZ culture collection or freshly isolated from
permafrost.
Exposure to oxygen, the last stress factor tested, occasionally occurs during late
summer when the uppermost permafrost thaws and water table of the active layers
decreased. Metabolic activity of methanogenic archaea within aerated soil slurries has been
previously observed (Wagner et al., 1999). Even without a protective soil matrix, the
permafrost strain Methanosarcina SMA-21 still exhibits a marked oxygen resistance. The
organisms survived for hours the presence of oxygen without any decrease in the cell
numbers or methane production rates. Moreover, a significant percentage (10 %) of the
population of Methanosarcina SMA-21 survived up to 72 hours of oxygenation. This is a very
interesting result since methanogenic archaea are strictly anaerobic organisms, which are
not known to have resting stages. These survival rates are high compared to those from
earlier studies for Methanosarcina barkeri and other methanogenic archaea from ecosystems
periodically subjected to oxygen stress (Kiener & Leisinger, 1983). Protection from oxygen
may occur at the cellular level (e.g. superoxide dimutase, catalase and other SOD protective
enzymes) or at the level of cell aggregates (Kiener & Leisinger, 1983; Brioukhanov et al.,
2006; Zhang et al., 2006). The arrangements of cells aggregates, which have been regularly
observed in Methanosarcina barkeri and Methanosarcina SMA-21 might lead to the
protection of the cells in the interior and thereby secure survival during extended periods of
oxygen stress. This assumption is in agreement with the data of Kobabe et al. (2004), who
found aggregates of methanogenic archaea in the dried upper layers of soils in polygon
depressions.
In summary, the high survival rates and activity of a Methanosarcina SMA-21 from
Siberian permafrost under different stress conditions suggest that these organisms possess
natural adaptation mechanisms to sub-zero temperatures, increased salinity, starvation,
desiccation and oxygen stress and have efficient repair mechanisms that allow them to live
under extreme fluctuating conditions of terrestrial permafrost, in contrast to other
methanogens isolated from non-permafrost habitats, which probably lack such mechanisms.
Most striking was the difference in survival potential between Methanosarcina barkeri and
Methanosarcina SMA-21, two representatives of the same genus. Therefore, it is of great
importance to sequence the genome of Methanosarcina SMA-21, as one of the
representatives of a permafrost community. The characterization of the physiological traits
potentially important to cryo-adaptation is necessary to begin understanding the adaptations
at the genome level.
From the astrobiological point of view, the physiological potential and the metabolic
specificity of Methanosarcina SMA-21 from permafrost provide very useful insight for the
investigation of potential life in extremely cold environments on other planets of our solar
system. We might conclude that the permafrost habitats on Earth represent an excellent
analogue for studying putative life on Mars. Recent analyses of Mars Express HRSC (High
Resolution Stereo Camera) images of many regions of the planet showed that the
morphology of Martian polygonal features is very similar to the morphology of terrestrial ice-
178
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
wedge polygons and is most likely the result of comparable processes (Kuzmin, 2005).
Although the experimental conditions presented here did not simulate all extreme permafrost
environmental conditions, major stresses were simulated, which organisms in terrestrial
permafrost and in Martian permafrost might be exposed to. The observation of high survival
rates of permafrost methanogen under defined stress conditions as well as under simulated
Martian conditions (Morozova et al., 2006) supports the possibility that microorganisms
similar to methanogens from Siberian permafrost could also exist in Martian permafrost
habitats. Methanogenic archaea from terrestrial permafrost may therefore serve as useful
models for further exploration of extraterrestrial life.
Acknowledgements
We thank the Russian-German field parties during the 2004 expedition (Ekaterina Abramova,
Irina Fedorova, Grigorij Federov, Alexander Makarov, Andreas Gattinger, Lars Helling and
Günter “MOLO” Stoof) for enjoyable field work under “extreme conditions”. Special thanks to
Susanne Liebner (AWI Potsdam, Germany) and Nicole Couture (McGill University, Canada)
for fruitful discussion and critical reading of the manuscript. This research has been
supported by Deutsche Forschungsgemeinschaft (German Research Foundation) priority
program 1115 “Mars and the terrestrial planets” (WA 1554/1-1).
179
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Orig Life Evol Biosph
DOI 10.1007/s11084-006-9024-7
6.4 Survival of Methanogenic Archaea from Siberian Permafrost
under Simulated Martian Thermal Conditions
Daria Morozova & Diedrich Möhlmann & Dirk Wagner
Received: 8 March 2006 / Accepted in revised form: 9 August 2006
# Springer Science + Business Media B.V. 2006
Abstract Methanogenic archaea from Siberian permafrost complementary to the already
well-studied methanogens from non-permafrost habitats were exposed to simulated Martian
conditions. After 22 days of exposure to thermo-physical conditions at Martian low- and midlatitudes up to 90% of methanogenic archaea from Siberian permafrost survived in pure
cultures as well as in environmental samples. In contrast, only 0.3% –5.8% of reference
organisms from non-permafrost habitats survived at these conditions. This suggests that
methanogens from terrestrial permafrost seem to be remarkably resistant to Martian
conditions. Our data also suggest that in scenario of subsurface lithoautotrophic life on
Mars, methanogenic archaea from Siberian permafrost could be used as appropriate
candidates for the microbial life on Mars.
Keywords methanogenic archaea . permafrost . astrobiology . life on Mars .
Mars simulation experiments
Introduction
Of all the planets explored by spacecrafts in the last four decades, Mars is considered as one of the
most similar planets to Earth, even though it is characterized by extreme cold and dry conditions
today. This view has been supported by the current ESA mission Mars Express, which identified
several different forms of water on Mars and methane in the Martian atmosphere (Formisano
2004). Because of the expected short lifetime of methane, this trace gas could only originate
from active volcanism – which was not yet observed on Mars – or from biological sources.
Data obtained by the Mars Express showed that water vapor and methane gas are concentrated
in the same regions of the Martian atmosphere (European Space Agency 2004). This finding
may have important implications for the possibility of microbial life on Mars (Moran et al.
2005). Furthermore, there is evidence that prior to 3.8 Ga ago, the environmental conditions on
Mars may have been similar to those on early Earth (Carr 1989; Durham et al. 1989; Wharton
D. Morozova (*) : D. Wagner
Alfred Wegener Institute for Polar and Marine Research,
Telegrafenberg A 43, 14473 Potsdam, Germany
e-mail: [email protected]
D. Möhlmann
DLR Institute of Planetary Research, Rutherfordstr. 2, 12489 Berlin, Germany
180
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
Orig Life Evol Biosph
et al. 1989; McKay and Davis 1991; McKay et al. 1992; Carr 1996). At this time microbial life
had already started on Earth and Archaea are thought to have been among the earliest living
organisms. If life had also emerged on Mars, it either adapted to the drastically changed
environments or it became extinct. One possibility for survival of Martian microorganisms
could be lithoautotrophic subsurface ecosystems such as deep sediments near polar ice caps and
in permafrost regions, where liquid-like (unfrozen) adsorption water can play a key-role for
transport of nutrients and waste products of biological processes (Möhlmann 2005). Evidence
of permafrost occurrence on present Mars (patterned ground, glacier or thermokarst) has been
found by Mars Express. Comparable environments exist in polar regions on Earth, for example
Antarctic ice cores (Abyzov et al. 1998, 1999), Greenland glacial ice (Tung et al. 2005) and
Siberian permafrost (Gilichinsky et al. 1993), where microorganisms existed for several million
years independent of photosynthetic energy production (Gilichinsky and Wagener 1994;
Vorobyova et al. 1998; Rivkina et al. 1998, Wagner et al. 2001).
Terrestrial permafrost, which covers around 24% of the Earth’s surface, is a significant
natural source of methane (Fung et al. 1991; Wagner et al. 2003, Smith et al. 2004). The
processes responsible for the formation of methane in permafrost soils are primarily
biological, carried out by methanogenic archaea, a small group of strictly anaerobic
chemolithotrophic organisms, which can grow using hydrogen as an energy source and
carbon dioxide as the only carbon source. They are widespread in nature and highly
abundant in extreme environments, tolerating low/high temperatures (permafrost, hot
springs), extreme salinity (saltern ponds) or low/high pH (solfataras, soda lakes). Beside
mesophilic species, also thermophilic and hyperthermophilic methanogens are known
(Stetter et al. 1990; Garcia et al. 2000). Recently, more attention has been paid to the
isolation of psychrophilic strains, since many habitats in which methanogens are found
belong to cold climates (Gounot 1999). So far, only a few strains (e.g., Methanococcoides
burtonii, Methanogenium frigidum, Methanosarcina spec.) have been isolated from cold
habitats (Franzmann et al. 1992, 1997; Simankova et al. 2003). Although the metabolism of
methanogenic archaea has been studied in different environments (Ni and Boone 1998;
Garcia et al. 2000; Eicher 2001; Lange and Ahring 2001), only a few studies have focussed
on the ecology of the methanogenic archaea in permafrost ecosystems (Vishnivetskaya
et al. 2000; Høj et al. 2005). Studies have shown that methanogenic archaea from Siberian
permafrost are well adapted to osmotic stress and are also highly resistant to inactivation by
desiccation, radiation, extremely low temperatures (Morozova and Wagner, data under
processing) and high oxygen partial pressure (Wagner et al. 1999).
Few investigations have been performed under conditions applicable to Mars,
particularly under water-stressed conditions (Sears et al. 2002). The present study focuses
on the ability of methanogenic archaea to survive under simulated Martian thermal
conditions. For this purpose, permafrost samples and pure cultures of methanogens were
used. Their resistance renders these organisms eminently suitable for this purpose.
Description of the Mars Simulation Experiment
Biological samples
Permafrost samples and preparation
Permafrost samples were obtained from the Lena Delta, Siberia. The investigation site
Samoylov Island (72°22′N, 126°28′E) is located within the central part of the Lena Delta,
181
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Orig Life Evol Biosph
which is one of the largest deltas in the world with an area of about 32,000 km2. A detailed
description of the geomorphologic situation of the island and the whole delta was given
previously (Schwamborn et al. 2002). The Lena Delta is located within the continuous
permafrost zone. It is characterized by an arctic continental climate with low annual air
temperature of −14.7 °C (Tmin =−48 °C, Tmax =18 °C) and a low mean annual precipitation
of 190 mm. The island is dominated by the typical permafrost pattern of low-centred
polygons which cover at least 70% of the island’s area. The soils in the Lena Delta are
entirely frozen, leaving only 20–50 cm upper part, so-called ‘active layer’, remaining
unfrozen during the summer months.
During the expedition ‘Lena 2004’ soil samples were collected from the active layer of
two soil profiles. These profiles represent major characteristic geomorphic units of the
island. They are different in regard to soil genesis and soil properties. One of these profiles
was located at the depression of a low-centred polygon (72°22′N, 126°28′E) in the eastern
part of the island. The prevalent soil type of the polygon depressions was a Typic
Historthel, classified according to the US Soil Taxonomy (Soil Survey Staff 1998). The
samples from the polygon depression were characterized by a high content of organic
matter and high porosity.
The second profile was located on a flood plain in the northern part of the island. At this
location, annual flooding leads to a continuing accumulation of fluvial sediments. The
substrate was dominated by sandy and silty fluvial material. The prevalent soil type of the
flood plain was a Typic Aquorthel (Soil Survey Staff 1998). Additional soil characteristics,
analysed according to Schlichting et al. (1995), are summarized in Table I. Soil samples
were filled in gas-tight plastic jars (Nalgene) and transported to Germany in frozen
condition. Approximately 10 g of each soil sample was used for dry weight determination.
All results were expressed per gram of dry soil.
Microbial cultures
For enrichment and isolation of methanogenic archaea the bicarbonate-buffered, oxygenfree OCM culture medium was used, prepared according to Boone et al. (1989). The
TABLE I Selected soil properties of a polygon centre and a flood plain soil on Samoylov Island, Lena Delta
Depth (cm)
Centre
0 –5
5 –10
10 –15
15 –20
20 –25
25 –30
Flood plain
0–5
5–9
9–18
18–35
35–40
40–52
182
H2O content (%)
Corg (%)
N (%)
Grain size fraction (%)
Clay
Silt
Sand
85.7
77.3
80.6
73.4
58.9
68.5
15.5
15.1
16.1
7.3
2.2
4.7
0.7
0.4
0.4
0.2
0.2
0.2
2.4
2.8
2.6
7.9
6.1
5.0
18.6
24.0
18.6
15.4
18.2
25.9
79.0
73.3
78.8
76.6
75.7
69.2
30.1
31.9
28.3
35.4
32.4
31.8
3.1
1.1
2.2
2.8
2.4
1.7
0.4
0.2
0.3
0.4
0.3
0.2
11.1
20.2
18.3
20.2
20.4
17.6
64.8
61.4
63.5
62.7
55.6
67.7
24.2
18.4
18.2
17.1
24.0
14.7
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
Orig Life Evol Biosph
medium was anaerobically dispensed into vials and 10 g of permafrost sample from anoxic
horizons of the floodplain were added. The head space was filled with an N2/CO2 mixture
(80:20, v/v). Methanol (20 mM) or H2/CO2 (80:20, v/v) were used as substrates. Inoculated
vials were incubated at 10 °C. For the isolation of methanogenic archaea, serial dilutions
(1:10) were carried out and cultures were incubated at 28 °C. Growth of contaminants was
inhibited by different antibiotics (5 g ml−1 erytromycin or phosphomycin). Purity was
checked microscopically and by lacking growth on medium containing 5 mM glucose,
5 mM pyruvate, 5 mM fumarate and 0.1% yeast extract.
All strains grew well at 28 °C and slowly at low temperatures (4 and 10 °C). The
isolated strains showed different morphologies. Methanosarcina spec. SMA-21 cells were
irregular cocci and 1–2 μm in diameter. Large cell aggregates were regularly observed.
Cells of the strain SMA-16 were small irregular diplococci, 0.5–1 μm in diameter. Strain
SMA-23 appeared as rod-shaped cells, ca. 1–2 μm in width and max. 10 μm in length,
often forming long cell chains.
Reference organisms
Methanobacterium spec. MC-20 was isolated from a non-permafrost sediments from Mangalia,
Romania at an incubation temperature of 28 °C. The cells were rod-shaped, 1–2 μm in width and
max. 8 μm in length. Methanosarcina barkeri DSM 8687 was originated from peat bog in
northern Germany (Sherer et al. 1983) and Methanogenium frigidum DSM 16458 (Franzmann
et al. 1997) was originated from the water column of the Ace Lake, Antarctica. Both cultures
were obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ;
Braunschweig, Germany).
The experimental set-up
Mars simulator
Simulation of the thermal conditions, typical for Martian mid- and low-latitudes, was
achieved in the laboratory for humidity related studies (HUMIDITY-Lab) of the German
Aerospace Center (DLR), Institute of Planetary Research in Berlin. The ‘Cold chamber’
provided a combination of diurnal temperature fluctuations in the range from −75 to +20 °C
and humidity fluctuations between aw-values of 0.1 and 0.9 in a Mars-like atmosphere
dominated by carbon dioxide (95.3%). The humidity corresponds to a water vapor pressure
of about 10−3 mbar (0.1 Pa) that equals to the average water vapor pressure on Mars
(corresponding to 10 pr 4 μm). The simulation experiment was carried out in a 6 mbar
Mars-like atmosphere for a period of 22 days (Figure 1). The average aW-value was 0.52.
Martian simulation experiments with permafrost soils
To determine the influence of simulated Martian conditions on survival potential of
methanogenic archaea in soil samples, fresh soil material (1 g) from the polygon depression
(Typic Historthel, Oi horizon, 5–10 cm depth) and the floodplain (Typic Aquorthel, A
horizon, 0–5 cm depth) was weighed into 12.5 ml plastic boxes (A/S NUNG, Denmark)
under anoxic conditions. Three replicates were used for each soil type. Before and after the
experiment the cell numbers were calculated as described in “Cell counts determination”.
After exposure to Martian conditions the soil samples were anaerobically incubated into
183
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
40.0
1.2
20.0
1.0
0.0
0.8
-20.0
0.6
-40.0
0.4
-60.0
0.2
-80.0
aw-value
temperature [˚C]
Orig Life Evol Biosph
0.0
time
temperature [˚C]
aw-value
Figure 1 Diurnal profile of simulated Martian temperature (bold line) and humidity (aW), – dashed line – in
the Mars simulator (2 days are shown).
25 ml glass flasks, 5 ml of sterile deionized water was added and the flasks were closed
with a screw cap containing a septum and incubated at 10 °C. The activity of methanogenic
archaea was measured before and after the experiment as described in “Methane analysis.”
Martian simulation experiments with pure methanogenic cultures
Six strains of methanogenic archaea were used in the simulation experiment. Strains
Methanosarcina spec. SMA-21, SMA-16 and Methanobacterium spec. MC-20 were grown
on bicarbonate-buffered, oxygen-free OCM culture medium (Boone et al. 1989) under an
atmosphere consisting of H2/CO2 (80:20, v/v, pressurized 150 kPa). Strain SMA-23 and
Methanosarcina barkeri were grown on oxygen-free MS culture medium (DSMZ No. 120)
supplemented with 20 mM methanol as a substrate. Methanogenium frigidum was grown on
oxygen-free EM culture medium (DSMZ No. 141) under an atmosphere of H2/CO2 (80:20, v:
v, pressurized 150 kPa) at 15 °C. All strains except Methanogenium frigidum were incubated
at 28 °C for about two weeks. Cells were harvested by centrifugation and 50 mg of the cell
pellet was inoculated into 1,500-μl glass jars (A–Z Analytik Zubehör GmbH). Three replicates
of each culture were used. Cell density of the cultures was between 2.3 and 8.1×107 cells
ml−1. Before and after the experiment cell numbers were calculated as described in “Cell
counts determination.” After the exposure to Martian conditions the cell pellets were placed
under anaerobic conditions into 25 ml glass flasks, supplemented with 10 ml fresh OCM
medium and H2 as a substrate. The flasks were closed with a screw cap containing a septum
and incubated at 28 °C (Methanogenium frigidum at 15 °C). The activity was measured before
and after the experiment as described in “Methane analysis.”
Methane analysis
The activity of methanogenic archaea was calculated based on the lineal increase of CH4
concentration in the headspace. Methane concentration was measured by gas chromatography.
184
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
Orig Life Evol Biosph
The gas chromatograph (Agilent 6890, Fa. Agilent Technologies) was equipped with a
Carbonplot capillary column (∅ 0.53 mm, 30 m length) and a flame ionization detector (FID).
Oven as well as injector temperature was 45 °C. The temperature of the detector was 250 °C.
Helium served as carrier gas. All gas sample analyses were done after calibration with standards
of the respective gases.
Cell counts determination
Cell numbers were calculated by Thoma cell counts and by fluorescence in situ hybridization
(FISH) using the universal oligonucleotid probe for Archaea (ARC915 Cy3). For microscopic
performance a Zeiss Axioskop 2 equipped with filters 02 (DAPI), 10 (FLUOS, DTAF) and 20
(Cy3), a mercury-arc lamp and an AxioCam digital camera for recording visualization of cells
was used.
Results
Effect of Martian conditions on methanogenic archaea in permafrost soils
The survival rates of methanogenic archaea in permafrost soils after three weeks of
exposure to the Martian thermal conditions was determined by both the methane production
rates and the cell counts before and after the experiment. Methanogenic archaea of the
floodplain showed high survival rates. The average cell numbers decreased from 9.1×106
cells g−1 at the beginning of the experiment to 6.6×106 cells g−1 after exposure to Martian
conditions, which equals 72.2% cell survival. Average cell numbers of methanogenic
archaea of the polygon depression decreased from 6.7×107 to 3.1×107 corresponding to a
survival of 46.6% of the cells. The methane production rates of the flood plain soil samples
slightly decreased after exposure to simulated Martian conditions from 0.07± 0.01 nmol
CH4 h−1 g−1 to 0.02±0.0004 nmol CH4 h−1 g−1 (Table II). The methane production rates of
the methanogenic archaea observed in the polygon depression samples decreased from 1.64±
0.15 nmol CH4 h−1 g−1 to 0.09±0.004 nmol CH4 h−1 g−1 after exposure to Martian
conditions. The decrease of activity after the experiment was much higher in the polygon
depression soils compared to the decrease of activity in soils of floodplain depression.
TABLE II Methane production rates and cell counts of methanogenic archaea in permafrost soil samples
before and after exposure to Martian conditions
Soil samples
Cell counts 106
Survival
rates (%)
CH4 production
(nmol h−1 g−1)
Flood-plain (5–10 cm depth), controla
Flood-plain (5–10 cm depth), after experiment
Centre (0–5 cm depth), controla
Centre (0–5 cm depth), after experiment
9.1±4.2
6.6±3.4
66.5±16.9
31.1±9.8
100
72.2
100
46.6
0.07±0.01
0.02±0.0004
1.64±0.15
0.09±0.004
Mean ± standard error, n=3.
a
Soil samples, which were not exposed to the Martian thermal conditions.
185
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Orig Life Evol Biosph
Effect of Martian conditions on pure methanogenic cultures
The methanogenic strains from Siberian permafrost and the reference organisms from nonpermafrost habitats showed significant differences in their survival potential under
simulated Martian conditions. The average cell number of strain Methanosarcina spec.
SMA-21 decreased from 6.1×107 cells ml−1 at the beginning of the experiment to 5.5×107
cells ml−1 at the end of the simulation, which equals a cell survival of 90.4%. Strains SMA16 and SMA-23 showed 67.3% and 60.6% survival, respectively (Figure 2, Table III). In
comparison, only 1.1% of strain Methanobacterium spec. MC-20, 5.8% of Methanogenium
frigidum and 0.3% of Methanosarcina barkeri survived the simulation of Martian
conditions (Table III). The decrease of cell numbers correlates well with the methane
production rates of the cultures. Thus, activity of strains SMA-21, SMA-16 and SMA-23
measured before the exposure to simulated Martian conditions was similar to that after the
simulation, whereas methane production of the reference organisms Methanobacterium
spec. MC-20, Methanogenium frigidum and Methanosarcina barkeri drastically decreased
after the experiment (Figure 2, Table III). The methane production rates of Methanosarcina
spec. SMA-21 slightly decreased after exposure to simulated Martian conditions from
48.61±6.57 nmol CH4 h−1 ml−1 to 44.11±5.08 nmol CH4 h−1 ml−1 (Table III). The
activities of two other permafrost isolates, SMA-16 and SMA-23 were also only marginally
affected by the Martian experiment. The methane production rates of SMA-16 decreased
from 52.77±6.18 nmol CH4 h−1 ml−1 at the beginning of the experiment to 45.37±
0.03 nmol CH4 h−1 ml−1 after the exposure. The methane production rates of SMA-23
5000
4000
5000
Ms. barkeri
Ms. barkeri control
4000
3000
3000
2000
2000
1000
1000
0
0
Mb. spec. MC-20
Mb. spec. MC-20 control
16000
b
14000
-1
CH4 [nmol ml ]
d
18000
5000
4000
Ms. spec. SMA-21
Ms. spec. SMA-21 control
a
SMA-16
SMA-16 control
e
SMA-23
SMA-23 control
f
12000
3000
10000
8000
2000
6000
4000
1000
2000
0
0
6000
120
Mg. frigidum
Mg. frigidum control
100
c
5000
80
4000
60
3000
40
2000
20
1000
0
0
0
50
100
150
Time [h]
200
250
300
350
0
50
100
150
200
250
300
Time [h]
Figure 2 Methane production activities of the reference organisms Methanosarcina barkeri (a),
Methanobacterium spec. MC-20 (b), Methanogenium frigidum (c) and methanogens isolated from Siberian
permafrost Methanosarcina spec. SMA-21 (d), SMA-16 (e), SMA-23 (f) before and after exposure to
simulated Martian conditions (the error bars represent the standard deviation, n=3).
186
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
Orig Life Evol Biosph
TABLE III Methane production rates and cell counts of methanogenic archaea before and after exposure to
Martian conditions
Cultures
Cell counts 107
Survival rates %
CH4 production
nmol h−1 ml−1
Methanosarcina spec. SMA-21, control
Methanosarcina spec. SMA-21
SMA-16, control
SMA-16
SMA-23, control
SMA-23
Methanobacterium spec. MC-20, control
Methanobacterium spec. MC-20
Methanogenium frigidum, (DSM 16458) control
Methanogenium frigidum (DSM 16458)
Methanosarcina barkeri (DSM 8687), control
Methanosarcina barkeri (DSM 8687)
6.1±0.6
5.5±0.8
6.2±1.1
4.2±0.9
7.8±1.4
4.7±1.2
8.1±1.3
0.09±0.01
2.3±0.8
0.1±0.04
3.7±0.5
0.01±0.00
100
90.4
100
67.3
100
60.6
100
1.1
100
5.8
100
0.3
48.61±6.57
44.11±5.08
52.77±6.18
45.37±0.03
22.13±1.94
13.92±3.87
27.38±3.09
0.03±0.001
2.76±0.07
0.003±0.005
20.43±2.38
0.01±0.01
Mean ± standard error, n=3.
decreased from 22.13±1.94 nmol CH4 h−1 ml−1 to 13.92±3.87 nmol CH4 h−1 ml−1. The
activities of the reference organisms Methanosarcina barkeri and Methanobacterium spec.
MC-20 after the simulation experiment were almost extinct (Figure 2, Table III). Methane
production rates of Methanogenium frigidum significantly decreased from 2.76±0.07 nmol
CH4 h−1 ml−1 measured before the experiment to 0.003±0.005 nmol CH4 h−1 ml−1 after the
exposure.
Discussion
Methanogenic archaea from Siberian permafrost showed unexpectedly high survival under
simulated Martian thermal conditions. Three weeks of diurnal temperature and humidity
cycles did not have significant effects on the viability of the methanogens in permafrost soil
samples and in pure cultures. In contrast, the diurnal changes in humidity and temperature
killed up to 99.7% of methanogenic archaea that originated from non-permafrost habitats.
This indicates that methanogenic archaea from permafrost are more resistant to temperature
shifts between −75 °C and 20 °C as well as an aw-value between 0.1 and 0.9 than well
studied methanogens from other environments.
Terrestrial permafrost is characterized by extreme environmental conditions such as subzero temperatures, aridity and higher than normal levels of back-ground radiation as a result
of an accumulation over geological time scales. In spite of the unfavorable living conditions
permafrost is colonized by a high number of viable microorganisms (102–108 cells per g−1),
including fungi, yeasts, algae, actinomycetes and bacteria as well as highly specialized
organisms like methanogenic archaea (Kobabe et al. 2004; Wagner et al. 2005). Seasonal
variation of soil temperatures, particularly freeze–thaw cycles in the active layer, results in
drastic changes of other environmental conditions like salinity, soil pressure, changing
oxygen conditions, availability of nutrients. The temperature variations also influence the
availability of pore water, which is an essential bio-physical requirement for the survival of
microorganisms in permafrost. The most important biological feature of this water is its
possible role in the transfer of ions and nutrients (Ostroumov and Siegert 1996).
187
6 Methanogenic Archaea as Model Organisms
Methane Cycle in Permafrost Ecosystems
Orig Life Evol Biosph
Comparing different permafrost samples it could be shown, that the extreme fluctuations
in humidity and temperature conditions were more harmful for the methanogens in a
polygon depression soil than those in a floodplain soil. One of the factors favoring the
viability of methanogens under simulated Martian conditions might be the soil texture.
Methanogenic archaea have a hydrophobic cell surface and a low electrophoretic mobility
which support the attachment of these organisms to the surface of charged soil particles
(Grotenhuis et al. 1992). The sorptive capacities of natural soil particles like clay and silt or
soil organic matter provide a protective effect on methanogenic archaea (Heijnen et al.
1992; Wagner et al. 1999). Previous investigations already demonstrated that due to a
protective role of the soil matrix and the existence of a complex microbial community
composed of aerobic and facultative anaerobic microorganisms, methanogenic archaea
exhibit a high survival potential against different stress factors like high oxygen partial
pressure (Wagner et al. 1999). The different survival rates found in two permafrost soils
might therefore result from differences in grain sizes or in the water adsorption capacity of
these two soils (so-called tension or matrix potential). Thus, higher rates of survival and
activity of methanogens after an exposure to Martian conditions in samples of the flood
plain soil could be a consequence of high silt content which protects the methanogenic
archaea against harsh conditions. Compared to the flood plain, the polygon depression was
dominated by sandy material.
Also the strong aggregate formation of up to 100 cells of Methanosarcina spec. SMA-21
could be one of the mechanisms for the resistance of this archaeon. The outer cells of an
aggregate may shield the inner cells from the damaging influence of low temperature, high
salinity or intensive radiation. Probably, soil or rock grains could also serve as a shield
against UV for these organisms and provide a habitat with stable temperatures. Since
permafrost is expected to be extensively present on Mars, it is possible that methanogenic
archaea could segregate in the subsurface niches and could survive under the harsh Martian
thermal conditions.
The pure cultures of methanogens, which were not associated with a protective soil
matrix, were also exposed to simulated Martian thermal conditions. These experiments
showed that Methanosarcina spec. SMA-21 and two other permafrost strains, SMA-16 and
SMA-23, exhibit a higher resistance than the reference organisms Methanobacterium spec.
MC-20 and Methanosarcina barkeri. Most striking is that temperature shifts between−75 °C
and 20 °C as well as humidity shifts with an aw-value between 0.1 and 0.9 (averaged
0.52) have no influence on the activity and survival rates of strain Methanosarcina spec.
SMA-21. The survival rate of Methanogenium frigidum, a psychrophilic methanogen
isolated from Ace Lake in Antarctica (Franzmann et al. 1997), was higher than that of the
other reference organisms. Nevertheless, the metabolic activity of this strain also drastically
decreased after exposure. It could be hypothesized that this methanogenic archaeon is
highly adapted to perennially cold environments but is affected by fluctuations of
temperature and water activity.
