Mancarella Caterina tesi
Alma Mater Studiorum – Università di Bologna
DOTTORATO DI RICERCA IN
ONCOLOGIA E PATOLOGIA SPERIMENTALE
Ciclo XXVII
Settore Concorsuale di afferenza: 06/F4
Settore Scientifico disciplinare: MED/33
IGF SYSTEM, CD99 AND TUMOR-SPECIFIC
CHROMOSOMAL TRANSLOCATIONS: EVALUATION OF
THEIR CROSS-TALK AND DEFINITION OF THEIR ROLE
IN EWING SARCOMA AND PROSTATE CANCER
Presentata da Caterina Mancarella
Coordinatore Dottorato
Relatore
Chiar.mo Prof.
Pier-Luigi Lollini
Chiar.mo Prof.
Pietro Ruggieri
Correlatore
Chiar.ma Prof.ssa
Katia Scotlandi
Esame finale anno 2015
Table of contents
Introduction .......................................................................................................................4
1.
2.
3.
Tumor-specific chromosomal translocations......................................................... 4
1.1
General aspects ............................................................................................... 4
1.2
Gene fusions in haematological disorders ...................................................... 5
1.3
Gene fusions in sarcomas ............................................................................... 6
1.4
Gene fusions in carcinomas............................................................................ 7
1.5
ETS-associated translocations ........................................................................ 8
Ewing sarcoma ...................................................................................................... 9
2.1
General characteristics ................................................................................... 9
2.2
Epidemiology and risk ................................................................................... 9
2.3
Localization, histopathology and staging ..................................................... 10
2.4
Course and diagnosis .................................................................................... 11
2.5
Cell of origin ................................................................................................ 12
2.6
Molecular biology of Ewing sarcoma .......................................................... 13
2.7
Treatment ..................................................................................................... 16
Prostate cancer ..................................................................................................... 18
3.1
Epidemiology and risk ................................................................................. 18
3.2
Prostate anatomy and histology ................................................................... 18
3.3
Diagnosis and staging................................................................................... 20
3.4
History of prostate cancer ............................................................................ 21
3.4.1
Cell of origin ......................................................................................... 22
3.4.2
Prostatic intraepithelial neoplasia (PIN) ............................................... 23
3.4.3
Latent and clinical cancer ..................................................................... 24
3.4.4
Metastasis.............................................................................................. 24
3.5
Molecular biology of prostate cancer ........................................................... 25
1
3.6
4.
The IGF system ................................................................................................... 31
4.1
5.
Prognosis and treatment ............................................................................... 28
The receptors ................................................................................................ 31
4.1.1
IGF-1R .................................................................................................. 32
4.1.2
IR .......................................................................................................... 33
4.1.3
Hybrid receptors ................................................................................... 34
4.2
Ligands and binding proteins ....................................................................... 35
4.3
IGF-1R: signal transduction pathways ......................................................... 36
4.4
IGF system and cancer ................................................................................. 38
4.5
IGF-1R as a therapeutic target ..................................................................... 42
4.6
IGF system in Ewing sarcoma ..................................................................... 45
4.7
IGF system in prostate cancer ...................................................................... 46
CD99 molecule .................................................................................................... 47
5.1
MIC2 gene and CD99 protein ...................................................................... 47
5.2
CD99 expression in normal and tumor tissues ............................................. 48
5.3
CD99 function in normal and tumor tissues................................................. 49
Aim of the study ..............................................................................................................52
Materials and Methods ....................................................................................................53
Results .............................................................................................................................61
1.
2.
TMPRSS2-ERG and IGF system ........................................................................ 61
1.1
Analysis of IGF system main components expression in PCa cell lines ..... 61
1.2
Functional evaluation of tERG/IGF-1R correlation in PCa ......................... 63
1.3
Efficacy of anti-IGF-1R agents in prostate cancer cells .............................. 66
1.4
Combinatory treatment of anti-IGF-1R therapy and anti-androgens ........... 69
ETS rearrangements and IGF-1R expression in Ewing sarcoma ........................ 72
3. Effects of Trabectedin (ET-743, YondelisTM) on ETS fusion genes binding to
IGF-1R promoter ........................................................................................................ 73
2
3.1
Evaluation of EWS-FLI1 binding to IGF-1R promoter upon stimulation with
trabectedin ............................................................................................................... 74
3.2
Evaluation of tERG binding to IGF-1R promoter upon stimulation with
trabectedin ............................................................................................................... 77
3.3
Therapeutic implications of trabectedin gene-specific effects ..................... 78
4. Prognostic relevance of IGF system and assessment of TMPRSS2-ERG/IGF-1R
axis in PCa patients ..................................................................................................... 79
4.1
Gene expression profile of IGF system in primary PCa .............................. 79
4.2
Protein expression of IGF-1R, IR and ERG in primary PCa tissues and
association with prognosis ...................................................................................... 81
5.
TMPRSS2-ERG and CD99 molecule ................................................................. 83
5.1
Preliminary data ........................................................................................... 83
5.2
Analysis of CD99 association with survival in primitive PCa samples ....... 87
5.3
Analysis of CD99 expression in PCa cell lines ............................................ 89
5.4
In vitro analysis of ETS rearrangements/CD99 correlation ......................... 90
Discussion......................................................................................................................100
Bibliography ..................................................................................................................106
3
Introduction
1. Tumor-specific chromosomal translocations
1.1 General aspects
Cancer is due to acquired genetic changes, sometimes associated with inherited
predisposing mutations. Hypothesis that chromosomal changes are responsible for
neoplasia was first proposed by Theodor Boveri in 1914 [1] but it was completely
accepted with improvements in cytogenetic and molecular techniques. Translocations
together with deletions and inversions represent the three main cytogenetic changes in
cancer. Translocations can be divided in specific, when consistently found in a certain
tumor types, and idiopathic, when observed in the tumor from one patient [2]. Up until
recently, importance of tumor-specific translocations was mainly diagnostic but the
more recent characterization of these rearrangements has provided important insights
into the neoplastic process [3]. Consequences of chromosomal translocations are
potentially two: activation of genes located at or near the breakpoints that are pivotal in
the control of cell growth and differentiation or generation of a chimaeric gene resulting
from fusion between two unrelated genes positioned at each of the involved
chromosomal breakpoints. In both of the cases, a factor with altered expression or
function is produced and it cooperates in establishing a transformed phenotype. In some
cases, translocations can inactivate oncosuppressor genes such as repression of TEL1 as
a consequence of the TEL1-AML translocation [4]. The first described translocation was
the Philadelphia chromosome, a reciprocal chromosomal translocation involving
chromosomes 9 and 22 in chronic myelogenous leukemia (CML) [5]. Subsequently, a
translocation between chromosomes 8 and 14 was discovered in Burkitt’s lymphoma [6]
where c-MYC oncogene translocates to the immunoglobulin heavy chain loci on
chromosome 14 [7]. These discoveries stimulated interest in cancer cytogenetics and, as
a consequence, information on chromosomal aberrations in cancer has increased over
the past two decades. In the early 1990s, specific translocations were found in sarcomas
including Ewing sarcoma, myxoid liposarcoma and synovial sarcomas. Until that
period, it was believed that chromosomal translocations were restricted to lymphoid
cancers and few sarcomas but subsequent studies showed that carcinomas can express
chromosomal translocations. The first example was the fusion between RET gene
4
encoding a tyrosine kinase receptor with the CCDC6 gene in papillary thyroid
carcinoma [8]. Afterwards, other gene fusions have been discovered in carcinomas.
Particularly, important fusion genes have been recently identified in prostate and lung
cancer.
Molecular cytogenetic techniques including fluorescence in situ hybridization (FISH),
multicolour FISH and array-based comparative genomic hybridization dramatically
improved analysis of chromosomal breakpoints that now can be mapped very precisely
[9]. Cytogenetic characterization allowed identification of almost 337 genes involved in
fusions in neoplastic disorders and they represent a substantial proportion of all mutated
genes implicated in oncogenesis [9]. Many of these chromosomal translocations are
associated with distinct tumor types, clinical features and characteristic gene expression
profiles. This information has become an important tool in the management of cancer
patients helping to establish a correct diagnosis, select appropriate treatment, and
predict outcome [9]. As a consequence, fusion genes represent useful biomarkers which
identification represents a remarkable advantage in a certain tumor type.
1.2 Gene fusions in haematological disorders
Leukaemias and limphomas, together constituting 8% of all cancers, harbor
translocations in almost all cases, representing 75% of all gene fusions known un human
neoplasia. These high percentages lead to opinion that these disorders are exclusively
caused by fusion genes. Actually, prevalence of most individual gene fusions is very
low and few well-known specific changes are observed in 100% of cases and represent
exceptions: BCR-ABL in CML, IGH-CCND1 in mantle cell lymphoma, MYC
deregulation in Burkitt’s lymphoma and PML-RARA in acute promyelocytic leukaemia
(APL). CML is characterized by a translocation between ABL gene on chromosome 9
and BCR gene promoter on chromosome 22. This results in the formation of a unique
in-frame fusion mRNA and a constitutively activated protein tyrosine kinase that was
shown to be oncogenic [10]. Subsequently, the tyrosine kinase inhibitor imatinib
mesylate, specific for the ABL, was developed [11] and preclinical and clinical trials
demonstrated its high efficacy becoming a new standard treatment for CML patients
[12]. Burkitt’s lymphoma is a B cell tumor containing the t(8;14) translocation in 70%
of cases and resulting in over-expression of c-MYC. Several therapeutic approaches
have been developed to target MYC-dependent tumors including inhibitors of
transcriptional machinery, inhibitors of MYC dimerization which prevents its DNA
binding, blockade of MYC stability but clinical trials evaluating effectiveness in
5
lymphoid malignancies are lacking [13]. Chromosomal translocation involving
chromosomes 11 and 14 in mantle cell lymphoma results in constitutional overexpression of cyclin D1 and, consequently, cell cycle deregulation. Nowadays, detection
of t(11;14) or cyclin D1 over-expression represent crucial features for a correct
diagnosis [14]. In over 98% of APL patients, a specific chromosomal translocation fuses
PML gene on chromosome 15 to the RARA gene on chromosome 17 resulting in
PML/RARA fusion protein which is the molecular determinant of the disease [15] and a
useful tool for tumor diagnosis [16].
1.3 Gene fusions in sarcomas
Bone and soft tissue sarcomas represent a clinically and morphologically heterogeneous
group of neoplasms of mesenchymal or neuroectodermal origin. The overall fraction of
sarcomas with chimeric genes is 15 to 20%. Between sarcomas presenting chromosomal
translocations, Ewing sarcoma, myxoid liposarcomas and synovial sarcomas harbor
chimeric genes in 100% of cases [9]. Ewing sarcoma specific translocation involves
EWSR1 gene on chromosome 22 and one of the ETS transcription factor genes,
particularly FLI1, located on chromosome 11, in 85% of cases, or ERG, on chromosome
21, in 11% of cases. EWS-ETS fusion gene results in a chimeric protein with aberrant
transcriptional activity. Since its discovery, EWS-FLI1 represented a fundamental tool
for Ewing sarcoma diagnosis and a key element for a better understanding of tumor
biology. Several studies demonstrated its importance in induction of a transformed
phenotype mainly through identification of its target genes. Being exclusively located
within the tumor and driving cell transformation, EWS-FLI1 represents an excellent
therapeutic target and some compounds were developed in the past years in order to
specifically block it. Particularly, the small molecule YK-4-279, disrupting interaction
between EWS-FLI1 and RNA Helicase A (RHA), which is a critical mechanism for
EWS transformation [17], was shown to induce apoptotic cell death [18] in preclinical
studies but it never entered the clinic. Currently, additional preclinical studies are
ongoing testing its efficacy alone or in combination with other compounds with the
purpose to optimize its use [19-21]. Myxoid liposarcoma is characterized by a
translocation fusing FUS gene, on chromosome 12, and CHOP gene on chromosome
16. The fusion FUS-CHOP protein functions as abnormal transcription factor and its
relevance in the pathogenesis of myxoid liposarcoma is well established [22]. Recent
evidences demonstrated that myxoid liposarcoma is particularly sensitive to Trabectedin
(ET-734, Yondelis), a marine alkaloid which is cytotoxic against a variety of tumor cell
6
lines [23] and human tumor xenografts in vivo [24]. In vitro studies demonstrated that
the high sensitivity of myxoid liposarcoma to this agent is due to the ability of
Trabectedin to act as a differentiating agent by blocking the transactivating capability of
FUS-CHOP [25, 26]. Clinical trials confirmed the high efficacy of Trabectedin in
patients [27].
The molecular hallmark of synovial sarcoma is a pathognomonic reciprocal
translocation leading to the fusion of SS18 to one of the homologs SSX genes,
generating oncogenic SS18-SSX fusion proteins with aberrant transcriptional activity
[28]. The specific biological function and the mechanism of action of SS18-SSX remain
to be defined but it has a crucial role in tumorigenesis and progression. No specific
agent has been developed jet to directly inhibit SS18-SSX as it is part of regulatory
active complexes but recently some studies have been focused on inhibition of SS18SSX-mediated pathways such as Wnt/β-catenin signaling. Preliminary data demonstrate
a good in vitro response to these agents [28].
1.4 Gene fusions in carcinomas
Occurrence of gene fusions in malignant epithelial tumors is generally rare and this lead
to the commonly view that chromosomal translocations have a minor role in the
pathogenesis of carcinomas [9]. Actually, carcinomas are characterized by gene
rearrangements as well but limitations of available techniques and the individual rarity
of these alterations made them more difficult to detect. Overall, almost all lymphomas
harbor translocations, whereas only one-fourth of all sarcomas is reported to possess the
same. Gene fusion have been recently discovered in carcinomas so that the exact
percentage of carcinomas harboring fusion genes is not clear. The most remarkable
recently discovered fusion genes in epithelial tumors include TMPRSS2-ERG in prostate
cancer and EML4-ALK in lung cancer. Prostate cancer is the first common cancer
associated with a high frequency to a gene fusion as almost 70% of cases present this
rearrangement. Through bioinformatic tools, Tomlins et al. in 2005 noticed a strong
over-expression of ETS transcription factor genes, ERG and ETV1, in prostate cancer
specimens [29]. Subsequently, the genes were found to be fused with the 5’ part of the
prostate-specific gene TMPRSS2 located on chromosome 21. The result is an androgenregulated over-expression of ERG or ETV1 which can stimulate transcription of target
genes for cell growth, invasion and metastases and promote cancer progression [30, 31].
At clinical level, TMPRSS2-ERG was found to improve detection of clinically
significant prostate cancer when combined with other biomarkers evaluation such as
7
PCA3 or SPINK1 [32-34]. In addition, prognostic relevance of TMPRSS2-ERG was
investigated in several epidemiological studies, giving controversial results. The
restricted expression of TMPRSS2-ERG to cancer cell made it a suitable therapeutic
target [35]. Currently, TMPRSS2-ERG inhibition in vitro has been demonstrated to
inhibit tumor growth. Specific siRNA via liposomal nanovector have been proposed
[36] representing a potential efficacious treatment with low toxicity for prostate cancer
patients.
Fusion between the anaplastic lymphoma kinase gene (ALK) and the echinoderm
microtubule-associated protein-like 4 gene (EML4) has been detected in a subset of nonsmall cell lung cancers (NSCLCs). The EML4-ALK fusion gene encodes a fusion
protein retaining the kinase domain of ALK [37]. Oncogenic fusion genes have been
detected in approximately 2-7% of NSCLC patients. EML4-ALK defines a molecular
subset of patients with distinct clinical characteristics and with a relevant therapeutic
option in crizotinib, a small molecule inhibitor of both ALK and c-MET, with high
tolerability and robust antitumor activity as demonstrated by clinical trials. Nowadays,
crizotinib is a new standard of care for patients with advanced, EML2-ALK-positive,
NSCLC [38].
1.5 ETS-associated translocations
The ETS transcription factors family was established from the v-ets oncogene,
discovered as part of the transforming fusion protein of E26 avian replication-defective
retrovirus. The v-ets oncogene was found to be able to transform fibroblasts,
myeloblasts, and erythroblasts in vitro. Today, the ETS family is known as one of the
largest families of transcriptional regulators, with various functions and activities. In
human, 27 ETS members have been identified and they are characterized by the ETS
domain, a 85 amino acids conserved sequence with DNA-binding capability. In
particular, this domain is composed of three alpha helices and a four-stranded, beta
sheet recognizing a core GGAA/T sequence (Ets binding site). ETS factors act as
positive or negative regulators of expression of genes that are involved in various
biological processes including cell proliferation, differentiation, hematopoiesis,
apoptosis, metastasis, tissue remodeling, angiogenesis and transformation [39]. The
importance of ETS genes in cancer was early demonstrated by in vitro and in vivo
studies showing cellular transformation induced by ETS1, ETS2 and ERG [40-42]. In
addition, ETS relevance in cancer has been demonstrated by the observation that ETS
genes are frequently mutated in tumors including frequent location at translocation
8
breakpoints. Particularly, ERG involvement in chromosomal rearrangements was
described in leukaemias and solid tumors including sarcomas and carcinomas. In
leukaemias, FUS gene on chromosome 16 was described to be fused with ERG in acute
myeloid leukaemia [43, 44]. The product is the FUS-ERG fusion protein, an early event
in cancer progression with established oncogenic properties including inhibition of
differentiation into neutrophils of a mouse myeloid precursor cell line [45]. As
previously mentioned, chromosomal rearrangements involving ERG have been also
described in Ewing sarcoma, where the ETS generates fusion genes with EWS driving
cell transformation, and prostate cancer, where the ETS genes fuse with androgenrelated TMPRSS2. Considering ETS involvement in chromosomal translocations as a
shared mechanism between different tumor types, identification of common or
distinctive mechanisms sustained by ETS rearrangement that could be relevant for
tumor biology and clinical management of tumors represents the objective of several
studies, including the one here presented.
2. Ewing sarcoma
2.1 General characteristics
In 1921, Dr. James Ewing described for the first time a lesion that he named a “diffuse
endothelioma of bone” [46] and that today is known as Ewing sarcoma (ES). ES
belongs to the Ewing’s sarcoma family tumors (ESFT) comprehending osseous ES,
extra-skeletal ES, Askin tumor and peripheral primitive neuroectodermal tumor (PNET)
[47, 48]. ES is a rare highly aggressive and poor differentiated disease composed by
small round cells. It mostly affects bone but can also involve soft tissues including
kidney, lung, bladder, prostate. From a biological point of view, ESFT are characterized
by a specific translocation resulting in most of the cases in the EWS-FLI1 chimeric
transcription factor that is transforming in cells.
2.2 Epidemiology and risk
ES is the second most common tumor of bone after osteosarcoma among children and
young adults, with an annual incidence rate of three per million. Some evidences show
that boys are more commonly affected than girls with a ratio of 1.5:1. In 90% of the
9
cases, patients are between the ages of 5 and 20 years while is rare in individuals older
than 40 and younger than 5 years. No environmental factor has been identified as a risk
factor for this tumor [49] and there is no evidence regarding familiar predisposition [50]
beside some studies reported an increased risk of neuroectodermal tumors and stomach
cancer in family members of ES patients [51] or congenital mesenchymal defects in ES
patients [52]. Ethnicity represents an important epidemiologic factor with the highest
risk in Caucasians more than Africans and Asians. Some studies demonstrated an
increased risk of secondary cancers after ES treatment including radiation-induced
osteosarcoma or therapy-related acute myeloid leukemia but incidence of ES as a
second tumor after therapy is rare [53, 54].
2.3 Localization, histopathology and staging
ES mainly arises as a primitive tumor of flat, short and long bones. In the appendicular
skeleton, femur is the most common localization followed by tibia, humerus, fibula, and
forearm bones. In the trunk, the most frequent localization is the pelvis, followed by
vertebrae and sacrum, scapula, ribs, and clavicle. In long bones ES can arise from
midshaft but may involve a larger portion or even the entire bone. Skull, hands and feet
involvement in rare. More frequently, ES presents as a permeative, infiltrative, poorly
defined osteolysis. The cortex is normally breached or destroyed by the tumor while
rarely the tumor remains intramedullary. ES is very soft, grayish and can be hyperemic
or hemorrhagic. In the center it is normally necrotic, with a semiliquid appearance.
Microscopically, the tumor is composed of small round cells closely packed and without
matrix. Cytoplasm is scarce, pale, granular, and clear to eosinophilic with poorly
defined limits. Nuclei are round/oval, with a distinct nuclear membrane and powder-like
chromatin, with one or more tiny nucleoli (Figure 1). Current staging of ES was
proposed by Enneking: EW I, solitary intraosseous; EW II, solitary extraosseous; EW
III, multicentric, skeletal; EW IV, distant metastases [55].
10
Figure 1. Histologic and radiographic appearance of Ewing sarcoma [56].
2.4 Course and diagnosis
Pain is the earliest symptom of ES together with swelling in a bone or joint. Systemic
symptoms such as weight loss and fever can be associated but sometimes lead to
erroneous diagnosis. ES usually displays an aggressive growth beside some cases where
ES remains intraosseous have been described. Metastases from ES at presentation are
about 20 to 25% and sites of metastases are the lungs in 50 percent of cases, bone in 25
percent of cases, and bone marrow in 25 percent of cases. Limph nodes and brain can
also be involved in metastases from ES [56]. In some cases, presence of multiple bone
lesions at diagnosis makes difficult to distinguish between metastases and a multicentric
origin of primitive tumor. The five-year survival rate is 60% in patients who present
with primitive tumor while it decreases at 30% in patients with metastasis. The ten-year
survival rate accounts 55% [57]. The poor prognosis of ES is due to both tumor
aggressiveness, as it displays an elevated rate of recurrence and metastases, and
secondary diseases caused by chemotherapy and radiotherapy [58]. Diagnosis of ES
requires a multidisciplinary approach involving immunological, genetic and imaging
techniques. Absence of exclusive morphologic characteristics of ES made the diagnosis
of this tumor difficult up to the 90’s when EWS-FLI1 fusion gene was discovered and,
consequently, the molecular analysis was introduced in the clinical practice. Biopsy
from at least two sites of the tumor should be obtained for pathological, cytogenetic and
molecular studies. In addition, as ES metastatizes to bone marrow, patients must
undergo bone marrow aspiration and biopsy at two or more sites [56]. Plain radiographs
and magnetic resonance imaging of the entire affected bone should be included in the
evaluation.
11
2.5 Cell of origin
The histogenesis of ES remains unknown despite the efforts and numerous studies
performed in this field. Many groups proposed different origins of this tumor but the
most accredited hypothesis are two: neural and mesenchymal histogenesis. The neural
hypothesis arises from the observation that EWS-FLI1 rearrangement is a common
feature between ES of bone and PNET. In addition, different studies evidenced that both
osseous [59] and extra-osseous [60] ES cell lines undergo neural differentiation upon
stimulation with differentiating agents. In particular, the study from Cavazzana et al.
evidenced that, in five osseous ES cell lines, treatment with AMPc +/- NGF induced
marked morphologic evidence of neural differentiation including neural filaments,
synthesis of neuron-specific enzymes such as cholinesterases and NSE, and expression
of neural tissue cytoskeleton proteins (NFTP). In that study, the authors strongly
provided evidences for neural histogenesis of ES and suggested a close relationship
between ES and peripheral neural tumors [59]. In the study from Noguera et al., the
authors evaluated the capability of three extra-osseous ES cell lines to differentiate
toward a neural and muscular direction upon stimulation with dibutyryl cyclin
adenosine-monophosphate (db cAMP) and 5-azacytidine, respectively. A neural but not
myoblastic differentiation was observed as all the cell lines expressed neural markers
including chromogranin, S-100 protein, and glial fibrillary acidic protein [60]. More
recently, it has been demonstrated that forced expression of EWS-FLI1 in a
rhabdomyosarcoma cell line induced cell morphology changes resembling ES cell
particularly through modulation of EWS-FLI1 target genes involved in neural crest
differentiation [61]. In parallel, several studies explored the hypothesis of a
mesenchymal origin of ES particularly through modulation of EWS-FLI1 expression in
different cellular models. Studies conducted on mesenchymal stem cells (MSC)
evidenced that forced expression of EWS-FLI1 blocked differentiation along osteogenic
and adipogenic lineage, accordingly with the undifferentiated phenotype of ES, [62] as
well as myogenic differentiation in a murine myoblast cell line [63]. Successive studies
confirmed that marrow-derived mesenchymal cells could be the progenitor of ES as
EWS-FLI1 expression induces acquisition of EWS-specific morphological features [64]
and because these cells are particularly permissive for EWS-FLI1 oncogenic
transformation also as unique event [64, 65]. On the opposite site, silencing of EWSFLI1 in different ES cell lines caused convergence toward the MSCs gene profile and
induced expression of specific MSC markers such as CD44, CD54, CD59, CD73.
Moreover, EWS-FLI1 silencing induces ES cells to differentiate along the adipogenic or
adipogenic lineage upon treatment with appropriate differentiation agents [66].
12
2.6 Molecular biology of Ewing sarcoma
Conventionally, bone sarcomas or soft tissues can be cytogenetically distinguished in
two groups: one group characterized by simple near-diploid karyotype with few
chromosome rearrangements and one group with a complex karyotype and a severe
disturbance in genomic stability [67]. ES belongs to the simple karyotype sarcomas
group as it carries a tumor-specific recurrent chromosome aberration leading to the
fusion of the EWSR1 gene with one of several members of the ETS family of
transcription factor [68], as previously cited. In 85% of the cases, patients express the
t(11;22)(q24;q12) translocation which product is EWS-FLI1 chimeric protein [69]. In
10-15% of the cases, the translocation t(21;12)(22;12) leads to the fusion of EWSR1 to
ERG while others translocations are rare and account 1 to 5% of the cases (Table 1).
Table 1. Translocations and fusion gene in ESFT.
Translocation
Fusion gene
Frequency (%)
t(11;22)(q24;q12)
EWS-FLI1
85
t(21;22)(q22;q12)
EWS-ERG
10
t(7;22)(p22;q12)
EWS-ETV1
<1
t(17;22)(q21;q12)
EWS-ETV4
<1
t(2;22)(q33;q12)
EWS-FEV
<1
The chimera holds the amino terminus of EWSR1 gene and the carboxy terminus of the
ETS gene acting as an aberrant transcription factor. EWSR1 gene, located on
chromosome 22, belongs to a subgroup of RNA-binding proteins called the TET family
and is ubiquitously expressed. Proteins of this family hold a central RNA-binding motif
and three regions rich in glycine, arginine and proline, interacting with RNA [69]. EWS
is a nuclear protein that appears to be recruited to promoter regions acting as a
promoter-specific transactivator upon association with other factors [49] such as RNA
13
polymerase II, TFIID and CBP/p300 [70]. In addition, the N-terminus domain is rich in
glutamine and it stimulates transcription if fused with DNA-binding domains, as
described in ES [71]. In most of the cases, the fusion gene interests EWSR1 and FLI1,
located on chromosome 11 (Figure 2). In particular, genes breakpoints most commonly
interest exon 7 of EWSR1 and exon 6 of FLI1 (type 1 fusion), showing a lower
transactivation potential than a second variant interesting EWSR1 exon 7 and FLI1 exon
5 (type 1 fusion). This lower transactivation potential appears to correlate with a higher
relapse-free survival of ES patients [72]. The resulting fusion protein holds 264 amino
acids of EWSR1 and 233 amino acids of the C-terminus portion of FLI1.
Figure 2. Representation of EWS-FLI1 chimera resulting from
t(11;22)(q24;q12) translocation [73].
Breakpoints can occur in different sites of the genes and result in several isoforms of the
chimera: variations interest 264-348 amino acids of EWS and 191-324 amino acids of
FLI1. EWS-ETS fusion proteins act as aberrant transcription factors modulating the
expression of target genes in a sequence-specific manner that is determined by the ETS
component under the control of potent EWS transactivation component [49]. In vitro
studies demonstrated that forced EWS-FLI1 expression is transforming in NIH3T3
murine fibroblasts while its silencing, via antisense RNA or short interfering RNA
(siRNA), caused growth inhibition, apoptosis, decreased anchorage-independent growth
and tumorigenicity in vivo [74-79]. By contrast, EWS-FLI1 expression in mouse
embryonic fibroblasts or human primary fibroblasts failed to induce transformation and
resulted in growth arrest and apoptosis [80, 81]. These last results underlie the
importance of a specific cellular context for EWS-FLI1-mediated oncogenesis [73].
Beside not so extensively studied, all the EWS-ETS fusion proteins act as aberrant
14
transcription factors and induce the same transformed phenotype. Beside other EWSETS rearrangements have not been so extensively studied, evidences suggest that all
EWS-ETS proteins act as aberrant transcription factors that can regulate gene
transcription and transform cells [72]. Explanation of this common behavior could be
the loose specificity of ETS proteins for target genes [82] and the contemporary high
homology in the DNA-binding domain [72]. Nevertheless, some functional differences
have been observed between the various translocations: oncogenic transformation in
NIH3T3 cells could be induced by EWS-FLI1, EWS-ERG and EWS-FEV but not by
EWS-ETV1 and EWS-ETV4 [83]. Another difference regards the location of the tumor
as in one study 11 cases on 12 harboring EWS-FEV, EWS-ETV1 or EWS-ETV4
presented extraosseous tumors but explanations are unknown. Overall, further studies
are needed to better understand these differences. In addition, non-EWS fusions have
been identified in less than 1% of cases. TET proteins family includes EWS, TLS and
TAF15 and TLS/ERG or TLS/FEV have been described in some ES patients adding
complexity to the ES biology. It is generally assumed that TET-ETS proteins function
in a similar fashion compared to EWS-FLI1 but further studies will be necessary [70].
As oncogenic processes are due to the aberrant transcriptional activity of the chimera,
several studies have been performed to identify EWS-ETS target genes. From this point
of view, RNA-interference (RNAi) based approaches, microarray technology and ChIP
analyses have been useful tool to identify a large number of genes dysregulated by
EWS-FLI1. Studies have demonstrated that NR0B1, NKX2.2, GLI1 are up-regulated by
EWS-FLI1 and possess a critical relevance in oncogenic transformation. On the other
side, EWS-FLI1 deregulates genes involved in cell proliferation, evasion of apoptosis,
drug-resistance, cell cycle control, angiogenesis. Particularly, the chimera up-regulates
PDGFC, IGF-1, MYC, CCND-1 e NKX2.2 while down-regulates p21, p57, TGFβRII
and IGFBP3 [70]. Some studies suggest that EWS-FLI1 oncogenic activity may also be
mediated by some DNA-binding-independent mechanisms. Indeed, expression of EWSFLI1 molecules with point mutations or large deletions in the ETS in NH3T3 cells were
still able to induce tumors in mice [84].
Additional chromosomal changes that are frequently found in ES include gain of
chromosome 1q (32%) and chromosome 2 (29%), trisomy of chromosomes 8 (67%),
and 12 (29%), losses of 9p (23%) and 16q (32%) [85, 86]. In addition, patients with
primary tumor with low copy number changes (≤ 3 copy number aberrations) show a
significant better prognosis in terms of overall and event-free survival respect to those
with a high number of alterations [86]. Homozygous deletions of CDKN2A, encoding
p16INK4a, has been observed in 10 to 30% of the cases and is associated with poor
prognosis when combined with co-presence of mutations on p53 [87]. Inactivating point
15
mutations of TP53 are present in 4-14% of cases and are associated with poor outcome
when compared to patients with wild type p53, defining another subgroup of patients
with poor clinical outcome [88]. Recently, as performed in other tumor types, the
genomic landscape of ES has been explored with next generation sequencing techniques
in order to identify additional molecular alterations that could be associated with tumor
aggressiveness. The results demonstrate that ES genome is very stable with a low
somatic mutational rate, compared to other tumors. Indeed, results from three different
groups highlighted just one genetic mutation more together with those previously
described. In particular, they discovered inactivating mutations on cohesin complex
subunit STAG2 in 21.5% of tumors [89-91] and STAG2 mutations were found
associated with poor overall survival [91]. This low mutational rate could be due to the
short amount of time of pediatric cancers to accumulate passenger mutations or to a
preponderant epigenetic- more than genetic-driven oncogenesis in pediatric tumors. In
addition, this could be a specific feature of fusion-driven cancers [89]. From the clinical
point of view, this paucity of mutations represents a limitation for the identification of
targetable pathways [90]. Overall, the results further highlight the importance of EWSETS rearrangements in this tumor type. As previously mentioned, EWS-FLI1 requires a
specific cellular environment to induce oncogenic transformation. Some critical factors
that have been identified include the presence of an intact insulin-like growth factors
(IGF) system and the expression of CD99, a 32kDa integral membrane glycoprotein
expressed in 90% of the cases. EWS-FLI1 directly affects at transcriptional level the
expression of important components of the IGF system thus creating the loop IGF1/IGF-1R sustaining cell growth [92]. CD99 acts as an oncogene in ES cells as
triggering of this molecules induces apoptosis and inhibition of growth in vitro and in
vivo and prevents normal neural differentiation [93, 94]. Considering its high
expression, it is considered a diagnostic biomarker together with neuron-specific
enolase (NSE), S-100, synaptophysin and, depending on the level of neural
differentiation, vimentin, cytokeratin and neurofilament [73].
2.7 Treatment
ES treatment is based on a combination of chemotherapy, surgery, and radiotherapy
[95]. The standard approach is given by local treatment of the tumor (surgery and/or
radiotherapy) and cycles of systemic chemotherapy (pre- and postoperatively). Surgery
16
plays an essential role in treatment of primary tumor, especially to avoid radiotherapy,
but it is not always feasible. Conventionally, in case of localized disease neo-adjuvant
chemotherapy is applied for a local control and to facilitate surgery. Chemotherapy
response is than monitored to evaluate clinical response and modulate adjuvant
chemotherapy. Chemotherapy is used as a combination of six drugs: cyclophosphamide,
ifosfamide, adriamycin, vincristine, dactinomycin D, and etoposide. Multicentric
clinical studies demonstrated an higher efficacy for the association of 4 drugs including
cyclophosphamide, adriamycin, vincristine, and dactinomycin D more than an
association of 3 drugs or the single drugs alone. Patients with metastatic disease remain
a therapeutic challenge. Patients with metastasis at diagnosis show a worse prognosis
when treated with the same regimen utilized for localized disease. For these patients a
more aggressive treatment is necessary and consists of higher doses and a reduced time
between cycles of treatment followed by myeloablative therapy and stem-cells
transplantation [56]. Overall, such aggressive treatment causes severe side effects.
Therapy amelioration represents an urgent need for ES and particularly for patients with
metastatic disease. Unfortunately, few new drugs are available for ES treatment and
always are less effective than conventional drugs. Innovative therapeutics have been
developed based on biological features of ES cells. In ES, IGF-1R represents an
attractive target of both monoclonal antibodies (MAb), including AVE1642, CP751,871, IMC-A12, and tyrosine kinase (TKI) inhibitors, including AEW-541 and
ADW742. These agents showed good preclinical results but poor clinical effects with
just a 10% of patients experiencing relevant benefits [96] especially for mechanisms of
innate or acquired resistance. Considering its elevated expression in ES cells and its key
role in ES malignancy, CD99 molecule has been considered as potential therapeutic
target. Recently, a new anti-CD99 MAb scFvC7 has been described showing benefits
based on its specificity to ES cells. Trabectedin, ET-743, is an alkylator agent with
antitumoral activity in different tumors, particularly those bearing translocations. In
myxoid liposarcoma, Trabectedin down-regulates the binding of FUS-CHOP fusion
gene product to promoter regions of its target genes. Some studies demonstrated that,
similarly, Trabectedin interfers with EWS-FLI1 activity [97]. In ES, clinical trials have
been performed showing an insufficient activity of this agent as monotherapy but a
good tolerability with low side effects [98, 99].
17
3. Prostate cancer
3.1 Epidemiology and risk
The first case of prostate cancer (PCa) was diagnosed by histological examination in
1853 by J. Adams, a surgeon at The London Hospital, who described this condition as
“a very rare disease” [100]. Today, PCa is the second most diagnosed cancer in adult
men and the sixth cause of death in males accounting for 14% of new cancer cases and
6% of cancer death worldwide. Incidence of PCa is 2 to 5 times higher in developed
countries compared with developing countries as a result of a set of risk factors and
diagnostic procedures [101]. Several risk factors have been identified during the years
and, despite no preventable factors exist, a general knowledge about them should be
maintained. Advanced age is the principle cause of PCa as most of the cases are men
over the age of 65 while it is rarely seen in men younger than 40 years. Autopsy data
indicate a 90% of prevalence in men ages 70 to 90 indicating more men will die with
PCa more that for it [102]. The second most common risk factor is the race with the
highest risk in Africans, intermediate in Caucasians and lowest among Asians [103].
The role of ethnicity is still unclear but may be related with a combination of
socioeconomic, environmental and dietary factors. Family history of PCa is a third well
established risk factor for the disease [104]. Particularly, the risk of PCa is two times
increased in men with a first degree relative and is even higher if the relative was
diagnosed at an age younger than 60 [105].
3.2 Prostate anatomy and histology
In men, prostate is a partly glandular and muscular organ surrounding the urethra at the
base of the bladder. Together with seminal vesicles and bulbourethral glands, prostate
represents an accessory gland of reproduction as its primary function is to secrete an
alkaline fluid forming part of the ejaculate, which aids in motility and nourishment of
the sperm. This fluid (pH 7.29) is rich in lipids, proteolytic enzymes, acid phosphatase,
fibrolysin and citric acids. The smooth muscle part of prostate helps semen expulsion
during ejaculation. The prostate gland is surrounded by the prostatic capsule and
18
neurovascular bundles outside of the capsule are responsible for erectile function.
According to the classic work of McNeal [106-108] , the prostate gland is characterized
by three major glandular regions: central, transition and peripheral zones (Figure 3). A
fourth zone is an anterior fibro-muscular zone lacking glandular components as it is
composed of muscle ad fibrous tissue. The central zone refers a vertical wedge of
glandular tissue lateral to each ejaculatory duct. A narrow band of stroma separates the
central zone from peripheral zone. Transition zone was found to lie in the convexity of
the peripheral zone. Differences between the three areas were described in terms of
stroma and glandular architecture. At histological level, prostate contains a
pseudostratified epithelium with three differentiated epithelial cell types: luminal, basal
and neuroendocrine [109-111]. Luminal cells form a continuous layer of polarized
columnar cells that produce protein secretions and express markers including
cytokeratins 8 and 18 and high levels of androgen receptor (AR). Basal cells are located
under the luminal cells and express p63, cytokeratins 5 and 14 but low or undetectable
levels of AR. Neuroendocrine cells are rare cells, which function is unknown,
expressing endocrine markers but no AR. In 75% of cases, PCa develops in the
peripheral zone while benign prostatic hyperplasia (BPH) develops in the transition
zone [112].
Figure
3.
Sagittal
diagram of adult human
prostate showing distal
urethra (UD), proximal
urethra
(UP)
and
ejaculatory duct (E).
Three major glandular
zones are shown: central
zone (CZ), peripheral
zone (PZ) and transition
zone (TZ) [113].
19
3.3 Diagnosis and staging
From a clinical point of view, patients with PCa at early stages are mostly
asymptomatic. Lower urinary tract symptoms including weak stream, urgency,
frequency, nocturia, incomplete emptying and incontinence may be present but are
common with benign prostatic hyperplasia. Patients with PCa may also present
hematuria, hematospermia and erectile dysfunction. Urinary symptoms must be
accompanied by further analysis in order to distinguish PCa from inflammatory
disorders or hyperplasia. In advanced disease, patients may present bone pain in
different locations including hips, back and pelvis, or unexplained anemia [114]. In
95%, PCa refers to an adenocarcinoma, originating from prostate gland epithelial cells
in peripheral zone and with luminal phenotype. However, other categories of PCa exist
such as ductal adenocarcinoma, mucinous adenocarcinoma and neuroendocrine prostate
cancer but are extremely rare [115]. Diagnosis of PCa is performed by a histologic
evaluation of prostate tissue sampled from a prostate needle biopsy. However, the
decision to perform a biopsy depends on prior Prostate Specific Antigen (PSA)
evaluation and digital rectal examination (DRE) findings as well as on age, ethnicity
and co-morbidities. PSA is a serine protease of the Kallikrein family produced by the
prostate and a component of seminal fluid important for ejaculation. Serum evaluation
of PSA for early PCa detection is part of the clinical practice since the 1980s [116].
Normal PSA value ranges from 0 to 4 ng/ml while it is found increased in case of PCa
as well as BPH, infections, ejaculation within 48 hours of serum evaluation, trauma and
age. For this reason, PSA serum evaluation remains an imperfect test. Nevertheless,
prostate biopsy is recommended for men with a serum PSA ≥ 4.0 ng/ml regardless of
DRE [117]. DRE is limited because it allows palpation of the posterior surface of the
gland but it is performed regardless of PSA analysis results. Men with positive DRE are
directed toward a biopsy independently on PSA serum levels. Considering the
limitations of both PSA evaluation and DRE, research of new biomarkers for early
diagnosis of PCa with characteristics of high specificity and sensitivity represent an
urgent need for this tumor. Transrectal ultrasound-guided needle biopsy represents the
main method to obtain prostatic tissue. The number of biopsies rage from 8 to 16 and
most of the tissue is sampled from the peripheral zone. The most common
complications of this procedure are hemorrhagic including hematuria, hematospermia
and hematochezia [118] thus patients taking antiplatelet drugs should discontinue the
treatment. Prostate biopsy is then categorized by the pathologists using a grading system
known as the Gleason Scoring system. This system was described in the 1960s and it
20
characterizes prostate tumor architecture and morphology. In addition, Gleason score
represents the strongest clinical predictor of PCa progression [119]. The Gleason system
assigns a grade to the two largest areas in each biopsy specimen. Grades span from 1 to
5 where 1 is the least aggressive and 5 is the most aggressive. The two numbers are
added and men diagnosed with a Gleason grade 7 or more are at increased risk of
extraprostatic extension, recurrence after initial therapy and more likely to die for the
disease. On the opposite side, men with Gleason minor that 7 have a low risk of cancerspecific death. In a study published in 2011 from Eggener et al. the overall 15-year PCa
specific mortality rate was evaluated in a cohort of more than 10000 patients treated
with radical prostatectomy. The results showed that the probability of death from PCa
varied by the age of the patients ranging from 0.6-1.2% for Gleason 6 or less, 4.7-6.5%
for Gleason 3+4, 6.6-11% for Gleason 4+3, and 22-37% for Gleason 8 or higher [120].
The staging of PCa is determined by PSA value, DRE findings, prostate biopsy results,
and Gleason score and it is important to establish the treatment options for the patients.
Staging is divided between clinical and pathological: clinical staging is based on clinical
findings such as PSA, DRE and imaging while pathologic staging is based on tissue
diagnosis and relies on the TNM system developed by the American Joint Committee
on Cancer. The TNM system describes the extent of tumor (T), lymph node
involvement (N), and presence of metastatic disease (M). Each category is further
divided in subcategories. Extent of the tumor is divided into T1-T4 with higher T
indicating higher involvement of the prostate and surrounding structures. Node category
is divided in 0 or 1 indicating lymph node involvement. Metastatic disease is
categorized in 0 if the disease is not spread or 1. Considering all these parameters,
patients are classified as “low-“, “intermediate-“ or “high-“ risk.
3.4 History of prostate cancer
Heterogeneity and multifocality represent two main characteristics of PCa posing
significant difficulties both at clinical and research level. Histological inspection of PCa
tissue reveals the high heterogeneity of this tumor type as it is characterized by
juxtaposition of benign glands, preneoplastic foci, and neoplastic foci of varying
severity [115]. Regarding multifocality, it has been widely described that, within a
section of PCa, individual genetically distinct neoplastic lesions, even in close
proximity, can be present. This evidence suggests multiple neoplastic foci may emerge
21
and evolve independently [121]. The main mediator of PCa development, as well as
normal prostate, is the AR. Particularly, AR sustains the proliferation of tumor cells
with its transcriptional activity upon stimulation of androgens. The most abundant
androgen is testosterone that is activated by 5a-reductase in dihydrotestosterone. In PCa,
AR suppresses proliferation of basal cells, supports survival of luminal cells and
promotes metastasis as demonstrated by studies in mice [122].
3.4.1
Cell of origin
Several studies have been conducted in mice to determine the cell of origin of PCa.
Considering the luminal phenotype of human PCa, the cell of origin should correspond
to either a luminal cell [123, 124] or a basal cell that can differentiate into luminal
progeny following oncogenic transformation [125]. Particularly, studies of PSA-Cre;
Ptenflox-flox mice suggested a luminal population corresponding to the cell of origin in
this model [126]. Analysis of Probasin-Myc and Nkx3.1-Myc transgenic mouse lines
suggested the same luminal origin [127]. In addition, histopathological evidence of
MYC expression in preneoplastic lesion is in line with the luminal origin of this tumor
as MYC is exclusively expressed by luminal cells but not basal cells [128]; similar
results have been reported with respect to telomere shortening [129] and the androgen
related-TMPRSS2-ERG fusion gene as AR is expressed by luminal cells [130]. On the
opposite side, different studies reported strong evidences regarding the basal origin of
this tumor. In the paper from Goldstein et al. it is demonstrated that injection of the
mixture of urogenital sinus mesenchyme (UGSM) with human prostate basal or luminal
cells into immunodeficient NOD(-)SCID(-)IL(-)2Rg-/- mice induced adenocarcinoma
when using basal cells but not luminal [125]. Another study conducted in Pb-Cre4;
Ptenflox/flox mice showed an expansion of basal cells as well as intermediate cells
coexpressing basal and luminal markers in tumors [131]. More recently, an analysis of
basal and luminal epithelial populations from mouse prostate has shown that basal cells
are more readily transformed by lentiviral expression of ERG and AR in tissue
reconstitution experiments [132]. Overall, these data indicate that despite all the
information obtained until now, further studies are necessary to better elucidate the
origin of this tumor. It remains unclear, whether different cells of origin are used in PCa
initiation [123].
22
3.4.2 Prostatic intraepithelial neoplasia (PIN)
PIN is a specific type of lesion that is believed to represent the primary precursor of
human PCa beside this relationship has not been demonstrated conclusively [133]. At
histological level PIN is characterized by the appearance of luminal epithelial
hyperplasia, reduction in basal cells, enlargement of nuclei and nucleoli, cytoplasmic
hyperchromasia, and nuclear atypia and increased expression of cellular proliferation
markers, in case of high-grade PIN [123] (Figure 4). PIN can be found as low-grade or
high-grade forms with high-grade form thought to represent the precursor of early
invasive carcinoma as demonstrated by different evidences. PIN lesions are found in
peripheral zone [134] and the features of high-grade PIN lesions generally precedes
those of carcinoma by at least 10 year, according with the idea of cancer progression
[135]. In addition, PIN lesions are multifocal as demonstrated by allelic imbalance
analysis and chromosomal abnormalities found in PIN are similar to those of early
invasive carcinoma [136, 137]. Architectural and cytological features look like those of
invasive carcinoma including disruption of basal layer [138]. Eventually, PIN lesions
express markers of differentiation commonly altered in early invasive carcinoma
including E-cadherin and vimentin [139, 140]. On the opposite side, exclusive PIN
characteristics include intact basement membrane [138], no PSA expression [140],
similarity between PIN histological characteristics and premalignant lesions of the
breast [141]. In addition, PIN lesions show architectural and cytological characteristics
that are not believed to be precursor features of prostate cancer [123].
Figure 4. Histopathology of human PCa. Hematoxylin-eosin-stained section of human (A)
benign normal tissue, (B) PIN, (C) well-differentiated adenocarcinoma, (D) poorlydifferentiated adenocarcinoma [123].
23
3.4.3 Latent and clinical cancer
Prostate carcinogenesis is a process of 20-30 years or more starting as a proliferative
inflammatory atrophy (PIA), passing through PIN and in some cases leading in a
carcinoma. Evidences suggest that one of the cause predisposing to cancer development
could be a prostate inflammation due to infectious agents or ingestion of carcinogens. In
addition, an inherited genetic background could also make an individual more
susceptible to prostate tumorigenesis but implicated genes must be discovered yet [142].
Clinically, PCa can be divided in two main groups: prostate tumors able to spread that
will end up being lethal with a clinical relevance, and others indicated as latent that are
relatively indolent [143]. Autopsy studies have indeed demonstrated that almost 70% of
men have a tumor in the prostate at the time of the death but with no clinical relevance.
It has been estimated that 15-30% of males over the age of 50 and 80% of males over 80
years of age harbor microscopic, latent PCa [144]. In addition, it is fatal for only 3% of
men. From this point of view, PSA evaluation doesn’t represent an useful biomarker as
it is informative of an organ- but not a disease-specific affection and PSA does not
distinguish which type of PCa a man may have i.e. a cancer that will never cause a
problem, a clinically relevant tumor that will cause morbidity and mortality if left in
place or an incurable, metastasizing form [142]. Nowadays, the main challenges in the
field of PCa research include the discrimination of the two forms of the disease, latent
or clinically relevant, and consequently the identification of which men can be cured
with treatment and which not require treatment avoiding treatment-induced morbidities.
3.4.4 Metastasis
The primary site for PCa metastasis is invariably the bone, where characteristics
osteoblastic lesions are formed [145]. Secondary sites are represented by lung, liver and
pleura [146]. Metastatic disease accounts for more than 90% of deaths associated with
PCa and almost 90% of patients dead for PCa die of metastatic bone disease [147]. Most
of bone metastasis are classified as osteoblastic, based on the radiographic appearance
of the lesions indicating a deregulation of bone resorption and formation processes.
Bone metastasis occur when PCa single cells, with acquired characteristics of motility
and invasiveness, detach from epithelial sheet, reach the circulation, adhere to bone
24
marrow endothelial cells and migrate to the bone [148]. In patient, bone metastatic
lesions cause severe bone pain, skeletal fracture, hypercalcemia, and spinal-cord
compression [149]. Mechanisms by which PCa cells form preferentially bone metastasis
and particularly osteoblastic skeletal lesions are overall unclear but numerous studies
have been conducted. Firstly, according to Paget’s seed and soil theory [150], several
bone paracrine factors contribute to the tropism of circulating PCa cells to the bone
mediating the interaction between disseminated cells and resident bone cells [148].
From this point of view, this process involves a variety of adhesion molecules expressed
by endothelial cells and PCa cells including CXCR4 [151], cadherin 11 [152], monocyte
chemotactic protein-1 (MCP-1) and its receptor CCR2 [153]. Secondly, osteoblastic
lesion is the result of the release of factors that stimulate osteoblast proliferation,
differentiation and consequently uncontrolled bone formation by metastatic cancer cells
[154]. This last process is also due to the osteo-mimicry capability of tumor cells. It is
still to be clarify whether cancer cells already possess osteomimetic phenotype or it is
acquired in the bone marrow. Anyhow, PCa cells are able to express factors involved in
normal bone development and remodeling. Osteoblastic differentiation is a complex
process regulated by several factors including bone morphogenetic proteins (BMPs),
insulin-like growth factor (IGF)-1 and -2, transforming growth factor-β1 (TGFβ1) and
TGFβ2, fibroblast growth factor (FGF), the transcription factor RUNX2 [148].
Interestingly, the same pathways are implicated in the activation of resident bone and
bone marrow cells induced by PCa cells [155-157].
3.5 Molecular biology of prostate cancer
PCa progression is accompanied by genetic alterations and molecular pathways holding
a specific significance in each stage. Emergence of large-scale sequencing studies of
cancer genomes has allowed the identification of the elevated molecular heterogeneity
of tumors including PCa [158]. Extensive genomic analysis in PCa have been
performed and both copy number variations and translocations have been identified as
the most common genetic alterations. One information that is still lacking is whether
there is a temporal sequence associated with this events or they are casually related
[123]. Mutations of AR represent one well-established alteration in this disease and they
are mostly related with castration-resistant stage. AR is amplified in one third of the
cases while 10-30% of tumors present gain-of-functions mutations. Recently, alternative
25
splice isoforms encoding constitutive active AR variants have been identified in
castration-resistant tumors. In addition, some studies identified the endogenous
expression of androgen synthetic enzymes in tumor tissue as a mechanism to activate
AR [123]. Around 85% of PIN lesions and adenocarcinomas display loss-ofheterozigosity (LOH) of chromosome 8p21.2 causing the deletion of a region containing
the NKX3.1 homeobox gene [159]. NKX3.1 is an oncosuppressor gene with a relevant
role in prostate epithelial cells differentiation [160]. Accordingly, NKX3.1 expression
was found low expressed in series of PCa and metastasis or completely lost in advanced
cancers [161]. Studies conducted in mice with the purpose to elucidate the role of
NKX3.1 in cancer initiation evidenced that NKX3.1 inactivation causes a defective
response to oxidative damage while its expression in PCa cell line protects against DNA
damage [162, 163]. MYC oncogene has been found amplified in a subset of advanced
PCa [164] while other studies found an up-regulation of MYC in PIN lesions and
carcinomas in absence of gene amplification suggesting an altered regulation of MYC
[128, 165]. MYC overexpression in mice induces PIN lesions, carcinoma and metastasis
[166] and expression of MYC is sufficient to immortalize human prostate nontumorigenic cells [123]. In 2005, the group of Tomlins et al. described chromosomal
rearrangements involving the androgen-responsive promoter of TMPRSS2, on
chromosome 21, and one of the ETS transcription factor family gene. The most
common of these rearrangements involves ERG, located on chromosome 21, and results
in the TMPRSS2-ERG fusion gene. This rearrangement, which can be due both to
deletion or translocation, causes an androgen-related over expression of transcription
factor ERG. A small percentage of cases contains fusions with other ETS transcription
factors as well as with promoter fusion partners other than TMPRSS2. Fusion genes
have been identified involving ETV1 and ETV4 ETS genes while TMPRSS2 was found
replaced by untranslated regions from the prostate-specific androgen-induced gene
SLC45A3 [167]. TMPRSS2-ERG is expressed in 15% of PIN lesions and in 50 to 70%
of localized PCa cases indicating it is an early event in this tumor [29]. Some evidences
indicate that the formation of this rearrangement could be due to the androgen receptor
activity itself that induces chromosomal proximity between the two genes following
DNA damage [130]. Alternative splicing events of the initial fusion transcripts induce
formation of more than eight fusion types which more frequently include the designated
type III form involving TMPRSS2 exon 1 fused to ERG exon 4 and the type VI
interesting TMPRSS2 exon 2 fused with ERG exon 4 [35]. It has been demonstrated
that cases expressing type VI isoform were more aggressive than those expressing type
III [168]. Studies exploring the functional significance of truncated ERG protein are
controversial but suggest that ETS activation promotes epithelial-mesenchymal
26
transition (EMT) and invasiveness [169-171]. Nevertheless, TMPRSS2-ERG has been
reported as insufficient to induce a transformed phenotype but instead to cooperate with
other mutations [172]. The product of the fusion gene in PCa is a constitutive
expression of ERG with a consequent deregulation of transcriptional pattern of the cells
expressing the fusion gene. ERG was found particularly up-regulated in peripheral zone
compared to transitional zone and analysis of deregulated genes indicated that
TMPRSS2-ERG-negative tissues were more similar to normal control, while
TMPRSS2-ERG-positive tissues displayed distinct deregulation of transcription [173].
Several studies have been focused on identification of target genes trying to elucidate
mechanisms mediating malignancy. ChIP analysis pointed out that PIM1 oncogene is a
direct target of ERG and that the consequent overexpression of PIM1 modifies cyclin
B1 levels in TMPRSS2-ERG-positive cells [174]. In vitro and in vivo studies evidenced
that ERG binds osteopontin (OPN) promoter. OPN is an extracellular matrix
glycophopshoprotein involved in the metastasis which is up-regulated by ERG [175].
Other target of TMPRSS2-ERG are represented by cysteine-rich secretory protein 3
(CRISP3), CACNA1D, PLA1A [176] but studies in this field are ongoing.
PTEN (phosphatase and tensin homolog deleted on chromosome ten) is a tumor
suppressor gene frequently altered in cancer and its protein represents a key mediator of
the oncogenic phosphoinositide 3 kinase (PI3K) pathway. A copy number loss of PTEN
has been described in PCa and it is considered as an early event in prostate
carcinogenesis [177] while PTEN loss in mice results in PIN or adenocarcinoma [178].
Loss of PTEN has been described to cooperate with other mutations including loss of
NKX3.1, up-regulation of c-Myc, and TMPRSS2-ERG fusion. More recently, recurrent
mutations with a role in PCa aggressiveness were found in SPOP, FOXA1 and MED12
genes [179, 180]. Up-regulation of Akt/PI3K pathway has been described in PCa as a
consequence of PTEN loss but also because of mutations interesting Akt1 [181] or the
p110β isoform PI3K [182]. Deregulation of this pathway has been particularly
associated with castration-resistant disease. In parallel, the MAPK signaling pathway,
including ERK (p42/44) and RAS or RAF, has been frequently found activated in
advanced disease [123]. Other alterations frequently found in PCa include deregulation
of oncogenic tyrosine kinases like Her2 or SRC [183, 184], up-regulation of the EZH2
gene, encoding for a histone lysine methyltransferase, which amplification has been
associated with aggressive tumors [185, 186]. In addition, the role of microRNAs
(miRNAs) in PCa has been widely investigated. In studies of miRNA expression
profile, a pattern discriminating between indolent from aggressive disease was
evidenced [187] as well as specific miRNAs were associated with castration-resistant
PCa [188]. miRNAs have been evidenced as regulators of important gene in PCa such
27
as PTEN, which expression is negatively regulated by the cluster miR-106b-25, or
EZH2 that is regulated by miR-101 [189]. In addition several miRNAs have been
associated with androgen receptor signaling including miR-125b, miR-21, miR-141,
others were found to be involved with cancer-related cell migration such as miR-141,
miR-143, miR-145. In addition, a serie of miRNAs was found associated with
metastasis: down-regulation of miR-16, miR-32a, miR-126*, miR-205, miR-146a was
found associated with metastasis while an up-regulation was found for miR-301 and
miR-125b [190]. Overall, data from molecular biology underlie the heterogeneity of this
tumor type and evidence that PCa can be considered as a collection of cancers [191]
characterized by sets of molecular alterations. The concept of molecular classification of
PCa can be useful in the perspective of personalized medicine as well as of
identification of subgroup of patients with different prognosis.
3.6 Prognosis and treatment
Potential prognostic factors have been investigated in PCa at clinical, pathological and
molecular level. Identification of prognostic biomarkers represents one of the main
challenges in PCa management especially to discriminate between indolent tumors,
which can be controlled by active surveillance, and tumors with aggressive behavior
requiring more radical treatment strategies. Patients are divided in risk groups predicting
biochemical relapse free survival, indicating increase in serum PSA after treatment, or
clinical relapse free survival [192]. The strongest clinical predictor of PCa is the
Gleason score where patients with Gleason 7 or more show increased risk of recurrence
or death after initial therapy. PSA levels at diagnosis is a standard risk factor for patients
stratification. Increased PSA at diagnosis is associated with poor outcome after
treatment [193]. Clinical, pathological and lymphnode pathological stages and margins
positivity are also considered determinants of PCa poor prognosis [194]. Together with
clinical parameters, many molecular and genetic factors have been investigated to better
individualize risk prediction [193] in cohort of patients undergone radical prostatectomy
or radiation therapy. First, numerous studies evaluated the association of TMPRSS2ERG and outcome of PCa patients obtaining controversial results. Recently, the study
conducted by Hägglöf et al pointed out an increased risk for PCa specific death for
patients expressing the fusion gene [195]. This data is not in accordance with previous
results obtained in two different studies [194, 196]. Nevertheless, the study by RubioBriones et al. pointed out that, beside without affecting prognosis, TMPRSS2-ERG
status classifies patients into groups defined by different clinico-pathological prognostic
28
factors with PSA, Gleason and margin status as prognostic factors in patients expressing
the fusion gene while clinical stage (cT), Gleason and margins displayed prognostic
relevance in non-expressors [194]. Molecular markers of PCa prognosis include Ki67
[197], loss of PTEN [198] or Akt mutations [199]. More recently, high speckle-type
POZ protein (SPOP) gene expression was found statistically associated with favorable
biochemical and clinical progression free survival [179] while elevated insulin-like
growth factor 2 binding protein 3 (IGF2BP3) serum levels were found associated with
poor prognosis [200]. In addition, miRNAs prognostic value was considered as well by
several studies. Particularly, a recent study evidenced miR-187 and miR-182 as
promising prognosis biomarkers in PCa [201]. Prognosis makers expression, extent of
the disease and patient age support the clinician in the decision of the most appropriate
treatment. Despite guidelines exist, the main purpose of all the efforts in the field of
biomarkers research is to address the patient toward a personalized treatment.
Consequently, patients will receive the most effective treatment with less side effect
avoiding useless and expensive therapies. Therapeutic options are thus different
considering, first of all, whether patient is affected by localized or advanced disease. In
case of localized disease, the therapeutic options are radical prostatectomy, radiotherapy
or cryotherapy. Surgical intervention for definitive treatment of PCa includes open
radical prostatectomy, laparoscopic radical prostatectomy and robot-assisted
laparoscopic radical prostatectomy. During the intervention the entire prostate gland and
seminal vesicles are removed. Radical prostatectomy side effects are erectile
dysfunction (ED) and urinary incontinence (UI). External beam radiation therapy (XRT)
means to deliver a curative dose of radiation to the prostate without damaging
surrounding tissues including bladder, rectum and bowel. Radiation therapy is a good
option for patients who are poor surgical candidates and radiation regimens must be
formulated based on risk levels. Side effects include urinary urgency and frequency,
dysuria, diarrhea, proctitis. Brachytherapy involves placing radioactive sources into the
prostatic tissues via needles, seeds, or wires under transrectal ultrasound guidance.
Rates of brachytherapy can be high- or low-dose where the low-dose-rate consists of
permanent implantation of “seeds”, whereas high-dose-rate is temporary. This therapy
is indicated for low-risk disease. Side effects are the same of XRT plus urinary
retention. Cryotherapy is a surgical intervention involving freezing of the gland. A
cryoprobe is inserted into the prostate through ultrasound guidance to a temperature of 100° to -200° for 10 minutes. Localized high-risk disease where prostatectomy is not
possible is indicated for this treatment. Complications include ED, UI, urinary retention,
rectal pain, fistula. Advanced disease refers to recurrent PCa following therapy, locally
recurrent disease, systemic recurrence, or clinical recurrence. Hormone therapy goal in
29
PCa is to reduce the levels of male hormones preventing the activation of AR and is
indicated for patients with advanced non metastatic disease . Castration can be carried
out surgically with orchiectomy or chemically with luteinizing hormone-releasing
hormone (LHRH) agonists. LHRH agonists most commonly used are leuprolide,
goserelin, triptorelin and histrelin and they can be used alone or in combination with
nonsteroidal antiandrogen like flutamide, bicalutamide, nilutamide. Unfortunately,
response to chemical castration lasts for 2 or 3 years before PSA begins to rise and in
that case patients are considered to have hormone refractory disease. In case of
refractory disease, secondary hormone therapy represents a therapeutic option. Overall,
hormone therapy has a significant impact on quality life with both acute- and long-term
effects. Acute side effects include fatigue, hot flashes, flare effects while long-terms
effects include cardiovascular disease, anemia, osteoporosis, sexual dysfunction.
Chemotherapy is used for the treatment of hormone refractory metastatic PCa and the
standard of care is docetaxel-based regimen. Docetaxel is administered in combination
with prednisone or mitoxantrone. Adverse side effects are myelosuppression,
hypersensitivity reaction, gastrointestinal upset, peripheral neuropathy. Patients with
bone metastasis should be considered for biphosphonate therapy with zoledronic acid.
Emerging therapies for the treatment of hormone refractory metastatic PCa are
cabazitaxel, abiraterone acetate, denosumab. Cabazitaxel is a microtubule inhibitor
approved for patients who have already been treated with docetaxel. Adverse effects
include neutropenia, gastrointestinal disturbance, renal insufficiency. Abiraterone
acetate is a second-generation anti-androgen drug that blocks the synthesis of androgens
through the inhibition of 17 α-hydroxylase/C17,20 lyase (CYP17A1). Denosumab is a
monoclonal antibody targeting RANKL, a protein involved in bone destruction. Side
effects indeed are hypocalcemia and osteonecrosi of the jaw [202].
30
4. The IGF system
The insulin-like growth factor (IGF) system includes three ligands (IGF-1, IGF-2 and
insulin), three receptors (IGF-1R, IGF-2R and insulin receptor - IR), and 6 IGF binding
proteins forming a family of extracellular proteins that bind IGF-1 and IGF-2 thus
regulating their bioavailability and activity [203, 204] (Figure 5). The IGF system plays
a pivotal role in normal growth and development and it mediates several aspects of
malignant phenotype in a variety of human malignancies [205].
Figure 5. Schematic representation of IGF system [206].
4.1 The receptors
The IGF system includes IGF-1R, IGF-2R, IR and hybrid receptors. IGF-1R and IR
evolved from an ancestral gene and display an elevated homology rate: 45 to 65% in the
ligand binding domains and 60 to 85% in the tyrosine kinase and substrate recruitment
domains. Together the two receptors control metabolism, growth, differentiation and
nutrient availability [207]. Beside the elevated homology, IGF-1R and IR carry out
different functions inside the cell. Particularly, IGF-1R regulates cell proliferation while
IR has a metabolic role. In vivo studies demonstrated that null mutants for IGF-1R
31
exhibit a severe growth deficiency (45% normal size) and die early for organ hypoplasia
[208] while mice lacking IR display an almost normal size (80-90%) but die for severe
hyperglycaemia and hyperketonaemia consistent with the preponderant metabolic
actions of IR [209]. The IGF-2R or cation-dependent mannose-6-phosphate receptor
does not share a phylogeny with IGF-1R and IR. It is considered an oncosuppressor as
down-regulates IGF-2 modulating its availability. In addition, loss of IGF-2R induces
an increase of body size in mice [210, 211].
4.1.1
IGF-1R
IGF-1R is a transmembrane tyrosine kinase receptor (RTK) constitutively expressed in
most cells and tissues and which role is mediate long term actions on growth and
development [212]. IGF1R gene, mapping to chromosome 15q25-26, comprises 21
exons and spans more than 100 kb. Control of IGF-1R gene expression takes place both
at transcriptional and post-transcriptional levels. Cloning studies pointed out that IGF1R promoter is regulated by cis- and trans-acting factors under physiological and
pathological conditions. The promoter is highly GC-rich (around 80%) and lacks TATA
and CCAAT boxes, normally required for efficient transcription initiation. Despite
absence of these motifs, transcription of IGF-1R is initiated within a unique initiator
element located around 1000 bp upstream of the ATG translation start codon [213].
The gene codifies for a single 180 kDa chain and IGF-1R cDNA is composed of 4101
nucleotides and predicts a 1367 amino acid precursor, including a 30 amino acid signal
peptide which is removed during translocation of the polypeptide chain. The 1337
amino acids left undergo a cleavage of the Arg-Lys-Arg-Arg sequence at position 707.
The resulting propeptide is glycosylated, dimerized and translocated to the Golgi
apparatus where it is cut by furin enzyme in α and β subunits [214]. Two αβ precursors
are attached by disulfide bonds forming heterotetrameric IGF-1R complex (β-α-α-β)
that is transported to the cytoplasmic membrane [215]. The N-terminal portion of IGF1R is glycosylated [216]. The mature IGF-1R is constituted by two α chains spanning
130-135 kDa and two β chains spanning 90-95 kDa, attached by disulfide bonds α-β, αα [217]. The two α subunits are completely extracellular and contain the ligand binding
sites. IGF-1R binds IGF-1 and IGF-2, but not insulin, with high affinity. Studies based
on the surface plasmon resonance technology demonstrated a difference of 4-fold in the
IGF-1R affinity for IGF-1 compared to IGF-2 [218]. The two β subunits are composed
32
of an extracellular portion containing 5 glycosylated sites, a transmembrane
hydrophobic region and the intracellular region holding domains involved in signal
transduction: juxtamembrane domain, tyrosine-kinase domain (TK), ATP binding site
and C-terminal portion [219].
4.1.2
IR
IR is expressed in liver, adipose tissue, skeletal muscle but also in brain, heart, kidney,
pulmonary alveoli, pancreatic acini, placenta vascular endothelium, monocytes,
granulocytes, erythrocytes, and fibroblasts [207]. This wide expression suggests that it
is functionally involved in multiple mechanisms, in addition to the metabolic role. IR
gene is located on chromosome 9 and it spans 120 kb containing 22 exons. The cDNA
was isolated by the groups of Ullich and Rutter in 1985 and revealed two insulin
receptor proreceptors sizes of 1343 and 1355 amino acids, respectively. This difference
is due to the inclusion or not of a 12-amino acids segment at the C-terminal end of the
IR α subunit. This segment is codified by exon 11, spanning 36 bp, that could be
alternatively spliced [220]. As a consequence, IR exists as two isoforms: isoform A (IRA), lacking exon 11, and isoform B (IR-B) containing exon 11. As IGF-1R, IR is a
heterotetrameric protein composed of two extracellular α subunits and two
transmembrane β subunits attached by disulfide bonds. The α and β chains are
synthesized by the same mRNA encoding for 1370 amino acids. The protein is cleaved
by furin into α and β subunits, glycosylated and processed into the Golgi apparatus. αsubunit contains 723 amino acids, with a molecular mass of 130 kDa while β-subunit is
composed of 620 amino acids with a molecular mass of 95 kDa. Similarly to IGF-1R,
the two subunits are involved in ligand binding and signal transduction, respectively.
The two isoforms of IR display different binding affinity. Insulin is equally bound by
IR-A and IR-B (EC50=0.2±0.2 nM e EC50=0.3±0.4 nM, respectively) [221]. A
substantial difference regards the binding of IGF-2 where IR-A displays a higher
affinity for IGF-2 compared to IR-B (EC50=0.9±0.4 nM e EC50=11.0±5.0 nM,
respectively) [221]. None of the two isoforms is able to bind IGF-1 (EC50>30 nM)
[222]. Exon 11 inclusion causes more differences between the two isoforms. IR-A is the
predominant IR isoforms in fetal tissues where mediates mitogenic effects while IR-B
appears in postnatal life in insulin-target tissues including liver, muscles, adipose tissue
regulating glucose metabolism [223]. Recently, IR-A has been found up-regulated in
different tumor types accordingly to studies performed on murine 32D cells indicating
33
that IR-A induces mitogenic and anti-apoptotic signals while IR-B induces
differentiation stimuli [224]. Considering that IR-A is capable to bind both insulin and
IGF-2, it has been demonstrated that the receptor induces mitogenic signals upon IGF-2
binding while metabolic upon insulin binding [207].
4.1.3
Hybrid receptors
In cells expressing both IGF-1R and IR, hybrid recptors (HRs) can be found as α-β IGF1R subunit can heterodimerize with one α-β of IR. In addition, IR isoforms can form
heterodimers IR-A/IR-B. In this last case, it has been demonstrated that IR-A/IR-B
hybrids recruit intracellular partners upon insulin or IGF-2 binding with the same
affinity as IR-A homodimers while affinity for IGF-1 is low. The data suggest that, in
presence of IR-A, IR-B hemireceptor is incorporated into hybrids with the consequence
that most insulin binding sites behave as IGF-2 binding sites [207]. Heterodimerization
occurring between IGF-1R and IR is mainly due to their high homology, spanning 27 to
84% depending on the region [225, 226]. The amount of hybrids is function of the mole
fractions of each receptor but in some tumor tissues the proportion of HRs is higher than
the expected suggesting there are still more unknown factors that can influence homoand heterodimers formation. HRs can involve IGF-1R/IR-A (HR-A) or IGF-1R/IR-B
(HR-B) presenting different biological characteristics. Studies demonstrate that both
HR-A and HR-B bind IGF-1 with elevated affinity (EC50= 0.3±0.2 nM and EC50=
2.5±0.5 nM, respectively). Medium-high affinity occurs between insulin or IGF-2 and
HR-A (EC50=3.7±0.9 and EC50=0.6±0.1, respectively) while they do not bind HR-B
(EC50> 100 nM and EC50=15.0±0.9nM, respectively) [221]. In vitro studies exploring
the HRs capabilities to phosphorylate a specific intracellular substrate, Crk-II, show that
binding of the three ligands to HR-A determines Crk-II phosphorylation while IGF1 and
IGF-2 only induce its phosphorylation upon HR-B binding. These results demonstrate
that hybrids expression modifies insulin functional role as it induces mitogenic more
than metabolic signals through HR-A activation. Modulation of insulin effects represent
a main hypothesis regarding the physiological role of the HRs [207].
34
4.2 Ligands and binding proteins
IGF-1 and IGF-2 display a high homology with insulin structure and they control
cellular and tissue growth [227]. IGF-1 is mainly produced by the liver under the
control of the pituitary growth hormone (GH) but it can also be expressed by other
organs with paracrine and autocrine effects [228]. For this reason, IGF-1 can be
considered both a circulating hormone and a growth factor. IGF-1 gene is located on
chromosome 12 and its expression is finely regulated in the liver. IGF-1 gene
expression is induced by the GH, which production is regulated by the pituitary gland
upon the regulation of the hypothalamic factors somatostatin and growth hormonereleasing hormone (GHRH). With a feedback mechanism, IGF-1 inhibits GH release
acting on hypothalamus and pituitary gland. The protein is a single chain of 7.5 kDa
containing 70 amino acids. IGF-1 expression increases from birth to puberty, when
stimulates growth and differentiation of different tissues including bone [229] while
decreases in the adult. Similarly to IGF-1, IGF-2 is expressed by liver and other tissues
in adults but its expression is not under GH control [230]. IGF-2 gene expression is
controlled by genetic imprinting and it is expressed by paternal chromosome under the
control of the differentially methylated region (DMR) associated with the H19 gene,
located upstream on chromosome 11. When DMR is methylated IGF-2 is expressed
[231]. Recently, a family of proteins called insulin-like growth factor 2 mRNA binding
proteins (IGF2BP1, 2, 3) has been found able to bind IGF-2 mRNA thus affecting its
expression. Particularly, binding of IGF2BP3 to IGF2 mRNA induces a stronger
expression of the ligand with stimulatory proliferative effects in different tumor types
[232]. At protein level, the two ligands share high homology (62%) but IGF-2 is
composed of 67 amino acids and it is expressed during life and its plasmatic levels are 3
to 7 folds higher that IGF-1. It induces proliferative and anti-apoptotic signals but it also
plays a role in embryonic and fetal growth as well as in growth and differentiation of
different tissues including muscle [233]. Insulin is a hormone produced by islets of
Langerhans β cells in pancreas. Its active form is given by two chains: chain A,
including 21 amino acids, and chain B, including 30 amino acids, cross linked by
disulfide bonds. Insulin explicates mainly metabolic effects inducing glucose up-take of
liver, adipose tissue and muscle upon hematic glucose increase. Specific amino acids
confer to IGF-1 and IGF-2, but not insulin, the capability to bind a family of binding
proteins (IGFBPs) which known components are 6. The IGFBPs hold IGF-dependent
and –independent functions. In fact, they modulate half-life and bio-availability of
IGFs: on one side they control the IGFs translocation toward specific tissues (IGFBP-1,
-2, -4) but they also sequester the ligands preventing the binding to the receptor:
35
IGFBP-6 binds IGF-2 with high affinity while IGFBP-3 binds preferentially IGF-1.
IGF-independent mechanisms include the inhibitory effect of IGFBP-3 on cell
proliferation and migration regardless of IGF-1 binding [234].
4.3 IGF-1R: signal transduction pathways
IGF-1R activation induces proliferative and anti-apoptotic stimuli to the cell. For this
reason, IGF-1R effects are crucial for the correct embryonic and postnatal development
in humans but are deleterious in the context of cancer as IGF-1R with its activity has
been found involved in proliferation, survival, migration, metastasis and
chemoresistance mechanisms in different tumor types. Upon the binding of IGF-1 and
IGF-2, the kinase domain of IGF-1R is activated inducing the auto-transphosphorilation
of three tyrosine residues in the TK domain (Tyr 1131, 1135, 1136). Consequently, the
activated TK domain phosphorilates several IGF-1R residues and different intracellular
substrates involved in signal transduction. In particular, phosphorilated tyrosine residue
950 in the juxtamembrane domain serves as a docking site for IGF-1R substrates
holding the Phosphotyrosine Binding Domain (PBT). The substrates include the family
of insulin receptor substrates (IRS) 1-4 and Shc proteins [218]. These substrates initiate
phosphorylation cascades that serve to transmit the IGF-1R signal.
Figure 6. Representation of IGF-1R signal transduction [206].
36
These proteins are recognized by down-stream effectors holding the Src-homology-2
(SH2) domain such as PI-3K, Grb2/SOS, Ras GTPase activating protein [218].
The phosphatidylinositol 3-kinase is composed of a p85 regulatory subunit and a p110
catalitic subunit that, upon IRS-1 activation, phosphorilates phophatidylinositol-(4,5)biphosphate (PIP2) into phophatidylinositol-(3,4,5)-trisphosphate (PIP3). PIP3 activates
down-stream substrates including protein kinase B (Akt) by phosphorilations on
threonine 308 and serine 473. Akt phosphorilation, in turn, regulates metabolic enzymes
such as glycogen synthase kinase 3 (GSK3), modulates apoptotic regulators like Bad
and caspase 9, and activates the mammalian target of rapamycin (mTOR) pathway thus
affecting protein synthesis through the p70 S6 kinase and the Elongation Factor 4
binding protein-1 (4E-BP1).
In parallel, IGF-1R leads to activation of Ras pathway. Ras is a GTP protein that is
activated when binds GTP while inactivated when binds GDP [235]. Ras is recruited
and activated by Grb2/SOS (ras guanine nucleotide exchange factor) complex: Grb2 is a
docking protein that can be activated both by IRS-1 or Shc. The active form of Ras
leads to activation of the serin/threonine kinase Raf1 and consequently MAPK (Mitogen
Activate Protein Kinase) family components including MEK1 and ERK1/2.
Translocation of ERK1/2 to the nucleus results in activation of a transcriptional program
leading to cellular proliferation.
In this way, IGF-1R controls different key points of cell cycle including the G0-G1,
through p70S6 kinase activation determining ribosome synthesis and entrance into the
cell cycle [236]; the G1-S progression is promoted by cyclin D1 increase and CDK4
expression that, in turn, phosphorilates pRb thus inducing E2F release and cyclin E
synthesis [237, 238]. Particularly, cyclin D1 control represents the main IGF-1R
mechanism of cell cycle progression control: cyclin D1 synthesis is indeed mediated by
both ERK1/2 and PI3K/Akt pathways. ERK1/2 regulates its transcriptional expression
while PI3K/Akt pathway stabilizes cyclin D1 mRNA thus favoring its protein synthesis.
In addition, IGF-1R regulates G2/M transition by promoting synthesis of cyclins A and
B, and cdc2 [218]. IGF-1R also avoids apoptosis induced by different agents including
hypoxia, osmotic stress and anti-tumor drugs [239]. Particularly, PI3K/Akt pathway
induces inhibitory phosphorylation of pro-apoptotic factors, including Bcl-2 family
member Bad [240], and caspase 9 [205]. Moreover, active Akt phosphorilates FoxO
transcription factor family members regulating cellular functions including cell growth
inhibition, and apoptosis induction through the anti-apoptotic protein Bim expression.
Upon Akt-induced activation, FoxO proteins translocate to the cytoplasm where
undergo ubiquitin-induced degradation. IGF-1R thus suppresses the FoxO proteins
transcriptional program. The MAPK pathway-induced apoptosis inhibition is given by
37
ERK1/2-mediated activation of several substrates including c-Myc, a Bcl-2 repressor,
and STAT3, inducer of anti-apoptotic proteins like Bcl-xL, Mcl-1, servivin.
Depending on the cell type, IGF-1R can also directly phosphorylate the Janus kinases
(JAK)-1 and -2 that are involved in cytokine-mediated signaling [218, 241].
Phosphorilation of JAK proteins can lead to activation/phopshorilation of STAT
proteins. In particular, STAT3 represents a very important mediator of IGF-1R
transforming potential [242].
4.4 IGF system and cancer
The IGF system and, particularly, IGF-1R plays a critical role in various malignancies.
Indeed, increased expression of IGF-1, IGF-2 and IGF-1R have been documented in
different tumor types including glioblastomas, neuroblastomas, meningiomas,
carcinomas of breast, gastrointestinal tract, ovarian, and Ewing sarcoma [218].
IGF-1R involvement in neoplastic transformation was first demonstrated by Sell et al.
Particularly, the authors conducted their study on fibroblast-like cell lines from mouse
embryos homozygous for a targeted null mutation of the IGF1R gene. These cells
showed refractoriness to semian virus 40 (SV40) large tumor antigen (TAg)-induced
transformation compared to control cell lines, highly sensitive to SV40 transforming
effects [243]. Several following studies demonstrated the resistance of this cellular
model to the transformation induced by other viral and cellular oncogenes: active Ras,
E5 protein from bovine papilloma virus, E7 protein from human papilloma virus, EWSETS fusion protein in Ewing sarcoma, viral oncogene v-src, over-expression of
receptors like EGF-R, IR, PDGF-Rβ and IRS-1. In addition, restoration of IGF-1R
expression made the cells susceptible to the transformation [244]. Conclusion of these
data is that IGF-1R is necessary for cell transformation but not sufficient as it must
cooperate with other agents (chemical, biological or phisical). In addition, the role of
IGF-1R in cancer is not through its over-expression but through its presence [245]. IGF1R-mediated tumorigenesis can be due to genetic or functional alterations.
Genetic alterations affecting IGF-1R include amplifications, and alterations of receptor
regulators.
IGF-1R gene amplification is a rare event but it has been described in melanoma [246],
primitive breast cancer [247], pancreatic adenocarcinoma [248].
Mostly, altered IGF-1R expression is induced by mutations of its transcriptional
regulators. Transcription factors associated with IGF-1R control include both
38
stimulatory and inhibitory factors that have been identified in cancer. Inhibitory
transcription factors include p53, WT1 and BRCA1.
p53 is a nuclear transcription factor that is activated in response to DNA damage or
hypoxia and it acts as an oncosuppressor as its activation leads to cell cycle blockade
and apoptosis. p53 regulates gene expression of several components of the IGF system:
it up-regulates IGFBP-3 [249] while down-regulates IGF-1R [250], IR [251], IGF-II
[252] and IRS-3 [253]. p53 mutations, occurring in 50% of tumors, cause loss of
IGFBP-3 and over-expression of IGF-1R, IGF-II, IR e IRS-3. In addition, loss of p53
up-regulates IGF-1R through MDM2 recruitment and decreased IGF-1R ubiquitination.
In turn, IGF-1R can regulate MDM2 expression and increase wild-type p53
ubiquitination [254]. WT1 is an oncosoppressor that inhibits gene expression of IGF-1R
and IGF-2.
In Wilm’s tumor and in breast cancer, WT1 mutations or deletions cause IGF-1R and
IGF-2 over-expression [250, 255]. More recently, several studies have demonstrated
that IGF-1R undergoes nuclear translocation and it directly interacts with DNA.
Moreover, IGF-1R binds IGF-1R gene promoter thus establishing an IGF-1R
autoregulation mechanism as demonstrated in breast cancer cells thus sustaining its own
expression [213, 256]. Studies in breast cancer demonstrated that IGF-1R is able to
transactivate the IGF-1R promoter in ER-negative cells. It is still unknown if IGF-1R
autoregulation is a general mechanism of gene regulation [256].
BRCA1 is a nuclear phosphoprotein with transcriptional activity and it is involved in
regulation of the G1-S and G2-M transitions acting as an oncosuppressor [257]. In breast
cancer, wild type BRCA1 represses IGF-1R transcription while truncated form of
BRCA1 is unable to decrease IGF-1R promoter activity [258]. Consistently, BRCA1
mutation carrier patients display higher IGF-1R levels than sporadic breast tumors
[259]. Stimulatory transcription factors include EWS-WT1 chimera in desmoplastic
small round cell tumor. This tumor is characterized by a chromosomal rearrangement
involving EWS gene and WT1, on chromosome 11. The resulting chimeric protein
possesses gain-of-function transcriptional activity and it was shown to bind WT1 ciselements and to transactivate the IGF-1R promoter [260].
Functional alterations of IGF-1R refers alterations of IGFBPs, down-stream substrates,
phosphateses regulating IGF-1R and its signaling, and IGF-2R.
Tumor progression can be due to a reduced expression of IGFBPs that modulate IGFs
availability both in circle and in tumor microenvironment. Decrease of IGFBP2 causes
an elevated mitogenic capability as IGF-1 and 2 are available for the receptor binding. It
has been demonstrated that proteases or caspases from tumor cells can digest the
IGFBPs allowing ligand release [261]. Between the six IGFBPs, IGFBP-3 is the most
39
commonly lost in tumor cell lines [218]. An exception is given by IGFBP-2, which
increased expression is associated with malignancy in glioma and other tumors [262,
263].
IGF-1R activity is altered by increased expression or constitutive activation of downstream effectors [218]. IRS-1 has been found constitutively activated in breast cancer,
leiomiosarcoma, Wilms tumor, randomiosarcoma, liposarcoma [264] while IRS-2 is
over-expressed in pancreatic tumor [265] or consistutively phosphorilated in metastatic
breast cancer compared to non metastatic cells [266]. In liver tumor, an up-regulation of
IGF-II, IRS-1 and IRS-2 has been reported [267] as well as constitutive activation of
ERK1/2 has been reported to reduce tumor IGFs- and IGF-1R-dependence [268].
Phosphateses regulating IGF-1R frequently altered in tumor include PTEN. PTEN
attenuates the signaling of different tyrosine kinase receptors including IGF-1R as it dephosphorilates PIP3 thus blocking Akt activation. Loss of PTEN induces a constitutive
activation of PI3K pathway and this mechanism has been described in different tumors
such as prostate, lung, stomach cancers [269, 270]. Protein tyrosine phosphatase 1B
(PTP-1B) is located in endoplasmic reticulum cytoplasm [271] and it exerts its action on
IGF-1R and IRS-1 [272, 273]. Absence of PTP-1B causes increased proliferation,
motility and growth [272].
Internalization and ubiquitination mechanisms can alter IGF-1R functions. IGF-1R
internalization is regulated by adaptor protein-2 (AP-2)-dependent endocytosis. Once in
endosomal compartment, ligand dissociation exerts a regulatory role on signaling and
some studies have pointed out the relevance of E-64-sensitive cysteine proteinase or
cathepsin B. In addition, alterations on cathepsin L were observed in breast cancer cells
[218, 274, 275]. IGF-1R ubiquitination is regulated by two E3 ligases: Nedd4 and
mouse double minute 2 (MDM2). Nedd4 binds IGF-1R through the adaptor protein
Grb10 and studies in mice have demonstrated that disruption in the maternal Grb10
allele induces embryo and placental overgrowth and 30% overweight compared to wildtype control [276]. MDM2 is a RING finger ubiquitin ligase that binds IGF-1R βsubunit thus starting its degradation process. MDM2 loss causes an increase in IGF-1R
expression levels [277].
IGF-2R represents an important oncosuppressor for the cell. It acts as a negative
regulator of IGF-2 avoiding its binding to IGF-1R or IR. Different primitive tumors
display loss-of-function mutations on IGF2R gene. In addition, studies conducted in
prostate cancer cells showed that IGF-2R dominant negative expression causes
increased cell growth rate while IGF-2R over-expression leads to growth decrease
[278].
40
The role of IGF-1R in tumor pathogenesis and progression in widely accepted but its
value as indicator of prognosis is still not completely clarify. Clinical studies evaluating
the prognostic potential of IGF-1R have reported either positive or negative associations
between receptor expression levels and patient outcome in different tumor types
including prostate cancer [279], non-small cell lung cancer [280]. In breast cancer no
correlation was found between IGF-1R and prognosis [281] while a correlation between
higher IGF-1R expression and good outcome was found in primary Ewing sarcoma
patients [282].
In the last years, different studies evidenced that IR is abnormally expressed in a variety
of tumor types where it mediates both metabolic and non-metabolic effects [207].
Particularly, studies demonstrated an altered splicing in tumor cells, leading to an
increased ratio IR-A:IR-B that influences cell response to insulin and IGFs. IR-A is
found over-expressed in carcinoma of breast, colon, lung but also rabdomiosarcoma,
leiomiosarcoma, and miosarcoma. The relevance of IR-A expression is due to its
capability to bind IGF-2. IGF-2 is frequently expressed by tumor cells and its binding to
IR-A is associated with stimulation of growth and cell invasion [223]. IR-B is not able
to bind IGF-2 and it is mainly associated with metabolic signals. Experimental studies
demonstrate that IR-A over-expression in NIH 3T3 fibroblasts or immortalized human
breast epithelial cells induces a ligand-dependent transformed phenotype and that this
effect is blocked by IR-blocking antibodies [283]. However, these cells were not able to
induce tumor in nude mice suggesting further alterations are required for a complete
transformation. The importance of IR-A in tumor progression has been demonstrate in
thyroid cancer where both IR and IGF-1R are over-expressed in differentiated tumor but
IR-A:IGF-1R ratio progressively increases with the differentiation loss [284]. In
addition, increased IR-A expression in tumor cells favors hybrids HR-A formation thus
increasing IGF-1 and 2 binding sites and conferring growth advantage to the cells [221].
In addition, IR-A/IGF-2 circuit activation has been found able to mediate resistance
mechanisms toward anti-IGF-1R agents [285] thus evidencing the relevant role of IR-A
in tumor.
The role of IGF-1 and IGF-2 in cancer is still controversial: a correlation between IGF1/IGF-2 expression levels and cancer progression has been evidenced in some tumor
types including liver, colon-rectal, and pancreatic carcinomas but this was not
confirmed in breast cancer. Overall, the data indicate a relevant role of the ligands in
tumor progression [218]. In some tumor types this proliferative stimulus is given by
circulating IGF-1 while in others by a paracrine or autocrine local synthesis of IGF-1
and 2. Probably, tumors initially depend from ligands produced by the host while they
become able to produce IGF-1 or IGF-2 autocrinely thus acquiring a higher malignancy
41
level during cancer progression. IGF-1 and IGF-2 circulating levels display a high
variability among individuals especially because of polymorphisms of IGF-1 and IGF-2
gene or alterations of ligand expression regulators including IGFBPs, GH and its
receptor, somatostatina, GHRH and its receptor [261]. Epidemiological studies have
evidenced that higher IGF-1 circulating levels are associated with increased cancer risk.
Increased IGF-1 expression and polymorphisms of IGF-1 itself or its regulators has
been correlated with increased risk of prostate, lung, breast, colon-rectal carcinomas and
sarcoma [286]. Several studies have demonstrated a correlation between endogenous or
exogenous insulin and cancer. In the 1970’s, studies in mice showed administration of
exogenous insulin caused breast and colon tumors [287]. Animal models of insulin
resistance, leading compensatory insulin increase, showed same results regarding
endogenous insulin effects: insulin-resistance correlates with increased colon-rectal
tumor formation in rats [288] and increased proliferation of lung and colon-rectal
xenografts [289]. Epidemiological studies have demonstrated an increased risk of
different tumors, including colon-rectal and endometrium cancer, in individuals with
higher insulin levels [290]. Recently, type II diabetes and obesity have been
demonstrated to be associated with increased risk of breast, colon, liver, pancreatic and
kidney tumors [207]. These studies, together with the discovery of IR-A relevance in
cancer, further support the hypothesis that insulin-resistance and the consequent
hiperinsulinemia represent the main link between diabetes and cancer [291]. In an
insulin-resistance condition, insulin-target tissues do not respond to insulin metabolic
stimuli while other epithelial tissues undergo the mitogenic insulin stimulation [292]. In
this condition, insulin can bind both IR-A and IGF-1R, with low affinity. In
hyperinsulinemia condition, the MAPK pathway is preferentially activated and induces
cell proliferation while the PI3K pathway, regulating metabolic signals, is normally
inhibited [293].
4.5 IGF-1R as a therapeutic target
Development of targeted therapeutic strategies is based on the identification of specific
alterations which are able to mediate cellular oncogenic pathways. In fact, the use of
target therapies is indicated for those cancer where it is possible to identify a gene or a
protein able to induce malignant phenotype. Identify a “druggable” substrate represents
an exceptional chance for tumor treatment and an important option to improve patient
outcome. Considering its biological effects, IGF-1R has emerged as a promising target
42
for the development of new therapeutic approaches, which can be combined with other
classical chemotherapeutics [294]. In the past decades, several IGF-1R inhibitors,
including monoclonal antibodies or tyrosine kinase inhibitors, have been developed and
their efficacy has been tested in a large variety of tumor types. Overall, the data show
that despite satisfactory preclinical effects, clinical trials did not give the expected
results and this could be due to onset of resistance mechanisms or lack of a suitable
patients selection. Identification of patients who can benefit of a specific target therapy
represents today one of the main challenge in the field of cancer treatment. Agents
aimed at IGF-1R down-regulation include monoclonal antibodies, tyrosine kinase
inhibitors but also dominant-negative proteins, antisense oligonucleotides, RNA
interference have been proposed.
Several monoclonal antibodies have been developed to target IGF-1R. Monoclonal
antobodies bind the extracellular domains of the receptor and block ligand binding. In
addition, antibodies are able to induce IGF-1R down-regulation by promoting receptor
internalization. The first available anti-IGF-1R antibody was αIR3. In 1989, Arteaga et
al. demonstrated its efficacy as inhibitor of human breast cancer cells in athymic mice
growth [295]. Some anti-IGF-1R antibodies are able to down-regulate IR, while being
IGF-1R specific, due to down-regulation of IGF-1R:IR hybrids or to endocytosis of IR
in close proximity to IGF-1R in membrane lipid drafts [296]. Fully human antibodies
have been developed and tested in preclinical and clinical trials. Anti-IGF-1R
monoclonal antibodies entered into clinical trials include CP-751,871 (figitumumab;
Pfizer) and AVE1642 (ImmunoGen Inc. and Sanofi). CP-751,871 is a fully human IgG2
blocking binding of IGF-1 to its receptor, IGF-1-induced receptor autophosphorylation
and IGF-1R down-regulation [297, 298]. Its efficacy has been tested in phase I trials in
different tumors including ES, prostate cancer, and multiple myeloma demonstrating to
be well tolerated but with low effectiveness especially alone. AVE1642 is a humanized
version of the anti-IGF-1R antibody EM164 [299]. Clinical trials have been performed
to test its efficacy alone or in combination in a variety of solid tumors. Overall, data
indicate again that the agent is well-tolerated but with partial responses especially in
sarcomas [300]. Biomarkers for sensitivity to these agents remain an urgent need.
Several compounds have been design to inhibit the tyrosine kinase activity of IGF-1R.
From this point of view, complications are due to the high homology rate between IGF1R and IR particularly in the tyrosine kinase domain (85%) and the ATP binding cleft
(100%). Small molecule inhibiting the kinase domain include NVP-AEW541 and NVPADW742 (Novartis) appearing to be equipotent for IGF-1R and IR inhibition in vitro
but specific for IGF-1R in intact cells [301, 302]. These agent displayed a good tumor
growth inhibition in models of fibrosarcoma, myeloma, and ES but development of
43
these agents was let down by toxicity. Inhibitors of ATP binding cleft lack IGF-1R
specificity while inhibitors of substrate phosphorilation show greater potential. In
particular, the cyclolignan picropodophyllin showed a great specificity for IGF-1R as it
inhibits tyrosine phosphorylation of Y1136 in the activation loop of kinase domain.
This agent showed a good potential in vitro. This class of compounds include OSI-906
(Astellas Pharma), a novel ligand-dependent autophosphorylation inhibitor of both IGF1R and IR which show a good potential in those tumors expressing the two receptors.
OSI-906 demonstrated good efficacy in preclinical studies and it is currently in clinical
testing especially in combination with other drugs such as everolimus in colorectal
cancer [303], doxorubicin in breast tumor cells [304]. In addition, biomarkers were
found predicting response to OSI-906 in hepatocellular carcinoma cell lines [305] or in
colorectal cancer [306]. Several phase I and II clinical trials are ongoing.
Dominant-negative proteins interfere with the wild-type protein by direct binding or
competition for binding substrates. The first described dominant-negative is 486/STOP,
holding an intact ligand-binding domain [307]. Its effects have been tested in
experimental models of breast, pancreatic, lung, colon tumors where inhibits migration
and metastases. Translation of this approach to clinical practice is limited by low
efficiency of delivery and stability.
Antisense oligonucleotides approach involves introduction into the cells of antisense
RNA or antisense oligonucleotides (ASOs) binding to a complementary mRNA target.
Gene expression is inhibited by RNase H-mediated mRNA cleavage or translation
block. Experimental studies demonstrated that antisense against IGF-1R cause growth
inhibition and apoptosis induction in vivo. Use of oligoantisense in clinic is limited by
low cellular up-take, non specific toxicity. Topical application or ex vivo transfection
represent two putative options to overcome these limitations. In the last case, patients
treated with ex vivo approaches display a clinical amelioration in 60% of cases [308]
confirming the benefit of an anti-IGF-1R treatment.
RNA interference technique known since 1998 as a process in which long doublestranded RNAs (dsRNAs) are cleaved by Dicer ribonuclease enzyme into short 21-23
nuleotide fragments called short interfering RNAs (siRNAs). siRNAs are incorporated
into a multi-protein RNA-inducing silencing complex (RISC) in which the antisense
siRNA target the cleavage of a complementary mRNA [309]. As dsRNAs can induce
apoptosis in mammalian cells, through stimulation of interferon expression, direct
introduction of siRNAs enabled the use of this tool in research cell biology. Molecular
interaction between siRNA and mRNA depends on the accessibility of the target as it
was demonstrated in breast cancer cell [205]. In vivo use of siRNA is limited by poor
cellular uptake and susceptibility to degradation which could be reduced by
44
incorporation within nanoparticles or conjugation with cholesterol. siRNA against IGF1R showed down-regulation of the target and decrease of tumor cell growth in
pancreatic cancer [310], and colon cancer cells [311].
4.6
IGF system in Ewing sarcoma
The importance of IGF system in ES was first described by Scotlandi et al. in 1996. The
authors demonstrated the presence of a unique, autocrine loop mediated by IGF-1R in
ES and PNET cell lines due to an autocrine production of IGF-1. Moreover, blockage of
the IGF-1R-mediated circuit by anti-IGF-1R αIR3 monoclonal antibody inhibits
ES/PNET cells growth via increased apoptosis, decrease of proliferation rate as well as
soft-agar growth and migration upon chemotactic stimulus [312]. Relevance of IGF-1R
in ES transformation was than demonstrated by Toretsky et al. with an in vitro study
performed on fibroblasts derived from IGF-1R knockdown or wild type mice. Copresence of both EWS-FLI1 and IGF-1R is required for cell transformation as lack of
one of the two factors prevents soft-agar growth. In addition, EWS-FLI1 alters IGF-1R
signaling as demonstrated by higher levels of phosphorilated IRS-1, one of the main
mediators of IGF-1R pathway, compared to cells non expressing the fusion gene [313].
Subsequently, a study focused on the identification of EWS-FLI1 target genes
demonstrated that EWS-FLI1 silencing induces expression of IGFBP-3, a key regulator
of proliferation signal mediated by IGF-1. ChIP analysis showed that EWS-FLI1 binds
IGFBP-3 promoter and represses its transcription. In this landscape, inhibition of this
protein represents a crucial event in ES tumorigenesis [78]. Confirmation of perturbing
effects of EWS-FLI1 on IGF system were given by other studies performed on
mesenchymal progenitors: EWS-FLI1 induces expression of IGF-1 and inhibits IGFBP3 , IGFBP-5 and IGFBP-7 [66, 78, 314]. Considering the importance of the IGF1R/IGF-1 loop in ES pathogenesis, down-stream mediators status was investigated in
ES cells demonstrating that MAPK and PI3-K pathways appeared to be constitutively
activated. Utilization of specific inhibitors of MAPK and PI3-K, PD98059 or U0126
and LY294002, respectively, impaired ES cell growth in monolayer and soft-agar basal
conditions inducing G1 blockage or affecting cell survival. In addition, MAPK
inhibition reduced migratory ability of ES cells and increased chemosensitivity to
doxorubicin, a leader drug in ES treatment [315].
Considering the relevance of IGF-1R in ES cell growth, efficacy of its inhibition was
tested in vitro and in vivo. IGF-1R blockage in ES causes inhibition of cancer cell
45
proliferation, survival, and anchorage-independent growth, inhibits tumorigenesis,
tumor invasion and metastasis, and sensitizes cancer cells to chemotherapy and
radiotherapy [206]. In vivo, αIR3 monoclonal antibody treatment was shown to induce
complete tumor regression in 50% of athymic mice [316].
4.7 IGF system in prostate cancer
In the prostate, IGF-1R plays a critical role in normal gland growth and development, as
well as in cancer initiation and progression [317]. First evidences regarding a putative
role of IGF system in this tumor type came from epidemiological studies showing that
higher IGF-1 serum concentration as well as decreased circulating IGFBP-3 correlated
with increased risk of PCa [318]. Subsequently, several in vitro and in vivo studies were
performed to assess IGF system role in PCa. Particularly, significance of prostate
stromal IGF-1 in PCa development was confirmed by Kawada et al.: conditioned
medium of prostate stromal cells, being rich in IGF-1, induced phosphorilation of IGF1R and increased growth of PCa cell lines. Furthermore, only chemical IGF-1R
inhibitors suppressed the prostate stromal cells-induced growth in PCa cells [319]. It
was concluded that stromal IGF-1 accelerates tumor growth in prostate. IGF-1R and
IGFBPs were found expressed in cell lines encouraging researchers to study the putative
role of IGF-1R in regulating growth, survival and metastases. A study conducted on 54
samples of primary PCa showed that IGF-1R was significantly up-regulated at protein
and mRNA levels compared to benign prostatic epithelium. In addition, IGF-1R
expression was maintained in metastasis samples [320]. This result is in accordance
with another study showing that intensity of IGF-1R immunostaining increased from
benign prostatic tumor over PIN to carcinoma [321]. The interaction between androgens
and IGF system has been considered too and some studies demonstrated that androgens
induce a selective up-regulation of IGF-1R in PCa cell lines via c-Src/ERK/cAMP–
response element-binding protein (CREB) activation that stimulates IGF-1R promoter.
Through this mechanism, androgens increase cell proliferation and invasiveness in
response to IGF-1 thus contributing to the progression to castration-resistant PCa [322,
323].
However results in the field of IGF system role in PCa are still controversial. Indeed,
some studies did not find any significant differences between IGF-1R expression levels
between normal and tumor tissues [324, 325] while others evidenced a correlation
between IGF-1R loss and malignancy. In particular, data from an in vitro study reported
a correlation between progression toward a metastatic stage and reduction of IGF-1R
46
expression [326]. An in vivo study performed by Sutherland et al. showed that in
conditional (Cre-loxP) prostate-specific IGF-1R knockout mouse model, IGF-1R
abrogation caused cell proliferation, hyperplasia and emergence of aggressive PCa
when p53 activity was compromised [327].
5. CD99 molecule
5.1 MIC2 gene and CD99 protein
CD99 antigen was identified in 1979 thorough 12E7 monoclonal antibody as highly
expressed in human lymphocytic leukemia cells [328]. CD99, also known as E2, is a 32
kDa glycoprotein codified by MIC2 gene which is located on pseudo-autosomal region
of sex chromosomes: X (Xp22.33-Xpter) and Y (Yp11-Ypter). The gene is 50kb and it
is orientated towards the centromere. MIC2 contains 10 exons that are smaller than the
average of mammalian genes. In addition, evolutionary studies indicate that the gene
can be detected by DNA hybridization only in primates [329]. MIC2 does not belong to
any known gene family but correlates with two genes located in the same pseudoautosomal region: PDBX and MIC2R. PBDX codifies for the Xga blood group antigen
sharing a 48% homology with CD99 [330] while MIC2R (MIC2-related) is related to
exons 1, 4 and 5 of MIC2. Transcripts from the MIC2R locus have been detected in all
human tissues but none of them contains a significant open reading frame making the
functional role of MIC2R still unknown [331].
CD99 gene encodes two distinct proteins as a results of alternative splicing process: a
wild-type full length CD99 or type 1 (CD99wt) and a truncated form or type II CD99
(CD99sh). Particularly, the CD99sh was identified in the process of screening a human
thymus λgt11 cDNA library by Hahn JH et al. in 1997. The CD99sh transcript contains
a 18-bp insertion at the boundary of exons 8 and 9 of MIC2 gene introducing an inframe stop codon that generates truncated polypeptide [332]. The resulting protein
contains 160 amino acids compared to the 185 amino acids of CD99wt. Conservation of
47
the two isoforms in primates suggests that both of them hold an important role but
regulatory mechanisms underlying splicing mechanisms are still unknown.
Sequence analysis of CD99wt cDNA suggests that CD99 contains a 100 amino acids
extracellular domain glycosilated with O-linked sugars, a putative transmembrane
domain of 25 amino acids and a 38 amino acids cytoplasmic domain. Biochemical
studies showed that CD99wt is highly sialylated and glycosylated, it carries no N-linked
sugar residues while carries O-linked oligosaccharides. Post-translational modifications
induce a molecular mass reduction going from 32 kDa to 28 kDa and 18 kDa after
neuraminidase and O-glycanase treatment, respectively [333]. The 32 kDa molecule
displays a certain similarity with collagen and other glycoproteins including CD43 and
CD34 involved in cell adhesion processes [334]. More recently, multidimensional
heteronuclear NMR and CD spectroscopy approaches have pointed out that CD99
cytoplasmic domain is composed of an α-helical conformation forming a symmetric
dimmer in the presence of the transmembrane domain. Consequently, no secondary
structure element seems to be present [335].
5.2 CD99 expression in normal and tumor tissues
Immunohistochemical analysis evidenced that CD99 is ubiquitously expressed in
normal cells and, particularly, an elevated CD99 expression has been found in
ependymal cells of brain and spinal cord, pancreatic islets, Leydig and Sertoli cells,
ovarian granulose cells and endothelial cells. Functional role of CD99 in these cells is
unknown while more information are available regarding its role in hematopoietic
system. In 1994, Dworzak et al. reported that CD99 is expressed in cells of all leukocyte
lineages and that its expression is correlated with maturational stages. Particularly, the
authors evidenced a general highest density of CD99 in the most immature stages of the
lymphocytic and granulocytic lineages. In the B-lineage cells, CD99 expression is
observed in the earliest maturational stages characterized by co-expression of CD34 and
CD10 antigens but is lost during maturation. Similarly, a remarkable CD99 expression
was observed in immature T-cells while low expression was detected upon
differentiation [336]. In the erythrocytes, MIC2 product displays a quantitative
polymorphism co-regulated with Xga blood group antigen. This co-expression is
supposed to be regulated at transcriptional level [337].
In addition to its physiological function, CD99 has a role in pathology and, particularly,
in cancer. Several evidenced demonstrate its role in acute lymphoblastic leukemia,
embryonal rabdomiosarcoma, synovial sarcoma, mesenchymal condrosarcoma, gastric
48
and ependimal tumors, in Ewing sarcoma and PNET. Particularly, in Ewing sarcoma
and PNET,
CD99 represents a diagnostic biomarker together with specific
chromosomal aberrations [338].
Considering that no antibody is able to specifically target CD99sh, RT-PCR represents
the best technique for CD99 isoforms discrimination. Overall, studies conducted in
normal and pathological tissues evidenced that CD99sh is expressed at lower levels
compared to CD99wt but its production may be up-regulated during specific stages of
cell differentiation, physiologic conditions or locations in the cells [332]. Accordingly,
it has been described that in immature T-cell lines CD99 is expressed as heterodimers
composed of a long chain associated with a short variant. During cell differentiation,
CD99 expression levels decrease putatively because a reduced expression of CD99sh
[339]. In addition, Lee et al. pointed out an association between CD99 subtypes
expression and neural differentiation in Ewing sarcoma cells. The authors found that
CD99sh was reduced upon differentiation while no difference was found in CD99wt
expression levels. These data suggest that in this tumor type CD99sh acts as a negative
regulator of neural differentiation [340].
5.3 CD99 function in normal and tumor tissues
Physiological functions of CD99 (wild type form) are not completely clear especially
because its ligand is still unknown and the protein structure still remains not completely
defined. Use of monoclonal antibodies directed against CD99 allowed identification of
some functions carried out by CD99. The first studies were performed in hematopoietic
tissues where CD99 function appears particularly correlated with cellular differentiation
degree. First evidences in T-lymphocytes pointed out that CD99 presence on the surface
was involved in spontaneous rosette formation with erythrocytes. As monoclonal
antibodies directed against CD99 blocked rosette formation [341], the authors
demonstrated that CD99 mediates T-cell adhesion events. In addition, CD99 activity
and density was found related with differentiation stage. Particularly, stimulation with
MAbs induced homotypic cell aggregation and apoptosis in CD4+ and CD8+
corticothymocytes but not in other T cells [342] suggesting a role in cellular
differentiation. A role of CD99 was also described in peripheral blood lymphocytes as
anti-CD99 antibodies treatment enhanced T cell proliferation in the presence of antiCD3 stimulation and resulted in a marked expression of T-cells activation markers like
CD69, CD40L [343]. Some studies pointed out that CD99 modulates adhesion of T
cells to the vascular endothelial cell wall during leukocyte extravasation events.
49
Particularly, E2 MAbs stimulation was shown to increase affinity/avidity for α4β1
integrins of peripheral T cells with CD4+ memory, but not CD4+ virgin T cells, on
endothelial vascular cell-adhesion molecule 1 (VCAM-1) [344]. In addition, some
studies evidenced the importance of CD99 expression on endothelial cells for
monocytes transendothelial migration [345].
In order to investigate physiologic relevance of CD99 in vivo, Bixel et al. cloned a
mouse cDNA coding for a protein 45% identical in its sequence with human CD99.
Antibodies against this mouse homolog were used in leukocites and the results showed
that the treatment induced blockade of cell aggregation, inhibition of transendothelial
migration and inhibition of recruitment on in vivo-activated T cells into inflamed skin
and edema formation [346].
Some studies evidenced a link between CD99 and osteoblast lineage. In particular, in a
study performed on osteosarcoma cells, MIC2 gene was demonstrated to be a target of
Cbfa1, a key transcription factor of osteoblast differentiation. Overexpression of Cbfa1
was induced in SaOs-2 through transfection of a dominant negative mutant of
Cbfa1(ΔCbfa1) and this procedure allowed the identification of 4 genes putatively under
the control of Cbfa1. Between them MIC2 was found as strongly overexpressed in
mutant cells compared to wild type cells. It is still unclear whether Cbfa1 directly
regulates transcription of MIC2 or through a signaling pathway.
Several studies have been carried out to elucidate the role of CD99 in pathology and,
particularly, in cancer. Overall, data regarding CD99 in tumor point out a dual role of
this molecule, acting as an oncogene or an oncosuppressor depending on the cellular
context [347].
High levels of CD99 were found particularly in ES, where it is also used as a relevant
diagnostic tool [338]. CD99 stimulation with monoclonal antibodies is reported to
induce cell death and homotypic adhesion in vitro as well as to reduce cell growth and
metastasis in vivo [348]. More recently, Rocchi et al. demonstrated, both in vitro and in
vivo, that silencing of CD99 correlates with an increased neural differentiation as
demonstrated by neurite-like outgrowth and higher expression of neural differentiation
markers such as beta-III tubulin and H-neurofilament [94]. In addition, CD99 was found
as a putative target gene of EWS-FLI1 as demonstrated by ChIP assay results showing
the recruitment of FLI1 on CD99 promoter in ES cells [94]. Considering CD99 is easily
accessible, it is expressed in all cases and mediates malignancy in ES, it represents a
suitable target for specific antibodies with putatively clinical application. With this
purpose, a nonimmunogenic human recombinant monospecific antibody against CD99
(dAbd C7) has been recently developed and its efficacy has been tested both in vitro and
in vivo. dAbd C7 gave satisfactory results in cell lines and in mice when combined with
50
doxorubicin without affecting viability or differentiation of normal human
mesenchymal stem cells [349].
Noteworthy is CD99 role in acute lymphoblastic leukemia as CD99 is found strongly
expressed in tumor cells compared to normal counterpart [350]. In addition, in this
tumor type CD99 evaluation represents a putative marker of minimal residual disease
[351].
On the opposite side, an oncosuppresive role for CD99 has been postulated in other
tumors. In lymphomas, in vitro down-regulation of CD99 generates B lymphocytes with
Hodgkin and Reed-Sternberg phenotype [352]. In pancreatic endocrine carcinomas,
CD99 is lost in malignant lesions compared to the benign and CD99 loss correlates with
a worse prognosis [353, 354]. In gastric adenocarcinoma, down-regulation of CD99 was
found associated with dedifferentiation of tumor cells suggesting a role for this protein
in tumorigenesis or tumor progression [355]. Studies conducted by Pelosi et al.
demonstrated the relevance of CD99 in gastrointestinal and pulmonary neuroendocrine
tumors evidencing a correlation between loss of CD99 positive cells and local invasion
or distant metastases [356] as well as an association between loss of CD99 and
occurrence of nodal metastases in patients [357].
CD99 is reported to act as an oncosuppressor in osteosarcoma as demonstrated by
Manara et al. In this study, the authors demonstrated that CD99 expression is low or
absent in osteosarcoma cells and patient specimens compared to normal counterparts.
As a confirmation, CD99 forced over-expression significantly reduced resistance to
anoikis, inhibited growth in anchorage-independent conditions and migration as well as
abrogated tumorigenic and metastatic ability [358]. In addition, a recent study
evidenced that forced CD99 expression suppresses osteosarcoma cell migration through
a marked inhibition of ROCK2/ezrin axis [359].
Sporadic data pointed also out a putative oncosuppressive role of CD99 in prostate
cancer. Forced over-expression of CD99 in prostate cancer cells causes an inhibition of
soft-agar growth as well as migration capability. Studies in mice confirmed that cells
over-expressing CD99 display a decreased tumor incidence and a reduced formation of
lung or bone metastases [347].
51
Aim of the study
Aberrant expression of ETS genes due to chromosomal translocations has been
described as a common feature of different tumor types including Ewing sarcoma and
prostate cancer. The ETS family includes several transcription factors sharing high
sequence homology in the DNA binding domain and regulating genes involved in
cancer initiation and progression. In Ewing sarcoma, EWS-ETS fusion proteins act as
aberrant transcription factors modulating the expression of a variety of known target
genes and driving pathogenesis of this tumor. In prostate cancer, the TMPRSS2-ETS
fusion gene, resulting in over-expression of an ETS member, represents an early event
in cancer progression but less information are available regarding the target genes
network dysregulated by this rearrangement. In this study, the impact of TMPRSS2ERG on two well documented targets of EWS-FLI1, including components of the
insulin-like growth factor system and the CD99 molecule, was evaluated. The aim of
this study was to identify common or distinctive ETS-related mechanisms which could
be exploited both at biological and clinical level. From the biological point of view,
identification of target genes for oncogenic ETS transcription factors between different
tumors may lead to a broader understanding of more general mechanisms underlying
malignant transformation. From the clinical standpoint, fusion genes and definition of
their cross-talk may allow identification of molecules with a putative relevance at
prognostic or therapeutic level.
52
Materials and Methods
CELL LINES
Prostate cancer cell lines PC-3, LNCaP, DU-145, VCaP were obtained from the
American Type Culture Collection (ATCC). 22RV1 prostate cancer cell line was
purchased from Sigma Aldrich. Immortalized non-malignant prostate cell line RWPE-1
and stable trasfectants RWPE-1_tERG or RWPE-1_empty vector were kindly provided
by Dr. Gambacorti-Passerini, University of Milano-Bicocca. ES cell lines TC-71 and
6647 were kindly provided by T.J. Triche (Children's Hospital, Los Angeles, CA). LAP35 EWS cell line was obtained in the Experimental Oncology Lab, Rizzoli Institute
(Bologna). PC-3, LNCaP, DU-145, TC-71, 6647 and LAP-35 cells were cultured in
Iscove’s Modified Dulbecco’s Medium (IMDM) (Lonza). 22RV1 cells were maintained
in RPMI 1640 (Gibco) while VCaP cells were maintained in Dulbecco’s Modified
Eagle’s Medium (DMEM) (Sigma) implemented with L-glucose and bicarbonate.
RWPE-1 and transfectant cells were maintained in keratinocyte-serum free medium
supplemented with epidermal growth factor and bovine pituitary extract (Life
Technologies Inc.). Culture medium of stable trasfectants RWPE-1_tERG or RWPE1_empty vector cells was implemented with G418 250μg/ml for selection maintenance.
IMDM, RPMI and DMEM media were supplemented with 10% inactivated Fetal
Bovine Serum (FBS) (Lonza) and 100 units/ml penicillin and 100 μg/ml streptomycin.
Cells were maintained at 37°C in a humidified 5% CO2 atmosphere. All cell lines were
tested for mycoplasma contamination every 3 months by MycoAlert mycoplasma
detection kit (Lonza) and were recently authenticated by STR PCR analysis using
genRESVR MPX-2 and genRESVR MPX-3 kits (Serac). The following loci were
verified for PCa cells: D3S1358, D19S433, D2S1338, D22S1045, D16S539, D18S51,
D1S1656, D10S1248, D2S441, TH01, VWA, D21S11, D8S1179, FGA, SE33. For ES
cells the following loci were verified: D16S539, D18S51, D19S433, D21S11, D2S1338,
D3S1358, D5S818, D8S1179, FGA, SE33, TH01, TPOX VWA.
CLINICAL PROSTATE SPECIMENS
Formalin fixed and paraffin-embedded (FFPE) blocks corresponding to PCa patients
were retrieved from the archives of the Biobank of the Fundación Instituto Valenciano
53
de Oncología according to the following criteria: specimens obtained from radical
retropubic prostatectomies from 1996 to 2002 and no history of previous treatment for
PCa (including androgen deprivation therapy or chemotherapy prior to surgery). 270
cases were identified to meet these criteria. All patients gave written informed consent
for tissue donation for research purposes before tissue collection, and the study was
approved by FIVO’s Institutional Ethical Committee (ref. number. 2010-19). Clinical
data were reviewed from clinical records and stored in a PCa-specific database. Patient
characteristics, including the T2E fusion gene status, and demographics are shown in
Table 1. Combined Gleason score was uniformly regarded by the same uro-pathologist
(Ana Calatrava from Fundación Instituto Valenciano de Oncología, Valencia, SPAIN ),
who also certified high-density cancer areas in haematoxylin and eosin stained slides to
ensure a purity of at least 75% of cancer cells. For comparative and calibration
purposes, we also analyzed 10 samples of normal prostate tissue obtained from patients
operated of radical cystectomies without pathological evidence of prostatic disease. T2E
gene fusion status was determined by RT-PCR and fluorescent in situ hybridization
(FISH) as described by and quantitative RT-PCR. Follow-up of the retrospective series
ranged from 2 to 189 months (median 96 months). Biochemical progression was
defined as serum PSA greater than 0,4ng/ml during follow-up and clinical progression
was defined as local (prostatic fossa), regional (lymph nodes) or distant (metastasis)
progression.
DRUGS
Anti-IGF-1R drugs were kindly provided by: ImmunoGen Inc. (AVE1642, a humanized
version of anti-IGF-1R EM164 antibody), Pfizer (CP-751,871/Figitumumab), and
Novartis (NVP-AEW541). Abiraterone acetate (S1123) and Cabazitaxel (S3022) were
purchased by Selleckchem. Trabectedin was provided as lyophilized formulations and
as clinical preparation by PharmaMar S.A., Colmenar Viejo, Madrid, Spain. OSI-906
(Linsitinib) was purchased by Selleck Chemicals. Doxorubicin (DXR) was purchased
from Sigma-Aldrich (St. Louis, MO, USA). Working dilutions of all drugs were
prepared immediately before use.
54
GENE EXPRESSION ANALYSIS
Cell line analysis
Cell lines total RNA (2 mg) was extracted with TRIzol (Invitrogen), a monophasic
solution of phenol and guanidine isothiocynate, and purified by precipitation with
isopropanol. Oligo dT primers (Applied Biosystems) were used to reverse transcribe
RNA with a 260/280 nm absorbance ratio of 1.5-2. Quantitative Real-Time PCR was
performed on ABI Prism 7900 (Applied Biosystems) using TaqMan or SYBR Green
assays (Applied Biosystems). Following predesigned TaqMan assay for target gene was
used: IGF-1R (Hs00181385_m1), CD99 (Hs00365982_m1). Following SYBR Green
assays
for
target
genes
were
used:
IR
(forward
5’CGTGGAGGATAATTACATCGTGTT-3’
and
reverse
5’TGGTCGGGCAAACTTTCT
-3’,
167bp),
IGF-1
(forward
5’TCGCATCTCTTCTACCTGGCGCTGT-3’
and
reverse
5’GCAATACATCTCCAGCCTCCTAGA-3’,
240bp),
IGF-2
(forward
5’GACCGCGGCTTCTACTTCAG
-3’
and
reverse
5’AAGAACTTGCCCACGGGGTAT -3’, 203bp).
Primer Express software (Applied
Biosystems) was used to design appropriate primer pairs and probe for reference gene
glyceraldehyde-3-phosphate
dehydrogenase
(GAPDH):
forward
5’GAAGGTGAAGGTCGGAGTC-3’, reverse 5’- GAAGATGGTGATGGGATTTC -3’
and probe 5’- CAAGCTTCCCGTTCTCAGCC -3’. Two replicates per gene were
considered. Relative quantification analysis was performed on 2-ΔΔCt method. Absolute
quantification assay for the measurement of total IGF-1R was performed by Dr. Roberta
Malaguarnera accordingly to the procedure published in 2011 [360].
Clinical specimens analysis
Isolation of RNA from three sections of 10μm paraffin-embedded tissue was performed
using RecoverAll™ Total Nucleic Acid Isolation Kit (Ambion) following providers’
specifications. RNA with a 260/280 nm absorbance ratio of 1.5-2 was reverse
transcribed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems)
according to manufacturer’s indications. Clinical samples were analyzed using ABI
7500-Fast Thermocycler Sequence Detection System (Applied Biosystems), according
to manufacturer’s instructions. Predesigned TaqMan probes for target genes were used:
IGF-1R (Hs00181385_m1), IR (Hs00961560_m1), IGFBP-3 (Hs00426287_m1), IGF-1
55
(Hs 00153126_m1), IGF-2 (Hs04188276_m1), CD99 (Hs00365982_m1), T2E
(Hs03063375_ft). For endogenous control β-2-microglobulin: (Hs99999907_m1) was
used (Applied Biosystem).
cDNA from normal human prostate samples was used as calibrator for comparative
analysis of PCa cases. Two replicates per gene were considered. Relative quantification
analysis was determined using the mean value of the control samples and following the
2-ΔΔCt method.
CHROMATIN IMMUNOPRECIPITATION (ChIP)
For ChIP assay cells plated in 60 or 100 mm Ø dishes were washed twice with PBS and
crosslinked with 1% formaldehyde at 37°C for 10 minutes. Cells were than washed with
fresh PBS, collected, resuspended in lysis buffer (1% SDS, 10mM EDTA, 50mM TrisHCl pH 8.1) and kept in ice for 10 minutes. Cells were then sonicated four times for 10
seconds at 30% of maximal power and collected by centrifugation at 4°C for 10 minutes
at 14000 rpm. Supernatants were collected and diluted in IP buffer (0.01% SDS, 1.1%
Triton X-100, 1.2mM EDTA, 16.7mM NaCl) and precleared with sonicated salmon
sperm DNA/ protein A agarose (UBI) for 1 hour at 4°C. Precleared chromatin was
immunoprecipitated for 12 hours with anti-ERG-1/2/3 (C-17, Santa Cruz
Biotechnology) or anti-FLI1 antibodies (C-19, Santa Cruz Biotechnology). Salmon
sperm DNA/ protein A agarose was added and precipitation was continued for 4 hours
at 4°C. Pellet was collected and the precipitates were washed sequentially for 5 minutes
with the following buffers: Wash A (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM
Tris-HCl pH 8.1, 150mM NaCl), Wash B (0.1% SDS, 1% Triton X-100, 2mM EDTA,
20mM Tris-HCl pH 8.1, 500mM NaCl), Wash C (0.25M LiCl, 1% NP-40, 1% sodium
deoxycholate, 1mM EDTA, 10mM Tris-HCl pH 8.1), and twice with TE buffer (10mM
Tris, 1mM EDTA). The immune complexes were eluted with elution buffer (1% SDS,
0.1M NaHCO3). The eluates were reverse crosslinked by heating at 65°C for 12 hours
and digested with proteinase K (0.5mg/ml) at 45°C for 1 hour. DNA was obtained by
phenol/chloroform/isoamylalcohol (25:24:1) extractions. Yeast tRNA was added to
each sample and DNA was precipitated with EtOH for 12 hours at 4°C and resuspended
in TE buffer. Samples were quantified with Nanodrop. Quantitative RT-PCR was
performed with custom primers flanking Ets-containing target promoters fragment.
IGF-1R promoter was evaluated by Real-Time PCR using the following custom
TaqMan assay: forward 5’-AGGAGGAGGAGGAGGAGGAG-3’, reverse 5’GCAGTTCGCAAGATCGCC-3’ and probe 5’-TTGACTCCGCGTTTCTGCCCCTCG-
56
3’. For the TaqMan assay design TFSEARCH - Searching Transcription Factor Binding
Sites, version 1.3 free website was used for the prediction of ETS binding sites in the
promoter of IGF-1R gene and the sequence spanning from 1041bp to 1051bp was
identified as the best. Beacon Designer 4 software was used for the design of the assay
spanning from 1005bp to 1114bp. PIM-1 promoter fragment containing ETS consensus
sequence was used as ERG immunoprecipitation positive control [174] by Real-Time
PCR
using
the
following
SYBR
Green
assay:
forward
5'GTGCTAGGCGAGTGGGAACAACTG-3'
and
reverse
5'AATGACCCAAATTCACCTCCTGAG-3'. CD99 and TGFβR2 promoter fragments
containing ETS consensus sequence were evaluated with the following SYBR Green
assays: CD99 promoter forward 5’- TTGTTAAGTGTGGGAAGGGC-3’ and reverse
5’CTGCTCACCTCAGGGAGTTC-3’
(417bp),
TGFβR2
promoter
5’GTGTGGGAGGGCGGTGAGGGGC-3’
and
reverse
5’GAGGGAAGCTGCACAGGAGTCCGGC-3’(285bp). For quantitative PCR (qPCR)
data are calculated with the following formula: % of recruitment = 2ΔCt x input
chromatin percentage, where ΔCt = Ct (input) - Ct (ETS IP) in accordance to Frank SR
et al [361].
IMMUNOHISTOCHEMISTRY
PCa specimens were incorporated in 11 tissue microarrays (TMA). Two or three
representative areas (1 mm in diameter) of each tumor were selected for TMA
production by first examining hematoxylin and eosin-stained prostatectomy tumor
slides and then sampling tissue from the corresponding paraffin blocks. A tissue
microarray instrument (Beecher Instruments) was used for TMA assembly. From TMA
blocks, 3-μm-thick sections were immunostained using rabbit anti-human IGF-1Rβ C20 sc-713 (Santa Cruz Biotechnology), anti-human IRβ C-19 sc-711 (Santa Cruz
Biotechnology), mouse anti-CD99 or anti-human ERG clone EP111 polyclonal-Ab
(Dako). Percentage of positive cells and cytoplasmic staining intensity were scored
semiquantitatively, forming four groups (from 0 to 3). Cases were scored as low
expression when staining intensity was between 0 and 1, and high expression when
intensity was 2 and 3.
57
IN VITRO ASSAYS
To assess drug sensitivity, MTT assay (Roche) was used according to manufacturer’s
instructions. Cells were plated into 96 well-plates (range 2,500-10,000 cells/well). After
24 hours, various concentrations of AVE1642 (0.01-50 µg/ml), NVP-AEW541 (0.03-5
µM), CP-751,871 (0.5-500 µg/ml), trabectedin (0.3-3 nM), OSI-906 (0.3-3 µM) or
Abiraterone acetate (1-100μM) were added and cells exposed to these drugs for up to 72
hours. Short interfering RNA knockdown of ERG was performed with siRNA from
Thermo Scientific Dharmacon: siGENOME_siRNA (D-003886-01). siGENOME_non
targeting_siRNA was used as control (D-001210-01-05). siRNA was transfected in
VCaP cells using siport NeoFX transfection agent (Life Technologies Inc.) according to
manufacturer’s instructions. Silencing was assessed after 48, 72, 96 and 120 hours from
transfection. VCaP cells were pre-treated with ERG siRNA (100nM) for 48 hours and
then exposed to CP-751,871 (0,01-1 µg/ml), NVP-AEW541 (0.2-2 µM) or Abiraterone
(3-30 µM) for 72 hours. Cell growth was assessed with Trypan Blue. ERG and IGF-1R
protein expression was investigated upon 72, 96 and 120 hours of Abiraterone treatment
(3-10 µM). Short interfering RNA knockdown of EWS-FLI1 was performed with
Lipofectamine (Invitrogen) following the manufacturer’s protocols. siRNA was used at
concentrations of 75 or 100 nM for 24 hours and siRNA sequences are the following:
CACCCACGTGCCTTCACAC targeting the 3’ portion of FLI1 (IDT). On-TargetPlus
NonTargeting Pool (Thermo Scientific Dharmacon) was used as scrambled control. For
combined treatments, cells were treated for 72h with drugs alone or combined in fixed
ratios. VCaP cells were treated for 72 hours with varying concentrations of CP-751,871
(1-100 µM) and Abiraterone (1-100 µM) or Cabazitaxel (0.003-0.3 µM). In Trabectedin
and OSI-906 combination experiments, ES cells were treated in fixed ratio 1:1000 while
PCa cells were treated in fixed ratio 1:100.
WESTERN BLOTTING
Proteins were collected from cells plated in 60 or 100 mm Ø dishes with a subconfluence status. Cell lysis was performed on ice with UPSTATE buffer for
phophorilated proteins (50mM Tris-HCl pH 7.4, 150mM NaCl, 1% NP-40, 1mM
EDTA, 0.25% sodio deossicolato, 1mM NaF) upon addition of proteases inhibitors
(1:100): aprotinin (10µg/ml), leupeptin (0.1mM), PMSF (1mM), sodium orhtovanadate
(0.2mM). After 30 minutes incubation, lysates were centrifuged and proteins from
58
solution fraction were collected. Protein concentration was obtained upon dilution in
Protein Assay (Bio-Rad) (1μl in 999μl) and spectrophotometer reading compared to a
standard curve. Equivalent amounts of total cell lysates were separated by 10% SDSPAGE under denaturating conditions and transferred onto nitrocellulose membrane
(Bio-Rad). Ponceau (Sigma-Aldrich) staining was used to evaluate transfer quality.
Membranes were blocked for 1 hour at room temperature with milk diluted in TBST (10
mM Tris-HCl ph 7.4, 150 mM NaCl e 0.1% Tween20) and than incubated overnight
with the following primary antibodies: anti-IGF1-Rβ, anti-IRβ, anti-GAPDH, antiLAMIN B, anti-ERG-1/2/3, anti-FLI1 (Santa Cruz Biotechnology), anti-AR (Cell
Signaling Technology), anti-actin, anti-CD99. Membranes were then incubated with
secondary anti-rabbit or anti-mouse antibodies conjugated to horseradish peroxidase
(Amersham) and revealed by ECL Western blotting detection reagents (GE Healthcare).
STATISTICAL ANALYSIS
Differences among means where analyzed using two-sided Student’s t test. Drug-drug
interactions combination index (CI) was calculated with the isobologram equation of
Chou-Talalay [362] by using CalcuSyn software (Biosoft). IC50 values were determined
using CalcuSyn software (Biosoft).Correlations analysis were performed using Fisher’s
exact test. Kaplan-Meier proportional risk log rank test was applied for survival curves.
BPFS and PFS were considered individually from the date of surgery to the date of
event. Univariate predictors of outcome were entered into a Cox proportional hazard
model using stepwise selection to identify independent predictors of prognosis,
considering the 95% CI.
59
Table 2. Clinicopathologic features of PCa patients evaluated for IGF system components
and CD99 expression by qRT-PCR or by IHC.
qRT-PCR (n = 270)
Parameter
Age
≤ 55
56-65
66-75
> 75
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN*:
pN0
pN1 or greater
Margins:
Negative
Positive
TMPRSS2/ERG**
Negative
Positive
IHC (n = 243)
No. Pts
%
No. Pts
%
15
81
138
36
5,6
30
51,1
13,3
12
74
124
28
5
31
52,1
11,7
109
129
32
40,4
47,8
11,9
87
123
29
36,4
51,4
12,1
154
74
40
57
27,6
14,9
132
69
36
55,6
29,1
15,1
248
21
92,2
7,8
219
19
92
7,9
135
135
50
50
115
124
48,1
51,8
236
12
95,2
4,8
209
10
95,4
4,5
137
133
50,7
49,3
116
123
48,5
51,4
92
178
34,1
65,9
102
117
46,5
53,4
SP, specimen; cT, clinical stage; PSA, prostatic specific antigen; pN, lymphnode pathological stage
*Lymphadenectomy was limited to the obturator fossa in most of the cases at the inclusion period
**IHC ERG expression was not detectable in 24/243 and negative in 85/219 cases (39%)
60
Results
1. TMPRSS2-ERG and IGF system
1.1 Analysis of IGF system main components expression in PCa cell lines
A panel of six prostate cell lines, including malignant VCaP, DU-145, PC-3, LNCaP,
22RV1 and the non-malignant RWPE-1 cells was analyzed for the basal expression of
different components of the IGF system. The panel of cell lines was characterized by
different expression levels of androgen receptor (AR) and the TMPRSS2-ERG (T2E)
gene fusion presence. VCaP cell line was the only one characterized by expression of
T2E as limited models of PCa cell lines constitutively expressing T2E are available. As
shown in figure 7, T2E presence corresponds to a high expression of ERG transcription
factor.
Figure 7. Western blotting analysis of
AR and ERG1/2/3 expression in a
panel of PCa cells. GAPDH is shown
as a loading control.
No IGF-1 or IGF-2 expression was detected in cell lines confirming a paracrine
activation of the IGF pathway, putatively exploited by the stroma, in this tumor. As
shown in figure 8, IR was found generally higher in PCa cells with respect to normal
61
cells. IGF-1R expression was found lower in PCa cells compared to RWPE-1 cell line
with the only remarkable exception of VCaP cells both at mRNA and protein levels.
These data suggested a potential correlation between tERG and IGF-1R.
Figure 8. Evaluation of IGF-1R and IR basal expression in prostate cell lines. Relative
mRNA expression levels (top) of IGF-1R and IR in prostate cancer cell lines. The
RWPE-1 cell line was used as a calibrator (2-ΔΔCt = 1). Protein expression levels of
receptors in prostate cells (bottom). The blots are representative of two independent
experiments.
62
1.2
Functional evaluation of tERG/IGF-1R correlation in PCa
For a comprehensive evaluation of the putative relationship between T2E and IGF-1R,
different approaches were followed and are shown in figure 9. First, a transient
silencing with siRNA directed against ERG was performed in VCaP cells. Interestingly,
upon 96 and 120 hours of ERG silencing a down-modulation of IGF-1R was evidenced
at protein levels compared to untreated cells or scrambled (Figure 9A). Second, IGF-1R
expression was evaluated in RWPE-1 cells stably transfected for tERG overexpression
(RWPE-1_tERG). The analysis pointed out that over-expression of ERG corresponded
to a higher expression of IGF-1R both at mRNA and protein levels (Figure 9B). Third,
as T2E fusion gene is regulated by androgens, IGF-1R expression was investigated in
VCaP cells upon abiraterone acetate stimulation. Abiraterone acetate is a secondgeneration anti-androgen drug that blocks the synthesis of androgens. VCaP cells were
treated for 72, 96 and 120h with two concentrations of abiraterone acetate and western
blotting analysis showed that together with a strong ERG down-regulation, IGF-1R
levels decreased upon 10 µM treatment in VCaP cells (Figure 9C).
To better address the role of tERG in IGF-1R modulation, putative transcriptional
regulation of ERG on IGF-1R promoter was investigated. An anti-ERG chromatin
immunoprecipitation (ChIP) assay was performed in VCaP and PC-3 cells which
express ERG at high or low levels, respectively, as well as in RWPE-1_tERG and
RWPE-1 empty vector transfected cells. As shown in figure 10, ChIP analysis indicated
that ERG binds the IGF-1R gene promoter, and the amount of binding was higher in
cells with tERG expression. Considering the increase at mRNA levels in VCaP and
RWPE-1_tERG compared to PC-3 or empty vector-transfected cells (Figures 8 and 9),
the results indicate that ERG directly regulates IGF-1R transcription in PCa and that the
increased amount of ERG due to fusion gene causes the higher IGF-1R expression in
T2E-positive cells.
63
A
B
C
Figure 9. tERG-dependent IGF-1R induction in prostate cancer cells. A, siRNA knockdown of
ERG (siERG) in VCaP induces a decrease in IGF-1R levels compared with non-treated control
(NT) or non-targeting siRNA (SCR) controls. B, IGF-1R is over-expressed in RWPE-1 cells
transfected with tERG compared with controls both at mRNA and protein level. Absolute IGF1R mRNA quantification was assessed in RWPE-1 cells over-expressing t-ERG or empty
vector-transfected cells (left). The blots are representative of two independent experiments
(right). C, Abiraterone acetate treatment induces down-regulation of ERG in VCaP cells and
IGF-1R. Cells were treated with abiraterone (3 and 10 µM) for the indicated time points.
Representative blots are shown. GAPDH was used for normalization.
64
AR
TMPRSS2
ERG
ERG
IGF-1R promoter
Figure 10. ERG acts as a stimulatory transcription factor in PCa cells. ChIP assay (top) was
performed on VCaP and PC-3 prostate cancer cells, as well as on tERG- or empty vectortransfected RWPE-1 cells. ERG was precipitated with an anti-ERG-1/2/3 antibody. The
results were obtained by quantitative RT-PCR. The data represent the recovery of each DNA
fragment relative to the total input DNA. A representative experiment is shown. Cartoon
(bottom) of the androgen/T2E/IGF-1R axis described in this study.
65
1.3
Efficacy of anti-IGF-1R agents in prostate cancer cells
As described in introduction section, several agents have been developed to specifically
target IGF-1R on the basis of its importance in sustaining cell growth of different
tumors. In PCa, several preclinical and clinical studies testing the effects of these agents
have been performed and evidenced a limited efficacy. In this field, relevance of T2E in
modulating the response to this type of treatment has been never considered.
PCa cell lines were exposed for 72 hours to increasing concentrations of CP-751,871 or
AVE1642, two anti-IGF-1R HAbs, as well as NVP-AEW541, a selective IGF-1R
tyrosine kinase inhibitor (TKI). As shown in figure 11, an overall resistance to these
agents was evidenced in the analyzed panel of cells with the exception of VCaP cells
showing a remarkably high sensitivity to all anti-IGF-1R agents.
66
Figure 11. Sensitivity to IGF-1R inhibition in PCa cells. Cell growth was
assessed using an MTT assay after a 72-h exposure to CP-751,871 or
AVE1642, two anti-IGF-1R-HAbs, and NVP-AEW541, an anti-IGF-1R
tyrosine kinase inhibitor (TKI) in prostate cell lines. The results are
displayed as the percentage of survival relative to controls. Points, mean
of two independent experiments; bars, SE.
To address the role of T2E/IGF-1R axis in influencing sensitivity to anti-IGF-1R agents,
VCaP cells were transiently transfected with anti-ERG siRNA for 48 hours and treated
with two concentrations of CP-751,871 HAb or NVP-AEW541 TKI corresponding to
the doses conferring 20 and 50% of cell growth inhibition. Cell count showed that ERG
expression significantly influenced efficacy of anti-IGF-1R agents as its silencing
reverted cell sensitivity toward CP-751,871 or NVP-AEW541 in VCaP cells (Figure
12).
67
Figure 12. tERG overexpression increases sensitivity to anti-IGF-1R agents. ERG
silencing was achieved in VCaP cells after a 48-h transfection of siERG (100 nM) or
scrambled control siRNA (100 nM); GAPDH was used as a loading control. Cell survival
is shown as the percentage of growth respect to untreated control. The data represent the
mean values of two independent experiments, and the bars represent the SE.
68
1.4 Combinatory treatment of anti-IGF-1R therapy and anti-androgens
In PCa, anti-IGF-1R inhibitors effects have been investigated in combination with
other drugs such as mitoxantrone (NCT00683475) or docetaxel [363]. TMPRSS2ERG is driven by androgens and, consequently, all its down-stream effects can be
putatively affected by androgens deregulation. In this landscape, sensitivity to
abiraterone acetate was first assessed in a small panel of PCa cells. Accordingly to
hormone response features, VCaP cells displayed a sensitivity to abiraterone
acetate, with an calculated IC50 of 20µM (Figure 13), while PC-3 and DU-145
cells were substantially resistant to the treatment. In VCaP cells, the doses of 3
and 30µM, conferring 20 and 50% of cell growth inhibition, respectively, were
chosen for further experiments.
Figure 13. Sensitivity to Abiraterone acetate in PCa cells. Cell growth was assessed using
an MTT assay after a 72-h exposure to Abiraterone acetate at the indicated doses. Results
are displayed as the percentage of survival relative to controls. Points, mean of two
independent experiments; bars, SE.
69
Response to abiraterone acetate in VCaP cells upon ERG silencing was
investigated. As already demonstrated in literature, patients harboring T2E better
respond to hormone treatment. Accordingly, ERG deprivation in VCaP cells
induced a significant decrease in sensitivity to abiraterone stimulation compared
to non treated or scrambled controls (Figure 14).
Figure 14. Reversion of sensitivity to abiraterone acetate by ERG knockdown. ERG
was silenced in VCaP cells with siERG (100 nM) or scrambled control siRNA (100
nM); GAPDH was used as a loading control. Cells were treated with abiraterone acetate
for 72 h at the indicated doses, and the survival percentage with respect to untreated
control is shown. The data represent the mean values of two independent experiments,
and the bars represent SE.
Interestingly, simultaneous administration of CP-751,871 and Abiraterone acetate
but not cabazitaxel, a microtubule inhibitor recently introduced in PCa treatment,
induced synergistic anti-proliferative effects in VCaP cells. In figure 15,
individual doses of CP-751,871, abiraterone acetate or cabazitaxel to achieve 90%
growth inhibition (blue line; ED90), 75% growth inhibition (green line; ED75)
and 50% (red line; ED50) growth inhibition are plotted on the x- and y- axes.
70
Drug-drug interaction was classified as synergistic when CI was lower than 0.90,
as additive when 0.90≤CI≤1.10, or as subadditive when CI was higher than 1.10.
Figure 15. The combination of an IGF-1R inhibitor with
Abiraterone acetate (top), but not cabazitaxel (bottom), results
in synergistic effects in TMPRSS2-ERG-positive cells. The CI
values representing ED90 are reported.
71
2. ETS rearrangements and IGF-1R expression in Ewing
sarcoma
Considering the results obtained in PCa regarding ERG capabilities to regulate IGF-1R
gene expression, activity of EWS-FLI1 on IGF-1R was investigated. EWS-FLI1 is the
hall mark of ES and several studies have been performed in the past years in order to
evidence target genes that could be de-regulated by EWS-FLI1. EWS-FLI1 has been
already demonstrated to influence transcriptional regulation of some IGF system
components, including IGF-1 and IGFBP-3, but not IGF-1R [92].
To address the EWS-FLI1 activity on IGF-1R, ES cell line TC-71 was transiently
transfected with two concentrations of anti-FLI1 siRNA and protein expression of FLI1
and IGF-1R was evaluated by western blotting. As shown in figure 16, knock-down of
EWS-FLI1 induced a down-regulation of IGF-1R protein highlighting a new interesting
mechanism in ES biology. Moreover, an anti-FLI1 chromatin immunoprecipitation
(ChIP) assay was performed in TC-71, 6647 and LAP-35 ES cell lines. TC-71
represents a model of EWS-FLI1 type 1 chimera while 6647 and LAP-35 cells display
EWS-FLI1 type 2 hybrid. ChIP analysis evidenced the recruitment of FLI1 to IGF-1R
promoter in all of the cellular models (Figure 17).
Figure 16. EWS-FLI1 knockdown in
TC-71 cells induces a decrease in
IGF-1R levels compared with nontreated control or scrambled control.
72
Figure 17. EWS-FLI1 basal recruitment on IGF-1R
promoter in three ES cell lines. Results were obtained
by quantitative RT-PCR. The data represent the
recovery of each DNA fragment relative to the total
input DNA. The data represent the mean values of two
independent experiments, and the bars represent the
SE.
3. Effects of Trabectedin (ET-743, YondelisTM) on ETS
fusion genes binding to IGF-1R promoter
Recently, capability of DNA binding agents including trabectedin has been
demonstrated to modulate activity of transcription factors, introducing a certain
specificity and a new level of complexity in the action of conventional agents. Such
effects have been already described in myxoid liposarcoma and ES where trabectedin
interferes with the activity of FUS-CHOP and EWS-FLI1, respectively, justifying the
elevated sensitivity to trabectedin of tumors harboring fusion genes. Trabectedin is a
tetrahydroisoquinoline molecule that binds to the N2 of guanine in the minor groove,
causing DNA damage and affecting transcription regulation in a promoter- and genespecific manner. In this study, the effects of trabectedin on IGF-1R were investigated
73
based on the evidence that ES cell variants resistant to trabectedin displayed an upregulation of IGF-1R and IRS-1 gene expression compared to parental cells [364].
3.1 Evaluation of EWS-FLI1 binding to IGF-1R promoter upon stimulation
with trabectedin
Trabectedin is one of the very few novel drugs recently proposed for the treatment of
sarcoma patients. However, the activity observed in ES was quite modest in the clinical
setting. Identification of mechanisms that could improve the efficacy of trabectedin in
ES represents the main goal to optimize the use of this drug.
The study was performed in TC-71 and 6647 cell lines as representative models of type
1 and type 2 EWS-FLI1 chimera, respectively. Anti-FLI1 ChIP assay and Real TimePCR were performed to monitor the binding of EWS-FLI1 to a conventional target
gene, TGFβR2, as well as IGF-1R promoter upon trabectedin or doxorubicin (DXR)
stimulation. Cell lines were treated with different concentrations of trabectedin or DXR
for 1 hour, IC50 doses were calculated and used for the experiments. Treatment with
Trabectedin (2.5nM and 10nM, respectively) or DXR (1μM and 2μM, respectively)
induced a significant reduction of EWS-FLI1 binding to TGFβR2 promoter (Figure 18).
Conversely, trabectedin but not DXR caused an increased recruitment of EWS-FLI1 on
IGF-1R promoter. As shown in figure 19, occupancy of EWS-FLI1 to IGF-1R promoter
was dose- and time-dependent. Interestingly, trabectedin-induced up-regulation of the
IGF-1R was also confirmed at protein level and the analysis pointed out that IGF-1R
increase was maintained up to 48 hours (Figure 19).
74
Figure 18. Trabectedin induces detachment of EWS-FLI1 from specific promoters. ChIP
assay results were obtained by quantitative RT-PCR and data are reported as fold
enrichment over the control. * p<0.05; ** p<0.001, Student’s t test.
75
A
B
C
Figure 19. Trabectedin induces recruitment of EWS-FLI1 on IGF-1R promoter in ES cells. A,
ChIP assay results in TC-71 and 6647 ES cells treated for 1h with trabectedin or DXR. Data
represent recovery of each DNA fragment relative to total input DNA, respect to control.
* p<0.05; Student’s t test. B, Time-course of EWS-FLI1 association with IGF-1R promoter
evaluated by quantitative RT-PCR in TC-71 cells. Bars represent SE. * p<0.05; ** p<0.001,
Student’s t test. C, Up-regulation of IGF-1R at protein level by western blotting after exposure
of TC-71 cells to trabectedin (0.5-1 nM) up to 48h. GAPDH was used as loading control.
76
3.2 Evaluation of tERG binding to IGF-1R promoter upon stimulation with
trabectedin
Evidences regarding efficacy of trabectedin as single agent in PCa are limited to one
phase II clinical trial carried out in metastatic castration-resistant patients. In this
population of PCa patients, few therapeutic options are available and the strategies
currently in use confer transient benefits evidencing that additional agents are needed.
In the study conducted by Michaelson et al., Trabectedin was administered following
two schedules but the results evidenced modest activity of this agent with a 13% of
patients experiencing a PSA decrease ≥50% [365]. Identification of patients with
specific molecular features who could benefit of trabectedin treatment could improve
use of this agent in clinic.
In this study, VCaP cells were treated for 1h with two doses of trabectedin (1 and 3nM)
and ChIP assay with anti-ERG antibody was performed. Doses were decided based on
cell count upon 1h treatment with a range of concentrations of trabectedin. ChIP assay
showed that trabectedin is able to displace ERG binding to PIM-1 promoter, a
conventional ERG target gene. Conversely to the results obtained in ES, trabectedin also
induced ERG detachment from IGF-1R promoter, evidencing a cellular-dependent
activity of trabectedin on IGF-1R promoter. Results of ChIP assay are shown in figure
20.
Figure 20. ChIP assay results displaying that Trabectedin reduces ERG binding to PIM-1 as
well as IGF-1R promoter in VCaP cell line after 1 hour of treatment. Results were obtained by
quantitative RT-PCR and data are reported as fold enrichment over the control. ** p<0.001,
Student’s t test.
77
3.3 Therapeutic implications of trabectedin gene-specific effects
Considering the increased IGF-1R expression in ES cells upon treatment with
trabectedin and the importance of IGF-1R in sustaining ES cells growth, TC-71, 6647
and LAP-35 cell lines were treated with a combination of trabectedin and the antiIGF1R/IR dual inhibitor OSI-906. OSI-906 was chosen because it has been already
reported that high levels of IR can overcome IGF-1R blockade in ES cells. Interestingly,
the combined treatment gave synergistic effects in ES cell lines. On the contrary,
combination of trabectedin with OSI-906 gave subadditive effects in VCaP PCa cells
harboring T2E rearrangement, according to inhibitory effects of trabectedin on IGF-1R
promoter occupancy (Table 3).
These results suggest that a combination of trabectedin and anti-IGF-1R inhibitor
represents a new potential therapeutic option for ES but not for PCa patients.
Table 3. Efficacy of Trabectedin and OSI-906 as single agents or in combination in ES and
PCa cell lines.
Cell line
Trabectedin (nM)
IC50 ± SE
OSI-906 (µM)
IC50 ± SE
Dose ratio
Drug combination
CI ± SE
Effect
TC-71
6647
LAP-35
VCaP
0.13 ± 0.01
0.22 ± 0.09
0.14 ± 0.03
1.96 ± 0.12
0.4 ± 0.15
1.25 ± 0.45
0.17 ± 0.07
0.18 ± 0.5
1:1000
1:1000
1:1000
1:100
0.819±0.01
0.687±0.06
0.734±0.08
1.43 ± 0.05
synergistic
synergistic
synergistic
subadditive
78
4. Prognostic relevance of IGF system and assessment of
TMPRSS2-ERG/IGF-1R axis in PCa patients
4.1 Gene expression profile of IGF system in primary PCa
Clinical role of IGF system was previously investigated in ES in order to identify
patients with distinct outcome and putatively different treatment protocols. Results
showed that transition to frank malignancy is associated with a reduction of IGF system
activity [282]. Prognosis value of IGF system and mainly of IGF-1R in PCa still
remains controversial. Noteworthy, T2E has been already reported to identify patients
with different clinico-pathological characteristics and different prognosis. Gene
expression of IGF-1R, IR, IGF-1, IGF-2 and IGF-BP3 was evaluated in a retrospective
series of 270 primary prostate tumors by Real-Time PCR (Table 2). While no IGF-2
expression was detected in samples, differential expression of IGF-1R, IGF-1, IGFBP-3
and IR was compared to normal prostate tissues following the 2-∆∆Ct method. As shown
in figure 21, no differential expression with respect to normal tissue was noticed for
IGF-1R (median=1,04; range=0,07-5,12), while a variable expression was evidenced for
IGF-1 (median=0,61; range=0,01-50,12) and IR (median=0,58; range=0,01-471,75).
IGFBP-3 was found to be substantially down-regulated (median=0,52; range=0,052,96).
Figure 21. IGF system expression profile in prostate cancer patients.
79
Expression of the genes was classified in “high” and “low” expression depending on if
obtained RQ values were above or below the first quartile respectively. The association
of IGF-1R, IR, IGF-1 and IGF-BP3 expression with clinico-pathological characteristics
and prognosis was analyzed. Fisher’s test pointed out an association between IGF-1R
and T2E expression in clinical samples (p=0,008). Particularly, patients harboring the
fusion gene showed higher IGF-1R mRNA levels, in keeping with the increased binding
of ERG to the IGF-1R promoter observed in the experimental models. No other
statistically significant correlations were found.
Kaplan-Meier and Log-rank tests were applied in order to evaluate the prognostic role
of IGF system components for both biochemical progression free survival (BPFS) and
clinical progression free survival (PFS) (Table 5). The analysis pointed out a
statistically significant association between high expression of IGF-1 and good BPFS or
PFS while a borderline association was evidenced between high expression of IGF-1R
and better BPFS. IGF-1 expression but not IGF-1R expression was significant in the
Cox proportional hazard multivariable analysis (hazard ratio (HR): 0,62. IC 95% [0,410,94], p=0,026) respect to BPFS. Since IGF-1R was found associated with the presence
of the T2E translocation both in cell lines and in patients, the series was divided
depending on the status of the fusion gene thus identifying two cohorts of patients: T2Epositive or –negative, respectively. In the two groups, IGF-1R, IR, IGF-1 and IGF-BP3
gene expression was classified in “high”, if the RQ value was above the first quartile,
and “low” expression, if RQ value was below the first quartile. Then, association with
clinico-pathological features and prognosis were assessed (Tables 6 and 7). No
association with clinico-pathological characteristics was found in any of the two groups.
Interestingly, Kaplan-Meier analysis evidenced that prognostic value of IGF-1R was
statistically stronger in T2E-negative patients (p-value = 0,016) while it was not
associated with survival in T2E-postive subgroup (p-value > 0,5). More in detail, the
analysis pointed out that in patients negative for the fusion gene, a lower expression of
IGF-1R confers a worse prognosis considering BPFS. This results further underlies the
importance of T2E in establishing subgroups of patients with different prognosis. IGF-1
was found associated with BPFS and PFS in all of the subgroups (Figure 22).
Accordingly to multivariate analysis, nor IGF-1 or IGF-1R represent independent
variables influencing prognosis in T2E-positive or –negative subgroups.
80
Figure 22. Prognostic value of IGF-1R and IGF-1 transcripts on BPFS of primary
PCa patients undergone radical prostatectomy without previous treatment. The total
series was divided into two groups depending if T2E was expressed or not.
Comparison of survival curves was performed by the log rank test. Time scale refers
to months from diagnosis. Thick lines indicate high expressing patients. BPFS,
biochemical progression free survival.
4.2 Protein expression of IGF-1R, IR and ERG in primary PCa tissues and
association with prognosis
Protein expression of IGF-1R, IR and ERG was analyzed in 243 cases from the same
series (Table 2). Expression of IGF-1R in primary PCa tissues was not detectable in
21/243 cases and negative in 12/222 of the samples (5%). Among the positive cases,
85% was classified as high-expressors (165/210). IR was found not detectable in 17/243
cases and negative in 51/226 of the samples (22,5%). Among the positive cases, 34%
81
was classified as high-expressors (76/226 ). ERG expression was not detectable in
24/243 and negative in 85/219 cases (39%) and 85% of them was classified as highexpressors. Interestingly, a statistically significant correlation was found between ERG
protein levels and classical T2E evaluation reported in Material and Methods section (p
< 0.0001, Fisher’s test). In addition, IGF-1R protein levels were significantly associated
with mRNA levels (p=0.047, Fisher’s test). IGF-1R was associated with ERG protein
levels (p<0.0001; Fisher’s test), further verifying the association between IGF-1R and
T2E (Figure 23), but no other association was evidenced. Kaplan-Meier analysis was
performed in the whole series as well as in ERG-positive and-negative groups but no
association with BPFS or PFS was found at protein level (Tables 8, 9 and 10).
Figure 23. Representative expression of ERG (top) and IGF-1R (bottom) in prostate cancer
tissue array samples by immunohistochemistry (magnification, x40). The cases were classified
as ‘high-expressors’ when medium or high positivity was present and ‘low-expressors’ when no
staining or low positivity was observed.
82
5.
TMPRSS2-ERG and CD99 molecule
5.1
Preliminary data
Preliminary data, previously obtained in the laboratory where this work has been
conducted, evidenced that CD99 acts as putative oncosuppresor in PCa. PC-3 cell line
was stably transfected for over-expression of CD99wt, as shown in figure 24.
Transfectant cells displayed an attenuate phenotype as demonstrated by a reduced
anchorage-independent growth (soft-agar assay) and a decreased migration capability
when compared to non treated or empty vector transfectant cell lines.
600
500
200
# of colonies
# of migrated cells
250
150
100
400
300
200
100
50
0
0
Figure 24. CD99 acts as an oncosuppressor in PCa cells. PC-3 cells were transfected for
CD99wt and its over-expression was evaluated by western blotting (top). Migratory
features of PC-3 parental and transfected cells (bottom right). Growth in soft-agar of
PC-3 and clones (bottom left) [347].
83
In vivo, PC-3 cells over-expressing CD99 showed a minor tumor incidence and a
decreased number of extrapulmonary metastases in mice as well as a higher tumor
latency with respect to parental cells [347] (Figure 25).
Figure 25. CD99 inhibits PCa cell metastatization in mice [347].
Clinical relevance of this data was confirmed by CD99 immunohistochemical analysis
performed in prostate tissues spanning from hyperplasias to primitive tumor and
metastases. In patients, CD99 expression was higher in benign lesion (70% positivity)
when compared to primitive (12,5% positivity) or metastases (30% positivity) tissues
(Figure 26).
84
a)
b)
c)
d)
Figure 26. CD99 evaluation by immunohistochemistry in
patients. a) Benign prostatic hyperplasia b) Prostate
adenocarcinoma grade II c) Prostate adenocarcinoma
grade III d) Bone mestatasis from prostate cancer.
As described in introduction section, the primary site for PCa metastasis is bone and
different factors take part in establishing this process including “homing” events,
capability to stimulate osteoblastic lineage and osteomimicry aptitude of PCa cells. A
preliminary clue indicating a putative role of CD99 in PCa bone metastasis was
obtained in this laboratory demonstrating particularly that PC-3 cells over-expressing
CD99 showed an overall down-regulation of genes involved in osteoblastic
differentiation. The results were obtained by GeneCARDs analysis showing that PC-3
cells over-expressing CD99 showed a lower expression of genes involved in
ossification, mineralization, bone development, cell-cell adhesion, cell-matrix adhesion,
matrix proteases and proteases inhibitors and transcription factors. Accordingly,
expression of proteins involved in osteoblastic differentiation were found higher in
primitive or metastases PCa lesions compared to benign lesions. Representative
immunohistochemistry images of the analyzed biomarkers including osteopontin, bone
sialoprotein, osteonectin and osteocalcin are shown in figure 27. Percentages of
positivity in the analyzed series is reported in table 4.
85
Table 4. Percentages of cases positive for osteoblastic differentiation markers.
% of positive
cases
Osteopontin
Bone sialoprotein
Osteonectin
Osteocalcin
Hyperplasias
40
30
0
50
Primitive
72
53
80
77
Metastasis
78
50
40
60
Figure 27. Immunohistochemical analysis of osteoblastic differentiation markers in
hyperplasias, primitive tumor and metastasis.
86
5.2 Analysis of CD99 association with survival in primitive PCa samples
In this section of the study, CD99 expression levels were analyzed in a large cohort of
primitive PCa specimens both at gene and protein levels (Table 2). Subsequently,
correlation between CD99 expression and clinico-pathological parameters as well as
BPFS or PFS was investigated. Studies focused on CD99 prognosis value are limited
and particularly none of them was related to PCa.
Gene expression of CD99 was evaluated in a retrospective series of 270 primary
prostate tumors by Real-Time PCR. Comparison with normal prostate tissues revealed a
slight lower expression of CD99 in tumor compared to healthy tissues (median value=
0,83 ; range=0,2-2,28) (Figure 28).
Figure 28. CD99 expression profile in prostate cancer patients.
Expression of CD99 was classified in “high” and “low” expression depending on if
obtained RQ value was above or below the first quartile, respectively. The association
with clinico-pathological characteristics and prognosis was analyzed. Fisher’s test
pointed out an association, marginal at best, between CD99 and T2E expression
(p=0,054). Particularly, patients harboring the fusion gene showed higher CD99 mRNA
levels. In addition, CD99 loss was found associated with positivity of margins (p=
0,034, Fisher’s test), index of a more aggressive disease and in accordance to
preliminary data indicating a role of CD99 in mestastatic process.
87
Kaplan-Meier and Log-rank tests were applied in order to evaluate the prognosis role of
CD99 for both BPFS and PFS (Table 5). The analysis pointed out that CD99 is not
statistically associated with survival but a trend of the curves indicated that higher
expression of CD99 confers a slight better outcome accordingly to the indicated
oncosuppressive value of CD99 in PCa (Figure 29).
BPFS
P= 0,074
Figure 29. CD99 expression and association with
BPFS or PFS in PCa. Time scale refers to months
from diagnosis. Thick lines indicate high
expressing
patients.
BPFS,
biochemical
progression free survival.
Since CD99 was found associated with T2E translocation, the series was divided
depending on the status of the fusion gene and CD99 gene expression was classified in
“high”, if the RQ value was above the first quartile, and “low” expression, if RQ value
was below the first quartile in the two groups. Fisher’s test pointed out no association
with clinico-pathological features or BPFS and PFS in any of the two groups.
88
At protein level, CD99 was analyzed by Tissue Microarray in the retrospective series of
243 cases. Expression of CD99 in primary PCa tissues was detected in 23/243 samples.
Among the positive cases, 42% was classified as high-expressors (94/220). Among
clinico-pathological parameters, CD99 was associated with ERG protein levels (p <
0,01 Fisher’s test), as T2E-positive cases correlated with higher CD99 expression.
Kaplan-Meier analysis was performed in the whole series as well as in ERG-positive
and-negative groups but no association with BPFS or PFS was found at protein level.
5.3 Analysis of CD99 expression in PCa cell lines
CD99 gene and protein levels were investigated in a panel of PCa cell lines including
malignant VCaP, DU-145, PC-3, LNCaP, 22RV1 and the non-malignant RWPE-1 cells.
As shown in figure 30, CD99 was found similarly expressed between PCa cells and
RWPE-1 cells with exception of LNCaP and 22RV1 cells which particularly displayed a
consistent down-modulation of CD99 at mRNA level. No remarkable difference was
noticed in VCaP cells at basal level compared to other cell lines.
89
CD99 mRNA expression vs.
RWPE-1 cells
2
1
0.5
0.25
0.125
Figure 30. Real Time-PCR (top) and western blotting
(bottom) analysis of CD99 in prostate cancer cells.
5.4 In vitro analysis of ETS rearrangements/CD99 correlation
Considering data obtained in patients, VCaP cells were transiently transfected with ERG
siRNA and CD99 expression was investigated to better elucidate a putative correlation
between fusion gene and CD99. Interestingly, 48 hours silencing of ERG induced a
down-regulation of CD99 at protein level but no modulation of CD99 transcript was
found (Figure 31). These data better reflect results obtained in patients highlighting a
stronger correlation between CD99 and ERG at protein level more than at mRNA level.
ETS rearrangements appear to be able to influence CD99 expression but no through a
direct transcriptional regulation. Accordingly, anti-ERG ChIP analysis was performed
in VCaP and PC-3 cells as well as in RWPE-1_ERG or empty vector transfected cells
90
and qRT-PCR was perform to evaluate recruitment to CD99 promoter. As shown in
figure 32, a fraction of ERG was actually found to bind CD99 gene promoter but the
amount of binding was not different in VCaP and RWPE-1_tERG models compared to
PC-3 or RWPE-1 empty vector transfected cells.
siERG
NT
SCR
VCaP
ERG-1/2/3
siERG
SCR
NT
GAPDH
CD99
GAPDH
Figure 31. ERG influences CD99 at protein level but not at mRNA
level. siRNA knockdown of ERG (siERG) in VCaP was assessed by
western blotting analysis. mRNA and protein expression of CD99 was
evaluated by Real Time-PCR (bottom left) and western blotting (bottom
right), respectively. A representative experiment is shown.
91
Figure 32. ChIP assay was performed on VCaP and PC-3 prostate cancer cells,
as well as on tERG- or empty vector-transfected RWPE-1 cells. ERG was
precipitated with an anti-ERG-1/2/3 antibody. The results were obtained by
quantitative RT-PCR. The data represent the recovery of each DNA fragment
relative to the total input DNA. A representative experiment is shown.
As a further confirmation of the marginal or indirect role of ERG in regulating CD99 at
transcriptional levels, trabectedin treatment in VCaP or PC-3 cell lines did not affect
ERG binding to CD99 promoter (Figure 33).
Conversely, previous data in ES showed that EWS-FLI1 actually is able to bind CD99
promoter thus regulating its expression [94]. Accordingly, trabectedin treatment in TC71 and 6647 ES cell lines induced a displacement of the chimera from CD99 promoter
(Figure 34).
92
Figure 33. Trabectedin reduces ERG binding to PIM-1 but not CD99 promoter in
VCaP cell line after 1 hour of treatment. Results were obtained by quantitative RTPCR and data are reported as fold enrichment over the control. ** p<0.001,
Student’s t test.
Figure 34. Trabectedin induces detachment of EWS-FLI1 from CD99 promoter.
ChIP assay results were obtained by quantitative RT-PCR and data are reported as
fold enrichment over the control. * p<0.05; ** p<0.001, Student’s t test.
93
Table 5. BPFS and clinical PFS log rank and Cox regression tests in primary PCa analyzed by qRTPCR.
Total cases
Parameter
Age
≤ 55
56-65
66-75
> 75
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
TMPRSS2/ERG
Negative
Positive
IGF-1R
Low
High
IR
Low
High
IGF-1
Low
High
IGFBP-3
Low
High
CD99
Low
High
No.
Pts
15
81
138
36
109
129
32
154
74
40
248
21
135
135
236
12
137
133
92
178
67
203
66
199
67
202
67
203
67
203
Biochemical Progression
No. Events Univariate
Multivariate
(% BPFS)
p Value
P Value
HR (95% CI)
0,245
5 (64,2)
43 (25,7)
58 (45,4)
18 (48,6)
< 0,0001
0,001
35 (56,4)
1
64 (28,7)
2,96 (1,66-5,29)
25 (11,7)
1,9 (1,16-3,11)
< 0,0001
0,025
57 (47,1)
1
37 (40,2)
1,98 (1,2-3,25)
29 (23,3)
1,46 (0,86-2,48)
< 0,0001
108 (42,3)
1
< 0,0001
16 (14,5)
2,57 (1,62-4,06)
< 0,0001
Not significant
43 (57,4)
81 (22,1)
< 0,0001
Not significant
105 (42,4)
11 (8,3)
< 0,0001
0,001
40 (56)
1
84 (20,4)
2,11 (1,36-3,28)
0,119
49 (32,5)
75 (44,3)
0,051
Not significant
34 (45,3)
90 (41,2)
0,974
29 (52,1)
93 (37,6)
< 0,0001
0,026
44 (18,2)
1
79 (47,2)
0,62 (0,41-0,94)
0,599
32 (43,1)
92 (39,5)
0,074
36 (28,3)
88 (43,4)
94
No. Events
(% PFS)
Clinical Progression
Univariate
p Value
HR (95% CI)
0,379
Multivariate
P Value
3 (79,4)
29 (50,1)
34 (69,8)
8 (59,2)
< 0,0001
17 (77,3)
43 (57,4)
14 (0)
0,015
1
3,03 (1,4-6,53)
1,57 (0,83-2,96)
0,005
0,163
0,082
34 (69)
24 (54,3)
15 (55,9)
0,029
66 (63,1)
8 (58,6)
1
2,46 (1,38-4,4)
0,001
0,002
Not significant
25 (77,9)
49 (48,4)
0,2
64 (63,6)
5 (50,9)
< 0,0001
24 (77)
50 (41,6)
0,039
1
1,74 (1,02-2,95)
0,957
26 (63,9)
48 (61,6)
0,835
17 (70,3)
57 (61,4)
0,632
17 (69,9)
57 (59,5)
0,002
26 (41,5)
47 (68,6)
0,943
17 (61,3)
57 (62,9)
0,657
18 (70,6)
56 (60,5)
Not significant
Table 6. BPFS and clinical PFS log rank and Cox regression tests in patients with PCa and TMPRSS2ERG fusion gene expression analyzed by qRT-PCR.
T2-ERG +
Parameter
Age
≤ 55
56-65
66-75
> 75
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
IGF-1R
Low
High
IR
Low
High
IGF-1
Low
High
IGFBP-3
Low
High
CD99
Low
High
No.
Pts
10
59
82
27
72
90
16
101
48
27
167
10
86
92
156
6
97
81
44
134
44
132
44
134
44
134
44
134
Biochemical Progression
No. Events Univariate
Multivariate
(% BPFS)
p Value
P Value
HR (95% CI)
0,787
4 (56)
28 (22)
31 (58,9)
12 (54,1)
< 0,0001
< 0,0001
20 (64,3)
1
43 (22,2)
6,32 (2,73-14,4)
< 0,0001
12 (25)
4,03 (1,91-8,47)
< 0,0001
0,001
0,001
35 (51,6)
1
21 (38,9)
3,66 (1,89-7,09)
< 0,0001
18 (29,3)
2,07 (1,04-4,14)
0,038
0,078
< 0,0001
69 (44,6)
1
6 (7,5)
3,63 (1,86-7,09)
< 0,0001
Not significant
22 (73,1)
53 (20,6)
< 0,0001
Not significant
62 (46,8)
6 (0)
< 0,0001
0,028
29 (57,9)
1
46 (20,1)
1,87 (1,06-3,27)
0,889
17 (60)
58 (43,1)
0,953
18 (55,7)
57 (42)
< 0,0001
Not significant
27 (16,5)
48 (53,3)
0,679
19 (50,8)
56 (41,6)
0,458
19 (53,1)
56 (43,2)
95
No. Events
(% PFS)
Clinical Progression
Univariate
p Value
HR (95% CI)
0,63
Multivariate
P Value
2 (78,8)
20 (51,2)
21 (67,6)
5 (68,8)
0,01
Not significant
13 (71,2)
29 (57,2)
6 (52,2)
0,021
20 (73,1)
16 (42,2)
11 (47,2)
0,035
1
2,53 (1,11-5,74)
1,17 (0,51-2,69)
0,053
44 (61,6)
4 (58,3)
0,027
0,703
< 0,0001
1
5,49 (2,15-14)
0,003
Not significant
14 (79)
34 (44,8)
0,468
41 (63,4)
2 (50)
0,031
Not significant
20 (72,4)
28 (30,4)
0,198
7 (82,1)
41 (57,5)
0,689
11 (68,7)
37 (59,4)
0,035
16 (28)
32 (69,8)
0,898
11 (69,4)
37 (58,8)
0,862
11 (72,9)
37 (59,1)
Not significant
Table 7. BPFS and clinical PFS log rank and Cox regression tests in patients with PCa and no TMPRSS2ERG fusion gene expression analyzed by qRT-PCR.
T2-ERG Parameter
Age
≤ 55
56-65
66-75
> 75
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
IGF-1R
Low
High
IR
Low
High
IGF-1
Low
High
IGFBP-3
Low
High
CD99
Low
High
Biochemical Progression
No. No. Events Univariate
Pts (% BPFS)
p Value
HR (95% CI)
0,108
5
1 (80)
22 15 (23,9)
56 27 (29,1)
9
6 (33,3)
0,001
37 15 (43,1)
1
39
21 (39)
6,32 (2,73-14,4)
16
13 (0)
4,03 (1,91-8,47)
0007
53 22 (38,3)
1
26 16 (27,6)
3,66 (1,89-7,09)
13 11 (15,4)
2,07 (1,04-4,14)
0,007
81 39 (37,4)
1
11
10 (0)
3,63 (1,86-7,09)
0,005
49 21 (38,2)
43
28 (26)
0,041
80
43 (34)
6
5 (16,7)
< 0,0001
40 11 (53,9)
1
52 38 (17,4)
1,87 (1,06-3,27)
0,016
23 15 (34,8)
69 34 (35,3)
0,217
22
9 (54,5)
67 38 (25,4)
0,001
22 17 (14,9)
69 31 (38,3)
0,832
23 11 (46,5)
69 38 (31,3)
0,395
23 15 (16,9)
69 34 (40,2)
Multivariate
P Value
No. Events
(% PFS)
Clinical Progression
Univariate
p Value
HR (95% CI)
0,402
Multivariate
P Value
1 (80)
9 (45,9)
13 (73)
3 (37,5)
< 0,0001
< 0,0001
< 0,0001
0,001
< 0,0001
0,038
< 0,0001
0,002
Not significant
4 (85,7)
14 (57)
8 (0)
0,937
14 (63)
8 (62,6)
4 (68,4)
0,035
1
2,53 (1,11-5,74)
1,17 (0,51-2,69)
0,192
22 (64,8)
4 (60)
Not significant
0,027
0,703
< 0,0001
1
5,49 (2,15-14)
0,140
Not significant
11 (75,7)
15 (52,5)
Not significant
0,280
23 (63,3)
3 (50)
0,028
0,001
4 (87,6)
22 (43,7)
0,099
9 (58,9)
17 (67,2)
0,423
5 (75,9)
21 (58)
Not significant
0,012
10 (51,1)
15 (69,3)
0,768
5 (75,9)
21 (62,1)
0,658
7 (66,1)
19 (62,8)
96
Not significant
Table 8. BPFS and clinical PFS log rank and Cox regression tests in primary PCa analyzed by IHC.
Total cases IHC
Parameter
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
ERG intensity
Negative
Positive
IGF-1R intensity
Low expressors
High expressors
IR intensity
Low expressors
High expressors
CD99 intensity
Low expressors
High expressors
Biochemical Progression
No. No. Events Univariate
Pts (% BPFS)
p Value
HR (95% CI)
< 0,0001
87 26 (57,7)
1
123 60 (29,5)
4,46 (2,39-8,33)
29 23 (11,5)
2,84 (1,68-4,8)
< 0,0001
132 49 (45,5)
1
69 34 (40,5)
2,26 (1,38-3,73)
36 25 (26,4)
1,66 (0,98-2,82)
< 0,0001
219 95 (41,4)
1
19 14 (17,6)
2,52 (1,59-4)
< 0,0001
115 37 (55,9)
124 72 (23,4)
< 0,0001
209 91 (42,2)
10
10 (0)
< 0,0001
116 33(54,8)
1
123 76(21,5)
2,11 (1,36-3,27)
0,366
101 50 (23,7)
114 53 (42,2)
0,945
53 25 (35,5)
165 79 (34,6)
0,265
148 66 (41,7)
74 37 (32,8)
0,915
123 58 (30,9)
93 44 (43,1)
Multivariate
P Value
< 0,0001
No. Events
(% PFS)
Clinical Progression
Univariate
p Value
HR (95% CI)
< 0,0001
Multivariate
P Value
Not significant
12 (78,8)
41 (57,5)
11 (29)
0,05
0,12
28 (69,4)
23 (52,3)
12 (60,3)
< 0,0001
0,250
58 (62,8)
6 (63,2)
0,013
Not significant
22 (77,3)
42 (50,1)
0,253
55 (64)
4 (50)
0,01
< 0,0001
19 (77,9)
45 (41)
0,257
31 (59,7)
30 (61,1)
0,939
15 (66,8)
46 (59,3)
0,566
39 (66,8)
21 (51,4)
0,802
34 (62,9)
26 (60,1)
97
0,008
1
2,11 (1,21-3,69)
Table 9. BPFS and clinical PFS log rank and Cox regression tests in patients with PCa and
TMPRSS2-ERG positive analyzed by IHC.
ERG Positive
Parameter
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
IGF-1R intensity
Low expressors
High expressors
IR intensity
Low expressors
High expressors
CD99 intensity
Low expressors
High expressors
No.
Pts
43
61
10
63
32
19
34
79
56
58
92
6
59
55
10
104
67
47
62
51
Biochemical Progression
No. Events Univariate
(% BPFS)
p Value
HR (95% CI)
<0,0001
13 (59,6)
1
32 (30,9)
5,98 (2,15-16,6)
8 (20)
3,16 (1,29-7,75)
<0,0001
21 (56,8)
1
16 (38)
3,98 (1,86-8,47)
16 (0)
2,39 (1,10-5,18)
<0,0001
7 (74,1)
46 (28,7)
0,006
18 (64,8)
35 (23,2)
0,001
40 (47,2)
6 (0)
<0,0001
17 (65)
1
36 (12,9)
2,65 (1,33-5,29)
0,654
4 (60)
49 (39,9)
0,845
31 (45,1)
22 (37,4)
0,175
32 (33,3)
20 (50,9)
Multivariate
P Value
0,003
0,002
Not significant
Not significant
Not significant
0,006
98
Clinical Progression
No. Events Univariate
Multivariate
(% PFS)
p Value HR (95% CI)
P Value
0,001
Not significant
5 (78,6)
24 (45,8)
1 (87,5)
0,079
11 (73,5)
12 (45,8)
7 (52,7)
0,006
0,048
3 (85,6)
1
27 (50,8)
3,42 (1-1,16)
0,077
10 (76,3)
20 (48,6)
0,906
23 (62,7)
2 (66,7)
0,04
Not significant
11 (74,3)
19 (39,4)
0,977
3 (65,6)
27 (60,5)
0,618
19 (61,8)
11 (62,4)
0,610
18 (45,4)
13 (65,2)
Table 10. BPFS and clinical PFS log rank and Cox regression tests in patients with PCa and
TMPRSS2-ERG negative analyzed by IHC.
ERG Negative
Parameter
Gleason-sp:
2-6
7
Greater than 7
PSA (ng/ml):
10 or less
10-20
Greater than 20
cT:
cT2b or less
cT3a or greater
pT:
pT2 or less
pT3 or greater
pN:
pN0
pN1 or greater
Margins:
Negative
Positive
IGF-1R intensity
Low expressors
High expressors
IR intensity
Low expressors
High expressors
CD99 intensity
Low expressors
High expressors
No.
Pts
32
53
16
52
32
15
93
8
43
58
93
4
43
58
43
58
74
25
58
41
Biochemical Progression
No. Events Univariate
(% BPFS)
p Value
HR (95% CI)
0,003
11 (32,7)
27 (23,7)
12 (15,6)
0,810
25 (16,9)
16 (43,6)
8 (44,4)
0,011
44 (25,2)
6 (15)
0,013
16 (30,2)
34 (18,7)
< 0.0001
45 (24,5)
1
4 (0)
21,73 (6,36-71,42)
0,003
14 (23,1)
1
36 (31,3)
2,71 (1,41-5,23)
0,786
21 (25,7)
29 (22,1)
0,06
33 (35,6)
15 (27,9)
0,078
25 (29,2)
24 (29,8)
Multivariate
P Value
Not significant
Not significant
Not significant
< 0,0001
0,003
99
Clinical Progression
No. Events Univariate
Multivariate
(% PFS)
p Value
P Value
HR (95% CI)
0,014
Not significant
6 (77,4)
16 (66,3)
9 (0)
0,929
17 (55,7)
9 (66,1)
4 (71,4)
0,055
Not significant
10 (52,6)
21 (55,9)
0,226
11 (72,2)
20 (46,9)
0,088
29 (60,1)
2 (0)
0,01
0,015
7 (78,6)
1
24 (38,5)
2,87 (1,23-6,71)
0,45
12 (68)
19 (55,8)
0,08
20 (68,9)
10 (0)
0,64
17 (66,7)
13 (44,5)
Discussion
Several studies have pointed out the relevance of ETS family of transcription factors in
pathogenesis and progression of several cancers. ETS proteins act as gene activators or
repressors, regulating genes involved in proliferation, differentiation, apoptosis,
metastasis, tissue remodeling, and angiogenesis. Expression of ETS genes has been
found altered both in leukaemias and solid tumors and, particularly, an aberrant
expression due to chromosomal translocations has been described as a common feature
of different tumor types including ES, PCa and acute myeloid leukaemia. Presence of
tumor-specific fusion genes represents a potential opportunity in clinic for identification
of diagnosis or prognosis biomarkers and pharmacologic intervention to therapeutic
benefit. More recently, interest in ETS-driven diseases has been further supported by
finding that several chemotherapeutic drugs including cytarabine, doxorubicin [366] and
etoposide [367] induce an ETS-attenuation gene expression signature while resulting in
significant co-morbidities, including organ-toxicity, such as cardiomyopathy, or second
malignancy due to shared molecular mechanisms between tumor and normal tissues
[368, 369]. Taken together these evidences highlight the importance of transversal
studies to unravel shared or distinct target genes, pathways and mechanisms of
regulation in ETS-driven diseases. In this study, ES and PCa have been considered in
order to identify common or distinctive mechanisms determined by ETS
rearrangements. Particularly, impact of EWS-FLI1, the hall mark of ES, and
TMPRSS2-ERG, in PCa, has been investigated on the IGF system and CD99 molecule.
In ES, EWS-FLI1 has been demonstrated to regulate transcription of some IGF system
components, including IGF-1 and IGFBP-3, acting as gene activator and repressor,
respectively, as well as CD99 promoter. It has been recently demonstrated that ETSpositive prostate tumors display a greater under-expression of IGFBP-3 compared to
ETS-negative [370]. The presented results demonstrate for the first time that IGF-1R
represents a common target of ETS rearrangements.
ChIP analysis showed ERG and FLI1 binding to the IGF-1R gene promoter, suggesting
a direct transcriptional regulation of IGF-1R by tERG in PCa or EWS-FLI1 in ES.
Possibility to have common deregulated genes is in line with previous evidences
demonstrating that tERG, EWS-ERG or FUS/ERG actually significantly up-regulate the
transcript of more than 100 common genes, including PIM-1, in the NIH-3T3 cell line
[174]. In PCa, a greater ERG recruitment to IGF-1R promoter was found in VCaP cells
compared to PC-3 or in RWPE-1_tERG compared to empty vector. In addition,
100
androgen deprivation induced by abiraterone acetate treatment in the androgenresponsive VCaP cells caused a decrease in the expression of ERG, as previously
reported [371], but also an inhibition of IGF-1R confirming the presence of a
TMPRSS2-ERG/IGF-1R androgen-regulated axis. The relationship between T2E and
IGF-1R was also confirmed in radical prostatectomy specimens; patients expressing the
fusion gene exhibited higher IGF-1R expression. TMPRSS2-ERG represents an early
event in prostate cancer but its expression is maintained from primary tumor cells to
metastatic cells [372]. Considering that RWPE-1 is a model of non-tumorigenic
immortalized cells while VCaP cells are representative of advanced disease, the data
indicate that TMPRSS2-ERG/IGF-1R axis may represent a constant mechanism along
the different stages of the pathology. The IGF-1R gene has been identified as a
molecular target for a number of stimulatory transcription factors and inhibitory
proteins with important implications in cancer. Aberrant fusion product such as EWSWT1, the genetic hallmarks of desmoplastic small round cell tumor, was found to act as
transactivator for the IGF-1R gene, providing a selective growth advantage to tumor
cells. Despite in contrast with previous evidences in literature [92], EWS-FLI1 was
found to bind IGF-1R gene promoter indicating a transcriptional regulation. In addition,
silencing of EWS-FLI1 was observed in parallel with down-regulation of IGF-1R
suggesting that IGF-1R is indeed a target of EWS-FLI1. Identification of EWS-FLI1
targets represents a key aspect in the understanding of the molecular behavior of ES. It
is widely recognized that EWS-FLI1 cooperates with the IGF system in establishment
of the pathology. Therefore, this study provide a crucial explanation of the elevated
IGF-1R expression described in 70 to 80% of patients [282] and more strongly support
the importance of EWS-FLI1 and IGF system in maintenance of ES malignancy.
On the contrary, data from this study indicate CD99 is differentially regulated between
ETS-related tumors as CD99 is a target of EWS-FLI1 but not of tERG. As previously
demonstrated, within different tumors ETS rearrangements can differentially regulate
expression of target genes like the reported KCNN2 [370]. In ES, CD99 represents a
validated EWS-FLI1 target as the chimera was found to bind its promoter and EWSFLI1 forced expression in mesenchymal stem cells induced up-regulation of CD99 [94,
373]. In PCa, CD99 acts as a putative oncosuppressor and it did not show significant
differences between tERG-positive and –negative cells both considering binding of
ERG to the promoter and transcript levels. Noteworthy, CD99 expression is decreased
in PCa in general suggesting that regulation of CD99 may be controlled by other
mechanisms, such as promoter methylation as described for CAV1 gene in PCa [374]. In
this study, a direct correlation was anyway found between ERG and CD99 proteins both
in vitro and in patients. Explanation of this relationship is not easy and it would request
101
more detailed analysis but putatively suggests that ERG target genes comprehend
regulators of CD99, possibly including miRNAs as previously demonstrated in ES
[375]. Considering that ERG expression represents a marker of malignancy while CD99
is associated with a benign phenotype in could be speculated that effective relevance of
this interaction could be marginal consistently with absence of association between
CD99 and survival.
From the clinical standpoint, the ETS/IGF-1R mechanism appears of high interest as it
provides basis for a more rationale use of anti-IGF-1R inhibitors in these tumor types.
In PCa, the contribution of IGF-1R to prostate carcinogenesis and progression remains
controversial, but epidemiological, preclinical and clinical results indicate that IGF-1R
over-expression plays an important role in the pathogenesis of CRPC. This evidence, in
particular, lead to the enrollment of castration-resistant prostate cancer patients in
several clinical trials investigating the effects of IGF-1R inhibitors but the studies
evidenced a modest effect of IGF-1R inhibition with a minority of patients experiencing
significant benefits. Data from this study demonstrate that only PCa cells expressing the
fusion gene and consequently higher levels of IGF-1R display a potential relevant
sensitivity to anti-IGF-1R agents. Accordingly, ERG silencing caused a decreased
sensitivity to the treatment. These results are in line with previous evidences
demonstrating that PARP1 inhibitors blocked ETS-positive but not ETS-negative
prostate cancer xenograft growth and reflect more recent evidences showing that
treatment with ganitumab, an IGF-1R inhibitor, blocked growth of T2E-positive VCaP
but not T2E-negative 22RV1 xenograft models [376]. In addition, ERG silencing
determined a decreased sensitivity to abiraterone acetate, consistently with previous
observations that T2E-positive PCa patients display a better response to anti-androgen
therapy. In clinic, the onset of androgen receptor-linked resistance mechanisms in
CRPC patients treated with abiraterone represents an important limitation and the
identification of “druggable” target involved in the androgen receptor pathway represent
an interesting opportunity to overcome the resistance. In this perspective, different
studies have been designed in order to combine abiraterone with targeted agents
including Src inhibitors [377] or PI3K pathway inhibitors [378]. The results provide a
preliminary in vitro evidence regarding the benefits of a combined treatment of the
monoclonal antibody CP-751,871 with abiraterone acetate. Particularly, in VCaP cells
association of CP-751,871 with abiraterone acetate gave synergistic effects, supporting
the concept of a simultaneous use of two targeted agents to deprive tERG-expressing
cells of fundamental pathways that operate in concert to sustain cell proliferation.
Overall, data in PCa provide a criterion for patient selection, identifying CRPC patients
expressing TMPRSS2-ERG as good responders to anti-IGF-1R treatment. In ES, all of
102
the patients express the EWS-FLI1 chimera therefore avoiding application of a similar
criterion in this tumor type. Anyway, presence of EWS-FLI1/IGF-1R axis provides
rationale for combination of anti-IGF-1R agents with the newly licensed
chemotherapeutic agent trabectedin consistently with its effects on IGF-1R expression
levels. Trabectedin is an alkylator agent particularly toxic in sarcomas bearing
translocations. The reason is the recently evidenced capability of DNA binding agents
including trabectedin but also DXR, mithramycin, and actinomycin D to alter
transcriptional activities of ETS rearrangements attenuating their gene signature. These
data introduce a certain level of specificity in the action of conventional agents,
depending on the drug itself, the transcription factor and the cellular context.
Accordingly, trabectedin and DXR caused detachment of EWS-FLI1 chimera from its
target promoters, including TGFβR2 and CD99, while only trabectedin enhanced EWSFLI1 occupancy on the IGF-1R promoter. Increased EWS-FLI1 binding to specific
promoters represent another variable in the mechanism of action of chemotherapeutics
and, in addition, appears peculiar of this tumor type. In PCa trabectedin was found to
decrease binding of ERG to both PIM-1 and IGF-1R promoters without affecting
binding to CD99 promoter evidencing the cell-specific action of this agent. These data
are in line with previous evidences in myxoid liposarcoma where trabectedin but not
DXR affected the binding of FUS-CHOP to target promoters [26]. In ES, increased
binding of EWS-FLI1 to IGF-1R promoter corresponded to higher IGF-1R protein
expression providing the rationale for a combined use of trabectedin with anti-IGF-1R
agents. Combination of trabectedin with the dual inhibitor IGF-1R/IR OSI-906, a small
molecule shown to have anti-tumoral activity against several tumors, gave synergistic
effects in the ES cell lines considered in this study. On the opposite side, no synergistic
effect was observed in VCaP PCa cells harboring the fusion gene. Use of anti-IGF-1R
inhibitors in ES gave satisfactory results at preclinical levels but limited effectiveness in
clinic [379]. Use of trabectedin as single agent did not demonstrated significant activity
in sarcomas including ES [99]. Considering the paucity of therapeutic choices in ES,
these data demonstrate the potential benefit of a combination between trabectedin and
anti-IGF-1R agents and provide a novel therapeutic strategy for treatment of ES
patients.
Understanding the clinical role of the IGF system represents an important choice to
defeat tumor cells because different subtypes of patients may have distinct outcome and
may require differential treatment. In this study, expression of different components of
the IGF system was analyzed in a primary PCa series taking in account gene fusion
presence. Overall, no relevant differential expression was found between tumor and
normal cells except for a lower tumor expression of IGFBP-3, consistently with
103
published data. In addition, as prognostic implications of IGF system components
expression are still controversial, association with outcome was evaluated both
considering total cases and subgroups of patients harboring or not the fusion gene.
Overall, the findings reported in this study support a relationship between high mRNA
expression of IGF-1 and IGF-1R and favorable outcome. High expression of IGF-1R
by immunohistochemistry did not distinguish patients with different prognosis but
immunohistochemistry has limited power in terms of antigen quantification.
Previous studies regarding IGF-1R prognosis value reported similar results in sarcomas
and in carcinomas. In ES, lower IGF-1 circulating levels were found in patients with
metastatic disease [380] while in a cohort of 57 patients a relationship was found
between high expression of IGF-1R and IGF-1 and favorable prognosis [282]. In breast
cancer, higher expression of IGF-1R was found in tumor specimens compared to
matched control samples [381]. Data in PCa are highly conflicting but, as previously
reported, some of them are in accordance with a correlation between elevated IGF-1R
activity and minor malignancy. Results from this study add another level of complexity
because, while IGF-1 significance was maintained in all the analyzed subgroups, IGF1R was found to influence BPFS in the TMPRSS2-ERG-negative patients while
marginal or no association was found in the total cases or TMPRSS2-ERG-positive
cases, respectively. Several studies report that TMPRSS2-ERG presence defines
patients with different biological and clinical behaviors [191]. For this reason,
identification of molecular targets related to androgen-mediated activation of
TMPRSS2-ERG has a relevance for the clinical management of PCa. Lesions mutually
exclusive with presence or absence of ETS rearrangements have been found laying the
basis for the molecular characterization of PCa, often beginning with ETS-positive and
ETS-negative subclasses. Mutations and deletions in PTEN and p53 are enriched in
ETS-positive tumors while mutations on SPOP, CDH1, and over-expression of SPINK1
exclusively occur in ETS-negative tumors defining molecular subtypes of PCa [382].
Recently, molecular alterations in SPOP gene were found to define a new subtype of
PCa and the prognosis value of SPOP was statistically more significant in the subgroup
of patients without the fusion gene [179]. Accordingly, the obtained results identify the
subgroup of ETS-negative and IGF-1R low-expressor patients as a group with a
particularly poor biochemical progression free survival. IGF-1R could thus represent a
useful biomarker for patients not harboring the fusion gene alongside the parameters
already used in clinic. IGF system sustains tumor cell proliferation, protects cells from
apoptosis and DNA damage but also favors differentiation [218], depending on the
cellular context. Overall, the presented results indicate IGF-1R drives different effects
depending on the presence or absence of TMPRSS2-ERG. In case of PCa, it has been
104
already reported that TMPRSS2-ERG regulates several pathways including
differentiation [383]. Indeed, it has been recently demonstrated that TMPRSS2-ERG
blocks luminal cell differentiation driving proliferation [384]. As a consequence, it
could be speculated that when TMPRSS2-ERG is expressed, IGF-1R acts in a less
differentiated phenotype where drives proliferation while IGF-1R activity turns toward
differentiation in presence of TMPRSS2-ERG and a more differentiated context. These
conclusions could be in accordance with a recent in vitro study showing that IGF-1R
stimulation induces differentiation in non-malignant cells while induces proliferation in
malignant cell models [385] further supporting the importance of the cellular context for
IGF-1R activity.
Identification of biomarkers in PCa represents an urgent need. With this perspective and
to get more insight regarding its value in PCa, CD99 prognostic relevance was
evaluated. Prognosis value of CD99 has been recently demonstrated in multiple
myeloma, where its expression correlates with longer overall survival [386], and in
osteosarcoma, where low expression of this molecule correlates with poor outcome
[387], while no previous information was available in PCa. In this study, despite a little
trend suggesting a correlation between CD99 expression and a better biochemical free
progression free survival, no clinical relevance for CD99 was found in the field of
prognostic biomarkers. In accordance to preliminary data indicating a role of CD99 in
metastasis, the data suggest that CD99 loss could represent a relevant event in
influencing invasiveness processes as supported by the association between CD99 and
positivity of margins.
In conclusion, this study demonstrates that IGF-1R is an important target of tERG and
EWS-FLI1, and that this interaction has relevant translational implications both in PCa
and in ES. In PCa, it leads to a higher IGF-1R expression both in cell lines and in
patients providing the rationale for treating the subpopulation of patients expressing
T2E with anti-IGF-1R agents especially in combination with abiraterone acetate. In ES,
trabectedin enhanced binding of EWS-FLI1 to the IGF-1R promoter, which resulted in
increased IGF-1R expression, suggesting the criterion for development of a therapy that
combines trabectedin with anti-IGF signaling agents. CD99 is differentially regulated
between PCa and ES, beside ETS consensus sequences are present in its promoter
suggesting further analysis are required. In addition it did not display prognostic value
in PCa while IGF-1R expression discriminates patients with different outcome inside
the subgroup of cases negative for the fusion gene.
105
Bibliography
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Stern, C., Boveri and the early days of genetics. Nature, 1950. 166(4219): p.
446.
Rabbitts, T.H., Chromosomal translocations in human cancer. Nature, 1994.
372(6502): p. 143-9.
Sorensen, P.H. and T.J. Triche, Gene fusions encoding chimaeric transcription
factors in solid tumours. Semin Cancer Biol, 1996. 7(1): p. 3-14.
Gunji, H., et al., TEL/AML1 shows dominant-negative effects over TEL as well
as AML1. Biochem Biophys Res Commun, 2004. 322(2): p. 623-30.
Rowley, J.D., Letter: A new consistent chromosomal abnormality in chronic
myelogenous leukaemia identified by quinacrine fluorescence and Giemsa
staining. Nature, 1973. 243(5405): p. 290-3.
Zech, L., et al., Characteristic chromosomal abnormalities in biopsies and
lymphoid-cell lines from patients with Burkitt and non-Burkitt lymphomas. Int J
Cancer, 1976. 17(1): p. 47-56.
Taub, R., et al., Translocation of the c-myc gene into the immunoglobulin heavy
chain locus in human Burkitt lymphoma and murine plasmacytoma cells. Proc
Natl Acad Sci U S A, 1982. 79(24): p. 7837-41.
Fusco, A., et al., A new oncogene in human thyroid papillary carcinomas and
their lymph-nodal metastases. Nature, 1987. 328(6126): p. 170-2.
Mitelman, F., B. Johansson, and F. Mertens, The impact of translocations and
gene fusions on cancer causation. Nat Rev Cancer, 2007. 7(4): p. 233-45.
Bartram, C.R., et al., Translocation of c-ab1 oncogene correlates with the
presence of a Philadelphia chromosome in chronic myelocytic leukaemia.
Nature, 1983. 306(5940): p. 277-80.
Buchdunger, E., et al., Inhibition of the Abl protein-tyrosine kinase in vitro and
in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res, 1996. 56(1): p.
100-4.
Kantarjian, H., et al., Hematologic and cytogenetic responses to imatinib
mesylate in chronic myelogenous leukemia. N Engl J Med, 2002. 346(9): p. 64552.
Sewastianik, T., et al., MYC deregulation in lymphoid tumors: molecular
mechanisms, clinical consequences and therapeutic implications. Biochim
Biophys Acta, 2014. 1846(2): p. 457-467.
Dreyling, M., Mantle cell lymphoma: biology, clinical presentation, and
therapeutic approaches. Am Soc Clin Oncol Educ Book, 2014: p. 191-8.
106
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
Liu, X., et al., The DNA binding property of PML/RARA but not the integrity of
PML nuclear bodies is indispensable for leukemic transformation. PLoS One,
2014. 9(8): p. e104906.
Welch, J.S., et al., Use of whole-genome sequencing to diagnose a cryptic fusion
oncogene. JAMA, 2011. 305(15): p. 1577-84.
Toretsky, J.A., et al., Oncoprotein EWS-FLI1 activity is enhanced by RNA
helicase A. Cancer Res, 2006. 66(11): p. 5574-81.
Erkizan, H.V., et al., A small molecule blocking oncogenic protein EWS-FLI1
interaction with RNA helicase A inhibits growth of Ewing's sarcoma. Nat Med,
2009. 15(7): p. 750-6.
Hong, S.H., et al., Pharmacokinetic modeling optimizes inhibition of the
'undruggable' EWS-FLI1 transcription factor in Ewing Sarcoma. Oncotarget,
2014. 5(2): p. 338-50.
Grohar, P.J., et al., Dual targeting of EWS-FLI1 activity and the associated DNA
damage response with trabectedin and SN38 synergistically inhibits Ewing
sarcoma cell growth. Clin Cancer Res, 2014. 20(5): p. 1190-203.
Barber-Rotenberg, J.S., et al., Single enantiomer of YK-4-279 demonstrates
specificity in targeting the oncogene EWS-FLI1. Oncotarget, 2012. 3(2): p. 17282.
Riggi, N., et al., Expression of the FUS-CHOP fusion protein in primary
mesenchymal progenitor cells gives rise to a model of myxoid liposarcoma.
Cancer Res, 2006. 66(14): p. 7016-23.
Izbicka, E., et al., In vitro antitumor activity of the novel marine agent,
ecteinascidin-743 (ET-743, NSC-648766) against human tumors explanted from
patients. Ann Oncol, 1998. 9(9): p. 981-7.
D'Incalci, M. and J. Jimeno, Preclinical and clinical results with the natural
marine product ET-743. Expert Opin Investig Drugs, 2003. 12(11): p. 1843-53.
Forni, C., et al., Trabectedin (ET-743) promotes differentiation in myxoid
liposarcoma tumors. Mol Cancer Ther, 2009. 8(2): p. 449-57.
Di Giandomenico, S., et al., Mode of action of trabectedin in myxoid
liposarcomas. Oncogene, 2014. 33(44): p. 5201-10.
Grosso, F., et al., Efficacy of trabectedin (ecteinascidin-743) in advanced
pretreated myxoid liposarcomas: a retrospective study. Lancet Oncol, 2007.
8(7): p. 595-602.
Trautmann, M., et al., SS18-SSX fusion protein-induced Wnt/beta-catenin
signaling is a therapeutic target in synovial sarcoma. Oncogene, 2014. 33(42):
p. 5006-16.
Tomlins, S.A., et al., Recurrent fusion of TMPRSS2 and ETS transcription factor
genes in prostate cancer. Science, 2005. 310(5748): p. 644-8.
Clark, J., et al., Diversity of TMPRSS2-ERG fusion transcripts in the human
prostate. Oncogene, 2007. 26(18): p. 2667-73.
107
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
Squire, J.A., et al., Prostate cancer as a model system for genetic diversity in
tumors. Adv Cancer Res, 2011. 112: p. 183-216.
Robert, G., et al., Rational basis for the combination of PCA3 and
TMPRSS2:ERG gene fusion for prostate cancer diagnosis. Prostate, 2013. 73(2):
p. 113-20.
Tomlins, S.A., et al., The role of SPINK1 in ETS rearrangement-negative
prostate cancers. Cancer Cell, 2008. 13(6): p. 519-28.
Laxman, B., et al., A first-generation multiplex biomarker analysis of urine for
the early detection of prostate cancer. Cancer Res, 2008. 68(3): p. 645-9.
Wang, J., et al., Pleiotropic biological activities of alternatively spliced
TMPRSS2/ERG fusion gene transcripts. Cancer Res, 2008. 68(20): p. 8516-24.
Shao, L., et al., Highly specific targeting of the TMPRSS2/ERG fusion gene
using liposomal nanovectors. Clin Cancer Res, 2012. 18(24): p. 6648-57.
Soda, M., et al., Identification of the transforming EML4-ALK fusion gene in
non-small-cell lung cancer. Nature, 2007. 448(7153): p. 561-6.
Casaluce, F., et al., ALK inhibitors: a new targeted therapy in the treatment of
advanced NSCLC. Target Oncol, 2013. 8(1): p. 55-67.
Seth, A. and D.K. Watson, ETS transcription factors and their emerging roles in
human cancer. Eur J Cancer, 2005. 41(16): p. 2462-78.
Seth, A., et al., c-ets-2 protooncogene has mitogenic and oncogenic activity.
Proc Natl Acad Sci U S A, 1989. 86(20): p. 7833-7.
Seth, A. and T.S. Papas, The c-ets-1 proto-oncogene has oncogenic activity and
is positively autoregulated. Oncogene, 1990. 5(12): p. 1761-7.
Hart, A.H., et al., Human ERG is a proto-oncogene with mitogenic and
transforming activity. Oncogene, 1995. 10(7): p. 1423-30.
Shimizu, K., et al., An ets-related gene, ERG, is rearranged in human myeloid
leukemia with t(16;21) chromosomal translocation. Proc Natl Acad Sci U S A,
1993. 90(21): p. 10280-4.
Panagopoulos, I., et al., Fusion of the FUS gene with ERG in acute myeloid
leukemia with t(16;21)(p11;q22). Genes Chromosomes Cancer, 1994. 11(4): p.
256-62.
Ichikawa, H., et al., Dual transforming activities of the FUS (TLS)-ERG
leukemia fusion protein conferred by two N-terminal domains of FUS (TLS).
Mol Cell Biol, 1999. 19(11): p. 7639-50.
Ewing, J., Classics in oncology. Diffuse endothelioma of bone. James Ewing.
Proceedings of the New York Pathological Society, 1921. CA Cancer J Clin,
1972. 22(2): p. 95-8.
Kovar, H., Progress in the molecular biology of ewing tumors. Sarcoma, 1998.
2(1): p. 3-17.
de Alava, E. and W.L. Gerald, Molecular biology of the Ewing's
sarcoma/primitive neuroectodermal tumor family. J Clin Oncol, 2000. 18(1): p.
204-13.
108
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
Khoury, J.D., Ewing sarcoma family of tumors. Adv Anat Pathol, 2005. 12(4): p.
212-20.
Buckley, J.D., et al., Epidemiology of osteosarcoma and Ewing's sarcoma in
childhood: a study of 305 cases by the Children's Cancer Group. Cancer, 1998.
83(7): p. 1440-8.
Novakovic, B., et al., Increased risk of neuroectodermal tumors and stomach
cancer in relatives of patients with Ewing's sarcoma family of tumors. J Natl
Cancer Inst, 1994. 86(22): p. 1702-6.
McKeen, E.A., et al., Birth defects with Ewing's sarcoma. N Engl J Med, 1983.
309(24): p. 1522.
Kuttesch, J.F., Jr., et al., Second malignancies after Ewing's sarcoma: radiation
dose-dependency of secondary sarcomas. J Clin Oncol, 1996. 14(10): p. 281825.
Travis, L.B., et al., Second cancers in patients with Ewing's sarcoma. Med
Pediatr Oncol, 1994. 22(4): p. 296-7.
Enneking, W.F., Musculoskeletal tumor staging: 1988 update. Cancer Treat Res,
1989. 44: p. 39-49.
Arndt, C.A. and W.M. Crist, Common musculoskeletal tumors of childhood and
adolescence. N Engl J Med, 1999. 341(5): p. 342-52.
Bacci, G., et al., Prognostic factors in nonmetastatic Ewing's sarcoma of bone
treated with adjuvant chemotherapy: analysis of 359 patients at the Istituto
Ortopedico Rizzoli. J Clin Oncol, 2000. 18(1): p. 4-11.
Tucker, M.A., et al., Bone sarcomas linked to radiotherapy and chemotherapy in
children. N Engl J Med, 1987. 317(10): p. 588-93.
Cavazzana, A.O., et al., Experimental evidence for a neural origin of Ewing's
sarcoma of bone. Am J Pathol, 1987. 127(3): p. 507-18.
Noguera, R., et al., Patterns of differentiation in extraosseous Ewing's sarcoma
cells. An in vitro study. Cancer, 1994. 73(3): p. 616-24.
Hu-Lieskovan, S., et al., EWS-FLI1 fusion protein up-regulates critical genes in
neural crest development and is responsible for the observed phenotype of
Ewing's family of tumors. Cancer Res, 2005. 65(11): p. 4633-44.
Torchia, E.C., S. Jaishankar, and S.J. Baker, Ewing tumor fusion proteins block
the differentiation of pluripotent marrow stromal cells. Cancer Res, 2003.
63(13): p. 3464-8.
Eliazer, S., et al., Alteration of mesodermal cell differentiation by EWS/FLI-1,
the oncogene implicated in Ewing's sarcoma. Mol Cell Biol, 2003. 23(2): p.
482-92.
Riggi, N., et al., Development of Ewing's sarcoma from primary bone marrowderived mesenchymal progenitor cells. Cancer Res, 2005. 65(24): p. 11459-68.
Castillero-Trejo, Y., et al., Expression of the EWS/FLI-1 oncogene in murine
primary bone-derived cells Results in EWS/FLI-1-dependent, ewing sarcomalike tumors. Cancer Res, 2005. 65(19): p. 8698-705.
109
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
Tirode, F., et al., Mesenchymal stem cell features of Ewing tumors. Cancer Cell,
2007. 11(5): p. 421-9.
Helman, L.J. and P. Meltzer, Mechanisms of sarcoma development. Nat Rev
Cancer, 2003. 3(9): p. 685-94.
Turc-Carel, C., et al., [Chromosomal translocation (11; 22) in cell lines of
Ewing's sarcoma]. C R Seances Acad Sci III, 1983. 296(23): p. 1101-3.
Delattre, O., et al., Gene fusion with an ETS DNA-binding domain caused by
chromosome translocation in human tumours. Nature, 1992. 359(6391): p. 1625.
Sankar, S. and S.L. Lessnick, Promiscuous partnerships in Ewing's sarcoma.
Cancer Genet, 2011. 204(7): p. 351-65.
May, W.A., et al., Ewing sarcoma 11;22 translocation produces a chimeric
transcription factor that requires the DNA-binding domain encoded by FLI1 for
transformation. Proc Natl Acad Sci U S A, 1993. 90(12): p. 5752-6.
Janknecht, R., EWS-ETS oncoproteins: the linchpins of Ewing tumors. Gene,
2005. 363: p. 1-14.
Riggi, N. and I. Stamenkovic, The Biology of Ewing sarcoma. Cancer Lett,
2007. 254(1): p. 1-10.
Ouchida, M., et al., Loss of tumorigenicity of Ewing's sarcoma cells expressing
antisense RNA to EWS-fusion transcripts. Oncogene, 1995. 11(6): p. 1049-54.
Kovar, H., et al., EWS/FLI-1 antagonists induce growth inhibition of Ewing
tumor cells in vitro. Cell Growth Differ, 1996. 7(4): p. 429-37.
Toretsky, J.A., et al., Inhibition of EWS-FLI-1 fusion protein with antisense
oligodeoxynucleotides. J Neurooncol, 1997. 31(1-2): p. 9-16.
Lambert, G., et al., EWS fli-1 antisense nanocapsules inhibits ewing sarcomarelated tumor in mice. Biochem Biophys Res Commun, 2000. 279(2): p. 401-6.
Prieur, A., et al., EWS/FLI-1 silencing and gene profiling of Ewing cells reveal
downstream oncogenic pathways and a crucial role for repression of insulin-like
growth factor binding protein 3. Mol Cell Biol, 2004. 24(16): p. 7275-83.
Siligan, C., et al., EWS-FLI1 target genes recovered from Ewing's sarcoma
chromatin. Oncogene, 2005. 24(15): p. 2512-24.
Deneen, B. and C.T. Denny, Loss of p16 pathways stabilizes EWS/FLI1
expression and complements EWS/FLI1 mediated transformation. Oncogene,
2001. 20(46): p. 6731-41.
Lessnick, S.L., C.S. Dacwag, and T.R. Golub, The Ewing's sarcoma oncoprotein
EWS/FLI induces a p53-dependent growth arrest in primary human fibroblasts.
Cancer Cell, 2002. 1(4): p. 393-401.
Graves, B.J. and J.M. Petersen, Specificity within the ets family of transcription
factors. Adv Cancer Res, 1998. 75: p. 1-55.
Braunreiter, C.L., et al., Expression of EWS-ETS fusions in NIH3T3 cells reveals
significant differences to Ewing's sarcoma. Cell Cycle, 2006. 5(23): p. 2753-9.
110
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
Welford, S.M., et al., DNA binding domain-independent pathways are involved
in EWS/FLI1-mediated oncogenesis. J Biol Chem, 2001. 276(45): p. 41977-84.
Armengol, G., et al., Recurrent gains of 1q, 8 and 12 in the Ewing family of
tumours by comparative genomic hybridization. Br J Cancer, 1997. 75(10): p.
1403-9.
Savola, S., et al., Combined use of expression and CGH arrays pinpoints novel
candidate genes in Ewing sarcoma family of tumors. BMC Cancer, 2009. 9: p.
17.
Huang, H.Y., et al., Ewing sarcomas with p53 mutation or p16/p14ARF
homozygous deletion: a highly lethal subset associated with poor
chemoresponse. J Clin Oncol, 2005. 23(3): p. 548-58.
Lopez-Guerrero, J.A., et al., Molecular analysis of the 9p21 locus and p53 genes
in Ewing family tumors. Lab Invest, 2001. 81(6): p. 803-14.
Brohl, A.S., et al., The genomic landscape of the Ewing Sarcoma family of
tumors reveals recurrent STAG2 mutation. PLoS Genet, 2014. 10(7): p.
e1004475.
Crompton, B.D., et al., The genomic landscape of pediatric ewing sarcoma.
Cancer Discov, 2014. 4(11): p. 1326-41.
Tirode, F., et al., Genomic Landscape of Ewing Sarcoma Defines an Aggressive
Subtype with Co-Association of STAG2 and TP53 Mutations. Cancer Discov,
2014. 4(11): p. 1342-53.
Herrero-Martin, D., et al., Stable interference of EWS-FLI1 in an Ewing
sarcoma cell line impairs IGF-1/IGF-1R signalling and reveals TOPK as a new
target. Br J Cancer, 2009. 101(1): p. 80-90.
Scotlandi, K., et al., CD99 engagement: an effective therapeutic strategy for
Ewing tumors. Cancer Res, 2000. 60(18): p. 5134-42.
Rocchi, A., et al., CD99 inhibits neural differentiation of human Ewing sarcoma
cells and thereby contributes to oncogenesis. J Clin Invest, 2010. 120(3): p. 66880.
Meyers, P.A. and A.S. Levy, Ewing's sarcoma. Curr Treat Options Oncol, 2000.
1(3): p. 247-57.
Olmos, D., et al., Targeting the Insulin-Like Growth Factor 1 Receptor in
Ewing's Sarcoma: Reality and Expectations. Sarcoma, 2011. 2011: p. 402508.
Grohar, P.J., et al., Ecteinascidin 743 interferes with the activity of EWS-FLI1 in
Ewing sarcoma cells. Neoplasia, 2011. 13(2): p. 145-53.
Lau, L., et al., A phase I and pharmacokinetic study of ecteinascidin-743
(Yondelis) in children with refractory solid tumors. A Children's Oncology
Group study. Clin Cancer Res, 2005. 11(2 Pt 1): p. 672-7.
Baruchel, S., et al., A phase 2 trial of trabectedin in children with recurrent
rhabdomyosarcoma, Ewing sarcoma and non-rhabdomyosarcoma soft tissue
sarcomas: a report from the Children's Oncology Group. Eur J Cancer, 2012.
48(4): p. 579-85.
111
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
Denmeade, S.R. and J.T. Isaacs, A history of prostate cancer treatment. Nat Rev
Cancer, 2002. 2(5): p. 389-96.
Jemal, A., et al., Global cancer statistics. CA Cancer J Clin, 2011. 61(2): p. 6990.
Haas, G.P. and W.A. Sakr, Epidemiology of prostate cancer. CA Cancer J Clin,
1997. 47(5): p. 273-87.
Hsing, A.W., L. Tsao, and S.S. Devesa, International trends and patterns of
prostate cancer incidence and mortality. Int J Cancer, 2000. 85(1): p. 60-7.
Gronberg, H., Prostate cancer epidemiology. Lancet, 2003. 361(9360): p. 85964.
Brandt, A., et al., Age-specific risk of incident prostate cancer and risk of death
from prostate cancer defined by the number of affected family members. Eur
Urol, 2010. 58(2): p. 275-80.
McNeal, J.E., Origin and development of carcinoma in the prostate. Cancer,
1969. 23(1): p. 24-34.
McNeal, J.E., The zonal anatomy of the prostate. Prostate, 1981. 2(1): p. 35-49.
McNeal, J.E., Normal histology of the prostate. Am J Surg Pathol, 1988. 12(8):
p. 619-33.
Foster, C.S., et al., Prostatic stem cells. J Pathol, 2002. 197(4): p. 551-65.
Hudson, D.L., Epithelial stem cells in human prostate growth and disease.
Prostate Cancer Prostatic Dis, 2004. 7(3): p. 188-94.
Peehl, D.M., Primary cell cultures as models of prostate cancer development.
Endocr Relat Cancer, 2005. 12(1): p. 19-47.
Applewhite, J.C., et al., Transrectal ultrasound and biopsy in the early diagnosis
of prostate cancer. Cancer Control, 2001. 8(2): p. 141-50.
Timms, B.G., Prostate development: a historical perspective. Differentiation,
2008. 76(6): p. 565-77.
Turner, B., Diagnosis and treatment of patients with prostate cancer: the nurse's
role. Nurs Stand, 2007. 21(39): p. 48-56; quiz 58.
Abate-Shen, C. and M.M. Shen, Molecular genetics of prostate cancer. Genes
Dev, 2000. 14(19): p. 2410-34.
Welch, H.G. and P.C. Albertsen, Prostate cancer diagnosis and treatment after
the introduction of prostate-specific antigen screening: 1986-2005. J Natl
Cancer Inst, 2009. 101(19): p. 1325-9.
Balk, S.P., Y.J. Ko, and G.J. Bubley, Biology of prostate-specific antigen. J Clin
Oncol, 2003. 21(2): p. 383-91.
Kam, S.C., et al., Complications of transrectal ultrasound-guided prostate
biopsy: impact of prebiopsy enema. Korean J Urol, 2014. 55(11): p. 732-6.
Gleason, D.F. and G.T. Mellinger, Prediction of prognosis for prostatic
adenocarcinoma by combined histological grading and clinical staging. J Urol,
1974. 111(1): p. 58-64.
112
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
Eggener, S.E., et al., Predicting 15-year prostate cancer specific mortality after
radical prostatectomy. J Urol, 2011. 185(3): p. 869-75.
Bostwick, D.G., et al., Independent origin of multiple foci of prostatic
intraepithelial neoplasia: comparison with matched foci of prostate carcinoma.
Cancer, 1998. 83(9): p. 1995-2002.
Niu, Y., et al., Androgen receptor is a tumor suppressor and proliferator in
prostate cancer. Proc Natl Acad Sci U S A, 2008. 105(34): p. 12182-7.
Shen, M.M. and C. Abate-Shen, Molecular genetics of prostate cancer: new
prospects for old challenges. Genes Dev, 2010. 24(18): p. 1967-2000.
Ma, X., et al., Targeted biallelic inactivation of Pten in the mouse prostate leads
to prostate cancer accompanied by increased epithelial cell proliferation but not
by reduced apoptosis. Cancer Res, 2005. 65(13): p. 5730-9.
Goldstein, A.S., et al., Identification of a cell of origin for human prostate
cancer. Science, 2010. 329(5991): p. 568-71.
Korsten, H., et al., Accumulating progenitor cells in the luminal epithelial cell
layer are candidate tumor initiating cells in a Pten knockout mouse prostate
cancer model. PLoS One, 2009. 4(5): p. e5662.
Iwata, T., et al., MYC overexpression induces prostatic intraepithelial neoplasia
and loss of Nkx3.1 in mouse luminal epithelial cells. PLoS One, 2010. 5(2): p.
e9427.
Gurel, B., et al., Nuclear MYC protein overexpression is an early alteration in
human prostate carcinogenesis. Mod Pathol, 2008. 21(9): p. 1156-67.
Meeker, A.K., et al., Telomere shortening is an early somatic DNA alteration in
human prostate tumorigenesis. Cancer Res, 2002. 62(22): p. 6405-9.
Mani, R.S., et al., Induced chromosomal proximity and gene fusions in prostate
cancer. Science, 2009. 326(5957): p. 1230.
Wang, S., et al., Pten deletion leads to the expansion of a prostatic
stem/progenitor cell subpopulation and tumor initiation. Proc Natl Acad Sci U S
A, 2006. 103(5): p. 1480-5.
Lawson, D.A., et al., Basal epithelial stem cells are efficient targets for prostate
cancer initiation. Proc Natl Acad Sci U S A, 2010. 107(6): p. 2610-5.
McNeal, J.E. and D.G. Bostwick, Intraductal dysplasia: a premalignant lesion
of the prostate. Hum Pathol, 1986. 17(1): p. 64-71.
Bostwick, D.G. and M.K. Brawer, Prostatic intra-epithelial neoplasia and early
invasion in prostate cancer. Cancer, 1987. 59(4): p. 788-94.
Sakr, W.A., et al., The frequency of carcinoma and intraepithelial neoplasia of
the prostate in young male patients. J Urol, 1993. 150(2 Pt 1): p. 379-85.
Sakr, W.A., et al., Allelic loss in locally metastatic, multisampled prostate
cancer. Cancer Res, 1994. 54(12): p. 3273-7.
Haggman, M.J., et al., Allelic loss of 8p sequences in prostatic intraepithelial
neoplasia and carcinoma. Urology, 1997. 50(4): p. 643-7.
113
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
Bostwick, D.G., et al., Architectural patterns of high-grade prostatic
intraepithelial neoplasia. Hum Pathol, 1993. 24(3): p. 298-310.
Nagle, R.B., et al., Cytokeratin characterization of human prostatic carcinoma
and its derived cell lines. Cancer Res, 1987. 47(1): p. 281-6.
Haggman, M.J., et al., The relationship between prostatic intraepithelial
neoplasia and prostate cancer: critical issues. J Urol, 1997. 158(1): p. 12-22.
Cardiff, R.D., et al., The mammary pathology of genetically engineered mice:
the consensus report and recommendations from the Annapolis meeting.
Oncogene, 2000. 19(8): p. 968-88.
Taichman, R.S., et al., The evolving biology and treatment of prostate cancer. J
Clin Invest, 2007. 117(9): p. 2351-61.
Fernandez-Serra, A., et al., [Prostate cancer: the revolution of the fusion genes].
Actas Urol Esp, 2011. 35(7): p. 420-8.
Scardino, P.T., R. Weaver, and M.A. Hudson, Early detection of prostate
cancer. Hum Pathol, 1992. 23(3): p. 211-22.
Logothetis, C.J. and S.H. Lin, Osteoblasts in prostate cancer metastasis to bone.
Nat Rev Cancer, 2005. 5(1): p. 21-8.
Bubendorf, L., et al., Metastatic patterns of prostate cancer: an autopsy study of
1,589 patients. Hum Pathol, 2000. 31(5): p. 578-83.
Sawyers, C.L., et al., AACR Cancer Progress Report 2013. Clin Cancer Res,
2013. 19(20 Suppl): p. S4-98.
Ibrahim, T., et al., Pathogenesis of osteoblastic bone metastases from prostate
cancer. Cancer, 2010. 116(6): p. 1406-18.
Liu, F., et al., Prostate cancer cells induce osteoblastic differentiation via
semaphorin 3A. Prostate, 2014.
Paget, S., The distribution of secondary growths in cancer of the breast. 1889.
Cancer Metastasis Rev, 1989. 8(2): p. 98-101.
Sun, Y.X., et al., Expression of CXCR4 and CXCL12 (SDF-1) in human prostate
cancers (PCa) in vivo. J Cell Biochem, 2003. 89(3): p. 462-73.
Chu, K., et al., Cadherin-11 promotes the metastasis of prostate cancer cells to
bone. Mol Cancer Res, 2008. 6(8): p. 1259-67.
Lu, Y., et al., Monocyte chemotactic protein-1 (MCP-1) acts as a paracrine and
autocrine factor for prostate cancer growth and invasion. Prostate, 2006.
66(12): p. 1311-8.
Suva, L.J., et al., Bone metastasis: mechanisms and therapeutic opportunities.
Nat Rev Endocrinol, 2011. 7(4): p. 208-18.
Morrissey, C., et al., Bone morphogenetic protein 7 is expressed in prostate
cancer metastases and its effects on prostate tumor cells depend on cell
phenotype and the tumor microenvironment. Neoplasia, 2010. 12(2): p. 192-205.
Mansson, P.E., et al., Heparin-binding growth factor gene expression and
receptor characteristics in normal rat prostate and two transplantable rat
prostate tumors. Cancer Res, 1989. 49(9): p. 2485-94.
114
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
Kodama, N., et al., A local bone anabolic effect of rhFGF2-impregnated gelatin
hydrogel by promoting cell proliferation and coordinating osteoblastic
differentiation. Bone, 2009. 44(4): p. 699-707.
Barbieri, C.E., et al., The mutational landscape of prostate cancer. Eur Urol,
2013. 64(4): p. 567-76.
Bethel, C.R., et al., Decreased NKX3.1 protein expression in focal prostatic
atrophy, prostatic intraepithelial neoplasia, and adenocarcinoma: association
with gleason score and chromosome 8p deletion. Cancer Res, 2006. 66(22): p.
10683-90.
Bhatia-Gaur, R., et al., Roles for Nkx3.1 in prostate development and cancer.
Genes Dev, 1999. 13(8): p. 966-77.
Bowen, C., et al., Loss of NKX3.1 expression in human prostate cancers
correlates with tumor progression. Cancer Res, 2000. 60(21): p. 6111-5.
Ouyang, X., et al., Loss-of-function of Nkx3.1 promotes increased oxidative
damage in prostate carcinogenesis. Cancer Res, 2005. 65(15): p. 6773-9.
Markowski, M.C., C. Bowen, and E.P. Gelmann, Inflammatory cytokines induce
phosphorylation and ubiquitination of prostate suppressor protein NKX3.1.
Cancer Res, 2008. 68(17): p. 6896-901.
Sato, K., et al., Clinical significance of alterations of chromosome 8 in highgrade, advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst, 1999.
91(18): p. 1574-80.
Sotelo, J., et al., Long-range enhancers on 8q24 regulate c-Myc. Proc Natl Acad
Sci U S A, 2010. 107(7): p. 3001-5.
Ellwood-Yen, K., et al., Myc-driven murine prostate cancer shares molecular
features with human prostate tumors. Cancer Cell, 2003. 4(3): p. 223-38.
Tomlins, S.A., et al., Distinct classes of chromosomal rearrangements create
oncogenic ETS gene fusions in prostate cancer. Nature, 2007. 448(7153): p.
595-9.
Wang, J., et al., Expression of variant TMPRSS2/ERG fusion messenger RNAs is
associated with aggressive prostate cancer. Cancer Res, 2006. 66(17): p. 834751.
Carver, B.S., et al., Aberrant ERG expression cooperates with loss of PTEN to
promote cancer progression in the prostate. Nature genetics, 2009. 41(5): p.
619-24.
Klezovitch, O., et al., A causal role for ERG in neoplastic transformation of
prostate epithelium. Proceedings of the National Academy of Sciences of the
United States of America, 2008. 105(6): p. 2105-10.
Tomlins, S.A., et al., Role of the TMPRSS2-ERG gene fusion in prostate cancer.
Neoplasia, 2008. 10(2): p. 177-88.
Shen, M.M. and C. Abate-Shen, Molecular genetics of prostate cancer: new
prospects for old challenges. Genes & development, 2010. 24(18): p. 19672000.
115
173.
174.
175.
176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
186.
187.
188.
189.
Shaikhibrahim, Z., et al., Genes differentially expressed in the peripheral zone
compared to the transitional zone of the normal human prostate and their
potential regulation by ETS factors. Mol Med Rep, 2012. 5(1): p. 32-6.
Magistroni, V., et al., ERG deregulation induces PIM1 over-expression and
aneuploidy in prostate epithelial cells. PLoS One, 2011. 6(11): p. e28162.
Flajollet, S., et al., Abnormal expression of the ERG transcription factor in
prostate cancer cells activates osteopontin. Mol Cancer Res, 2011. 9(7): p. 91424.
Farooqi, A.A., et al., Androgen receptor and gene network: Micromechanics
reassemble the signaling machinery of TMPRSS2-ERG positive prostate cancer
cells. Cancer Cell Int, 2014. 14: p. 34.
Taylor, B.S., et al., Integrative genomic profiling of human prostate cancer.
Cancer Cell, 2010. 18(1): p. 11-22.
Wang, S., et al., Prostate-specific deletion of the murine Pten tumor suppressor
gene leads to metastatic prostate cancer. Cancer Cell, 2003. 4(3): p. 209-21.
Garcia-Flores, M., et al., Clinico-pathological significance of the molecular
alterations of the SPOP gene in prostate cancer. Eur J Cancer, 2014.
Barbieri, C.E., et al., Exome sequencing identifies recurrent SPOP, FOXA1 and
MED12 mutations in prostate cancer. Nat Genet, 2012. 44(6): p. 685-9.
Boormans, J.L., et al., An activating mutation in AKT1 in human prostate
cancer. Int J Cancer, 2008. 123(11): p. 2725-6.
Lee, S.H., et al., A constitutively activated form of the p110beta isoform of PI3kinase induces prostatic intraepithelial neoplasia in mice. Proc Natl Acad Sci U
S A, 2010. 107(24): p. 11002-7.
Mellinghoff, I.K., et al., HER2/neu kinase-dependent modulation of androgen
receptor function through effects on DNA binding and stability. Cancer Cell,
2004. 6(5): p. 517-27.
Fizazi, K., The role of Src in prostate cancer. Ann Oncol, 2007. 18(11): p. 176573.
Saramaki, O.R., et al., The gene for polycomb group protein enhancer of zeste
homolog 2 (EZH2) is amplified in late-stage prostate cancer. Genes
Chromosomes Cancer, 2006. 45(7): p. 639-45.
Bachmann, I.M., et al., EZH2 expression is associated with high proliferation
rate and aggressive tumor subgroups in cutaneous melanoma and cancers of the
endometrium, prostate, and breast. J Clin Oncol, 2006. 24(2): p. 268-73.
DeVere White, R.W., et al., MicroRNAs and their potential for translation in
prostate cancer. Urol Oncol, 2009. 27(3): p. 307-11.
Sun, T., et al., The role of microRNA-221 and microRNA-222 in androgenindependent prostate cancer cell lines. Cancer Res, 2009. 69(8): p. 3356-63.
Varambally, S., et al., Genomic loss of microRNA-101 leads to overexpression
of histone methyltransferase EZH2 in cancer. Science, 2008. 322(5908): p.
1695-9.
116
190.
191.
192.
193.
194.
195.
196.
197.
198.
199.
200.
201.
202.
203.
204.
205.
206.
Casanova-Salas, I., et al., miRNAs as biomarkers in prostate cancer. Clin Transl
Oncol, 2012. 14(11): p. 803-11.
Barbieri, C.E., F. Demichelis, and M.A. Rubin, Molecular genetics of prostate
cancer: emerging appreciation of genetic complexity. Histopathology, 2012.
60(1): p. 187-98.
D'Amico, A.V., et al., Cancer-specific mortality after surgery or radiation for
patients with clinically localized prostate cancer managed during the prostatespecific antigen era. J Clin Oncol, 2003. 21(11): p. 2163-72.
Martin, N.E., et al., Prognostic determinants in prostate cancer. Cancer J, 2011.
17(6): p. 429-37.
Rubio-Briones, J., et al., Clinical implications of TMPRSS2-ERG gene fusion
expression in patients with prostate cancer treated with radical prostatectomy. J
Urol, 2010. 183(5): p. 2054-61.
Hagglof, C., et al., TMPRSS2-ERG expression predicts prostate cancer survival
and associates with stromal biomarkers. PLoS One, 2014. 9(2): p. e86824.
Pettersson, A., et al., The TMPRSS2:ERG rearrangement, ERG expression, and
prostate cancer outcomes: a cohort study and meta-analysis. Cancer Epidemiol
Biomarkers Prev, 2012. 21(9): p. 1497-509.
Bettencourt, M.C., et al., Ki-67 expression is a prognostic marker of prostate
cancer recurrence after radical prostatectomy. J Urol, 1996. 156(3): p. 1064-8.
Halvorsen, O.J., S.A. Haukaas, and L.A. Akslen, Combined loss of PTEN and
p27 expression is associated with tumor cell proliferation by Ki-67 and
increased risk of recurrent disease in localized prostate cancer. Clin Cancer
Res, 2003. 9(4): p. 1474-9.
Li, R., et al., Prognostic value of Akt-1 in human prostate cancer: a
computerized quantitative assessment with quantum dot technology. Clin Cancer
Res, 2009. 15(10): p. 3568-73.
Szarvas, T., et al., Prognostic value of tissue and circulating levels of IMP3 in
prostate cancer. Int J Cancer, 2014. 135(7): p. 1596-604.
Casanova-Salas, I., et al., Identification of miR-187 and miR-182 as Biomarkers
of Early Diagnosis and Prognosis in Patients with Prostate Cancer Treated with
Radical Prostatectomy. J Urol, 2014.
Dunn, M.W. and M.W. Kazer, Prostate cancer overview. Semin Oncol Nurs,
2011. 27(4): p. 241-50.
Clemmons, D.R., Role of insulin-like growth factor binding proteins in
controlling IGF actions. Mol Cell Endocrinol, 1998. 140(1-2): p. 19-24.
Rosenfeld, R.G., et al., The insulin-like growth factor binding protein
superfamily: new perspectives. Pediatrics, 1999. 104(4 Pt 2): p. 1018-21.
Riedemann, J. and V.M. Macaulay, IGF1R signalling and its inhibition. Endocr
Relat Cancer, 2006. 13 Suppl 1: p. S33-43.
Scotlandi, K. and P. Picci, Targeting insulin-like growth factor 1 receptor in
sarcomas. Curr Opin Oncol, 2008. 20(4): p. 419-27.
117
207.
208.
209.
210.
211.
212.
213.
214.
215.
216.
217.
218.
219.
220.
221.
222.
Belfiore, A., et al., Insulin receptor isoforms and insulin receptor/insulin-like
growth factor receptor hybrids in physiology and disease. Endocr Rev, 2009.
30(6): p. 586-623.
Liu, J.P., et al., Mice carrying null mutations of the genes encoding insulin-like
growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell, 1993. 75(1): p. 5972.
Accili, D., et al., Early neonatal death in mice homozygous for a null allele of
the insulin receptor gene. Nat Genet, 1996. 12(1): p. 106-9.
Baserga, R., et al., The IGF-I receptor in cell growth, transformation and
apoptosis. Biochim Biophys Acta, 1997. 1332(3): p. F105-26.
LeRoith, D., et al., Molecular and cellular aspects of the insulin-like growth
factor I receptor. Endocr Rev, 1995. 16(2): p. 143-63.
Abbott, A.M., et al., Insulin-like growth factor I receptor gene structure. J Biol
Chem, 1992. 267(15): p. 10759-63.
Werner, H. and R. Sarfstein, Transcriptional and epigenetic control of IGF1R
gene expression: implications in metabolism and cancer. Growth Horm IGF
Res, 2014. 24(4): p. 112-8.
Ullrich, A., et al., Insulin-like growth factor I receptor primary structure:
comparison with insulin receptor suggests structural determinants that define
functional specificity. EMBO J, 1986. 5(10): p. 2503-12.
Jansson, M., M. Uhlen, and B. Nilsson, Structural changes in insulin-like
growth factor (IGF) I mutant proteins affecting binding kinetic rates to IGF
binding protein 1 and IGF-I receptor. Biochemistry, 1997. 36(14): p. 4108-17.
Dricu, A., et al., Inhibition of N-linked glycosylation using tunicamycin causes
cell death in malignant cells: role of down-regulation of the insulin-like growth
factor 1 receptor in induction of apoptosis. Cancer Res, 1997. 57(3): p. 543-8.
Massague, J. and M.P. Czech, The subunit structures of two distinct receptors
for insulin-like growth factors I and II and their relationship to the insulin
receptor. J Biol Chem, 1982. 257(9): p. 5038-45.
Samani, A.A., et al., The role of the IGF system in cancer growth and
metastasis: overview and recent insights. Endocr Rev, 2007. 28(1): p. 20-47.
Annunziata, M., R. Granata, and E. Ghigo, The IGF system. Acta Diabetol,
2011. 48(1): p. 1-9.
Seino, S. and G.I. Bell, Alternative splicing of human insulin receptor
messenger RNA. Biochem Biophys Res Commun, 1989. 159(1): p. 312-6.
Pandini, G., et al., Insulin/insulin-like growth factor I hybrid receptors have
different biological characteristics depending on the insulin receptor isoform
involved. J Biol Chem, 2002. 277(42): p. 39684-95.
Belfiore, A., The role of insulin receptor isoforms and hybrid insulin/IGF-I
receptors in human cancer. Curr Pharm Des, 2007. 13(7): p. 671-86.
118
223.
224.
225.
226.
227.
228.
229.
230.
231.
232.
233.
234.
235.
236.
237.
238.
239.
Frasca, F., et al., Insulin receptor isoform A, a newly recognized, high-affinity
insulin-like growth factor II receptor in fetal and cancer cells. Mol Cell Biol,
1999. 19(5): p. 3278-88.
Sciacca, L., et al., Signaling differences from the A and B isoforms of the insulin
receptor (IR) in 32D cells in the presence or absence of IR substrate-1.
Endocrinology, 2003. 144(6): p. 2650-8.
De Meyts, P., Insulin and its receptor: structure, function and evolution.
Bioessays, 2004. 26(12): p. 1351-62.
Denley, A., et al., Molecular interactions of the IGF system. Cytokine Growth
Factor Rev, 2005. 16(4-5): p. 421-39.
Daughaday, W.H., et al., On the nomenclature of the somatomedins and insulinlike growth factors. J Clin Endocrinol Metab, 1987. 65(5): p. 1075-6.
Rosen, C.J. and M. Pollak, Circulating IGF-I: New Perspectives for a New
Century. Trends Endocrinol Metab, 1999. 10(4): p. 136-141.
Clemmons, D.R., Role of IGF-I in skeletal muscle mass maintenance. Trends
Endocrinol Metab, 2009. 20(7): p. 349-56.
Clemmons, D.R., Involvement of insulin-like growth factor-I in the control of
glucose homeostasis. Curr Opin Pharmacol, 2006. 6(6): p. 620-5.
Gallagher, E.J. and D. LeRoith, The proliferating role of insulin and insulin-like
growth factors in cancer. Trends Endocrinol Metab, 2010. 21(10): p. 610-8.
Bell, J.L., et al., Insulin-like growth factor 2 mRNA-binding proteins
(IGF2BPs): post-transcriptional drivers of cancer progression? Cell Mol Life
Sci, 2013. 70(15): p. 2657-75.
Reeve, A.E., et al., Expression of insulin-like growth factor-II transcripts in
Wilms' tumour. Nature, 1985. 317(6034): p. 258-60.
Granata, R., et al., Dual effects of IGFBP-3 on endothelial cell apoptosis and
survival: involvement of the sphingolipid signaling pathways. FASEB J, 2004.
18(12): p. 1456-8.
Ceresa, B.P. and J.E. Pessin, Insulin regulation of the Ras
activation/inactivation cycle. Mol Cell Biochem, 1998. 182(1-2): p. 23-9.
Dupont, J., et al., The insulin-like growth factor axis in cell cycle progression.
Horm Metab Res, 2003. 35(11-12): p. 740-50.
Rosenthal, S.M. and Z.Q. Cheng, Opposing early and late effects of insulin-like
growth factor I on differentiation and the cell cycle regulatory retinoblastoma
protein in skeletal myoblasts. Proc Natl Acad Sci U S A, 1995. 92(22): p.
10307-11.
Dupont, J., M. Karas, and D. LeRoith, The potentiation of estrogen on insulinlike growth factor I action in MCF-7 human breast cancer cells includes cell
cycle components. J Biol Chem, 2000. 275(46): p. 35893-901.
Dunn, S.E., et al., Dietary restriction reduces insulin-like growth factor I levels,
which modulates apoptosis, cell proliferation, and tumor progression in p53deficient mice. Cancer Res, 1997. 57(21): p. 4667-72.
119
240.
241.
242.
243.
244.
245.
246.
247.
248.
249.
250.
251.
252.
253.
254.
Datta, S.R., et al., Akt phosphorylation of BAD couples survival signals to the
cell-intrinsic death machinery. Cell, 1997. 91(2): p. 231-41.
Gual, P., et al., Interaction of Janus kinases JAK-1 and JAK-2 with the insulin
receptor and the insulin-like growth factor-1 receptor. Endocrinology, 1998.
139(3): p. 884-93.
Zong, C.S., et al., Stat3 plays an important role in oncogenic Ros- and insulinlike growth factor I receptor-induced anchorage-independent growth. J Biol
Chem, 1998. 273(43): p. 28065-72.
Sell, C., et al., Simian virus 40 large tumor antigen is unable to transform mouse
embryonic fibroblasts lacking type 1 insulin-like growth factor receptor. Proc
Natl Acad Sci U S A, 1993. 90(23): p. 11217-21.
Werner, H. and I. Bruchim, The insulin-like growth factor-I receptor as an
oncogene. Arch Physiol Biochem, 2009. 115(2): p. 58-71.
Baserga, R., The IGF-I receptor in cancer research. Exp Cell Res, 1999. 253(1):
p. 1-6.
Zhang, J., J.M. Trent, and P.S. Meltzer, Rapid isolation and characterization of
amplified DNA by chromosome microdissection: identification of IGF1R
amplification in malignant melanoma. Oncogene, 1993. 8(10): p. 2827-31.
Almeida, A., et al., The insulin-like growth factor I receptor gene is the target
for the 15q26 amplicon in breast cancer. Genes Chromosomes Cancer, 1994.
11(1): p. 63-5.
Armengol, G., et al., DNA copy number changes and evaluation of MYC,
IGF1R, and FES amplification in xenografts of pancreatic adenocarcinoma.
Cancer Genet Cytogenet, 2000. 116(2): p. 133-41.
Buckbinder, L., et al., Induction of the growth inhibitor IGF-binding protein 3
by p53. Nature, 1995. 377(6550): p. 646-9.
Werner, H., et al., Wild-type and mutant p53 differentially regulate transcription
of the insulin-like growth factor I receptor gene. Proc Natl Acad Sci U S A,
1996. 93(16): p. 8318-23.
Webster, N.J., et al., Repression of the insulin receptor promoter by the tumor
suppressor gene product p53: a possible mechanism for receptor overexpression
in breast cancer. Cancer Res, 1996. 56(12): p. 2781-8.
Lee, Y.I., et al., Activation of the insulin-like growth factor II transcription by
aflatoxin B1 induced p53 mutant 249 is caused by activation of transcription
complexes; implications for a gain-of-function during the formation of
hepatocellular carcinoma. Oncogene, 2000. 19(33): p. 3717-26.
Sciacchitano, S., et al., Cloning of the mouse insulin receptor substrate-3 (mIRS3) promoter, and its regulation by p53. Mol Endocrinol, 2002. 16(7): p. 157789.
Heron-Milhavet, L. and D. LeRoith, Insulin-like growth factor I induces MDM2dependent degradation of p53 via the p38 MAPK pathway in response to DNA
damage. J Biol Chem, 2002. 277(18): p. 15600-6.
120
255.
256.
257.
258.
259.
260.
261.
262.
263.
264.
265.
266.
267.
268.
269.
Drummond, I.A., et al., Repression of the insulin-like growth factor II gene by
the Wilms tumor suppressor WT1. Science, 1992. 257(5070): p. 674-8.
Sarfstein, R., et al., Insulin-like growth factor-I receptor (IGF-IR) translocates
to nucleus and autoregulates IGF-IR gene expression in breast cancer cells. J
Biol Chem, 2012. 287(4): p. 2766-76.
Werner, H. and I. Bruchim, IGF-1 and BRCA1 signalling pathways in familial
cancer. Lancet Oncol, 2012. 13(12): p. e537-44.
Abramovitch, S., et al., BRCA1-Sp1 interactions in transcriptional regulation of
the IGF-IR gene. FEBS Lett, 2003. 541(1-3): p. 149-54.
Maor, S., et al., Elevated insulin-like growth factor-I receptor (IGF-IR) levels in
primary breast tumors associated with BRCA1 mutations. Cancer Lett, 2007.
257(2): p. 236-43.
Werner, H., et al., A novel EWS-WT1 gene fusion product in desmoplastic small
round cell tumor is a potent transactivator of the insulin-like growth factor-I
receptor (IGF-IR) gene. Cancer Lett, 2007. 247(1): p. 84-90.
Pollak, M.N., Insulin-like growth factors and neoplasia. Novartis Found Symp,
2004. 262: p. 84-98; discussion 98-107, 265-8.
Elmlinger, M.W., et al., In vivo expression of insulin-like growth factor-binding
protein-2 in human gliomas increases with the tumor grade. Endocrinology,
2001. 142(4): p. 1652-8.
Baron-Hay, S., et al., Elevated serum insulin-like growth factor binding protein2 as a prognostic marker in patients with ovarian cancer. Clin Cancer Res,
2004. 10(5): p. 1796-806.
Chang, Q., et al., Constitutive activation of insulin receptor substrate 1 is a
frequent event in human tumors: therapeutic implications. Cancer Res, 2002.
62(21): p. 6035-8.
Kornmann, M., et al., Enhanced expression of the insulin receptor substrate-2
docking protein in human pancreatic cancer. Cancer Res, 1998. 58(19): p. 42504.
Jackson, J.G., et al., Regulation of breast cancer cell motility by insulin receptor
substrate-2 (IRS-2) in metastatic variants of human breast cancer cell lines.
Oncogene, 2001. 20(50): p. 7318-25.
Boissan, M., et al., Overexpression of insulin receptor substrate-2 in human and
murine hepatocellular carcinoma. Am J Pathol, 2005. 167(3): p. 869-77.
Satyamoorthy, K., et al., Insulin-like growth factor-1 induces survival and
growth of biologically early melanoma cells through both the mitogen-activated
protein kinase and beta-catenin pathways. Cancer Res, 2001. 61(19): p. 731824.
Zhang, D. and P. Brodt, Type 1 insulin-like growth factor regulates MT1-MMP
synthesis and tumor invasion via PI 3-kinase/Akt signaling. Oncogene, 2003.
22(7): p. 974-82.
121
270.
271.
272.
273.
274.
275.
276.
277.
278.
279.
280.
281.
282.
Zhao, H., et al., PTEN inhibits cell proliferation and induces apoptosis by
downregulating cell surface IGF-IR expression in prostate cancer cells.
Oncogene, 2004. 23(3): p. 786-94.
Frangioni, J.V., et al., The nontransmembrane tyrosine phosphatase PTP-1B
localizes to the endoplasmic reticulum via its 35 amino acid C-terminal
sequence. Cell, 1992. 68(3): p. 545-60.
Buckley, D.A., et al., Regulation of insulin-like growth factor type I (IGF-I)
receptor kinase activity by protein tyrosine phosphatase 1B (PTP-1B) and
enhanced IGF-I-mediated suppression of apoptosis and motility in PTP-1Bdeficient fibroblasts. Mol Cell Biol, 2002. 22(7): p. 1998-2010.
Goldstein, B.J., et al., Tyrosine dephosphorylation and deactivation of insulin
receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by
the formation of a ternary complex with the Grb2 adaptor protein. J Biol Chem,
2000. 275(6): p. 4283-9.
Authier, F., M. Kouach, and G. Briand, Endosomal proteolysis of insulin-like
growth factor-I at its C-terminal D-domain by cathepsin B. FEBS Lett, 2005.
579(20): p. 4309-16.
Navab, R., et al., Loss of responsiveness to IGF-I in cells with reduced cathepsin
L expression levels. Oncogene, 2008. 27(37): p. 4973-85.
Charalambous, M., et al., Disruption of the imprinted Grb10 gene leads to
disproportionate overgrowth by an Igf2-independent mechanism. Proc Natl
Acad Sci U S A, 2003. 100(14): p. 8292-7.
Froment, P., J. Dupont, and J. Christophe-Marine, Mdm2 exerts pro-apoptotic
activities by antagonizing insulin-like growth factor-I-mediated survival. Cell
Cycle, 2008. 7(19): p. 3098-103.
Schaffer, B.S., et al., Opposing roles for the insulin-like growth factor (IGF)-II
and mannose 6-phosphate (Man-6-P) binding activities of the IGF-II/Man-6-P
receptor in the growth of prostate cancer cells. Endocrinology, 2003. 144(3): p.
955-66.
Ozkan, E.E., Plasma and tissue insulin-like growth factor-I receptor (IGF-IR) as
a prognostic marker for prostate cancer and anti-IGF-IR agents as novel
therapeutic strategy for refractory cases: a review. Mol Cell Endocrinol, 2011.
344(1-2): p. 1-24.
Zhao, S., et al., Insulin-like growth factor receptor 1 (IGF1R) expression and
survival in non-small cell lung cancer patients: a meta-analysis. Int J Clin Exp
Pathol, 2014. 7(10): p. 6694-704.
Shimizu, C., et al., Expression of insulin-like growth factor 1 receptor in
primary breast cancer: immunohistochemical analysis. Hum Pathol, 2004.
35(12): p. 1537-42.
Scotlandi, K., et al., Expression of insulin-like growth factor system components
in Ewing's sarcoma and their association with survival. Eur J Cancer, 2011.
47(8): p. 1258-66.
122
283.
284.
285.
286.
287.
288.
289.
290.
291.
292.
293.
294.
295.
296.
297.
Frittitta, L., et al., Insulin receptor overexpression in 184B5 human mammary
epithelial cells induces a ligand-dependent transformed phenotype. J Cell
Biochem, 1995. 57(4): p. 666-9.
Vella, V., et al., A novel autocrine loop involving IGF-II and the insulin
receptor isoform-A stimulates growth of thyroid cancer. J Clin Endocrinol
Metab, 2002. 87(1): p. 245-54.
Garofalo, C., et al., Identification of common and distinctive mechanisms of
resistance to different anti-IGF-IR agents in Ewing's sarcoma. Mol Endocrinol,
2012. 26(9): p. 1603-16.
Tao, Y., et al., Mechanisms of disease: signaling of the insulin-like growth
factor 1 receptor pathway--therapeutic perspectives in cancer. Nat Clin Pract
Oncol, 2007. 4(10): p. 591-602.
Heuson, J.C., N. Legros, and R. Heimann, Influence of insulin administration on
growth of the 7,12-dimethylbenz(a)anthracene-induced mammary carcinoma in
intact, oophorectomized, and hypophysectomized rats. Cancer Res, 1972. 32(2):
p. 233-8.
Tran, T.T., et al., Direct measure of insulin sensitivity with the hyperinsulinemiceuglycemic clamp and surrogate measures of insulin sensitivity with the oral
glucose tolerance test: correlations with aberrant crypt foci promotion in rats.
Cancer Epidemiol Biomarkers Prev, 2003. 12(1): p. 47-56.
Yakar, S., et al., Increased tumor growth in mice with diet-induced obesity:
impact of ovarian hormones. Endocrinology, 2006. 147(12): p. 5826-34.
Gunter, M.J., et al., Insulin, insulin-like growth factor-I, endogenous estradiol,
and risk of colorectal cancer in postmenopausal women. Cancer Res, 2008.
68(1): p. 329-37.
Pisani, P., Hyper-insulinaemia and cancer, meta-analyses of epidemiological
studies. Arch Physiol Biochem, 2008. 114(1): p. 63-70.
Pollak, M., Insulin and insulin-like growth factor signalling in neoplasia. Nat
Rev Cancer, 2008. 8(12): p. 915-28.
Jalving, M., et al., Metformin: taking away the candy for cancer? Eur J Cancer,
2010. 46(13): p. 2369-80.
Arcaro, A., Targeting the insulin-like growth factor-1 receptor in human cancer.
Front Pharmacol, 2013. 4: p. 30.
Arteaga, C.L., et al., Blockade of the type I somatomedin receptor inhibits
growth of human breast cancer cells in athymic mice. J Clin Invest, 1989. 84(5):
p. 1418-23.
Sachdev, D., et al., Down-regulation of insulin receptor by antibodies against
the type I insulin-like growth factor receptor: implications for anti-insulin-like
growth factor therapy in breast cancer. Cancer Res, 2006. 66(4): p. 2391-402.
Cohen, B.D., et al., Combination therapy enhances the inhibition of tumor
growth with the fully human anti-type 1 insulin-like growth factor receptor
monoclonal antibody CP-751,871. Clin Cancer Res, 2005. 11(5): p. 2063-73.
123
298.
299.
300.
301.
302.
303.
304.
305.
306.
307.
308.
309.
310.
311.
Gualberto, A., Figitumumab (CP-751,871) for cancer therapy. Expert Opin Biol
Ther, 2010. 10(4): p. 575-85.
Maloney, E.K., et al., An anti-insulin-like growth factor I receptor antibody that
is a potent inhibitor of cancer cell proliferation. Cancer Res, 2003. 63(16): p.
5073-83.
Soria, J.C., et al., A dose finding, safety and pharmacokinetic study of AVE1642,
an anti-insulin-like growth factor-1 receptor (IGF-1R/CD221) monoclonal
antibody, administered as a single agent and in combination with docetaxel in
patients with advanced solid tumours. Eur J Cancer, 2013. 49(8): p. 1799-807.
Garcia-Echeverria, C., et al., In vivo antitumor activity of NVP-AEW541-A
novel, potent, and selective inhibitor of the IGF-IR kinase. Cancer Cell, 2004.
5(3): p. 231-9.
Mitsiades, C.S., et al., Inhibition of the insulin-like growth factor receptor-1
tyrosine kinase activity as a therapeutic strategy for multiple myeloma, other
hematologic malignancies, and solid tumors. Cancer Cell, 2004. 5(3): p. 221-30.
Bendell, J.C., et al., A phase Ib study of linsitinib (OSI-906), a dual inhibitor of
IGF-1R and IR tyrosine kinase, in combination with everolimus as treatment for
patients with refractory metastatic colorectal cancer. Invest New Drugs, 2014.
Zeng, X., et al., Enhancement of doxorubicin cytotoxicity of human cancer cells
by tyrosine kinase inhibition of insulin receptor and type I IGF receptor. Breast
Cancer Res Treat, 2012. 133(1): p. 117-26.
Zhao, H., et al., Epithelial-mesenchymal transition predicts sensitivity to the
dual IGF-1R/IR inhibitor OSI-906 in hepatocellular carcinoma cell lines. Mol
Cancer Ther, 2012. 11(2): p. 503-13.
Pitts, T.M., et al., Development of an integrated genomic classifier for a novel
agent in colorectal cancer: approach to individualized therapy in early
development. Clin Cancer Res, 2010. 16(12): p. 3193-204.
D'Ambrosio, C., et al., A soluble insulin-like growth factor I receptor that
induces apoptosis of tumor cells in vivo and inhibits tumorigenesis. Cancer Res,
1996. 56(17): p. 4013-20.
Andrews, D.W., et al., Results of a pilot study involving the use of an antisense
oligodeoxynucleotide directed against the insulin-like growth factor type I
receptor in malignant astrocytomas. J Clin Oncol, 2001. 19(8): p. 2189-200.
Fire, A., et al., Potent and specific genetic interference by double-stranded RNA
in Caenorhabditis elegans. Nature, 1998. 391(6669): p. 806-11.
Subramani, R., et al., Targeting insulin-like growth factor 1 receptor inhibits
pancreatic cancer growth and metastasis. PLoS One, 2014. 9(5): p. e97016.
Fathi, M., et al., Demonstration of dose dependent cytotoxic activity in SW480
colon cancer cells by (1)(7)(7)Lu-labeled siRNA targeting IGF-1R. Nucl Med
Biol, 2013. 40(4): p. 529-36.
124
312.
313.
314.
315.
316.
317.
318.
319.
320.
321.
322.
323.
324.
325.
326.
327.
Scotlandi, K., et al., Insulin-like growth factor I receptor-mediated circuit in
Ewing's sarcoma/peripheral neuroectodermal tumor: a possible therapeutic
target. Cancer Res, 1996. 56(20): p. 4570-4.
Toretsky, J.A., et al., The insulin-like growth factor-I receptor is required for
EWS/FLI-1 transformation of fibroblasts. J Biol Chem, 1997. 272(49): p. 308227.
Cironi, L., et al., IGF1 is a common target gene of Ewing's sarcoma fusion
proteins in mesenchymal progenitor cells. PLoS One, 2008. 3(7): p. e2634.
Benini, S., et al., Contribution of MEK/MAPK and PI3-K signaling pathway to
the malignant behavior of Ewing's sarcoma cells: therapeutic prospects. Int J
Cancer, 2004. 108(3): p. 358-66.
Scotlandi, K., et al., Blockage of insulin-like growth factor-I receptor inhibits
the growth of Ewing's sarcoma in athymic mice. Cancer Res, 1998. 58(18): p.
4127-31.
Pollak, M., W. Beamer, and J.C. Zhang, Insulin-like growth factors and prostate
cancer. Cancer Metastasis Rev, 1998. 17(4): p. 383-90.
Chan, J.M., et al., Plasma insulin-like growth factor-I and prostate cancer risk:
a prospective study. Science, 1998. 279(5350): p. 563-6.
Kawada, M., et al., Insulin-like growth factor I secreted from prostate stromal
cells mediates tumor-stromal cell interactions of prostate cancer. Cancer Res,
2006. 66(8): p. 4419-25.
Hellawell, G.O., et al., Expression of the type 1 insulin-like growth factor
receptor is up-regulated in primary prostate cancer and commonly persists in
metastatic disease. Cancer Res, 2002. 62(10): p. 2942-50.
Liao, Y., et al., Up-regulation of insulin-like growth factor axis components in
human primary prostate cancer correlates with tumor grade. Hum Pathol, 2005.
36(11): p. 1186-96.
Malaguarnera, R., et al., Metformin inhibits androgen-induced IGF-IR upregulation in prostate cancer cells by disrupting membrane-initiated androgen
signaling. Endocrinology, 2014. 155(4): p. 1207-21.
Pandini, G., et al., Androgens up-regulate the insulin-like growth factor-I
receptor in prostate cancer cells. Cancer Res, 2005. 65(5): p. 1849-57.
Dhanasekaran, S.M., et al., Delineation of prognostic biomarkers in prostate
cancer. Nature, 2001. 412(6849): p. 822-6.
Cox, M.E., et al., Insulin receptor expression by human prostate cancers.
Prostate, 2009. 69(1): p. 33-40.
Schayek, H., et al., Progression to metastatic stage in a cellular model of
prostate cancer is associated with methylation of the androgen receptor gene
and transcriptional suppression of the insulin-like growth factor-I receptor
gene. Exp Cell Res, 2010. 316(9): p. 1479-88.
Sutherland, B.W., et al., Conditional deletion of insulin-like growth factor-I
receptor in prostate epithelium. Cancer Res, 2008. 68(9): p. 3495-504.
125
328.
329.
330.
331.
332.
333.
334.
335.
336.
337.
338.
339.
340.
341.
342.
343.
344.
Levy, R., et al., A human thymus-leukemia antigen defined by hybridoma
monoclonal antibodies. Proc Natl Acad Sci U S A, 1979. 76(12): p. 6552-6.
Smith, M.J., P.J. Goodfellow, and P.N. Goodfellow, The genomic organisation
of the human pseudoautosomal gene MIC2 and the detection of a related locus.
Hum Mol Genet, 1993. 2(4): p. 417-22.
Ellis, N.A., et al., Cloning of PBDX, an MIC2-related gene that spans the
pseudoautosomal boundary on chromosome Xp. Nat Genet, 1994. 6(4): p. 394400.
Smith, M.J. and P.N. Goodfellow, MIC2R: a transcribed MIC2-related
sequence associated with a CpG island in the human pseudoautosomal region.
Hum Mol Genet, 1994. 3(9): p. 1575-82.
Hahn, J.H., et al., CD99 (MIC2) regulates the LFA-1/ICAM-1-mediated
adhesion of lymphocytes, and its gene encodes both positive and negative
regulators of cellular adhesion. J Immunol, 1997. 159(5): p. 2250-8.
Aubrit, F., et al., The biochemical characterization of E2, a T cell surface
molecule involved in rosettes. Eur J Immunol, 1989. 19(8): p. 1431-6.
Waclavicek, M., et al., CD99 engagement on human peripheral blood T cells
results in TCR/CD3-dependent cellular activation and allows for Th1-restricted
cytokine production. J Immunol, 1998. 161(9): p. 4671-8.
Kim, H.Y., et al., Solution structure of the cytoplasmic domain of human CD99
type I. Mol Cells, 2004. 18(1): p. 24-9.
Dworzak, M.N., et al., Flow cytometric assessment of human MIC2 expression
in bone marrow, thymus, and peripheral blood. Blood, 1994. 83(2): p. 415-25.
Ellis, N.A., et al., PBDX is the XG blood group gene. Nat Genet, 1994. 8(3): p.
285-90.
Kovar, H., et al., Overexpression of the pseudoautosomal gene MIC2 in Ewing's
sarcoma and peripheral primitive neuroectodermal tumor. Oncogene, 1990.
5(7): p. 1067-70.
Alberti, I., et al., CD99 isoforms expression dictates T cell functional outcomes.
FASEB J, 2002. 16(14): p. 1946-8.
Lee, E.J., et al., CD99 type II is a determining factor for the differentiation of
primitive neuroectodermal cells. Exp Mol Med, 2003. 35(5): p. 438-47.
Bernard, A., et al., A T cell surface molecule different from CD2 is involved in
spontaneous rosette formation with erythrocytes. J Immunol, 1988. 140(6): p.
1802-7.
Bernard, G., et al., The E2 molecule (CD99) specifically triggers homotypic
aggregation of CD4+ CD8+ thymocytes. J Immunol, 1995. 154(1): p. 26-32.
Wingett, D., K. Forcier, and C.P. Nielson, A role for CD99 in T cell activation.
Cell Immunol, 1999. 193(1): p. 17-23.
Bernard, G., et al., CD99 (E2) up-regulates alpha4beta1-dependent T cell
adhesion to inflamed vascular endothelium under flow conditions. Eur J
Immunol, 2000. 30(10): p. 3061-5.
126
345.
346.
347.
348.
349.
350.
351.
352.
353.
354.
355.
356.
357.
358.
359.
360.
Schenkel, A.R., et al., CD99 plays a major role in the migration of monocytes
through endothelial junctions. Nat Immunol, 2002. 3(2): p. 143-50.
Bixel, G., et al., Mouse CD99 participates in T-cell recruitment into inflamed
skin. Blood, 2004. 104(10): p. 3205-13.
Scotlandi, K., et al., CD99 isoforms dictate opposite functions in tumour
malignancy and metastases by activating or repressing c-Src kinase activity.
Oncogene, 2007. 26(46): p. 6604-18.
Cerisano, V., et al., Molecular mechanisms of CD99-induced caspaseindependent cell death and cell-cell adhesion in Ewing's sarcoma cells: actin
and zyxin as key intracellular mediators. Oncogene, 2004. 23(33): p. 5664-74.
Guerzoni, C., et al., CD99 Triggering in Ewing Sarcoma Delivers a Lethal
Signal through p53 Pathway Reactivation and Cooperates with Doxorubicin.
Clin Cancer Res, 2014.
Dworzak, M.N., et al., CD99 (MIC2) expression in paediatric B-lineage
leukaemia/lymphoma reflects maturation-associated patterns of normal Blymphopoiesis. Br J Haematol, 1999. 105(3): p. 690-5.
Dworzak, M.N., et al., CD99 expression in T-lineage ALL: implications for flow
cytometric detection of minimal residual disease. Leukemia, 2004. 18(4): p.
703-8.
Kim, S.H., et al., Generation of cells with Hodgkin's and Reed-Sternberg
phenotype through downregulation of CD99 (Mic2). Blood, 1998. 92(11): p.
4287-95.
Maitra, A., et al., Global expression analysis of well-differentiated pancreatic
endocrine neoplasms using oligonucleotide microarrays. Clin Cancer Res, 2003.
9(16 Pt 1): p. 5988-95.
Goto, A., et al., Prevalence of CD99 protein expression in pancreatic endocrine
tumours (PETs). Histopathology, 2004. 45(4): p. 384-92.
Jung, K.C., et al., Immunoreactivity of CD99 in stomach cancer. J Korean Med
Sci, 2002. 17(4): p. 483-9.
Pelosi, G., et al., CD99 immunoreactivity in gastrointestinal and pulmonary
neuroendocrine tumours. Virchows Arch, 2000. 437(3): p. 270-4.
Pelosi, G., et al., Decreased immunoreactivity of CD99 is an independent
predictor of regional lymph node metastases in pulmonary carcinoid tumors. J
Thorac Oncol, 2006. 1(5): p. 468-77.
Manara, M.C., et al., CD99 acts as an oncosuppressor in osteosarcoma. Mol
Biol Cell, 2006. 17(4): p. 1910-21.
Zucchini, C., et al., CD99 suppresses osteosarcoma cell migration through
inhibition of ROCK2 activity. Oncogene, 2014. 33(15): p. 1912-21.
Malaguarnera, R., et al., Insulin receptor isoforms and insulin-like growth factor
receptor in human follicular cell precursors from papillary thyroid cancer and
normal thyroid. J Clin Endocrinol Metab, 2011. 96(3): p. 766-74.
127
361.
362.
363.
364.
365.
366.
367.
368.
369.
370.
371.
372.
373.
374.
Frank, S.R., et al., Binding of c-Myc to chromatin mediates mitogen-induced
acetylation of histone H4 and gene activation. Genes Dev, 2001. 15(16): p.
2069-82.
Chou, T.C., et al., Computerized quantitation of synergism and antagonism of
taxol, topotecan, and cisplatin against human teratocarcinoma cell growth: a
rational approach to clinical protocol design. J Natl Cancer Inst, 1994. 86(20):
p. 1517-24.
Molife, L.R., et al., The insulin-like growth factor-I receptor inhibitor
figitumumab (CP-751,871) in combination with docetaxel in patients with
advanced solid tumours: results of a phase Ib dose-escalation, open-label study.
Br J Cancer, 2010. 103(3): p. 332-9.
Manara, M.C., et al., The molecular mechanisms responsible for resistance to
ET-743 (Trabectidin; Yondelis) in the Ewing's sarcoma cell line, TC-71. Int J
Oncol, 2005. 27(6): p. 1605-16.
Michaelson, M.D., et al., Multicenter phase II study of trabectedin in patients
with metastatic castration-resistant prostate cancer. Ann Oncol, 2012. 23(5): p.
1234-40.
Stegmaier, K., et al., Signature-based small molecule screening identifies
cytosine arabinoside as an EWS/FLI modulator in Ewing sarcoma. PLoS Med,
2007. 4(4): p. e122.
Boro, A., et al., Small-molecule screen identifies modulators of EWS/FLI1 target
gene expression and cell survival in Ewing's sarcoma. Int J Cancer, 2012.
131(9): p. 2153-64.
Tanaka, M., et al., Somatic chromosomal translocation between Ewsr1 and Fli1
loci leads to dilated cardiomyopathy in a mouse model. Sci Rep, 2015. 5: p.
7826.
Lipshultz, S.E., et al., Cardiovascular disease in adult survivors of childhood
cancer. Annu Rev Med, 2015. 66: p. 161-76.
Camoes, M.J., et al., Potential downstream target genes of aberrant ETS
transcription factors are differentially affected in Ewing's sarcoma and prostate
carcinoma. PLoS One, 2012. 7(11): p. e49819.
Cai, C., et al., Reactivation of androgen receptor-regulated TMPRSS2:ERG
gene expression in castration-resistant prostate cancer. Cancer Res, 2009.
69(15): p. 6027-32.
Mehra, R., et al., Characterization of TMPRSS2-ETS gene aberrations in
androgen-independent metastatic prostate cancer. Cancer Res, 2008. 68(10): p.
3584-90.
Riggi, N., et al., EWS-FLI-1 expression triggers a Ewing's sarcoma initiation
program in primary human mesenchymal stem cells. Cancer Res, 2008. 68(7): p.
2176-85.
Cui, J., et al., Hypermethylation of the caveolin-1 gene promoter in prostate
cancer. Prostate, 2001. 46(3): p. 249-56.
128
375.
376.
377.
378.
379.
380.
381.
382.
383.
384.
385.
386.
387.
Franzetti, G.A., et al., MiR-30a-5p connects EWS-FLI1 and CD99, two major
therapeutic targets in Ewing tumor. Oncogene, 2013. 32(33): p. 3915-21.
Fahrenholtz, C.D., P.J. Beltran, and K.L. Burnstein, Targeting IGF-IR with
ganitumab inhibits tumorigenesis and increases durability of response to
androgen-deprivation therapy in VCaP prostate cancer xenografts. Mol Cancer
Ther, 2013. 12(4): p. 394-404.
Cai, H., et al., Invasive prostate carcinoma driven by c-Src and androgen
receptor synergy. Cancer Res, 2011. 71(3): p. 862-72.
Carver, B.S., et al., Reciprocal feedback regulation of PI3K and androgen
receptor signaling in PTEN-deficient prostate cancer. Cancer Cell, 2011. 19(5):
p. 575-86.
Olmos, D., et al., Safety, pharmacokinetics, and preliminary activity of the antiIGF-1R antibody figitumumab (CP-751,871) in patients with sarcoma and
Ewing's sarcoma: a phase 1 expansion cohort study. Lancet Oncol, 2010. 11(2):
p. 129-35.
Toretsky, J.A., et al., Insulin-like growth factor type 1 (IGF-1) and IGF binding
protein-3 in patients with Ewing sarcoma family of tumors. Cancer, 2001.
92(11): p. 2941-7.
Schnarr, B., et al., Down-regulation of insulin-like growth factor-I receptor and
insulin receptor substrate-1 expression in advanced human breast cancer. Int J
Cancer, 2000. 89(6): p. 506-13.
Barbieri, C.E. and S.A. Tomlins, The prostate cancer genome: perspectives and
potential. Urol Oncol, 2014. 32(1): p. 53 e15-22.
Sreenath, T.L., et al., Oncogenic activation of ERG: A predominant mechanism
in prostate cancer. J Carcinog, 2011. 10: p. 37.
Mounir, Z., et al., TMPRSS2:ERG blocks neuroendocrine and luminal cell
differentiation to maintain prostate cancer proliferation. Oncogene, 2014.
Heidegger, I., et al., Diverse functions of IGF/insulin signaling in malignant and
noncancerous prostate cells: proliferation in cancer cells and differentiation in
noncancerous cells. Endocrinology, 2012. 153(10): p. 4633-43.
Shin, S.J., et al., Expression of CD99 in Multiple Myeloma: A Clinicopathologic
and Immunohistochemical Study of 170 Cases. Korean J Pathol, 2014. 48(3): p.
209-16.
Zhou, Q., et al., Downregulation of CD99 and upregulation of human leukocyte
antigen class II promote tumor aggravation and poor survival in patients with
osteosarcomas. Onco Targets Ther, 2014. 7: p. 477-84.
129
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertising