Oxymonads Are Closely Related to the Excavate Taxon Trimastix Shigeharu Moriya,

Oxymonads Are Closely Related to the Excavate Taxon Trimastix Shigeharu Moriya,
Oxymonads Are Closely Related to the Excavate Taxon Trimastix
Joel B. Dacks,* Jeffrey D. Silberman,†1 Alastair G. B. Simpson,‡2, Shigeharu Moriya,§
Toshiaki Kudo,§ Moriya Ohkuma,§ and Rosemary J. Redfield\
*Program in Evolutionary Biology, Canadian Institute for Advanced Research, Department of Biochemistry and Molecular
Biology, Dalhousie University, Halifax, Nova Scotia, Canada; †Josephine Bay Paul Center in Comparative Molecular Biology
and Evolution, Marine Biological Laboratory, Woods Hole, Massachusetts; ‡School of Biological Sciences, University of
Sydney, New South Wales, Australia; §Institute of Physical and Chemical Research and Japan Science and Technology
Corporation, Wako, Saitama, Japan; and \Department of Zoology, University of British Columbia, Vancouver, British
Columbia, Canada
Despite intensive study in recent years, large-scale eukaryote phylogeny remains poorly resolved. This is particularly
problematic among the groups considered to be potential early branches. In many recent systematic schemes for
early eukaryotic evolution, the amitochondriate protists oxymonads and Trimastix have figured prominently, having
been suggested as members of many of the putative deep-branching higher taxa. However, they have never before
been proposed as close relatives of each other. We amplified, cloned, and sequenced small-subunit ribosomal RNA
genes from the oxymonad Pyrsonympha and from several Trimastix isolates. Rigorous phylogenetic analyses indicate
that these two protist groups are sister taxa and are not clearly related to any currently established eukaryotic
lineages. This surprising result has important implications for our understanding of cellular evolution and high-level
eukaryotic phylogeny. Given that Trimastix contains small, electron-dense bodies strongly suspected to be derived
mitochondria, this study constitutes the best evidence to date that oxymonads are not primitively amitochondriate.
Instead, Trimastix and oxymonads may be useful organisms for investigations into the evolution of the secondary
amitochondriate condition. All higher taxa involving either oxymonads or Trimastix may require modification or
abandonment. Affected groups include four contemporary taxa given the rank of phylum (Metamonada, Loukozoa,
Trichozoa, Percolozoa), and the informal excavate taxa. A new ‘‘phylum-level’’ taxon may be warranted for oxymonads and Trimastix.
Introduction
Recent years have seen increasing uncertainty
about the broadest-scale structure of the eukaryotic evolutionary tree, particularly the identity of the deepest
extant branches. These difficulties have been revealed
by the implementation of novel analysis methods (Stiller
and Hall 1999), the use of different models of evolution
(Silberman et al. 1999), and the use of genes giving
conflicting results (Embley and Hirt 1998). Another major problem is the absence of many key protist groups
from most or all molecular phylogenies. Oxymonads
and Trimastix are two such key groups.
Oxymonads are a group of structurally distinct, obligately symbiotic flagellates (usually with four flagella
per cell), most of which are cellulose digesters found in
the hindgut of termites and wood-eating cockroaches.
First described by Leidy in 1877, oxymonads are best
known for their atypical sexual cycles, described in a
long series of papers by Cleveland (summarized by
1 Present address: UCLA Institute of Geophysics and Planetary
Physics and Department of Microbiology and Immunology, University
of California–Los Angeles.
2 Present address: Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada.
Abbreviations: ML, maximum likelihood; sp., species; ssu rDNA,
small-subunit ribosomal RNA gene.
Key words: ssu rDNA, eukaryote evolution, protist, phylogenetics, metamonad, mitochondria, sex.
Address for correspondence and reprints: Joel B. Dacks, Program
in Evolutionary Biology, Canadian Institute for Advanced Research,
Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 4H7. E-mail:
[email protected]
Mol. Biol. Evol. 18(6):1034–1044. 2001
q 2001 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
1034
Cleveland 1956). Some oxymonads, such as Saccinobaculus and Oxymonas, undergo self-fusion of gametes
(autogamy). These taxa are thought to have a one-step
meiosis, in which a single reductive division produces
two daughter cells, instead of the two divisions and four
daughter cells typical of meiosis in other organisms (but
see Haig 1993). Other oxymonads, such as Pyrsonympha, do not undergo true sexual reproduction, but, rather,
have a ploidy cycle in which their initially high ploidy
is reduced by a series of apparently meiotic divisions
and then restored by multiple rounds of DNA replication
(Hollande and Carruette-Valentin 1970). Unlike most
eukaryotes, oxymonads also lack mitochondria and Golgi dictyosomes (Brugerolle 1991). This cytological simplicity, especially the lack of mitochondria, led to oxymonads being advanced as one of the most primitive
groups of eukaryotes (Cavalier-Smith 1981).
The relationships of oxymonads with other eukaryotes are uncertain and contentious. In the modern era,
they have generally been allied with the other cytologically simple, amitochondriate, tetraflagellate protists,
i.e., the retortamonads and diplomonads. These groups
formed the widely accepted phylum Metamonada, united by their shared possession of four anterior basal bodies and lack of organelles (Cavalier-Smith 1981, 1998).
However, the distinctive presence of a motile axostyle,
a cytoskeletal backbone running the length of oxymonad
cells, sets the oxymonads apart from the other metamonads. In his 1991 review, Brugerolle suggested that
there was ‘‘a probable long evolutionary distance between this group and the other two.’’ Recent elongation
factor (EF-1 alpha) phylogenies that include the first
gene sequence data from oxymonads (Moriya, Ohkuma,
and Kudo 1998; Dacks and Roger 1999) indicate that a
An Oxymonad-Trimastix Clade
close relationship with diplomonads is unlikely. Newer
accounts of eukaryotic diversity instead place oxymonads with Heterolobosea and Stephanopogon in the contentious phylum Percolozoa (Cavalier-Smith 1999,
2000) or simply describe them as ‘‘eukaryotic taxa without known sister groups’’ (Patterson 1999).
The genus Trimastix was first described by Kent in
1880 but has only recently become the subject of detailed study by evolutionary protistologists. Trimastix
are free-living anaerobes/microaerophiles with four flagella and a broad ventral feeding groove. Ultrastructural
examinations have revealed that Trimastix lack classical
mitochondria, having instead small, membrane-bounded
organelles resembling hydrogenosomes (O’Kelly 1993;
Brugerolle and Patterson 1997; Simpson, Bernard, and
Patterson 2000). The discovery of these organelles
prompted Cavalier-Smith (1997) to group Trimastix with
the hydrogenosome-bearing parabasalids in a new phylum, Trichozoa. However, detailed ultrastructural examinations also demonstrated that Trimastix shares a
large number of cytoskeletal similarities with a seemingly diverse collection of mitochondriate and amitochondriate protists that also have feeding grooves: the
retortamonads, core jakobids (Reclinomonas, Jakoba,
and Histiona), Malawimonas, Carpediemonas, some diplomonads, and some Heterolobosea (O’Kelly, Farmer,
and Nerad 1999; O’Kelly and Nerad 1999; Patterson
1999; Simpson and Patterson 1999). Trimastix has been
included with these groups in the informal assemblage
‘‘excavate taxa,’’ envisaged as a monophyletic or paraphyletic group (Simpson and Patterson 1999). CavalierSmith (1999) recently rejected Trichozoa and instead
erected a new phylum, Loukozoa, based on the shared
presence of a ventral feeding groove (and referring to
the presence of either mitochondria or mitochondrion
homologs). Loukozoa, containing only Trimastix and the
core jakobids (Cavalier-Smith 1999, 2000), is proposed
as the most basal eukaryotic group. Until now, no published molecular sequence data have been available for
Trimastix.
Without a reasonable phylogeny of eukaryotes, it
is impossible to trace the origin and evolution of uniquely eukaryotic traits, be they ultrastructural traits, organizational traits, or aspects of life history. Given that
both oxymonads and Trimastix have been independently
proposed as deep-branching eukaryotes, their phylogenetic placement bears strongly on issues of deep eukaryote phylogeny. Furthermore, given the unusual sexual cycles of oxymonads and the absence of classical
mitochondria from both oxymonads and Trimastix, resolving the placement of these lineages could improve
our understanding of the evolutionary history of sex and
of the acquisition, loss, and modification of
mitochondria.
We sequenced the small-subunit ribosomal RNA
genes (ssu rDNA) from three isolates of Trimastix and
from an oxymonad (Pyrsonympha sp.). The Pyrsonympha sample had to be isolated by hand from the termite
gut community using micromanipulation, and therefore
in situ hybridization was employed to verify the source
of the Pyrsonympha sequence. The relationship of these
1035
four rDNA sequences to each other and to other eukaryotic taxa was determined by phylogenetic analysis.
Materials and Methods
Protist Isolation and Gene Amplification
Pyrsonympha cells were obtained from specimens
of the Western subterranean termite (Reticulitermes hesperus), a species known to harbor the oxymonads Pyrsonympha and Dinenympha (Grosovsky and Margulis
1982), collected from a natural colony near Kelowna,
Canada. Termite gut contents were diluted into modified
Trager’s media (Buhse, Stamler, and Smith 1975). The
largest cells with typical Pyrsonympha morphology
were selected away from nonoxymonad flagellates by
micromanipulation, washed, and reselected. Due to the
difficulty of manipulation and identification, the cells
were identifiable only as Pyrsonympha sp.
About 50–75 cells were pelleted by centrifugation
at 3,000 rpm for 1 min, and DNA was extracted using
standard techniques (Maniatis, Fritsch, and Sambrook
1982). The 39 region of the Pyrsonympha sp. ssu rDNA
gene (639 nt) was amplified by PCR, using eukaryotic
specific primer 59N (TGAAACTTAAAGGAATTGACGGA) and primer B from Medlin et al. (1988). Cycling
parameters began with an initial denaturation of 958C
for 1 min, followed by 1 min at 458C and 3 min at 728C.
This cycle was repeated an additional 29 times with the
initial heating step at 948C for 10 s, and was followed
by a final cycle with extension time increased to 4 min
to promote the complete extension of products. The resulting PCR products were cloned into a pGem-T vector
(Promega BioTech, Madison, Wis.) and sequenced on
an ABI sequencer.
Once the identity of this clone was verified by in
situ hybridization (see below), its sequence was used to
design the 39 primer 3A (ACGCGTGCGGTTCAGATT). This was used with the universal 59 primer 5A2
(CTGGTTGATCCTGCCAG) to amplify the remaining
59 component of the oxymonad gene. The reaction was
performed using Taq polymerase augmented with trace
amounts of Pfu polymerase to discourage PCR-induced
replication errors. Cycling parameters of 958C for 1 min,
528C for 1 min, and 728C for 3 min were used for the
first cycle. This was followed by 31 repetitions with the
melting step at 948C decreased to 30 s and one additional cycle with the final extension time at 728C increased to 4 min. The resultant PCR products were
cloned into a TopoTA vector 2.1 (InVitrogen, Carlsbad,
Calif.).
Two independent 59 ssu rDNA PCR clones, from
separate PCR reactions, were sequenced on a LICOR
sequencer. These 59 ssu rDNA fragments of 1,553 unambiguously assigned bases overlapped the previous 39
fragment by 182 positions. The consensus sequence was
assembled based on two- to four-fold coverage of all
regions (not always on both strands), with any discrepancies checked against gel traces and bases assigned
manually.
The Trimastix marina isolate studied was the
‘‘freshwater’’ monoprotistan culture isolate detailed by
1036
Dacks et al.
Bernard, Simpson, and Patterson (2000) and studied by
Simpson, Bernard, and Patterson (2000). Trimastix pyriformis ATCC 50598 and T. pyriformis ATCC 50562
cell pellets were obtained from the American Type Culture Collection (Manassas, Va.). Genomic DNA was isolated using the PureGene DNA isolation kit (Gentra Systems, Inc., Minneapolis, Minn.). Following cell lysis,
RNase treatment, protein precipitation, and precipitation
of genomic DNA with isopropanol, the DNA was resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0
(TE), and subjected to chloroform : isoamyl alcohol extraction followed by precipitation with an equal volume
of 13% PEG in 0.7 M NaCl. DNA was resuspended in
TE. The ssu rDNA from each organism was amplified
by PCR using eukaryotic specific primers A and B
(Medlin et al. 1988) and cloned into pGem-T or pGemT easy (Promega BioTech) as previously described (Silberman et al. 1999). Cycle conditions were 30 cycles of
10 s denaturation at 948C, 1 min annealing at 378C, and
3 min extension at 728C, followed by a single ‘‘polishing’’ step of 10 min at 728C. Multiple independent recombinant clones were used as sequencing templates
(for T. marina, n 5 7; for both T. pyriformis isolates, n
5 10). The ssu rDNA clones of each species were independently pooled prior to sequencing on a LICOR
4200L apparatus using IR-labeled primers. Minimal heterogeneity was detected in the rDNA of T. marina, but
this heterogeneity was confined to hypervariable regions. Additionally, the ssu rDNA PCR product of T.
pyriformis ATCC 50562 was sequenced directly to confirm sequence homogeneity of the rRNA gene(s). All
Trimastix genes were sequenced completely in both
orientations.
In Situ Hybridization
To confirm the origin of the Pyrsonympha sp. sequence, in situ hybridization was performed on Reticulitermes speratus gut biota as described previously
(Moriya, Ohkuma, and Kudo 1998). Fluorescence in
situ hybridization (FISH) and enzymatic amplified
immunohybridization studies used a probe specific to
the Pyrsonympha-derived sequence (Oxy1270-FITC;
TACGCGTGCGGTTCAGATTA), which differs from
the eukaryote consensus at the six underlined positions.
Probe Euk1379-Texas Red (TACAAAGGGCAGGGAC) was used as a positive control for the FISH
analysis.
Phylogenetic Analysis
Two distinct ssu rDNA data sets were analyzed to
establish the phylogenetic affinities of the new sequences. DNA sequences were manually aligned using conserved primary and secondary structures. Only unambiguously aligned positions were considered in phylogenetic analyses. An evolutionary broad-scale data set
containing species representing most major eukaryote
lineages consisted of 45 taxa and 1,303 aligned positions
(taxa and accession numbers are listed in table 1). To
assess finer-scale relationships, we used a restricted subset (31 taxa, 1,447 aligned characters).
Hierarchical log likelihood ratio tests using the program MODELTEST, version 3.0b (Posada and Crandall
1998), showed that a general time-reversible model incorporating a correction for among-site rate variation
and invariable sites (GTR1G1I) best described both
data sets. The character state rate matrix, the base composition, the gamma shape parameter (a value), and the
proportion of invariable sites (I) were similarly estimated by likelihood methods. This explicit model of nucleotide evolution was used in maximum-likelihood (ML)
and distance analyses. For all analyses, gaps were treated as missing data and starting trees were obtained by
100 replicates of random stepwise taxon addition.
Branching order and stability were assessed by analyses
of 100 or more bootstrapped data sets. All phylogenetic
analyses were performed using PAUP*, version 4.0b
(Swofford 1998).
Kishino-Hasegawa tests (Kishino and Hasegawa
1989) using PAUP*, version 4.0b, were performed by
constraining the backbone ML topology and removing
the branch/clade of interest. All possible trees were then
constructed by replacing the taxon/clade at each position
on the constrained backbone. Significance between the
likelihood scores of alternative tree topologies was tested under a GTR1G1I model of nucleotide evolution.
Assessment of phylogenetic signal content within
the data sets and identification of taxa contributing excessive phylogenetic noise (i.e., putative long-branch
taxa) were done by tree independent regression and variance analyses using the RASA computer package, version 2.3.7 (Lyons-Weiler, Hoelzer, and Tausch 1996), by
implementing the analytical model for the estimation of
null slope. Plotting the ratio of the variances of phylogenetic (cladistic) similarity to phenetic similarity (taxon
variance ratio) identified those taxa which most contributed to branch length heterogeneity. The phylogenetic
signal content of the data set was reassessed after systematic removal of long-branched taxa. The 31-taxon
data set was also analyzed using the permutation model
for the calculation of null slope provided by RASA, version 2.5 (10 permutations) (Lyons-Weiler and Hoelzer
1999).
Results
Physical Attributes of ssu rDNAs
The amplified regions contained all of each ssu
rDNA gene except for the first and last ;25 nt. The
sequences from T. marina and T. pyriformis ATCC
50562 and ATCC 50598 were typical in size for eukaryotes (1,850, 1,823, and 1,837 bp, respectively),
while the hypervariable regions of the Pyrsonympha sp.
sequence were slightly expanded, resulting in an ssu
rDNA of 2,012 bp. The base composition of all four
sequences was typical of eukaryote ssu rDNAs (44%–
47% G1C).
In Situ Hybridization
The Pyrsonympha sp. cells were obtained from the
hindgut of the subterranean termite Reticulitermes hesperus, which contains a heterogeneous protist commu-
An Oxymonad-Trimastix Clade
1037
Table 1
Taxa Included in the Broad-Scale Data Set
Taxon Name
Accession No.
Taxonomic Affiliation
Mnemiopsis leidyi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Diaphanoeca grandis . . . . . . . . . . . . . . . . . . . . . . . . . . .
Corallochytrium limacisporum . . . . . . . . . . . . . . . . . . .
Apusomonas proboscidea . . . . . . . . . . . . . . . . . . . . . . . .
Athelia bombacina . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Candida maltosa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Chlorella vulgaris . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Chlamydomonas reinhardtii . . . . . . . . . . . . . . . . . . . . . .
Oryza sativa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Zamia pumila . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Acanthamoeba castellanii . . . . . . . . . . . . . . . . . . . . . . .
Hartmannella vermiformis . . . . . . . . . . . . . . . . . . . . . . .
Cryptomonas phi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Chroomonas sp. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Porphyra umbilicalis . . . . . . . . . . . . . . . . . . . . . . . . . . .
Stylonema alsidii . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Emiliana huxleyi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Phaeocystis globosa . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ochromonas danica . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Achlya bisexualis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Oxytricha granulifera . . . . . . . . . . . . . . . . . . . . . . . . . . .
Trimastix pyriformis ATCC 50562 . . . . . . . . . . . . . . . .
Trimastix pyriformis ATCC 50598 . . . . . . . . . . . . . . . .
Trimastix marina . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Pyrsonympha sp. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Blepharisma americanum . . . . . . . . . . . . . . . . . . . . . . .
Symbiodinium pilosum . . . . . . . . . . . . . . . . . . . . . . . . . .
Prorocentrum micans . . . . . . . . . . . . . . . . . . . . . . . . . . .
Toxoplasma gondi . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Theileria annulata . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vannella anglica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Endolimax nana . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Entamoeba histolytica . . . . . . . . . . . . . . . . . . . . . . . . . .
Mastigamoeba balamuthi . . . . . . . . . . . . . . . . . . . . . . . .
Dictyostelium discoideum . . . . . . . . . . . . . . . . . . . . . . .
Hyperamoeba sp. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Physarum polycephalum . . . . . . . . . . . . . . . . . . . . . . . .
Euglena gracilis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Trypanosoma brucei . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Naegleria gruberi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Psalteriomonas lanterna . . . . . . . . . . . . . . . . . . . . . . . .
Trichomonas vaginalis . . . . . . . . . . . . . . . . . . . . . . . . . .
Trichonympha sp. (cf collaris) . . . . . . . . . . . . . . . . . . .
Hexamita inflata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Giardia muris . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
L10826
L10824
L42528
L37037
M55638
D14593
X13688
M32703
X00755
M20017
M13435
M95168
X57162
X81328
L26202
L26204
L04957
X77476
M32704
M32705
X53486
AF244903
AF244904
AF244905
AF244906
M97909
M88518
M14649
M97703
M64243
AF099101
AF149916
X56991
L23799
K02641
AF093247
X13160
M12677
M12676
M18732
X94430
U17510
AF023622
L07836
X65063
Ctenophore
Choanoflagellate
Choanozoa
Apusomonad
Basidiomycete
Deuteromycete
Chlorophyte
Chlorophyte
Streptophyte
Streptophyte
Amoebae
Amoebae
Cryptomonad
Cryptomonad
Rhodophyte
Rhodophyte
Haptophyte
Haptophyte
Stramenopile
Stramenopile
Ciliate
Trimastix
Trimastix
Trimastix
Oxymonad
Ciliate
Dinoflagellate
Dinoflagellate
Apicomplexan
Apicomplexan
Amoebae
Entamoebid
Entamoebid
Pelobiont
Dictyostelid
Myxogastrid
Myxogastrid
Euglenozoan
Euglenozoan
Heteroloboseid
Heteroloboseid
Parabasalid
Parabasalid
Diplomonad
Diplomonad
nity including three species of each of the two oxymonad genera Pyrsonympha and Dinenympha (Kirby 1932).
The genera are readily distinguished by morphology and
size (170 mm average and 25–80 mm, respectively), but
the species of each are not readily distinguished, as their
sizes and morphologies overlap (Grassé 1952). Because
the DNA preparation was not from a pure culture, we
used in situ hybridization studies to confirm the source
of the ssu rDNA sequence. For convenience, these studies used the closely related Japanese termite R. speratus
which contains the same two oxymonad genera. The
positive control for FISH experiments was a Texas Red–
labeled probe complementary to all eukaryotic ssu
rDNA (Euk1379); it annealed to all of the protistan inhabitants of the R. speratus hindgut (fig. 1A-1). The
FITC-labeled Pyrsonympha probe (Oxy1270; fig. 1) differed from the eukaryote consensus at six strongly conserved positions; it hybridized strongly to all cells with
Pyrsonympha or Dinenympha size and morphology but
not to nonoxymonad protists (fig. 1A-2). Similar results
were obtained when termite gut contents stained with
Oxy1270-FITC were examined with anti-FITC antibodies (fig. 1B). These results confirm that an oxymonad
species was the source of the ssu rDNA sequence obtained. As the DNA was obtained from the largest cells
with Pyrsonympha morphology, we assigned the sequence to Pyrsonympha sp.
Phylogenetic Analysis of the 45-Taxon Data Set
To test the relationships of the Pyrsonympha and
Trimastix sequences to each other and to other eukaryotes, we initially performed phylogenetic analyses on a
45-taxon data set containing representatives of all major
eukaryote groups. With this set, Pyrsonympha sp. and
the Trimastix species formed a clade that was highly
supported by bootstrap values under all models and
methods of phylogenetic analyses (fig. 2A) and was re-
1038
Dacks et al.
FIG. 1.—In situ micrographs of Reticulitermes speratus gut fauna. A, fluorescence in situ hybridization analysis with two probes: Euk1379
(eukaryote universal probe) labeled with Texas Red, and Oxy1270 (putative Pyrsonympha probe) labeled with fluorescein. A-1, Texas red
fluorescence. A-2, fluorescein fluorescence. B, Anti-FITC antibody analysis using the Oxy1270 probe. B-1, Phase contrast illumination. B-2,
Staining with anti-FITC antibody. Organisms are seen under 2003 magnification.
covered in all optimum trees. Within this clade, the Trimastix sequences were monophyletic in ML and parsimony analyses, but Pyrsonympha sp. and T. marina
were sister taxa under distance methods with the best
available model of nucleotide evolution.
The strength of the oxymonad/Trimastix clade was
further examined by performing a series of KishinoHasegawa (KH) log likelihood ratio tests under the optimum model of phylogenetic reconstruction
(GTR1G1I). The best ML tree from the 45-taxon data
set was used as a backbone constraint in the absence of
Pyrsonympha, and Pyrsonympha was then added to each
possible branching position. Log likelihood scores for
each tree were then calculated. The most likely tree topology was that shown in figure 2A. Only five other
topologies fell within the acceptable 95% confidence interval. Of these, the top four were simple permutations,
with the Pyrsonympha branch connecting to all possible
nodes within the Trimastix clade. Interestingly, the top
P value for nonrejected trees was also the optimal topology recovered in distance analyses, a specific relationship of Pyrsonympha sp. with T. marina (P 5
0.2879). Other support values ranged from P 5 0.23 to
P 5 0.07. The least likely topology that failed to be
rejected was that with Pyrsonympha branching as the
sister taxon to Vanella anglica, but the value was marginal (P 5 0.06). The KH tests were then repeated with
the Pyrsonympha sequence retained and the Trimastix
sequences removed, but no other topologies for the
placement of the Trimastix sequences fell within the
95% confidence interval. Overall, these analyses strongly supported a specific relationship between oxymonads
and Trimastix.
Our ssu rDNA analyses did not establish a specific
relationship between the oxymonad-plus-Trimastix clade
and the various groups to which either has been linked
by morphological studies or recent classification schema, i.e., diplomonads, parabasalids, and heteroloboseids
(Cavalier-Smith 1998, 1999; Simpson and Patterson
1999). In fact, there was no significant support for
grouping this clade with any major eukaryotic lineage
(fig. 2A). This was explicitly examined by constraining
the oxymonad/Trimastix clade, rearranging it along a
constrained ML backbone tree topology, and performing
KH tests (GTR1G1I model of nucleotide evolution). Of
the 79 potential branching positions for the oxymonad/
Trimastix clade, 36 failed to be rejected. Notable among
An Oxymonad-Trimastix Clade
1039
FIG. 2.—Phylogenetic analysis of ssu rDNA. New sequences are shown in bold. All other sequences were obtained from GenBank. A, The
optimal maximum-likelihood (GTR1G1 I) tree is shown with bootstrap values for maximum-likelihood distances and maximum parsimony at
nodes supported over 50%, with the exception of the Pyrsonympha/Trimastix node, for which values under a variety of methods and optimality
criteria are listed. Crit 5 optimality criteria used in analysis; D 5 distance; K2P 5 Kimura 2 parameters; L 5 likelihood; MP 5 maximum
parsimony; Z 5 quartet puzzling. The tree is arbitrarily shown as rooted on diplomonads. B, The optimal maximum-likelihood topology is
shown with maximum-likelihood, minimum evolution, and maximum-parsimony bootstrap values shown at nodes supported over 50%. An
asterisk represents bootstrap values ,50, and the scale bar shows the number of changes per site.
the rejected clades was sisterhood with parabasalids as
proposed by Cavalier-Smith (1997).
RASA Analyses
Rapidly evolving gene sequences (‘‘long-branch
sequences’’) in molecular data sets can produce enough
phylogenetic noise to obscure biologically meaningful
relationships (Lyons-Weiler, Hoelzer, and Tausch 1996;
Stiller and Hall 1999). To determine whether Pyrsonympha and Trimastix constitute long-branch sequences,
to assess the phylogenetic signal of our 45-taxon data
set, and to aid in taxa selection for finer-scale analyses,
we performed a series of regression analyses of signal
content using the computer program RASA (LyonsWeiler, Hoelzer, and Tausch 1996). The null hypothesis
was that no relationship existed between cladistic signal
and phenetic similarity among the sequences tested. For
the 45-taxon broad-scale data set, this hypothesis could
not be rejected, indicating that long-branch sequences
may be obscuring some phylogenetic signal. Using variance analyses as a guide, ssu rDNA sequences were
then removed from the data set until a statistically significant phylogenetic signal (t RASA $ 1.65) was
achieved. Table 2 shows that to obtain significant signal
content it was necessary to remove all diplomonads, parabasalids, heteroloboseids, euglenozoans, myxogastrids,
and entamoebids and either Mastigamoeba balamuthi or
Dictyostelium discoideum. Thus, any of the relationships
in figure 2A involving these lineages may be due to
long-branch attraction rather than phylogenetic signal.
Importantly, Pyrsonympha and Trimastix do not branch
among these taxa (fig. 2A). Consequently, their placement in trees is likely to be independent of long-branch
artifacts.
To explore relationships involving Pyrsonympha
and Trimastix, the diplomonads, parabasalids, heteroloboseids, euglenozoans, myxogastrids, and entamoebids
were removed from the data set, leaving 33 taxa and
1,416 aligned characters, and RASA analyses were repeated. This set did not give a significant phylogenetic
signal (table 2). However, when any one of the M. balamuthi, D. discoideum, or Pyrsonympha sp. sequences
were also removed, significant phylogenetic signal was
recovered. Thus, M. balamuthi and D. discoideum sequences were removed, yielding a data set of 31 taxa
and 1,447 characters. RASA analysis under an analytical
model then confirmed that this set produced significant
phylogenetic signal (df 5 431, tRASA 5 4.03). Two taxa
in this set, Pyrsonympha sp. and the amoeba V. anglica,
had relatively high taxon variance ratios and long
branches. In fact, when the more stringent permutation
model provided by RASA, version 2.5, was used for the
calculation of the null slope (Lyons-Weiler and Hoelzer
1999), the presence of these two taxa in the data set
1040
Dacks et al.
Table 2
Taxa Removed to Obtain rRASA Values
Taxa Removed
Set of 45 taxa
None . . . . . . . . . . . . . . .
A ..................
B ..................
C ..................
D ..................
E ..................
J ...................
A, B . . . . . . . . . . . . . . .
A, J . . . . . . . . . . . . . . . .
A–C . . . . . . . . . . . . . . . .
A–D . . . . . . . . . . . . . . .
A–D, I . . . . . . . . . . . . .
A–D, J . . . . . . . . . . . . .
A–E . . . . . . . . . . . . . . . .
A–D, I, J . . . . . . . . . . .
A–E, I . . . . . . . . . . . . . .
A–E, J . . . . . . . . . . . . . .
A–F . . . . . . . . . . . . . . . .
A–E, I, J . . . . . . . . . . . .
A–F, I . . . . . . . . . . . . . .
A–F, J . . . . . . . . . . . . . .
A–D, F, I, J . . . . . . . . .
A–F, I, J . . . . . . . . . . . .
Set of 33 taxa
None . . . . . . . . . . . . . . .
F ..................
I ...................
L ..................
F, I . . . . . . . . . . . . . . . . .
F, L . . . . . . . . . . . . . . . .
I, L . . . . . . . . . . . . . . . .
F, I, L . . . . . . . . . . . . . .
F, H, I, L . . . . . . . . . . .
df
tRASA
942
857
857
857
857
857
857
779
776
699
626
557
557
557
524
524
524
524
461
461
461
492
431
22.43
23.11
22.60
22.00
22.97
23.25
22.62
22.97
23.27
21.86
21.06
21.40
21.62
0.19
21.85
0.27
1.32
0.48
1.85*
0.05
2.21*
21.66
3.30*
492
461
461
461
431
431
431
402
374
0.96
1.92*
1.84*
2.72*
3.60*
4.84*
4.95*
11.04*
16.25*
NOTE.—A 5 diplomonads; B 5 parabasalids; C 5 Heterolobosea; D 5
Euglenozoa; E 5 myxogastrids; F 5 Dictyostelium; G 5 Hartmanella; H 5
Vanella; I 5 Mastigamoeba; J 5 Entamoebidae; K 5 Acanthamoeba; L 5 Pyrsonympha. Significant tRASA scores (.1.65) are indicated by an asterisk.
caused tRASA to be below the significance value. However, their wide separation in the phylogenetic trees in
figure 2 suggests that long-branch attraction between
them is not a problem. The removal of both Pyrsonympha and Vanella from the data set yielded a tRASA
value well above the significance value (df 5 374, tRASA
5 7.39).
Phylogenetic Analysis of the 31-Taxon Data Set
Guided by the RASA results, we reduced the number of fast-evolving sequences in the data set to better
resolve the phylogenetic relationship of Pyrsonympha to
the different Trimastix species and that of the Pyrsonympha/Trimastix clade to other eukaryotic lineages. Use
of only these 31 taxa allowed unambiguous alignment
of 1,447 nucleotide positions, increasing the power of
the phylogenetic analysis. The results from this reduced
data set paralleled those of the previous analyses (fig.
2B). High bootstrap values under ML, distance, and parsimony strongly supported a Pyrsonympha-plus-Trimastix clade. Pyrsonympha was the earliest-diverging taxon
within this clade in ML and parsimony analyses, while
a weakly supported sister taxon relationship between
Pyrsonympha sp. and T. marina was observed in distance analyses (bootstrap value of 43). Finally, as with
previous phylogenetic analyses of ssu rDNA phylogenies, the major eukaryotic lineages were robustly
monophyletic.
RASA analyses of the 31-taxon data set (which included both the Pyrsonympha and the Vanella sequences) rejected the null hypothesis of no relationship between cladistic signal and phenetic similarity under an
analytical RASA model, while analyses under a permutations model did not reject the null hypothesis. For
this reason, phylogenetic analyses were performed to determine whether these ‘‘long-branch taxa’’ were masking any other affinities of the Trimastix sequences. In
the absence of the Pyrsonympha sequence, with or without Vanella, the Trimastix sequences formed a clade
with 100% support under parsimony and ML distance
models and showed no strong affinity for any other lineage in the data set. Returning the Pyrsonympha sequence to the data set in the absence of Vanella produced a robust Pyrsonympha/Trimastix clade with 100%
support in phylogenetic analyses with both parsimony
and ML distance models (data not shown). Therefore,
the presence of the ‘‘long-branch sequences’’ of Pyrsonympha and Vanella do not appear to obscure any relationships relevant to this study.
Unfortunately, inclusion of more characters did not
improve resolution of the relationships among the major
eukaryote lineages. The oxymonad/Trimastix clade
seems to represent yet another eukaryotic lineage without obvious close relatives in ssu rDNA phylogenies.
However, since KH tests of the 45-taxon data set failed
to reject sister relationships of this clade with many of
the major eukaryotic clades, this interpretation should
be viewed as tentative, to be further tested as new sequences and methods become available.
Discussion
Our study showed a specific relationship between
the representative oxymonad Pyrsonympha and Trimastix. The result was robust under a variety of phylogenetic reconstruction methods, optimality criteria, and
models of nucleotide evolution and was confirmed by
rigorous statistical tests. This relationship suggests new
lines of research into the evolution of some important
eukaryotic traits and has a variety of implications for
broad-scale eukaryote systematics.
Relationship Between Pyrsonympha and Dinenympha
We assigned the name Pyrsonympha sp. to our oxymonad sequence because it was derived from a pool
of the largest cells with distinctive Pyrsonympha morphology. However, despite this selection during the initial micromanipulation and cell isolation, the Oxy1270
probe hybridized to both Pyrsonympha and Dinenympha
specimens. Both R. hesperus and R. speratus are reported to harbor multiple morphologically distinguishable species of both Pyrsonympha and Dinenympha (Yamin 1979). However, Hollande and Carruette-Valentin
(1970) concluded from microscopic observations and
An Oxymonad-Trimastix Clade
DNA content measurements that Pyrsonympha and Dinenympha are probably morphs of the same organism,
with the reduction in size from Pyrsonympha to Dinenympha being due to successive rounds of meiotic division. The hybridization of Oxy1270 to both Dinenympha and Pyrsonympha cells may indicate that these are
the same organism or that the probe (to a fairly conserved region of the ssu rDNA) was unable to distinguish these two genera. Further molecular phylogeny
and in situ microscopy work will be necessary to better
address this question.
Evolution of Mitochondria, Commensalism, and Sex
Under the archezoa hypothesis, amitochondriate
protists without obvious relationships to mitochondrionbearing taxa are viewed as potentially primitive eukaryotes that diverged prior to the acquisition of the mitochondrial symbiont (Cavalier-Smith 1983; Roger 1999).
However, wherever examined, amitochondriate taxa
have been found to possess nuclear-encoded genes that
appear to be of mitochondrial origin (see Roger 1999).
In the cases of two such amitochondriate taxa, parabasalids and Entamoeba, diverse evidence suggests that certain membrane-bounded organelles within the cell (hydrogenosomes in parabasalids; mitosomes/cryptons in
Entamoeba) are the physical relics of mitochondria
(Clark and Roger 1995; Roger, Clark, and Doolittle
1996; Mai et al. 1999; Tovar, Fischer, and Clark 1999;
Rotte et al. 2000). These findings have bolstered the
position that double-membrane-bounded organelles of
other amitochondriate taxa, where present, are also likely to be modified mitochondria (e.g., Roger 1999). Conversely, the apparent lack of any similar double-membrane-bounded organelle in diplomonads has allowed
some researchers the freedom to continue to propose a
(form of) primitively amitochondriate status for this
group. For example, it has been suggested that the diplomonad ‘‘mitochondrial genes’’ were all acquired by
separate lateral transfers from other prokaryotes or were
transferred prior to the complete and/or permanent incorporation of the mitochondrial symbiont, with the protomitochondrial form discarded by ancestors of diplomonads (Sogin 1997; Chihade et al. 2000).
Like diplomonads, oxymonads are widely held to
completely lack mitochondria-like organelles (Brugerolle 1991; but see Bloodgood et al. 1974; Roger 1999).
No potentially mitochondrial genes have yet been reported and, viewed by themselves, oxymonads have remained candidates for true ‘‘archezoa,’’ that is, primitively amitochondriate eukaryotes. In contrast, Trimastix
cells contain small organelles bounded by two membranes. The cellular and molecular biology of these organelles have not been examined; however, most authors
have argued that they are modified mitochondria of
some form (Brugerolle and Patterson 1997). This argument is consistent with ultrastructural evidence suggesting a close relationship between Trimastix and the mitochondrion-bearing excavate taxa, such as Malawimonas (O’Kelly, Farmer, and Nerad 1999; O’Kelly and Nerad 1999; Simpson, Bernard, and Patterson 2000). If
1041
either or both of the propositions are accepted, the close
relationship between Trimastix and oxymonads demonstrated here is the strongest (and arguably the only) positive evidence to date that oxymonads are secondarily
amitochondriate. Thus, while the arguments for primarily amitochondriate diplomonads are weak in our opinion, whatever their merit they cannot be generalized or
transplanted to oxymonads without provision of an alternative explanation for the organelles in Trimastix.
The relationship uncovered in this study may instead help illuminate the evolutionary process of mitochondrial loss. Our phylogenies are consistent with Trimastix and oxymonads sharing a recent common ancestor that lacked classical mitochondria, with further evolutionary divergence then generating the different
amitochondriate conditions seen in extant Trimastix and
oxymonads. The most intriguing possibility is that Trimastix retains an intermediate stage in the same process
of mitochondrion loss that culminated in the condition
now found in oxymonads. If this were even approximately true, oxymonads and Trimastix together could
provide a particularly useful system for the study of the
evolution of amitochondriate states.
The morphological simplicity of many obligately
symbiotic or parasitic taxa is routinely interpreted as a
‘‘reduction’’ in consequence of their adoption of the
commensal habit. However, if the common ancestor of
Trimastix and oxymonads was amitochondriate and was
free-living like its Trimastix descendants, the ‘‘reduced’’
amitochondriate state in oxymonads would in fact predate their adoption of a commensal habit and might be
viewed instead as a preadaptation to life in metazoan
digestive tracts. Alternatively, Trimastix may be secondarily free-living, a scenario which seems less parsimonious with present data, and, intuitively, less likely.
However, we note that reversions to a free-living habit
from commensalism appear to have occurred within
some other amitochondriate taxa, including parabasalids
(Gunderson et al. 1995; Edgcomb et al. 1998) and possibly diplomonads and retortamonads (Siddall, Hong,
and Desser 1992; Bernard, Simpson, and Patterson
1997).
Given the potential interest to evolutionary and cell
biologists, it is important to establish whether the oxymonad/Trimastix clade includes other extant organisms.
Assuming a single origin for the mitochondrion, the hypothesis of a shared amitochondriate history for Trimastix and oxymonads would be falsified by the discovery of any mitochondriate group that branched within the oxymonad-Trimastix clade. Given the current
poor sampling of mitochondriate excavate taxa for nuclear genes (see below), it would appear unwise to discount this possibility at present. A better understanding
of the immediate relations of the oxymonad-Trimastix
clade may also help polarize the evolutionary history of
commensalism for the group. Molecular phylogenies are
required that incorporate a broad sample of mitochondriate excavate taxa in addition to Trimastix and oxymonads. The contention that oxymonads lack any cellular mitochondrial homolog is also worth testing. Unusual densely staining bodies have been recorded in Pyr-
1042
Dacks et al.
sonympha (Bloodgood et al. 1974), although it is
unclear whether these are double-membrane-bound or
have any equivalent in other oxymonads.
The identification of a definite relative of oxymonads also provides a new opportunity to understand the
evolutionary significance of their unusual sexual cycles.
To date, sexuality has not been reported in Trimastix,
although this is unsurprising given the limited contemporary examination of the group. If subsequent studies
demonstrate that the unusual features of oxymonad sex,
such as one-step meiosis, autogamy, or ploidy cycles,
are shared by Trimastix, then these traits may be traced
back to the common oxymonad/Trimastix ancestor. On
the other hand, finding that Trimastix mirrors standard
eukaryotic sexual cycles would suggest that the atypical
features of oxymonad sex are derived. An asexual Trimastix lineage would shed no light on the matter, as sex
could easily have been lost. Since ploidy cycles, in particular, have been proposed as an intermediate evolutionary step to the origin of sex (Kondrashov 1994), it
is important to examine both the overall placement of
the oxymonad/Trimastix clade and the possibility of a
sexual cycle in Trimastix.
Implications for Broad-Scale Eukaryotic Systematics
The close relationship between oxymonads and Trimastix has important implications for ‘‘phylum-level’’
eukaryotic systematics. In the modern era, oxymonads
have been considered to be allied with diplomonads and
retortamonads in the phylum Metamonada (CavalierSmith 1981, 1998) or with Heterolobosea (sensu lato)
and Stephanopogon in the phylum Percolozoa (CavalierSmith 1999). Trimastix has been allied with parabasalids
in the phylum Trichozoa (Cavalier-Smith 1997) and with
jakobids in the phylum Loukozoa (Cavalier-Smith
1999). All of these phyla were or are primarily diagnosed by circumscription (a summary of important attributes of the organisms is contained therein) rather
than in an explicitly ‘‘phylogenetic’’ manner. However,
the circumscriptions of Metamonada and Percolozoa
would not accommodate Trimastix, which has both mitochondrion-like organelles and Golgi dictyosomes, nor
would the circumscriptions of Trichozoa and Loukozoa
accommodate oxymonads, which lack Golgi dictyosomes and ventral feeding grooves. It may be most expedient to create a new taxon to encompass Trimastix
and oxymonads. Given that each has generally been given its own class or subphylum (e.g., Cavalier-Smith
1997, 1998, 1999, 2000), this new taxon would arguably
deserve the rank of phylum if Linnean ranking were
continued.
Should the ‘‘excavate taxa’’ grouping be abandoned? Although the excavate taxa are remote from one
another in our ssu rDNA analysis (fig. 2A), it may be
difficult to establish phylogenetic ties among sequences
possessing very different rates of evolutionary change,
i.e., Trimastix versus diplomonads and heteroloboseids.
In fact, we demonstrate the poor quality of the ssu rDNA
data set for phylogenetic reconstruction if diplomonads
and heteroloboseids are included in the analysis. In light
of the extensive morphological data supporting a common origin for excavate taxa (Simpson and Patterson
1999; Simpson, Bernard, and Patterson 2000), it would
be most premature to abandon the excavate hypothesis
on the basis of our phylogenies. Additional molecular
and morphological studies may help clarify the issue.
Small-subunit rDNA sequences from additional excavate taxa that do not fall into the fast-evolving category
would be particularly useful. The close relationship between Trimastix and oxymonads is, of itself, consistent
with the excavate hypothesis, provided it is assumed that
oxymonads have lost an ancestral ‘‘excavate-type’’ feeding groove and that the excavate taxa are a paraphyletic
assemblage (Simpson, Bernard, and Patterson 2000).
The lack of signal in the small-subunit rDNA data
set when long-branch taxa are included highlights the
current uncertainty as to the identity of the most basal
branches in the eukaryotic tree. It has been suggested
that the bacteria-like mitochondrial genome of the core
jakobid Reclinomonas americana most closely resembles the ancestral state (Lang et al. 1997), leading to
arguments for a rooting of the eukaryotic tree with this
group (Cavalier-Smith 1999). This possibility could suggest an early-diverging status for oxymonads independent of previous arguments of cellular simplicity, since
ultrastructural data strongly link Trimastix and core jakobids as typical excavate taxa (O’Kelly, Farmer, and
Nerad 1999).
It was originally thought that the eukaryotic tree
could be rooted using single-gene sequences from single
representatives of key eukaryotic groups. We now know
that this strategy is very unlikely to be successful. The
best approach may be to first establish solid withingroup phylogenies for each of the major eukaryote
groups using multiple genes as well as ultrastructural
data. Should this result in a well-resolved and taxonomically diverse eukaryotic phylogeny, then rooting experiments could be performed to identify the earliestbranching eukaryotic lineages.
Acknowledgments
Special thanks are due to Andrew Roger, John Logsdon, and James Lyons-Weiler for helpful discussions; to
John Archibald and Yuji Inagaki for critical reading of
the manuscript; and to W. F. Doolittle, M. L. Sogin, and
D. J. Patterson. We would like to thank Interior Pest
Control and Ryan Sinotte for aid in obtaining R. hesperus specimens, and Mike Holder for computational
assistance. This work was supported by a Canadian
NSERC grant to R.J.R., a Canadian MRC grant to W.
F. Doolittle, NIH grant GM32964 to M. L. Sogin, and
Australian Research Council (ARC) and Australian Biological Resources Study (ABRS) grants to D. J. Patterson. This work was also partly supported by grants
for the Biodesign Research Program, the Genome Research Program, and the EcoMolecular Science Research Program from the Institute of Physical and
Chemical Research (RIKEN). This manuscript has been
assigned IGPP number 5499.
An Oxymonad-Trimastix Clade
LITERATURE CITED
BERNARD, C., A. G. B. SIMPSON, and D. J. PATTERSON. 1997.
An ultrastructural study of a free-living retortamonad Chilomastix cuspidata (Larsen & Patterson, 1990) n. comb.
(Retortamonadida, Protista). Eur. J. Protistol. 33:254–265.
———. 2000. Some free-living flagellates from anoxic sediments. Ophelia 52:113–142.
BLOODGOOD, R. A., K. R. MILLER, T. P. FITZHARRIS, and J. R.
MCINTOSH. 1974. The ultrastructure of Pyrsonympha and
its associated microorganisms. J. Morphol. 143:77–106.
BRUGEROLLE, G. 1991. Flagellar and cytoskeletal systems in
amitochondriate flagellates: Archamoeba, Metamonada and
Parabasala. Protoplasma 164:70–90.
BRUGEROLLE, G., and D. J. PATTERSON. 1997. Ultrastructure
of Trimastix convexa Hollande, an amitochondriate anaerobic flagellate with a previously undescribed organization.
Eur. J. Protistol. 33:121–130.
BUHSE, H. E., S. J. STAMLER, and H. E. SMITH. 1975. Protracted maintenance of symbiotic polymastigote flagellates outside their termite host. J. Protozool. 22:11A–12A.
CAVALIER-SMITH, T. 1981. Eukaryote kingdoms: seven or
nine? Biosystems 14:461–481.
———. 1983. A 6-kingdom classification and a unified
phylogeny. Pp. 1027–1034 in H. E. A. SCHENK and W.
SCHWEMMLER, eds. Endocytobiology II. Walter de Gruyter,
Berlin.
———. 1997. Amoeboflagellates and mitochondrial cristae in
eukaryote evolution: megasystematics of the new protozoan
subkingdoms Eozoa and Neozoa. Arch. Protistenkd. 147:
237–258.
———. 1998. A revised six-kingdom system of life. Biol. Rev.
Camb. Philos. Soc. 73:203–266.
———. 1999. Principles of protein and lipid targeting in secondary symbiogenesis: euglenoid, dinoflagellate, and sporozoan plastid origins and the eukaryote family tree. J. Eukaryot. Microbiol. 46:347–366.
———. 2000. Flagellate megaevolution. The basis for eukaryote
diversification. Pp. 361–390 in B. S. C. LEADBEATER and J.
C. GREEN, eds. The flagellates. Taylor and Francis, London.
CHIHADE, J. W., J. R. BROWN, P. R. SCHIMMEL, and L. RIBAS
DE POUPLANA. 2000. Origin of mitochondria in relation to
evolutionary history of eukaryotic alanyl-tRNA synthetase.
Proc. Natl. Acad. Sci. USA 97:12153–12157.
CLARK, C. G., and A. J. ROGER. 1995. Direct evidence for
secondary loss of mitochondria in Entamoeba histolytica.
Proc. Natl. Acad. Sci. USA 92:6518–6521.
CLEVELAND, L. R. 1956. Brief account of the sexual cycles of
the flagellates of Cryptocercus. J. Protozool. 3:161–180.
DACKS, J., and A. J. ROGER. 1999. The first sexual lineage and
the relevance of facultative sex. J. Mol. Evol. 48:779–783.
EDGCOMB, V. P., E. VISCOGLIOSI, A. G. B. SIMPSON P. DELGADO-VISCOGLIOSI, A. J. ROGER, and M. L. SOGIN. 1998.
New insights into the phylogeny of trichomonads inferred
from small subunit rRNA sequences. Protist 149:359–366.
EMBLEY, T. M., and R. P. HIRT. 1998. Early branching eukaryotes? Curr. Opin. Genet. Dev. 8:624–629.
GRASSÉ, P. P. 1952. Classe des Zooflagellés Zooflagellata ou
Zoomastigina. Pp. 574–578 in P.-P. GRASSÉ, ed. Traité de
zoologie. Masson et Cie, Paris.
GROSOVSKY, B. D. D., and L. MARGULIS. 1982. Termite microbial communities. Pp. 519–532 in R. G. BURNS and J.
H. SLATER, eds. Experimental microbial ecology. Blackwell
Scientific, Oxford, England.
GUNDERSON, J., G. HINKLE, D. LEIPE, H. G. MORRISON, S. K.
STICKEL, D. A. ODELSON, J. A. BREZNAK, T. A. NERAD, M.
MULLER, and M. L. SOGIN. 1995. Phylogeny of trichomo-
1043
nads inferred from small-subunit rRNA sequences. J. Eukaryot. Microbiol. 42:411–415.
HAIG, D. 1993. Alternatives to meiosis: the unusual genetics
of red algae, microsporidia, and others. J. Theor. Biol. 163:
15–31.
HOLLANDE, A., and J. CARRUETTE-VALENTIN. 1970. Appariement chromosomique et complexes synaptonematiques dans
les noyaux en cours de dépolyploidisation chez Pyrsonympha flagellata: le cycle évolutif des Pyrsonymphines symbiontes de Reticulitermes lucifugus. C. R. Acad. Sci. Paris
270:2550–2555.
KENT, W. S. 1880. Manual of the Infusoria: flagellate, ciliate
and tentaculiferous Protozoa, British and foreign. David
Brogue, London.
KIRBY, H. J. 1932. Flagellates of the genus Trichonympha in
termites. Univ. Calif. Publ. Zool. 37:350–454.
KISHINO, H., and M. HASEGAWA. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in
Hominoidea. J. Mol. Evol. 29:170–179.
KONDRASHOV, A. S. 1994. The asexual ploidy cycle and the
origin of sex. Nature 370:213–216.
LANG, B. F., G. BURGER, C. J. O’KELLY, R. CEDERGREN, G.
B. GOLDING, C. LEMIEUX, D. SANKOFF, M. TURMEL, and
M. W. GRAY. 1997. An ancestral mitochondrial DNA resembling a eubacterial genome in miniature. Nature 387:
493–497.
LYONS-WEILER, J., and G. A. HOELZER. 1999. Null model selection, compositional bias, character state bias, and the limits of phylogenetic information. Mol. Biol. Evol. 16:1400–
1406.
LYONS-WEILER, J., G. A. HOELZER, and R. J. TAUSCH. 1996.
Relative apparent synapomorphy analysis (RASA). I: The
statistical measurement of phylogenetic signal. Mol. Biol.
Evol. 13:749–757.
MAI, Z., S. GHOSH, M. FRISARDI, B. ROSENTHAL, R. ROGERS,
and J. SAMUELSON. 1999. Hsp60 is targeted to a cryptic
mitochondrion-derived organelle (‘‘crypton’’) in the microaerophilic protozoan parasite Entamoeba histolytica. Mol.
Cell. Biol. 19:2198–2205.
MANIATIS, T., E. F. FRITSCH, and J. SAMBROOK. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
MEDLIN, L., H. J. ELWOOD, S. STICKEL, and M. L. SOGIN.
1988. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 71:491–499.
MORIYA, S., M. OHKUMA, and T. KUDO. 1998. Phylogenetic
position of symbiotic protist Dinenympha exilis in the hindgut of the termite Reticulitermes speratus inferred from the
protein phylogeny of elongation factor 1 alpha. Gene 210:
221–227.
O’KELLY, C. 1993. The jakobid flagellates: structural features
of Jakoba, Reclinomonas and Histiona and implications for
the early diversification of eukaryotes J. Eukaryot. Microbiol. 40:627–636.
O’KELLY, C. J., M. A. FARMER, and T. A. NERAD. 1999. Ultrastructure of Trimastix pyriformis (Klebs) Bernard et al.:
similarities of Trimastix species with retortamonad and jakobid flagellates. Protist 150:149–162.
O’KELLY, C. J., and T. A. NERAD. 1999. Malawimonas jakobiformis n. gen., n. sp. (Malawimonadidae n. fam.): a jakoba-like heterotrophic nanoflagellate with discoidal mitochondrial cristae. J. Eukaryot. Microbiol. 46:522–531.
PATTERSON, D. J. 1999. The diversity of eukaryotes. Am. Nat.
154:S96–S124.
POSADA, D., and K. A. CRANDALL. 1998. Modeltest: testing
the model of DNA substitution. Bioinformatics 14:817–818.
1044
Dacks et al.
ROGER, A. J. 1999. Reconstructing early events in eukaryotic
evolution. Am. Nat. 154:S146–S163.
ROGER, A. J., C. G. CLARK, and W. F. DOOLITTLE. 1996. A
possible mitochondrial gene in the early-branching amitochondriate protist Trichomonas vaginalis. Proc. Natl. Acad.
Sci. USA 93:14618–14622.
ROTTE, C., K. HENZE, M. MULLER, and W. MARTIN. 2000.
Origins of hydrogenosomes and mitochondria. Curr. Opin.
Microbiol. 3:481–486.
SIDDALL, M. E., H. HONG, and S. S. DESSER. 1992. Phylogenetic analysis of the Diplomonadida (Wenyon, 1926) Brugerolle, 1975: evidence for heterochrony in protozoa and
against Giardia lamblia as a ‘‘missing link.’’ J. Protozool.
39:361–367.
SILBERMAN, J. D., C. G. CLARK, L. S. DIAMOND, and M. L.
SOGIN. 1999. Phylogeny of the genera Entamoeba and Endolimax as deduced from small-subunit ribosomal RNA sequences. Mol. Biol. Evol. 16:1740–1751.
SIMPSON, A. G. B., C. BERNARD, and D. J. PATTERSON. 2000.
The ultrastructure of Trimastix marina, an excavate flagellate. Eur. J. Protistol. 36:229–252.
SIMPSON, A. G. B., and D. J. PATTERSON. 1999. The ultrastructure of Carpediemonas membranifera: (Eukaryota), with
reference to the ‘‘excavate hypothesis.’’ Eur. J. Protistol. 35:
353–370.
SOGIN, M. 1997. History assignment: when was the mitochondrion founded? Curr. Opin. Genet. Dev. 7:792–799.
STILLER, J. W., and B. J. HALL. 1999. Long-branch attraction
and the rDNA model of early eukaryotic evolution. Mol.
Biol. Evol. 16:1270–1279.
SWOFFORD, D. L. 1998. PAUP*. Phylogenetic analysis using
parsimony (*and other methods). Sinauer, Sunderland,
Mass.
TOVAR, J., A. FISCHER, and C. G. CLARK. 1999. The mitosome,
a novel organelle related to mitochondria in the amitochondrial parasite Entamoeba histolytica. Mol. Microbiol. 32:
1013–1021.
YAMIN, M. A. 1979. Flagellates of the orders Trichomonadida
Kirby, Oxymonadida Grasse, and Hypermastigida Grassi
and Foa reported from lower termites (Isoptera families
Mastotermitidae, Kalotermitidae, Hodotermitidae, Termopsidae, Rhinotermitidae and Serritermitidae) and from the
wood-feeding Cryptocercus (Dictyoptera: Cryptocercidae).
Sociobiology 3:3–117.
WILLIAM MARTIN, reviewing editor
Accepted February 9, 2001
Was this manual useful for you? yes no
Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Download PDF

advertisement