The simulation experiment indicates high survival rates of methanogenic archaea from
permafrost after exposure to simulated Martian thermal conditions. Without exception, every
environment can only support life when water is present in liquid form, at least temporary. As
has been shown by Mars Odyssey measurements, the present Martian surface is not as dry as
has been postulated. In the upper meters of the Martian surface liquid water is present in the
form of adsorbed water. The content of adsorption water in the upper millimeter to centimeter
thick surface layer ranges from multiple layers of water molecules, when the atmosphere is
saturated, to less than one single molecular layer when the atmosphere is dry (Möhlmann
188
Methane Cycle in Permafrost Ecosystems
6 Methanogenic Archaea as Model Organisms
Orig Life Evol Biosph
et al. 2004). At larger depths, the content of adsorption water tends to become stable with
about one to two mono-layers. The presence of adsorption water layers is restricted to the
upper parts of the Martian surface. Adsorption is strongest during night and morning hours.
The amount of adsorption water depends on the surface properties and on the humidity of the
atmosphere. While the upper layers freeze at low temperatures, the lower one to two monolayers remains unfrozen down to a temperature of about −133 °C (Möhlmann 2005). The
temporary existence of adsorption water in the uppermost layers of the Martian surface
enables potential organisms to accumulate liquid-like water during the time adsorption water
is present at night and morning. The Mars simulation experiment with diurnal profiles of
Martian temperature and humidity within 6 mbar CO2-atmosphere indicate the availability of
adsorption water on Mars for biological processes. Comparable environments could be found
in terrestrial permafrost, where adsorption water exists in a liquid-like state at temperatures
down to −60 °C (Ananyan 1970).
The permafrost microbial community has been described as a “community of survivors”
(Friedmann 1994), which has to resist the combination of extreme conditions and the extreme
fluctuation of these conditions. High survival rates of methanogenic archaea under simulated
Martian conditions indicate unknown physiological adaptations and suggest that these
microorganisms have established ways to cope with stresses which has to include repair of the
damaged DNA, repair of cell membranes and other vital functions to maintain the viability of
cells. It remains to be determined that freeze protection mechanisms (i.e., trehalose
accumulation, synthesis of molecular chaperones, adaptation of plasma membrane composition, synthesis of antioxidant proteins, accumulation of compatible solutes, expression of
hydrophylins and other cryoprotectants) overlap with tolerance mechanisms protecting
against various other stress types like desiccation, starvation or high salt concentration (Berry
and Foegeding 1997; Macario et al. 1999; Cleland et al. 2004; Georlette et al. 2004).
Furthermore, it remains to be determined whether Martian and terrestrial permafrost have
zones with similar physical and chemical conditions (Ostroumov, 1995). Due to the
physiological potential and metabolic specificity of methanogenic archaea, no organic
matter is needed for their growth. Kral et al. (2004) have demonstrated that certain
methanogens can survive on Mars soil simulant (JSC Mars-1, collected from volcanoes on
the Hawaii island) when they are supplied with CO2, molecular hydrogen and varying
amounts of water.
The permafrost habitats on Earth represent an excellent analogue for studying putative
life on Mars. Recent analyses of Mars Express high resolution stereo camera (HRSC)
images of many regions of the planet showed that the morphology of the Martian polygonal
features is very similar to the morphology of the terrestrial ice–wedge polygons and is most
likely formed by comparable processes (Kuzmin 2005). The observation of high survival
rates of methanogens under simulated Martian conditions supports the possibility that
microorganisms similar to the isolates from Siberian permafrost could also exist in the
Martian permafrost. Methanogenic archaea from terrestrial permafrost may therefore serve
as useful models for further exploration of extraterrestrial life.
Acknowledgments The authors wish to thank the Russian–German team of the Expedition LENA 2004 for
enjoyable field work under extreme conditions, in particular Waldemar Schneider for logistic and Günter
‘Molo’ Stoof for technical support (both Alfred Wegener Institute for Polar and Marine Research). Special
thanks go to the team of the HUMIDITY-Lab Dr. Roland Wernecke & Partner and Andreas Lorek (German
Aerospace Center) as well as to the whole group of simulators (especially Dr. Jelka Ondruschka, Ulrike
Pogoda de la Vega, Prof. Dr. Sieglinde Ott, and Dr. Petra Rettberg) for successful cooperation. This research
has been supported by Deutsche Forschungsgemeinschaft (German Research Foundation) priority program
1115 “Mars and the terrestrial planets” (WA 1554/1–2).
189
7 Synthesis
Methane Cycle in Permafrost Ecosystems
7 Synthesis
7.1 Introduction
The Arctic plays a key role in the Earth’s climate system for two reasons. On the one
hand, global warming is predicted to be most pronounced at high latitudes, and
observational evidence over the past 25 years suggests that this warming is already
under way (Serreze et al., 2000; Mack et al., 2004; Richter-Menge et al., 2006). On
the other hand, one third of the global carbon pool is stored in ecosystems of the
northern latitudes (Post et al., 1982; Gorham, 1991). Thus there is considerable
socio-economic interest in predicting how the carbon balance of the northern
ecosystems will respond to ongoing climate warming.
Global warming will have important implications for the functional diversity of
microbial communities in these systems. It is likely that temperature increases in high
latitudes may stimulate microbial activity and carbon decomposition in Arctic
environments and are accelerating climate change through the increase of trace gas
(CH4, CO2) release (Melillo et al., 2002; Zimov et al., 2006). Figure 7.1 summarises
the process variables of trace gas fluxes from permafrost environments.
Figure 7.1: Schematic view of the process variables influencing the formation, transport and release
of climate-relevant trace gases.
190
Methane Cycle in Permafrost Ecosystems
7 Synthesis
The microorganisms, which are the drivers of methane production and oxidation in
Arctic wetlands, have remained obscure. Their function, population structure and
reaction to environmental change is largely unknown, which means that also an
important part of the process knowledge on methane fluxes in permafrost
ecosystems, as shown in Figure 7.1, is far from completely understood. This
hampers prediction of the effects of climate warming on arctic methane fluxes, in
particular when these predictions are based on models that do not take into account
the specific nature of microbial populations in permafrost soils and sediments.
Understanding these microbial populations is therefore highly important for
understanding the global climatic effects of a warming Arctic.
Under the umbrella of the Russian-German Cooperation SYSTEM LAPTEV SEA a
multidisciplinary research concept was developed and applied on the Arctic methane
cycle that connect trace gas flux measurements with studies on microbial processes
and communities. During eight expeditions to the Lena Delta from 1998 to 2005
(Rachold 1999, 2000; Rachold and Grigoriev, 2001; Pfeiffer and Grigoriev, 2002;
Grigoriev et al., 2003; Schirrmeister et al., 2004; Wagner et al., 2006; Schirrmeister
and Wagner., in press), methane fluxes were measured, microbial processes under
in situ conditions were studied, and samples from different permafrost ecosystems
were taken for further molecular ecological analyses. The Russian-German research
station Samoylov provided the basis for all the field investigations (Hubberten et al.,
2006). In particular, the objectives of the present study were:
7.2
to measure and balance methane fluxes from tundra environments of the
Lena Delta
to characterize soil ecological parameters determining microbial processes
in permafrost ecosystems
to gain more insights into the control functions of microorganisms involved in
the Arctic methane cycle and their response to climate change
to improve and increase the knowledge of the abundance and biodiversity of
microbial communities involved in the carbon decomposition in permafrost
environments and of their phylogenetic affiliations
to determine tolerance limits of methanogenic archaea isolated from Siberian
permafrost under extreme living conditions
Methane Release from Tundra Environments of the Lena Delta
The methane release from tundra environments was measured within the scope of a
long-term study on trace gas fluxes (CH4, CO2) in the Lena Delta since 1998 until
today and will be still continue in the future. Presently, a data record of the methane
191
7 Synthesis
Methane Cycle in Permafrost Ecosystems
emissions for the last eight years is evaluated in regarding to long-term trends of
trace gas fluxes in the Siberian Arctic (Wagner et al., in prep.).
Closed chamber measurements were used to study the methane fluxes on the plot
scale and to link these results with soil ecological variables and microbial processes
(see chapter 7.3). In 2002, these measurements were complemented by a
micrometeorological eddy covariance measurement system, which was designed for
high-resolution measurements on turbulent fluxes of methane, carbon dioxide,
momentum, heat and water in the atmospheric boundary layer (Kutzbach, 2005).
These additional analyses provide data for the balance on trace gas fluxes on the
ecosystem scale and for the validation and improvement of process-based flux
models.
Figure 7.2: Schematic overview of the spatial fluctuations of methane emissions from the different
landscape units on Samoylov Island (study site and expedition): 1. northern floodplain, LENA 2002
and LENA-ANABAR 2003; 2. western floodplain, LENA 1999; 3./4. low-center ice-wedge polygons on
the long-term study site, LENA 1999 until LENA 2006; 5./6. polygonal lakes, LENA 2000 and LENA
2001; 7. perennially frozen ground, LENA 2001 and LENA 2002; 8. Holocene and Pleistocene icewedges, LENA 2000.
The long-term study site is located on Samoylov Island in the polygonal tundra, which
is the typical patterned ground in the Siberian Arctic. The microrelief elements (rim
and depression) of these low-centered polygons and the respective soil and
vegetation types appear in regular cyclic intervals of 10–30 m (see page 150, Fig. 9.3
A). Thus, soil conditions, vegetation characteristics, and consequently methane
192
7 Synthesis
Methane Cycle in Permafrost Ecosystems
fluxes in polygonal tundra are highly variable on the small scale (decimetres to
metres) but rather homogenous on the large scale (102 to 104 metres). Figure 7.2
illustrates the spatial fluctuations in methane emission from the different landscape
units on Samoylov Island. In the following, each one data set of methane emission
measured with closed chamber (1999) and micrometeorological eddy covariance
(2003/2004) technique will be discussed. The two data records were exemplarily
selected, because they cover the longest time series in the Lena Delta.
Table 7.1: Daily methane emission rates for the entire vegetation period from the polygonal study site
on Samoylov Island (n = 5).
methane emission (mg CH4 m-2d-1)
micro site
depressed
center
elevated
rim
June
July
August
September
October
Mean
54.1
93.7
44
17.9
11.2
Min
13.7
60.3
32.9
7
2.3
Max
89.4
119.6
72.6
25.8
25.3
Mean
2.5
4.7
6.1
2.1
1.7
Min
0.7
3.3
3.1
0.6
0.7
Max
4.6
6.2
11.4
4
3.9
In 1999, the methane release from the polygonal site (plot scale) could be measured
for the first time during the entire vegetation period from the end of May to the
beginning of September (chapter 4.2). The methane fluxes of the depression differed
strongly from those of the rim of the polygon. The mean flux rate for the total
vegetation period of the depression was 53.2 ± 8.7 mg CH4 m-2 d-1, whereas the
mean flux rate of the dryer rim part of the polygon was 4.7 ± 2.5 mg CH4 m-2 d-1. The
emission of methane from the depression covered dominantly by Carex aquatilis
showed large seasonal fluctuations. Right from the start of soil thawing a relatively
high methane flux rate of more than 10 mg CH4 m-2 d-1 was determined at the
beginning of June (Table 7.1). This rate increased with advanced thawing of the
active layer and reached the highest values with about 120 mg CH4 m-2 d-1 in the
middle of July. In contrast to the polygon depression, methane fluxes of the rim,
which is dominated by moss vegetations, showed minor seasonal fluctuations.
During the whole season the rate was lower than 12 mg CH4 m-2 d-1.
The strong seasonal and spatial fluctuations are caused by the fundamental
microbial processes of methane production and oxidation (chapter 7.3), which are
193
7 Synthesis
Methane Cycle in Permafrost Ecosystems
steered by numerous abiotic (e.g. soil temperature, soil moisture, active layer thaw
depth) and biotic (organic matter quality, vegetation) variables:
1. One important parameter controlling methane emissions is soil temperature,
because the microbiological activity depends on temperature, as confirmed by
numerous studies of methane emission using closed chamber or eddy
covariance techniques (e.g. Nakano et al., 2000; Christensen et al., 2001;
Hargreaves et al., 2001). However, this relationship has changes based on
depth within the soil profile. The upper soil layers, dominated by mesophilic
microorganisms, are characterized by high temperature fluctuations, while the
bottom part, populated by psychrophilic microbes, showed lower in situ
temperatures with slight seasonal variations (chapter 4.2; 4.3; 5.2). Therefore,
the methane production and oxidation in the top soil is rather more influenced
by temperature fluctuations than as by the processes in the bottom of the
active layer.
2. Many studies identified the thaw depth of soils as an important predictor of
methane emission (e.g. Friborg et al., 2000; Tsuyuzaki et al., 2001; van
Huissteden et al., 2005). In the present study, the thaw depth was found to
correlate weakly with the methane emissions and does not improve the
applied flux model based on soil temperature (chapter 3.1). This observation
can be explained in two ways. Firstly, during short flux studies, which use the
closed chamber technique, the correlation between methane flux and thaw
depth is usually spatial. A spatial correlation at one point in time does not
imply the existence of a temporal correlation during the course of the season.
Secondly, during distinct periods of the season, soil thaw depth and soil
temperature are highly correlated. In this case, the methane fluxes were also
significantly correlated with the thawing of the active layer shown for the early
vegetation period in 1999 (Figure 7.3; chapter 4.2). However, when the time
series included data from the periods of spring thaw and autumnal freezeback, the different behaviour of the two variables became apparent and the
ability of soil thaw depth to explain variations of methane flux diminished.
3. In many other studies, the water table position was identified as the main
factor that controls methane emission (e.g. Friborg et al., 2000; Suyker et al.,
1996). This was explained with the regulation of the methane
production/oxidation balance through changes of the aerobic/anaerobic soil
column ratio. However, no significant influence of the water table on methane
flux was detected by high-resolution eddy covariance measurements, despite
the great variations of the water table position through the season. This can be
explained with respect to the microrelief elements prevalent in our study area:
Firstly, in the polygon rims, the water table was always well below the soil
surface, so the ratio of aerobic/anaerobic soil column was always high.
194
Methane Cycle in Permafrost Ecosystems
7 Synthesis
Furthermore, process studies have shown that oxidation activity in these soils
is greatest near the aerobic-anaerobic interface, where psychrophylic
methanotrophic bacteria exist and the substrate provision is at its optimum
(chapter 4.3). Hence the methane flux from polygon rim areas does not
respond strongly to variations of the water table position. Secondly, despite
the variations in water table position, in most of the polygon centers, the water
table was distinctly above the soil surface in most measurement periods, so
that the change in the water table position could not influence the methane
production/oxidation balance significantly. However, extreme draught could
lower the water level below the soil surface in many polygon centers and lead
to increased oxidation and overall decreased methane flux. This “on-off
switch” effect was observed for single polygon center sites on Samoylov Island
during the summer of 1999 (chapter 4.2).
4. The vegetation occupies a central position for the gas transport. Plants can
have both enhancing and attenuating effects on methane emission. Through
the aerenchyma of vascular plants, oxygen is transported from the
atmosphere to the rhizosphere, thus stimulating methane oxidation in
otherwise anoxic soil horizons (Van der Nat & Middelburg 1998; Popp et al.
2000). In opposite direction, the aerenchyma are a major pathway for methane
transport from the anoxic horizons to the atmosphere, bypassing the
oxic/anoxic interface in the soil, where methane oxidation is prominent
(chapters 4.2 and 4.3). Furthermore, the vegetation provides the substrates for
methanogenesis as decaying plant material and fresh root exudates (Whiting
& Chanton 1992; Joabsson et al. 1999). Using self-constructed chambers,
methane transport via Carex aquatilis was shown to account for between 27
and 68 % of overall methane emissions at the polygonal tundra on Samoylov
Island (chapter 3.2).
The eddy covariance measurements of methane fluxes from wet polygonal tundra
(ecosystem scale) on Samoylov Island revealed daily summer fluxes of about 30 mg
CH4 m-2 d-1 (chapter 3.1). These values are lower compared to methane emissions
reported by other eddy covariance flux studies from arctic wetlands. Friborg et al.
(2000) reported average methane fluxes of about 50 mg m-2 d-1 during July and
August from a north-east Greenland fen (74°N) and Hargreaves et al. (2001)
measured a mean methane emission of 38 mg m-2 d-1 from a Finnish mire (69°N) in
August. These differences can be mainly attributed to: (i) the longer field campaign
on Samoylov Island, including the period of spring thaw and autumnal freeze back
(June-October) and (ii) the genesis of ice-wedge polygons, which lead to a strong
spatial heterogeneity in soil and vegetation properties and to a high surface coverage
of dry sites (> 50%). However, as the main driving parameters of methane emission
on the ecosystem scale soil temperature and near surface atmospheric turbulence
195
7 Synthesis
Methane Cycle in Permafrost Ecosystems
was identified. A model based on these variables explained variations of methane
flux corresponding to continuous processes of microbial methane generation and
oxidation (chapter 7.3), and diffusion through soil and plants (chapter 3.2) reasonably
well.
a
b
c
Figure 7.3: Redox potential (a), thaw depth (b) and methane emission (c) measured in a polygonal
tundra for the main vegetation period in 1999 on Samoylov Island.
196
7 Synthesis
Methane Cycle in Permafrost Ecosystems
For the overall balance of methane emissions from the entire delta the first land
cover classification was performed on the basis of Landsat 7 ETM+ images and
applied for an upscaling of methane fluxes as inferred from closed chamber
measurements (chapter 3.3). Nine land cover classes characterized by their
vegetation, surface moisture, and topography could be defined by this approach for
the Lena Delta region (Figure 7.4).
1.5% (444 km²)
2.1% (610 km²)
12.1% (3519 km²)
28.5%
(8277km²)
7.5%
(2173 km²)
6.3% (1832 km²)
Shallow water
Mainly non-vegetated areas
Wet sedge- and moss-dominated tundra
Moist grass- and moss-dominated tundra
Moist to dry dwarf shrub-dominated tundra
Dry moss-, sedge- and dwarf shrub-dominated tundra
5.5% (1590 km²)
5.8% (1697 km²)
Water bodies
30.6%
(8894 km²)
Dry grass-dominated tundra
Dry tussock tundra
Figure 7.4: Results of land cover classification of the Lena Delta based on Landsat 7 ETM+ images
(modified according to Schneider et al., submitted).
The total area of the Lena Delta was quantified with 29036 km2 with large spatial
fluctuations in methane emission rates ranging from 0-200 mg m-2 d-1 (Figure 7.5).
Although the measured methane emissions on the plot scale (Figure 7.2) are similar
to those reported from analogous areas in high latitudes (e.g. reviewed by Harriss et
al., 1993, Corradi et al., 2005; van Huissteden et al., 2005), the regionally weighted
mean daily methane fluxes of the Lena Delta (10 mg CH4 m-2d-1) are less than those
calculated for other arctic wetlands. Although long-term studies of methane emission
rates are necessary for the refinement of global methane flux estimates (Matthews
and Fung, 1987), most of the studies on methane fluxes in the high arctic consider
only a measuring period of less than four weeks (Bartlett et al., 1992; Whalen and
Reeburgh, 1992; Vourlitis et al., 1993; Christensen et al., 2000; Nakano et al., 2000;
Tsuyuzaki et al., 2001). Most calculations are only based on measurements made
through a couple of days for the whole season (Torn and Chapin, 1993; Christensen
et al., 1995; Oberbauer et al., 1998; Verville et al., 1998). The low methane emission
estimated in this study can be explained by the used integrative approach of longterm flux measurements and supervised land cover classifications, which has not
been undertaken so far. The annual methane emission of the Lena Delta amounts to
about 0.03 Tg. A comparison of the Lena Delta source strength with other arctic
areas is difficult, since so far only few other studies were published presenting a
balance of methane emissions for tundra environments (Whalen & Reeburgh, 1988;
197
7 Synthesis
Methane Cycle in Permafrost Ecosystems
Morrissey & Livingston, 1992; Christensen, 1993; MacDonald et al., 1998;
Christensen et al., 2000).
Figure 7.5: Methane emission in the Lena Delta. Calculation based on supervised classification of
satellite data and on methane flux studies (projection: UTM (WGS84), zone 52; classification: Landsat
7 ETM+, acquisition dates: 27.07.00 and 26.07.01; map according to Schneider 2005).
This study is the first attempt to assess the methane fluxes of the Lena Delta based
on field measurements and on satellite data. The used approach provides a more
realistic estimation of the real methane emissions on the regional scale as the
hitherto published results, because of the high-resolution data base and the applied
remote sensing methods. Despite some potential uncertainties, the results show that
the Lena Delta contributes significantly to the global methane emission because of its
extensive wetland areas. Furthermore, the study delivered the longest high-resolution
time series of methane emissions on the ecosystem scale in the high Arctic using
eddy covariance technique.
7.3 Microbial Processes and Communities Involved in the Arctic Methane Cycle
As the preceding notes indicate, the microbial processes of methane production and
oxidation as well as the involved microbial communities must be known in order to
understand the spatial and seasonal fluctuations of methane fluxes (chapter 7.2) and
198
Methane Cycle in Permafrost Ecosystems
7 Synthesis
for the assessment of the recent and future carbon dynamics in permafrost
environments. The remarks in this chapter will mainly focus on the results obtained
from the polygonal study site on Samoylov Island, unless otherwise stated.
Permafrost environments in the Arctic are characterised by extreme environmental
conditions which demand a specific resistance of microorganisms to survive and to
be metabolic active under these conditions. The seasonal unfrozen part of
permafrost (active layer, approx. 0.5 m thickness at the study site) is subjected to
freezing and thawing cycles during the year with an extreme surface temperature
from about +25 °C to –45 °C. During the Quarternary, prolonged cryogenic processes
led to the formation of patterned grounds like the low-centered ice-wedge polygons
on the main investigation area on Samoylov Island (Figure 1.5). During the summer
period, soils within these polygons are showing large gradients in temperature and
geochemistry along their depths profiles (chapters 4.1, 4.2, 4.3, 5.2), which are the
main environmental factors influencing the microbial communities in permafrost soils.
The present study reveals differences of the micro-relief elements of the investigated
low-center polygon between the elevated rim and the depressed center in respect to
microbial activities, community structure, and soil characteristics on the ecosystem
scale (centimetres to metres).
In spite of the extreme habitat conditions permafrost soils are colonized by high
numbers of microorganisms including representatives of Bacteria and Archaea
(chapters 4.3 and 5.1). The highest total cell counts were in the range of 109 cells g-1
soil and decrease from the top to the bottom of the active layer. Detailed analyses of
methanotrophic cell counts showed highest numbers in the polygon rim where they
ranged between 1.0 x 108 and 3.0 x 106 cells g-1 soil, while their numbers in the
polygon center were two orders of magnitude lower compared to the rim part. In
contrast, most methanogenic archaea were found in the upper soil horizon of the
polygon center with 3.0 x 108 cells g-1 soil, which assigned to 22 % of total cell
counts.
These high cell numbers are reflected also in the high microbial biomass (expressed
in total phospholipid biomarker concentrations) with maximal values for the polygon
rim and center, respectively, of 105.5 and 851.6 nmol g-1 soil (chapter 5.2). They are
significantly higher than in arable soils (35.2 – 59.4 nmol g-1, Gattinger et al., 2002b,
Zelles, 1999), rice paddies (44.7 – 90.9 nmol g-1 dw, Bai et al., 2000), and boreal
Swedish peatlands (0.2 – 7.0 nmol g-1 wet peat, Sundh et al., 1997).
Independently of the harsh living conditions in permafrost ecosystems both methane
production and methane oxidation could be proven in all examined soils. However,
activities of methanogens and methanotrophs differed significantly in their rates and
distribution patterns among the two investigated profiles of the main study site
(chapters 4.2, 5.2 and 5.3).
199
7 Synthesis
Methane Cycle in Permafrost Ecosystems
The methane production and oxidation in the polygon rim showed the typical activity
patterns as known from other hydromorphic soils (e.g. Krumholz et al., 1995), which
means in the case of methane production no or less activity in the dry and oxic upper
horizons and increasing rates in the anoxic bottom layers. In contrast, this pattern
was not observed in the polygon center. Here the highest methane production
occurred in the upper soil horizons, which posses not the best conditions for
methanogenesis shown by the redox status of this site (chapter 4.1).
These small-scale differences in the activity in the microrelief could be attributed
primarily to the quality of organic matter. Although organic carbon is highly
accumulated in permafrost soils, a substrate limitation was found by studying
potential methane production rates (chapters 5.2, 5.3). Subsequent analyses
revealed a decrease of bioavailable organic matter (BWEOC) along with an
increasing humification index with increasing soil depth. This trend shows that there
is actually a high quantity of organic matter, particularly in the wet center, but that this
carbon is not available for the microorganisms.
Another important factor for microbial metabolism is the habitat temperature. Even if
only few psychrophilic strains of methanogens and methanotrophs have been
described so far (Cavicchioli, 2006; Trotsenko and Khmelenina, 2002), the present
results indicate a shift within the microbial communities from mesophilic to
psychrotolerant or psychrophilic organisms with increasing soil depth.
This adaptation was shown by phospholipid analyses, which reveal a shift of the
overall composition of the microbiota with depth in both soils of the polygon. An
increasing portion of iso- and anteiso-branched fatty acids related to the amount of
straight chain fatty acids (both groups of biomarker are synthesised by different
groups of bacteria; chapter 5.2) was determined. Branched chain fatty acids are
typical found in cold-adapted microorganisms. This general trend was confirmed by
the investigations on methanogenesis and methanotrophy in dependence of the
temperature at the same site (chapters 4.3, 5.2 and 5.3).
The soils on Samoylov Island showed at least two optima of methane production
activity within the vertical profile. Especially in the polygon rim, the highest activity
occurred in the bottom of the active layer with an in situ temperature of around 1°C.
The methane oxidation activity showed vertical shifts within the optimal temperature
and within the distribution of type I and type II methanotrophs. In the upper active
layer, maximum methane oxidation potentials were detected at 21°C. Deep active
layer zones that are constantly exposed to temperatures below 2°C showed a
maximum potential for methane oxidation at 4°C. This indicates a dominance of
psychrophilic methanotrophs close to the permafrost table.
These findings indicate an adaptation of the microbial communities involved in the
methane cycle of permafrost soils to the low in situ temperatures. This is also in
200
Methane Cycle in Permafrost Ecosystems
7 Synthesis
accordance with the determination of high cell numbers of 1.2 x 108 cells g-1 soil in
the boundary layer to the permafrost (chapter 5.1).
Figure 7.6: Phylogenetic tree illustrating the affiliation of methanogenic 16S rRNA gene sequences reamplified from DGGE bands for Methanosarcinaceae. The “backbone” trees are based on maximum
likelihood analysis of the dataset made with RAxML-IV and partial sequences of the permafrost DGGE
bands (shown in bold) were added to the tree using parsimony addition tool of the ARB program
package. The scale bar represents 0.05 changes per nucleotide. Identification of the bands is shown
in chapter 5.3. Clone name, accession number, environment and length of each sequence are
indicated.
201
7 Synthesis
Methane Cycle in Permafrost Ecosystems
Investigations on the microbial diversity in permafrost soils started only recently and
are yet not fully completed. However, preliminary results of bacterial 16S rDNA clone
library analyses revealed a distinct variability of the main phyla (e.g. Bacteroidetes,
Chloroflexi, Firmicutes and Proteobacteria) within the soil of the polygon rim, while
the community composition in the center soil is more homogenous (Liebner et al., in
prep.). On the other hand, community structure analysis based on phospholipid
profiling showed similarities between both soils for esterlinked PLFAs (biomarkers for
bacteria) and differences in the fraction of unsaponifiable PLFAs and PLELs
(biomarkers for anaerobes and archaea; chapter 5.2). The differences in the
community structure both in the vertical profile and in the microrelief seem to be
primarily refered to the differences in the soil moisture regime. The polygon rim is
characterized by oxic conditions in the upper part, while anoxic conditions dominate
above the permafrost table. In contrast, the polygon center is predominantly
characterized by water saturation over the entire vertical profile.
Detailed sequence analyses of methanogenic communities in three different
permafrost soils based on 16S rRNA gene fingerprints revealed a distinct diversity of
methanogenic archaea affiliated to Methanomicrobiaceae, Methanosarcinaceae and
Methanosaetaceae (chapter 5.3). There were no restrictions of the detected families
to specific depths or sites. Only sequences of Methanosaetaceae could not be
detected in the polygon center soil of Mamontovy Klyk. According to statistic
analyses out of the 28 sequences, 16 sequences can be assigned to four specific
permafrost clusters. Figure 7.6 illustrates exemplarily the affiliation of methanogenic
16S rRNA gene sequences re-amplified from DGGE bands for Methanosarcinaceae.
It is hypothesized from the obtained results, albeit somewhat speculative, that these
clusters are formed by methanogenic archaea characterised by specific adaptation
processes to the harsh permafrost conditions. However, a relationship between the
activity and the diversity of methanogens in permafrost soils could not be proven.
Apart from the understanding of the ecological system (integration of soil variables
with microbial processes and community structure), the seasonal change of the
microbial processes is of importance for the knowledge of the large seasonal
fluctuations in methane emissions (chapter 7.2). Therefore, the methane production
and oxidation was quantified under in situ conditions in early and late summer in
1999 (chapter 4.2).
The microbiological processes of the polygon depression clearly correlate with the
observed seasonal methane fluctuations. By the beginning of July, the methane
production in the upper soil layer was unusually high with a rate of about 39 nmol
CH4 h-1 g-1. At the same time, methane oxidation in the upper soil layer amounted to
about 2 nmol CH4 h-1 g-1, whereas no activity was found in the deeper soil layers.
Considering the analysed methane production and oxidation rates and the calculated
202
Methane Cycle in Permafrost Ecosystems
7 Synthesis
potential fluxes within the soil profile, only 4 % of the produced methane is oxidized
by the methanotrophic bacteria in the upper soil layer. Compared with other
ecosystems, where up to 90 % of the formed methane can be oxidized by
methanotrophic bacteria (Frenzel et al., 1990; Khalil et al., 1998; Le Mer and Roger,
2001), the oxidation activity in the permafrost soil is very low at the beginning of the
vegetation period. The high methane production rate together with the low methane
oxidation rate can explain the highest methane fluxe rates determined in July 1999
(Figure 7.3c).
At the beginning of August, the methane production and oxidation activity of the
microorganisms differed completely from those of July. The methane production in
the upper soil layer drastically decreased to about 4.5 nmol CH4 h-1 g-1, while the
methane oxidation, which could be detected now in nearly the whole profile, strongly
increased to rates between 4 and 7 nmol CH4 h-1 g-1. The calculated balance of the
methane production and oxidation for the whole profile showed, that the microbial
methane oxidation capacity (66 mg m-2 d-1) in this period was about two times higher
than the methane production (29 mg m-2 d-1). Nevertheless, a significant methane
release from the polygon depression was also determined in August 1999, which can
be attributed to the influence of the vegetation (chapter 3.2). Figure 7.7 summarizes
the results of integrated investigations on methane fluxes and microbial processes for
this case study.
Figure 7.7: Illustration of the microbial processes associated with the methane cycle as well as the
methane flux rates of a polygonal tundra on the basis of the spring and late summer conditions
(detailed explanations are given in chapter 4.2).
203
7 Synthesis
Methane Cycle in Permafrost Ecosystems
The degradation of permafrost and the associated release of climate-relevant trace
gases, as a consequence of an enhanced turnover of organic carbon and from
ancient methane reservoirs, represent a potential risk with respect to future global
warming. At this point, it becomes important to know how the microorganisms and
their potential activities behave in the perennially frozen ground.
Therefore, a permafrost core of Holocene age was drilled in the Lena Delta in order
to improve the prediction of the carbon dynamics in highly sensitive Arctic permafrost
ecosystems (chapter 4.4). The organic carbon of the permafrost sediments varied
between 0.6 and 4.9 % and was characterized by an increasing humification index
with permafrost depth. A high methane concentration was found in the upper 4 m of
the deposits, which correlates well with the methanogenic activity and archaeal
biomass (expressed as PLEL concentration). Even the incubation of core material at
–3 °C and –6 °C with and without substrates showed a significant methane
production (range: 0.04 – 0.78 nmol CH4 h-1 g-1).
This work shows for the first time that microorganisms (particularly methanogens and
methanotrophs) do not only survive in permafrost habitats but also can be metabolic
active in perennially frozen deposits. Despite the adaptation of the microorganisms to
their cold environment, it was shown that a slight increase of the temperature can
lead to a substantial increase of methanogenic activity. In dependence of the
microrelief, the hydrological conditions and the vegetation, the methane oxidation can
be an important sink for methane in permafrost ecosystems. However, the erosion
and degradation of permafrost can lead to an extensive expansion of the methane
reservoir by in situ methanogenesis as shown for the Holocene deposits, with their
subsequent impacts on total methane budget.
7.4 Survival of
Conditions
Methanogenic
Archaea
under
Extreme
Environmental
Terrestrial permafrost, in which microorganisms have survived for several millions of
years (Vorobyova et al., 1997, Rivkina et al., 1998), is considered as a model for
extraterrestrial analogues, because of their comparable environmental conditions
(chapter 6.1). The Martian surface and terrestrial permafrost areas show similar
morphological structures (Figure 7.8), which points to profound cryogenic processes
(Kuzmin, 2005). Despite the harsh living conditions, terrestrial permafrost is colonized
by high numbers of microorganisms such as methanogenic archaea (cp. chapter
7.3). Survival of microorganisms is sustained by anabiosis (dormant stage of life) or
by reduced metabolic activity in unfrozen water films (chapter 4.4). Methanogenic
archaea represent the most suitable model organisms for studying life under extreme
204
7 Synthesis
Methane Cycle in Permafrost Ecosystems
permafrost conditions, because of their potential to lithoautotrophic growth (chapter
6.1).
a
b
Figure 7.8: Polygonal patterned ground: a.) Lena Delta, Siberian Arctic (April 1999, photo W.
Schneider, AWI) and b.) Mars, Northern Hemisphere, (May 1999, photo NASA).
For the investigation of the stress tolerance of methanogenic archaea,
representatives of these organisms have been enriched and isolated from permafrost
soils of Samoylov Island with hydrogen, methanol and acetate as substrates (Figure
7.9). Most of the experiments were carried out with Methanosarcina spec. SMA-21.
The organism was grown on bicarbonate-buffered, oxygen-free OCM culture medium
(Boone et al., 1989) under an atmosphere of H2/CO2 (80:20 v/v, pressurised to 150
kPa). SMA-21 grew well at 28°C and slowly at low temperatures (4°C and 10°C). The
cells grow as irregular cocci, with a diameter of 1-2 µm. Cell aggregates were
regularly observed. All other methanogenic isolates were not phylogenetically
described so far. However, cells of the strain SMA-16 were small irregular diplococci,
0.5–1 µm in diameter. Strain SMA-23 appeared as rod-shaped cells with about 1 µm
in width and max. 8 µm in length. This strain often appears in the forms of long cell
chains.
The survival potential of Methanosarcina SMA-21 was analyzed in comparison to
methanogenic archaea from non-permafrost environments as reference organisms
(Methanosarcina barkeri DSM 8687, Methanobacterium spec. MC-20; chapter 6.3).
They were exposed to different environmental stress conditions comprising low
temperature (down to -78.5 °C), high salinity (up to 6 M NaCl), starvation (up to 3
months), long-term freezing (up to 2 years), desiccation (up to 25 days) and oxygen
exposure (up to 72 hours).
205
7 Synthesis
Methane Cycle in Permafrost Ecosystems
a
b
c
d
e
f
Figure 7.9: Phase contrast and fluorescence micrographs of methanogenic archaea isolated from
Siberian permafrost. Methanosarcina SMA-21 (a, b), strain SMA-16 (c, d) and strain SMA-23 (e, f).
The cells were stained with the general oligonucleotid probe for Archaea (ARC915 Cy3, d), DAPI (f)
and self fluorescence by 420 nm (b). Bar = 10 µm (photos according to Morozova et al, in press).
Methanosarcina SMA-21 showed remarkably high resistance to all of the tested
stress conditions, while the reference organisms reacted very sensitively to the same
stress parameters (chapter 6.3). Strain SMA-21 can be active even under salt
saturated conditions. The activity was twice as high at 4°C with 0.022 nmol CH4 h-1
206
Methane Cycle in Permafrost Ecosystems
7 Synthesis
ml-1 than it was at 28°C (0.013 nmol CH4 h-1 ml-1) at the same salt concentration. This
corresponds to the environmental conditions in permafrost in late autumn. During the
freeze-back of the active layer the salt concentration in the remaining pore water
increases. Furthermore, a high survival of more than 70% of the cells was observed
after freezing at -78.5°C. Pre-conditioning to cold temperatures (cold shock), known
to increase the resistance to freezing of many microorganisms due to the expression
of cold-responsive genes and cryoprotectant molecules (Kim & Dunn, 1997; Wouters
et al., 2001; Georlette, 2004; Weinberg et al., 2005), does not increase the freezing
tolerance of Methanosarcina SMA-21. This finding is consistent with the resistance to
long-term freezing of this archaeon observed after two-year exposure at -20°C
without any pre-conditioning. Both results suggest that this strain is already adapted
to the extreme temperature regime of the permafrost habitat.
Incubation of the reference organisms without any substrate was very efficient in
reducing the survival potential of these methanogens, which do not survive after one
month of starvation. In contrast, Methanosarcina SMA-21 maintained high survival
rates even after being starved for three months. The same trend was observed for
desiccation, which was lethal for the reference organisms, whereas Methanosarcina
SMA-21 survived for at least 25 days.
Most striking was the ability of the permafrost strain to survive for several hours in the
presence of oxygen without any decrease in cell numbers or methane production
rates. Moreover, a significant portion (10 %) of Methanosarcina SMA-21 population
survived up to 72 hours of oxygenation.
It has been shown by Kiener and Leisinger (1983) that the arrangement of cells in
packets, which is typical for the genus Methanosarcina, protected these anaerobic
colony-forming units during extended periods of environmental stress like varying
oxygen concentrations. Thus, it was concluded that the outer cell aggregates of
Methanosarcina SMA-21 also protect the inner cells from the damaging influence of
the permafrost environments, such as caused by ice crystal formation at low
temperatures that increases the salinity or leads to high oxygen concentrations. Apart
from the physico-chemical conditions of permafrost, the physiological properties of
methanogens are relevant for the adaptation to extreme conditions. The survival of
methanogenic archaea in permafrost can be archieved, if they aquire the abilities of
DNA repair, modification of cell membranes and other vital functions to maintain cell
viability (Rivkina et al., 2004). However, cell damages caused by different stress
factors seem to be compensated by similar protecting mechanisms. For instance
most of freeze protection mechanisms (synthesis of chaperones, accumulation of
compatible solutes, modification of cytoplasm membrane, synthesis of antioxidants)
overlap with tolerance mechanisms protecting cells against desiccation, starvation or
high salt concentrations (Macario et al., 1999; Georlette et al., 2004).
207
7 Synthesis
Methane Cycle in Permafrost Ecosystems
Apart from the single stress experiments, the probability of methanogens to survive
under present Martian conditions was studied by running a unique Mars simulation
experiment within the HUMIDITY-Lab of the German Aerospace Center (chapter 6.4).
Figure 7.10: Methane production activities of the reference organisms Methanosarcina barkeri (a),
Methanobacterium MC-20 (b), Methanogenium frigidum (c) and methanogens isolated from Siberian
permafrost Methanosarcina SMA-21 (d), SMA-16 (e), SMA-23 (f) before and after exposure to
simulated Martian conditions (the error bars represent the standard deviation, n=3).
Three strains of methanogens from Siberian permafrost (Methanosarcina SMA-21,
SMA-23 and SMA-16) and three reference organisms from non-permafrost habitats,
(Methanosarcina barkeri DSM 8687, Methanogenium frigidum DSM 16458 and
Methanobacterium spec. MC-20), were exposed to conditions equivalent to those of
the equatorial Martian surface for 22 days: the diurnal temperature during the
simulation varied between -75°C and +20 and the water activity between aw values of
0.1 and 0.9 in an anoxic, Mars-like atmosphere dominated by carbon dioxide (95.3
%). The methanogens from permafrost and non-permafrost habitats showed distinct
differences in their survival potential under Martian conditions.
The average cell number of Methanosarcina SMA-21 decreased from 6.1×107 cells
ml−1 at the beginning of the experiment to 5.5×107 cells ml−1 at the end of the
simulation, which equals to a survival rate of 90.4%. Strains SMA-16 and SMA-23
showed a survival rate of 67.3% and 60.6%, respectively. In comparison, only 1.1%
208
Methane Cycle in Permafrost Ecosystems
7 Synthesis
of Methanobacterium MC-20, 5.8% of Methanogenium frigidum and 0.3% of
Methanosarcina barkeri survived under simulated Martian conditions. The decrease
of cell numbers correlates well with the methane production rates of the cultures.
Thus, activity of strains SMA-16, SMA-21 and SMA-23 measured prior to the
exposure to simulated Martian conditions was similar to that after the simulation,
whereas methane production of the reference organisms Mb. MC-20, Mg. frigidum
and Ms. barkeri drastically decreased after the experiment (Figure 7.10). The
methane production rates of Ms. SMA-21 slightly decreased after exposure to
simulated Martian conditions from 48.61 ± 6.57 nmol CH4 h−1 ml−1 to 44.11 ± 5.08
nmol CH4 h−1 ml−1. The activities of two other permafrost isolates, SMA-16 and SMA23 were also only marginally affected by the Martian experiment. The methane
production rates of SMA-16 decreased from 52.77 ± 6.18 nmol CH4 h−1 ml−1 at the
beginning of the experiment to 45.37 ± 0.03 nmol CH4 h−1 ml−1 after the exposure.
The methane production rates of SMA-23 decreased from 22.13 ± 1.94 nmol CH4 h−1
ml−1 to 13.92 ± 3.87 nmol CH4 h−1 ml−1. The activities of the reference organisms Ms.
barkeri and Mb. MC-20 after the simulation experiment were almost extinct. Methane
production rates of Mg. frigidum significantly decreased from 2.76 ± 0.07 nmol CH4
h−1 ml−1 measured before the experiment to 0.003 ± 0.005 nmol CH4 h−1 ml−1 after
the exposure. Obviously methanogenic archaea from permafrost ecosystems more
persistent under unfavourable, mars-like living conditions than those from nonpermafrost environments.
209
8 Conclusions
Methane Cycle in Permafrost Ecosystems
8 Conclusions
The present thesis provides the first integrated research on methane dynamics in
Arctic permafrost ecosystems that connects trace gas flux measurements with
studies on microbial processes and communities. The findings demonstrate the close
relationship between apparent methane fluxes and the modes and intensities of
microbiological processes of methane production and oxidation in the polygonal
tundra soils. The permafrost environment forces the adaptation of the microbial
communities to low temperature conditions with species, which have been untraced
in temperate ecosystems so far. An important finding is that in addition to soil
characteristics and climate conditions, the activity and physiology of the microbial
communities dictate trace gas fluxes in permafrost soils. In this manner, the
conducted study underlines that the prediction and modeling of the future fate of the
large carbon reservoir in permafrost ecosystems also has to involve a sophisticated
view of the small-scale microbiological processes in permafrost soils. The following
conclusions can be drawn from the specific results obtained in this study:
The methane emission from the polygonal tundra is comparatively low
regarding both daily summer fluxes (typically 30 mg CH4 m-2 d-1) and the total
annual flux (3 g CH4 m-2). Reason for this may be (a) the very low permafrost
temperature in the study region, (b) the sandy soil texture and low bioavailability of nutrients in the soils, and (c) the genesis of ice-wedge polygons
which lead to a strong spatial heterogeneity in soil and vegetation properties
and to a high surface coverage of dry micro-sites (> 50 %).
The used upscaling approach for the calculation of methane flux balances,
based on remote sensing and supervised image classification, provides a
more realistic estimation of the methane emission on the regional scale than
most of the published data for comparable environments.
Although permafrost soils include a high amount of organic carbon,
methanogenesis is substrate-limited because of a depth-dependence
decrease of organic matter quality within the soils. This is an important finding
for modeling and calculating trace gas fluxes from permafrost environments,
because the known flux models only consider the total carbon amount.
The microbial community analyses show that permafrost soils of the Siberian
Arctic are composed by members of all three domains of life (Archaea,
Bacteria and Eukarya), with a total biomass comparable to temperate soil
ecosystems.
Both groups of microorganisms (methanogens and methanotrophs) involved in
the Arctic methane cycle are well adapted to the extreme environmental
conditions of their habitat. This is reflected in a shift of the microbial
210
Methane Cycle in Permafrost Ecosystems
8 Conclusions
communities from mesophilic to psychrotolerant or psychrophilic species along
the temperature gradient of permafrost soils.
Phylogenetic analyses of methanogenic archaea reveal specific clusters of
these organisms only found in the investigated permafrost ecosystems so far.
The DNA sequences obtained from permafrost soils are belonging probable to
methanogenic archaea characterized by specific adaptations to extreme
permafrost conditions.
Methanogenic archaea from terrestrial permafrost show an unexpected
resistance against extreme living conditions and even survived under
simulated Martian temperature and humidity conditions. In consideration of the
results from the last Mars missions, which proved the presents of both the
appropriate substrates (H2 + CO2) for lithoautotrophic methanogenesis and the
product (CH4) of methanogenic metabolism on Mars, organisms comparable
to methanogens from permafrost can be seen as one of the most likely
candidates for life on Mars.
Furthermore, the results show that methane of microbial origin in perennially frozen
deposits probably represents an unconsidered source for the global methane budget.
Methane release to the atmosphere from frozen ground is mediated by ongoing
permafrost degradation through enhanced thermokarst formation and accelerated
coastal erosion in the Arctic. Although the change in permafrost conditions by global
warming is examined in the framework of several international projects (e.g. ACD:
Arctic Coastal Dynamics, CALM: Circumpolar Active Layer Monitoring), these
investigations should be linked more closely with microbiological process studies and
biodiversity research. Microbial parameters important for the assessment of the
carbon turnover (e.g. cell numbers, activities, biodiversity and stability of microbial
communities) should be analysed at observation areas in the Arctic, where long-term
ongoing monitoring programs are undertaken. The evaluation of microbiological data
and their correlation with climatic and geochemical results represents the basis for
the understanding of the role of permafrost in the global system, in particular
feedback mechanisms related to material fluxes and greenhouse gas emissions in
the scope of a warming Earth.
211
9 References
Methane Cycle in Permafrost Ecosystems
9 References
Since in two manuscripts (Chapter 5.1 and 6.1) the citations are specified after
numbers, these are placed in front of the summarized list of references.
References of Chapter 5.1: Characterisation of microbial community composition of a Siberian tundra
soil by fluorescence in situ hybridisation
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
212
Post, W.M., Emanuel, W.R., Zinke, P.J. and Stangenberger, A.G. (1982) Soil carbon pools
and world life zones. Nature 298, 156-159.
Oechel, W.C. and Billings, W.D. (1992) Effects of global change on the carbon balance of artic
plants and ecosystems. In: Arctic ecosystems in a changing climate. An ecophysiological
perspective. (Chapin, F.S., Ed.) Academic, San Diego, California.
Smith, L.C., MacDonald, G.M., Velichko, A.A., Beilman, D.W., Borisova, O.K., Frey. K.E.,
Kremenetski, K.V. and Sheng, Y. (2004) Siberian peatlands a net carbon sink and global
methane source since the early holocene. Science 303, 353-356.
Gorham, E. (1991) Northern peatlands: role in the carbon cycle and probable responses to
climatic warming. Ecological Applications 1, 182-195.
Nadelhoffer, K.J., Giblin, G.R., Shaver, G.R. and Linkins, A.E. (1992) Microbial processes and
plant nutrient availability in arctic soils. In: Arctic ecosystems in a changing climate. An
ecophysiological perspective. (Chapin, F.S., Ed.) Academic, San Diego, California.
Khalil, M.A.K. and Rasmussen, R.A. (1983) Sources, sinks, and seasonal cycles of
atmospheric methane. J. Geophys. Res. 88, 5131-5144.
Christensen, T.R., Jonasson, S., Havström, M. and Livens, F. R. (1999) Carbon cycling and
methane exchange in Eurasian tundra ecosystems. Ambio 28, 239-244.
Fung, I., John, J., Lerner, J., Matthews, E., Prather, M., Steele L. P. and Fraser, P. J. (1991)
Three dimensional model synthesis of the global methane cycle. J. Geophys. Res. 96, 1303313065.
IPCC (Intergovernmental Panel of Climate Change). (1990) Scientific Assessment. Cambridge
Univ. Press, Cambridge.
Christensen, T. (1991) Arctic and sub-Arctic soil emissions: possible implications for global
climate change. Polar Record 27, 205-210.
Chen, G., Zhu, H. and Zhang, Y. (2003) Soil microbial activities and carbon and nitrogen
fixation. Research in Microbiology 154, 393-398.
Zyvangtsev, D. (1994) Vertical distribution of microbial communities in soils. In: Beyond the
biomass (Ritz, K., Dighton, J., Giller, K., Eds.) pp. 29-37, Wiley, West Sussex, UK.
Blume, E., Bischoff, M., Reichert, J., Moorman, T., Konopka, A. and Turco, R. (2002) Surface
and subsurface community structure and metabolic activity as a function of soil depth and
season. Appl. Soil Ecol. 592, 1-11.
Skinner, F.A., Jones, P.C.T. and Mollison, J.E. (1952a comparison of a direct- and a platecounting technique for the quantitative estimation of soil microorganisms. J. Gen. Microbiol. 6,
261-271.
Wagner, M., Amann, R., Lemmer, H. and Schleifer, K.-H. (1993) Probing activated sludge with
oligonucleotides specific for proteobacteria: inadequacy of culture-dependent methods for
describing microbial community stucture. Appl. Environ. Microbiol. 59, 1250-1525.
Amann, R. I., Ludwig, W. and Schleifer, K.-H. (1995) Phylogenetic identification and in situ
detection of individual microbial cells without cultivation. FEMS Microbiol. Rev. 59, 143-169.
Poulsen, L. K., Ballard, G. and Stahl, D. A. Use of rRNA fluorescence in situ hybridization for
measuring the activity of single cells in young and established biofilms. Appl. Environ.
Microbiol. 59, 1354-1360.
Kemp, P.F, Lee, S. and LaRoche, J. (1993) Estimating the growth rate of slowly growing
marine bacteria from RNA content. Appl. Environ. Microbiol. 59, 2594-2601.
DeLong, E. F., Wickham, G. S. and Pace, N. R. (1989) Phylogenetic stains: ribosomal RNAbased probes for the identification of single cells. Science 243, 1360-1362.
Hahn, D., Amann, R. I., Ludwig, W., Akkermanns, A. D. L. and Schleifer, K.-H. (1992)
Detection of micro-organisms in soil after in situ hybridization with rRNA-targeted,
fluorescently labelled oligonucleotides. J. Gen. Microbiol. 138, 879-887.
Methane Cycle in Permafrost Ecosystems
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
9 References
Moter, A. and Göbel, U. B. (2000) Fluorescence in situ hybridization (FISH) for direct
visualization of microorganisms. J. Microbiol. Methods 41, 85-112.
Amann, R., Glöckner, F.-O. and Neef, A. (1997) Modern methods in subsurface microbiology:
in situ identification of microorganisms with nucleic acid probes. FEMS Microbiol. Rev. 20,
191-200.
Pernthaler, J., Glöckner, F.O., Schönhuber, W. and Amann, R. (2001) Fluorescence in situ
hybridization with rRNA-targeted oligonucleotide probes. In: Methods in Microbiology: Marine
Microbiology. Vol. 30. (Paul, J., Ed.) Academic Press Ltd., London.
Amann, R. I. (1995) In situ identification of micro-organisms by whole cell hybridization with
rRNA-targeted nucleic acid probes. In: Molecular Microbial Ecology Manual (Akkemann,
A.D.C., van Elsas, J.D. and de Bruigin, F.J., Eds.) pp.1-15. Kluwer Academic Publishers,
Dortrecht.
Christensen, H., Hansen, M. and Sørensen, J. (1999) Counting and size classification of
active soil bacteria by fluorescence in situ hybridization with an rRNA oligonucleotide probe.
Appl. Environ. Microbiol. 65,1753-1761.
Bouvier, T. and del Giorgio, P.A. (2003) Factors influencing the detection of bacterial cells
using fluorescence in situ hybridization (FISH): a quantitative review of published reports.
FEMS Microbiol. Ecol. 44, 3-15.
Wagner, D., Kobabe, S., Pfeiffer, E.-M. and Hubberten, H.-W. (2003) Microbial controls on
methane fluxes from a polygonal Tundra of the Lena Delta, Siberia. Permafrost and Periglac.
Process. 14, 173-185.
Rachold, V. and Grigoriev M.N. (Eds) (2000). Russian-German Cooperation SYSTEM
LAPTEV SEA 2000: The Expedition LENA 1999. Reports on Polar Research 354, 1-269.
Schwamborn, G., Rachold, V. and Grigoriev, M.N. (2002) Late Quaternary sedimentation
history of the Lena Delta. Quaternary International 89, 119-134.
Bouvier, T. and del Giorgio, P.A. (2003) Factors influencing the detection of bacterial cells
using fluorescence in situ hybridization (FISH): a quantitative review of published reports.
FEMS Microbiol. Ecol. 44, 3-15.
Wagner, D., Kobabe, S., Pfeiffer, E.-M. and Hubberten, H.-W. (2003) Microbial controls on
methane fluxes from a polygonal Tundra of the Lena Delta, Siberia. Permafrost and Periglac.
Process. 14, 173-185.
Rachold, V. and Grigoriev M.N. (Eds) (2000). Russian-German Cooperation SYSTEM
LAPTEV SEA 2000: The Expedition LENA 1999. Reports on Polar Research 354, 1-269.
Schwamborn, G., Rachold, V. and Grigoriev, M.N. (2002) Late Quaternary sedimentation
history of the Lena Delta. Quaternary International 89, 119-134.
Schoeneberger, P.J., Wysocki, D.A.. Benham, E.C. and Broderson, W.D. (Eds.), (2002) Field
book for describing and sampling soils, Version 2.0. Natural Resources Conservation service,
National Soil Survey Center, Lincoln, NE.
Schlichting, E., Blume, H.-P. and Stahr, K. (1995) Bodenkundliches Praktikum – Pareys
Studientexte 81. Blackwell Wissensverlag, Berlin.
Soil Survey Staff. (1998) Keys to Soil taxonomy, 8th edition. USDA-The national resources
conservation service, Lincoln.
Kutzbach, L., Wagner, D. and Pfeiffer, E.-M. (2003) Effect of microrelief and vegetation on
methane emission from wet polygonal tundra, Lena Delta, Northern Siberia. Biogeochemistry,
in press.
Friedrich, K. (2001) Energie- und Wasserhaushalt eines Tundrenstandortes im Lena-Delta.
Diploma-thesis, TU Dresden.
Sherr, B. F., Sherr, E. B. and Fallon, R. D. (1987) Use of monodispersed, fluorescently
labelled bacteria to estimate in situ protozoan bacterivory. Appl. Environ. Microbiol. 53, 958965.
Bloem, J., Veninga, M. and Shephard, J. (1995) Fully automatic determination of soil
bacterium numbers, cell volumes, and frequencies of dividing cells by confocal laser scanning
microscopy and image analysis. Appl. Environ. Microbiol. 61, 926-936.
Snaidr, J., Amann, R., Huber, I., Ludwig, W. and Schleifer, K.-H. (1997) Phylogenetic analysis
and in situ identification of bacteria in activated sludge. Appl. Environ. Microbiol. 63, 28842896.
Stahl, D.A. and Amann, R. (1991) Development and application of nucleic acid probes. In:
Nucleic acid techniques in bacterial systematics (Stackebrandt, E. and Goodfellow, M., Eds.)
pp. 205-248. Wiley and Sons, New York.
Daims, H., Ramsing, N.B., Schleifer, K.-H. and Wagner, M. (2001) Cultivation-independent,
semiautomatic determination of absolute bacterial cell numbers in environmental samples by
fluorescence in situ hybridization. Appl. Environ. Microbiol. 67, 5810-5818.
213
9 References
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
[63]
[64]
[65]
214
Methane Cycle in Permafrost Ecosystems
Friedrich, U., Naismith, M.M., Altendorf, K. and Lipski, A. (1999) Community analysis of
biofilters using fluorescence in situ hybridization including a new probe for the Xanthomonas
branch of the class Proteobacteria. Appl. Environ. Microbiol. 65, 3547-3554.
Felske, A., Akkermans, A. D. L. and de Vos, W. M. (1998) In situ detection of an uncultured
predominant bacillus in Dutch grassland soils. Appl. and Environ. Microbiol.64, 4588-4590.
Schmidt, N. (1999) Microbial properties and habitats of permafrost soils an Taymir peninsula,
central Siberia. Reports on Polar Research 340, 1-164.
Dedysh, S.N., Dunfield, P.F., Derakshani, M., Stubner, S., Heyer, J. and Liesack, W. (2003)
Differential detection of type II methanotrophic bacteria in acidic peatlands using newly
developed 16S rRNA-targeted fluorescent oligonucleotide probes. FEMS Microbiol. Ecol. 43,
299-308.
Atlas, R.M. and Bartha, R. (1993) Microbial Ecology Fundamentals and Applications. The
Benjamin/Cummings Publishing Company, Redwood City, California.
Vorobyova, E., Soina, V., Gorlenko, M., Minkovskaya, N., Zalinova, N., Mamukelashvili, A.,
Gilichinsky, D., Rivkina, E. and Vishnivetskaya, T. (1997) The deep cold biosphere: facts and
hypothesis. FEMS Microbiol. Rev. 20, 277-290.
Vishnivetskaya, T., Kathariou, S., McGrath, J., Gilichinsky, D. and Tiedje, J.M. (2000) Lowtemperature recovery strategies for the isolation of bacteria from ancient permafrost
sediments. Extremophiles 4, 165-173.
Rivkina, E.M., Friedmann, E.I., McKay, C.P. and Gilichinsky, D.A. (2000) Metabolic activity of
permafrost bacteria below the freezing point. Appl. Environ. Microbiol. 66, 3230-3233.
Zarda, B., Hahn, D., Chatzinotas, A., Schönhuber, W., Neef, A., Amann, R. I. and Zeyer, J.
(1997) Analysis of bacterial community structure in bulk soil by in situ hybridization. Arch.
Microbiol. 168, 185-192.
Lynch, J.M. (1998) Microorganisms in their natural environments: the terrestrial environment.
In: Micro-organisms in action: concepts and applications in microbial ecology (Lynch, J.M. and
Hobbie, J.E., Eds.), pp. 103-131Blackwell Scientific Publications, London, England.
Smith, J.L. and Paul, E.A. (1990) The significance of soil microbial biomass estimations. In:
Soil biochemistry (Bollag, J.-M. and Stotzky G., Eds.). Marcel Dekker, Inc., pp. 357-395. New
York, N.Y..
Aldén, L., Demoling, F. and Bååth, E. (2001) Rapid method of determining factors limiting
bacterial growth in soil. Appl. Environ. Microbiol. 67, 1830-1838.
Fierer, N., Schimel, J.P. and Holden, P.A. (2003) Variations in microbial community
composition through two soil depth profiles. Soil Biology & Biochemistry 35, 167-176.
Holmes, B The Genera Flavobacterium, Sphingobacterium, and Weeksella In: The
Prokaryotes: An Evolving Electronic Resource for the Microbiological Community, (Dworkin,
M. et al., Eds.), 3rd edition, release 3.0, 1999, Springer-Verlag, New York, http://link.springerny.com/link/service/books/10125/.
Reichenbach, H. The order Cytophagales In: The Prokaryotes: An Evolving Electronic
Resource for the Microbiological Community, (Dworkin, M. et al., eds.), 3rd edition, release
3.0, 1999, Springer-Verlag, New York, http://link.springer-ny.com/link/service/books/10125/.
LaMontagne, M.G., Schimel, J.P. and Holden, P.A. (2003) Comparison of subsurface and
surface soil bacterial communities in California grassland as assessed by terminal restriction
fragment length polymorphisms of PCR-amplified 16SrRNA genes. Microb. Ecol. 46, 216-227.
Rovira A.D. (1956) Plant root excretions in relation to the rhizosphere effect II. A study of the
properties of root exudates and its effect on the growth of micro-organisms isolated from the
rhizosphere and control soil. Plant Soil 7, 195–208.
Bolton, H., Jr., Fredrickson, J.K. and Elliott, L.F. (1993) Microbial ecology of the rhizosphere.
In: Soil Microbial Ecology (Metting, F.B., Jr., Ed.), pp. 27–63. Marcel Dekker, New York.
Armstrong, J., Armstrong, W., Beckett, P.M., Halder, J.E., Lythe, S. Holt, R. and Sinclair, A.
(1996) Pathway of aeration and the mechanisms and beneficial effects of humidity- and
Venturi-induced convections in Phragmites australis (Cav.) Trin.ex Steud. Aquatic Botany 54,
177-197.
Brix, H., Sorrell, B.K. and Schierup, H.H. (1996) Gas fluxes achieved by in situ convective flow
in Phragmites australis. Aquatic Botany 54, 151-163.
Bendix, M., Tornbjerg, T. and Brix, H. (1994) Internal gas transport in Typha latifolia L. and
Typha angustifolia L. 1. Humidity-induced pressurization and convective throughflow. Aquatic
Botany 49, 75-89.
Hales, B.A., Edwards, C., Ritchie, D.A., Hall, G., Pickup, R.W. and Saunders, J.R. (1995)
Isolation and identification of methaongen-specific DNA from blanket bog peat by PCR
amplification. Appl. Environ. Microbiol. 62, 668-675.
Methane Cycle in Permafrost Ecosystems
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
[77]
[78]
[79]
[80]
[81]
[82]
9 References
Whitman, W.B., Bowen, T.C. and Boone, D.R. (1992) The methanogenic bacteria. In: The
prokaryotes (Balows, A., Trüper, H.G., Dworkin, M., Harder, W. and Schleifer, K.H., Eds.)Vol.
1, pp. 719-767, Springer.
Wagner, D. and Pfeiffer, E.-M. (1997) Two temperature optima of methane production in a
typical soil of the Elbe river marshland. FEMS Microbiol. Ecol. 22, 145-153.
Mayer, H.-P. and Conrad, R. (1990) Factors influencing the population of methanogenic
bacteria and the initiation of methane production upon flooding of paddy soils. FEMS
Microbiol. Ecol. 73, 103-112.
Peters, V. and Conrad, R. (1995) Methanogenic and other strictly anaerobic bacteria in desert
soil and other oxic soils. Appl. Environ. Microbiol. 61, 1673-1676.
Wagner, D. and Pfeiffer, E.-M. (1997) Two temperature optima of methane production in a
typical soil of the Elbe river marshland. FEMS Microbiol. Ecol. 22, 145-153.
Wachinger, G., Fiedler, S., Zepp, K., Gattinger, A., Sommer, M. and Roth, K. (2000) Variability
of soil methane production on the micro-scale: spatial association with hot spots of organic
material and archaeal populations. Soil Biol. Biochem. 32, 1121-1130.
Valentine, D.W., Holland, E.A. and Schimel, D.S. (1994) Ecosystem and physiological controls
over methane production in northern wetlands. J. Geophys. Res. 99, 1563-1571.
Zepp-Falz, K., Holliger, C., Großkopf, R., Liesack, W., Nozhenikova, A.N., Müller, B., Wehrli,
B. and Hahn, D. (1999) Vertical distribution of methanogens in the anoxic sediment of Rotsee
(Switzerland). Appl. Environ. Microbiol. 65, 2402-2408.
Harris. J.M. and Tibbles, B.J. (1997) Factors affecting bacterial productivity in soils on isolated
inland nunataks in continental Antarctica. Microb. Ecol. 33, 106-123.
Bölter, M., Blume, H.-P. and Kuhn, D. (1999) Soils and their microbiological properties from a
transect from Cape Horn to the Antarctic Peninsula. Polar Bioscience 12, 54-67.
Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R. and Stahl, D.A. (1990)
Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing
mixed microbial populations. Appl. Environ. Microbiol. 56, 1919-1925.
Daims, H., Brühl, A., Amann, R., Schleifer, K-H. and Wagner, M. (1999) The domain-specific
probe EUB338 is insufficient for the detection of all Bacteria; development and evaluation of a
more comprehensive probe set. System. and Appl. Microbiol. 22, 434-444.
Wallner, G., Amann, R. and Beisker, W. (1993) Optimizing fluorescent in situ hybridization with
rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms.
Cytometry 14, 136-143.
Neef, A. (1997) Anwendung der in situ Einzelzell-Identifizierung von Bakterien zur
Populationsanalyse in komplexen mikrobiellen Biozönosen. Ph.D. Thesis, Technische
Universität München.
Manz, W., Amann, R., Ludwig, W., Wagner, M. and Schleifer, K-H. (1992) Phylogenetic
Oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and
solutions. System. Appl. Microbiol. 15, 593-600.
Roller C., Wagner M., Amann R., Ludwig W. and Schleifer, K.-H. (1994). In situ probing of
Gram-positive bacteria with high DNA G+C content using 23S rRNA- targeted
oligonucleotides. Microbiol. 140, 2849-2858.
Meier, H., Amann, R., Ludwig, W. and Schleifer, K-H. (1999) Specific oligonucelotide probes
for in situ detection of a major group of gram-positive bacteria with low DNA G+C content.
System. Appl. Microbiol. 22, 186-196.
References of Chapter 6.1: Microbial life in terrestrial permafrost: methanogenesis and nitrification in
gelisols as potentials for exobiological processes
1 Wharton Jr., R.A., McKay, C.P., Mancinelli, R.L., Simmons Jr., G.M. (1989). Early martian
environments: the antarctic and other terrestrial analogs. Adv. Space Res. 9: 147-153.
2 Horneck, G. (in press). The microbial world and the case for Mars. Planet. Space Sci.
3 Soil Survey Staff (1998). Keys to Soil Taxonomy. Lincoln, Nebraska. U.S. Department of
Agriculture, Soil Conservation Service. Pocahontas Press, Blacksburg.
4 French, H.M. (1996). The periglacial environment. Longman, Westminster.
5 Herbert, R.A. (1996). The ecology and physiology of psychrophilic microorganisms, in (Herbert,
R.A., Cod, G.A., eds.) Microbes in extreme environments. Academic Press, London: 1-23.
6 Yershov, E.D. (1998). General Geochryology. Cambridge University Press, Cambridge.
7 Gounot, A.M. (1991). Bacterial life at low temperature: physiological aspects and
biotechnological implications. J. Appl. Bacteriol. 71: 386-397.
215
9 References
Methane Cycle in Permafrost Ecosystems
8 Russel, N.J., Hamamoto, T. (1998). Psychrophiles. In: (Horokoshi, K., Grant, W.D., eds.)
Extremophiles: microbial life in extreme environments. Wiley, New York: 25-45.
9 Morita, R.Y. (1975). Psychrophilic bacteria. Bacteriol. Rev. 39: 144-167.
10 Rivkina, E., Friedmann, E.I., McKay, C.P., Gilichinsky, D. (2000). Metabolic activity of
permafrost bacteria below the freezing point. Appl. Environ. Microbiol. 66: 3230-3233.
11 Morita, R.Y. (1992). Low-temperature environments. In: (Lederberg, J., ed.) Encyclopedia of
microbiology. Academic Press, San Diego: 625-637.
12 Ananyan, A.A. (1970). Unfrozen water content in frozen clay at temperature from -0.6 °C to
-40 °C - -60 °C. Merzlotnye Issledovaniya 10: 267-270 (in Russian).
13 Ostroumov, V.E., Siegert, C. (1996). Exobiological aspects of mass transfer in microzones of
permafrost deposits. Adv. Space Res. 18: 79-86.
14 McGrath, J., Wagener, S., Gilichinsky, D.A. (1994). Cryobiological studies of ancient
microoprganisms isolated from the Siberian permafrost. In: (Gilichinsky, D.A., ed.) Viable
microorgansisms in permafrost. Pushchino Research Centre, Pushchino: 48-67.
15 Russel, N.J. (1990). Cold adaptation of microorganisms. Phil. Trans. Roy. Soc. Lond. 326: 595611.
16 Shi, T., Reeves, R.H., Gilichinsky, D.A., Friedmann, E.I. (1997). Characterization of viable
bacteria from siberian permafrost by 16S rDNA sequencing. Microb. Ecol. 33: 169-179.
17 E. Lebedeva, V. Soina: Nitrifying bacteria as a promising group for paleoecological
investigations in the permafrost, in Viable microorganisms in permafrost, D.A. Gilichinsky (Ed.),
1th Int`l Conference on Cryopedology and Global Change, November 1992 (Pushchino
Research Centre, Pushchino 1994) pp. 74-82
18 Gilichinsky, D.A., Vorobyova, E.A., Erokhina, L.G., Fyordorov-Dayvdov, D.G., Chaikovskya,
N.R. (1992). Long-term preservation of microbial ecosystems in permafrost. Adv. Space Res.
12 (4): 255-263
19 Morita, R.Y. (2000). Is hydrogen the universal energy source for long-term survival? Microbial
Ecology 38: 307-320.
20 Garcia, J.L. (1990). Taxonomy and ecology of methanogens. FEMS Microbiol. Rev. 87: 297308.
21 Deppenmeier, U., Müller, V., Gottschalk, G. (1996). Pathways of energy conservation in
methanogenic archaea. Arch. Microbiol. 165: 149-163.
22 Whitman, W.B., Bowen, T.C., Boone, D.R. (1992). The methanogenic bacteria. In: (Balows, A.,
Trüper, H.G., Dworkin, M., Harder, W., Schleifer, K.H., eds.) The Prokaryotes. Springer Verlag,
New York: 719-767.
23 Gounot, A.M. (1999). Microbial life in permanently cold soils. In: (Margesin, R., Schinner, F.,
eds.) Cold-adapted organisms. Springer, Berlin: 3-16.
24 Robertson, D.E., Noll, D., Roberts, M.F., Menaia, J.A., Boone, D.R. (1990). Detection of the
osmoregulator betaine in methanogens. Appl. Environ. Microbiol. 56: 563-565.
25 Rivkina, E., Friedmann, E.I., McKay, C.P. Gilichinsky, D.A. (1998). Biogeochemical activity of
anaerobic microorganisms from buried permafrost sediments. Geomicrobiology 15: 187-193.
26 Peters, V., Conrad, R. (1995). Methanogenic and other strictly anaerobic bacteria in desert soil
and other oxic soils. Appl. Environ. Microbiol. 61: 1673-1676.
27 Stetter, K.O., Fiala, G., Huber, G., Huber, R., Segerer, A. (1990). Hyperthermophilic
microorganisms. FEMS Microbiol. Rev. 75: 117-124.
28 Watson, S.W., Bock, E., Harms, H, Koops, H.P., Hooper, A.B. (1989). Nitrifying bacteria. In
(Staley, J.T., Bryant, M.P., Pfennig, N., Holt, J.G., eds.) Bergey's Manual of Systematic
Bacteriology, 1th Ed., Vol 3, (Williams & Wilkins Co., Baltimore pp. 1808-1834.
29 Bock, E. and Koops, H.-P. (1992). The genus Nitrobacter and related genera. In: (Balows, A.,
Trüper, H.G., Dworkin, M., Harder, W., Schleifer, K.H., eds.) The Prokaryotes. Springer Verlag,
New York: 2302-2309.
30 Koops H.-P., Möller U.C. (1992) The lithotrophic ammonia-oxidizing bacteria. In In: (Balows, A.,
Trüper, H.G., Dworkin, M., Harder, W., Schleifer, K.H., eds.) The Prokaryotes. Springer Verlag,
New York: 2625-2637.
31 Teske, A., Alm, E., Regan, J.M., Toze, S., Rittmann, B.E., Stahl, D.A. (1994). Evolutionary
relationships among ammonia- and nitrite-oxidizing bacteria. J. Bacteriol. 176: 6623-6630.
32 Ehrich, S., Behrens, D., Lebedeva, E., Ludwig, W., Bock, E. (1995). A new obligately
chemolithoautotrophic, nitrite-oxidizing bacterium, Nitrospira moscoviensis sp. nov. and its
phylogenetic relationship. Arch. Microbiol. 164: 16-23.
33 Spieck, E., Bock, E. Genus Nitrospira. In (Garrity, G.M., Williams, S.T.,Staley, J.T., Brenner,
D.J., Holt, J.G., Boone, D.R., Castenholz, R.W., Krieg, N.R., Schleifer, K.H. eds.) Bergey´s
Manual of Systematic Bacteriology, , 2nd Ed., Vol 1 (Williams & Wilkins Co., Baltimore in
press).
34 Stüven R., Bock E. (2000) Nitrification and denitrification as a source for NO and NO2
production in high-strength wastewater. Wat. Res., in press
216
Methane Cycle in Permafrost Ecosystems
9 References
35 Wilson, K., Sprent, J.I., Hopkins, D.W. (1997). Nitrification in antarctic soils. Nature 385: 404
36 Mansch, R. Bock, E. (1998) Biodeterioration of natural stone with special reference to nitrifying
bacteria. Biodegradation 9, 47-64
37 Fredrickson, J.K., Garland, T.R., Hicks, R.J., Thomas, J.M., Li, S.W., McFadden, K.M. (1989).
Lithotrophic and heterotrophic bacteria in deep subsurface sediments and their relation to
sediment properties. Geomicrobiol. J. 7: 53-66.
38 Lin, L. (1994). Kompatible Solute in nitrifizierenden Bakterien, Ph.D. Thesis, University of
Hamburg, Hamburg.
39 Conrad R. (1996) Soil microorganisms as controllers of atmospheric trace gases (H2, CO,
CH4, OCS, N2O, and NO). Microbiol. Rev. 60: 609-640
40 Wagner, D., Pfeiffer, E.-M. (1997). Two temperature optima of methane production in a typical
soil of the Elbe river marshland. FEMS Microbiol. Ecol. 22: 145-153.
41 Rivkina, E., Gilichinsky, D., Wagener, S., Tiedje, T., McGrath, J. (1998). Biogeochemical
activity of anaerobic microorganisms from buried permafrost sediments. Geomicrobiol. 15: 187193.
42 V.S. Soina, E.V. Lebedeva, O.V. Golyshina, D.G. Fedorov-Davydov, D.A. Gilichinsky. (1991)
Nitrifying bacteria from permafrost deposits of the Kolyma lowland. Microbiologia 60, 187-190,
in Russian
43 Friedmann, I. (1994). Permafrost as microbial habitat. in Viable microorganisms in permafrost,
D.A. Gilichinsky (Ed.), 1th Int`l Conference on Cryopedology and Global Change, November
1992 (Pushchino Research Centre, Pushchino 1994) pp.21-26
44 Panikov, N.S. (1997). A kinetic approach to microbial ecology in arctic and boreal ecosystems
in relation to global change. In: (Oechel, W.C., ed.) Global change and arctic terrestrial
ecosystems. Springer, Berlin: 171-188.
45 Samarkin, V.A., Gundelwein, A., Pfeiffer, E.-M. (1999). Studies of methane production and
emission in relation to the microrelief of a polygonal tundra in northern Siberia. In. (Kassens,
H., Bauch, H.A., Dmitrenko, I.A., Eicken, H., Hubberten, H.-W., Melles, M., Thiede, J.,
Timokhov, L.A., eds.) Land-ocean systems in the Siberian arctic. Springer, Berlin: 329-342.
46 Pfeiffer, E.-M. Wagner, D., Becker, H., Vlasenko, A., Kutzbach, L., Boike, J., Quass, W., Kloss,
W., Schulz, B., Kurchatova, A., Pozdnyakov, V.I., Akhmadeeva, I. (2000). Modern processes in
permafrost affected soils. In: (Rachold, V., Gregoriev, M.N.,eds.) Russian-German cooperation
System Laptev Sea 2000: The Expedition Lean 1999. Reports Polar Res. 354: 22-54.
47 Kotsyurbenko, O.R., Simankova, M.V., Nozhevnikova, A.N., Zhilina, T.N., Bolotina, N.P.,
Lysenko A.M., Osipov, G.A. (1995). New species of psychrophilic acetogens: Acetobacterium
bakii sp. nov. , A. paludosum sp. nov., A. fimetarium sp. nov. Arch. Microbiol. 163: 29-34.
48 Omelchenko, M.V., Vasilyeva, L.V., Zavarzin, G.A. (1993). Psychrophilic methanotroph from
tundra soil. Curr. Microbiol. 27: 255-259.
49 Finne, G. and Matches, J.R. (1974). Low-temperature-growing clostridia from marine
sediments. Can. J. Microbiol. 20: 1639-1645.
50 Janssen, H. (1994) Anreicherung, Isolierung und Charakterisierung nitrifizierender und
methylotropher Bakterien aus Permafrostboden, Diploma Thesis, University of Hamburg,
Hamburg
51 Franzmann, P.D., Liu, Y., Balkwill, D.L., Aldrich, H.C., Conway de Macario, E., Boone, D.R.
(1997). Methanogenium frigidium sp. nov., a psychrophilic, H2-using methanogen from Ace
Lake, Antarctica. Int. J. Syst. Bacteriol. 47: 1068-1072.
52 Putzer, K.P., Buchholz, L.A., Lidstrom, M.E., Remsen, C.C. (1991). Separation of
methanotrophic bacteria by using percoll and its application to isolation of mixed and pure
cultures. Appl. Environ. Microbiol. 57: 3656-3659.
53 Amann, R.I., Ludwig, W., Schleifer, K.-H. (1995). Phylogenetic identification and in situ
detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143-169.
54 Raskin, L., Stromley, J.M., Rittmann, B.E., Stahl, D.A. (1994). Group-specific 16S rRNA
hybridization probes to describe natural communities of methanogens. Appl. Environ. Microbiol.
60: 1232-1240.
55 Bartosch., S. Wolgast, I. Spieck, E., Bock, E. (1999) Identification of nitrite-oxidizing bacteria
with monoclonal antibodies recognizing the nitrite oxidoreductase. Appl. Environ. Microbiol 65:
4126-4133
56 Pinck C., Coeur C., Potier P., Bock E. (2001) Polyclonal antibodies recognizing the AmoB of
ammonia oxidizers of the ß-subclass of Proteobacteria. Appl. Environ. Microbiol. 67: 118-124
57 Hartwig, C. (1999) Anreicherung von Nitrospira aus Naturproben, Diploma Thesis, University of
Hamburg, Hamburg
58 Bartosch, S., Hartwig, C., Spieck, E., Bock, E. Detection of Nitrospira-like bacteria in various
soils. submitted.
59 Vestal, J.R., White, D.C. (1989) Lipid Analysis in Microbial Ecology. Bioscience 39:535-541
217
9 References
Methane Cycle in Permafrost Ecosystems
60 Ohtsubo, S., Kanno, M., Miyahara, G., Kohno, S., Koga, Y., Miura, I. (1993). A sensitive
method for quantification of aceticlastic methanogens and estimation of total methanogenic
cells in natural environments based on an analysis of ether-linked glycerolipids. FEMS
Microbiol. Ecol. 12: 39-50.
61 Lipski, A., Spieck, E., Makolla, A., Altendorf, KH. Fatty acid profiles of nitrite-oxidizing bacteria
reflect their phylogenetic heterogeneity. submitted.
62 Rothfuss, F., Conrad, R. (1993). Vertical profiles of CH4 concentrations, dissolved substrates
and processes involved in CH4 production in a flooded Italian rice field. Biogeochem. 18: 137152.
63 Christensen, T. (1993). Methane emission from arctic tundra. Biogeochem. 21: 117-139.
64 Kotsyurbenko, O.R., Nozhevnikova, A.N., Soloviova, T.I., Zavarzin, G.A. (1996).
Methanogenesis at low temperatures by microflora of tundra wetland soil. Antonie van
Leeuwenhoek 69: 75-86.
65 Schramm, A., Larsen, L.H., Revsbech, N.P., Ramsing, N.B., Amann, R. , Schleifer, K.-H.
(1996). Structure and function of a nitrifying biofilm as determined by in situ hybridization and
the use of microelectrodes. Appl. Environ. Microbiol. 62: 4641-4647.
66 Wagner, D., Pfeiffer, E.-M., Bock, E. (1999). Methane production in aerated marshland and
model soils: effects of microflora and soil texture. Soil Biol. Biochem. 31: 999-1006.
67 Scharpenseel, H.W., Pfeiffer, E.M. (1997). Carbon turnover in different climates and
environments. Adv. Soil Sci. 577-590
68 Pfeiffer, E.-M., Janssen, H. (1994). Characterization of orgnaic carbon, using the δ13C-value of
a permafrost site in the Kolyma-Indigirka-Lowland, Northeast Siberia. In: (Kimble, J., Ahrens,
R.J., eds.) Proceedings of the meeting on the classification, correlation, and management of
permafrost-affected soils, Alaska, USA. USDA, Lincoln: 90-98.
69 Rothschild, L.J., DesMarais, D. (1989). Stable carbon isotope fractionation in the search for life
on early Mars. Adv. Space Sci. 9: 159-165.
70 Horneck, G. (in press). The microbial world and the case for Mars. Plaet. Space Sci.
71 Horneck, G. (1995). Exobiology, the study of the origin, evolution and distribution of life within
the context of cosmic evolution: a review. Planet. Space Sci. 43: 189-217.
Summarized List of References:
Abuzov SS, Mitskevich NI, Poglazova MN (1998) Microflora of the deep glacier horizon of Central
Antarctica, Microbiol. 67: 451-458.
Abuzov SS, Mitskevich NI, Poglazova MN, Barkov NI, Lipenkov VYa, Bobin NE, Kudryashov BB,
Pashkevich VM (1999) Antarctic ice sheet as an object for solving some methodological problems
of exobiology, Adv. Space Res. 23/2: 371-376.
ACIA (2004), Impacts of a Warming Arctic, Arctic Climate Impact Assessment, Cambridge University
Press, New York, USA.
Akhmadeeva I, Becker H, Friedrich K, Wagner D, Pfeiffer E-M, Quass W, Zhurbenko M, and Zöller E
(1999) Investigation site ‘Samoylov’. p. 19-21. In V. Rachold (ed.) Expeditions in Siberia in 1998.
Reports on Polar Research 315. Bremerhaven, Alfred-Wegener-Institut.
Alexander V, and Schell DM (1973) Seasonal and spatial variation of nitrogen fixation in Barrow,
Alaska, Tundra. Arc. Alp. Res. 5: 77-88.
Amann R, Binder BJ, Olson RJ, Chisholm SW, Devereux R, and Stahl DA (1990) Combination of 16S
rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial
populations. Applied and Environmental Microbiology, 56: 1919-1925.
Amann R, Ludwig W, and Schleifer KH (1995) Phylogenetic identification and in situ detection of
individual microbial cells without cultivation. FEMS Microbiology Reviews, 59: 143-169.
Ananyan AA (1970) Unfrozen water content in frozen clay at a temperature from -0.6°C to -40°C
-60°C. Merzlotnye Issledovaniya 10: 267-270 (in Russian).
Andreev A, Tarasov P, Schwamborn G et al. (2004) Holocene paleoenvironmental records from
Nikolay Lake, Lena River Delta, Arctic Russia. Palaeogeography, Palaeoclimatology,
Palaeoecology 209: 197-217.
Andreev A, Klimanov A (2005) Late-Glacial and Holocene in Chapter 5 East Siberia (Based on data
obtained mainly in Central Yakutia), Geological Society of America Bulletin 382: 98-102.
Anisomov OA, Nelson FE, and Pavlov AV (1999) Predictive scenarios of permafrost development
under conditions of global climate change in the XXI century. Earth Cryology, 3: 15-25.
Are F, and Reimnitz E (2000) An overview of the Lena River Delta setting: Geology, tectonics,
geomorpholgy, and hydrology. J. Coastal Res. 16: 1083-1093.
Armstrong W (1979) Aeration in higher plants. In Woolhouse HW (Ed) Advances in Botanical
Research (pp 226-333). Academic Press, New York.
218
Methane Cycle in Permafrost Ecosystems
9 References
Armstrong J, Armstrong W, Beckett PM, Halder JE, Lythe S, Holt R & Sinclair A (1996) Pathways of
aeration and the mechanisms and beneficial effects of humidity- and Venturi-induced convections
in Phragmites australis (Cav.) Trin. ex Steud. Aquat. Bot. 54: 177-197.
Arndt JL, and Richardson JL (1989) Geochemical development of hydric soil salinity in a North Dakota
prairie-pothole wetland system. Soil Sci. Soc. Am. J. 53: 848-855.
Aselmann I, and Crutzen J (1989) Global distribution of natural freshwater wetlands and rice paddies,
their net primary productivity, seasonality and possible methane emissions. J. Atmospheric Chem.
8: 307-358.
Augustin J, Merbach W, Schmidt W and Reining E (1996) Effect of changing temperature and water
table on trace gas emisssion from minerotrophic mires. J Appl Bot 70: 45-51.
Bai Q, Gattinger A, and Zelles L (2000) Characterisation of microbial consortia in paddy rice soil by
phosholipid analysis. Microbiol Ecol 39: 273-281.
Bakermans C, Tsapin AI, Souza-Egipsy V, Gilichinsky DA and Nealson K (2003) Reproduction and
metabolism at -10°C of bacteria isolated from Siberian permafrost, Environ. Microbiol. 5: 321-326.
Banning N, Brock F, Fry JC, Parkes RJ, Hornibrook ER & Weightman AJ (2005) Investigation of the
methanogen population structure and activity in a brackish lake sediment. Environ Microbiol 7:
947-960.
Bartlett KB, Crill PM, Sass RL, Harriss RC, Dise NB (1992) Methane emissions from tundra
environments in the Yukon-Kuskokwim Delta, Alaska. Journal of Geophysical Research 97 (D15):
16645-16660.
Bartlett KB, Harriss RC (1993). Review and assessment of methane emissions from wetlands.
Chemosphere, 26 (1-4): 261-320.
Bartlett RJ, James BR (1995) System for categorising soil redox status by chemical field testing.
Geoderma 68: 211-218.
Basiliko N, Yavitt JB, Dees PM & Merkel SM (2003) Methane biogeochemistry and methanogen
communities in two northern peatland ecosystems, New York State. Geomicrobiol J 20: 563-577.
Bergman I, Klarqvist M, Nilsson M. 2000. Seasonal variation in rates of methane production from peat
of various botanical origins: effects of temperature and substrate quality. FEMS Microbiology
Ecology 33: 181-189.
Berry ED & Foegeding PM (1997) Cold temperature adaptation and growth of microorganisms. J Food
Protection 60 (12): 1583-1594.
Beyer L, Sorge C, Blume H-P, and Schulten HR (1995) Soil organic matter composition and
transformation in Gelic Histosols of coastal continental Antarctica. Soil Biol. Biochem. 27: 12791288.
Beyer L, Pingpank K, Wriedt G, and Bölter M (2000) Soil formation in coastal continental Antarctica
(Wilkes Land). Geoderma 95: 283-304.
Bianchi TS, Freer ME, Wetzel RG (1996) Temporal and spatial variability, and the role of dissolved
organic carbon (DOC) in methane fluxes from the Sabine River Floodplain (Southeast Texas,
U.S.A.). Archiv für Hydrobiologie 136: 261-287.
Bleich K and Stahr K (1978) Ein Eisen-Bändchen-Stagnogley in der Bodengesellschaft der mittleren
Arktis Kanadas. Eiszeitalter und Gegenwart 28: 179-188.
Bliss LC (1997) Arctic ecosystems of North America. p. 541-686. In Wielgolaski FE (ed.) Polar and
Alpine Tundra. Ecosystems of the world 3. Elsevier, Amsterdam.
Bockheim JG and Tarnocai C (1998) Recognition of cryoturbation for classifying permafrost-affected
soils. Geoderma 81: 281-293.
Bockheim JG, Everett LR, Hinkel KM, Nelson FE and Brown J (1999) Soil organic storage and
distribution in Arctic Tundra, Barrow, Alaska. Soil Sci. Soc. Am. J. 63: 934-940.
Bockheim JG, Hinkel KM and Nelson FE (2003) Predicting carbon storage in Tundra soils of Arctic
Alaska. Soil Sci. Soc. Am. J. 67: 948-950
Boike J (1997) Thermal, hydrological and geochemical dynamics of the active layer at a continuous
permafrost site, Taymyr Peninsula, Siberia. Reports on Polar Research 242: 1-67.
Boike J, Roth K and Overduin PP (1998) Thermal and hydraulic dynamics of the active layer a
continuous permafrost site (Taymyr Peninsula, Siberia). Water Res. Res. 34: 355-365.
Boike J, Hinzman L, Overduin PP, Romanovsky V, Ippisch O, Roth K (2003) A comparison of snow
th
melt at three circumpolar sites: Spitzbergen, Siberia, Alaska. Proceedings of the 8 International
Conference on Permafrost, Zurich, Switzerland, 21-25 July 2003.
Boike J and Wille C (2006) The meteorology, and energy and water balance of polygonal tundra in the
Lena Delta, Siberia during wet and dry years, Journal of Geophysical Research, (in review).
Boone D, Johnson R and Liu Y (1989) Diffusion of the interspecies electron carriers H2 and formate in
methanogenic ecosystems and its implications in the measurement of Km for H2 or formate
uptake. Appl Environ Microbiol 55: 1735-1741.
219
9 References
Methane Cycle in Permafrost Ecosystems
Bowman JP, Sly LI, Nichols PD and Hayward AC (1993) Revised taxonomy of the methanotrophs:
Description of Methylobacter gen. nov., emendation of Methylococcus, validation of Methylosinus
and Methylocystis species, and a proposal that the family Methylococcaceae includes only the
group I methanotrophs. Int J Syst Bacteriol 43: 735-753.
Bowman JP, McCammon SA and Skerratt JH (1997) Methylosphaera hansonii gen. nov., sp. Nov., a
psychrophilic, group I methanotroph from Antarctic marine-salinity, meromictic lakes. Microbiology
143: 1451-1459.
Bowman JP, McCammon SA, Lewis T, Skerratt JH, Brown JL, Nichols DS and McMeekin TA (1998)
Psychroflexus torquis gen. nov., sp. Nov., a psychrophilic species from Antarctic sea ice, and
reclassification of Flavobacterium gondwanense (Dobson et al. 1993) as Psychroflexus
gondwanense gen. nov., comb.nov. Microbiology 144: 1601-1609. Braun-Blanquet J (1964)
Pflanzensoziologie. Springer, Wien.
Börjesson G, Sundh I and Svensson B (2004) Microbial oxidation of CH4 at different temperatures in
landfill cover soils. FEMS Microbiol Ecol 48: 305-312.
Böttcher J and Strebel O (1988) Ermittlung des Redoxpotentials (Eh-Wert) von Böden und
Grundwässern aus dem zeitlichen Verlauf der Elektrodendepolarisation. Z. Pflanzenernaehr.
Bodenkd. 151: 363-368.
Brioukhanov AL, Netrusov AI and Eggen RIL (2006) The catalase and superoxide dismutase genes
are transcriptionally up-regulated upon oxidative stress in the strictly anaerobic archaeon
Methanosarcina barkeiri. Microbiology 152: 1671-1677.
Brook RK & Kenkel NC (2002). A multivariate approach to vegetation mapping of Manitoba´s Hudson
Bay Lowlands. International Journal of Remote Sensing, 23 (21), 4761-4776.
Brown J (1967) Tundra soils formed over ice wedges, Northern Alaska. Soil Sci. Soc. Am. Proc. 31:
686-691.
Bubier JA, Moore TR, Bellisario L, Comer NT (1995) Ecological controls on methane emissions from a
northern peatland complex in the zone of discontinous permafrost, Manitoba, Canada. Global
Biogeochemical Cycles 9: 455-470.
Cao M, Marshall S, Gregson K (1996) Global carbon exchange and methane emissions from natural
wetlands: Application of a process-based model, Journal of Geophysical 635 Research, 101(D9):
14399-14414.
Cao M, Gregson K, Marshall S (1998) Global methane emission from wetlands and its sensivity to
climate change. Atmospheric Environment, 32 (19): 3293-3299.
Carr MH (1989) Recharge of the early atmosphere of Mars by impact-induced release of CO2. Icarus
79: 311-327.
Carr MH (1996) Water on Mars. Oxford University Press, Oxford.
Cavicchioli R (2006) Cold-adapted archaea. Nature 4: 331-343.
Cavigelli MA and Robertson GP (2001) Role of denitrifier diversity in rates of nitrous oxide
consumption in a terrestrial ecosystem. Soil Biology and Biochemistry, 33, 297-310.
Chan OC, Wolf M, Hepperle D & Casper P (2002) Methanogenic archaeal community in the sediment
of an artificially partitioned acidic bog lake, FEMS Microbiol Ecol 42: 119-129.
Chan OC, Claus P, Casper P, Ulrich A, Lueders T and Conrad R (2005) Vertical distribution of the
methanogenic archaeal community in Lake Dagow sediment. Environ Microbiol 7: 1139-1149.
Chanton JP & Dacey JWH (1991) Effects of vegetation on methane flux, reservoirs, and carbon
isotopic composition. In: Sharkey TD, Holland EA and Mooney HA (Eds) Trace Gas Emissions by
Plants (pp 65-89). Academic Press, San Diego.
Chanton JP, Bauer JE, Glaser PA, Siegel DI, Kelly CA, Tyler SC, Romanowicz EH & Lazrus A (1995)
Radiocarbon evidence for the substrates supporting methane formation within northern Minnesota
peatlands. Geochem Cosmochim Acta 59: 3663-3668.
Chapin III FS, Mcguire AD, Randerson J, Pielke R, Baldocchi D, Hobbie SE, Roulet N, Eugster W,
Kasischke E, Rastetter EB, Zimov SA, Running SW (2000) Arctic and boreal ecosystems of
western North America as components of the climate system, Global Change Biology, 6(S1), 211223.
Chapman WL, Walsh JE (1993) Recent Variations of Sea Ice and Air Temperature in High Latitudes,
Bull. Am. Meteorol. Soc., 74(1), 33-47.
Chavez PS (1996). Image-based atmospheric corrections – revised and improved. Photogrammetric
Engineering & Remote Sensing, 62 (9), 1025-1036.
Chernov YI and Matveyeva NV (1997) Arctic ecosystems in Russia. In: Wielgolaski FE (Ed) Polar and
Alpine Tundra - Ecosystems of the World 3 (pp 361-507). Elsevier, Amsterdam.
Chin KJ and Conrad R (1995) Intermediary metabolism in methanogenic paddy soil and the influence
of temperature. FEMS Microbiol Ecol 18: 85-102.
Choudhry GLG (1984) Photophysical and photochemical properties of soil and aquatic humic
materials. Residue Rev 92: 59-112.
220
Methane Cycle in Permafrost Ecosystems
9 References
Christensen TR (1993) Methane emission from arctic tundra. Biogeochemistry 21: 117-139.
Christensen TR, Jonasson S, Callaghan TV, Havström M (1995) Spatial variation in high-latitude
methane flux along a transect across Siberian and Eurasian tundra environments, J. Geophys.
Res. 100, 21035-21045.
Christensen TR, Prentice IC, Kaplan J, Haxeltine A, Sitch S (1996) Methane flux from northern
wetlands and tundra: an ecosystem source modelling approach. Tellus 48B: 651-660.
Christensen TR, Jonasson S, Havstroem M and Livens FR (1999) Carbon cycling and methane
exchange in Estuarine tundra ecosystems. AMBIO, 28, 239-244.
Christensen TR, Friborg T, Sommerkorn M, Kaplan J, Illeris L, Soegaard H, Nordstroem C, Jonasson
S (2000) Trace gas exchange in a high-arctic valley: 1. Variations in CO2 and CH4 flux between
tundra vegetation types. Global Biogeochemical Cycle, 14: 701-713.
Christensen TR, Lloyd D, Svensson B, Martikainen P, Harding R, Oskarsson H, Friborg T, Søgaard H
and Panikov N (2001) Biogenic controls on trace gas fluxes in northern wetlands. IGBP-Global
Change NewsLetter 51: 9-15.
Christensen PR, Wyatt MB, Glotch TD, Rogers AD, Anwar S, Arvidson RE, Bandfield JL, Blaney DL,
Budney C, Calvin WM, Fallacaro A, Fergason RL, Gorelick N, Graft TG, Hamilton VE, Hayes AG,
Johnson JR, Knudson AT, McSween HY, Mehall GL, Mehall LK, Moerisch JE, Morris RV, Smith
MD, Squyres SW, Ruff SW and Wolff MJ (2004) Mineralogy at Meridiani Planum from the MiniTes experiment on the Opportunity Rover. Science 306: 1733-1739.
th
Chuvilin EM, Ershov ED and Naletova NS (1998a) Ionic migration in frozen soils and ice. Proc. 7 Int.
Conf. of Permafrost. Yellowknife, Canada, pp. 167-171.
Chuvilin EM, Ershov ED and Smirnova OG (1998b) Mass transfer and structure formation in freezing.
th
Proc. 7 Int. Conf. of Permafrost. Yellowknife, Canada, pp. 173-179.
Cihlar J (2000). Land cover mapping of large areas from satellites: status and research priorities.
International Journal of Remote Sensing, 21 (6 & 7), 1093-1114.
Clark MH and Ping C-L (1997) Hydrology, morphology, and redox potentials in four soils of South
Central Alaska. p. 113-131. In Vepraskas MJ and Sprecher SW (ed.) Aquic conditions and hydric
soils: The problem soils. SSSA Spec. Publ. No. 50. Madison, WI.
Clein JS and Schimel JP (1995) Microbial activity of tundra and taiga soils at sub-zero temperatures.
Soil Biol & Biochem 27: 1231-1234.
Cleland D, Krader P, McCree C, Tang J and Emerson D (2004) Glycine betaine as a cryoprotectant for
prokaryotes. J Microbiol Methods 58: 31-38.
Colwell FS, Nunoura T, Delwiche ME et al. (2005) Evidence of minimal methanogenic numbers and
activity in sediments collected from the JAPEX/JNOC/GSC et al. Mallik 5L-38 Gas Hydrate
Production Research Well. In: Scientific Results from Mallik 2002 Gas Hydrate Production
Research Well Program, Mackenzie Delta, Northwest Territories, Canada (eds Dallimore SR,
Collett TS), pp. 1-11. Bulletin 585. Geological Survey of Canada, Microbiology section.
Congalton RG (1991) A review of assessing the accuracy of classifications of remotely sensed data.
Remote sensing of Environment, 37, 35-46.
Conrad R (1989) Control of methane production in terrestrial ecosystems, in Exchange of Trace
Gases between Terrestrial Ecosystems and the Atmosphere, edited by M. O. Andreae and D. S.
Schimel, pp. 39-58, John Wiley and Sons, Chichester, UK.
Conrad R (2005) Quantification of methanogenic pathways using stable carbonisotopic signatures: a
review and a proposal. Organ Geochem 36: 739-752.
Corradi C, Kolle O, Walter K, Zimov SA, Schulze ED (2005) Carbon dioxide and methane exchange of
a north-east Siberian tussock tundra, Global Change Biology, 11, 1910-1925.
Daims H, Bruehl A, Amann R, Schleifer KH and Wagner M (1999) The domain specific probe EUB338
is insufficient for the detection of all Bacteria, development and evaluation of a more
comprehensive probe set. Systematic and Applied Microbiology, 22, 434-444.
Davidson EA, Janssens IA and Luo Y (2006) On the variability of respiration in terrestrial ecosystems:
moving beyond Q10. Global Change Biology, 12, 154-164.
Deppenmeier U, Müller V, Gottschalk G (1996) Pathways of energy conservation in methanogenic
archaea. Archive of Microbiology 165: 149-163.
Dise NB (1992) Winter fluxes of methane from Minnesota peatlands. Biogeochemistry 17 (2): 71-83.
th
Douglas LA and Tedrow JCF (1960) Tundra soils of arctic Alaska. Trans. 7 Int. Cong. Soil Sci.
Madison, Vol. 4, Com. V, pp. 291-304.
Dunfield P, Knowles R, Dumont R and Moore TR (1993) Methane production and consumption in
temperate and subarctic peat soils: Response to temperature an pH. Soil Biol. Biochem.
25(3): 321-326.
Durham R, Schmunk RB and Chamberlain JW (1989) Comparative analysis of the atmospheres of
early Earth and Mars. Adv Space Res 9: 139-142.
221
9 References
Methane Cycle in Permafrost Ecosystems
DSMZ – Deutsche Sammlung für Mikroorganismen und Zellkulturen: Medium No. 120:
Methanosarcina, http://www.dsmz.de/media/med120.htm.
DSMZ – Deutsche Sammlung für Mikroorganismen und Zellkulturen: Medium No. 141:
Methanogenium, http://www.dsmz.de/media/med141.htm.
Ehhalt DH, Schmidt U (1978) Sources and sinks of atmospheric methane. Pure and Applied
Geophysics 116: 452-464.
Eicher J (2001) Biotechnological uses of archaeal extremozymes. Biotechnology Advances 19: 261278.
Eller G, Stubner S and Frenzel P (2001) Group-specific 16 rRNA targeted probes for detection of type
I and type II methanotrophs by fluorescence in situ hybridisation. FEMS Microbiology Letters, 198,
91-97.
Eller G, Krüger M and Frenzel P (2004) Comparing field and microcosm experiments: a case study on
methano- and methylotrophic bacteria in paddy soil. FEMS Microbiology Ecology, 51, 279-291
Elovskaya LG (1987) Classification and diagnostics of Yakutian permafrost soils. Yakutian Section of
the Siberian Branch of the Academy of Science USSR, Yakutsk.
European Space Agency (2004) Water and Methane maps overlap on Mars: a new clue?
http://www.esa.int/SPECIALS/Mars_Express/SEML131XDYD_0.html.
Everett KR and Parkinson RJ (1977) Soil and landform associations, Prudhoe Bay area, Alaska. Arct.
Alp. Res. 9:1-19.
Everett KR and Brown J (1982) Some recent trends in the physical and chemical characterization and
mapping of tundra soils, arctic slope of Alaska. Soil Sci. 133: 264-280.
Falge E, Baldocchi D, Olson R, Anthoni P, Aubinet M, Bernhofer C, Burba G, Ceulemans R, Clement
R, Dolman H, Granier A, Gross P, Grünwald TH, Hollinger D, Jensen NO, Katul G, Keronen P,
Kowalski A, Lai CT, Law BE, Meyers T, Moncrieff J, Moors E, Munger JW, Pilegaard K, Rannik Ü,
Rebmann C, Suyker A, Tenhunen J, Tu K, Verma S, Vesala T, Wilson K, Wofsy S (2001), Gap
filling strategies for defensible annual sums of net ecosystem exchange, Agric. Forest Meteorol.,
107, 43-69.
Farrell RE, Swerhone GDW and Van Kessel C (1991) Construction and evaluation of a reference
electrode assembly for use in monitoring in situ soil redox potentials. Commun. Soil. Sci. Plant
Anal. 22: 1059-1068.
Felix NA & Binney DL (1989). Accuracy assessment of a LANDSAT-assisted vegetationmap of the
coastal plain of the Arctic National Wildlife Refuge. Photogrammetric Engineering & Remote
Sensing, 55 (4), 475-478.
Ferguson RS (1991). Detection and classification of muskox habitat on Banks Island, Northern
Territories, Canada, using LANDSAT Thematic Mapper data. Arctic, 44 (1), 66-74.
Feustel IC, Dutilly A and Anderson MS (1939) Properties of soils from North American arctic region.
Soil Sci. 48: 183-199.
Fiedler S (1997) In-situ-Langzeitmessungen des Redoxpotentials in hydromorphen Böden einer
Endmoränenlandschaft im württembergischen Alpenvorland. Hohenheimer Bodenkdl. Hefte 42: 1135.
Fiedler S, Wagner D, Kutzbach L, Pfeiffer EM (2004) Element redistribution along hydraulic and redox
gradients of low-centered-polygons, Lena Delta, Northern Siberia, Soil Sci. Soc. Am. J., 68, 10041011.
Foken T and Wichura B (1996) Tools for quality assessment of surface-based flux measurements,
Agricultural and Forest Meteorology, 78(1), 83-105.
Formisano V (2004) Detection of methane in the atmosphere of Mars. Science 306: 1758-1761.
Franzmann PD, Springer N, Ludwig W, De Macario EC and Rohde M (1992) A methanogenic
archaeon from Ace Lake, Antarctica – Methanococcoides burtonii sp. nov. Syst Appl Microbiol15:
573-58.
Franzmann PD, Liu Y, Balkwill DL, Aldrich HC, Conway de Macario E, Boone DR (1997)
Methanogenium frigidium sp. nov., a psychrophilic, H2-using methanogen from Ace Lake,
Antarctica. International Journal of Systematic Bacteriology 47: 1068-1072.
French HM (1996) The Periglacial Environment, Longman, London, UK.
Frenzel P, Thebrath B, Conrad R (1990) Oxidation of methane in the oxic surface layer of a deep lake
sediment (Lake Constance). FEMS Microbiology Ecology 73: 149-158.
Frenzel P, Karofeld E (2000) CH4 emission from a hollow-ridge complex in a raised bog: the role of
CH4 production and oxidation. Biogeochemistry 51: 91-112.
Friborg T, Christensen TR, Søgaard H (1997) Rapid response of greenhouse gas emission to early
spring thaw in a subarctic mire as shown by micrometeorological techniques. Geophysical
Research Letters 24: 3061-3064.
222
Methane Cycle in Permafrost Ecosystems
9 References
Friborg T, Christensen TR, Hansen BU, Nordstroem C, Soegaard H (2000) Trace gas exchange in a
high-arctic valley 2. Landscape CH4 fluxes measured and modeled using eddy correlation data,
Global Biogeochem. Cycles, 14(3), 715-724.
Friborg T, Soegaard H, Christensen TR, Lloyd CR and Panikov N (2003) Siberian wetlands: where a
sink is a source. Geophysical Research Letters, 30, 2129-2131.
Friedmann E (1994) Permafrost as microbial habitat, Viable microorganisms in permafrost, Institute of
Soil Science and photosynthesis, Russian Academy of Science, Pushkino, pp. 21-26.
Frolking S and Crill P (1994) Climate controls on temporal variability of methane flux from a poor fen in
southeastern New Hampshire: Measurement and modeling, Global Biogeochemical Cycles, 8(4),
385-397.
Frostegard A and Bååth E (1996) The use of phospholipid fatty acid analysis to estimate bacterial and
fungal biomass in soil. Biol Fert Soils 22: 59-65.
Fung I, John J, Lerner J, Matthews E, Prather M, Steele LP, Fraser PJ (1991) Three-dimensional
model synthesis of the global methane cycle. J Geophysical Res 96: 13033-13065.
Galand PE, Saarnio S, Fritze H & Yrjälä K (2002) Depth related diversity of methanogen Archaea in
Finnish oligotrophic fen. FEMS Microbiol Ecol 42: 441-449.
Galand PE, Fritze H & Yrjälä K (2003) Microsite-dependent changes in methanogenic populations in a
boreal oligotrophic fen. Environ Microbiol 5: 1133-1143.
Galand PE, Juottonen H, Fritze H & Yrjälä K (2005) Methanogen communities in a drained bog: effect
of ash fertilization. Microb Ecol 49: 209-217.
Ganzert L, Zimmermann U & Wagner D (2004). Microbial process studies on methane fluxes from
permafrost environments. In: Schirrmeister L, Grigoriev MN, Kutzbach L, Wagner D, Bolshiyanov
DYu (Eds.). Russian-German Cooperation System Laptev Sea: The expedition Lena-Anabar
2003, Reports on Polar and Marine Research, 489, 20-29.
Ganzert L, Jurgens G, Münster U and Wagner D (2006) Methanogenic communities in permafrostaffected soils on the Laptev Sea coast, Siberian Arctic, characterized by 16S rRNA gene
fingerprints. FEMS Microbiol Ecology DOI 10.1111/j.1574-6941.2006.00205.x.
Ganzert L, Jurgens G, Münster U et al. (2006) Biodiversity of methanogenic archaea in permafrost
environments of the Laptev Sea coast. FEMS Microbiology Ecology, awaiting acceptance.
Gattinger A, Schloter M and Munch JC (2002a) Phospholipid etherlipid and phospholipid fatty acid
fingerprints in selected euryarchaeotal monocultures for taxonomic profiling. FEMS Microbiol Lett
213: 133 –139.
Gattinger A, Ruser R, Schloter M and Munch JC (2002b) Microbial community structure varies in
different soil zones of a potato field. J Plant Nutr Soil Sci 165: 421-428.
Gattinger A, Günthner A, Schloter M et al. (2003) Characterisation of Archaea in soil ecosystems by
polar lipid analysis. Acta Biotechnology, 23, 21-28.
Garcia JL, Patel BKC and Olliver B (2000) Taxonomic, phylogenetic and ecological diversity of
methanogenic archaea. Anaerobe 6: 205-226.
Georlette D, Blaise V, Collins T, D’Amico S, Gratia E, Hoyoux A, Marx J-C, Sonan G, Feller G and
Gerday C (2004) Some like it cold: biocatalysis at low temperatures. FEMS Microbiol Rev 28: 2542.
Gersper PL, Alexander V and Barkley SA (1980) The soils and their nutrients. p. 219-254. In J. Brown
(ed.) An arctic ecosystem. The coastal tundra at Barrow, Alaska. Hutchinson and Ross.
Stoudsburg Dowden.
Gilichinsky D, Soina VS and Petrova MA (1993) Cryoprotective properties of water in the Earth
cryolithosphere and its role in exobiology, Origins Life Evol. Biosphere 23, 65-75.
Gilichinsky D and Wagener S (1994) Microbial life in permafrost, in Gilichinsky D (ed.) Viable
microorganisms in Permafrost, Pushchino Research Cener, pp. 7-20.
Gilichinsky D, Rivkina E, Shcherbakova V, Laurinavichuis K and Tiedje J (2003) Supercooled water
brines within permafrost - an unknown ecological niche for microorganisms: a model for
astrobiology. Astrobiology 3/2: 331-341.
Glissman K, Chin KJ, Casper P and Conrad R (2004) Methanogenic pathway and archaeal community
structure in the sediment of eutrophic Lake Dagow: effect of temperature. Microb Ecol 48: 389399.
Gounot AM (1999) Microbial life in permanently cold soils. In: Cold-adapted organisms (eds Margesin
R, Schinner F) pp. 3-16, Springer, Berlin.
Gorham E (1991) Northern peatlands role in the carbon cycle and probable responses to climatic
warming. Ecological Applications 1: 182-195.
Grigoriev MN (1993) Cryomorphogenesis of the Lena River mouth area, pp. 176, SB Russian
Academy of Science, Yakutsk, Russia (in Russian).
223
9 References
Methane Cycle in Permafrost Ecosystems
Grigoriev MN, Rachold V, Bolshiyanov DYu, Pfeiffer EM, Schirrmeister L, Wagner D and Hubberten
HW (2003) Russian-German Cooperation SYSTEM LAPTEV SEA: The expedition LENA 2002,
Reports on Polar and Marine Research 466, pp.341.
Gross MF, Hardinsky MA, Doolittle JA & Klemas V (1990) Relationships among depth to frozen soil,
soil wetness, and vegetation type and biomass in tundra near Bethel, Alaska, USA. Arctic and
Alpine Research, 22 (3), 275-282.
Grosse G, Schirrmeister L, Malthus TJ (2006) Application of Landsat-7 satellite data and a DEM for
the quantification of the thermokarst-affected terrain types in the periglacial Lena-Anabar coastal
lowland. Polar Research, 25 (1), 51-67.
Grosskopf R, Janssen PH and Liesack W (1998a) Diversity and structure of the methanogenic
community in anoxic rice paddy soil microcosms as examined by cultivation and direct 16S rRNA
gene sequence retrieval. Appl Environ Microbiol 64: 960-969.
Grosskopf R, Stubner S and Liesack W (1998b) Novel euryarchaeotal lineages detected on rice roots
and in the anoxic bulk soil of flooded rice microcosms. Appl Environ Microbiol 64: 4983-4989.
Große W, Büchel HB & Tiebel H (1991) Pressurized ventilation in wetland plants. Aquat. Bot.
39: 89-98.
Grotenhuis J, Plugge C, Stams A and Zehnder A (1992) Hydrophobicities and electrophoretic
mobilities of anaerobic bacterial isolates from methanogenic granular sludge, Appl. Environ.
Microbiol. 58: 1054-1056.
Grulke NE, Riechers GH, Oechel WC, Hjelm U and Jaeger C (1990) Carbon balance in tussock tundra
under ambient and elevated atmospheric CO2. Oecologia 83: 485-494.
Grünfeld S and Brix H (1999) Methanogenesis and methane emissions: effects of water table,
substrate type and presence of Phragmites australis. Aquat. Bot. 64: 63-75.
Gunary D, Hallsworth EG and DV Crawford (1965) The experimental study of the mobility of ions in
soils, with particular reference to phosphorus. p. 149-156. In Hallworth EG, and Crawford DV (ed.)
Experimental pedology. Butterworths. London.
Haag RW (1974) Nutrient limitations to plant production in two tundra communities. Can. J. Bot. 52:
103-116.
Hales BA, Edwards C, Ritchie DA, Hall G, Pickup RW and Saunders JR (1996) Isolation and
identification of methanogen-specific DNA from blanket bog peat by PCR amplification and
sequence analysis. Appl Environ Microbiol 62: 668-675.
Hallsworth EG, Beattie JA and Darley WE (1982) Formation of soils in an aridic environmental western
New South Wales, Australia, Catena Suppl. 1: 83-102.
Hansen J, Nazarenko L, Ruedy R, Sato M, Willis J, Del Genio A, Koch D, Lacis A, Lo K, Menon S,
Novakov T, Perlwitz J, Russell G, Schmidt GA and Tausnev N (2005) Earth´s energy imbalance:
conformation and implications. Science 308: 1431-1435.
Hansen J, Fung I, Lacis A, Rind D, Lebedeff S, Ruedy R, Russell G, Stone P (1988) Global climate
changes as forecast by Goddard Institute for Space Studies three-dimensional model. Journal of
Geophysical Research 93: 9341-9364.
Hanson RS and Hanson TE (1996) Methanotrophic Bacteria. Microbiological Reviews, 60 (2), 439-471
Hargreaves KJ, Fowler D (1998) Quantifying the effects of water table and soil temperature on the
emission of methane from peat wetland at the field scale. Atmospheric Environment 32: 32753282.
Hargreaves KJ, Fowler D, Pitcairn CER, Aurela M (2001) Annual methane emission from Finnish
mires estimated from eddy covariance campaign measurements, Theor. Appl. Climatol. 70, 203213.
Harriss R, Bartlett K, Frolking S and Crill P (1993) Methane emission from northern high-latitude
wetlands. p. 449-485. In Oremland RS (ed.) Biogeochemistry of global change. New York:
Chapman and Hall.
Harvey HR, Fallon RD, Patton JS (1986) The effect of organic matter and oxygen on the degradation
of bacterial membrane lipids in marine sediments. Geochimica et Cosmochimica Acta, 50,
795-804.
Hedderich R and Whitman WB (2005) Physiology and Biochemistry of the methane-producing
Archaea. The Prokaryotes, An Evolving Electronic Resource for the Microbiological Community,
3rd edition, release 3.2, December 31, 2005 (Dworkin M et al., eds): Springer-Verlag, New York,
http://link.springer-ny.com/link/service/books/10125/.
Heijnen CE, Hok-A-Hin CH and Van Veen JA (1992) Improvments to the use of bentonite clay as a
protective agent increasing survival levels of bacteria introduced into soil. Soil Biology &
Biochemistry, 24, 533-538.
Heikkinen JEP, Virtanen T, Huttunen JT, Elsakov V & Martikainen PJ (2004) Carbon balance in
Easteuropean tundra. Global Biogeochemical Cycles, 18, GB1023, doi: 10.1029/2003GB002054.
224
Methane Cycle in Permafrost Ecosystems
9 References
Henckel T, Roslev P and Conrad R (2000) Effects of O2 and CH4 on presence and activity of the
indigenous methanotrophic community in rice field soil. Environmental Microbiology, 2 (6), 666679.
Heyer J and Suckow R (1985) Ökologische Untersuchungen der Methanoxydation in einem sauren
Moorsee. Limnologica 16(2): 247-266.
Hinkel KM and Outcalt SI (1994) Identification of heat transfer processes during soil cooling, freezing
and thaw in central Alaska. Permafrost and Periglacial Proc. 5: 217-235.
HMCR, Hydrometeorological Centre of Russia (2004) Russia’s Weather, http://meteo.infospace.ru.
Hogg EH (1993) Decay potential of hummock and hollow Sphagnum peats at different depths in a
Swedish raised bog. Oikos, 66, 269-278.
Høj L, Olsen RA and Torsvik VL (2005) Archaeal communities in High Arctic wetlands at Spitsbergen,
Norway (78°N) as characterised by 16S rRNA gene fingerprinting. FEMS Microbiol Ecol 53: 89101.
Holzapfel-Pschorn A, Conrad R and Seiler W (1986) Production, oxidation and emission of methane in
rice paddies. FEMS Microbiol. Ecol. 31: 343-351.
Horz HP, Raghubanshi AS, Heyer J, Kammann C, Conrad and Dunfield R, PF (2002) Activity and
community structure of methane-oxidising bacteria in a wet meadow soil. FEMS Microbiology
Ecology, 41, 247-257.
Houghton JT, Ding Y, Griggs DJ, Noguer M, van der Linden PJ, Xiaosu D (Eds.) (2001) Climate
Change 2001: The Scientific Basis. Contribution of Working Group I to the Third Assessment
Report of the Intergovernmental Panel on Climate Change, 944 pp., Cambridge University Press,
UK.
Huang C, Townshend JRG, Zhan X, Hansen M, DeFries R & Solhberg R (1998) Developing the
spectral trajectories of major land cover change processes. Proceedings of SPIE (Beijing:SPIE),
155-162.
Hubberten HW, Wagner D, Pfeiffer EM, Boike J and Gukov A Yu (2006) The Russian-German
research station Samoylov, Lena Delta – a key site for polar research in the Siberian arctic.
Polarforschung 73: 111-116.
Intergovernmental Panel of Climate Change (2001) Climate Change 2001: Impacts, Adaption, and
Vulnerability. Cambridge University Press, Cambridge.
IPCC (2001) Climate change 2001: The scientific basis. Contribution of the working group I to the third
assessment report of the Intergovernmental Panel on Climate Change. Houghton JT, Ding Y,
Griggs DJ, Nogner M, van der Linden PJ, Dai X, Maskell K and Johnson CA (Eds.) Cambridge
University Press, Cambridge, New York, 881.
ISSS-ISRIC-FAO (1998) World Reference Base for Soil Resources. FAO, World Soil Resources
Report No. 84, Rome.
IUPAC-IUB Commission on biochemical nomenclature (1977) The nomenclature of lipids. Eur J
Biochem 79: 11-21.
Iversen N and Blackburn H (1981) Seasonal Rates of Methane Oxidation in Anoxic Marine Sediments.
Applied and Environmental Microbiology, 41(6), 1295-1300.
Jeanthon C, L`Haridon S, Pradel N and Prieur D (1999) Rapid identification of hyperthermophilic
methanococci isolated from deep-sea hydrothermal vents. Int J Syst Bacteriol 49: 591-594.
Joabsson A, Christensen TR and Wallén B (1999) Influence of vascular plant photosynthetic rate on
CH4 emission from peat monoliths from southern boreal Sweden. Polar Res. 18: 215-220.
Joabsson A and Christensen TR (2001) Methane emissions from wetlands and their relationship with
vascular plants: an Arctic example. Global Change Biology 7, 919-932.
John MK (1970) Colorimetric determination of phosphorus in soil and plant material with ascorbic acid.
Soil Sci. 109: 214-220.
Joria PE & Jorgenson JC (1996) Comparison of three methods for mapping tundra with Landsat digital
data. Photogrammetric Engineering & Remote Sensing, 62 (2), 163-169.
Juottonen H, Galand PE, Tuittila ES, Laine J, Fritze H and Yrjälä K (2005) Methanogen communities
and Bacteria along an ecohydrological gradient in a northern raised bog complex. Environ
Microbiol 7(10): 1547-1557.
Jurgens G, Glöckner FO, Amann R, Saano A, Montonen L, Likolammi M and Münster U (2000)
Identification of novel Archaea in bacterioplancton of a boreal forest lake by phylogenetic analysis
and fluorescence in situ hybridisation. FEMS Microbiol Ecol 34: 45-56.
Kaneda T (1991) Iso- and anteiso-fatty acids in bacteria: Biosynthesis, function, and taxonomic
significance. Microbiol Rev 55: 288-302.
Kattenberg A, Giorgi F, Grassel H, Meehl GA, Michell JFB, Stoufer RJ, Tokioka T, Weaver AJ, Wigley
TML (1996) Climate models – projections of future climate. In Climate Change 1995, Houghton JT
(ed). University Press: Cambridge; 285-357.
225
9 References
Methane Cycle in Permafrost Ecosystems
Kelker D and Chanton J (1997) The effect of clipping on methane emissions from Carex.
Biogeochemistry 39: 37-44.
Kellog CE (1934) Morphology and genesis of the Solonetz soils of western North Dakota. Soil Sci. 38:
483-501.
Keough BP, Schmidt TM and Hicks RE (2003) Archaeal nucleic acids in picoplankton from great lakes
on three continents. Microbial Ecol 46: 238-248.
Kessler, MA and Werner BT (2003) Self-organization of sorted patterned ground. Science 299:
380-383.
Khalil MAK, Rasmussen RA, Shearer MJ (1998) Effects of production and oxidation processes on
methane emissions from rice fields. Journal of Geophysical Research 103: 25,233-25,239.
Kiener A and Leisinger T (1983) Oxygen sensitivity of methanogenic bacteria. Syst Appl Microbiol 4:
305-312.
Kim WS and Dunn NW (1997) Identification of a cold shock gene in lactic acid bacteria and the effect
of cold shock on cryotolerance. Curr Microbiol 35: 59-63.
Kimura H, Sugihara M, Yamamoto H, Patel BKC, Kato K and Hanada S (2005) Microbial community in
a geothermal aquifer associated with the subsurface of the Great Artesian Basin, Australia.
Extremophiles 9(5): 407-414.
King GM and Adamsen APS (1992) Effects of temperature on methane consumption in a forest soil
and in pure cultures of the methanotroph Methylomonas rubra. Appl. Env. Microbiol. 58(9): 27582763.
King JY, Reeburgh WS and Regli SK (1998) Methane emission and transport by arctic sedges in
Alaska: Results of a vegetation removal experiment. J. Geophys. Res. 103(D22): 29083-29092
Kling GW, Klipphut GW & Miller MC (1992) The flux of CO2 and CH4 from lakes and rivers in arctic
Alaska. Hydrobiologia, 240, 23-36.
Klingelhofer G, Morris RV, Bernhard B, Schroder C, Rodnov DS, de Souza PA, Yen A, Gellert R,
Evlanov EN, Zubkov B, Foh J, Bonnes U, Kankeleit E, Gutlich P, Ming DW, Renz F, Wdowiak T,
Squyres SW and Arvidson RE (2004) Jarosite and hematite at Meridiani Planum from
Opportunity’s Mossbauer spectrometer. Science 306: 1740-1745.
Knief C, Lipski A and Dunfield PF (2003) Diversity and activity of methanotrophic bacteria in different
upland soils. Appl Environ Microbiol 69: 6703-6714.
Knief C, Dunfield PF (2005) Response and adaptation of different methanotrophic bacteria to low
methane mixing ratios. Environmental Microbiology,7(9), 1307-1317.
Knief C, Kolb S, Bodelier PLE, Lipski A, Dunfield PF (2006) The active methanotrophic community in
hydromorphic soils changes in response to changing methane concentration. Environmental
Microbiology, 8(2), 321-333.
Kobabe S, Wagner D and Pfeiffer EM (2004) Characterization of microbial community composition of
a Siberian tundra soil by fluorescence in situ hybridization. FEMS Microbiol Ecol 50: 13-23.
Končalová H (1990) Anatomical adaptions to waterlogging in roots of wetland graminoids: limitations
and drawbacks. Aquat. Bot. 38: 127-134.
Kormann R, Mueller H, Werle P (2001) Eddy flux measurements of methane over the fen "Murnauer
Moos", 11°11'E, 47°39'N, using a fast tunable diode laser spectrometer, Atmos. Environ. 35 (14)
2533-2544.
Korotaev VN (1986) Geomorphology of river deltas on the Arctic coast of Siberia. Polar Geography
and Geology 10: 139-147.
Kotsyurbenko OR, Nozhevnikova AN and Zavarzin GA (1993) Methanogenic degradation of organic
matter by anaerobic bacteria at low temperature. Chemosphere 27: 1745-1761.
Kotsyurbenko OR, Chin KJ, Glagolev MV, Stubner S, Simankova MV, Nozhevnikova AN and Conrad
R (2004) Acetoclastic and hydrogenotrophic methane production and methanogenic populations in
an West-Siberian peat bog. Environ Microbiol 6: 1159-1173.
Kotlyakov V, Khromova T (2002) Permafrost, Snow and Ice, In, Stolbovoi V and McCallum I (eds) CDROM Land Recources of Russia, International Institute of Applied 715 Systems Analysis and the
Russian Academy of Science, Laxenburg, Austria.
Kral TA, Bekkum CR and McKay CP (2004) Growth of methanogens on a Mars soil stimulant, Origins
of Life and Evolution of the Biosphere 34: 615-626.
Krueger M, Eller G, Conrad R and Frenzel P (2002) Seasonal variation in pathways of CH4 production
and in CH4 oxidation in rice fields determined by stable carbon isotopes and specific inhibitors.
Global Change Biology, 8, 265-280.
Krumholz LR, Hollenback JL, Roskes SJ and Ringelberg DB (1995) Methanogenesis and
methanotrophy within a Sphagnum peatland. FEMS Microbiol. Ecol. 18: 215-224.
Kutzbach L (2000) Die Bedeutung der Vegetation und bodeneigener Parameter für die Methanflüsse
in Permafrostböden. Master Thesis, University of Hamburg, Institute of Soil Science. 105p.
226
Methane Cycle in Permafrost Ecosystems
9 References
Kutzbach L & Kurchatova A (2002) Methane-related investigations of soils and waters in the SangaDzhie region. In: Pfeiffer E-M & Grigoriev MN (Eds.). Russian-German Cooperation System
Laptev Sea 2000: The expedition Lena 2001, Reports on Polar and Marine Research, 426, 76-87.
Kutzbach L, Kurchatova AN, Stoof G (2003) The flora of Samoylov Island - A documentation, in
Russian-German Cooperation SYSTEM LAPTEV SEA, The Expedition LENA 2002, Reports on
Polar and Marine Research 466, edited by M. N. Grigoriev, 58-63, Alfred-Wegener-Institute,
Bremerhaven, Germany.
Kutzbach L, Wagner D and Pfeiffer EM (2004) Effect of microrelief and vegetation on methane
emission from wet polygonal tundra, Lena Delta, Northern Siberia. Biogeochemistry, 69 (3), 341362.
Kutzbach L, Stoof G, Schneider W, Wille C, Abramova EN (2004a) Seasonal progression of activelayer thickness dependent on microrelief, in Expeditions in Siberia in 2003, Reports on Polar and
Marine Research 489, edited by Schirrmeister L, 34-38, Alfred-Wegener-Institute, Bremerhaven,
Germany.
Kutzbach L (2006) The Exchange of Energy, Water and Carbon Dioxide between Wet Arctic Tundra
and the Atmosphere at the Lena River Delta, Northern Siberia, Thesis, University of Hamburg,
Reports on Polar and Marine Resrach (in press).
Kuzmin RO (2005) Ground Ice in the Martian Regolith, in T. Tokano (ed.) Water on Mars and Life,
Springer Verlag Berlin, pp. 155-183.
Lange M and Ahring B (2001) A comprehensive study into the molecular methodology and molecular
biology of methanogenic archaea. FEMS Microbiol Rev 25: 553-571.
Lehmann-Richter S, Grosskopf R, Liesack W, Frenzel P and Conrad R (1999) Methanogenic archaea
and CO2-dependent methanogenesis on washed rice roots Appl Environ Microbiol 65: 2402-2408.
Le Mer J and Roger P (2001) Production, oxidation, emission and consumption of methane by soils:
A review. European Journal of Soil Biology 37, 25-50.
Liblik LK, Moore TR, Bubier JL, Robinson SD (1997) Methane emissions from wetlands in the zone of
discontinuous permafrost: Fort Simpson, Northwest Territories, Cananda. Global Biogeochemical
Cycles 11: 485-494.
Liebner S and Wagner D (2006) Abundance, distribution and potential activity of methane oxidising
bacteria in permafrost soils from the Lena Delta, Siberia, Environmental Microbiology 9, 107-117
Liebner S, Harder J and Wagner D. (in prep.) Microbial and methanotrophic diversity in Siberian
permafrost soils from the Lena Delta, Siberia, based on 16S rDNA clone libraries and CARD FISH
analysis.
Lin C, Raskin L and Stahl DA (1997) Microbial community structure in gastrointestinal tracts of
domestic animals: comparative analyses using rRNA-targeted oligonucleotide probes. FEMS
Microbiol Ecol 22: 281-294.
Lipski A, Altendorf K (1997) Identification of heterotrophic bacteria isolated from ammonia-supplied
experimental biofilters. System Applied Microbiology, 20, 448-457.
Lloyd J and Taylor JA (1994) On the temperature dependence of soil respiration. Functional Ecology,
8, 315-323.
Lu Y & Conrad R (2005) In situ stable isotope probing of methanogenic archaea in the rice
rhizosphere. Science 309: 1088-1090.
Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar, Buchner A, Lai T, Steppi S, Jobb
G, Forster W, Brettske I, Gerbe S, Ginhart AW, Gross O, Grumann S, Hermann S, Jost R, Konig
A, Liss T, Lussmann R, May M, Nonhoff B, Reichel B, Strehlow R, Stamatakis A, Stuckmann N,
Vilbig A, Lenke M, Ludwig T, Bode A and Schleifer KH (2004) ARB: a software environment for
sequence data. Nucleic Acids Res 25: 1363-1371.
Lueders T and Friedrich M (2000) Archaeal population dynamics during sequential reduction
processes in rice field soil. Appl Environ Microbiol 66: 2732-2742.
Lundin LC and Johnsson H (1994) Ion dynamics of a freezing soil monitored in situ by time domain
reflectometry. Water Resour. Res. 30: 3471-3478.
Macalady JL, McMillan AM, Dickens AF, Tyler SC and Scow KM (2002) Population dynamics of type I
and II methanotrophic bacteria in rice soils. Environmental Microbiology, 4(3), 148-157.
Macario AJL, Lange M, Ahring BK and De Macario EC (1999) Stress genes and proteins in the
archaea. Microbiol Mol Biol Rev 63/4: 923-967.
MacDonald JA, Fowler D, Hargreaves KJ, Skiba U, Leith ID & Murray MB (1998) Methane emission
rates from a northern wetland; response to temperature, water table and transport. Atmospheric
Environment, 32 (19), 3219-3227.
MacLean AH and Pawluck S (1975) Soil genesis in relation to groundwater and soil moisture regimes
near Vegreville., Alberta. Can. J. Soil Sci. 26: 278-293.
Mangelsdorf K, Haberer RM, Zink KG et al. (2005) Molecular indicators for the occurrence of deep
microbial communities at the JAPEX/JNOC/GSC et al. Mallik 5L-38 Gas Hydrate Production
227
9 References
Methane Cycle in Permafrost Ecosystems
Research Well. In: Scientific Results from Mallik 2002 Gas Hydrate Production Research Well
Program, Mackenzie Delta, Northwest Territories, Canada (eds Dallimore SR, Collett TS), pp. 1829. Bulletin 585. Geological Survey of Canada, Microbiology section.
Martens CS, Kelley CA, Chanton JP & Showers WJ (1992) Carbon and hydrogen isotopic
characterization of methane from wetlands and lakes of the Yukon-Kuskokwim Delta, Western
Alaska. Journal of Geophysical Research, 97 (D15), 16689-16701.
Martikainen PJ, Nykänen H, Alm J and Silvola J (1995) Changes in fluxes of carbon dioxide, methane
and nitrous oxide due to forest drainage of mire sites of different trophy. Plant Soil 168-169: 571577.
Mathrani IM and Boone DR (1985) Isolation and characterization of a moderatly halophilic
methanogen from a solar saltern. Appl Environ Microbiol 50: 140-143.
Matthews E (1983) Global vegetation and landuse: New high resolution data bases for climate studies.
Journal of Climate and Applied Meteorology, 22, 474-487.
Matthews E, Fung I (1987) Methane emission from natural wetlands: global distribution, area, and
environmental characteristics of sources. Global Biogeochemical Cycles 1 (1): 61-86.
Matthews E, (2000) Wetlands. In: Khalil MAK (Ed.). Atmospheric methane, its role in the global
environment, Springer, 202-233.
Matveyeva NV (1994) Floristic classification and ecology of tundra vegetation of the Taymyr
Peninsula, northern Siberia. J. Vegetation Science 5: 813-828.
Maxwell B (1997) Recent climate patterns in the Arctic. In: Oechel WC, Callaghan T, Gilmanov T,
Holten JI, Maxwell B, Molau U and Sveinbjörnsson B (Eds) Global Change and Arctic Terrestrial
Ecosystems (pp. 21-46) Springer, New York.
McCown BH (1978) The interactions of organic nutrients, soil nitrogen, and soil temperature and plant
growth and survival in the arctic environment. p. 435-456. In L.L. Tieszen (ed.) Vegetation and
Production Ecology of an Alaskan Arctic Tundra. Ecological Studies 29 Springer, New York.
McKay CP and Davis W (1991) Duration of liquid water habitats on early Mars. Icarus 90: 214-221.
McKay CP, Friedman EI, Wharton RA and Davies WL (1992) History of water on Mars: a biological
perspective. Adv Space Res 12: 231-238.
McMillen R (1988) An eddy correlation technique with extended applicability to nonsimple terrain,
Boundary-Layer Meteorology, 43, 231-245.
Mehra OP and ML Jackson (1960) Iron oxide removal from soils and clays. Clays Clay Miner. 7: 317327.
Melillo JM, Steudler PA, Aber JD, Newkirk K, Lux H, Bowles FP, Catricala C, Magill A, Ahrens T and
Morrisseau S (2002) Soil warming and carbon-cycle feedbacks to the climate system. Science
298: 2173-2176.
Melloh RA, Crill PM (1996) Winter methane dynamics in a temperate peatland. Global Biogeochemical
Cycles 10: 247-254.
Meyer H (2003) Studies on recent cryogenesis, in Russian-German Cooperation SYSTEM LAPTEV
SEA, The Expedition LENA 2002, Reports on Polar and Marine Research 466, edited by Grigoriev
MN, 8-16, Alfred-Wegener-Institute, Bremerhaven, Germany.
Michaelson GJ, Ping CL and Kimble JM (1996) Carbon storage and distribution in tundra soils of Arctic
Alaska, USA. Arct. Alp. Res. 28: 414-424.
Mindock CA, Petrova MA and Hollingsworth RI (2000) Re-evaluation of osmotic effects as a general
adaptive strategy for bacteria in sub-freezing conditions. Biophysical Chemistry 89(1): 13-24.
Mitsch WJ, Mitsch RH & Turner RE (1994) Wetlands of the Old and New Worlds: ecology and
management. In: Mitsch WJ (Ed.). Global wetlands: Old World and New. Elsevier Science,
Amsterdam, 3-56.
Möhlmann D, Wernecke R and Schwanke V (2004) Measurement principle and equipment for
measuring humidity contents in the upper Martian surface and subsurface, ESA SP-543, 163 168.
Möhlmann D (2005) Adsorption Water-Related Potential Chemical and Biological Processes in the
Upper Martian Surface, Astrobiology 5, 770 -777.
Moncrieff JB, Massheder JM, de Bruin H, Elbers J, Friborg T, Heusinkveld B, Kabat P, Scott S,
Soegaard H, Verhoef A (1997) A system to measure surface fluxes of momentum, sensible heat,
water vapour and carbon dioxide, J. Hydrol., 188-189, 589-611.
Moore CJ (1986) Frequency response corrections for eddy correlation systems, Boundary-Layer
Meteorology, 37, 17-35.
Moore T, Roulet N, Knowles R (1990) Spatial and temporal variations of methane flux from 745
subarctic/northern boreal fens. Global Biogeochemical Cycles, Volume 4, Issue 1, p. 29-46.
Moore TR and Roulet NT (1993) Methane flux: Water table relations in northern wetlands. Geophys.
Res. Lett. 20: 587-590.
228
Methane Cycle in Permafrost Ecosystems
9 References
Moosavi SC and Crill PM (1998) CH4 oxidation by tundra wetlands as measured by a selective
inhibitor technique. J. Geophys. Res. 103(D22): 29093-29106.
Moran M, Miller JD, Kral T and Scott D (2005) Desert methane: implications for life detection on Mars,
Icarus 178, 277-280.
Morgenstern A (2005) GIS based analysis of the morphometry and spatial distribution of lakes in the
Lena Delta, NE-Siberia. Diploma thesis, University of Potsdam, 70pp, (in German).
Morita RY (1975) Psychrophilic bacteria. Bacteriological Review 39: 144-167.
Morita RY(1992) Low-temperature environments. In Encyclopedia of Microbiology, Vol. 2, Lederbetrg J
(ed) Academic Press: San Diego; 625-637.
Morita RY (1995) Low-Temperature Environ-ments. Encyclopedia of Microbiology, (Vol.2), Academic
Press, San Diego.
Morozova D, Möhlmann D and Wagner D (2006) Survival of methanogenic archaea from Siberian
permafrost under simulated Martian thermal conditions. Orig. Life Evol Biosph. DOI
10.1007/s11084-006-9024-7.
Morozova D, Möhlmann D and Wagner D (in press) Response of methanogenic archaea from Siberian
permafrost to Martian thermo-physical conditions. ESA Special Publication – Microorganisms and
the Martian Environment.
Morrissey LA and Livingston GP (1992) Methane emissions from Alaska arctic tundra: An assessment
of local spatial variability. J. Geophys. Res. 97 (D15): 16661-16670.
Morrissey LA, Zobel DB, Livingston GB (1993) Significance of stomatal control on methane release
from Carex dominated wetlands. Chemosphere 26(1-4): 339-355.
Muller SV, Racoviteanu AE & Walker DA (1999). LANDSAT MSS-derived land-cover map of Northern
Alaska: extrapolation methods and a comparison with photo-interpreted and AVHRR-derived
maps. International Journal of Remote Sensing, 20 (15 & 16), 2921-2946.
Müller K (1997) Patterned ground and properties of permafrost soils of the Northsiberian Lena Delta.
J. Plant. Nutr. Soil Sci. 160: 497-503.
Müller-Lupp W (2002) Freeze and Thaw in Siberian Permafrost Soils - Methods and Ecological
Relevance. Reports on Polar and Marine Research 415: p. 145.
Nadeau MJ, Grootes PM, Schleicher M et al. (1998) Sample throughput and data quality at the
Leibniz-Labor AMS facility. Radiocarbon, 40, 239-245.
Nadeau MJ, Schleicher M, Grootes PM et al. (1997) The Leibniz-Labor facility at the Christian Albrecht
University, Kiel, Germany. Nuclear Instruments and Methods in Physics Research, 123, 22-30.
Nakano T, Kuniyoshi S and Fukuda M (2000) Temporal variation in methane emission from tundra
wetlands in a permafrost area, northeastern Siberia. Atmos. Environ. 34: 1205-1213.
Nichols PD, Guckert JB, White DC (1986) Determination of monounsaturated fatty acid double-bond
position and geometry for microbial monocultures and complex consortia by capillary GC-MS of
their dimethyl disulphide adducts. Journal of Microbiological Methods, 5, 49-55.
NSIDC (2003) Circumpolar Active-Layer Permafrost System, CD-ROM, National Snow and Ice Data
Center, University of Colorado, Boulder, Colorado, USA.
Nykänen H, Alm J, Silvola J, Tolonen K and Martikainen PJ (1998) Methane fluxes on boreal
peatlands of different fertility and the effect of long-term experimental lowering of the water table
on flux rates. Global Biogeochem. Cycles 12: 53-69.
Oberbauer SF, Starr G, Pop EW (1998) Effects of extended growing and soil warming on carbon
dioxide and methane exchange of tussock tundra in Alaska. Journal of Geophysical Research
103: 29,075-29,082.
Oechel WC, Hastings SJ, Jenkins M, Riechers G, Grulke NE and Vourlitis GL (1993) Recent change
of arctic tundra ecosystems from a net carbon sink to a source. Nature. 361: 520-526.
Oechel WC, Callaghan T, Gilmanov T et al. (1997) Global change and Arctic terrestrial ecosystems.
Ecological Studies 124, Springer, Berlin, 493 pp.
Omelchenko MV, Vasilyeva LV, Zavarzin GA (1993) Psychrophilic methanotrophs from tundra soils.
Current Microbiology 27: 255-259.
Osterkamp TE (2001) Subsea Permafrost. Chapter in: Steele, J.H., Thorpe, S.A. and Turekian, K.K.
(Editors). Encyclopedia of Ocean Sciences, p. 2902-2912, Academic Press.
OstroumovV (1995) A physical and chemical characterization of Martian permafrost as possible
habitat for viable organisms, Adv. Space Res. 15/3, 229-236.
Ostroumov V, Siegert C (1996) Exobiological aspects of mass transfer in microzones of permafrost
deposits. Advances in Space Research, 18, 79-86.
Overduin PP and Young KL (1997) The effect of freezing on soil moisture and nutrient distribution at
Levinson-Lessing Lake, Taymyr Peninsula, Siberia. p. 237-333. In: Iskandar IK, Wright EA, Radke
JK, Sharratt BS, Groenevelt PH and Hinzman LD (ed) International Symposium on Physics,
Chemistry, and Ecology of Seasonally Frozen Soils. Special Report 97-10. Fairbanks, Alaska.
229
9 References
Methane Cycle in Permafrost Ecosystems
Panikov NS, Belyaev AS, Semenov AM & Zelenev VV (1993) Methane production and uptake in some
terrestrial ecosystems of the former USSR. In: Oremland, R.S. (Ed.). Biogeochemistry of Global
Change, Chapman & Hall Inc., 221-244.
Panikov NS (1997) A kinetic approach to microbial ecology in arctic and boreal ecosystems in relation
to global change. In Global Change and Arctic Terrestrial Ecosystems, Oechel WC (ed). Springer:
Berlin; 171-188.
Panikov NS, Dedysh SN (2000) Cold season CH4 and CO2 emission from boreal peat bogs (West
Siberia) winter fluxes and thaw activation dynamics. Global Biogeochemical Cycles 14: 10711080.
Panikov NS, Dedysh SN, Kolesnikov OM, Mardini AI, Sizova MV (2001), Metabolic and environmental
control on methane emission from soils: mechanistic studies of mesotrophic fen in West Siberia,
Water, Air, & Soil Pollution: Focus, 1(5-6), 415-428, doi:10.1023/A:1013153927194.
Pernthaler J, Gloeckner FO, Schoenhuber W and Amann R (2001) Fluorescence in situ hybridization
(FISH) with rRNA-targeted oligonucleotide probes. Methods in Microbiology: Marine Microbiology,
30, 207-226.
Pfeiffer EM, Wagner D, Becker H, Vlasenko A, Kutzbach L, Boike J, Quass W, Kloss W, Schulz B,
Kurchatova A, Pozdnyakov VI, Akhmadeeva I (2000) Modern processes in permafrost affected
soils. In Russian-German Cooperation System Laptev Sea 2000: The Expedition Lena 1999,
Rachold V, Grigoriev MN (eds). Reports on Polar Research 354; 22-54.
Pfeiffer EM and MN Grigoriev (2002) Russian-German cooperation system Laptev Sea 2000: The
expedition LENA 2001. Reports on Polar Research 426: 21-41.
Pfeiffer EM, D Wagner, S Kobabe, Kutzbach L, Kurchatova AN, Stoof G, Wille C 760 (2002) Modern
processes in permafrost affected soils, in Russian-German Cooperation SYSTEM LAPTEV SEA
2000, The Expedition LENA 2001, Reports on Polar Research 426, edited by Pfeiffer EM and
Grigoriev MN, 21-41, Alfred-Wegener-Institute, Bremerhaven, Germany.
Popp TJ, Chanton JP, Whiting GJ and Grant N (2000) Evaluation of methane oxidation in the
rhizosphere of a Carex dominated fen in north central Alberta, Canada. Biogeochemistry 51:
259-281.
Post WM, Emanuel WR, Zinke PJ and Stangenberger AG (1982) Soil carbon pools and world life
zones. Nature, 298, 156-159, doi:10.1038/298156a0.
Rachold V and Grigoriev MN (1999) Russian-German cooperation system Laptev Sea 2000: The Lena
delta 1998 expedition. Reports on Polar Research 315: 1-259.
Rachold V and Grigoriev MN (2000) Russian-German cooperation system Laptev Sea 2000: The
expedition LENA 1999. Reports on Polar Research 354: pp. 303.
Rachold V and Grigoriev MN (2001) Russian-German cooperation system Laptev Sea 2000: The
expedition Lena 2000. Reports on Polar Research 388: pp. 135.
Rachold V, Grigoriev MN, Are FE et al. (2000) Coastal erosion vs riverine sediment discharge in the
Arctic Shelf seas. International Journal of Earth Sciences, 89, 450-460.
Ramakrishnan B, Lueders T, Dunfield PF, Conrad R and Friedrich MW (2001) Archaeal community
structures in rice soils from different geographical regions before and after initiation of methane
production, FEMS Microbiol Ecol 37: 175-186.
Ratledge C and Wilkinson SG eds. (1988) Microbial Lipids, Vol 1. London: Academic Press.
Reeburgh WS, King JY, Regli SK, Kling GW, Auerbach NA, Walker DA (1998) A CH4 emission
estimate for the Kuparuk River basin, Alaska. Journal of Geophysical Research 103: 29,00529,013.
Rees WG, Williams M & Vitebsky P (2003) Mapping land cover change in a reindeer herding area of
the Russian Arctic using LANDSAT TM and ETM+ imagery and indigenous knowledge. Remote
Sensing of Environment, 85, 441-452.
Richards JA & Jia X (1999) Remote sensing digital image analysis. An Introduction, 3.Edt., Springer,
Berlin, Heidelberg, New York, 363.
Richardson JL, Arndt JL and Montgomery JA (2001) Hydrology of wetland and related soils. p. 35-84.
In Richardson JL and Vepraskas MJ (ed.) Wetland soils. Genesis, hydrology, landscape and
classification. Lewis Publishers. Boca Raton, London, New York, Washington D.C.
Richter-Menge J, Overland J, Proshutinsky A et al. (2006) State of the Arctic Report. NOAA OAR
Special Report, NOAA/OAR/PMEL, Seattle, WA, 36 pp.
Rieger S (1983) The genesis and classification of cold soils. New York: Academic Press. 230p.
Ringelberg DB, Sutton S, White DC (1997) Biomass, bioactivity and biodiversity: microbial ecology of
the deep subsurface: analysis of ester-linked phospholipid fatty acids. FEMS Microbiology
Reviews, 20, 371-377.
Rivkina EM, Gilichinsky DA (1996) Methane as a paleoindicator of the dynamics of permafrost
deposits. Limnology and Mineral Resources, 31, 396-399.
230
Methane Cycle in Permafrost Ecosystems
9 References
Rivkina EM, Gilichinsky D, Wagener S et al. (1998) Biochemical activity of anaerobic microorganisms
from buried permafrost sediments. Geomicrobiology, 15, 187-193.
Rivkina EM, Friedmann EI, McKay CP et al. (2000) Metabolic activity of permafrost bacteria below the
freezing point. Applied Environmental Microbiolology, 66, 3230-3233.
Rivkina E, Laurinavichius K, McGrath J, Tiedje J, Shcherbakova V, Gilichinsky D (2004) Microbial life
in permafrost, Advances in Space Research, 33(8), 770, 1215-1221, doi:10.1016/j. asr. 2003.06.
024.
Romanovskii NN, Hubberten HW (2001) Results of permafrost modelling of the lowlands and shelf of
the Laptev Sea region, Russia. Permafrost and Periglacial Processes. 12: 191-202.
ROSHYDROMET, Russian Federal Service for Hydrometeorology and Environmental Monitoring
(2004), Weather Information for Tiksi, http://www.worldweather.org/107/c01040.htm World
Meteorological Organization.
Roslev P and King GM (1996) Regulation of methane oxidation in a freshwater wetland by water table
changes and anoxia. FEMS Microbiology Ecology, 19, 105-115.
Rothschild LJ and Mancinelli RL (2001) Life in extreme environments. Nature 409, 1092-1101
Roulet NT Jano A, Kelly CA, Klinger LF, Moore TR, Protz R, Ritter JA and Rouse WR (1994) Role of
the Hudson bay lowland as a source of atmospheric methane. J. Geophys. Res. 99 (D1): 14351454.
Roura-Carol M and Freeman C (1999) Methane release from peat soils: effects of Sphagnum and
Juncus. Soil Biol. Biochem. 31: 323-325.
Russel NJ, Hamamoto T (1998) Psychrophiles. In: Extremophiles: microbial life in extreme
environments (eds Horikoshi K, Grant WD), pp. 25-45, J. Wiley, New York.
Samarkin VA, Fedorov-Davydov DG, Vecherskaya MS, Rivkina EM (1994) CO2 and CH4 emissions on
cryosols and subsoil permafrost and possible global climate changes In Soil processes and
greenhouse effect, Lal R, Kimble JM, Levine E (eds) USDA Soil Conservation Service, National
Soil Survey Center, Lincoln, NE; 55-71.
Samarkin VA, Gundelwein A and Pfeiffer EM (1999) Studies of methane production and emission in
relation to the microrelief of a polygonal tundra in northern Siberia. In Kassens H, Bauch HA,
Dmitrenko IA, et al. (Eds) Land-Ocean Systems in the Siberian Arctic, Dynamics and History
(pp 329-342). Springer, Berlin.
Schachtschabel P, Blume HP, Brümmer, Hartge KH and Schwertmann U (1998) Scheffer/
Schachtschabel - Lehrbuch der Bodenkunde. Enke, Stuttgart
Schimel JP (1995) Plant transport and methane production as controls on methane flux from arctic wet
meadow tundra. Biogeochemistry 28: 183-200.
Schimel JP, Gulledge J (1998) Microbial community structure and global trace gases. Global Change
Biology 4: 745-758.
Schink B and Zeikus JG (1982) Microbial ecology of pectin decomposition in anoxic lake sediments.
J. General Microb. 128: 393-404.
Schirrmeister L, Grosse G, Schwamborn G, Andreev AA, Meyer H, Kunitsky VV, Kuznetsova TV,
Dorozhkina MV, Pavlova EY, Bobrov AA, Oezen D (2003) Late Quaternary History of the
Accumulation Plain North of the Chekanovsky Ridge (Lena Delta, Russia): A Multidisciplinary
Approach. Polar Geography, 27 (4), 277-319.
Schirrmeister L and Wagner D (2007) Russian-German Cooperation System Laptev Sea 2000: The
Expedition LENA 2005. Reports on Polar and Marine Research (in press).
Schirrmeister L, Grigoriev MN, Kutzbach L, Wagner D and Bolshiyanov DYu (2004) Russian-German
Cooperation System Laptev Sea 2000: The Expedition Lena-Anabar 2003. Reports on Polar and
Marine Research 489, pp.331.
Schlichting E (1973) Pseudogleye und Gleye - Genese und Nutzung hydromorpher Böden. p. 1-6. In
Schlichting E and Schwertmann U (ed.) Pseudogley & Gley. Trans. Comm. V and VI Int. Soc. Soil
Sci., Verlag Chemie, Weinheim.
Schlichting E, Blume HP and Stahr K (1995) Bodenkundliches Praktikum - Pareys Studientexte 81.
Blackwell Wissenschaftsverlag, Berlin.
Schneider J (2005) Bilanzierung von Methanemissionen in Tundrengebieten am Beispiel des LenaDeltas, Nordostsibirien, auf der Basis von Fernerkundungsdaten und Geländeuntersuchungen.
Diploma thesis, TU Dresden.
Schneider J, Grosse G, Kutzbach L and Wagner D (2006) Land cover classification of tundra
environments in the arctic Lena Delta based on Landsat 7 ETM+ data and its application for
upscaling of methane emissions, Proceedings the Globwetland Symposium - Looking at wetlands
from Space, 19-20 October 2006, Frascati, Italy.
Schoeneberger PJ, Wysocki DA, Benham EC and Broderson WD (1998) Field book for describing and
sampling soils. Natural Recources Conservation Service, USDA, National Soil Survey Center,
Lincoln.
231
9 References
Methane Cycle in Permafrost Ecosystems
Schuepp PH, Leclerc MY, MacPherson JI, Desjardins RL (1990) Footprint prediction of scalar fluxes
from analytical solutions of the diffusion equation, Boundary-Layer Meteorology, 50 (1-4), 355373, doi:10.1007/BF00120530.
Schüller H (1969) Die CAL-Methode, eine neue Methode zur Bestimmung des pflanzenverfügbaren
Phosphates in Böden. Z. Pflanzenernaehr. Bodenkd. 123: 48-63.
Schütz H, Schröder P and Rennenberg H (1991) Role of plants in regulating the methane flux to the
atmosphere. In: Sharkey TD, Holland EA & Mooney HA (Eds) Trace Gas Emissions by Plants (pp
29-63). Academic Press, San Diego.
Schwamborn G, Rachold V, Grigoriev MN (2002) Late quaternary sedimentation history of the Lena
Delta. Quaternary International 89: 119-134.
Schwertmann U (1964) Differenzierung der Eisenoxide durch Extraktion mit Ammoniumoxalat-Lösung.
Z. Pflanzenernaehr. Bodenkd. 101: 194-202.
Sears DWG, Benoit PH, McKeever SWS, Banerjee D, Kral T, Stites W, Roe L, Jansma P, Mattioli G
(2002) Investigation of biological, chemical and physical processes on and in planetary surfaces
by laboratory simulation, Planetary and Space Science 50, 821-828.
Sebacher DJ, Harriss RC and Bartlett KB (1985) Methane emissions to the atmosphere through
aquatic plants. J. Environ. Qual. 14: 39-46.
Segers R (1998) Methane production and methane consumption: a review of processes underlying
wetland methane fluxes. Biogeochemistry 41: 23-51.
Seibt A, Hoth P and Naumann D (2000) Gas solubility in formation waters of the North German Basin implications for geothermal energy recovery. In: Proceedings World Geothermal Congress 2000
Kyushu-Tohoku Japan May 28 - June 10 2000 (pp 1713-1718). International Geothermal
Association IGA, Pisa, Italy.
Semiletov IP, Pipko II, Pivovarov NYa, Popov VV, Zimov SA, Voropaev YuV & Daviodov SP (1996)
Atmospheric carbon emission from north Asian lakes: a factor of global significance. Atmospheric
Environment, 30 (10/11), 1657-1671.
Senesi N, Miano TM, Provenzano MR et al. (1989) Spectroscopic and compositional comparative
characterization of I.H.S.S reference and standard fulvic and humic acids of various origin. Sci
Total Environ, 81/82, 143-156.
Serreze MC, Walsh JE, Chapin III, Osterkamp FS, Dyurgerov T, Romanovsky M, Oechel V, Morison
WC, Zhang J, T and Barry RG (2000) Observational evidence of recent change in the northern
high-latitude environment. Climatic Change, 46, 159-206.
Sherer P, Lippert H and Wolff G (1983) Composition of the major elements and trace elements of 10
methanogenic bacteria determined by inductively coupled plasma emission spectrometry. J Biol
Trace Elem Res 5: 149-163.
Shi T, Reevers R, Gilichinsky D et al. (1997) Characterization of viable bacteria from Siberian
permafrost by 16S rDNA sequencing. Microbial Ecology, 33, 167-179.
Shuisong N and Boone D (1998) Extremophilic methanogenic archaea and their adaptation
mechanisms. Extremophiles: Microbial Life in Extreme Environments: 211-232.
Slobodkin AI, Panikov NS, Zavarzin GA (1992) Formation and uptake of methane in tundra and boreal
wetlands. Microbiology 61: 683-691.
Simankova MV, Kotsyurbenko OR, Lueders T, Nozhevnikova AN, Wagner B, Conrad R and Friedrich
MW (2003) Isolation and characterization of new strains of methanogens from cold terrestrial
habitats. Syst Appl Microbiol 26: 312-318.
Smith J, Stone R and Fahrenkamp-Uppenbrink J (2002) Trouble in polar paradise: Polar science
(Introduction). Science 297: 1489.
Smith LC, MacDonald GM, Velichko AA, Beilman WD, Borisova OK, Frey KE, Kremenetski KV, Sheng
Y (2004) Siberian peatlands: a net carbon sink and global methane source since the early
Holocene. Science 303: 353-356.
Soil Survey Staff, Soil Conservation Service, USDA (1998) Keys to Soil Taxonomy 8th Edition.
Pocahontas, Blacksburg, Virginia.
Soil Survey Staff (1999) Soil Taxonomy - a basic system of soil classification for making and
interpreting soil surveys, 2nd ed., 869 pp., US Government printing Office, Washington D.C.
Sommer M and Schlichting E (1997) Archetypes of catenas in respect to matter - a concept for
structuring and grouping catenas. Geoderma 76: 1-33.
Sommer M, Thies H, Kolb E; Bächle H and Stahr K (1997) Biogeochemistry of a cirque-lake
landscape: An interdisciplinary study in a catchment of the northern Black Forest, Germany. Water
Resour. Res. 33: 2129-2142.
Sorrel BK and Boon PI (1994) Convective gas flow in Eleocharis sphacelata R.Br.: methane transport
and release from wetlands. Aquat. Bot. 47: 197-212.
Spirina EV and Fedorov-Davydov DG (1998) Microbiological characterization of cryogenic soils in the
Kolymskaya Lowland. Eurasian Soil Sci 31: 1331-1344.
232
Methane Cycle in Permafrost Ecosystems
9 References
Spott O (2003) Frostmusterbedingte Seen der Polygonalen Tundra und ihre Funktion als Quellen
atmospärischen Methans, Diploma Thesis, 125 pp., University of Leipzig, Leipzig, Germany.
Stamatakis A, Ludwig T and Meier H (2005) RAxML-III: A fast program for maximum likelihood-based
inferrence of large phylogenetic trees. Bioinformatic 21: 456-463.
Stein LY, La Duc MT, Grundl TJ and Nealson KH (2001) Bacterial and archaeal populations
associated with freshwater ferromanganous micronodules and sediments. Environ Microbiol 3: 1018.
Stein LY, Jones G, Alexander B, Elmund K, Wright-Jones C and Nealson KH (2002) Intriguing
microbial diversity associated with metal-rich particles from a freshwater reservoir. FEMS
Microbiol Ecol 42: 431-440.
Steinwald AL and Richardson JL (1989) Gypsum occurrence in soils on the margin of semi permanent
prairie pothole wetlands. Soil Sci. Soc. Am. J. 53: 836-842.
Stetter KO, Fiala G, Huber G, Huber R and Segerer A (1990) Hyperthermophilic microorganisms.
FEMS Microbiol Rev 75: 117-124.
Steudler PA, Jones RD, Castro MS, Melillo JM and Lewis DL (1996) Microbial controls on methane
oxidation in temperate forest and agricultural soils. In Microbiology of atmospheric trace gases.
Murrell JC and Kelly DP (eds) Berlin: Springer, pp. 69-81.
Story M & Congalton RG (1986) Accuracy assessment: A user’s perspective. Photogrammetric
Engineering and Remote Sensing, 52 (6), 835-841.
Stotzky G (1966) Influence of clay minerals on microorganisms. III. Effect of particle size, cation
exchange capacity and surface area on bacteria. Canadian Journal of Microbiology, 12, 12351246
Stow D, Hope A, Boynton W, Phinn S, Walker D & Auerbach N (1998) Satellite-derived vegetation
index and cover type maps for estimating carbon dioxide flux for arctic tundra regions.
Geomorphology, 21, 313-327.
Ström L, Ekberg A, Mastepanov M and Christensen TB (2003) The effect of vascular plants on carbon
turnover and methane emissions from a tundra wetland. Global Change Biol 9: 1185-1192.
Stuiver M, Reimer PJ, Braziunas TF (1998) High-precision radiocarbon age calibration for terrestrial
and marine samples. Radiocarbon, 40, 1127-1151.
Sundh I, Nilsson M and Borgå P (1997) Variation in microbial community structure in two boreal
peatlands as determined by analysis of phospholipid fatty acid profiles. Appl Environ Microbiol 63:
1476-1482.
Suyker AE, Verma SB, Clement RJ, Billesbach DP (1996) Methane flux in a boreal fen: Season-long
measurement by eddy correlation, J. Geophys. Res., 101(D22), 28637-28648,
doi:10.1029/96JD02751.
Svensson BH and Rosswall T (1984) In situ methane production from acid peat in plant communities
with different moisture regimes in a subarctic mire. Oikos 43: 341-350.
Takeuchi W, Tamura M & Yasuoka Y (2003) Estimation of methane emission from West Siberian
wetland by scaling technique between NOAA AVHRR and SPOT HRV. Remote Sensing of
Environment, 85, 21-29.
Tarnocai C and SC Zoltai (1978) Earth hummocks of the Canadian arctic and subarctic. Arct. Alp. Res.
10: 581-594.
Tedrow JCF, Drew JV and Douglas LA (1958) Major genetic soils of the Arctic Slope of Alaska. J. Soil
Sci. 9: 33-45.
Tedrow JCF (1977) Soils of the polar landscapes. Rutgers University Press, New Brunswick, New
Jersey.
Thomas KL, Benstead J, Davies KL and Lloyd D (1996) Role of wetland plants in the diurnal control of
CH4 and CO2 fluxes in peat. Soil Biol. Biochem. 28: 17-23.
Thomsson E, Gustafsson L and Larsson C (2005) Starvation response of Saccharomyces cerevisiae
grown in anaerobic nitrogen- or carbon-limited chemostat cultures. Appl Environ Microbiol 71/6:
3007-3013.
Torn MS and Chapin FS (1993) Environmental and biotic controls over methane flux from arctic
tundra. Chemosphere 26: 357-368.
Tornbjerg T, Bendix M and Brix H (1994) Internal gas transport in Typha latifolia L. and Typha
angustifolia L. 2. Convective throughflow pathways and ecological significance. Aquat. Bot. 49: 91105.
Traina SJ, Novak J and Smeck NE (1990) An ultraviolet absorbance method for estimating the percent
aromatic carbon content of humic acids. J. Environ. Qual. 19: 151-153.
Trotsenko YA and Khmelenina VN (2005) Aerobic methanotrophic bacteria of cold ecosystems. FEMS
Microbiology Ecology, 53, 15-26.
Tsuyuzaki S, Nakano T, Kuniyoshi S and Fukuda M (2001) Methane flux in grassy marshlands near
Kolyma River, north-eastern Siberia. Soil Biol. Biochem. 33: 1419-1423.
233
9 References
Methane Cycle in Permafrost Ecosystems
Tung HC, Bramall NE and Price PB (2005) Microbial origin of excess methane in glacial ice and
implications for life on Mars, PNAS 102 (in press).
Valentine DW, Holland EA and Schimel DS (1993) Ecological controls over methane and carbon
dioxide fluxes along a successional gradient. J Geophys Res 99: 1563-1571.
Van Bodegom P, Stams F, Mollema L, Boeke S, Leffelaar P (2001) Methane oxidation and the
competition for oxygen in the rice rhizosphere. Applied and Environmental Microbiology 67: 35863597.
Van der Nat FJWA and Middelburg JJ (1998) Seasonal variation in methane oxidation by the
rhizosphere of Phragmites australis and Scirpus lacustris. Aquat. Bot. 61(2): 95-110.
Van Huissteden J, Maximov TC, Dolman AJ (2005) High methane flux from an arctic floodplain
(Indigirka Lowlands, eastern Siberia), J. Geophys. Res., 110, G02002, doi: 10.1029/
2005JG000010.
Van Vliet-Lanoё B (1991) Differential frost heave, load casting and convection: converging
mechanisms; a discussion of the origin of cryoturbations. Permafrost Periglac Process. 2:123-139.
Vecherskaya MS, Galchenko VF, Sokolova EN, Samarkin VA (1993) Activity and species composition
of aerobic methanotrophic communities in tundra soils. Current Microbiology 27: 181-184.
Vepraskas MJ and SP Faulkner (2001) Redox chemistry of hydric soils. p. 85-105. In Richardson JL
and Vepraskas MJ (ed.) Wetland soils. Genesis, hydrology, landscape and classification. Lewis
Publishers. Boca Raton, London, New York, Washington D.C.
Verville JH, Hobbie SE, Chapin III FS, Hooper DU (1998) Response of tundra CH4 and CO2 flux to
manipulation of temperature and vegetation. Biogeochemistry 41: 215-235.
Virtanen T, Mikkola K & Nikula A (2004) Satellite image based vegetation classification of a large area
using limited ground reference data: a case study in the Usa Basin, north-east European Russia.
Polar Research, 23 (1), 51-66.
Vishnivetskaya T, Kathariou S, McGrath J, Gilichinsky D and Tiedje J (2000) Low-temperature
recovery strategies for the isolation of bacteria from ancient permafrost sediments. Extremophiles
4: 165-173.
Von Zezschwitz E, Schwertmann U and Ulrich B (1973) Die Podsolierungsstadien von Braunerden
aus Schieferschutt. Z. Pflanzenernähr. Bodenkd. 136: 40-52.
Vorobyova EA, Gilichinsky DA, Sonina VS et al. (1998), Antarctic permafrost as microbial habitat, in
Lake Vostok Study: Scientific Objectieves and Technological Requirements, International
Workshop , March 24-26, St. Petersburg, Russia, p.97.
Vourlitis GL, Oechel WC, Hastings SJ, Jenkins MA (1993) The effect of soil moisture and thaw depth
on CH4 flux from wet coastal tundra ecosystems on the north slope of Alaska. Chemosphere
26: 329-337.
Wachinger G, Fiedler S, Zepp K, Gattinger A, Sommer M and Roth K (2000) Variability of soil methane
production on the micro-scale: spatial association with hot spots of organic material and archaeal
populations. Soil Biol & Biochem 32: 1121-1130.
Waddington JM, Roulet NT and Swanson RV (1996) Water table control of CH4 emission
enhancement by vascular plants in boreal peatlands. J. Geophys. Res. 101: 22775-22785.
Wagner D and Pfeiffer EM (1997) Two temperature optima of methane production in a typical soil of
the Elbe river marshland. FEMS Microbiol Ecol 22: 145-153.
Wagner D, Pfeiffer EM and Bock E (1999) Methane production in aerated marshland and model soils:
effects of microflora and soil texture. Soil Biology and Biochemistry 31: 999-1006.
Wagner D, Kurchatova A and Stoff G (2001a) Modern processes in permafrost affected soils. p. 1623. In Rachold V and Grigoriev MN (ed.) Russian-German Cooperation System Laptev Sea 2000.
The Expedition LENA 2000. Reports on Polar Research 388.
Wagner D, Spieck E, Bock E and Pfeiffer EM (2001b) Microbial life in terrestrial permafrost:
methanogenesis and nitrification in Gelisols as potentials for exobiological processes. p.143-159.
In Horneck G and Baumstark-Khan C (ed.) Astrobiology: The quest for the conditions of life.
Springer. Berlin, Heidelberg, New York.
Wagner D, Kobabe S, Pfeiffer EM et al. (2003a) Microbial controls on methane fluxes from a polygonal
tundra of the Lena Delta, Siberia. Permafrost Periglac Process 14, 173-185.
Wagner D, Wille C, Kobabe S et al. (2003b) Simulation of freezing-thawing cycles in a permafrost
microcosm for assessing microbial methane production under extreme conditions. Permafrost and
Periglacial Processes, 14, 367-374.
Wagner D, Lipski A, Embacher A, Gattinger A (2005) Methane fluxes in permafrost habitats of the
Lena Delta: effects of microbial community structure and organic matter quality. Environ Microbiol
7: 1582-1592.
Wagner D, Gattinger A, Embacher A, Pfeiffer EM, Schloter M, Lipski A (2006) Methanogenic activity
and biomass in Holocene permafrost deposits of the Lena Delta, Siberian Arctic and its implication
for the global methane budget, Global Change Biology (submitted).
234
Methane Cycle in Permafrost Ecosystems
9 References
Wagner D. and Bolshiyanov D. (2006) Russian-German Cooperation System Laptev Sea 2000: The
Expedition LENA 2004. Reports on Polar and Marine Research 539, pp.123.
Wagner D., Kobabe S., Kurchatova A., Ganzert L., Zimmermann U., Morozova D., Liebner S., Joseph
J. and Pfeiffer E.-M. (in prep.) Spatial and temporal variations of methane fluxes from polygonal
tundra of the Lena Delta, Siberia: a eight-year study.
Wallner G, Amann R and Beisker W (1993) Optimizing fluorescent in situ hybridization with rRNAtargeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry,
14, 136-143.
Walter BP, Heimann M, Shannon RD and White JR (1996) A processed-based model to derive
methane emissions from natural wetlands. Geophysical Research Letters, 23(25), 3731-3734.
Walter BP and Heimann M (2000) A processed-based, climate-sensitive model to drive methane
emissions from natural wetlands: Applications to five wetland sites, sensitivity to model
parameters, and climate. Global Biochemical Cycles, 14(3), 745-765.
Wardlaw AC (1985) Practical statistics for experimental biologists. John Wiley and Sons, Chichester.
Washburn A L (1979) Geocryology, A Survey of Periglacial Processes and Environments, 406 pp.,
Arnold, London, UK.
Watanabe T, Asakawa S, Nakamura A, Nagaoka K and Kimura M (2004) DGGE method for analyzing
16S rDNA of methanogenic archaeal community in paddy field soil. FEMS Microbiol Lett 232:
153-163.
Wein N (1999) Sibirien. Perthes Regionalprofile. Gotha: Klett-Perthes. 248p.
Weinberg MV, Schut GJ, Brehm S, Datta S and Adams MWW (2005) Cold shock of a
hypertharmophilic archaeon: Pyrococcus furiosus exhibit multiple responses to a suboptimal
growth temperature with a key role of membrane-bound glycoproteins. J Bacteriol 187(1): 336348.
Whalen SC, Reeburgh WS (1988) A methane flux time series for tundra environments. Global
Biogeochemical Cycles 2 (4): 399-409.
Whalen SC & Reeburgh WS (1990) A methane flux transect along the trans-Alaska pipeline haul road.
Tellus, 42 (B), 237-249.
Whalen SC and Reeburgh WS (1992) Interannual variations in tundra methane emission: A 4-year
time series at fixed sites, Global Biogeochemical Cycles, 6(2) 139-159.
Whalen SC, Reeburgh WS and Reimers CE (1996) Control of tundra methane emission by microbial
oxidation. In: Reynolds JF and Tenhunen JD (Eds) Landscape function and disturbance in Arctic
tundra, Ecological Studies 120 (pp 257-274) Springer, Berlin, Germany.
Wharton Jr RA, McKay CP, Mancinelli RL and Simmons Jr GM (1989) Early Martian environments: the
Antarctic and other terrestrial analogs. Adv Space Res 9/6: 147-153.
White DC, Davis WM, Nickels JS et al. (1979) Determination of the sedimentary microbial biomass by
extractible lipid phosphate. Oecologia, 40, 51-62].
Whiting GJ and Chanton JP (1992) Plant-dependent CH4-emission in a subarctic Canadian fen. Global
Biogeochem. Cycles 9: 225-231.
Whittig LD and Janitzky P (1963) Mechanisms of formation of sodium carbonate in soils
I. manifestations of biologic conversions. J. Soil Sci. 14: 322-333.
Wiegand CL, Lyles L and Cater DL (1966) Interspersed salt-effected and unaffected dryland soils of
the lower Rio Grande Valley: II. Occurrence of salinity in relation to infiltration rates and profile
characteristics. Soil Sci. Soc. Am. Proc.
Wille C (2004) Air photography and surface classification of Samoylov Island, in Expeditions in Siberia
in 2003, Reports on Polar and Marine Research 489, edited by L. Schirrmeister, 39-40, AlfredWegener-Institute, Bremerhaven, Germany.
Wise MG, McArthur JV and Shimkets LJ (2001) Methylosarcina fibrata gen. nov., sp. Nov. and
Methylosarcina quisquiliarum sp. Nov., novel type I methanotrophs. Int J Syst Bacteriol 51:
611-621.
Worthy DEJ, Levin I, Hopper F, Ernst MK &. Trivett NBA (2000) Evidence for a link between climate
and northern wetland methane emissions. Journal of Geophysical Research, 105 (D3), 40314038.
Wouters JA, Frenkiel H, de Vos WM, Kuipers OP and Abee T (2001) Cold shock proteins of
Lactococcus lactus MG1363 are involved in cryoprotection and in the production of cold-induced
proteins. Appl Environ Microbiol 67(11): 5171-5178.
Wuebbles J and Hayhoe K (2002) Atmospheric methane and global change. Earth-Science Reviews,
57, 177-210.
WWIS (2004). World Weather Information Service, http://worldweather.org/107/c01040.html.
Yamamoto S, Alcauskas JB and Crozier TE (1976) Solubility of methane in distilled water and
seawater J. Chem. Eng. Data 21(1) 78-80.
235
9 References
Methane Cycle in Permafrost Ecosystems
Yavitt JB, Williams CJ, Wieder RK (2000) Controls on microbial production of methane and carbon
dioxide in three Sphagnum-dominated peatland ecosystems as revealed by a reciprocal field peat
transplant experiment. Geomicrobiological Journal 17: 61-88.
Yershov ED (1998) General geochryology. Cambridge University Press, Cambridge, pp. 580.
Zarda B, Hahn D, Chatzinotas A, Schoenhuber W, Neef A, Amann R and Zeyer J (1997) Analysis of
bacterial community structure in bulk soil by in situ hybridization. Archives of Microbiology, 168,
185-192.
Zelles L, Bai QY (1993) Fractionation of fatty acids derived from soil lipids by solid phase extraction
and their quantitative analysis by GC-MS. Soil Biology and Biochemistry, 25, 495-507.
Zelles L and Bai QY (1994) Fatty acid patterns of phospholipids and lipopolysaccharids in
environmental samples. Chemosphere 28: 391-411.
Zelles L (1997) Phospholipid fatty acid profiles in selected members of soil microbial communities.
Chemosphere 35: 275-294.
Zelles L (1999) Fatty acid patterns of phospholipids and lipopolysaccharides in the characterisation of
microbial communities in soil: a review. Biology and Fertility of Soils, 29, 111-129.
Zhang T, Barry RG, Knowles K, Heginbotton JA and Brown J (1999) Statistics and characteristics of
permafrost and ground-ice distribution in the northern hemisphere. Polar Geography, 23(2), 132154.
Zhang W, Culley DE, Nie L and Brockman FJ (2006) DNA microarray analysis of anaerobic
Methanosarcina barkeri reveals responses to heat shock and air exposure. J Ind Microbiol
Biotechnol DOI 10.1007/s10295-006-0114-3.
Zimov SA, Voropaev YV, Semiletov IP, Davidov SP, Prosiannikov SF, Chapin III FS, Chapin MC,
Trumbore S & Tyler S (1997) North Siberian lakes: a methane source fueled by Pleistocene
carbon. Science, 277, 800-802.
Zimov SA, Schuur EAG and Chapin III FS (2006) Permafrost and the global carbon budget. Science
312: 1612-1613.
Zsolnay A, Baigar E, Jiminez M et al. (1999) Differentiation with flourescence spectroscopy the
sources of dissolved organic carbon. Chemosphere, 38, 45-50.
Zsolnay A (2003) Dissolved organic matter: artefacts, definitions, and functions. Geoderma, 113, 187209.
236
Methane Cycle in Permafrost Ecosystems
Acknowledgements
Acknowledgements
My warmest thanks to Prof. Dr. Hans-Wolfgang Hubberten for the integration of
geomicrobiological investigations into the Periglacial Research section of the Alfred Wegener
Institute for Polar and Marine Research in Potsdam, for his confidence during the set-up of the
microbiological laboratories and for his boundless support of my scientific work throughout the
past few years. I am very grateful to Prof. Dr. Jörn Thiede for his support in the framework of the
Laptev Sea project and his benefit during the development of the research topic
“Geomicrobiology in Periglacial Regions”. I cordially thank Prof. Dr. Ingo Schneider for his
everlasting support of my teaching as well as his advice on the writing of this thesis and all other
terribly official tasks. I am deeply grateful to Prof. Dr. Eva-Maria Pfeiffer for her cordial friendship
during long years of joint methane research and for her efforts in bringing me closer to permafrost
soils. I am also grateful to Prof. Dr. Eberhard Bock for the hospitality that he granted me in
Hamburg during the first two years of my permafrost research.
This work is based upon permafrost samples, which were frequently obtained under difficult and
“extreme” conditions. Many of the studies would not have been possible without the grants of the
BMBF and the DFG. I thank all participants of the Lena Delta expeditions for their great
commitment to sample collection and transport. Particularly, I appreciate Dr. Dimitry Bolshiyanov,
Dr. Svenja Kobabe, Dr. Anna Kurchatova, Dr. Lars Kutzbach, Dr. Volker Rachold, Dr. Lutz
Schirrmeister, Waldemar Schneider and Günter “Molo” Stoof.
The numerous expeditions would not have been possible without the help and support of all my
colleagues and friends in Moscow, St. Petersburg, Yakutsk and Tiksi. I appreciate Dr. Ekatarina
Abramova, Viktor Dobrobaba, Dr. Alexander Gukov and Dimitri Melnitschenko, and all the people
from Tiksi. I am very grateful to Alexander Dereviagin (best taxi driver) and his wife Ludmilla for
their warm welcome in Moscow and for making impossible things possible, and to Dr. Mikhail
Grigoriev (best Russian teacher), who welcomed me and my colleagues in Tiksi with a small but
wonderful dinner on the first evening on the other side of the polar circle.
My warmest thanks to the GEOMICs Heiko Baschek, Christine Flemming, Lars Ganzert,
Katharina Koch, Susanne Liebner, Daria Morozova and Christian Wille for their enthusiasm with
the establishment of new methods and to their eagerness to work, which is also reflected in some
of the publications included in this thesis.
I thank Prof. Dr. Dietrich Möhlmann and the whole team of simulators for an enjoyable time in the
HUMIDITY-Lab: Ralf Möller, Dr. Jelka Ondruschka, Prof. Dr. Sieglinde Ott, Dr. Petra Rettberg,
Ulrike Pogoda de la Vega and Dr. Roland Wernecke.
Several colleagues, many of whom coauthored papers in this thesis, are much appreciated. First
of all, I am very grateful to Dr. Andreas Gattinger, who beside all the science (MUFAs, PUFAs
etc.) became a friend to me. Next, I thank Dr. German Jurgens, the ARB master, from the most
Finnish working group I have ever heard from and Dr. Bernhard Diekmann for excellent
proofreading of the manuscript. Furthermore, I highly appreciate fruitful discussions with Dr. Julia
Boike, Prof. Dr. Rick Cavicchioli, Dr. Arndt Embacher, Dr. Sabine Fiedler, Dr. David Gilichinski,
Dr. Jens Harder, Prof. Dr. Ulrike Herzschuh, Conrad Kopsch, Dr. André Lipski, Dr. Hanno Meyer,
Leone Montonen, Dr. Uwe Münster, Dr. Paul Overduin, Dr. Elizaveta Rivkina, Dr. Michael
Schloter, Dr. Georg Schwamborn, Dr. Christine Siegert, Dr. Mark Skidmore, Dr. Eva Spieck, and
Uta Zimmermann.
Finally, I am grateful to Ute Bastian, Antje Eulenburg, Susanne Kopelke, Gerald Müller, Lutz
Schönecke and Arthur Zielke for analytical and technical support.
237
Appendix
Methane Cycle in Permafrost Ecosystems
Appendix
Correspondence for the Publications under Revision:
Global Change Biology (chapter 4.4)
Dear Dr. Wagner,
The above manuscript has now been reviewed and assessed by the appropriate Subject Editor. We are enclosing
copies of the referees’ comments, and the decision of the Subject Editor. We are happy to be able to inform you
that, on the basis of this advice, your manuscript will become acceptable for publication after you have dealt
with the points raised by the referees and the Subject Editor. When returning a revised manuscript, please
include a covering letter keyed to the referees’ comments indicating the changes you have made. This
manuscript will not be seen again by the Subject Editor, so we will appreciate your help in enabling us to assess
whether or not you have made the required changes.
We shall need the following when you return the MS – please check each item carefully:
Two copies of the final manuscript, including all graphic and artwork
•
•
•
•
A copy of the MS on CD, including all graphic and artwork (please do not use floppy disk)
A completed CD description form (enclosed)
A signed copyright release form (enclosed – we CANNOT publish without copyright release)
A formal statement that the work has not been published elsewhere.
In order to schedule publication efficiently, we impose a deadline of 45 days for the return of revised
manuscripts. Manuscripts returned after the deadline may be regarded as new submissions, with a new receipt
date, and may be subject to the full peer review process.
Global Change Biology uses photographs supplied by authors for the front cover of the journal. If you have any
candidate photographs for the cover, please include them for our consideration. Please also include a brief,
informative caption, with a photocredit, if required.
Thank you for submitting your interesting research to Global Climate Change.
Best regards,
Steve Long/Becky Heid
Chief Editor/Editorial Assistant
Global Change Biology
Department of Plant Biology
University of Illinois
190 Edward R. Madigan Laboratory
1201 West Gregory Drive
Urbana, IL61801-3838, USA
------------------------------------------------------------------------------------------------------------NEW! Impact factor
4.333
ISI Ranking 1/134 Environmental Science
FAX +1-217-244-7563
e-mail: [email protected]
Manuscript Number: GCB 06-381
Manuscript Full Title: Methanogenic activity and biomass in Holocene permafrost deposits of the Lena Delta,
Siberian Arctic and its implication for the global methane budget
Manuscript Authors: Wagner D, Gattinger A, Embacher A, Pfeiffer E-M, Schloter M and Lipski A
Subject Editor: Prentice
238
Appendix
Methane Cycle in Permafrost Ecosystems
Global Change Biology
Editorial Office:
MS#: 06-381
Department of Plant Biology
University of Illinois
1201 W. Gregory, Urbana, IL 61801
Email: [email protected]
Ref#: 1
This form will be sent to the authors
Title:
Methanogenic activity and biomass in Holocene permafrost deposits of the
Lena Delta, Siberian Arctic and its implication for the global methane budget
Authors:
Wagner D, Gattinger A, Embacher A, Pfeiffer E-M, Schloter M and Lipski A
Please indicate your assessment by checking the appropriate boxes:
Quality of the Science
Experimentally and/or theoretically excellent
reliable data, no flaws
Importance of the Science
Research of major significance on topic of
central importance; highly novel
X
Competent; no major flaws
Important research on topic of broad
significance; novel aspects
Mostly competent, but suffering from serious
flaws
Useful research on topic that lacks
originality; sound but routine
Weak, major flaws or inconsistencies
Research on topic of limited significance, or
outside the scope of GCB
X
Please summarise your assessments by rating the quality and importance of the
science:
Insert a rating value from 1 (low) to 5 (high)
Quality of the Science
4
Importance of the Science
Does this manuscript require significant reduction in length?
4
NO
If "Yes", please indicate where shortening is required in your specific comments, or by
annotations to the manuscript
239
Appendix
Methane Cycle in Permafrost Ecosystems
Global Change Biology
Editorial Office:
MS#: 06-381
Department of Plant Biology
University of Illinois
1201 W. Gregory, Urbana, IL 61801
Email: [email protected]
Ref#: 2
This form will be sent to the authors
Title:
Methanogenic activity and biomass in Holocene permafrost deposits of the
Lena Delta, Siberian Arctic and its implication for the global methane budget
Authors:
Wagner D, Gattinger A, Embacher A, Pfeiffer E-M, Schloter M and Lipski A
Please indicate your assessment by checking the appropriate boxes:
Quality of the Science
Experimentally and/or theoretically excellent
reliable data, no flaws
Importance of the Science
Research of major significance on topic of
central importance; highly novel
x
Competent; no major flaws
Important research on topic of broad
significance; novel aspects
Mostly competent, but suffering from serious
flaws
Useful research on topic that lacks
originality; sound but routine
Weak, major flaws or inconsistencies
Research on topic of limited significance, or
outside the scope of GCB
x
Please summarise your assessments by rating the quality and importance of the science:
Insert a rating value from 1 (low) to 5 (high)
Quality of the Science
4
Importance of the Science
Does this manuscript require significant reduction in length?
If "Yes", please indicate where shortening is required in your
specific comments, or by annotations to the manuscript
240
Yes
x
4
No
Methane Cycle in Permafrost Ecosystems
Appendix
FEMS Microbiology Ecology (chapter 6.3)
Dear Ms. Daria Morozova,
Manuscript id: FEMSEC-06-10-0411
Title: Stress response of methanogenic archaea from Siberian permafrost
compared to methanogens from non-permafrost habitats
Authors: Morozova, Daria; Wagner, Dirk
Submitted to: FEMS Microbiology Ecology
Thank you for submitting the above manuscript to our journal. It has now
been expertly refereed and their recommendations are given below.
You will see that the reviewers, although they found merit in your study,
have raised a number of concerns that preclude acceptance in its present
form. The discussion should be shortened and overstatements avoided. In
addition, the authors need justify the experimental design and choice of
control organisms.
If you feel able to address these comments and the points I mention below,
then I will be happy to consider a revised manuscript.
- Please return your revised manuscript within two months if at all
possible.
- You should upload your revised manuscript files via your Submitting
Author Center at http://mc.manuscriptcentral.com/femsec . To do this, go to
the list “Manuscripts with Decisions” (under My Manuscripts) and then click
“create a revision” at the right-hand side (under Actions). Please note
that this option will disappear 90 days from today.
- Upload a source file (Word or RTF format) of your text.
- Upload a point-by-point response to the reviewers' comments.
Further guidelines may be found by clicking the "FEMS Revision
Instructions" icon, reached via the "Instructions and Forms" button at the
top right of all Manuscript Central pages
(http://mc.manuscriptcentral.com/societyimages/femsec/FEMS-RevisionInstructions.pdf).
- Once the submission process is complete, you will receive an email
confirmation and the manuscript will be passed automatically to your
Editor.
- If your paper is accepted, the electronic files will in principle be used
for final publication, but the publisher may request a set of high-quality
print-outs of your figures for production purposes.
I am looking forward to receiving your revision in due course. Please let
me know if you decide not to submit a revision, or cannot respond within
the two months noted above.
Best wishes, Kornelia Smalla
Prof. Dr. Kornelia Smalla
Editor
FEMS Microbiology Ecology
241
Appendix
Methane Cycle in Permafrost Ecosystems
List of Oral and Poster Presentations
Invited Talks
Wagner, D. (2006) Long-term studies on methane fluxes from permafrost environments of the Lena
Delta, Siberia: microbial processes and communities, TUMSS Research Cluster Seminar Series,
ETH Zurich, Switzerland, 23.11.2006.
Wagner, D., Morozova D., Möhlmann D., Rettberg P. (2006) Response of methanogenic archaea from
Siberian permafrost to Martian thermo-physical conditions, European Planetary Science Congress
2006, Berlin, Germany, 18.-22. September 2006.
Wagner, D. (2006) Methane fluxes from Siberian permafrost: microbial communities and their
astrobiological relevance, Colloquium, German Research Centre for Biotechnology, Braunschweig,
12.09.2006.
Wagner, D. (2006) Response of methanogenic archaea from Siberian permafrost to Martian
conditions, Adlershofer Planetenseminar, Institut für Planetenforschung, Deutsches Luft- und
Raumfahrtzentrum, 26.04.2006.
Morozova, D. and Wagner, D. (2005) Tolerance limits of methanogenic life in terrestrial permafrost,
DFG Colloquium: Mars and the Terrestrial Planets, Berlin, 29.-30. August 2005.
Wagner, D. (2005) Cold adapted microorganisms: natural processes and possibilities of their technical
utilization, Workshop on Challenges of Permafrost Degradation of Siberian Soils to Science and
Technology, Institute of Forest (RAS), Krasnoyarsk, Russia, 16.-19. März 2005.
Wagner, D. (2004) Langzeitstudien zur Methanfreisetzung aus Tundrenböden des Lena Deltas,
Sibirien, Geowissenschaftliches Institutskolloquium, Institut für Geophysik und Geologie,
Universität Leipzig, 10.06.2004.
Wagner, D. (2004) Methane fluxes from tundra environments of the Lena Delta: long-term studies and
astrobiological relevance, Colloquium, Max Planck Institute for Biogeochemistry, Jena, 03.06.2004.
Wagner, D. and Hubberten, H.-W. (2004) Long-term studies on methane fluxes from tundra
environments of the Lena Delta: microbial processes, Biogeochemistry and Permafrost Modeling,
International Workshop on Permafrost-Carbon-Climate Interactions, Paris, France, 17.-18. Februar
2004.
Wagner, D. (2003) Methanogene Mikrobengemeinschaften im terrestrischen Permafrost und ihre
Relevanz für mögliches Leben auf dem Mars, Astrobiology Colloquium, Deutsches Zentrum für
Luft- und Raumfahrt, Institut für Luft- und Raumfahrtmedizin, Köln, 27.11.2003.
Wagner, D., Spieck, E. and Pfeiffer, E.-M. (2003) Tolerance limits of microbial life in terrestrial
permafrost, DFG Colloquium: Mars and the Terrestrial Planets, Münster, 20.-21. August 2003.
Wagner, D. (2002) Mikrobiologische Prozessstudien zum Methankreislauf in Permafrostböden,
Kolloquiumsvortrag, Aktuelle Themen der Erdsystemforschung, Universität Hamburg, Institut für
Bodenkunde, 13.11.2002.
Wagner, D. (2002). Microbial controls on methane emission from Siberian tundra environments,
Kolloquiumsvortrag, Bodenökologisches Seminar, GSF-Forschungszentrum für Umwelt und
Gesundheit, Institut für Bodenökologie, Neuherberg, 06.11.2002.
Wagner, D. (2002) Microbial archives in permafrost: methanogenic archaea as key-organisms,
HELMERT-Summerschool, Potsdam, 12.-18. September 2002.
Wagner D. (2001) Methanflüsse aus Permafrostböden Sibiriens: Ergebnisse und offene Fragen,
Kolloquiumsvortrag, Universität Kiel, Institut für Polarökologie, 05.02.2001.
Wagner D. (2000) Saisonale Variabilität von rezenten Stoffumsetzungen: Cryosole und
Methanogenese, Kolloquiumsvortrag, Universität Hohenheim, Institut für Bodenkunde und
Standortlehre, Stuttgart, 17.05.2000.
Wagner D. (1998) Methane production and release of trace gases from sub-arctic tundra, Siberia,
Second TUNDRA Meeting, Utrecht, The Netherlands, 15.-19. Dezember 1998.
242
Methane Cycle in Permafrost Ecosystems
Appendix
Oral Presentations (for the last 5 years)
Liebner, S., Harder, J. and Wagner, D. (2006) Stability of methane oxidising communities in Siberian
permafrost soils in the context of global climate change, International Conference on Alpine and
Polar Microbiology, Innsbruck, Austria, 27.-30. March 2006.
Morozova, D. and Wagner, D. (2006) Methanogene Archaeen aus sibirischem Permafrost als
Modellsysteme für das Leben auf dem Mars, DPG-AEF Tagung, Heidelberg, Deutschland, 13.-16.
März 2006.
Morozova, D. and Wagner, D. (2006) Methanogenic archaea in terrestrial permafrost as a model for
probable microbial life on Mars, International Conference on Alpine and Polar Microbiology,
Innsbruck, Austria, 27.-30. March 2006.
Morozova, D. and Wagner, D. (2006) Methanogenic archaea from Siberian permafrost as prime
candidates for life on Mars, DFG Workshop, Cologne, Germany, 4.-5. May 2006.
Rettberg, P., Wagner, D., Ott, S., Ondruschka, J. and Möhlmann, D. (2006) Survival potential of
terrestrial organisms under Martian conditions, ESA-CNES Workshop on Special Regions,
European Space Research and Technology Centre, Noordwijk, The Netherlands, 25. January
2006.
Cannone, N., Guglielmin, M., Wagner, D. and Hubberten, H.-W. (2005) Active layer characteristics
and bacterial occurrence across a latitudinal gradient in Victoria Land (continental Antarctica) as
indicator of functional processes in permafrost environments and ecosystems, Second European
Conference on Permafrost, EUCOP 2005, Potsdam, Germany, 12.-16. June 2005.
Gattinger, A., Embacher, A., Labrenz, M., Wagner, D. and Schloter, M. (2005) Die Bedeutung der
organischen Bodensubstanz für die Anpassung und Entwicklung von Archaeengemeinschaften in
Böden, Jahrestagung der Deutschen Bodenkundlichen Gesellschaft, Marburg, Deutschland, 3.-11.
September 2005.
Liebner, S. and Wagner, D. (2005) Spatial variance of methane oxidation rates in Siberian permafrost
soils in dependence of the temperature: an indicator for microbial changes of structure and
diversity? Workshop on Development and Control of Functional Biodiversity at Micro- and Macroscales, Neuherberg, Germany, 5.-7. October 2005.
Liebner, S. and Wagner, D. (2005) Temperature-Dependence of Methane Oxidation Rates in
Permafrost Soils of the Lena Delta, Siberia, 22. International Polar Meeting, Jena, Germany, 18.–
24. September 2005.
Meyer, H., Yoshikawa, K., Schirrmeister, L., Andreev, A. A., Wagner, D. and Hubberten, H.-W. (2005)
The Vault Creek permafrost tunnel - Late Quaternary climate and environmental history of the
Fairbanks region, Alaska, Second European Conference on Permafrost, EUCOP 2005, Potsdam,
Germany, 12.-16. June 2005.
Morozova, D. and Wagner, D. (2005) Tolerance limits of methanogenic archaea from Siberian
permafrost: effects of high salinity and low temperatures, Second European Conference on
Permafrost EUCOP 2005, Potsdam, Germany, 12.-16. June 2005.
Morozova, D. and Wagner, D. (2005) Microbial life under extreme environments of permafrost:
tolerance limits of methanogenic archaea as keystone organisms for the investigation of
extraterrestrial life, 22. International Polar Meeting, Jena, Germany, 18.–24. September 2005.
Morozova, D. and Wagner, D. (2005) Survival potential of methanogenic archaea from Siberian
permafrost: investigation of possible extraterrestrial life, VAAM Annual Meeting, Gottingen,
Germany, 25.-28. September 2005.
Morozova, D. and Wagner, D. (2005) Methanogenic archaea under permafrost extreme conditions: a
model for putative life on Mars, International workshop on Astrobiology: Life in extreme conditions,
Oslo, Norway, 21.-22. November 2005.
Morozova, D. and Wagner, D. (2005) Methanogenic archaea from Siberian permafrost: fit for Mars?
5th European Workshop on Astrobiology, Budapest, Hungary, 10.-12. October 2005.
Schneider, J., Kleber, A. and Wagner, D. (2005) Balance of methane emissions from tundra
environments of the Lena Delta based on remote sensing, 22. International Polar Meeting, Jena,
Germany, 18.–24. September 2005.
Wagner, D., Gattinger, A., Lipski, A. and Schloter, M. (2005) Effects of microbial communities and
organic matter quality on methane fluxes in different areas of a Siberian polygon tundra, Second
European Conference on Permafrost, EUCOP 2005, Potsdam, Germany, 12.-16. June 2005.
243
Appendix
Methane Cycle in Permafrost Ecosystems
Wagner, D. and Morozova, D. (2005) Methanogenic archaea in terrestrial permafrost: a model for
probable microbial life in Martian permafrost, ARCHAEA - The First Generation, Hohenheimer
Castle Academy, Munich, Germany, 2.-4. June 2005.
Wagner, D., Gattinger, A., Lipski, A. and Schloter, M. (2005) Methane fluxes, microbial activities and
community structures in a wet tundra of the Lena Delta, 22. International Polar Meeting, Jena,
Germany, 18.–24. September 2005.
Cannone, N., Guglielmin, M., Wagner, D. and Hubberten, H.-W. (2004) Active layer characteristics
across a latitudinal gradient in Victoria Land (Continental Antarctica) as indicator of functional
processes in permafrost environments and ecosystems, XXVIII SCAR Meeting, Bremen, Germany,
25.-31. July 2004.
Kobabe, S., Liebner, S, Pfeiffer, E.-M. and Wagner, D. (2004) Characterisation of microbial
community controlling methane emission from Siberian tundra soils by FISH, International
Conference on Arctic Microbiology, Rovaniemi, Finland, 22.-25. March 2004.
Morozova, D., Wagner, D. and Hubberten, H.-W. (2004) Subsurface microbial life as a model for
extraterrestrial permafrost habitats, El`gygytgyn Lake Workshop, Leipzig, Germany, 24.-26. March
2004.
Pfeiffer, E.-M., Spott, O., Kutzbach, L. and Wagner, D. (2004) Patterned ground related soils and
lakes and their role as sources for methane, International Conference “Cryosphere of Oil-And-Gas
Bearing Provinces”, Tyumen, Russia, 22.-29. May 2004.
Wagner, D., Kurchatova, A. and Gattinger, A. (2004) Methanogenesis in late Pleistocene permafrost
sediments of the Lena Delta, Siberia, International Workshop on Geomicrobiology, Aarhus,
Denmark, 28.-31. January 2004.
Wagner, D. and Morozova, D. (2004) Tolerance limits of methanogenic archaea in terrestrial
permafrost, International Conference “Cryosphere of Oil-And-Gas Bearing Provinces”, Tyumen,
Russia, 22.-29. May 2004.
Wagner, D., Embacher, A., Lipski, A. and Gattinger, A. (2004) Methane fluxes in different areas of a
Siberian polygon tundra: effects of organic matter quality and microbial communities, VAAM Annual
Meeting 2004, Braunschweig, Germany, 28.-31. March 2004.
Wagner, D. and Gattinger, A. (2004) Archaeal activity and biomass in Holocene permafrost deposits
of the Lena Delta, Siberia, International Conference on Arctic Microbiology, Rovaniemi, Finland,
22.-25. March 2004.
Pfeiffer, E.-M. and Wagner, D. (2003) Permafrost related methane fluxes and their importance for
climate change effects, Agriculture in Northern Ecosystems: Effects of Global Change on Soil
Ecological Processes, Vechta, Germany, 2.-4. April 2003.
Wagner, D., Pfeiffer, E.-M. and Hubberten, H.-W. (2003) Methane cycle in permafrost soils: first
evidence of cold adaptation of methanogenic archaea and methylotrophic bacteria, Workshop on
Cold Adaptation of Aquatic Microorganisms, Bremen, 11.-14. Mai 2003.
Wagner, D. and Pfeiffer, E.-M. (2003) Mikrobielle Methanbildung unter extremen Umweltbedingungen
in Permafrostböden: Ein Modell für exobiologische Prozesse? 21. Internationale Polartagung, Kiel,
Deutschland, 16.-21. März 2003.
Wagner, D., Pfeiffer, E.-M. and Hubberten, H.-W. (2003) Long-term studies on methane fluxes from
tundra environments in the Lena Delta, Siberia, NECC Conference: The Carbon Balance of Aquatic
and Terrestrial Ecosystems and their Interaction, Lammi, Finland, 26.-28. October 2003.
Kobabe, S., Wagner, D., Schröder, H., Damm, E., Kassens, H. and Pfeiffer, E.-M. (2002) Methane
contents in different compartment of the Laptev Sea - Preliminary results, Climate Drivers of the
North, Kiel, Germany, 8.-11. May 2002.
Kutzbach, L., Wagner, D., Wille, C., Kobabe, S. and Pfeiffer, E.-M. (2002) Permafrostlandschaften als
Quellen atmosphärischen Methans: Feldstudien zur zeitlichen und flächenhaften Variabilität der
Methanemission aus Tundren des Lena-Deltas, Geo 2002 - Jahrestagung der Gesellschaften der
Festen Erde in der Bundesrepublik Deutschland, Würzburg, Deutschland, 1.-5. Oktober 2002.
Pfeiffer, E.-M. and Wagner, D. (2002) Methane studies in the active layer: methanogenesis as a
model process for the extreme habitat development in permafrost, Extreme Phenomena in the
Cryosphere, Pushchino, Russia, 5.-8. May 2002.
244
Methane Cycle in Permafrost Ecosystems
Appendix
Wagner, D. and Pfeiffer, E.-M. (2002) Microbial life in permafrost soils: methanogenesis as analogues
for exobiological processes, Water in the Upper Martian Surface, Potsdam, Germany, 17.-19. April
2002.
Wagner, D., Pfeiffer, E.-M. and Samarkin, V. (2002) Microbial controls on methane emission from
Siberian tundra environments: open questions and future perspectives, Climate Drivers of the
North, Kiel, Germany, 8.-11. May 2002.
Wagner, D., Kobabe, S. and Pfeiffer, E.-M. (2002) Microbial controls on methane emission from
Siberian tundra environments, VAAM Annual Meeting 2002, Göttingen, Germany, 24.-27. March
2002.
Wagner, D., Kobabe, S. and Pfeiffer, E.-M. (2002) Bedeutung der mikrobiellen Methanbildung und oxidation für die Methanfreisetzung aus arktischen Tundren Sibiriens, GEO 2002- Jahrestagung
der Gesellschaften der Festen Erde in der Bundesrepublik Deutschland, Würzburg, Deutschland,
1.-5. Oktober 2002.
Wagner, D., Pfeiffer, E. -M. and Hubberten, H.-W. (2002) The consequences of microbial processes
for the methane emission from Siberian permafrost environments, AGU 2002 Fall Meeting, San
Francisco, USA, 6.-10. December 2002.
Wagner, D. and Pfeiffer, E.-M. (2002) Methanogenesis as a model process for extreme habitat
development: process studies in the active layer of different permafrost sites, Second European
Workshop on Exo/Astrobiology, Graz, Austria, 16.-19. September 2002.
Poster Presentations (for the last 5 years)
Jurgens, G., Münster, U., Grigoriev, M. and Wagner, D. (2006) Archaeal activity and diversity in Late
Pleistocene permafrost sediments of the river Lena Delta, Siberia, Russia, 11th International
Symposium on Microbial Ecology, Vienna, Austria, 20.-25. August 2006,.
Liebner, S., Harder, J. and Wagner, D. (2006) Bacterial diversity in Siberian permafrost soils based on
16S rDNA clone libraries and in situ cell counting, 11th International Symposium on Microbial
Ecology, Vienna, Austria, 20.-25. August 2006.
Morozova, D. and Wagner, D. (2006) Response of methanogens from Siberian permafrost to extreme
conditions of terrestrial and extraterrestrial permafrost, VAAM Annual Meeting 2006, Jena,
Germany, 19.-22. March 2006.
Morozova, D. and Wagner, D. (2006) Response of methanogens from Siberian permafrost to extreme
conditions of terrestrial and extraterrestrial permafrost, VAAM Annual Meeting 2006, Jena,
Germany, 19.-22. March 2006.
Morozova, D. and Wagner, D. (2006) Highly resistant methanogenic archaea from Siberian
permafrost as candidates for the possible life on Mars, 6th European Workshop on Astrobiology,
Lyon, France, 16.-18. October 2006.
Sachs, T., Wille, C. and Wagner, D. (2006) Trace gas flux measurements on Samoylov Island, Lena
Delta, 8th Workshop SYSTEM LAPTEV SEA, St. Petersburg, Russia, 7.-9. February 2006.
Schneider, J., Grosse, G., Kutzbach, L. and Wagner, D. (2006) Land cover classification of tundra
environments in the Arctic Lena Delta based on Landsat 7 ETM+ data and its application for upscaling of methane emissions, GlobWetland Symposium - Looking at Wetlands from Space, ESAESRIN, Frascati, Italy, 19.-20. October 2006.
Wagner, D., Kobabe, S., Lipski, A. and Gattinger, A. (2006) Effects of microbial community structure
and soil organic matter on methanogenesis in Siberian permafrost soils, International Conference
on Alpine and Polar Microbiology, Innsbruck, Austria, 27.-30. March 2006.
Wagner, D. and Morozova, D. (2006) Methanogenic archaea as potential candidates for life on Mars,
6th European Workshop on Astrobiology, Lyon, France,16.-18. October 2006.
Ganzert, L. and Wagner, D. (2005) Biodiversity of methanogenic archaea in permafrost affected soils
of the Lena Delta, Siberia, 22. International Polar Meeting, Jena, Germany, 18.-24. September
2005.
Ganzert, L. and Wagner, D. (2005) Composition of methanogenic archaeal communities in permafrost
soils of Northern Siberia, VAAM Annual Meeting 2005, Göttingen, Germany, 23.-26. September
2005.
245
Appendix
Methane Cycle in Permafrost Ecosystems
Gattinger, A., Embacher, A., Labrenz, M., Wagner, D. and Schloter, M. (2005) The Importance of soil
organic matter for adaptation and evolution of archaeal communities in terrestrial ecosystems,
ARCHAEA - The First Generation, Munich, Germany, 2.-4. June 2005.
Liebner, S. and Wagner, D. (2005) Cold loving methanotrophic communities in permafrost soils of the
Lena Delta, Siberia, VAAM Annual Meeting 2005, Göttingen, Germany, 23.-26. September 2005.
Liebner, S. and Wagner, D. (2005) Adaptation and composition of methanotrophic communities in
permafrost soils of the Lena Delta, Siberia, 2nd European Conference On Permafrost, Potsdam,
Germany, 12.-16. June 2005.
Meyer, H., Schirrmeister, L., Andreev, A., Wagner, D., Hubberten, H.-W., Yoshikawa, K. and Brown, J.
(2005) Multi-proxy approach to a buried ice-wedge system, Barrow, Alaska, 1st CLIC International
Science Conference, Beijing, China, 11.-15. April 2005.
Meyer, H., Yoshikawa, K., Schirrmeister, L., Andreev, A., Wagner, D. and Hubberten, H.-W. (2005)
Palaeoenvironmental record of a Late Quaternary permafrost tunnel in the Vault Creek, Fairbanks
region, Alaska, 1st CLIC International Science Conference, Beijing, China, 11.-15. April 2005.
Meyer, H., Schirrmeister, L., Andreev, A. A., Wagner, D., Hubberten, H.-W., Yoshikawa, K. and
Brown, J. (2005) A buried ice-wedge system as archive for the Late Quaternary environmental
history near Barrow, Alaska, EUCOP II, 2nd European Conference on Permafrost, Potsdam,
Germany, 12.-16. June 2005.
Wagner, D. and Morozova, D. (2005) Methane production in terrestrial permafrost: a model for
possible microbial life in Martian permafrost, VAAM Annual Meeting 2005, Göttingen, Germany,
23.-26. September 2005.
Kurchatova, A. N., Pfeiffer, E.-M., Slagoda, E. A. and Wagner, D. (2004) Ranks of cryostructures of
ice complex sequences of the Lena Delta, Russia, International Conference “Cryosphere of OilAnd-Gas Bearing Provinces”, Tyumen, Russia, 22.-29. May 2004.
Wagner, D., Kobabe, S., Pfeiffer, E. -M. and Hubberten, H.-W. (2003) Methanogenesis under extreme
environmental conditions in permafrost soils: a model for exobiological processes? 8th International
Conference on Permafrost, Zurich, Switzerland, 21.-25. July 2003.
Wagner, D., Liebner, S. and Kobabe, S. (2003) Activity and diversity of methanogens and
methanotrophs under extreme environmental conditions in permafrost soils, International
Symposium on Structure and Function of Soil Microbiota, Marburg, Germany, 18.-20. September
2003.
Kobabe, S., Wagner, D. and Pfeiffer, E.-M. (2002) Methane production in Siberian tundra soils:
Influence of temperature and substrates, VAAM Annual Meeting 2002, Göttingen, Germany, 24.27. March 2002.
Kutzbach, L., Wille, C., Wagner, D. and Pfeiffer, E.-M. (2002) The eddy covariance technique as a tool
to determine trace gas fluxes on the ecosystem scale, Climate Drivers of the North Conference,
Kiel, Germany, 8.-11. May 2002.
Pfeiffer, E.-M., Kobabe, S. and Wagner, D. (2002) Methane fluxes in Siberia and their relevance for
the permafrost-related gas hydrate research, Climate Drivers of the North,
246
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement